U.S. patent application number 14/374945 was filed with the patent office on 2014-12-25 for alpha-amylase.
This patent application is currently assigned to DSM IP ASSETS B.V.. The applicant listed for this patent is DSM ASSETS B.V.. Invention is credited to Lucie Parenicova.
Application Number | 20140377407 14/374945 |
Document ID | / |
Family ID | 48094809 |
Filed Date | 2014-12-25 |
United States Patent
Application |
20140377407 |
Kind Code |
A1 |
Parenicova; Lucie |
December 25, 2014 |
ALPHA-AMYLASE
Abstract
This invention relates to a novel alpha-amylase, a process for
its preparation and the use of the amylase. The invention relates
to a newly identified polynucleotide sequence from Alicyclobacillus
pohliae comprising a gene that encodes the novel alpha-amylase
enzyme. The invention features the full length coding sequence of
the novel gene as well as the amino acid sequence of the
full-length functional protein of the gene. The invention also
relates to methods of using these proteins in industrial processes,
for example in food industry, such as the baking industry. Also
included in the invention are cells transformed with a
polynucleotide according to the invention suitable for producing
these proteins and cells.
Inventors: |
Parenicova; Lucie; (Echt,
NL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DSM ASSETS B.V. |
Heerlen |
|
NL |
|
|
Assignee: |
DSM IP ASSETS B.V.
Heerlen
IL
|
Family ID: |
48094809 |
Appl. No.: |
14/374945 |
Filed: |
January 29, 2013 |
PCT Filed: |
January 29, 2013 |
PCT NO: |
PCT/EP2013/051608 |
371 Date: |
July 28, 2014 |
Current U.S.
Class: |
426/20 ; 426/549;
426/61; 435/202; 435/252.3; 435/252.31; 435/252.33; 435/252.34;
435/252.35; 435/254.11; 435/254.2; 435/254.21; 435/254.22;
435/254.23; 435/254.3; 435/254.4; 435/254.5; 435/254.6; 435/254.7;
435/254.8; 435/320.1; 435/325; 435/346; 435/348; 435/358; 435/365;
435/369; 435/91.1; 536/23.2 |
Current CPC
Class: |
A21D 8/042 20130101;
A21D 13/06 20130101; C12N 15/00 20130101; C12N 9/2417 20130101;
C12Y 302/01001 20130101 |
Class at
Publication: |
426/20 ;
536/23.2; 435/320.1; 435/91.1; 435/202; 435/252.3; 435/254.11;
435/254.2; 435/348; 435/325; 435/252.31; 435/252.35; 435/252.33;
435/252.34; 435/358; 435/365; 435/369; 435/346; 435/254.22;
435/254.23; 435/254.21; 435/254.3; 435/254.7; 435/254.8; 435/254.4;
435/254.5; 435/254.6; 426/61; 426/549 |
International
Class: |
C12N 9/28 20060101
C12N009/28; A21D 13/06 20060101 A21D013/06; A21D 8/04 20060101
A21D008/04 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 30, 2012 |
EP |
12153083.6 |
Jan 30, 2012 |
US |
61592085 |
Jul 23, 2012 |
US |
13532072 |
Claims
1. A polynucleotide encoding for a polypeptide having alpha-amylase
activity comprising: (a) a polynucleotide sequence encoding a
polypeptide having an amino acid sequence as set out in amino acids
34 to 719 of SEQ ID NO: 2; or (b) a polynucleotide sequence
encoding a polypeptide having at least 99.5% identity to a
polypeptide having an amino acid sequence as set out in amino acids
34 to 719 of SEQ ID NO: 2; or (c) a polynucleotide sequence as set
out in nucleotides 100 to 2157 of SEQ ID NO: 1 or SEQ ID NO: 3; or
(d) a polynucleotide sequence as set out in SEQ ID NO: 1 or SEQ ID
NO: 3.
2. The polynucleotide according to claim 1, wherein the
polynucleotide is produced by Alicyclobacillus pohliae
NCIMB14276.
3. A vector comprising the polynucleotide sequence according to
claim 1.
4. The vector according to claim 3 which is an expression vector
wherein the polynucleotide sequence is operably linked with at
least one regulatory sequence allowing for expression of the
polynucleotide sequence in a suitable host cell.
5. The vector according to claim 4, wherein the suitable host cell
is an Aspergillus, Bacillus, Chrysosporium, Escherichia,
Kluyveromyces, Penicillium, Pseudomonas, Saccharomyces,
Streptomyces or Talaromyces species, preferably a Bacillus
subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis,
Escherichia coli, Aspergillus Niger or Aspergillus oryzae
species.
6. A recombinant host cell comprising the polynucleotide according
to claim 1.
7. The recombinant host cell according to claim 6 capable of
expressing or over-expressing said polynucleotide or a vector
comprising said polynucleotide.
8. A method for manufacturing the polynucleotide according to claim
1 comprising culturing a host cell transformed with said
polynucleotide or a vector thereof and isolating said
polynucleotide or said vector from said host cell.
9. An alpha-amylase polypeptide comprising: (a) an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
(b) an amino acid sequence having at least 99.5% identity to an
amino acid sequence as set out in amino acids 34 to 719 of SEQ ID
NO: 2; or (c) an amino acid sequence encoded by a polynucleotide as
set out in nucleotides 100 to 2157 of SEQ ID NO: 1 or SEQ ID NO: 3;
or (d) an amino acid sequence having at least 70% identity to an
amino acid sequence as set out in amino acids 34 to 719 of SEQ ID
NO: 2 and having at least one of Asp at position 184, Ala at
position 297, Thr at position 368 and Asn at position 489, said
positions being defined with reference to SEQ ID NO: 2; or (e) an
amino acid sequence having at least 70% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2 and said amino acid sequence
characterized in that when used to prepare a baked product having a
least 5 wt % sugar based on flour, said baked product has reduced
hardness after storage in comparison with a baked product prepared
without use of said amino acid sequence.
10. The polypeptide according to claim 9 obtainable by expressing
the polynucleotide a vector comprising said polynucleotide in an
appropriate host cell.
11. A method for manufacturing the polypeptide according to claim 9
comprising cultivating a recombinant host cell under condition
which allow for expression of the polynucleotide or a vector
comprising said polynucleotide and, optionally, recovering an
encoded polypeptide from the cell or culture medium.
12. A polypeptide according to claim 9 capable of being used in
food manufacturing.
13. A polypeptide according to claim 12 capable of being used in
manufacture of a baked product, optionally a bread or a cake.
14. Enzyme composition comprising the polypeptide according to
claim 9 and one or more components selected from the group
consisting of milk powder, gluten, granulated fat, an additional
enzyme, an amino acid, a salt, an oxidant such as ascorbic acid,
bromate and azodicarbonamide, a reducing agent such as L-cysteine,
an emulsifier such as mono-glycerides, di-glycerides, glycerol
monostearate, sodium stearoyl lactylate, calcium stearoyl
lactylate, polyglycerol esters of fatty acids and diacetyl tartaric
acid esters of mono- and diglycerides, gums such as guargum and
xanthangum, flavours, acids such as citric acid and propionic acid,
starch, modified starch, gluten, humectants such as glycerol, and
preservatives.
15. Enzyme composition according to claim 14, wherein the
additional enzyme is a lipolytic enzyme, optionally a
phospholipase.
16. Method to prepare a dough comprising the step of combining the
polypeptide according to claim 9 and at least one dough
ingredient.
17. A dough comprising the polypeptide according to claim 9.
18. Method to prepare a baked product comprising baking the dough
according to claim 17.
19. Baked product obtainable by the method according to claim
18.
20. A method to produce a polypeptide having at least 60% identity
to (a) an amino acid sequence as set out in amino acids 34 to 719
of SEQ ID NO: 2 or an amino acid sequence having at least 99.5%
identity to amino acids 34 to 719 of the amino acid sequence of SEQ
ID NO: 2; or (b) an amino acid sequence encoded by the
polynucleotide according to claim 1, comprising using
Alicyclobacillus pohliae NCIMB14276.
21. The polypeptide according to claim 9 capable of being used to
reduce hardness after storage of a baked product comprising at
least 5 wt % sugar based on flour.
Description
FIELD OF INVENTION
[0001] This invention involves a novel alpha-amylase, a process for
its preparation and the use of the amylase.
[0002] The invention relates to a newly identified polynucleotide
sequence comprising a gene that encodes the novel alpha-amylase
enzyme. The invention features the full length coding sequence of
the novel gene as well as the amino acid sequence of the
full-length functional protein of the gene. The invention also
relates to methods of using these proteins in industrial processes,
for example in food industry, such as the baking industry. Also
included in the invention are cells transformed with a
polynucleotide according to the invention suitable for producing
these proteins and cells. The invention relates to a method of
manufacturing the polynucleotide according to the invention. The
invention further relates to a method for manufacturing the
polypeptide according to the invention.
BACKGROUND OF THE INVENTION
[0003] Studies on bread staling have indicated that the starch
fraction in bread recrystallizes during storage, thus causing an
increase in crumb firmness, which may be measured as an increase in
hardness of bread slices.
[0004] The present invention relates to an alpha-amylase.
Alpha-amylases have been used in industry for a long time.
[0005] Alpha-amylases have traditionally been provided through the
inclusion of malted wheat or barley flour and give several
advantages to the baker. Alpha-amylase is used to give satisfactory
gas production and gas retention during dough leavening and to give
satisfactory crust color. This means that if this enzyme is not
used in sufficient amount, the volume, texture, and appearance of
the loaf are substantially impaired. Alpha-amylase occurs naturally
within the wheat crop itself, measured routinely by Hagberg Falling
Number (ICC method 107), and steps are taken to minimise such
variations by the addition of alpha-amylase at the mill and through
the use of specialty ingredients at the bakery as the enzyme is of
such critical importance.
[0006] In more recent times, alpha-amylase from cereal has been
largely replaced with enzymes from microbial sources, including
fungal and bacterial sources. Through use of biotechnology in
strain selection, fermentation and processing, enzymes can be
prepared from such microbial sources and this brings advantage over
malt flour because the enzyme is of more controlled quality,
relatively pure and more cost effective in use.
[0007] The properties of alpha-amylases, and their technological
effects, do however show important differences. Besides giving
influence to gas production, gas retention and crust color,
alpha-amylase can have bearing on the shelf-life of the baked
product.
[0008] Starch within the wheat flour contains two principal
fractions, amylose and amylopectin, and these are organised in the
form of starch granules. A proportion of these granules from
hard-milling wheat varieties become "damaged", with granules
splitting apart as a consequence of the energy of milling. In the
process of baking, the starch granules gelatinise; this process
involves a swelling of the granule by the uptake of water and a
loss of the crystalline nature of the granule; in particular
amylopectins within the native granule are known to exist as
crystallites and these molecules dissociate and lose crystallinity
during gelatinisation. Once the bread has been baked, amylopectin
recrystallises slowly over a numbers of days and it is this
recrystallisation, or retrogradation of starch, that is regarded as
being the principal cause of bread staling.
[0009] These varying forms of the starch and their interaction with
alpha-amylase dictate the role the enzyme has with respect to
baking technology. Alpha-amylase from fungal sources, most
typically coming from Aspergillus species, acts principally on
damaged starch during the mixing of dough and throughout
fermentation/proof. The low heat stability of the enzyme means that
the enzyme is inactivated during baking and, critically before
starch gelatinisation has taken place, such that there is little or
no breakdown of the starch from the undamaged fraction. As a
consequence, fungal amylase is useful in providing sugars for
fermentation and color, but has practically no value in extending
shelf-life. Bacterial alpha-amylase, most typically from Bacillus
amyloliquifaciens, on the other hand does bring extended
temperature stability and activity during the baking of bread and
while starch is undergoing gelatinisation. Bacterial amylase then
leads to more extensive modification of the starch and, in turn,
the qualities of the baked bread; in particular the crumb of the
baked bread can be perceptibly softer throughout shelf-life and can
permit the shelf-life to be increased. However, while bacterial
alpha-amylase can be useful with regard to shelf-life extension, it
is difficult to use practically as small over-doses lead to an
unacceptable crumb structure of large and open pores, while the
texture can become too soft and "gummy".
[0010] The inventor has identified an alpha amylase from a
particular bacterial source that has a thermostability falling
inbetween typical fungal and bacterial alpha amylases. The
thermostability of this enzyme is higher than fungal alpha amylase,
thereby allowing greater activity on amylopectin during and after
gelatinisation, but it is not acting as long into the baking
process as the typical bacterial amylases and is not over digesting
the starch.
[0011] U.S. Pat. No. 4,598,048 describes the preparation of a
maltogenic amylase enzyme. U.S. Pat. No. 4,604,355 describes a
maltogenic amylase enzyme, preparation and use thereof. U.S. Pat.
No. RE38,507 describes an antistaling process and agent. The
product described in U.S. Pat. No. RE38,507 is used in industry
under the trade name Novamyl.RTM..
[0012] It was set out to find an organism able to produce an
improved alpha-amylase. As a result the inventor has identified the
Alicyclobacillus pohliae NCIMB14276 strain which was discovered in
the Antarctic. This is a new strain, it was not previously used as
a source for an alpha-amylase which has improved properties.
SUMMARY OF THE INVENTION
[0013] The present invention relates to polypeptides. The invention
provides a novel alpha-amylase that may be used for retarding
staling of baked products such as bread and cake. The invention
further provides novel polynucleotides encoding the novel
alpha-amylase enzyme.
[0014] Accordingly, the invention relates to: [0015] a
polynucleotide encoding for a polypeptide having alpha-amylase
activity comprising: [0016] (a) a polynucleotide sequence encoding
a polypeptide having an amino acid sequence as set out in SEQ ID
NO: 2 or having an amino acid sequence as set out in amino acids 34
to 719 of SEQ ID NO: 2; or [0017] (b) a polynucleotide sequence
encoding a polypeptide having at least 99.5% identity to a
polypeptide having an amino acid sequence as set out in amino acids
34 to 719 of SEQ ID NO: 2; or [0018] (c) a polynucleotide sequence
as set out in nucleotides 100 to 2157 of SEQ ID NO: 1 or SEQ ID NO:
3; or [0019] (d) a polynucleotide sequence as set out in SEQ ID NO:
1 or SEQ ID NO: 3.
[0020] Further the invention concerns: [0021] an alpha-amylase
polypeptide comprising: [0022] (a) an amino acid sequence as set
out in amino acids 34 to 719 of SEQ ID NO: 2; or [0023] (b) an
amino acid sequence having at least 99.5% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
[0024] (c) an amino acid sequence encoded by a polynucleotide as
set out in nucleotides 100 to 2157 of SEQ ID NO: 1 or SEQ ID NO: 3;
or [0025] (d) the amino acid sequence according to (c), wherein the
polynucleotide is produced by Alicyclobacillus pohliae NCIMB14276;
or [0026] (e) an amino acid sequence having at least 70% identity
to an amino acid sequence as set out in amino acids 34 to 719 of
SEQ ID NO: 2 and having at least one of Asp at position 184, Ala at
position 297, Thr at position 368 and Asn at position 489, said
positions being defined with reference to SEQ ID NO: 2; or [0027]
(f) an amino acid sequence having at least 70% identity to an amino
acid sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2
and having at least one of Asp at position 184, Ala at position
297, Thr at position 368 and Asn at position 489, said positions
being defined with reference to SEQ ID NO: 2 and said amino acid
sequence characterized in that when used to prepare a baked product
having a least 5 wt % sugar based on flour, said baked product has
reduced hardness after storage in comparison with a baked product
prepared without use of said amino acid sequence.
[0028] In another aspect the invention relates to a vector
comprising the polynucleotide sequence according to the invention.
The invention also relates to a recombinant host cell comprising
the polynucleotide according to the invention. The invention
relates to a method of manufacturing the polynucleotide according
to the invention. The invention further relates to a method for
manufacturing the polypeptide according to the invention. The
invention relates to the use of said polypeptide in food
manufacturing. The invention also relates to an enzyme composition.
The invention also relates to a method to prepare a dough and to a
dough comprising the polypeptide according to the invention or the
enzyme composition according to the invention.
[0029] The invention also relates to a method to prepare a baked
product comprising the step of baking the dough according to the
invention.
[0030] The invention further relates to a baked product.
[0031] The invention further relates to a method to produce a
polypeptide comprising the use of Alicyclobacillus pohliae
NCIMB14276.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 sets out the plasmid map of pGBB09.
[0033] FIG. 2 sets out the plasmid map of pGBB09DSM-AM1.
[0034] FIG. 3 Sets out SEQ ID NO: 1.
[0035] FIG. 4 Sets out SEQ ID NO: 2.
[0036] FIG. 5 Sets out SEQ ID NO: 3.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0037] SEQ ID NO: 1 sets out the polynucleotide sequence from
Alicyclobacillus pohliae NCIMB14276 encoding the wild type signal
sequence (set out in nucleotides 1 to 99), the alpha-amylase
according to the invention (set out in nucleotides 100 to 2157),
and a stop codon at the 3'-terminus (set out in nucleotides 2157 to
2160).
[0038] SEQ ID NO: 2 sets out the amino acid sequence of the
Alicyclobacillus pohliae NCIMB14276 wild type signal sequence (set
out in amino acids 1 to 33) and the alpha-amylase according to the
invention (set out in amino acids 34 to 719). Also referred to
herein as DSM-AM protein.
[0039] SEQ ID NO: 3 sets out a codon optimised polynucleotide
sequence from Alicyclobacillus pohliae NCIMB14276 encoding the wild
type signal sequence (set out in nucleotides 1 to 99), the
alpha-amylase according to the invention (set out in nucleotides
100 to 2157), and a stop codon at the 3'-terminus (set out in
nucleotides 2157 to 2160).
DETAILED DESCRIPTION OF THE INVENTION
[0040] Throughout the present specification and the accompanying
claims the words "comprise" and "include" and variations such as
"comprises", "comprising", "includes" and "including" are to be
interpreted as open and inclusive. That is, these words are
intended to convey the possible inclusion of other elements or
integers not specifically recited, where the context allows.
[0041] Throughout the present specification and the accompanying
claims the wording "nucleotides 100 to 2157" means nucleotides 100
up to and including 2157. Throughout the present specification and
the accompanying claims the wording "amino acids 34 to 719" means
amino acids 34 up to and including 719.
[0042] The terms "polypeptide having an amino acid sequence as set
out in amino acids 34 to 719 of SEQ ID NO: 2, "the mature
polypeptide as set out in SEQ ID NO: 2" and "mature DSM-AM" are
used interchangeably herein.
[0043] The terms "polypeptide having at least 99.5% identity to a
polypeptide having an amino acid sequence as set out in amino acids
34 to 719 of SEQ ID NO: 2", "mature polypeptide according to the
invention", "mature enzyme according to the invention", "amylolytic
enzyme according to the invention", "alpha-amylase enzyme according
to the invention", "alpha-amylase according to the invention" and
"polypeptide according to the invention" are used interchangeably
herein.
[0044] The terms "polypeptide having at least 70% identity to a
polypeptide having an amino acid sequence as set out in amino acids
34 to 719 of SEQ ID NO: 2", "mature polypeptide according to the
invention", "mature enzyme according to the invention", "amylolytic
enzyme according to the invention", "alpha-amylase enzyme according
to the invention", "alpha-amylase according to the invention" and
"polypeptide according to the invention" are used interchangeably
herein.
[0045] The terms "according to the invention" and "of the
invention" are used interchangeably herein.
[0046] The terms "DSM-AM gene", "alpha-amylase gene according to
the invention", "AM gene" and "polynucleotide according to SEQ ID
NO: 1" are used interchangeably herein.
[0047] The term "polynucleotide according to the invention"
includes SEQ ID NO: 1 and SEQ ID NO: 3.
[0048] In the context of the present invention "mature polypeptide"
is defined herein as a polypeptide having alpha-amylase activity
that is in its final form following translation and any
post-translational modifications, including N-terminal processing,
C-terminal truncation, glycosylation, phosphorylation, etc. The
process of maturation may depend on the particular expression
vector used, the expression host and the production process.
[0049] To confirm the polynucleotide sequence of the DSM-AM gene
from the Alicyclobacillus pohliae NCIMB14276, the whole genome of
A. pohliae NCIMB14276 was sequenced. The results hereof confirmed
the polynucleotide, encoding the DSM-AM protein, is as disclosed in
SEQ ID NO: 1. From this the 719 amino acid sequence of the DSM-AM
protein as set out in SEQ ID NO: 2 was confirmed. The first 33
amino acids, starting from the N'-terminus of the DSM-AM protein,
belong to the signal sequence.
Polynucleotides
[0050] The invention relates to a polynucleotide encoding for a
polypeptide having alpha-amylase activity comprising: [0051] (a) a
polynucleotide sequence encoding a polypeptide having an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
[0052] (b) a polynucleotide sequence encoding a polypeptide having
at least 99.5% identity to a polypeptide having an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
[0053] (c) a polynucleotide sequence as set out in nucleotides 100
to 2157 of SEQ ID NO: 1 or SEQ ID NO: 3; or [0054] (d) a
polynucleotide sequence as set out in SEQ ID NO: 1 or SEQ ID NO:
3.
[0055] In an aspect, a polynucleotide of the invention is an
isolated polynucleotide comprising: [0056] (a) a polynucleotide
sequence as set out in nucleotides 100 to 2157 of the
polynucleotide sequence of SEQ ID NO: 1 or 3 (inclusive of
nucleotides 100 and 2157, for the avoidance of doubt); or [0057]
(b) a polynucleotide sequence encoding a polypeptide having an
amino acid sequence as set out in SEQ ID NO: 2 or having an amino
acid sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2
(inclusive of amino acids 34 and 719, for the avoidance of doubt);
or [0058] (c) a polynucleotide sequence as set out in SEQ ID NO:1
or SEQ ID NO:3.
[0059] In one aspect such isolated polynucleotide can be obtained
synthetically, e.g. by solid phase synthesis or by other methods
known to the person skilled in the art.
[0060] The sequences according to SEQ ID NO: 1 and SEQ ID NO: 3
include the nucleotides encoding the mature polypeptide according
to the invention and the wild type signal sequence. SEQ ID NO: 2
includes the mature polypeptide according to the invention and the
wild type signal sequence.
