U.S. patent application number 14/366553 was filed with the patent office on 2014-12-04 for fatty alcohol forming acyl reductase (far) variants and methods of use.
The applicant listed for this patent is Codexis, Inc.. Invention is credited to Patricia Choudhary, Louis A. Clark, Kristian Karlshoej.
Application Number | 20140357727 14/366553 |
Document ID | / |
Family ID | 48669370 |
Filed Date | 2014-12-04 |
United States Patent
Application |
20140357727 |
Kind Code |
A1 |
Clark; Louis A. ; et
al. |
December 4, 2014 |
FATTY ALCOHOL FORMING ACYL REDUCTASE (FAR) VARIANTS AND METHODS OF
USE
Abstract
The present disclosure provides methods useful for producing
fatty alcohol compositions from recombinant host cells. The
disclosure further provides fatty acyl-CoA reductase (FAR) variant
enzymes, polynucleotides encoding the FAR variant enzymes, and
vectors and host cells comprising polynucleotides encoding the FAR
variant enzymes.
Inventors: |
Clark; Louis A.; (San
Francisco, CA) ; Karlshoej; Kristian; (Naperville,
IL) ; Choudhary; Patricia; (Foster City, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Codexis, Inc. |
Redwood City |
CA |
US |
|
|
Family ID: |
48669370 |
Appl. No.: |
14/366553 |
Filed: |
December 13, 2012 |
PCT Filed: |
December 13, 2012 |
PCT NO: |
PCT/US2012/069444 |
371 Date: |
June 18, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61577756 |
Dec 20, 2011 |
|
|
|
61578673 |
Dec 21, 2011 |
|
|
|
61636044 |
Apr 20, 2012 |
|
|
|
61674053 |
Jul 20, 2012 |
|
|
|
Current U.S.
Class: |
514/724 ;
435/157; 435/191; 435/252.33; 435/320.1; 510/392; 510/471; 510/505;
536/23.2 |
Current CPC
Class: |
C12Y 102/0108 20130101;
A61K 2800/10 20130101; A61K 8/342 20130101; C12N 9/0008 20130101;
C12P 7/04 20130101; C12Y 102/0105 20130101; Y02P 20/52 20151101;
A61Q 19/00 20130101; C07C 31/125 20130101; C12Y 102/01 20130101;
A61Q 5/00 20130101 |
Class at
Publication: |
514/724 ;
536/23.2; 435/252.33; 435/191; 435/320.1; 435/157; 510/505;
510/392; 510/471 |
International
Class: |
C12P 7/04 20060101
C12P007/04; C12N 9/02 20060101 C12N009/02; A61Q 5/00 20060101
A61Q005/00; A61K 8/34 20060101 A61K008/34; A61Q 19/00 20060101
A61Q019/00 |
Claims
1. A microorganism engineered to produce a fatty alcohol
composition, said microorganism comprising a polynucleotide
sequence encoding a variant fatty alcohol forming acyl-CoA
reductase (FAR) polypeptide, wherein said variant FAR comprises an
amino acid sequence having at least 90% sequence identity to SEQ ID
NO:2 and further comprising a substitution at one or more positions
selected from positions 18, 65, 128, 134, 138, 177, 188, 224, 226,
405, 418, 433, 458, 487, 502, 508, 509, and 511, wherein the
position is numbered with reference to SEQ ID NO:2, and wherein the
microorganism produces a fatty alcohol composition comprising at
least 20% of C12 and C14 alcohols.
2. The microorganism of claim 1, wherein the microorganism is a
bacterial microorganism.
3. The microorganism of claim 2, wherein the microorganism is E.
coli.
4. The microorganism of claim 1, wherein the substitution is
selected from Q18I/L, R65G, N128C/H/L, N134D/K/R/S/Y, E138Q/R,
N177D/E/L/R/T, P188D/E/I/R/S/W, K224R, L226M, P405A/C/F/G/L/V,
Q418I/N/R/V, S433H/K/N/R/Y, S458E/N/Q, G487R/Y, L502A/Q/R/S/W,
R508D/G/H/L/M, K509D/G/H/P/Q/R, and A511D/G/I/K/P/R/S/T.
5. The microorganism of claim 4, wherein the substitution is
selected from Q18I/L, R65G, N128H, N134S, E138Q, N177T, P188S,
K224R, L226M, P405V, Q418V, S433K, S458Q, G487R, L5025, R508D,
K509D, and A511T.
6. The microorganism of claim 1, further comprising a substitution
at one or more positions selected from positions 4, 6, 7, 14, 62,
104, 108, 189, 220, 227, 316, 318, 355, 361, 365, 401, 410, 496,
507, and 510, wherein the position is numbered with reference to
SEQ ID NO:2.
7. The microorganism of claim 6, wherein the substitution is
selected from Q4/N/R/S/W/Y, Q6C/H/K/P/R/S/V/Y, Q7H/N, G14K/L/M/R/V,
P62Q, V104I/M, R108E/G/H/Q, A189L/N, R220A/H, E227G, I316L,
V318F/L/M, 1355F/L/S/W, I361C/F/L, M365N, G401A/C/L/S/TN,
G410D/H/R, E496D/G, T507H/Q, and K510D/E/L/M/N/R/S.
8. The microorganism of claim 7, wherein the substitution is
selected from Q4Y, Q6R, Q7N, G14L, P62Q, V104I, R108H, A189N,
R220H, E227G, 1316L, V318F, I355L, I361F, M365N, G401V, G410H,
E496G, T507H, and K510E.
9. The microorganism of claim 1, comprising the amino acid sequence
of any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, or
28.
10. The microorganism of claim 1, comprising substitutions at two
or more positions.
11. The microorganism of claim 1, wherein the microorganism
produces a fatty alcohol composition comprising at least 30% of C12
and C14 fatty alcohols.
12. The microorganism of claim 11, wherein the microorganism
produces a fatty alcohol composition comprising at least 60% of C12
and C14 fatty alcohols.
13. The microorganism of claim 1, wherein the microorganism
produces a fatty alcohol composition comprising at least 40% of C12
fatty alcohol.
14. The microorganism of claim 13, wherein the microorganism
produces a fatty alcohol composition comprising from about 40% to
about 75% of C12 fatty alcohol.
15. The microorganism of claim 1, wherein the microorganism
produces a fatty alcohol composition comprising no more than about
30% of C14 fatty alcohol.
16. The microorganism of claim 15, wherein the microorganism
produces a fatty alcohol composition comprising from about 20% to
about 30% of C14 fatty alcohol.
17. The fatty alcohol composition produced by the microorganism of
claim 1.
18. A microorganism engineered to produce a fatty alcohol
composition, said microorganism comprising a polynucleotide
sequence encoding a variant fatty alcohol forming acyl-CoA
reductase (FAR) polypeptide, wherein said variant FAR comprises an
amino acid sequence having at least 90% sequence identity to SEQ ID
NO:2 or SEQ ID NO:4 and further comprising a substitution at one or
more positions selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 20, 23, 40, 43, 44, 45, 47, 49, 50, 52, 61,
62, 63, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,
81, 83, 84, 85, 86, 87, 88, 89, 90, 91, 93, 97, 98, 100, 101, 103,
104, 106, 107, 108. 111, 112, 113, 115, 116, 118, 120, 121, 122,
123, 126, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138,
140, 144, 145, 148, 150, 151, 153, 154, 155, 156, 157, 158, 160,
161, 162, 163, 164, 166, 167, 174, 176, 177, 178, 179, 180, 181,
182, 185, 186, 187, 188, 189, 190, 191, 192, 193, 195, 196, 197,
198, 200, 205, 206, 207, 208, 209, 211, 212, 215, 216, 218, 220,
221, 224, 225, 226, 227, 228, 231, 235, 236, 238, 239, 240, 241,
242, 244, 245, 246, 247, 253, 258, 263, 264, 266, 267, 268, 270,
273, 275, 277, 278, 280, 281, 283, 284, 285, 286, 288, 303, 306,
308, 310, 313, 316, 318, 331, 337, 338, 339, 341, 351, 352, 355,
359, 361, 362, 363, 365, 368, 370, 373, 374, 376, 377, 380, 382,
384, 387, 388, 389, 393, 396, 397, 398, 399, 400, 401, 402, 404,
405, 406, 308, 409, 410, 411, 412, 413, 414, 416, 417, 418, 419,
421, 424, 426, 429, 430, 432, 433, 436, 442, 443, 446, 452, 458,
463, 465, 466, 474, 478, 482, 487, 489, 490, 491, 494, 495, 496,
498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510,
511, or 512, wherein the position is numbered with reference to SEQ
ID NO:2, and wherein the microorganism produces a fatty alcohol
composition comprising at least 30% of C12 and C14 fatty
alcohols.
19. The microorganism of claim 18, wherein the substitution is
selected from M1E/G/L/R/V/W, A2D/F/G/H/P/Q/R/S/T/W/Y, T3/I/L,
Q4/N/R/S/W/Y, Q5M/N, Q6C/H/K/P/R/S/V/Y, Q7H/N, N8A/E/H/V, G9C/F/V,
A10T, 511D/G, A12D/R/S/T, S13G/L/V, G14K/L/M/R/V, V15I, L16G/I/S,
E17C/G/H/R, Q18I/L, R20K, H23R, K40R, R43H, T44A, V45A/S, D47E/N,
G49E, G50A, H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/Y, F68A/V,
L69E/I/M/Q, N70D/E/L/M/R/T, E71C/M/Q/S, 172L, A73G/H/K/L/M,
S74K/L/P/T/W, S75C/E/H/N, S76E/F/I/L/R, V771/P/T, F78M,
E79D/I/L/Q/V, R801/L, L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V,
F89D/N/P/R, E90D/Q, T91A/R, L93D, V97I, H98P, 1100V, T101A,
E103C/S/V, V104I/M, E106A/H, S107A, R108E/G/H/Q, L111I, T112G,
P113I/Q, R115D, F116Y, A118K, A120C, G121T, Q122E/H/T, V123L,
F126V, N128C/H/L, S129D, A130C/S, A131P/S, S132H, V133A/G,
N134D/K/R/S/Y, F135E, R136L, E137L, E138Q/R, D140Y, K144A/E/R,
1145E/H, L148E/K/T, L150P, E151G/R/V, V153F/I, A154G/R,
A155G/M/R/T/W, L156M, A157Q/V, E158D/N, N160T, S161P/Y, A162K,
M163L, A164V, 1166L/M, Q167H, N174A, K176G/I/M, N177D/E/L/R/T,
S178F/L, G179D/S/W, Q180C/R, I181D/E/L/V, T182G/I/K/R, V185G/I/P,
I186H, K187P, P188D/E/I/R/S/W, A189L/N, G190I/K/L, E191V/W, 5192A,
I193C/L/V, R195F/H/I/N/W, S196D, T197F/P, D198S, Y200F, E205K,
L206C, V207L/M, H208R, L209N/T/Y, Q211H/L/N/R, D212F, S215E/Y,
D216G/Q, K218P/Q/R, R220A/H, Y221D/K, K224R, V225C/M, L226M, E227G,
K228H, V231A, 1235E, S236I, A238G, N239C, N240Q/R/T, Y241F, G242E,
S244A/P/R, D245H, T246A/P/V, Y247N, L253P/V, L258P, S263N, G264R,
S266A/T, L267H, T268N, V270L, 5273F, 1275V, S277A, A278C, E2801,
E281S/Y, S283A/E/F/M/T, P284C/L/Q, G285D, W286Y, E288D/H/Q, E303G,
S306T/W, F3081, G310LN, 5313Q, I316L, V318F/L/M, S331V, S337G,
G338E, S339P, Q341R, G351C, 5352G, I355F/L/S/W, K359E, 1361C/F/L,
D362L, Y363H, M365N, A368S, T370A/I, A373W, A374Y, D376K/P/R,
Q377H/K, Y380H/R, R382H/Q, T384S, F3871/L, V388L, A3891/M/L/V,
K393A, D396G, V397L, V398Y, V3991, G400S, G401A/C/L/S/TN, M402V,
V4041/L, P405A/C/F/G/L/V, L406Y, 1408L, A409T/V/W/Y, G410D/H/R,
K411R, A412V, M413L/R, R414K, A416L/V, G417V, Q418I/N/R/V, N419S,
E421D/G/I/L/N/P/R/S/V, V424M, K426R/T, D429E/K/R, T430A/H/I,
R432C/Q, S433H/K/N/R/Y, T436A, T4421, A443T, Y446F, S452E/G/N,
S458E/N/Q, L463V, R465K, V466G/Q, Q474L/R, Q478E, C482R, G487R/Y,
L489F, N490C/S, R491M, L494Y, K495C/S, E496D/G, K498G/N, L499R/S/V,
Y500H/N, S501C/F/W, L502A/Q/R/S/W, R503c/K, A504D/E/S/T, A505E/G/K,
D506G/L/M/R/W, T507H/Q, R508D/G/H/L/M, K509D/G/H/P/Q/R,
K510D/E/L/M/N/R/S, A511D/G/I/K/P/R/S/T, and/or A512M/R.
20. The microorganism of claim 18, wherein the variant FAR
comprises an amino acid substitution set selected from the
substitution sets listed in Table 1, Table 2, Table 4, Table 7,
Table 8, Table 9, Table 10, or Table 11.
21. The microorganism of claim 18, wherein the microorganism is a
bacterial microorganism.
22. The microorganism of claim 21, wherein the microorganism is E.
coli.
23. An isolated variant fatty alcohol forming acyl-CoA reductase
(FAR) polypeptide comprising an amino acid substitution set
selected from the substitution sets listed in Table 1, Table 2,
Table 4, Table 7, Table 8, Table 9, Table 10, or Table 11.
24. The isolated variant FAR polypeptide of claim 23, comprising
the amino acid sequence of any of SEQ ID NOs:6, 8, 10, 12, 14, 16,
18, 20, 22, 24, 26, or 28.
25. A recombinant polynucleotide comprising a sequence encoding the
variant FAR polypeptide of claim 1.
26. An expression vector comprising the recombinant polynucleotide
of claim 25.
27. A host cell comprising the recombinant polynucleotide of claim
25.
28. A method of producing a fatty alcohol composition, the method
comprising culturing the microorganism of claim 1 in the presence
of a carbon source under conditions in which fatty alcohols are
produced.
29. The method of claim 28, further comprising recovering the fatty
alcohol composition.
30. The method of claim 28, wherein at least 2 g/L of recoverable
fatty alcohols are produced.
31. A composition comprising the fatty alcohols, or derivatives
thereof, produced by the method of claim 28.
32. The composition of claim 31, wherein the composition is a
detergent composition.
33. The composition of claim 31, wherein the composition is a
personal care composition.
34. A method of producing a detergent composition, the method
comprising: combining the fatty alcohols produced by the method of
claim 28, or a fraction thereof, with a detergent component
selected from sodium carbonate, a complexation agent, zeolites, a
protease, a lipase, amylase, carboxymethyl cellulose, optical
brighteners, colorants, and perfumes; thereby producing the
detergent composition.
35. A detergent composition produced by the method of claim 34.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S.
Provisional Application No. 61/577,756, filed Dec. 20, 2011; of
U.S. Provisional Application No. 61/578,673, filed Dec. 21, 2011;
of U.S. Provisional Application No. 61/636,044, filed Apr. 20,
2012; and of U.S. Provisional Application No. 61/674,053, filed
Jul. 20, 2012; the entire content of each of which is incorporated
herein by reference.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED AS AN ASCII FILE
[0002] The Sequence Listing written in file 90834-853678_ST25.TXT,
created on Dec. 13, 2012, 121,968 bytes, machine format IBM-PC,
MS-Windows operating system, is hereby incorporated by
reference.
FIELD OF THE INVENTION
[0003] This invention relates to fatty alcohol forming acyl
reductases (FAR) variants, recombinant bacterial microorganisms
incorporating polynucleotides encoding the FAR variants, and
production of fatty alcohols by the engineered bacterial
microorganisms.
BACKGROUND OF THE INVENTION
[0004] Crude petroleum has traditionally been used as a primary
source for raw materials for producing numerous specialty
chemicals. Specialty chemicals that can be produced from the
petrochemical raw materials include fatty alcohols. These fatty
alcohols have many industrial and commercial uses. For
illustration, fatty alcohols are components of commercial waxes,
lubricating oils, cosmetics, and solvents. Medium chain fatty
alcohols such as C12 and C14 fatty alcohols act as surfactants and
are used as ingredients in the personal care industry and in the
manufacture of detergent.
[0005] Fatty alcohols can be obtained from crude petroleum.
However, this process requires a significant amount of energy and
involves the use of a non-renewable energy source. There is a need
for improved methods for producing fatty alcohols, such as medium
chain fatty alcohols.
BRIEF SUMMARY OF THE INVENTION
[0006] In one aspect, the invention provides microorganisms
engineered to produce a fatty alcohol composition. In some
embodiments, the microorganism comprises a polynucleotide sequence
encoding a variant fatty alcohol forming acyl-CoA reductase (FAR)
polypeptide, wherein said variant FAR comprises an amino acid
sequence having at least 90% sequence identity to SEQ ID NO:2 and
further comprising a substitution at one or more positions selected
from positions 18, 65, 128, 134, 138, 177, 188, 224, 226, 405, 418,
433, 458, 487, 502, 508, 509, and 511, wherein the position is
numbered with reference to SEQ ID NO:2, and wherein the
microorganism produces a fatty alcohol composition comprising at
least 20% of C12 and C.sub.1-4 alcohols.
[0007] In some embodiments, the microorganism comprises a
substitution selected from Q18I/L, R65G, N128C/H/L, N134D/K/R/S/Y,
E138Q/R, N177D/E/L/R/T, P188D/E/I/R/S/W, K224R, L226M,
P405A/C/F/G/L/V, Q418I/N/R/V, S433H/K/N/R/Y, S458E/N/Q, G487R/Y,
L502A/Q/R/S/W, R508D/G/H/L/M, K509D/G/H/P/Q/R, and
A511D/G/I/K/P/R/S/T. In some embodiments, the substitution is
selected from Q181/L, R65G, N128H, N134S, E138Q, N177T, P188S,
K224R, L226M, P405V, Q418V, S433K, S458Q, G487R, L502S, R508D,
K509D, and A511T. In some embodiments, the microorganism further
comprises a substitution at one or more positions selected from
positions 4, 6, 7, 14, 62, 104, 108, 189, 220, 227, 316, 318, 355,
361, 365, 401, 410, 496, 507, and 510, wherein the position is
numbered with reference to SEQ ID NO:2. In some embodiments, the
substitution is selected from Q4/N/R/S/W/Y, Q6C/H/K/P/R/S/V/Y,
Q7H/N, G14K/L/M/R/V, P62Q, V104I/M, R108E/G/H/Q, A189L/N, R220A/H,
E227G, I316L, V318F/L/M, I355F/L/S/W, 1361C/F/L, M365N,
G401A/C/L/S/TN, G410D/H/R, E496D/G, T507H/Q, and K510D/E/L/M/N/R/S.
In some embodiments, the substitution is selected from Q4Y, Q6R,
Q7N, G14L, P62Q, V104I, R108H, A189N, R220H, E227G, I316L, V318F,
I355L, I361F, M365N, G401V, G410H, E496G, T507H, and K510E. In some
embodiments, the microorganism comprises substitutions at two,
three, four, five, six, seven, eight, nine, ten or more positions.
In some embodiments, the microorganism comprises the amino acid
sequence of any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, or 28. In some embodiments, the microorganism comprises a
functional fragment of a FAR variant sequence as described
herein.
[0008] In some embodiments, the microorganism comprises a
polynucleotide sequence encoding a variant fatty alcohol forming
acyl-CoA reductase (FAR) polypeptide, wherein said variant FAR
comprises an amino acid sequence having at least 90% sequence
identity to SEQ ID NO:2 or SEQ ID NO:4 and further comprising a
substitution at one or more positions selected from 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 23, 40, 43, 44,
45, 47, 49, 50, 52, 61, 62, 63, 65, 66, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 83, 84, 85, 86, 87, 88, 89, 90, 91, 93,
97, 98, 100, 101, 103, 104, 106, 107, 108. 111, 112, 113, 115, 116,
118, 120, 121, 122, 123, 126, 128, 129, 130, 131, 132, 133, 134,
135, 136, 137, 138, 140, 144, 145, 148, 150, 151, 153, 154, 155,
156, 157, 158, 160, 161, 162, 163, 164, 166, 167, 174, 176, 177,
178, 179, 180, 181, 182, 185, 186, 187, 188, 189, 190, 191, 192,
193, 195, 196, 197, 198, 200, 205, 206, 207, 208, 209, 211, 212,
215, 216, 218, 220, 221, 224, 225, 226, 227, 228, 231, 235, 236,
238, 239, 240, 241, 242, 244, 245, 246, 247, 253, 258, 263, 264,
266, 267, 268, 270, 273, 275, 277, 278, 280, 281, 283, 284, 285,
286, 288, 303, 306, 308, 310, 313, 316, 318, 331, 337, 338, 339,
341, 351, 352, 355, 359, 361, 362, 363, 365, 368, 370, 373, 374,
376, 377, 380, 382, 384, 387, 388, 389, 393, 396, 397, 398, 399,
400, 401, 402, 404, 405, 406, 308, 409, 410, 411, 412, 413, 414,
416, 417, 418, 419, 421, 424, 426, 429, 430, 432, 433, 436, 442,
443, 446, 452, 458, 463, 465, 466, 474, 478, 482, 487, 489, 490,
491, 494, 495, 496, 498, 499, 500, 501, 502, 503, 504, 505, 506,
507, 508, 509, 510, 511, or 512, wherein the position is numbered
with reference to SEQ ID NO:2, and wherein the microorganism
produces a fatty alcohol composition comprising at least 30% of C12
and C14 alcohols. In some embodiments, the substitution is selected
from M1E/G/L/R/V/W, A2D/F/G/H/P/Q/R/S/T/W/Y, T3/I/L, Q4/N/R/S/W/Y,
Q5M/N, Q6C/H/K/P/R/S/V/Y, Q7H/N, N8A/E/H/V, G9C/FN, A10T, S11D/G,
A12D/R/S/T, S13G/L/V, G14K/L/M/R/V, V151, L16G/I/S, E17C/G/H/R,
Q18I/L, R20K, H23R, K40R, R43H, T44A, V45A/S, D47E/N, G49E, G50A,
H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/Y, F68AN, L69E/I/M/Q,
N70D/E/L/M/R/T, E71C/M/Q/S, 172L, A73G/H/K/L/M, S74K/L/P/T/W,
S75C/E/H/N, S76E/F/I/L/R, V77I/P/T, F78M, E79D/1/L/Q/V, R80I/L,
L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V, F89D/N/P/R, E90D/Q,
T91A/R, L93D, V97I, H98P, 1100V, T101A, E103C/S/V, V104I/M,
E106A/H, S107A, R108E/G/H/Q, L111I, T112G, P113I/Q, R115D, F116Y,
A118K, A120C, G121T, Q122E/H/T, V123L, F126V, N128C/H/L, S129D,
A130C/S, A131P/S, S132H, V133A/G, N134D/K/R/S/V, F135E, R136L,
E137L, E138Q/R, D140Y, K144NE/R, 1145E/H, L148E/K/T, L150P,
E151G/RN, V153F/I, A154G/R, A155G/M/R/T/W, L156M, A157Q/V, E158D/N,
N160T, S161P/Y, A162K, M163L, A164V, 1166L/M, Q167H, N174A,
K176G/I/M, N177D/E/L/R/T, S178F/L, G179D/S/W, Q180C/R, 1181D/E/L/V,
T182G/I/K/R, V185G/I/P, 1186H, K187P, P188D/E/I/R/S/W, A189UN,
G190I/K/L, E191V/W, S192A, I193C/L/V, R195F/H/I/N/W, S196D,
T197F/P, D198S, Y200F, E205K, L206C, V207L/M, H208R, L209N/T/Y,
Q211H/L/N/R, D212F, S215E/Y, D216G/Q, K218P/Q/R, R220A/H, Y221D/K,
K224R, V225C/M, L226M, E227G, K228H, V231A, 1235E, R236I, A238G,
N239C, N240Q/R/T, Y241F, G242E, S244A/P/R, D245H, T246A/P/V, Y247N,
L253P/V, L258P, S263N, G264R, S266A/T, L267H, T268N, V270L, S273F,
1275V, S277A, A278C, E280I, E281S/Y, S283A/E/F/M/T, P284C/L/Q,
G285D, W286Y, E288D/H/Q, E303G, S306T/W, F3081, G310LN, S313Q,
I316L, V318F/L/M, S331V, S337G, G338E, S339P, Q341R, G351C, S352G,
I355F/L/S/W, K359E, I361C/F/L, D362L, Y363H, M365N, A368S, T370A/I,
A373W, A374Y, D376K/P/R, Q377H/K, Y380H/R, R382H/Q, T384S, F387I/L,
V388L, A389I/M/L/V, K393A, D396G, V397L, V398Y, V399I, G400S,
G401A/C/L/S/T/V, M402V, V404I/L, P405A/C/F/G/L/V, L406Y, 1408L,
A409T/V/W/Y, G410D/H/R, K411R, A412V, M413L/R, R414K, A416L/V,
G417V, Q418I/N/R/V, N419S, E421D/G/I/L/P/R/S/V, V424M, K426R/T,
D429E/FUR, T430A/H/I, R432C/Q, S433H/K/N/R/Y, T436A, T442I, A443T,
Y446F, S452E/G/N, S458E/N/Q, L463V, R465K, V466G/Q, Q474L/R, Q478E,
C482R, G487R/Y, L489F, N490C/S, R491M, L494Y, K495C/S, E496D/G,
K498G/N, L499R/S/V, Y500H/N, S501C/F/W, L502A/Q/R/S/W, R503C/K,
A504D/E/S/T, A505E/G/K, D506G/L/M/R/W, T507H/Q, R508D/G/H/L/M,
K509D/G/H/P/Q/R, K510D/E/L/M/N/R/S, A511D/G/I/K/P/R/S/T and/or
A512M/R.
[0009] In some embodiments, the microorganism comprises a
polynucleotide sequence encoding a FAR variant comprising an amino
acid substitution set selected from the substitution sets listed in
Table 1, Table 2, Table 4, Table 7, Table 8, Table 9, Table 10, or
Table 11.
[0010] In some embodiments, the microorganism is a bacterial
microorganism. In some embodiments, the microorganism is E.
coli.
[0011] In some embodiments, the microorganism produces a fatty
alcohol composition comprising at least 30% of C12 and C14 fatty
alcohols. In some embodiments, the microorganism produces a fatty
alcohol composition comprising at least 60% of C12 and C14 fatty
alcohols. In some embodiments, the microorganism produces a fatty
alcohol composition comprising at least 40% of C12 fatty alcohol.
In some embodiments, the microorganism produces a fatty alcohol
composition comprising from about 40% to about 75% of C12 fatty
alcohol. In some embodiments, the microorganism produces a fatty
alcohol composition comprising no more than about 30% of C14 fatty
alcohol. In some embodiments, the microorganism produces a fatty
alcohol composition comprising from about 20% to about 30% of C14
fatty alcohol.
[0012] In another aspect, the invention provides a fatty alcohol
composition produced by a microorganism as described herein.
[0013] In another aspect, the invention relates to an isolated
variant fatty alcohol forming acyl-CoA reductase (FAR) polypeptide.
In some embodiments, the FAR variant polypeptide comprises an amino
acid substitution set selected from the substitution sets listed in
Table 1, Table 2, Table 4, Table 7, Table 8, Table 9, Table 10, or
Table 11. In some embodiments, the polypeptide comprises the amino
acid sequence of any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, or 28.
[0014] In another aspect, the invention relates to a recombinant
polynucleotide comprising a sequence encoding a variant FAR
polypeptide encompassed by the invention. In some embodiments, the
polynucleotide comprises the nucleotide sequence of any of SEQ ID
NOs:5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, or 27. In some
embodiments, the polynucleotide is a codon optimized
polynucleotide.
[0015] In another aspect, the invention relates to a vector
comprising a polynucleotide sequence encoding a FAR variant
polypeptide and optionally comprising one or more control
sequences, such as a promoter capable of mediating expression of
the polynucleotide encoding the FAR variant polypeptide in a host
microorganism.
[0016] In another aspect, the invention relates to a host cell
comprising a polynucleotide sequence encoding a FAR variant
polypeptide.
[0017] In another aspect, a FAR variant protein, vectors and cells
comprising a nucleic acid encoding the FAR variant protein,
microorganisms engineered to express the FAR variant protein, and
fatty alcohol products obtained from the microorganisms are
provided, where the FAR variant protein has 100% identity to SEQ ID
NO:2 except for the substitions present in any individual FAR
variant selected from variant numbers 1-1046 in Table 1, Table 2,
Table 4, Table 7, Table 8, Table 9, or Table 10. In other
embodiments, the FAR variant protein has 100% identity to SEQ ID
NO:2 except for (1) the substitions present in any individual FAR
variant selected from variant numbers 1-1046 in Table 1, Table 2,
Table 4, Table 7, Table 8, Table 9, or Table 10 and (2) one, two,
three, four, five, six, seven, eight, nine, ten, eleven or twelve
additional substitutions, e.g., 1-5, 2-6, 4-8, or 5-12
substitutions (which optionally are conservative
substitutions).
[0018] In another aspect, a FAR variant protein, vectors and cells
comprising a nucleic acid encoding the FAR variant protein,
microorganisms engineered to express the FAR variant protein, and
fatty alcohol products obtained from the microorganisms are
provided, where the FAR variant protein has 100% identity to SEQ ID
NO:4 except for the substitions present in any individual FAR
variant selected from variant numbers 1047-1070 in Table 11. In
other embodiments, the FAR variant protein has 100% identity to SEQ
ID NO:4 except for (1) the substitions present in any individual
FAR variant selected from variant numbers 1047-1070 in Table 11 and
(2) one, two, three, four, five, six, seven, eight, nine, ten,
eleven or twelve additional substitutions, e.g., 1-5, 2-6, 4-8,
5-12 substitutions (which optionally are conservative
substitutions).
[0019] In another aspect, the invention relates to methods of
producing a fatty alcohol composition comprising culturing a
microorganism (e.g., E. coli) comprising a variant FAR polypeptide
encompassed by the invention in a suitable culture medium in the
presence of a carbon source under conditions in which fatty
alcohols are produced. In some embodiments, at least 2 g/L (e.g.,
at least 2.5 g/L, at least 3 g/L, at least 3.5 g/L, at least 4 g/L,
at least 4.5 g/L, at least 5 g/L, at least 10 g/L, at least 20 g/L,
at least 30 g/L, at least 40 g/L, or at least 50 g/L) of
recoverable fatty alcohols are produced. In some embodiments, the
method further comprises recovering the fatty alcohol
composition.
[0020] In another aspect, the invention relates to compositions
and/or derivatives of the fatty alcohol compositions produced by
the methods of the invention. In some embodiments, the fatty
alcohol compositions produced by the methods encompassed by the
invention, or a fraction thereof, are further reduced to yield an
alkane composition. In some embodiments the fatty alcohol
composition produced by the methods encompassed by the invention
are esterified yielding fatty esters. In some embodiments, the
fatty alcohol compositions produced by the methods encompassed by
the invention, or a fraction thereof, are modified to produce fatty
esters. In some embodiments, the composition is a detergent
composition. In some embodiments, the composition is a personal
care composition.
[0021] In another aspect, the invention provides methods of
producing a detergent composition, the method comprising combining
the fatty alcohols produced by the methods described herein, or a
fraction thereof, with a detergent component selected from sodium
carbonate, a complexation agent, zeolites, a protease, a lipase,
amylase, carboxymethyl cellulose, optical brighteners, colorants
and perfumes, thereby producing the detergent composition. In
another aspect, the invention relates to detergent compositions
produced by a method described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1. Relative fatty alcohol chain length distribution for
FAR variants.
[0023] FIG. 2. Alignment of FAR proteins closely related to the
Marinobacter algicola FAR (ZP.sub.--01892457). Only the first
.about.300 amino acids of the alignment are shown. The cofactor
binding domain TGxxGxxG and the 2 putative YxxxK motifs are
indicated. 1=Oceanobacter RED65; 2=Marinobacter aquaeolei; 3=Marine
bacteria HP15; 4=Hahella KCTC 2396; 5=Marinobacter algicola.
[0024] FIG. 3. Alignment of FARs from plants, silk moth, mouse, and
Marinobacter algicola. Only the active site motif (YxxxKxxxE)
region is shown. 1=Arabidopsis CER4 (AAL49822); 2=Jojoba
(AAD38039); 3=Arabidopsis (ABZ10954); 4=Arabidopsis (ABZ10951);
5=Arabidopsis (ABZ10952); 6=Arabidopsis (ABZ10953); 7=Wheat TAA1a
(CAD67817); 8=Silk moth (NP.sub.--001036967); 9=Mouse (AAH07178);
10=M. algicola (ZP.sub.--01892457).
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0025] Unless defined otherwise, all technical and scientific terms
used herein generally have the same meaning as commonly understood
by one of ordinary skill in the art to which this invention
pertains. Generally, the nomenclature used herein and the
laboratory procedures of cell culture, molecular genetics, organic
chemistry, analytical chemistry and nucleic acid chemistry
described below are those well-known and commonly employed in the
art. It is noted that the indefinite articles "a" and "an" and the
definite article "the" are used in the present application to mean
one or more unless the context clearly dictates otherwise. Further,
the term "or" is used in the present application to mean the
disjunctive "or" and the conjunctive "and."
[0026] The terms "fatty alcohol forming acyl-CoA reductase," "fatty
acyl reductase," "FAR", "FAR polypeptide," and "FAR enzyme" are
used interchangeably herein to refer to an enzyme that catalyzes
the reduction of a fatty acyl-CoA, a fatty acyl-ACP, or other fatty
acyl thioester complex to a fatty alcohol, in a reaction linked to
the oxidation of NAD(P)H to NAD(P).sup.+, as shown in the following
Scheme 1:
##STR00001##
wherein "R" represents a C7 to C23 saturated, unsaturated, linear,
branched or cyclic hydrocarbon chain, and "R.sub.1" represents CoA,
ACP or other fatty acyl thioester substrates. CoA is a non-protein
acyl carrier group factor (or moiety) involved in the synthesis and
oxidation of fatty acids. "ACP" is a polypeptide or protein subunit
of fatty acid synthase used in the synthesis of fatty acids. In
some embodiments, a FAR catalyzes the reduction of a fatty
acyl-CoA, a fatty acyl-ACP, or other fatty acyl thioester complex
to a fatty aldehyde intermediate, which is reduced to a fatty
alcohol by a second oxidoreductase enzyme.
[0027] "Fatty aldehyde" as used herein refers to a saturated or
unsaturated aliphatic aldehyde.
[0028] The term "fatty acid" as used herein refers to a compound
having the formula RCO--OH, or a salt thereof, wherein "R" is as
defined above. In some embodiments, the fatty acid salt is a
potassium salt, a sodium salt, or an ammonium salt. Saturated or
unsaturated fatty acids can be described as "Ca:b", wherein "a" is
an integer that represents the total number of carbon atoms and "b"
is an integer that refers to the number of double bonds in the
carbon chain.
[0029] The term "fatty alcohol" as used herein refers to an
aliphatic alcohol of the formula R--OH, where R is as defined
above. Saturated or unsaturated fatty alcohols can also be
described using the nomenclature "Ca:b" or, alternatively
"Ca:b-OH", wherein "a" is an integer that represents the total
number of carbon atoms in the fatty alcohol and "b" is an integer
that refers to the number of double bonds in the carbon chain. In
some embodiments, a fatty alcohol produced according to the methods
disclosed herein is a C8-C24 saturated or unsaturated fatty alcohol
(i.e., a C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19,
C20, C21, C22, or C24 fatty alcohol). In some embodiments, one or
more of the following fatty alcohols are present: 1-decanol,
1-dodecanol, 1-tetradecanol, 1-hexadecanol and 1-octadecanol.
[0030] Unsaturated fatty acids or fatty alcohols can be referred to
as "cis .DELTA..sup.x" or "trans .DELTA..sup.x", wherein "cis" and
"trans" refer to the carbon chain configuration around the double
bond and "x" indicates the number of the first carbon of the double
bond, wherein carbon 1 is the carboxylic acid carbon of the fatty
acid or the carbon bound to the --OH group of the fatty
alcohol.
[0031] A "fatty alcohol composition" refers to fatty alcohols
produced from a recombinant microorganism. A fatty alcohol
composition may comprise a plurality (e.g., combination) of fatty
alcohols, such as but not limited to fatty alcohols having a carbon
chain length of C12, C14, C16, and C18. In one embodiment, a fatty
alcohol composition comprises predominantly fatty alcohols having a
specific carbon chain length (such as but not limited to C12 or C14
fatty alcohols). The fatty alcohol composition may comprise
saturated, unsaturated, and/or branched fatty alcohols. As used
herein, the phrase "C12 to C14 fatty alcohols" means C12 and C14
fatty alcohols; similarly, the phrases "C12 to C16 fatty alcohols";
"C14 to C16 fatty alcohols"; and "C12 to C18 fatty alcohols" mean
C12, C14, and C16 fatty alcohols; C14 and C16 fatty alcohols; and
C12, C14, C16, and C18 fatty alcohols, respectively.
[0032] The terms "fatty acyl-thioester" and "fatty acyl-thioester
complex" refer to a compound of formula (I) in Scheme 1, in which a
fatty acyl moiety is covalently linked via a thioester linkage to a
carrier moiety. Fatty acyl-thioesters are substrates for the
improved FAR polypeptides described herein.
[0033] The term "fatty acyl-CoA" refers to a compound of formula
(I) in Scheme 1, wherein R.sub.1 is Coenzyme A ("CoA").
[0034] The term "fatty acyl-ACP" refers to a compound of formula
(I) in Scheme 1, wherein R.sub.1 is acyl carrier protein
("ACP").
[0035] The term "fatty acid synthase" or "FAS" refers to an enzyme
or enzyme complex that catalyzes the conversion of acetyl-CoA and
malonyl-CoA to fatty acyl-ACP as set forth in the following Scheme
2:
##STR00002##
wherein ACP is a protein which comprises a covalently attached
phosphopantetheine moiety. In certain embodiments, the FAS is
composed of more than one distinct enzymatic activity. In various
embodiments, the distinct enzymatic activities reside in separate
polypeptides. In some embodiments, the separate polypeptides form
one or more protein complexes.
[0036] The term "acyl-ACP thioesterase (TE)" refers to an enzyme
that catalyzes the cleavage of acyl-ACP to form a fatty acid, as
shown in the following Scheme 3, wherein R has the same meaning as
set forth above:
##STR00003##
[0037] The terms "fatty acyl-CoA synthetase," "acyl-CoA
synthetase," and "FACS" are used interchangeably herein to refer to
an enzyme that catalyzes the formation of a covalent complex
between the acyl portion of the fatty acid and CoA as shown in the
following Scheme 4, wherein R has the same meaning as set forth
above:
##STR00004##
[0038] The term "acetyl-CoA carboxylase" or "ACC" refers to an
enzyme that catalyzes the conversion of acetyl-CoA to malonyl-CoA
as shown in the following Scheme 5:
##STR00005##
[0039] The term "acyl-CoA dehydrogenase" or "ACD" refers an enzyme
that catalyzes the introduction of a trans double-bond between C2
and C3 of an acyl-CoA thioester substrate as shown in the following
Scheme 6:
##STR00006##
[0040] "Conversion" refers to the enzymatic conversion of the
substrate to the corresponding product.
[0041] "Naturally-occurring" or "wild-type" refers to the form
found in nature. For example, a naturally occurring or wild-type
polypeptide or polynucleotide sequence is a sequence present in an
organism that can be isolated from a source in nature and which has
not been intentionally modified by human manipulation. A wild-type
organism or cell refers to an organism or cell that has not been
intentionally modified by human manipulation.
[0042] The term "wild-type fatty alcohol forming acyl-CoA
reductase" or "wild-type FAR," as used herein, refers to a
naturally-occurring FAR polypeptide. In some embodiments, a
wild-type FAR is produced by a gammaproteobacteria, including but
not limited to strains of Marinobacter, Oceanobacter, and Hahella.
Naturally occurring FAR polypeptides are described, for example, in
US patent publication 2011/0000125, incorporated by reference
herein. In some embodiments, a wild-type FAR is a
naturally-occurring FAR polypeptide that is produced by the
Marinobacter algicola strain DG893 (SEQ ID NO:2). In some
embodiments, a wild-type FAR is a naturally-occurring FAR
polypeptide that is produced by the Marinobacter aquaeolei strain
VT8 (SEQ ID NO:4). FARs that are not produced in nature can be
denoted "recombinant" FARs, whether prepared using recombinant
techniques or by chemical synthesis.
[0043] The term "FAR variant" refers to a FAR polypeptide having
substitutions at one or more positions relative to a wild-type FAR
polypeptide and to functional (or "biologically active") fragments
thereof. In one embodiment, "FAR variants" comprise at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least 97%, at least 98%, or at least 99% sequence
identity to SEQ ID NO:2 or a functional fragment thereof. In
another embodiment, "FAR variants" comprise at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 91%, at
least 92%, at least 93%, at least 94%, at least 95%, at least 96%,
at least 97%, at least 98%, or at least 99% sequence identity to
SEQ ID NO: 4, or a functional fragment thereof.
[0044] In the context of a FAR polypeptide, "variant" refers to a
FAR polypeptide or polynucleotide comprising one or more
modifications relative to a wild-type FAR polypeptide such as
wild-type FAR from Marinobacter species. In the context of a
polynucleotide encoding a FAR polypeptide, "variant" refers to a
polynucleotide encoding a FAR variant.
[0045] The terms "modifications" and "mutations," when used in the
context of substitutions, deletions, insertions and the like with
respect to polynucleotides and polypeptides, are used
interchangeably herein and refer to changes that are introduced by
genetic manipulation to create variants from a wild-type
sequence.
[0046] "Deletion" refers to modification to a polypeptide by
removal of one or more amino acids relative to a reference
polypeptide. Deletions can comprise removal of 1 or more amino
acids, 2 or more amino acids, 5 or more amino acids, 10 or more
amino acids, 15 or more amino acids, or 20 or more amino acids, up
to 10% of the total number of amino acids, or up to 20% of the
total number of amino acids making up the reference polypeptide
while retaining enzymatic activity or having improved improperties
(e.g., improved enzymatic activity) relative to the reference
polypeptide. Deletions can be directed to the internal portions
and/or terminal portions of the polypeptide. In one embodiment, the
deletion comprises the removal of a continuous amino acid segment.
In another embodiment, the deletion comprises the removal of two or
more amino acids or amino acid segments that are discontinuous
(i.e., two or more amino acids or amino acid segments separated by
one or more amino acid residues that are not removed from the
reference polypeptide). The term "deletion" is also used to a DNA
modification in which or more nucleotides or nucleotide base-pairs
have been removed, as compared to the corresponding reference,
parental, or wild-type DNA.
[0047] "Insertion" refers to modification to a polypeptide by
addition of one or more amino acids to the reference polypeptide.
In some embodiments, the modification comprises insertions of one
or more amino acids to the naturally occurring polypeptide as well
as insertions of one or more amino acids to other modified
polypeptides. Insertions can be in the internal portions, or in the
carboxy or amino terminus. "Insertions," as used herein, includes
fusion proteins as is known in the art.
