Antibodies And Their Uses For Diagnosis And Treatment Of Cytomegalovirus Infection And Associated Diseases

Abstract

Anti CMV antibodies are provided. Thus an antibody of the present invention comprises an antigen recognition domain capable of binding an MHC molecule being complexed with a cytomegalovirus (CMV) pp65 or pp64 peptide, wherein the antibody does not bind said MHC molecule in an absence of said complexed peptide, and wherein the antibody does not bind said peptide in an absence of said MHC molecule. Also provided are methods of using the antibodies.

Description

RELATED APPLICATIONS

[0001] This application is a division of U.S. patent application Ser. No. 13/727,643 filed on Dec. 27, 2012, which is a division of U.S. patent application Ser. No. 12/450,476 filed on Jan. 6, 2010, now U.S. Pat. No. 8,361,473, which is a National Phase of PCT Patent Application No. PCT/IL2008/000437 having International filing date of Mar. 27, 2008, which claims the benefit of priority under 35 USC .sctn.119(e) of U.S. Provisional Patent Application Nos. 60/929,207 filed on Jun. 18, 2007 and 60/907,343 filed on Mar. 29, 2007. The contents of the above applications are all incorporated by reference as if fully set forth herein in their entirety.

SEQUENCE LISTING STATEMENT

[0002] The ASCII file, entitled 60137SequenceListing.txt, created on Aug. 26, 2014, comprising 220,126 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

FIELD AND BACKGROUND OF THE INVENTION

[0003] The present invention, in some embodiments thereof, relates to methods of diagnosing and treating cytomegalovirus diseases and, more particularly, but not exclusively, to antibodies capable of same.

[0004] Of all the human herpesviruses described to date, infection with cytomegalovirus (CMV) is considered to be the main cause of morbidity and mortality. Approximately 70% of the world population are carriers of the virus. Primary infection with the virus results in a life long persistence in a latent form and is therefore generally asymptomatic in healthy adults. However, some individuals, such as immuno-compromised organ transplant recipients, or individuals infected with human immunodeficiency virus (HIV), are at high risk of developing life threatening CMV disease due to CMV reactivation. In addition, CMV has emerged in recent years as the most important cause of congenital infection in the developed world, commonly leading to mental retardation and developmental disability.

[0005] Immunity to CMV is complex and involves humoral and cell-mediated responses. Studies showed that both natural killer (NK) cells and cytotoxic T-lymphocytes (CTLs) are of primary importance in prevention of recurrence. Many gene products participate in generating the CTL response to CMV infection, however, the high level expression frequencies of the viral protein pp65 (e.g., Genbank Accession No. M15120; SEQ ID NO:48) suggests pp65 as the main target of the CTL-mediated immune response. Among all pp65 peptides, CMV specific-CTL activity in HLA-A2 positive individuals was found to be mainly directed to the peptide pp65.sub.495-503 (NLVPMVATV; SEQ ID NO:3) (Chee M S et al., 1990).

[0006] Cytosolic proteins, usually synthesized in the cells, such as CMV viral proteins, enter the class I MHC pathway of antigen presentation. In the first step, ubiquitinated cytoplasmic proteins are degraded by the proteasome, a cytoplasmic multiprotein complex which generates a large portion of peptides destined for display by class I MHC molecules. Peptides are then delivered from the cytoplasm to the endoplasmic reticulum (ER) by the transporter associated with antigen presentation (TAP) molecules. Newly formed class I MHC dimers in the ER associate with and bind peptides delivered by the TAP. Peptide binding stabilizes class I MHC molecules and permits their movement out of the ER, through the Golgi apparatus, to the cell surface. This pathway ensures that any cell synthesizing viral proteins can be marked for recognition and killing by CD8+ CTL.

[0007] Characterization of class I MHC-peptide presentation is essential for understanding the acquired arm of the immune response. The conventional strategy for detecting and studying rare populations of antigen (Ag)-specific CD8+ T cells is the application of tetrameric arrays of class I peptide-MHC complexes (Altman J D., et al., 1996; Lee P P et al., 1999).

[0008] The diagnosis of diseases associated with CMV infection such as retinitis, pneumonia, gastrointestinal disorders, and encephalitis is based on clinical, histological, virological and DNA tests.

[0009] Current methods of treating CMV in immuno-compromised (e.g., immuno-suppressed) subjects (e.g., HIV patients, bone marrow transplanted subjects), especially CMV retinitis, include anti viral drugs such as Foscarnet (FOSCAVIR.RTM.), Cidofovir (VISTIDE.RTM.) Valganciclovir (VALCYTE.RTM.) Ganciclovir implants (VITRASERT.RTM.) Fomivirsen (VITRAVENE.RTM.). However, the use of these drugs may be associated with serious side effects such as kidney damage, neutropenia and hypocalcemia. One strategy of directly targeting CMV associated pathologies includes the use of HLA-A2-restricted CD8(+) CTLs directed against pp65. However, attempts to use CMV-specific CD8+ T cell clones for killing CMV-infected retinal pigment epithelial cells have failed (Allart S, et al., 2003; Invest Ophthalmol V is Sci. 44: 665-71).

[0010] Additional background art includes U.S. patent application Ser. Nos. 11/203,137; 11/074,803; 10/510,229; and 11/582,416 to Reiter Y, et al.

SUMMARY OF THE INVENTION

[0011] According to an aspect of some embodiments of the present invention there is provided an antibody comprising an antigen recognition domain capable of binding an MHC molecule being complexed with a cytomegalovirus (CMV) pp65 or pp64 peptide, wherein the antibody does not bind the MHC molecule in an absence of the complexed peptide, and wherein the antibody does not bind the peptide in an absence of the MHC molecule.

[0012] According to an aspect of some embodiments of the present invention there is provided an antibody comprising a multivalent form of the antibody of the present invention.

[0013] According to an aspect of some embodiments of the present invention there is provided a pharmaceutical composition comprising as an active ingredient the antibody of the antibody of the present invention.

[0014] According to an aspect of some embodiments of the present invention there is provided a method of detecting a cell expressing a cytomegalovirus (CMV) antigen, comprising contacting the cell with the antibody of the present invention under conditions which allow immunocomplex formation, wherein a presence or a level above a predetermined threshold of the immunocomplex is indicative of CMV expression in the cell.

[0015] According to an aspect of some embodiments of the present invention there is provided a method of diagnosing a cytomegalovirus (CMV) infection in a subject in need thereof, comprising contacting a cell of the subject with the antibody of the present invention under conditions which allow immunocomplex formation, wherein a presence or a level above a pre-determined threshold of the immunocomplex in the cell is indicative of the CMV infection in the subject.

[0016] According to an aspect of some embodiments of the present invention there is provided a method of treating a disease associated with cytomegalovirus (CMV) infection, comprising administering to a subject in need thereof a therapeutically effective amount of the antibody of the present invention, thereby treating the disease associated with CMV infection.

[0017] According to some embodiments of the invention, the cytomegalovirus (CMV) pp65 or pp64 peptide is set forth by SEQ ID NO:3.

[0018] According to some embodiments of the invention, the antigen recognition domain comprises complementarity determining region (CDR) amino acid sequences as set forth in SEQ ID NOs:24-26 and 30-32.

[0019] According to some embodiments of the invention, the antigen recognition domain comprises complementarity determining region (CDR) amino acid sequences as set forth in SEQ ID NOs: 36-38 and 42-44.

[0020] According to some embodiments of the invention, the antibody being conjugated to a therapeutic moiety.

[0021] According to some embodiments of the invention, the antibody is attached to a detectable moiety.

[0022] According to some embodiments of the invention, the antibody being an antibody fragment.

[0023] According to some embodiments of the invention, the multivalent form is an IgG antibody.

[0024] According to some embodiments of the invention, the subject has a suppressed or a compromised immune system.

[0025] According to some embodiments of the invention, the CMV infection is associated with a disease selected from the group consisting of mononucleosis, retinitis, pneumonia, gastrointestinal disorders, and encephalitis.

[0026] According to some embodiments of the invention, the cell is a retina cell, lung epithelial cell, a gastrointestinal epithelial cell or a brain cell.

[0027] According to some embodiments of the invention, the subject is an immuno-compromised organ transplant recipient.

[0028] According to some embodiments of the invention, the subject is infected with human immunodeficiency virus (HIV).

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0030] As used herein, the terms "comprising" and "including" or grammatical variants thereof are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof. This term encompasses the terms "consisting of" and "consisting essentially of".

[0031] The phrase "consisting essentially of" or grammatical variants thereof when used herein are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof but only if the additional features, integers, steps, components or groups thereof do not materially alter the basic and novel characteristics of the claimed composition, device or method.

[0032] The term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the biotechnology and medical art.

BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0034] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

[0035] In the drawings:

[0036] FIGS. 1a-d depict the specificity of recombinant Fab Abs to the MHC class I (HLA-A2)-CMV pp65-derived peptide (NLVPMVATV; SEQ ID NO:3) complex. FIG. 1a--A histogram depicting an ELISA assay in which phage Fab clones were reacted with HLA-A2/pp65 complexes. Fab clones were reacted against a specific MHC class I-peptide complex (HLA-A2/pp65.sub.495-503, marked as "CMV") and control non-specific complexes containing gp100.sub.280-288 peptide (SEQ ID NO:4; YLEPGPVTA; marked as "280"). FIG. 1b--An SDS-PAGE analysis depicting the expression and purification of HLA-A2/pp65 TCR-like Fabs. SDS-PAGE analysis of the purified Fab proteins was performed after metal affinity chromatography. Note the intense protein bands purified from phage clone F5 or H9 with a molecular weight of 45 kDa. FIGS. 1c and d--Bar graphs depicting an ELISA assay of the binding of soluble purified Fabs to the HLA-A2-peptide complexes. The soluble clones H9 (FIG. 1c) and F5 (FIG. 1d) were reacted against a specific complex (HLA-A2/pp65; "CMV") or control non specific complexes containing the following peptides: EBV (280-288; SEQ ID NO:5; GLCTLVAML), gp100 (280-288; SEQ ID NO:4), hTERT (540-548; SEQ ID NO:6; ILAKFLHWL), gp100 (209-217; SEQ ID NO:7; IMDQVPFSV), hTERT (865-873; SEQ ID NO:8; RLVDDFLLV), Gag (77-85; SEQ ID NO:9; SLYNTVATL), Pol (476-484; SEQ ID NO:10; ILEPVHGV), MART (26-35; SEQ ID NO:11; ELAGIGILTV), XAGE (SEQ ID NO:12; GVFPSAPSPV), TARP (29-37; SEQ ID NO:13; FLRNFSLML), TAX (11-19; SEQ ID NO:14; LLFGYPVYV). Specificity towards HLA-A2/pp65 complex can be observed in each of the two clones.

[0037] FIGS. 2a-d are flow cytometry analyses depicting the detection of MHC-peptide complexes on the surface of APCs using the H9 and F5 soluble Fabs. JY or RMAS-HHD cell lines were pulsed with various specific and nonspecific peptides. JY cells (FIGS. 2a and c) or RMAS-HHD cells (FIGS. 2b and d) loaded with the CMV pp65.sub.495-503 peptide (SEQ ID NO:3) or control peptides ("280", "540"), incubated with the H9 (FIGS. 2a, b) or F5 (FIGS. 2c, d) Fab respectively. Specific staining of the pp65 loaded cells, but not the control cells, is shown. The same type of assay was performed with 10 different control HLA-A2-restricted peptides (data not shown).

[0038] FIGS. 3a-c are flow cytometry analyses depicting the detection of MHC-peptide complexes on the surface of JY cells using H9 Fab in its monomeric or tetrameric forms. The JY cell line was pulsed with different peptides. FIG. 3a--JY cells loaded with pp65.sub.495-503 peptide (SEQ ID NO:3). Incubations were with H9 Fab monomer and PE-labeled anti human Fab, or with H9 Fab tetramer connected to PE labeled streptavidin. FIG. 3b-JY cells loaded with pp65.sub.495-503 peptide (SEQ ID NO:3). Incubations were with H9 Fab monomer and FITC-labeled anti human Fab, or with H9 whole IgG Ab and FITC-labeled anti human Fab. FIG. 3c-JY cells loaded with gp100.sub.280-288 280-288 (SEQ ID NO:4) as a control. Incubations were with H9 Fab monomer and PE-labeled anti human Fab, H9 Fab tetramer connected to PE labeled streptavidin or with H9 IgG Ab and PE-labeled anti human Fab. Note the specific binding of the H9 Fab in its monomeric or tetrameric form, as well as the whole IgG H9 Ab to JY cells pulsed with the HLA-A2-CMV peptide (pp65 495-503) but not with JY cells when pulsed with the control peptide (gp100 280-288). Also note the increased avidity of the IgG Ab as compared to the monomeric Fab, or the increased avidity of the tetrameric Fab form as compared to the monomeric Fab form.

[0039] FIGS. 4a-c are graphs depicting the affinity determination of the H9 Ab in its monomeric (FIG. 4a) or IgG (FIG. 4b) forms, as detected by surface plasmon resonance (SPR) analysis. Each of the forms was flowed over the relevant wells at three different concentrations (0.05 .mu.M, 0.1 .mu.M, 0.2 .mu.M) of biotinylated HLA-A2-pp65 495-503 complexes. As a control, H9 Ab were flowed over wells which were coated with control biotinylated HLA-A2/pEBV complexes (FIG. 4c). Note the absence of binding signal of the H9 Ab over the HLA-A2/pEBV complex (the concentration of HLA-A2/pEBV complex was 0.2 .mu.M) as compared to the HLA-A2/pp65 complex (the concentration of HLA-A2/pp65 complex was 0.2 .mu.M).

[0040] FIGS. 5a-c are flow cytometry analyses depicting the detection of Fab sensitivity threshold (FIGS. 5a-b) and of rare cells bearing the specific peptide-MHC complex in a heterogenous cell population (FIG. 5c). In order to detect Fab sensitivity threshold, JY cells were pulsed with various concentrations of pp65.sub.495-503 peptide (0.65 nM, 0.1 .mu.M, 012 .mu.M, 0.25 .mu.M, 0.5 .mu.M, 1 .mu.M or 100 .mu.M), and incubated with H9 Fab monomer (at a concentration of 10 .mu.g/ml) and PE-labeled anti human Fab (FIG. 5a), or H9 Fab tetramer (at a concentration of 10 .mu.g/ml) connected to PE labeled streptavidin (FIG. 5b). Note the significantly low concentration of the pp65.sub.495-503 peptide needed to pulse JY cells in order to obtain a significant binding with the H9 tetramer [e.g., a threshold of 65 nM) of the pp65 495-503 peptide] or the H9 monomer [e.g., a threshold of 0.1 .mu.M of the pp65 495-503 peptide]. Detection of rare population of cells bearing the specific MHC-peptide complex was by pulsing JY APCs with the pp65 495-503 peptide and mixing them with APD cells (HLA-A2- B cell line) at different ratios (FIG. 5c) so as to obtain pre-determined concentrations of cells expressing the specific MHC-peptide complex. The mixed population was stained with H9 Fab (at a concentration of 10 .mu.g/ml), and detection sensitivity was monitored by flow cytometry. Note the specific detection of as low as 5% cells bearing the specific MHC-pp65 495-503 complex.

[0041] FIGS. 6a-m are flow cytometry analyses (FIGS. 6a-l) and a bar graph (FIG. 6m) depicting the detection of the specific HLA-A2/pp65 complex by H9 tetramer (FIG. 6e-h) or H9 IgG Ab (Data not shown), after naturally occurring active intracellular processing. HLA-A2 positive fibroblasts were infected with the CMV laboratory strain AD169 (FIGS. 6a, e, i). HLA-A2 positive uninfected fibroblasts were used as a control (FIGS. 6c, g, k) as well as HLA-A2 negative infected fibroblasts (FIGS. 6b, f, j) or HLA-A2 negative uninfected fibroblasts (FIGS. 6d, h, l). Incubation were with PE labeled BB7.2 (FIGS. 6a-d), PE labeled H9 tetramer (FIGS. 6e-h) or anti pp65 FITC mAB (FIGS. 6i-l) followed by the secondary antibody FITC-labeled anti mouse IgG, 72 hours after infection. Note the specific binding of the H9 tetramer to HLA-A2 positive cells following infection with CMV (FIG. 6e) as compared to the absence of binding to HLA-A2 negative cells (FIG. 60 or to uninfected cells (FIGS. 6g and h), demonstrating the specific HLA-A2-CMV (pp65 495-503) complex-dependent binding of the H9 antibody to cells ex vivo. In contrast, note the non-CMV-dependent binding of the BB7.2 Ab to HLA-A2 positive cells [same binding efficacy in the presence (FIG. 6a) or absence (FIG. 6c) of CMV peptide], and the non-HLA-A2-dependent binding of the Anti pp65 Ab in CMV-infected cells [same binding efficacy in HLA-A2 positive (FIG. 6i) or HLA-A2 negative (FIG. 6j) cells]. FIG. 6m--A cytotoxicity assay by which H9 IgG Ab is shown to block virus infected cells killing mediated by specific CTL line. Fibroblast cells were radioactively labeled with S.sup.35 methionine before infection with the CMV virus and 72 hours later the cells were incubated with the H9 IgG Ab. CTLs were added at a target (fibroblast cells infected with CMV):effector (CTL) ratio of 1:10 and incubated for five hours. Cells incubated with W6 Ab (an antibody directed against HLA-A,B,C) were used as positive control, while cells without any Ab incubation served as a reference for the maximum killing rate. These results demonstrate the TCR-like specificity of the H9 IgG Ab to specific CMV-infected cells.

[0042] FIGS. 7a-t are flow cytometry analyses depicting kinetic assays which follow the dynamics between the HLA-A2 extracellular presentation, the HLA-A2/pp65 peptide extracellular and intracellular complex presentation and the pp65 expression, in HLA-A2+ (positive) cells infected with the CMV wild-type (WT) AD169 strain. 36 (FIGS. 7a-e), 72 (FIGS. 7f-j), 96 (FIGS. 7k-o), and 120 (FIGS. 7p-t) hours after infection the cells were harvested and incubated with the BB7.2 PE labeled Ab (FIGS. 7c, d, h, i, m, n, r, s), anti pp65 Ab (FIGS. 7e, j, o, t; intracellular) and H9 IgG Ab (FIGS. 7a, b, f, g, k, l, p, q) antibodies and analyzed by flow cytometry. FITC-labeled anti mouse antibody and Alexa fluor.sup.488-labeled anti human antibody were used as secondary antibodies for the anti pp65 mAb and the H9 IgG Ab respectively. Intracellular staining was feasible by cells permeabilization.

[0043] FIGS. 8a-t are flow cytometry analyses depicting kinetic assays which follow the dynamics between the HLA-A2 extracellular presentation, the HLA-A2/pp65 peptide extracellular and intracellular complex presentation and the pp65 expression, in HLA-A2+ (positive) cells infected with the RV798 mutant strain. 36 (FIGS. 8a-e), 72 (FIGS. 8f-j), 96 (FIGS. 8k-o), and 120 (FIGS. 8p-t) hours after infection cells were harvested and incubated with BB7.2 PE labeled Ab (FIGS. 8c, d, h, i, m, n, r, s), anti pp65 Ab (FIGS. 8e, j, o, t; intracellular) and H9 IgG Ab (FIGS. 8a, b, f, g, k, l, p, q) antibodies and analyzed by flow cytometry. FITC-labeled anti mouse antibody and Alexa fluor.sup.488-labeled anti human antibody were used as secondary antibodies for the anti pp65 mAb and the H9 IgG Ab respectively. Intracellular staining was feasible by cells permeabilization.

[0044] FIGS. 9a-y are flow cytometry analyses depicting kinetic assays which follow the dynamics between the HLA-A2 extracellular presentation, the HLA-A2/pp65 peptide extracellular and intracellular complex presentation and the pp65 expression, in HLA-A2+ (positive) uninfected cells (FIGS. 9a-t) or in HLA-A2- (negative) cells infected with the AD169 Wild Type strain of CMV. Staining with the H9 IgG antibody, BB7.2 antibody or the anti pp65 antibodies was effected in the uninfected cells harvested at parallel times [i.e., 36 (FIGS. 9a-e), 72 (FIGS. 9f-j), 96 (FIGS. 9k-o), and 120 (FIGS. 9p-t) hours] to the cells infected with the viruses as described in FIGS. 7a-t and 8a-t, hereinabove. Infected HLA-A2- (negative) cells were harvested and stained with the H9 IgG antibody, BB7.2 antibody or the anti pp65 antibody at 120 hours after infection with the AD169 CMV virus. Extracellular staining with the H9 IgG antibody is shown in FIGS. 9a, f, k, p and u. Intracellular staining with the H9 IgG antibody is shown in FIGS. 9b, g, l, q and v. Extracellular staining with the BB7.2 antibody is shown in FIGS. 9c, h, m, r and w. Intracellular staining with the BB7.2 antibody is shown in FIGS. 9d, i, n, s and x. Staining with the anti pp65 antibody is shown in FIGS. 9e, j, o, t, and y. FITC-labeled anti mouse antibody and Alexa fluor.sup.488-labeled anti human antibody were used as secondary antibodies for the anti pp65 mAb and the H9 IgG Ab respectively. Intracellular staining was feasible by cells permeabilization.

[0045] FIGS. 10a-d are bar graphs depicting quantization of the number of HLA-A2/pp65 complexes inside and on the surface of virus infected cells. The level of fluorescence intensity on stained cells was compared with the fluorescence intensities of calibration beads with known numbers of PE molecules per bead, thus providing a mean of quantifying PE-stained cells using a flow cytometer. Incubations were with BB7.2 PE labeled Ab (FIGS. 10c and d), and H9 Ab (FIGS. 10a and b). PE-labeled anti kappa antibody was used as a secondary antibody for the H9 IgG Ab. The calculated number of HLA-A2/pp65 complexes inside cells (FIG. 10a) and on the surface (FIG. 10b) as well as the number of general HLA-A2 complexes inside the cells (FIG. 10c) and on the surface (FIG. 10d) in each time scale, is shown for cells infected with AD169 (WT), RV798 (mutant), and uninfected cells.

[0046] FIGS. 11a-o are confocal microscopy images of immuno-fluorescence analyses depicting direct visualization of HLA-A2/pp65 complexes in CMV infected fibroblasts. Infected cells were harvested at five time scales post infection [24 (FIGS. 11a-c), 48 (FIGS. 11d-f), 72 (FIGS. 11g-i), 96 (FIGS. 11j-l) and 120 (FIGS. 11m-o) hours]. Intracellular double staining were with the H9 Ab and Golgi marker. Secondary Ab for the H9 Ab was anti human alexa fluor.sup.488. Secondary antibody for the Golgi marker was anti mouse alexa fluor.sup.594. Shown are images of H9 Ab alone (FIGS. 11a, d, g, j, m), Golgi marker alone (FIGS. 11b, e, h, k, n) or merged images of H9 and Golgi marker (FIGS. 11c, f, I, l, o).

[0047] FIGS. 12a-o are confocal microscopy images of immuno-fluorescence analyses depicting direct visualization of HLA-A2/pp65 complexes in CMV infected fibroblasts. Infected cells were harvested at five time scales post infection [24 (FIGS. 12a-c), 48 (FIGS. 12d-f), 72 (FIGS. 12g-i), 96 (FIGS. 12j-l) and 120 (FIGS. 12m-o) hours]. Intracellular double staining were with the H9 Ab and the ER marker. Secondary Ab for the H9 Ab was anti human alexa fluor.sup.488. Secondary antibody for the ER marker was anti mouse alexa fluor.sup.594. Shown are images of H9 Ab alone (FIGS. 12a, d, g, j, m), ER marker alone (FIGS. 12b, e, h, k, n) or merged images of H9 and ER marker (FIGS. 12c, f, I, l, o).

[0048] FIGS. 13a-j are confocal microscopy images of immuno-fluorescence analyses depicting direct visualization of HLA-A2/pp65 complexes of the surface (extracellular) of CMV infected fibroblasts. The cells were extracellularly stained with the H9 Ab, and anti human alexa fluor.sup.488 as a secondary Ab (FIGS. 13a-e). Noninfected fibroblast cells were used as a control (FIGS. 13f-h). Verification of the virus infection was with anti pp65 Ab and anti mouse alexa fluor.sup.594 as a secondary Ab (FIGS. 13i-j).

[0049] FIGS. 14a-d depict the amino acid sequences (FIGS. 14a and c; SEQ ID NOs:16 and 18) and the nucleic acid sequences (FIGS. 14b and d; SEQ ID NOs:17 and 19) of the heavy chain (FIGS. 14a and b) and the light chain (FIGS. 14c and d) of Fab H9. The CDRs are shown in red; the constant regions are shown in green.

[0050] FIGS. 15a-d depict the amino acid sequences (FIGS. 15a and c; SEQ ID NOs:20 and 22) and the nucleic acid sequences (FIGS. 15b and d; SEQ ID NOs:21 and 23) of the heavy chain (FIGS. 15a and b) and the light chain (FIGS. 15c and d) of Fab F5. The CDRs are shown in red; the constant regions are shown in green.

[0051] FIGS. 16a-d are flow cytometry (FACS) analyses depicting the detection of HLA-A2/pp65 complexes on the surface of virus-infected cells taken from patients. PBMCs isolated from BMT recipients and healthy donors were stained extracellular and intracellular with the H9 Ab and the secondary anti human alexa fluor.sup.488 Ab. FIG. 16a-Confirmation of the cells' typing by staining with anti HLA-A2 (BB7.2) Ab. FIG. 16b-Extracellular staining of the BMT recipient cells with the H9 Ab. No detection of HLA-A2/pp65 complexes is seen in the infected cells using the H9 Ab. FIGS. 16c-d--Intracellular staining of both BMT recipients (FIG. 16c) and health donor cells (FIG. 16d) with the H9 Ab. A significant specific staining with the H9 Ab of the permeabilized infected cells is seen in the BMT recipients (FIG. 16c). In contrast, no staining of the H9 Ab is seen in cells of the healthy control.

[0052] FIGS. 17a-i are flow cytometry (FACS) analyses depicting examination of the proteasome inhibitor effect on the complexes presentation. Infected (FIGS. 17a-f) fibroblasts were harvested at three time scales post infection [48 (FIGS. 17a, d), 72 (FIGS. 17b, e), 96 (FIGS. 17c, f) hours], and treated overnight with 10 .mu.g/ml ALLN (acetyl-leucyl-leucyl-norleucinal) (FIGS. 17a-c) or remained untreated (FIGS. 17d-f). The cells were stained with H9 Ab followed by anti human alexa fluor.sup.488 as a secondary Ab. FACS analysis shows increased intensity of the signals after treatment with the proteasome inhibitor (FIGS. 17a-c), compared to untreated cells (FIGS. 17d-f). Control, uninfected cells (FIGS. g-i) showed no signal while stained with the H9 Ab.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0053] The present invention, in some embodiments thereof, relates to antibodies capable of binding MHC molecules being complexed with cytomegalovirus (CMV) pp65 or pp64 peptides which can be used to detect CMV infection and presentation on the cell surface and, more particularly, but not exclusively, to methods of diagnosing and treating diseases associated with CMV infection.

[0054] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.

[0055] While reducing the invention to practice, the present inventors have generated human T cell receptor (TCR)-like antibodies directed against complexes of MHC and CMV pp65 or pp64 antigenic peptides which can recognize cells infected with CMV and thus can be used to diagnose and treat diseases associated with CMV infection.

[0056] As shown in the Examples section which follows, recombinant antibodies [e.g., clones H9 (the amino acid sequence of the heavy chain is set forth by SEQ ID NO:16; the amino acid sequence of the light chain is set forth by SEQ ID NO:18) and F5 (the amino acid sequence of the heavy chain is set forth by SEQ ID NO:20; the amino acid sequence of the light chain is set forth by SEQ ID NO:22] which can specifically recognize MHC molecules when complexed with CMV pp65-derived peptides such as the pp65.sub.495-503 (SEQ ID NO:3) were isolated and were found to exhibit fine specificity to soluble or membrane-presented CMV pp65-MHC class I complex (Examples 1 and 2 of the Examples section which follows). In addition, multivalent forms of these antibodies (e.g., tetrameric Fabs or bivalent IgG) which exhibit increased avidity while preserving the specificity to the CMV pp65-MHC complex (Example 3 of the Examples section which follows) were capable of detecting as low as 5% of subpopulations of cells bearing CMV pp65 peptide-MHC complexes (Example 4 of the Examples section which follows). Cytotoxicity assays using pp65-specific CD8+ T lymphocytes further demonstrated the specificity of the TCR-like antibodies of the invention for CMV pp65-MHC complexes by their ability to block killing by the CTLs (Example 6 of the Examples section which follows). Moreover, the TCR-like antibodies of the invention enabled one, for the first time, to follow CMV pp65-MHC class I complexes both inside and on the surface of cells infected with CMV (Example 5 of the Examples section which follows). In addition, as shown in FIGS. 7-9 and described in Example 7 of the Examples section which follows, the TCR-like antibodies of the invention demonstrated that there is no correlation between class I MHC down regulation induced by wild-type virus and the generation/presentation of the virus-specific HLA-A2/pp65.sub.495-503 complex. Further quantitative data revealed that specific HLA-A2/pp65 complexes are being generated in large amounts and accumulated inside the infected cell in a mechanism that is independent to the overall down regulation of HLA-A2 molecules in these cells (Example 8 of the Examples section which follows). In addition, confocal microscopy analysis demonstrated that immediately after CMV infection specific HLA-A2/pp65 complexes are being generated and accumulated in the Golgi compartment and only about 72 hours after infection are the HLA-A2/pp65 complexes displayed on the cell surface (Example 9 of the Examples section which follows). Moreover, as shown in FIGS. 16a-d and described in Example 12 of the Examples section which follows, the antibodies of the invention were shown to be capable of detecting HLA-A2/pp65 complexes in blood cells of subjects with CMV reactivation due to immune suppression (e.g., bone marrow transplanted subjects). In addition, as shown in FIGS. 17a-j and described in Example 13 of the Examples section which follows, incubation of cells with a proteasome inhibitor resulted in increased presentation of the MHC/pp65 complexes on the cell surface.

[0057] Thus, according to an aspect of some embodiments of the present invention there is provided an antibody comprising an antigen recognition domain capable of binding a Major histocompatibility complex (MHC) molecule being complexed with a cytomegalovirus (CMV) pp65 or pp64 peptide, wherein the antibody does not bind the MHC molecule in an absence of the complexed peptide, and wherein the antibody does not bind the peptide in an absence of the MHC molecule.

[0058] As used herein, the phrase "major histocompatibility complex (MHC)" refers to a complex of antigens encoded by a group of linked loci, which are collectively termed H-2 in the mouse and HLA in humans. The two principal classes of the MHC antigens, class I and class II, each comprise a set of cell surface glycoproteins which play a role in determining tissue type and transplant compatibility. In transplantation reactions, cytotoxic T-cells (CTLs) respond mainly against foreign class I glycoproteins, while helper T-cells respond mainly against foreign class II glycoproteins.

[0059] Major histocompatibility complex (MHC) class I molecules are expressed on the surface of nearly all cells. These molecules function in presenting peptides which are mainly derived from endogenously synthesized proteins to CD8+ T cells via an interaction with the .alpha..beta. T-cell receptor. The class I MHC molecule is a heterodimer composed of a 46-kDa heavy chain which is non-covalently associated with the 12-kDa light chain .beta.-2 microglobulin. In humans, there are several MHC haplotypes, such as, for example, HLA-A2, HLA-A1, HLA-A3, HLA-A24, HLA-A28, HLA-A31, HLA-A33, HLA-A34, HLA-B7, HLA-B45 and HLA-Cw8, their sequences can be found at the kabbat data base, at htexttransferprotocol://immuno.bme.nwu.edu. Further information concerning MHC haplotypes can be found in Paul, B. Fundamental Immunology Lippincott-Rven Press.

[0060] Cytomegalovirus (CMV) belongs to the human herpesviruses. There are several known strains of CMV, including strains 1042, 119, 2387. 4654, 5035, 5040, 5160, 5508, AD169, Eisenhardt, Merlin, PT, Toledo and Towne. During viral infection, the expressed viral proteins, e.g., pp65 of the CMV AD169 strain [GenBank Accession No. M15120 for nucleic acid coding sequence (SEQ ID NO:48) and GenBank Accession No. AAA45996.1 for amino acids (SEQ ID NO:50); or GenBank Accession No. P06725 (SEQ ID NO:53)] pp64 of the CMV Towne strain [GenBank Accession No. M67443 for nucleic acid coding sequence (SEQ ID NO:49) and GenBank Accession No. AAA45994.1 for amino acids (SEQ ID NO:51); or GenBank Accession No. P18139 (SEQ ID NO:52)] are subject to proteasomal degradation and the MHC-restricted peptides bind to the MHC molecules [e.g., MHC class I or MHC class II] and are further presented therewith on the cell surface. The pp65 (561 amino acids in length) and pp64 (551 amino acids in length) proteins of the CMV AD169 and Towne strains, respectively, are 99% identical proteins and share the same amino acid sequence from position 3-551 of pp64 and 13-561 of pp65.

[0061] As used herein the term "peptide" refers to native peptides (either proteolysis products or synthetically synthesized peptides) and further to peptidomimetics, such as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body, or more immunogenic. Such modifications include, but are not limited to, cyclization, N terminus modification, C terminus modification, peptide bond modification, including, but not limited to, CH.sub.2--NH, CH.sub.2--S, CH.sub.2--S.dbd.O, O.dbd.C--NH, CH.sub.2--O, CH.sub.2--CH.sub.2, S.dbd.C--NH, CH.dbd.CH or CF.dbd.CH, backbone modification and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified in Quantitative Drug Design, C. A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.

[0062] As used herein in the specification and in the claims section below the term "amino acid" is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including for example hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term "amino acid" includes both D- and L-amino acids. Further elaboration of the possible amino acids usable according to the invention and examples of non-natural amino acids useful in MHC-I HLA-A2 recognizable peptide antigens are given herein under.

[0063] Based on accumulated experimental data, it is nowadays possible to predict which of the peptides of a protein will bind to MHC, class I. The HLA-A2 MHC class I has been so far characterized better than other HLA haplotypes, yet predictive and/or sporadic data is available for all other haplotypes.

[0064] With respect to HLA-A2 binding peptides, assume the following positions (P1-P9) in a 9-mer peptide:

P1-P2-P3-P4-P5-P6-P7-P8-P9

[0065] The P2 and P2 positions include the anchor residues which are the main residues participating in binding to MHC molecules. Amino acid resides engaging positions P2 and P9 are hydrophilic aliphatic non-charged natural amino (examples being Ala, Val, Leu, Ile, Gln, Thr, Ser, Cys, preferably Val and Leu) or of a non-natural hydrophilic aliphatic non-charged amino acid [examples being norleucine (Nle), norvaline (Nva), .alpha.-aminobutyric acid]. Positions P1 and P3 are also known to include amino acid residues which participate or assist in binding to MHC molecules, however, these positions can include any amino acids, natural or non-natural. The other positions are engaged by amino acid residues which typically do not participate in binding, rather these amino acids are presented to the immune cells. Further details relating to the binding of peptides to MHC molecules can be found in Parker, K. C., Bednarek, M. A., Coligan, J. E., Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J Immunol. 152, 163-175, 1994., see Table V, in particular. Hence, scoring of HLA-A2.1 binding peptides can be performed using the HLA Peptide Binding Predictions software approachable through a worldwide web interface at hypertexttransferprotocol://worldwideweb (dot) bimas (dot) dcrt (dot) nih (dot) gov/molbio/hla_bind/index. This software is based on accumulated data and scores every possible peptide in an analyzed protein for possible binding to MHC HLA-A2.1 according to the contribution of every amino acid in the peptide. Theoretical binding scores represent calculated half-life of the HLA-A2.1-peptide complex.

[0066] Hydrophilic aliphatic natural amino acids at P2 and P9 can be substituted by synthetic amino acids, preferably Nleu, Nval and/or .alpha.-aminobutyric acid. P9 can be also substituted by aliphatic amino acids of the general formula --HN(CH.sub.2).sub.nCOOH, wherein n=3-5, as well as by branched derivatives thereof, such as, but not limited to,

##STR00001##

wherein R is, for example, methyl, ethyl or propyl, located at any one or more of the n carbons.

[0067] The amino terminal residue (position P1) can be substituted by positively charged aliphatic carboxylic acids, such as, but not limited to, H.sub.2N(CH.sub.2).sub.nCOOH, wherein n=2-4 and H.sub.2N--C(NH)--NH(CH.sub.2).sub.nCOOH, wherein n=2-3, as well as by hydroxy Lysine, N-methyl Lysine or ornithine (Orn). Additionally, the amino terminal residue can be substituted by enlarged aromatic residues, such as, but not limited to, H.sub.2N--(C.sub.6H.sub.6)--CH.sub.2--COOH, p-aminophenyl alanine, H.sub.2N--F(NH)--NH--(C.sub.6H.sub.6)--CH.sub.2--COOH, p-guanidinophenyl alanine or pyridinoalanine (Pal). These latter residues may form hydrogen bonding with the OH.sup.- moieties of the CMV pp65 residues at the MHC-1 N-terminal binding pocket, as well as to create, at the same time aromatic-aromatic interactions.

[0068] Derivatization of amino acid residues at positions P4-P8, should these residues have a side-chain, such as, OH, SH or NH.sub.2, like Ser, Tyr, Lys, Cys or Orn, can be by alkyl, aryl, alkanoyl or aroyl. In addition, OH groups at these positions may also be derivatized by phosphorylation and/or glycosylation. These derivatizations have been shown in some cases to enhance the binding to the T cell receptor.

[0069] Longer derivatives in which the second anchor amino acid is at position P10 may include at P9 most L amino acids. In some cases shorter derivatives are also applicable, in which the C terminal acid serves as the second anchor residue.

[0070] Cyclic amino acid derivatives can engage position P4-P8, preferably positions P6 and P7. Cyclization can be obtained through amide bond formation, e.g., by incorporating Glu, Asp, Lys, Orn, di-amino butyric (Dab) acid, di-aminopropionic (Dap) acid at various positions in the chain (--CO--NH or --NH--CO bonds). Backbone to backbone cyclization can also be obtained through incorporation of modified amino acids of the formulas H--N((CH.sub.2).sub.n--COOH)--C(R)H--COOH or H--N((CH.sub.2).sub.n--COOH)--C(R)H--NH.sub.2, wherein n=1-4, and further wherein R is any natural or non-natural side chain of an amino acid.