[0061] An "isolated polynucleotide" or "isolated nucleic acid" is a
DNA or RNA that is not immediately contiguous with both of the
coding sequences with which it is immediately contiguous (one on
the 5' end and one on the 3' end) in the naturally occurring genome
of the organism from which it is obtained. Thus, in one embodiment,
an isolated polynucleotide includes some or all of the 5'
non-coding (e.g., promotor) sequences that are immediately
contiguous to the coding sequence. The term therefore includes, for
example, a recombinant DNA that is incorporated into a vector, into
an autonomously replicating plasmid or virus, or into the genomic
DNA of a prokaryote or eukaryote, or which exists as a separate
molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction endonuclease treatment) independent of other sequences.
It also includes a recombinant DNA that is part of a hybrid gene
encoding an additional polypeptide that is substantially free of
cellular material, viral material, or culture medium (when produced
by recombinant DNA techniques), or chemical precursors or other
chemicals (when chemically synthesized). Moreover, an "isolated
polynucleotide fragment" is a polynucleotide fragment that is not
naturally occurring as a fragment and would not be found in the
natural state.
[0062] Polynucleotides of the invention also include
polynucleotides which comprise certain variant sequences of the
coding sequence of SEQ ID NO: 1 or 3 and which can encode a
functional alpha-amylase. Such variant sequences thus encode
polypeptides with alpha-amylase activity.
[0063] A polynucleotide sequence of the invention will generally
comprise sequence encoding a polypeptide having at least about
99.5% sequence identity to a polypeptide having an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 as
calculated over the full lengths of those sequences.
[0064] The coding sequence of SEQ ID NO: 1 or 3 may be modified by
nucleotide substitutions. The polynucleotide of SEQ ID NO: 1 or 3
may alternatively or additionally be modified by one or more
insertions and/or deletions and/or by an extension at either or
both ends. The modified polynucleotide encodes a polypeptide which
has alpha-amylase activity.
[0065] In an embodiment of the polynucleotide according to the
invention the polynucleotide is produced by Alicyclobacillus
pohliae NCIMB14276. As used herein, the terms "polynucleotide" or
"nucleic acid molecule" and the like are intended to include DNA
molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g.,
mRNA) and analogs of the DNA or RNA generated using nucleotide
analogs. The polynucleotide molecule can be single-stranded or
double-stranded, but preferably is double-stranded DNA. The
polynucleotide may be synthesized so that it includes synthetic or
modified nucleotides. A number of different types of modification
to polynucleotides are known in the art. These include
methylphosphonate and phosphorothioate backbones, addition of
acridine or polylysine chains at the 3' and/or 5' ends of the
molecule. Such oligonucleotides can be used, for example, to
prepare polynucleotides that have altered base-pairing abilities or
increased resistance to nucleases.
[0066] For the purposes of the present invention, it is to be
understood that the polynucleotides described herein may be
modified by any method available in the art. Such modifications may
be carried out, for example to increase the extent to which a
polynucleotide of the invention may be expressed in a suitable host
cell.
[0067] A polynucleotide of the invention, such as a DNA
polynucleotide, may be produced recombinantly, synthetically, or by
any means available to those of skill in the art. They may also be
cloned by standard techniques. A polynucleotide of the invention is
typically provided in isolated and/or purified form.
[0068] Polynucleotides may be produced using recombinant means, for
example using PCR (polymerase chain reaction) cloning techniques.
This will involve making a pair of primers (e.g. of about 15-30
nucleotides) to a region of the polynucleotide which it is desired
to amplify, bringing the primers into contact with mRNA or cDNA
obtained from a suitable cell, performing a polymerase chain
reaction under conditions which bring about amplification of the
desired region, isolating and recovering the amplified DNA. The
primers may be designed to contain suitable restriction enzyme
recognition sites so that the amplified DNA can conveniently be
cloned into a suitable cloning vector.
[0069] Such techniques may be used to obtain all or part of the
polynucleotide of SEQ ID NO: 1 or 3 described herein or variants
thereof.
[0070] Polynucleotides which do not have 100% sequence identity to
the sequence of SEQ ID NO: 1 or 3 but which nevertheless fall
within the scope of the invention may be obtained in a number of
ways. For example, polynucleotides may be obtained by an
appropriate mutagenesis technique, such as site-directed
mutagenesis of SEQ ID NO: 1 or 3. This may be useful where, for
example, silent codon changes are required to sequences to optimize
codon preferences for a particular host cell in which the
polynucleotide sequences are being expressed. Other sequence
changes may be desired in order to introduce restriction enzyme
recognition sites, or to alter the property or function of the
polypeptides encoded by the polynucleotides.
[0071] To increase the likelihood that the introduced enzyme is
expressed in active form in a cell of the invention, the
corresponding encoding nucleotide sequence may be adapted to
optimise its codon usage to that of the chosen host cell, for
example SEQ ID NO: 3. Several methods for codon optimisation are
known in the art. A preferred method to optimise codon usage of the
nucleotide sequences to that of the chosen host cell is a codon
pair optimization technology as disclosed in WO2006/077258 and/or
WO2008/000632. WO2008/000632 addresses codon-pair optimization.
Codon-pair optimisation is a method wherein the nucleotide
sequences encoding a polypeptide are modified with respect to their
codon-usage, in particular the codon-pairs that are used, to obtain
improved expression of the nucleotide sequence encoding the
polypeptide and/or improved production of the encoded polypeptide.
Codon pairs are defined as a set of two subsequent triplets
(codons) in a coding sequence.
[0072] As a simple measure for gene expression and translation
efficiency, herein, the Codon Adaptation Index (CAI), as described
in Xuhua Xia, Evolutionary Bioinformatics 2007, 3: 53-58, is used.
The index uses a reference set of highly expressed genes from a
species to assess the relative merits of each codon, and a score
for a gene is calculated from the frequency of use of all codons in
that gene. The index assesses the extent to which selection has
been effective in moulding the pattern of codon usage. In that
respect it is useful for predicting the level of expression of a
gene, for assessing the adaptation of viral genes to their hosts,
and for making comparisons of codon usage in different organisms.
The index may also give an approximate indication of the likely
success of heterologous gene expression. In the codon pair
optimized genes according to the invention, the CAI is 0.6 or more,
0.7 or more, 0.8 or more, 0.85 or more, 0.87 or more 0.90 or more,
0.95 or more, or about 1.0.
[0073] The invention further provides double stranded
polynucleotides comprising a polynucleotide of the invention and
its complement.
[0074] Polynucleotides, probes or primers of the invention may
carry a revealing label. Suitable labels include radioisotopes such
as .sup.32P or .sup.35S, enzyme labels, or other protein labels
such as biotin. Such labels may be added to polynucleotides, probes
or primers of the invention and may be detected using techniques
known per se.
Polypeptides
[0075] The invention provides an (isolated) polypeptide having
starch degrading activity. The invention further relates to a
method for manufacturing the polypeptide according to the
invention.
[0076] The terms "peptide" and "oligopeptide" are considered
synonymous (as is commonly recognized) and each term can be used
interchangeably as the context requires to indicate a chain of at
least two amino acids coupled by peptidyl linkages. The word
"polypeptide" (or protein) is used herein for chains containing
more than seven amino acid residues. All oligopeptide and
polypeptide formulas or sequences herein are written from left to
right and in the direction from amino terminus to carboxy terminus.
The three-letter code of amino acids used herein is commonly known
in the art and can be found in Sambrook, et al. (Molecular Cloning:
A Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 2001).
[0077] The invention relates to an alpha-amylase polypeptide
comprising: [0078] (a) an amino acid sequence as set out in amino
acids 34 to 719 of SEQ ID NO: 2; or [0079] (b) an amino acid
sequence having at least 99.5% identity to an amino acid sequence
as set out in amino acids 34 to 719 of SEQ ID NO: 2; or [0080] (c)
an amino acid sequence encoded by a polynucleotide as set out in
nucleotides 100 to 2157 of SEQ ID NO: 1 or SEQ ID NO: 3; or [0081]
(d) an amino acid sequence having at least 70% identity to an amino
acid sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2
and having at least one of Asp at position 184, Ala at position
297, Thr at position 368 and Asn at position 489, said positions
being defined with reference to SEQ ID NO: 2; or [0082] (e) an
amino acid sequence having at least 70% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2 and said amino acid sequence
characterized in that when used to prepare a baked product having a
least 5 wt % sugar based on flour, said baked product has reduced
hardness after storage in comparison with a baked product prepared
without use of said amino acid sequence.
[0083] In an embodiment, the invention relates to an isolated
polypeptide comprising: [0084] (a) amino acid sequence as set out
in amino acids 34 to 719 of SEQ ID NO: 2; or or [0085] (b) an amino
acid sequence encoded by a polynucleotide as set out in nucleotides
100 to 2157 of SEQ ID NO: 1 or 3; or [0086] (c) the amino acid
sequence according to (b), wherein the polynucleotide is produced
by Alicyclobacillus pohliae NCIMB14276; or [0087] (d) an amino acid
sequence encoded by a polynucleotide sequence as set out in SEQ ID
NO: 1 or SEQ ID NO: 3.
[0088] The polypeptide of the invention comprises the amino acid
sequence having at least 99.5% identity, preferably at least 99.6%
identity, preferably at least 99.7% identity preferably at least
99.8% identity, preferably at least 99.9% identity to a polypeptide
having an amino acid sequence as set out in amino acids 34 to 719
of SEQ ID NO: 2 which has alpha-amylase activity. In general, the
naturally occurring amino acid sequence shown in amino acids 34 to
719 of SEQ ID NO: 2 is preferred.
[0089] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 70% identity, in an aspect at
least 80% identity, in an aspect at least 85% identity, in an
aspect at least 90% identity, in an aspect at least 95% identity to
an amino acid sequence as set out in amino acids 34 to 719 of SEQ
ID NO: 2 and having at least one of Asp at position 184, Ala at
position 297, Thr at position 368 and Asn at position 489, said
positions being defined with reference to SEQ ID NO: 2.
[0090] As is known to the person skilled in the art it is possible
that the N- and/or C-termini of SEQ ID NO: 2 or of the mature
polypeptide in the amino acid sequence according to SEQ ID NO: 2
(as set out in amino acids 34 to 719) might be heterogeneous, due
to variations in processing during maturation. In particular such
processing variations might occur upon overexpression of the
polypeptide. In addition, exo-protease activity might give rise to
heterogeneity. The extent to which heterogeneity occurs depends
also on the host and fermentation protocols that are used. Such
C-terminal processing artefacts might lead to shorter polypeptides
or longer polypeptides as indicated with SEQ ID NO: 2 or with the
mature polypeptide in the amino acid sequence according to SEQ ID
NO: 2. As a result of such processing variations the N-terminus
might also be heterogeneous. Processing variants at the N-terminus
could be due to alternative cleavage of the signal sequence by
signal peptidases.
[0091] In a further aspect, the invention provides an isolated
polynucleotide encoding the polypeptide according to SEQ ID NO: 2
or of the mature polypeptide in the amino acid sequence according
to SEQ ID NO: 2 which contain additional residues and start at
position -1, or -2, or -3 etc. Alternatively, it might lack certain
residues and as a consequence start at position 2, or 3, or 4 etc.
Also additional residues may be present at the C-terminus, e.g. at
position 720, 721 etc. Alternatively, the C-terminus might lack
certain residues and as a consequence end at position 718, or 717
etc.
[0092] The polypeptide of the invention preferably has at 99.5%
sequence identity to the sequence set out in SEQ ID NO: 2.
[0093] The sequence of the polypeptide of SEQ ID NO: 2 can thus be
modified to provide polypeptides of the invention. Amino acid
substitutions may be made, for example, 1, 2, 3 or 4 substitutions.
The modified polypeptide retains activity as an alpha amylase.
[0094] In an aspect the polypeptide of the invention has at least
70% identity, in an aspect at least 80% identity, in an aspect at
least 85% identity, in an aspect at least 90% identity, in an
aspect at least 95% identity, in an aspect at least 99.5% identity
to a polypeptide having an amino acid sequence as set out in SEQ ID
NO: 2 or having an amino acid sequence as set out in amino acids 34
to 719 of SEQ ID NO: 2.
[0095] Preferably, such an polypeptide has an amino acid sequence
which, when aligned with the amino acid sequence as set in SEQ ID
NO 2, comprises at least one of Asp at position 184, Ala at
position 297, Thr at position 368 and Asn at position 489, said
positions being defined with reference to SEQ ID NO: 2. Preferably
such an alpha-amylase comprises at least Ala at position 297 said
position being defined with reference to SEQ ID NO: 2.
[0096] In an aspect the polypeptide of the invention may comprise
at least two of Asp at position 184, Ala at position 297, Thr at
position 368 and Asn at position 489, said positions being defined
with reference to SEQ ID NO: 2. Preferably such a polypeptide
comprises at least: Asp at position 184 and Ala at position 297; at
least Ala at position 297 and Thr at position 368; or at least Ala
at position 297 and Asn at position 489, all of said positions
being defined with reference to SEQ ID NO: 2.
[0097] In an aspect the polypeptide of the invention may comprise
at least three of Asp at position 184, Ala at position 297, Thr at
position 368 and Asn at position 489, said positions being defined
with reference to SEQ ID NO: 2. Preferably, such a polypeptide
comprises at least: Ala at position 297, Thr at position 368 and
Asn at position 489; Asp at position 184, Ala at position 297 and
Thr at position 368; or Asp at position 184, Ala at position 297
and Asn at position 489, all of said positions being defined with
reference to SEQ ID NO: 2.
[0098] In an aspect the polypeptide of the invention may comprise
Asp at position 184, Ala at position 297, Thr at position 368 and
Asn at position 489, all of said positions being defined with
reference to SEQ ID NO: 2.
[0099] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 80% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2.
[0100] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 85% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2.
[0101] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 90% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2.
[0102] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 95% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2.
[0103] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 80% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having Asp at position 184, Ala at position 297, Thr at position
368 and Asn at position 489, said positions being defined with
reference to SEQ ID NO: 2.
[0104] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 85% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having Asp at position 184, Ala at position 297, Thr at position
368 and Asn at position 489, said positions being defined with
reference to SEQ ID NO: 2.
[0105] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 90% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having Asp at position 184, Ala at position 297, Thr at position
368 and Asn at position 489, said positions being defined with
reference to SEQ ID NO: 2.
[0106] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 95% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having Asp at position 184, Ala at position 297, Thr at position
368 and Asn at position 489, said positions being defined with
reference to SEQ ID NO: 2.
[0107] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 99.5% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having Asp at position 184, Ala at position 297, Thr at position
368 and Asn at position 489, said positions being defined with
reference to SEQ ID NO: 2.
[0108] In an aspect the polypeptide of the invention comprises an
amino acid sequence having at least 70% identity to an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2 and
having at least one of Asp at position 184, Ala at position 297,
Thr at position 368 and Asn at position 489, said positions being
defined with reference to SEQ ID NO: 2 and said amino acid sequence
characterized in that when used to prepare a baked product having a
least 5 wt % sugar based on flour, said baked product has reduced
hardness after storage in comparison with a baked product prepared
without use of said amino acid sequence.
[0109] The one or more amino acids of the polypeptide according to
the invention may be substituted in order to improve the expression
in a host cell. In addition one or more amino acids of the protein
according to the invention may be substituted to change the enzymes
specific activity or thermal stability.
[0110] Conservative amino acid substitutions refer to the
interchangeability of residues having similar side chains. For
example, a group of amino acids having aliphatic side chains is
glycine, alanine, valine, leucine, and isoleucine; a group of amino
acids having aliphatic-hydroxyl side chains is serine and
threonine; a group of amino acids having amide-containing side
chains is asparagine and glutamine; a group of amino acids having
aromatic side chains is phenylalanine, tyrosine, and tryptophan; a
group of amino acids having basic side chains is lysine, arginine,
and histidine; and a group of amino acids having sulphur-containing
side chains is cysteine and methionine.
[0111] Preferred conservative amino acids substitution groups
include: valine-leucine-isoleucine, phenylalanine-tyrosine,
lysine-arginine, alanine-valine, and asparagine-glutamine.
Substitutional variants of the amino acid sequence disclosed herein
are those in which at least one residue in the disclosed sequences
has been removed and a different residue inserted in its place.
Preferably, the amino acid change is conservative. Preferred
conservative substitutions for each of the naturally occurring
amino acids include: Ala to ser; Arg to lys; Asn to gln or his; Asp
to glu; Cys to ser or ala; Gln to asn; Glu to asp; Gly to pro; His
to asn or gln; He to leu or val; Leu to ile or val; Lys to arg; gln
or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr
to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.
[0112] Polypeptides of the invention may be in a substantially
isolated form. It will be understood that the polypeptide may be
mixed with carriers or diluents which will not interfere with the
intended purpose of the polypeptide and still be regarded as
substantially isolated. The polypeptide of the invention may also
be in a substantially purified form, in which case it will
generally comprise the polypeptide in a preparation in which more
than 50%. e.g. more than 80%, 90%, 95% or 99%, by weight of the
polypeptide in the preparation is a polypeptide of the
invention.
[0113] For example, recombinantly produced polypeptides and
proteins produced in host cells are considered isolated for the
purpose of the invention as are native or recombinant polypeptides
which have been substantially purified by any suitable technique
such as, for example, the single-step purification method disclosed
in Smith and Johnson, Gene 67:31-40 (1988).
[0114] The polypeptide of the invention may be chemically modified,
e.g. post-translationally modified. For example, they may be
glycosylated or comprise modified amino acid residues. They may
also be modified by the addition of Histidine residues or a T7 tag
to assist their purification or by the addition of a signal
sequence to promote their secretion from a cell. Such modified
polypeptides and proteins fall within the scope of the term
"polypeptide" of the invention.
[0115] For secretion of the translated protein into the lumen of
the endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, an appropriate secretion signal sequence
may be fused to the polynucleotide of the invention. The signals
may be endogenous to the polypeptide or they may be heterologous
signals.
[0116] The polypeptide according to the invention may be produced
in a modified form, such as a fusion protein, and may include not
only secretion signals but also additional heterologous functional
regions. Thus, for instance, a region of additional amino acids,
particularly charged amino acids, may be added to the N-terminus of
the polypeptide to improve stability and persistence in the host
cell, during purification or during subsequent handling and
storage. Also, peptide moieties may be added to the polypeptide to
facilitate purification.
[0117] Polypeptides of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-glycosylated.
In addition, polypeptides of the invention may also include an
initial modified methionine residue, in some cases as a result of
host-mediated processes.
Sequence Identity
[0118] The terms "homology", "percent identity", "percent homology"
and "percentage of identity" are used interchangeably herein. For
the purpose of this invention, it is defined here that in order to
determine the percent homology of two amino acid sequences or of
two polynucleotide sequences (also referred to herein as nucleic
acid sequences), the sequences are aligned for optimal comparison
purposes. In order to optimize the alignment between the two
sequences gaps may be introduced in any of the two sequences that
are compared. Such alignment can be carried out over the full
length of the sequences being compared. Alternatively, the
alignment may be carried out over a shorter length, for example
over about 20, about 50, about 100 or more nucleic acids/based or
amino acids. The percent homology or percent identity is the
percentage of identical matches between the two sequences over the
reported aligned region.
[0119] A comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. The skilled person will be aware of the
fact that several different computer programs are available to
align two sequences and determine the homology between two
sequences (Kruskal, J. B. (1983) An overview of sequence comparison
In D. Sankoff and J. B. Kruskal, (ed.), Time warps, string edits
and macromolecules: the theory and practice of sequence comparison,
pp. 1-44 Addison Wesley). The percent identity between two amino
acid sequences or between two nucleotide sequences may be
determined using the Needleman and Wunsch algorithm for the
alignment of two sequences. (Needleman, S. B. and Wunsch, C. D.
(1970) J. Mol. Biol. 48, 443-453). Both amino acid sequences and
polynucleotide sequences can be aligned by the algorithm. The
Needleman-Wunsch algorithm has been implemented in the computer
program NEEDLE. For the purpose of this invention the NEEDLE
program from the EMBOSS package was used (version 2.8.0 or higher,
EMBOSS: The European Molecular Biology Open Software Suite (2000)
Rice, P. Longden, I. and Bleasby, A. Trends in Genetics 16, (6) pp
276-277, http://emboss.bioinformatics.nl/). For protein sequences
EBLOSUM62 is used for the substitution matrix. For nucleotide
sequence, EDNAFULL is used. The optional parameters used are a
gap-open penalty of 10 and a gap extension penalty of 0.5. The
skilled person will appreciate that all these different parameters
will yield slightly different results but that the overall
percentage identity of two sequences is not significantly altered
when using different algorithms.
[0120] After alignment by the program NEEDLE as described above the
percentage of identity between a query sequence and a sequence of
the invention is calculated as follows: Number of corresponding
positions in the alignment showing an identical aminoacid or
identical nucleotide in both sequences divided by the total length
of the alignment after subtraction of the total number of gaps in
the alignment. The percent identity defined as herein can be
obtained from NEEDLE by using the NOBRIEF option and is labelled in
the output of the program as "longest-identity".
[0121] The polynucleotide and protein sequences of the present
invention can further be used as a "query sequence" to perform a
search against public databases to, for example, identify other
family members or related sequences. Such searches can be performed
using the NBLAST and XBLAST programs (version 2.0) of Altschul, et
al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can
be performed with the NBLAST program, score=100, wordlength=12 to
obtain nucleotide sequences homologous to the polynucleotide of the
invention. BLAST protein searches can be performed with the XBLAST
program, score=50, wordlength=3 to obtain amino acid sequences
homologous to protein molecules of the invention. To obtain gapped
alignments for comparison purposes, Gapped BLAST can be utilized as
described in Altschul et al., (1997) Nucleic Acids Res. 25(17):
3389-3402. When utilizing BLAST and Gapped BLAST programs, the
default parameters of the respective programs (e.g., XBLAST and
NBLAST) can be used. See the homepage of the National Center for
Biotechnology Information at http://www.ncbi.nlm.nih.gov/.