[0048] A FAR polypeptide (i.e., a FAR variant) is "derived from" a
wild-type FAR polypeptide sequence by introducing modifications
(e.g., amino acid substitutions) into a wild-type sequence (e.g.,
the wild-type FAR polypeptide of SEQ ID NO:2 or SEQ ID NO:4) using
in vitro mutagenesis or molecular evolution methods known in the
art. Typically, the polypeptide sequence of a FAR variant will be
at least 70% (alternatively, at least 75%, at least 80%, at least
85%, at least 90%, at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
or at least 99%) identical to the wild-type sequence.
[0049] "Percentage of sequence identity," "percent identity" and
"percentage homology" are used interchangeably herein to refer to
comparisons among polynucleotides and polypeptides, and are
determined by comparing two optimally aligned sequences over a
comparison window, where the portion of the polynucleotide or
polypeptide sequence in the comparison window may comprise
additions or deletions (i.e., gaps) as compared to the reference
sequence (which may also contain gaps to optimize the alignment)
for alignment of the two sequences. The percentage may be
calculated by determining the number of positions at which the
identical nucleic acid base or amino acid residue occurs in both
sequences to yield the number of matched positions, dividing the
number of matched positions by the total number of positions in the
window of comparison (including positions where one of the
sequences has a gap(s)) and multiplying the result by 100 to yield
the percentage of sequence identity. For example, a polypeptide
with an amino acid sequence matching SEQ ID NO:2 at 491 positions,
with one gap, would have 491/512=95.9% identity to SEQ ID NO:2.
Similarly, a FAR variant that has 475 residues (i.e., less than
full-length) and matches SEQ ID NO:2 at 460 positions would have
460/475=96.8% identity. Those of skill in the art appreciate that
there are many established algorithms available to align two
sequences and that different methods may give slightly different
results.
[0050] Alignment of sequences for comparison can be conducted,
e.g., by the local homology algorithm of Smith and Waterman, 1981,
Adv. Appl. Math. 2:482, by the homology alignment algorithm of
Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, by the search for
similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad.
Sci. USA 85:2444, by computerized implementations of these
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG Wisconsin
Software Package), or by visual inspection (see generally, Current
Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current
Protocols, a joint venture between Greene Publishing Associates,
Inc. and John Wiley & Sons, Inc., (1995 Supplement) (Ausubel)).
The Clustral (Chema R., Sugawara H., Koike T., Lopez R., Gibson T.
J., Higgins D. G., Thompson J. D., (2003) Multiple sequence
alignment with the Clustral series of programs, Nucleic Acids Res.,
31, 3497-3500.) and T-Coffee (T-COFFEE: A novel method for multiple
sequence alignments. Notredame, Higgins, Hering a, JMB 302
(205-217) 2000 software packages may also be used to align
sequences.
[0051] Examples of algorithms that are suitable for determining
percent sequence identity and sequence similarity are the BLAST and
BLAST 2.0 algorithms, which are described in Altschul et al., 1990,
J. Mol. Biol. 215: 403-410 and Altschul et al., 1977, Nucleic Acids
Res. 3389-3402, respectively. Software for performing BLAST
analyses is publicly available through the National Center for
Biotechnology Information website. This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence, which either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to
as, the neighborhood word score threshold (Altschul et al, supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
then extended in both directions along each sequence for as far as
the cumulative alignment score can be increased. Cumulative scores
are calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always >0) and N
(penalty score for mismatching residues; always <0). For amino
acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
For amino acid sequences, the BLASTP program uses as defaults a
wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62
scoring matrix (see Henikoff and Henikoff, 1989, Proc Natl Acad Sci
USA 89:10915). Exemplary determination of sequence alignment and %
sequence identity can employ the BESTFIT or GAP programs in the GCG
Wisconsin Software package (Accelrys, Madison Wis.), using default
parameters provided.
[0052] "Reference sequence" refers to a defined sequence used as a
basis for a sequence comparison. In some cases, a "reference
sequence" refers to the sequence of a wild-type FAR (e.g., SEQ ID
NO:2 or 4) or the sequence of a specified FAR variant (e.g., SEQ ID
NO:6, 8, or 10). A reference sequence may be a subset of a larger
sequence, for example, a segment of a full-length gene or
polypeptide sequence. Generally, a reference sequence is at least
20 nucleotide or amino acid residues in length, at least 25
residues in length, at least 50 residues in length, at least 100
residues in length or the full length of the nucleic acid or
polypeptide. Since two polynucleotides or polypeptides may each (1)
comprise a sequence (i.e., a portion of the complete sequence) that
is similar between the two polynucleotides or polypeptides, and (2)
may further comprise a sequence that is divergent between the two
polynucleotides or polypeptides, sequence comparisons between two
(or more) polynucleotides or polypeptide are typically performed by
comparing sequences of the two polynucleotides over a "comparison
window" to identify and compare local regions of sequence
similarity.
[0053] "Comparison window" refers to a conceptual segment of at
least about 20 contiguous nucleotide positions or amino acids
residues wherein a sequence may be compared to a reference sequence
of at least 20 contiguous nucleotides or amino acids and wherein
the portion of the sequence in the comparison window may comprise
additions or deletions (i.e., gaps) of 20 percent or less as
compared to the reference sequence (which does not comprise
additions or deletions) for optimal alignment of the two sequences.
The comparison window can be longer than 20 contiguous residues,
and includes, optionally 30, 40, 50, 100, or longer windows.
[0054] Nucleic acids "hybridize" when they associate, typically in
solution. Nucleic acids hybridize due to a variety of
well-characterized physico-chemical forces, such as hydrogen
bonding, solvent exclusion, base stacking and the like. As used
herein, the term "stringent hybridization wash conditions" in the
context of nucleic acid hybridization experiments, such as Southern
and Northern hybridizations, are sequence dependent, and are
different under different environmental parameters. An extensive
guide to the hybridization of nucleic acids is found in Tijssen
(1993) "Laboratory Techniques in biochemistry and Molecular
Biology-Hybridization with Nucleic Acid Probes," Part I, Chapter 2
(Elsevier, New York), which is incorporated herein by reference.
For polynucleotides of at least 100 nucleotides in length, low to
very high stringency conditions are defined as follows:
prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 .mu.g/ml sheared and denatured salmon
sperm DNA, and either 25% formamide for low stringencies, 35%
formamide for medium and medium-high stringencies, or 50% formamide
for high and very high stringencies, following standard Southern
blotting procedures. For polynucleotides of at least 100
nucleotides in length, the carrier material is finally washed three
times each for 15 minutes using 2.times.SSC, 0.2% SDS at least at
50.degree. C. (low stringency), at least at 55.degree. C. (medium
stringency), at least at 60.degree. C. (medium-high stringency), at
least at 65.degree. C. (high stringency), and at least at
70.degree. C. (very high stringency).
[0055] "Codon optimized" refers to changes in the codons of the
polynucleotide encoding a protein to those preferentially used in a
particular organism such that the encoded protein is efficiently
expressed in the organism. Although the genetic code is degenerate
in that most amino acids are represented by several codons, called
"synonyms" or "synonymous" codons, it is well known that codon
usage by particular organisms is nonrandom and biased towards
particular codon triplets. This codon usage bias may be higher in
reference to a given gene, genes of common function or ancestral
origin, highly expressed proteins versus low copy number proteins,
and the aggregate protein coding regions of an organism's genome.
In some embodiments, the polynucleotides encoding enzymes may be
codon optimized for optimal production from the host organism
selected for expression. For example, in some embodiments, a
polynucleotide encoding a FAR variant as described herein (e.g.,
comprising one or more substitution sets listed in Table 1, Table
2, Table 4, Table 7, Table 8, Table 9, Table 10, or Table 11) is
codon optimized for expression in bacteria, e.g., E. coli.
[0056] "Preferred, optimal, high codon usage bias codons" refers
interchangeably to codons that are used at higher frequency in the
protein coding regions than other codons that code for the same
amino acid. The preferred codons may be determined in relation to
codon usage in a single gene, a set of genes of common function or
origin, highly expressed genes, the codon frequency in the
aggregate protein coding regions of the whole organism, codon
frequency in the aggregate protein coding regions of related
organisms, or combinations thereof. Codons whose frequency
increases with the level of gene expression are typically optimal
codons for expression. A variety of methods are known for
determining the codon frequency (e.g., codon usage, relative
synonymous codon usage) and codon preference in specific organisms,
including multivariate analysis, for example, using cluster
analysis or correspondence analysis, and the effective number of
codons used in a gene (See GCG Codon Preference, Genetics Computer
Group Wisconsin Package; CodonW, John Peden, University of
Nottingham; McInerney, J. O, 1998, Bioinformatics 14:372-73;
Stenico et al., 1994, Nucleic Acids Res. 222437-46; Wright, F.,
1990, Gene 87:23-29). Codon usage tables are available for a
growing list of organisms (see for example, Wada et al., 1992,
Nucleic Acids Res. 20:2111-2118; Nakamura et al., 2000, Nucleic
Acids Res. 28:292; Henaut and Danchin, "Escherichia coli and
Salmonella," 1996, Neidhardt, et al. Eds., ASM Press, Washington
D.C., p. 2047-2066). The data source for obtaining codon usage may
rely on any available nucleotide sequence capable of coding for a
protein. These data sets include nucleic acid sequences actually
known to encode expressed proteins (e.g., complete protein coding
sequences-CDS), expressed sequence tags (ESTs), or predicted coding
regions of genomic sequences (see for example, Mount, D.,
Bioinformatics: Sequence and Genome Analysis, Chapter 8, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001;
Uberbacher, E. C., 1996, Methods Enzymol. 266:259-281; Tiwari et
al., 1997, Comput. Appl. Biosci. 13:263-270).
[0057] In describing the variants and amino acid substitutions of
the present invention, the nomenclature described below is used. In
all cases the accepted IUPAC single letter or triple letter amino
acid abbreviations are employed. IUPAC single letter amino acid
abbreviations are as follows: alanine (A); cysteine (C); aspartic
acid (D); glutamic acid (E); phenylalanine (F); glycine (G);
histidine (H); isoleucine (I); lysine (K); leucine (L); methionine
(M); asparagine (N); proline (P); glutamine (Q); arginine (R);
serine (S); threonine (T); valine (V); tryptophan (W); and tyrosine
(Y). For amino acid substitutions relative to a specified sequence,
the following nomenclature is used: [Original amino acid, position,
substituted amino acid]. As a non-limiting example, for a variant
polypeptide described with reference to SEQ ID NO:2, "A2V"
indicates that in the variant polypeptide, the alanine at position
2 of the reference sequence is replaced by valine, with amino acid
position being determined by optimal alignment of the variant
sequence with SEQ ID NO:2. Similarly, "A512K/S/T" describes three
variants: a variant in which the alanine at position 512 of the
reference sequence is replaced by lysine, a variant in which the
alanine at position 512 of the reference sequence is replaced by
serine, and a variant in which the alanine at position 512 of the
reference sequence is replaced by threonine. In some embodiments,
an amino acid (or base) may be called "X," by which is meant any
amino acid (or base). For example, X2D/F/G/H/I/P/N/Q/T/V/W can
refer to a substitution in a FAR homolog in which the residue (X)
at the position in the homolog corresponding to position 2 of a
specified sequence (e.g., SEQ ID NO:2) is substituted so that the
residue at position 2 is any of D, F, G, H, I, P, N, Q, T, V, and
W.
[0058] The term "amino acid substitution set" or "substitution set"
refers to a group of amino acid substitutions. A protein
characterized as comprising a particular "substitution set"
comprises the substitutions of the substitution set relative to a
reference amino acid sequence. A substitution set can have 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more amino acid
substitutions. Exemplary substitution sets are provided in Tables
1, 2, 4, and 7-11. For example, the substitution set for Variant 26
(Table 1) consists of the amino acid substitutions N134S, E138Q,
P188S, and A511T. Examples of polypeptides comprising this
substitution set include, without limitation, Variant 26 and each
of Variants 27-33. In some embodiments, a substitution set is
described relative to a reference amino acid sequence that is a FAR
variant and comprises the substitutions of the reference amino acid
sequence. For example, the substitution set for Variant 144 (Table
2) consists of the amino acid substitutions G65R, S266A, R382H,
A389M, and G401V relative to SEQ ID NO:10. SEQ ID NO:10 is FAR
Variant 129, which has the substitution set Q181, R65G, N128H,
N134S, E138Q, N177T, P188S, K224R, L226M, P405V, Q418V, S433K,
S458Q, G487R, L502S, R508D, K509D, and A511T relative to SEQ ID
NO:2. Accordingly, Variant 144 also comprises the amino acid
substitutions Q181, R65G, N128H, N134S, E138Q, N177T, P188S, K224R,
L226M, P405V, Q418V, S433K, S458Q, G487R, L502S, R508D, K509D, and
A511T relative to SEQ ID NO:2.
[0059] A "conservative substitution," as used with reference to
amino acids, refers to the substitution of an amino acid with a
chemically similar amino acid. Amino acid substitutions which often
preserve the structural and/or functional properties of the
polypeptide in which the substitution is made are known in the art
and are described, for example, by H. Neurath and R. L. Hill, 1979,
in "The Proteins," Academic Press, New York. The most commonly
occurring exchanges are isoleucine/valine, tyrosine/phenylalanine,
aspartic acid/glutamic acid, lysine/arginine, methionine/leucine,
aspartic acid/asparagine, glutamic acid/glutamine,
leucine/isoleucine, methionine/isoleucine, threonine/serine,
tryptophan/phenylalanine, tyrosine/histidine, tyrosine/tryptophan,
glutamine/arginine, histidine/asparagine, histidine/glutamine,
lysine/asparagine, lysine/glutamine, lysine/glutamic acid,
phenylalanine/leucine, phenylalanine/methionine, serine/alanine,
serine/asparagine, valine/leucine, and valine/methionine.
[0060] In some embodiments, conservatively substituted variations
of a polypeptide (e.g., a FAR polypeptide) includes substitutions
of one or more amino acids of the polypeptide with a conservatively
selected amino acid of the same conservative substitution group. In
some embodiments less than 10%, less than 5%, less than 2% and
sometimes less than 1% of the amino acids of the polypeptide are
replaced. In some embodiments, there may be at least 1, at least 2,
at least 3, at least 4, at least 5, at least 6, at least 7, at
least 8, at least 9, at least 10, at least 15, at least 20, at
least 25, at least 30, at least 35, or at least 40 conservative
substitutions in a polypeptide. In some embodiments, there is no
more than 1, no more than 2, no more than 3, no more than 4, no
more than 5, no more than 6, no more than 7, no more than 8, no
more than 9, no more than 10, no more than 15, no more than 20, no
more than 25, no more than 30, no more than 35, or no more than 40
conservative substitutions in a polypeptide. The addition of
sequences which do not alter the encoded activity of a
polynucleotide (e.g., a FAR polynucleotide), such as the addition
of a non-functional or non-coding sequence, is considered a
conservative variation of the polynucleotide.
[0061] "Functional fragment" (or "biologically active fragment"),
as used herein, refers to a polypeptide that has an amino-terminal
and/or carboxy-terminal deletion and/or internal deletion, but
where the remaining amino acid sequence is identical to the
corresponding positions in the sequence to which it is being
compared (e.g., a full-length FAR variant of the invention) and
that retains substantially all of the activity of the full-length
polypeptide. Functional fragments of variant FARs can comprise up
to 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of
the corresponding full-length variant FAR enzyme.
[0062] An "endogenous" polynucleotide, gene, promoter or
polypeptide refers to any polynucleotide, gene, promoter or
polypeptide that originates in a particular host cell. A
polynucleotide, gene, promoter or polypeptide is not endogenous to
a host cell if it has been removed from the host cell, subjected to
laboratory manipulation, and then reintroduced into a host
cell.
[0063] A "heterologous" polynucleotide, gene, promoter or
polypeptide refers to any polynucleotide, gene, promoter or
polypeptide that is introduced into a host cell that is not
normally present in that cell, and includes any polynucleotide,
gene, promoter or polypeptide that is removed from the host cell
and then reintroduced into the host cell.
[0064] "Recombinant host cell," "engineered host cell,"
"recombinant microorganism," and "engineered microorganism" are
used interchangeably herein and refer to a microorganism (e.g., a
bacteria, yeast, filamentous fungi, or algae) into which has been
introduced a heterologous polynucleotide, gene, promoter, e.g., an
expression vector, or to a microorganism (e.g., a bacteria, yeast,
filamentous fungi, or algae) having a heterologous polynucleotide
or gene integrated into the genome.
[0065] "Control sequence" is defined herein to include all
components, which are necessary or advantageous for the expression
of a polypeptide of the present disclosure. Each control sequence
may be native or foreign to the nucleic acid sequence encoding the
polypeptide. Such control sequences include, but are not limited
to, a leader, polyadenylation sequence, propeptide sequence,
promoter, signal peptide sequence, and transcription terminator. At
a minimum, the control sequences include a promoter, and
transcriptional and translational stop signals. The control
sequences may be provided with linkers for the purpose of
introducing specific restriction sites facilitating ligation of the
control sequences with the coding region of the nucleic acid
sequence encoding a polypeptide.
[0066] "Operably linked" and "operably associated" are defined
herein as a configuration in which a control sequence is
appropriately placed at a position relative to the coding sequence
of the DNA sequence such that the control sequence directs the
expression of a polynucleotide and/or polypeptide.
[0067] "Promoter sequence" is a nucleic acid sequence that is
recognized by a host cell for expression of the coding region. The
control sequence may comprise an appropriate promoter sequence. The
promoter sequence contains transcriptional control sequences, which
mediate the expression of the polypeptide. The promoter may be any
nucleic acid sequence which shows transcriptional activity in the
host cell of choice including mutant, truncated, and hybrid
promoters, and may be obtained from genes encoding extracellular or
intracellular polypeptides either endogenous or heterologous to the
host cell.
[0068] The term "expression" includes any step involved in the
production of the polypeptide including, but not limited to,
transcription, post-transcriptional modification, translation,
post-translational modification, and secretion.
[0069] The terms "transform" or "transformation," as used in
reference to a cell, means a cell has a non-native nucleic acid
sequence integrated into its genome or as an episome (e.g.,
plasmid) that is maintained through multiple generations.
[0070] The term "culturing" refers to growing a population of
microbial cells under suitable conditions in a liquid or solid
medium. In particular embodiments, culturing refers to the
fermentative bioconversion of a substrate to an end product.
[0071] The term "recoverable," as used in reference to producing a
composition (e.g., fatty alcohols) by a method of the present
invention, refers to the amount of composition which can be
isolated from the reaction mixture yielding the composition
according to methods known in the art.
II. Introduction
[0072] The present invention relates to, among other things,
variant FAR enzymes with improved properties, polynucleotides
encoding the variant FAR enzymes, recombinant microorganisms
comprising a nucleic acid encoding a FAR variant, microorganisms
capable of expressing the FAR variants, processes for producing
fatty alcohols and other compositions derived therefrom using the
FAR variants and the resultant compositions.
[0073] Wild-type FAR polypeptides have been described. See, e.g.,
WO 2011/008535 (published 20 Jan. 2011), incorporated by reference
herein for all purposes. Certain FAR enzymes from
gammaproteobacteria (e.g., strains of Marinobacter and Oceanobacter
or taxonomic equivalents thereof) are capable of generating high
yields of fatty alcohols when genes encoding these enzymes are
expressed in heterologous cells. For example, the wild-type FAR
enzyme of Marinobacter species algicola (strain DG893) is capable
of producing a significantly increased yield of total fatty alcohol
as compared to FAR enzymes from B. mori, when expressed in an E.
coli host. The invention provides FAR variants with improved
properties as compared to their wild-type counterparts.
[0074] SEQ ID NO:2 is the amino acid sequence of the wild-type FAR
from Marinobacter algicola (strain DG893) and is described in WO
2011/008535. SEQ ID NO:1 is the wild-type polynucleotide sequence
encoding the wild-type FAR protein from Marinobacter algicola
strain DG893 (SEQ ID NO:2). SEQ ID NO:4 is the amino acid sequence
of wild-type FAR from Marinobacter aquaeolei VT8, which is also
described in WO 2011/008535. SEQ ID NO:3 is a polynucleotide
sequence encoding the wild-type FAR protein from Marinobacter
aquaeolei VT8 (SEQ ID NO:4) that is codon optimized for expression.
Amino acid sequence identity between SEQ ID NO:2 and SEQ ID NO:4 is
about 78%. See WO 2012/006114.
[0075] In one aspect, the invention relates to improved FAR
polypeptides. In another aspect, it can be seen that substitutions
introduced at numerous different amino acid (also referred to
herein as "residue") positions within a wild-type FAR (e.g., a FAR
of SEQ ID NO:2 or SEQ ID NO:4) yield FAR variant polypeptides
capable of catalyzing increased production of shorter chain (e.g.,
C12 to C14) fatty alcohols as compared to the wild-type FAR, as
shown for example in Table 1, Table 2, Table 4, Table 7, Table 8,
Table 9, Table 10, or Table 11. In a related aspect, the invention
relates to polynucleotides that encode a FAR variant polypeptide
capable of catalyzing increased production of C12 and C14 fatty
alcohols as compared to the wild-type FAR. In a related aspect, the
invention relates to microorganisms (e.g., bacterial microorganisms
such as E. coli) comprising a polynucleotide sequence encoding a
FAR variant polypeptide, wherein the microorganism produces a fatty
alcohol composition having a fatty alcohol profile which comprises
a higher percentage of C12 and C14 fatty alcohols as compared to
the fatty alcohol profile of a fatty alcohol composition produced
by a microorganism expressing a wild-type FAR.
[0076] Section IV ("FAR Variants") and Section XI ("Examples"),
below, describe exemplary FAR variants with improved properties.
One such improved property, discussed in Section III ("Improved
Properties of FAR Variants") and Section XI, is that a cell
expressing the FAR variant produces a more desired profile of fatty
alcohols than a cell expressing a wild-type FAR. Sections V
("Polynucleotides and Expression Systems for Expressing FAR
Variants") and VI ("Host Cells Comprising FAR Variants") describe
polynucleotides and vectors, and cell systems, respectively, used
to express FAR variant proteins in cells and to produce fatty
alcohols. Section VII ("Methods of Producing Fatty Alcohols")
describes methods for producing fatty alcohols using recombinant
cells and recovering the produced fatty alcohols. Section III (and
various other sections) describes the characteristics of fatty
alcohols produced according to the methods of the invention,
including fatty alcohol production levels and fatty alcohol
profiles. Section IX describes "Exemplary Compositions Containing
Fatty Alcohols and Fatty Alcohol Derivatives." Section X describes
methods for producing FAR proteins.
III. Improved Properties of Far Variants
[0077] In one aspect, the invention provides FAR variants having
improved properties over a wild-type FAR enzyme (e.g., SEQ ID NO:2
or 4) or over a reference sequence (e.g., SEQ ID NO:6, 8, 10, 12,
or 14). For example, a host cell or microorganism expressing a FAR
variant of the invention may have the improved property of
increased fatty alcohol production compared to a cell expressing a
wild-type FAR (also referred to herein as a "control cell") and/or
the fatty alcohols produced may have a different fatty alcohol
profile than the fatty alcohol profile produced by the control
cell. In some embodiments, a cell expressing a FAR variant produces
(i.e., yields) an increased amount of fatty alcohols as compared to
a wild-type FAR (e.g., SEQ ID NO:2 or 4) or a reference FAR variant
(e.g., SEQ ID NO:6, 8, 10, 12, or 14). In some embodiments, a cell
expressing a FAR variant has a fatty alcohol profile that comprises
a higher percentage of shorter chain fatty alcohols (e.g., C12 and
C14) as compared to a control cell expressing a reference FAR. In
some embodiments, the fatty alcohol profile produced by a cell
expressing a FAR variant is characterized by an increased amount of
C12 fatty alcohol (e.g., C12:0 (1-dodecanol) and/or C12:1 (cis
.DELTA..sup.5-dodecenol)), an increased amount of C14 fatty alcohol
(e.g., C14:0 (1-tetradecanol) and/or C14:1 (cis
.DELTA..sup.7-1-tetradecanol)), an increased amount of C12 and C14
fatty alcohols (e.g., C12:0 (1-dodecanol), C12:1 (cis
.DELTA..sup.5-dodecenol), C14:0 (1-tetradecanol), and/or C14:1 (cis
.DELTA..sup.7-1-tetradecanol)), a decreased amount of C18 fatty
alcohol (e.g., C18:0 (1-octadecanol) or C18:1 (cis
.DELTA..sup.11-1-octadecenol), or combinations of these, as
compared to a wild-type FAR (e.g., SEQ ID NO:2 or SEQ ID NO:4) or a
reference FAR (e.g., any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18,
20, 22, 24, 26, or 28). As used herein, "increased production of
shorter chain fatty alcohols" with a FAR variant refers to an
increased amount of shorter chain fatty alcohols (e.g., C12 and C14
fatty alcohols) as compared to a reference FAR (e.g., a wild-type
FAR), and/or an increased proportion of shorter chain fatty
alcohols (e.g., C12 and C14 fatty alcohols) in a fatty alcohol
composition produced with the FAR variant as compared to a
reference FAR (e.g., a wild-type FAR).
[0078] Other improved properties of FAR variants include, but are
not limited to, increased total fatty alcohol production; increased
level of carbon chain saturation; increased fatty alcohol
production at a specified culture pH (e.g., pH 3.5, 4, 4.5, 5, 5.5,
6, 6.5, 7, 7.5, or 8) or over a broader pH range (e.g., pH 3.5-7);
increased production of fatty alcohols at a specified culture
temperature (e.g., about 28.degree. C., about 30.degree. C., about
35.degree. C., about 37.degree. C., or about 40.degree. C.), or
over a broader temperature range (e.g., 30.degree. C.-42.degree.
C.).
Fatty Alcohol Production
[0079] In some embodiments, the engineered microorganisms according
to the invention, such as E. coli, comprising a FAR variant as
described herein, are capable of producing at least about 1.5-fold
(e.g., at least about 2.0-fold, at least about 3.0-fold, at least
about 4.0-fold, and at least about 5.0-fold) more fatty alcohols
than a wild-type FAR corresponding to SEQ ID NO:2 or SEQ ID NO:4
when assayed under the same conditions. In some embodiments, the
engineered microorganisms according to the invention, such as E.
coli, comprising a FAR variant as described herein, are capable of
producing at least about 1.5-fold more fatty alcohols than a
reference FAR variant (e.g., a FAR variant having the amino acid
sequence of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12,
or SEQ ID NO:14) when assayed under the same conditions. In some
embodiments, the engineered microorganisms according to the
invention, such as E. coli, comprising a FAR variant as described
herein, are capable of producing a fatty alcohol profile having one
or more of an increased amount of C12:0 (1-dodecanol), an increased
amount of C12:1 (cis .DELTA..sup.5-dodecenol), an increased amount
of C14:0 (1-tetradecanol), an increased amount of C14:1 (cis
.DELTA..sup.7-1-tetradecanol), an increased amount of C16:0
(1-hexadecanol), an increased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol), a decreased amount of C18:0
(1-octadecanol), or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol) as compared to a wild-type FAR or
reference FAR variant when assayed under the same conditions.
[0080] In some embodiments, a FAR variant polypeptide of the
invention is capable of producing more fatty alcohol than a
wild-type polypeptide corresponding to SEQ ID NO:2 or SEQ ID NO:4
when total fatty alcohol production is determined. "Total fatty
alcohol," as used herein, refers to the intracellular and secreted
amount of fatty alcohol. In some embodiments, a FAR variant
polypeptide of the invention is capable of producing more fatty
alcohol than a wild-type polypeptide corresponding to SEQ ID NO:2
or SEQ ID NO:4 when secreted fatty alcohol production is
determined. "Secreted fatty alcohol," as used herein, refers to the
extracellular fatty alcohol.
[0081] Fatty alcohol content can be measured using art known
methods, such as methods described herein below. In some
embodiments, an engineered microorganism of the invention
comprising a FAR variant polypeptide as described herein is capable
of producing more fatty alcohol than a wild-type polypeptide
corresponding to SEQ ID NO:2 or SEQ ID NO:4 or a reference FAR
variant (e.g., a FAR variant corresponding to SEQ ID NO:6, SEQ ID
NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14) when fatty
alcohol production is determined by gas chromatography. In certain
embodiments, total fatty alcohol production is determined by
measuring production of representative fatty alcohols such as C12:0
(1-dodecanol), C12:1 (cis .DELTA..sup.5-dodecenol), C14:0
(1-tetradecanol), C14:1 (cis .DELTA..sup.7-1-tetradecanol), C16:0
(1-hexadecanol), C16:1 (cis .DELTA..sup.9-1-hexadecenol), C18:0
(1-octadecanol), and/or C18:1 (cis
.DELTA..sup.11-1-octadecenol).
[0082] In some embodiments, the fatty alcohol compositions that are
produced comprise saturated fatty alcohols. In some embodiments,
the fatty alcohol compositions comprise unsaturated fatty alcohols.
In some embodiments, the unsaturated fatty alcohols are
monounsaturated fatty alcohols. In some embodiments, the fatty
alcohol compositions comprise both saturated and unsaturated fatty
alcohols, and the amount of unsaturated fatty alcohols is less than
about 30%, such as less than about 20%, such as less than about
10%, such as less than about 5%, such as less than about 1% of the
fatty alcohols present in the composition. In some embodiments, C12
to C18 fatty alcohols comprise at least about 85%, such as at least
about 90%, such as at least about 92%, such as at least about 95%,
such as at least about 97%, such as at least about 99% of the
produced fatty alcohols. In certain embodiments, C12 to C16 fatty
alcohols comprise about 80%, such as at least about 85%, such as at
least about 90%, such as at least about 92%, such as at least about
95%, such as at least about 97%, such as at least about 99% by
weight of the produced fatty alcohols. In certain embodiments, C12
to C14 fatty alcohols (e.g., C12 and C14 fatty alcohols) comprise
at least about 20%, such as at least about 25%, such as at least
about 30%, such as at least about 35%, such as at least about 40%,
such as at least about 45%, such as at least about 50%, such as at
least about 55%, such as at least about 60%, such as at least about
65%, such as at least 70%, such as at least 75%, such as at least
80%, such as at least 85%, such as at least 90% of the produced
fatty alcohols.
[0083] In some embodiments, C12 to C16 fatty alcohols comprise at
least about 80%, at least about 85%, at least about 90%, or at
least about 95% by weight of the total isolated fatty alcohols. In
certain embodiments, C12 to C14 fatty alcohols (e.g., C12 and C14
fatty alcohols) comprise at least about 40%, at least about 45%, at
least about 50%, at least about 55%, at least about 60%, at least
about 65%, at least about 70%, at least about 75%, at least about
80%, or at least about 85% by weight of the total isolated fatty
alcohols. In some embodiments, the fatty alcohol compositions that
are recovered (e.g., the C12 to C16 fatty alcohols or the C12 to
C14 fatty alcohols) comprise saturated fatty alcohols. In some
embodiments, the fatty alcohol compositions that are recovered
(e.g., the C12 to C16 fatty alcohols or the C12 to C14 fatty
alcohols) comprise a mixture of saturated and unsaturated fatty
alcohols.
Fatty Alcohol Profiles
[0084] In some embodiments, the engineered microorganisms of the
invention comprising a FAR variant polypeptide as described herein
produce fatty alcohol profiles that differ from the fatty alcohol
profiles produced by wild-type FAR. A "fatty alcohol profile"
refers to the chain length distribution in a composition containing
fatty alcohols, or the chain length distribution of fatty alcohols
produced by a cell. In some embodiments, the fatty alcohol profile
contains saturated fatty alcohols, unsaturated fatty alcohols, or a
mixture of saturated and unsaturated fatty alcohols. The degree of
unsaturation and position within a chain can also vary. For
example, a fatty alcohol may have 1, 2, 3, or more double bonds.
Additionally, two fatty alcohols with the same chain length may
each have a single double bond but at different positions. In some
embodiments, the relative proportions of C12:0 (1-dodecanol), C12:1
(cis .DELTA..sup.5-dodecenol), C14:0 (1-tetradecanol), C14:1 (cis
.DELTA..sup.7-1-tetradecanol), C16:0 (1-hexadecanol), C16:1 (cis
.DELTA..sup.9-1-hexadecenol), C18:0 (1-octadecanol), or C18:1 (cis
.DELTA..sup.11-1-octadecenol) are measured to determine fatty
alcohol profile. Fatty alcohol profiles can be measured using art
known methods, such as methods described hereinbelow.
[0085] In some embodiments, the FAR variant has at least about 70%
(or at least about 75%, at least about 80%, at least about 85%, at
least about 90%, at least about 91%, at least about 92%, at least
about 93%, at least about 94%, at least about 95%, at least about
96%, at least about 97%, at least about 98%, or at least about 99%)
sequence identity to SEQ ID NO:2 or SEQ ID NO:4 and comprises one
or more amino acid substitutions as described herein (e.g., one or
more amino acid substitutions or amino acid substitution sets
listed in Table 1, Table 2, Table 6, Table 7, Table 8, Table 9,
Table 10, or Table 11), wherein a cell or microorganism in which
the FAR variant is expressed produces a fatty alcohol profile that
differs from the fatty alcohol profile that is produced by a
corresponding cell of the same type expressing the wild-type FAR or
reference FAR from which the FAR variant derived when cultured
under the same conditions. For example, a cell (e.g., E. coli)
expressing the FAR variant may produce a higher percentage of a
particular fatty alcohol (e.g., a higher percentage of C12, C14,
and/or C16) than the cell expressing the wild-type FAR; or produce
a lower percentage of a particular fatty alcohol (e.g., a lower
percentage of C18) than the cell expressing the wild-type; or
produces a higher percentage of a range of fatty alcohols (such as
a higher percentage of C12 to C16 or C12 to C14 fatty alcohols)
than the cell expressing the wild-type. Generally, the fatty
alcohol profiles produced by a host cell (e.g., E. coli) expressing
a FAR variant and by a corresponding host cell of the same type
expressing the wild-type FAR from which the FAR variant may be
derived are measured by culturing the cells under the same
conditions, e.g, the same culture medium conditions (e.g., using LB
or M9YE medium), the same temperature conditions (e.g., at
30.degree. C. or at 37.degree. C.), and for the same culture period
conditions (e.g., culture for 24 hours).
[0086] In some embodiments, the engineered microorganisms of the
present invention produce fatty alcohol compositions having an
increased amount of C12:0 (1-dodecanol), an increased amount of
C12:1 (cis .DELTA..sup.5-dodecenol), an increased amount of C14:0
(1-tetradecanol), an increased amount of C14:1 (cis
.DELTA..sup.7-1-tetradecanol), an increased amount of C16:0
(1-hexadecanol), and/or an increased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol) relative to the wild-type FAR from
which the FAR variant is derived. In some embodiments, the
engineered microorganisms of the present invention produce fatty
alcohol compositions having a decreased amount of C18:0
(1-octadecanol), and/or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol) relative to the wild-type FAR from
which the FAR variant is derived.
[0087] In some embodiments, the fatty alcohol compositions that are
produced comprise an increased amount of one or more of C12:0
(1-dodecanol), C12:1 (cis .DELTA..sup.5-dodecenol), C14:0
(1-tetradecanol), C14:1 (cis .DELTA..sup.7-1-tetradecanol), C16:0
(1-hexadecanol), and/or C16:1 (cis .DELTA..sup.9-1-hexadecenol)
relative to the wild-type FAR from which the FAR variant is
derived. For example, in some embodiments, the fatty alcohol
compositions comprise an increased amount of C12:0 (1-dodecanol)
relative to the wild-type FAR from which the FAR variant is derived
(e.g., increased by at least about 5%, at least about 10%, at least
about 15%, at least about 20%, at least about 25%, at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, or more relative to the wild-type FAR enzyme from
which the FAR variant is derived). In some embodiments, the fatty
alcohol compositions comprise an increased amount of C12:1 (cis
.DELTA..sup.5-dodecenol) relative to the wild-type FAR from which
the FAR variant is derived (e.g., increased by at least about 5%,
at least about 10%, at least about 15%, at least about 20%, at
least about 25%, at least about 30%, at least about 35%, at least
about 40%, at least about 45%, at least about 50%, or more relative
to the wild-type FAR enzyme from which the FAR variant is derived).
In some embodiments, the fatty alcohol compositions comprise an
increased amount of C14:0 (1-tetradecanol) relative to the
wild-type FAR from which the FAR variant is derived (e.g.,
increased by at least about 5%, at least about 10%, at least about
15%, at least about 20%, at least about 25%, at least about 30%, at
least about 35%, at least about 40%, at least about 45%, at least
about 50%, or more relative to the wild-type FAR enzyme from which
the FAR variant is derived). In some embodiments, the fatty alcohol
compositions comprise an increased amount of C14:1 (cis
A.sup.7-1-tetradecanol) relative to the wild-type FAR from which
the FAR variant is derived (e.g., increased by at least about 5%,
at least about 10%, at least about 15%, at least about 20%, at
least about 25%, at least about 30%, at least about 35%, at least
about 40%, at least about 45%, at least about 50%, or more relative
to the wild-type FAR enzyme from which the FAR variant is derived).
In some embodiments, the fatty alcohol compositions comprise an
increased amount of C16:0 (1-hexadecanol) relative to the wild-type
FAR from which the FAR variant is derived (e.g., increased by at
least about 5%, at least about 10%, at least about 15%, at least
about 20%, at least about 25%, at least about 30%, at least about
35%, at least about 40%, at least about 45%, at least about 50%, or
more relative to the wild-type FAR enzyme from which the FAR
variant is derived). In some embodiments, the fatty alcohol
compositions comprise an increased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol) relative to the wild-type FAR from
which the FAR variant is derived (e.g., increased by at least about
5%, at least about 10%, at least about 15%, at least about 20%, at
least about 25%, at least about 30%, at least about 35%, at least
about 40%, at least about 45%, at least about 50%, or more relative
to the wild-type FAR enzyme from which the FAR variant is
derived).
[0088] In some embodiments, the fatty alcohol compositions comprise
a combination of two or more of: an increased amount of C12:0
(1-dodecanol) (e.g., increased by at least about 5%, at least about
10%, at least about 15%, at least about 20%, at least about 25%, at
least about 30%, at least about 35%, at least about 40%, at least
about 45%, at least about 50%, or more relative to the wild-type
FAR enzyme from which the FAR variant is derived); an increased
amount of C12:1 (cis .DELTA..sup.5-dodecenol) (e.g., increased by
at least about 5%, at least about 10%, at least about 15%, at least
about 20%, at least about 25%, at least about 30%, at least about
35%, at least about 40%, at least about 45%, at least about 50%, or
more relative to the wild-type FAR enzyme from which the FAR
variant is derived); an increased amount of C14:0 (1-tetradecanol)
(e.g., increased by at least about 5%, at least about 10%, at least
about 15%, at least about 20%, at least about 25%, at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, or more relative to the wild-type FAR enzyme from
which the FAR variant is derived); an increased amount of C14:1
(cis .DELTA..sup.7-1-tetradecanol) (e.g., increased by at least
about 5%, at least about 10%, at least about 15%, at least about
20%, at least about 25%, at least about 30%, at least about 35%, at
least about 40%, at least about 45%, at least about 50%, or more
relative to the wild-type FAR enzyme from which the FAR variant is
derived); an increased amount of C16:0 (1-hexadecanol) (e.g.,
increased by at least about 5%, at least about 10%, at least about
15%, at least about 20%, at least about 25%, at least about 30%, at
least about 35%, at least about 40%, at least about 45%, at least
about 50%, or more relative to the wild-type FAR enzyme from which
the FAR variant is derived); an increased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol) (e.g., increased by at least about 5%,
at least about 10%, at least about 15%, at least about 20%, at
least about 25%, at least about 30%, at least about 35%, at least
about 40%, at least about 45%, at least about 50%, or more relative
to the wild-type FAR enzyme from which the FAR variant is derived);
a decreased amount of C18:0 (1-octadecanol) (e.g., decreased by at
least about 5%, at least about 10%, at least about 15%, at least
about 20%, at least about 25%, at least about 30%, at least about
35%, at least about 40%, at least about 45%, at least about 50%, or
more relative to the wild-type FAR enzyme from which the FAR
variant is derived); or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol) (e.g., decreased by at least about
5%, at least about 10%, at least about 15%, at least about 20%, at
least about 25%, at least about 30%, at least about 35%, at least
about 40%, at least about 45%, at least about 50%, or more relative
to the wild-type FAR enzyme from which the FAR variant is
derived).
[0089] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and methods as described herein
have a fatty alcohol profile comprising at least about 60%, at
least about 65%, at least about 70%, at least about 75%, at least
about 80%, at least about 85%, at least about 90%, or at least
about 95% of C10 to C18 fatty alcohols.
[0090] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising at least about 60%, at
least about 65%, at least about 70%, at least about 75%, at least
about 80%, at least about 85%, at least about 90%, or at least
about 95% of C12 to C18 fatty alcohols.
[0091] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising at least about 50%, at
least about 60%, at least about 65%, at least about 70%, at least
about 75%, at least about 80%, at least about 85%, at least about
90%, or at least about 95% of C12 to C16 fatty alcohols (e.g., C12,
C14, and C16 fatty alcohols).
[0092] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising at least about 3%, at least
about 4%, at least about 5%, at least about 8%, at least about 10%,
at least about 15%, at least about 20%, at least about 25%, at
least about 30%, at least about 40%, at least about 45%, at least
about 50%, at least about 55%, at least about 60%, at least about
65%, at least about 70%, or at least about 75% of C12 to C14 fatty
alcohols (e.g., C12 and C14 fatty alcohols).
[0093] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising at least about 50%, at
least about 60%, at least about 65%, at least about 70%, at least
about 75%, at least about 80%, at least about 85%, at least about
90%, or at least about 95% of C14 to C16 (e.g., C14 and C16 fatty
alcohols).
[0094] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising at least about 1%, at least
about 2%, at least about 3%, at least about 4%, at least about 5%,
at least about 10%, at least about 15%, at least about 20%, at
least about 25%, at least about 30%, at least about 40%, at least
about 45%, at least about 50%, at least about 55%, at least about
60%, at least about 65%, at least about 70%, or at least about 75%
of C12 fatty alcohols. In some embodiments, fatty alcohol
compositions produced by the engineered microorganisms and the
methods described herein have a fatty alcohol profile comprising
from about 20% to about 60%, from about 20% to about 75%, from
about 30% to about 60%, from about 30% to about 75%, from about 40%
to about 60%, from about 40% to about 75% of C12 fatty
alcohols.
[0095] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising at least about 3%, at least
about 4%, at least about 5%, at least about 8%, at least about 10%,
at least about 15%, at least about 20%, at least about 25%, at
least about 30%, at least about 40%, at least about 45%, or at
least about 50% of C14 fatty alcohols. In some embodiments, the
fatty alcohol compositions produced by the engineered
microorganisms and the methods described herein have a fatty
alcohol profile comprising no more than about 40%, no more than
about 35%, no more than about 30%, or no more than about 25% of C14
fatty alcohols. In some embodiments, the fatty alcohol compositions
produced by the engineered microorganisms and the methods described
herein have a fatty alcohol profile comprising from about 15% to
about 40%, from about 20% to about 35%, or from about 20% to about
30% of C14 fatty alcohols.
[0096] In some embodiments, the fatty alcohol compositions produced
by the engineered microorganisms and the methods described herein
have a fatty alcohol profile comprising less than about 20%, less
than about 15%, less than about 10%, or less than about 5% of C18
fatty alcohols.