[0071] Cyclization via formation of S--S bonds through incorporation of two Cys residues is also possible. Additional side-chain to side chain cyclization can be obtained via formation of an interaction bond of the formula --(--CH.sub.2--).sub.n--S--CH.sub.2--C--, wherein n=1 or 2, which is possible, for example, through incorporation of Cys or homoCys and reaction of its free SH group with, e.g., bromoacetylated Lys, Orn, Dab or Dap.

[0072] Peptide bonds (--CO--NH--) within the peptide may be substituted by N-methylated bonds (--N(CH.sub.3)--CO--), ester bonds (--C(R)H--C--O--O--C(R)--N--), ketomethylen bonds (--CO--CH.sub.2--), .alpha.-aza bonds (--NH--N(R)--CO--), wherein R is any alkyl, e.g., methyl, carba bonds (--CH.sub.2--NH--), hydroxyethylene bonds (--CH(OH)--CH.sub.2--), thioamide bonds (--CS--NH--), olefinic double bonds (--CH.dbd.CH--), retro amide bonds (--NH--CO--), peptide derivatives (--N(R)--CH.sub.2--CO--), wherein R is the "normal" side chain, naturally presented on the carbon atom.

[0073] These modifications can occur at any of the bonds along the peptide chain and even at several (2-3) at the same time. According to some embodiments of the invention, but not in all cases necessary, these modifications should exclude anchor amino acids.

[0074] Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted for synthetic non-natural acid such as TIC, naphthylelanine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe or o-methyl-Tyr.

[0075] Various pp65 or pp64 MHC restricted peptides can be used to form the MHC-CMV pp65 peptide complex. See for example, the peptides described in Examples 10 and 11 of the Examples section which follows (Tables 5-137).

[0076] According to some embodiments of the invention, the antibodies recognize a complex formed between the MHC class I molecule (HLA-A2) and the CMV pp65 peptide set forth by SEQ ID NO:3.

[0077] The term "antibody" as used herein includes intact molecules as well as functional fragments thereof, such as Fab, F(ab').sub.2, Fv and scFv that are capable of specific binding to a human major histocompatibility complex (MHC) class I-restricted CMV pp65 or pp64 epitope. These functional antibody fragments are defined as follows: (i) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (ii) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (iii) F(ab').sub.2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab').sub.2 is a dimer of two Fab' fragments held together by two disulfide bonds; (iv) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (v) scFv or "single chain antibody" ("SCA"), a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.

[0078] Methods of making these fragments are known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference) and are further described herein below.

[0079] An exemplary method for generating antibodies capable of specifically binding a CMV pp65 peptide restricted to an MHC-I complex is described in the Examples section herein below.

[0080] In addition, such antibodies may be generated by (i) immunizing a genetically engineered non-human mammal having cells expressing the human major histocompatibility complex (MHC) class I, with a soluble form of an MHC class I molecule being complexed with the HLA-restricted epitope; (ii) isolating mRNA molecules from antibody producing cells, such as splenocytes, of the non-human mammal; (iii) producing a phage display library displaying protein molecules encoded by the mRNA molecules; and (iv) isolating at least one phage clone from the phage display library, the at least one phage displaying the antibody specifically bindable (with an affinity below 200 nanomolar, e.g., below 100 nanomolar, e.g., below 50 nanomolar, e.g., below 30 nanomolar, e.g., below 20 nanomolar, e.g., below 10 nanomolar) to the human major histocompatibility complex (MHC) class I being complexed with the HLA-restricted epitope. The genetic material of the phage isolate is then used to prepare a single chain antibody or other forms of antibodies as is further described herein below. For example, the genetic material of the phage isolate can be used to prepare a single chain antibody which is conjugated to an identifiable or a therapeutic moiety. According to some embodiments of the invention, the non-human mammal is devoid of self MHC class I molecules. According to some embodiments of the invention, the soluble form of the MHC class I molecule is a single chain MHC class I polypeptide including a functional human .beta.-2 microglobulin amino acid sequence directly or indirectly covalently linked to a functional human MHC class I heavy chain amino acid sequence.

[0081] Recombinant MHC class I and class II complexes which are soluble and which can be produced in large quantities are described in, for example, Denkberg, G. et al. 2002, and further in U.S. patent application Ser. No. 09/534,966 and PCT/IL01/00260 (published as WO 01/72768), all of which are incorporated herein by reference. Soluble MHC class I molecules are available or can be produced for any of the MHC haplotypes, such as, for example, HLA-A2, HLA-A1, HLA-A3, HLA-A24, HLA-A28, HLA-A31, HLA-A33, HLA-A34, HLA-B7, HLA-B45 and HLA-Cw8, following, for example the teachings of PCT/IL01/00260, as their sequences are known and can be found at the kabbat data base hypertexttransferprotocol://immuno (dot) bme (dot) nwu (dot) edu/, the contents of the site is incorporated herein by reference. Such soluble MHC class I molecules can be loaded with suitable HLA-restricted epitopes and used for vaccination of non-human mammal having cells expressing the human major histocompatibility complex (MHC) class I as is further detailed hereinbelow.

[0082] Non-human mammal having cells expressing a human major histocompatibility complex (MHC) class I and devoid of self major histocompatibility complex (MHC) class I can be produced using (i) the sequence information provided in the kabbat data base, at hypertexttransferprotocol://immuno (dot) bme (dot) nwu (dot) edu/, which is incorporated herein by reference and pertaining to human MHC haplotypes, such as, for example, HLA-A2, HLA-A1, HLA-A3, HLA-A24, HLA-A28, HLA-A31, HLA-A33, HLA-A34, HLA-B7, HLA-B45 and HLA-Cw8, (ii) conventional constructs preparation techniques, as described in, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); and (iii) conventional gene knock-in/knock-out techniques as set forth, for example, in U.S. Pat. Nos. 5,487,992, 5,464,764, 5,387,742, 5,360,735, 5,347,075, 5,298,422, 5,288,846, 5,221,778, 5,175,385, 5,175,384, 5,175,383, 4,736,866; in International Publications WO 94/23049, WO93/14200, WO 94/06908 and WO 94/28123; as well as in Burke and Olson, Methods in Enzymology, 194:251-270, 1991; Capecchi, Science 244:1288-1292, 1989; Davies et al., Nucleic Acids Research, 20 (11) 2693-2698, 1992; Dickinson et al., Human Molecular Genetics, 2(8): 1299-1302, 1993; Duff and Lincoln, "Insertion of a pathogenic mutation into a yeast artificial chromosome containing the human APP gene and expression in ES cells", Research Advances in Alzheimer's Disease and Related Disorders, 1995; Huxley et al., Genomics, 9:742-750 1991; Jakobovits et al., Nature, 362:255-261, 1993; Lamb et al., Nature Genetics, 5: 22-29, 1993; Pearson and Choi, Proc. Natl. Acad. Sci. USA, 1993. 90:10578-82; Rothstein, Methods in Enzymology, 194:281-301, 1991; Schedl et al., Nature, 362: 258-261, 1993; Strauss et al., Science, 259:1904-1907, 1993, all of which are incorporated herein by reference.

[0083] Of particular interest is the paper by Pascolo et al., published in J. Exp. Med. 185: 2043-2051, 1997, which describe the preparation of mice expressing the human HLA-A2.1, H-2Db and HHD MHC class I molecules and devoid of mice MHC class I altogether.

[0084] An exemplary antibody, referred to as the H9 antibody, capable of binding to an MHC class I complexed with a CMV pp65 epitope comprises complementarity determining region (CDR) amino acid sequences as set forth in SEQ ID NOs:24-26 (for the heavy chain) and 30-32 (for the light chain).

[0085] Another exemplary antibody, referred to as the F5 antibody, capable of binding to an MHC class I complexed with a CMV pp65 epitope comprises complementarity determining region (CDR) amino acid sequences as set forth in SEQ ID NOs:36-38 (for the heavy chain) and 42-44 (for the light chain).

[0086] The invention provides a nucleic acid construct comprising a nucleic acid sequence encoding the CDR sequences of the heavy chain and the light chain of the antibody of the invention. The nucleic acid construct may further comprise a promoter for directing expression of the nucleic acid sequence in a host cell.

[0087] According to some embodiments of the invention, the nucleic acid construct comprising the nucleic acid sequences set forth by SEQ ID NOs:27-29 (for the heavy chain CDRs) and SEQ ID NOs:33-35 (for the light chain CDRs).

[0088] According to some embodiments of the invention, the nucleic acid construct comprising the nucleic acid sequences set forth by SEQ ID NOs:39-41 (for the heavy chain CDRs) and SEQ ID NOs:45-47 (for the light chain CDRs).

[0089] According to some embodiments of the invention, the nucleic acid construct comprising the nucleic acid sequence set forth by SEQ ID NO:17 (for the heavy chain) and SEQ ID NO:19 (for the light chain).

[0090] According to some embodiments of the invention, the nucleic acid construct comprising the nucleic acid sequence set forth by SEQ ID NO:21 (for the heavy chain) and SEQ ID NO:23 (for the light chain).

[0091] As mentioned herein above, the antibodies of the invention may be antibody fragments. Antibody fragments according to the invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of a DNA sequence encoding the fragment.

[0092] Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. For example, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab').sub.2. This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab' monovalent fragments. Alternatively, an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly. These methods are described, for example, by Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647, and references contained therein, which patents are hereby incorporated by reference in their entirety. See also Porter, R. R., Biochem. J., 73: 119-126, 1959. Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.

[0093] Fv fragments comprise an association of V.sub.H and V.sub.L chains. This association may be noncovalent, as described in Inbar et al., Proc. Nat'l Acad. Sci. USA 69:2659-62, 1972. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. According to some embodiments of the invention, the Fv fragments comprise V.sub.H and V.sub.L chains connected by a peptide linker. These single-chain antigen binding proteins (scFv) are prepared by constructing a structural gene comprising DNA sequences encoding the V.sub.H and V.sub.L domains connected by an oligonucleotide. The structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains. Methods for producing scFvs are described, for example, by Whitlow and Filpula, Methods, 2: 97-105, 1991; Bird et al., Science 242:423-426, 1988; Pack et al., Bio/Technology 11:1271-77, 1993; and Ladner et al., U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety.

[0094] Another form of an antibody fragment is a peptide coding for a single complementarity-determining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry, Methods, 2: 106-10, 1991.

[0095] According to some embodiments of the invention, the antibodies are multivalent forms such as tetrameric Fabs or IgG1 antibodies. The advantages of the multivalent forms of the antibody of the invention include increased avidity, yet without compromising the antibody specificity to its target (i.e., the MHC-CMV pp65 peptide complex). Exemplary methods for generating tetrameric Fabs or IgG1 antibodies are described in the general materials and experimental methods of the Examples section herein below.

[0096] Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.

[0097] The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

[0098] Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

[0099] Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1):86-95 (1991)]. Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio/Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

[0100] It will be appreciated that once the CDRs of an antibody are identified, using conventional genetic engineering techniques, expressible polynucleotides encoding any of the forms or fragments of antibodies described herein can be devised and modified in one of many ways in order to produce a spectrum of related-products as further described herein below.

[0101] The antibody of the invention can be used in vitro, ex vivo and in vivo in various therapeutic or diagnostic applications.

[0102] In case the antibody of the invention is to be used for administration into an individual (e.g., human), the human or humanized antibody or antibody fragment will generally tend to be better tolerated immunologically than one of non human origin since non variable portions of non human antibodies will tend to trigger xenogeneic immune responses more potent than the allogeneic immune responses triggered by human antibodies which will typically be allogeneic with the individual. It will be preferable to minimize such immune responses since these will tend to shorten the half-life, and hence the effectiveness, of the antibody of the invention in the individual. Furthermore, such immune responses may be pathogenic to the individual, for example by triggering harmful inflammatory reactions.

[0103] Alternately, an antibody or antibody fragment of human origin, or a humanized antibody, will also be advantageous for applications in which a functional physiological effect, for example an immune response against a target cell, activated by a constant region of the antibody or antibody fragment in the individual is desired. For example, for applications including targeted cell killing a specific immune response is advantageous. Such applications particularly include those in which the functional interaction between a functional portion of the antibody or antibody fragment, such as an Fc region, with a molecule such as an Fc receptor or an Fc-binding complement component, is optimal when such a functional portion is, similarly to the Fc region, of human origin.

[0104] Depending on the application and purpose, the antibody of the invention which includes a constant region, or a portion thereof, of any of various isotypes may be employed. According to some embodiments of the invention, the isotype is selected so as to enable or inhibit a desired physiological effect, or to inhibit an undesired specific binding of the antibody of the invention via the constant region or portion thereof. For example, for inducing antibody-dependent cell mediated cytotoxicity (ADCC) by a natural killer (NK) cell, the isotype can be IgG; for inducing ADCC by a mast cell/basophil, the isotype can be IgE; and for inducing ADCC by an eosinophil, the isotype can be IgE or IgA. For inducing a complement cascade the composition-of-matter may comprise an antibody or antibody fragment comprising a constant region or portion thereof capable of initiating the cascade. For example, the antibody or antibody fragment may advantageously comprise a Cgamma2 domain of IgG or Cmu3 domain of IgM to trigger a C1q-mediated complement cascade.

[0105] Conversely, for avoiding an immune response, such as the aforementioned one, or for avoiding a specific binding via the constant region or portion thereof, the antibody of the invention may not comprise a constant region (be devoid of a constant region), or a portion thereof, of the relevant isotype.

[0106] Additionally or alternatively, depending on the application and purpose, the antibody or antibody fragment may be attached to any of various functional moieties. An antibody or antibody fragment, such as that of the invention, attached to a functional moiety may be referred to in the art as an "immunoconjugate".

[0107] According to some embodiments of the invention, the functional moiety is a detectable moiety or a toxin. An antibody or antibody fragment attached to a toxin may be referred to in the art as an "immunotoxin".

[0108] As is described and demonstrated in further detail hereinbelow, a detectable moiety or a toxin may be particularly advantageously employed in applications of the invention involving use of the antibody of the invention to detect the complex or cells expressing the complex of the MHC molecule and the cytomegalovirus (CMV) pp65 peptide and/or to kill cells expressing or presenting such a complex.

[0109] For applications involving using the antibody of the invention to detect the antigen-presenting portion of the complex, the detectable moiety attached to the antibody or antibody fragment can be a reporter moiety enabling specific detection of the MHC-CMV pp65 peptide complex bound by the antibody or antibody fragment of the invention.

[0110] While various types of reporter moieties may be utilized to detect the MHC-CMV pp65 peptide complex, depending on the application and purpose, the reporter moiety can be a fluorophore or an enzyme. Alternately, the reporter moiety may be a radioisotope, such as [125]iodine. Further examples of reporter moieties, including those detectable by Positron Emission Tomagraphy (PET) and Magnetic Resonance Imaging (MRI), are well known to those of skill in the art.

[0111] A fluorophore may be advantageously employed as a detection moiety enabling detection of the MHC-CMV pp65 peptide complex via any of numerous fluorescence detection methods. Depending on the application and purpose, such fluorescence detection methods include, but are not limited to, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH), fluorescence resonance energy transfer (FRET), and the like.

[0112] Various types of fluorophores, depending on the application and purpose, may be employed to detect the MHC-CMV pp65 peptide complex.

[0113] Examples of suitable fluorophores include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FITC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas red, PE-Cy5, and the like.

[0114] Preferably, the fluorophore is phycoerythrin.

[0115] As is described and illustrated in the Examples section below, the antibody of the invention attached to a fluorophore, such as phycoerythrin, can be used to optimally detect the MHC-CMV pp65 peptide complex using various immunofluorescence-based detection methods.

[0116] Ample guidance regarding fluorophore selection, methods of linking fluorophores to various types of molecules, such as an antibody or antibody fragment of the invention, and methods of using such conjugates to detect molecules which are capable of being specifically bound by antibodies or antibody fragments comprised in such immunoconjugates is available in the literature of the art [for example, refer to: Richard P. Haugland, "Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992-1994", 5th ed., Molecular Probes, Inc. (1994); U.S. Pat. No. 6,037,137 to Oncoimmunin Inc.; Hermanson, "Bioconjugate Techniques", Academic Press New York, N.Y. (1995); Kay M. et al., 1995. Biochemistry 34:293; Stubbs et al., 1996. Biochemistry 35:937; Gakamsky D. et al., "Evaluating Receptor Stoichiometry by Fluorescence Resonance Energy Transfer," in "Receptors: A Practical Approach," 2nd ed., Stanford C. and Horton R. (eds.), Oxford University Press, UK. (2001); U.S. Pat. No. 6,350,466 to Targesome, Inc.]. While various methodologies may be employed to detect the MHC-CMV pp65 peptide complex using a fluorophore, such detection is preferably effected as described and demonstrated in the Examples section below.

[0117] Alternately, an enzyme may be advantageously utilized as the detectable moiety to enable detection of the antigen-presenting portion of the complex via any of various enzyme-based detection methods. Examples of such methods include, but are not limited to, enzyme linked immunosorbent assay (ELISA; for example, to detect the antigen-presenting portion of the complex in a solution), enzyme-linked chemiluminescence assay (for example, to detect the complex in an electrophoretically separated protein mixture), and enzyme-linked immunohistochemical assay (for example, to detect the complex in a fixed tissue).

[0118] Numerous types of enzymes may be employed to detect the antigen-presenting portion of the complex, depending on the application and purpose. For example, an antibody or antibody fragment attached to an enzyme such as horseradish peroxidase can be used to effectively detect the MHC-CMV pp65 peptide complex, such as via ELISA, or enzyme-linked immunohistochemical assay.

[0119] Examples of suitable enzymes include, but are not limited to, horseradish peroxidase (HPR), beta-galactosidase, and alkaline phosphatase (AP).

[0120] Ample guidance for practicing such enzyme-based detection methods is provided in the literature of the art (for example, refer to: Khatkhatay M I. and Desai M., 1999. J Immunoassay 20:151-83; Wisdom G B., 1994. Methods Mol. Biol. 32:433-40; Ishikawa E. et al., 1983. J Immunoassay 4:209-327; Oellerich M., 1980. J Clin Chem Clin Biochem. 18:197-208; Schuurs A H. and van Weemen B K., 1980. J Immunoassay 1:229-49). While various methodologies may be employed to detect the antigen-presenting portion of the complex using an enzyme, such detection is preferably effected as described in the Examples section below.

[0121] The functional moiety may be attached to the antibody or antibody fragment in various ways, depending on the context, application and purpose.

[0122] A polypeptidic functional moiety, in particular a polypeptidic toxin, may be advantageously attached to the antibody or antibody fragment via standard recombinant techniques broadly practiced in the art (for Example, refer to Sambrook et al., infra, and associated references, listed in the Examples section which follows).

[0123] A functional moiety may also be attached to the antibody or antibody fragment using standard chemical synthesis techniques widely practiced in the art [for example, refer to the extensive guidelines provided by The American Chemical Society (for example at: hypertexttransferprotocol://worldwideweb (dot) chemistry (dot) org/portal/Chemistry)]. One of ordinary skill in the art, such as a chemist, will possess the required expertise for suitably practicing such chemical synthesis techniques.

[0124] Alternatively, a functional moiety may be attached to the antibody or antibody fragment by attaching an affinity tag-coupled antibody or antibody fragment of the invention to the functional moiety conjugated to a specific ligand of the affinity tag.

[0125] Various types of affinity tags may be employed to attach the antibody or antibody fragment to the functional moiety.

[0126] Examples of detectable moieties that can be used in the invention include but are not limited to radioactive isotopes, phosphorescent chemicals, chemiluminescent chemicals, fluorescent chemicals, enzymes, fluorescent polypeptides and epitope tags. The detectable moiety can be a member of a binding pair, which is identifiable via its interaction with an additional member of the binding pair, and a label which is directly visualized. In one example, the member of the binding pair is an antigen which is identified by a corresponding labeled antibody. In one example, the label is a fluorescent protein or an enzyme producing a colorimetric reaction.

[0127] When the detectable moiety is a polypeptide, the immunolabel (i.e. the antibody conjugated to the detectable moiety) may be produced by recombinant means or may be chemically synthesized by, for example, the stepwise addition of one or more amino acid residues in defined order using solid phase peptide synthetic techniques. Examples of polypeptide detectable moieties that can be linked to the antibodies of the invention using recombinant DNA technology include fluorescent polypeptides, phosphorescent polypeptides, enzymes and epitope tags.

[0128] Expression vectors can be designed to fuse proteins encoded by the heterologous nucleic acid insert to fluorescent polypeptides. For example, antibodies can be expressed from an expression vector fused with a green fluorescent protein (GFP)-like polypeptide. A wide variety of vectors are commercially available that fuse proteins encoded by heterologous nucleic acids to the green fluorescent protein from Aequorea victoria ("GFP"), the yellow fluorescent protein and the red fluorescent protein and their variants (e.g., Evrogen). In these systems, the fluorescent polypeptide is entirely encoded by its amino acid sequence and can fluoresce without requirement for cofactor or substrate. Expression vectors that can be employed to fuse proteins encoded by the heterologous nucleic acid insert to epitope tags are commercially available (e.g., BD Biosciences, Clontech).

[0129] Alternatively, chemical attachment of a detectable moiety to the antibodies of the invention can be effected using any suitable chemical linkage, direct or indirect, as via a peptide bond (when the detectable moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer. Such chimeric peptides may be linked via bonding at the carboxy (C) or amino (N) termini of the peptides, or via bonding to internal chemical groups such as straight, branched or cyclic side chains, internal carbon or nitrogen atoms, and the like. Such modified peptides can be easily identified and prepared by one of ordinary skill in the art, using well known methods of peptide synthesis and/or covalent linkage of peptides. Description of fluorescent labeling of antibodies is provided in details in U.S. Pat. Nos. 3,940,475, 4,289,747, and 4,376,110.

[0130] Exemplary methods for conjugating two peptide moieties are described herein below:

[0131] SPDP Conjugation:

[0132] Any SPDP conjugation method known to those skilled in the art can be used. For example, in one illustrative embodiment, a modification of the method of Cumber et al. (1985, Methods of Enzymology 112: 207-224) as described below, is used.

[0133] A peptide, such as an identifiable or therapeutic moiety, (1.7 mg/ml) is mixed with a 10-fold excess of SPDP (50 mM in ethanol) and the antibody is mixed with a 25-fold excess of SPDP in 20 mM sodium phosphate, 0.10 M NaCl pH 7.2 and each of the reactions incubated, e.g., for 3 hours at room temperature. The reactions are then dialyzed against PBS.

[0134] The peptide is reduced, e.g., with 50 mM DTT for 1 hour at room temperature. The reduced peptide is desalted by equilibration on G-25 column (up to 5% sample/column volume) with 50 mM KH.sub.2PO.sub.4 pH 6.5. The reduced peptide is combined with the SPDP-antibody in a molar ratio of 1:10 antibody:peptide and incubated at 4.degree. C. overnight to form a peptide-antibody conjugate.

[0135] Glutaraldehyde Conjugation:

[0136] Conjugation of a peptide (e.g., an identifiable or therapeutic moiety) with an antibody can be accomplished by methods known to those skilled in the art using glutaraldehyde. For example, in one illustrative embodiment, the method of conjugation by G. T. Hermanson (1996, "Antibody Modification and Conjugation, in Bioconjugate Techniques, Academic Press, San Diego) described below, is used.

[0137] The antibody and the peptide (1.1 mg/ml) are mixed at a 10-fold excess with 0.05% glutaraldehyde in 0.1 M phosphate, 0.15 M NaCl pH 6.8, and allowed to react for 2 hours at room temperature. 0.01 M lysine can be added to block excess sites. After-the reaction, the excess glutaraldehyde is removed using a G-25 column equilibrated with PBS (10% v/v sample/column volumes)

[0138] Carbodiimide Conjugation:

[0139] Conjugation of a peptide with an antibody can be accomplished by methods known to those skilled in the art using a dehydrating agent such as a carbodiimide. Most preferably the carbodiimide is used in the presence of 4-dimethyl aminopyridine. As is well known to those skilled in the art, carbodiimide conjugation can be used to form a covalent bond between a carboxyl group of peptide and an hydroxyl group of an antibody (resulting in the formation of an ester bond), or an amino group of an antibody (resulting in the formation of an amide bond) or a sulfhydryl group of an antibody (resulting in the formation of a thioester bond).

[0140] Likewise, carbodiimide coupling can be used to form analogous covalent bonds between a carbon group of an antibody and an hydroxyl, amino or sulfhydryl group of the peptide. See, generally, J. March, Advanced Organic Chemistry: Reaction's, Mechanism, and Structure, pp. 349-50 & 372-74 (3d ed.), 1985. By means of illustration, and not limitation, the peptide is conjugated to an antibody via a covalent bond using a carbodiimide, such as dicyclohexylcarbodiimide. See generally, the methods of conjugation by B. Neises et al. (1978, Angew Chem., Int. Ed. Engl. 17:522; A. Hassner et al. (1978, Tetrahedron Lett. 4475); E. P. Boden et al. (1986, J. Org. Chem. 50:2394) and L. J. Mathias (1979, Synthesis 561). The level of immunocomplex may be compared to a control sample from a non-diseased subject, wherein an up-regulation of immunocomplex formation is indicative of disease associated with CMV infection. Preferably, the subject is of the same species e.g. human, preferably matched with the same age, weight, sex etc. It will be appreciated that the control sample may also be of the same subject from a healthy tissue, prior to disease progression or following disease remission.

[0141] Preferably, the affinity tag is a biotin molecule, more preferably a streptavidin molecule.

[0142] A biotin or streptavidin affinity tag can be used to optimally enable attachment of a streptavidin-conjugated or a biotin-conjugated functional moiety, respectively, to the antibody or antibody fragment due to the capability of streptavidin and biotin to bind to each other with the highest non covalent binding affinity (i.e., with a Kd of about 10.sup.-14 to 10.sup.-15). A biotin affinity tag may be highly advantageous for applications benefiting from. Thus, the antibody of invention can be a multimeric form of the antibody or antibody fragment, which may be optimally formed by conjugating multiple biotin-attached antibodies or antibody fragments of the invention to a streptavidin molecule, as described in further detail below.

[0143] As used herein the term "about" refers to plus or minus 10 percent.

[0144] Various methods, widely practiced in the art, may be employed to attach a streptavidin or biotin molecule to a molecule such as the antibody or antibody fragment to a functional moiety.

[0145] For example, a biotin molecule may be advantageously attached to an antibody or antibody fragment of the invention attached to a recognition sequence of a biotin protein ligase. Such a recognition sequence is a specific polypeptide sequence serving as a specific biotinylation substrate for the biotin protein ligase enzyme. Ample guidance for biotinylating a target polypeptide such as an antibody fragment using a recognition sequence of a biotin protein ligase, such as the recognition sequence of the biotin protein ligase BirA, is provided in the literature of the art (for example, refer to: Denkberg, G. et al., 2000. Eur. J. Immunol. 30:3522-3532). Preferably, such biotinylation of the antibody or antibody fragment is effected as described and illustrated in the Examples section below.

[0146] Alternately, various widely practiced methods may be employed to attach a streptavidin molecule to an antibody fragment, such as a single chain Fv (for example refer to Cloutier S M. et al., 2000. Molecular Immunology 37:1067-1077; Dubel S. et al., 1995. J Immunol Methods 178:201; Huston J S. et al., 1991. Methods in Enzymology 203:46; Kipriyanov S M. et al., 1995. Hum Antibodies Hybridomas 6:93; Kipriyanov S M. et al., 1996. Protein Engineering 9:203; Pearce L A. et al., 1997. Biochem Molec Biol Intl 42:1179-1188).

[0147] Functional moieties, such as fluorophores, conjugated to streptavidin are commercially available from essentially all major suppliers of immunofluorescence flow cytometry reagents (for example, Pharmingen or Becton-Dickinson). Standard recombinant DNA chemical techniques are preferably employed to produce a fusion protein comprising streptavidin fused to a polypeptidic functional moiety. Standard chemical synthesis techniques may also be employed to form the streptavidin-functional moiety conjugate. Extensive literature is available providing guidance for the expression, purification and uses of streptavidin or streptavidin-derived molecules (Wu S C. et al., 2002. Protein Expression and Purification 24:348-356; Gallizia A. et al., 1998. Protein Expression and Purification 14:192-196), fusion proteins comprising streptavidin or streptavidin-derived molecules (Sano T. and Cantor C R., 2000. Methods Enzymol. 326:305-11), and modified streptavidin or streptavidin-derived molecules (see, for example: Sano T. et al., 1993. Journal of Biological Chemistry 270:28204-28209), including for streptavidin or streptavidin-derived molecules whose gene sequence has been optimized for expression in E. coli (Thompson L D. and Weber P C., 1993. Gene 136:243-6).

[0148] As mentioned, the antibody may be conjugated to a therapeutic moiety. The therapeutic moiety can be, for example, a cytotoxic moiety, a toxic moiety, a cytokine moiety and a second antibody moiety comprising a different specificity to the antibodies of the invention.

[0149] In a similar fashion to an immunolabel, an immunotoxin (i.e. a therapeutic moiety attached to an antibody of the invention) may be generated by recombinant or non-recombinant means. Thus, the invention envisages a first and second polynucleotide encoding the antibody of the invention and the therapeutic moiety, respectively, ligated in frame, so as to encode an immunotoxin. The following Table 1 provides examples of sequences of therapeutic moieties.

TABLE-US-00001 TABLE 1 Amino Acid sequence Nucleic Acid sequence (Genbank (Genbank Therapeutic Moiety Accession No.) Accession No.) Pseudomonas exotoxin AAB25018 S53109 Diphtheria toxin E00489 E00489 interleukin 2 CAA00227 A02159 CD3 P07766 X03884 CD16 AAK54251 AF372455 interleukin 4 P20096 ICRT4 HLA-A2 P01892 K02883 interleukin 10 P22301 M57627 Ricin A toxin 225988 A23903

[0150] According to some embodiments of the invention, the toxic moiety is PE38 KDEL.

[0151] Exemplary methods of conjugating the antibodies of the invention to peptide therapeutic agents are described herein above.

[0152] As mentioned, the antibody of the invention, which is capable of specifically recognizing and binding an MHC-CMV pp65 peptide complex as described above, can be used to detecting cell expressing a cytomegalovirus (CMV) antigen.

[0153] Thus, according to an aspect of some embodiments of the invention there is provided a method of detecting a cell expressing a cytomegalovirus (CMV) antigen. The method is effected by contacting the cell with the antibody under conditions which allow immunocomplex formation, wherein a presence or a level above a predetermined threshold of the immunocomplex is indicative of CMV expression in the cell.

[0154] The contacting may be effected in vitro (e.g., in a cell line), ex vivo or in vivo.

[0155] As mentioned, the method of the invention is effected under conditions sufficient to form an immunocomplex (e.g. a complex between the antibodies of the invention and the MHC-CMV pp65 peptide); such conditions (e.g., appropriate concentrations, buffers, temperatures, reaction times) as well as methods to optimize such conditions are known to those skilled in the art, and examples are disclosed herein.

[0156] As described in the Examples section which follows, the immunocomplex can be formed and detected within the cell or on the cell surface. For detection in the cell, the conditions include a permeabilization agent (e.g., a solution including saponin), to enable penetration of the antibody inside the cell. According to some embodiments of the invention, the immunocomplex is formed on the surface of the cell.

[0157] Determining a presence or level of the immunocomplex of the invention is dependent on the detectable moiety to which the antibody is attached, essentially as described hereinabove.

[0158] A non-limiting example of the immunocomplex of the invention is the complex formed between the antibody of the invention (e.g., H9 or F5) and a protein complex comprising MHC class I heavy chain (HLA-A2) and pp65 peptide as set forth by SEQ ID NO:3.

[0159] As mentioned, the antibody of the invention, which is capable of specifically recognizing and binding an MHC-CMV pp65 peptide complex, can be used to diagnose CMV infection in a subject in need thereof.

[0160] Thus, according to another aspect of the invention, there is provided a method of diagnosing a cytomegalovirus (CMV) infection in a subject in need thereof. The method is effected by contacting a cell of the subject with the antibody under conditions which allow immunocomplex formation, wherein a presence or a level above a pre-determined threshold of the immunocomplex in the cell is indicative of the CMV infection in the subject.

[0161] As used herein the phrase "subject in need thereof" refers to a mammal, preferably, a human subject which is suspected of being infected with CMV.

[0162] According to some embodiments of the invention, the subject has a suppressed or a compromised immune system, such as an immuno-compromised organ transplant recipient or a subject infected with human immunodeficiency virus (HIV).

[0163] According to some embodiments of the invention, the CMV infection is associated with a disease selected from the group consisting of mononucleosis, retinitis, pneumonia, gastrointestinal disorders, and encephalitis.

[0164] According to some embodiments of the invention, the cell is a retina cell, lung epithelial cell, a gastrointestinal epithelial cell and/or a brain cell.

[0165] The antibody described herein can be used to treat a disease associated with CMV infection.

[0166] According to an additional aspect of the invention there is provided a method of treating a disease associated with cytomegalovirus (CMV) infection, the method is effected by administering to a subject in need thereof a therapeutically effective amount of the antibody thereby treating the disease associated with CMV infection.

[0167] The term "treating" refers to inhibiting or arresting the development of a disease, disorder or condition and/or causing the reduction, remission, or regression of a disease, disorder or condition. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a disease, disorder or condition, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a disease, disorder or condition.

[0168] The antibodies of the invention may be provided per se or may be administered as a pharmaceutical composition.

[0169] As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0170] Herein the term "active ingredient" refers to the antibodies of the invention accountable for the biological effect.

[0171] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0172] Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

[0173] Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0174] Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.

[0175] Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

[0176] Pharmaceutical compositions of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0177] Pharmaceutical compositions for use in accordance with the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

[0178] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0179] For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

[0180] Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0181] Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

[0182] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0183] For administration by nasal inhalation, the active ingredients for use according to the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0184] The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

[0185] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

[0186] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

[0187] The pharmaceutical composition of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

[0188] Pharmaceutical compositions suitable for use in context of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (the antibody of the invention or the nucleic acid construct encoding same) effective to prevent, alleviate or ameliorate symptoms of a pathology, (e.g., a disease associated with cytomegalovirus infection) or prolong the survival of the subject being treated.

[0189] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0190] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0191] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. 1).

[0192] Dosage amount and interval may be adjusted individually to provide plasma or brain levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0193] Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

[0194] The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

[0195] Compositions of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration and use. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.

[0196] As used herein the term "about" refers to .+-.10%.

[0197] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0198] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

[0199] Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.

[0200] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, Calif. (1990); Marshak et al., "Strategies for Protein Purification and Characterization--A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

GENERAL MATERIALS AND EXPERIMENTAL METHODS

Generation of Biotinylated Single-Chain MHC/Peptide Complexes

[0201] Single-chain MHC (scMHC)/peptide complexes were produced by in vitro refolding of inclusion bodies produced in Escherichia coli, as described (Denkberg, G. et al., 2000). Briefly, a single-chain .beta..sub.2-microglobulin (.beta..sub.2m)-HLA/A2 (scMHC) construct, in which the .beta..sub.2m and HLA-A2 genes are connected to each other by a flexible peptide linker (wherein the .beta.2m gene is translationally fused upstream of the gene encoding the MHC heavy chain) (HLA-A2), was engineered to contain the BirA recognition sequence for site-specific biotinylation at the C terminus (scMHC-BirA). In vitro refolding was performed in the presence of a 5-10 molar excess of the antigenic peptides, as described (Denkberg, G. et al., 2000). Correctly folded MHC/peptide complexes were isolated and purified by anion exchange Q-Sepharose chromatography (Pharmacia, Peapack, N.J.), followed by site-specific biotinylation using the BirA enzyme (Avidity, Denver, Colo.), as previously described (Altman, J. D. et al., 1996). The homogeneity and purity of the scMHC-peptide complexes were analyzed by various biochemical means, including SDS-PAGE, size exclusion chromatography, and ELISA, as previously described (Denkberg, G. et al., 2000).

[0202] Selection of Phage Antibodies on Biotinylated Complexes

[0203] Selection of phage Abs on biotinylated complexes was preformed, as described (Denkberg, G., et al., 2002; Lev A., et al., 2002). Briefly, a large human Fab library containing 3.7.times.10.sup.10 different Fab clones (De Haard, H J., et al., 1999) was used for the selection. Phages (10.sup.13) were first preincubated with streptavidin-coated paramagnetic beads (200 .mu.l; Dynal, Oslo, Norway) to deplete the streptavidin binders. The remaining phages were subsequently used for panning with decreasing amounts of biotinylated scMHC-peptide complexes. The streptavidin-depleted library was incubated in solution with soluble biotinylated scHLA-A2/pp65 complexes (500 nM for the first round, and 100 nM for the following rounds) for 30 minutes at room temperature (RT).

[0204] Streptavidin-coated magnetic beads (200 .mu.l for the first round of selection, and 100 .mu.l for the second and third rounds) were added to the mixture and incubated for 10-15 minutes at RT. The beads were washed extensively 12 times with PBS/Tween 0.1%, and additional two washes were with PBS. Bound phages were eluted with triethylamine (100 mM, 5 minutes at RT), followed by neutralization with Tris-HCl (1 M, pH 7.4), and used to infect E. coli TG1 cells (OD=0.5) for 30 minutes at 37.degree. C.

[0205] The diversity of the selected Abs was determined by DNA fingerprinting using a restriction endonuclease (BstNI), which is a frequent cutter of Ab V gene sequences. The Fab DNA of different clones was PCR amplified using the primers pUC-reverse [5'-AGCGGATAACAATTTCACACAGG-3' (SEQ ID NO:1)] and fd-tet-seq24 [5'-TTTGTCGTCTTTCCAGACGTTAGT-3' (SEQ ID NO:2)], followed by digestion with BstNI (NEB, Beverly, Mass.) (2 hours, 60.degree. C.) and analysis on agarose gel electrophoresis.

[0206] Expression and Purification of Soluble Recombinant Fab Abs

[0207] Fab Abs were expressed and purified, as described recently (Denkberg, G., et al., 2000). BL21 bacterial cells were grown to OD.sub.600=0.8-1.0 and induced to express the recombinant Fab Ab by the addition of 1 mM isopropyl 13-D-thiogalactoside (IPTG) for 3-4 hours at 30.degree. C. Periplasmic content was released using the B-PER solution (Pierce, Rockford, Ill.), which was applied onto a prewashed TALON column (Clontech, Palo Alto, Calif.). Bound Fabs were eluted using 0.5 ml of 100 mM imidazole in PBS. The eluted Fabs were dialyzed twice against PBS (overnight, 4.degree. C.) to remove residual imidazole.