Vectors
[0122] Polynucleotides of the invention can be incorporated into a
vector, including cloning and expression vectors. A vector may be a
recombinant replicable vector. The vector may be used to replicate
a polynucleotide of the invention in a compatible host cell. The
vector may conveniently be subjected to recombinant DNA
procedures
[0123] The invention also pertains to methods of growing,
transforming or transfecting such vectors in a suitable host cell,
for example under conditions in which expression of a polypeptide
of the invention occurs. The invention provides a method of making
polypeptides of the invention by introducing a polynucleotide of
the invention into a vector, in an embodiment an expression vector,
introducing the vector into a compatible host cell, and growing the
host cell under conditions which bring about replication of the
vector. The vector may be recovered from the host cell.
[0124] A vector according to the invention may be an autonomously
replicating vector, i.e. a vector which exists as an
extra-chromosomal entity, the replication of which is independent
of chromosomal replication, e.g. a plasmid. Alternatively, the
vector may be one which, when introduced into a host cell, is
integrated into the host cell genome and replicated together with
the chromosome(s) into which it has been integrated.
[0125] One type of vector is a "plasmid", which refers to a
circular double stranded DNA loop into which additional DNA
segments can be inserted. Another type of vector is a viral vector,
wherein additional DNA segments can be inserted into the viral
genome. Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g., bacterial vectors
having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g., bacterial integration vector with
out a suitable origin of replication or a non-episomal mammalian
vectors) are integrated into the genome of a host cell upon
introduction into the host cell, and thereby are replicated along
with the host genome.
[0126] Moreover, certain vectors are capable of directing the
expression of genes to which they are operatively linked. Such
vectors are referred to herein as "expression vectors". The terms
"expression vector", "expression construct" and "recombinant
expression vector" are used interchangeably herein. In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of plasmids. The terms "plasmid" and "vector can
be used interchangeably herein as the plasmid is the most commonly
used form of vector. However, the invention is intended to include
such other forms of expression vectors, such as cosmid, viral
vectors (e.g., replication defective retroviruses, adenoviruses and
adeno-associated viruses) and phage vectors which serve equivalent
functions.
[0127] Vectors according to the invention may be used in vitro, for
example for the production of RNA or used to transfect or transform
a host cell, for example a bacterial cell, and used for the
production of an alpha-amylase as encoded by a polynucleotide of
the invention.
[0128] The recombinant expression vectors of the invention comprise
a polynucleotide of the invention in a form suitable for expression
of the polynucleotide in a host cell, which means that the
recombinant expression vector includes one or more regulatory
sequences, selected on the basis of the host cells to be used for
expression, which is operably linked to the polynucleotide sequence
to be expressed.
[0129] Within a recombinant expression vector, "operably linked" is
intended to mean that the nucleotide sequence of interest is linked
to the regulatory sequence(s) in a manner which allows for
expression of the nucleotide sequence (e.g., in an in vitro
transcription/translation system or in a host cell when the vector
is introduced into the host cell), i.e. the term "operably linked"
refers to a juxtaposition wherein the components described are in a
relationship permitting them to function in their intended manner.
A regulatory sequence such as a promoter, enhancer or other
expression regulation signal "operably linked" to a coding sequence
is positioned in such a way that expression of the coding sequence
is achieved under conditions compatible with the control sequences
or the sequences are arranged so that they function in concert for
their intended purpose, for example transcription initiates at a
promoter and proceeds through the DNA sequence encoding the
polypeptide.
[0130] The term "regulatory sequence" is intended to include
promoters, enhancers and other expression control elements (e.g.,
polyadenylation signal). Such regulatory sequences are described,
for example, in Goeddel; Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990).
[0131] The term regulatory sequences includes those sequences which
direct constitutive expression of a nucleotide sequence in many
types of host cells and those which direct expression of the
nucleotide sequence only in a certain host cell (e.g.
tissue-specific regulatory sequences).
[0132] A vector or expression construct for a given host cell may
thus comprise the following elements operably linked to each other
in a consecutive order from the 5'-end to 3'-end relative to the
coding strand of the sequence encoding the polypeptide of the first
invention: (1) a promoter sequence capable of directing
transcription of the nucleotide sequence encoding the polypeptide
in the given host cell; (2) a ribosome binding site to facilitate
the translation of the transcribed RNA (3) optionally, a signal
sequence capable of directing secretion of the polypeptide from the
given host cell into a culture medium; (4) a polynucleotide
sequence according to the invention; and preferably also (5) a
transcription termination region (terminator) capable of
terminating transcription downstream of the nucleotide sequence
encoding the polypeptide.
[0133] Downstream of the nucleotide sequence according to the
invention there may be a 3' untranslated region containing one or
more transcription termination sites (e.g. a terminator, herein
also referred to as a stop codon). The origin of the terminator is
less critical. The terminator can, for example, be native to the
DNA sequence encoding the polypeptide. However, preferably a
bacterial terminator is used in bacterial host cells and a
filamentous fungal terminator is used in filamentous fungal host
cells. More preferably, the terminator is endogenous to the host
cell (in which the nucleotide sequence encoding the polypeptide is
to be expressed). In the transcribed region, a ribosome binding
site for translation may be present. The coding portion of the
mature transcripts expressed by the constructs will include a start
codon is usually AUG (or ATG), but there are also alternative start
codons, such as for example GUG (or GTG) and UUG (or TTG), which
are used in prokaryotes. Also a stop or translation termination
codon is appropriately positioned at the end of the polypeptide to
be translated.
[0134] Enhanced expression of the polynucleotide of the invention
may also be achieved by the selection of homologous and
heterologous regulatory regions, e.g. promoter, secretion leader
and/or terminator regions, which may serve to increase expression
and, if desired, secretion levels of the protein of interest from
the expression host and/or to provide for the inducible control of
the expression of a polypeptide of the invention.
[0135] It will be appreciated by those skilled in the art that the
design of the expression vector can depend on such factors as the
choice of the host cell to be transformed, the level of expression
of protein desired. The expression vectors of the invention can be
introduced into host cells to thereby produce proteins or peptides,
encoded by polynucleotides as described herein (e.g. the
polypeptide having alpha amylase activity according to the
invention or a variant thereof as described herein).
[0136] The recombinant expression vectors of the invention, also
referred to herein as "vector of the invention" can be designed for
expression of the polypeptides according to the invention in
prokaryotic or eukaryotic cells. For example, the polypeptides
according to the invention can be produced in bacterial cells such
as E. coli and Bacilli, insect cells (using baculovirus expression
vectors), fungal cells, yeast cells or mammalian cells. Suitable
host cells are discussed herein and further in Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990). Alternatively, the recombinant expression
vector can be transcribed and translated in vitro, for example
using T7 promoter regulatory sequences and T7 polymerase.
[0137] For most bacteria, filamentous fungi and yeasts, the vector
or expression construct is preferably integrated in the genome of
the host cell in order to obtain stable transformants. In case the
expression constructs are integrated in the host cells genome, the
constructs are either integrated at random loci in the genome, or
at predetermined target loci using homologous recombination, in
which case the target loci preferably comprise a highly expressed
gene.
[0138] Accordingly, expression vectors useful in the present
invention include chromosomal-, episomal- and virus-derived vectors
e.g., vectors which is a plasmid, bacteriophage, yeast episome,
yeast chromosomal elements, viruses such as baculoviruses, papova
viruses, vaccinia viruses, adenoviruses, fowl pox viruses,
pseudorabies viruses and retroviruses, and vectors which are
combinations thereof, such as those consisting of plasmid and
bacteriophage genetic elements, such as cosmids and phagemids.
[0139] The polynucleotide according to the invention should be
operatively linked to an appropriate promoter. Aside from the
promoter native to the gene encoding the polypeptide of the
invention, other promoters may be used to direct expression of the
polypeptide of the invention. The promoter may be selected for its
efficiency in directing the expression of the polypeptide of the
invention in the desired expression host. A suitable promoter may
be one which is an "inducible promoter" is one which causes mRNA
synthesis of a gene to be initiated temporally under specific
conditions. Alternatively, a promoter may be a "constitutive"
promoter, i.e. one that permits the gene to be expressed under
virtually all environmental conditions, i.e. a promoter that
directs constant, non-specific gene expression. A "strong
constitutive promoter", i.e., a promoter which causes mRNAs to be
initiated at high frequency compared to a native host cell may be
used.
[0140] In the invention, bacteria may preferably be used as host
cells for the expression of a polypeptide of the invention, in
particular Bacilli. Suitable inducible promoters useful in such
host cells include: (i) Promoters may be regulated primarily by an
ancillary factor such as a repressor or an activator. The
repressors are sequence-specific DNA binding proteins that repress
promoter activity. The transcription can be initiated from this
promoter in the presence of an inducer that prevents binding of the
repressor to the operator of the promoter. Examples of such
promoters from Gram-positive microorganisms include, but are not
limited to, gnt (gluconate operon promoter); penP from Bacillus
licheniformis; glnA (glutamine synthetase); xylAB (xylose operon);
araABD (L-arabinose operon) and P.sub.spac promoter, a hybrid
SPO1/lac promoter that can be controlled by inducers such as
isopropyl-.beta.-D-thiogalactopyranoside [IPTG] ((Yansura D. G.,
Henner D. J. Proc Natl Acad Sci USA. 1984 81(2):439-443).
Activators are also sequence-specific DNA binding proteins that
induce promoter activity. Examples of such promoters from
Gram-positive microorganisms include, but are not limited to,
two-component systems (PhoP-PhoR, DegU-DegS, SpoOA-Phosphorelay),
LevR, Mry and GItC. (ii) Production of secondary sigma factors can
be primarily responsible for the transcription from specific
promoters. Examples from Gram-positive microorganisms include, but
are not limited to, the promoters activated by sporulation specific
sigma factors: .sigma..sup.F, .sigma..sup.E, .sigma..sup.G and
.sigma..sup.K and general stress sigma factor, .sigma..sup.B. The
.sigma..sup.B-mediated response is induced by energy limitation and
environmental stresses (Hecker M, Volker U. Mol Microbiol. 1998;
29(5):1129-1136.). (iii) Attenuation and antitermination also
regulates transcription. Examples from Gram-positive microorganisms
include, but are not limited to, trp operon and sacB gene. (iv)
Other regulated promoters in expression vectors are based the sacR
regulatory system conferring sucrose inducibility (Klier A F,
Rapoport G. Annu Rev Microbiol. 1988; 42:65-95).
[0141] Strong constitutive promoters are well known and an
appropriate one may be selected according to the specific sequence
to be controlled in the host cell. Suitable inducible promoters
useful in bacteria, such as Bacilli, include: promoters from
Gram-positive microorganisms such as, but are not limited to,
SPO1-26, SPO1-15, veg, pyc (pyruvate carboxylase promoter), and
amyE. Examples of promoters from Gram-negative microorganisms
include, but are not limited to, tac, tet, trp-tet, lpp, lac,
lpp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, .lamda.-P.sub.R,
and .lamda.-P.sub.L.
[0142] Additional examples of promoters useful in bacterial cells,
such as Bacilli, include the .alpha.-amylase and SPo2 promoters as
well as promoters from extracellular protease genes.
[0143] In an embodiment, the promoter sequences may be obtained
from a bacterial source. In another embodiment, the promoter
sequences may be obtained from a gram positive bacterium such as a
Bacillus strain, e.g., Bacillus alkalophilus, Bacillus
amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus
clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus,
Bacillus lentus, Bacillus licheniformis, Bacillus megaterium,
Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis,
or Bacillus thuringiensis; or a Streptomyces strain, e.g.,
Streptomyces lividans or Streptomyces murinus; or from a gram
negative bacterium, e.g., E. coli or Pseudomonas sp.
[0144] An example of a suitable promoter for directing the
transcription of a polynucleotide sequence in the methods of the
present invention is the promoter obtained from the E. coli lac
operon. Another example is the promoter of the Streptomyces
coelicolor agarase gene (dagA). Another example is the promoter of
the Bacillus lentus alkaline protease gene (aprH). Another example
is the promoter of the Bacillus licheniformis alkaline protease
gene (subtilisin Carlsberg gene). Another example is the promoter
of the Bacillus subtilis levansucrase gene (sacB). Another example
is the promoter of the Bacillus subtilis alphaamylase gene (amyF).
Another example is the promoter of the Bacillus licheniformis
alphaamylase gene (amyL). Another example is the promoter of the
Bacillus stearothermophilus maltogenic amylase gene (amyM). Another
example is the promoter of the Bacillus amyloliquefaciens
alpha-amylase gene (amyQ). Another example is a "consensus"
promoter having the sequence TTGACA for the "-35" region and TATAAT
for the "-10" region. Another example is the promoter of the
Bacillus licheniformis penicillinase gene (penP). Another example
are the promoters of the Bacillus subtilis xylA and xylB genes.
[0145] A variety of promoters can be used that are capable of
directing transcription in the recombinant host cells of the
invention. Preferably the promoter sequence is from a highly
expressed gene. Examples of preferred highly expressed genes from
which promoters may be selected and/or which are comprised in
preferred predetermined target loci for integration of expression
constructs, include but are not limited to genes encoding
glycolytic enzymes such as triose-phosphate isomerases (TPI),
glyceraldehyde-phosphate dehydrogenases (GAPDH), phosphoglycerate
kinases (PGK), pyruvate kinases (PYK or PKI), alcohol
dehydrogenases (ADH), as well as genes encoding amylases,
glucoamylases, proteases, xylanases, cellobiohydrolases,
.beta.-galactosidases, alcohol (methanol) oxidases, elongation
factors and ribosomal proteins. Specific examples of suitable
highly expressed genes include e.g. the LAC4 gene from
Kluyveromyces sp., the methanol oxidase genes (AOX and MOX) from
Hansenula and Pichia, respectively, the glucoamylase (glaA) genes
from A. niger and A. awamori, the A. oryzae TAKA-amylase gene, the
A. nidulans gpdA gene and the T. reesei cellobiohydrolase
genes.
[0146] Examples of strong constitutive and/or inducible promoters
which may be used in fungal expression host cells include those
which are obtainable from the fungal genes for xylanase (xlnA),
phytase, ATP-synthetase, subunit 9 (oliC), triose phosphate
isomerase (tpi), alcohol dehydrogenase (AdhA), .alpha.-amylase
(amy), amyloglucosidase (AG-from the glaA gene), acetamidase (amdS)
and glyceraldehyde-3-phosphate dehydrogenase (gpd) promoters.
[0147] All of the above-mentioned promoters are readily available
in the art.
[0148] The vector may contain a polynucleotide of the invention
oriented in an antisense direction to provide for the production of
antisense RNA.
[0149] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via natural competence, conventional transformation or
transfection techniques. As used herein, the terms "transformation"
and "transfection" are intended to refer to a variety of
art-recognized techniques for introducing foreign polynucleotide
(e.g., DNA) into a host cell, including calcium phosphate or
calcium chloride co-precipitation, DEAE-dextran-mediated
transfection, transduction, infection, lipofection, cationic
lipidmediated transfection or electroporation. Suitable methods for
transforming or transfecting host cells can be found in Sambrook,
et al. (supra) and other laboratory manuals.
[0150] In order to identify and select cells which harbour a
vector, a gene that encodes a selectable marker (e.g., resistance
to antibiotics) is generally introduced into the host cells along
with the polynucleotide of the invention. Preferred selectable
markers include, but are not limited to, those which confer
resistance to drugs or which complement a defect in the host
cell.
[0151] Such markers include ATP synthetase, subunit 9 (oliC),
orotidine-5'-phosphatedecarboxylase (pvrA), the bacterial G418
resistance gene (this may also be used in yeast, but not in fungi),
the ampicillin resistance gene (E. coli), resistance genes for,
neomycin, kanamycin, tetracycline, spectinomycin, erythromycin,
chloramphenicol, phleomycin (Bacillus) and the E. coli uidA gene,
coding for .beta.-glucuronidase (GUS). Vectors may be used in
vitro, for example for the production of RNA or used to transfect
or transform a host cell.
[0152] They also include e.g. versatile marker genes that can be
used for transformation of most filamentous fungi and yeasts such
as acetamidase genes or cDNAs (the amdS, niaD, facA genes or cDNAs
from A. nidulans, A. oryzae or A. niger), or genes providing
resistance to antibiotics like G418, hygromycin, bleomycin,
kanamycin, methotrexate, phleomycin orbenomyl resistance (benA).
Alternatively, specific selection markers can be used such as
auxotrophic markers which require corresponding mutant host
strains: e.g. D-alanine racemase (from Bacillus), URA3 (from S.
cerevisiae or analogous genes from other yeasts), pyrG or pyrA
(from A. nidulans or A. niger), argB (from A. nidulans or A. niger)
or trpC. In an embodiment the selection marker is deleted from the
transformed host cell after introduction of the expression
construct so as to obtain transformed host cells capable of
producing the polypeptide which are free of selection marker
genes.
[0153] Expression of proteins in prokaryotes is often carried out
in with vectors containing constitutive or inducible promoters
directing the expression of either fusion or non-fusion proteins.
Fusion vectors add a number of amino acids to a protein encoded
therein, e.g. to the amino terminus of the recombinant protein.
Such fusion vectors typically serve three purposes: 1) to increase
expression of recombinant protein; 2) to increase the solubility of
the recombinant protein; and 3) to aid in the purification of the
recombinant protein by acting as a ligand in affinity purification.
Often, in fusion expression vectors, a proteolytic cleavage site is
introduced at the junction of the fusion moiety and the recombinant
protein to enable separation of the recombinant protein from the
fusion moiety subsequent to purification of the fusion protein.
[0154] Appropriate culture mediums and conditions for the
above-described host cells are known in the art.
[0155] Vectors preferred for use in bacteria are for example
disclosed in WO-A1-2004/074468, which are hereby enclosed by
reference. Other suitable vectors will be readily apparent to the
skilled artisan.
[0156] Vectors of the invention may be transformed into a suitable
host cell as described herein to provide for expression of a
polypeptide of the invention. Thus, in a further aspect the
invention provides a process for preparing a polypeptide according
to the invention which comprises cultivating a host cell
transformed or transfected with an expression vector encoding the
polypeptide, and recovering the expressed polypeptide.
Host Cells
[0157] The invention further provides "recombinant host cells" also
referred herein as "host cells" transformed or transfected with the
vectors for the replication and/or expression of polynucleotides of
the invention. The cells will be chosen to be compatible with the
said vector. Promoters and other expression regulation signals may
be selected to be compatible with the host cell for which
expression is designed.
[0158] The invention features cells, e.g., transformed host cells
or recombinant host cells comprising a polynucleotide according to
the invention or comprising a vector according to the
invention.
[0159] A "transformed host cell" or "recombinant host cell" is a
cell into which (or into an ancestor of which) has been introduced,
by means of recombinant DNA techniques, a polynucleotide according
to the invention. Both prokaryotic and eukaryotic cells are
included, e.g., bacteria, fungi, yeast, insect, mammalian and the
like.
[0160] Preferred are cells of a Bacillus strain, e.g., Bacillus
alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus
circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus,
Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus
megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus
subtilis, or Bacillus thuringiensis; or a Streptomyces strain,
e.g., Streptomyces lividans or Streptomyces murinus; or from a gram
negative bacterium, e.g., E. coli or Pseudomonas sp.
[0161] According to another aspect, the host cell is a eukaryotic
host cell. Preferably, the eukaryotic cell is a mammalian, insect,
plant, fungal, or algal cell. Preferred mammalian cells include
e.g. Chinese hamster ovary (CHO) cells, COS cells, 293 cells,
Per.C6.RTM. cells, and hybridomas. A number of vectors suitable for
stable transfection of mammalian cells are available to the public,
methods for constructing such cell lines are also publicly known,
e.g., in Ausubel et al. (supra).
[0162] In an embodiment insect cells include e.g. Sf9 and Sf21
cells and derivatives thereof.
[0163] In an embodiment the eukaryotic cell is a fungal cell, i.e.
a yeast cell, such as Candida, Hansenula, Kluyveromyces, Pichia,
Saccharomyces, Schizosaccharomyces, or Yarrowia strain. Preferably
from Kluyveromyces lactis, S. cerevisiae, Hansenula polymorpha,
Yarrowia lipolytica and Pichia pastoris, or a filamentous fungal
cell.
[0164] Filamentous fungi include all filamentous forms of the
subdivision Eumycota and Oomycota (as defined by Hawksworth et al.,
In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition,
1995, CAB International, University Press, Cambridge, UK). The
filamentous fungi are characterized by a mycelial wall composed of
chitin, cellulose, glucan, chitosan, mannan, and other complex
polysaccharides. Vegetative growth is by hyphal elongation and
carbon catabolism is obligately aerobic. Filamentous fungal strains
include, but are not limited to, strains of Acremonium, Agaricus,
Aspergillus, Aureobasidium, Chrysosporium, Coprinus, Cryptococcus,
Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor,
Myceliophthora, Neocallimastix, Neurospora, Paecilomyces,
Penicillium, Piromyces, Panerochaete, Pleurotus, Schizophyllum,
Talaromyces, Thermoascus, Thielavia, Tolypocladium, and
Trichoderma. In an embodiment filamentous fungal cells belong to a
species of an Aspergillus, Chrysosporium, Penicillium, Talaromyces,
Fusarium or Trichoderma genus, and preferably a species of
Aspergillus niger, Aspergillus awamori, Aspergillus foetidus,
Aspergillus sojae, Aspergillus fumigatus, Talaromyces emersonii,
Aspergillus oryzae, Chrysosporium lucknowense, Myceliophthora
thermophila, Fusarium oxysporum, Trichoderma reesei or Penicillium
chrysogenum. In an embodiment the host cell is Aspergillus
niger.
[0165] If the host cell according to the invention is an
Aspergillus niger host cell, the host cell preferably is CBS
513.88, CBS124.903 or a derivative thereof.
[0166] A host cell can be chosen that modulates the expression of
the inserted sequences, or modifies and processes the gene product
in a specific, desired fashion. Such modifications (e.g.,
glycosylation) and processing (e.g., cleavage) of protein products
may facilitate optimal functioning of the protein.