[0097] In certain embodiments, the fatty alcohol compositions
produced by the methods described herein have a fatty alcohol
profile comprising a mixture of saturated and unsaturated C12
(e.g., C12:0 and C12:1), C14 (C14:0 and C14:1), C16 (C16:0 and
C16:1), and C18 (C18:0 and C18-1) fatty alcohols. In some
embodiments, the fatty alcohol profile comprises at least about
10%, at least about 15%, at least about 20%, at least about 25%, at
least about 30%, at least about 35%, at least about 40%, at least
about 45%, at least about 50%, at least about 55%, at least about
60% or more of C14:0 fatty alcohol. In some embodiments, the fatty
alcohol profile further comprises at least about 20%, at least
about 25%, at least about 30%, at least about 35%, at least about
40%, at least about 45%, at least about 50%, at least about 55%, at
least about 60%, at least about 65%, or more of C16:1 fatty
alcohol. In some embodiments, the fatty alcohol profile further
comprises at least about 10%, at least about 15%, at least about
20%, at least about 25%, at least about 30%, at least about 35%, at
least about 40%, at least about 45%, at least about 50% or more of
C16:0 fatty alcohol. In some embodiments, the fatty alcohol profile
further comprises up to about 1%, up to about 5%, up to about 10%,
up to about 15%, up to about 20%, or up to about 25% of C18:1 fatty
alcohol.
[0098] In some embodiments, the fatty alcohol profile comprises at
least about 10%, at least about 15%, at least about 20%, at least
about 25%, at least about 30%, at least about 35%, at least about
40%, at least about 45%, at least about 50%, at least about 55%, at
least about 60%, at least about 65% of C12 (e.g., C12:0 and/or
C12:1) fatty alcohol. In some embodiments, the fatty alcohol
profile further comprises at least about 20%, at least about 25%,
at least about 30%, at least about 35%, at least about 40%, at
least about 45%, at least about 50%, at least about 55%, at least
about 60%, at least about 65%, or more of C14 (e.g., C14:0 andor
C14:1) fatty alcohol. In some embodiments, the fatty alcohol
profile further comprises at least about 5%, at least about 10%, at
least about 15%, at least about 20%, at least about 25%, at least
about 30%, at least about 35%, at least about 40%, at least about
45%, at least about 50% or more of C16 (e.g., C16:0 and/or C16:1)
fatty alcohol. In some embodiments, the fatty alcohol profile
further comprises up to about 1%, up to about 5%, up to about 10%,
up to about 15%, up to about 20%, or up to about 25% of C18 (e.g.,
C18:0 and/or C18:1) fatty alcohol.
Fatty Alcohol Measurements
[0099] FAR fatty alcohol production and fatty alcohol profiles
(i.e., chain length distribution) can be determined by methods
described in the Examples section and/or using any other method
known in the art. Fatty alcohol production by an organism
expressing a FAR variant can be described as an absolute quantity
(e.g., moles/liter of culture) or as a fold-improvement over
production by an organism or culture expressing a reference FAR
sequence (e.g., a wild-type FAR or a different FAR variant).
[0100] Fatty alcohol production and/or fatty alcohol profiles by a
microorganism expressing a FAR polypeptide can be measured, for
example, using gas chromatography. In general, cells expressing a
FAR variant are cultured, total or secreted fatty alcohols are
isolated, and fatty alcohol amount and/or content is measured.
[0101] Any number of assays can be used to determine whether a host
cell expressing a FAR variant as described herein produces an
increased amount of fatty alcohols (e.g., at least 1.5 times more
fatty alcohols) compared to a corresponding cell of the same type
expressing a wild-type FAR, and/or whether a host cell expressing a
FAR variant as described herein produces a different fatty alcohol
profile compared to a corresponding cell of the same type
expressing a wild-type FAR, including exemplary assays described
herein. In one exemplary assay, fatty alcohols produced by
productive E. coli strains are collected by extraction of 0.5 mL E.
coli whole culture (culture medium plus cells) expressing a FAR
variant using 1 mL of isopropanol:methyl t-butyl ether (MTBE) (4:6
ratio). The extraction mixture is allowed to shake for 2 hours at
room temperature. The extraction mixture is then centrifuged, the
upper organic phase transferred into a vial and analyzed by the gas
chromatography (GC) equipped with flame ionization detector (FID)
and DB-5MS column (length 30 m, I.D. 0.32 mm, film 0.25 um),
starting at 150.degree. C., and increasing the temperature at a
rate of 25.degree. C./min to 246.degree. C., then holding for 1.81
min.
[0102] Fatty alcohol production by a host cell expressing a FAR
variant can also be compared to a comparable cell ("control cell")
expressing a reference sequence, such as a wild-type FAR or a
different FAR variant. Typically the FARs of the host and control
cells are under control of the same promoter and the cells are
maintained under the same conditions. For illustration, fatty
alcohol production can be measured in E. coli (e.g., strain E. coli
BW25113), using FARs under the control of the same promoter (e.g.,
the lac promoter), where the cells are cultured at 37.degree. C.
and fatty alcohol produced after 24 hours of culture are
measured.
[0103] Fatty alcohol profiles (i.e., chain length distribution) can
be determined, for example, using gas chromatography and/or mass
spectroscopy. In an exemplary assay, fatty alcohols are produced as
described above and the identification of individual fatty alcohols
is performed by comparison to commercial standards (Sigma Chemical
Company, 6050 Spruce St. Louis, Mo. 63103). The identity of the
peaks can also be confirmed by running the samples through a gas
chromatography (GC) equipped with mass spectrometer (MS) as
needed.
IV. Far Variants
[0104] In one aspect, the sequences of the improved FAR
polypeptides described herein comprise at least about 70% sequence
identity with a wild-type FAR polypeptide and comprise one or more
mutations (e.g. amino acid substitutions) as compared to the
wild-type FAR from which the FAR variant is derived, such that when
expressed in a recombinant host cell, the cell produces an
increased amount of fatty alcohols or produces a fatty alcohol
composition comprising changes in a fatty alcohol profile as
compared to a control cell expressing a wild-type FAR.
Substitutions that yield increased fatty alcohol production under
these conditions are described herein. These substitutions can be
used singly or in any combinations. In some embodiments, a FAR
variant comprises a single substitution set, e.g., a substitution
set of any of Tables 1, 2, 4, 7, 8, 9, 10, or 11. In some
embodiments, a FAR variant comprises two or more (e.g., two, three,
four, five, or more) substitution sets. In some embodiments,
combinations of substitutions can be selected so as to provide
fatty alcohol production under the conditions specified that is at
least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold,
about 5-fold, about 6-fold, about 7-fold, about 8-fold, about
9-fold, or about 10-fold greater than that of the wild-type FAR
(e.g., SEQ ID NO:2 or SEQ ID NO:4). In some embodiments,
combinations of substitutions can be selected so as to provide
fatty alcohol compositions having increased amounts of C12 fatty
alcohols, C14 fatty alcohols, and/or C16 fatty alcohols under the
conditions specified as compared to the wild-type FAR (e.g., SEQ ID
NO:2 or SEQ ID NO:4). In some embodiments, combinations of
substitutions can be selected so as to provide fatty alcohol
compositions wherein an increased proportion of the total
composition comprises C12 fatty alcohols, C14 fatty alcohols,
and/or C16 fatty alcohols under the conditions specified as
compared to the wild-type FAR (e.g., SEQ ID NO:2 or SEQ ID
NO:4).
[0105] It has been discovered that certain substitutions, both
singly and in various combinations, yield an increase in the
shorter chain (e.g., C12 and C14) fatty alcohols produced by an
engineered microorganism (e.g., an increased total amount of C12
and C14 fatty alcohols and/or an increased proportion of C12 and
C14 fatty alcohols in a fatty alcohol composition), relative to a
wild-type FAR or a reference FAR variant. These substitutions may
include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, or more than
30 substitutions. In some embodiments, the FAR variants of the
invention differ from wild-type FAR (e.g., SEQ ID NO:2 or SEQ ID
NO:4) or a reference FAR variant (e.g., SEQ ID NO:6, SEQ ID NO:8,
SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14) by 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more
amino acid residues. In some embodiments, the FAR variant
polypeptides of the invention differ from SEQ ID NO:2, SEQ ID NO:4,
SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID
NO:14 in up to 20 residues. In some embodiments, the improved FAR
polypeptides differ from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ
ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14 in up to 15
residues, sometimes in up to 12 residues, or sometimes in up to 10
residues.
[0106] As shown herein, for example in Tables 1, 2, 4, 7, 8, 9, 10,
and 11, it can be seen that substitutions introduced at any of a
number of different amino acid positions in the wild-type FAR of
SEQ ID NO:2 or the wild-type FAR of SEQ ID NO:4 have yielded FAR
variants capable of producing fatty alcohol compositions with
increased levels of shorter chain fatty alcohols (e.g., C12 and
C14) when introduced into a host cell or microorganism (e.g., a
bacteria, yeast, filamentous fungi, or algae), as compared to the
fatty alcohol chain length composition produced by the wild-type
FAR when introduced into corresponding host cells or microorganisms
of the same type. In addition, substitutions (e.g., substitutions
listed in any of Tables 1, 2, 4, 7, 8, 9, 10, or 11) that are
introduced into a FAR variant reference sequence, such as SEQ ID
NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14,
have yielded FAR variants capable of producing fatty alcohol
compositions with increased levels of shorter chain fatty alcohols
(e.g., C12 and C14) when introduced into a host cell or
microorganism, as compared to the fatty alcohol chain length
composition produced by the FAR variant reference sequence when
introduced into corresponding host cells or microorganisms of the
same type. These substitutions may include 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 15, 20, 25, 30, or more than 30 substitutions.
[0107] In some embodiments, a FAR variant polypeptide comprises at
least about 75% (e.g., at least 80%, at least 85%, at least 90%, at
least 91%, at least 92%, at least 93%, at least 94%, at least 95%,
at least 96%, at least 97%, at least 98%, or at least 99%) sequence
identity to SEQ ID NO:2 (wild-type M. algicola FAR) and also
comprises one or more amino acid substitutions as described herein
(e.g., one or more amino acid substitutions or amino acid
substitution sets listed in Table 1, Table 2, Table 4, Table 7,
Table 8, Table 9, or Table 10).
[0108] In some embodiments, a FAR variant polypeptide comprises at
least about 75% (e.g., at least 80%, at least 85%, at least 90%, at
least 91%, at least 92%, at least 93%, at least 94%, at least 95%,
at least 96%, at least 97%, at least 98%, or at least 99%) sequence
identity to SEQ ID NO:4 (wild-type M. aquaeolei FAR) and also
comprises one or more amino acid substitutions as described herein
(e.g., one or more amino acid substitutions or amino acid
substitution sets listed in Table 11).
[0109] In some embodiments, a FAR variant polypeptide comprises at
least about 75% (e.g., at least 80%, at least 85%, at least 90%, at
least 91%, at least 92%, at least 93%, at least 94%, at least 95%,
at least 96%, at least 97%, at least 98%, or at least 99%) sequence
identity to a reference FAR polypeptide (e.g., a FAR variant of SEQ
ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14)
and also comprises one or more amino acid substitutions as
described herein. In some embodiments, said FAR variant polypeptide
comprises an amino acid substitution set listed in Table 1, Table
2, Table 4, Table 7, Table 8, Table 9, Table 10, or Table 11. In
another aspect, the invention relates to FAR variants that comprise
an amino acid sequence encoded by a nucleic acid that hybridizes
under stringent conditions over substantially the entire length of
a nucleic acid corresponding to SEQ ID NO:5, SEQ ID NO:7, SEQ ID
NO:9. SEQ ID NO:11, or SEQ ID NO:13, wherein the FAR variant, when
expressed in a recombinant host cell, produces an increased amount
of fatty alcohols or produces a fatty alcohol composition
comprising changes in a fatty alcohol profile as compared to a
control cell expressing the reference FAR polypeptide. Exemplary
reference FAR polypeptides include, for illustration and not
limitation, SEQ ID NOs:6, 8, 10, 12, and 14.
[0110] In certain embodiments the FAR variant comprises an amino
acid sequence having at least 80% (alternatively, at least 85%, at
least 88%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99%) sequence identity to SEQ ID NO:2 and
comprises a substitution at one or more positions selected from
positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 20, 23, 40, 43, 44, 45, 47, 49, 50, 52, 61, 62, 63, 65, 66,
68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 83, 84, 85,
86, 87, 88, 89, 90, 91, 93, 97, 98, 100, 101, 103, 104, 106, 107,
108. 111, 112, 113, 115, 116, 118, 120, 121, 122, 123, 126, 128,
129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 140, 144, 145,
148, 150, 151, 153, 154, 155, 156, 157, 158, 160, 161, 162, 163,
164, 166, 167, 174, 176, 177, 178, 179, 180, 181, 182, 185, 186,
187, 188, 189, 190, 191, 192, 193, 195, 196, 197, 198, 200, 205,
206, 207, 208, 209, 211, 212, 215, 216, 218, 220, 221, 224, 225,
226, 227, 228, 231, 235, 236, 238, 239, 240, 241, 242, 244, 245,
246, 247, 253, 258, 263, 264, 266, 267, 268, 270, 273, 275, 277,
278, 280, 281, 283, 284, 285, 286, 288, 303, 306, 308, 310, 313,
316, 318, 331, 337, 338, 339, 341, 351, 352, 355, 359, 361, 362,
363, 365, 368, 370, 373, 374, 376, 377, 380, 382, 384, 387, 388,
389, 393, 396, 397, 398, 399, 400, 401, 402, 404, 405, 406, 308,
409, 410, 411, 412, 413, 414, 416, 417, 418, 419, 421, 424, 426,
429, 430, 432, 433, 436, 442, 443, 446, 452, 458, 463, 465, 466,
474, 478, 482, 487, 489, 490, 491, 494, 495, 496, 498, 499, 500,
501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, or 512,
wherein the position is numbered with reference to SEQ ID NO:2. In
some embodiments, the FAR variant comprises substitutions at 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or
more positions. In certain embodiments, the FAR variant comprises
an amino acid sequence having at least 80% (alternatively, at least
85%, at least 88%, at least 90%, at least 91%, at least 92%, at
least 93%, at least 94%, at least 95%, at least 96%, at least 97%,
at least 98%, or at least 99%) sequence identity to SEQ ID NO:2 and
comprises one or more substitutions selected from M1E/G/L/RN/W,
A2D/F/G/H/P/Q/R/S/T/W/Y, T3/I/L, Q4/N/R/S/W/Y, Q5M/N,
Q6C/H/K/P/R/SN/Y, Q7H/N, N8A/E/HN, G9C/FN, A10T, S11D/G,
A12D/R/S/T, S13G/L/V, G14K/L/M/RN, V151, L16G/I/S, E17C/G/H/R,
Q181/L, R20K, H23R, K40R, R43H, T44A, V45A/S, D47E/N, G49E, G50A,
H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/Y, F68AN, L69E/I/M/Q,
N70D/E/L/M/R/T, E71C/M/Q/S, 172L, A73G/H/K/L/M, S74K/L/P/T/W,
S75C/E/H/N, S76E/F/I/L/R, V77I/P/T, F78M, E79D/I/L/Q/V, R801/L,
L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V, F89D/N/P/R, E90D/Q,
T91A/R, L93D, V97I, H98P, 1100V, T101A, E103C/S/V, V104I/M,
E106A/H, S107A, R108E/G/H/Q, L111I, T112G, P113I/Q, R115D, F116Y,
A118K, A120C, G121T, Q122E/H/T, V123L, F126V, N128C/H/L, S129D,
A130C/S, A131P/S, S132H, V133A/G, N134D/K/R/S/V, F135E, R136L,
E137L, E138Q/R, D140Y, K144A/E/R, I145E/H, L148E/K/T, L150P,
E151G/RN, V153F/I, A154G/R, A155G/M/R/T/W, L156M, A157Q/V, E158D/N,
N160T, S161P/Y, A162K, M163L, A164V, 1166L/M, Q167H, N174A,
K176G/I/M, N177D/E/L/R/T, S178F/L, G179D/S/W, Q180C/R, 1181D/E/L/V,
T182G/I/K/R, V185G/1/P, I186H, K187P, P188D/E/I/R/S/W, A189L/N,
G190I/K/L, E191V/W, S192A, I193C/L/V, R195F/H/I/N/W, S196D,
T197F/P, D198S, Y200F, E205K, L206C, V207L/M, H208R, L209N/T/Y,
Q211H/L/N/R, D212F, S215EN, D216G/Q, K218P/Q/R, R220A/H, Y221D/K,
K224R, V225C/M, L226M, E227G, K228H, V231A, 1235E, R236I, A238G,
N239C, N240Q/R/T, Y241F, G242E, S244A/P/R, D245H, T246A/P/V, Y247N,
L253P/V, L258P, S263N, G264R, S266A/T, L267H, T268N, V270L, S273F,
1275V, S277A, A278C, E2801, E281S/Y, S283A/E/F/M/T, P284C/L/Q,
G285D, W286Y, E288D/H/Q, E303G, S306T/W, F3081, G310L/V, S313Q,
I316L, V318F/L/M, S331V, S337G, G338E, S339P, Q341R, G351C, S352G,
I355F/L/S/W, K359E, I361C/F/L, D362L, Y363H, M365N, A368S, T370A/I,
A373W, A374Y, D376K/P/R, Q377H/K, Y380H/R, R382H/Q, T384S, F3871/L,
V388L, A3891/M/L/V, K393A, D396G, V397L, V398Y, V399I, G400S,
G401A/C/L/S/TN, M402V, V404I/L, P405A/C/F/G/L/V, L406Y, I408L,
A409T/V/W/Y, G410D/H/R, K411R, A412V, M413L/R, R414K, A416L/V,
G417V, Q418I/N/RN, N419S, E421D/G/I/L/P/R/S/V, V424M, K426R/T,
D429E/K/R, T430A/H/I, R432C/Q, S433H/K/N/R/Y, T436A, T442I, A443T,
Y446F, S452E/G/N, S458E/N/Q, L463V, R465K, V466G/Q, Q474L/R, Q478E,
C482R, G487R/Y, L489F, N490C/S, R491M, L494Y, K495C/S, E496D/G,
K498G/N, L499R/S/V, Y500H/N, S501C/F/W, L502A/Q/R/S/W, R503c/K,
A504D/E/S/T, A505E/G/K, D506G/L/M/R/W, T507H/Q, R508D/G/H/L/M,
K509D/G/H/P/Q/R, K510D/E/L/M/N/R/S, A511D/G/I/K/P/R/S/T, and/or
A512M/R. In some embodiments, the FAR variant comprises 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
substitions.
[0111] In some embodiments, the FAR variant comprises an amino acid
sequence having at least 80% (alternatively, at least 85%, at least
88%, at least 90%, at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
or at least 99%) sequence identity to SEQ ID NO:4 and comprises a
substitution at one or more positions selected from positions 8,
74, 116, 135, 228, 411, 430, 434, 438, 503, 512, and 513, wherein
the position is numbered with reference to SEQ ID NO:4. In some
embodiments, the FAR variant comprises substitutions at 2, 3, 4, 5
or more positions. In certain embodiments, the FAR variant
comprises an amino acid sequence having at least 80%
(alternatively, at least 85%, at least 88%, at least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least 97%, at least 98%, or at least 99%) sequence
identity to SEQ ID NO:4 and comprises one or more substitutions
selected from H8K, A74K/L, D116A/E, N135K, E228G, D411R, D430K,
S434K/F/W, I438V, L503R/S, A512G/Q/P, and A513G/K/R/S/T/P. In some
embodiments, the FAR variant comprises 2, 3, 4, 5 or more
substitutions.
[0112] In certain embodiments, the FAR variant comprises an amino
acid sequence having at least 90% (alternatively, at least 91%, at
least 92%, at least 93%, at least 94%, at least 95%, at least 96%,
at least 97%, at least 98%, or at least 99%) sequence identity to
SEQ ID NO:6 and comprises a substitution at one or more positions
selected from positions 14, 18, 65, 69, 71, 74, 77, 87, 91, 98,
104, 128, 134, 137, 138, 148, 153, 161, 180, 185, 188, 207, 209,
224, 227, 244, 246, 266, 283, 288, 303, 306, 331, 351, 365, 370,
374, 376, 377, 380, 382, 389, 398, 401, 404, 405, 406, 409, 410,
412, 413, 416, 418, 421, 429, 430, 432, 433, 443, 446, 452, 458,
466, 474, 487, 499, 500, 502, 505, 508, 509, 510, and 511, wherein
the position is numbered with reference to SEQ ID NO:6. In certain
embodiments, the FAR variant comprises an amino acid sequence
having at least 80% (alternatively, at least 85%, at least 88%, at
least 90%, at least 91%, at least 92%, at least 93%, at least 94%,
at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%) sequence identity to SEQ ID NO:6 and comprises a substitution
at one or more positions selected from 14R/V, 18Q, 61R, 65G, 69E/Q,
71Q, 74K/P, 77I, 87V, 91R, 98P, 104I/M, 128H, 134R/K/S, 137L, 138Q,
148E, 153I, 161P, 180R, 185I, 188I, 207L, 209N/T, 224R, 227G,
244A/P, 246A, 266A, 283M/F/E/T, 288Q, 303G, 306W, 331V, 351C, 365N,
370I, 374Y, 376P, 377K, 380R, 382H, 389I/M/L/V, 398Y, 401L/V/S/A/C,
405L/C/V/A/F/G, 404I, 406Y, 409V/W/Y, 410H/R, 412V, 413R, 416L/V,
418R/V/I, 421R/I/S/L/N/V/P, 429K/R/E, 430I/H, 432C/Q, 433H/N/K/Y/R,
443T, 446F, 452N/G, 458Q, 466Q, 474R, 487R/Y, 499S, 500N,
502R/S/A/Q/, 505K, 508G/H/D, 509H/D, 510D, and/or 511S/K/T/R/G. In
some embodiments, the FAR variant comprises 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
substitutions.
[0113] In certain embodiments, the FAR variant comprises an amino
acid sequence having at least 90% (alternatively, at least 91%, at
least 92%, at least 93%, at least 94%, at least 95%, at least 96%,
at least 97%, at least 98%, or at least 99%) sequence identity to
SEQ ID NO:8 and comprises a substitution at one or more positions
selected from positions 18, 61, 65, 74, 77, 104, 134, 137, 161,
246, 266, 283, 306, 370, 374, 380, 382, 389, 398, 401, 405, 410,
412, 421, 429, 446, 487, 499, 502, 505, 508, and 511, wherein the
position is numbered with reference to SEQ ID NO:8. In certain
embodiments, the FAR variant comprises an amino acid sequence
having at least 90% (alternatively, at least 91%, at least 92%, at
least 93%, at least 94%, at least 95%, at least 96%, at least 97%,
at least 98%, or at least 99%) sequence identity to SEQ ID NO:8 and
comprises one or more substitutions selected from 18Q, 61R, 65R,
74P, 771/Q, 1041, 134R/K, 137L, 161P, 246A, 266A, 283F, 306W, 370I,
374Y, 380R, 382H, 389M, 398Y, 401V, 405C/L/A, 410R, 412V, 421G/S/R,
429K, 446F, 487Y/G, 499R/S, 502W, 505K, 508G, and 511K. In some
embodiments, the FAR variant comprises 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more substitutions.
[0114] In certain embodiments, the FAR variant comprises an amino
acid sequence having at least 95% (alternatively, at least 96%, at
least 97%, at least 98%, at least 99% and even 100%) sequence
identity to SEQ ID NO:10 and comprises a substitution at one or
more positions selected from positions 18, 61, 65, 74, 77, 104,
134, 137, 161, 246, 266, 283, 306, 370, 374, 380, 382, 389, 398,
401, 405, 410, 412, 421, 429, 446, 487, 499, 502, 505, 508, and
511, wherein the position is numbered with reference to SEQ ID
NO:10. In some embodiments, the FAR variant comprises an amino acid
sequence having at least 95% (alternatively, at least 96%, at least
97%, at least 98%, at least 99% and even 100%) sequence identity to
SEQ ID NO:10 and comprises one or more substitutions selected from
18Q, 61R, 65R, 74P, 771/Q, 104I, 134R/K, 137L, 161P, 246A, 266A,
283F, 306W, 370I, 374Y, 380R, 382H, 389M, 398Y, 401V, 405C/L/A,
410R, 412V, 421G/S/R, 429K, 446F, 487Y/G, 499R/S, 502W, 505K, 508G,
and 511K. In some embodiments, the variant FAR comprises an amino
acid sequence having at least 95% (alternatively, at least 96%, at
least 97%, at least 98%, at least 99% and even 100%) sequence
identity to SEQ ID NO:10 and comprises a substitution at at least
two, three, four, or more positions, wherein at least two of the
positions are selected from 18, 61, 65, 74, 77, 104, 134, 137, 161,
246, 266, 283, 306, 370, 374, 380, 382, 389, 398, 401, 405, 410,
412, 421, 429, 446, 487, 499, 502, 505, 508, and 511. In some
embodiments, the variant FAR comprises an amino acid sequence
having at least 95% (alternatively, at least 96%, at least 97%, at
least 98%, at least 99% and even 100%) sequence identity to SEQ ID
NO:10 and comprises two, three, four, or more substitutions,
wherein at least two of the positions are selected from positions
18Q, 61R, 65R, 74P, 77I/Q, 104I, 134R/K, 137L, 161P, 246A, 266A,
283F, 306W, 370I, 374Y, 380R, 382H, 389M, 398Y, 401V, 405C/L/A,
410R, 412V, 421G/S/R, 429K, 446F, 487Y/G, 499R/S, 502W, 505K, 508G,
and 511K. In some embodiments, the FAR variant comprises 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
substitutions.
[0115] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 134, 138, 188,
405, 418, 458, 502, 508, 509, and 511, wherein the position is
numbered with reference to SEQ ID NO:2. In some embodiments, a FAR
variant comprises one or more substitutions selected from N134S,
E138Q, P188S, P405V, Q418V, S458Q, L502S, R508D, K509D, and A511T.
In some embodiments, a FAR variant comprises the substitution set
N134S, E138Q, P1885, P405V, Q418V, S458Q, L502S, R508D, K509D, and
A511T. In some embodiments, a FAR variant has the amino acid
sequence of SEQ ID NO:8.
[0116] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 18, 65, 128, 134,
138, 177, 188, 224, 226, 405, 418, 433, 458, 487, 502, 508, 509,
and 511, wherein the position is numbered with reference to SEQ ID
NO:2. In some embodiments, a FAR variant comprises one or more
substitutions selected from Q181, R65G, N128H, N134S, E138Q, N177T,
P188S, K224R, L226M, P405V, Q418V, S433K, S458Q, G487R, L502S,
R508D, K509D, and A511T. In some embodiments, a FAR variant
comprises the substitution set Q181, R65G, N128H, N134S, E138Q,
N177T, P188S, K224R, L226M, P405V, Q418V, S433K, S458Q, G487R,
L502S, R508D, K509D, and A511T. In some embodiments, a FAR variant
has the amino acid sequence of SEQ ID NO:10.
[0117] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 7, 18, 65, 128,
138, 177, 188, 224, 226, 227, 365, 401, 405, 418, 433, 458, 487,
502, 508, 509, and 511, wherein the position is numbered with
reference to SEQ ID NO:2. In some embodiments, a FAR variant
comprises one or more substitutions selected from Q7N, Q181, R65G,
N128H, E138Q, N177T, P188S, K224R, L226M, E227G, M365N, G401V,
P405V, Q418V, S433K, S458Q, G487R, L5025, R508D, K509D, and A511T.
In some embodiments, a FAR variant comprises the substitution set
Q7N, Q181, R65G, N128H, E138Q, N177T, P188S, K224R, L226M, E227G,
M365N, G401V, P405V, Q418V, S433K, S458Q, G487R, L502S, R508D,
K509D, and A511T. In some embodiments, a FAR variant has the amino
acid sequence of SEQ ID NO:16.
[0118] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 7, 18, 65, 104,
128, 138, 177, 188, 224, 226, 227, 365, 401, 405, 410, 418, 433,
458, 487, 502, 508, 509, and 511, wherein the position is numbered
with reference to SEQ ID NO:2. In some embodiments, a FAR variant
comprises one or more substitutions selected from Q7N, Q181, R65G,
V104I, N128H, E138Q, N177T, P188S, K224R, L226M, E227G, M365N,
G401V, P405V, G410R, Q418V, S433K, S458Q, G487R, L502S, R508D,
K509D, and A511T. In some embodiments, a FAR variant comprises the
substitution set Q7N, Q181, R65G, V104I, N128H, E138Q, N177T,
P188S, K224R, L226M, E227G, M365N, G401V, P405V, G410R, Q418V,
S433K, S458Q, G487R, L502S, R508D, K509D, and A511T. In some
embodiments, a FAR variant has the amino acid sequence of SEQ ID
NO:18.
[0119] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 7, 18, 65, 104,
128, 138, 177, 188, 224, 226, 227, 318, 365, 401, 405, 410, 418,
433, 458, 487, 502, 508, 509, and 511, wherein the position is
numbered with reference to SEQ ID NO:2. In some embodiments, a FAR
variant comprises one or more substitutions selected from Q7N,
Q181, R65G, V104I, N128H, E138Q, N177T, P188S, K224R, L226M, E227G,
V318F, M365N, G401V, P405V, G410R, Q418V, S433K, S458Q, G487R,
L502S, R508D, K509D, and A511T. In some embodiments, a FAR variant
comprises the substitution set Q7N, Q181, R65G, V104I, N128H,
E138Q, N177T, P188S, K224R, L226M, E227G, V318F, M365N, G401V,
P405V, G410R, Q418V, S433K, S458Q, G487R, L502S, R508D, K509D, and
A511T. In some embodiments, a FAR variant has the amino acid
sequence of SEQ ID NO:20.
[0120] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 7, 18, 104, 128,
138, 177, 188, 224, 226, 227, 318, 361, 365, 401, 405, 410, 418,
433, 458, 487, 496, 502, 508, 509, 510, and 511, wherein the
position is numbered with reference to SEQ ID NO:2. In some
embodiments, a FAR variant comprises one or more substitutions
selected from Q7N, Q181, V104I, N128H, E138Q, N177T, P188S, K224R,
L226M, E227G, V318F, I361F, M365N, G401V, P405V, G410R, Q418V,
S433K, S458Q, G487R, E496G, L502S, R508D, K509D, K510E, and A511T.
In some embodiments, a FAR variant comprises the substitution set
Q7N, Q181, V104I, N128H, E138Q, N177T, P188S, K224R, L226M, E227G,
V318F, I361F, M365N, G401V, P405V, G410R, Q418V, S433K, S458Q,
G487R, E496G, L502S, R508D, K509D, K510E, and A511T. In some
embodiments, a FAR variant has the amino acid sequence of SEQ ID
NO:22.
[0121] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 7, 14, 18, 104,
128, 138, 177, 188, 189, 220, 224, 226, 227, 316, 318, 355, 361,
365, 401, 405, 410, 418, 433, 458, 487, 496, 502, 508, 509, 510,
and 511, wherein the position is numbered with reference to SEQ ID
NO:2. In some embodiments, a FAR variant comprises one or more
substitutions selected from Q7N, G14L, Q181, V104I, N128H, E138Q,
N177T, P188S, A189N, R220H, K224R, L226M, E227G, I316L, V318F,
I355F, I361F, M365N, G401V, P405V, G410H, Q418V, S433K, S458Q,
G487R, E496G, L502A, R508D, K509D, K510E, and A511T. In some
embodiments, a FAR variant comprises the substitution set Q7N,
G14L, Q181, V104I, N128H, E138Q, N177T, P188S, A189N, R220H, K224R,
L226M, E227G, I316L, V318F, I355F, I361F, M365N, G401V, P405V,
G410H, Q418V, S433K, S458Q, G487R, E496G, L502A, R508D, K509D,
K510E, and A511T. In some embodiments, a FAR variant has the amino
acid sequence of SEQ ID NO:24.
[0122] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 6, 7, 18, 104,
108, 128, 138, 177, 188, 224, 226, 227, 318, 355, 361, 365, 401,
405, 410, 418, 433, 458, 487, 496, 502, 508, 509, 510, and 511,
wherein the position is numbered with reference to SEQ ID NO:2. In
some embodiments, a FAR variant comprises one or more substitutions
selected from Q6R, Q7N, Q181, V104I, R108H, N128H, E138Q, N177T,
P188S, K224R, L226M, E227G, V318F, I355L, I361F, M365N, G401V,
P405V, G410R, Q418V, S433K, S458Q, G487R, E496G, L502S, R508D,
K509D, K510E, and A511T. In some embodiments, a FAR variant
comprises the substitution set Q6R, Q7N, Q181, V104I, R108H, N128H,
E138Q, N177T, P188S, K224R, L226M, E227G, V318F, I355L, I361F,
M365N, G401V, P405V, G410R, Q418V, S433K, S458Q, G487R, E496G,
L502S, R508D, K509D, K510E, and A511T. In some embodiments, a FAR
variant has the amino acid sequence of SEQ ID NO:26.
[0123] In some embodiments, a FAR variant comprises a substitution
at one or more positions selected from positions 4, 6, 7, 18, 62,
104, 108, 128, 138, 177, 188, 224, 226, 227, 316, 318, 355, 361,
365, 401, 405, 410, 418, 433, 458, 487, 496, 502, 507, 508, 509,
510, and 511, wherein the position is numbered with reference to
SEQ ID NO:2. In some embodiments, a FAR variant comprises one or
more substitutions selected from Q4Y, Q6R, Q7N, Q181, P62Q, V104I,
R108H, N128H, E138Q, N177T, P188S, K224R, L226M, E227G, I316L,
V318F, I355L, I361F, M365N, G401V, P405V, G410H, Q418V, S433K,
S458Q, G487R, E496G, L502S, T507H, R508D, K509D, K510E, and A511I.
In some embodiments, a FAR variant comprises the substitution set
Q4Y, Q6R, Q7N, Q181, P62Q, V104I, R108H, N128H, E138Q, N177T,
P188S, K224R, L226M, E227G, I316L, V318F, I355L, I361F, M365N,
G401V, P405V, G410H, Q418V, S433K, S458Q, G487R, E496G, L502S,
T507H, R508D, K509D, K510E, and A511I. In some embodiments, a FAR
variant has the amino acid sequence of SEQ ID NO:28.
[0124] In certain embodiments, the FAR variant comprises an amino
acid sequence having at least 80% (alternatively, at least 85%, at
least 88%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99%) sequence identity to SEQ ID NO:2 and
comprises one or more substitution sets selected from the
substitutions sets listed in any of Table 1, Table 2, Table 4,
Table 7, Table 8, Table 9, Table 10, or Table 11. In some
embodiments, the FAR variant comprises at least 80% sequence
identity to SEQ ID NO:2 and comprises one or more substitution sets
selected from the substitutions sets listed in any of Table 1,
Table 2, Table 4, Table 7, Table 8, Table 9, Table 10, or Table 11,
and a host cell or microorganism expressing the FAR variant
produces an increased amount of shorter chain fatty alcohols (e.g.,
C12 and C14) as compared to a host cell or microorganism expressing
a wild-type FAR of SEQ ID NO:2. In some embodiments, a host cell or
microorganism expressing the FAR variant produces at least
1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold,
about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about
10-fold or more of C12 and C14 fatty alcohols as compared to a host
cell or microorganism expressing a wild-type FAR of SEQ ID NO:2. In
some embodiments, the fatty alcohol composition comprising C12 and
C14 fatty alcohols produced from a host cell or microorganism
comprising the FAR variant will comprise at least 10%, at least
15%, at least 20%, at least 25%, at least 30%, at least 35%, at
least 40%, at least 45%, at least 50%, at least 55%, at least 60%,
at least 65%, at least 70%, or at least 75% C12 and C14 fatty
alcohols.
[0125] In certain embodiments, the FAR variant comprises an amino
acid sequence having at least 80% (alternatively, at least 85%, at
least 88%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99%) sequence identity to SEQ ID NO:4 and
comprises one or more substitution sets selected from the
substitutions sets listed in any of Table 1, Table 2, Table 4,
Table 7, Table 8, Table 9, Table 10, or Table 11. In some
embodiments, the FAR variant comprises one or more substitution
sets listed in Table 11. In some embodiments, the FAR variant
comprises at least 80% sequence identity to SEQ ID NO:4 and
comprises one or more substitution sets selected from the
substitutions sets listed in any of Table 1, Table 2, Table 4,
Table 7, Table 8, Table 9, Table 10, or Table 11, and a host cell
or microorganism expressing the FAR variant produces an increased
amount of shorter chain fatty alcohols (e.g., C12 and C14) as
compared to a host cell or microorganism expressing a wild-type FAR
of SEQ ID NO:4. In some embodiments, a host cell or microorganism
expressing the FAR variant produces at least 1.5-fold, about
2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold,
about 7-fold, about 8-fold, about 9-fold, or about 10-fold or more
of C12 and C14 fatty alcohols as compared to a host cell or
microorganism expressing a wild-type FAR of SEQ ID NO:4. In some
embodiments, the fatty alcohol composition comprising C12 to C14
fatty alcohols produced from a host cell or microorganism
comprising the FAR variant will comprise at least 10%, at least
15%, at least 20%, at least 25%, at least 30%, at least 35%, at
least 40%, at least 45%, at least 50%, at least 55%, at least 60%,
at least 65%, at least 70%, or at least 75% C12 and C14 fatty
alcohols.
[0126] Improved or increased fatty alcohol production of a FAR
variant relative to a reference polypeptide can be detected by
comparing fatty alcohol production by host cells expressing the FAR
variant to fatty alcohol production by host cells (of the same
type) expressing the reference protein (which may be a wild-type or
variant FAR) or a host cell not expressing exogenous FAR. It will
be understood by those of skill that it is desirable that the only
paramater varied between the cells is the FAR being expressed
(e.g., a wild-type FAR or a FAR variant). Thus, for example, the
FAR variant and reference polypeptide will be encoded by
polynucleotides with the same sequence except at codons
corresponding to substitutions (typically a sequence that is codon
optimized for the cell type) and will be controlled by the same
promoter, and cells expressing the polypeptides will be cultured
under the same conditions. Improved or increased fatty alcohol
production of a cell expressing a FAR variant relative to a cell
not expressing an exogenous FAR may also be measured.
[0127] For bacterial host cells, such as E. coli, exemplary assay
conditions are described in Examples 2 and 4. In one approach, E.
coli are transformed with an expression cassette comprising a
sequence encoding the FAR variant or the reference protein (e.g.,
wild-type FAR, such as FAR Maa or FAR Maq) and an operably linked
promoter. The cells may be stably transformed. The promoter may be
constitutive or inducible. The lac promoter may be used. The cells
are grown in medium (e.g., M9YE medium containing 0.5-5% glucose;
Dunny, G. M., and Clewell, D. B., 1975. J. Bacteriol. 124:784-790)
and any appropriate selection agents (see Examples 2 and 4). In one
approach the cells are cultured for a period of time (e.g., 18
hours or 24 hours) and fatty alcohol production is assayed.
Typically, total fatty alcohol is assayed, but the amount of fatty
alcohol secreted into the medium may be assayed if desired. In some
embodiments, the promoter is inducible. For example, cells may be
grown (e.g., to an OD.sub.600 of 0.6-0.8), at which point
expression of the heterologous FAR gene is induced (e.g., by
addition of IPTG to a 1 mM final concentration when the lac
promoter is used). Incubation is continued for 24 hours at
30.degree. C. (alternatively 37.degree. C. or 40.degree. C.) and
fatty alcohol production is assayed.
[0128] Other exemplary assays for assessing FAR activity are known
in the art. See, for example, U.S. Pat. No. 5,370,996; US
2010/0203614; and Wahlen et al., Appl. Environ. Microbiol.
75(9):2758 (2009).
[0129] It will be apparent that the same assays may be used to
asssess FAR activity of functionally active fragments of FAR
variants.
Functional Fragments of FAR Variants
[0130] Skilled artisans will appreciate that oftentimes, the full
length sequence of an enzyme is not required for enzymatic
activity. Therefore, "functional fragments" of the various FAR
variants described herein are also contemplated and included in the
disclosure. In some embodiments the term "FAR variants" encompasses
functional fragments. Sometimes both FAR variants and functional
fragments thereof are referred to herein as "improved FAR variant
polypeptides." The enzymatic activity of functional fragments may
be measured as described in the hereinbelow.
[0131] In some embodiments the functional fragments comprise at
least 85%, at least 90%, at least 93%, at least 95%, at least 96%,
at least 97%, at least 98% and at least 99% of the corresponding
full-length FAR variant enzyme (e.g., a FAR variant of any of SEQ
ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ
ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24,
SEQ ID NO:26, or SEQ ID NO:28). In many instances, functional
fragments, like the full-length FAR variant enzyme from which they
are derived, will produce 1.5-fold or higher total fatty alcohol
than the wild-type FAR of SEQ ID NO:2, when assayed under the same
conditions. In some embodiments, the functional fragments of the
FAR variants of the invention are from about 350 to about 550 amino
acids in length, e.g., from about 350 to about 500 amino acids in
length, from about 350 to about 475 amino acids in length, from
about 350 to about 450 amino acids in length and also from about
350 to about 400 amino acids in length. In some embodiments, the
functional fragments of FAR variants of the invention are from 400
to 550 amino acids in length, such as from about 400 to 500, from
about 450 to 500, from about 475 to 500, from about 500 to 525, or
from 505 to 515 amino acids in length. In some embodiments, the
functional fragments of the FAR variants of the invention are from
about 350 to about 550 amino acids in length, e.g., from about 350
to about 500 amino acids in length, from about 350 to about 475
amino acids in length, from about 350 to about 450 amino acids in
length and also from about 350 to about 400 amino acids in length.
In some embodiments, the functional fragments of FAR variants of
the invention are from 400 to 550 amino acids in length, such as
from about 400 to 500, from about 450 to 500, from about 475 to
500, from about 500 to 525, or from 505 to 515 amino acids in
length as compared to a full-length FAR variant (e.g., a FAR
variant of any of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID
NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ
ID NO:22, SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:28).
[0132] In some embodiments, regions of one or both termini, such
as, for example, from about 1 to about 10; 1 to about 15; or 1 to
about 20 residues at one or both termini, may be removed without
significantly deleteriously affecting the activity of the enzyme.
Such deletions can often times be made internally without
detrimental effect.
Exemplary Substitutions in Marinobacter algicola FAR Homologs
[0133] In another aspect, the present invention provides FAR
variants of naturally occurring FAR enzymes of marine
proteobacteria species other than Marinobacter algicola (strain
DG893) which comprise a substitution or modification at least one
position corresponding to a substitution of a M. algicola FAR
variant described herein, and which have improved properties
relative to the naturally occurring FAR enzyme.
[0134] In particular, analogous substitutions may be made in marine
gammaproteobacteria with significant sequence similarity to
Marinobacter algicola (strain DG893). For example, analogous
substitutions may be made in other species of Marinobacter
including but not limited to M. algicola, M. aquaeolei, M.
arcticus, M. actinobacterium, and M. lipolyticus; species of
Oceanobacter including but not limited to Oceanobacter sp. Red65
(renamed Bermanella marisrubi), Oceanobacter strain WH099, and O.
kriegii; and species of Hahella including but not limited to H.
chejuensis and equivalent species thereof.
[0135] It is within the ability of one of ordinary skill in the art
to identify other examples of structurally homologous proteins. The
present invention provides variants of these and other FAR proteins
in which substitutions are made at residues corresponding to those
identified herein in the M. algicola FAR protein.