[0208] ELISA with Phage Clones and Purified Fab Abs

[0209] The binding specificities of individual phage clones and soluble Fab were determined by ELISA using biotinylated scMHC-peptide complexes. ELISA plates (Falcon) were coated overnight with BSA-biotin (1 .mu.g/well). After having been washed, the plates were incubated (1 hour, RT) with streptavidin (1 .mu.g/well), washed extensively, and further incubated (1 hour, RT) with 0.5 .mu.g of MHC/peptide complexes. The plates were blocked for 30 minutes at RT with PBS/2% skim milk and subsequently were incubated for 1 hour at RT with phage clones (.about.10.sup.9 phages/well) or various concentrations of soluble purified Fab. After having been washed, the plates were incubated with HRP-conjugated/anti-human Fab Ab (for soluble Fabs) or HRP-conjugated anti-M13 phage (for phage-displayed Fabs). Detection was performed using tetramethylbenzidine reagent (Sigma-Aldrich, St. Louis, Mo.). The HLA-A2-restricted peptides used for specificity studies of the Fab phage clones or purified Fab Abs are as described in Examples 1 and 2 below.

[0210] Generation of Fluorescently-Labeled Tetrameric Fab

[0211] The genes encoding the L and H chain of Fab H9 were cloned separately into a T7-promotor pET-based expression vector. The L chain gene was engineered to contain the BirA recognition sequence for site-specific biotinylation at the C terminus. These constructs were expressed separately in E. coli BL21 cells and upon induction with IPTG, intracellular inclusion bodies that contain large amounts of the recombinant protein accumulated. Inclusion bodies of both chains were purified, solubilized, reduced with 10 mg/ml DTE (Dithioerithrol), and subsequently refolded at a 1:1 ratio in a redox-shuffling buffer system containing 0.1 M Tris, 0.5 M arginine, and 0.09 mM oxidized glutathione, pH 8.0. Correctly folded Fab was then isolated and purified by anion exchange MonoQ chromatography (Pharmacia). The Fab peak fractions were concentrated using Centricon-30 (Amicon, Beverly, Mass.) to 1 mg/ml, and the buffer was exchanged to Tris-HCl (10 mM, pH 8.0). Biotinylation was performed using the BirA enzyme (Avidity), as previously described. Excess biotin was removed from biotinylated Fabs using a G-25 desalting column. PE-labeled streptavidin (Jackson ImmunoResearch, West Grove, Pa.) was added at a molar ratio of 1:4 to produce fluorescent tetramers of the biotinylated Fab.

[0212] Generation of Whole IgG from Recombinant Fab

[0213] To transform the recombinant fragments into whole IgG molecules, the eukaryotic expression vector pCMV/myc/ER (Invitrogen) was used. The heavy and the light chains of the Fab were cloned separately. Each shuttle expression vector carries a different antibiotics resistance gene and thus expression was facilitated by co-transfection of the two constructs into human embryonic kidney HEK293 cells. Cotransfections of HEK293 cells were performed using the nonliposomal transfection reagent FuGene 6 (Roche, Brussels, Belgium) according to the manufacturer's instructions. The transfection was performed with serum free medium containing 0.8 mg/ml of G418, and 100 .mu.g/ml of hygromycin. Forty-eight hours after transfection limiting dilutions were performed into medium containing 0.8 mg/ml of G418, and 100 .mu.g/ml of hygromycin. Cells were plated in 96-well plates at 1000 cells per well. Medium was exchanged after 5 and 10 days. Wells in which a single colony grew up to 50% of the well were further trypsinized with 20 .mu.l and 20 .mu.l medium and splitted into two wells: 10 .mu.l into a 24 well plate (backup) and 30 .mu.l into a 24 well plate (experiment). When the plate reached 80% confluency, serum starvation was initiated by reducing each day serum percentile to 0.5%. After 48 hours of incubation with 0.5% fetal calf serum (FCS), screening of cell culture supernatants was performed by ELISA and FACS assays. The IgG secreting clones that exhibited the best binding reactivity as detected by ELISA, FACS and the highest amount of protein, were selected for antibody production and purification.

[0214] Protein A-SEPHAROSE.TM. 4 Fast Flow beads (Amersham) were prepared according to the manufacturer's instructions. Briefly, supernatant was loaded on the Protein A-Sepharose beads at 15-50 ml/h. Unbound immunoglobulins were washed with 0.001 M NaH.sub.2PO.sub.4 and 0.019 M Na.sub.2HPO.sub.4. Bound immunoglobulins were then eluted with 0.1 M citric acid at pH 3. Five fractions were collected with 250 .mu.l of elusion buffer and immediately neutralized with 80 .mu.l of Tris-HCL pH 9. IgG concentration was measured using the Pierce protein assay. The eluted protein was dialyzed against PBS pH 7.4 over night. 10 mgs of IgG were produced from 1 L of culture supernatant.

[0215] Flow Cytometry

[0216] The B cell line RMAS-HHD, which is transfected with a single-chain .beta..sub.2m-HLA-A2 gene, the EBV-transformed HLA-A2.sup.+ JY cells, and the HLA-A2- B cell line APD-70 were used to determine the reactivity of the recombinant Fab Abs with cell surface-expressed HLA-A2/peptide complexes. Peptide pulsing was performed as indicated: 10.sup.6 cells were washed twice with serum-free RPMI and incubated overnight at 26.degree. C. or 37.degree. C., respectively, in medium containing 1-50 .mu.M of the peptide. The RMAS-HHD cells were subsequently incubated at 37.degree. C. for 2-3 hours to stabilize cell surface expression of MHC-peptide complexes.

[0217] Cells were incubated for 60 minutes at 4.degree. C. with recombinant Fab Abs (10 .mu.g/ml) in 100 .mu.l PBS. After one wash, the cells were incubated with 1 .mu.g anti-human Fab (Jackson ImmunoResearch) for another 60 minutes at 4.degree. C. After three washes, the cells were resuspended in ice-cold PBS. The cells were analyzed by a FACStar flow cytometer (BD Biosciences, San Jose, Calif.).

[0218] Surface Plasmon Resonance

[0219] 0.0025 mg/ml of biotinylated HLA-A2/pp65 or control HLA-A2/EBV complexes were bound to a streptavidin (SA) sensor chip (Biacore, Uppsala, Sweden) per well. Measurements of 780-800 RU were detected for each well after complexes binding. Soluble isolated antibodies in their monomeric/IgG form were diluted in PBS at three concentration (0.05 .mu.M, 0.1 .mu.M, 0.2 .mu.M) and were flowed over the relevant wells at a rate of 10 .mu.l/min at room temperature. Responses were recorded using Biacore 2000 and analyzed using BlAevaluation software 3.2 (Biacore, Uppsala, Sweden).

[0220] Cell Infection

[0221] Human fibroblasts which express the HLA-A2 allele were obtained from primary cultures of foreskins and grown in Dulbecco's modified Eagle's medium (DMEM), containing 2 mM Glutamine, 100 IU of penicillin/ml, 10% fetal calf serum (FCS), non essential amino acid (1:100), sodium Pyruvate (1:100) and 10 mM hepes. The cells were infected at an MOI of 0.5-1 with the laboratory strain AD169.sup.41 and harvested at five time scales for FACS analysis. MHC expression on virus infected or uninfected cells was determined using PE conjugated anti HLA-A2 (BB7.2) monoclonal antibody. Detection of infection was with anti pp65 monoclonal antibody (clone IL11, Virusys, Sykesville, Md. USA) and anti mouse PE as secondary antibody. For intracellular staining cells were fixed with 0.3% formaldehyde and then permeabilized with PBS containing 0.05% Saponin and 1% goat serum used for blocking.

[0222] Cytotoxicity Assay

[0223] Target cells were cultured in 48-well plates in DMEM medium plus 10% FCS and were grown up until confluent. Cells were washed and incubated overnight with 15 .mu.Ci/ml (1 Ci 37 GBq) [.sup.35S] methionine (NEN). After 1 hour of incubation with the IgG H9 (10-20 .mu.g/ml or the indicated concentration at 37.degree. C.), effector CTL cells were added at a target:effector ratio of 1:3 respectively and incubated for 5 hours at 37.degree. C. After incubation, [.sup.35S] methionine release from target cells was measured in a 50-.mu.l sample of the culture supernatant. All assays were performed in triplicate.

[0224] Confocal Microscopy

[0225] Infected and noninfected fibroblast cells were fixed for 10 minutes with 0.5% paraformaldehyde, and washed twice with PBS containing 0.1% bovine serum albumin (BSA). The cells were permeabilized and incubated with anti pp65 mAb, H9 IgG, anti calnexin (Chemicon, cat. No. MAB3126), and/or cis-golgi matrix protein (GM130) (BD transduction laboratories, cat No. 610822) in the presence of a PBS medium containing 0.05% saponin, 1% fetal bovine serum, and 0.1% BSA, for 40 minutes at 4.degree. C. Cells were subsequently washed and further incubated with goat anti mouse secondary Ab conjugated to Alexa-flour.sup.594 (Molecular Probes, cat. No. A21216), and goat anti human secondary Ab conjugated to Alexa-flour.sup.488 (Molecular Probes, cat. No. A11013), respectively. DRAQ5 (Alexis Biochemicals) was added to the stained cells before they were washed again. Images were collected on a LSM 510 META laser scanning microscope (Carl Zeiss Microimaging Inc) using a .times.63 oil immersion objective numerical aperture 1.32, at different zoom factors. Alexa Fluor.sup.488 was excited using an argon laser at 488 nm. Alexa Fluor.sup.594 was excited using a krypton laser at 568 mm Differential interference contrast images were collected simultaneous with the fluorescence images using the transmitted light detector. Z stacks of images were collected using a step increment of 0.3 .mu.m between planes. All pictures were taken with identical settings.

[0226] Isolation of PBMCs

[0227] Samples of 20-30 ml blood obtained from healthy donors or BMT patients, containing 500 units (U) of heparin was added to 50 ml sterile tubes containing 15 ml LYMPHOPREP.TM. (Axis shield PoC AS, Oslo Norway). The blood was added gently without mixing between the Ficoll and the blood. The tubes were centrifuged for 30 minutes at 1000 g without brakes. The upper layer that contains the serum was removed and the Buffy coat that contains the peripheral blood mononuclear cells (PBMCs) was transferred to new tubes. The PBMCs were washed twice with 40 ml of phosphate buffer saline (PBS) and 2 mM EDTA (centrifuged at 700 g for 8 minutes). The PBMCs were resuspended in 20 ml PBS, counted, centrifuged at 500 g for 8 minutes and resuspended in PBMCs medium at 1-5.times.10.sup.6 cells/ml. About 70.times.10.sup.6 cells are isolated from a total of 50 ml blood sample.

Example I

Selection and Cloning of Recombinant Antibodies Specific for HLA-A2-PP65 Complex

Experimental Results

[0228] Selection of Recombinant Antibodies Specific for HLA-A2/pp65 Complexes

[0229] Recombinant peptide-HLA-A2 complexes that present the pp65.sub.495-503 (SEQ ID NO:3) CMV-derived peptide were generated using a single-chain MHC (scMHC) construct according to the method previously described previously (Denkberg G., et al., 2000). In this construct, the extracellular domains of HLA-A2 are connected into a single-chain molecule with .beta..sub.2m using a 15-aa flexible linker (the .beta.2m is translationally fused upstream of the MHC heavy chain). The scMHC-peptide complexes were produced by in vitro refolding of inclusion bodies in the presence of the pp65 495-503 peptide (SEQ ID NO:3). The refolded scHLA-A2/pp65 complexes were found to be pure, homogenous, and monomeric by SDS-PAGE and size exclusion chromatography analyses (data not shown). Recombinant scMHC-peptide complexes generated by this strategy were previously characterized in detail for their biochemical, biophysical, and biological properties, and were found to be correctly folded and functional (Denkberg G., et al., 2000; Denkberg G., et al., 2001).

[0230] A large human Fab library containing 3.7.times.10.sup.10 different Fab clones was used for the selection on biotinylatd HLA-A2/pp65 complexes (De Haard H J., et al., 1999). Phage displayed antibodies which were capable of binding to the specific biotinylated HLA-A2/peptide complex were selected as previously described (Denkberg G., et al., 2002; Lev A., et al., 2002). Enrichment in phage titer was observed after three rounds of panning (Table 2, hereinbelow). Specificity of the selected phage antibodies against the complex was analyzed by a differential ELISA assay in which binding was tested against specific (pp65 495-503 peptide; SEQ ID NO:3) and non specific (gp100 280-288 peptide; SEQ ID NO:4) biotinylated HLA-A2/peptide complexes. These were immobilized to wells through BSA-biotin-streptavidin. As shown in FIG. 1a, a high percentage of specific clones was observed; 54 clones of the 96 screened (56%), were peptide specific and bound the specific peptide/MHC used in the selection (i.e., the scHLA-A2/pp65 complex).

TABLE-US-00002 TABLE 2 Table 2: Results of the amounts of phages counted before and after each panning (inputs and outputs). Enrichment of the outputs can be seen in each panning round. Round of Panning Phage input Phage output Enrichment 1.sup.st 10.sup.12 4 .times. 10.sup.5 2.sup.nd 1.5 .times. 10.sup.12 5 .times. 10.sup.6 75 3.sup.rd 5 .times. 10.sup.12 1.5 .times. 10.sup.9 750

[0231] Cloning of Two Fab Clones with Specificity to the HLA-A2-pp65.sub.495-503 Complex

[0232] The diversity within the selected TCR-like Fabs was assessed by DNA fingerprint analysis using the BstNI restriction enzyme. The analysis revealed two different clones, termed H9 and F5 with HLA-A2/pp65 specificity (data not shown). DNA sequencing analysis confirmed these observations. The nucleic acid and amino acid sequences of the heavy and light chains of H9 Fab clone are provided in FIGS. 14a-d (SEQ ID NOs:16-19). The nucleic acid and amino acid sequences of the heavy and light chains of F5 Fab clone are provided in FIGS. 15a-d (SEQ ID NOs:20-23). The amino acid sequences of the CDRs of the H9 and F5 Fab Abs are provided in Table 3, hereinbelow. The nucleic acid sequences of the CDRs of the H9 and F5 Fab Abs are provided in Table 4, hereinbelow.

TABLE-US-00003 TABLE 3 Amino acid sequences of the CDRs of the Fab antibodies Fab clone CDRs heavy chain CDRs light chain H9 SYAISW RASQSVSSSYLA (SEQ ID NO: 24; CDR1) (SEQ ID NO: 30; CDR1) GIIPIFGTANYAQKFQG GASSRAT (SEQ ID NO: 25; CDR2) (SEQ ID NO: 31; CDR2) GDLYYYDSSGYPRYYFDY QHYSTSPGFT (SEQ ID NO: 26; CDR3) (SEQ ID NO: 32; CDR3) F5 SSNYYWG TRSTGSITSNYVH (SEQ ID NO: 36; CDR1) (SEQ ID NO: 42; CDR1) AIYYSGSTYYNPSLKS EDNERPS (SEQ ID NO: 37; CDR2) (SEQ ID NO: 43; CDR2) RIGVAGQWYFDLWGRGTLVTVSS QSYDDSNHISV (SEQ ID NO: 38; CDR3) (SEQ ID NO: 44; CDR3) Table 3: CDRs (amino acid sequences) of the heavy and light chains of Fabs H9 and F5.

TABLE-US-00004 TABLE 4 Nucleic acid sequences of the CDRs of the Fab antibodies Fab clone CDRs heavy chain CDRs light chain H9 GCTATGCTATCAGCTG AGGGCCAGTCAGAGTGTTAGCAGCA (SEQ ID NO: 27; CDR1) GCTACTTAGC GGGATCATCCCTATCTTTGGTACAGCAAAC (SEQ ID NO: 33; CDR1) TACGCACAGAAGTTCCAGGG GGTGCATCCAGCAGGGCCACT (SEQ ID NO: 28; CDR2) (SEQ ID NO: 34; CDR2) GGGGATCTGTATTACTATGATAGTAGTG AGCACTATAGCACCTCACCTGG GTTATCCGCGATACTACTTTGACTA GTTCACT (SEQ ID NO: 29; CDR3) (SEQ ID NO:35; CDR3) F5 AGCAGTAATTACTACTGGGGC ACCCGCAGCACTGGCAGCATTAC (SEQ ID NO: 39; CDR1) CAGCAACTATGTGCAC GCTATCTATTATAGTGGGAGCACCTACTAC (SEQ ID NO: 45; CDR1) AACCCGTCCCTCAAGAGT GAGGATAACGAAAGACCCTCT (SEQ ID NO: 40; CDR2) (SEQ ID NO: 46; CDR2) CGTATAGGAGTGGCTGGCCAATGGTATTTC CAGTCTTATGATGACAGCAATC GATCTCTGGGGCCGTGGCACCCTGGTCAC ATATTTCTGTC CGTCTCAAGC (SEQ ID NO: 47; CDR3) (SEQ ID NO: 41; CDR3) Table 4: CDRs (nucleic acid sequences) of the heavy and light chains of Fabs H9 and F5.

[0233] Production of the Recombinant, Soluble Fab Clones

[0234] The isolated Fab clones with specificity toward the HLA-A2/pp65 complex (H9, F5) were produced in a soluble form in E. coli BL21 cells. These Fabs which are tagged at the CH1 domain with a hexahistidine sequence, were purified from the periplasmic fraction by metal affinity chromatography. SDS-PAGE analysis revealed the level of purification and the expected molecular size of the Fab antibodies (FIG. 1b).

[0235] These data demonstrate the isolation of recombinant antibodies with peptide-specific, MHC restricted binding to the CMV-derived T cell epitope pp65.sub.495-503 (SEQ ID NO:3).

Example 2

Characterization of HLA-A21PP65-Specific TCR-Like Recombinant Antibodies

Experimental Results

[0236] HLA-A2/pp65-Specific TCR-Like Recombinant Antibodies Exhibit Binding Characteristics and Fine Specificity of a TCR-Like Molecule

[0237] The specificity of the two recombinant monoclonal Fab antibodies to the MHC-CMV peptide complex was tested by ELISA (FIGS. 1c and d). To determine the correct folding of the bound complexes and their stability during the binding assays, the ability of the complexes to react with the conformation-specific mAb, w6/32, that recognizes HLA complexes only when folded correctly and when containing peptide was monitored. As shown in FIGS. 1c and d, the soluble Fab Abs reacted only with the specific HLA-A2/pp65 complex but not with other control HLA-A2/peptide complexes containing viral epitopes derived from the TAX protein (e.g., TAX 11-19; SEQ ID NO:14), Gag (e.g., Gag 77-85; SEQ ID NO:9) or Pol (e.g., Pol 476-484; SEQ ID NO:10), or a variety of tumor-associated epitopes such as telomerase epitopes [e.g., hTERT 540 (SEQ ID NO:6) or hTERT 865 (SEQ ID NO:8)], melanoma gp100 epitopes [e.g., 209 (SEQ ID NO:7) or 280 (SEQ ID NO:4)], XAGE (SEQ ID NO:12), TARP (SEQ ID NO:13) and MART-1-derived epitopes (e.g., MART 26-35; SEQ ID NO:11) (Pascolo S., et al., 1997). Thus, these peptide-specific and MHC-restricted Fab antibodies exhibit the binding characteristics and fine specificity of a TCR-like molecule.

[0238] HLA-A2/pp65-Specific TCR-Like Recombinant Antibodies Specifically Bind MHC-Peptide Complexes Presented on Cells

[0239] To demonstrate that the isolated Fab antibodies can bind the specific MHC-peptide complex not only in the recombinant soluble form, but also in the native form, as expressed on the cell surface, the present inventors used murine TAP2 (transporter associated with antigen presentation)-deficient RMA-S cells transfected with the human HLA-A2 gene in a single-chain format (Pascolo S., et al., 1997) (HLA-A2.1/Db-.beta..sub.2m single chain, RMA-S--HHD cells). The pp65.sub.495-503 peptide and control peptides were loaded on RMA-S--HHD cells and the ability of the selected Fab Abs to bind to peptide-loaded cells was monitored by flow cytometry. Peptide-induced MHC stabilization of the TAP2 mutant RMA-S-HHD cells was demonstrated by the reactivity of mAbs w6/32 (HLA conformation dependent) and BB7.2 (HLA-A2 specific) with peptide-loaded, but not unloaded cells (data not shown). As shown in FIGS. 2b and d, Fabs H9 and F5 reacted only with pp65-loaded RMA-S-HHD cells, but not with cells loaded with the EBV derived peptide. Similar results were observed in FACS analysis using 10 other HLA-A2-restricted peptides (data not shown).

[0240] In addition, the present inventors used the TAP.sup.+ EBV-transformed B-lymphoblast HLA-A2.sup.+ JY cells as APCs. These cells have normal TAP; consequently, peptide loading is facilitated by the exchange of endogenously derived peptides with HLA-A2-restricted peptides supplied externally by incubation of the cells with the desired peptides. As shown in FIGS. 2a and c, the Fab antibodies recognize only JY cells loaded with the specific pp65 peptide to which they were selected, but not with control HLA-A2-restricted peptides derived from melanoma gp100 [G9-154 (SEQ ID NO:15) and G9-280 (SEQ ID NO:4) epitopes] and MART1 peptides (SEQ ID NO:11), or a telomerase human telomerase reverse transcriptase (hTERT)-derived peptide (T540 epitope; SEQ ID NO:6). As a control, peptide-loaded HLA-A2.sup.-/HLA-A1.sup.+ APD B cells were used. No binding of the Fab Abs to these cells was observed (data not shown). These results demonstrate the ability of the selected Fabs to detect specifically complexes of HLA-A2 in association with the pp65.sub.495-503 peptide (SEQ ID NO:3), on the surface of cells.

[0241] These results demonstrate the fine specificity of the recombinant Fab clones H9 and F5 to soluble or membrane-presented CMV-MHC class I complex.

Example 3

Generation of Multivalent Antibody Forms and their Binding to Peptide-Pulsed APCs

Experimental Results

[0242] Increased Avidity of Fab Tetramers to Peptide Pulsed APCs

[0243] Fab fragments isolated from the phage library are monovalent. To increase the avidity of these fragments, Fab tetramers were generated. This approach was previously used to increase the binding avidity of peptide-MHC complexes to the TCR or to increase the sensitivity of recombinant Ab molecules (Cloutier S M., et al., 2000). To form a Fab tetramer with H9, a BirA tag sequence for site-specific biotinylation was introduced at the C-terminus of the light chain. The Fab domains were expressed separately in E. coli and were refolded in vitro followed by purification and in vitro biotinylation using the E. coli-derived BirA enzyme (Cohen C J., et al., 2002). H9 Fab tetramers were generated with a fluorescently labeled streptavidin and their reactivity was examined by flow cytometry with JY pulsed cells. As shown in FIG. 3a the fluorescence intensity measured on peptide-pulsed JY cells with the H9 Fab tetramer was significantly higher compared to the reactivity of the H9 Fab monomer. The specificity, however, was not altered (FIG. 3c).

[0244] Increased Avidity of Whole IgG Antibodies to Peptide Pulsed APCs

[0245] Another strategy for increasing the avidity was by creating a whole IgG antibody molecule which is bivalent. To transform the recombinant Fab fragment into a whole IgG molecule, eukaryotic shuttle expression vectors containing the constant regions of IgG1 for the heavy chain and a vector containing the constant domain of a kappa light chain were used. Recombinant H9 Fab-derived IgG was produced from these expression vectors by co-transfection of the two constructs into human embryonic kidney HEK293 cells. After proper selection and generation of stable secreting clones, purified TCR-like whole IgG molecules were produced and tested for binding specifically towards APCs pulsed with the pp65495-503 peptide. As shown in FIG. 3b, the binding specificity of the whole IgG molecule was maintained. As expected, the fluorescence intensity observed with the IgG was significantly higher compared to that of the Fab monomer. JY cells pulsed with control peptide (derived from gp100) were incubated with the three H9 constructs (monomer, tetramer, whole IgG Ab) to confirm specificity (FIG. 3c).

[0246] These results demonstrate the generation of bivalent (IgG) or tetrameric Fab antibodies and the increased avidity, yet without compromising specificity of the recombinant antibodies to the CMV-MHC class I complex.

Example 4

The TCR-Like Antibodies of the Invention are Highly Specific and Sensitive to MHC-CMV Peptide Complexes

Experimental Results

[0247] Determination of Binding Affinity of the Recombinant TCR-Like Antibodies

[0248] Binding affinity determination of the H9 Ab was performed by surface plasmon resonance (SPR) analysis using streptavidin sensor chips coated with biotinylated HLA-A2/pp65 or control HLA-A2/EBV complexes. The apparent affinity of the monomeric/IgG forms of the H9 Ab indicated K.sub.D values of 8 nM and 5 nM, respectively. The time necessary for binding of the H9 Fab/IgG Ab to the specific complexes (K.sub.on) was 1.05.times.10.sup.5 l/Ms and 5.99.times.10.sup.5 l/Ms, respectively. The dissociation rate (Kd or K.sub.off) of the H9 Fab was 8.79.times.10.sup.4 l/s compared to the H9 IgG Ab, which was 3.52.times.10.sup.-3 l/s (FIGS. 4a, b). No significant binding of the antibodies was detected when control HLA-A2/EBV complexes were immobilized to the sensor chip (FIG. 4c).

[0249] The Recombinant TCR-Like Antibodies are Highly Specific to the MHC-pp65 Complex

[0250] To study the sensitivity of ligand recognition by the Fab and its derivatives the reactivity threshold was examined by peptide titration on JY cells which were pulsed with different concentrations of the pp65 495-503 peptide. As shown in FIGS. 5a and b, peptide titration of pulsed JY demonstrated that the staining intensity was dependent on the concentration of the peptide used for pulsing, and that peptide concentrations at the low nM range were sufficient for Fab tetramer (FIG. 5b) but not for the monomer (FIG. 5a). Thus, the tetrameric form of H9 Fab was able to detect much lower numbers of peptide/HLA-A2 complexes on the surface of peptide-pulsed JY cells than the monomer. Similar results were observed with the whole IgG molecule (data not shown). Overall, these and additional studies revealed that the H9 tetramer and IgG molecules are capable of detecting HLA-A2/pp65 complexes on cells pulsed with as low as .about.100 nM pp65.sub.495-503 peptide.

[0251] The Recombinant TCR-Like Antibodies can Detect Low Amounts of MHC-pp65 Complexes Presented on Cells in a Mixed Population of Cells

[0252] The TCR-like Fab were further used to detect APCs bearing the specific peptide-MHC complexes in a heterogeneous cell population. This can verify the ability of the TCR-like Fab molecules to detect complexes on individual cell samples in a mixed cell population. To simulate the situation of a heterogeneous population of cells in which only a small fraction might express the specific peptide-MHC complex, pp65 peptide pulsed JY cells were mixed with HLA-A2.sup.-/HLA-A1.sup.+ APD B cells at various ratios and the reactivity of H9 Fab was analyzed by flow cytometry. As shown in FIG. 5c, staining with H9 Fab tetramer allows accurate identification of the admixed pp65 JY pulsed cells that express on their surface HLA-A2/pp65 complexes, using a simple one-color flow cytometry analysis. Using various ratios of mixtures between pulsed and nonpulsed cells, the H9 Fab was shown capable of detecting as low as 5% pp65 JY pulsed cells within a background population of 95% nonpulsed cells (FIG. 5c).

[0253] Altogether, these results demonstrate detection of cell subpopulation bearing CMV peptide-MHC complexes.

Example 5

The TCR-Like Antibodies of the Invention can Detect HLA-A2/PP65 Complexes on Surface of Viral-Infected Cells

Experimental Results

[0254] Detection of HLA-A2/pp65 Complexes on the Surface of Virus-Infected Cells

[0255] To test the ability of the isolated Fab to bind specifically HLA-A2/pp65 complexes produced under naturally occurring physiological Antigen (Ag) processing, HLA-A2 positive fibroblasts were infected with the CMV laboratory strain AD169 at multiplicity of infection (MOI) of 0.5 (FIGS. 6a-l). HLA-A2 negative fibroblasts infected with the virus, were used as control in addition to uninfected HLA-A2 negative and positive cells. 72 hours after infection, infected and control cells were incubated with the tetrameric form of H9. To verify the expression of HLA-A2 molecules on the surface of infected, versus uninfected cells, the human fibroblasts were also stained with PE-labeled BB7.2. Confirmation for efficiency of virus infection was monitored with anti pp65 mAb and the secondary antibody FITC-labeled anti mouse IgG. As shown in FIGS. 6a and c, there was a somewhat decrease in the expression of HLA-A2 complexes on the surface of the virus infected cells, due to the virus well known down regulation mechanism of the MHC expression. However, despite the relatively low amount of HLA-A2 expressed on the cell surface, there was still specific staining of infected cells with the H9 tetramer (FIGS. 6e and g), suggesting that the isolated antibody was able to detect not only complexes presented on peptide pulsed APCs but also specific MHC-peptide complexes expressed after active and naturally occurring endogenous intracellular processing. The H9 Ab showed no binding at all in the control uninfected cells (FIGS. 6g and h) as well as in the HLA-A2 negative cells (FIG. 6f), indicating its fine specificity towards HLA-A2/pp65 complexes presented on the cell surface. Staining with the anti pp65 mAb revealed the expression of the pp65 protein after successful infection of the fibroblasts (FIGS. 6i and j).

[0256] The specificity of the H9 Ab was verified using a control TCR-like Ab (2F1) which recognizes specifically class I MHC complexes in association with the gp100 280-288 peptide. No staining was visible in this assay, confirming again the H9 tetramer's specificity (data not shown).

[0257] These results demonstrate, for the first time, the ability to follow the CMV-MHC class I complexes on the cells surface of APC as well as inside infected cells.

Example 6

The TCR-Like Antibodies of the Invention can Compete with CTLs on Specific HLA-A2/PP65 Sites and Thereby Prevent CTL-Mediated Cytotoxicity

Experimental Results

[0258] The H9 Ab can Prevent CTL-Mediated Cytotoxicity Directed Against the HLA-A2-pp65 Complex

[0259] The specificity of the H9 Ab to the MHC-pp65 495-503 complex presented on cells was further demonstrated by the specific inhibition of CTL-mediated cell killing by the H9 antibody. Briefly, fibroblast cells were radioactively labeled with S.sup.35-methionine before infection with the CMV virus and 72 hours later the cells were incubated with H9 Ab. CTLs from a line targeted to the pp65 (495-503) epitope were added at a target (i.e., fibroblast cells)-effector (i.e., CTL) ratio of 1:10 and incubated for five hours. Cells incubated with anti-HLA-A2 W6/32 MAb were used as positive control, while cells without any Ab incubation served as a reference for maximal killing. As shown in FIG. 6m, maximal percentage of killing was observed in the virus infected cells which were not incubated with Abs (CMV CTL alone). However, incubation with the H9 IgG Ab exhibited .about.60% blockage of killing by the CTLs (CMV CTL+H9).

[0260] The cytotoxicity assay demonstrated the capability of the isolated antibody to recognize specifically complexes presented on virus infected cells and its potential to compete with the same sites recognized by CTLs, leading to the blockage of killing by these effector cells.

Example 7

The TCR-Like Antibodies of the Invention are Valuable Tools for Following the Dynamics of HLA-A2/PP65 Expression in Cells Infected with the CMV Virus

Experimental Results

[0261] The Dynamics of HLA-A2/pp65 Complex Expression in Cells Infected with Wild-Type and Mutant Virus

[0262] The fact that the H9 Ab was able to detect specific complexes on virus infected cells enabled to follow the expression levels of the complexes throughout the virus infection cycle. Based on precedent results which showed down regulation of MHC class I expression after viral infection (Ahn, K. et al. 1996), the present inventors investigated whether the generation and presentation of HLA-A2/pp65 complexes throughout various time points after infection is influenced by the down regulation mechanism. To this end two strategies were employed; (i) the intracellular versus extracellular staining with H9 or anti-HLA-A2 BB7.2 Abs which enabled to determine if the level of the complexes generation/expression is correlated with their uptake to the cell surface; (ii) the usage of a mutant strain of CMV which does not induce down regulation of MHC class I. The level of expression of HLA-A2/pp65 complexes in cells infected with the wild type AD169 strain was compared to that in cells infected with the mutant strain. For this purpose, the genetically modified CMV strain RV798 (Jones T R and Sun L., 1997), which lacks most of the genes responsible for the down regulation mechanism of MHC class I (US2 to US11 genes), was employed.

[0263] As shown in FIGS. 7a-t, 8a-t and 9a-y, the general expression of HLA-A2 class I MHC was followed throughout four time points (36, 72, 96 and 120 hours) after cell infection with AD169 WT CMV strain (FIGS. 7a-t) and RV798 mutant CMV strain (FIGS. 8a-t), as well as the expression of specific HLA-A2 complexes in association with the pp65 495-503 peptide using the H9 IgG Ab. The infection efficiency was monitored by following the expression of the pp65 protein in infected cells through the use of an anti-pp65 MAb. Detection with H9 or BB7.2 Abs was performed in each time point by intracellular and extracellular staining. To verify the specificity of the reagents used for detection, especially the reactivity of the anti-HLA-A2/pp65 495-503 TCR-like antibody, controls which were uninfected HLA-A2 positive fibroblasts (FIGS. 9a-t) or CMV infected human fibroblasts that are HLA-A2 negative (FIGS. 9u-y) were used. The results show progressive expression of pp65 in cells infected with wild-type (FIGS. 7e, j, o, t) and mutant (FIGS. 8e, j, o, t) CMV strains while in non-infected cells (FIGS. 9e, j, o, t) no expression was observed. The expression of pp65 in cells that were infected with the mutant stain RV798 was somewhat higher. Staining with the anti pp65 Ab also indicated that the cells begin to express the pp65 protein less than 36 hours after infection (data not shown). These data are in agreement with previous studies (Soderberg-Naucler C., et al., 1998). Expression of HLA-A2 on the surface of cells infected with wild-type virus clearly showed a phenotype involving significant down regulation of HLA-A2 expression (FIGS. 7c, h, m and r) compared to the uninfected fibroblasts (FIGS. 9c, h, m, r). This down regulation is increased over time through the progression of the time points. Also, the intracellular expression of HLA-A2 in infected cells seemed to be higher than the amount in the uninfected cells (Compare FIGS. 7d, i, n and s to FIGS. 9d, i, n and s, respectively). These data are in agreement with previous studies (Ahn K., et al., 1996).

[0264] When cells were infected with wild-type virus, a specific and gradual increase in staining with the H9 IgG TCR-like antibody was observed indicating the generation of HLA-A2/pp65 495-503 complexes inside infected cells (FIGS. 7b, g, l and q) as well as their presentation on the cell surface (FIGS. 7a, f, k and p). However, although the amount of complexes which bear the pp65 495-503 peptide seemed to be quite low at the cell surface (e.g., compare FIG. 7f with 7g), intracellular staining of these specific complexes revealed a very significant large pool of complexes inside the cell. This might indicate that although the pp65 is well processed inside the cell and its peptides are deposited on the class I MHC, it is avoided from being displayed on the cell surface as part of the virus evasion mechanisms. Interestingly, there was no correlation between HLA-A2 down regulation as clearly observed through the progression of time and the significant increase in the intracellular pools of HLA-A2/pp65 495-503 complexes or their expression on the cell surface. Most striking is that after 120 hours the expression of HLA-A2 is very low however both intracellular pools are very high and surface expression is significant.

[0265] The Reactivity of the H9 IgG Molecule to the MHC-CMV pp65 Peptide Complex Both Inside and on the Surface of Cells is Highly Specific

[0266] Non-infected HLA-A2 positive cells were stained with anti-HLA-A2 antibody BB7.2 both inside (FIGS. 9d, i, n, s) and on the surface (FIGS. 9c, h, m, r). As shown, there were no observed alterations in HLA-A2 expression inside the cells as well as its presentation on the cell surface throughout the time points tested after infection. In contrary to the infected fibroblasts, the amount of complexes as determined using the BB7.2 antibody on the cell surface of non-infected cells seemed to be higher than their amount inside the cells (compare FIGS. 9c, h, m, r with FIGS. 9d, i, n, s, respectively). No pools of complexes were observed inside the cells (FIGS. 9d, i, n, s) as seen in the infected fibroblasts (FIGS. 7d, i, n, s). This implies that the HLA-A2 complexes expressed inside the uninfected cells are freely presented on the cell surface, in contrast to the infected cells (see FIGS. 7d, i, n, s). In contrast, the H9 TCR-like antibody was not reactive with uninfected cells both inside (FIGS. 9b, g, l, q) and on the cell surface (FIGS. 9a, f, k, p), indicating its fine specificity towards its antigen.

[0267] When HLA-A2 negative human fibroblasts were infected with wild-type CMV, pp65 expression was clearly observed (FIG. 9y), however, no reactivity with the anti-HLA-A2 antibody (FIGS. 9w, x) or the H9 TCR-like antibody (FIGS. 9u, v) was observed inside or on the surface of the infected cells indicating the highly specific reactivity of the molecules.

[0268] The presentation of HLA-A2/pp65 complexes was further examined both inside the cells and on their surface less than 24 hours after infection. These studies demonstrated that although pp65 is expressed, there is no presentation of its peptides on HLA-A2 molecules (Data not shown).

[0269] FIGS. 8a-t follow the dynamics of antigen presentation in the mutant strain RV798. The infected cells were efficiently infected with the virus as observed from the staining with anti-pp65 (FIGS. 8e, j, o, t). It was clearly observed that the effect of the mutant virus on HLA-A2 expression inside and on the surface of infected cells was diminished, thus the mutant virus no longer significantly down regulates HLA-A2 expression, as expected. When using the H9 IgG TCR-like antibody, similar to the results observed with wild-type CMV, a gradual increase over time of intracellular pools of HLA-A2/pp65 495-503 complexes inside infected cells was observed (FIGS. 8b, g, l, q) as well as their gradual appearance on the cell surface (FIGS. 8a, f, k, p). Also, it was quite evident that the number of HLA-A2/pp65 495-503 complexes inside the infected cells was higher than those on the cell surface (Compare FIGS. 8b, g, l, q to FIGS. 8a, f, k, p, respectively). This may indicate that although the mutant virus does not activate the down regulation mechanism, there are still HLA-A2 pools as well as specific HLA-A2/pp65 pools inside the cells, which are avoided from being presented on the cell surface.