[0167] Various host cells have characteristic and specific
mechanisms for post-translational processing and modification of
proteins and gene products. Appropriate cell lines or host systems
familiar to those of skill in the art of molecular biology and/or
microbiology can be chosen to ensure the desired and correct
modification and processing of the foreign protein produced. To
this end, eukaryotic host cells that possess the cellular machinery
for proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product can be used. Such host cells
are well known in the art.
[0168] If desired, a host cell as described above may be used to in
the preparation of a polypeptide according to the invention. Such a
method typically comprises cultivating a recombinant host cell
(e.g. transformed or transfected with an expression vector as
described above) under conditions to provide for expression (by the
vector) of a coding sequence encoding the polypeptide, and
optionally recovering, more preferably recovering and purifying the
produced polypeptide from the cell or culture medium.
Polynucleotides of the invention can be incorporated into a
recombinant replicable vector, e.g. an expression vector. The
vector may be used to replicate the polynucleotide in a compatible
host cell. Thus in a further embodiment, the invention provides a
method of making a polynucleotide of the invention by introducing a
polynucleotide of the invention into a replicable vector,
introducing the vector into a compatible host cell, and growing the
host cell under conditions which bring about the replication of the
vector. The vector may be recovered from the host cell.
[0169] Preferably the polypeptide according to the invention is
produced as a secreted protein in which case the nucleotide
sequence encoding a mature form of the polypeptide in the
expression construct is operably linked to a nucleotide sequence
encoding a signal sequence. Preferably the signal sequence is
native (homologous), also referred to herein as "wild type" to the
nucleotide sequence encoding the polypeptide. Alternatively the
signal sequence is foreign (heterologous) to the nucleotide
sequence encoding the polypeptide, in which case the signal
sequence is preferably endogenous to the host cell in which the
nucleotide sequence according to the invention is expressed.
Examples of suitable signal sequences for Bacilli are from the
amyE, yurI fliL, vpr, glpQ, phy, lytC, ywsB, ybbD, ybxI, yolA,
ylqB, ybbC, peI, yckD, ywaD, ywmD, yweA, yraJ, dacF, yfjS, yybN,
yrpD, yvcE, wprA, yxaL, ykwD, yncM2, sacB, phrC, SacC, yoqM, ykoJ,
lip, yfkN, yurI, ybfO, yfkD, yoaJ, xynA, penP, ydjM, yddT, yojL,
yomL, yqxI, yrvJ, yvpA, yjcM, yjfA, ypjP, ggt, yoqH, ywtD, ylaE,
yraJ, lytB, lytD, nprB, nucB, rplR, yfhK, yjdB, ykvV, ybbE, yuiC,
ylbL, yacD, yvpB genes from Bacillus subtilis. Suitable yeast
signal sequences are those from yeast a-factor genes. Similarly, a
suitable signal sequence for filamentous fungal host cells is e.g.
a signal sequence those from a filamentous fungal amyloglucosidase
(AG) gene, e.g. the A. niger glaA gene. This may be used in
combination with the amyloglucosidase (also called (gluco) amylase)
promoter itself, as well as in combination with other promoters.
Hybrid signal sequences may also be used with the context of the
present invention.
[0170] Preferred heterologous secretion leader sequences are those
originating from the fungal amyloglucosidase (AG) gene (glaA-both
18 and 24 amino acid versions e.g. from Aspergillus), the
.alpha.-factor gene (yeasts e.g. Saccharomyces and Kluyveromyces)
or the .alpha.-amylase (amyE, amyQ and amyL) and alkaline protease
aprE and natural protease genes (Bacillus). The vectors may be
transformed or transfected into a suitable host cell as described
above to provide for expression of a polypeptide of the invention.
This process may comprise culturing a host cell transformed with an
expression vector as described above under conditions to provide
for expression by the vector of a coding sequence encoding the
polypeptide.
[0171] The invention thus provides host cells transformed or
transfected with or comprising a polynucleotide or vector of the
invention. Preferably the polynucleotide is carried in a vector for
the replication and expression of the polynucleotide. The cells
will be chosen to be compatible with the said vector and may for
example be prokaryotic (for example bacterial), fungal, yeast or
plant cells.
[0172] A heterologous host cell may also be chosen wherein the
polypeptide of the invention is produced in a form which is
substantially free of enzymatic activities that might interfere
with the applications, e.g. free from starch degrading,
cellulose-degrading or hemicellulose degrading enzymes. This may be
achieved by choosing a host cell which does not normally produce
such enzymes.
[0173] The invention encompasses processes for the production of
the polypeptide of the invention by means of recombinant expression
of a DNA sequence encoding the polypeptide. For this purpose the
DNA sequence of the invention can be used for gene amplification
and/or exchange of expression signals, such as promoters, secretion
signal sequences, in order to allow economic production of the
polypeptide in a suitable homologous or heterologous host cell. A
homologous host cell is a host cell which is of the same species or
which is a variant within the same species as the species from
which the DNA sequence is obtained.
[0174] The host cell may over-express the polypeptide, and
techniques for engineering over-expression are well known. The host
may thus have two or more copies of the encoding polynucleotide
(and the vector may thus have two or more copies accordingly).
[0175] Therefore in one embodiment of the invention the recombinant
host cell according to the invention is capable of expressing or
overexpressing a polynucleotide or vector according to the
invention.
[0176] Another aspect of the invention is a method for producing a
polypeptide of the invention comprising (a) culturing a recombinant
host cell according to the invention under conditions such that the
polypeptide of the invention is produced; and (b) optionally
recovering the polypeptide of the invention from the cell culture
medium.
[0177] According to the present invention, the production of the
polypeptide of the invention can be effected by the culturing of a
host cell according to the invention, which has been transformed
with one or more polynucleotides of the present invention, in a
conventional nutrient fermentation medium. The method of the
invention comprises the step of culturing a host cell of the
invention under conditions such that a polypeptide of the invention
is produced.
[0178] The recombinant host cells according to the invention may be
cultured using procedures known in the art. For each combination of
a promoter and a host cell, culture conditions are available which
are conducive to the expression the DNA sequence encoding the
polypeptide. After reaching the desired cell density or titre of
the polypeptide the culture is stopped and the polypeptide is
recovered using known procedures.
[0179] The term "culturing" includes maintaining and/or growing a
living recombinant host cell of the present invention, in
particular the recombinant host cell according to the invention. In
one aspect, a recombinant host cell of the invention is cultured in
liquid media. In another aspect, a recombinant host cell is
cultured in solid media or semi-solid media.
[0180] Preferably, the recombinant host cell of the invention is
cultured in liquid media comprising nutrients essential or
beneficial to the maintenance and/or growth of the recombinant host
cell. Such nutrients include, but are not limited to, carbon
sources or carbon substrates, e.g. complex carbohydrates such as
bean or grain meal, starches, sugars, sugar alcohols, hydrocarbons,
oils, fats, fatty acids, organic acids and alcohols; nitrogen
sources, e.g. vegetable proteins, peptones, peptides and amino
acids obtained from grains, beans and tubers, proteins, peptides
and amino acids obtained from animal sources such as meat, milk and
animal byproducts such as peptones, meat extracts and casein
hydrolysates; inorganic nitrogen sources such as urea, ammonium
sulfate, ammonium chloride, ammonium nitrate and ammonium
phosphate; phosphorous sources, e.g. phosphoric acid, sodium and
potassium salts thereof; trace elements, e.g. magnesium, iron,
manganese, calcium, copper, zinc, boron, molybdenum and/or cobalt
salts; as well as growth factors such as amino acids, vitamins,
growth promoters and the like.
[0181] The selection of the appropriate medium may be based on the
choice of expression host, i.e. the choice of the recombinant host
cell and/or based on the regulatory requirements of the expression
construct. Such media are known to those skilled in the art. The
medium may, if desired, contain additional components favouring the
transformed expression hosts over other potentially contaminating
microorganisms.
[0182] The recombinant host cells may be cultured in liquid media
either continuously or intermittently, by conventional culturing
methods such as standing culture, test tube culture, shaking
culture, aeration spinner culture or fermentation. Preferably, the
recombinant host cells are cultured in a fermentor. Fermentation
processes of the invention include batch, fed-batch and continuous
methods of fermentation. A variety of such processes have been
developed and are well known in the art.
[0183] The recombinant host cells are preferably cultured under
controlled pH. In one embodiment, recombinant host cells may be
cultured at a pH of between 4.5 and 8.5, preferably 6.0 and 8.5,
more preferably at a pH of about 7. The desired pH may be
maintained by any method known to those skilled in the art.
[0184] Preferably, the recombinant host cells are further cultured
under controlled aeration and under controlled temperatures. In one
embodiment, the controlled temperatures include temperatures
between 15 and 70.degree. C., preferably the temperatures are
between 20 and 55.degree. C., more preferably between 30 and
50.degree. C.
[0185] The appropriate conditions are usually selected based on the
choice of the expression host and the protein to be produced.
[0186] After fermentation, if necessary, the cells can be removed
from the fermentation broth by means of centrifugation or
filtration. After fermentation has stopped or after removal of the
cells, the polypeptide of the invention may then be recovered and,
if desired, purified and isolated by conventional means, including,
but not limited to, treatment with a conventional resin, treatment
with a conventional adsorbent, alteration of pH, solvent
extraction, dialysis, filtration, concentration, crystallization,
recrystallization, pH adjustment, lyophilisation and the like.
[0187] For example, the alpha-amylase enzyme according to the
invention can be recovered and purified from recombinant cell
cultures by methods known in the art (Protein Purification
Protocols, Methods in Molecular Biology series by Paul Cutler,
Humana Press, 2004).
[0188] Usually, the compound is "isolated" when the resulting
preparation is substantially free of other components. In one
embodiment, the preparation has a purity of greater than about 80%
(by dry weight) of the desired compound (e.g. less than about 20%
of all the media, components or fermentation byproducts), in
another embodiment greater than about 90% of the desired compound,
in another embodiment greater than about 95% of the desired
compound and in another embodiment greater than about 98 to 99% of
the desired compound.
[0189] Alternatively, however, the desired compound is not purified
from the recombinant host cell or the culture. The entire culture
or the culture supernatant may be used as a source of the product.
In a specific embodiment, the culture or the culture supernatant is
used without modification. In a further embodiment, the culture or
the culture supernatant is concentrated, dried and/or
lyophilized.
[0190] The recombinant host cell of the invention is capable of
producing a polypeptide of the invention compound under suitable
conditions. Preferably, production of a polypeptide of the
invention means production of at least about 50 mg, about 100 mg,
about 200 mg, about 500 mg, about 1 g, about 3 g, about 5 g or
about 10 g polypeptide of the invention per litre culture
medium.
Enzyme Preparation
[0191] Bacillus strain DSM-AMB154-1 (see examples) was cultivated
under aerobic conditions in a suitable fermentation medium.
[0192] A suitable medium medium may contain assimilable sources of
carbon and nitrogen besides inorganic salts optionally together
with growth promoting nutrients, such as yeast extract.
Fermentation is typically conducted at 35-40.degree. C. and at a pH
of 6.5-7.5 and preferably kept approximately constant by automatic
means. The enzyme is excreted into the medium. At the end of
fermentation, if required, the production host may be killed by
means known by the person skilled in the art. The ensuing
fermentation broth may be freed of bacterial cells, debris
therefrom together with other solids, for example by filtration or
centrifugation. The filtrate or supernatant containing the enzyme
may be further clarified, for example by filtration or
centrifugation, and then concentrated as required, for example by
ultrafiltration or in an evaporator under reduced pressure to give
a concentrate which, if desired, may be taken to dryness, for
example by lyophilization or spray-drying. Typically, the resulting
crude enzyme product exhibits an activity in the range of about
10,000-500,000 MU per gram.
[0193] The polynucleotide according to the invention comprises a
nucleotide sequence selected from:
[0194] The invention relates to a polynucleotide encoding for a
polypeptide having alpha-amylase activity comprising: [0195] (a) a
polynucleotide sequence encoding a polypeptide having an amino acid
sequence as set out in SEQ ID NO: 2 or having an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
[0196] (b) a polynucleotide sequence encoding a polypeptide having
at least 99.5% identity to a polypeptide having an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
[0197] (c) a polynucleotide sequence as set out in nucleotides 100
to 2157 of SEQ ID NO: 1 or SEQ ID NO: 3; or [0198] (d) a
polynucleotide sequence as set out in SEQ ID NO: 1 or SEQ ID NO:
3.
[0199] The polynucleotide according to the invention encodes for an
alpha-amylase.
[0200] In an embodiment of the polynucleotide according to the
invention, the polynucleotide is an isolated polynucleotide
comprising: [0201] (a) a polynucleotide sequence as set out in SEQ
ID NO: 1 or 3; or [0202] (b) a polynucleotide sequence as set out
in nucleotides 100 to 2157 of the polynucleotide sequence of SEQ ID
NO: 1 or 3 (inclusive of nucleotides 100 and 2157, for the
avoidance of doubt); or [0203] (c) a polynucleotide sequence
encoding a polypeptide having an amino acid sequence as set out in
SEQ ID NO: 2 or having an amino acid sequence as set out in amino
acids 34 to 719 of SEQ ID NO: 2 (inclusive of amino acids 34 and
719, for the avoidance of doubt).
[0204] In an embodiment of the polynucleotide according to the
invention, the polynucleotide is produced by Alicyclobacillus
pohliae NCIMB14276.
[0205] In a further aspect of the polynucleotide according to the
invention the isolated polynucleotide is produced by
Alicyclobacillus pohliae NCIMB14276.
[0206] The vector according to the invention comprises the
polynucleotide sequence according to the invention.
[0207] In an embodiment of the vector according to the invention
the vector is an expression vector, wherein the polynucleotide
sequence according to the invention is operably linked with at
least one regulatory sequence allowing for expression of the
polynucleotide sequence in a suitable host cell.
[0208] Suitable host cells include bacteria, including Escherichia,
Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas,
Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium
(Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter,
Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or
Streptomyces. In an aspect of the vector according to the
invention, the host cell is a the bacterial cell is selected from
the group consisting of B. subtilis, B. puntis, B. megaterium, B.
halodurans, B. pumilus, G. oxydans, Caulobactert crescentus CB 15,
Methylobacterium extorquens, Rhodobacter sphaeroides, Pseudomonas
zeaxanthinifaciens, Paracoccus denitrificans, C. glutamicum,
Staphylococcus carnosus, Streptomyces lividans, Sinorhizobium
melioti and Rhizobium radiobacter.
[0209] In a further embodiment of the vector according to the
invention the suitable host cell is a is an Aspergillus, Bacillus,
Chrysosporium, Escherichia, Kluyveromyces, Penicillium,
Pseudomonas, Saccharomyces, Streptomyces or Talaromyces species,
preferably the host cell is a Bacillus subtilis, Bacillus
amyloliquefaciens, Bacillus licheniformis, Escherichia coli,
Aspergillus Niger or Aspergillus oryzae species.
[0210] The recombinant host cell according to the invention may
comprise the polynucleotide according to the invention or the
vector according to the invention.
[0211] In an embodiment of the recombinant host cell according the
invention, the recombinant host cell is capable of expressing or
over-expressing the polynucleotide according to the invention or
the vector according to the invention.
[0212] The method according to the invention for manufacturing the
polynucleotide according to the invention or the vector according
to the invention comprises the steps of culturing a host cell
transformed with said polynucleotide or said vector and isolating
said polynucleotide or said vector from said host cell.
[0213] The polypeptide according to the invention comprises: [0214]
an alpha-amylase polypeptide comprising: [0215] (a) an amino acid
sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2; or
[0216] (b) an amino acid sequence having at least 99.5% identity to
an amino acid sequence as set out in amino acids 34 to 719 of SEQ
ID NO: 2; or [0217] (c) an amino acid sequence encoded by a
polynucleotide as set out in nucleotides 100 to 2157 of SEQ ID NO:
1 or SEQ ID NO: 3; or [0218] (d) an amino acid sequence having at
least 70% identity to an amino acid sequence as set out in amino
acids 34 to 719 of SEQ ID NO: 2 and having at least one of Asp at
position 184, Ala at position 297, Thr at position 368 and Asn at
position 489, said positions being defined with reference to SEQ ID
NO: 2; or [0219] (e) an amino acid sequence having at least 70%
identity to an amino acid sequence as set out in amino acids 34 to
719 of SEQ ID NO: 2 and having at least one of Asp at position 184,
Ala at position 297, Thr at position 368 and Asn at position 489,
said positions being defined with reference to SEQ ID NO: 2 and
said amino acid sequence characterized in that when used to prepare
a baked product having a least 5 wt % sugar based on flour, said
baked product has reduced hardness after storage in comparison with
a baked product prepared without use of said amino acid
sequence.
[0220] In an embodiment of the polypeptide according to the
invention, the polypeptide is an isolated polypeptide comprising:
[0221] (a) amino acid sequence as set out in amino acids 34 to 719
of SEQ ID NO: 2; or [0222] (b) an amino acid sequence encoded by
the polynucleotide as set out in nucleotides 100 to 2157 of SEQ ID
NO: 1 or 3; or [0223] (c) the amino acid sequence according to (b),
wherein the polynucleotide is produced by Alicyclobacillus pohliae
NCIMB14276.
[0224] In an embodiment of the polypeptide according to the
invention, the polypeptide is obtainable by expressing the
polynucleotide according to the invention or the vector according
to the invention in an appropriate host cell.
[0225] The method according to the invention for manufacturing the
polypeptide according the invention comprises cultivating the
recombinant host cell according to the invention under condition
which allow for expression of the polynucleotide according to the
invention or the vector according to the invention and, optionally,
recovering the encoded polypeptide from the cell or culture
medium.
[0226] In an embodiment of the method according to the invention
for manufacturing the polypeptide according to the invention the
method comprises cultivating a host cell comprising a vector, the
vector comprising a polynucleotide comprising: [0227] (a) a
polynucleotide sequence as set out in SEQ ID NO: 1 or 3; or [0228]
(b) a polynucleotide sequence as set out in nucleotides 100 to 2157
of the polynucleotide sequence of SEQ ID NO: 1 or 3 (inclusive of
nucleotides 100 and 2157, for the avoidance of doubt); or [0229]
(c) a polynucleotide sequence encoding a polypeptide having an
amino acid sequence as set out in SEQ ID NO: 2 or having an amino
acid sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2
(inclusive of amino acids 34 and 719, for the avoidance of doubt),
under conditions which allow for expression of the vector and,
optionally, recovering the encoded polypeptide from the cell or
culture medium.
[0230] In an embodiment of the method according to the invention
for manufacturing the polypeptide according to the invention the
method comprises cultivating a host cell comprising a
polynucleotide, said polynucleotide comprising: [0231] (a) a
polynucleotide sequence as set out in SEQ ID NO: 1 or 3; or [0232]
(b) a polynucleotide sequence as set out in nucleotides 100 to 2157
of the polynucleotide sequence of SEQ ID NO: 1 or 3 (inclusive of
nucleotides 100 and 2157, for the avoidance of doubt); or [0233]
(c) a polynucleotide sequence encoding a polypeptide having an
amino acid sequence as set out in SEQ ID NO: 2 or having an amino
acid sequence as set out in amino acids 34 to 719 of SEQ ID NO: 2
(inclusive of amino acids 34 and 719, for the avoidance of doubt),
[0234] under conditions which allow for expression of the
polynucleotide and, optionally, recovering the encoded polypeptide
from the cell or culture medium.
[0235] The polypeptide according to the invention may be used in
food manufacturing.
[0236] In an embodiment of the use in food manufacturing, the use
is the manufacture of a baked product, including without limitation
a bread or a cake.
[0237] The enzyme composition according to the invention comprises
the polypeptide according to the invention and one or more
components selected from the group consisting of milk powder,
gluten, granulated fat, an additional enzyme, an amino acid, a
salt, oxidants (including ascorbic acid, bromate and
Azodicarbonamide (ADA)), reducing agents (including L-cysteine),
emulsifiers (including mono/di glycerides, monoglycerides such as
glycerol monostearate (GMS), sodium stearoyl lactylate (SSL),
calcium stearoyl lactylate (CSL), polyglycerol esters of fatty
acids (PGE) and diacetyl tartaric acid esters of mono- and
diglycerides (DATEM), gums (including guargum and xanthangum),
flavours, acids (including citric acid, propionic acid), starch,
modified starch, gluten, humectants (including glycerol) and
preservatives.
[0238] In an embodiment of the enzyme composition according to the
invention the additional enzyme is a lipolytic enzyme, preferably a
phospholipase, a galactolipase or an enzyme having both
phospholipase and galactolipase activity.
[0239] In an embodiment of the enzyme composition according to the
invention the additional enzyme is a phospholipase.
[0240] In an embodiment of the enzyme composition according to the
invention the additional enzyme is a galactolipase.
[0241] In an embodiment of the enzyme composition according to the
invention the additional enzyme is an enzyme having both
phospholipase and galactolipase activity.
[0242] The method according to the invention to prepare a dough
comprises the step of combining the polypeptide according to the
invention or the enzyme composition according to the invention and
at least one dough ingredient. `Combining` includes without
limitation, adding the polypeptide or the enzyme composition
according to the invention to the at least one dough ingredient,
adding the at least one dough ingredient to the polypeptide or the
enzyme composition according to the invention, mixing the
polypeptide according to the invention and the at least one dough
ingredient.
[0243] A dough ingredient includes a component selected from flour,
egg, water, salt, sugar, flavours, fat (including butter,
margarine, oil and shortening), baker's yeast, a chemical leavening
system, milk, oxidants (including ascorbic acid, bromate and
Azodicarbonamide (ADA)), reducing agents (including L-cysteine),
emulsifiers (including mono/di glycerides, mono glycerides such as
glycerol monostearate (GMS), sodium stearoyl lactylate (SSL),
calcium stearoyl lactylate (CSL), polyglycerol esters of fatty
acids (PGE) and diacetyl tartaric acid esters of mono- and
diglycerides (DATEM), gums (including guargum and xanthangum),
acids (including citric acid, propionic acid), starch, modified
starch, gluten, humectants (including glycerol) and
preservatives.