[0136] To produce FAR homologs with improved properties, the
sequences of the wild-type M. algicola FAR and the FAR homolog
(e.g., a M. aquaeolei FAR protein) can be aligned in a pairwise
manner as described supra. Based on the alignment, a residue in a
position in the homolog that corresponds, based on the alignment,
with a specified position in M. algicola FAR is identified. For
example, analogous substitutions in wild-type M. aquaeolei FAR to
those substitutions described in Table 1, Table 2, Table 4, Table
7, Table 8, Table 9, or Table 10 can be made by aligning the
wild-type M. algicola FAR protein (SEQ ID NO:2) with the wild-type
M. aquaeolei FAR protein (SEQ ID NO:4). Analogous substitutions in
M. aquaeolei are described herein in Example 10.
[0137] Thus, in some embodiments, the present invention provides a
recombinant FAR variant comprising at least about 70% (or at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%, at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99%) sequence
identity to SEQ ID NO:2 and comprising one or more amino acid
substitutions selected from X1E/G/URN/W, X2D/F/G/H/P/Q/R/S/T/W/Y,
X3/I/L, X4/N/R/S/W/Y, X5M/N, X6C/H/K/P/R/S/V/Y, X7H/N, X8A/E/H/V,
X9C/FN, X10T, X11D/G, X12D/R/S/T, X13G/L/V, X14K/L/M/R/V, X15I,
X16G/I/S, X17C/G/H/R, X18I/L, X20K, X23R, X40R, X43H, X44A, X45A/S,
X47E/N, X49E, X50A, X52Y, X61R, X62Q, X63D, X65G, X66D/F/S/Y,
X68A/V, X69E/I/M/Q, X70D/E/L/M/R/T, X71C/M/Q/S, X72L, X73G/H/K/L/M,
X74K/L/P/T/W, X75C/E/H/N, X76E/F/I/L/R, X77I/P/T, X78M,
X79D/I/L/Q/V, X80I/L, X81F/T, X83E, X84A, X85E, X86S, X87V, X88G/V,
X89D/N/P/R, X90D/Q, X91A/R, X93D, X97I, X98P, X100V, X101A,
X103C/S/V, X104I/M, X106A/H, X107A, X108E/G/H/Q, X1111, X112G,
X113I/Q, X115D, X116Y, X118K, X120C, X121T, X122E/H/T, X123L,
X126V, X128C/H/L, X129D, X130C/S, X131P/S, X132H, X133A/G,
X134D/K/R/S/Y, X135E, X136L, X137L, X138Q/R, X140Y, X144A/E/R,
X145E/H, X148ENT, X150P, X151G/RN, X153F/I, X154G/R, X155G/M/R/T/W,
X156M, X157Q/V, X158D/N, X160T, X161P/Y, X162K, X163L, X164V,
X166L/M, X167H, N174A, X176G/I/M, X177D/E/L/R/T, X178F/L,
X179D/S/W, X180C/R, X181D/E/L/V, X182G/I/K/R, X185G/I/P, X186H,
X187P, X188D/E/I/R/S/W, X189L/N, X190I/K/L, X191V/W, X192A,
X193C/L/V, X195F/H/I/N/W, X196D, X197F/P, X198S, X200F, X205K,
X206C, X207L/M, X208R, X209N/T/Y, X211H/L/N/R, X212F, X215E/Y,
X216G/Q, X218P/Q/R, X220A/H, X221D/K, X224R, X225C/M, X226M, X227G,
X228H, X231A, X235E, X236I, X238G, X239C, X240Q/R/T, X241F, X242E,
X244A/P/R, X245H, X246A/P/V, X247N, X253P/V, X258P, X263N, X264R,
X266A/T, X267H, X268N, X270L, X273F, X275V, X277A, X278C, X280I,
X281S/Y, X283A/E/F/M/T, X284C/L/Q, X285D, X286Y, X288D/H/Q, X303G,
X306T/W, X3081, X310L/V, X313Q, X316L, X318F/L/M, X331V, X337G,
X338E, X339P, X341R, X351C, X352G, X355F/L/S/W, X359E, X361C/F/L,
X362L, X363H, X365N, X368S, X370A/I, X373W, X374Y, X376K/P/R,
X377H/K, X380H/R, X382H/Q, X384S, X3871/L, X388L, X3891/M/L/V,
X393A, X396G, X397L, X398Y, X3991, X400S, X401A/C/L/S/TN, X402V,
X404I/L, X405A/C/F/G/UV, X406Y, X408L, X409TN/W/Y, X410D/H/R,
X411R, X412V, X413L/R, X414K, X416L/V, X417V, X418I/N/R/V, X419S,
X421D/G/I/L/P/R/S/V, X424M, X426R/T, X429E/K/R, X430A/H/I, X432C/Q,
X433H/K/N/R/Y, X436A, X4421, X443T, X446F, X452E/G/N, X458E/N/Q,
X463V, X465K, X466G/Q, X474L/R, X478E, X482R, X487R/Y, X489F,
X490C/S, X491M, X494Y, X495C/S, X496D/G, X498G/N, X499R/S/V,
X500H/N, X501C/F/W, X502A/Q/R/S/W, X503C/K, X504D/E/S/T, X505E/G/K,
X506G/L/M/R/W, X507H/Q, X508D/G/H/L/M, X509D/G/H/P/Q/R,
X510D/E/L/M/N/R/S, X511D/G/I/K/P/R/S/T, and/or X512M/R, wherein the
position is numbered with reference to a wild-type M. algicola FAR
(e.g., SEQ ID NO:2), and wherein the FAR variant, when expressed in
a host cell, exhibits increased fatty alcohol production of C12 to
C14 or C12 to C16 fatty alcohols relative to the wild-type FAR
homolog from which the FAR variant is derived. In some embodiments,
the FAR variant produces an increased amount of fatty alcohols as
compared to the wild-type FAR. In some embodiments, the FAR variant
produces an increased amount of an aggregate comprising one or more
of the fatty alcohols C12:0 (1-dodecanol), C12:1 (cis
A.sup.5-dodecenol), C14:0 (1-tetradecanol), C14:1 (cis
.DELTA..sup.7-1-tetradecanol), C16:1 (cis
.DELTA..sup.9-1-hexadecenol), and C16:0 (1-hexadecanol), as
compared to the wild-type FAR. In some embodiments, the FAR variant
produces a fatty alcohol profile having a decreased amount of C18:0
(1-octadecanol) and/or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol) as compared to the wild-type FAR. In
some embodiments, the FAR variant produces a fatty alcohol profile
having an increased amount of C12:0 (1-dodecanol), C12:1 (cis
.DELTA..sup.5-dodecenol), C14:0 (1-tetradecanol), and/or C14:1 (cis
.DELTA..sup.7-1-tetradecanol). In some embodiments, the fatty
alcohol profile produced by the FAR variant comprises an increased
amount of C12:0 (1-dodecanol) as compared to the wild-type FAR. In
some embodiments, the fatty alcohol profile produced by the FAR
variant further comprises an increased amount of C12:1 (cis
.DELTA..sup.5-dodecenol) as compared to the wild-type FAR. In some
embodiments, the fatty alcohol profile produced by the FAR variant
further comprises an increased amount of C14:0 (1-tetradecanol) as
compared to the wild-type FAR.
[0138] In some embodiments, the present invention relates to a
method of making FAR variants having increased fatty alcohol
production and/or an improved fatty alcohol profile relative to
wild-type FAR. In some embodiments, the method comprises: [0139]
(a) identifying a sequence that comprises at least about 70% (or at
least about 75%, at least about 80%, at least about 85%, at least
about 90%, at least about 95%, at least about 96%, at least about
97%, at least about 98%, or at least about 99%) sequence identity
to SEQ ID NO:2 (alternatively, SEQ ID NO:4); [0140] (b) aligning
the identified sequence with the sequence of SEQ ID NO:2
(alternatively, SEQ ID NO:4); and [0141] (c) substituting one or
more amino acid residues from the identified sequence, wherein the
substitutions are made at one or more positions corresponding to
positions selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 20, 23, 40, 43, 44, 45, 47, 49, 50, 52, 61, 62,
63, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,
83, 84, 85, 86, 87, 88, 89, 90, 91, 93, 97, 98, 100, 101, 103, 104,
106, 107, 108. 111, 112, 113, 115, 116, 118, 120, 121, 122, 123,
126, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 140,
144, 145, 148, 150, 151, 153, 154, 155, 156, 157, 158, 160, 161,
162, 163, 164, 166, 167, 174, 176, 177, 178, 179, 180, 181, 182,
185, 186, 187, 188, 189, 190, 191, 192, 193, 195, 196, 197, 198,
200, 205, 206, 207, 208, 209, 211, 212, 215, 216, 218, 220, 221,
224, 225, 226, 227, 228, 231, 235, 236, 238, 239, 240, 241, 242,
244, 245, 246, 247, 253, 258, 263, 264, 266, 267, 268, 270, 273,
275, 277, 278, 280, 281, 283, 284, 285, 286, 288, 303, 306, 308,
310, 313, 316, 318, 331, 337, 338, 339, 341, 351, 352, 355, 359,
361, 362, 363, 365, 368, 370, 373, 374, 376, 377, 380, 382, 384,
387, 388, 389, 393, 396, 397, 398, 399, 400, 401, 402, 404, 405,
406, 308, 409, 410, 411, 412, 413, 414, 416, 417, 418, 419, 421,
424, 426, 429, 430, 432, 433, 436, 442, 443, 446, 452, 458, 463,
465, 466, 474, 478, 482, 487, 489, 490, 491, 494, 495, 496, 498,
499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, or
512 when the positions are aligned with SEQ ID NO:2.
[0142] In some embodiments, step (c) of the method comprises making
one or more amino acid substitutions selected from M1E/G/UR/V/W,
A2D/F/G/H/P/Q/R/S/T/W/Y, T3/I/L, Q4/N/R/S/W/Y, Q5M/N,
Q6C/H/K/P/R/S/V/Y, Q7H/N, N8A/E/H/V, G9C/F/V, A10T, S11D/G,
A12D/R/S/T, S13G/L/V, G14K/L/M/R/V, V15I, L16G/I/S, E17C/G/H/R,
Q181/L, R20K, H23R, K40R, R43H, T44A, V45A/S, D47E/N, G49E, G50A,
H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/V, F68A/V, L69E/I/M/Q,
N70D/E/L/M/R/T, E71C/M/Q/S, 172L, A73G/H/K/L/M, S74K/L/P/T/W,
S75C/E/H/N, S76E/F/I/L/R, V77I/P/T, F78M, E79D/I/L/Q/V, R80I/L,
L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V, F89D/N/P/R, E90D/Q,
T91A/R, L93D, V97I, H98P, I100V, T101A, E103C/S/V, V104I/M,
E106A/H, S107A, R108E/G/H/Q, L111I, T112G, P113I/Q, R115D, F116Y,
A118K, A120C, G121T, Q122E/H/T, V123L, F126V, N128C/H/L, S129D,
A130C/S, A131P/S, S132H, V133A/G, N134D/K/R/S/V, F135E, R136L,
E137L, E138Q/R, D140Y, K144A/E/R, 1145E/H, L148E/K/T, L150P,
E151G/R/V, V153F/I, A154G/R, A155G/M/R/T/W, L156M, A157Q/V,
E158D/N, N160T, S161P/Y, A162K, M163L, A164V, I166L/M, Q167H,
N174A, K176G/I/M, N177D/E/L/R/T, S178F/L, G179D/S/W, Q180C/R,
I181D/E/L/V, T182G/I/K/R, V185G/I/P, I186H, K187P, P188D/E/I/R/S/W,
A189L/N, G190I/K/L, E191V/W, S192A, I193C/L/V, R195F/H/I/N/W,
S196D, T197F/P, D198S, Y200F, E205K, L206C, V207L/M, H208R,
L209N/T/Y, Q211H/L/N/R, D212F, S215EN, D216G/Q, K218P/Q/R, R220A/H,
Y221D/K, K224R, V225C/M, L226M, E227G, K228H, V231A, 1235E, R236I,
A238G, N239C, N240Q/R/T, Y241F, G242E, S244A/P/R, D245H, T246A/P/V,
Y247N, L253P/V, L258P, S263N, G264R, S266A/T, L267H, T268N, V270L,
S273F, 1275V, S277A, A278C, E280I, E281S/Y, S283A/E/F/M/T,
P284C/L/Q, G285D, W286Y, E288D/H/Q, E303G, S306T/W, F3081, G310L/V,
S313Q, I316L, V318F/L/M, S331V, S337G, G338E, S339P, Q341R, G351C,
S352G, I355F/L/S/W, K359E, I361C/F/L, D362L, Y363H, M365N, A368S,
T370A/I, A373W, A374Y, D376K/P/R, Q377H/K, Y380H/R, R382H/Q, T384S,
F3871/L, V388L, A3891/M/L/V, K393A, D396G, V397L, V398Y, V399I,
G400S, G401A/C/L/S/TN, M402V, V404I/L, P405A/C/F/G/L/V, L406Y,
I408L, A409T/V/W/Y, G410D/H/R, K411R, A412V, M413L/R, R414K,
A416L/V, G417V, Q418I/N/RN, N419S, E421D/G/I/L/P/R/S/V, V424M,
K426R/T, D429E/K/R, T430A/H/I, R432C/Q, S433H/K/N/R/Y, T436A,
T4421, A443T, Y446F, S452E/G/N, S458E/N/Q, L463V, R465K, V466G/Q,
Q474L/R, Q478E, C482R, G487R/Y, L489F, N490C/S, R491M, L494Y,
K495C/S, E496D/G, K498G/N, L499R/S/V, Y500H/N, S501C/F/W,
L502A/Q/R/S/W, R503c/K, A504D/E/S/T, A505E/G/K, D506G/L/M/R/W,
T507H/Q, R508D/G/H/L/M, K509D/G/H/P/Q/R, K510D/E/L/M/N/R/S,
A511D/G/I/K/P/R/S/T, and/or A512M/R.
[0143] In some embodiments, the method further comprises
determining whether the one or more amino acid substitutions
increase fatty alcohol production and/or an improved fatty alcohol
profile in comparison to the wild-type FAR from which the FAR
variant is derived.
[0144] M. aquaeolei FAR Variants
[0145] In a related aspect, FAR variants derived from M. aquaeolei
FAR (SEQ ID NO:4) are provided. Table 11 shows exemplary
substitutions and substitution sets. In one aspect, the invention
provides a FAR variant comprising at least about 70%, at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%, at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99% sequence
identity to SEQ ID NO:4 and comprising a substitution at a
substitution position (or set of positions) disclosed in Table 11.
These variants are sometimes referred to as "FAR Maq variants." It
will be appreciated, as noted above, that SEQ ID NO:4 and SEQ ID
NO:2 share about 78% sequence identity. Accordingly, FAR Maq
variants can be viewed as a subgenus of FAR variants of the
invention to which all disclosure herein is applicable.
[0146] In some embodiments, a FAR variant comprises an amino acid
sequence having at least about 70%, at least about 75%, at least
about 80%, at least about 85%, at least about 90%, at least about
91%, at least about 92%, at least about 93%, at least about 94%, at
least about 95%, at least about 96%, at least about 97%, at least
about 98%, or at least about 99% sequence identity to SEQ ID NO:4
and comprises a substitution relative to SEQ ID NO:4 at one or more
positions selected from position 8, position 74, position 116,
position 135, position 228, position 411, position 430, position
434, position 438, position 503, position 512, and position 513,
wherein the position is numbered with reference to SEQ ID NO:4. In
some embodiments, the amino acid residue in the FAR variant at
position 8 relative to SEQ ID NO:4 is histidine (H8); the amino
acid residue in the FAR variant at position 74 relative to SEQ ID
NO:4 is alanine (A74); the amino acid residue in the FAR variant at
position 116 relative to SEQ ID NO:4 is aspartic acid (D116); the
amino acid residue in the FAR variant at position 135 relative to
SEQ ID NO:4 is asparagine (N135); the amino acid residue in the FAR
variant at position 228 relative to SEQ ID NO:4 is glutamic acid
(E228); the amino acid residue in the FAR variant at position 411
relative to SEQ ID NO:4 is aspartic acid (D411); the amino acid
residue in the FAR variant at position 430 relative to SEQ ID NO:4
is aspartic acid (D430); the amino acid residue in the FAR variant
at position 434 relative to SEQ ID NO:4 is serine (S434); the amino
acid residue in the FAR variant at position 438 relative to SEQ ID
NO:4 is isoleucine (I438); the amino acid residue in the FAR
variant at position 503 relative to SEQ ID NO:4 is leucine (L503);
the amino acid residue in the FAR variant at position 512 relative
to SEQ ID NO:4 is alanine (A512); and the amino acid residue in the
FAR variant at position 513 relative to SEQ ID NO:4 is alanine
(A513). In some embodiments, a FAR variant comprises an amino acid
substitution at residue H8K that is lysine (H8K). In some
embodiments, a FAR variant comprises an amino acid substitution at
residue A74 that is selected from lysine and leucine (A74K/L). In
some embodiments, a FAR variant comprises an amino acid
substitution at residue D116 that is selected from alanine and
glutamic acid (D116A/E). In some embodiments, a FAR variant
comprises an amino acid substitution at residue N135 that is lysine
(N135K). In some embodiments, a FAR variant comprises an amino acid
substitution at residue E228 that is glycine (E228G). In some
embodiments, a FAR variant comprises an amino acid substitution at
residue D411 that is arginine (D411R). In some embodiments, a FAR
variant comprises an amino acid substitution at residue D430 that
is lysine (D430K). In some embodiments, a FAR variant comprises an
amino acid substitution at residue S434 that is selected from
lysine, phenylalanine, and tryptophan (S434K/F/W). In some
embodiments, a FAR variant comprises an amino acid substitution at
residue I438 that is valine (I438V). In some embodiments, a FAR
variant comprises an amino acid substitution at residue L503 that
is selected from arginine and serine (L503R/S). In some
embodiments, a FAR variant comprises an amino acid substitution at
residue A512 that is selected from glycine, proline, and glutamine
(A512G/P/Q). In some embodiments, a FAR variant comprises an amino
acid substitution at residue A513 that is selected from glycine,
lysine, proline, arginine, serine, threonine (and A513G/K/P/R/S/T).
In some embodiments, a FAR variant comprises 100% amino acid
sequence identity to SEQ ID NO:4 except for amino acid
substitutions at one or more of positions H8, A74, D116, N135,
E228, D411, D430, S434, I1438, L503, A512, and A513 as numbered
with reference to SEQ ID NO:4.
[0147] FAR Maq variants of the invention as described herein may
have any of the improved properties disclosed hereinabove, such as
increased total fatty alcohol production, increased production of
fatty alcohols at at a specified culture pH or over an increased pH
range, or changes in fatty alcohol profile as compared to a
wild-type FAR.
[0148] FAR Maq variants of the invention may comprise a
substitution or substitution set exemplified in Table 11. For
example, FAR Maq Variant No. 1047 (see Table 11) has a lysine
(substituted for asparagine) at position 135 (numbered with
reference to SEQ ID NO:4). More broadly, FAR Maq variants of the
invention may comprise a substitution at a position or set of
positions exemplified in Table 11. As a non-limiting example, FAR
Maq Variant No. 1047 (see Table 11) has a substitution for
asparagine at position 135 (wherein the positions are numbered with
reference to SEQ ID NO:4), and accordingly a particular FAR Maq
variant of the invention may comprise a substitution at position
135 (i.e., any residue other than asparagine), and optionally any
other substitutions as described herein, e.g., as described in
Table 11.
FAR Motifs
[0149] In some embodiments, a FAR variant of the invention
comprises an amino acid motif that is conserved among FAR enyzmes
such as bacterial FARs and/or plant FARs. The characteristics of
FARs from plants have been described, e.g., in Rowland and
Domergue, Plant Sci. 193-194:28-38 (2012). Plant FAR proteins are
about 500 amino acids long, and some contain an amino terminal
extension of .about.50 to 120 amino acids that serves as a transit
peptide to target the protein to the organelles. In certain
embodiments, a FAR enzyme or functional fragment thereof that is
especially suitable for the production of fatty alcohols is
identified by the presence of one or more domains, which are found
in proteins with FAR activity. In various embodiments, the one or
more domains are identified by multiple sequence alignments using
hidden Markov models ("HMMs") to search large collections of
protein families, for example, the Pfam collection available at
pfam.sanger.ac.uk/. See R. D. Finn et al. (2008) Nucl. Acids Res.
Database issue 36:D281-D288.
[0150] In certain embodiments, the one or more protein domains by
which FAR enzymes are identified is a NAD binding domain. In some
embodiments, the NAD binding domain is categorized in the
"NAD_binding.sub.--4" domain family (Pfam domain PF07993). The
NAD_binding.sub.--4 domain is characterized by the motif
[I,V,F]-X-[I,L,V]-T-G-X-T-G-F-L-[G,A]. See Aarts et al., Plant J.
12:615-623 (1997), incorporated by reference herein. This motif is
believed to be involved in NAD(P)H binding. In some embodiments,
the NAD binding domain is near the N-terminus. As shown in FIG. 2,
inspection of bacterial FARs closely related to M. algicola FAR
(Oceanobacter RED65, M. aquaeolei, marine bacteria HP15, and
Hahella KCTC 2396) revealed the presence of the TGxxGxxG motif. In
certain embodiments, the one or more protein domains by which FAR
enzymes are identified is a "sterile" domain (Pfam domain PF03015).
In some embodiments, the sterile domain is near the C-terminus. In
certain embodiments, a FAR variant of the invention comprises a NAD
binding domain near the N-terminus and a sterile domain near the
C-terminus.
[0151] Additionally, FAR enzymes from Marinobacter and other
bacteria contain the classic YxxxK active site motif of the
short-chain dehydrogenase/reductase superfamily (Kavanaugh et al.,
Cell. Mol. Life. Sci. 65:3895-3906 (2008)). Inspection of bacterial
FARs closely related to M. algicola FAR (Oceanobacter RED65, M.
aquaeolei, marine bacteria HP15, and Hahella KCTC 2396) revealed
the presence of a YxxxK motif, as shown in FIG. 2. Furthermore, as
shown in FIG. 3, an inspection of an alignment between the YxxxK
motif region from M. algicola FAR and that of some FARs from
plants, insects, or mouse revealed that this motif can be extended
to YxxxKxxxE. Further comparisons showed that in another family of
bacterial FARs, represented by the FAR from M. aquaeolei VT8
(protein YP.sub.--959769), the motif YxxxK could be extended to
YxxxKxxxK/R. It is predicted that changing any one or more of these
three conserved residues in the motif (for example, by changing to
alanine) will drastically affect enzymatic activity.
[0152] In some embodiments, a FAR enzyme of the invention is
identified by the presence of the TGxxGxxG motif near the
N-terminus and/or the presence of the YxxxKxxxE/K/R motif. In one
embodiment, the present invention relates to FAR variants
comprising at least about 70% (e.g., at least 75%, at least 80%, at
least 85%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99%) sequence identity with a wild-type FAR
polypeptide and comprising one or more mutations (e.g. amino acid
substitutions) as compared to the wild-type FAR from which the FAR
variant is derived, wherein the FAR variant comprises the amino
acid motif TGxxGxxG. In another embodiment, the present invention
relates to FAR variants comprising at least about 70% (e.g., at
least 75%, at least 80%, at least 85%, at least 90%, at least 91%,
at least 92%, at least 93%, at least 94%, at least 95%, at least
96%, at least 97%, at least 98%, or at least 99%) sequence identity
with a wild-type FAR polypeptide and comprising one or more
mutations (e.g. amino acid substitutions) as compared to the
wild-type FAR from which the FAR variant is derived, wherein the
FAR variant comprises the amino acid motif YxxxKxxxE/K/R. In some
embodiments, the FAR variant comprises both the TGxxGxxG motif and
the YxxxKxxxE/K/R motif.
Additional Metabolic Engineering
[0153] In one embodiment, the recombinant host cell exhibiting
increased production of shorter chain fatty alcohols (e.g.,
increased amount of shorter chain fatty alcohols and/or an
increased proportion of shorter chain fatty alcohols in a fatty
alcohol composition) further contains an exogenous gene operably
linked to a promoter that is functional in the microbial organism.
The incorporation of the exogenous gene can be accomplished as
described herein or using any techniques well known in the art.
[0154] In some embodiments, the host cell can be modified to
express or over-express one or more genes encoding enzymes, other
than FAR, that are involved in fatty acyl-CoA derivative
biosynthesis. In particular embodiments, the gene encodes a fatty
acid biosynthetic ("Fab") enzyme, an acyl-CoA synthetase ("ACS"),
or an acyl-ACP thioesterase ("TE"). In some embodiments, one or
more Fab enzymes are overexpressed in a host cell. See, e.g., U.S.
Provisional Application No. 61/577,756, filed Dec. 20, 2011,
incorporated by reference herein. There are at least 8 enzymes
involved fatty acid initiation and elongation biosynthesis,
including FabA, FabB, FabD, FabF, FabG, FabH, Fabl, and FabZ. In
some embodiments, the gene encodes "FabH," .beta.-ketoacyl-ACP
synthase III (EC 2.3.1.180). In some embodiments, the host cell
comprises a polynucleotide sequence encoding an E. coli FabH
protein. Polynucleotides encoding FabH enzymes are known in the
art. See, e.g., Tsay et al., 1992, J. Biol. Chem. 267:6807-6814. In
some embodiments, the gene encodes "Fabl," a trans-2-enoyl-ACP
reductase (EC 1.3.1.9 and 1.3.1.10). In some embodiments, the gene
encodes "FabZ," a beta-hydroxyacyl-ACP dehydratase (EC 4.2.1.59 to
4.2.61). In some embodiments, the gene encodes "FadD," an acyl-CoA
synthetase (EC 6.2.1). In some embodiments, the gene encodes TE, a
thioesterase (EC 3.1.2.1 to EC 3.1.2.27 and also EC3.1.1.5 and EC
3.1.2.-). When multiple exogenous genes are expressed, in some
embodiments, the expression vector encoding a first enzyme (e.g., a
FAR variant) and the expression vector encoding a second enzyme
(e.g., a Fab enzyme, ACS, or TE) are separate nucleic acids. In
other embodiments, the first enzyme and the second enzyme are
encoded on the same expression vector, and expression of each
enzyme is independently regulated by a different promoter.
V. Polynucleotides and Expression Systems for Expressing FAR
Variants
[0155] In another aspect, the present invention provides
polynucleotides encoding the FAR variants as described herein. In
some embodiments, the invention relates to a polynucleotide
sequence that encodes an improved FAR polypeptide wherein the
polynucleotide encodes a fatty acyl reductase (FAR) polypeptide
comprising a sequence that is at least 75%, at least 80%, at least
85%, at least 90%, at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
or at least 99% identical to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6,
SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID
NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ
ID NO:26, or SEQ ID NO:28; and said improved FAR polypeptide
comprising one or more substitutions (e.g., one or more of the
specified substitutions or substitution sets as described herein,
e.g., one or more substitutions or substitution sets in any of
Tables 1, 2, 6, 7, 8, 9, 10, or 11).
[0156] The polynucleotide can be a DNA or RNA, and can be
single-stranded or double-stranded. The polynucleotide may be
operably linked to one or more heterologous regulatory or control
sequences that control gene expression to create a recombinant
polynucleotide capable of expressing the polypeptide. Expression
constructs containing a heterologous polynucleotide encoding the
FAR variant can be introduced into appropriate host cells to
express the FAR variant.
[0157] In some embodiments, the FAR variant is generated from a
wild-type FAR polynucleotide sequence (e.g., a wild-type M.
algicola FAR polynucleotide sequence of SEQ ID NO:1 or a wild-type
M. aquaeolei FAR polynucleotide sequence of SEQ ID NO:3) or the
portion thereof comprising the open reading frame, with changes
made as required at the codons corresponding to substitutions
(residues mutated relative to the wild-type sequence as described
herein, for example at any of Table 1, Table 2, Table 4, Table 7,
Table 8, Table 9, Table 10, or Table 11). In addition, one or more
"silent" nucleotide changes can be incorporated. In certain
embodiments, the FAR variant is generated from a reference sequence
that is a variant FAR polynucleotide sequence (e.g., the variant
encoded by the sequence of any of SEQ ID NO:5, SEQ ID NO:7, SEQ ID
NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ
ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:27
or the portion thereof comprising the open reading frame, with
changes made as required at the codons corresponding to
substitutions. In addition, one or more "silent" nucleotide changes
can be incorporated.
[0158] The availability of a polypeptide sequence of a specific FAR
variant polypeptide provides a description of all polynucleotides
capable of encoding that enzyme or fragment because of the known
correspondence between amino acids and the genetic code. For most
organisms the genetic code is "Amino Acid (one letter code)
[codons]": phenylalanine (F) [TTT, TTC]; leucine (L) [TTA, TTG,
CTT, CTC, CTA, CTG]; isoleucine (I) [ATT, ATC, ATA]; methionine (M)
[ATG]; valine (V) [TGG, GTC, GTA, GTG]; serine (S) [TCT, TCC, TCA,
TCG, AGT, AGC]; proline (P) [CCT, CCC, CCA, CCG]; threonine (T)
[ACT, ACC, ACA, ACG]; alanine (A) [GCT, GCC, GCA, GCG]; tyrosine
(Y) [TAT, TAC]; histidine (H) [CAT, CAC]; glutamine (Q) [CAA, CAG];
asparagine (N) [AAT, AAC]; lysine (K) AAA, AAG]; aspartic acid (D)
[GAT, GAC]; glutamic acid (E) [GAA, GAG]; cysteine (C) [TGT, TGC];
tryptophan (W) [TGG]; arginine (R) [CGT, CGC, CGA, CGG, AGA, AGG];
and glycine (G) [GGT, GGC, GGA, GGG]. In certain embodiments, the
degeneracy of the genetic code is used to produce a large number of
polynucleotides that encode the variant FAR polypeptides described
herein. In some embodiments, the polynucleotides that encode the
variant FAR polypeptides described herein are codon optimized for
expression in specific microorganisms. In particular embodiments,
the polynucleotides that encode the variant FAR polypeptides
described herein are codon optimized for expression in bacteria,
yeast (such as S. cerevisiae or Y. lipolytica) or filamentous
fungi. In other specific embodiments, the polynucleotides are codon
optimized for expression in E. coli. Codon schemes and/or methods
for determining codon schemes optimized for particular
microorganisms of interest are well known (see, e.g., the
references cited with the definition of "preferred, optimal high,
codon usage bias codons"; see also
http://www.kazusa.or.jp/codon/).
[0159] A variety of methods are known for determining the codon
frequency (e.g., codon usage, relative synonymous codon usage) and
codon preference in specific organisms, including multivariate
analysis, for example, using cluster analysis or correspondence
analysis, and the effective number of codons used in a gene (see
GCG CodonPreference, Genetics Computer Group Wisconsin Package;
Codon W, John Peden, University of Nottingham; McInerney, J. O,
1998, Bioinformatics 14:372-73; Stenico et al., 1994, Nucleic Acids
Res. 222437-46; Wright, F., 1990, Gene 87:23-29; Wada et al., 1992,
Nucleic Acids Res. 20:2111-2118; Nakamura et al., 2000, Nucl. Acids
Res. 28:292; Henaut and Danchin, "Escherichia coli and Salmonella,"
1996, Neidhardt, et al. Eds., ASM Press, Washington D.C., p.
2047-2066, all of which are incorporated herein by reference). The
data source for obtaining codon usage may rely on any available
nucleotide sequence capable of coding for a protein. These data
sets include nucleic acid sequences actually known to encode
expressed proteins (e.g., complete protein coding sequences-CDS),
expressed sequence tags (ESTs), or predicted coding regions of
genomic sequences (see for example, Mount, D., Bioinformatics:
Sequence and Genome Analysis, Chapter 8, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 2001; Uberbacher, E.
C., 1996, Methods Enzymol. 266:259-281; Tiwari et al., 1997,
Comput. Appl. Biosci. 13:263-270, all of which are incorporated
herein by reference).
[0160] In some embodiments, the present invention provides a method
for making a FAR polynucleotide variant, wherein the method
comprises (1) introducing one or more mutations into a
polynucleotide encoding a FAR which comprises at least 70%
(alternatively, at least 75%, at least 80%, at least 85%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98% or at least 99%
and even 100%) sequence identity to the amino acid sequence of SEQ
ID NO:2 or a functional fragment thereof to produce a modified
polynucleotide and wherein the polynucleotide encodes a FAR variant
having at least 80% (alternatively, at least 85%, at least 88%, at
least 90%, at least 91%, at least 92%, at least 93%, at least 94%,
at least 95%, at least 96%, at least 97%, at least 98%, or at least
99%) sequence identity to SEQ ID NO:2 and comprises a substitution
at one or more positions selected from positions 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 23, 40, 43, 44,
45, 47, 49, 50, 52, 61, 62, 63, 65, 66, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 83, 84, 85, 86, 87, 88, 89, 90, 91, 93,
97, 98, 100, 101, 103, 104, 106, 107, 108. 111, 112, 113, 115, 116,
118, 120, 121, 122, 123, 126, 128, 129, 130, 131, 132, 133, 134,
135, 136, 137, 138, 140, 144, 145, 148, 150, 151, 153, 154, 155,
156, 157, 158, 160, 161, 162, 163, 164, 166, 167, 174, 176, 177,
178, 179, 180, 181, 182, 185, 186, 187, 188, 189, 190, 191, 192,
193, 195, 196, 197, 198, 200, 205, 206, 207, 208, 209, 211, 212,
215, 216, 218, 220, 221, 224, 225, 226, 227, 228, 231, 235, 236,
238, 239, 240, 241, 242, 244, 245, 246, 247, 253, 258, 263, 264,
266, 267, 268, 270, 273, 275, 277, 278, 280, 281, 283, 284, 285,
286, 288, 303, 306, 308, 310, 313, 316, 318, 331, 337, 338, 339,
341, 351, 352, 355, 359, 361, 362, 363, 365, 368, 370, 373, 374,
376, 377, 380, 382, 384, 387, 388, 389, 393, 396, 397, 398, 399,
400, 401, 402, 404, 405, 406, 308, 409, 410, 411, 412, 413, 414,
416, 417, 418, 419, 421, 424, 426, 429, 430, 432, 433, 436, 442,
443, 446, 452, 458, 463, 465, 466, 474, 478, 482, 487, 489, 490,
491, 494, 495, 496, 498, 499, 500, 501, 502, 503, 504, 505, 506,
507, 508, 509, 510, 511, or 512, wherein the position is numbered
with reference to SEQ ID NO:2; transforming a host cell with the
modified polynucleotide; and screening the transformed host cell
for an improvement in a desired phenotype relative to a
corresponding transformed host cell comprising a polynucleotide
encoding a reference FAR such as a wild-type FAR comprising at
least 70% (alternatively, at least 75%, at least 80%, at least 85%,
at least 90%, at least 92%, at least 93%, at least 94%, at least
95%, at least 96%, at least 97%, at least 98%, at least 99%, or
even 100%) sequence identity to the amino acid sequence of SEQ ID
NO:2 or a functional fragment thereof. In some embodiments, the
modified polynucleotide sequence encodes a FAR variant having one
or more substitutions selected from M1E/G/L/R/V/W,
A2D/F/G/H/P/Q/R/S/T/W/Y, T3/I/L, Q4/N/R/S/W/Y, Q5M/N,
Q6C/H/K/P/R/S/V/Y, Q7H/N, N8A/E/H/V, G9C/F/V, A10T, S11D/G,
A12D/R/S/T, S13G/L/V, G14K/L/M/R/V, V151, L16G/I/S, E17C/G/H/R,
Q181/L, R20K, H23R, K40R, R43H, T44A, V45A/S, D47E/N, G49E, G50A,
H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/Y, F68A/V, L69E/I/M/Q,
N70D/E/L/M/R/T, E71C/M/Q/S, 172L, A73G/H/K/L/M, S74K/L/P/T/W,
S75C/E/H/N, S76E/F/I/L/R, V77I/P/T, F78M, E79D/I/L/Q/V, R80I/L,
L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V, F89D/N/P/R, E90D/Q,
T91A/R, L93D, V97I, H98P, 1100V, T101A, E103C/S/V, V104I/M,
E106A/H, S107A, R108E/G/H/Q, L111I, T112G, P113I/Q, R115D, F116Y,
A118K, A120C, G121T, Q122E/H/T, V123L, F126V, N128C/H/L, S129D,
A130C/S, A131P/S, S132H, V133A/G, N134D/K/R/S/Y, F135E, R136L,
E137L, E138Q/R, D140Y, K144A/E/R, I145E/H, L148E/K/T, L150P,
E151G/RN, V153F/I, A154G/R, A155G/M/R/T/W, L156M, A157Q/V, E158D/N,
N160T, S161P/Y, A162K, M163L, A164V, I166L/M, Q167H, N174A,
K176G/I/M, N177D/E/L/R/T, S178F/L, G179D/S/W, Q180C/R, 1181D/E/L/V,
T182G/I/K/R, V185G/I/P, I186H, K187P, P188D/E/I/R/S/W, A189L/N,
G1901/K/L, E191V/W, S192A, I193C/L/V, R195F/H/I/N/W, S196D,
T197F/P, D198S, Y200F, E205K, L206C, V207L/M, H208R, L209N/T/Y,
Q211H/L/N/R, D212F, S215E/Y, D216G/Q, K218P/Q/R, R220A/H, Y221D/K,
K224R, V225C/M, L226M, E227G, K228H, V231A, I235E, R2361, A238G,
N239C, N240Q/R/T, Y241F, G242E, S244A/P/R, D245H, T246A/P/V, Y247N,
L253P/V, L258P, S263N, G264R, S266A/T, L267H, T268N, V270L, S273F,
1275V, S277A, A278C, E2801, E281S/Y, S283A/E/F/M/T, P284C/L/Q,
G285D, W286Y, E288D/H/Q, E303G, S306T/W, F3081, G310L/V, S313Q,
I316L, V318F/L/M, S331V, S337G, G338E, S339P, Q341R, G351C, S352G,
I355F/L/S/W, K359E, 1361C/F/L, D362L, Y363H, M365N, A368S, T370A/I,
A373W, A374Y, D376K/P/R, Q377H/K, Y380H/R, R382H/Q, T384S, F387I/L,
V388L, A389I/M/L/V, K393A, D396G, V397L, V398Y, V399I, G400S,
G401A/C/L/S/TN, M402V, V404I/L, P405A/C/F/G/L/V, L406Y, 1408L,
A409T/V/W/Y, G410D/H/R, K411R, A412V, M413L/R, R414K, A416L/V,
G417V, Q418I/N/R/V, N419S, E421D/G/I/L/P/R/S/V, V424M, K426R/T,
D429E/K/R, T430A/H/I, R432C/Q, S433H/K/N/R/Y, T436A, T4421, A443T,
Y446F, S452E/G/N, S458E/N/Q, L463V, R465K, V466G/Q, Q474L/R, Q478E,
C482R, G487R/Y, L489F, N490C/S, R491M, L494Y, K495C/S, E496D/G,
K498G/N, L499R/S/V, Y500H/N, S501C/F/W, L502A/Q/R/S/W, R503c/K,
A504D/E/S/T, A505E/G/K, D506G/L/M/R/W, T507H/Q, R508D/G/H/L/M,
K509D/G/H/P/Q/R, K510D/E/L/M/N/R/S, A511D/G/I/K/P/R/S/T and/or
A512M/R. In some embodiments the modified polynucleotide sequence
encoding a FAR variant will comprise at least 85% (alternatively,
at least 88%, at least 90%, at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97% at
least 98%, or at least 99%) sequence identity with nucleic acid
sequence of SEQ ID NO:1.
[0161] In some embodiments, the present invention provides a method
for making a FAR polynucleotide variant, wherein the method
comprises introducing one or more mutations into a polynucleotide
encoding a FAR which comprises at least 90% (alternatively, at
least 92%, at least 93%, at least 94%, at least 95%, at least 96%,
at least 97%, at least 98%, at least 99%, or even 100%) sequence
identity to the amino acid sequence of any of SEQ ID NOs:6, 8, 10,
12, 14, 16, 18, 20, 22, 24, 26, or 28, or a functional fragment
thereof, to produce a modified polynucleotide, wherein the
modification is selected from the group consisting of a
substitution, a deletion, and an insertion; transforming a host
cell with the modified polynucleotide; and screening the
transformed host cell for an improvement in a desired phenotype
relative to a corresponding transformed host cell comprising a
polynucleotide encoding the variant FAR having at least 90% (e.g.,
at least 91%, at least 92%, at least 93%, at least 94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% and
even 100%) sequence identity to the amino acid sequence of the FAR
polypeptide from which the FAR variant was derived. Exemplary
desired phenotypes include improved fatty alcohol production,
improved total and/or secreted fatty alcohol composition, and/or
alteration of the fatty alcohol composition (including, but not
limited to, an increase in the amount of C12 to C14 fatty alcohols
produced, or a profile comprising, for example, one or more, an
increased amount of C12:0 (1-dodecanol), an increased amount of
C14:0 (1-tetradecanol), a decreased amount of C16:0
(1-hexadecanol), and a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol) as compared to a wild-type FAR (e.g.,
SEQ ID NO:2 or SEQ ID NO:4) or a reference FAR (e.g., any of SEQ ID
NOs:6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, or 28). In some
embodiments, the modified polynucleotide sequence encoding a FAR
variant will comprise at least 90% (e.g., at least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least 98%, at least 99%, or even 100%) sequence
identity with nucleic acid sequence of any of SEQ ID NOs:5, 7, 9,
11, 13, 15, 17, 19, 21, 23, 25, or 27.
[0162] In some embodiments, the FAR variant comprises an amino acid
sequence encoded by a nucleic acid that hybridizes under moderate,
stringent or highly stringent conditions over substantially the
entire length of a nucleic acid corresponding to SEQ ID NO:1, SEQ
ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ
ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21,
SEQ ID NO:23, SEQ ID NO:25, or SEQ ID NO:27.
[0163] Certain silent mutations have also been identified in
polynucleotides encoding the variant FAR polypeptides which appear
to confer the property of increased fatty alcohol production in
transformed E. coli cells as compared to wild-type M. algicola
DG893 FAR (see Table 1). The silent mutations include: t6a, t6g,
t6c, t9c, t9g, t27c, a30g, a51g, a81t, a147t, c171t, t174c, t180c,
t226a, a237g, g243a, a318g, c321g, c321a, a336c, t339g, t363c,
c402t, t459c, a474g, a540g, t564g, a615g, g627t, t628c, a633g,
g681a, g711a, t792c, t834c, t870c, t927c, t967c, c994t, t1026c,
t1149c, c1173t, t1203c, t1236g, t1248c, g1263a, g1272a, c1281t,
t1287c, g1290c, t1297a, c1299g, t1326c, t1357c, c1366t, t1372a,
t1374g, t1398c, t1410c, t1413c, t1435c, t1461g, g1485a, g1497t,
t1501a, t1504c, t1515g, t1515a, t1521c, t1524c, a1527g, and t1533c
(where nucleotide position is determined by alignment with SEQ ID
NO:1).
Polynucleotide Synthesis
[0164] Polynucleotides encoding variant FAR polypeptides can be
prepared using methods that are well known in the art. Typically,
oligonucleotides of up to about 40 bases are individually
synthesized, then joined (e.g., by enzymatic or chemical ligation
methods, or polymerase-mediated methods) to form essentially any
desired continuous sequence. For example, polynucleotides of the
present invention can be prepared by chemical synthesis using, for
example, the classical phosphoramidite method described by
Beaucage, et al., 1981, Tetrahedron Letters, 22:1859-69, or the
method described by Matthes, et al., 1984, EMBO J. 3:801-05, both
of which are incorporated herein by reference. These methods are
typically practiced in automated synthetic methods. According to
the phosphoramidite method, oligonucleotides are synthesized, e.g.,
in an automatic DNA synthesizer, purified, annealed, ligated and
cloned in appropriate vectors.