[0270] In general, these results present the usage of the H9 Ab to follow the dynamic expression and kinetics of HLA-A2/pp65 495-503 presentation intracellularly and on the surface of infected cells as a function of time after viral infection. Most striking is the observation that there is no correlation between class I MHC down regulation induced by wild-type virus and the generation/presentation of the viral specific HLA-A2/pp65 495-503 complex. On the contrary, the down regulation did not affect the generation of a significant and large intracellular pool of viral complexes and their appearance over time on the cell surface. Similar studies using the H9 antibody and a mutant virus that abolishes class I MHC down regulation showed a similar pattern of expression inside the cell and on its surface with somewhat increased number of complexes on both compared to wild-type virus especially between 24-72 hours after infection.

Example 8

The TCR-Like Antibodies of the Invention can be Used to Quantify the Number of HLA-A2/PP65 Complexes on Viral Infected CELLS

[0271] The knowledge of the number of complexes presented on the cell surface can be used to understand how the immune system identifies viral infection. Related to the studies presented herein, the present inventors attempted to quantify and compare the number of complexes generated inside the infected cells to those presented on the cell surface, as follows.

Experimental Results

[0272] Quantization of the Number of HLA-A2/pp65 Complexes on the Surface of Infected Cells

[0273] The unique H9 IgG TCR-like antibody enables the present inventors to directly quantify the number and percentage of specific HLA-A2/pp65 complexes among HLA-A2-derived complexes which are displayed on the cell surface. Staining of virus infected cells with the H9 IgG TCR-like antibody enabled the present inventors to directly count the number of complexes on the surface of the infected cells using a PE-labeled anti kappa secondary monoclonal antibody that generates a 1:1 binding stoichiometry with the H9 IgG molecule. The level of fluorescence intensity resulting from specific reactivity of the H9 IgG antibody on infected cells can be directly correlated with the fluorescence intensities of calibration beads with known numbers PE molecules per bead (QuantiBRITE PE beads; BD Biosciences), using simple flow cytometry calibrations. This strategy enabled the present inventors to determine the number of PE molecules bound to the cells and thereby the number of sites which are bound by the H9 antibody.

[0274] In agreement to the results presented on FIGS. 7-9 (Example 7, hereinabove), there was an immediate and massive down regulation of HLA-A2 complexes (using the BB7 Ab) from the cell surface after infection with the CMV wild-type strain (FIG. 10d). In all time points there were about 5,000 complexes observed on the cell surface compared to .about.25,000 complexes in the uninfected cells, implying that there was over 85% decrease in the amount of HLA-A2 complexes presented on the cell surface (FIG. 10d). The number of HLA-A2 complexes inside the cells in infected vs uninfected cells remained almost the same (FIG. 10c). The number of HLA-A2/pp65 complexes presented on the cell surface was gradually increased over time (FIG. 10b). Specific complexes were observed using the H9 antibody starting at 36 hours after infection and the number reached to approximately 400 sites/cell 120 hours after infection (FIG. 10c). This implies that 120 hours after infection with the virus, about 10%-15% of the HLA-A2 complexes presented on the cell surfaces bear the pp65 495-503 peptide. Interestingly, the number of these specific complexes inside the cells reaches to .about.2000/cell after 120 hours (FIG. 10A). This number is close to the total number of HLA-A2 complexes inside the cell, suggesting that most of the HLA-A2 complexes which accumulate inside infected cells are

[0275] HLA-A2/pp65. This might also suggest that most of these specific complexes which are generated inside the cells are avoided from being presented on the surface.

[0276] Using the mutant virus, the same number of HLA-A2 molecules on the cell surface was observed as in the uninfected cells (FIG. 10d). The number of sites reached to approximately 20,000 (FIG. 10d). However, the number of complexes quantified inside the cells was significantly higher than the number observed in the uninfected cells, and approached to .about.10,000 (FIG. 10c) compared to .about.1,000 in the uninfected cells (FIG. 10c). As for HLA-A2/pp65 complexes, there were .about.400 sites detected on the cell surface (FIG. 10b), implying that similar to cells infected with wild-type virus most of viral HLA-A2/pp65 complexes are avoided from being transported to the cell surface. The percentage of these complexes amongst HLA-A2 complexes on the cell surface is very low. However, the number of HLA-A2/pp65 complexes inside the infected cells reached to approximately 3,000 (FIG. 10a) in each time point after 72 hours thus until 120 hours after infection there is an accumulation of the specific complexes inside the cell. This accumulation might lead to the observation that after this time point, most of the complexes inside the cell are composed of HLA-A2/pp65.

[0277] These data provide a quantitative measure to the observation that specific HLA-A2/pp65 complexes are being generated in large amounts and accumulated inside the infected cell in a mechanism that is independent to the overall down regulation of HLA-A2 molecules in these cells. The accumulation was observed with wild-type and mutant virus strains and for both the accumulated HLA-A2/pp65 complexes were avoided from being presented in large amounts on the cell surface.

[0278] These results visualize large intracellular pools of the viral complexes after infection, follow and quantify their expression on the surface. These results demonstrate that despite significant down regulation of MHC expression by wild-type virus large pools of specific viral complexes are generated intracellularly, and their export to the cell surface occurs in a limited quantity. These studies describe the first attempt to directly visualize and analyze the dynamics of a naturally occurring viral-derived human MHC-peptide complex after viral infection.

[0279] The data also demonstrate the ability of the TCR-like antibody of the instant application to detect and accurately quantify the number of HLA-A2/peptide complexes on the surface of infected cells under naturally occurring intracellular processing. These results can be used to follow the effectiveness of viral strategies for immunization.

Example 9

Visualization Through Confocal Microscopy Imaging of HLA-A2/PP65 Expression in Virus-Infected Cells

Experimental Results

[0280] Visualization Through Confocal Microscopy Imaging of HLA-A2/PP65 Expression in Virus-Infected Cells

[0281] Confocal microscopy of CMV infected cells stained with the H9 IgG TCR-like antibody enabled the present inventors to visualize and image the specific HLA-A2/pp65 complexes generated inside the cells, as well as their display on the cell surface. Moreover, it enabled the present inventors to localize the complexes inside the cell during the virus infection cycle.

[0282] CMV infected cells were harvested every 24 hours for 5 days. At each time point cells were stained with the H9 Ab, and anti human alexa fluor.sup.488 as a secondary Ab. The cells were also stained intracellularly with the H9 Ab, anti calnexin, cis Golgi matrix protein (GM130), and anti pp65 Ab, after fixation and permeabilization. Secondary antibody for the ER marker, Golgi marker and anti pp65 was anti mouse alexa fluor.sup.594. Noninfected fibroblast cells were used as a control.

[0283] The results of these assays further demonstrate and image the significant pool of specific HLA-A2/pp65 complexes generated inside infected cells (FIGS. 11a-o, 12a-o). The data also show that the specific complexes are densely colocalized with the cis-golgi apparatus (FIGS. 11a-o). This co-localization is observed clearly after 24 hours in comparison with the later time points, in which the complexes are more widely distributed and co-localized to the ER/cytosol as indicated by co-staining with the various localization markers (FIGS. 12a-o). Additionally, as time progresses, a significant enlargement of the Golgi apparatus is observed, as part of the morphological changes of the infected cells. Extracellular staining of the HLA-A2/pp65 complexes showed their display on the cell surface only after 72 hours post infection (FIGS. 13a-e). These results are with complete agreement with the flow cytometry analysis of the kinetic of HLA-A2/pp65 epitope presentation as shown in FIGS. 7a-t, 8a-t and 9a-y. Confocal microscopy analysis of control noninfected cells showed no staining with the H9 Ab (FIGS. 13f-h), indicating its fine specificity towards the HLA-A2/pp65 complexes. Staining with anti pp65 Ab confirmed the effectiveness of the viral infection in the experiments (FIGS. 13i-j).

[0284] These results visualize the present inventors' finding that specific HLA-A2/pp65 complexes are being generated and accumulate in infected cells and are localized in the Golgi compartment. They are prevented from being displayed on the cell surface at early time points and only 72 hours after infection they can be imaged on the cell surface. The fact that the specific complexes are prevented from being displayed on the cell surface is only temporary. Progressed time scales showed that the complexes are being significantly displayed on the cell surface. The intermediate time points clearly show that the complexes are less co-localized with the Golgi due to their movement to the cell membrane. The phenomena of Golgi enlargement is usually attributed to an extensive synthesis of proteins after viral infection. These results can imply that this enlargement is also due to the specific accumulation of complexes in the Golgi.

Example 10

CMV PP64 MHC Restricted Peptides

[0285] Tables 5-70 hereinbelow provide the user parameters and scoring information used to select CMV PP64 restricted peptides (each of 9 or 10 amino acids in length) of various HLA molecules. The analysis was performed using the Bimas software [hypertexttransferprotocol://worldwideweb-bimas (dot) cit (dot) nih (dot) gov/molbio/hla_bind/]. The scoring results and the sequences of the selected peptides (according to each user parameters and scoring information) are provided in Table 137 in Example 11, hereinbelow. The CMV PP64 kDa protein used for analysis is provided by SEQ ID NO:52 [(GenBank Accession No. P18139; PP65_HCMVT 64 kDa lower matrix phosphoprotein--Human cytomegalovirus (strain Towne) (HHV-5) (Human herpesvirus 5)].

TABLE-US-00005 TABLE 5 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A1 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported 15 back in scoring output table

TABLE-US-00006 TABLE 6 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A1 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported 20 back in scoring output table

TABLE-US-00007 TABLE 7 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0201 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 48 scoring output table

TABLE-US-00008 TABLE 8 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0201 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 53 scoring output table

TABLE-US-00009 TABLE 9 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0205 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 50 scoring output table

TABLE-US-00010 TABLE 10 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0205 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 47 scoring output table

TABLE-US-00011 TABLE 11 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A24 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 61 scoring output table

TABLE-US-00012 TABLE 12 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A24 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 76 scoring output table

TABLE-US-00013 TABLE 13 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A3 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 23 scoring output table

TABLE-US-00014 TABLE 14 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A3 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 21 scoring output table

TABLE-US-00015 TABLE 15 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A68.1 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 79 scoring output table

TABLE-US-00016 TABLE 16 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A68.1 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 77 scoring output table

TABLE-US-00017 TABLE 17 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_1101 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 5 scoring output table

TABLE-US-00018 TABLE 18 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_1101 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 4 scoring output table

TABLE-US-00019 TABLE 19 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3101 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 10 scoring output table

TABLE-US-00020 TABLE 20 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3101 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 17 scoring output table

TABLE-US-00021 TABLE 21 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3302 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 39 scoring output table

TABLE-US-00022 TABLE 22 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3302 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 34 scoring output table

TABLE-US-00023 TABLE 23 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B14 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 61 scoring output table

TABLE-US-00024 TABLE 24 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B14 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 60 scoring output table

TABLE-US-00025 TABLE 25 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B40 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 36 scoring output table

TABLE-US-00026 TABLE 26 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B40 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 42 scoring output table

TABLE-US-00027 TABLE 27 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B60 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 41 scoring output table

TABLE-US-00028 TABLE 28 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B60 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 49 scoring output table

TABLE-US-00029 TABLE 29 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B61 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 44 scoring output table

TABLE-US-00030 TABLE 30 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B61 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 45 scoring output table

TABLE-US-00031 TABLE 31 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B62 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 57 scoring output table

TABLE-US-00032 TABLE 32 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B62 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 54 scoring output table

TABLE-US-00033 TABLE 33 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B7 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 55 scoring output table

TABLE-US-00034 TABLE 34 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B7 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 62 scoring output table

TABLE-US-00035 TABLE 35 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B8 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 12 scoring output table

TABLE-US-00036 TABLE 36 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B8 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 14 scoring output table

TABLE-US-00037 TABLE 37 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2702 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 71 scoring output table

TABLE-US-00038 TABLE 38 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2702 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 72 scoring output table

TABLE-US-00039 TABLE 39 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2705 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 276 scoring output table

TABLE-US-00040 TABLE 40 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2705 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 283 scoring output table

TABLE-US-00041 TABLE 41 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3501 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 72 scoring output table

TABLE-US-00042 TABLE 42 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3501 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 81 scoring output table

TABLE-US-00043 TABLE 43 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3701 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 90 scoring output table

TABLE-US-00044 TABLE 44 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3701 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 100 scoring output table

TABLE-US-00045 TABLE 45 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3801 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 50 scoring output table

TABLE-US-00046 TABLE 46 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3801 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 59 scoring output table

TABLE-US-00047 TABLE 47 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3901 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 100 scoring output table

TABLE-US-00048 TABLE 48 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3901 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 102 scoring output table

TABLE-US-00049 TABLE 49 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3902 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 61 scoring output table

TABLE-US-00050 TABLE 50 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3902 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 69 scoring output table

TABLE-US-00051 TABLE 51 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_4403 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 47 scoring output table

TABLE-US-00052 TABLE 52 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_4403 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 56 scoring output table

TABLE-US-00053 TABLE 53 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5101 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 139 scoring output table

TABLE-US-00054 TABLE 54 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5101 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 127 scoring output table

TABLE-US-00055 TABLE 55 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5102 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 149 scoring output table

TABLE-US-00056 TABLE 56 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5102 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 140 scoring output table

TABLE-US-00057 TABLE 57 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5103 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in scoring output table 89

TABLE-US-00058 TABLE 58 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5103 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 86 scoring output table

TABLE-US-00059 TABLE 59 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5201 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 111 scoring output table

TABLE-US-00060 TABLE 60 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5201 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported back in 120 scoring output table

TABLE-US-00061 TABLE 61 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5801 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back in 55 scoring output table

TABLE-US-00062 TABLE 62 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5801 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported 50 back in scoring output table

TABLE-US-00063 TABLE 63 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0301 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported back 99 in scoring output table

TABLE-US-00064 TABLE 64 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0301 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported 91 back in scoring output table

TABLE-US-00065 TABLE 65 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0401 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported 88 back in scoring output table

TABLE-US-00066 TABLE 66 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0401 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported 96 back in scoring output table

TABLE-US-00067 TABLE 67 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0602 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported 115 back in scoring output table

TABLE-US-00068 TABLE 68 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0602 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported 117 back in scoring output table

TABLE-US-00069 TABLE 69 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0702 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 543 number of top-scoring subsequences reported 61 back in scoring output table

TABLE-US-00070 TABLE 70 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0702 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 551 number of subsequence scores calculated 542 number of top-scoring subsequences reported 73 back in scoring output table

Example 11

CMV PP65 MHC Restricted Peptides

[0286] Tables 71-136 hereinbelow provide the user parameters and scoring information used to select CMV PP65 restricted peptides (each of 9 or 10 amino acids in length) of various HLA molecules. The analysis was performed using the Bimas software [hypertexttransferprotocol://worldwideweb-bimas (dot) cit (dot) nih (dot) gov/molbio/hla_bind/]. The scoring results and the sequences of the selected peptides (according to each user parameters and scoring information) are provided in Table 137, hereinbelow. The CMV PP65 kDa protein used for analysis is provided by SEQ ID NO:53 [GenBank Accession No. P06725; PP65_HCMVA 65 kDa lower matrix phosphoprotein--Human cytomegalovirus (strain AD169) (HHV-5) (Human herpesvirus 5)].

TABLE-US-00071 TABLE 71 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A1 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 15 back in scoring output table

TABLE-US-00072 TABLE 72 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A1 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 20 back in scoring output table

TABLE-US-00073 TABLE 73 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0201 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 48 back in scoring output table

TABLE-US-00074 TABLE 74 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0201 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 53 back in scoring output table

TABLE-US-00075 TABLE 75 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0205 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 51 back in scoring output table

TABLE-US-00076 TABLE 76 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_0205 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 47 back in scoring output table

TABLE-US-00077 TABLE 77 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A24 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 64 scoring output table

TABLE-US-00078 TABLE 78 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A24 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 76 back in scoring output table

TABLE-US-00079 TABLE 79 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A3 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 23 back in scoring output table

TABLE-US-00080 TABLE 80 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A3 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 21 back in scoring output table

TABLE-US-00081 TABLE 81 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A68.1 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 79 back in scoring output table

TABLE-US-00082 TABLE 82 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A68.1 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 77 back in scoring output table

TABLE-US-00083 TABLE 83 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_1101 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 5 back in scoring output table

TABLE-US-00084 TABLE 84 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_1101 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 4 back in scoring output table

TABLE-US-00085 TABLE 85 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3101 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 10 back in scoring output table

TABLE-US-00086 TABLE 86 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3101 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 17 back in scoring output table

TABLE-US-00087 TABLE 87 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3302 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 40 back in scoring output table

TABLE-US-00088 TABLE 88 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected A_3302 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 36 back in scoring output table

TABLE-US-00089 TABLE 89 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B14 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 65 back in scoring output table

TABLE-US-00090 TABLE 90 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B14 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported 63 back in scoring output table

TABLE-US-00091 TABLE 91 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B40 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported 35 back in scoring output table

TABLE-US-00092 TABLE 92 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B40 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 42 reported back in scoring output table

TABLE-US-00093 TABLE 93 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B60 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 42 reported back in scoring output table

TABLE-US-00094 TABLE 94 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B60 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 50 reported back in scoring output table

TABLE-US-00095 TABLE 95 User Parameters and Scoring Information User Parameters and Scoring Information method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B61 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 44 reported back in scoring output table

TABLE-US-00096 TABLE 96 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B61 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 46 reported back in scoring output table

TABLE-US-00097 TABLE 97 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B62 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 57 reported back in scoring output table

TABLE-US-00098 TABLE 98 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B62 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 54 reported back in scoring output table

TABLE-US-00099 TABLE 99 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B7 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 57 reported back in scoring output table

TABLE-US-00100 TABLE 100 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B7 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 63 reported back in scoring output table

TABLE-US-00101 TABLE 101 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B8 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 12 reported back in scoring output table

TABLE-US-00102 TABLE 102 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B8 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 15 reported back in scoring output table

TABLE-US-00103 TABLE 103 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2702 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 74 reported back in scoring output table

TABLE-US-00104 TABLE 104 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2702 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 74 reported back in scoring output table

TABLE-US-00105 TABLE 105 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2705 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences 282 reported back in scoring output table

TABLE-US-00106 TABLE 106 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_2705 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences 287 reported back in scoring output table

TABLE-US-00107 TABLE 107 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3501 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 74 scoring output table

TABLE-US-00108 TABLE 108 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3501 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back 82 in scoring output table

TABLE-US-00109 TABLE 109 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3701 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back 93 in scoring output table

TABLE-US-00110 TABLE 110 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3701 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back 103 in scoring output table

TABLE-US-00111 TABLE 111 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3801 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 51 scoring output table

TABLE-US-00112 TABLE 112 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3801 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 59 scoring output table

TABLE-US-00113 TABLE 113 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3901 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 104 scoring output table

TABLE-US-00114 TABLE 114 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3901 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 105 scoring output table

TABLE-US-00115 TABLE 115 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3902 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 63 scoring output table

TABLE-US-00116 TABLE 116 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_3902 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 70 scoring output table

TABLE-US-00117 TABLE 117 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_4403 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 47 scoring output table

TABLE-US-00118 TABLE 118 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_4403 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 57 scoring output table

TABLE-US-00119 TABLE 119 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5101 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 141 scoring output table

TABLE-US-00120 TABLE 120 method selected to limit number of results cutoff score 1 HLA molecule type selected B_5101 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 128 scoring output table

TABLE-US-00121 TABLE 121 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5102 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 151 scoring output table

TABLE-US-00122 TABLE 122 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5102 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 140 scoring output table

TABLE-US-00123 TABLE 123 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5103 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 90 scoring output table

TABLE-US-00124 TABLE 124 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5103 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 86 scoring output table

TABLE-US-00125 TABLE 125 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5201 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 114 scoring output table

TABLE-US-00126 TABLE 126 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5201 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 120 scoring output table

TABLE-US-00127 TABLE 127 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5801 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 55 scoring output table

TABLE-US-00128 TABLE 128 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected B_5801 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 49 scoring output table

TABLE-US-00129 TABLE 129 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0301 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 103 scoring output table

TABLE-US-00130 TABLE 130 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0301 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 93 scoring output table

TABLE-US-00131 TABLE 131 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0401 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 90 scoring output table

TABLE-US-00132 TABLE 132 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0401 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 98 scoring output table

TABLE-US-00133 TABLE 133 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0602 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 119 scoring output table

TABLE-US-00134 TABLE 134 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0602 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 120 scoring output table

TABLE-US-00135 TABLE 135 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0702 length selected for subsequences to be scored 9 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 553 number of top-scoring subsequences reported back in 62 scoring output table

TABLE-US-00136 TABLE 136 method selected to limit number of results cutoff score cutoff score selected 1 HLA molecule type selected Cw_0702 length selected for subsequences to be scored 10 echoing mode selected for input sequence Y echoing format numbered lines length of user's input peptide sequence 561 number of subsequence scores calculated 552 number of top-scoring subsequences reported back in 74 scoring output table

[0287] Table 137 hereinbelow, depicts subsequence residue listing (Sequence), SEQ ID NO: and scoring results [Rank and Score (the estimate of half time of disassociation of a molecule containing this subsequence)] obtained according to the user parameters and scoring information summarized in Tables 5-136, hereinabove, for HLA restricted peptides derived from the CMV pp65 (SEQ ID NO:53) or pp64 (SEQ ID NO:52) polypeptides. For each row, a reference to the relevant "user parameters and scoring information Table" is made by indicating the "Table No." on the last column

TABLE-US-00137 Lengthy table referenced here US20140363440A1-20141211-T00001 Please refer to the end of the specification for access instructions.

Example 12

Detection of HLA-A2/PP65 Complexes on the Surface of Virus-Infected Cells of Patients

[0288] The ability of the H9 Ab to detect HLA-A2/pp65 complexes was further evaluated in heterogeneous population of cells taken from CMV infected individuals. Briefly, samples were taken from bone marrow transplanted (BMT) patients whom are under reactivation of CMV infection due to immuno-suppression. Healthy donors were used as a control to verify the H9 Fab specificity.

Experimental Results

[0289] Peripheral blood mononuclear cells (PBMCs) were isolated from samples taken from BMT patients and healthy donors. The isolated cells were stained with the H9 Ab and the secondary anti human alexa fluor.sup.488 Ab. For intracellular staining with the H9 Ab, the cells were permeabilized as described under "General Materials and Experimental Methods".

[0290] Both healthy donors and BMT patients were HLA-A2+ (i.e., express the HLA-A2 allele) as detected by the anti HLA-A2 Ab (BB7.2) and anti mouse alexa fluor.sup.488 Abs (FIG. 16a and data not shown). Extracellular staining with the H9 Ab did not detect complexes of the HLA-A2/pp65 on the surface of infected cells taken from BMT patients or healthy controls (FIG. 16b and data not shown). However, as shown in FIGS. 16c and d, intracellular staining with the H9 Ab demonstrated a significant binding of the antibody to the infected cells from BMT patients (FIG. 16c) as compared to the control cells taken from healthy donors (FIG. 16d). These results confirm the ability of the isolated H9 Ab to detect specific HLA-A2/pp65 complexes not only after directed infection with laboratory strain of the CMV, but also complexes derived from cells undergoing reactivation of the virus e.g., due to immuno-suppression.

Example 13

Proteasome Inhibitor Effect on HLA-A2/PP65 Complexes in Virus Infected Cells

Experimental Results

[0291] The Release of Complexes Accumulation from their Intracellular Location to the Cell Surface by Proteasome Inhibitor

[0292] The proteasome inhibitor acetyl-leucyl-leucyl-norleucinal (ALLN; available from CALBIOCHEM Cat. No. 208750) was used in order to understand the mechanism by which complexes are prevented from reaching the cell membrane. The effect of the proteasome inhibitor was examined by FACS analysis, while treating the infected cells with ALLN at three time scales after infection. At each time scale, the cells were extracellularly stained with the H9 Ab and anti human alexa-flour.sup.488 as a secondary Ab. As shown in FIGS. 17a-i there was a significant effect of the inhibitor on the presentation of the complexes on the cell surface. Presence of the inhibitor at each time scale caused an increased presentation of the complexes on the cell surface compared to untreated cells. The effect of the increased presentation was more significant at the lower time scales, and seamed to reach a steady state at 96 hours post infection. Control uninfected cells showed no staining with the H9 Ab. Thus, incubation with the proteasome inhibitor ALLN increased presentation of the MHC/pp65 complexes on the cell surface.

SUMMARY

[0293] In this study, the present inventors have demonstrated the selection of recombinant Fab Abs directed against a human viral T cell epitope derived from CMV, from a large nonimmune human Ab phage library. These Abs exhibit an exquisite, very specific, and special binding pattern: they can bind in a peptide-specific manner only to HLA-A2/pp65 complexes; hence, these are recombinant Abs with T cell Ag receptor-like specificity. In contrast to the inherent low affinity of TCRs, these molecules display the high affinity binding characteristics of Abs, in the nM range, while retaining TCR specificity. The present inventors have demonstrated here the ability of these Abs to bind specifically to recombinant class I peptide-MHC complexes, as well as to complexes presented on the surface of peptide pulsed APCs.

[0294] An important feature of the TCR-like Fab Abs isolated in this study is their capability to detect TCR ligands at cell surface densities close to the threshold limit for T cell recognition. The H9 HLA-A2/pp65-specific TCR-like Fab Ab was able to detect in a reproducible manner as low as 100 sites/cell. Using flow cytometry, it was possible to use the H9 Fab Ab to detect the specific ligand on cells pulsed with peptide concentrations similar to those required to activate T cell hybridoma or CTL lines to cytokine secretion and within a few fold of the minimal concentration able to sensitize target cells for lysis in a short-term assay (Porgador A., et al., 1997).

[0295] These data indicate that when applied to dissociated cell populations using flow cytometry, the detection of ligand with H9 and other TCR-like Fabs with similar affinity approaches the sensitivity of T cells, and hence that these molecules are suitable reagents for evaluating antigenic complex expression at low, but physiologically relevant levels. In this study, the detection sensitivity of specific ligand was observed with as low as 100 complexes per cell. Thus, this principle has been applied in this study to mixtures of peptide pulsed HLA-A2+ JY cells, and the HLA-A2- B cell line APD. By using the H9 tetramer in a single-step staining for flow cytometry, it was possible to readily identify pp65 495-503 peptide pulsed JY cells admixed with APD cells in as low proportion as 5%.

[0296] The avidity of the TCR-like Ab molecules was improved by making the recombinant monovalent molecules into multivalent molecules. This was feasible by altering the basic Fab form to a tetrameric molecule or to a whole bivalent IgG Ab.

[0297] Detection of class I MHC complexes in association with the pp65 495-503 peptide on virus infected cells, showed the ability of the H9 Ab to recognize complexes not only on the surface of peptide pulsed APCs, but also complexes which were produced by naturally occurring active antigen processing. Cytotoxicity assays directed to virus infected cells confirmed these findings. The blockage of killing by the CTLs after incubation with the H9 Ab showed a competition between the cytotoxic T-cell receptor and the H9 TCR-like Ab on the same site presented on the virus infected cell.

[0298] Using the H9 Ab at various time points following infection the present inventors could track the presentation level of HLA-A2/pp65 complexes during the course of virus infection cycle. Specific staining with the H9 Ab lead to the observation that the expression level of the specific HLA-A2/pp65 complexes on the cell surface does not represent the overall quantity of these specific complexes, because as shown most of them are located inside the cell. The results presented herein demonstrate the existence of a significant large pool of specific HLA-A2/pp65 complexes inside virus infected cells, which increased as a function of time after viral infection. The use of a CMV mutant strain which lacks the genes responsible for MHC class I down regulation revealed similar findings. Large pools of specific complexes, bearing the pp65 495-503 peptide, were found inside the cells. In contrast to the uninfected cells, there is a large amount of MHC class I complexes inside the cells which are infected with the wild-type/mutant strain.

[0299] The results of the kinetic assays also clearly show that there is a great correlation between the pp65 expression level and its presentation level. Both increase as time goes by. Moreover, the timing of the pp65 expression might precede the processing and presentation of this protein, as presented in the results.

[0300] This work provides also quantitative data about the number of specific HLA-A2/pp65 complexes generated inside infected cells as well as presented on the cell surface after active intracellular processing by virus infected cells. The results revealed for the first time the number of sites which are presented on the cell surface and recognized by the immune system. Moreover, quantization of general HLA-A2 complexes enabled the present inventors to determine the percentage of complexes down regulated after viral infection. It also enabled the present inventors to compare between the number of general complexes and the number of specific HLA-A2/pp65 complexes inside the cells and on their surface. This analysis enables the determination of the percentage of the specific complexes among the general complexes. The results indicated quantitatively that most of the complexes inside the virus infected cells are bearing the pp65 495-503 peptide. Large numbers of specific complexes were also found in the cells infected with the mutant strain, strengthening the previous data, regarding the pools which are prevented from being translocated to the membrane.

[0301] Confocal immunofluorescence microscopy enabled for the first time direct visualization of the intracellular and extracellular sites of peptide-MHC molecules throughout virus infection cycle, as well as determination of their localization inside the cell. This visualization revealed the colocalization of the HLA-A2/pp65 complexes with the cis-golgi apparatus. It also showed the exact movement of the complexes from this location to the cell surface, in correlation to the virus infection kinetics. At the progressed time scales there was a significant display of the complexes on the cell surface.

[0302] The study presented here shows the usage of an isolated human recombinant Ab towards a specific viral peptide-MHC class I in the following: (i) tracking the level of specific complexes throughout time scale which represents a viral infection cycle; (ii) tracking the number of complexes throughout time scale inside the cell and on its surface and analysis of this data; (iii) visualization of complexes in a viral infection system which demonstrate the intracellular localization of the complexes throughout time scale, and; (iv) detection of the correlation between protein expression and its derived peptide presentation on HLA-A2 complexes after processing.

[0303] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0304] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.

REFERENCES

Additional References are Cited in Text

[0305] 1. Ahn, K. et al. Human cytomegalovirus inhibits antigen presentation by a sequential multistep process Proc. Natl. Acad. Sci. U.S.A 93, 10990-10995 (1996). [0306] 2. Allart S, et al., 2003; Invest Ophthalmol V is Sci. 44: 665-71 [0307] 3. Altman, J. D. et al. Phenotypic analysis of antigen-specific T lymphocytes. Science 274, 94-96 (1996). [0308] 4. Chee, M. S. et al. Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top. Microbiol. Immunol. 154, 125-169 (1990). [0309] 5. Cohen, C. J. et al. Direct detection and quantitation of a distinct T-cell epitope derived from tumor-specific epithelial cell-associated mucin using human recombinant antibodies endowed with the antigen-specific, major histocompatibility complex-restricted specificity of T cells Cancer Res. 62, 5835-5844 (2002). [0310] 6. Cloutier, S. M. et al. Streptabody, a high avidity molecule made by tetramerization of in vivo biotinylated, phage display-selected scFv fragments on streptavidin. Mol. Immunol. 37, 1067-1077 (2000). [0311] 7. De Haard, H. J. et al. A large non-immunized human Fab fragment phage library that permits rapid isolation and kinetic analysis of high affinity antibodies. J. Biol. Chem. 274, 18218-18230 (1999). [0312] 8. Denkberg, G., Cohen, C. J., Segal, D., Kirkin, A. F. & Reiter, Y. Recombinant human single-chain MHC-peptide complexes made from E. coli By in vitro refolding: functional single-chain MHC-peptide complexes and tetramers with tumor associated antigens. Eur. J. Immunol. 30, 3522-3532 (2000). [0313] 9. Denkberg, G., Cohen, C. J. & Reiter, Y. Critical role for CD8 in binding of MHC tetramers to TCR: CD8 antibodies block specific binding of human tumor-specific MHC-peptide tetramers to TCR. J. Immunol. 167, 270-276 (2001). [0314] 10. Denkberg, G. et al. Direct visualization of distinct T cell epitopes derived from a melanoma tumor-associated antigen by using human recombinant antibodies with MHC-restricted T cell receptor-like specificity. Proc. Natl. Acad. Sci. U.S.A 99, 9421-9426 (2002). [0315] 11. Jones, T. R. & Sun, L. Human cytomegalovirus US2 destabilizes major histocompatibility complex class I heavy chains J. Virol. 71, 2970-2979 (1997). [0316] 12. Lee, P. P. et al. Characterization of circulating T cells specific for tumor-associated antigens in melanoma patients. Nat Med 5, 677-685 (1999). [0317] 13. Lev, A. et al. Isolation and characterization of human recombinant antibodies endowed with the antigen-specific, major histocompatibility complex-restricted specificity of T cells directed toward the widely expressed tumor T-cell epitopes of the telomerase catalytic subunit. Cancer Res. 62, 3184-3194 (2002). [0318] 14. Pascolo, S. et al. HLA-A2.1-restricted education and cytolytic activity of CD8(+) T lymphocytes from beta2 microglobulin (beta2m) HLA-A2.1 monochain transgenic H-2Db beta2m double knockout mice. J. Exp. Med. 185, 2043-2051 (1997). [0319] 15. Porgador, A., Yewdell, J. W., Deng, Y. P., Bennink, J. R. & Germain, R. N. Localization, quantitation, and in situ detection of specific peptide MHC class I complexes using a monoclonal antibody. Immunity 6, 715-726 (1997). [0320] 16. Soderberg-Naucler, C., Fish, K. N. & Nelson, J. A. Growth of human cytomegalovirus in primary macrophages. Methods 16, 126-+(1998).