[0244] In an aspect of the method according to the invention to
prepare a dough, the method comprises the steps of combining the
polypeptide according to the invention and at least one component
selected from flour, egg, water, salt, sugar, flavours, fat
(including butter, margarine, oil and shortening), baker's yeast, a
chemical leavening systems, milk, oxidants (including ascorbic
acid, bromate and Azodicarbonamide (ADA)), reducing agents
(including L-cysteine), emulsifiers (including mono/di glycerides,
monoglycerides such as glycerol monostearate (GMS), sodium stearoyl
lactylate (SSL), calcium stearoyl lactylate (CSL), polyglycerol
esters of fatty acids (PGE) and diacetyl tartaric acid esters of
mono- and diglycerides (DATEM), gums (including guargum and
xanthangum), acids (including citric acid, propionic acid), starch,
modified starch, gluten, humectants (including glycerol) and
preservatives.
[0245] In an aspect of the method according to the invention to
prepare a dough, the method comprises the steps of combining the
enzyme composition according to the invention and at least one
component selected from flour, egg, water, salt, sugar, flavours,
fat (including butter, margarine, oil and shortening), baker's
yeast, a chemical leavening systems, milk, oxidants (including
ascorbic acid, bromate and Azodicarbonamide (ADA)), reducing agents
(including L-cysteine), emulsifiers (including mono/di glycerides,
monoglycerides such as glycerol monostearate (GMS), sodium stearoyl
lactylate (SSL), calcium stearoyl lactylate (CSL), polyglycerol
esters of fatty acids (PGE) and diacetyl tartaric acid esters of
mono- and diglycerides (DATEM), gums (including guargum and
xanthangum), acids (including citric acid, propionic acid), starch,
modified starch, gluten, humectants (including glycerol) and
preservatives.
[0246] `Combining` in the above two aspects includes without
limitation, adding the polypeptide or the enzyme composition
according to the invention to the at least one component indicated
above, adding the at least one component indicated above to the
polypeptide or the enzyme composition according to the invention,
mixing the polypeptide according to the invention and the at least
one component indicated above.
[0247] A dough according to the invention may comprise the
polypeptide according to the invention or the enzyme composition
according to the invention.
[0248] The method according to the invention to prepare a baked
product comprises the step of baking the dough according to the
invention.
[0249] In an embodiment of the method to prepare a baked product,
the method comprises baking a dough comprising the polypeptide
according to the invention.
[0250] In an embodiment of the method to prepare a baked product,
the method comprises baking a dough comprising the enzyme
composition according to the invention.
[0251] In an embodiment of the method to prepare a baked product
the baked product is bread or cake.
[0252] The baked product according to the invention is obtainable
by the method according to the invention to prepare the baked
product.
[0253] The method according the invention to produce a polypeptide
having at least 60% identity, in an embodiment at least 70%
identity, in an embodiment at least 80% identity, in an embodiment
at least 85% identity, in an embodiment at least 90% identity, in
an embodiment at least 95% identity with [0254] (a) a polypeptide
having an amino acid sequence as set out in amino acids 34 to 719
of SEQ ID NO: 2; or [0255] (b) a polypeptide having at least 99.5%
identity to a polypeptide having an amino acid sequence as set out
in amino acids 34 to 719 of SEQ ID NO: 2; or [0256] (c) an amino
acid sequence encoded by the polynucleotide as set out in
nucleotides 100 to 2157 of SEQ ID NO: 1 or 3, comprises the use of
Alicyclobacillus pohliae NCIMB14276.
[0257] The alpha-amylase according to the invention is a starch
degrading enzyme. Alpha-amylase activity can suitably be determined
using the Ceralpha.RTM. procedure, which is recommend by the
American Association of Cereal Chemists (AACC).
[0258] A lipolytic enzyme, also referred to herein as lipase, is an
enzyme that hydrolyses triacylglycerol and/or galactolipid and or
phospholipids.
[0259] Lipase activity may be determined spectrophotometrically by
using the chromogenic substrate p-nitrophenyl palmitate (pNPP,
Sigma N-2752). In this assay the pNPP is dissolved in 2-propanol
(40 mg pNPP per 10 ml 2-propanol (Merck 1.09634)) and suspended in
100 mM Acetate buffer pH=5.0 containing 1.0% Triton X-100 (Merck
1.12298) (5 ml substrate in 45 ml buffer). The final substrate
concentration is 1.1 mM. The lipase is incubated with this
substrate solution at 37.degree. C. for 10 minutes. The reaction is
stopped by addition of stop buffer 2% TRIS (Merck 1.08387) +1%
Triton X-100 in a 1:1 ratio with respect to the reaction mixture
and subsequently the formed p-nitrophenol (pNP) is measured at 405
nm. This assay can also be applied at different pH values in order
to determine pH dependence of a lipase. It should be understood
that at different pH values different buffers might be required or
that different detergents might be necessary to emulsify the
substrate. One lipase unit is defined as the amount of enzyme that
liberates 1 micromole of p-nitrophenol per minute at the reaction
conditions stated. It should be understood that it is not uncommon
practice in routine analysis to use standard calibration enzyme
solutions with known activity determined in a different assay to
correlate activity a given assay with units as would be determined
in the calibration assay.
[0260] Alternatively, lipase activity may be determined by using
2,3-mercapto-1-propanol-tributyrate (TBDMP) as a substrate. Lipase
hydrolyses the thioester bond(s) of TBDMP thereby liberating
butanoic acid and 2,3-mercapto-1-propanol-dibutyrate,
2,3-mercapto-1-propanol-monobutyrate or 2,3-mercapto-1-propanol.
The liberated thiol groups are titrated in a subsequent reaction
with 4,4,-dithiodipyridine (DTDP) forming 4-thiopyridone. The
latter is in a tautomeric equilibrium with 4-mercapthopyridine
which absorbs at 334 nm. The reaction is carried out in 0.1 M
acetate buffer pH 5.0 containing 0.2% Triton-X100, 0.65 mM TBDMP
and 0.2 mM DTDP at 37.degree. C. One lipase unit is defined as the
amount of enzyme that liberates 1 micromole of 4-thiopyridone per
minute at the reaction conditions stated.
[0261] In addition to spectrophotometric measurement lipase
activity may also be determined using titrimetric measurement. For
example the esterase activity of a lipolytic enzyme may be measured
on tributyrin as a substrate according to Food Chemical Codex,
Forth Edition, National Academy Press, 1996, p 803.
[0262] A phospholipase is an enzyme that catalyzes the release of
fatty acyl groups from a phospholipid. It may be a phospholipase A2
(PLA2, EC 3.1.1.4) or a phospholipase A1 (EC 3.1.1.32). It may or
may not have other activities such as triacylglycerol lipase (EC
3.1.1.3) and/or galactolipase (EC 3.1.1.26) activity.
[0263] The phospholipase may be a native enzyme from mammalian or
microbial sources. An example of a mammalian phospholipase is
pancreatic PLA2, e.g. bovine or porcine PLA2 such as the commercial
product Lecitase 10L (porcine PLA2, product of Novozymes A/S).
[0264] Microbial phospholipases may be from Fusarium, e.g. F.
oxysporum phospholipase A1 WO 1998/026057), F. venenatum
phospholipase A1 (described in WO 2004/097012 as a phospholipase A2
called FvPLA2), from Tuber, e.g. T. borchii phospholipase A2
(called TbPLA2, WO 2004/097012).
[0265] The phospholipase may also be a lipolytic enzyme variant
with phospholipase activity, e.g. as described in WO 2000/032758 or
WO 2003/060112.
[0266] The phospholipase may also catalyze the release of fatty
acyl groups from other lipids present in the dough, particularly
wheat lipids. Thus, the phospholipase may have triacylglycerol
lipase activity (EC 3.1.1.3) and/or galactolipase activity (EC
3.1.1.26).
[0267] The phospholipase may be a lipolytic enzyme as described in
WO2009/106575, such as the commercial product Panamore.RTM.,
product of DSM.
[0268] The term `baked product` refers to a baked food product
prepared from a dough. Examples of baked products, whether of a
white, brown or whole-meal type, which may be advantageously
produced by the present invention include bread (in particular
white, whole-meal or rye bread), typically in the form of loaves or
rolls, French baguette-type bread, pastries, croissants, brioche,
panettone, pasta, noodles (boiled or (stir-)fried), pita bread and
other flat breads, tortillas, tacos, cakes, pancakes, cookies in
particular biscuits, doughnuts, including yeasted doughnuts,
bagels, pie crusts, steamed bread, crisp bread, brownies, sheet
cakes, snack foods (e.g., pretzels, tortilla chips, fabricated
snacks, fabricated potato crisps). The term baked product includes,
bread containing from 2 to 30 wt % sugar, fruit containing bread,
breakfast cereals, cereal bars, eggless cake, soft rolls and
gluten-free bread. Gluten free bread herein and herein after is
bread than contains at most 20 ppm gluten. Several grains and
starch sources are considered acceptable for a gluten-free diet.
Frequently used sources are potatoes, rice and tapioca (derived
from cassava) Baked product includes without limitation tin bread,
loaves of bread, twists, buns, such as hamburger buns or steamed
buns, chapati, rusk, dried steam bun slice, bread crumb, matzos,
focaccia, melba toast, zwieback, croutons, soft pretzels, soft and
hard bread, bread sticks, yeast leavened and chemically-leavened
bread, laminated dough products such as Danish pastry, croissants
or puff pastry products, muffins, danish, bagels, confectionery
coatings, crackers, wafers, pizza crusts, tortillas, pasta
products, crepes, waffles, parbaked products and refrigerated and
frozen dough products.
[0269] An example of a parbaked product includes, without
limitation, partially baked bread that is completed at point of
sale or consumption with a short second baking process.
[0270] The bread may be white or brown pan bread; such bread may
for example be manufactured using a so called American style Sponge
and Dough method or an American style Direct method.
[0271] The term tortilla herein includes corn tortilla and wheat
tortilla. A corn tortilla is a type of thin, flat bread, usually
unleavened made from finely ground maize (usually called "corn" in
the United States). A flour tortilla is a type of thin, flat bread,
usually unleavened, made from finely ground wheat flour. The term
tortilla further includes a similar bread from South America called
arepa, though arepas are typically much thicker than tortillas. The
term tortilla further includes a laobing, a pizza-shaped thick
"pancake" from China and an Indian Roti, which is made essentially
from wheat flour. A tortilla usually has a round or oval shape and
may vary in diameter from about 6 to over 30 cm.
[0272] The term "dough" is defined herein as a mixture of flour and
other ingredients. In one aspect the dough is firm enough to knead
or roll. The dough may be fresh, frozen, prepared or parbaked. The
preparation of frozen dough is described by Kulp and Lorenz in
Frozen and Refrigerated Doughs and Batters.
[0273] Dough is made using dough ingredients, which include without
limitation (cereal) flour, a lecithin source including egg, water,
salt, sugar, flavours, a fat source including butter, margarine,
oil and shortening, baker's yeast, chemical leavening systems such
as a combination of an acid (generating compound) and bicarbonate,
a protein source including milk, soy flour, oxidants (including
ascorbic acid, bromate and Azodicarbonamide (ADA)), reducing agents
(including L-cysteine), emulsifiers (including mono/di glycerides,
monoglycerides such as glycerol monostearate (GMS), sodium stearoyl
lactylate (SSL), calcium stearoyl lactylate (CSL), polyglycerol
esters of fatty acids (PGE) and diacetyl tartaric acid esters of
mono- and diglycerides (DATEM), gums (including guargum and
xanthangum), flavours, acids (including citric acid, propionic
acid), starch, modified starch, gluten, humectants (including
glycerol) and preservatives.
[0274] Cereals include maize, rice, wheat, barley, sorghum, millet,
oats, rye, triticale, buckwheat, quinoa, spelt, einkorn, emmer,
durum and kamut.
[0275] Dough is usually made from basic dough ingredients including
(cereal) flour, such as wheat flower or rice flour, water and
optionally salt. For leavened products, primarily baker's yeast is
used next to chemical leavening systems such as a combination of an
acid (generating compound) and bicarbonate.
[0276] The term dough herein includes a batter. A batter is a
semi-liquid mixture, being thin enough to drop or poor from a
spoon, of one or more flours combined with liquids such as water,
milk or eggs used to prepare various foods, including cake.
[0277] The dough may be made using a mix including a cake mix, a
biscuit mix, a brownie mix, a bread mix, a pancake mix and a crepe
mix.
[0278] The term dough includes frozen dough, which may also be
referred to as refrigerated dough. There are different types of
frozen dough; that which is frozen before proofing and that which
is frozen after a partial or complete proofing stage. The frozen
dough is typically used for manufacturing baked products including
without limitation biscuits, breads, bread sticks and
croissants.
[0279] The invention also relates to the use of the alpha-amylase
according to the invention in a number of industrial processes.
Despite the long-term experience obtained with these processes, the
alpha-amylase according to the invention may feature advantages
over the enzymes currently used. Depending on the specific
application, these advantages may include aspects like lower
production costs, higher specificity towards the substrate, less
antigenic, less undesirable side activities, higher yields when
produced in a suitable microorganism, more suitable pH and
temperature ranges, better tastes of the final product as well as
food grade and kosher aspects.
[0280] In an embodiment the alpha-amylase according to the
invention may be used in the food industry, including in food
manufacturing.
[0281] An example of an industrial application of the alpha-amylase
enzyme according to the invention in food is its use in baking
applications. The alpha-amylase according to the invention may for
example be used in baked products such as bread or cake. For
example to improve quality of the dough and/or the baked
product.
[0282] Therefore in one embodiment of the invention provides the
use of the alpha-amylase according to the invention in the
preparation of a dough and provides a dough comprising the
alpha-amylase according to the invention. The invention also
provides the preparation of a dough comprising the steps of adding
the alpha-amylase according to the invention to at least one dough
ingredient.
[0283] Yeast, enzymes and optionally additives are generally added
separately to the dough.
[0284] Enzymes may be added in a dry, e.g. granulated form, in a
liquid form or in the form of a paste. Additives are in most cases
added in powder form. Suitable additives include oxidants
(including ascorbic acid, bromate and Azodicarbonamide (ADA)),
reducing agents (including L-cysteine), emulsifiers (including
mono/di glycerides, monoglycerides such as glycerol monostearate
(GMS), sodium stearoyl lactylate (SSL), calcium stearoyl lactylate
(CSL), polyglycerol esters of fatty acids (PGE) and diacetyl
tartaric acid esters of mono- and diglycerides (DATEM), gums
(including guargum and xanthangum), flavours, acids (including
citric acid, propionic acid), starch, modified starch, gluten,
humectants (including glycerol) and preservatives.
[0285] The preparation of a dough from the dough ingredients is
well known in the art and includes mixing of said ingredients and
optionally one or more moulding and fermentation steps.
[0286] The preparation of baked products from such doughs is also
well known in the art and may comprise moulding and shaping and
further fermentation of the dough followed by baking at required
temperatures and baking times. In one embodiment the invention
provides a method to prepare a baked product comprising the step of
baking the dough according to the invention. The baking of the
dough to produce a baked product may be performed using methods
well known in the art. The invention also provides a baked product
obtainable according to this method. In an embodiment the baked
product according to the invention is bread or cake. In one aspect
of the invention, the alpha-amylase according to the invention may
be used to prepare laminated doughs for baked products with
improved crispiness.
[0287] The present invention also relates to methods for preparing
a dough or a baked product comprising incorporating into the dough
an effective amount of the alpha-amylase according to the
invention, which improves one or more properties of the dough or
the baked product obtained from the dough relative to a dough or a
baked product in which the polypeptide is not incorporated.
[0288] The phrase "incorporating into the dough" is defined herein
as adding the alpha-amylase enzyme according to the invention to
the dough, any ingredient from which the dough is to be made,
and/or any mixture of dough ingredients from which the dough is to
be made. In other words, the alpha-amylase enzyme according to the
invention may be added in any step of the dough preparation and may
be added in one, two or more steps. The alpha-amylase enzyme
according to the invention is added to the ingredients of a dough
that is kneaded and baked to make the baked product using methods
well known in the art. See, for example, U.S. Pat. No. 4,567,046,
EP-A-426,211, JP-A-60-78529, JP-A-62-111629, and
JP-A-63-258528.
[0289] The term "effective amount" is defined herein as an amount
of the alpha-amylase according to the invention that is sufficient
for providing a measurable effect on at least one property of
interest of the dough and/or baked product. A suitable amount is in
a range of 10-20000 MU units/kg flour, in an embodiment 100-2000
MU/kg flour, in a further embodiment 200-1000 MU/kg flour. A
suitable amount includes 1 ppm-2000 ppm of an enzyme having an
activity in a range of about 10.000 to 12.000. In an embodiment an
effective amount is in a range of 10-200 ppm of an enzyme having an
activity in a range of about 10.000 to 12.000, in another
embodiment 20-80 ppm of an enzyme having an activity in a range of
about 10.000 to 12.000. In an embodiment an effective amount is in
a range of 10-200 ppm of an enzyme having an activity of about
10.000 MU/g. Herein and hereinafter MU stands for Maltotriose Unit
as defined in the examples under the heading Maltotriose Assay (MU
Assay).
[0290] The term "improved property" is defined herein as any
property of a dough and/or a product obtained from the dough,
particularly a baked product, which is improved by the action of
the alpha-amylase enzyme according to the invention relative to a
dough or product in which the alpha-amylase enzyme according to the
invention is not incorporated. The improved property may include,
but is not limited to, increased strength of the dough, increased
elasticity of the dough, increased stability of the dough, reduced
stickiness of the dough, improved extensibility of the dough,
improved machineability of the dough, increased volume of the baked
product, improved flavour of the baked product, improved crumb
structure of the baked product, improved crumb softness of the
baked product, reduced blistering of the baked product, improved
crispiness, improved resilience both initial and in particular
after storage, reduced hardness after storage and/or improved
anti-staling of the baked product.
[0291] The improved property may include faster dough development
time of the dough and/or reduced dough stickiness of the dough.
[0292] The improved property may include improved foldability of
the baked product, such as improved foldability of a tortilla, a
pancake, a flat bread, a pizza crust, a roti and/or a slice of
bread.
[0293] The improved property may include improved flexibility of
the baked product including improved flexibility of a tortilla, a
pancake, a flat bread, a pizza crust, a roti and/or a slice of
bread.
[0294] The improved property may include improved stackability of
flat baked products including tortillas, pancakes, flat breads,
pizza crusts, roti.
[0295] The improved property may include reduced stickiness of
noodles and/or increased flexibility of noodles.
[0296] The improved property may include reduced clumping of cooked
noodles and/or improved flavor of noodles even after a period of
storage.
[0297] The improved property may include reduction of formation of
hairline cracks in a product in crackers as well as creating a
leavening effect and improved flavor development.
[0298] The improved property may include improved mouth feel and
/or improved softness on squeeze,
[0299] The improved property may include reduced damage during
transport, including reduced breaking during transport.
[0300] The improved property may include reduced hardness after
storage of gluten-free bread.
[0301] The improved property may include improved resilience of
gluten-free bread. The improved property may include improved
resilience both initial and in particular after storage of
gluten-free bread.
[0302] The improved property may include reduced hardness after
storage of rye bread.
[0303] The improved property may include reduced loss of resilience
over storage of rye bread,
[0304] The improved property may include reduced loss of resilience
over storage of a baked product comprising at least 5 wt % sugar,
in an aspect comprising at least 8 wt % sugar, in an aspect
comprising at least 12 wt % sugar, in an aspect comprising at least
15 wt % sugar based on flour. In an aspect comprising at least 18
wt % sugar, in an aspect comprising at least 20 wt % sugar, in an
aspect comprising at least 25 wt % sugar, in an aspect comprising
at least 30 wt % sugar based on flour. So for example 5% means 50
grams sugar per 1000 gram of flour used in the recipe.
[0305] The improved property may include reduced hardness after
storage of a baked product comprising at least 5 wt % sugar, in an
aspect comprising at least 8 wt % sugar, in an aspect comprising at
least 12 wt % sugar, in an aspect comprising at least 15 wt % sugar
based on flour. In an aspect comprising at least 18 wt % sugar, in
an aspect comprising aspect at least 20 wt % sugar, in an aspect
comprising at least 25 wt % sugar, in an aspect comprising at least
30 wt % sugar based on flour. So for example 5% means 50 grams
sugar per 1000 gram of flour used in the recipe.
[0306] Improved mouth feel includes sense of softness on an initial
bite or after chewing, preferably without a sticky feeling in the
mouth and/or without the baked product sticking to the teeth.
Improved mouth feel includes the baked product feeling less dry in
the mouth on an initial bite or after chewing. Improved mouth feel
includes the baked product feeling less dry in the mouth on an
initial bite or after chewing after it has been kept outside its
packaging or container. The improved property may include that
after a slice of bread was taken from its packaging or container
and exposed to ambient conditions for 5 minutes, in an aspect for
10 minutes, in an aspect for 20 minutes it has improved
mouthfeel.
[0307] The improved property may include that after a the cookie
was taken from its packaging or container and exposed to ambient
conditions for 10 minutes, in an aspect for 20 minutes, in an
aspect for 30 minutes, in an aspect an hour it has improved
mouthfeel. In an aspect ambient conditions herein and herein after
include a temperature of 20 degrees C. and a moisture level of 40%
humidity.
[0308] Reduced breaking during transport includes the baked
product, including without limitation cookies, bread such as gluten
free bread, does not break in additional pieces as a consequence of
transport.
[0309] Improved softness on squeeze includes the tactile experience
that if a bun is held between the fingers and the thumb of a hand
and the thumb and fingers are moved towards each other it takes
less force.
[0310] Improved foldability of a baked product may be determined as
follows.
[0311] The baked product is laid on a flat surface. The baked
product is folded by picking up one edge of the product and placing
it on the opposite edge of the product. This way a folded baked
product is obtained having a bend curve in an area located at or
close to the center. The surface of the outside of the bend of
folded baked product is visually inspected. The foldability is
improved if fewer cracks are observed at or close to the bend. This
may be a particularly useful property if the baked product is a
tortilla and/or a slice of bread.