[0165] In addition, essentially any nucleic acid can be custom
ordered from any of a variety of commercial sources, such as The
Midland Certified Reagent Company (Midland, Tex.), The Great
American Gene Company (Ramona, Calif.), ExpressGen Inc. (Chicago,
Ill.), Operon Technologies Inc. (Alameda, Calif.), and many
others.
[0166] Polynucleotides may also be synthesized by well-known
techniques as described in the technical literature. See, e.g.,
Carruthers, et al., 1982, Cold Spring Harbor Symp. Quant. Biol.,
47:411-18 and Adams et al., 1983, J. Am. Chem. Soc. 105:661, both
of which are incorporated herein by reference. Double stranded DNA
fragments may then be obtained either by synthesizing the
complementary strand and annealing the strands together under
appropriate conditions, or by adding the complementary strand using
DNA polymerase with an appropriate primer sequence.
[0167] General texts that describe molecular biological techniques
which are useful herein, including the use of vectors, promoters,
protocols sufficient to direct persons of skill through in vitro
amplification methods, including the polymerase chain reaction
(PCR) and the ligase chain reaction (LCR), and many other relevant
methods, include Berger and Kimmel, Guide to Molecular Cloning
Techniques, Methods in Enzymology volume 152 Academic Press, Inc.,
San Diego, Calif. (Berger); Sambrook et al., Molecular Cloning--A
Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989 ("Sambrook") and Current
Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current
Protocols, a joint venture between Greene Publishing Associates,
Inc. and John Wiley & Sons, Inc., (supplemented through 2009)
("Ausubel"), all of which are incorporated herein by reference.
Reference is made to Berger, Sambrook, and Ausubel, as well as
Mullis et al., (1987) U.S. Pat. No. 4,683,202; PCR Protocols A
Guide to Methods and Applications (Innis et al. eds) Academic Press
Inc. San Diego, Calif. (1990) (Innis); Arnheim & Levinson (Oct.
1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3,
81-94; (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86, 1173;
Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87, 1874; Lomeli
et al. (1989) J. Clin. Chem. 35, 1826; Landegren et al., (1988)
Science 241, 1077-1080; Van Brunt (1990) Biotechnology 8, 291-294;
Wu and Wallace, (1989) Gene 4, 560; Barringer et al. (1990) Gene
89, 117, and Sooknanan and Malek (1995) Biotechnology 13: 563-564,
all of which are incorporated herein by reference. Methods for
cloning in vitro amplified nucleic acids are described in Wallace
et al., U.S. Pat. No. 5,426,039, which is incorporated herein by
reference.
Vectors
[0168] The present invention further provides DNA constructs and
vectors comprising polynucleotides encoding the variant FAR
polypeptides for expression in heterologous recombinant host cells.
In certain embodiments, the DNA constructs and vectors comprise a
polynucleotide sequence that encodes any one of the variant FAR
polypeptides as disclosed above. In certain embodiments, the DNA
constructs and vectors comprise a polynucleotide sequence as
encompassed by the invention and disclosed herein above. In certain
embodiments, the DNA constructs and vectors comprise a
polynucleotide sequence that encodes a variant FAR polypeptide
herein, wherein the variant FAR is a full-length FAR. In other
embodiments, the DNA constructs and vectors comprise a
polynucleotide sequence that encodes a variant FAR polypeptide,
wherein the variant FAR is a functional fragment of a variant
full-length FAR enzyme. In certain embodiments, the polynucleotides
encoding variant FAR polypeptides for expression in heterologous
recombinant host cells as described herein are operably linked to a
promoter, and optionally, to other control sequences.
[0169] In a particular aspect the present invention provides an
expression vector comprising a FAR polynucleotide operably linked
to a heterologous promoter. Expression vectors of the present
invention may be used to transform an appropriate host cell to
permit the host to express the FAR protein. Methods for recombinant
expression of proteins in bacteria, yeast, and other organisms are
well known in the art, and a number expression vectors are
available or can be constructed using routine methods.
[0170] A recombinant expression vector can be any vector, e.g., a
plasmid or a virus, which can be manipulated by recombinant DNA
techniques to facilitate expression of a variant FAR polypeptide in
a recombinant host cell. In certain embodiments, the expression
vectors is stably integrated into the chromosome of the recombinant
host cell and comprises one or more heterologous genes operably
linked to one or more control sequences useful for production of a
variant FAR polypeptide. In other embodiments, the expression
vector is an extrachromosomal replicative DNA molecule, e.g., a
linear or closed circular plasmid, that is found either in low copy
number (e.g., from about 1 to about 10 copies per genome
equivalent) or in high copy number (e.g., more than about 10 copies
per genome equivalent). Expression vectors which, in certain
embodiments, are useful for expressing variant FAR enzymes as
disclosed herein are commercially available, e.g., from
Sigma-Aldrich Chemicals, St. Louis, Mo. and Stratagene, LaJolla,
Calif. In some embodiments, examples of suitable expression vectors
are plasmids which are derived from pBR322 (Gibco BRL), pUC (Gibco
BRL), pREP4, pCEP4 (Invitrogen) or pPoly (Lathe et al., 1987, Gene
57:193-201).
[0171] In certain embodiments, the present disclosure provides a
plasmid for expression of heterologous genes in E. coli. Expression
vector pCK110900, which comprises a P15A origin of replication
"ori" (P15A ori), lac a CAP binding site, a lac promoter, a T7
ribosomal binding site (T7g10 RBS) and a chloramphenicol resistance
gene (camR). This expression vector is depicted in FIG. 3 of U.S.
Patent Publication No. 2006/0195947, which is incorporated herein
by reference in its entirety. Other suitable plasmid vectors
include derivatives of pCL1920 and pCL1921 (Lerner and Inouye,
1990; NAR 18:4631). These vectors contain the pSC101 ori and confer
resistance to spectinomycin (GenBank:AB236930). In some embodiments
the vector is an expression vector derived from pCL1920 including
the Trc promoter and the lacIq gene from E. coli. In some
embodiments the vector is pLS8379 or an expression vector derived
from pLS8379. In some embodiments the vector is pCDX11 or an
expression vector derived from pCDX11.
[0172] In certain embodiments, the present disclosure provides a
replicating plasmid for expression of heterologous genes in
Yarrowia, and particularly in Y. lipolytica.
[0173] In various embodiments, an expression vector optionally
contains a ribosome binding site (RBS) for translation initiation,
and a transcription terminator, such as PinII. RBS are effective
control elements for protein production and the type of RBS can
result in different expression levels of the same protein. One
skilled in the art is aware of a number of well-characterized RBS.
See, e.g., Vellanoweth and Rabinowitz, 1992, Mol. Microbiol. 6:
1105-1114. In some embodiments, the RBS is from the native E. coli
FabA gene (5' ATAAAATAAGGCTTACAGAGAA; SEQ ID NO:47) or from the
native E. coli FabH gene (5' ACCGAAAAGTGACTGAGCGTAC; SEQ ID NO:48).
The vector also optionally includes appropriate sequences for
amplifying expression, e.g., an enhancer.
Promoters
[0174] Suitable promoters include constitutive promoters, regulated
promoters, and inducible promoters. Appropriate promoter sequences
can be obtained from genes encoding extracellular or intracellular
polypeptides which are either endogenous or heterologous to the
host cell. Methods for the isolation, identification and
manipulation of promoters of varying strengths are available in or
readily adapted from the art. See, e.g., Nevoigt et al. (2006)
Appl. Environ. Microbiol. 72:5266-5273, the disclosure of which is
herein incorporated by reference in its entirety.
[0175] In certain embodiments, the DNA constructs and vectors
comprising a polynucleotide encoding a variant FAR polypeptides are
suitable for expression in bacteria. For bacterial host cells,
suitable promoters for directing transcription of the nucleic acid
constructs of the present disclosure, include the promoters
obtained from the E. coli lac operon, Streptomyces coelicolor
agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB),
Bacillus licheniformis alpha-amylase gene (amyL), Bacillus
stearothermophilus maltogenic amylase gene (amyM), Bacillus
amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis
penicillinase gene (penP), Bacillus subtilis xylA and xylB genes,
Bacillus megaterium promoters, and prokaryotic beta-lactamase gene
(VIIIa-Kamaroff et al., Proc. Natl. Acad. Sci. USA 75: 3727-3731
(1978)), as well as the tac promoter (DeBoer et al., Proc. Natl.
Acad. Sci. USA 80: 21-25 (1993)). Additional promoters include trp
promoter, phage lambda PL, T7 promoter, promoters found at PromEC
and the like. Promoters suitable for use in the present disclosure
are described in Terpe H., 2006, Appl. Microbiol. Biotechnol.
72:211-222 and in Sambrook et al (2001) Molecular Cloning: A
Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Laboratory
Press, New York.
[0176] In various embodiments, the DNA constructs and vectors
comprising polynucleotides encoding a variant FAR polypeptide are
suitable for expression in yeast. In certain embodiments, the DNA
constructs and vectors comprising the polynucleotides encoding a
variant FAR are suitable for expression in oleaginous yeast, such
as but not limited to Yarrow lipolytica. In certain embodiments the
promoter is a Y. lipolytica promoter.
[0177] In certain embodiments, the DNA constructs and vectors
comprising the polynucleotides encoding a variant FAR polypeptide
are suitable for expression in yeast, such as but not limited to S.
cerevisiae. For yeast host cells, suitable promoters for directing
transcription of the nucleic acid constructs of the present
disclosure are known to the skilled artisan and include, but are
not limited to, an enolase (ENO-1_gene) promoter, a galactokinase
(GAL1) promoter, an alcohol dehyrogenase/glyceraldehyde-3-phosphate
dehydrogenase (ADH2/GAP) promoter, a translation elongation factor
EF-1 alpha (TEF1) promoter as well as those described by Romanos et
al. (1992) Yeast 8:423-488. In other embodiments, promoters include
the TEF1 promoter and an RPS7 promoter.
[0178] In various embodiments, the DNA constructs and vectors
comprising polynucleotides encoding a variant FAR polypeptide are
suitable for expression in filamentous fungal host cells. For these
cells, suitable promoters for directing the transcription of the
nucleic acid constructs of the present disclosure include promoters
obtained from the genes for Aspergillus oryzae TAKA amylase,
Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral
alpha-amylase, Aspergillus niger acid stable alpha-amylase,
Aspergillus niger or Aspergillus awamori glucoamylase (glaA),
Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease,
Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans
acetamidase, and Fusarium oxysporum trypsin-like protease (WO
96/00787), as well as the NA2-tpi promoter (a hybrid of the
promoters from the genes for Aspergillus niger neutral
alpha-amylase and Aspergillus oryzae triose phosphate isomerase),
and mutant, truncated, and hybrid promoters thereof. Examples of
suitable promoters useful for directing the transcription of the
nucleotide constructs of the present invention in a filamentous
fungal host cell are promoters such as cbh1, cbh2, egl1, egl2,
pepA, hfb1, hfb2, xyn1, amy, and glaA (Nunberg et al., Mol. Cell.
Biol., 4:2306-2315 (1984), Boel et al., EMBO J. 3:1581-1585 ((1984)
and EPA 137280).
Other Regulatory Elements
[0179] In various embodiments, the polynucleotides useful for
expressing heterologous FAR enzymes in recombinant host cells are
operably linked to other control sequences, including but not
limited to, a transcription terminator sequence, a signal sequence
that when translated directs the expressed polypeptide into the
secretory pathway of the recombinant host cell, and a
polyadenylation sequence (eukaryotes). The choice of appropriate
control sequences for use in the polynucleotide constructs of the
present disclosure is within the skill in the art and in various
embodiments is dependent on the recombinant host cell used and the
desired method of recovering the fatty alcohol compositions
produced.
[0180] In various embodiments, the expression vector includes one
or more selectable markers, which permit easy selection of
transformed cells. Selectable markers for use in a host organism as
described herein include, but are not limited to, genes that confer
antibiotic resistance (e.g., ampicillin, kanamycin, chloramphenicol
or tetracycline resistance) to the recombinant host organism that
comprises the vector.
VI. Recombinant Host Cells Expressing Far Variants and Producing
Fatty Alcohols
[0181] In some embodiments, the present invention provides a method
for producing a recombinant host cell, wherein the method
comprises: (a) providing a nucleic acid construct of the present
invention, wherein the nucleic acid construct comprises
polynucleotide encoding a FAR variant polypeptide as described
herein; and (b) transforming a host cell with the nucleic acid
construct to produce a recombinant cell wherein the FAR variant is
produced. In certain embodiments, the present invention provides a
recombinant microorganism (e.g., a bacterial microorganism, e.g.,
Ecol) engineered to produce a fatty alcohol composition comprising
a polynucleotide sequence encoding a FAR variant polypeptide,
wherein the FAR variant is any one of the FAR variants described
herein (e.g., a FAR variant comprising one or more substitution
sets listed in any of Table 1, Table 2, Table 4, Table 7, Table 8,
Table 9, Table 10, or Table 11).
[0182] In some embodiments, the host cell is a bacterial cell. In
some embodiments, the host cell is a yeast cell. The engineered
host cell is cultured in a suitable nutrient medium under
conditions permitting the expression of the variant FAR enzyme. The
medium used to culture the cells may be any conventional medium
suitable for growing the host cells, such as minimal or complex
media containing appropriate supplements. Suitable media are
available from commercial suppliers or may be prepared according to
published recipes (e.g., in catalogues of the American Type Culture
Collection).
Host Cells
[0183] The recombinant host cells of the present invention
generally comprise a polynucleotide, such as one of the
polynucleotides described above, encoding an improved FAR
polypeptide. Suitable host cells include, but are not limited to,
bacteria, yeast, filamentous fungi, and algae. In certain
embodiments, the host cell is a bacteria, e.g., E. coli. Cells
which are useful in the practice of the present disclosure are
readily accessible from a number of culture collections and other
sources, e.g., the American Type Culture Collection (ATCC),
Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ)
(German Collection of Microorganisms and Cell Culture),
Centraalbureau Voor Schimmelcultures (CBS), and Agricultural
Research Service Patent Culture Collection, Northern Regional
Research Center (NRRL).
[0184] In certain embodiments, the engineered microorganisms
according to the invention are wild-type microorganisms. In other
embodiments, the engineered microorganisms are genetically modified
microorganisms. As used herein, "genetically modified"
microorganisms include microorganisms having one or more endogenous
genes removed, microorganisms having one or more endogenous genes
with reduced expression compared to the parent or wild-type
microorganism, or microorganisms having one or more genes
overexpressed compared to the parent or wild-type microorganism. In
certain embodiments, the one or more genes that are overexpressed
are endogenous to the microorganism. In some embodiments, the one
or more genes that are overexpressed are heterologous to the
microorganism.
[0185] Prokaryotic Host Cells
[0186] In some embodiments, the host cell is a prokaryotic cell.
Suitable prokaryotic cells include gram positive, gram negative and
gram-variable bacterial cells. In certain embodiments, host cells
include, but are not limited to, species of a genus selected from
the group consisting of Agrobacterium, Alicyclobacillus, Anabaena,
Anacystis, Acinetobacter, Acidothermus, Arthrobacter, Azobacter,
Bacillus, Bifidobacterium, Brevibacterium, Butyrivibrio, Buchnera,
Campestris, Camplyobacter, Clostridium, Corynebacterium,
Chromatium, Coprococcus, Cyanobacteria, Escherichia, Enterococcus,
Enterobacter, Erwinia, Fusobacterium, Faecalibacterium,
Francisella, Flavobacterium, Geobacillus, Haemophilus,
Helicobacter, Klebsiella, Lactobacillus, Lactococcus, Ilyobacter,
Micrococcus, Microbacterium, Mesorhizobium, Methylobacterium,
Methylobacterium, Mycobacterium, Neisseria, Pantoea, Pseudomonas,
Prochlorococcus, Rhodobacter, Rhodopseudomonas, Rhodopseudomonas,
Roseburia, Rhodospirillum, Rhodococcus, Scenedesmun, Streptomyces,
Streptococcus, Synnecoccus, Saccharomonospora, Staphylococcus,
Serratia, Salmonella, Shigella, Thermoanaerobacterium, Tropheryma,
Tularensis, Temecula, Thermosynechococcus, Thermococcus,
Ureaplasma, Xanthomonas, Xylella, Yersinia and Zymomonas. In
particular embodiments, the host cell is a species of a genus
selected from the group consisting of Agrobacterium, Arthrobacter,
Bacillus, Clostridium, Corynebacterium, Escherichia, Erwinia,
Geobacillus, Klebsiella, Lactobacillus, Mycobacterium, Pantoea,
Rhodococcus, Streptomyces and Zymomonas.
[0187] In certain embodiments, the recombinant host cell is an
industrial bacterial strain. Numerous bacterial industrial strains
are known and suitable for use in the methods disclosed herein. In
some embodiments, the bacterial host cell is a species of the genus
Bacillus, e.g., B. thuringiensis, B. megaterium, B. subtilis, B.
lentus, B. circulans, B. pumilus, B. lautus, B. coagulans, B.
brevis, B. pumilus, B. licheniformis, B. alkaophius, B.
licheniformis, B. clausii, B. stearothermophilus, B. halodurans,
and B. amyloliquefaciens. In some embodiments the bacterial host
cell is a species of the genus Erwinia, e.g., E. uredovora, E.
carotovora, E. ananas, E. herbicola, E. punctata or E. terreus. In
other embodiments the bacterial host cell is a species of the genus
Pantoea, e.g., P. citrea or P. agglomerans. In still other
embodiments, the bacterial host cell is a species of the genus
Streptomyces, e.g., S. ambofaciens, S. achromogenes, S.
avermitilis, S. coelicolor, S. aureofaciens, S. aureus, S.
fungicidicus, S. griseus or S. lividans. In further embodiments,
the bacterial host cell is a species of the genus Zymomonas, e.g.,
Z. mobilis or Z. lipolytica. In further embodiments, the bacterial
host cell is a species of the genus Rhodococcus, e.g. R.
opacus.
[0188] In particular embodiments, the bacterial host cell is a
species of the genus Escherichia, e.g., E. coli. In certain
embodiments, the E. coli is a wild-type bacterium. In various
embodiments, the wild-type E. coli bacterial strain useful in the
processes described herein is selected from, but not limited to,
strain W3110, strain MG1655 and strain BW25113. In other
embodiments, the E. coli is genetically modified. Examples of
genetically modified E. coli useful as recombinant host cells
include, but are not limited to, genetically modified E. coli found
in the Keio Collection, available from the National BioResource
Project at NBRP E. coli, Microbial Genetics Laboratory, National
Institute of Genetics 1111 Yata, Mishima, Shizuoka, 411-8540.
[0189] Yeast Host Cells
[0190] In certain embodiments, the recombinant host cell is a
yeast. In various embodiments, the yeast host cell is a species of
a genus selected from the group consisting of Candida, Hansenula,
Saccharomyces, Schizosaccharomyces, Rhototorua, Issatchenkia,
Rhodosporidium, Pichia, Kluyveromyces, and Yarrowia. In particular
embodiments, the yeast host cell is a species of a genus selected
from the group consisting of Saccharomyces, Candida, Pichia and
Yarrowia.
[0191] In various embodiments, the yeast host cell is selected from
the group of Rhodotorula (e.g., R. glutinous, R. graminis, R.
mucilaginosa, R. minuta, R. bacarum), Rhodosporidium toruloides,
Hansenula polymorpha, Saccharomyces (e.g., S. cerevisiae, S.
carlsbergensis, S. diastaticus, S. norbensis, and S. kluyveri,).
Schizosaccharomyces pombe, Pichia pastoris, Pichia finlandica,
Pichia trehalophila, Pichia ferniemtans, Issatchenkia orientalis,
Pichia kodamae, Pichia membranaefaciens, Pichia opuntiae, Pichia
thermotolerans, Pichia salictaria, Pichia quercuum, Pichia pijperi,
Pichia stipitis, Pichia methanolica, Pichia angusta, Kluyveromyces
lactis, Candida (e.g., C. revkaufi, C. pulcherrima, C. tropicalis,
C. utills, C. curvata D, C. curvata R, C. diddensiae, C. boldinii,
C. albicans, C. krusei, C. ethanolic), Yarrowia (e.g. Y.
paralipolytica, and Y. lipolytica), Cryptococcus (terricolus)
albidus var. albidus, Cryptococcus laurentii, Trichosporon pullans,
Trichosporon cutaneum, Trichosporon cutancum, Trichosporon
pullulans, Lipomyces starkeyii, Lipomyces lipoferus, Lipomyces
tetrasporus, Endomycopsis vernalis, Hansenula ciferri, Hansenula
saturnus, and Trigonopsis variables and synonyms or taxonomic
equivalents thereof. In certain embodiments, the yeast is Y.
lipolytica. In certain embodiments, Yarrowia lipolytica strains
include, but are not limited to, DSMZ 1345, DSMZ 3286, DSMZ 8218,
DSMZ 70561, DSMZ 70562, DSMZ 21175, ATCC 20362, ATCC 18944 and ATCC
76982. In certain embodiments, the yeast host cell is a wild-type
cell. In various embodiments, the wild-type yeast cell strain is
selected from, but not limited to, strain BY4741, strain FL100a,
strain INVSC1, strain NRRL Y-390, strain NRRL Y-1438, strain NRRL
YB-1952, strain NRRL Y-5997, strain NRRL Y-7567, strain NRRL
Y-1532, strain NRRL YB-4149 and strain NRRL Y-567. In other
embodiments, the yeast host cell is genetically modified. Examples
of genetically modified yeast useful as recombinant host cells
include, but are not limited to, genetically modified yeast found
in the Open Biosystems collection found at
http://www.openbiosystems.com/GeneExpression/Yeast/YKO/. See
Winzeler et al. (1999) Science 285:901-906.
[0192] In yet other embodiments, the recombinant host cell is a
filamentous fungus. In certain embodiments, the filamentous fungal
host cell is a species of a genus selected from the group
consisting of Achlya, Acremonium, Aspergillus, Aureobasidium,
Bjerkandera, Ceriporiopsis, Cephalosporium, Chrysosporium,
Cochliobolus, Corynascus, Ctyphonectria, Cryptococcus, Coprinus,
Coriolus, Diplodia, Endothis, Fusarium, Gibberella, Gliocladium,
Humicola, Hypocrea, Myceliophthora, Mucor, Neurospora, Penicillium,
Podospora, Phlebia, Piromyces, Pyricularia, Rhizomucor, Rhizopus,
Schizophyllum, Scytalidium, Sporotrichum, Talaromyces, Thermoascus,
Thielavia, Trametes, Tolypocladium, Trichoderma, Verticillium,
Volvariella, and teleomorphs, synonyms or taxonomic equivalents
thereof.
[0193] In some embodiments, the filamentous fungal host cell is an
Aspergillus species, a Chrysosporium species, a Corynascus species,
a Fusarium species, a Humicola species, a Myceliophthora species, a
Neurospora species, a Penicillum species, a Tolypocladium species,
a Tramates species, or Trichoderma species. In other embodiments,
the Trichoderma species is selected from T. longibrachiatum, T.
viride, Hypocrea jecorina and T. reesei; the Aspergillus species is
selected from A. awamori, A. funigatus, A. japonicus, A. nidulans,
A. niger, A. aculeatus, A. foetidus, A. oryzae, A. sojae, and A.
kawachi; the Chrysosporium species is C. lucknowense; the Fusarium
species is selected from F. graminum, F. oxysporum and F.
venenatum; the Myceliophthora species is M. thermophilia; the
Neurospora species is N. crassa; the Humicola species is selected
from H. insolens, H. grisea, and H. lanuginosa; the Penicillum
species is selected from P. purpurogenum, P. chrysogenum, and P.
verruculosum; the Thielavia species is T. terrestris; and the
Trametes species is selected from T. villosa and T. versicolor.
[0194] In some embodiments, the filamentous fungal host is a
wild-type organism. In other embodiments, the filamentous fungal
host is genetically modified.
Transformation and Cell Culture
[0195] In some embodiments, a host cell is transformed with a
polynucleotide encoding a FAR variant as described herein. In
transformation, the polynucleotide that is introduced into the host
cell remains in the genome or on a plasmid or other stably
maintained vector in the cell and is capable of being inherited by
the progeny thereof. Stable transformation is typically
accomplished by transforming the host cell with an expression
vector comprising the polynucleotide of interest (e.g., the
polynucleotide encoding the FAR variant) along with a selectable
marker gene (e.g., a gene that confers resistance to an
antibiotic). Only those host cells which have integrated the
polynucleotide sequences of the expression vector into their genome
will survive selection with the marker (e.g., antibiotic). These
stably transformed host cells can then be propagated according to
known methods in the art.
[0196] Methods, reagents and tools for transforming host cells
described herein, such as bacteria, yeast (including oleaginous
yeast) and filamentous fungi are known in the art. General methods,
reagents and tools for transforming, e.g., bacteria can be found,
for example, in Sambrook et al (2001) Molecular Cloning: A
Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Laboratory
Press, New York. Methods, reagents and tools for transforming yeast
are described in "Guide to Yeast Genetics and Molecular Biology,"
C. Guthrie and G. Fink, Eds., Methods in Enzymology 350 (Academic
Press, San Diego, 2002). Methods, reagents and tools for
transforming, culturing, and manipulating Y. lipolytica are found
in "Yarrowia lipolytica," C. Madzak, J. M. Nicaud and C. Gaillardin
in "Production of Recombinant Proteins. Novel Microbial and
Eucaryotic Expression Systems," G. Gellissen, Ed. 2005, which is
incorporated herein by reference for all purposes. In some
embodiments, introduction of the DNA construct or vector of the
present invention into a host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection,
PEG-mediated transformation, electroporation, or other common
techniques (See Davis et al., 1986, Basic Methods in Molecular
Biology, which is incorporated herein by reference).
[0197] The engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating promoters,
selecting transformants, or amplifying the FAR polynucleotide.
Culture conditions, such as temperature, pH and the like, are those
previously used with the host cell selected for expression, and
will be apparent to those skilled in the art. As noted, many
references are available for the culture and production of many
cells, including cells of bacterial, plant, animal (especially
mammalian) and archebacterial origin. See e.g., Sambrook, Ausubel,
and Berger (all supra), as well as Freshney (1994) Culture of
Animal Cells, a Manual of Basic Technique, third edition,
Wiley-Liss, New York and the references cited therein; Doyle and
Griffiths (1997) Mammalian Cell Culture: Essential Techniques John
Wiley and Sons, NY; Humason (1979) Animal Tissue Techniques, fourth
edition W.H. Freeman and Company; and Ricciardelli, et al., (1989)
In Vitro Cell Dev. Biol. 25:1016-1024, all of which are
incorporated herein by reference. For plant cell culture and
regeneration, Payne et al. (1992) Plant Cell and Tissue Culture in
Liquid Systems John Wiley & Sons, Inc. New York, N.Y.; Gamborg
and Phillips (eds) (1995) Plant Cell, Tissue and Organ Culture;
Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin
Heidelberg New York); Jones, ed. (1984) Plant Gene Transfer and
Expression Protocols, Humana Press, Totowa, N. J. and Plant
Molecular Biology (1993) R. R. D. Croy, Ed. Bios Scientific
Publishers, Oxford, U.K. ISBN 0 12 198370 6, all of which are
incorporated herein by reference. Cell culture media in general are
set forth in Atlas and Parks (eds.) The Handbook of Microbiological
Media (1993) CRC Press, Boca Raton, Fla., which is incorporated
herein by reference. Additional information for cell culture is
found in available commercial literature such as the Life Science
Research Cell Culture Catalogue (1998) from Sigma-Aldrich, Inc (St
Louis, Mo.) ("Sigma-LSRCCC") and, for example, The Plant Culture
Catalogue and supplement (1997) also from Sigma-Aldrich, Inc (St
Louis, Mo.) ("Sigma-PCCS"), all of which are incorporated herein by
reference.
VII. Methods of Producing Fatty Alcohols
[0198] The present disclosure also provides methods of producing
fatty alcohols with the FAR variant polypeptides described herein,
as well as the resultant fatty alcohol compositions produced by
said methods.
[0199] In some particular embodiments, a method of producing a
fatty alcohol composition comprises culturing a recombinant
microorganism in a suitable culture medium, wherein the recombinant
microorganism comprises a gene encoding a FAR variant polypeptide
capable of producing at least about 1.5 more fatty alcohols than a
wild-type FAR comprising SEQ ID NO:2 when assayed under the same
conditions, or as compared to a reference FAR variant (e.g., a
reference FAR variant comprising SEQ ID NO:6, SEQ ID NO:8, SEQ ID
NO:10, SEQ ID NO:12, or SEQ ID NO:14) when assayed under the same
conditions.
[0200] In some embodiments, a method of producing a fatty alcohol
composition comprises culturing a recombinant microorganism in a
suitable culture medium, wherein the recombinant microorganism
comprises a gene encoding a FAR variant capable of producing a
fatty alcohol profile having one or more of an increased amount of
C12:0 (1-dodecanol), an increased amount of C12:1 (cis
.DELTA..sup.5-dodecenol), an increased amount of C14:0
(1-tetradecanol), an increased amount of C14:1 (cis
.DELTA..sup.7-1-tetradecanol), a decreased amount of C16:0
(1-hexadecanol), a decreased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol), a decreased amount of C18:0
(1-octadecanol), or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol) as compared to a wild-type FAR
comprising SEQ ID NO:2 or SEQ ID NO:4. In some embodiments, a
method of producing a fatty alcohol composition comprises culturing
a recombinant microorganism in a suitable culture medium, wherein
the recombinant microorganism comprises a gene encoding a FAR
variant capable of producing an increased amount of C10 to C18
fatty alcohols, an increased amount of C12 to C16 fatty alcohols,
an increased amount of C12 to C14 fatty alcohols, an increased
amount of C14 to C16 fatty alcohols, or a decreased amount of C18
fatty alcohols as compared to a wild-type FAR comprising SEQ ID
NO:2 when assayed under the same conditions, or as compared to a
reference FAR variant (e.g., a reference FAR variant comprising SEQ
ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14)
when assayed under the same conditions.
[0201] In some embodiments, the method comprises culturing a
recombinant microorganism (for example, but not limited to a strain
of E. coli) in a suitable culture medium, wherein the recombinant
microorganism comprises a gene encoding a FAR variant polypeptide
comprising a sequence that is at least about 70% (or at least about
75%, at least about 80%, at least about 85%, at least about 90%, at
least about 91%, at least about 92%, at least about 93%, at least
about 94%, at least about 95%, at least about 96%, at least about
97%, at least about 98%, or at least about 99%) identical to SEQ ID
NO:2 or SEQ ID NO:4 and comprises one or more amino acid
substitutions selected from M1E/G/L/R/V/W, A2D/F/G/H/P/Q/R/S/T/W/Y,
T3/I/L, Q4/N/R/S/W/Y, Q5M/N, Q6C/H/K/P/R/S/V/Y, Q7H/N, N8A/E/HN,
G9C/F/V, A10T, S11D/G, A12D/R/S/T, S13G/L/V, G14K/L/M/RN, V151,
L16G/I/S, E17C/G/H/R, Q181/L, R20K, H23R, K40R, R43H, T44A, V45A/S,
D47E/N, G49E, G50A, H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/Y,
F68AN, L69E/I/M/Q, N70D/E/L/M/R/T, E71C/M/Q/S, 172L, A73G/H/K/L/M,
S74K/L/P/T/W, S75C/E/H/N, S76E/F/I/L/R, V771/P/T, F78M, E79D/I/UQN,
R80I/L, L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V, F89D/N/P/R,
E90D/Q, T91A/R, L93D, V971, H98P, I100V, T101A, E103C/S/V, V104I/M,
E106A/H, S107A, R108E/G/H/Q, L111I, T112G, P113I/Q, R115D, F116Y,
A118K, A120C, G121T, Q122E/H/T, V123L, F126V, N128C/H/L, S129D,
A130C/S, A131P/S, S132H, V133A/G, N134D/K/R/S/Y, F135E, R136L,
E137L, E138Q/R, D140Y, K144A/E/R, 1145E/H, L148E/K/T, L150P,
E151G/RN, V153F/I, A154G/R, A155G/M/R/T/W, L156M, A157QN, E158D/N,
N160T, S161P/Y, A162K, M163L, A164V, 1166L/M, Q167H, N174A,
K176G/1/M, N177D/E/L/R/T, S178F/L, G179D/S/W, Q180C/R, 1181D/E/L/V,
T182G/I/K/R, V185G/I/P, I186H, K187P, P188D/E/I/R/S/W, A189L/N,
G190I/K/L, E191V/W, S192A, I193C/L/V, R195F/H/I/N/W, S196D,
T197F/P, D198S, Y200F, E205K, L206C, V207L/M, H208R, L209N/T/Y,
Q211H/L/N/R, D212F, S215E/Y, D216G/Q, K218P/Q/R, R220A/H, Y221D/K,
K224R, V225C/M, L226M, E227G, K228H, V231A, I235E, R2361, A238G,
N239C, N240Q/R/T, Y241F, G242E, S244A/P/R, D245H, T246A/P/V, Y247N,
L253P/V, L258P, S263N, G264R, S266A/T, L267H, T268N, V270L, S273F,
1275V, S277A, A278C, E2801, E281S/Y, S283A/E/F/M/T, P284C/L/Q,
G285D, W286Y, E288D/H/Q, E303G, S306T/W, F3081, G310UV, S313Q,
I316L, V318F/L/M, S331V, S337G, G338E, S339P, Q341R, G351C, S352G,
I355F/L/S/W, K359E, I361C/F/L, D362L, Y363H, M365N, A368S, T370A/I,
A373W, A374Y, D376K/P/R, Q377H/K, Y380H/R, R382H/Q, T384S, F3871/L,
V388L, A389I/M/L/V, K393A, D396G, V397L, V398Y, V3991, G400S,
G401A/C/L/S/TN, M402V, V4041/L, P405A/C/F/G/L/V, L406Y, 1408L,
A409TN/W/Y, G410D/H/R, K411R, A412V, M413L/R, R414K, A416UV, G417V,
Q418I/N/R/V, N419S, E421D/G/I/L/P/R/S/V, V424M, K426R/T, D429E/K/R,
T430A/H/I, R432C/Q, S433H/K/N/R/Y, T436A, T4421, A443T, Y446F,
S452E/G/N, S458E/N/Q, L463V, R465K, V466G/Q, Q474L/R, Q478E, C482R,
G487R/Y, L489F, N490C/S, R491M, L494Y, K495C/S, E496D/G, K498G/N,
L499R/S/V, Y500H/N, S501C/F/W, L502A/Q/R/S/W, R503C/K, A504D/E/S/T,
A505E/G/K, D506G/L/M/R/W, T507H/Q, R508D/G/H/L/M, K509D/G/H/P/Q/R,
K510D/E/L/M/N/R/S, A511D/G/I/K/P/R/S/T, and/or A512M/R, wherein the
amino acid positions are numbered with reference to SEQ ID NO:2;
and allowing expression of said gene, wherein said expression
results in the production of a composition of fatty alcohols (e.g.,
a composition having an increased amount of C12:0 (1-dodecanol), an
increased amount of C12:1 (cis .DELTA..sup.5-dodecenol), an
increased amount of C14:0 (1-tetradecanol), an increased amount of
C14:1 (cis .DELTA..sup.7-1-tetradecanol), an increased amount of
C16:0 (1-hexadecanol), an increased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol), a decreased amount of C18:0
(1-octadecanol), or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol)); or a composition comprising a fatty
alcohol profile having one or more of an increased amount of C12:0
(1-dodecanol), an increased amount of C12:1 (cis
.DELTA..sup.5-dodecenol), an increased amount of C14:0
(1-tetradecanol), an increased amount of C14:1 (cis
.DELTA..sup.7-1-tetradecanol), an increased amount of C16:0
(1-hexadecanol), an increased amount of C16:1 (cis
.DELTA..sup.9-1-hexadecenol), a decreased amount of C18:0
(1-octadecanol), or a decreased amount of C18:1 (cis
.DELTA..sup.11-1-octadecenol)) as compared to a wild-type FAR).
[0202] While not meant to limit the invention in any manner, in
some embodiments, the method of producing a fatty alcohol
composition comprises: [0203] a) culturing a recombinant strain of
E. coli, Yarrowia, or Saccharomyces, in a suitable culture medium,
wherein the recombinant strain comprises a gene encoding a FAR
variant polypeptide, [0204] b) allowing expression of said gene,
and [0205] c) producing the fatty alcohol composition, wherein i)
the FAR variant polypeptide comprises an amino acid sequence that
is at least about 70% identical to SEQ ID NO:2 or SEQ ID NO:4 and
comprises one or more amino acid substitutions as described herein
(e.g., one or more amino acid substitutions sets listed in Table 1,
Table 2, Table 4, Table 7, Table 8, Table 9, Table 10, or Table
11); ii) the culturing is carried at a temperature of about
20.degree. C. to about 40.degree. C. and from about 16 to 120
hours, iii) the culture medium comprises a carbon source comprising
fermentable sugars obtained from a cellulosic feedstock, and iv) at
least about 5 g/L of recoverable fatty alcohols are produced. In
some embodiments, fermentable sugars in the culture medium include
glucose and/or sucrose.
[0206] In some embodiments, the method of producing a fatty alcohol
composition comprises: [0207] a) culturing a recombinant strain of
E. coli a suitable culture medium, wherein the recombinant strain
comprises a gene encoding a FAR variant polypeptide, [0208] b)
allowing expression of said gene, and [0209] c) producing the fatty
alcohol composition, wherein i) the FAR variant polypeptide
comprises comprises an amino acid sequence having at least 90% (at
least 91%, at least 92%, at least 93%, at least 94%, at least 95%,
at least 96%, at least 97%, at least 98%, or at least 99%) sequence
identity to any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, or 28, and comprises a substitution at one or more
positions selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 20, 23, 40, 43, 44, 45, 47, 49, 50, 52, 61, 62,
63, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,
83, 84, 85, 86, 87, 88, 89, 90, 91, 93, 97, 98, 100, 101, 103, 104,
106, 107, 108. 111, 112, 113, 115, 116, 118, 120, 121, 122, 123,
126, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 140,
144, 145, 148, 150, 151, 153, 154, 155, 156, 157, 158, 160, 161,
162, 163, 164, 166, 167, 174, 176, 177, 178, 179, 180, 181, 182,
185, 186, 187, 188, 189, 190, 191, 192, 193, 195, 196, 197, 198,
200, 205, 206, 207, 208, 209, 211, 212, 215, 216, 218, 220, 221,
224, 225, 226, 227, 228, 231, 235, 236, 238, 239, 240, 241, 242,
244, 245, 246, 247, 253, 258, 263, 264, 266, 267, 268, 270, 273,
275, 277, 278, 280, 281, 283, 284, 285, 286, 288, 303, 306, 308,
310, 313, 316, 318, 331, 337, 338, 339, 341, 351, 352, 355, 359,
361, 362, 363, 365, 368, 370, 373, 374, 376, 377, 380, 382, 384,
387, 388, 389, 393, 396, 397, 398, 399, 400, 401, 402, 404, 405,
406, 308, 409, 410, 411, 412, 413, 414, 416, 417, 418, 419, 421,
424, 426, 429, 430, 432, 433, 436, 442, 443, 446, 452, 458, 463,
465, 466, 474, 478, 482, 487, 489, 490, 491, 494, 495, 496, 498,
499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, or
512, wherein the position is numbered with reference to SEQ ID
NO:2; ii) the culturing is carried at a temperature of about
20.degree. C. to about 40.degree. C. and from about 16 to 120
hours; iii) the culture medium comprises a carbon source comprising
fermentable sugars; and iv) at least about 5 g/L of fatty alcohol
are produced. In certain embodiments, one or more substitutions are
selected from M1E/G/URN/W, A2D/F/G/H/P/Q/R/S/T/W/Y, T3/I/L,
Q4/N/R/S/W/Y, Q5M/N, Q6C/H/K/P/R/S/V/Y, Q7H/N, N8A/E/H/V, G9C/FN,
A10T, 311D/G, A12D/R/S/T, S13G/L/V, G14K/L/M/RN, V15I, L16G/I/S,
E17C/G/H/R, Q181/L, R20K, H23R, K40R, R43H, T44A, V45A/S, D47E/N,
G49E, G50A, H52Y, H61R, P62Q, A63D, R65G, E66D/F/S/Y, F68AN,
L69E/I/M/Q, N70D/E/L/M/R/T, E71C/M/Q/S, I72L, A73G/H/K/L/M,
S74K/L/P/T/W, S75C/E/H/N, S76E/F/I/L/R, V77I/P/T, F78M,
E79D/I/L/Q/V, R80I/L, L81F/T, H83E, D84A, D85E, N86S, E87V, A88G/V,
F89D/N/P/R, E90D/Q, T91A/R, L93D, V971, H98P, I100V, T101A,
E103C/S/V, V104I/M, E106A/H, S107A, R108E/G/H/Q, L111I, T112G,
P113I/Q, R115D, F116Y, A118K, A120C, G121T, Q122E/H/T, V123L,
F126V, N128C/H/L, S129D, A130C/S, A131P/S, S132H, V133A/G,
N134D/K/R/S/V, F135E, R136L, E137L, E138Q/R, D140Y, K144A/E/R,
I145E/H, L148E/K/T, L150P, E151G/R/V, V153F/I, A154G/R,
A155G/M/R/T/W, L156M, A157Q/V, E158D/N, N160T, S161P/Y, A162K,
M163L, A164V, 1166L/M, Q167H, N174A, K176G/I/M, N177D/E/L/R/T,
S178F/L, G179D/S/W, Q180C/R, I181D/E/L/V, T182G/I/K/R, V185G/I/P,
I186H, K187P, P188D/E/I/R/S/W, A189L/N, G190I/K/L, E191V/W, S192A,
I193C/L/V, R195F/H/I/N/W, S196D, T197F/P, D198S, Y200F, E205K,
L206C, V207L/M, H208R, L209N/T/Y, Q211H/L/N/R, D212F, S215E/Y,
D216G/Q, K218P/Q/R, R220A/H, Y221D/K, K224R, V225C/M, L226M, E227G,
K228H, V231A, 1235E, R236I, A238G, N239C, N240Q/R/T, Y241F, G242E,
S244A/P/R, D245H, T246A/P/V, Y247N, L253P/V, L258P, S263N, G264R,
S266A/T, L267H, T268N, V270L, S273F, 1275V, S277A, A278C, E2801,
E281S/Y, S283A/E/F/M/T, P284C/L/Q, G285D, W286Y, E288D/H/Q, E303G,
S306T/W, F3081, G310L/V, S313Q, I316L, V318F/L/M, S331V, S337G,
G338E, S339P, Q341R, G351C, S352G, I355F/L/S/W, K359E, I361C/F/L,
D362L, Y363H, M365N, A368S, T370A/I, A373W, A374Y, D376K/P/R,
Q377H/K, Y380H/R, R382H/Q, T384S, F3871/L, V388L, A389I/M/L/V,
K393A, D396G, V397L, V398Y, V399I, G400S, G401A/C/L/S/T/V, M402V,
V404I/L, P405A/C/F/G/L/V, L406Y, I408L, A409T/V/W/Y, G410D/H/R,
K411R, A412V, M413L/R, R414K, A416L/V, G417V, Q418I/N/RN, N419S,
E421D/G/I/L/N/P/R/S/V, V424M, K426R/T, D429E/K/R, T430A/H/I,
R432C/Q, S433H/K/N/RN, T436A, T442I, A443T, Y446F, S452E/G/N,
S458E/N/Q, L463V, R465K, V466G/Q, Q474L/R, Q478E, C482R, G487R/Y,
L489F, N490C/S, R491M, L494Y, K495C/S, E496D/G, K498G/N, L499R/S/V,
Y500H/N, S501C/F/W, L502A/Q/R/S/W, R503c/K, A504D/E/S/T, A505E/G/K,
D506G/L/M/R/W, T507H/Q, R508D/G/H/L/M, K509D/G/H/P/Q/R,
K510D/E/L/M/N/R/S, A511D/G/I/K/P/R/S/T, and/or A512M/R.