TABLE-US-LTS-00001 [0320] LENGTHY TABLES The patent application contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140363440A1). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

Sequence CWU 1

1

904123DNAArtificial sequenceSingle strand DNA oligonucleotide 1agcggataac aatttcacac agg 23224DNAArtificial sequenceSingle strand DNA oligonucleotide 2tttgtcgtct ttccagacgt tagt 2439PRTArtificial sequenceCMV pp65 (495-503) HLA-A2 restricted peptide 3Asn Leu Val Pro Met Val Ala Thr Val 1 5 49PRTArtificial sequencegp100 (280-288) derived HLA control peptide 4Tyr Leu Glu Pro Gly Pro Val Thr Ala 1 5 59PRTArtificial sequenceEBV (280-288) derived HLA control peptide 5Gly Leu Cys Thr Leu Val Ala Met Leu 1 5 69PRTArtificial sequencehTERT (540-548) derived HLA control peptide 6Ile Leu Ala Lys Phe Leu His Trp Leu 1 5 79PRTArtificial sequencemelanoma gp100 (209-217) derived HLA control peptide 7Ile Met Asp Gln Val Pro Phe Ser Val 1 5 89PRTArtificial sequencehTERT (865-873) derived HLA control peptide 8Arg Leu Val Asp Asp Phe Leu Leu Val 1 5 99PRTArtificial sequenceGag (77-85) derived HLA control peptide 9Ser Leu Tyr Asn Thr Val Ala Thr Leu 1 5 108PRTArtificial sequencePol (476-484) derived HLA control peptide 10Ile Leu Glu Pro Val His Gly Val 1 5 1110PRTArtificial sequenceMART-1 (26-35) derived HLA control peptide 11Glu Leu Ala Gly Ile Gly Ile Leu Thr Val 1 5 10 1210PRTArtificial sequenceXAGE derived HLA control peptide 12Gly Val Phe Pro Ser Ala Pro Ser Pro Val 1 5 10 139PRTArtificial sequenceTARP (29-37) derived HLA control peptide 13Phe Leu Arg Asn Phe Ser Leu Met Leu 1 5 149PRTArtificial sequenceTAX (11-19) derived HLA control peptide 14Leu Leu Phe Gly Tyr Pro Val Tyr Val 1 5 159PRTArtificial sequenceMelanoma gp100 (154-162) derived HLA control peptide 15Lys Thr Trp Gly Gln Tyr Trp Gln Val 1 5 16230PRTArtificial sequenceH9 Fab heavy chain polypeptide sequence 16Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30 Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Asp Leu Tyr Tyr Tyr Asp Ser Ser Gly Tyr Pro Arg Tyr 100 105 110 Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala 115 120 125 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser 130 135 140 Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe 145 150 155 160 Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly 165 170 175 Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu 180 185 190 Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr 195 200 205 Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys 210 215 220 Val Glu Pro Lys Ser Cys 225 230 17690DNAArtificial sequenceH9 Fab heavy chain coding sequence 17gaagtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac agcaaactac 180gcacagaagt tccagggcag agtcacgatt accgcggacg aatccacgag cacagcctac 240atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaggggat 300ctgtattact atgatagtag tggttatccg cgatactact ttgactactg gggccagggc 360accctggtca ccgtctcaag cgcctccacc aagggcccat cggtcttccc cctggcaccc 420tcctccaaga gcacctctgg gggcacagcg gccctgggct gcctggtcaa ggactacttc 480cccgaaccgg tgacggtgtc gtggaactca ggcgccctga ccagcggcgt ccacaccttc 540ccggctgtcc tacagtcctc aggactctac tccctcagca gcgtagtgac cgtgccctcc 600agcagcttgg gcacccagac ctacatctgc aacgtgaatc acaagcccag caacaccaag 660gtggacaaga aagttgagcc caaatcttgt 69018197PRTArtificial sequenceH9 Fab light chain polypeptide sequence 18Leu Glu Thr Thr Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro 1 5 10 15 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser 20 25 30 Ser Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu 35 40 45 Val Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe 50 55 60 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu 65 70 75 80 Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Tyr Ser Thr Ser 85 90 95 Pro Gly Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Arg Arg Thr 100 105 110 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 115 120 125 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 130 135 140 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 145 150 155 160 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 165 170 175 Ser Leu Ser Ser His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe 180 185 190 Asn Arg Gly Glu Cys 195 19597DNAArtificial sequenceH9 Fab light chain coding sequence 19cttgaaacga cactcacgca gtctccaggc accctgtctt tgtctccagg ggaaagagcc 60accctctcct gcagggccag tcagagtgtt agcagcagct acttagcctg gtaccagcag 120aaacctggcc aggctcccag gctcgtcatc tatggtgcat ccagcagggc cactggcatc 180ccagacaggt tcagtggcag tgggtctggg acagacttca ctctcaccat cagcagactg 240gagcctgaag attttgcagt ttattactgt cagcactata gcacctcacc tgggttcact 300tttggccagg ggaccaagct ggagatcaga cgaactgtgg ctgcaccatc tgtcttcatc 360ttcccgccat ctgatgagca gttgaaatct ggaactgcct ctgttgtgtg cctgctgaat 420aacttctatc ccagagaggc caaagtacag tggaaggtgg ataacgccct ccaatcgggt 480aactcccagg agagtgtcac agagcaggac agcaaggaca gcacctacag cctcagcagc 540catcagggcc tgagctcgcc cgtcacaaag agcttcaaca ggggagagtg ttaataa 59720225PRTArtificial sequenceF5 Fab heavy chain polypeptide sequence 20Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30 Asn Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Ala Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Ala Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg Arg Ile Gly Val Ala Gly Gln Trp Tyr Phe Asp Leu Trp 100 105 110 Gly Arg Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125 Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 130 135 140 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 145 150 155 160 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 165 170 175 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 180 185 190 Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 195 200 205 His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser 210 215 220 Cys 225 21675DNAArtificial sequenceF5 Fab heavy chain coding sequence 21caggtgcagc tgcaggagtc cggcccagga ctggtgaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc agcagtaatt actactgggg ctggatccgc 120cagcccccag ggaaggggct ggagtggatt ggtgctatct attatagtgg gagcacctac 180tacaacccgt ccctcaagag tcgagtcgcc atatccgtag acacgtccaa gaaccagttc 240tcgctgaagt tgagttctgt gaccgccgca gacacggctg tctattactg tgcgagacgt 300ataggagtgg ctggccaatg gtatttcgat ctctggggcc gtggcaccct ggtcaccgtc 360tcaagcgcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc 420tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 480gtgtcgtgga actcaggcgc cctgaccagc ggcgtccaca ccttcccggc tgtcctacag 540tcctcaggac tctactccct cagcagcgta gtgaccgtgc cctccagcag cttgggcacc 600cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagaaagtt 660gagcccaaat cttgt 67522199PRTArtificial sequenceF5 Fab light chain polypeptide sequence 22Leu Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Gly Ser Pro Gly 1 5 10 15 Lys Thr Val Thr Ile Ser Cys Thr Arg Ser Thr Gly Ser Ile Thr Ser 20 25 30 Asn Tyr Val His Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr 35 40 45 Val Ile Cys Glu Asp Asn Glu Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Ile Asp Ile Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser 65 70 75 80 Gly Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp 85 90 95 Asp Ser Asn His Ile Ser Val Phe Gly Thr Gly Thr Lys Val Thr Val 100 105 110 Leu Gly Gln Pro Lys Ala Asn Pro Cys Leu Ile Ser Asp Phe Tyr Pro 115 120 125 Gly Ala Val Thr Val Ala Trp Lys Ala Asp Gly Ser Pro Val Lys Ala 130 135 140 Gly Val Glu Thr Thr Lys Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala 145 150 155 160 Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Arg 165 170 175 Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr 180 185 190 Val Ala Pro Ala Glu Cys Ser 195 23660DNAArtificial sequenceF5 Fab light chain coding sequence 23cttaatttta tgctgactca gccccactct gtgtcggggt ctccggggaa gacggttacc 60atctcctgca cccgcagcac tggcagcatt accagcaact atgtgcactg gtaccagcag 120cgcccgggca gttcccccac cactgtgatc tgtgaggata acgaaagacc ctctggggtc 180cctgatcgat tctctggctc catcgacatc tcctccaact ctgcctccct caccatctct 240ggactgaaga ctgaggacga ggctgactac tactgtcagt cttatgatga cagcaatcat 300atttctgtct tcggtactgg gaccaaggtc accgtcctag gtcagcccaa ggccaacccc 360tgtctgatca gtgacttcta cccgggagct gtgacagtgg cctggaaggc agatggcagc 420cccgtcaagg cgggagtgga gaccaccaaa ccctccaaac agagcaacaa caagtacgcg 480gccagcagct acctgagcct gacgcccgag cagtggaagt cccacagaag ctacagctgc 540caggtcacgc atgaggggag caccgtggag aagacagtgg cccctgcaga atgttcataa 600actgtcactc tgttcccgcc ctcctctgag gagctccaag ccaacaaggc cacactagtg 660246PRTArtificial sequenceH9 Fab VH CDR1 24Ser Tyr Ala Ile Ser Trp 1 5 2517PRTArtificial sequenceH9 Fab VH CDR2 25Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe Gln 1 5 10 15 Gly 2618PRTArtificial sequenceH9 Fab VH CDR3 26Gly Asp Leu Tyr Tyr Tyr Asp Ser Ser Gly Tyr Pro Arg Tyr Tyr Phe 1 5 10 15 Asp Tyr 2716DNAArtificial sequenceH9 Fab VH CDR1 coding sequence 27gctatgctat cagctg 162850DNAArtificial sequenceH9 Fab VH CDR2 coding sequence 28gggatcatcc ctatctttgg tacagcaaac tacgcacaga agttccaggg 502953DNAArtificial sequenceH9 Fab VH CDR3 coding sequence 29ggggatctgt attactatga tagtagtggt tatccgcgat actactttga cta 533012PRTArtificial sequenceH9 Fab VL CDR1 30Arg Ala Ser Gln Ser Val Ser Ser Ser Tyr Leu Ala 1 5 10 317PRTArtificial sequenceH9 Fab VL CDR2 31Gly Ala Ser Ser Arg Ala Thr 1 5 3210PRTArtificial sequenceH9 Fab VL CDR3 32Gln His Tyr Ser Thr Ser Pro Gly Phe Thr 1 5 10 3335DNAArtificial sequenceH9 Fab VL CDR1 coding sequence 33agggccagtc agagtgttag cagcagctac ttagc 353421DNAArtificial sequenceH9 Fab VL CDR2 coding sequence 34ggtgcatcca gcagggccac t 213529DNAArtificial sequenceH9 Fab VL CDR3 coding sequence 35agcactatag cacctcacct gggttcact 29367PRTArtificial sequenceF5 Fab VH CDR1 36Ser Ser Asn Tyr Tyr Trp Gly 1 5 3716PRTArtificial sequenceF5 Fab VH CDR2 37Ala Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser 1 5 10 15 3823PRTArtificial sequenceF5 Fab VH CDR3 38Arg Ile Gly Val Ala Gly Gln Trp Tyr Phe Asp Leu Trp Gly Arg Gly 1 5 10 15 Thr Leu Val Thr Val Ser Ser 20 3921DNAArtificial sequenceF5 Fab VH CDR1 coding sequence 39agcagtaatt actactgggg c 214048DNAArtificial sequenceF5 Fab VH CDR2 coding sequence 40gctatctatt atagtgggag cacctactac aacccgtccc tcaagagt 484169DNAArtificial sequenceF5 Fab VH CDR3 coding sequence 41cgtataggag tggctggcca atggtatttc gatctctggg gccgtggcac cctggtcacc 60gtctcaagc 694213PRTArtificial sequenceF5 Fab VL CDR1 42Thr Arg Ser Thr Gly Ser Ile Thr Ser Asn Tyr Val His 1 5 10 437PRTArtificial sequenceF5 Fab VL CDR2 43Glu Asp Asn Glu Arg Pro Ser 1 5 4411PRTArtificial sequenceF5 Fab VL CDR3 44Gln Ser Tyr Asp Asp Ser Asn His Ile Ser Val 1 5 10 4539DNAArtificial sequenceF5 Fab VL CDR1 coding sequence 45acccgcagca ctggcagcat taccagcaac tatgtgcac 394621DNAArtificial sequenceF5 Fab VL CDR2 coding sequence 46gaggataacg aaagaccctc t 214733DNAArtificial sequenceF5 Fab VL CDR3 coding sequence 47cagtcttatg atgacagcaa tcatatttct gtc 33484102DNAHuman cytomegalovirus 48aagcttacgg aaaatacgac agagaagacg agtcctgtca ctttagccat ggtctgcggc 60gatctctaaa cagaggaccc tgataatggg aaacggacac taggcgtccg cgccatacgg 120gattaaaaca aaaaaaaatc ggtggtggtg tgtgatgggg tgtggtgacg gtggggcttc 180gcctcttttt tttgtaataa aaaaagacac tgaataatcc gcggttgtct ctgtgtagaa 240cgtttttatt tcgggttccg cgtttggtcg cctgcctatg taaggcggcg gccgcagagg 300gcgcgccgct cagtcgccta cacccgtacg cgcaggcagc atggagtcgc gcggtcgccg 360ttgtcccgaa atgatatccg tactgggtcc catttcgggg cacgtgctga aagccgtgtt 420tagtcgcggc gatacgccgg tgctgccgca cgagacgcga ctcctgcaga cgggtatcca 480cgtacgcgtg agccagccct cgctgatctt ggtatcgcag tacacgcccg actcgacgcc 540atgccaccgc ggcgacaatc agctgcaggt gcagcacacg tactttacgg gcagcgaggt 600ggagaacgtg tcggtcaacg tgcacaaccc cacgggccga agcatctgcc ccagccagga 660gcccatgtcg atctatgtgt acgcgctgcc gctcaagatg ctgaacatcc ccagcatcaa 720cgtgcaccac tacccgtcgg cggccgagcg caaacaccga cacctgcccg tagctgacgc 780tgtgattcac gcgtcgggca agcagatgtg gcaggcgcgt ctcacggtct cgggactggc 840ctggacgcgt cagcagaacc agtggaaaga gcccgacgtc tactacacgt cagcgttcgt 900gtttcccacc aaggacgtgg cactgcggca cgtggtgtgc gcgcacgagc tggtttgctc 960catggagaac acgcgcgcaa ccaagatgca ggtgataggt gaccagtacg tcaaggtgta 1020cctggagtcc ttctgcgagg acgtgccctc cggcaagctc tttatgcacg tcacgctggg 1080ctctgacgtg gaagaggacc tgacgatgac ccgcaacccg caacccttca tgcgccccca 1140cgagcgcaac ggctttacgg tgttgtgtcc caaaaatatg ataatcaaac cgggcaagat 1200ctcgcacatc atgctggatg tggcttttac ctcacacgag cattttgggc tgctgtgtcc 1260caagagcatc ccgggcctga gcatctcagg taacctgttg atgaacgggc agcagatctt 1320cctggaggta caagccatac gcgagaccgt ggaactgcgt cagtacgatc ccgtggctgc 1380gctcttcttt ttcgatatcg acttgctgct gcagcgcggg cctcagtaca gcgagcaccc 1440caccttcacc agccagtatc gcatccaggg caagcttgag taccgacaca cctgggaccg 1500gcacgacgag ggtgccgccc agggcgacga cgacgtctgg accagcggat cggactccga 1560cgaagaactc gtaaccaccg agcgcaagac

gccccgcgtc accggcggcg gcgccatggc 1620gggcgcctcc acttccgcgg gccgcaaacg caaatcagca tcctcggcga cggcgtgcac 1680gtcgggcgtt atgacacgcg gccgccttaa ggccgagtcc accgtcgcgc ccgaagagga 1740caccgacgag gattccgaca acgaaatcca caatccggcc gtgttcacct ggccgccctg 1800gcaggccggc atcctggccc gcaacctggt gcccatggtg gctacggttc agggtcagaa 1860tctgaagtac caggaattct tctgggacgc caacgacatc taccgcatct tcgccgaatt 1920ggaaggcgta tggcagcccg ctgcgcaacc caaacgtcgc cgccaccggc aagacgcctt 1980gcccgggcca tgcatcgcct cgacgcccaa aaagcaccga ggttgagcca cccgccgcac 2040gcgcttagga cgactctata aaaacccacg tccactcaga cacgcaactt ttggccgcca 2100cacctgtcac cgctgctata tttgcgacag ttgccggaac ccttcccgac ctcccacgaa 2160gacccgttca cctttgcgca tcccctgacc ctccccccat cccgccttcg caatgtctca 2220ggcatcgtcc tcgcccggtg agggaccctc gtcggaagcg gccgcgatca gcgaggccga 2280agccgccagc ggaagctttg gtcgcctgca ctgccaggtg cttcggctca tcaccaacgt 2340ggaaggcggc tcgctggaag ccggtcgtct gcgactcctg gacctgcgta ccaacataga 2400ggtgagccgg ccctcggttc tctgctgttt tcaggagaac aaatctccgc acgacaccgt 2460agacctgacc gacttaaaca tcaagggccg ctgcgtggtg ggcgaacagg accgactgct 2520ggtggacctc aacaactttg gcccacgacg cctgacgcca ggctcagaaa acaacacggt 2580ctcggtactg gcctttgcgc tgccgctgga ccgcgtgccc gttagcggac tgcacctctt 2640tcagagccag cggcgcggcg gcgaagaaaa tcggccgcga atggaagcgc gcgccatcat 2700ccgccgcacg gctcaccact gggccgtgcg actgaccgta acgccgaact ggcgccgcag 2760aaccgacagc agtttggagg cagggcagat ctttgtcagc cagttcgcct ttcgcgccgg 2820cgccatcccg ctgacgctgg tagacgccct ggagcagctg gcctgttcgg accctaacac 2880gtacatccac aaaacggaga cggacgaacg aggccaatgg atcatgctgt ttctgcatca 2940cgactcaccg cacccgccga ccagcgtgtt tctgcacttt tcggtttaca cgcatcgcgc 3000cgaggtggtg gcgcgacaca atccgtaccc gcacctacga cgcttgccgg acaacggctt 3060ccagctgttg attcccaaaa gttttacgct gacgcgcata catcccgagt acatcgtgca 3120gatccagaat gctttcgaga ccaatcagac tcacgacacc atctttttcc cggaaaacat 3180cccgggcgtc tccatagaag ccggcccgct acccgatcgt gtgcgaatca ccctccgcgt 3240cacgctgacc ggcgatcagg ccgttcattt ggaacaccga cagccgctag gccgcatcca 3300ctttttccgc cgtgggtttt ggactctcac acccggtaaa ccggacaaaa tcaagcgtcc 3360ccaggtgcag ctgcgcgccg gtctctttcc acggagcaac gtcatgcgcg gcgccgtctc 3420cgagtttctc ccgcagtccc ccggattacc acccaccgag gaagaggagg aagaagagga 3480agaggacgac gaagatgacc tctcctccac accgacgccg acccccctgt ccgaagccat 3540gtttgccggc ttcgaggaag ccagcggcga cgaggactcg gacacccaag ccggactgtc 3600cccggcactg atcctgaccg gacaaagacg tcgaagcggt aacaacgggg ctctcacgct 3660cgtcatcccc tcgtggcacg tctttgcgag ccttgacgac ttggtaccat taacggtgag 3720cgtgcagcac gccgcactac gacctacctc ttatctgcgc agcgacatgg acggcgacgt 3780gcgtaccgcg gcagacatca gcagcacgtt gcggtccgtg cccgcgccac gaccctcacc 3840catcagcacc gcttccactt ccagcacccc acgcagtcga ccccgcatct agagagagac 3900ttctttgttt ttcccccgcg tgtttttccc attccctgta tttatttcta aataataaaa 3960acacagagac gttgataata accgcggtgt gctttattag ggtatcacgg tgtagaaaaa 4020aaagagaggg aagccctaaa tatagcgtct ctcttactcg agcttattga gcgcagccac 4080aaaaatccgc cgattcagat ct 4102491932DNAHuman cytomegalovirus 49gccatggcat ccgtactggg tcccatttcg gggcacgtgc tgaaagccgt gtttagtcgc 60ggcgacacgc cggtgctgcc gcacgagacg cgactcctgc agacgggtat ccacgtgcgc 120gtgagccagc cctcgctgat cctggtgtcg cagtacacgc ccgactcgac gccatgccac 180cgcggcgaca atcagctgca ggtgcagcac acgtacttta cgggcagcga ggtggagaac 240gtgtcggtca acgtgcacaa ccccacgggc cggagcatct gccccagcca agagcccatg 300tcgatctatg tgtacgcgct gccgctcaag atgctgaaca tccccagcat caacgtgcac 360cactacccgt cggcggccga gcgcaaacac cgacacctgc ccgtagctga cgctgtgatt 420cacgcgtcgg gcaagcagat gtggcaggcg cgtctcacgg tctcgggact ggcctggacg 480cgtcagcaga accagtggaa agagcccgac gtctactaca cgtcagcgtt cgtgtttccc 540accaaggacg tggcactgcg gcacgtggtg tgcgcgcacg agctggtttg ctccatggag 600aacacgcgcg caaccaagat gcaggtgata ggtgaccagt acgtcaaggt gtacctggag 660tccttctgcg aggacgtgcc ctccggcaag ctctttatgc acgtcacgct gggctctgac 720gtggaagagg acctgacgat gacccgcaac ccgcaaccct tcatgcgccc ccacgagcgc 780aacggcttta cggtgttgtg tcccaaaaat atgataatca aaccgggcaa gatctcgcac 840atcatgctgg atgtggcttt tacctcacac gagcattttg ggctgctgtg tcccaagagc 900atcccgggcc tgagcatctc aggtaaccta ttgatgaacg ggcagcagat cttcctggag 960gtgcaagcga tacgcgagac cgtggaactg cgtcagtacg atcccgtggc tgcgctcttc 1020tttttcgata tcgacttgct gctgcagcgc gggcctcagt acagcgaaca ccccaccttc 1080accagccagt atcgcatcca gggcaagctt gagtaccgac acacctggga ccggcacgac 1140gagggtgccg cccagggcga cgacgacgtc tggaccagcg gatcggactc cgacgaggaa 1200ctcgtaacca ccgagcgcaa gacgccccgc gttaccggcg gcggcgccat ggcgggcgcc 1260tccacttccg cgggccgcaa acgcaaatca gcatcctcgg cgacggcgtg cacggcgggc 1320gttatgacac gcggccgcct taaggccgag tccaccgtcg cgcccgaaga ggacaccgac 1380gaggattccg acaacgaaat ccacaatccg gccgtgttca cctggccgcc ctggcaggcc 1440ggcatcctgg cccgcaacct ggtgcccatg gttgctacgg ttcagggtca gaatctgaag 1500taccaggagt tcttctggga cgccaacgac atctaccgca tcttcgccga attggaaggc 1560gtatggcagc ccgctgcgca acccaaacgt cgccgccacc ggcaagacgc cttgcccggg 1620ccatgcatcg cctcgacgcc caaaaagcac cgaggttgag ccacccgccg cgcacgctta 1680ggacgactct ataaaaaccc acgtccactc agacacgcga cttttggccg ccacacctgt 1740cgccgctgct atatttgcga cagttgccgg aacccttccc gacctcccac gaagacccgt 1800tcacctttgc gcatcccctg accccccccc tcatcccgcc ttcgcgatgt ctcaggcatc 1860gtcctcgccc ggtgagggac cctcgtcgga agcggccgcg atcagcgagg ccgaagccgc 1920cagcggaagc tt 193250548PRTHuman cytomegalovirus 50Met Glu Ser Arg Gly Arg Arg Cys Pro Glu Met Ile Ser Val Leu Gly 1 5 10 15 Pro Ile Ser Gly His Val Leu Lys Ala Val Phe Ser Arg Gly Asp Thr 20 25 30 Pro Val Leu Pro His Glu Thr Arg Leu Leu Gln Thr Gly Ile His Val 35 40 45 Arg Val Ser Gln Pro Ser Leu Ile Leu Val Ser Gln Tyr Thr Pro Asp 50 55 60 Ser Thr Pro Cys His Arg Gly Asp Asn Gln Leu Gln Val Gln His Thr 65 70 75 80 Tyr Phe Thr Gly Ser Glu Val Glu Asn Val Ser Val Asn Glu Pro Met 85 90 95 Ser Ile Tyr Val Tyr Ala Leu Pro Leu Lys Met Leu Asn Ile Pro Ser 100 105 110 Ile Asn Val His His Tyr Pro Ser Ala Ala Glu Arg Lys His Arg His 115 120 125 Leu Pro Val Ala Asp Ala Val Ile His Ala Ser Gly Lys Gln Met Trp 130 135 140 Gln Ala Arg Leu Thr Val Ser Gly Leu Ala Trp Thr Arg Gln Gln Asn 145 150 155 160 Gln Trp Lys Glu Pro Asp Val Tyr Tyr Thr Ser Ala Phe Val Phe Pro 165 170 175 Thr Lys Asp Val Ala Leu Arg His Val Val Cys Ala His Glu Leu Val 180 185 190 Cys Ser Met Glu Asn Thr Arg Ala Thr Lys Met Gln Val Ile Gly Asp 195 200 205 Gln Tyr Val Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp Val Pro Ser 210 215 220 Gly Lys Leu Phe Met His Val Thr Leu Gly Ser Asp Val Glu Glu Asp 225 230 235 240 Leu Thr Met Thr Arg Asn Pro Gln Pro Phe Met Arg Pro His Glu Arg 245 250 255 Asn Gly Phe Thr Val Leu Cys Pro Lys Asn Met Ile Ile Lys Pro Gly 260 265 270 Lys Ile Ser His Ile Met Leu Asp Val Ala Phe Thr Ser His Glu His 275 280 285 Phe Gly Leu Leu Cys Pro Lys Ser Ile Pro Gly Leu Ser Ile Ser Gly 290 295 300 Asn Leu Leu Met Asn Gly Gln Gln Ile Phe Leu Glu Val Gln Ala Ile 305 310 315 320 Arg Glu Thr Val Glu Leu Arg Gln Tyr Asp Pro Val Ala Ala Leu Phe 325 330 335 Phe Phe Asp Ile Asp Leu Leu Leu Gln Arg Gly Pro Gln Tyr Ser Glu 340 345 350 His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Glu Tyr 355 360 365 Arg His Thr Trp Asp Arg His Asp Glu Gly Ala Ala Gln Gly Asp Asp 370 375 380 Asp Val Trp Thr Ser Gly Ser Asp Ser Asp Glu Glu Leu Val Thr Thr 385 390 395 400 Glu Arg Lys Thr Pro Arg Val Thr Gly Gly Gly Ala Met Ala Gly Ala 405 410 415 Ser Thr Ser Ala Gly Arg Lys Arg Lys Ser Ala Ser Ser Ala Thr Ala 420 425 430 Cys Thr Ser Gly Val Met Thr Arg Gly Arg Leu Lys Ala Glu Ser Thr 435 440 445 Val Ala Pro Glu Glu Asp Thr Asp Glu Asp Ser Asp Asn Glu Ile His 450 455 460 Asn Pro Ala Val Phe Thr Trp Pro Pro Trp Gln Ala Gly Ile Leu Ala 465 470 475 480 Arg Asn Leu Val Pro Met Val Ala Thr Val Gln Gly Gln Asn Leu Lys 485 490 495 Tyr Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Phe Ala 500 505 510 Glu Leu Glu Gly Val Trp Gln Pro Ala Ala Gln Pro Lys Arg Arg Arg 515 520 525 His Arg Gln Asp Ala Leu Pro Gly Pro Cys Ile Ala Ser Thr Pro Lys 530 535 540 Lys His Arg Gly 545 51551PRTHuman cytomegalovirus 51Met Ala Ser Val Leu Gly Pro Ile Ser Gly His Val Leu Lys Ala Val 1 5 10 15 Phe Ser Arg Gly Asp Thr Pro Val Leu Pro His Glu Thr Arg Leu Leu 20 25 30 Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser Leu Ile Leu Val 35 40 45 Ser Gln Tyr Thr Pro Asp Ser Thr Pro Cys His Arg Gly Asp Asn Gln 50 55 60 Leu Gln Val Gln His Thr Tyr Phe Thr Gly Ser Glu Val Glu Asn Val 65 70 75 80 Ser Val Asn Val His Asn Pro Thr Gly Arg Ser Ile Cys Pro Ser Gln 85 90 95 Glu Pro Met Ser Ile Tyr Val Tyr Ala Leu Pro Leu Lys Met Leu Asn 100 105 110 Ile Pro Ser Ile Asn Val His His Tyr Pro Ser Ala Ala Glu Arg Lys 115 120 125 His Arg His Leu Pro Val Ala Asp Ala Val Ile His Ala Ser Gly Lys 130 135 140 Gln Met Trp Gln Ala Arg Leu Thr Val Ser Gly Leu Ala Trp Thr Arg 145 150 155 160 Gln Gln Asn Gln Trp Lys Glu Pro Asp Val Tyr Tyr Thr Ser Ala Phe 165 170 175 Val Phe Pro Thr Lys Asp Val Ala Leu Arg His Val Val Cys Ala His 180 185 190 Glu Leu Val Cys Ser Met Glu Asn Thr Arg Ala Thr Lys Met Gln Val 195 200 205 Ile Gly Asp Gln Tyr Val Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp 210 215 220 Val Pro Ser Gly Lys Leu Phe Met His Val Thr Leu Gly Ser Asp Val 225 230 235 240 Glu Glu Asp Leu Thr Met Thr Arg Asn Pro Gln Pro Phe Met Arg Pro 245 250 255 His Glu Arg Asn Gly Phe Thr Val Leu Cys Pro Lys Asn Met Ile Ile 260 265 270 Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala Phe Thr Ser 275 280 285 His Glu His Phe Gly Leu Leu Cys Pro Lys Ser Ile Pro Gly Leu Ser 290 295 300 Ile Ser Gly Asn Leu Leu Met Asn Gly Gln Gln Ile Phe Leu Glu Val 305 310 315 320 Gln Ala Ile Arg Glu Thr Val Glu Leu Arg Gln Tyr Asp Pro Val Ala 325 330 335 Ala Leu Phe Phe Phe Asp Ile Asp Leu Leu Leu Gln Arg Gly Pro Gln 340 345 350 Tyr Ser Glu His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys 355 360 365 Leu Glu Tyr Arg His Thr Trp Asp Arg His Asp Glu Gly Ala Ala Gln 370 375 380 Gly Asp Asp Asp Val Trp Thr Ser Gly Ser Asp Ser Asp Glu Glu Leu 385 390 395 400 Val Thr Thr Glu Arg Lys Thr Pro Arg Val Thr Gly Gly Gly Ala Met 405 410 415 Ala Gly Ala Ser Thr Ser Ala Gly Arg Lys Arg Lys Ser Ala Ser Ser 420 425 430 Ala Thr Ala Cys Thr Ala Gly Val Met Thr Arg Gly Arg Leu Lys Ala 435 440 445 Glu Ser Thr Val Ala Pro Glu Glu Asp Thr Asp Glu Asp Ser Asp Asn 450 455 460 Glu Ile His Asn Pro Ala Val Phe Thr Trp Pro Pro Trp Gln Ala Gly 465 470 475 480 Ile Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val Gln Gly Gln 485 490 495 Asn Leu Lys Tyr Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg 500 505 510 Ile Phe Ala Glu Leu Glu Gly Val Trp Gln Pro Ala Ala Gln Pro Lys 515 520 525 Arg Arg Arg His Arg Gln Asp Ala Leu Pro Gly Pro Cys Ile Ala Ser 530 535 540 Thr Pro Lys Lys His Arg Gly 545 550 52551PRTHuman cytomegalovirus 52Met Ala Ser Val Leu Gly Pro Ile Ser Gly His Val Leu Lys Ala Val 1 5 10 15 Phe Ser Arg Gly Asp Thr Pro Val Leu Pro His Glu Thr Arg Leu Leu 20 25 30 Gln Thr Gly Ile His Val Arg Val Ser Gln Pro Ser Leu Ile Leu Val 35 40 45 Ser Gln Tyr Thr Pro Asp Ser Thr Pro Cys His Arg Gly Asp Asn Gln 50 55 60 Leu Gln Val Gln His Thr Tyr Phe Thr Gly Ser Glu Val Glu Asn Val 65 70 75 80 Ser Val Asn Val His Asn Pro Thr Gly Arg Ser Ile Cys Pro Ser Gln 85 90 95 Glu Pro Met Ser Ile Tyr Val Tyr Ala Leu Pro Leu Lys Met Leu Asn 100 105 110 Ile Pro Ser Ile Asn Val His His Tyr Pro Ser Ala Ala Glu Arg Lys 115 120 125 His Arg His Leu Pro Val Ala Asp Ala Val Ile His Ala Ser Gly Lys 130 135 140 Gln Met Trp Gln Ala Arg Leu Thr Val Ser Gly Leu Ala Trp Thr Arg 145 150 155 160 Gln Gln Asn Gln Trp Lys Glu Pro Asp Val Tyr Tyr Thr Ser Ala Phe 165 170 175 Val Phe Pro Thr Lys Asp Val Ala Leu Arg His Val Val Cys Ala His 180 185 190 Glu Leu Val Cys Ser Met Glu Asn Thr Arg Ala Thr Lys Met Gln Val 195 200 205 Ile Gly Asp Gln Tyr Val Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp 210 215 220 Val Pro Ser Gly Lys Leu Phe Met His Val Thr Leu Gly Ser Asp Val 225 230 235 240 Glu Glu Asp Leu Thr Met Thr Arg Asn Pro Gln Pro Phe Met Arg Pro 245 250 255 His Glu Arg Asn Gly Phe Thr Val Leu Cys Pro Lys Asn Met Ile Ile 260 265 270 Lys Pro Gly Lys Ile Ser His Ile Met Leu Asp Val Ala Phe Thr Ser 275 280 285 His Glu His Phe Gly Leu Leu Cys Pro Lys Ser Ile Pro Gly Leu Ser 290 295 300 Ile Ser Gly Asn Leu Leu Met Asn Gly Gln Gln Ile Phe Leu Glu Val 305 310 315 320 Gln Ala Ile Arg Glu Thr Val Glu Leu Arg Gln Tyr Asp Pro Val Ala 325 330 335 Ala Leu Phe Phe Phe Asp Ile Asp Leu Leu Leu Gln Arg Gly Pro Gln 340 345 350 Tyr Ser Glu His Pro Thr Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys 355 360 365 Leu Glu Tyr Arg His Thr Trp Asp Arg His Asp Glu Gly Ala Ala Gln 370 375 380 Gly Asp Asp Asp Val Trp Thr Ser Gly Ser Asp Ser Asp Glu Glu Leu 385 390 395 400 Val Thr Thr Glu Arg Lys Thr Pro Arg Val Thr Gly Gly Gly Ala Met 405 410 415 Ala Gly Ala Ser Thr Ser Ala Gly Arg Lys Arg Lys Ser Ala Ser Ser 420 425 430 Ala Thr Ala Cys Thr Ala Gly Val Met Thr Arg Gly Arg Leu Lys Ala 435 440 445 Glu Ser Thr Val Ala Pro Glu Glu Asp Thr Asp Glu Asp Ser Asp Asn 450 455 460 Glu Ile His Asn Pro Ala Val Phe Thr Trp Pro Pro Trp Gln Ala Gly 465 470 475 480 Ile Leu Ala Arg Asn Leu Val Pro Met Val Ala Thr Val Gln Gly Gln 485 490 495 Asn Leu