[0312] Improved stackability may be determined as follows. [0313]
10 baked products are stacked on top of each other and sealed in a
polymer package, such as polyethylene foil. This yields a pack of
baked products. 10 packs of baked product are stacked on top of
each other and kept under ambient conditions for 3 days, in an
aspect for 5 days in an aspect for 1 week, in an aspect for 2
weeks. Ambient conditions are conditions as defined herein. After
this period the bottom pack of baked products is opened, the baked
products are separated from each other and the surfaces of the
products are visually inspected. The stackability is improved if
less surface damage is observed. Surface damage may be caused e.g.
by rupture of the surface during separation of two baked products
that were stacked on top of each other. This may be a particularly
useful property if the baked product is a tortilla.
[0314] Faster dough development time may be determined as
follows
[0315] Dough development time is the time the dough need to reach
maximum consistency, maximum viscosity before gluten strands begin
to break down. It may be determined by measuring peak time, using a
Farinograph.RTM. from Brabender.RTM., Germany. If a faronigraph is
used to determine dough development time, dough development time is
the time between the moment water is added and the moment the curve
reaches its highest point. Peak time is preferably expressed in
minutes.
[0316] Reduced dough stickiness may be determined as follows.
[0317] Dough stickiness is preferably determined on two separate
batches of at least 8 dough pieces, with the Texture Analyser
TAXT2i (Stable Micro Systems Ltd., Surrey, UK) equipped with a 5 kg
load cell in the measure force in compression mode with a
cylindrical probe (25 mm diameter). Using pre- and post-test speeds
of 2.0 mm/s, while the test speed is 1.0 mm/s. Dough pieces are
centered and compressed 50% and the probe is held for 10 s at
maximum compression. A negative peak value indicates dough
stickiness. A less negative peak value indicates reduced dough
stickiness.
[0318] Increased flexibility may be determined as follows.
[0319] The baked product is laid on a flat surface. The baked
product is rolled to a shape similar to a pipe, this way a rolled
baked product is obtained. The flexiblity is improved if the rolled
baked product remains its rolled up shape and does not roll open.
This may be a particularly useful property if the baked product is
a tortilla or a pancake.
[0320] The improved property may be determined by comparison of a
dough and/or a baked product prepared with and without addition of
the (isolated) polypeptide of the present invention in accordance
with the methods of present invention which are described below in
the Examples. Organoleptic qualities may be evaluated using
procedures well established in the baking industry, and may
include, for example, the use of a panel of trained
taste-testers.
[0321] The term "increased strength of the dough" is defined herein
as the property of a dough that has generally more elastic
properties and/or requires more work input to mould and shape.
[0322] The term "increased elasticity of the dough" is defined
herein as the property of a dough which has a higher tendency to
regain its original shape after being subjected to a certain
physical strain.
[0323] The term "increased stability of the dough" is defined
herein as the property of a dough that is less susceptible to
forming faults as a consequence of mechanical abuse thus better
maintaining its shape and volume and is evaluated by the ratio of
height:width of a cross section of a loaf after normal and/or
extended proof.
[0324] The term "reduced stickiness of the dough" is defined herein
as the property of a dough that has less tendency to adhere to
surfaces, e.g., in the dough production machinery, and is either
evaluated empirically by the skilled test baker or measured by the
use of a texture analyser (e.g. a TAXT Plus) as known in the
art.
[0325] The term "improved extensibility of the dough" is defined
herein as the property of a dough that can be subjected to
increased strain or stretching without rupture.
[0326] The term "improved machineability of the dough" is defined
herein as the property of a dough that is generally less sticky
and/or more firm and/or more elastic. Consequently there is less
fouling of plant equipment and a reduced need for cleaning.
[0327] The term "increased volume of the baked product" is
preferably measured as the volume of a given loaf of bread
determined by an automated bread volume analyser (eg. BVM-3, TexVol
Instruments AB, Viken, Sweden), using ultrasound or laser detection
as known in the art. In case the volume is increased, the property
is improved. Alternatively the height of the baked product after
baking in the same size tin is an indication of the baked product
volume. In case the height of the baked product has increased, the
volume of the baked product has increased.
[0328] The term "reduced blistering of the baked product" is
defined herein as a visually determined reduction of blistering on
the crust of the baked bread.
[0329] The term "improved crumb structure of the baked product" is
defined herein as the property of a baked product with finer cells
and/or thinner cell walls in the crumb and/or more
uniform/homogenous distribution of cells in the crumb and is
usually evaluated visually by the baker or by digital image
analysis as known in the art (eg. C-cell, Calibre Control
International Ltd, Appleton, Warrington, UK).
[0330] The term "improved softness of the baked product" is the
opposite of "hardness" and is defined herein as the property of a
baked product that is more easily compressed and is evaluated
either empirically by the skilled test baker or measured by the use
of a texture analyzer (e.g. TAXT Plus) as known in the art.
[0331] The term "improved flavor of the baked product" is evaluated
by a trained test panel.
[0332] The term "improved anti-staling of the baked product" is
defined herein as the properties of a baked product that have a
reduced rate of deterioration of quality parameters, e.g. reduced
hardness after storage and/or decreased loss of resilience after
storage.
[0333] Anti-staling properties may be demonstrated by a reduced
hardness after storage of the baked product. The alpha-amylase
according to the invention may result in reduced hardness, e.g. in
a baked product that is more easily compressed. The hardness of the
baked product may be evaluated either empirically by the skilled
test baker or measured by the use of a texture analyzer (e.g. TAXT
Plus) as known in the art. The hardness measured within 24 hours
after baking is called initial hardness. The hardness measured 24
hours or more after baking is called hardness after storage, and is
also a measure for determining shelf life. In case the initial
hardness has reduced, it has improved. In case the hardness after
storage has reduced, it has improved. Preferably hardness is
measured as described in example 9 herein.
[0334] Resilience of the baked product is preferably measured by
the use of a texture analyzer (e.g. TAXTPlus) as known in the
art.
[0335] The resilience measured within 24 hours after baking is
called initial resilience. The resilience measured 24 hours or more
after baking is called resilience after storage, and is also a
measure for determining shelf life. Freshly baked product typically
gives crumb of high initial resilience but resilience is lost over
shelf-life. Improved anti-staling properties may be demonstrated by
a reduced loss of resilience over storage. Preferably resilience is
measured as described in example 9 herein.
[0336] The term "improved crispiness" is defined herein as the
property of a baked product to give a crispier sensation than a
reference product as known in the art, as well as to maintain this
crispier perception for a longer time than a reference product.
This property can be quantified by measuring a force versus
distance curve at a fixed speed in a compression experiment using
e.g. a texture analyzer TA-XT Plus (Stable Micro Systems Ltd,
Surrey, UK), and obtaining physical parameters from this
compression curve, viz. (i) force of the first peak, (ii) distance
of the first peak, (iii) the initial slope, (iv) the force of the
highest peak, (v) the area under the graph and (vi) the amount of
fracture events (force drops larger than a certain preset value).
Indications of improved crispness are a higher force of the first
peak, a shorter distance of the first peak, a higher initial slope,
a higher force of the highest peak, higher area under the graph and
a larger number of fracture events. A crispier product should score
statistically significantly better on at least two of these
parameters as compared to a reference product. In the art,
"crispiness" is also referred to as crispness, crunchiness or
crustiness, meaning a material with a crispy, crunchy or crusty
fracture behaviour.
[0337] The present invention may provide a dough having at least
one of the improved properties selected from the group consisting
of increased strength, increased elasticity, increased stability,
reduced stickiness, and/or improved extensibility of the dough.
[0338] The invention also may provide a baked product having
increased loaf volume. The invention may provide as well a baked
product having at least one improved property selected from the
group consisting of increased volume, improved flavour, improved
crumb structure, improved crumb softness, improved crispiness,
reduced blistering and/or improved anti-staling.
[0339] The alpha-amylase according to the invention may be used for
retarding staling of a baked product such as bread and cake.
Retarding of staling may be indicated by a reduced hardness, in
particular a reduced hardness after storage compared to a baked
product, including bread and cake, that is produced without the
alpha-amylase according to the invention according to the
invention.
[0340] The alpha-amylase according to the invention has an
intermediate thermostability compared with other alpha-amylases
used in the industry. The alpha-amylase of the invention has higher
temperature stability than fungal alpha-amylase or alpha amylase
from cereal flour. On the other hand, it has a lower
thermostability at high temperature, in particular a lower
thermostability at the inactivation temperature of the
alpha-amylase during baking, than other amylases used in the
industry, such as bacterial alpha-amylase.
[0341] The alpha-amylase according to the invention has a lower
thermostability at a high temperature, in an embodiment at a
temperature above 70.degree. C., preferably at a temperature above
75.degree. C., preferably at a temperature above 78.degree. C.,
preferably at a temperature above 80.degree. C., preferably at a
temperature above 82.degree. C., preferably at a temperature above
85.degree. C., compared to known alpha-amylases as measured using a
method as described in example 8 herein. Preferably thermostability
is evaluated as follows: 25 MU/ml purified enzyme solution in a
buffer containing 50 mM sodium acetate, pH 5.0, 1 mM CaCl.sub.2 and
1 g/L BSA are pre-incubated in an Eppendorf tube for 30 minutes at
various temperatures (40.degree. C. to 86.degree. C.). The residual
enzyme activity is determined using the MU assay described herein
in the examples under "Determination of enzyme activity", "2)
Maltotriose assay (MU assay)".
[0342] The alpha-amylase enzyme according to the invention is
preferably active during baking and is preferably inactivated
before end of baking.
[0343] Benefits of the alpha-amylase according to the invention
having an intermediate thermostability and/or a lower
thermostability at a high temperature, may include, without
limitation, one or more of the following.
[0344] An enzyme having lower thermostability at a high temperature
may result in an increased level of denaturation of the enzyme
during the baking process. This may result in a more complete
inactivation of the enzyme activity and thus impart greater control
of enzyme function in the baking process.
[0345] It has been observed that small and large baked products
have different heat transfer rates, different bake times and
consequently different thermal treatments. The alpha-amylase
according to the invention may be beneficial for baked products
undergoing less thermal treatment as a consequence of reduced
baking time and/or temperature.
[0346] It has been observed that bread baked at a higher altitude
such as locations above 2000 m (e.g. Mexico City 2240 m altitude)
may suffer from difficulties in achieving crumb temperatures
sufficient to inactivate thermostable enzymes. Without being bound
to theory, it is thought that this is because the water boils at a
lower temperature due to the lower atmospheric pressure, and this
dictates the maximum temperature reached in the centre of a baked
product. A lower maximum temperature in the centre of the baked
product may make it more difficult to (fully) inactivate the
enzyme. An alpha-amylase having lower thermostability at high
temperature might confer advantage in such locations, such as
Mexico City, for example.
[0347] Industrial bakeries are under increasing pressure to reduce
baking times and oven temperatures--often to below 20 minutes, both
for cost benefit and for sustainability reasons. A more heat labile
enzyme may be better suited to a shorter baking time in that the
enzyme is more effectively denatured at the end of the baking
process. Parbaked bread receives a shorter baking time--e.g.
typically 20% shorter baking process and/or 10.degree. C. lower
oven temperature than full baked equivalents, and may therefore
also be expected to benefit from an enzyme having lower
thermostability at high temperatures.
[0348] The alpha-amylase enzyme of the present invention and/or
additional enzymes to be used in the methods of the present
invention may be in any form suitable for the use in question, e.g.
in the form of a dry powder, agglomerated powder or granulate, in
particular a non-dusting granulate, liquid, in particular a
stabilized liquid, or protected enzyme such described in WO01/11974
and WO02/26044. A liquid form includes without limitation an
emulsion, a suspension and a solution. Granulates and agglomerated
powders may be prepared by conventional methods, e.g. by spraying
the alpha-amylase enzyme according to the invention onto a carrier
in a fluid-bed granulator. The carrier may consist of particulate
cores having a suitable particle size. The carrier may be soluble
or insoluble, suitable carriers include a salt (such as NaCl or
sodium sulphate), sugar alcohol (such as sorbitol), starch, rice
flour, wheat flour, corn grits, maltodextrins or soy.
[0349] Such granulate or agglomerated powder, comprising the
polypeptide of the present invention, may be referred to as a
baking additive. The baking additive preferably has a narrow
particle size distribution with more than 95% (by weight) of the
particles in the range from 25 to 500 .mu.m.
[0350] The amylolytic enzyme according to the invention and/or
additional enzymes may be contained in slow-release formulations.
Methods for preparing slow-release formulations are well known in
the art. Adding nutritionally acceptable stabilizers such as sugar,
sugar alcohol, or another polyol, and/or lactic acid or another
organic acid according to established methods may for instance,
stabilize liquid enzyme preparations.
[0351] Preferably the enzyme according to the invention is provided
in a dry form, to allow easy handling of the product. Irrespective
of the formulation of the enzyme, the formulation may comprise one
or more additives. Examples of suitable additives include oxidants
(including ascorbic acid, bromate and Azodicarbonamide (ADA)),
reducing agents (including L-cysteine), emulsifiers (including
mono/di glycerides, monoglycerides such as glycerol monostearate
(GMS), sodium stearoyl lactylate (SSL), calcium stearoyl lactylate
(CSL), polyglycerol esters of fatty acids (PGE) and diacetyl
tartaric acid esters of mono- and diglycerides (DATEM), gums
(including guargum and xanthangum), flavours, acids (including
citric acid, propionic acid), starch, modified starch, gluten,
humectants (including glycerol) and preservatives.
[0352] The alpha-amylase enzyme according to the invention may also
be incorporated in yeast comprising compositions such as disclosed
in EP-A-0619947, EP-A-0659344 and WO02/49441.
[0353] For inclusion in a pre-mix of flour it is advantageous that
the (isolated) polypeptide according to the invention is in the
form of a dry product, e.g., a non-dusting granulate, whereas for
inclusion together with a liquid it is advantageously in a liquid
form.
[0354] One or more additional enzymes may also be incorporated into
the dough. Therefore the invention provides an enzyme composition
comprising the alpha-amylase enzyme according to the invention and
one or more additional enzymes. The enzyme composition may be a
baking enzyme composition. This enzyme composition may be used in
dough products and baked products obtained from such dough. For
example it may used in dough products further containing eggs and
in baked products, such as brioche and panettone, both regular and
with a reduced amount of eggs. The additional enzyme may be of any
origin, including mammalian and plant, and preferably of microbial
(bacterial, yeast or fungal) origin and may be obtained by
techniques conventionally used in the art.
[0355] In an embodiment, the additional enzyme may be an amylase,
including a further alpha-amylase, such as an fungal alpha-amylase
(which may be useful for providing sugars fermentable by yeast and
retarding staling), beta-amylase, a cyclodextrin
glucanotransferase, a protease, a peptidase, in particular, an
exopeptidase (which may be useful in flavour enhancement),
transglutaminase, triacyl glycerol lipase (which may be useful for
the modification of lipids present in the dough or dough
constituents so as to soften the dough), galactolipase,
phospholipase, cellulase, hemicellulase, in particular a
pentosanase such as xylanase (which may be useful for the partial
hydrolysis of pentosans, more specifically arabinoxylan, which
increases the extensibility of the dough), protease (which may be
useful for gluten weakening in particular when using hard wheat
flour), protein disulfide isomerase, e.g., a protein disulfide
isomerase as disclosed in WO 95/00636, glycosyltransferase,
peroxidase (which may be useful for improving the dough
consistency), laccase, or oxidase, hexose oxidase, e.g., a glucose
oxidase, aldose oxidase, pyranose oxidase, lipoxygenase or L-amino
acid oxidase (which may be useful in improving dough consistency)
or a protease.
[0356] The cellulase may be from A. niger or from Trichoderma
reesei.
[0357] The amyloglucosidase, may be an amyloglucosidase from
Aspergillus such as from A. oryzae or A. niger, preferably from A.
niger.
[0358] In an embodiment the additional enzyme is a lipolytic
enzyme, including a triacyl glycerol lipase, a phospholipase, a
galactolipase and an enzyme having both galactolipase and
phospholipase activity.
[0359] The triacyl glycerol lipase may be a fungal lipase,
preferably from Rhizopus, Aspergillus, Candida, Penicillum,
Thermomyces, or Rhizomucor. In an embodiment the triacyl glycerol
lipase is from Rhyzopus, in a further embodiment a triacyl glycerol
lipase from Rhyzopus oryzae is used. Optionally a combination of
two or more triacyl glycerol lipases may be used.
[0360] In a further embodiment the lipolytic enzyme is a
phospholipase or an enzyme having both galactolipase and
phospholipase activity. Such lipases are known to be active on the
endogenous lipids of wheat and on extraneous lipid sources, for
example as provided by added shortening fat or from lecithin.
Preferentially the lipase cleaves polar lipids and has
phospholipase activity, galactolipase activity or a combination of
phospholipase and galactolipase activity to create
lysophospholipids, such as lysophoshotidyl choline, and
lysogalactolipids such as digalactosylmonoglyceride. The
specificity of the lipase can be shown through in vitro assay
making use of appropriate substrate, for example triacylglycerol
lipid, phosphotidylcholine and diglactosyldiglyceride, or
preferably through analysis of the reactions products that are
generated in the dough during mixing and fermentation.
[0361] Panamore.RTM., Lipopan.RTM. F, Lipopan.RTM. 50 and
Lipopan.RTM. S are commercialised to standardised lipolytic
activity, using a measurement of DLU for Panamore.RTM. from DSM and
a measurement of LU for the Lipopan.RTM. family from Novozymes. DLU
is defined as the amount of enzyme needed to produce 1 micromol/min
of p-nitrophenol from p-nitrophenyl palmitate at pH 8.5 at
37.degree. C., while LU is defined as the amount of enzyme needed
to produce 1 micromol/min of butyric acid from tributyrin at pH 7
at 30.degree. C. Lipases are optimally used with the alpha-amylase
of the invention at 2-850 DLU/kg flour or at 50-23500 LU/kg
flour.
[0362] In an embodiment of the enzyme composition according to the
invention the additional enzyme is Panamore.RTM. as described in
WO2009/106575.
[0363] In an embodiment of the enzyme composition of the invention
the additional enzyme is an enzyme as described in WO9826057.
[0364] In an aspect of the enzyme composition according to the
invention the additional enzyme is an enzyme as described in U.S.
Pat. No. RE38,507.
[0365] In an aspect of the enzyme composition according to the
invention the additional enzyme is an enzyme as described in WO
9943794, in particular in EP1058724B1.
[0366] If one or more additional enzyme activities are to be added
in accordance with the methods of the present invention, these
activities may be added separately or together with the polypeptide
according to the invention, for example as the enzyme composition
according to the invention, which includes a bread-improving
composition and/or a dough-improving composition. The other enzyme
activities may be any of the enzymes described above and may be
dosed in accordance with established baking practices.
[0367] In an embodiment the enzyme composition according to the
invention is provided in a dry form, to allow easy addition to the
dough, the dough ingredients, but liquid forms are also possible. A
liquid form includes without limitation an emulsion, a suspension
and a solution. Irrespective of the formulation of the enzyme
composition, any additive or additives known to be useful in the
art to improve and/or maintain the enzyme's activity, the quality
of the dough and/or the baked product may be applied. Examples of
suitable additives include oxidants (including ascorbic acid,
bromate and Azodicarbonamide (ADA)), reducing agents (including
L-cysteine), emulsifiers (including mono/di glycerides,
monoglycerides such as glycerol monostearate (GMS), sodium stearoyl
lactylate (SSL), calcium stearoyl lactylate (CSL), polyglycerol
esters of fatty acids (PGE) and diacetyl tartaric acid esters of
mono- and diglycerides (DATEM), gums (including guargum and
xanthangum), flavours, acids (including citric acid, propionic
acid), starch, modified starch, gluten, humectants (including
glycerol) and preservatives.
[0368] The alpha-amylase according to the invention may be
incorporated in a pre-mix, e.g. in the form of a flour composition,
for dough and/or baked products made from dough, in which the
pre-mix comprises a polypeptide of the present invention. The term
"pre-mix" is defined herein to be understood in its conventional
meaning, i.e. as a mix of baking agents, generally including flour,
which may be used not only in industrial bread-baking
plants/facilities, but also in retail bakeries. The pre-mix may be
prepared by mixing the alpha-amylase according to the invention or
the enzyme composition according to the invention with a suitable
carrier such as flour, starch or a salt. The pre-mix may contain
additives as mentioned above.
[0369] In another aspect, the alpha-amylase enzyme according to the
invention may be used in the production of cake and in the
production of a batter from which a cake can be made.
[0370] In another aspect, the alpha-amylase enzyme according to the
invention may be used to reduce hardness after storage of a baked
product containing at least 10 wt % sugar based on flour. So for
example 5% means 50 grams per 1000 gram of flour used in the
recipe.
[0371] The alpha-amylase enzyme according to the invention may be
used in the preparation of a wide range of cakes, including
shortened cakes, such as for example pound cake and butter cake,
and including foam cakes, such as for example meringues, sponge
cake, biscuit cake, roulade, genoise and chiffon cake. Sponge cake
is a type of soft cake based on wheat flour, sugar, baking powder
and eggs (and optionally baking powder). The only fat present is
from the egg yolk, which is sometimes added separately from the
white. It is often used as a base for other types of cakes and
desserts. A pound cake is traditionally prepared of one pound each
of flour, butter, eggs, and sugar, optionally complemented with
baking powder. In chiffon cake the butter/margarine has been
replaced by oil. Sugar and egg yolk content has been decreased
compared to pound or sponge cake and egg white content has been
increased.
[0372] A method to prepare a batter preferably comprises the steps
of: [0373] a. preparing the batter of the cake by adding at least:
[0374] i. sugar; [0375] ii. flour; [0376] iii. the alpha-amylase
enzyme according to the invention; [0377] iv. at least one egg; and
[0378] v. optionally a phospholipase.
[0379] A method to prepare a cake according to the invention
further comprises the step of [0380] b. baking the batter to yield
a cake.
[0381] The person skilled in the art knows how to prepare a batter
or a cake starting from dough ingredients. Optionally one or more
other ingredients can be present in the composition e.g. to allow
reduction of eggs and/or fat in the cake, such as hydrocolloids,
yeast extract, calcium.