[0210] Fatty alcohol compositions can be made by culturing a host
cell comprising a FAR variant as described herein in a suitable
culture medium under conditions (e.g., time, temperature, and/or pH
conditions) suitable for the production of fatty alcohols, and
producing the fatty alcohol composition. In some embodiments, the
methods further comprise isolating the fatty alcohol compositions
from the culture medium. In some embodiments, the host cell
comprising the FAR variant is cultured under temperature conditions
of from about 10.degree. C. to about 60.degree. C. (e.g., from
about 15.degree. C. to about 50.degree. C., from about 20.degree.
C. to about 45.degree. C., from about 20.degree. C. to about
40.degree. C., from about 20.degree. C. to about 35.degree. C., or
from about 25.degree. C. to about 45.degree. C.). In some
embodiments, the host cell comprising the FAR variant is cultured
under time conditions the fermentation of from about 8 hours to 240
hours (e.g., from about 8 hours to about 168 hours, from about 8
hours to 144 hours, from about 16 hours to about 120 hours, or from
about 24 hours to about 72 hours). In some embodiments, the host
cell comprising the FAR variant is cultured under pH conditions of
about pH 4-8 (e.g., about pH 4.5 to 7.5, about pH 5 to 7, or about
pH 5.5 to 6.5).
[0211] The methods of producing fatty alcohol compositions as
described herein can be carried out in cell-free systems with
isolated FAR variant polypeptides, or in cell-based systems with
microorganisms engineered to express one or more FAR variant
polypeptides as described herein.
[0212] In embodiments in which fatty alcohols are produced in
cell-free systems, an isolated FAR variant polypeptide is provided
with a substrate (a fatty acyl-ACP and/or a fatty acyl-CoA complex)
and NAD(P)H under suitable conditions of temperature, pH, and ionic
strength and time sufficient for the production of a fatty alcohol
composition. In some embodiments, the FAR variant polypeptide is
provided with a composition of a fatty acid, Coenzyme A and a fatty
acyl-CoA synthase under suitable conditions of temperature, pH and
ionic strength and time sufficient for production of a fatty
alcohol composition.
[0213] In embodiments employing cell-based systems, a recombinant
host cell capable of expressing a gene that encodes a FAR variant
polypeptide as described herein above is cultured in an aqueous
nutrient medium comprising an assimilable source of carbon under
conditions suitable for production of a fatty alcohol composition.
Any of the various host microorganisms described herein can be
used.
Fermentation Methods
[0214] Fermentation of the recombinant host cell is carried out
under suitable conditions and for a time sufficient for production
of fatty alcohols. Conditions for the culture and production of
cells, including filamentous fungi, bacterial and yeast cells, are
readily available. Cell culture media in general are set forth in
Atlas and Parks, Eds., The Handbook of Microbiological Media (1993)
CRC Press, Boca Raton, Fla., which is incorporated herein by
reference. The individual components of such media are available
from commercial sources, e.g., under the Difco.TM. and BBL.TM.
trademarks. In one non-limiting example, the aqueous nutrient
medium is a "rich medium" comprising complex sources of nitrogen,
salts, and carbon, such as YP medium, comprising 10 g/L of peptone
and 10 g/L yeast extract of such a medium. In other non-limiting
embodiments, the aqueous nutrient medium comprises a mixture of
Yeast Nitrogen Base (Difco.TM.) in combination supplemented with an
appropriate mixture of amino acids, e.g., SC medium. In particular
aspects of this embodiment, the amino acid mixture lacks one or
more amino acids, thereby imposing selective pressure for
maintenance of an expression vector within the recombinant host
cell.
[0215] The recombinant microorganisms can be grown under batch or
continuous fermentation conditions. Classical batch fermentation is
a closed system, wherein the compositions of the medium is set at
the beginning of the fermentation and is not subject to artificial
alternations during the fermentation. A variation of the batch
system is a fed-batch fermentation which also finds use in the
present invention. In this variation, the substrate is added in
increments as the fermentation progresses. Fed-batch systems are
useful when catabolite repression is likely to inhibit the
metabolism of the cells and where it is desirable to have limited
amounts of substrate in the medium. Batch and fed-batch
fermentations are common and well known in the art. Continuous
fermentation is an open system where a defined fermentation medium
is added continuously to a bioreactor and an equal amount of
conditioned medium is removed simultaneously for processing.
Continuous fermentation generally maintains the cultures at a
constant high density where cells are primarily in log phase
growth. Continuous fermentation systems strive to maintain steady
state growth conditions. Methods for modulating nutrients and
growth factors for continuous fermentation processes as well as
techniques for maximizing the rate of product formation are well
known in the art of industrial microbiology.
[0216] In some embodiments, fermentations are carried out a
temperature within the range of from about 10.degree. C. to about
60.degree. C., from about 15.degree. C. to about 50.degree. C.,
from about 20.degree. C. to about 45.degree. C., from about
25.degree. C. to about 45.degree. C., from about 30.degree. C. to
about 45.degree. C. and from about 25.degree. C. to about
40.degree. C.
[0217] In other embodiments, the fermentation is carried out for a
period of time within the range of from about 8 hours to 240 hours,
from about 8 hours to about 168 hours, from about 8 hours to 144
hours, from about 16 hours to about 120 hours, or from about 24
hours to about 72 hours. It will be understood that, in certain
embodiments where thermostable host cells are used, fermentations
may be carried out at higher temperatures.
[0218] In other embodiments, the fermentation is carried out at a
pH in the range of 4 to 8, in the range of 4.5 to 7.5, in the range
of 5 to 7, or in the range of 5.5 to 6.5.
[0219] Carbon sources useful in the aqueous fermentation medium or
broth of the disclosed process in which the recombinant
microorganisms are grown are those assimilable by the recombinant
host strain. Assimilable carbon sources are available in many forms
and include renewable carbon sources and the cellulosic and starch
feedstock substrates obtained there from. Such examples include,
for example, depolymerized cellulosic material, monosaccharides,
disaccharides, oligosaccharides, saturated and unsaturated fatty
acids, succinate, acetate and mixtures thereof. Further carbon
sources include, without limitation, glucose, galactose, sucrose,
xylose, fructose, glycerol, arabinose, mannose, raffinose, lactose,
maltose, and mixtures thereof.
[0220] In some preferred embodiments, the assimilable carbon source
is from cellulosic and/or starch feedstock derived from but not
limited to, wood, wood pulp, paper pulp, grain (e.g., corn grain),
corn stover, corn fiber, rice, paper and pulp processing waste,
woody or herbaceous plants and residue, fruit or vegetable pulp,
distillers grain, grasses, rice hulls, wheat straw, cotton, hemp,
flax, sisal, corn cobs, sugar cane bagasse, sugar beets, sorghum,
barley, barley straw, switch grass, wood chips, municipal solid
wastes, aquatic crops, and mixtures thereof.
[0221] In some embodiments, the cellulosic feedstock useful as an
assimilable carbon source has been derived from a biomass substrate
that has been pretreated. The term "biomass" is broadly used herein
to encompasses any living or dead biological material that contains
a polysaccharide substrate, including but not limited to cellulose,
starch, other forms of long-chain carbohydrate polymers, and
mixtures of such sources. A biomass substrate is "pretreated,"
using methods known in the art, such as chemical pretreatment
(e.g., ammonia pretreatment, dilute acid pretreatment, dilute
alkali pretreatment, or solvent exposure), physical pretreatment
(e.g., steam explosion or irradiation), mechanical pretreatment
(e.g., grinding or milling) and biological pretreatment (e.g.,
application of lignin-solubilizing microorganisms) and combinations
thereof, to increase the susceptibility of cellulose to hydrolysis.
In some embodiments, the substrate is slurried prior to
pretreatment.
[0222] The following references described various means of
pretreatment. Steam explosion performing acid pretreatment of
biomass substrates is described in U.S. Pat. No. 4,461,648.
Continuous pretreatment using a slurry is described U.S. Pat. No.
7,754,457. Methods of alkali pretreatment is such as Ammonia Freeze
Explosion, Ammonia Fiber Explosion or Ammonia Fiber Expansion
("AFEX") are described in U.S. Pat. Nos. 5,171,592; 5,037,663;
4,600,590; 6,106,888; 4,356,196; 5,939,544; 6,176,176; 5,037,663
and 5,171,592. Alternative methods to AFEX utilizing a dilute
ammonia pretreatments are described in WO2009/045651 and US
2007/0031953. Chemical pretreatments with organic solvents are
disclosed in U.S. Pat. No. 4,556,430. Other pretreatments methods
are disclosed in U.S. Pat. No. 7,465,791, and Weil et al. (1997)
Appl. Biochem. Biotechnol., 68(1-2): 21-40 (1997).
Production Levels
[0223] The methods described herein produce fatty alcohols in high
yield. Cells expressing FAR variants described herein may yield
fatty alcohols in the range of about 0.5 g to at least 35.0 g fatty
alcohols per liter of nutrient medium, depending upon the FAR
variant polypeptide used. Exemplary culture conditions for E. coli
are provided in the examples. Other E. coli culture conditions, as
well as culture conditions for other host cells, are known or can
be determined. In some embodiments, about 20 g/L to about 50 g/L
(e.g., about 20 g/L, about 25 g/L, about 30 g/L, about 35 g/L,
about 40 g/L, about 45 g/L, or about 50 g/L), or sometimes about 50
g/L to about 100 g/L (e.g., about 50 g/L, about 60 g/L, about 70
g/L, about 80 g/L, about 90 g/L, or about 100 g/L) are produced. In
particular embodiments, the amount of fatty alcohols produced by
the methods described herein is at least about 0.5 g/L, such as at
least about 1 g/L, such as at least about 1.5 g/L, such as at least
about 2.0 g/L, such as at least about 2.5 g/L, such as at least
about 3 g/L, such as at least about 3.5 g/L, such as at least about
4 g/L, such as at least about 4.5 g/L, such as at least about 5
g/L, such as at least about 10 g/L of medium. In various
embodiments, the amount of fatty alcohols produced by the methods
described herein is at least about 20 g/L, such as at least about
30 g/L, such as at least about 40 g/L, such as at least about 50
g/L of medium. In some embodiments fermentation yields at least
0.1, at least 0.15 or at least 0.18 g fatty alcohol/gram glucose.
In some embodiments fermentation yields at least 1 gram, at least
1.5 grams, or at least 1.8 grams fatty alcohol/gram dry cell
weight.
[0224] In some embodiments, the methods described herein produce
fatty alcohol compositions of particular chain lengths in high
yield. In some embodiments, the methods described herein produce
fatty alcohol compositions comprising at least about 90% C10-C18
fatty alcohols in an amount that is at least about 0.5 g/L, such as
at least about 1 g/L, at least about 1.5 g/L, at least about 2.0
g/L, at least about 2.5 g/L, at least about 3 g/L, at least about
3.5 g/L, at least about 4 g/L, at least about 4.5 g/L, at least
about 5 g/L, at least about 10 g/L, at least about 20 g/L, at least
about 30 g/L, at least about 40 g/L, or at least about 50 g/L fatty
alcohols per liter of medium. In some embodiments, the methods
described herein produce fatty alcohol compositions comprising at
least about 90% C12-C16 fatty alcohols in an amount that is at
least about 0.5 g/L, such as at least about 1 g/L, at least about
1.5 g/L, at least about 2.0 g/L, at least about 2.5 g/L, at least
about 3 g/L, at least about 3.5 g/L, at least about 4 g/L, at least
about 4.5 g/L, at least about 5 g/L, at least about 10 g/L, at
least about 20 g/L, at least about 30 g/L, at least about 40 g/L,
or at least about 50 g/L fatty alcohols per liter of medium. In
some embodiments, the methods described herein produce fatty
alcohol compositions comprising at least about 90% C12-C14 fatty
alcohols in an amount that is at least about 0.5 g/L, such as at
least about 1 g/L, at least about 1.5 g/L, at least about 2.0 g/L,
at least about 2.5 g/L, at least about 3 g/L, at least about 3.5
g/L, at least about 4 g/L, at least about 4.5 g/L, at least about 5
g/L, at least about 10 g/L, at least about 20 g/L, at least about
30 g/L, at least about 40 g/L, or at least about 50 g/L fatty
alcohols per liter of medium. In some embodiments, the methods
described herein produce fatty alcohol compositions comprising at
least about 90% C14-C16 fatty alcohols in an amount that is at
least about 0.5 g/L, such as at least about 1 g/L, at least about
1.5 g/L, at least about 2.0 g/L, at least about 2.5 g/L, at least
about 3 g/L, at least about 3.5 g/L, at least about 4 g/L, at least
about 4.5 g/L, at least about 5 g/L, at least about 10 g/L, at
least about 20 g/L, at least about 30 g/L, at least about 40 g/L,
or at least about 50 g/L fatty alcohols per liter of medium.
[0225] In some embodiments, the methods described herein produce an
aggregate of the fatty alcohols C12:0 (1-dodecanol), C12:1 (cis
.DELTA..sup.5-1-dodecenol), C14:0 (1-tetradecanol), C14:1 (cis
.DELTA..sup.7-1-tetradecenol), C16:1 (cis
.DELTA..sup.9-1-hexadecenol), C16:0 (1-hexadecanol), C18:1 (cis
.DELTA..sup.11-1-octadecenol), and C18:0 (1-octadecanol) in high
yield. In some embodiments, the methods described herein produce an
aggregate of the fatty alcohols C12:0 (1-dodecanol), C12:1 (cis
.DELTA..sup.5-1-dodecenol), C14:0 (1-tetradecanol), C14:1 (cis
.DELTA..sup.7-1-tetradecenol), C16:0 (1-hexadecanol), and C16:1
(cis .DELTA..sup.9-1-hexadecenol) in high yield. In some
embodiments, the amount of such an aggregate of fatty alcohols that
is produced is at least about 0.5 g/L, such as at least about 1
g/L, at least about 1.5 g/L, at least about 2.0 g/L, at least about
2.5 g/L, at least about 3 g/L, at least about 3.5 g/L, at least
about 4 g/L, at least about 4.5 g/L, at least about 5 g/L, at least
about 10 g/L, at least about 20 g/L, at least about 30 g/L, at
least about 40 g/L, or at least about 50 g/L of medium.
[0226] In some embodiments, the amount of fatty alcohols produced
by the methods described herein is in the range of about 100 mg/g
to about 5 g/g of dry cell weight. In other embodiments, the amount
of fatty alcohols produced by the methods described herein is in
the range of about 1 g/g to about 4 g/g of dry cell weight, such as
in the range of about 2 g/g to about 3 g/g of dry cell weight by
routine modification of culturing conditions.
[0227] In certain embodiments, the amount of fatty alcohols
produced by the methods described herein is in the range of about
10% to about 20% of dry cell weight, such as in the range of about
20% to about 30% of dry cell weight, such as in the range of about
30% to about 40% of dry cell weight, such as in the range of about
40% to about 50% of dry cell weight, such as in the in range of
about 50% to about 60% of dry cell weight, such as in the range of
about 60% to about 70% of dry cell weight, such as in the range of
about 70% to about 80% of dry cell weight by routine modification
of culturing conditions.
Recovery of Fatty Alcohols
[0228] Fatty alcohols produced by the methods can be isolated to
yield fatty alcohol compositions. In some embodiments, recombinant
microorganism hosts secrete the fatty alcohols into the nutrient
medium. For cell-based methods carried out with recombinant
microorganism hosts that secrete the fatty alcohols into the
nutrient medium, the fatty alcohols can be isolated by solvent
extraction of the aqueous nutrient medium with a suitable water
immiscible solvent. Phase separation followed by solvent removal
provides the fatty alcohol which may then be further purified and
fractionated using methods and equipment known in the art. In other
aspects of the disclosure, the secreted fatty alcohols coalesce to
form a water immiscible phase that can be directly separated from
the aqueous nutrient medium either during the fermentation or after
its completion.
[0229] In certain embodiments, fatty alcohols are isolated by
separating the cells from the aqueous nutrient medium, for example
by centrifugation, resuspension and extraction of the fatty
alcohols from the recombinant host cells using an organic solvent
or solvent mixture. Suitable protocols for recovering fatty
alcohols from recombinant host cells and/or culture medium are
known to the skilled artisan.
[0230] In some embodiments, at least 10%, such as at least 20%, at
least 25%, at least 30%, at least 40%, at least 50%, at least 60%,
at least 70%, at least 80%, or at least 90% of the fatty alcohols
(e.g., C12 to 16 fatty alcohols or C12 to C14 fatty alcohols)
produced by the methods described herein are secreted by the
recombinant host cell or engineered microorganism comprising a FAR
variant as described herein. In some embodiments, at least 10%,
such as at least 20%, at least 25%, at least 30%, at least 40%, at
least 50%, at least 60%, at least 70%, at least 80%, or at least
90% of the fatty alcohols (e.g., C12 to 16 fatty alcohols or C12 to
C14 fatty alcohols) produced by the methods described herein are
secreted into the culture medium.
[0231] Fatty alcohols produced with microorganism hosts that do not
secrete the fatty alcohols into the nutrient medium can be
recovered by first lysing the cells to release the fatty alcohols
and extracting the fatty alcohols from the lysate using
conventional means. Reference is made to Yeast Protocols Handbook,
Clontech Laboratories, Inc., A Takara Bio Company, 1290 Terra Bella
Ave., Mountain View, Calif. 94043, published July 2009, available
online.
VIII. Fatty Alcohol Derivatives
[0232] Fatty alcohols produced using the methods and variants
disclosed herein can be converted to a variety of commercially
useful compounds, referred to as fatty alcohol derivatives. Without
limitation, exemplary fatty alcohol derivatives include fatty
acids, fatty aldehydes, fatty esters, wax esters, fatty acetates,
ethoxylates, sulphates, phosphates, amines, alkanes, and alkenes.
The fatty alcohol derivatives may be obtained from fatty alcohols
using either enzymatic or chemical methods. In some embodiments,
the fatty alcohols can be reacted with a sulfonic acid group to
produce sulfate derivatives.
[0233] In some embodiments, total fatty alcohols produced in a
fermentation are derivatized. Sometimes fatty alcohols produced in
a fermentation are fractionated, and a fraction(s) is
derivatized.
Alkane and/or Alkene Compositions
[0234] In some embodiments, the fatty alcohol compositions produced
by the methods described herein can be reduced to yield alkanes
and/or alkenes having the same carbon chain length as the fatty
alcohol starting materials. Without being bound by any particular
theory, the hydroxyl group of an alcohol is a poor leaving group,
and therefore, in principle a chemical moiety that binds to the
oxygen atom of the hydroxyl group to make it a better leaving group
can be used to reduce the fatty alcohols described herein. In
another embodiment, alkanes can be produced by hydrogenation of
fatty alcohols or fatty acids.
[0235] Any method known in the art can be used to reduce the fatty
alcohols produced according to the methods described herein. In
some embodiments, reduction of fatty alcohols can be carried out
chemically, for example, by a Barton deoxygenation (or
Barton-McCombie deoxygenation), a two-step reaction in which the
alcohol is first converted to a methyl xanthate or thioimidazoyl
carbamate, and the xanthate or thioimidazoyl carbamate is reduced
with a tin hydride or trialkylsilane reagent under radical
conditions to produce the alkane and/or alkene. See J. J. Li, C.
Limberakis, D. A. Pflum, Modern Organic Synthesis in the Laboratory
(Oxford University Press, 2007) at pp. 81-83.
[0236] In some embodiments, reduction of fatty alcohols to the
corresponding alkanes and/or alkenes can be accomplished using a
microorganism that has a biosynthetic pathway for reducing fatty
alcohols. In certain embodiments, the microorganism is a bacterium.
In specific embodiments, the bacterium is Vibrio furnissii strain
M1. In some embodiments, the fatty alcohol compositions produced by
the methods described herein are contacted with the appropriate
microorganism for reduction to alkanes and/or alkenes. In other
embodiments, the fatty alcohol compositions produced by the methods
described herein are contacted with membrane fractions from the
appropriate microorganism so that the reduction is carried out in a
cell free system. See, e.g., Park, 2005, J. Bacteriol.
187(4):1426-1429.
[0237] In certain embodiments, alkanes and/or alkenes produced by
the reduction of fatty alcohols described herein are isolated from
the reaction mixture and unreduced fatty alcohol starting materials
to produce a composition that comprises substantially all alkanes
and/or alkenes. In some embodiments, the alkanes and/or alkenes
produced by the reduction of fatty alcohols described herein and
the unreacted fatty alcohol starting materials are isolated from
the reaction mixture to produce a composition comprising alkanes
and/or alkenes and fatty alcohols.
[0238] In certain embodiments, the resulting compositions comprise
at least about 60% alkanes and/or alkenes, such as at least about
70% alkanes and/or alkenes, such as at least about 80% alkanes
and/or alkenes, such as at least about 85% alkanes and/or alkenes,
such as at least about 90% alkanes and/or alkenes, such as at least
about 92% alkanes and/or alkenes, such as at least about 95%
alkanes and/or alkenes, such as at least about 96% alkanes and/or
alkenes, such as at least about 97% alkanes and/or alkenes, such as
at least about 98% alkanes and/or alkenes, such as at least about
99% alkanes and/or alkenes by weight of the composition after
reduction.
[0239] In other embodiments, the resulting compositions comprise at
least about 10% alkanes and/or alkenes, such as at least about 20%
alkanes and/or alkenes, such as at least about 30% alkanes and/or
alkenes, such as at least about 40% alkanes and/or alkenes, such as
at least about 50% alkanes and/or alkenes by weight of the
composition after reduction.
[0240] In some typical embodiments, the compositions produced by
the methods described herein comprise one or more alkanes selected
from the group consisting of octane, decane, dodecane, tetradecane,
hexadecane, octadecane, icosane and docosane. In other typical
embodiments, the compositions produced by the methods described
herein comprise one or more alkenes selected from the group
consisting of octane, decene, dodecene, tetradecene, hexadecene,
octadecene, icosene, and docosene.
[0241] In typical embodiments, C12 to C16 alkanes and/or alkenes
comprise at least about 80%, such as at least about 85%, such as at
least about 90%, such as at least about 92%, such as at least about
95%, such as at least about 97%, such as at least about 99% by
weight of the total alkanes and/or alkenes in the composition. In
certain embodiments, C12 to C14 alkanes and/or alkenes comprise
about 80%, such as at least about 85%, such as at least about 90%,
such as at least about 92%, such as at least about 95%, such as at
least about 97%, such as at least about 99% by weight of the total
alkanes and/or alkenes in the composition.
[0242] In certain embodiments, alkanes and/or alkenes having
particular carbon chain lengths can be isolated from longer and/or
shorter alkanes and/or alkenes, for example by HPLC. In certain
embodiments, alkane and/or alkene compositions that are suitable,
e.g., for use in jet fuels, comprise C10 to C14 alkanes and/or
alkenes. In other embodiments, alkane and/or alkene compositions
that are suitable, e.g., for use in diesel fuels comprise alkanes
and/or alkenes that have 16 or more carbons (e.g., C16 or
longer-chain alkanes and/or alkenes).
Ester Compositions
[0243] In certain embodiments, the fatty alcohols are further
processed with a carboxylic acid to form acid esters.
Esterification reactions of fatty alcohols are well-known in the
art. In certain embodiments, the transesterification reaction is
carried out in the presence of a strong catalyst, e.g., a strong
alkaline such as sodium hydroxide. In other embodiments, the
reaction is carried out enzymatically using an enzyme that
catalyzes the conversion of fatty alcohols to acid esters, such as
lipoprotein lipase. See, e.g., Tsujita et al., 1999, J. Biochem.
126(6):1074-1079.
IX. Exemplary Compositions Containing Fatty Alcohols and Fatty
Alcohol Derivatives
Detergent Compositions
[0244] In certain embodiments, the fatty alcohol compositions
described herein and compounds derived there from can be used as
components of detergent compositions. Detergent compositions
containing fatty alcohols produced by the methods of the present
invention include compositions used in cleaning applications,
including, but not limited to, laundry detergents, hand-washing
agents, dishwashing detergents, rinse-aid detergents, household
detergents, and household cleaners, in liquid, gel, granular,
powder, or tablet form. In some embodiments, the fatty alcohol
compositions produced by the methods described above can be used
directly in detergent compositions. In some embodiments, the fatty
alcohols can be reacted with a sulfonic acid group to produce
sulfate derivatives that can be used as components of detergent
compositions. Detergent compositions that can be generated using
the fatty alcohol compositions produced by the methods of the
present invention include, but are not limited to, hair shampoos
and conditioners, carpet shampoos, light-duty household cleaners,
light-duty household detergents, heavy-duty household cleaners, and
heavy-duty household detergents. Detergent compositions generally
include, in addition to fatty alcohols, one or more or of builders
(e.g., sodium carbonate, complexation agents, soap, and zeolites),
enzymes (e.g., a protease, a lipase and an amylases); carboxymethyl
cellulose, optical brighteners, fabric softeners, colourants and
perfumes (e.g., cyclohexyl salicylate).
[0245] In some embodiments, sulfate derivatives derived from the
fatty alcohol compositions are used in products such as hair
shampoos, carpet shampoos, light-duty household cleaners, and
light-duty household detergents. In some embodiments, fatty alcohol
compositions (e.g., C16-C18) produced by the methods described
herein are used in products such as hair shampoos and conditioners.
In some embodiments, sulfate derivatives (e.g., C16-18) derived
from the fatty alcohol compositions are used in products such as
heavy-duty household cleaners and heavy-duty household detergents.
Indeed, it is not intended that the present invention be limited to
any particular detergent, detergent formulation nor detergent
use.
Personal Care Compositions
[0246] In certain embodiments, the fatty alcohol compositions
described herein and compounds derived therefrom are used as
components of personal care compositions. In some embodiments, the
fatty alcohol compositions produced by the methods described above
can be used directly in personal care compositions. Personal care
compositions containing fatty alcohols produced by the methods of
the present invention include compositions used for application to
the body (e.g., for application to the skin, hair, nails, or oral
cavity) for the purposes of grooming, cleaning, beautifying, or
caring for the body, including but not limited to lotions, balms,
creams, gels, serums, cleansers, toners, masks, sunscreens, soaps,
shampoos, conditioners, body washes, styling aids, and cosmetic
compositions (e.g., makeup in liquid, cream, solid, anhydrous, or
pencil form). In some embodiments, the fatty alcohols can be
reacted with a sulfonic acid group to produce sulfate derivatives
that can be used as components of said compositions. Indeed, it is
not intended that the present invention be limited to any
particular formulation, nor use.
[0247] In some embodiments, fatty alcohol compositions (e.g., C12)
produced by the methods described herein are used in products such
as lubricating oils, pharmaceuticals, and as an emollient in
cosmetics. In some embodiments, fatty alcohol compositions (e.g.,
C14) produced by the methods described herein are used in products
such as cosmetics (e.g., cold creams) for its emollient properties.
In some embodiments, fatty alcohol compositions (e.g., C16)
produced by the methods described herein are used in products such
as cosmetics (e.g., skin creams and lotions) as an emollient,
emulsifier, or thickening agent. In some embodiments, fatty alcohol
compositions (e.g., C18) produced by the methods described herein
are used in products such as lubricants, resins, perfumes, and
cosmetics, e.g., as an emollient, emulsifier, or thickening agent.
In some embodiments, sulfate derivatives (e.g., C12 to 14) derived
from the fatty alcohol compositions produced by the methods
described herein are used in products such as toothpastes. Indeed,
it is not intended that the present invention be limited to any
particular formulation, nor use.
Other Compositions
[0248] In some embodiments, fatty alcohol compositions (e.g., C12)
produced by the methods described herein are used in products such
as lubricating oils, pharmaceuticals, and as an emollient in
cosmetics. In some embodiments, fatty alcohol compositions (e.g.,
C14) produced by the methods described herein are used in products
such as cosmetics (e.g., cold creams) for its emollient properties.
In some embodiments, fatty alcohol compositions (e.g., C16)
produced by the methods described herein are used in products such
as cosmetics (e.g., skin creams and lotions) as an emollient,
emulsifier, or thickening agent. In some embodiments, fatty alcohol
compositions (e.g., C18) produced by the methods described herein
are used in products such as lubricants, resins, perfumes, and
cosmetics, e.g., as an emollient, emulsifier, or thickening agent.
In some embodiments, sulfate derivatives (e.g., C12 to 14) derived
from the fatty alcohol compositions produced by the methods
described herein are used in products such as toothpastes.
[0249] In some instances, fatty alcohols (especially cetyl alcohol,
stearyl alcohol and myristyl alcohol) may be used as food additives
(e.g., adjuvants and production aids).
X. Production and Recovery of Far Variants
[0250] In some cases, it will be useful to isolate a FAR variant
polypeptide as described herein. Thus, in another aspect, the
present invention provides a method of making a polypeptide having
improved FAR enzymatic activity, for example, a polypeptide capable
of catalyzing increased production of C12 and C14 fatty alcohols as
compared to wild-type FAR. In some embodiments, the method
comprises: providing a host cell transformed with any one of the
described FAR polynucleotides of the present invention (e.g., a
polynucleotide encoding a FAR variant polypeptide as described
herein); culturing the transformed host cell in a culture medium
under conditions in which the host cell expresses the encoded FAR
variant polypeptide; and optionally recovering or isolating the
expressed FAR variant polypeptide. The method further provides
optionally lysing the transformed host cells after expressing the
encoded FAR variant polypeptide and optionally recovering or
isolating the expressed FAR variant polypeptide from the cell
lysate. The present invention further provides a method of making
an FAR variant polypeptide, said method comprising cultivating a
host cell transformed with a FAR variant polypeptide under
conditions suitable for the production of the FAR variant
polypeptide and recovering the FAR variant polypeptide.
[0251] The FAR variant polypeptide can be recovered from the host
cell using protein recovery techniques that are well known in the
art, including those described herein. Cells are typically
harvested by centrifugation, disrupted by physical or chemical
means, and the resulting crude extract may be retained for further
purification. Microbial cells employed in expression of proteins
can be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell lysing
agents, or other methods, which are well known to those skilled in
the art.
[0252] The resulting polypeptide may be recovered/isolated and
optionally purified by any of a number of methods known in the art.
For example, the polypeptide may be isolated from the nutrient
medium by conventional procedures including, but not limited to,
centrifugation, filtration, extraction, spray-drying, evaporation,
chromatography (e.g., ion exchange, affinity, hydrophobic
interaction, chromatofocusing, and size exclusion), or
precipitation. Protein refolding steps can be used, as desired, in
completing the configuration of the mature protein. Finally, high
performance liquid chromatography (HPLC) can be employed in the
final purification steps. See, for example, Parry et al., 2001,
Biochem. J. 353:117, and Hong et al., 2007, Appl. Microbiol.
Biotechnol. 73:1331, both incorporated herein by reference. In
addition to the references noted supra, a variety of purification
methods are well known in the art, including, for example, those
set forth in Sandana (1997) Bioseparation of Proteins, Academic
Press, Inc.; Bollag et al. (1996) Protein Methods, 2.sup.nd
Edition, Wiley-Liss, NY; Walker (1996) The Protein Protocols
Handbook Humana Press, NJ; Harris and Angal (1990) Protein
Purification Applications: A Practical Approach, IRL Press at
Oxford, Oxford, England; Harris and Angal Protein Purification
Methods: A Practical Approach, IRL Press at Oxford, Oxford,
England; Scopes (1993) Protein Purification: Principles and
Practice 3.sup.rd Edition, Springer Verlag, NY; Janson and Ryden
(1998) Protein Purification: Principles, High Resolution Methods
and Applications, Second Edition, Wiley-VCH, NY; and Walker (1998)
Protein Protocols on CD-ROM, Humana Press, NJ, all of which are
incorporated herein by reference.
XI. Examples
[0253] The following examples are offered to illustrate, but not to
limit the claimed invention.
Example 1
Wild-type M. algicola DG893 FAR Gene Acquisition and Vector
Construction
[0254] Gene acquisition of wild-type M. algicola DG893 FAR ("FAR
Maa") is described in the published application WO/2011/008535. The
genomic sequence of M. algicola DG893 can also be found at GenBank
Accession No. NZ_ABCP01000001.1. The amino acid sequence of the
encoded FAR polypeptide is designated SEQ ID NO:2. A codon
optimized polynucleotide sequence encoding the FAR polypeptide of
SEQ ID NO: 2 is designated SEQ ID NO:1. The M. algicola DG893 FAR
gene and genes encoding variants of the M. algicola DG893 FAR were
cloned into the vector pCK110900 (depicted as FIG. 3 in U.S. Patent
Appln. Pub. 2006/0195947) under the control of a lac promoter, as
described in WO 2011/008535. The resulting plasmids were introduced
into E. coli BW25113, BW25113 .DELTA.fadE, or BW25113 Ltor R (Baba
et al., Molecular Systems Biology, 2006 doi:10,1038/msb4100050
Article No. 2006.0008), W3110-.DELTA.fhuA and MG1655-7740 by
routine transformation methods.
Example 2
Evaluation of FAR Variants Using Microtiter Plate Assays
[0255] FAR variants were screened under several slightly differing
conditions. Variant Nos. 1-144 were grown in 96-well shallow plates
containing 180 .mu.L Luria Bertani (LB) or M9YE medium supplemented
with 1% glucose and 30 .mu.g/mL chloramphenicol (CAM), for
approximately 16-18 hours (overnight) in a shaker-incubator at
30.degree. C., 200 rpm. A 5% inoculum was used in 96-deep-well
plates to initiate fresh 380 .mu.L culture containing 2.times.YT
broth medium supplemented with 30 .mu.g/mL CAM and 0.4% glucose.
Some variants from later rounds of screening were grown in 96-well
shallow plates containing 180 .mu.L M9YE medium supplemented with
1% glucose and 30 .mu.g/mL chloramphenicol (CAM), for approximately
16-18 hours (overnight) in a shaker-incubator at 30.degree. C. or
37.degree. C., 200 rpm. A 5% inoculum was used in 96-deep-well
plates to initiate fresh 380 .mu.L culture containing M9YE broth
medium supplemented with 30 .mu.g/mL CAM and 5% glucose. Other
variants from later rounds of screening were grown in 96-well
shallow plates containing 180 .mu.L M9YE medium supplemented with
1% glucose, 150 mM BisTris pH 7.0, and 100 .mu.g/mL spectinomycin
(SPEC), for approximately 16-18 hours (overnight) in a
shaker-incubator at 30.degree. C. or 37.degree. C., 200 rpm. A 5%
inoculum was used in 96-deep-well plates to initiate fresh 380
.mu.L culture containing M9YE broth medium supplemented with 100
.mu.g/mL SPEC, 5% glucose, and 150 mM BisTris pH 7.0. The culture
was incubated for 2 hours at 30.degree. C. or 37.degree. C., 250
rpm to an OD.sub.600 of 0.6-0.8, at which point expression of the
heterologous FAR gene was induced with
isopropyl-.beta.-D-thiogalactoside (IPTG) (1 mM final
concentration). Incubation was continued for about 24 hours under
the same conditions.
[0256] Cell cultures were extracted with 1 mL of isopropanol:methyl
t-butyl ether (MTBE) (4:6 ratio) for 2 hours. The extracts were
centrifuged and the upper organic phase was transferred into
polypropylene 96-well plates and analyzed by the following GC-FID
method using DB-5MS column (length 30 m, I.D. 0.32 mm, film 0.25
um): start temp. 150.degree. C., increase the temperature at a rate
of 25.degree. C./min to 246.degree. C. and hold for 2.66 min. Total
run time, 6.50 min. Under the above GC conditions the approximate
retention times (min (.+-.0.05 min)) of produced fatty alcohols and
acids were as follows: 2.50, C12:0-OH; 2.79, C12:0-OOH; 3.19,
C14:0-OH; 3.48, C14:0-OOH; 3.18, C14:1-OH; 3.24, C14:0-OH; 3.61,
C15:0-OH; 3.91, C16:1-OH; 3.98, C16:0-OH; 4.15, C16:0-OOMe
(internal standard); 4.21, C16:1-OOH; 4.28, C16:0-OOH; 4.83,
C18:1-OH; 4.92, C18:0-OH; 5.31, C18:0-OOH and 5.51, C18:1-OOH.
Identification of individual fatty alcohol was done by comparison
to commercial standards (Sigma Chemical Company, 6050 Spruce St.
Louis, Mo. 63103).
[0257] Table 1 provides the relative fold improvement (FIOP) in the
proportion of C12 and C14 fatty alcohols in the total fatty
alcohols produced (i.e., the improvement in the percentage of C12
and C14 fatty alcohols in the total fatty alcohol titer) for
illustrative variants relative to wild-type M. algicola DG893 FAR
(SEQ ID NO 2) or a reference FAR variant. For the data shown in
Table 1, the total fatty alcohol titer was determined by first
adding the titers of each fatty alcohol measured (C10:0-OH,
C12:1-OH, C12:0-OH, C13:0-OH, C14:1-OH, C14:0-OH, C15:0-OH,
C16:1-OH, C16:0-OH, C18:1-OH, and C18:0-OH). The percentage of each
fatty alcohol species was then calculated as a percentage of the
total fatty alcohols measured.
[0258] For the data shown in Table 1, codon-optimized SEQ ID NO:1
was mutated and used to express FAR variants. Relative improvement
in the proportion of C12 and C14 fatty alcohol produced is
presented as fold improvement (FIOP) over SEQ ID NO:2 (for Variant
Nos. 1-26); over FAR Variant 26 (for Variant Nos. 27-85); over FAR
Variant 85 (for Variant Nos. 86-92); over FAR Variant 92 (for
Variant Nos. 93-118); or over FAR Variant 118 (for Variant Nos.
119-143) at 30.degree. C. In Table 1, the amino acid substitutions
listed for each variant correspond to residue positions of SEQ ID
NO:2 (e.g., "N134S" means that the residue at position 134 in SEQ
ID NO:2 (asparagine) is substituted with serine), and the amino
acid positions were determined by optimal alignment with SEQ ID
NO:2.
TABLE-US-00001 TABLE 1 Variant FAR polypeptides and relative fold
improvement in proportion of C12 and C14 fatty alcohols produced
FIOP in proportion Variant of C12 and C14 fatty No. Amino acid
substitutions relative to SEQ ID NO: 2 alcohols produced.sup.a 1
A2H ++ 2 E71Q + 3 T246A + 4 A2T + 5 A2Q + 6 Q7N + 7 E137L + 8 A2P +
9 A2W + 10 A2D + 11 G9F + 12 A511R + 13 S331V + 14 A2F + 15 L209T +
16 S74K + 17 A2G + 18 A511G + 19 A443T + 20 P188S + 21 N134R + 22
N134S + 23 N134K + 24 E227G + 25 E138Q + 26 N134S; E138Q; P188S;
A511T ++ 27 N134S; E138Q; P188S; S306W; A511T *** 28 N134S; E138Q;
P188S; E421R; A511T ** 29 N134S; E138Q; P188S; P405L; A511T ** 30
N134S; E138Q; P188S; P405C; A511T ** 31 N134S; E138Q; P188S; P405V;
A511T ** 32 N134S; E138Q; P188S; P405A; A511T ** 33 N134S; E138Q;
P188S; A412V; A511T ** 34 N134R; E138Q; P188S; A511T ** 35 N134K;
E138Q; P188S; A511T ** 36 E138Q; P188S; A511T ** 37 N134S; E138Q;
P188S; G410R; A511T ** 38 N134S; E138Q; P188S; L502S; A511T ** 39
N134S; E138Q; P188S; E421I; A511T ** 40 N134S; E138Q; P188S; P405F;
A511T ** 41 N134S; E138Q; P188S; P405G: A511T ** 42 N134S; E138Q;
P188S; G487Y; A511T * 43 N134S; E138Q; P188S; D429K; A511T * 44
N134S; E138Q; P188S; G401V; A511T * 45 N134S; E138Q; P188S; E421S;
A511T * 46 N134S; E138Q; P188S; E421L; A511T * 47 N134S; E138Q;
P188S; G401L; A511T * 48 N134S; E138Q; P188S; L499S; A511T * 49
N134S; E138Q; P188S; Q418R; A511T * 50 N134S; E138Q; P188S; E303G;
A511T * 51 N134S; E138Q; P188S; Q418V; A511T * 52 N134S; E138Q;
P188S; Q418I; A511T * 53 N134S; E138Q; P188S; E421N; A511T * 54
N134S; E138Q; P188S; E421V; A511T * 55 N134S; E138Q; P188S; A505K;
A511T * 56 N134S; E138Q; P188S; L209N; A511T * 57 N134S; E138Q;
P188S; G401S; A511T * 58 N134S; E138Q; P188S; L502R; A511T * 59
N134S; E138Q; P188S; R508G; A511T * 60 N134S; E138Q; P188S; S433H;
A511T * 61 N134S; E138Q; P188S; A511S * 62 N134S; E138Q; P188S;
A374Y; A511T * 63 N134S; E138Q; S161P; P188S; A511T * 64 N134S;
E138Q; P188S; G401A; A511T * 65 N134S; E138Q; P188S; R508H; A511T *
66 N134S; E138Q; P188S; S433N; A511T * 67 N134S; E138Q; P188S;
L502A; A511T * 68 N134S; E138Q; P188S; L502Q; A511T * 69 N134S;
E138Q; P188S; A416L; A511T * 70 N134S; E138Q; P188S; S433K; A511T *
71 N134S; E138Q; L148E; P188S; A511T * 72 N134S; E138Q; P188S;
Y380R; A511T * 73 E87V; N134S; E138Q; P188S; A511T * 74 N134S;
E138Q; P188S; A409V; A511T * 75 N134S; E138Q; P188S; T430I; A511T *
76 V77I; N134S; E138Q; P188S; A511T * 77 N134S; E138Q; P188S;
Y500N; A511T * 78 N134S; E138Q; Q180R; P188S; A511T * 79 N134S;
E138Q; P188S; V404I; A511T * 80 N134S; E138Q; P188S; E288Q; A511T *
81 N134S; E138Q; P188S; K510D; A511T * 82 N134S; E138Q; P188S;
S433Y; A511T * 83 N134S; E138Q; V185I; P188S; A511T * 84 N134S;
E138Q; P188S; A416V; A511T * 85 N134S; E138Q; P188S; P405V; Q418V;
A511T *** 86 N134S; E138Q; P188S; P405V; Q418R; S433R; A511T
.dagger. 87 N134S; E138Q; P188S; P405V; Q418V; S433R; A511T
.dagger. 88 H61R; N134S; E138Q; P188S; P405V; Q418V; A511T .dagger.