Lys Tyr Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg 500 505 510 Ile Phe Ala Glu Leu Glu Gly Val Trp Gln Pro Ala Ala Gln Pro Lys 515 520 525 Arg Arg Arg His Arg Gln Asp Ala Leu Pro Gly Pro Cys Ile Ala Ser 530 535 540 Thr Pro Lys Lys His Arg Gly 545 550 53561PRTHuman cytomegalovirus 53Met Glu Ser Arg Gly Arg Arg Cys Pro Glu Met Ile Ser Val Leu Gly 1 5 10 15 Pro Ile Ser Gly His Val Leu Lys Ala Val Phe Ser Arg Gly Asp Thr 20 25 30 Pro Val Leu Pro His Glu Thr Arg Leu Leu Gln Thr Gly Ile His Val 35 40 45 Arg Val Ser Gln Pro Ser Leu Ile Leu Val Ser Gln Tyr Thr Pro Asp 50 55 60 Ser Thr Pro Cys His Arg Gly Asp Asn Gln Leu Gln Val Gln His Thr 65 70 75 80 Tyr Phe Thr Gly Ser Glu Val Glu Asn Val Ser Val Asn Val His Asn 85 90 95 Pro Thr Gly Arg Ser Ile Cys Pro Ser Gln Glu Pro Met Ser Ile Tyr 100 105 110 Val Tyr Ala Leu Pro Leu Lys Met Leu Asn Ile Pro Ser Ile Asn Val 115 120 125 His His Tyr Pro Ser Ala Ala Glu Arg Lys His Arg His Leu Pro Val 130 135 140 Ala Asp Ala Val Ile His Ala Ser Gly Lys Gln Met Trp Gln Ala Arg 145 150 155 160 Leu Thr Val Ser Gly Leu Ala Trp Thr Arg Gln Gln Asn Gln Trp Lys 165 170 175 Glu Pro Asp Val Tyr Tyr Thr Ser Ala Phe Val Phe Pro Thr Lys Asp 180 185 190 Val Ala Leu Arg His Val Val Cys Ala His Glu Leu Val Cys Ser Met 195 200 205 Glu Asn Thr Arg Ala Thr Lys Met Gln Val Ile Gly Asp Gln Tyr Val 210 215 220 Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp Val Pro Ser Gly Lys Leu 225 230 235 240 Phe Met His Val Thr Leu Gly Ser Asp Val Glu Glu Asp Leu Thr Met 245 250 255 Thr Arg Asn Pro Gln Pro Phe Met Arg Pro His Glu Arg Asn Gly Phe 260 265 270 Thr Val Leu Cys Pro Lys Asn Met Ile Ile Lys Pro Gly Lys Ile Ser 275 280 285 His Ile Met Leu Asp Val Ala Phe Thr Ser His Glu His Phe Gly Leu 290 295 300 Leu Cys Pro Lys Ser Ile Pro Gly Leu Ser Ile Ser Gly Asn Leu Leu 305 310 315 320 Met Asn Gly Gln Gln Ile Phe Leu Glu Val Gln Ala Ile Arg Glu Thr 325 330 335 Val Glu Leu Arg Gln Tyr Asp Pro Val Ala Ala Leu Phe Phe Phe Asp 340 345 350 Ile Asp Leu Leu Leu Gln Arg Gly Pro Gln Tyr Ser Glu His Pro Thr 355 360 365 Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu Glu Tyr Arg His Thr 370 375 380 Trp Asp Arg His Asp Glu Gly Ala Ala Gln Gly Asp Asp Asp Val Trp 385 390 395 400 Thr Ser Gly Ser Asp Ser Asp Glu Glu Leu Val Thr Thr Glu Arg Lys 405 410 415 Thr Pro Arg Val Thr Gly Gly Gly Ala Met Ala Gly Ala Ser Thr Ser 420 425 430 Ala Gly Arg Lys Arg Lys Ser Ala Ser Ser Ala Thr Ala Cys Thr Ser 435 440 445 Gly Val Met Thr Arg Gly Arg Leu Lys Ala Glu Ser Thr Val Ala Pro 450 455 460 Glu Glu Asp Thr Asp Glu Asp Ser Asp Asn Glu Ile His Asn Pro Ala 465 470 475 480 Val Phe Thr Trp Pro Pro Trp Gln Ala Gly Ile Leu Ala Arg Asn Leu 485 490 495 Val Pro Met Val Ala Thr Val Gln Gly Gln Asn Leu Lys Tyr Gln Glu 500 505 510 Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile Phe Ala Glu Leu Glu 515 520 525 Gly Val Trp Gln Pro Ala Ala Gln Pro Lys Arg Arg Arg His Arg Gln 530 535 540 Asp Ala Leu Pro Gly Pro Cys Ile Ala Ser Thr Pro Lys Lys His Arg 545 550 555 560 Gly 549PRTArtificial sequenceHLA restricted peptide 54Ala Ala Glu Arg Lys His Arg His Leu 1 5 559PRTArtificial sequenceHLA restricted peptide 55Ala Ala Leu Phe Phe Phe Asp Ile Asp 1 5 5610PRTArtificial sequenceHLA restricted peptide 56Ala Ala Leu Phe Phe Phe Asp Ile Asp Leu 1 5 10 579PRTArtificial sequenceHLA restricted peptide 57Ala Ala Gln Gly Asp Asp Asp Val Trp 1 5 5810PRTArtificial sequenceHLA restricted peptide 58Ala Ala Gln Gly Asp Asp Asp Val Trp Thr 1 5 10 599PRTArtificial sequenceHLA restricted peptide 59Ala Ala Gln Pro Lys Arg Arg Arg His 1 5 6010PRTArtificial sequenceHLA restricted peptide 60Ala Ala Gln Pro Lys Arg Arg Arg His Arg 1 5 10 619PRTArtificial sequenceHLA restricted peptide 61Ala Cys Thr Ala Gly Val Met Thr Arg 1 5 629PRTArtificial sequenceHLA restricted peptide 62Ala Cys Thr Ser Gly Val Met Thr Arg 1 5 6310PRTArtificial sequenceHLA restricted peptide 63Ala Asp Ala Val Ile His Ala Ser Gly Lys 1 5 10 649PRTArtificial sequenceHLA restricted peptide 64Ala Glu Leu Glu Gly Val Trp Gln Pro 1 5 6510PRTArtificial sequenceHLA restricted peptide 65Ala Glu Leu Glu Gly Val Trp Gln Pro Ala 1 5 10 6610PRTArtificial sequenceHLA restricted peptide 66Ala Glu Arg Lys His Arg His Leu Pro Val 1 5 10 679PRTArtificial sequenceHLA restricted peptide 67Ala Glu Ser Thr Val Ala Pro Glu Glu 1 5 6810PRTArtificial sequenceHLA restricted peptide 68Ala Glu Ser Thr Val Ala Pro Glu Glu Asp 1 5 10 6910PRTArtificial sequenceHLA restricted peptide 69Ala Phe Thr Ser His Glu His Phe Gly Leu 1 5 10 709PRTArtificial sequenceHLA restricted peptide 70Ala Phe Val Phe Pro Thr Lys Asp Val 1 5 7110PRTArtificial sequenceHLA restricted peptide 71Ala Phe Val Phe Pro Thr Lys Asp Val Ala 1 5 10 729PRTArtificial sequenceHLA restricted peptide 72Ala Gly Ala Ser Thr Ser Ala Gly Arg 1 5 7310PRTArtificial sequenceHLA restricted peptide 73Ala Gly Ala Ser Thr Ser Ala Gly Arg Lys 1 5 10 749PRTArtificial sequenceHLA restricted peptide 74Ala Gly Ile Leu Ala Arg Asn Leu Val 1 5 7510PRTArtificial sequenceHLA restricted peptide 75Ala Gly Ile Leu Ala Arg Asn Leu Val Pro 1 5 10 769PRTArtificial sequenceHLA restricted peptide 76Ala Gly Arg Lys Arg Lys Ser Ala Ser 1 5 7710PRTArtificial sequenceHLA restricted peptide 77Ala Gly Arg Lys Arg Lys Ser Ala Ser Ser 1 5 10 789PRTArtificial sequenceHLA restricted peptide 78Ala Gly Val Met Thr Arg Gly Arg Leu 1 5 7910PRTArtificial sequenceHLA restricted peptide 79Ala Gly Val Met Thr Arg Gly Arg Leu Lys 1 5 10 809PRTArtificial sequenceHLA restricted peptide 80Ala His Glu Leu Val Cys Ser Met Glu 1 5 8110PRTArtificial sequenceHLA restricted peptide 81Ala His Glu Leu Val Cys Ser Met Glu Asn 1 5 10 829PRTArtificial sequenceHLA restricted peptide 82Ala Ile Arg Glu Thr Val Glu Leu Arg 1 5 839PRTArtificial sequenceHLA restricted peptide 83Ala Leu Phe Phe Phe Asp Ile Asp Leu 1 5 8410PRTArtificial sequenceHLA restricted peptide 84Ala Leu Phe Phe Phe Asp Ile Asp Leu Leu 1 5 10 859PRTArtificial sequenceHLA restricted peptide 85Ala Leu Pro Gly Pro Cys Ile Ala Ser 1 5 8610PRTArtificial sequenceHLA restricted peptide 86Ala Leu Pro Gly Pro Cys Ile Ala Ser Thr 1 5 10 879PRTArtificial sequenceHLA restricted peptide 87Ala Leu Pro Leu Lys Met Leu Asn Ile 1 5 889PRTArtificial sequenceHLA restricted peptide 88Ala Leu Arg His Val Val Cys Ala His 1 5 8910PRTArtificial sequenceHLA restricted peptide 89Ala Leu Arg His Val Val Cys Ala His Glu 1 5 10 909PRTArtificial sequenceHLA restricted peptide 90Ala Met Ala Gly Ala Ser Thr Ser Ala 1 5 919PRTArtificial sequenceHLA restricted peptide 91Ala Asn Asp Ile Tyr Arg Ile Phe Ala 1 5 929PRTArtificial sequenceHLA restricted peptide 92Ala Pro Glu Glu Asp Thr Asp Glu Asp 1 5 9310PRTArtificial sequenceHLA restricted peptide 93Ala Pro Glu Glu Asp Thr Asp Glu Asp Ser 1 5 10 949PRTArtificial sequenceHLA restricted peptide 94Ala Gln Gly Asp Asp Asp Val Trp Thr 1 5 9510PRTArtificial sequenceHLA restricted peptide 95Ala Gln Gly Asp Asp Asp Val Trp Thr Ser 1 5 10 969PRTArtificial sequenceHLA restricted peptide 96Ala Gln Pro Lys Arg Arg Arg His Arg 1 5 9710PRTArtificial sequenceHLA restricted peptide 97Ala Gln Pro Lys Arg Arg Arg His Arg Gln 1 5 10 989PRTArtificial sequenceHLA restricted peptide 98Ala Arg Leu Thr Val Ser Gly Leu Ala 1 5 9910PRTArtificial sequenceHLA restricted peptide 99Ala Arg Leu Thr Val Ser Gly Leu Ala Trp 1 5 10 1009PRTArtificial sequenceHLA restricted peptide 100Ala Arg Asn Leu Val Pro Met Val Ala 1 5 10110PRTArtificial sequenceHLA restricted peptide 101Ala Arg Asn Leu Val Pro Met Val Ala Thr 1 5 10 1029PRTArtificial sequenceHLA restricted peptide 102Ala Ser Gly Lys Gln Met Trp Gln Ala 1 5 10310PRTArtificial sequenceHLA restricted peptide 103Ala Ser Gly Lys Gln Met Trp Gln Ala Arg 1 5 10 1049PRTArtificial sequenceHLA restricted peptide 104Ala Ser Ser Ala Thr Ala Cys Thr Ala 1 5 1059PRTArtificial sequenceHLA restricted peptide 105Ala Ser Ser Ala Thr Ala Cys Thr Ser 1 5 1069PRTArtificial sequenceHLA restricted peptide 106Ala Ser Thr Ser Ala Gly Arg Lys Arg 1 5 10710PRTArtificial sequenceHLA restricted peptide 107Ala Ser Thr Ser Ala Gly Arg Lys Arg Lys 1 5 10 10810PRTArtificial sequenceHLA restricted peptide 108Ala Ser Val Leu Gly Pro Ile Ser Gly His 1 5 10 1099PRTArtificial sequenceHLA restricted peptide 109Ala Thr Ala Cys Thr Ala Gly Val Met 1 5 11010PRTArtificial sequenceHLA restricted peptide 110Ala Thr Ala Cys Thr Ala Gly Val Met Thr 1 5 10 1119PRTArtificial sequenceHLA restricted peptide 111Ala Thr Ala Cys Thr Ser Gly Val Met 1 5 11210PRTArtificial sequenceHLA restricted peptide 112Ala Thr Ala Cys Thr Ser Gly Val Met Thr 1 5 10 1139PRTArtificial sequenceHLA restricted peptide 113Ala Thr Val Gln Gly Gln Asn Leu Lys 1 5 11410PRTArtificial sequenceHLA restricted peptide 114Ala Thr Val Gln Gly Gln Asn Leu Lys Tyr 1 5 10 11510PRTArtificial sequenceHLA restricted peptide 115Ala Val Phe Ser Arg Gly Asp Thr Pro Val 1 5 10 11610PRTArtificial sequenceHLA restricted peptide 116Ala Val Phe Thr Trp Pro Pro Trp Gln Ala 1 5 10 11710PRTArtificial sequenceHLA restricted peptide 117Ala Val Ile His Ala Ser Gly Lys Gln Met 1 5 10 1189PRTArtificial sequenceHLA restricted peptide 118Ala Trp Thr Arg Gln Gln Asn Gln Trp 1 5 11910PRTArtificial sequenceHLA restricted peptide 119Ala Trp Thr Arg Gln Gln Asn Gln Trp Lys 1 5 10 1209PRTArtificial sequenceHLA restricted peptide 120Cys Ala His Glu Leu Val Cys Ser Met 1 5 1219PRTArtificial sequenceHLA restricted peptide 121Cys Glu Asp Val Pro Ser Gly Lys Leu 1 5 12210PRTArtificial sequenceHLA restricted peptide 122Cys Glu Asp Val Pro Ser Gly Lys Leu Phe 1 5 10 12310PRTArtificial sequenceHLA restricted peptide 123Cys His Arg Gly Asp Asn Gln Leu Gln Val 1 5 10 12410PRTArtificial sequenceHLA restricted peptide 124Cys Ile Ala Ser Thr Pro Lys Lys His Arg 1 5 10 1259PRTArtificial sequenceHLA restricted peptide 125Cys Pro Glu Met Ile Ser Val Leu Gly 1 5 12610PRTArtificial sequenceHLA restricted peptide 126Cys Pro Glu Met Ile Ser Val Leu Gly Pro 1 5 10 1279PRTArtificial sequenceHLA restricted peptide 127Cys Pro Lys Asn Met Ile Ile Lys Pro 1 5 12810PRTArtificial sequenceHLA restricted peptide 128Cys Pro Lys Asn Met Ile Ile Lys Pro Gly 1 5 10 1299PRTArtificial sequenceHLA restricted peptide 129Cys Pro Lys Ser Ile Pro Gly Leu Ser 1 5 13010PRTArtificial sequenceHLA restricted peptide 130Cys Pro Lys Ser Ile Pro Gly Leu Ser Ile 1 5 10 1319PRTArtificial sequenceHLA restricted peptide 131Cys Pro Ser Gln Glu Pro Met Ser Ile 1 5 13210PRTArtificial sequenceHLA restricted peptide 132Cys Pro Ser Gln Glu Pro Met Ser Ile Tyr 1 5 10 1339PRTArtificial sequenceHLA restricted peptide 133Cys Ser Met Glu Asn Thr Arg Ala Thr 1 5 13410PRTArtificial sequenceHLA restricted peptide 134Cys Ser Met Glu Asn Thr Arg Ala Thr Lys 1 5 10 13510PRTArtificial sequenceHLA restricted peptide 135Cys Thr Ala Gly Val Met Thr Arg Gly Arg 1 5 10 13610PRTArtificial sequenceHLA restricted peptide 136Cys Thr Ser Gly Val Met Thr Arg Gly Arg 1 5 10 1379PRTArtificial sequenceHLA restricted peptide 137Asp Ala Leu Pro Gly Pro Cys Ile Ala 1 5 13810PRTArtificial sequenceHLA restricted peptide 138Asp Ala Leu Pro Gly Pro Cys Ile Ala Ser 1 5 10 1399PRTArtificial sequenceHLA restricted peptide 139Asp Ala Asn Asp Ile Tyr Arg Ile Phe 1 5 14010PRTArtificial sequenceHLA restricted peptide 140Asp Ala Asn Asp Ile Tyr Arg Ile Phe Ala 1 5 10 1419PRTArtificial sequenceHLA restricted peptide 141Asp Ala Val Ile His Ala Ser Gly Lys 1 5 14210PRTArtificial sequenceHLA restricted peptide 142Asp Ala Val Ile His Ala Ser Gly Lys Gln 1 5 10 1439PRTArtificial sequenceHLA restricted peptide 143Asp Asp Asp Val Trp Thr Ser Gly Ser 1 5 14410PRTArtificial sequenceHLA restricted peptide 144Asp Asp Val Trp Thr Ser Gly Ser Asp Ser 1 5 10 1459PRTArtificial sequenceHLA restricted peptide 145Asp Glu Asp Ser Asp Asn Glu Ile His 1 5 14610PRTArtificial sequenceHLA restricted peptide 146Asp Glu Asp Ser Asp Asn Glu Ile His Asn 1 5 10 1479PRTArtificial sequenceHLA restricted peptide 147Asp Glu Glu Leu Val Thr Thr Glu Arg 1 5 14810PRTArtificial sequenceHLA restricted peptide 148Asp Glu Glu Leu Val Thr Thr Glu Arg Lys 1 5 10 1499PRTArtificial sequenceHLA restricted peptide 149Asp Glu Gly Ala Ala Gln Gly Asp Asp 1 5 15010PRTArtificial sequenceHLA restricted peptide 150Asp Glu Gly Ala Ala Gln Gly Asp Asp Asp 1 5 10 1519PRTArtificial sequenceHLA restricted peptide 151Asp Ile Tyr Arg Ile Phe Ala Glu Leu 1 5 15210PRTArtificial sequenceHLA restricted peptide 152Asp Leu Leu Leu Gln Arg Gly Pro Gln Tyr 1 5 10 1539PRTArtificial sequenceHLA restricted peptide 153Asp Asn Glu Ile His Asn Pro Ala Val 1 5 15410PRTArtificial sequenceHLA restricted peptide 154Asp Asn Glu Ile His Asn Pro Ala Val Phe 1 5 10 15510PRTArtificial sequenceHLA restricted peptide 155Asp Asn Gln Leu Gln

Val Gln His Thr Tyr 1 5 10 1569PRTArtificial sequenceHLA restricted peptide 156Asp Pro Val Ala Ala Leu Phe Phe Phe 1 5 15710PRTArtificial sequenceHLA restricted peptide 157Asp Pro Val Ala Ala Leu Phe Phe Phe Asp 1 5 10 1589PRTArtificial sequenceHLA restricted peptide 158Asp Gln Tyr Val Lys Val Tyr Leu Glu 1 5 15910PRTArtificial sequenceHLA restricted peptide 159Asp Gln Tyr Val Lys Val Tyr Leu Glu Ser 1 5 10 1609PRTArtificial sequenceHLA restricted peptide 160Asp Arg His Asp Glu Gly Ala Ala Gln 1 5 16110PRTArtificial sequenceHLA restricted peptide 161Asp Arg His Asp Glu Gly Ala Ala Gln Gly 1 5 10 1629PRTArtificial sequenceHLA restricted peptide 162Asp Ser Asp Glu Glu Leu Val Thr Thr 1 5 16310PRTArtificial sequenceHLA restricted peptide 163Asp Ser Asp Asn Glu Ile His Asn Pro Ala 1 5 10 16410PRTArtificial sequenceHLA restricted peptide 164Asp Thr Asp Glu Asp Ser Asp Asn Glu Ile 1 5 10 1659PRTArtificial sequenceHLA restricted peptide 165Asp Thr Pro Val Leu Pro His Glu Thr 1 5 16610PRTArtificial sequenceHLA restricted peptide 166Asp Thr Pro Val Leu Pro His Glu Thr Arg 1 5 10 1679PRTArtificial sequenceHLA restricted peptide 167Asp Val Ala Phe Thr Ser His Glu His 1 5 16810PRTArtificial sequenceHLA restricted peptide 168Asp Val Ala Phe Thr Ser His Glu His Phe 1 5 10 1699PRTArtificial sequenceHLA restricted peptide 169Asp Val Ala Leu Arg His Val Val Cys 1 5 17010PRTArtificial sequenceHLA restricted peptide 170Asp Val Ala Leu Arg His Val Val Cys Ala 1 5 10 1719PRTArtificial sequenceHLA restricted peptide 171Asp Val Glu Glu Asp Leu Thr Met Thr 1 5 17210PRTArtificial sequenceHLA restricted peptide 172Asp Val Glu Glu Asp Leu Thr Met Thr Arg 1 5 10 1739PRTArtificial sequenceHLA restricted peptide 173Asp Val Pro Ser Gly Lys Leu Phe Met 1 5 17410PRTArtificial sequenceHLA restricted peptide 174Asp Val Pro Ser Gly Lys Leu Phe Met His 1 5 10 1759PRTArtificial sequenceHLA restricted peptide 175Asp Val Trp Thr Ser Gly Ser Asp Ser 1 5 17610PRTArtificial sequenceHLA restricted peptide 176Asp Val Trp Thr Ser Gly Ser Asp Ser Asp 1 5 10 1779PRTArtificial sequenceHLA restricted peptide 177Asp Val Tyr Tyr Thr Ser Ala Phe Val 1 5 17810PRTArtificial sequenceHLA restricted peptide 178Asp Val Tyr Tyr Thr Ser Ala Phe Val Phe 1 5 10 1799PRTArtificial sequenceHLA restricted peptide 179Glu Asp Ser Asp Asn Glu Ile His Asn 1 5 1809PRTArtificial sequenceHLA restricted peptide 180Glu Asp Thr Asp Glu Asp Ser Asp Asn 1 5 1819PRTArtificial sequenceHLA restricted peptide 181Glu Asp Val Pro Ser Gly Lys Leu Phe 1 5 18210PRTArtificial sequenceHLA restricted peptide 182Glu Asp Val Pro Ser Gly Lys Leu Phe Met 1 5 10 1839PRTArtificial sequenceHLA restricted peptide 183Glu Glu Asp Leu Thr Met Thr Arg Asn 1 5 18410PRTArtificial sequenceHLA restricted peptide 184Glu Glu Asp Thr Asp Glu Asp Ser Asp Asn 1 5 10 1859PRTArtificial sequenceHLA restricted peptide 185Glu Glu Leu Val Thr Thr Glu Arg Lys 1 5 18610PRTArtificial sequenceHLA restricted peptide 186Glu Glu Leu Val Thr Thr Glu Arg Lys Thr 1 5 10 1879PRTArtificial sequenceHLA restricted peptide 187Glu Phe Phe Trp Asp Ala Asn Asp Ile 1 5 18810PRTArtificial sequenceHLA restricted peptide 188Glu Phe Phe Trp Asp Ala Asn Asp Ile Tyr 1 5 10 18910PRTArtificial sequenceHLA restricted peptide 189Glu Gly Ala Ala Gln Gly Asp Asp Asp Val 1 5 10 1909PRTArtificial sequenceHLA restricted peptide 190Glu His Phe Gly Leu Leu Cys Pro Lys 1 5 19110PRTArtificial sequenceHLA restricted peptide 191Glu His Phe Gly Leu Leu Cys Pro Lys Ser 1 5 10 1929PRTArtificial sequenceHLA restricted peptide 192Glu His Pro Thr Phe Thr Ser Gln Tyr 1 5 19310PRTArtificial sequenceHLA restricted peptide 193Glu His Pro Thr Phe Thr Ser Gln Tyr Arg 1 5 10 1949PRTArtificial sequenceHLA restricted peptide 194Glu Ile His Asn Pro Ala Val Phe Thr 1 5 19510PRTArtificial sequenceHLA restricted peptide 195Glu Ile His Asn Pro Ala Val Phe Thr Trp 1 5 10 1969PRTArtificial sequenceHLA restricted peptide 196Glu Leu Glu Gly Val Trp Gln Pro Ala 1 5 19710PRTArtificial sequenceHLA restricted peptide 197Glu Leu Glu Gly Val Trp Gln Pro Ala Ala 1 5 10 1989PRTArtificial sequenceHLA restricted peptide 198Glu Leu Arg Gln Tyr Asp Pro Val Ala 1 5 19910PRTArtificial sequenceHLA restricted peptide 199Glu Leu Arg Gln Tyr Asp Pro Val Ala Ala 1 5 10 2009PRTArtificial sequenceHLA restricted peptide 200Glu Leu Val Cys Ser Met Glu Asn Thr 1 5 20110PRTArtificial sequenceHLA restricted peptide 201Glu Leu Val Cys Ser Met Glu Asn Thr Arg 1 5 10 2029PRTArtificial sequenceHLA restricted peptide 202Glu Leu Val Thr Thr Glu Arg Lys Thr 1 5 2039PRTArtificial sequenceHLA restricted peptide 203Glu Met Ile Ser Val Leu Gly Pro Ile 1 5 20410PRTArtificial sequenceHLA restricted peptide 204Glu Met Ile Ser Val Leu Gly Pro Ile Ser 1 5 10 20510PRTArtificial sequenceHLA restricted peptide 205Glu Asn Thr Arg Ala Thr Lys Met Gln Val 1 5 10 2069PRTArtificial sequenceHLA restricted peptide 206Glu Pro Asp Val Tyr Tyr Thr Ser Ala 1 5 20710PRTArtificial sequenceHLA restricted peptide 207Glu Pro Asp Val Tyr Tyr Thr Ser Ala Phe 1 5 10 2089PRTArtificial sequenceHLA restricted peptide 208Glu Pro Met Ser Ile Tyr Val Tyr Ala 1 5 20910PRTArtificial sequenceHLA restricted peptide 209Glu Pro Met Ser Ile Tyr Val Tyr Ala Leu 1 5 10 2109PRTArtificial sequenceHLA restricted peptide 210Glu Arg Lys His Arg His Leu Pro Val 1 5 21110PRTArtificial sequenceHLA restricted peptide 211Glu Arg Lys His Arg His Leu Pro Val Ala 1 5 10 2129PRTArtificial sequenceHLA restricted peptide 212Glu Arg Lys Thr Pro Arg Val Thr Gly 1 5 21310PRTArtificial sequenceHLA restricted peptide 213Glu Arg Lys Thr Pro Arg Val Thr Gly Gly 1 5 10 2149PRTArtificial sequenceHLA restricted peptide 214Glu Arg Asn Gly Phe Thr Val Leu Cys 1 5 21510PRTArtificial sequenceHLA restricted peptide 215Glu Arg Asn Gly Phe Thr Val Leu Cys Pro 1 5 10 2169PRTArtificial sequenceHLA restricted peptide 216Glu Ser Phe Cys Glu Asp Val Pro Ser 1 5 21710PRTArtificial sequenceHLA restricted peptide 217Glu Ser Arg Gly Arg Arg Cys Pro Glu Met 1 5 10 21810PRTArtificial sequenceHLA restricted peptide 218Glu Ser Thr Val Ala Pro Glu Glu Asp Thr 1 5 10 2199PRTArtificial sequenceHLA restricted peptide 219Glu Thr Arg Leu Leu Gln Thr Gly Ile 1 5 22010PRTArtificial sequenceHLA restricted peptide 220Glu Thr Arg Leu Leu Gln Thr Gly Ile His 1 5 10 2219PRTArtificial sequenceHLA restricted peptide 221Glu Val Glu Asn Val Ser Val Asn Val 1 5 22210PRTArtificial sequenceHLA restricted peptide 222Glu Val Glu Asn Val Ser Val Asn Val His 1 5 10 2239PRTArtificial sequenceHLA restricted peptide 223Glu Val Gln Ala Ile Arg Glu Thr Val 1 5 22410PRTArtificial sequenceHLA restricted peptide 224Glu Val Gln Ala Ile Arg Glu Thr Val Glu 1 5 10 2259PRTArtificial sequenceHLA restricted peptide 225Glu Tyr Arg His Thr Trp Asp Arg His 1 5 2269PRTArtificial sequenceHLA restricted peptide 226Phe Ala Glu Leu Glu Gly Val Trp Gln 1 5 2279PRTArtificial sequenceHLA restricted peptide 227Phe Cys Glu Asp Val Pro Ser Gly Lys 1 5 22810PRTArtificial sequenceHLA restricted peptide 228Phe Cys Glu Asp Val Pro Ser Gly Lys Leu 1 5 10 2299PRTArtificial sequenceHLA restricted peptide 229Phe Asp Ile Asp Leu Leu Leu Gln Arg 1 5 2309PRTArtificial sequenceHLA restricted peptide 230Phe Phe Asp Ile Asp Leu Leu Leu Gln 1 5 23110PRTArtificial sequenceHLA restricted peptide 231Phe Phe Asp Ile Asp Leu Leu Leu Gln Arg 1 5 10 2329PRTArtificial sequenceHLA restricted peptide 232Phe Phe Phe Asp Ile Asp Leu Leu Leu 1 5 23310PRTArtificial sequenceHLA restricted peptide 233Phe Phe Phe Asp Ile Asp Leu Leu Leu Gln 1 5 10 2349PRTArtificial sequenceHLA restricted peptide 234Phe Phe Trp Asp Ala Asn Asp Ile Tyr 1 5 23510PRTArtificial sequenceHLA restricted peptide 235Phe Phe Trp Asp Ala Asn Asp Ile Tyr Arg 1 5 10 2369PRTArtificial sequenceHLA restricted peptide 236Phe Gly Leu Leu Cys Pro Lys Ser Ile 1 5 23710PRTArtificial sequenceHLA restricted peptide 237Phe Gly Leu Leu Cys Pro Lys Ser Ile Pro 1 5 10 23810PRTArtificial sequenceHLA restricted peptide 238Phe Leu Glu Val Gln Ala Ile Arg Glu Thr 1 5 10 23910PRTArtificial sequenceHLA restricted peptide 239Phe Met His Val Thr Leu Gly Ser Asp Val 1 5 10 24010PRTArtificial sequenceHLA restricted peptide 240Phe Met Arg Pro His Glu Arg Asn Gly Phe 1 5 10 2419PRTArtificial sequenceHLA restricted peptide 241Phe Pro Thr Lys Asp Val Ala Leu Arg 1 5 24210PRTArtificial sequenceHLA restricted peptide 242Phe Pro Thr Lys Asp Val Ala Leu Arg His 1 5 10 2439PRTArtificial sequenceHLA restricted peptide 243Phe Ser Arg Gly Asp Thr Pro Val Leu 1 5 2449PRTArtificial sequenceHLA restricted peptide 244Phe Thr Gly Ser Glu Val Glu Asn Val 1 5 24510PRTArtificial sequenceHLA restricted peptide 245Phe Thr Gly Ser Glu Val Glu Asn Val Ser 1 5 10 2469PRTArtificial sequenceHLA restricted peptide 246Phe Thr Ser His Glu His Phe Gly Leu 1 5 24710PRTArtificial sequenceHLA restricted peptide 247Phe Thr Ser His Glu His Phe Gly Leu Leu 1 5 10 24810PRTArtificial sequenceHLA restricted peptide 248Phe Thr Ser Gln Tyr Arg Ile Gln Gly Lys 1 5 10 2499PRTArtificial sequenceHLA restricted peptide 249Phe Thr Val Leu Cys Pro Lys Asn Met 1 5 25010PRTArtificial sequenceHLA restricted peptide 250Phe Thr Val Leu Cys Pro Lys Asn Met Ile 1 5 10 25110PRTArtificial sequenceHLA restricted peptide 251Phe Thr Trp Pro Pro Trp Gln Ala Gly Ile 1 5 10 2529PRTArtificial sequenceHLA restricted peptide 252Phe Val Phe Pro Thr Lys Asp Val Ala 1 5 25310PRTArtificial sequenceHLA restricted peptide 253Phe Val Phe Pro Thr Lys Asp Val Ala Leu 1 5 10 2549PRTArtificial sequenceHLA restricted peptide 254Phe Trp Asp Ala Asn Asp Ile Tyr Arg 1 5 25510PRTArtificial sequenceHLA restricted peptide 255Phe Trp Asp Ala Asn Asp Ile Tyr Arg Ile 1 5 10 2569PRTArtificial sequenceHLA restricted peptide 256Gly Ala Ala Gln Gly Asp Asp Asp Val 1 5 25710PRTArtificial sequenceHLA restricted peptide 257Gly Ala Ala Gln Gly Asp Asp Asp Val Trp 1 5 10 2589PRTArtificial sequenceHLA restricted peptide 258Gly Ala Met Ala Gly Ala Ser Thr Ser 1 5 25910PRTArtificial sequenceHLA restricted peptide 259Gly Ala Met Ala Gly Ala Ser Thr Ser Ala 1 5 10 2609PRTArtificial sequenceHLA restricted peptide 260Gly Ala Ser Thr Ser Ala Gly Arg Lys 1 5 26110PRTArtificial sequenceHLA restricted peptide 261Gly Ala Ser Thr Ser Ala Gly Arg Lys Arg 1 5 10 26210PRTArtificial sequenceHLA restricted peptide 262Gly Asp Asp Asp Val Trp Thr Ser Gly Ser 1 5 10 26310PRTArtificial sequenceHLA restricted peptide 263Gly Asp Asn Gln Leu Gln Val Gln His Thr 1 5 10 2649PRTArtificial sequenceHLA restricted peptide 264Gly Asp Gln Tyr Val Lys Val Tyr Leu 1 5 26510PRTArtificial sequenceHLA restricted peptide 265Gly Asp Gln Tyr Val Lys Val Tyr Leu Glu 1 5 10 26610PRTArtificial sequenceHLA restricted peptide 266Gly Asp Thr Pro Val Leu Pro His Glu Thr 1 5 10 2679PRTArtificial sequenceHLA restricted peptide 267Gly Phe Thr Val Leu Cys Pro Lys Asn 1 5 26810PRTArtificial sequenceHLA restricted peptide 268Gly Phe Thr Val Leu Cys Pro Lys Asn Met 1 5 10 2699PRTArtificial sequenceHLA restricted peptide 269Gly Gly Ala Met Ala Gly Ala Ser Thr 1 5 27010PRTArtificial sequenceHLA restricted peptide 270Gly Gly Ala Met Ala Gly Ala Ser Thr Ser 1 5 10 2719PRTArtificial sequenceHLA restricted peptide 271Gly Gly Gly Ala Met Ala Gly Ala Ser 1 5 27210PRTArtificial sequenceHLA restricted peptide 272Gly Gly Gly Ala Met Ala Gly Ala Ser Thr 1 5 10 2739PRTArtificial sequenceHLA restricted peptide 273Gly His Val Leu Lys Ala Val Phe Ser 1 5 27410PRTArtificial sequenceHLA restricted peptide 274Gly His Val Leu Lys Ala Val Phe Ser Arg 1 5 10 27510PRTArtificial sequenceHLA restricted peptide 275Gly Ile His Val Arg Val Ser Gln Pro Ser 1 5 10 27610PRTArtificial sequenceHLA restricted peptide 276Gly Ile Leu Ala Arg Asn Leu Val Pro Met 1 5 10 27710PRTArtificial sequenceHLA restricted peptide 277Gly Lys Ile Ser His Ile Met Leu Asp Val 1 5 10 2789PRTArtificial sequenceHLA restricted peptide 278Gly Lys Leu Glu Tyr Arg His Thr Trp 1 5 27910PRTArtificial sequenceHLA restricted peptide 279Gly Lys Leu Glu Tyr Arg His Thr Trp Asp 1 5 10 2809PRTArtificial sequenceHLA restricted peptide 280Gly Lys Leu Phe Met His Val Thr Leu 1 5 2819PRTArtificial sequenceHLA restricted peptide 281Gly Lys Gln Met Trp Gln Ala Arg Leu 1 5 28210PRTArtificial sequenceHLA restricted peptide 282Gly Lys Gln Met Trp Gln Ala Arg Leu Thr 1 5 10 2839PRTArtificial sequenceHLA restricted peptide 283Gly Leu Ala Trp Thr Arg Gln Gln Asn 1 5 2849PRTArtificial sequenceHLA restricted peptide 284Gly Leu Ser Ile Ser Gly Asn Leu Leu 1 5 28510PRTArtificial sequenceHLA restricted peptide 285Gly Leu Ser Ile Ser Gly Asn Leu Leu Met 1 5 10 28610PRTArtificial sequenceHLA restricted peptide 286Gly Asn Leu Leu Met Asn Gly Gln Gln Ile 1 5 10 2879PRTArtificial sequenceHLA restricted peptide 287Gly Pro Cys Ile Ala Ser Thr Pro Lys 1 5 28810PRTArtificial sequenceHLA restricted peptide 288Gly Pro Cys Ile Ala Ser Thr Pro Lys Lys 1 5 10 2899PRTArtificial sequenceHLA restricted peptide 289Gly Pro Ile Ser Gly His Val Leu Lys 1 5 29010PRTArtificial sequenceHLA restricted peptide 290Gly Pro Ile Ser Gly His Val Leu Lys Ala 1 5 10 2919PRTArtificial sequenceHLA restricted peptide 291Gly Pro Gln Tyr Ser Glu His Pro Thr 1 5 29210PRTArtificial sequenceHLA restricted peptide 292Gly Pro Gln Tyr Ser Glu His Pro Thr Phe 1 5