[0382] The above-mentioned industrial applications of the
alpha-amylase enzyme according to the invention comprise only a few
examples and this listing is not meant to be restrictive.
[0383] Other uses of the alpha-amylase according to the invention
may include: [0384] the production of glucose, fructose and maltose
syrups; [0385] production of starch hydrolysates such as
maltodextrins; [0386] production of modified starches; [0387]
modification of starch components in animal feed; [0388]
replacement of malt in brewing; [0389] use in a Glue including wall
paper paste; [0390] use in plastic objects made using starch,
including plastic bags made from polymerized starch films; and/or
[0391] use in waist bread reprocessing.
EXAMPLES
Determination of Enzyme Activity
1) AACC Method 22-02.01
Measurement of Alpha-Amylase in Plant and Microbial Materials Using
the Ceralpha.RTM. Method
[0392] The alpha-amylase activity was quantified by measuring
activity using a Megazyme CERALPHA alpha-amylase assay kit
(Megazyme International Ireland Ltd., Co. Wicklow, Ireland)
according to the manufacturer's instruction.
2) Maltotriose Assay (MU Assay)
[0393] One Maltotriose Unit (MU) is defined as the amount of enzyme
that liberates 1 .mu.mole glucose per minute using maltotriose
substrate under the following assay conditions. Enzymatic activity
was determined at 37.degree. C. and pH 5.0 using maltotriose as
substrate. Enzymatic hydrolysis of maltotriose results in
quantitative release of glucose, which is a measure for enzymatic
activity. The final assay concentrations: 8 mg/ml maltotriose,
0.007 to 0.02 MU/ml mature DSM-AM, 20 mM citrate buffer, 0.2 mg/ml
BSA, 2 mM NaCl. The reaction was stopped after 30 minutes (addition
of 0.33 M NaOH in 1:10 ratio) and the released glucose was
converted into gluconate-6-P in two steps during which NADH is
formed, using a Glucose Hexokinase FS kit (Diagn. Syst). The
resulting absorbance increases at a wavelength of 340 nm was a
measure for the amount of glucose released during the 30 minute
incubation. Activity was calculated using a glucose calibration
line.
Example 1
Production of the Alpha-Amylase of the Invention
Cloning and Enzyme Preparation
[0394] As described in further detail below the alpha-amylase gene
was cloned and expressed in B. subtilis in the following way
Strains and Plasmids
[0395] Bacillus subtilis strain BS154 (CBS 363.94) (.DELTA.aprE,
.DELTA.nprE, amyE-, spo-) is described in Quax and Broekhuizen 1994
Appl Microbiol Biotechnol. 41: 425-431.
[0396] The E. coli/B. subtilis shuttle vector pBHA12 is described
in (WO2008/000632). Alicyclobacillus pohliae NCIMB14276 was
described by Imperio et al (Int. J. Syst. Evol. Microbiol
58:221-225, 2008).
[0397] Bacillus stearothermophilus C599 (NCIMB11873) is described
in WO91/04669.
Molecular Biology Techniques
[0398] Molecular biology techniques known to the skilled person
were performed (see: Sambrook & Russell, Molecular Cloning: A
Laboratory Manual, 3rd Ed., CSHL Press, Cold Spring Harbor, N.Y.,
2001). Polymerase chain reaction (PCR) was performed on a
thermocycler with Phusion High-Fidelity DNA polymerase (Finnzymes
OY, Aspoo, Finland) according to the instructions of the
manufacturer.
Amylase Activity
[0399] Alpha-amylase activity in the broth of B. subtilis cultures
was quantified as described above according to AACC Method
22-02.01.
Sequencing of Alicyclobacillus pohliae Genome
[0400] The genome of Alicyclobacillus pohliae NCIMB14276 was
sequenced by BaseClear (Leiden, The Netherlands). The DNA was
fragmented (shearing) and DNA adapters were ligated to both ends of
the DNA fragments. Two sets of Illumina GAllx sequence reads were
obtained. One set consisted of paired-end reads, spanning a
distance of around 250 (+-125) nucleotides. The second set
consisted of mate pair reads, spanning a distance of around 4200
nucleotides (+-2100). On all Illumina GAllx sequence reads a
quality filtering was applied based on Phred quality scores. In
addition, low quality and ambiguous nucleotides were trimmed off
from the remaining reads. The filtered paired-end and mate pair
reads were used for `De novo` assembly in the CLC Genomics
Workbench version 4.6.1 or 4.7 (CLC bio, Aarhus, Denmark). In this
way, a set of pre-assembled contigs (contiguous sequences) were
obtained. The contigs were arranged further (scaffolding) using
SSPACE described by Boetzer et al. (Bioinformatics 27:578-579,
2011). The sequence analysis revealed that the Alicyclobacillus
pohliae NCIMB14276 genome contains a gene encoding an alpha-amylase
enzyme named DSM-AM herein with the nucleotide sequence as set out
in SEQ ID NO: 1, see also FIG. 3.
[0401] The corresponding DSM-AM protein encoded by SEQ ID NO.1 has
the amino acid sequence as set out in SEQ ID NO: 2, see also FIG.
4.
[0402] The nucleotide sequence of the codon optimized DSM-AM gene
is set out in SEQ ID NO: 3, see also FIG. 5.
Example 2
Expression of A. pohliae DSM-AM Gene in Bacillus subtilis
[0403] An amyQ terminator and a PmeI restriction site were
introduced in the pBHA12 vector by digesting pBHA12 with SphI and
HindIII and cloning the following DNA sequence
5'-GCATGCGTTTAAACAAAAACACCTCCAAGCTGAGTGCGGGTATCAGCTTGGAGGTGC
GTTTATTTTTTCAGCCGTATGACAAGGTCGGCATCAGAAGCTT-3' (the 5'SphI and
3'HindIII restriction sites are underlined).
[0404] The fragment was cloned into pBHA12 which resulted in vector
pGBB09 (FIG. 1).
[0405] The DSM-AM gene was synthesised by GeneArt (Germany) and at
the 5' end the PacI restriction site was added and at its 3'end the
PmeI restriction site was added. The DSM-AM gene was cloned into
the Pad and PmeI digested pGBB09 vector which resulted in vector
pGBB09DSM-AM1 (FIG. 2). This vector was transformed to B. subtilis
strain BS154. The sequence of the plasmid was confirmed by DNA
sequencing. The B. subtilis strain BS154 containing pGBB09DSM-AM1
was named DSM-AMB154-1.
Example 3
Expression of DSM-AM with B. subtilis in Shake Flasks
[0406] B. subtilis strains DSM-AMB154-1 and BS154 were grown in a
shake flask. These shake flasks contained 20 ml 2.times.TY medium
composed of 1.6% (w/v) Bacto tryptone, 1% (w/v) Yeast extract and
0.5% (w/v) NaCl. The cultures were shaken vigorously at 37.degree.
C. and 250 rpm for 16 hours and 0.2 ml culture medium was used to
inoculate 20 ml SMM medium. SMM pre-medium contains 1.25% (w/w)
yeast extract, 0.05% (w/w) CaCl2, 0.075% (w/w) MgCl2.6H2O, 15
.mu.g/l MnSO4.4H2O, 10 .mu.g/l CoCl2.6H2O, 0.05% (w/w) citric acid,
0.025% (w/w) antifoam 86/013 (Basildon Chemicals, Abingdon, UK). To
complete SMM medium, 20 ml of 5% (w/v) maltose and 20 ml of a 200
mM Na-phosphate buffer stock solution (pH 6.8), both prepared and
sterilized separately, were added to 60 ml SMM pre-medium. These
cultures were incubated for 48 hours at 37.degree. C. and 250 rpm.
The supernatants were harvested and analysed for enzyme
productivity. The alpha-amylase activity of strain DSM-AMB154-1 was
measured according to AACC Method 22-02.01 as described in above.
The supernatant of DSM-AMB154-1 contained alpha-amylase activity
whereas the parent strain BS154 did not.
Example 4
Enzyme Preparation
[0407] Bacillus strain DSM-AMB154-1 was cultivated under aerobic
conditions in a suitable fermentation medium.
[0408] The enzyme was secreted into the medium. The ensuing
fermentation broth was filtered to remove bacterial cells, debris
from these cells and other solids. The filtrate containing the
enzyme, thus obtained, was then concentrated by ultrafiltration to
yield a concentrate containing mature DSM-AM.
Example 5
Enzyme Purification
[0409] The purification was performed using of the following steps.
The concentrated fermentation broth obtained in example 4
containing mature DSM-AM was mixed with 50 mM HEPES buffer, pH 7.5
containing 400 mg/ml (NH.sub.4).sub.2SO4 (1:1 ratio). The solution
was stirred overnight at 4.degree. C., and followed by
centrifugation at 3220 rcf, 4.degree. C. for 10 minutes. The pellet
was resuspended in 25 mM Tris buffer, pH7.5, and filtrated through
0.45 .mu.m filter. The conductivity of the solution was adjusted to
2 ms/cm by addition of MilliQ water, and followed by pH adjustment
to pH=7.5. The solution was concentrated by Vivaspin 20 ml
Concentrator (Sartorius Stedim) 10.000 MWCO, at 3220 rcf, 4.degree.
C. for 15 min. The solution was applied to a Q-Sepharose column
equilibrated with 25 mM HEPES buffer, pH 7.5. The protein was
collected in flow-through. Flow-through was re-applied to a
Q-sepharose column equilibrated with 25 mM HEPES buffer, pH 9.5.
Protein was eluted with a 0-1 M NaCl gradient. The purified mature
DSM-AM enzyme was desalted by a PD-10 desalting column (GE
Healthcare) using 25 mM Tris buffer, pH7.5.
Protein Determination
[0410] The protein concentration of the purified mature DSM-AM
enzyme as obtained in example 5 was determined by BCA.TM. protein
assay kit (Pierce) according to the manufacturer's instruction with
the following condition: the ratio of the sample to WR reagent was
1:12, and the absorbance of the mixture was determined at
wavelength of 540 nm.
Example 6
Enzyme Properties
[0411] Dependence of the enzyme activity of the mature DSM-AM as
obtained in example 5, on pH was tested by the MU assay described
above using a reaction mixture in which pH was adjusted to
different values (pH 4.0, 4.3, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5). Two
measurements with two final enzyme concentrations, 0.01 and 0.018
MU/ml were taken. The results were described as a relative
activity. The pH optimum for mature DSM-AM was found to be at pH
5.0. The activities measured at the other indicated pH's are shown
in the table below. The value corresponds to an average value of
both measurements at different enzyme concentrations.
TABLE-US-00001 TABLE 6.1 pH 4.0 4.3 5.0 5.5 6.0 6.5 7.0 7.5
Relative activity 68% 76% 100% 87% 71% 40% 21% 8%
[0412] Dependence of the mature DSM-AM enzyme activity on
temperature was determined using the MU assay described above with
the reaction temperatures set to 40.degree. C., 50.degree. C.,
60.degree. C., 65.degree. C., 70.degree. C., 75.degree. C.,
80.degree. C. and 90.degree. C. Mature DSM-AM was most active at
60-75.degree. C. and the enzyme lost approximately 90% of its
activity when the temperature was above 90.degree. C.
Example 7
Alpha-Amylase Activity
[0413] The alpha-amylase activity of the mature DSM-AM as obtained
in example 5, was quantified by measuring activity using a Megazyme
CERALPHA alpha-amylase assay kit (Megazyme International Ireland
Ltd., Co. Wicklow, Ireland) according to the manufacturer's
instruction.
TABLE-US-00002 TABLE 7.1 Activity in Activity in Ceralpha Ceralpha
Sample Activity assay @ 40.degree. C. assay @ 60.degree. C. Mature
DSM-AM 1095 MU/ml 124 U/ml 191 U/ml Control malt Estimated 1.9 U/ml
2.8 U/ml flour Estimated 36 U/ml 43 U/ml
Example 8
Thermostability of Mature DSM-AM
[0414] To evaluate the thermostability of the mature DSM-AM, as
obtained in example 5, 25 MU/ml purified enzyme solution in a
buffer containing 50 mM sodium acetate, pH 5.0, 1 mM CaCl.sub.2 and
1 g/L BSA were pre-incubated in an Eppendorf tube for 30 minutes at
various temperatures (40.degree. C. to 86.degree. C.). The residual
enzyme activity was determined using the MU assay described above.
For comparison, Novamyl.RTM. 10.000 was included. The results were
expressed as a percentage of the activity of a sample that was
pre-incubated for 30 minutes at 4.degree. C.
[0415] In the temperature range from 40.degree. C. to 75.degree. C.
comparable high-level activities (above 90%) were observed for
mature DSM-AM and Novamyl.RTM. 10.000 (data not shown). The
residual enzyme activities from the temperature range of 76 to
86.degree. C. are listed in the Table 8.1 below. These data clearly
demonstrated that mature DSM-AM and Novamyl.RTM. 10.000 are
comparably thermostable at temperatures up to about 80.degree. C.
However, at the temperatures of about 80.degree. C. and higher the
residual enzymatic activity of mature DSM-AM is lower than that of
Novamyl.RTM. 10.000.
TABLE-US-00003 TABLE 8.1 Enzyme activity Temperature [.degree. C.]
4 76 78 80 82 84 86 Mature DSM-AM 100% 91% 85% 69% 38% 14% 1%
Novamyl .RTM. 10.000 100% 87% 82% 72% 54% 31% 10% Novamyl .RTM.
10.000 was obtained from Novozymes, Denmark.
[0416] To further evaluate the thermostability of the mature
DSM-AM, as obtained in example 5, the residual activity of 7.5
MU/ml mature DSM-AM was tested in glass tube in a buffer of 50 mM
sodium acetate, pH 4.3, 1 mM CaCl.sub.2. After incubation at
80.degree. C. for 15 minutes, the residual activity was determined
as described above. Mature DSM-AM showed a residual activity of 3%
whereas Novamyl.RTM. 10.000 showed 13% residual activity at the
same conditions. The results are listed in Table 8.2
TABLE-US-00004 TABLE 8.2 Residual activity Temperature [.degree.
C.] 4 80 Mature DSM-AM 100% 3% Novamyl .RTM. 10.000 100% 13%
Novamyl .RTM. 10.000 was obtained from Novozymes, Denmark.
Example 9
Baking Experiment
[0417] The baking performance of the mature DSM-AM was tested in
Dutch tin bread. Two ingredient lists were used (see Tabel 9.1).
Recipe A was used for the results in Table 9.2, recipe B was used
for the results in Table 9.3. The Control in table 9.2 and 9.3
refers to a loaf of bread prepared using recipe A and B
respectively, and not containing mature DSM-AM.
[0418] In the baking experiments a concentrate of mature DSM-AM,
which may be produced as described in example 4, was dosed at
550-605 MU/kg flour.
[0419] The ingredients listed in Table 9.1 were mixed in a Diosna
SP-12 mixer for 4 minutes at speed 400 turns/min and thereafter at
speed 1560 turns/min for 10 min, to a final dough temperature of
27.degree. C. The dough was divided in 8 pieces of 840 g, rounded
and proofed for 45 minutes at 28.degree. C. and 90% relative
humidity.
[0420] Afterwards the dough pieces were moulded, and placed in
greased tins (DGP-01) and proofed for 75 minutes at 35.degree. C.
at relative humidity of 88%.
[0421] The fully proofed dough pieces were placed in an Wachtel
Piccolo oven and baked in a first phase at 280.degree. C. for 7
minutes with initial steam addition. After that the temperature was
raised to 265.degree. C./270.degree. C. for 28 minutes in a second
phase.
[0422] Thereafter the oven was unloaded, the breads were depanned
and placed on a rack to cool for at least 1 hour at ambient
temperature, which is typically between 20 and 25.degree. C. After
1-2 hours cooling, the breads were wrapped in polyethylene plastic
bags.
[0423] Thereafter the breads were assessed.
[0424] The breads were kept in the plastic bags in between the
hardness measurements.
TABLE-US-00005 TABLE 9.1 Recipe A Recipe B Ingredient (grams)
(grams) Type Flour (Kolibri*) 2400 Flour (Ibis)* 600 Flour
Edelweiss* 4500 Fresh yeast 108 180 Koningsgist* Salt 81 81 Bread
improver 22.5 Basic tin (DGP-06)** Bread improver 135 Rich Bread
Improver*** Water 2470 2585 .sup.+/-1% Calcium propionate 1.8
*Kolibri, Edelweiss and Ibis flour were obtained from Meneba, the
Netherlands. Koningsgist was obtained from AB Mauri, the
Netherlands **basic bread improver comprising 20 ppm ascorbic acid
(from DSM Nutritional Products, Switzerland), 5 ppm Bakezyme .RTM.
P500 (fungal alpha-amylase from DSM, The Netherlands), 15 ppm
Bakezyme .RTM. HSP6000 (fungal hemicellulase from DSM, The
Netherlands) and Kolibri flour as mixing material. ***Rich Bread
Improver comprising Soy flour (from Soja Austria, Austria) 32.9 wt
%, Whey powder (from Vreugdenhill, The Netherlands), 18 wt % Palm
oil (100% palmoil, from Remia, The Netherlands), 6 wt %, Rapeseed
oil (from Aldoc B.V., The Netherlands), 3 wt %, SSL (from Cognis
Deutschland GmbH&Co. KG, Germany), 10 wt %, Kolibri flour (from
Meneba, The Netherlands) 30.1 wt %
Measurement of Hardness
[0425] The bread was sliced with a bread slicer set at 2.1 cm slice
distance.
[0426] The hardness was measured using a using a Texture Analyser
TA-XTPIus from Stable Micro Systems apparatus and applying the
following settings.
Settings
[0427] Test mode=Compression [0428] Pre-test speed=3 mm/s [0429]
Test speed=1 mm/s [0430] Post test speed 5 mm/s [0431] Distance=5
mm [0432] Hold time=10 sec [0433] Trigger force=5 g
[0434] The hardness listed is the Force measured; the max peak
value recorded in gram. Resilience is the Force (F) after 10 sec
holding time divided by max peak force multiply by 100.
Resilience=(F2/F1).times.100
[0435] After cooling down to room temperature the volumes of the
loaves were determined by an automated bread volume analyser
(BVM-3, TexVol Instruments). The loaf volume of the control bread
is defined as 100%.
[0436] The Consistency, Body, Development, Extensibility,
Elasticity, Stickiness, of the dough were evaluated by an
experienced baker and judged as good.
[0437] Volume, crumb structure and crumb colour of the bread were
judged by an experienced baker as good.
[0438] Satisfactory results were obtained, that indicated a good
dough and a good bread.
TABLE-US-00006 TABLE 9.2 Average values of three tests with recipe
A. Relative Volume Hardness Hardness (%) day 0 day 4 day 7 Control
100 529 653 Mature 101 374 525 DSM-AM (550 MU/kg flour)
[0439] Day 0 is the day the bread was baked. Day 4 is the 4th day
after the bread was baked. Day 7 is the 7th day after the bread was
baked.
TABLE-US-00007 TABLE 9.3 Longer shelf life tests with Edelweiss
(recipe B) Relative Volume Hardness Hardness Hardness (%) day 0
week 1 week 2 week 3 Control 100 429 592 672 Mature 101 263 426 516
DSM-AM (605 MU/kg flour)
[0440] Day 0 is the day the bread was baked. Week 1 is the 7.sup.th
day after the bread was baked. Week 2 is the 14.sup.th day after
the bread was baked. Week 3 is the 21.sup.st day after the bread
was baked.
[0441] From these results it can be seen that the hardness of the
bread slices when prepared using the mature DSM-AM is reduced after
storage as compared to the control bread slices which lack this
enzyme.
Example 10
Baking Experiment
[0442] The baking performance of the mature DSM-AM was tested in
open top tin bread containing higher levels of sugar. For
comparison, Novamyl.RTM. 10.000 was included. The sugar added was
in the range of 12 to 20%. The ingredients used in the baking
experiment are listed in Table 10.1. The results are shown in Table
10.2. The Control in table 10.2 refers to a loaf of bread prepared
not containing mature DSM-AM or Novamyl.RTM. 10.000.
[0443] In the baking experiments a concentrate of mature DSM-AM,
which may be produced as described in example 4, was dosed at 550
MU/kg flour. In comparison Novamyl.RTM. 10.000 was added at 50
mg/kg flour
[0444] The ingredients listed in Table 10.1 were mixed in a Diosna
SP-12 mixer 400 turns at a frequency of 25 Hz and thereafter 1800
turns at a frequency of 50 Hz, to a final dough temperature of
27.degree. C. The dough was divided in 8 pieces of 840 g, rounded
and proofed for 45 minutes at 28.degree. C. and 90% relative
humidity.
[0445] Afterwards the dough pieces were moulded, and placed in
greased tins (DGP-01) and proofed for 75 minutes at 35.degree. C.
at relative humidity of 88%.
[0446] The fully proofed dough pieces were placed in a Wachtel
Piccolo oven and baked in a first phase at 200/230.degree. C. for
15 minutes with initial steam addition. After that the temperature
was decreased to 160/180.degree. C. for 20 minutes in a second
phase.
[0447] Thereafter the oven was unloaded, the breads were depanned
and placed on a rack to cool for at least 1 hour at ambient
temperature, which is typically between 20 and 25.degree. C. After
1-2 hours cooling, the breads were wrapped in polyethylene plastic
bags.
[0448] Thereafter the breads were assessed.
[0449] The breads were kept in the plastic bags in between the
hardness measurements.
TABLE-US-00008 TABLE 10.1 Ingredient Recipe (grams) Type Flour
(BG100*) 4500 Fresh yeast 108 Koningsgist* Salt 81 Bread improver
22.5 Basic tin (DGP-06)** Sugar 540-720-900 Water 2430 .sup.+/-1%
*BG100 flour was obtained from Paniflour, Belgium. Koningsgist was
obtained from AB Mauri, the Netherlands **basic bread improver
comprising 20 ppm ascorbic acid (from DSM Nutritional Products,
Switzerland), 5 ppm Bakezyme .RTM. P500 (fungal alpha-amylase from
DSM, The Netherlands), 15 ppm Bakezyme .RTM. HSP6000 (fungal
hemicellulase from DSM, The Netherlands) and Kolibri flour as
mixing material.