89 N134S; E138Q; P188S; P405V; Q418V; K509H; A511T .dagger. 90
N134S; E138Q; P188S; P405V; Q418V; R508D; A511T .dagger. 91 N134S;
E138Q; P188S; P405V; Q418V; K509D; A511T .dagger. 92 N134S; E138Q;
P188S; P405V; Q418V; S458Q; L502S; .dagger. R508D; K509D; A511T 93
N134S; E138Q; P188S; A389I; P405V; Q418V; S458Q; {circumflex over (
)}{circumflex over ( )}{circumflex over ( )} L502S; R508D; K509D;
A511T 94 N134S; E138Q; P188S; A389M; P405V; Q418V; {circumflex over
( )}{circumflex over ( )} S458Q; L502S; R508D; K509D; A511T 95
N134S; E138Q; P188S; A389L; P405V; Q418V; S458Q; {circumflex over (
)}{circumflex over ( )} L502S; R508D; K509D; A511T 96 N134S; E138Q;
P188S; A389V; P405V; Q418V; S458Q; {circumflex over ( )}{circumflex
over ( )} L502S; R508D; K509D; A511T 97 V104I; N134S; E138Q; P188S;
P405V; Q418V; S458Q; {circumflex over ( )}{circumflex over ( )}
L502S; R508D; K509D; A511T 98 V104M; N134S; E138Q; P188S; P405V;
Q418V; {circumflex over ( )} S458Q; L502S; R508D; K509D; A511T 99
N134S; E138Q; P188S; S283M; P405V; Q418V; {circumflex over ( )}
S458Q; L502S; R508D; K509D; A511T 100 N134S; E138Q; P188S; S283F;
P405V; Q418V; S458Q; {circumflex over ( )} L502S; R508D; K509D;
A511T 101 N134S; E138Q; P188S; S283E; P405V; Q418V; S458Q;
{circumflex over ( )} L502S; R508D; K509D; A511T 102 N134S; E138Q;
P188S; S283T; P405V; Q418V; S458Q; {circumflex over ( )} L502S;
R508D; K509D; A511T 103 N134S; E138Q; P188S; T370I; P405V; Q418V;
S458Q; {circumflex over ( )} L502S; R508D; K509D; A511T 104 N134S;
E138Q; P188S; P405V; Q418V; D429R; {circumflex over ( )} S458Q;
L502S; R508D; K509D; A511T 105 N134S; E138Q; P188S; P405V; Q418V;
D429E; {circumflex over ( )} S458Q; L502S; R508D; K509D; A511T 106
G14V; N134S; E138Q; P188S; P405V; Q418V; S458Q; {circumflex over (
)} L502S; R508D; K509D; A511T 107 N134S; E138Q; P188S; Q377K;
P405V; Q418V; {circumflex over ( )} S458Q; L502S; R508D; K509D;
A511T 108 N134S; E138Q; P188S; S244A; P405V; M413R; {circumflex
over ( )} Q418V; S458Q; L502S; R508D; K509D; A511T 109 N134S;
E138Q; P188S; S244P; P405V; Q418V; S458Q; {circumflex over ( )}
L502S; R508D; K509D; A511T 110 N134S; E138Q; P188S; P405V; Q418V;
R432C; {circumflex over ( )} S458Q; L502S; R508D; K509D; A511T 111
N134S; E138Q; P188S; P405V; Q418V; S458Q; L502S; {circumflex over (
)} R508D; K509D; A511T 112 L69E; N134S; E138Q; P188S; P405V; Q418V;
S458Q; {circumflex over ( )} L502S; R508D; K509D; A511T 113 G14R;
N134S; E138Q; P188S; P405V; Q418V; S458Q; {circumflex over ( )}
L502S; R508D; K509D; A511T 114 N134S; E138Q; P188S; D376P; P405V;
Q418V; {circumflex over ( )} S458Q; L502S; R508D; K509D; A511T 115
N134S; E138Q; P188S; P405V; Q418V; S458Q; {circumflex over ( )}
Q474R; L502S; R508D; K509D; A511T 116 N134S; E138Q; P188S; P405V;
Q418V; S458Q; {circumflex over ( )} V466Q; L502S; R508D; K509D;
A511T 117 L69Q; N134S; E138Q; P188S; P405V; Q418V; S458Q;
{circumflex over ( )} L502S; R508D; K509D; A511T 118 N134S; E138Q;
P188S; P405V; Q418V; S433K; S458Q; {circumflex over ( )}{circumflex
over ( )}{circumflex over ( )} L502S; R508D; K509D; A511T 119
N134S; E138Q; P188S; P405V; M365N; Q418V; # S433K; S458Q; L502S;
R508D; K509D; A511T 120 N134S; E138Q; P188S; P405V; Q418I; S433K;
S458Q; # L502S; R508D; K509D; A511T 121 H98P; N134S; E138Q; P188S;
P405V; Q418V; S433K; # S458Q; L502S; R508D; K509D; A511T 122 N134S;
E138Q; P188S; P405V; Q418V; R432Q; # S433K; S458Q; L502S; R508D;
K509D; A511T 123 T91R; N134S; E138Q; P188S; P405V; Q418V; S433K; #
S458Q; L502S; R508D; K509D; A511T 124 N134S; E138Q; V1531; P188S;
P405V; Q418V; S433K; # S458Q; L502S; R508D; K509D; A511T 125 N134S;
E138Q; P188S; P405V; Q418V; S433K; S458Q; ## G487R; L502S; R508D;
K509D; A511T 126 N134S; E138Q; P188S; K224R; P405V; Q418V; S433K; #
S458Q; L502S; R508D; K509D; A511T 127 N134S; E138Q; P188S; P405V;
Q418V; T430H; S433K; # S458Q; L502S; R508D; K509D; A511T 128 N134S;
E138Q; P188S; V398Y; P405V; Q418V; S433K; # S458Q; L502S; R508D;
K509D; A511T 129 Q18I; R65G; N128H; N134S; E138Q; N177T; P188S; ##
K224R; L226M; P405V; Q418V; S433K; S458Q; G487R; L502S; R508D;
K509D; A511T 130 N134S; E138Q; P188S; G401C; P405V; Q418V; # S433K;
S458Q; L502S; R508D; K509D; A511T 131 N134S; E138Q; P188S; P405V;
Q418V; S433K; S452N; # S458Q; L502S; R508D; K509D; A511T 132 N134S;
E138Q; P188S; P405V; Q418V; E421P; S433K; # S458Q; L502S; R508D;
K509D; A511T 133 N134S; E138Q; P188S; P405V; L406Y; Q418V; S433K;
## S458Q; L502S; R508D; K509D; A511T 134 N134S; E138Q; P188S;
G351C; P405V; Q418V; # S433K; S458Q; L502S; R508D; K509D; A511T 135
N128H; N134S; E138Q; P188S; P405V; Q418V; S433K; ## S458Q; L502S;
R508D; K509D; A511T 136 N134S; E138Q; P188S; P405V; A409Y; Q418V;
S433K; # S458Q; L502S; R508D; K509D; A511T 137 R65G; N134S; E138Q;
P188S; P405V; Q418V; S433K; # S458Q; L502S; R508D; K509D; A511T 138
N134S; E138Q; P188S; P405V; Q418V; S433K; S458Q; ## L502S; R508D;
K509D; A511K 139 N134S; E138Q; P188S; V207L; P405V; Q418V; S433K; #
S458Q; L502S; R508D; K509D; A511T 140 N134S; E138Q; P188S; P405V;
A409W; Q418V; # S433K; S458Q; L502S; R508D; K509D; A511T 141 N134S;
E138Q; P188I; P405V; Q418V; S433K; S458Q; # L502S; R508D; K509D;
A511T 142 N134S; E138Q; P188S; P405V; Q418V; S433K; S452G; # S458Q;
L502S; R508D; K509D; A511T 143 N134S; E138Q; P188S; P405V; G410H;
Q418V; # S433K; S458Q; L502S; R508D; K509D; A511T .sup.aFatty
alcohols measured for the relative fold improvement include: C12:1
(cis .DELTA..sup.5-1-dodecenol), C12:0 (1-dodecanol), C14:1 (cis
.DELTA..sup.7-1-tetradecanol), and C14:0 (1-tetradecanol). + = 1.0
to 1.5 fold improvement over wild-type M. algicola FAR ++ = 1.6 to
2.0 fold improvement over wild-type M. algicola FAR * = 1.0 to 1.5
fold improvement over Variant No. 26 ** = 1.6 to 2.0 fold
improvement over Variant No. 26 *** = >2.0 fold improvement over
Variant No. 26 .dagger. = 1.0 to 1.5 fold improvement over Variant
No. 85 {circumflex over ( )} = 0.5 to 1.0 fold improvement over
Variant No. 92 {circumflex over ( )}{circumflex over ( )} = >1.0
to 2.0 fold improvement over Variant No. 92 {circumflex over (
)}{circumflex over ( )}{circumflex over ( )} = >2.0 fold
improvement over Variant No. 92 # = 0.5 to 1.0 fold improvement
over Variant No. 118 ## = >1.0 fold improvement over Variant No.
118
[0259] Table 2 provides the amount by percentage of C12 and C14
fatty alcohols in the total fatty alcohol titer (as measured in
g/L) and the relative fold improvement (FIOP) in the proportion of
C12 and C14 fatty alcohols in the total fatty alcohols produced
(i.e., the improvement in the percentage of C12 and C14 fatty
alcohols in the total fatty alcohol titer) for illustrative
variants relative to Variant No. 129 (SEQ ID NO:10) at 30.degree.
C. Fatty alcohols were measured, and the proportion of each fatty
alcohol species was determined, as described above for Table 1. In
Table 2, the amino acid substitutions listed for each variant
correspond to residue positions of SEQ ID NO:10. Variants were
screened as described above. For the variants illustrated in Table
2, the titer (in g/L) of C12 and C14 fatty alcohols produced was
measured to be in the range of 0.58 to 1.72 g/L. The relative fold
improvement in the proportion of C12 and C14 fatty alcohols
produced, relative to SEQ ID NO:10, ranged from 0.4-fold to
1.2-fold.
TABLE-US-00002 TABLE 2 Variant FAR polypeptides and the % of C12
and C14 fatty alcohol production and relative improvement in
proportion of C12 and C14 fatty alcohols produced FIOP in
proportion Variant % C12 of C12 and C14 fatty No. Amino Acid
Substitutions Relative to SEQ ID NO: 10 and C14 alcohols produced
144 G65R, S266A, R382H, A389M, G401V 41 ++ 145 G65R, S266A, A389M,
A412V 41 ++ 146 G65R, S266A, A389M, A412V, T511K 39 ++ 147 G65R,
S266A, A389M, G401V, A412V, T511K 40 ++ 148 G65R, S266A, A389M,
G401V, T511K 40 ++ 149 G65R, S266A, A389M, G401V, A412V 40 ++ 150
I18Q, S74P, S266A, G410R, A505K 38 ++ 151 S306W, V405C, E421G,
R487Y 40 ++ 152 I18Q, S74P, S266A, T370I, G410R 38 ++ 153 I18Q,
S74P, S266A, T370I, G410R, A505K 36 ++ 154 S266A, G401V 36 ++ 155
V104I, V405C 36 ++ 156 I18Q, S266A, T370I, G410R 35 + 157 S74P,
S266A, T370I 37 ++ 158 G65R, S266A, G401V, T511K 32 + 159 I18Q,
S74P, S266A, T370I 34 + 160 S74P, S266A, T370I, G410R, A505K 38 ++
161 I18Q, V104I, S134R, S306W, V405C, E421G 36 ++ 162 I18Q, S74P,
S266A, G410R, E421S, A505K 36 ++ 163 I18Q, V104I, S134R, S306W,
V405C, E421G, R487Y 36 ++ 164 S266A, A389M, A412V, T511K 38 ++ 165
I18Q, V104I, S306W, V405L, E421R, R487Y 38 ++ 166 I18Q, V104I,
S134K, S306W, V405C, R487Y 35 + 167 A412V, D429K, L499R 33 + 168
I18Q, S74P, S266A, T370I, A505K 32 + 169 S74P, S266A, A505K 35 ++
170 S134K, S306W, V405L 35 + 171 2G65R, S266A 30 + 172 18Q, V104I,
S134K, S306W, V405L 34 + 173 I18L, S74P, S266A, T370I, E421R, A505K
36 ++ 174 V77I, T246A, A374Y, V405A, R487G, D508G 31 + 175 I18Q,
V104I, S306W, V405L 34 + 176 S266A, A389M 38 ++ 177 V77I, T246A,
V405A, R487G, D508G 31 + 178 I18Q, S74P, S266A, T370I, G410R,
E421S, A505K 33 + 179 I18Q, V104I, S134R, S306W, V405C 33 + 180
H61R, V77I, T246V, V405C, D508G 34 + 181 T246A, A374Y, V405A,
R487G, D508G 30 + 182 I18Q, V1041, S134R, S306W, V405C, E421R,
R487Y 34 + 183 I18Q, S266A, T370I, G410R, E421S, A505K 35 + 184
I18Q, S74P, S266A, T370I, E421R, A505K 35 + 185 I18Q, S266A, T370I,
G410R, A505K 32 + 186 I18Q, S134R, S306W, V405C 31 + 187 S161P,
S283F, A412V, D429K, L499R 30 + 188 I18Q, S74P, S266A, T370I,
E421S, A505K 32 + 189 E71Q, E137L, S161P, S283F, A412V, L499R 27 +
190 H61R, T246A, V405A, R487G, D508G 27 + 191 I18Q, S74P, S266A,
T370I, R382H, G410R, S502W, A505K 26 + 192 I18Q, S306W, V398Y,
V405C, E421R 42 ++ 193 E71Q, E137L, S161P, S283F, L499S 26 + 194
V104I, S134R, S306W, V405C, R487Y 30 + 195 E71Q, E137L, S161P,
S283F, D429K, L499S 26 + 196 S266A, A389M, G401V, A412V, T511K 34 +
197 H61R, T246A, A374Y, V405C, R487G, D508G 24 + 198 I18Q, V104I,
S134K, S306W, V398Y, V405C, E421R 39 ++ 199 E71Q, E137L, S161P,
S283F, Y380R, A412V, D429R 25 + 200 E71Q, E137L, S161P, S283F,
Y380R, A412V, Y446F, L499R 21 + * % value rounded to the nearest
unit. + = .ltoreq.1.0 fold improvement over Variant No. 129 ++ =
>1.0 fold improvement over Variant No. 129
Example 3
Chain Length Profile of Fatty Alcohols Exhibited by Representative
FAR Variants
[0260] The chain length profile of a subset of FAR variants was
evaluated. Table 3 provides the relative chain length distribution
of fatty alcohols exhibited by recombinant E. coli strains
expressing wild-type FAR Maa or FAR variants when cultured at
30.degree. C. As described above for Example 2, the total fatty
alcohol titer was determined by adding the titers of each fatty
alcohol measured (C10:0-OH, C12:1-OH, C12:0-OH, C13:0-OH, C14:1-OH,
C14:0-OH, C15:-OH, C16:1-OH, C16:0-OH, C18:1-OH, and C18:0-OH). The
percentage of each fatty alcohol species was then calculated as a
percentage of the total fatty alcohols measured.
TABLE-US-00003 TABLE 3 Relative chain length distribution of fatty
alcohols FAR Variant Relative Chain Length Distribution of fatty
alcohols.sup.a No. C12:0 C14:0 C14:1 C16:1 C16:0 C18:1 Wild-type 0
3 0 10 36 51 (SEQ ID NO: 2) Variant 0 4 0 23 31 42 26 Variant 0 9 0
37 28 26 85 Variant 0 9 0 28 38 25 92 Variant 0 19 0 40 31 10 118
Variant 1 29 4 52 12 3 129 .sup.aThe relative chain length
distribution is expressed as a percentage of the total fatty
alcohols (g/L) detected via GC-FID. Fatty alcohols include: C12:0
(1-dedecanol), C14:1 (cis .DELTA..sup.7-1-tetradecanol), C14:0
(1-tetradecanol), C16:1 (cis .DELTA..sup.9-1-hexadecenol), C16:0
(1-hexadecanol), and C18:1 (cis .DELTA..sup.11-1-octadecenol).
Example 4
Evaluation of FAR Variants with Improved Activity Using
Fermentors
[0261] In an aerated, agitated stirred tank 10 L fermentor, 3.0 L
of growth medium containing 33.85 g 5.times.M9 powder (BD Difco), 6
g Bacto yeast extract (BD), 3 g ammonium phosphate dibasic
(Sigma-Aldrich), 15 g ammonium sulfate (EMD), 9 g glucose (Sigma),
1.48 g magnesium sulfate, heptahydrate (Sigma), 44 mg Calcium
chloride, Dihydrate (Sigma), 15 ml trace elements solution, 12.6 mg
EDTA (Sigma-Aldrich), 150 mg Fe(III) Citrate (Sigma), 6.75 mg
Thiarnine.HCl (Sigma), and 90 .mu.g chloroamphenicol (Sigma
Chemical Co.) was brought to a temperature of 30.degree. C. or
37.degree. C. The fermentor is inoculated with a culture of E. coli
strain containing FAR variants to a starting optical density
(OD.sub.600) of about 1.0. The inoculum was grown in a 1000 mL
baffled shake flask containing 200 ml of 47.6 g/L terrific broth
powder (Difco), 4 ml/L glycerol (Sigma), and 30 .mu.g/ml
chloroamphenicol (Sigma Chemical Co.) at 30.degree. C. or
37.degree. C., 250 rpm until the OD600 reached .about.8.0-10.0. The
fermentor was agitated at 300-1200 rpm and air supplied at 3.0
L/min to maintain a minimum dissolved oxygen level of 30% of
saturation. The pH of the culture was controlled at about 7.0 by
addition of 5 N sodium hydroxide.
[0262] After consumption of the 3 g/L initial glucose, an
exponential fed-batch growth phase was initiated by exponential
addition of feed solution containing 500 g/L glucose (Sigma), 13.06
g/L magnesium sulfate, heptahydrate (Sigma), 100 g/L ammonium
sulfate (EMD), 10 ml/L trace elements solution, 8.4 mg/L EDTA
(Sigma-Aldrich), 100 mg/L Fe(III) Citrate (Sigma), 4.5 mg/L
Thiamine.HCl (Sigma), and 30 .mu.g/L chloroamphenicol (Sigma
Chemical Co.) to the fermentor. After approximately 16 hours of
fed-batch culture, the expression of FAR variants was induced by
the addition of isopropyl-.beta.-D-thiogalactoside (IPTG) (US
Biological) to a final concentration of about 1 mM. Production of
fatty alcohol was maintained by addition of a feed solution
containing 650 g/L glucose (Sigma), 5.6 g/L magnesium sulphate,
heptahydrate (Sigma), 6.5 g/L ammonium sulfate (EMD), 15 ml/L trace
elements solution, 6.3 mg/L EDTA (Sigma-Aldrich), 75 mg/L Fe(III)
Citrate (Sigma), 5.6 mg/L Thiamine.HCl (Sigma), 30 .mu.g/L
chloroamphenicol (Sigma Chemical Co.), and 1 mM IPTG. The culture
was grown for about another 120 hours at 30.degree. C. or
37.degree. C. Samples were taken at various time points for
extraction and analysis. Extraction and quantification of fatty
alcohols was performed as described above in Example 2.
Example 5
Generation of FAR Variants SEQ ID NO:16 and SEQ ID NO:18 and Fatty
Alcohol Production with SEQ ID NOs:16 and 18
[0263] Libraries of saturation mutagenesis of whole protein as well
as combinatorial libraries were created in FAR from M. algicola and
screened in E. coli for fatty alcohol production and chain length
composition via GC-FID. Combinations of amino acid substitutions
were identified that yielded an increased proportion of 1-dodecanol
and 1-tetradecanol in the total fatty alcohol titer compared to
backbone, including the following combinations of substitutions
listed in Table 4:
TABLE-US-00004 TABLE 4 Variant FAR polypeptides and the relative
fold improvement in proportion of C12 and C14 fatty alcohols
produced FIOP in proportion of C12 and C14 FAR Amino acid
substitutions relative fatty alcohols Sequence to SEQ ID NO: 2
produced.sup.a SEQ ID Q7N; Q18I; R65G; N128H; E138Q; N177T; ++ NO:
16 P188S; K224R; L226M; E227G; M365N; G401V; P405V; Q418V; S433K;
S458Q; G487R; L502S; R508D; K509D; A511T SEQ ID Q7N; Q18I; V104I;
N128H; E138Q; N177T; ++ NO: 18 P188S; K224R; L226M; E227G; M365N;
G401V; P405V; G410R; Q418V; S433K; S458Q; G487R; L502S; R508D;
K509D; A511T .sup.aFIOP in % of C12 and C14 for SEQ ID NO: 16 was
measured over Variant 129; FIOP in % of C12 and C14 for SEQ ID NO:
18 was measured over SEQ ID NO: 16. ++ = >1.0 fold improvement
over backbone sequence
[0264] The FAR variant polynucleotide of SEQ ID NO:15, encoding the
FAR variant polypeptide having the amino acid sequence of SEQ ID
NO:16, was introduced into the vector pCDX11 to generate pCDX11-SEQ
ID NO:16. The FAR variant polynucleotide of SEQ ID NO:17, encoding
the FAR variant polypeptide having the amino acid sequence of SEQ
ID NO:18, was introduced into the vector pCDX11 to generate
pCDX11-SEQ ID NO:18. To obtain a tightly regulated expression
vector, the P.sub.TRC promoter present in pLS8379 was replaced with
a synthetic DNA fragment containing a P.sub.TRC variant where a
symmetrical Lac operator (Sadler et al., 1983, PNAS 80:6785-6789)
was introduced upstream of the -35 region of P.sub.TRC. This
promoter was synthesized as an EcoRV-NcoI DNA fragment (GeneScript,
Piscataway, N.J.) (SEQ ID NO:45) and used to replace the EcoRV-NcoI
region from pLS8379 previously cut with the same restriction
enzymes. The DNA sequence of plasmid pLS8379 is provided as SEQ ID
NO:46. A ligation reaction containing the two DNA fragments was
incubated overnight at 16.degree. C. and then transformed into E.
coli Top10 electrocompetent cells (Invitrogen, Carlsbad, Calif.)
following the manufacturer's protocols. Cells were plated onto LB
agar plates containing 100 micrograms/mL of spectinomycin. Places
were then incubated overnight at 37.degree. C. Obtained clones were
sequence verified.
[0265] Recombinant E. coli host strains comprising a plasmid as
specified in Table 5 or Table 6 below were grown in M9YE (Sambrook
et al., (2001) Molecular Cloning: A Laboratory Manual 3.sup.rd Ed
Cold Spring Harbor, N.Y.) medium supplemented with 1% glucose, 2
g/l yeast extract and 100 .mu.g/mL spectinomycin for approximately
16-18 hours (overnight) at 30.degree. C., 200 rpm. A 5% inoculum
was used to initiate fresh M9YE media, 5% glucose and 2 g/l yeast
extract containing 30 30 .mu.g/nL CAM. The culture was incubated in
a shaker for 2.5 hours at 30.degree. C. and at 250 rpm to an
OD.sub.600 of about 0.6 to about 0.8. The expression of the
heterologous FAR was then induced with
isopropyl-.beta.-D-thiogalactoside (IPTG) (1 mM final
concentration). Incubation was continued for about 48 hours under
the same conditions. Fatty acid species including fatty alcohols
were extracted using 1 mL of methyl isobutyl ketone (MIBK) into 500
.mu.l of cell culture, sealed tightly and shaken for .gtoreq.2.5
hr. The extract was centrifuged and analyzed directly by GC-FID. A
1 .mu.L sample was analyzed by GC-FID with the split ratio 1:10
using the following conditions: GC-6890N from Agilent Technologies
equipped with FID detector and HP-5 column (length 30 m, I.D. 0.32
mm, film 0.25 .mu.m). GC method: start at 100.degree. C., increase
the temperature with a rate of 25.degree. C./min to 246.degree. C.
and hold for 1.96 min. Total run time was 7.8 min. Under the above
GC conditions, the approximate retention times (min) of produced
fatty alcohols and acids were as follows: 1.81, C10:0-OH; 2.47,
C12:0-OH; 5.08, C14:0-OH; 5.40, C14:0-OOH; 5.74, C16:1-OH; 5.93,
C16:0-OH; 6.11, C16:0-OOMe (internal standard); 6.16, C16:1-OOH;
6.29, C16:0-OOH; 6.80, C18:1-OH; 6.90, C18:0-OH; and 7.3, C18:0-
and C18:1-OOH. Results of fatty alcohol production (total fatty
alcohol production ("FOH") and the relative percentages of C12,
C14, C16, or C18 fatty alcohols) under these conditions are
depicted in Tables 5-6. Identification of individual fatty alcohols
was determined by comparison to commercial standards (Sigma
Chemical Company, 6050 Spruce St. Louis, Mo. 63103).
TABLE-US-00005 TABLE 5 Fatty Alcohol (FOH) Production in a W3110
.DELTA.fhuA Strain % % % % % Total FOH Plasmids Saturation C12 C14
C16 C18 (g/L)* pCDX11-SEQ ID 65 12 57 30 2 +++ NO: 16 % as measured
by calculating the individual fatty alcohols as part of the sum of
all fatty alcohol measured (C10:0-OH, C12:0-OH, C14:0-OH, C16:1-OH,
C16:0-OH, C18:1-OH, and C18:0-OH). All values were rounded to the
closest unit. CX (wherein X = 12, 14, 16 or 18) denotes both
saturated and unsaturated species. *+++ = .gtoreq.3.0.
TABLE-US-00006 TABLE 6 Fatty Alcohol (FOH) Production in a W3110K
Strain % % % % % Total FOH Plasmids saturation C12 C14 C16 C18
(g/L) pCDX11-SEQ ID 56 13 52 30 2 ++ NO: 18 % as measured by
calculating the individual fatty alcohols as part of the sum of all
fatty alcohol measured (C10:0-OH, C12:0-OH, C14:0-OH, C16:1-OH,
C16:0-OH, C18:1-OH, and C18:0-OH). All values were rounded to the
closest unit. CX (wherein X = 12, 14, 16 or 18) denotes both
saturated and unsaturated species. *++ = 1.0 to <3.0.
Example 6
Evaluation of FAR Variants
[0266] E. coli strains containing M. algicola FAR were grown in
96-well NUNC flat well plates containing 180 .mu.L M9YE medium
supplemented with 1% glucose, 150 mM BisTris pH 7.0, and 100 mg/L
spectinomycin. The plates were incubated for 24 hours at 30.degree.
C., 200 rpm, 2'' throw, and 85% relative humidity. The cells were
diluted by transferring 20 .mu.L of overnight grown culture into
the 96-well CoStar deep well plates containing 400 .mu.L M9YE
supplemented with a total of 5% glucose, 150 mM BisTris pH 7.0, and
100 mg/L spectinomycin. The strains were induced with 1 mM IPTG 6
hours post induction and were incubated for 48 hours at 30.degree.
C., 250 rpm, 2''throw, and 85% relative humidity. Cell cultures
were extracted with 950 .mu.L of methyl isobutyl ketone for 2
hours. The extracts were centrifuged and the upper organic phase
was transferred into polypropylene 96-well plates and analyzed
using GC-FID. A 4 .mu.L sample was analyzed by GC-FID with a split
ratio of 1:10 using the following conditions: GC-6890N from Agilent
Technologies equipped with a FID detector and HP-5 column (length
30 m, I.D. 0.32 mm, film 0.25 um): start temp. 150.degree. C.,
increase the temperature at a rate of 25.degree. C./min to
246.degree. C. and hold for 2.66 min. Total run time, 6.50 min.
Under the above GC conditions the approximate retention times (min
(.+-.0.05 min)) of produced fatty alcohols and acids were as
follows: 2.41, C12:0-OH; 3.04, C14:1.DELTA.7-OH, 3.14; C14:0-OH;
3.53, C15:0-OH; 3.86, C16:1A9-OH, 3.93; C16:0-OH; 4.75,
C18:1A11-OH, 4.85; C18:0-OH. Identification of individual fatty
alcohol was done by comparison to commercial standards (Sigma
Chemical Company, 6050 Spruce St. Louis, Mo. 63103).
[0267] Table 7 provides the relative fold improvement (FIOP) in the
proportion of C12:0 fatty alcohols produced and in the increase in
total fatty alcohol titer for illustrative variants relative to FAR
variant SEQ ID NO:18 at 30.degree. and/or 37.degree. C. In Table 7,
the amino acid substitutions listed for each variant correspond to
residue positions of SEQ ID NO:18.
TABLE-US-00007 TABLE 7 Variant FAR polypeptides and relative fold
improvement in proportion of C12:0 fatty alcohols produced and
total fatty alcohol titer Amino Acid FIOP in FIOP in FIOP in FIOP
in Substitutions proportion total fatty proportion total fatty
Relative to of C12:0- alcohol of C12:0- alcohol Variant SEQ ID OH,
titer, OH, titer, No. NO: 18 30.degree. C. 30.degree. C. 37.degree.
C. 37.degree. C. 201 A2F ++ + ++ + 202 A2H ++ + ++ + 203 A2P ++ +
204 A2R + ++ 205 A2S ++ + 206 A2Y ++ + ++ + 207 Q4N ++ ++ ++ + 208
Q4R ++ + 209 Q4S ++ + ++ + 210 Q4W ++ + ++ + 211 Q4Y ++ + ++ + 212
Q5M ++ + + ++ 213 Q5N + ++ ++ + 214 Q6P ++ ++ ++ + 215 Q6R ++ + ++
+ 216 Q6S ++ + 217 Q6V ++ + 218 Q6Y ++ + ++ + 219 N8V ++ + ++ + 220
G9V + ++ + ++ 221 S11D + ++ + ++ 222 S11G + ++ + + 223 A12D + + +
++ 224 A12R + ++ + ++ 225 A12T + ++ + ++ 226 S13G + ++ 227 S13L + +
+ ++ 228 S13V + + + ++ 229 G14L ++ + ++ + 230 G14M ++ ++ ++ + 231
L16G + + + ++ 232 L16I ++ + ++ + 233 L16S + + + ++ 234 E17C + + +
++ 235 E17H + ++ + ++ 236 E17R + ++ + ++ 237 R20K ++ + ++ + 238
E66D + ++ + ++ 239 E66F + + + ++ 240 E66S + ++ + ++ 241 E66Y + + +
++ 242 F68A + + + ++ 243 F68V + + + ++ 244 L69I + ++ + ++ 245 L69M
+ ++ + ++ 246 L69Q + + + ++ 247 N70D + ++ + ++ 248 N70L + ++ + ++
249 N70M + ++ + ++ 250 N70R + ++ + ++ 251 N70T + ++ + ++ 252 E71C +
+ + ++ 253 E71M + + + ++ 254 E71S + + + ++ 255 I72L + ++ + ++ 256
A73G + ++ + ++ 257 A73H + + + ++ 258 A73K + ++ + ++ 259 A73L + ++ +
++ 260 A73M + + + ++ 261 S74L ++ + 262 S74T + ++ + ++ 263 S74W + +
+ ++ 264 S75C + ++ + ++ 265 S75E + + + ++ 266 S75H + ++ + ++ 267
S75N + ++ + ++ 268 S76E + ++ + ++ 269 S76F + + + ++ 270 S76I + ++ +
++ 271 S76L + + + ++ 272 S76R + + + ++ 273 V77P + + + ++ 274 V77T +
++ + ++ 275 F78M + + + ++ 276 E79D + ++ + ++ 277 E79I + + + ++ 278
E79L + + + ++ 279 E79Q + ++ + ++ 280 E79V + + + ++ 281 R80I + + +
++ 282 R80L + + + ++ 283 L81F + + + ++ 284 L81T + + + ++ 285 A88V +
+ + ++ 286 F89D ++ + 287 F89N ++ + 288 F89P ++ + 289 F89R ++ + 290
E90D + ++ 291 L93D ++ + 292 E103C + + + ++ 293 E103S + + + ++ 294
E103V + + ++ ++ 295 E106A + + + ++ 296 E106H + ++ + ++ 297 R108E ++
+ ++ + 298 P113I + + + ++ 299 H128C + + 300 H128L + + 301 S129D + +
302 A130C + + 303 A130S + + 304 A131P ++ + 305 A131S + + 306 S132H
+ + 307 V133A + + 308 F135E ++ + 309 K144E ++ + ++ + 310 I145E + +
311 I145H + + 312 L148T ++ ++ + ++ 313 L150P ++ + 314 E151G + + +
++ 315 E151V + + + ++ 316 V153F ++ + 317 A154G + + + ++ 318 A154R
++ + ++ + 319 A155M ++ + ++ + 320 A155R + + + ++ 321 A155W + + ++
++ 322 S161Y ++ + ++ + 323 N174A ++ + ++ + 324 K176G ++ + ++ + 325
K176I + + + ++ 326 T177D ++ + + + 327 T177E + + + ++ 328 T177L + +
++ ++ 329 T177R ++ ++ + + 330 S178L + ++ ++ + 331 G179S + ++ 332
G179W ++ + 333 Q180C + ++ + ++ 334 I181D + + + + 335 I181E + + + +
336 I181L + ++ + ++ 337 T182G + + + ++ 338 T182I + + ++ ++ 339
T182K + + + ++ 340 T182R + + + ++ 341 V185G + ++ + + 342 V185P + ++
+ ++ 343 I186H + ++ + + 344 K187P + ++ + + 345 S188D + ++ + ++ 346
S188E + + ++ ++ 347 S188R + ++ ++ + 348 S188W + ++ + ++ 349 A189L +
+ + ++ 350 A189N + ++ + ++ 351 G190I + ++ + + 352 G190K ++ ++ + +
353 G190L + ++ + ++ 354 E191V + ++ ++ + 355 E191W ++ + + ++ 356
I193C + ++ + ++ 357 I193L ++ + + ++ 358 R195F + ++ 359 R195H + ++
360 R195I + ++ 361 R195N ++ ++ 362 R195W + ++ 363 S196D + ++ 364
T197F + ++ 365 D198S ++ ++ 366 L206C ++ ++ 367 V207M + ++ 368 L209Y
+ ++ 369 Q211H ++ ++ 370 Q211L + ++ 371 Q211N ++ ++ 372 D212F ++ ++
373 D216G ++ ++ 374 D216Q ++ ++ 375 K218R ++ ++ 376 R220A ++ ++ 377
R220H ++ ++ 378 V225C + ++ 379 V225M + ++ 380 K228H + ++ 381 I235E
+ ++ 382 N239C + ++ 383 N240Q ++ ++ 384 N240T + ++ 385 Y241F ++ ++
386 S244R + ++ 387 G264R ++ ++ 388 L267H + ++ 389 T268N + ++ + ++
390 I275V + ++ 391 S277A + ++ 392 A278C + ++ 393 E280I + ++ 394
E281S + ++ 395 E281Y + ++ 396 P284C + ++ 397 P284Q + ++ 398 W286Y +
++ 399 E288D + + + + 400 E288H + ++ 401 F308I ++ + 402 G310L ++ +
403 S313Q ++ + + + 404 I316L ++ + 405 V318F ++ + ++ + 406 V318L ++
+ ++ + 407 V318M ++ + 408 I355F ++ + ++ + 409 I355L ++ + ++ + 410
I355W ++ + 411 I361C ++ + ++ + 412 I361F ++ + ++ + 413 I361L ++ +
++ + 414 D362L + ++ + ++ 415 A373W ++ ++ ++ ++ 416 D376K + ++ + ++
417 D376P + ++ + ++ 418 D376R + ++ + ++ 419 F387I ++ + 420 F387L ++
+ 421 V401T + ++ 422 R487G ++ + 423 L489F ++ + 424 N490C ++ + 425
R491M ++ ++ 426 L494Y + ++ 427 K495C + ++ 428 K495S + ++ 429 E496G
+ ++ 430 K498G ++ + 431 S501W ++ + 432 S502A ++ + 433 R503C + ++
434 A504D ++ + 435 A504E + ++ 436 A504S ++ + 437 A505G ++ + 438
A505E ++ + 439 D506L ++ + 440 D506M ++ +
441 D506R ++ + 442 D506W ++ + 443 T507H ++ + 444 D508L + ++ 445
D508M ++ + 446 D509P ++ + 447 D509Q ++ + 448 D509R ++ + 449 K510D +
++ 450 K510E + ++ 451 K510L + ++ 452 K510M ++ + 453 K510N + ++ 454
K510R ++ + 455 K510S + ++ 456 T511D + ++ 457 T511I + ++ 458 T511S +
++ 459 A512M + ++ 460 A512R + ++ + = up to 1.0 fold improvement
over FAR variant SEQ ID NO: 18 ++ = >1.0 fold improvement over
FAR variant SEQ ID NO: 18
[0268] Table 8 provides the relative fold improvement (FIOP) in the
proportion of C12:0 fatty alcohols produced and in the increase in
total fatty alcohol titer for illustrative variants relative to FAR
Variant No. 405 (SEQ ID NO:20) at 30.degree. C. (for Variant Nos.
461-781) or at 37.degree. C. (for Variant Nos. 782-864). In Table
8, the amino acid substitutions listed for each variant correspond
to residue positions of SEQ ID NO:20.
TABLE-US-00008 TABLE 8 Variant FAR polypeptides and relative fold
improvement in proportion of C12:0 fatty alcohols produced and
total fatty alcohol titer FIOP in FIOP in total Variant Amino Acid
Substitutions Relative to SEQ ID proportion of fatty alcohol No.