10 2939PRTArtificial sequenceHLA restricted peptide 293Gly Gln Asn Leu Lys Tyr Gln Glu Phe 1 5 29410PRTArtificial sequenceHLA restricted peptide 294Gly Gln Asn Leu Lys Tyr Gln Glu Phe Phe 1 5 10 2959PRTArtificial sequenceHLA restricted peptide 295Gly Gln Gln Ile Phe Leu Glu Val Gln 1 5 29610PRTArtificial sequenceHLA restricted peptide 296Gly Gln Gln Ile Phe Leu Glu Val Gln Ala 1 5 10 2979PRTArtificial sequenceHLA restricted peptide 297Gly Arg Lys Arg Lys Ser Ala Ser Ser 1 5 29810PRTArtificial sequenceHLA restricted peptide 298Gly Arg Lys Arg Lys Ser Ala Ser Ser Ala 1 5 10 2999PRTArtificial sequenceHLA restricted peptide 299Gly Arg Leu Lys Ala Glu Ser Thr Val 1 5 30010PRTArtificial sequenceHLA restricted peptide 300Gly Arg Leu Lys Ala Glu Ser Thr Val Ala 1 5 10 3019PRTArtificial sequenceHLA restricted peptide 301Gly Arg Arg Cys Pro Glu Met Ile Ser 1 5 30210PRTArtificial sequenceHLA restricted peptide 302Gly Arg Arg Cys Pro Glu Met Ile Ser Val 1 5 10 3039PRTArtificial sequenceHLA restricted peptide 303Gly Arg Ser Ile Cys Pro Ser Gln Glu 1 5 30410PRTArtificial sequenceHLA restricted peptide 304Gly Arg Ser Ile Cys Pro Ser Gln Glu Pro 1 5 10 3059PRTArtificial sequenceHLA restricted peptide 305Gly Ser Asp Ser Asp Glu Glu Leu Val 1 5 30610PRTArtificial sequenceHLA restricted peptide 306Gly Ser Asp Ser Asp Glu Glu Leu Val Thr 1 5 10 3079PRTArtificial sequenceHLA restricted peptide 307Gly Ser Asp Val Glu Glu Asp Leu Thr 1 5 30810PRTArtificial sequenceHLA restricted peptide 308Gly Ser Asp Val Glu Glu Asp Leu Thr Met 1 5 10 3099PRTArtificial sequenceHLA restricted peptide 309Gly Ser Glu Val Glu Asn Val Ser Val 1 5 31010PRTArtificial sequenceHLA restricted peptide 310Gly Ser Glu Val Glu Asn Val Ser Val Asn 1 5 10 3119PRTArtificial sequenceHLA restricted peptide 311Gly Val Met Thr Arg Gly Arg Leu Lys 1 5 31210PRTArtificial sequenceHLA restricted peptide 312Gly Val Met Thr Arg Gly Arg Leu Lys Ala 1 5 10 31310PRTArtificial sequenceHLA restricted peptide 313Gly Val Trp Gln Pro Ala Ala Gln Pro Lys 1 5 10 31410PRTArtificial sequenceHLA restricted peptide 314His Ala Ser Gly Lys Gln Met Trp Gln Ala 1 5 10 31510PRTArtificial sequenceHLA restricted peptide 315His Glu His Phe Gly Leu Leu Cys Pro Lys 1 5 10 3169PRTArtificial sequenceHLA restricted peptide 316His Glu Leu Val Cys Ser Met Glu Asn 1 5 31710PRTArtificial sequenceHLA restricted peptide 317His Glu Leu Val Cys Ser Met Glu Asn Thr 1 5 10 3189PRTArtificial sequenceHLA restricted peptide 318His Glu Arg Asn Gly Phe Thr Val Leu 1 5 31910PRTArtificial sequenceHLA restricted peptide 319His Glu Arg Asn Gly Phe Thr Val Leu Cys 1 5 10 32010PRTArtificial sequenceHLA restricted peptide 320His Glu Thr Arg Leu Leu Gln Thr Gly Ile 1 5 10 3219PRTArtificial sequenceHLA restricted peptide 321His Phe Gly Leu Leu Cys Pro Lys Ser 1 5 32210PRTArtificial sequenceHLA restricted peptide 322His Phe Gly Leu Leu Cys Pro Lys Ser Ile 1 5 10 3239PRTArtificial sequenceHLA restricted peptide 323His His Tyr Pro Ser Ala Ala Glu Arg 1 5 32410PRTArtificial sequenceHLA restricted peptide 324His His Tyr Pro Ser Ala Ala Glu Arg Lys 1 5 10 3259PRTArtificial sequenceHLA restricted peptide 325His Ile Met Leu Asp Val Ala Phe Thr 1 5 32610PRTArtificial sequenceHLA restricted peptide 326His Ile Met Leu Asp Val Ala Phe Thr Ser 1 5 10 3279PRTArtificial sequenceHLA restricted peptide 327His Leu Pro Val Ala Asp Ala Val Ile 1 5 32810PRTArtificial sequenceHLA restricted peptide 328His Leu Pro Val Ala Asp Ala Val Ile His 1 5 10 3299PRTArtificial sequenceHLA restricted peptide 329His Asn Pro Thr Gly Arg Ser Ile Cys 1 5 3309PRTArtificial sequenceHLA restricted peptide 330His Pro Thr Phe Thr Ser Gln Tyr Arg 1 5 33110PRTArtificial sequenceHLA restricted peptide 331His Pro Thr Phe Thr Ser Gln Tyr Arg Ile 1 5 10 3329PRTArtificial sequenceHLA restricted peptide 332His Arg Gly Asp Asn Gln Leu Gln Val 1 5 33310PRTArtificial sequenceHLA restricted peptide 333His Arg Gly Asp Asn Gln Leu Gln Val Gln 1 5 10 3349PRTArtificial sequenceHLA restricted peptide 334His Arg His Leu Pro Val Ala Asp Ala 1 5 33510PRTArtificial sequenceHLA restricted peptide 335His Arg His Leu Pro Val Ala Asp Ala Val 1 5 10 3369PRTArtificial sequenceHLA restricted peptide 336His Arg Gln Asp Ala Leu Pro Gly Pro 1 5 33710PRTArtificial sequenceHLA restricted peptide 337His Arg Gln Asp Ala Leu Pro Gly Pro Cys 1 5 10 33810PRTArtificial sequenceHLA restricted peptide 338His Thr Trp Asp Arg His Asp Glu Gly Ala 1 5 10 3399PRTArtificial sequenceHLA restricted peptide 339His Thr Tyr Phe Thr Gly Ser Glu Val 1 5 3409PRTArtificial sequenceHLA restricted peptide 340His Val Leu Lys Ala Val Phe Ser Arg 1 5 3419PRTArtificial sequenceHLA restricted peptide 341His Val Arg Val Ser Gln Pro Ser Leu 1 5 34210PRTArtificial sequenceHLA restricted peptide 342His Val Arg Val Ser Gln Pro Ser Leu Ile 1 5 10 3439PRTArtificial sequenceHLA restricted peptide 343His Val Val Cys Ala His Glu Leu Val 1 5 34410PRTArtificial sequenceHLA restricted peptide 344His Val Val Cys Ala His Glu Leu Val Cys 1 5 10 3459PRTArtificial sequenceHLA restricted peptide 345His Tyr Pro Ser Ala Ala Glu Arg Lys 1 5 3469PRTArtificial sequenceHLA restricted peptide 346Ile Ala Ser Thr Pro Lys Lys His Arg 1 5 34710PRTArtificial sequenceHLA restricted peptide 347Ile Ala Ser Thr Pro Lys Lys His Arg Gly 1 5 10 3489PRTArtificial sequenceHLA restricted peptide 348Ile Cys Pro Ser Gln Glu Pro Met Ser 1 5 34910PRTArtificial sequenceHLA restricted peptide 349Ile Cys Pro Ser Gln Glu Pro Met Ser Ile 1 5 10 3509PRTArtificial sequenceHLA restricted peptide 350Ile Phe Ala Glu Leu Glu Gly Val Trp 1 5 3519PRTArtificial sequenceHLA restricted peptide 351Ile Phe Leu Glu Val Gln Ala Ile Arg 1 5 3529PRTArtificial sequenceHLA restricted peptide 352Ile Gly Asp Gln Tyr Val Lys Val Tyr 1 5 35310PRTArtificial sequenceHLA restricted peptide 353Ile Gly Asp Gln Tyr Val Lys Val Tyr Leu 1 5 10 3549PRTArtificial sequenceHLA restricted peptide 354Ile His Ala Ser Gly Lys Gln Met Trp 1 5 3559PRTArtificial sequenceHLA restricted peptide 355Ile His Asn Pro Ala Val Phe Thr Trp 1 5 3569PRTArtificial sequenceHLA restricted peptide 356Ile His Val Arg Val Ser Gln Pro Ser 1 5 35710PRTArtificial sequenceHLA restricted peptide 357Ile His Val Arg Val Ser Gln Pro Ser Leu 1 5 10 3589PRTArtificial sequenceHLA restricted peptide 358Ile Ile Lys Pro Gly Lys Ile Ser His 1 5 35910PRTArtificial sequenceHLA restricted peptide 359Ile Ile Lys Pro Gly Lys Ile Ser His Ile 1 5 10 3609PRTArtificial sequenceHLA restricted peptide 360Ile Lys Pro Gly Lys Ile Ser His Ile 1 5 36110PRTArtificial sequenceHLA restricted peptide 361Ile Lys Pro Gly Lys Ile Ser His Ile Met 1 5 10 3629PRTArtificial sequenceHLA restricted peptide 362Ile Leu Ala Arg Asn Leu Val Pro Met 1 5 36310PRTArtificial sequenceHLA restricted peptide 363Ile Leu Ala Arg Asn Leu Val Pro Met Val 1 5 10 36410PRTArtificial sequenceHLA restricted peptide 364Ile Leu Val Ser Gln Tyr Thr Pro Asp Ser 1 5 10 3659PRTArtificial sequenceHLA restricted peptide 365Ile Met Leu Asp Val Ala Phe Thr Ser 1 5 36610PRTArtificial sequenceHLA restricted peptide 366Ile Met Leu Asp Val Ala Phe Thr Ser His 1 5 10 3679PRTArtificial sequenceHLA restricted peptide 367Ile Asn Val His His Tyr Pro Ser Ala 1 5 36810PRTArtificial sequenceHLA restricted peptide 368Ile Asn Val His His Tyr Pro Ser Ala Ala 1 5 10 3699PRTArtificial sequenceHLA restricted peptide 369Ile Pro Gly Leu Ser Ile Ser Gly Asn 1 5 37010PRTArtificial sequenceHLA restricted peptide 370Ile Pro Gly Leu Ser Ile Ser Gly Asn Leu 1 5 10 3719PRTArtificial sequenceHLA restricted peptide 371Ile Pro Ser Ile Asn Val His His Tyr 1 5 37210PRTArtificial sequenceHLA restricted peptide 372Ile Pro Ser Ile Asn Val His His Tyr Pro 1 5 10 3739PRTArtificial sequenceHLA restricted peptide 373Ile Gln Gly Lys Leu Glu Tyr Arg His 1 5 37410PRTArtificial sequenceHLA restricted peptide 374Ile Gln Gly Lys Leu Glu Tyr Arg His Thr 1 5 10 3759PRTArtificial sequenceHLA restricted peptide 375Ile Arg Glu Thr Val Glu Leu Arg Gln 1 5 37610PRTArtificial sequenceHLA restricted peptide 376Ile Arg Glu Thr Val Glu Leu Arg Gln Tyr 1 5 10 3779PRTArtificial sequenceHLA restricted peptide 377Ile Ser Gly His Val Leu Lys Ala Val 1 5 37810PRTArtificial sequenceHLA restricted peptide 378Ile Ser Gly His Val Leu Lys Ala Val Phe 1 5 10 3799PRTArtificial sequenceHLA restricted peptide 379Ile Ser His Ile Met Leu Asp Val Ala 1 5 38010PRTArtificial sequenceHLA restricted peptide 380Ile Ser His Ile Met Leu Asp Val Ala Phe 1 5 10 38110PRTArtificial sequenceHLA restricted peptide 381Ile Ser Val Leu Gly Pro Ile Ser Gly His 1 5 10 3829PRTArtificial sequenceHLA restricted peptide 382Ile Tyr Val Tyr Ala Leu Pro Leu Lys 1 5 38310PRTArtificial sequenceHLA restricted peptide 383Ile Tyr Val Tyr Ala Leu Pro Leu Lys Met 1 5 10 3849PRTArtificial sequenceHLA restricted peptide 384Lys Ala Val Phe Ser Arg Gly Asp Thr 1 5 38510PRTArtificial sequenceHLA restricted peptide 385Lys Ala Val Phe Ser Arg Gly Asp Thr Pro 1 5 10 3869PRTArtificial sequenceHLA restricted peptide 386Lys Asp Val Ala Leu Arg His Val Val 1 5 38710PRTArtificial sequenceHLA restricted peptide 387Lys Asp Val Ala Leu Arg His Val Val Cys 1 5 10 3889PRTArtificial sequenceHLA restricted peptide 388Lys Glu Pro Asp Val Tyr Tyr Thr Ser 1 5 38910PRTArtificial sequenceHLA restricted peptide 389Lys Glu Pro Asp Val Tyr Tyr Thr Ser Ala 1 5 10 39010PRTArtificial sequenceHLA restricted peptide 390Lys His Arg His Leu Pro Val Ala Asp Ala 1 5 10 3919PRTArtificial sequenceHLA restricted peptide 391Lys Ile Ser His Ile Met Leu Asp Val 1 5 39210PRTArtificial sequenceHLA restricted peptide 392Lys Ile Ser His Ile Met Leu Asp Val Ala 1 5 10 39310PRTArtificial sequenceHLA restricted peptide 393Lys Leu Glu Tyr Arg His Thr Trp Asp Arg 1 5 10 3949PRTArtificial sequenceHLA restricted peptide 394Lys Leu Phe Met His Val Thr Leu Gly 1 5 39510PRTArtificial sequenceHLA restricted peptide 395Lys Leu Phe Met His Val Thr Leu Gly Ser 1 5 10 3969PRTArtificial sequenceHLA restricted peptide 396Lys Met Leu Asn Ile Pro Ser Ile Asn 1 5 39710PRTArtificial sequenceHLA restricted peptide 397Lys Met Leu Asn Ile Pro Ser Ile Asn Val 1 5 10 3989PRTArtificial sequenceHLA restricted peptide 398Lys Met Gln Val Ile Gly Asp Gln Tyr 1 5 39910PRTArtificial sequenceHLA restricted peptide 399Lys Met Gln Val Ile Gly Asp Gln Tyr Val 1 5 10 4009PRTArtificial sequenceHLA restricted peptide 400Lys Asn Met Ile Ile Lys Pro Gly Lys 1 5 40110PRTArtificial sequenceHLA restricted peptide 401Lys Asn Met Ile Ile Lys Pro Gly Lys Ile 1 5 10 4029PRTArtificial sequenceHLA restricted peptide 402Lys Pro Gly Lys Ile Ser His Ile Met 1 5 40310PRTArtificial sequenceHLA restricted peptide 403Lys Pro Gly Lys Ile Ser His Ile Met Leu 1 5 10 4049PRTArtificial sequenceHLA restricted peptide 404Lys Gln Met Trp Gln Ala Arg Leu Thr 1 5 40510PRTArtificial sequenceHLA restricted peptide 405Lys Gln Met Trp Gln Ala Arg Leu Thr Val 1 5 10 4069PRTArtificial sequenceHLA restricted peptide 406Lys Arg Lys Ser Ala Ser Ser Ala Thr 1 5 40710PRTArtificial sequenceHLA restricted peptide 407Lys Arg Lys Ser Ala Ser Ser Ala Thr Ala 1 5 10 4089PRTArtificial sequenceHLA restricted peptide 408Lys Arg Arg Arg His Arg Gln Asp Ala 1 5 40910PRTArtificial sequenceHLA restricted peptide 409Lys Arg Arg Arg His Arg Gln Asp Ala Leu 1 5 10 4109PRTArtificial sequenceHLA restricted peptide 410Lys Ser Ala Ser Ser Ala Thr Ala Cys 1 5 41110PRTArtificial sequenceHLA restricted peptide 411Lys Ser Ala Ser Ser Ala Thr Ala Cys Thr 1 5 10 4129PRTArtificial sequenceHLA restricted peptide 412Lys Ser Ile Pro Gly Leu Ser Ile Ser 1 5 41310PRTArtificial sequenceHLA restricted peptide 413Lys Ser Ile Pro Gly Leu Ser Ile Ser Gly 1 5 10 41410PRTArtificial sequenceHLA restricted peptide 414Lys Thr Pro Arg Val Thr Gly Gly Gly Ala 1 5 10 4159PRTArtificial sequenceHLA restricted peptide 415Lys Val Tyr Leu Glu Ser Phe Cys Glu 1 5 41610PRTArtificial sequenceHLA restricted peptide 416Lys Val Tyr Leu Glu Ser Phe Cys Glu Asp 1 5 10 4179PRTArtificial sequenceHLA restricted peptide 417Lys Tyr Gln Glu Phe Phe Trp Asp Ala 1 5 41810PRTArtificial sequenceHLA restricted peptide 418Lys Tyr Gln Glu Phe Phe Trp Asp Ala Asn 1 5 10 4199PRTArtificial sequenceHLA restricted peptide 419Leu Ala Arg Asn Leu Val Pro Met Val 1 5 42010PRTArtificial sequenceHLA restricted peptide 420Leu Ala Arg Asn Leu Val Pro Met Val Ala 1 5 10 4219PRTArtificial sequenceHLA restricted peptide 421Leu Ala Trp Thr Arg Gln Gln Asn Gln 1 5 42210PRTArtificial sequenceHLA restricted peptide 422Leu Ala Trp Thr Arg Gln Gln Asn Gln Trp 1 5 10 4239PRTArtificial sequenceHLA restricted peptide 423Leu Cys Pro Lys Asn Met Ile Ile Lys 1 5 4249PRTArtificial sequenceHLA restricted peptide 424Leu Cys Pro Lys Ser Ile Pro Gly Leu 1 5 42510PRTArtificial sequenceHLA restricted peptide 425Leu Cys Pro Lys Ser Ile Pro Gly Leu Ser 1 5 10 4269PRTArtificial sequenceHLA restricted peptide 426Leu Glu Gly Val Trp Gln Pro Ala Ala 1 5 42710PRTArtificial sequenceHLA restricted peptide 427Leu Glu Ser Phe Cys Glu Asp Val Pro Ser 1 5 10 4289PRTArtificial sequenceHLA restricted peptide 428Leu Glu Val Gln Ala Ile Arg Glu Thr 1 5 42910PRTArtificial sequenceHLA restricted peptide 429Leu Glu Val Gln Ala Ile Arg Glu Thr Val 1 5 10 4309PRTArtificial sequenceHLA restricted peptide 430Leu Glu Tyr

Arg His Thr Trp Asp Arg 1 5 43110PRTArtificial sequenceHLA restricted peptide 431Leu Glu Tyr Arg His Thr Trp Asp Arg His 1 5 10 4329PRTArtificial sequenceHLA restricted peptide 432Leu Phe Phe Phe Asp Ile Asp Leu Leu 1 5 43310PRTArtificial sequenceHLA restricted peptide 433Leu Phe Phe Phe Asp Ile Asp Leu Leu Leu 1 5 10 4349PRTArtificial sequenceHLA restricted peptide 434Leu Phe Met His Val Thr Leu Gly Ser 1 5 43510PRTArtificial sequenceHLA restricted peptide 435Leu Phe Met His Val Thr Leu Gly Ser Asp 1 5 10 4369PRTArtificial sequenceHLA restricted peptide 436Leu Gly Pro Ile Ser Gly His Val Leu 1 5 43710PRTArtificial sequenceHLA restricted peptide 437Leu Gly Pro Ile Ser Gly His Val Leu Lys 1 5 10 4389PRTArtificial sequenceHLA restricted peptide 438Leu Gly Ser Asp Val Glu Glu Asp Leu 1 5 43910PRTArtificial sequenceHLA restricted peptide 439Leu Gly Ser Asp Val Glu Glu Asp Leu Thr 1 5 10 44010PRTArtificial sequenceHLA restricted peptide 440Leu Lys Ala Val Phe Ser Arg Gly Asp Thr 1 5 10 4419PRTArtificial sequenceHLA restricted peptide 441Leu Lys Met Leu Asn Ile Pro Ser Ile 1 5 44210PRTArtificial sequenceHLA restricted peptide 442Leu Lys Met Leu Asn Ile Pro Ser Ile Asn 1 5 10 44310PRTArtificial sequenceHLA restricted peptide 443Leu Lys Tyr Gln Glu Phe Phe Trp Asp Ala 1 5 10 44410PRTArtificial sequenceHLA restricted peptide 444Leu Leu Cys Pro Lys Ser Ile Pro Gly Leu 1 5 10 4459PRTArtificial sequenceHLA restricted peptide 445Leu Leu Leu Gln Arg Gly Pro Gln Tyr 1 5 44610PRTArtificial sequenceHLA restricted peptide 446Leu Leu Leu Gln Arg Gly Pro Gln Tyr Ser 1 5 10 4479PRTArtificial sequenceHLA restricted peptide 447Leu Leu Met Asn Gly Gln Gln Ile Phe 1 5 44810PRTArtificial sequenceHLA restricted peptide 448Leu Leu Met Asn Gly Gln Gln Ile Phe Leu 1 5 10 4499PRTArtificial sequenceHLA restricted peptide 449Leu Leu Gln Arg Gly Pro Gln Tyr Ser 1 5 4509PRTArtificial sequenceHLA restricted peptide 450Leu Leu Gln Thr Gly Ile His Val Arg 1 5 45110PRTArtificial sequenceHLA restricted peptide 451Leu Leu Gln Thr Gly Ile His Val Arg Val 1 5 10 4529PRTArtificial sequenceHLA restricted peptide 452Leu Met Asn Gly Gln Gln Ile Phe Leu 1 5 4539PRTArtificial sequenceHLA restricted peptide 453Leu Asn Ile Pro Ser Ile Asn Val His 1 5 45410PRTArtificial sequenceHLA restricted peptide 454Leu Asn Ile Pro Ser Ile Asn Val His His 1 5 10 4559PRTArtificial sequenceHLA restricted peptide 455Leu Pro Gly Pro Cys Ile Ala Ser Thr 1 5 45610PRTArtificial sequenceHLA restricted peptide 456Leu Pro Gly Pro Cys Ile Ala Ser Thr Pro 1 5 10 4579PRTArtificial sequenceHLA restricted peptide 457Leu Pro His Glu Thr Arg Leu Leu Gln 1 5 45810PRTArtificial sequenceHLA restricted peptide 458Leu Pro His Glu Thr Arg Leu Leu Gln Thr 1 5 10 4599PRTArtificial sequenceHLA restricted peptide 459Leu Pro Leu Lys Met Leu Asn Ile Pro 1 5 46010PRTArtificial sequenceHLA restricted peptide 460Leu Pro Leu Lys Met Leu Asn Ile Pro Ser 1 5 10 4619PRTArtificial sequenceHLA restricted peptide 461Leu Pro Val Ala Asp Ala Val Ile His 1 5 46210PRTArtificial sequenceHLA restricted peptide 462Leu Pro Val Ala Asp Ala Val Ile His Ala 1 5 10 4639PRTArtificial sequenceHLA restricted peptide 463Leu Gln Arg Gly Pro Gln Tyr Ser Glu 1 5 46410PRTArtificial sequenceHLA restricted peptide 464Leu Gln Arg Gly Pro Gln Tyr Ser Glu His 1 5 10 4659PRTArtificial sequenceHLA restricted peptide 465Leu Gln Thr Gly Ile His Val Arg Val 1 5 46610PRTArtificial sequenceHLA restricted peptide 466Leu Gln Thr Gly Ile His Val Arg Val Ser 1 5 10 4679PRTArtificial sequenceHLA restricted peptide 467Leu Gln Val Gln His Thr Tyr Phe Thr 1 5 46810PRTArtificial sequenceHLA restricted peptide 468Leu Gln Val Gln His Thr Tyr Phe Thr Gly 1 5 10 4699PRTArtificial sequenceHLA restricted peptide 469Leu Arg His Val Val Cys Ala His Glu 1 5 47010PRTArtificial sequenceHLA restricted peptide 470Leu Arg His Val Val Cys Ala His Glu Leu 1 5 10 4719PRTArtificial sequenceHLA restricted peptide 471Leu Arg Gln Tyr Asp Pro Val Ala Ala 1 5 47210PRTArtificial sequenceHLA restricted peptide 472Leu Arg Gln Tyr Asp Pro Val Ala Ala Leu 1 5 10 4739PRTArtificial sequenceHLA restricted peptide 473Leu Ser Ile Ser Gly Asn Leu Leu Met 1 5 47410PRTArtificial sequenceHLA restricted peptide 474Leu Ser Ile Ser Gly Asn Leu Leu Met Asn 1 5 10 47510PRTArtificial sequenceHLA restricted peptide 475Leu Thr Met Thr Arg Asn Pro Gln Pro Phe 1 5 10 4769PRTArtificial sequenceHLA restricted peptide 476Leu Thr Val Ser Gly Leu Ala Trp Thr 1 5 47710PRTArtificial sequenceHLA restricted peptide 477Leu Thr Val Ser Gly Leu Ala Trp Thr Arg 1 5 10 4789PRTArtificial sequenceHLA restricted peptide 478Leu Val Cys Ser Met Glu Asn Thr Arg 1 5 47910PRTArtificial sequenceHLA restricted peptide 479Leu Val Cys Ser Met Glu Asn Thr Arg Ala 1 5 10 4809PRTArtificial sequenceHLA restricted peptide 480Leu Val Ser Gln Tyr Thr Pro Asp Ser 1 5 48110PRTArtificial sequenceHLA restricted peptide 481Leu Val Ser Gln Tyr Thr Pro Asp Ser Thr 1 5 10 48210PRTArtificial sequenceHLA restricted peptide 482Leu Val Thr Thr Glu Arg Lys Thr Pro Arg 1 5 10 48310PRTArtificial sequenceHLA restricted peptide 483Met Ala Gly Ala Ser Thr Ser Ala Gly Arg 1 5 10 4849PRTArtificial sequenceHLA restricted peptide 484Met Ala Ser Val Leu Gly Pro Ile Ser 1 5 4859PRTArtificial sequenceHLA restricted peptide 485Met Glu Asn Thr Arg Ala Thr Lys Met 1 5 48610PRTArtificial sequenceHLA restricted peptide 486Met Glu Asn Thr Arg Ala Thr Lys Met Gln 1 5 10 4879PRTArtificial sequenceHLA restricted peptide 487Met His Val Thr Leu Gly Ser Asp Val 1 5 48810PRTArtificial sequenceHLA restricted peptide 488Met Ile Ile Lys Pro Gly Lys Ile Ser His 1 5 10 4899PRTArtificial sequenceHLA restricted peptide 489Met Ile Ser Val Leu Gly Pro Ile Ser 1 5 4909PRTArtificial sequenceHLA restricted peptide 490Met Leu Asp Val Ala Phe Thr Ser His 1 5 4919PRTArtificial sequenceHLA restricted peptide 491Met Leu Asn Ile Pro Ser Ile Asn Val 1 5 49210PRTArtificial sequenceHLA restricted peptide 492Met Leu Asn Ile Pro Ser Ile Asn Val His 1 5 10 49310PRTArtificial sequenceHLA restricted peptide 493Met Asn Gly Gln Gln Ile Phe Leu Glu Val 1 5 10 4949PRTArtificial sequenceHLA restricted peptide 494Met Gln Val Ile Gly Asp Gln Tyr Val 1 5 49510PRTArtificial sequenceHLA restricted peptide 495Met Gln Val Ile Gly Asp Gln Tyr Val Lys 1 5 10 4969PRTArtificial sequenceHLA restricted peptide 496Met Arg Pro His Glu Arg Asn Gly Phe 1 5 49710PRTArtificial sequenceHLA restricted peptide 497Met Arg Pro His Glu Arg Asn Gly Phe Thr 1 5 10 49810PRTArtificial sequenceHLA restricted peptide 498Met Ser Ile Tyr Val Tyr Ala Leu Pro Leu 1 5 10 49910PRTArtificial sequenceHLA restricted peptide 499Met Thr Arg Gly Arg Leu Lys Ala Glu Ser 1 5 10 5009PRTArtificial sequenceHLA restricted peptide 500Met Thr Arg Asn Pro Gln Pro Phe Met 1 5 50110PRTArtificial sequenceHLA restricted peptide 501Met Thr Arg Asn Pro Gln Pro Phe Met Arg 1 5 10 5029PRTArtificial sequenceHLA restricted peptide 502Met Val Ala Thr Val Gln Gly Gln Asn 1 5 50310PRTArtificial sequenceHLA restricted peptide 503Met Val Ala Thr Val Gln Gly Gln Asn Leu 1 5 10 50410PRTArtificial sequenceHLA restricted peptide 504Asn Asp Ile Tyr Arg Ile Phe Ala Glu Leu 1 5 10 5059PRTArtificial sequenceHLA restricted peptide 505Asn Glu Ile His Asn Pro Ala Val Phe 1 5 50610PRTArtificial sequenceHLA restricted peptide 506Asn Glu Ile His Asn Pro Ala Val Phe Thr 1 5 10 5079PRTArtificial sequenceHLA restricted peptide 507Asn Gly Phe Thr Val Leu Cys Pro Lys 1 5 50810PRTArtificial sequenceHLA restricted peptide 508Asn Gly Phe Thr Val Leu Cys Pro Lys Asn 1 5 10 5099PRTArtificial sequenceHLA restricted peptide 509Asn Gly Gln Gln Ile Phe Leu Glu Val 1 5 5109PRTArtificial sequenceHLA restricted peptide 510Asn Ile Pro Ser Ile Asn Val His His 1 5 51110PRTArtificial sequenceHLA restricted peptide 511Asn Ile Pro Ser Ile Asn Val His His Tyr 1 5 10 5129PRTArtificial sequenceHLA restricted peptide 512Asn Leu Lys Tyr Gln Glu Phe Phe Trp 1 5 5139PRTArtificial sequenceHLA restricted peptide 513Asn Leu Leu Met Asn Gly Gln Gln Ile 1 5 51410PRTArtificial sequenceHLA restricted peptide 514Asn Leu Leu Met Asn Gly Gln Gln Ile Phe 1 5 10 51510PRTArtificial sequenceHLA restricted peptide 515Tyr Tyr Thr Ser Ala Phe Val Phe Pro Thr 1 5 10 5169PRTArtificial sequenceHLA restricted peptide 516Asn Met Ile Ile Lys Pro Gly Lys Ile 1 5 51710PRTArtificial sequenceHLA restricted peptide 517Asn Met Ile Ile Lys Pro Gly Lys Ile Ser 1 5 10 5189PRTArtificial sequenceHLA restricted peptide 518Asn Pro Ala Val Phe Thr Trp Pro Pro 1 5 51910PRTArtificial sequenceHLA restricted peptide 519Asn Pro Ala Val Phe Thr Trp Pro Pro Trp 1 5 10 5209PRTArtificial sequenceHLA restricted peptide 520Asn Pro Gln Pro Phe Met Arg Pro His 1 5 52110PRTArtificial sequenceHLA restricted peptide 521Asn Pro Gln Pro Phe Met Arg Pro His Glu 1 5 10 5229PRTArtificial sequenceHLA restricted peptide 522Asn Pro Thr Gly Arg Ser Ile Cys Pro 1 5 52310PRTArtificial sequenceHLA restricted peptide 523Asn Pro Thr Gly Arg Ser Ile Cys Pro Ser 1 5 10 5249PRTArtificial sequenceHLA restricted peptide 524Asn Gln Leu Gln Val Gln His Thr Tyr 1 5 52510PRTArtificial sequenceHLA restricted peptide 525Asn Gln Leu Gln Val Gln His Thr Tyr Phe 1 5 10 5269PRTArtificial sequenceHLA restricted peptide 526Asn Gln Trp Lys Glu Pro Asp Val Tyr 1 5 52710PRTArtificial sequenceHLA restricted peptide 527Asn Gln Trp Lys Glu Pro Asp Val Tyr Tyr 1 5 10 5289PRTArtificial sequenceHLA restricted peptide 528Asn Thr Arg Ala Thr Lys Met Gln Val 1 5 52910PRTArtificial sequenceHLA restricted peptide 529Asn Thr Arg Ala Thr Lys Met Gln Val Ile 1 5 10 5309PRTArtificial sequenceHLA restricted peptide 530Asn Val His His Tyr Pro Ser Ala Ala 1 5 5319PRTArtificial sequenceHLA restricted peptide 531Asn Val His Asn Pro Thr Gly Arg Ser 1 5 53210PRTArtificial sequenceHLA restricted peptide 532Asn Val His Asn Pro Thr Gly Arg Ser Ile 1 5 10 53310PRTArtificial sequenceHLA restricted peptide 533Asn Val Ser Val Asn Val His Asn Pro Thr 1 5 10 5349PRTArtificial sequenceHLA restricted peptide 534Pro Ala Ala Gln Pro Lys Arg Arg Arg 1 5 5359PRTArtificial sequenceHLA restricted peptide 535Pro Ala Val Phe Thr Trp Pro Pro Trp 1 5 5369PRTArtificial sequenceHLA restricted peptide 536Pro Cys His Arg Gly Asp Asn Gln Leu 1 5 5379PRTArtificial sequenceHLA restricted peptide 537Pro Cys Ile Ala Ser Thr Pro Lys Lys 1 5 5389PRTArtificial sequenceHLA restricted peptide 538Pro Asp Val Tyr Tyr Thr Ser Ala Phe 1 5 53910PRTArtificial sequenceHLA restricted peptide 539Pro Asp Val Tyr Tyr Thr Ser Ala Phe Val 1 5 10 54010PRTArtificial sequenceHLA restricted peptide 540Pro Glu Met Ile Ser Val Leu Gly Pro Ile 1 5 10 5419PRTArtificial sequenceHLA restricted peptide 541Pro Gly Lys Ile Ser His Ile Met Leu 1 5 5429PRTArtificial sequenceHLA restricted peptide 542Pro Gly Leu Ser Ile Ser Gly Asn Leu 1 5 54310PRTArtificial sequenceHLA restricted peptide 543Pro Gly Leu Ser Ile Ser Gly Asn Leu Leu 1 5 10 5449PRTArtificial sequenceHLA restricted peptide 544Pro His Glu Arg Asn Gly Phe Thr Val 1 5 54510PRTArtificial sequenceHLA restricted peptide 545Pro His Glu Arg Asn Gly Phe Thr Val Leu 1 5 10 5469PRTArtificial sequenceHLA restricted peptide 546Pro His Glu Thr Arg Leu Leu Gln Thr 1 5 5479PRTArtificial sequenceHLA restricted peptide 547Pro Met Ser Ile Tyr Val Tyr Ala Leu 1 5 5489PRTArtificial sequenceHLA restricted peptide 548Pro Pro Trp Gln Ala Gly Ile Leu Ala 1 5 54910PRTArtificial sequenceHLA restricted peptide 549Pro Pro Trp Gln Ala Gly Ile Leu Ala Arg 1 5 10 55010PRTArtificial sequenceHLA restricted peptide 550Pro Gln Pro Phe Met Arg Pro His Glu Arg 1 5 10 5519PRTArtificial sequenceHLA restricted peptide 551Pro Gln Tyr Ser Glu His Pro Thr Phe 1 5 55210PRTArtificial sequenceHLA restricted peptide 552Pro Gln Tyr Ser Glu His Pro Thr Phe Thr 1 5 10 5539PRTArtificial sequenceHLA restricted peptide 553Pro Arg Val Thr Gly Gly Gly Ala Met 1 5 55410PRTArtificial sequenceHLA restricted peptide 554Pro Arg Val Thr Gly Gly Gly Ala Met Ala 1 5 10 5559PRTArtificial sequenceHLA restricted peptide 555Pro Ser Ala Ala Glu Arg Lys His Arg 1 5 5569PRTArtificial sequenceHLA restricted peptide 556Pro Ser Leu Ile Leu Val Ser Gln Tyr 1 5 5579PRTArtificial sequenceHLA restricted peptide 557Pro Ser Gln Glu Pro Met Ser Ile Tyr 1 5 5589PRTArtificial sequenceHLA restricted peptide 558Pro Thr Phe Thr Ser Gln Tyr Arg Ile 1 5 5599PRTArtificial sequenceHLA restricted peptide 559Pro Val Ala Asp Ala Val Ile His Ala 1 5 5609PRTArtificial sequenceHLA restricted peptide 560Pro Val Leu Pro His Glu Thr Arg Leu 1 5 56110PRTArtificial sequenceHLA restricted peptide 561Pro Val Leu Pro His Glu Thr Arg Leu Leu 1 5 10 5629PRTArtificial sequenceHLA restricted peptide 562Gln Ala Gly Ile Leu Ala Arg Asn Leu 1 5 56310PRTArtificial sequenceHLA restricted peptide 563Gln Ala Gly Ile Leu Ala Arg Asn Leu Val 1 5 10 5649PRTArtificial sequenceHLA restricted peptide 564Gln Ala Ile Arg Glu Thr Val Glu Leu 1 5 56510PRTArtificial sequenceHLA restricted peptide 565Gln Ala Ile Arg Glu Thr Val Glu Leu Arg 1 5 10 5669PRTArtificial sequenceHLA restricted peptide 566Gln Ala Arg Leu Thr Val Ser Gly Leu 1 5 56710PRTArtificial sequenceHLA restricted peptide 567Gln Ala Arg Leu Thr Val Ser Gly Leu Ala 1 5 10 5689PRTArtificial sequenceHLA restricted peptide 568Gln Asp Ala Leu Pro