Measurement of Hardness
[0450] The bread was sliced with a bread slicer set at 2.1 cm slice
distance.
[0451] The hardness was measured using a using a Texture Analyser
TA-XTPIus from Stable Micro Systems apparatus and applying the
following settings.
Settings
[0452] Test mode=Compression [0453] Pre-test speed=3 mm/s [0454]
Test speed=1 mm/s [0455] Post test speed 5 mm/s [0456] Distance=5
mm [0457] Hold time=10 sec [0458] Trigger force=5 g
[0459] The hardness listed is the Force measured; the max peak
value recorded in gram. Resilience is the Force (F) after 10 sec
holding time divided by max peak force multiply by 100.
Resilience=(F2/F1).times.100
[0460] After cooling down to room temperature the volumes of the
loaves were determined by an automated bread volume analyser
(BVM-3, TexVol Instruments). The loaf volume of the control bread
is defined as 100%.
[0461] The Consistency, Body, Development, Extensibility,
Elasticity, Stickiness, of the dough were evaluated by an
experienced baker and judged as good.
[0462] Volume, crumb structure and crumb colour of the bread were
judged by an experienced baker as good.
[0463] Satisfactory results were obtained, that indicated a good
dough and a good bread.
TABLE-US-00009 TABLE 10.2 Shelflife test Mature DSM-AM Control (550
MU/kg flour) Hardness day 4 480 252 12 wt % sugar Hardness day 7
603 316 12 wt % sugar Hardness day 4 530 341 16 wt % sugar Hardness
day 7 637 400 16 wt % sugar Hardness day 4 977 553 20 wt % sugar
Hardness day 7 1209 726 20 wt % sugar
[0464] Day 0 is the day the bread was baked. Day 4 is the 4th day
after the bread was baked. Day 7 is the 7th day after the bread was
baked.
[0465] From these results it can be seen that the hardness of the
bread slices when prepared using the mature DSM-AM is reduced after
storage as compared to the control bread slices which lack this
enzyme.
Example 11
Baking Experiment
[0466] The baking performance of the mature DSM-AM was tested in
Dutch tin bread. Two ingredient lists were used (see Table 11.1).
Recipe A was used for the results in Table 11.2, recipe B was used
for the results in Table 11.3. The Control in table 11.2 and 11.3
refers to a loaf of bread prepared using recipe A and B
respectively, and not containing mature DSM-AM.
[0467] In the baking experiments a concentrate of mature DSM-AM,
which may be produced as described in example 4, was dosed at
550-605 MU/kg flour.
[0468] The ingredients listed in Table 11.1 were mixed in a Diosna
SP-12 mixer 400 turns at a frequency of 25 Hz and thereafter 1800
turns at a frequency of 50 Hz, to a final dough temperature of
27.degree. C. The dough was divided in 8 pieces of 840 g, rounded
and proofed for 45 minutes at 28.degree. C. and 90% relative
humidity.
[0469] Afterwards the dough pieces were moulded, and placed in
greased tins (DGP-01) and proofed for 75 minutes at 35.degree. C.
at relative humidity of 88%.
[0470] The fully proofed dough pieces were placed in an Wachtel
Piccolo oven and baked in a first phase at 280.degree. C. for 7
minutes with initial steam addition. After that the temperature was
raised to 265.degree. C./270.degree. C. for 28 minutes in a second
phase.
[0471] Thereafter the oven was unloaded, the breads were depanned
and placed on a rack to cool for at least 1 hour at ambient
temperature, which is typically between 20 and 25.degree. C. After
1-2 hours cooling, the breads were wrapped in polyethylene plastic
bags.
[0472] Thereafter the breads were assessed.
[0473] The breads were kept in the plastic bags in between the
hardness measurements.
TABLE-US-00010 TABLE 11.1 Recipe A Recipe B Ingredient (grams)
(grams) Type Flour (Kolibri*) 3600 Flour (Ibis)* 900 Flour
Edelweiss* 4500 Fresh yeast 108 180 Koningsgist* Salt 81 81 Bread
improver 22.5 Basic tin (DGP-06)** Bread improver 135 Rich Bread
Improver*** Water 2470 2585 .sup.+/-1% Calcium propionate 1.8
*Kolibri, Edelweiss and Ibis flour were obtained from Meneba, the
Netherlands. Koningsgist was obtained from AB Mauri, the
Netherlands **basic bread improver comprising 20 ppm ascorbic acid
(from DSM Nutritional Products, Switzerland), 5 ppm Bakezyme .RTM.
P500 (fungal alpha-amylase from DSM, The Netherlands), 15 ppm
Bakezyme .RTM. HSP6000 (fungal hemicellulase from DSM, The
Netherlands) and Kolibri flour as mixing material. ***Rich Bread
Improver comprising Soy flour (from Soja Austria, Austria) 32.9 wt
%, Whey powder (from Vreugdenhill, The Netherlands), 18 wt % Palm
oil (100% palmoil, from Remia, The Netherlands), 6 wt %, Rapeseed
oil (from Aldoc B.V., The Netherlands), 3 wt %, SSL (from Cognis
Deutschland GmbH&Co. KG, Germany), 10 wt %, Kolibri flour (from
Meneba, The Netherlands) 30.1 wt %
Measurement of Hardness
[0474] The bread was sliced with a bread slicer set at 2.1 cm slice
distance.
[0475] The hardness was measured using a using a Texture Analyser
TA-XTPIus from Stable Micro Systems apparatus and applying the
following settings.
Settings
[0476] Test mode=Compression [0477] Pre-test speed=3 mm/s [0478]
Test speed=1 mm/s [0479] Post test speed 5 mm/s [0480] Distance=5
mm [0481] Hold time=10 sec [0482] Trigger force=5 g
[0483] The hardness listed is the Force measured; the max peak
value recorded in gram. Resilience is the Force (F) after 10 sec
holding time divided by max peak force multiply by 100.
Resilience=(F2/F1).times.100
[0484] After cooling down to room temperature the volumes of the
loaves were determined by an automated bread volume analyser
(BVM-3, TexVol Instruments). The loaf volume of the control bread
is defined as 100%.
[0485] The Consistency, Body, Development, Extensibility,
Elasticity, Stickiness, of the dough were evaluated by an
experienced baker and judged as good.
[0486] Volume, crumb structure and crumb colour of the bread were
judged by an experienced baker as good.
[0487] Satisfactory results were obtained, that indicated a good
dough and a good bread.
TABLE-US-00011 TABLE 11.2 Average values of three tests with recipe
A. Relative Volume Hardness Hardness (%) day 0 day 4 day 7 Control
100 529 653 Mature 101 374 525 DSM-AM (550 MU/kg flour)
[0488] Day 0 is the day the bread was baked. Day 4 is the 4th day
after the bread was baked. Day 7 is the 7th day after the bread was
baked.
TABLE-US-00012 TABLE 11.3 Longer shelf life tests with Edelweiss
(recipe B) Relative Volume Hardness Hardness Hardness (%) day 0
week 1 week 2 week 3 Control 100 429 592 672 Mature 101 263 426 516
DSM-AM (605 MU/kg flour)
[0489] Day 0 is the day the bread was baked. Week 1 is the 7.sup.th
day after the bread was baked. Week 2 is the 14.sup.th day after
the bread was baked. Week 3 is the 21.sup.st day after the bread
was baked.
[0490] From these results it can be seen that the hardness of the
bread slices when prepared using the mature DSM-AM is reduced after
storage as compared to the control bread slices which lack this
enzyme.
Sequence CWU 1
1
412160DNAAlicyclobacillus
pohliaesource(1)..(2160)/organism="Alicyclobacillus pohliae" /mol_
type="unassigned DNA" 1atgaaaaaga aaacgctttc attatttgtg ggactgatgc
tgctcctcgg tcttctgttc 60agcggttctc ttccgtacaa tccaaacgcc gctgaagcca
gcagttccgc aagcgtcaaa 120ggggacgtga tttaccagat tatcattgac
cggttttacg atggggacac gacgaacaac 180aatcctgcca aaagttatgg
actttacgat cccaccaaat cgaagtggaa aatgtattgg 240ggcggggatc
tggagggggt tcgtcaaaaa cttccttatc ttaaacagct gggcgtaacg
300acgatctggt tgtccccggt tttggacaat ctggatacac ttgcaggtac
cgataacact 360ggctatcacg gatactggac gcgcgatttt aaacagattg
aggaacattt cgggaattgg 420accacatttg acacgttggt caatgatgct
caccaaaacg gaatcaaggt gattgtcgac 480tttgtgccca atcattcaac
tccttttaag gcaaacgatt ccacctttgc ggaaggcggc 540gccctctacg
acaacggaac ctatatgggc aattattttg atgacgcaac aaaagggtac
600tttcaccata atggggacat cagcaactgg gacgaccggt acgaggcgca
atggaaaaac 660ttcacggatc cagccggttt ctcgcttgcc gatttgtcgc
aggaaaatgg cacgattgct 720caatacctga ccgatgcggc ggttcaatta
gtagcacatg gagcggatgg tttgcggatt 780gatgcggtga agcattttaa
ttctgggttc tccaaatcgt tggctgataa actgtaccaa 840aagaaagaca
ttttcctagt gggggaatgg tacggagatg accccggagc agccaatcat
900ttggaaaagg tccggtacgc caacaacagc ggtgtcaatg tgctggattt
tgatctcaac 960acggtgattc gaaatgtgtt cggtacattt acgcaaacga
tgtacgatct taacaatatg 1020gtgaaccaaa cggggaacga gtacaaatac
aaagaaaatc taatcacatt tatcgataac 1080catgatatgt cgagatttct
tacggtaaat tcgaacaagg cgaatttgca ccaggcgctt 1140gctttcattc
tcacttcgcg gggaacgccc tccatctatt acggaaccga acaatacatg
1200gcaggcggca atgacccgta caacaggggg atgatgccgg cgtttgatac
gacaaccacc 1260gcctttaaag aggtgtcaac tctggcgggg ttgcgcagga
acaatgcagc gatccagtac 1320ggcaccacca cccaacgttg gatcaacaat
gatgtttaca tttatgagcg gaaatttttc 1380aacgatgtcg tattggtggc
catcaatcga aacacgcaat cctcctactc gatttccggt 1440ttgcagactg
ccttgccaaa tggcaactat gcggattatc tgtcagggct gttggggggg
1500aacgggattt ccgtttccaa tggaagtgtc gcttcgttca cgcttgcgcc
tggagccgtg 1560tctgtttggc agtacagcac atccgcttca gcgccgcaaa
tcggatcggt tgctccgaat 1620atgggaattc cgggtaatgt ggtcacgatc
gacgggaaag gttttggaac gacgcaggga 1680accgtgacat ttggcggagt
gacagcgact gtaaaatcct ggacatcaaa ccggattgaa 1740gtgtacgtgc
ccaacatggc cgccggtctg accgatgtaa aagtcaccgc gggtggagtt
1800tccagcaatc tgtattctta caatattttg agtggaacgc agacatcggt
tgtgtttact 1860gtgaaaagtg ctcctccgac caacctgggg gataagattt
acctgacggg caacataccg 1920gaattgggaa attggagcac ggatacgagc
ggagccgtta acaatgcgca agggcccctg 1980ctcgcgccca attatccgga
ttggttttat gtattcagcg ttccggcagg aaagacgatt 2040caattcaagt
ttttcatcaa gcgtgcggat ggaacgattc aatgggagaa tggttcgaac
2100cacgtggcca caactcccac gggtgcaacc ggtaacatca ctgtcacgtg
gcaaaactag 21602719PRTAlicyclobacillus pohliae 2Met Lys Lys Lys Thr
Leu Ser Leu Phe Val Gly Leu Met Leu Leu Leu 1 5 10 15 Gly Leu Leu
Phe Ser Gly Ser Leu Pro Tyr Asn Pro Asn Ala Ala Glu 20 25 30 Ala
Ser Ser Ser Ala Ser Val Lys Gly Asp Val Ile Tyr Gln Ile Ile 35 40
45 Ile Asp Arg Phe Tyr Asp Gly Asp Thr Thr Asn Asn Asn Pro Ala Lys
50 55 60 Ser Tyr Gly Leu Tyr Asp Pro Thr Lys Ser Lys Trp Lys Met
Tyr Trp 65 70 75 80 Gly Gly Asp Leu Glu Gly Val Arg Gln Lys Leu Pro
Tyr Leu Lys Gln 85 90 95 Leu Gly Val Thr Thr Ile Trp Leu Ser Pro
Val Leu Asp Asn Leu Asp 100 105 110 Thr Leu Ala Gly Thr Asp Asn Thr
Gly Tyr His Gly Tyr Trp Thr Arg 115 120 125 Asp Phe Lys Gln Ile Glu
Glu His Phe Gly Asn Trp Thr Thr Phe Asp 130 135 140 Thr Leu Val Asn
Asp Ala His Gln Asn Gly Ile Lys Val Ile Val Asp 145 150 155 160 Phe
Val Pro Asn His Ser Thr Pro Phe Lys Ala Asn Asp Ser Thr Phe 165 170
175 Ala Glu Gly Gly Ala Leu Tyr Asp Asn Gly Thr Tyr Met Gly Asn Tyr
180 185 190 Phe Asp Asp Ala Thr Lys Gly Tyr Phe His His Asn Gly Asp
Ile Ser 195 200 205 Asn Trp Asp Asp Arg Tyr Glu Ala Gln Trp Lys Asn
Phe Thr Asp Pro 210 215 220 Ala Gly Phe Ser Leu Ala Asp Leu Ser Gln
Glu Asn Gly Thr Ile Ala 225 230 235 240 Gln Tyr Leu Thr Asp Ala Ala
Val Gln Leu Val Ala His Gly Ala Asp 245 250 255 Gly Leu Arg Ile Asp
Ala Val Lys His Phe Asn Ser Gly Phe Ser Lys 260 265 270 Ser Leu Ala
Asp Lys Leu Tyr Gln Lys Lys Asp Ile Phe Leu Val Gly 275 280 285 Glu
Trp Tyr Gly Asp Asp Pro Gly Ala Ala Asn His Leu Glu Lys Val 290 295
300 Arg Tyr Ala Asn Asn Ser Gly Val Asn Val Leu Asp Phe Asp Leu Asn
305 310 315 320 Thr Val Ile Arg Asn Val Phe Gly Thr Phe Thr Gln Thr
Met Tyr Asp 325 330 335 Leu Asn Asn Met Val Asn Gln Thr Gly Asn Glu
Tyr Lys Tyr Lys Glu 340 345 350 Asn Leu Ile Thr Phe Ile Asp Asn His
Asp Met Ser Arg Phe Leu Thr 355 360 365 Val Asn Ser Asn Lys Ala Asn
Leu His Gln Ala Leu Ala Phe Ile Leu 370 375 380 Thr Ser Arg Gly Thr
Pro Ser Ile Tyr Tyr Gly Thr Glu Gln Tyr Met 385 390 395 400 Ala Gly
Gly Asn Asp Pro Tyr Asn Arg Gly Met Met Pro Ala Phe Asp 405 410 415
Thr Thr Thr Thr Ala Phe Lys Glu Val Ser Thr Leu Ala Gly Leu Arg 420
425 430 Arg Asn Asn Ala Ala Ile Gln Tyr Gly Thr Thr Thr Gln Arg Trp
Ile 435 440 445 Asn Asn Asp Val Tyr Ile Tyr Glu Arg Lys Phe Phe Asn
Asp Val Val 450 455 460 Leu Val Ala Ile Asn Arg Asn Thr Gln Ser Ser
Tyr Ser Ile Ser Gly 465 470 475 480 Leu Gln Thr Ala Leu Pro Asn Gly
Asn Tyr Ala Asp Tyr Leu Ser Gly 485 490 495 Leu Leu Gly Gly Asn Gly
Ile Ser Val Ser Asn Gly Ser Val Ala Ser 500 505 510 Phe Thr Leu Ala
Pro Gly Ala Val Ser Val Trp Gln Tyr Ser Thr Ser 515 520 525 Ala Ser
Ala Pro Gln Ile Gly Ser Val Ala Pro Asn Met Gly Ile Pro 530 535 540
Gly Asn Val Val Thr Ile Asp Gly Lys Gly Phe Gly Thr Thr Gln Gly 545
550 555 560 Thr Val Thr Phe Gly Gly Val Thr Ala Thr Val Lys Ser Trp
Thr Ser 565 570 575 Asn Arg Ile Glu Val Tyr Val Pro Asn Met Ala Ala
Gly Leu Thr Asp 580 585 590 Val Lys Val Thr Ala Gly Gly Val Ser Ser
Asn Leu Tyr Ser Tyr Asn 595 600 605 Ile Leu Ser Gly Thr Gln Thr Ser
Val Val Phe Thr Val Lys Ser Ala 610 615 620 Pro Pro Thr Asn Leu Gly
Asp Lys Ile Tyr Leu Thr Gly Asn Ile Pro 625 630 635 640 Glu Leu Gly
Asn Trp Ser Thr Asp Thr Ser Gly Ala Val Asn Asn Ala 645 650 655 Gln
Gly Pro Leu Leu Ala Pro Asn Tyr Pro Asp Trp Phe Tyr Val Phe 660 665
670 Ser Val Pro Ala Gly Lys Thr Ile Gln Phe Lys Phe Phe Ile Lys Arg
675 680 685 Ala Asp Gly Thr Ile Gln Trp Glu Asn Gly Ser Asn His Val
Ala Thr 690 695 700 Thr Pro Thr Gly Ala Thr Gly Asn Ile Thr Val Thr
Trp Gln Asn 705 710 715 32160DNAArtificial Sequencecodon optimised
polynucleotide sequence from Alicyclobacillus pohliae NCIMB14276
3atgaagaaga aaacactttc tctatttgtc ggtttgatgc tgctgcttgg tttgctgttc
60tctggttcac ttccttacaa cccgaatgca gctgaggctt cttcaagtgc aagtgtgaag
120ggagatgtga tttaccaaat catcatcgac cgtttctatg acggtgacac
aacaaacaac 180aatccggcaa aatcatacgg cctgtatgat ccgacaaaaa
gcaaatggaa aatgtactgg 240ggcggagatc ttgaaggcgt tcgccaaaag
ctgccatatt tgaagcagct tggtgtaacg 300acgatttggc tttcgcctgt
tcttgacaat cttgatacgc tggcaggtac tgacaataca 360ggttatcacg
gctactggac aagagatttc aaacaaatcg aagagcattt cggaaactgg
420acgacatttg acacacttgt gaatgatgct caccaaaacg gcatcaaagt
gatcgttgat 480ttcgttccga atcacagcac gccattcaaa gcaaacgaca
gcacgtttgc agaaggcggt 540gctttgtacg ataacggtac ttacatggga
aattattttg atgatgcaac aaaaggctat 600ttccatcata acggagatat
cagcaactgg gatgaccgtt atgaagcaca atggaaaaac 660ttcacagatc
ctgctggctt cagccttgct gatttatcac aagaaaacgg aacgatcgct
720caatatttaa ctgacgctgc tgttcagctt gttgctcacg gtgctgacgg
ccttcgcatt 780gatgcagtga agcacttcaa cagcggcttc agcaaaagcc
ttgctgacaa gctgtatcaa 840aagaaggata ttttccttgt cggtgaatgg
tatggagatg acccaggtgc tgctaatcac 900cttgaaaaag tgcgttatgc
aaacaactct ggtgtaaatg tgcttgattt tgatttgaat 960acggttatcc
gcaatgtatt cggaacattt acacaaacga tgtacgattt aaacaacatg
1020gtgaaccaaa caggaaatga atacaaatat aaagaaaacc tgattacatt
tattgacaac 1080catgatatga gccgcttcct gactgtaaac agcaacaaag
caaaccttca tcaggcactt 1140gcttttattt taacttcaag aggaacaccg
tcaatttact acggaacaga acaatatatg 1200gcaggcggaa atgatccata
caaccgcggc atgatgcctg cttttgatac aacaacaact 1260gcattcaaag
aagtatcaac gcttgcaggg ctgcgtcgta ataatgcagc aattcaatac
1320ggcacaacaa ctcagcgctg gatcaacaat gatgtataca tatatgaaag
aaaattcttt 1380aatgatgttg tgcttgttgc aatcaaccga aatacacaat
cttcttattc catcagcggc 1440cttcaaacgg cactgccaaa cggaaactac
gctgattacc tttccggcct gcttggcgga 1500aacggaattt ctgtcagcaa
cggttctgtt gcatcattta cgcttgctcc tggtgctgtt 1560tctgtttggc
aatattcaac ttcagcttct gctcctcaaa tcggttctgt tgcaccgaat
1620atgggtatcc cgggaaacgt tgtgacgatt gacggaaaag gcttcggaac
gacacaaggt 1680actgtaacat tcggcggcgt tactgcaact gtaaaaagct
ggacatcaaa ccgtattgaa 1740gtgtatgtgc cgaatatggc tgctggcctg
actgatgtaa aagtgacagc tggcggtgtt 1800tcttcaaacc tatactctta
caacatttta tcaggcacac aaacatctgt tgtattcact 1860gtaaaatcag
caccgccgac aaacctaggt gacaagattt acttaacagg aaacatccct
1920gagcttggaa actggagcac tgatacaagc ggagctgtta acaatgcaca
aggcccgctt 1980cttgcaccga attatccgga ctggttttat gtattctctg
ttcctgctgg aaaaacgatt 2040caattcaaat tctttatcaa acgcgctgac
ggaacgattc aatgggaaaa cggttcaaac 2100catgtggcaa caactccaac
tggtgcaaca ggaaatatca ctgttacttg gcagaattaa 21604100DNAArtificial
Sequencesynthetic polynucleotide sequence containing an amyQ
terminator, a PmeI restriction site, and SphI and HindIII
restriction sites 4gcatgcgttt aaacaaaaac acctccaagc tgagtgcggg
tatcagcttg gaggtgcgtt 60tattttttca gccgtatgac aaggtcggca tcagaagctt
100
* * * * *
References