Gly Pro Cys Ile 1 5 56910PRTArtificial sequenceHLA restricted peptide 569Gln Asp Ala Leu Pro Gly Pro Cys Ile Ala 1 5 10 5709PRTArtificial sequenceHLA restricted peptide 570Gln Glu Phe Phe Trp Asp Ala Asn Asp 1 5 57110PRTArtificial sequenceHLA restricted peptide 571Gln Glu Phe Phe Trp Asp Ala Asn Asp Ile 1 5 10 5729PRTArtificial sequenceHLA restricted peptide 572Gln Glu Pro Met Ser Ile Tyr Val Tyr 1 5 57310PRTArtificial sequenceHLA restricted peptide 573Gln Glu Pro Met Ser Ile Tyr Val Tyr Ala 1 5 10 5749PRTArtificial sequenceHLA restricted peptide 574Gln Gly Asp Asp Asp Val Trp Thr Ser 1 5 5759PRTArtificial sequenceHLA restricted peptide 575Gln Gly Lys Leu Glu Tyr Arg His Thr 1 5 57610PRTArtificial sequenceHLA restricted peptide 576Gln Gly Lys Leu Glu Tyr Arg His Thr Trp 1 5 10 57710PRTArtificial sequenceHLA restricted peptide 577Gln Gly Gln Asn Leu Lys Tyr Gln Glu Phe 1 5 10 57810PRTArtificial sequenceHLA restricted peptide 578Gln His Thr Tyr Phe Thr Gly Ser Glu Val 1 5 10 5799PRTArtificial sequenceHLA restricted peptide 579Gln Ile Phe Leu Glu Val Gln Ala Ile 1 5 58010PRTArtificial sequenceHLA restricted peptide 580Gln Ile Phe Leu Glu Val Gln Ala Ile Arg 1 5 10 5819PRTArtificial sequenceHLA restricted peptide 581Gln Leu Gln Val Gln His Thr Tyr Phe 1 5 58210PRTArtificial sequenceHLA restricted peptide 582Gln Leu Gln Val Gln His Thr Tyr Phe Thr 1 5 10 5839PRTArtificial sequenceHLA restricted peptide 583Gln Met Trp Gln Ala Arg Leu Thr Val 1 5 58410PRTArtificial sequenceHLA restricted peptide 584Gln Met Trp Gln Ala Arg Leu Thr Val Ser 1 5 10 5859PRTArtificial sequenceHLA restricted peptide 585Gln Asn Leu Lys Tyr Gln Glu Phe Phe 1 5 58610PRTArtificial sequenceHLA restricted peptide 586Gln Asn Leu Lys Tyr Gln Glu Phe Phe Trp 1 5 10 5879PRTArtificial sequenceHLA restricted peptide 587Gln Asn Gln Trp Lys Glu Pro Asp Val 1 5 58810PRTArtificial sequenceHLA restricted peptide 588Gln Asn Gln Trp Lys Glu Pro Asp Val Tyr 1 5 10 5899PRTArtificial sequenceHLA restricted peptide 589Gln Pro Ala Ala Gln Pro Lys Arg Arg 1 5 59010PRTArtificial sequenceHLA restricted peptide 590Gln Pro Ala Ala Gln Pro Lys Arg Arg Arg 1 5 10 5919PRTArtificial sequenceHLA restricted peptide 591Gln Pro Phe Met Arg Pro His Glu Arg 1 5 59210PRTArtificial sequenceHLA restricted peptide 592Gln Pro Phe Met Arg Pro His Glu Arg Asn 1 5 10 5939PRTArtificial sequenceHLA restricted peptide 593Gln Pro Lys Arg Arg Arg His Arg Gln 1 5 59410PRTArtificial sequenceHLA restricted peptide 594Gln Pro Lys Arg Arg Arg His Arg Gln Asp 1 5 10 5959PRTArtificial sequenceHLA restricted peptide 595Gln Pro Ser Leu Ile Leu Val Ser Gln 1 5 59610PRTArtificial sequenceHLA restricted peptide 596Gln Pro Ser Leu Ile Leu Val Ser Gln Tyr 1 5 10 5979PRTArtificial sequenceHLA restricted peptide 597Gln Gln Ile Phe Leu Glu Val Gln Ala 1 5 59810PRTArtificial sequenceHLA restricted peptide 598Gln Gln Ile Phe Leu Glu Val Gln Ala Ile 1 5 10 5999PRTArtificial sequenceHLA restricted peptide 599Gln Gln Asn Gln Trp Lys Glu Pro Asp 1 5 60010PRTArtificial sequenceHLA restricted peptide 600Gln Gln Asn Gln Trp Lys Glu Pro Asp Val 1 5 10 6019PRTArtificial sequenceHLA restricted peptide 601Gln Arg Gly Pro Gln Tyr Ser Glu His 1 5 60210PRTArtificial sequenceHLA restricted peptide 602Gln Arg Gly Pro Gln Tyr Ser Glu His Pro 1 5 10 6039PRTArtificial sequenceHLA restricted peptide 603Gln Val Ile Gly Asp Gln Tyr Val Lys 1 5 60410PRTArtificial sequenceHLA restricted peptide 604Gln Val Ile Gly Asp Gln Tyr Val Lys Val 1 5 10 60510PRTArtificial sequenceHLA restricted peptide 605Gln Val Gln His Thr Tyr Phe Thr Gly Ser 1 5 10 6069PRTArtificial sequenceHLA restricted peptide 606Gln Trp Lys Glu Pro Asp Val Tyr Tyr 1 5 60710PRTArtificial sequenceHLA restricted peptide 607Gln Trp Lys Glu Pro Asp Val Tyr Tyr Thr 1 5 10 6089PRTArtificial sequenceHLA restricted peptide 608Gln Tyr Asp Pro Val Ala Ala Leu Phe 1 5 60910PRTArtificial sequenceHLA restricted peptide 609Gln Tyr Asp Pro Val Ala Ala Leu Phe Phe 1 5 10 61010PRTArtificial sequenceHLA restricted peptide 610Gln Tyr Arg Ile Gln Gly Lys Leu Glu Tyr 1 5 10 6119PRTArtificial sequenceHLA restricted peptide 611Gln Tyr Ser Glu His Pro Thr Phe Thr 1 5 61210PRTArtificial sequenceHLA restricted peptide 612Gln Tyr Ser Glu His Pro Thr Phe Thr Ser 1 5 10 6139PRTArtificial sequenceHLA restricted peptide 613Gln Tyr Thr Pro Asp Ser Thr Pro Cys 1 5 6149PRTArtificial sequenceHLA restricted peptide 614Gln Tyr Val Lys Val Tyr Leu Glu Ser 1 5 61510PRTArtificial sequenceHLA restricted peptide 615Gln Tyr Val Lys Val Tyr Leu Glu Ser Phe 1 5 10 6169PRTArtificial sequenceHLA restricted peptide 616Arg Cys Pro Glu Met Ile Ser Val Leu 1 5 6179PRTArtificial sequenceHLA restricted peptide 617Arg Glu Thr Val Glu Leu Arg Gln Tyr 1 5 6189PRTArtificial sequenceHLA restricted peptide 618Arg Gly Asp Asn Gln Leu Gln Val Gln 1 5 61910PRTArtificial sequenceHLA restricted peptide 619Arg Gly Asp Asn Gln Leu Gln Val Gln His 1 5 10 6209PRTArtificial sequenceHLA restricted peptide 620Arg Gly Asp Thr Pro Val Leu Pro His 1 5 62110PRTArtificial sequenceHLA restricted peptide 621Arg Gly Pro Gln Tyr Ser Glu His Pro Thr 1 5 10 6229PRTArtificial sequenceHLA restricted peptide 622Arg Gly Arg Leu Lys Ala Glu Ser Thr 1 5 62310PRTArtificial sequenceHLA restricted peptide 623Arg Gly Arg Leu Lys Ala Glu Ser Thr Val 1 5 10 6249PRTArtificial sequenceHLA restricted peptide 624Arg Gly Arg Arg Cys Pro Glu Met Ile 1 5 62510PRTArtificial sequenceHLA restricted peptide 625Arg Gly Arg Arg Cys Pro Glu Met Ile Ser 1 5 10 6269PRTArtificial sequenceHLA restricted peptide 626Arg His Asp Glu Gly Ala Ala Gln Gly 1 5 62710PRTArtificial sequenceHLA restricted peptide 627Arg His Asp Glu Gly Ala Ala Gln Gly Asp 1 5 10 6289PRTArtificial sequenceHLA restricted peptide 628Arg His Leu Pro Val Ala Asp Ala Val 1 5 62910PRTArtificial sequenceHLA restricted peptide 629Arg His Leu Pro Val Ala Asp Ala Val Ile 1 5 10 6309PRTArtificial sequenceHLA restricted peptide 630Arg His Val Val Cys Ala His Glu Leu 1 5 63110PRTArtificial sequenceHLA restricted peptide 631Arg His Val Val Cys Ala His Glu Leu Val 1 5 10 6329PRTArtificial sequenceHLA restricted peptide 632Arg Ile Phe Ala Glu Leu Glu Gly Val 1 5 63310PRTArtificial sequenceHLA restricted peptide 633Arg Ile Phe Ala Glu Leu Glu Gly Val Trp 1 5 10 6349PRTArtificial sequenceHLA restricted peptide 634Arg Ile Gln Gly Lys Leu Glu Tyr Arg 1 5 63510PRTArtificial sequenceHLA restricted peptide 635Arg Ile Gln Gly Lys Leu Glu Tyr Arg His 1 5 10 6369PRTArtificial sequenceHLA restricted peptide 636Arg Lys His Arg His Leu Pro Val Ala 1 5 6379PRTArtificial sequenceHLA restricted peptide 637Arg Lys Ser Ala Ser Ser Ala Thr Ala 1 5 63810PRTArtificial sequenceHLA restricted peptide 638Arg Lys Ser Ala Ser Ser Ala Thr Ala Cys 1 5 10 6399PRTArtificial sequenceHLA restricted peptide 639Arg Leu Lys Ala Glu Ser Thr Val Ala 1 5 6409PRTArtificial sequenceHLA restricted peptide 640Arg Leu Leu Gln Thr Gly Ile His Val 1 5 64110PRTArtificial sequenceHLA restricted peptide 641Arg Leu Leu Gln Thr Gly Ile His Val Arg 1 5 10 6429PRTArtificial sequenceHLA restricted peptide 642Arg Leu Thr Val Ser Gly Leu Ala Trp 1 5 64310PRTArtificial sequenceHLA restricted peptide 643Arg Leu Thr Val Ser Gly Leu Ala Trp Thr 1 5 10 64410PRTArtificial sequenceHLA restricted peptide 644Arg Asn Gly Phe Thr Val Leu Cys Pro Lys 1 5 10 6459PRTArtificial sequenceHLA restricted peptide 645Arg Asn Leu Val Pro Met Val Ala Thr 1 5 64610PRTArtificial sequenceHLA restricted peptide 646Arg Asn Leu Val Pro Met Val Ala Thr Val 1 5 10 64710PRTArtificial sequenceHLA restricted peptide 647Arg Asn Pro Gln Pro Phe Met Arg Pro His 1 5 10 6489PRTArtificial sequenceHLA restricted peptide 648Arg Pro His Glu Arg Asn Gly Phe Thr 1 5 64910PRTArtificial sequenceHLA restricted peptide 649Arg Pro His Glu Arg Asn Gly Phe Thr Val 1 5 10 6509PRTArtificial sequenceHLA restricted peptide 650Arg Gln Asp Ala Leu Pro Gly Pro Cys 1 5 65110PRTArtificial sequenceHLA restricted peptide 651Arg Gln Asp Ala Leu Pro Gly Pro Cys Ile 1 5 10 6529PRTArtificial sequenceHLA restricted peptide 652Arg Gln Gln Asn Gln Trp Lys Glu Pro 1 5 65310PRTArtificial sequenceHLA restricted peptide 653Arg Gln Gln Asn Gln Trp Lys Glu Pro Asp 1 5 10 6549PRTArtificial sequenceHLA restricted peptide 654Arg Gln Tyr Asp Pro Val Ala Ala Leu 1 5 65510PRTArtificial sequenceHLA restricted peptide 655Arg Gln Tyr Asp Pro Val Ala Ala Leu Phe 1 5 10 6569PRTArtificial sequenceHLA restricted peptide 656Arg Arg Cys Pro Glu Met Ile Ser Val 1 5 65710PRTArtificial sequenceHLA restricted peptide 657Arg Arg Cys Pro Glu Met Ile Ser Val Leu 1 5 10 6589PRTArtificial sequenceHLA restricted peptide 658Arg Arg His Arg Gln Asp Ala Leu Pro 1 5 65910PRTArtificial sequenceHLA restricted peptide 659Arg Arg His Arg Gln Asp Ala Leu Pro Gly 1 5 10 6609PRTArtificial sequenceHLA restricted peptide 660Arg Arg Arg His Arg Gln Asp Ala Leu 1 5 66110PRTArtificial sequenceHLA restricted peptide 661Arg Arg Arg His Arg Gln Asp Ala Leu Pro 1 5 10 66210PRTArtificial sequenceHLA restricted peptide 662Arg Ser Ile Cys Pro Ser Gln Glu Pro Met 1 5 10 6639PRTArtificial sequenceHLA restricted peptide 663Arg Val Ser Gln Pro Ser Leu Ile Leu 1 5 66410PRTArtificial sequenceHLA restricted peptide 664Arg Val Ser Gln Pro Ser Leu Ile Leu Val 1 5 10 6659PRTArtificial sequenceHLA restricted peptide 665Arg Val Thr Gly Gly Gly Ala Met Ala 1 5 6669PRTArtificial sequenceHLA restricted peptide 666Ser Ala Ala Glu Arg Lys His Arg His 1 5 66710PRTArtificial sequenceHLA restricted peptide 667Ser Ala Ala Glu Arg Lys His Arg His Leu 1 5 10 6689PRTArtificial sequenceHLA restricted peptide 668Ser Ala Phe Val Phe Pro Thr Lys Asp 1 5 66910PRTArtificial sequenceHLA restricted peptide 669Ser Ala Phe Val Phe Pro Thr Lys Asp Val 1 5 10 6709PRTArtificial sequenceHLA restricted peptide 670Ser Ala Gly Arg Lys Arg Lys Ser Ala 1 5 67110PRTArtificial sequenceHLA restricted peptide 671Ser Ala Gly Arg Lys Arg Lys Ser Ala Ser 1 5 10 6729PRTArtificial sequenceHLA restricted peptide 672Ser Ala Ser Ser Ala Thr Ala Cys Thr 1 5 67310PRTArtificial sequenceHLA restricted peptide 673Ser Ala Ser Ser Ala Thr Ala Cys Thr Ala 1 5 10 67410PRTArtificial sequenceHLA restricted peptide 674Ser Ala Ser Ser Ala Thr Ala Cys Thr Ser 1 5 10 6759PRTArtificial sequenceHLA restricted peptide 675Ser Ala Thr Ala Cys Thr Ala Gly Val 1 5 67610PRTArtificial sequenceHLA restricted peptide 676Ser Ala Thr Ala Cys Thr Ala Gly Val Met 1 5 10 6779PRTArtificial sequenceHLA restricted peptide 677Ser Ala Thr Ala Cys Thr Ser Gly Val 1 5 67810PRTArtificial sequenceHLA restricted peptide 678Ser Ala Thr Ala Cys Thr Ser Gly Val Met 1 5 10 6799PRTArtificial sequenceHLA restricted peptide 679Ser Asp Asn Glu Ile His Asn Pro Ala 1 5 68010PRTArtificial sequenceHLA restricted peptide 680Ser Asp Asn Glu Ile His Asn Pro Ala Val 1 5 10 6819PRTArtificial sequenceHLA restricted peptide 681Ser Asp Ser Asp Glu Glu Leu Val Thr 1 5 68210PRTArtificial sequenceHLA restricted peptide 682Ser Asp Ser Asp Glu Glu Leu Val Thr Thr 1 5 10 6839PRTArtificial sequenceHLA restricted peptide 683Ser Asp Val Glu Glu Asp Leu Thr Met 1 5 68410PRTArtificial sequenceHLA restricted peptide 684Ser Asp Val Glu Glu Asp Leu Thr Met Thr 1 5 10 6859PRTArtificial sequenceHLA restricted peptide 685Ser Glu His Pro Thr Phe Thr Ser Gln 1 5 68610PRTArtificial sequenceHLA restricted peptide 686Ser Glu His Pro Thr Phe Thr Ser Gln Tyr 1 5 10 6879PRTArtificial sequenceHLA restricted peptide 687Ser Glu Val Glu Asn Val Ser Val Asn 1 5 68810PRTArtificial sequenceHLA restricted peptide 688Ser Glu Val Glu Asn Val Ser Val Asn Val 1 5 10 6899PRTArtificial sequenceHLA restricted peptide 689Ser Phe Cys Glu Asp Val Pro Ser Gly 1 5 69010PRTArtificial sequenceHLA restricted peptide 690Ser Phe Cys Glu Asp Val Pro Ser Gly Lys 1 5 10 6919PRTArtificial sequenceHLA restricted peptide 691Ser Gly His Val Leu Lys Ala Val Phe 1 5 69210PRTArtificial sequenceHLA restricted peptide 692Ser Gly His Val Leu Lys Ala Val Phe Ser 1 5 10 6939PRTArtificial sequenceHLA restricted peptide 693Ser Gly Lys Leu Phe Met His Val Thr 1 5 69410PRTArtificial sequenceHLA restricted peptide 694Ser Gly Lys Leu Phe Met His Val Thr Leu 1 5 10 6959PRTArtificial sequenceHLA restricted peptide 695Ser Gly Lys Gln Met Trp Gln Ala Arg 1 5 69610PRTArtificial sequenceHLA restricted peptide 696Ser Gly Lys Gln Met Trp Gln Ala Arg Leu 1 5 10 69710PRTArtificial sequenceHLA restricted peptide 697Ser Gly Leu Ala Trp Thr Arg Gln Gln Asn 1 5 10 6989PRTArtificial sequenceHLA restricted peptide 698Ser Gly Ser Asp Ser Asp Glu Glu Leu 1 5 69910PRTArtificial sequenceHLA restricted peptide 699Ser Gly Ser Asp Ser Asp Glu Glu Leu Val 1 5 10 7009PRTArtificial sequenceHLA restricted peptide 700Ser Gly Val Met Thr Arg Gly Arg Leu 1 5 70110PRTArtificial sequenceHLA restricted peptide 701Ser Gly Val Met Thr Arg Gly Arg Leu Lys 1 5 10 7029PRTArtificial sequenceHLA restricted peptide 702Ser His Glu His Phe Gly Leu Leu Cys 1 5 70310PRTArtificial sequenceHLA restricted peptide 703Ser His Glu His Phe Gly Leu Leu Cys Pro 1 5 10 7049PRTArtificial sequenceHLA restricted peptide 704Ser His Ile Met Leu Asp Val Ala Phe 1 5 70510PRTArtificial sequenceHLA restricted peptide 705Ser His Ile Met Leu Asp Val Ala Phe Thr 1 5 10 7069PRTArtificial sequenceHLA

restricted peptide 706Ser Ile Cys Pro Ser Gln Glu Pro Met 1 5 70710PRTArtificial sequenceHLA restricted peptide 707Ser Ile Cys Pro Ser Gln Glu Pro Met Ser 1 5 10 7089PRTArtificial sequenceHLA restricted peptide 708Ser Ile Asn Val His His Tyr Pro Ser 1 5 70910PRTArtificial sequenceHLA restricted peptide 709Ser Ile Asn Val His His Tyr Pro Ser Ala 1 5 10 71010PRTArtificial sequenceHLA restricted peptide 710Ser Ile Pro Gly Leu Ser Ile Ser Gly Asn 1 5 10 7119PRTArtificial sequenceHLA restricted peptide 711Ser Ile Ser Gly Asn Leu Leu Met Asn 1 5 7129PRTArtificial sequenceHLA restricted peptide 712Ser Ile Tyr Val Tyr Ala Leu Pro Leu 1 5 71310PRTArtificial sequenceHLA restricted peptide 713Ser Ile Tyr Val Tyr Ala Leu Pro Leu Lys 1 5 10 7149PRTArtificial sequenceHLA restricted peptide 714Ser Leu Ile Leu Val Ser Gln Tyr Thr 1 5 7159PRTArtificial sequenceHLA restricted peptide 715Ser Met Glu Asn Thr Arg Ala Thr Lys 1 5 71610PRTArtificial sequenceHLA restricted peptide 716Ser Met Glu Asn Thr Arg Ala Thr Lys Met 1 5 10 7179PRTArtificial sequenceHLA restricted peptide 717Ser Gln Glu Pro Met Ser Ile Tyr Val 1 5 71810PRTArtificial sequenceHLA restricted peptide 718Ser Gln Glu Pro Met Ser Ile Tyr Val Tyr 1 5 10 7199PRTArtificial sequenceHLA restricted peptide 719Ser Gln Pro Ser Leu Ile Leu Val Ser 1 5 72010PRTArtificial sequenceHLA restricted peptide 720Ser Gln Pro Ser Leu Ile Leu Val Ser Gln 1 5 10 7219PRTArtificial sequenceHLA restricted peptide 721Ser Gln Tyr Arg Ile Gln Gly Lys Leu 1 5 72210PRTArtificial sequenceHLA restricted peptide 722Ser Gln Tyr Arg Ile Gln Gly Lys Leu Glu 1 5 10 7239PRTArtificial sequenceHLA restricted peptide 723Ser Gln Tyr Thr Pro Asp Ser Thr Pro 1 5 72410PRTArtificial sequenceHLA restricted peptide 724Ser Gln Tyr Thr Pro Asp Ser Thr Pro Cys 1 5 10 7259PRTArtificial sequenceHLA restricted peptide 725Ser Arg Gly Asp Thr Pro Val Leu Pro 1 5 72610PRTArtificial sequenceHLA restricted peptide 726Ser Arg Gly Asp Thr Pro Val Leu Pro His 1 5 10 7279PRTArtificial sequenceHLA restricted peptide 727Ser Arg Gly Arg Arg Cys Pro Glu Met 1 5 72810PRTArtificial sequenceHLA restricted peptide 728Ser Arg Gly Arg Arg Cys Pro Glu Met Ile 1 5 10 72910PRTArtificial sequenceHLA restricted peptide 729Ser Ser Ala Thr Ala Cys Thr Ala Gly Val 1 5 10 73010PRTArtificial sequenceHLA restricted peptide 730Ser Ser Ala Thr Ala Cys Thr Ser Gly Val 1 5 10 7319PRTArtificial sequenceHLA restricted peptide 731Ser Thr Pro Cys His Arg Gly Asp Asn 1 5 7329PRTArtificial sequenceHLA restricted peptide 732Ser Thr Ser Ala Gly Arg Lys Arg Lys 1 5 7339PRTArtificial sequenceHLA restricted peptide 733Ser Thr Val Ala Pro Glu Glu Asp Thr 1 5 7349PRTArtificial sequenceHLA restricted peptide 734Ser Val Leu Gly Pro Ile Ser Gly His 1 5 73510PRTArtificial sequenceHLA restricted peptide 735Ser Val Leu Gly Pro Ile Ser Gly His Val 1 5 10 73610PRTArtificial sequenceHLA restricted peptide 736Ser Val Asn Val His Asn Pro Thr Gly Arg 1 5 10 7379PRTArtificial sequenceHLA restricted peptide 737Thr Ala Cys Thr Ala Gly Val Met Thr 1 5 73810PRTArtificial sequenceHLA restricted peptide 738Thr Ala Cys Thr Ala Gly Val Met Thr Arg 1 5 10 7399PRTArtificial sequenceHLA restricted peptide 739Thr Ala Cys Thr Ser Gly Val Met Thr 1 5 74010PRTArtificial sequenceHLA restricted peptide 740Thr Ala Cys Thr Ser Gly Val Met Thr Arg 1 5 10 7419PRTArtificial sequenceHLA restricted peptide 741Thr Ala Gly Val Met Thr Arg Gly Arg 1 5 74210PRTArtificial sequenceHLA restricted peptide 742Thr Ala Gly Val Met Thr Arg Gly Arg Leu 1 5 10 7439PRTArtificial sequenceHLA restricted peptide 743Thr Asp Glu Asp Ser Asp Asn Glu Ile 1 5 7449PRTArtificial sequenceHLA restricted peptide 744Thr Glu Arg Lys Thr Pro Arg Val Thr 1 5 7459PRTArtificial sequenceHLA restricted peptide 745Thr Gly Gly Gly Ala Met Ala Gly Ala 1 5 74610PRTArtificial sequenceHLA restricted peptide 746Thr Gly Gly Gly Ala Met Ala Gly Ala Ser 1 5 10 7479PRTArtificial sequenceHLA restricted peptide 747Thr Gly Ser Glu Val Glu Asn Val Ser 1 5 74810PRTArtificial sequenceHLA restricted peptide 748Thr Gly Ser Glu Val Glu Asn Val Ser Val 1 5 10 7499PRTArtificial sequenceHLA restricted peptide 749Thr Lys Asp Val Ala Leu Arg His Val 1 5 75010PRTArtificial sequenceHLA restricted peptide 750Thr Lys Asp Val Ala Leu Arg His Val Val 1 5 10 75110PRTArtificial sequenceHLA restricted peptide 751Thr Lys Met Gln Val Ile Gly Asp Gln Tyr 1 5 10 75210PRTArtificial sequenceHLA restricted peptide 752Thr Leu Gly Ser Asp Val Glu Glu Asp Leu 1 5 10 7539PRTArtificial sequenceHLA restricted peptide 753Thr Met Thr Arg Asn Pro Gln Pro Phe 1 5 75410PRTArtificial sequenceHLA restricted peptide 754Thr Met Thr Arg Asn Pro Gln Pro Phe Met 1 5 10 7559PRTArtificial sequenceHLA restricted peptide 755Thr Pro Cys His Arg Gly Asp Asn Gln 1 5 75610PRTArtificial sequenceHLA restricted peptide 756Thr Pro Cys His Arg Gly Asp Asn Gln Leu 1 5 10 7579PRTArtificial sequenceHLA restricted peptide 757Thr Pro Asp Ser Thr Pro Cys His Arg 1 5 75810PRTArtificial sequenceHLA restricted peptide 758Thr Pro Asp Ser Thr Pro Cys His Arg Gly 1 5 10 7599PRTArtificial sequenceHLA restricted peptide 759Thr Pro Arg Val Thr Gly Gly Gly Ala 1 5 76010PRTArtificial sequenceHLA restricted peptide 760Thr Pro Arg Val Thr Gly Gly Gly Ala Met 1 5 10 7619PRTArtificial sequenceHLA restricted peptide 761Thr Pro Val Leu Pro His Glu Thr Arg 1 5 76210PRTArtificial sequenceHLA restricted peptide 762Thr Pro Val Leu Pro His Glu Thr Arg Leu 1 5 10 7639PRTArtificial sequenceHLA restricted peptide 763Thr Arg Ala Thr Lys Met Gln Val Ile 1 5 76410PRTArtificial sequenceHLA restricted peptide 764Thr Arg Ala Thr Lys Met Gln Val Ile Gly 1 5 10 7659PRTArtificial sequenceHLA restricted peptide 765Thr Arg Gly Arg Leu Lys Ala Glu Ser 1 5 76610PRTArtificial sequenceHLA restricted peptide 766Thr Arg Gly Arg Leu Lys Ala Glu Ser Thr 1 5 10 7679PRTArtificial sequenceHLA restricted peptide 767Thr Arg Leu Leu Gln Thr Gly Ile His 1 5 76810PRTArtificial sequenceHLA restricted peptide 768Thr Arg Leu Leu Gln Thr Gly Ile His Val 1 5 10 7699PRTArtificial sequenceHLA restricted peptide 769Thr Arg Asn Pro Gln Pro Phe Met Arg 1 5 77010PRTArtificial sequenceHLA restricted peptide 770Thr Arg Asn Pro Gln Pro Phe Met Arg Pro 1 5 10 7719PRTArtificial sequenceHLA restricted peptide 771Thr Arg Gln Gln Asn Gln Trp Lys Glu 1 5 77210PRTArtificial sequenceHLA restricted peptide 772Thr Arg Gln Gln Asn Gln Trp Lys Glu Pro 1 5 10 7739PRTArtificial sequenceHLA restricted peptide 773Thr Ser Ala Phe Val Phe Pro Thr Lys 1 5 77410PRTArtificial sequenceHLA restricted peptide 774Thr Ser Ala Gly Arg Lys Arg Lys Ser Ala 1 5 10 77510PRTArtificial sequenceHLA restricted peptide 775Thr Ser Gly Ser Asp Ser Asp Glu Glu Leu 1 5 10 7769PRTArtificial sequenceHLA restricted peptide 776Thr Ser Gly Val Met Thr Arg Gly Arg 1 5 77710PRTArtificial sequenceHLA restricted peptide 777Thr Ser Gly Val Met Thr Arg Gly Arg Leu 1 5 10 7789PRTArtificial sequenceHLA restricted peptide 778Thr Ser His Glu His Phe Gly Leu Leu 1 5 77910PRTArtificial sequenceHLA restricted peptide 779Thr Ser His Glu His Phe Gly Leu Leu Cys 1 5 10 7809PRTArtificial sequenceHLA restricted peptide 780Thr Ser Gln Tyr Arg Ile Gln Gly Lys 1 5 78110PRTArtificial sequenceHLA restricted peptide 781Thr Ser Gln Tyr Arg Ile Gln Gly Lys Leu 1 5 10 7829PRTArtificial sequenceHLA restricted peptide 782Thr Thr Glu Arg Lys Thr Pro Arg Val 1 5 78310PRTArtificial sequenceHLA restricted peptide 783Thr Thr Glu Arg Lys Thr Pro Arg Val Thr 1 5 10 7849PRTArtificial sequenceHLA restricted peptide 784Thr Val Ala Pro Glu Glu Asp Thr Asp 1 5 78510PRTArtificial sequenceHLA restricted peptide 785Thr Val Ala Pro Glu Glu Asp Thr Asp Glu 1 5 10 78610PRTArtificial sequenceHLA restricted peptide 786Thr Val Glu Leu Arg Gln Tyr Asp Pro Val 1 5 10 7879PRTArtificial sequenceHLA restricted peptide 787Thr Val Leu Cys Pro Lys Asn Met Ile 1 5 78810PRTArtificial sequenceHLA restricted peptide 788Thr Val Leu Cys Pro Lys Asn Met Ile Ile 1 5 10 7899PRTArtificial sequenceHLA restricted peptide 789Thr Val Gln Gly Gln Asn Leu Lys Tyr 1 5 7909PRTArtificial sequenceHLA restricted peptide 790Thr Val Ser Gly Leu Ala Trp Thr Arg 1 5 7919PRTArtificial sequenceHLA restricted peptide 791Thr Trp Asp Arg His Asp Glu Gly Ala 1 5 79210PRTArtificial sequenceHLA restricted peptide 792Thr Trp Asp Arg His Asp Glu Gly Ala Ala 1 5 10 7939PRTArtificial sequenceHLA restricted peptide 793Thr Trp Pro Pro Trp Gln Ala Gly Ile 1 5 79410PRTArtificial sequenceHLA restricted peptide 794Thr Trp Pro Pro Trp Gln Ala Gly Ile Leu 1 5 10 79510PRTArtificial sequenceHLA restricted peptide 795Thr Tyr Phe Thr Gly Ser Glu Val Glu Asn 1 5 10 7969PRTArtificial sequenceHLA restricted peptide 796Val Ala Ala Leu Phe Phe Phe Asp Ile 1 5 7979PRTArtificial sequenceHLA restricted peptide 797Val Ala Asp Ala Val Ile His Ala Ser 1 5 79810PRTArtificial sequenceHLA restricted peptide 798Val Ala Asp Ala Val Ile His Ala Ser Gly 1 5 10 7999PRTArtificial sequenceHLA restricted peptide 799Val Ala Phe Thr Ser His Glu His Phe 1 5 80010PRTArtificial sequenceHLA restricted peptide 800Val Ala Phe Thr Ser His Glu His Phe Gly 1 5 10 8019PRTArtificial sequenceHLA restricted peptide 801Val Ala Leu Arg His Val Val Cys Ala 1 5 80210PRTArtificial sequenceHLA restricted peptide 802Val Ala Leu Arg His Val Val Cys Ala His 1 5 10 8039PRTArtificial sequenceHLA restricted peptide 803Val Ala Thr Val Gln Gly Gln Asn Leu 1 5 80410PRTArtificial sequenceHLA restricted peptide 804Val Ala Thr Val Gln Gly Gln Asn Leu Lys 1 5 10 8059PRTArtificial sequenceHLA restricted peptide 805Val Cys Ala His Glu Leu Val Cys Ser 1 5 80610PRTArtificial sequenceHLA restricted peptide 806Val Cys Ala His Glu Leu Val Cys Ser Met 1 5 10 8079PRTArtificial sequenceHLA restricted peptide 807Val Cys Ser Met Glu Asn Thr Arg Ala 1 5 8089PRTArtificial sequenceHLA restricted peptide 808Val Glu Glu Asp Leu Thr Met Thr Arg 1 5 80910PRTArtificial sequenceHLA restricted peptide 809Val Glu Glu Asp Leu Thr Met Thr Arg Asn 1 5 10 8109PRTArtificial sequenceHLA restricted peptide 810Val Glu Leu Arg Gln Tyr Asp Pro Val 1 5 81110PRTArtificial sequenceHLA restricted peptide 811Val Glu Leu Arg Gln Tyr Asp Pro Val Ala 1 5 10 8129PRTArtificial sequenceHLA restricted peptide 812Val Glu Asn Val Ser Val Asn Val His 1 5 81310PRTArtificial sequenceHLA restricted peptide 813Val Glu Asn Val Ser Val Asn Val His Asn 1 5 10 8149PRTArtificial sequenceHLA restricted peptide 814Val Phe Pro Thr Lys Asp Val Ala Leu 1 5 81510PRTArtificial sequenceHLA restricted peptide 815Val Phe Pro Thr Lys Asp Val Ala Leu Arg 1 5 10 8169PRTArtificial sequenceHLA restricted peptide 816Val Phe Ser Arg Gly Asp Thr Pro Val 1 5 81710PRTArtificial sequenceHLA restricted peptide 817Val Phe Ser Arg Gly Asp Thr Pro Val Leu 1 5 10 8189PRTArtificial sequenceHLA restricted peptide 818Val Phe Thr Trp Pro Pro Trp Gln Ala 1 5 81910PRTArtificial sequenceHLA restricted peptide 819Val His His Tyr Pro Ser Ala Ala Glu Arg 1 5 10 8209PRTArtificial sequenceHLA restricted peptide 820Val His Asn Pro Thr Gly Arg Ser Ile 1 5 82110PRTArtificial sequenceHLA restricted peptide 821Val His Asn Pro Thr Gly Arg Ser Ile Cys 1 5 10 8229PRTArtificial sequenceHLA restricted peptide 822Val Ile Gly Asp Gln Tyr Val Lys Val 1 5 82310PRTArtificial sequenceHLA restricted peptide 823Val Ile Gly Asp Gln Tyr Val Lys Val Tyr 1 5 10 8249PRTArtificial sequenceHLA restricted peptide 824Val Ile His Ala Ser Gly Lys Gln Met 1 5 82510PRTArtificial sequenceHLA restricted peptide 825Val Ile His Ala Ser Gly Lys Gln Met Trp 1 5 10 8269PRTArtificial sequenceHLA restricted peptide 826Val Lys Val Tyr Leu Glu Ser Phe Cys 1 5 8279PRTArtificial sequenceHLA restricted peptide 827Val Leu Cys Pro Lys Asn Met Ile Ile 1 5 82810PRTArtificial sequenceHLA restricted peptide 828Val Leu Cys Pro Lys Asn Met Ile Ile Lys 1 5 10 8299PRTArtificial sequenceHLA restricted peptide 829Val Leu Gly Pro Ile Ser Gly His Val 1 5 83010PRTArtificial sequenceHLA restricted peptide 830Val Leu Gly Pro Ile Ser Gly His Val Leu 1 5 10 8319PRTArtificial sequenceHLA restricted peptide 831Val Leu Lys Ala Val Phe Ser Arg Gly 1 5 83210PRTArtificial sequenceHLA restricted peptide 832Val Leu Lys Ala Val Phe Ser Arg Gly Asp 1 5 10 8339PRTArtificial sequenceHLA restricted peptide 833Val Leu Pro His Glu Thr Arg Leu Leu 1 5 8349PRTArtificial sequenceHLA restricted peptide 834Val Met Thr Arg Gly Arg Leu Lys Ala 1 5 8359PRTArtificial sequenceHLA restricted peptide 835Val Asn Val His Asn Pro Thr Gly Arg 1 5 83610PRTArtificial sequenceHLA restricted peptide 836Val Asn Val His Asn Pro Thr Gly Arg Ser 1 5 10 8379PRTArtificial sequenceHLA restricted peptide 837Val Pro Met Val Ala Thr Val Gln Gly 1 5 83810PRTArtificial sequenceHLA restricted peptide 838Val Pro Met Val Ala Thr Val Gln Gly Gln 1 5 10 8399PRTArtificial sequenceHLA restricted peptide 839Val Pro Ser Gly Lys Leu Phe Met His 1 5 84010PRTArtificial sequenceHLA restricted peptide 840Val Pro Ser Gly Lys Leu Phe Met His Val 1 5 10 8419PRTArtificial sequenceHLA restricted peptide 841Val Gln Ala Ile Arg Glu Thr Val Glu 1 5 84210PRTArtificial sequenceHLA restricted peptide 842Val Gln Ala Ile Arg Glu Thr Val Glu Leu 1 5 10 84310PRTArtificial sequenceHLA restricted peptide 843Val Gln Gly Gln Asn Leu Lys Tyr Gln Glu 1 5 10 8449PRTArtificial sequenceHLA restricted peptide 844Val Gln His Thr Tyr

Phe Thr Gly Ser 1 5 84510PRTArtificial sequenceHLA restricted peptide 845Val Gln His Thr Tyr Phe Thr Gly Ser Glu 1 5 10 8469PRTArtificial sequenceHLA restricted peptide 846Val Arg Val Ser Gln Pro Ser Leu Ile 1 5 84710PRTArtificial sequenceHLA restricted peptide 847Val Arg Val Ser Gln Pro Ser Leu Ile Leu 1 5 10 8489PRTArtificial sequenceHLA restricted peptide 848Val Ser Gln Pro Ser Leu Ile Leu Val 1 5 84910PRTArtificial sequenceHLA restricted peptide 849Val Ser Gln Pro Ser Leu Ile Leu Val Ser 1 5 10 8509PRTArtificial sequenceHLA restricted peptide 850Val Ser Gln Tyr Thr Pro Asp Ser Thr 1 5 8519PRTArtificial sequenceHLA restricted peptide 851Val Ser Val Asn Val His Asn Pro Thr 1 5 85210PRTArtificial sequenceHLA restricted peptide 852Val Thr Gly Gly Gly Ala Met Ala Gly Ala 1 5 10 8539PRTArtificial sequenceHLA restricted peptide 853Val Thr Thr Glu Arg Lys Thr Pro Arg 1 5 85410PRTArtificial sequenceHLA restricted peptide 854Val Thr Thr Glu Arg Lys Thr Pro Arg Val 1 5 10 8559PRTArtificial sequenceHLA restricted peptide 855Val Val Cys Ala His Glu Leu Val Cys 1 5 85610PRTArtificial sequenceHLA restricted peptide 856Val Val Cys Ala His Glu Leu Val Cys Ser 1 5 10 8579PRTArtificial sequenceHLA restricted peptide 857Val Trp Gln Pro Ala Ala Gln Pro Lys 1 5 85810PRTArtificial sequenceHLA restricted peptide 858Val Trp Gln Pro Ala Ala Gln Pro Lys Arg 1 5 10 8599PRTArtificial sequenceHLA restricted peptide 859Val Tyr Ala Leu Pro Leu Lys Met Leu 1 5 86010PRTArtificial sequenceHLA restricted peptide 860Val Tyr Ala Leu Pro Leu Lys Met Leu Asn 1 5 10 8619PRTArtificial sequenceHLA restricted peptide 861Val Tyr Leu Glu Ser Phe Cys Glu Asp 1 5 86210PRTArtificial sequenceHLA restricted peptide 862Val Tyr Leu Glu Ser Phe Cys Glu Asp Val 1 5 10 8639PRTArtificial sequenceHLA restricted peptide 863Val Tyr Tyr Thr Ser Ala Phe Val Phe 1 5 8649PRTArtificial sequenceHLA restricted peptide 864Trp Asp Ala Asn Asp Ile Tyr Arg Ile 1 5 86510PRTArtificial sequenceHLA restricted peptide 865Trp Asp Ala Asn Asp Ile Tyr Arg Ile Phe 1 5 10 8669PRTArtificial sequenceHLA restricted peptide 866Trp Asp Arg His Asp Glu Gly Ala Ala 1 5 8679PRTArtificial sequenceHLA restricted peptide 867Trp Lys Glu Pro Asp Val Tyr Tyr Thr 1 5 86810PRTArtificial sequenceHLA restricted peptide 868Trp Lys Glu Pro Asp Val Tyr Tyr Thr Ser 1 5 10 8699PRTArtificial sequenceHLA restricted peptide 869Trp Pro Pro Trp Gln Ala Gly Ile Leu 1 5 87010PRTArtificial sequenceHLA restricted peptide 870Trp Pro Pro Trp Gln Ala Gly Ile Leu Ala 1 5 10 8719PRTArtificial sequenceHLA restricted peptide 871Trp Gln Ala Gly Ile Leu Ala Arg Asn 1 5 87210PRTArtificial sequenceHLA restricted peptide 872Trp Gln Ala Gly Ile Leu Ala Arg Asn Leu 1 5 10 8739PRTArtificial sequenceHLA restricted peptide 873Trp Gln Ala Arg Leu Thr Val Ser Gly 1 5 87410PRTArtificial sequenceHLA restricted peptide 874Trp Gln Ala Arg Leu Thr Val Ser Gly Leu 1 5 10 8759PRTArtificial sequenceHLA restricted peptide 875Trp Gln Pro Ala Ala Gln Pro Lys Arg 1 5 87610PRTArtificial sequenceHLA restricted peptide 876Trp Gln Pro Ala Ala Gln Pro Lys Arg Arg 1 5 10 8779PRTArtificial sequenceHLA restricted peptide 877Trp Thr Arg Gln Gln Asn Gln Trp Lys 1 5 8789PRTArtificial sequenceHLA restricted peptide 878Tyr Ala Leu Pro Leu Lys Met Leu Asn 1 5 87910PRTArtificial sequenceHLA restricted peptide 879Tyr Ala Leu Pro Leu Lys Met Leu Asn Ile 1 5 10 8809PRTArtificial sequenceHLA restricted peptide 880Tyr Asp Pro Val Ala Ala Leu Phe Phe 1 5 88110PRTArtificial sequenceHLA restricted peptide 881Tyr Asp Pro Val Ala Ala Leu Phe Phe Phe 1 5 10 8829PRTArtificial sequenceHLA restricted peptide 882Tyr Phe Thr Gly Ser Glu Val Glu Asn 1 5 88310PRTArtificial sequenceHLA restricted peptide 883Tyr Phe Thr Gly Ser Glu Val Glu Asn Val 1 5 10 8849PRTArtificial sequenceHLA restricted peptide 884Tyr Leu Glu Ser Phe Cys Glu Asp Val 1 5 8859PRTArtificial sequenceHLA restricted peptide 885Tyr Pro Ser Ala Ala Glu Arg Lys His 1 5 88610PRTArtificial sequenceHLA restricted peptide 886Tyr Pro Ser Ala Ala Glu Arg Lys His Arg 1 5 10 8879PRTArtificial sequenceHLA restricted peptide 887Tyr Gln Glu Phe Phe Trp Asp Ala Asn 1 5 88810PRTArtificial sequenceHLA restricted peptide 888Tyr Gln Glu Phe Phe Trp Asp Ala Asn Asp 1 5 10 8899PRTArtificial sequenceHLA restricted peptide 889Tyr Arg His Thr Trp Asp Arg His Asp 1 5 89010PRTArtificial sequenceHLA restricted peptide 890Tyr Arg His Thr Trp Asp Arg His Asp Glu 1 5 10 8919PRTArtificial sequenceHLA restricted peptide 891Tyr Arg Ile Phe Ala Glu Leu Glu Gly 1 5 89210PRTArtificial sequenceHLA restricted peptide 892Tyr Arg Ile Phe Ala Glu Leu Glu Gly Val 1 5 10 8939PRTArtificial sequenceHLA restricted peptide 893Tyr Arg Ile Gln Gly Lys Leu Glu Tyr 1 5 89410PRTArtificial sequenceHLA restricted peptide 894Tyr Arg Ile Gln Gly Lys Leu Glu Tyr Arg 1 5 10 8959PRTArtificial sequenceHLA restricted peptide 895Tyr Ser Glu His Pro Thr Phe Thr Ser 1 5 89610PRTArtificial sequenceHLA restricted peptide 896Tyr Ser Glu His Pro Thr Phe Thr Ser Gln 1 5 10 8979PRTArtificial sequenceHLA restricted peptide 897Tyr Thr Pro Asp Ser Thr Pro Cys His 1 5 89810PRTArtificial sequenceHLA restricted peptide 898Tyr Thr Pro Asp Ser Thr Pro Cys His Arg 1 5 10 8999PRTArtificial sequenceHLA restricted peptide 899Tyr Thr Ser Ala Phe Val Phe Pro Thr 1 5 90010PRTArtificial sequenceHLA restricted peptide 900Tyr Thr Ser Ala Phe Val Phe Pro Thr Lys 1 5 10 9019PRTArtificial sequenceHLA restricted peptide 901Tyr Val Lys Val Tyr Leu Glu Ser Phe 1 5 90210PRTArtificial sequenceHLA restricted peptide 902Tyr Val Lys Val Tyr Leu Glu Ser Phe Cys 1 5 10 9039PRTArtificial sequenceHLA restricted peptide 903Tyr Val Tyr Ala Leu Pro Leu Lys Met 1 5 90410PRTArtificial sequenceHLA restricted peptide 904Tyr Val Tyr Ala Leu Pro Leu Lys Met Leu 1 5 10

Claims

1. A method of treating an immuno-compromised organ transplant recipient subject having a cytomegalovirus (CMV) infection, comprising administering to the subject a therapeutically effective amount of an antibody comprising an antigen recognition domain capable of binding a class I MHC molecule being complexed with a cytomegalovirus (CMV) pp65 or pp64 peptide as set forth by SEQ ID NO:3, wherein the antibody does not bind said MHC molecule in an absence of said complexed peptide, and wherein the antibody does not bind said peptide in an absence of said MHC molecule, thereby treating the immuno-compromised organ transplant recipient subject with CMV infection.

2. The method of claim 1, wherein said class I MHC molecule is an HLA-A2.

3. The method of claim 1, wherein said antibody is conjugated to a therapeutic moiety.

4. The method of claim 1, wherein the antibody an antibody fragment.

5. The method of claim 1, wherein the antibody is an IgG subtype.