NO: 20 C12:0-OH titer 461 S178F; I316L; I361F; N490C; S502A ++ +
462 A155T; F308I; I355F; R491M; D506M ++ + 463 A155T; F308I; I355L;
L489F; A505G; D506M; T507H ++ + 464 I316L; I361F; N490C; S502A ++ +
465 V15I; I316L; I361F; N490C; S502A ++ + 466 Q4Y; G14L; K144E;
A154R; I316L; F387L; D508M ++ + 467 Q6Y; N8V; S74L; R108H; D198S;
I355L; A504D ++ + 468 Q6V; R108H; D198S; R220H; I355L; A504D ++ +
469 Q4W; G14L; K144E; S178F; I316L; I361F; N490C; S502A ++ + 470
S178F; A189N; I361F; E496G; K510S ++ + 471 M1G; F308I; I355L;
L489F; A505G ++ + 472 S75N; I361F ++ ++ 473 S178F; I316L; I361F;
S502A; K510R ++ + 474 V15I; K144E; I316L; F387L; D508M ++ + 475
I361F; N490C; S502A ++ + 476 Q6S; R108E; D198S; R220H; I355L; A504D
++ + 477 I361F; L489F ++ + 478 V15I; F387L; D508M ++ + 479 S178F;
I361F ++ + 480 G14L; S178F; I361F ++ + 481 A155T; F308I; I355L;
R491M ++ + 482 N8V; S74L; D198S; R220H; I355L; A504S ++ + 483
S178F; A189N; I361F; R410H ++ ++ 484 S75N; E151G; A189N; F308I;
I361C ++ + 485 A189N; I361F; K498G; K510E ++ ++ 486 F308I; R491M ++
+ 487 A155T; F308I; I355F; D506M; T507H ++ + 488 A155T; F308I;
I355F; R491M ++ + 489 Q4W; G14L; K144E; I316L; I361F; N490C ++ +
490 N8V; S74L; R108H; D198S; I355L; A504D ++ + 491 I361F; K498G;
K510S ++ + 492 Q4R; G14L; K144E; I166M; I316L; F387L; D508M ++ +
493 M1G; S178F; I316L; I361F; N490C; K498N; S502A ++ + 494 A155T;
I361F; E496G; K498G; K510R ++ ++ 495 I275V; F308I; I361C ++ + 496
A155T; F308I; I355L; T507H ++ + 497 S75N; R108H; A189N; I361F;
L489F ++ + 498 S75N; A155T; R195W; G310L; I316L; I355F; I361C ++ +
499 A155T; F308I; I355L; L489F; S501W ++ + 500 R108H; R220H; I355L;
A504D ++ + 501 S178F; A189N; I361F; Y380H; E496G; K498G; D506M ++ +
502 A155T; F308I; I355F; R491M; S501W ++ + 503 Q6P; S74L; D198S;
R220H; I355L; A504D ++ + 504 Q4N; G14L; K144E; G179D; D508M ++ +
505 K144E; I316L; F387L; D508M ++ + 506 S75N; R108H; R195W; V225M;
F308I; I361F ++ + 507 A155T; S178F; A189N; I361F; K498G; K510S ++ +
508 S178F; I361F; N490C; S502A ++ + 509 A155T; A189N; I361F; E496G
++ ++ 510 A155T; F308I; I355F; S501W ++ + 511 Q4Y; G14L; G179D;
F387L; D508M ++ + 512 A155T; S178F; A189N; I361F; E496G; K510S ++ +
513 R108H; F308I; I361F; L489F ++ + 514 A155T; S178F; I361F; K498G
++ + 515 S178F; A189N; I361F; E496G; K510E ++ + 516 F308I; I355L;
L489F ++ + 517 G14L; S178F; I316L; I361F; N490C ++ ++ 518 Q6P; N8E;
S74L; D198S; R220H; I355L; A504D ++ + 519 S178F; I316L; I361F;
N490C ++ + 520 A155T; S178F; A189N; I361F ++ + 521 S178F; I316L;
I361F; N490C; K498G ++ + 522 A155T; A189N; I361F; Y380H; E496G;
D506M; K510E ++ ++ 523 S75N; R108H; R195W; I316L; I361F; L489F ++ +
524 A155T; A189N; I361F; E496G; K510E ++ ++ 525 S74L; R108H; D198S;
R220H; I355L; A504D ++ + 526 S75N; R108H; A189N; V225M; F308I;
I355F ++ + 527 A155T; F308I; I355L ++ + 528 D198S; I355L; A504D ++
+ 529 A2G; S75N; A155T; I275V; F308I; I361F ++ + 530 S178F; I361F;
K498G ++ ++ 531 A155T; F308I; R491M; A505G ++ + 532 K144E; F387L;
D508M ++ + 533 A155T; F308I; I355F; S501W; A505G ++ + 534 A155T;
S178F; A189N; I361F; K498G; D506M; K510E ++ + 535 R195W; F308I;
I355L; L489F ++ + 536 A155T; S178F; A189N; I361F; E496G; K498G;
K510E ++ + 537 S178F; G310L; I361F; N490C; S502A ++ + 538 A155T;
F308I; I355L; L489F ++ + 539 S75N; R108H; E151G; I355L; L489F ++ +
540 A155T; S178F; A189N; I361F; E496G; K510E ++ + 541 S75N; R108H;
A155T; F308I; I355L; I361C; L489F ++ + 542 G14L; G310L; I361C ++ +
543 I316L; F387L; D508M ++ + 544 Q6P; A504D ++ + 545 I361F; E496G;
K510E ++ ++ 546 A155T; S178F; A189N; I361F; E496G; K498G ++ + 547
A155T; S178F; A189N; I361F; E496G ++ + 548 M1G; A155T; F308I;
I355L; L489F; T507H ++ + 549 R108H; F387L ++ + 550 Q6P; R108E;
S161Y; D198S; R220H; I355L; A504D ++ + 551 Q6C; D47E; S74L; R108H;
S161Y; D198S; A504D ++ + 552 S178F; I361F; E496G; K498G ++ ++ 553
F308I; I355W; R491M; D506M ++ + 554 K144E; R220H; I316L; I361C;
N490C ++ + 555 R108H; E191V; F387L ++ + 556 R108H; D198S; R220H;
I355L ++ + 557 S75N; V225M; F308I; I361L ++ + 558 G14L; K144E;
I166M; G179D; F387L ++ + 559 A155T; S178F; A189N; I361F; K498G;
K510E ++ + 560 A155T; S178F; A189N; I361F; Y380H; E496G; K498G;
K510E ++ + 561 Q6S; S74L; R108H; L148K; D198S; R220H; I355L; A504D
++ + 562 T268N ++ + 563 A155T; F308I; I355W; L489F ++ + 564 N490C;
S502A ++ + 565 R108H; E151G; I275V; F308I; I361L ++ + 566 Q4R;
G14L; K144E; G179D ++ + 567 G14L; R20K; R220H; G310L; I316L; I361F;
K498G ++ + 568 G14L; D47N; I316L; F387L; D508M ++ + 569 K498G;
S502A ++ + 570 S75N; R108H; A155T; F308I; I361F ++ + 571 Q6V;
R220H; I355W; A504S ++ + 572 F387L ++ + 573 S75N; R108H; A189N;
G310L; I355F ++ + 574 Q6C; N8V; D47N; S74L; R108H; R220H ++ ++ 575
Q6C; N8V; S74L; R108H; R220H ++ + 576 S75N; R108H; E151G; A189N;
I275V; F308I; I361C ++ ++ 577 M1V; S161Y; S178F; I316L; I361F ++ +
578 S178F; I361F; K510S ++ + 579 G14L; K144E; G179D; I316L; F387L
++ + 580 S178F; G310L; I361F; N490C ++ + 581 K144E; I316L ++ + 582
Q4W; K144E; S178F; I316L; I361C; N490C ++ + 583 K144E; I166M;
I316L; F387L ++ + 584 Q6S; S74P; R108Q; L148K; R220H; A504S ++ +
585 G310L; I361F ++ ++ 586 G14L; K144E; S178F; G310L; I361C ++ ++
587 A155M; S178F; I316L; I361F; N490C; S502A ++ + 588 K144E; D508M
++ + 589 A155T; S178F; A189N; E496G; K498G; K510S ++ + 590 S178F;
I316L; I361C; N490C; S502A ++ + 591 K144E; A154R; I316L; F387L ++ +
592 N8V; R108H; R220H; I355W; A504D ++ + 593 S75N; R108H; A189N;
I275V; F308I; L489F ++ + 594 R108H; E191V ++ ++ 595 R108H; E151G;
R195W; V225M; I275V; I316L; I355F; L489F ++ + 596 K144E; I166M;
F387L; D508M ++ + 597 I316L ++ + 598 Q4S; K144E; A154R; I166M;
D508M ++ + 599 S178F; I316L; I361F; N490C; K510R ++ + 600 I166M;
I316L; D508M ++ + 601 S75N; R108H; E151G; I275V; I361C ++ + 602
G285D; T430A ++ + 603 L148K; D198S; I355W; A504D ++ + 604 R108H;
S178F; E191V; ++ ++ 605 V15I; K144E; A154R; I166M; G179D; I316L;
F387L; D508M + + 606 R108H + ++ 607 A155T; F308I; I355F; L489F;
D506M + + 608 G14L; I166M; I316L; F387L; D508M + + 609 K144E;
G179D; I316L; F387L; D508M + + 610 Q6V; N8V; R108E; L148K; S161Y;
R220H; I355L; A504D + + 611 Q4N; K144E; G179D; T511P + + 612 S75N;
R108H; S178F; A189N; V225M; F308I; I361C + + 613 V15I; A154R;
I316L; F387L + ++ 614 S178F; G310L; I316L; I361C; N490C; S502A + +
615 V15I; K144E; G179D; I316L; F387L; D508M + + 616 S75N; R108H;
E151G; R195W; G310L; I355L; L489F + + 617 N8V; R108H; D198S; R220H;
I355W; A504S + + 618 S75N; R108H; A155T; S178F; R195W; V225M;
F308I; I361C + + 619 S75N; K144E; I166M; F387L + + 620 R108H;
A154R; E191V + + 621 S178F; A189N; K498G; K510E + + 622 A155T;
S178F; A189N + + 623 S74L; R108H; L148K; S161Y; I355L; A504D + +
624 S75N; R108H; E151G; A189N; I275V; F308I; I361L + + 625 R108H;
A155T; I316L; I361C; L489F + + 626 K144E; S178F; I316L; I361L;
N490C; S502A + + 627 R108H; I166M; F387L + + 628 S75N; R108H;
A155T; R195W; V225M; I316L; I361C + + 629 I166M; I316L; F387L;
D508M + + 630 A154R; F387L + + 631 E151G; R195W; I275V + + 632
R108Q; S161Y; D198N; I355S; A504D + + 633 R108H; A155M; S178F + +
634 K144E; G179D; D508M + ++ 635 S74L; R108H; L148K; D198S; R220H;
I355L; A504S + + 636 K144E; A154R; I166M; D508M + + 637 S178F;
I316L; I361C; N490C + + 638 A155T + + 639 S178F; G310V; I361F;
N490C + + 640 G14L; G179D; I316L + + 641 S75N; R108H; E151G; A155T;
S178F; V225M; I275V + + 642 Q6V; N8V; S74L; R108E; L148K; S161Y;
D198S; R220H; I355L; + + A504D 643 I166M; F387L + + 644 G14L;
A155M; S161Y; I361C; N490C + + 645 G14L; K144E; S178F; G310L;
I361F; S502A + + 646 K144E; A154R; G179D; I316L; F387L; D508M + +
647 M1W; S74L; R108E; L148K; S161Y; D198S; R220H; I355L; + + A504D
648 S75N; R108H; R195W; I361L + + 649 S178F; I316L; I361L; N490C;
S502A + + 650 S75N; R108H; A155T; F308I; I355F + + 651 G14L; K144E;
S178F; R220H; G310L; N490C + + 652 S74L; R108E; L148K; S161Y;
D198S; R220H; I355L; A504D + + 653 S75N; E151G; R195W; V225M;
I275V; F308I; I361L + + 654 Q6V; R108E; D198S; I355W; A504D + + 655
R108H; E151G; A189N; I275V; G310L; I361C + ++ 656 G14L; K144E;
S178F; G310L; I361C; N490C; S501F; T511S + + 657 A155T; F308I;
I355F; L489F + + 658 I355W; A504D + + 659 K144E; I166M; D508M + +
660 S75N; R108H; V225M; I275V; I361L + + 661 Q6P; S74L; L148K;
S161Y; D198S; R220H; I355L; A504D + + 662 R108H; A155T; S178F + +
663 S75N; E151G; R195W; G310L; I361F + + 664 G14L; K144E; I166M;
G179D; I316L; F387L; D508M + + 665 I166M; E191V + ++ 666 M1V;
A155T; F308I; I355F; L489F; T507H + + 667 R220H; I355L; A504D + ++
668 S75N; R108H; A155T; V225M; I275V; I361C + ++ 669 S75N; R108H;
R195W; I275V; G310L + + 670 S178F; I316L; I361L; N490C + + 671
R108H; I166M + + 672 R108H; I275V; I361L + ++ 673 V15I; I166M;
I316L; D508M + + 674 Q6P; R108E; L148K; S161Y; D198S; R220H; I355L;
A504D + + 675 G14L; K144E; A155M; S178F; R220H; G310L; I361F;
K498G; + + S502A 676 Q6Y; R108H; D198S; R220H; I355W; A504D + + 677
S178F; G310V; I316L; I361C; N490C + + 678 Q6V; D198S; R220H; I355W;
A504D + + 679 Q4R; G14L; K144E; I166M; G179D; I316L; F387L; D508M +
+ 680 S178F; G310L; I361C; S502A + + 681 E496G + ++ 682 I166M;
S178F + + 683 S75N; R108H; A155T; A189N; V225M; I275V; I361C + +
684 Q4S; A155M; S178F; G310L; S502A + + 685 Q6Y; N8V; S74L; R108E;
D198S; R220H; I355W; A504D + + 686 S178F; G310L; I361L; N490C;
S502A + + 687 S75N; E151G; R195W; V225M; G310L; I361C; L489F + +
688 S75N; E151G; I275V; I361L + ++ 689 K144E; I166M + ++ 690 M1W;
R220H; I355W; A504D + + 691 R491M + + 692 K144E; A154R; G179D;
I316L; D508M + + 693 Q4W; S178F; R220H; I316L; I361L + ++ 694 N8V;
R108E; S161Y; D198S; R220H; I355W; A504D + + 695 K144E; G179D;
I316L + ++ 696 S75N; E151G; S178F; A189N; V225M; I275V; I361C + +
697 N8V; S161Y; R220H; I355W; A504S + + 698 Q6H; N8A; G9C; S74P;
R108E; S161Y; R220H; I355W; A504D + +
699 K144E; I166M; I316L + ++ 700 M1R; D198S; I355W; A504D + + 701
G310L; I316L; I361C; N490C; K498G; S502A + + 702 S161Y; D198S;
I355W; A504D + + 703 Q6S; R108H; S161Y; D198S; R220H; I355W; A504D
+ + 704 S178F; G310L; N490C; S502A + + 705 S74L; S161Y; D198S;
I355W; A504D + + 706 F308I; I355W; R491M; D506M; T507H + + 707
S161Y; D198S; R220H; I355W; A504D + + 708 K144E; S178F; G310L;
I361L; K498G; S502A + + 709 Q6P; V45A; D47E; S74L; S161Y; D198S;
I355W; A504D + + 710 S75N; A155T; I275V; F308I + + 711 S74L; R108H;
S161Y; I355W; A504D + + 712 G14L; I166M; G179D; F387L; D509G + +
713 Q4W; G14L; K144E; I166M; G179D; I316L; F387L; D508M + + 714
M1G; A2T; S74L; R108H; S161Y; I355W; A504D + + 715 S74L; D198S;
R220H; I355W; A504D + + 716 G14L; S178F; G310L; I361F; N490C; S502A
+ + 717 R108H; S161Y; D198S; R220H; I355W; A504D + + 718 S75N;
E151G; G310L; I361L + ++ 719 M1G; S178F; G310L; I361C; N490C; S502A
+ + 720 M1R; A155T; I355W; S501W + + 721 K144E; I166M; G179D; D508M
+ + 722 Q6V; S74L; D198S; R220H; I355W; A504D + + 723 Q4Y; G14L;
S178F; D212F; G310L; I361C; N490C; S502A + + 724 S75N; E151G;
V225M; I275V; G310L; I361F + + 725 S74L; R108H; D198S; R220H;
I355W; A504D + + 726 K144E; A154R; G179D; F387L; D508M + ++ 727
G14L; A155W; S178F; R220H; G310L; I361C; N490C; S502A; + + D508M
728 G14L; K144E; S178F; G310L; I361L; N490C + ++ 729 Q4R; G14L;
K144E; I166M; I316L; F387L + + 730 Q4R; K144E; A154R; I166M; F387L;
D508M + + 731 M1L; S178F; G310L; I361C; N490C; S502A + + 732 S75N;
S178F; A189N; L489F + + 733 Q4W; K144E; I316L; F387L; D508M + ++
734 R108H; G179W; E191V + + 735 K144E; A154R; I166M; I316L; F387L +
+ 736 G14L; K144E; A154R; I166M; I316L; F387L; D508M + + 737 S75N;
E151G; A155T; R195W; V225M; I275V; G310L; I316L; + + I355L; I361C
738 S178F; G310L; I361C; N490C; S502A + + 739 S75N; R108H; R195W;
V225M; F308I; G310L; I355L + + 740 G14L; K144E; S178F; G310L;
I361F; N490C; K510R + + 741 S75N; I275V; I355F; L489F + + 742 N8V;
R108H; S178F; G310L; I361C; N490C; S502A + + 743 S178F; G310L;
I361C; N490C; K498G + + 744 R108H; A154R; I166M; E191V; F387L + +
745 Q4S; Q6C; R43H; V45S; D47E; R108H; L148K; S161Y; D198S; + +
R220H; I355L; A504D 746 G14L; S178F; G310L; I361L; N490C + + 747
K144E; A155M; S178F; I316L; I361L; N490C + ++ 748 S75N; E151G;
V225M; I275V; I316L; I361L; L489F + + 749 S178F; G310L; I361C;
N490C + + 750 K144E; A154R; I166M; F387L; D508M + + 751 S178F;
G310L; I361L; N490S; K498N; S502A + + 752 S75N; A155T; S178F;
R195W; I275V; I361C + + 753 S75N; S178F; A189N; I275V; F308I; I361L
+ + 754 K144E; I166M; G179D; F387L + + 755 R20K; S178F; D198S;
G310L; I361C; N490C; S502A + + 756 R108H; L148K; I166M; F387L + +
757 S75N; A155T; S178F; R195W; G310L; I355L + + 758 S161Y; S178F;
G310L; I361C; N490C + + 759 A155T; F308I; I355W; R491M; A505G + +
760 A155T; F308I; I355W; R491M; S501C; T507H + + 761 S75N; E151G;
S178F; V225M; F308I; L489F; + + 762 A2R; T3L; Q4N; Q5N; Q6K; A120C;
Q138R; D140Y; F308I; + + I355W; A505G 763 G14L; K144E; A154R;
I166M; G179D; I316L; F387L; D508M + + 764 S75N; R108H; A155T;
S178F; V225M; I275V; F308I + + 765 A155M; G179W; E191V; F387L + +
766 F308I; I355W; S501W + + 767 K144E; I166M; G179D; I316L; F387L;
D508M + + 768 G14L; S161Y; S178F; R220H; G310L; I361L; N490C; S502A
+ + 769 A155T; F308I; I355W + + 770 S178F; G310L; I361L; N490C + +
771 S75N; R108H; A155T; I275V; G310L; I361L + + 772 Q4W; R20K;
K144E; S178F; G310L; I361L; N490C; K498G + + 773 K144E; A154R;
I166M; G179D; F387L + + 774 K144E; A154R; I166M; G179D; F387L;
D508M + + 775 Q4R; K144E; I166M; G179D; I316L; F387L; D508M + + 776
S75N; R108H; F308I; G310L; I361L + + 777 K144E; S178F; D198S;
G310L; I361L; N490C + + 778 R108H; I166M; G179W; F387L + + 779
R108H; F387L; V424M + + 780 D85E; R108H; Y247N; S283A; F387L;
G417V; N419S; T436A; + + T442I 781 R108H; A154R; A157Q; E158N;
L159*; N160T; S178F; E191V; + + F387L 782 T197F; Y221D; R236I;
G242E; D245H; G264R; S273F; S283F; ++ + P284L 783 V15I; R195W;
V225M; R410H; A504E; K510L ++ + 784 R195W; R410H; A504E ++ ++ 785
V133G; N134D; D140Y ++ ++ 786 V133G ++ + 787 A238G ++ ++ 788 V15I;
R195W; V225M; R410H; K510S 1 ++ 789 E280I + ++ 790 Q211R; S215Y;
K218P; Y221K; G227E; V231A; S244P; L253V; + ++ L258P 791 E151G;
I275V; K495S; E496G; T511I + ++ 792 M1G + ++ 793 S75N; K495S + ++
794 S75N; I275V; K495S; E496G; T511I + ++ 795 R195W; A504E + ++ 796
Y241F + ++ 797 Q211L; V225C; A278C + ++ 798 V15I; R195W; R410H;
A504E + ++ 799 G49E; S188W; E280I + ++ 800 S188W; Y241F + + 801
R195N + ++ 802 S75N; E151G; I275V; K495S; E496G + + 803 R195H + ++
804 M1E; A2R; T177E; T197F; R220A + ++ 805 T182G; R195N + ++ 806
L267H + ++ 807 T182G; R195I + ++ 808 L209Y; R220A; P284Q + + 809
Q211H + ++ 810 S75N; E151G; K495C; E496G; T511I + ++ 811 V15I;
R195W; V225M; R410H; A504E + ++ 812 V15I; R195W; R410H; K510S + ++
813 V15I; R195W; V225M; R410H + ++ 814 V133A; T182G; R195H; N239C +
+ 815 S75N; I275V; K495C; T511I + ++ 816 S75N; E496G + ++ 817 V15I;
R195W; K510N + ++ 818 S75N; E151G; K495S + ++ 819 V15I; R195W;
R410H; K510N + ++ 820 R195N; N239C + + 821 V15I; R195W; V225M;
R410H; A504E; K510S + ++ 822 S196D; Q211H; Y241F + + 823 R195W;
V225M; K510E + ++ 824 S75N; K495S; T511D + ++ 825 G264R + ++ 826
S75N; I275V; K495C + ++ 827 S75N; I275V; K495S + ++ 828 S75N;
E151G; K495C; T511S + ++ 829 S188W; S196D; Y241F + + 830 V15I;
R195W; V225M; R410H; K510E + + 831 V15I; R195W; R410H; A504E; K510S
+ + 832 A164V; I275V; K495S; T511D + + 833 S75N; I275V; E496G + +
834 V15I; R195W; V225M; R410H; A504E; K510D + + 835 V15I; R195W;
V225M; R410H; K510D + + 836 V15I; R195W; K510D + + 837 M1L; S188W;
Q211H; Y241F + + 838 M1G; V15I; P62Q; R195W; K510D + ++ 839 V15I;
R195W; R410H; K510E + ++ 840 T182G; R195N; N239C + + 841 S188W;
Q211N; L267H + + 842 S75N; I275V; K495C; T511S + ++ 843 S75N;
I275V; K495C; E496D; T511S + ++ 844 V15I; R195W; R410H; K510D + ++
845 T177E; T197F; R220A; G264R + + 846 S75N; E151G; I275V; E496G +
++ 847 T177E; T197F; G264R; P284Q + + 848 S75N; E151G; I275V;
E496G; T511I + ++ 849 S188W; S196D; Q211L; Y241F + + 850 S75N;
E151G; I275V; K495C; E496G + ++ 851 Q122H; T182G; R195H; L206C;
N239C + + 852 S75N; E151G; I275V; K495C + ++ 853 S75N; E151G;
I275V; E496G; T511S + ++ 854 K144R + ++ 855 S75N; E151G; I275V;
K495C; T511D + ++ 856 E90Q; T197F; L209Y; R220A; G264R; P284Q + +
857 S75N; E151G; I275V; E496G; T511D + ++ 858 L209Y; P284Q + ++ 859
T197F; R220A; G264R + ++ 860 M1L; S188W; S196D; L267H; E280I + +
861 N134Y; S188W; S196D; Y241F; L267H + + 862 T197F; P284Q + ++ 863
S188W; S196D; Y241F; A278C + + 864 T197F; R220A; P284Q + ++ + = up
to 1.0 fold improvement over FAR variant 405 (SEQ ID NO: 20) ++ =
>1.0 fold improvement over FAR variant 405 (SEQ ID NO: 20)
[0269] Table 9 provides the relative fold improvement (FIOP) in the
proportion of C12:0 fatty alcohols produced and in the increase in
total fatty alcohol titer for illustrative variants relative to FAR
variant 545 (SEQ ID NO:22) at 30.degree. C. In Table 9, the amino
acid substitutions listed for each variant correspond to residue
positions of SEQ ID NO:22.
TABLE-US-00009 TABLE 9 Variant FAR polypeptides and relative fold
improvement in proportion of C12:0 fatty alcohols produced and
total fatty alcohol titer FIOP in FIOP in total Variant Amino Acid
Substitutions Relative to SEQ ID proportion of fatty alcohol No.
NO: 22 C12:0-OH titer 865 G14L; A189N; R220H; I316L; I355F; R410H;
S502A ++ ++ 866 G14L; I316L; I355F; A504D ++ ++ 867 A189N; R220H;
I316L; I355F; R410H; S502A; A504D ++ ++ 868 G14L; R220H; I316L;
I355F; S502A ++ ++ 869 G14L; A189N; R220H; I316L; I355 ++ + 870
G14L; A189N; R220H; I316L; I355F; F387L; R410H; S502A ++ + 871
G14L; A189N; R220H; I316L; I355F; F387L; R410H; A504D ++ + 872
I316L; I355F; F387L; R410H; A504D ++ ++ 873 A189N; I316L; I355F;
A504D ++ + 874 G14L; A189N; I355F; S502A; A504D ++ ++ 875 I355F;
A512M ++ ++ 876 I355F; S502A; A504D ++ ++ 877 G14L; I355F; L489F;
S502A; A504D ++ ++ 878 G14L; A189N; R220H; I355F; A504D ++ ++ 879
G14L; A189N; R220H; I355F ++ ++ 880 G14L; R220H; I355F; L489F;
S502A; A504D ++ ++ 881 G14L; R220H; I316L; I355F; F387L; R410H;
A504D ++ ++ 882 G14L; A189N; I355F; A504D ++ ++ 883 G14L; A189N;
R220H; I355F; S502A; A504D ++ ++ 884 I355F ++ ++ 885 Q4H; I355F;
D506M ++ ++ 886 A189N; I316L; R410H; E510K ++ ++ 887 I316L; R487G
++ ++ 888 G14L; A189N; I316L; F387L; S502A; A504D ++ ++ 889 I316L;
R410H ++ ++ 890 G14L; A189N; I316L; R410H; E510K ++ ++ 891 G14L;
I316L; R410H ++ ++ 892 G14L; A189N; I316L; R410H ++ ++ 893 Q6R;
R108H; I355L ++ ++ 894 A189N; I316L; R410H ++ ++ 895 Q6V; I355L ++
++ 896 A2S ++ ++ 897 A2S; I316L ++ ++ 898 Q6V; S74L; R108H; I355L
++ ++ 899 A189N; R220H; I355F; A504D ++ ++ 900 Q6V; R108H; I355L;
V401T ++ ++ 901 Q6R; S74L; R108E; L148K; Q167H; I355L; R487G ++ ++
902 I355L; V401T; R487G ++ ++ 903 I355L; V401T; R487G; A504S ++ ++
904 K144E; L148K; R491M; D506R; D509Q ++ ++ 905 I316L; R491M ++ ++
906 K144E; I355L ++ ++ 907 F387L; A512M ++ ++ 908 G14L; T268N;
R410H; D508M; E510R ++ ++ 909 A189N; R220H; I355F ++ ++ 910 Q6V;
S74L; R108H; K144E; Q167H; I355L ++ ++ 911 K426T ++ ++ 912 I316L;
T507H ++ ++ 913 K144E; L148K; R487G; R491M; D506R ++ ++ 914 G14L;
A189N; R220H; I355F; F387L; S502A; A504D ++ ++ 915 Q6V; R487G;
A504S ++ ++ 916 R487G; R491M ++ ++ 917 G14L; T268N; R410H; E510R ++
++ 918 Q6R; A154R; I355L; V401T ++ ++ 919 G14L; I316L; E510K ++ ++
920 G14L; A189N; R220H; I316L; I355F; F387L; R410H; L489F; ++ +
S502A; A504D 921 Q6R; A154R; I355L ++ ++ 922 K144E; D509R ++ ++ 923
G14L; A189N; R220H; I355F; F387L; R410H; A504D ++ + 924 G14L;
A189N; T268N; R410H; E510K ++ ++ 925 Q6C; R108E; K144E ++ ++ 926
G14L; A189N; I316L; E510K ++ ++ 927 G14L; A189N; R220H; F387L;
S502A; A504D ++ ++ 928 K144E; L148K; R491M ++ ++ 929 Q6V; K144E ++
++ 930 G14L; R220H; F387L; S502A ++ ++ 931 L148K; R491M ++ ++ 932
Q6V; R108H; A504S ++ ++ 933 G14L; A189N; I316L; R410H; D508M; E510R
++ ++ 934 G14L; R410H ++ ++ 935 G14L; R220H; I316L; F387L; R410H;
L489F; S502A ++ ++ 936 G14L; I355F; F387L; R410H; L489F; S502A;
A504D ++ + 937 R410H; E510K ++ ++ 938 G14L; I316L ++ ++ 939 Q6V;
S74L ++ ++ 940 G14L; I355F; L489F; A504D ++ + 941 G14L; A189N;
R410H ++ ++ 942 Y500H; A504D; D506M ++ ++ 943 G14L; A189N; R220H;
I355F; L489F; A504D ++ + 944 K144E; L148K ++ ++ 945 R491M; D506R ++
++ 946 G14L; T268N; D508M ++ ++ 947 G14L; T101A; D396G ++ ++ 948
G14L; A189N; R220H; I316L; I355F; F387L; L489F; A504D ++ + 949
I316L ++ ++ 950 T246P ++ ++ 951 G14L; A189N; R220H; L489F; S502A ++
++ 952 A189N; R220H ++ ++ 953 G14L; R220H; I316L; F387L; L489F;
S502A ++ + 954 G14L; T268N; I316L; F387L; S502A ++ + 955 G14L;
A189N; E510K ++ ++ 956 A189N; R220H; F387L; A504D ++ ++ 957 G14L;
R410H; D508M; E510K ++ ++ 958 G14L; F387L; S502A ++ ++ 959 G14L;
T268N ++ ++ 960 G14L; A189N; R220H ++ ++ 961 T507H ++ ++ 962 Q167H
++ ++ 963 R487G; R491M; D509R ++ ++ 964 G14L; A189N; R220H; F387L;
L489F; S502A; A504D ++ + 965 G14L; A189N; T268N ++ ++ 966 D509Q ++
++ 967 G14L; A189N; R220H; T268N; F387L; A504D ++ + 968 E510K ++ ++
969 R220H; A504D ++ ++ 970 K144E; L148K; S178F; R491M; D506R ++ ++
971 R108H; L148K; A504S ++ ++ 972 G14L; D508M ++ ++ 973 Q6V; A154R;
A504S ++ ++ 974 A189N; R220H; I355F; F387L; L489F ++ + 975 K144E;
L148K; R491M; D509Q ++ ++ 976 Q6C; S74L; R108H; L148K; R487G ++ ++
977 A155T; S178F ++ ++ 978 K144E; L148K; R491M; D506R ++ ++ 979
G14L; R410H; D506M; D508M ++ ++ 980 Q6V; K144E; G179D; I355L; V401T
++ ++ 981 R491M; D506R; D509R ++ ++ 982 G14L; A189N; I316L; F387L;
L489F; S502A; A504D; D506G ++ ++ 983 Q6C; K144E; Q167H; G310L;
I355L; V401T; R487G ++ ++ 984 G14L; T268N; R410H ++ ++ 985 Q6R;
K144E; Q167H; G310L; I355L; R487G; A504S ++ ++ 986 Q6C; Q167H;
G310L; I355L; R487G ++ ++ 987 R410H; L489F; S502A ++ ++ 988 Q6C;
R136L; Q167H; E205K; G310L; I355L; A504S ++ ++ 989 D506R; D509R ++
++ 990 Q6V; L148K; L279*; V401T; R487G; A504S ++ + 991 S178F ++ ++
992 G14L; A189N; T268N; I316L; R410H; E510K ++ + 993 Q6V; K144E;
G310L; I355L; V401T ++ ++ 994 R108Q; Q167H; G179D ++ + 995 G14L;
A189N; L489F ++ ++ 996 G14L; A189N; T268N; I316L; R410H; E510R ++ +
997 Q6C; G310L; I355L; R487G ++ ++ 998 G14L; A189N; R220H; T268N;
A504D ++ + 999 K144E; L148K; D506R; D509Q ++ ++ 1000 L489F; S502A;
A504D ++ ++ 1001 Q6R; G310V ++ ++ 1002 S74L; R108E; L148K ++ ++
1003 Q6C; S74L; R108H; K144E; G310L; I355L; A504S ++ ++ 1004 Q6R;
S74L; R108H; K144E; G310L; I355L ++ ++ 1005 G14L; T268N; S502A ++
++ 1006 G14L; T268N; R410H; D508M ++ ++ 1007 G310L; I355L; V401T ++
++ 1008 S178F; R491M; D506R; D509Q ++ ++ 1009 G14L; T268N; E510K ++
++ 1010 Q6V; K144E; G310L; V401T; R487G ++ ++ 1011 A189N; R220H;
L489F; S502A; A504D ++ ++ 1012 G14L; A189N; T268N; R410H; D508M;
E510R ++ ++ 1013 Q6V; S74L; R108H; Q167H; G310L; A504S ++ ++ 1014
A189N; R220H; I316L; L489F ++ + 1015 Q6V; R108H; G310L; R487G ++ ++
1016 R220H; L489F; S502A ++ ++ 1017 S178F; R487G; R491M; D509R ++ +
1018 Q6R; R108H; K144E; G310L ++ ++ 1019 G14L; A189N; T268N; D506M;
E510K ++ + 1020 A155T; S178F; R491M; D506R; D509Q ++ + 1021 Q6V;
G310L; V401T ++ ++ 1022 K144E; L148K; S178F; R491M; D509Q ++ + 1023
Q6C; S74L; G310L; A504S ++ ++ 1024 Q6R; L148K; G310L; I355L; V401T
+ + 1025 Q6C; S74L; L148K; Q167H; G310L + ++ 1026 Q6R; R108H;
L148K; G310L; V401T; A504S + + + = up to 0.5 fold improvement over
FAR variant 285 (SEQ ID NO: 22) ++ = >0.5 fold improvement over
FAR variant 285 (SEQ ID NO: 22)
[0270] Table 10 provides the relative fold improvement (FIOP) in
the proportion of C12:0 fatty alcohols produced and in the increase
in total fatty alcohol titerfor illustrative variants relative to
FAR variant 893 (SEQ ID NO:26) at 30.degree. C. In Table 10, the
amino acid substitutions listed for each variant correspond to
residue positions of SEQ ID NO:26.
TABLE-US-00010 TABLE 10 Variant FAR polypeptides and relative fold
improvement in proportion of C12:0 fatty alcohols produced and
total fatty alcohol titer FIOP in proportion FIOP in Variant Amino
Acid Substitutions Relative to of total fatty No. SEQ ID NO: 26
C12:0-OH alcohol titer 1027 Q4Y; P62Q; A189N; I316L; R410H; ++ +
T507H; T511S 1028 P62Q; A189N; I316L; R410H; T511I ++ + 1029 Q4Y;
P62Q; I316L; R410H; ++ + T507H; T511I 1030 Q4Y; G14L; P62Q; A189N;
I316L; ++ + R410H; T507H 1031 Q4Y; G14L; P62Q; A189N; T197F; ++ +
I316L; R410H; T507H 1032 Q4S; P62Q; A189N; I316L; ++ + T507H; T511I
1033 Q4S; G14L; P284L; I316L; T511I ++ + 1034 Q4Y; R410H ++ ++ 1035
Q4Y; G14L; T511S ++ ++ 1036 Q4Y; P62Q; A189N; T507H; T511S ++ ++
1037 T507H + ++ 1038 T507H; T511I + ++ 1039 Q4Y; P62Q; T507H; T511S
+ + 1040 Q4Y; A189N + ++ 1041 Q4Y; P62Q; T197F; T511I + ++ 1042
Q4S; A189N; T507H; T511I + ++ 1043 Q4S; P62Q; T507H; T511I + ++
1044 Q4S; A189N; A504E; T511S + + 1045 Q4S; A189N; T511S + + 1046
Q4S; G14L; P62Q; T511S + + + = up to 1.0 fold improvement over FAR
variant 633 (SEQID NO: 26) ++ = >1.0 fold improvement over FAR
variant 633 (SEQ ID NO: 26)
Example 7
Chain Length Profile of Fatty Alcohols Exhibited by Representative
FAR Variants
[0271] The chain length profile of a subset of FAR variants was
evaluated as described above in FIG. 2. For each FAR variant
evaluated, the total fatty alcohol titer was determined by first
adding the titers of each fatty alcohol measured (C10:0-OH,
C12:1-OH, C12:0-OH, C13:0-OH, C14:1-OH, C14:0-OH, C15:-OH,
C16:1-OH, C16:0-OH, C18:1-OH, and C18:0-OH). The percentage of each
fatty alcohol species was then calculated as a percentage of the
total fatty alcohols measured. FIG. 1 provides the relative chain
length distribution (rounded to the nearest percent) of each of the
fatty alcohols C10:0, C12:0, C12:1, C14:0, C14:1, C16:0, C16:1,
C18:0, and C18:1 in total fatty alcohol titers produced by
recombinant E. coli strains expressing wild-type FAR Maa (SEQ ID
NO:2) or a FAR variant having the sequence of SEQ ID NO:8, SEQ ID
NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ
ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, or SEQ ID NO:28
when cultured at 30.degree. C.
Example 8
Evaluation of FAR Variants Obtained from Wild-Type M. aquaeolei
[0272] Gene acquisition of wild-type M. aquaeolei FAR ("FAR Maq")
is described in the published application WO 2011/008535. The amino
acid sequence of M. aquaeolei FAR can be found at GenBank Accession
Number YP.sub.--959486, and is designated herein as SEQ ID NO:4.
The polynucleotide sequence of the codon-optimized gene encoding
the FAR polypeptide of SEQ ID NO:4 is designated SEQ ID NO:3. The
M. aquaeolei FAR gene and genes encoding variants of the M.
aquaeolei FAR were cloned into the vector pCK110900 (depicted as
FIG. 3 in published application US 2006/0195947) under the control
of a lac promoter as described in WO/2011/008535. The resulting
plasmids were introduced into E. coli BW25113 Ltor R (Baba et al.,
Molecular Systems Biology, 2006 doi:10,1038/msb4100050 Article No.
2006.0008) by routine transformation methods. The engineered E.
coli strains comprising a plasmid containing a heterologous gene
encoding wild-type and variant FARs were grown and tested as
described above in Example 2.
Example 9
Evaluation of M. aquaeolei FAR Variants Using Microtiter Plates
[0273] FAR Maq variants were grown in 96-well shallow plates
containing 180 .mu.L M9YE medium supplemented with 1% glucose and
30 .mu.g/mL chloramphenicol (CAM), for approximately 16-18 hours
(overnight) in a shaker-incubator at 30.degree. C., 200 rpm. A 5%
inoculum was used in 96-deep-well plates to initiate fresh 380
.mu.L M9YE medium culture supplemented with 30 .mu.g/mL CAM and
0.5% glucose. The culture was incubated for 2 hours at 30.degree.
C., 250 rpm to an OD.sub.600 of 0.6-0.8, at which point expression
of the heterologous FAR gene was induced with
isopropyl-.beta.-D-thiogalactoside (IPTG) (1 mM final
concentration). Incubation was continued for about 24 hours under
the same conditions. An additional amount of glucose (0.5% w/v
final conc.) was added to the culture at 6 hours after induction by
IPTG. Cell cultures were extracted with 1 mL of isopropanol:methyl
t-butyl ether (MTBE) (4:6 ratio) for 2 hours. The extracts were
centrifuged and the upper organic phase was transferred into
polypropylene 96-well plates and analyzed by the GC-FID method
described above in Example 2. Identification of individual fatty
alcohol was done by comparison to commercial standards (Sigma
Chemical Company, 6050 Spruce St. Louis, Mo. 63103).
[0274] Table 11 provides the relative fold improvement (FIOP) in
the proportion of C12 and C14 fatty alcohols in the total fatty
alcohols produced (i.e., the improvement in the percentage of C12
and C14 fatty alcohols in the total fatty alcohol titer) for
illustrative variants relative to wild-type M. aquaeolei FAR at
30.degree. C. Codon-optimized SEQ ID NO:3 was mutated and used to
express FAR Maq Variant Nos. 1047-1070. The improvement in
proportion of C12 and C14 fatty alcohols was determined as
described in Example 2. The improvement in total production of
fatty alcohols for variants as compared to SEQ ID NO:4 was in the
range of 0.8 to 2.5. In Table 11, the amino acid substitutions
listed for each variant correspond to residue positions of SEQ ID
NO:4 (e.g., "N135K" means that the residue at position 135 in SEQ
ID NO:4 (asparagine) is substituted with lysine), and the amino
acid positions were determined by optimal alignment with SEQ ID
NO:4.
TABLE-US-00011 TABLE 11 Variant FAR polypeptides and relative fold
improvement in production of C12 and C14 fatty alcohols. Relative
FIOP of Amino acid substitutions C12 and C14 fatty alcohol Variant
No. relative to SEQ ID NO: 4 production.dagger. 1047 N135K + 1048
A74K + 1049 D430K ++ 1050 E228G + 1051 L503R + 1052 S434K ++ 1053
A512P + 1054 A512S + 1055 A512K ++ 1056 S434F + 1057 A512R ++ 1058
A512G ++ 1059 S434W + 1060 K511G + 1061 A512Q + 1062 A512T + 1063
L503S + 1064 A74L + 1065 H8K + 1066 D411R + 1067 K511P + 1068 D116A
+ 1069 D116E + 1070 I438V + .dagger.+ = 1.0 to 1.5 fold improvement
over wild-type M. aquaeolei FAR (SEQ ID NO: 4) ++ = 1.6 to 2.0 fold
improvement over wild-type M. aquaeolei FAR (SEQ ID NO: 4). Fatty
alcohols measured include: C14:0 (1-tetradecanol), C16:1 (cis
.DELTA..sup.9-1-hexadecenol), C16:0 (1-hexadecanol), and C18:1 (cis
.DELTA..sup.11-1-octadecenol).
[0275] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference in their entirety for all
purposes.
Sequence CWU 1
1
4811539DNAMarinobacter algicola 1atggctactc aacaacaaca gaacggtgca
tctgcatccg gcgtcttgga acaacttcgt 60ggaaagcacg ttcttatcac aggtactacc
ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta ctgttccgga
tattggaggt attcatctgc tgattcgtgg caataaacgt 180catccagccg
ctcgtgaacg tttcctgaac gaaattgcgt cctcctccgt cttcgaacgt
240ttgcgtcacg atgataatga agccttcgag accttcttgg aagaacgtgt
tcactgtatt 300accggtgagg ttactgaatc ccgttttggt ttgacacctg
aacgttttcg tgctttggcc 360ggtcaggttg acgcttttat taacagcgct
gcaagcgtga actttcgtga ggaattggat 420aaagccctga aaatcaacac
cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac 480tccgctatgg
cggtcattca ggtttccact tgttacgtta acggtaaaaa ctccggtcaa
540attaccgaat ccgtcattaa acctgctggc gaatccattc cccgttccac
tgacggttac 600tacgagatcg aagaattggt ccatctgttg caagacaaga
tttccgatgt taaagctcgt 660tactccggca aagttctgga gaaaaaattg
gttgatttgg gtattcgtga ggccaataat 720tacggatggt ccgacaccta
cacattcacc aaatggttgg gtgaacaact gctgatgaag 780gccttgtctg
gtcgttcttt gactattgtg cgtccctcta ttattgagtc cgctttggaa
840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg atgccattat
cttggcttat 900gcccgtgaaa aagttagcct gttccctgga aaacgttccg
gcattattga tgttattcct 960gtcgatttgg ttgcgaactc catcatcttg
tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta tttatcaatg
ttgcagcggt ggttctaatc caatctccct gggtaagttc 1080attgattatt
tgatggccga ggctaagacc aactatgctg cctacgatca actgttttat
1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat tgtttgacgt
tgttgttggt 1200ggtatgcgtg ttcctctttc tattgccggt aaagctatgc
gtttggctgg tcaaaatcgt 1260gagttgaaag tgcttaagaa ccttgatacg
acccgttccc ttgcaaccat ttttggcttc 1320tatactgctc ccgactatat
cttccgtaac gatagcttga tggccctggc ttctcgtatg 1380ggtgaattgg
atcgtgttct tttcccagtt gatgctcgtc aaattgattg gcagttgtac
1440ttgtgtaaaa ttcatttggg tggtctgaac cgttacgctt tgaaggaacg
taaactgtat 1500tctttgcgtg ctgctgatac tcgtaaaaaa gctgcctaa
15392512PRTMarinobacter algicola 2Met Ala Thr Gln Gln Gln Gln Asn
Gly Ala Ser Ala Ser Gly Val Leu 1 5 10 15 Glu Gln Leu Arg Gly Lys
His Val Leu Ile Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val
Val Leu Glu Lys Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly
Ile His Leu Leu Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60
Arg Glu Arg Phe Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65
70 75 80 Leu Arg His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu
Glu Arg 85 90 95 Val His Cys Ile Thr Gly Glu Val Thr Glu Ser Arg
Phe Gly Leu Thr 100 105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln
Val Asp Ala Phe Ile Asn 115 120 125 Ser Ala Ala Ser Val Asn Phe Arg
Glu Glu Leu Asp Lys Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu
Glu Asn Val Ala Ala Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met
Ala Val Ile Gln Val Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Asn
Ser Gly Gln Ile Thr Glu Ser Val Ile Lys Pro Ala Gly Glu Ser 180 185
190 Ile Pro Arg Ser Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His
195 200 205 Leu Leu Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser
Gly Lys 210 215 220 Val Leu Glu Lys Lys Leu Val Asp Leu Gly Ile Arg
Glu Ala Asn Asn 225 230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe
Thr Lys Trp Leu Gly Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser
Gly Arg Ser Leu Thr Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser
Ala Leu Glu Glu Pro Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys
Val Ala Asp Ala Ile Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val
Ser Leu Phe Pro Gly Lys Arg Ser Gly Ile Ile Asp Val Ile Pro 305 310
315 320 Val Asp Leu Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala
Leu 325 330 335 Ser Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser
Gly Gly Ser 340 345 350 Asn Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr
Leu Met Ala Glu Ala 355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln
Leu Phe Tyr Arg Arg Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn
Arg Lys Leu Phe Asp Val Val Val Gly 385 390 395 400 Gly Met Arg Val
Pro Leu Ser Ile Ala Gly Lys Ala Met Arg Leu Ala 405 410 415 Gly Gln
Asn Arg Glu Leu Lys Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430
Ser Leu Ala Thr Ile Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435
440 445 Arg Asn Asp Ser Leu Met Ala Leu Ala Ser Arg Met Gly Glu Leu
Asp 450 455 460 Arg Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp
Gln Leu Tyr 465 470 475 480 Leu Cys Lys Ile His Leu Gly Gly Leu Asn
Arg Tyr Ala Leu Lys Glu 485 490 495 Arg Lys Leu Tyr Ser Leu Arg Ala
Ala Asp Thr Arg Lys Lys Ala Ala 500 505 510 31542DNAMarinobacter
aquaeolei 3atggctatcc agcaggttca tcacgccgac acatcctcct ctaaagtcct
gggtcaactt 60cgtggtaaac gtgtcttgat taccggcact actggattct tgggtaaagt
cgtcttggaa 120cgtttgattc gtgccgttcc tgacatcggt gctatctacc
tgctgattcg tggtaacaag 180cgtcacccgg atgctcgttc tcgtttcttg
gaggagattg ctacctcctc tgtctttgat 240cgtttgcgtg aagctgattc
cgaaggtttc gatgctttcc tggaagaacg tattcactgt 300gttactggtg
aagttactga agctggtttc ggtattggtc aagaggacta tcgtaagttg
360gccaccgaat tggacgcagt catcaattct gctgcctccg tcaacttccg
tgaggagttg 420gataaggctc tggccatcaa cactctgtgt ttgcgtaaca
tcgctggtat ggtggatctt 480aaccctaagc tggccgttct tcaagtctct
acgtgttacg tcaacggtat gaactctggt 540caagttactg aatccgtcat
caaaccagct ggtgaagctg ttcctcgttc tcctgatgga 600ttctacgaga
tcgaggaatt ggttcgtctg ctgcaagaca agattgaaga cgttcaagca
660cgttactctg gtaaggtgtt ggagcgtaag ttggttgatt tgggtattcg
tgaggctaat 720cgttacggtt ggtctgatac atacaccttc acgaaatggt
tgggtgaaca acttctgatg 780aaagccttga atggtcgtac cttgactatt
ctgcgtccta gcatcattga atctgctttg 840gaagaaccag cacctggttg
gattgaaggc gtgaaagttg cagatgcgat catcttggct 900tatgctcgtg
agaaggttac tttgtttccg ggtaaacgtt ctggtatcat tgatgtgatt
960cctgttgact tggttgccaa ttccatcatc ttgtctttgg ctgaggctct
gggcgaacct 1020ggtcgtcgtc gtatctacca atgttgttct ggtggtggta
atcctatctc cctgggcgag 1080ttcattgatc acctgatggc tgaatccaaa
gccaactatg ccgcatacga tcatctgttc 1140taccgtcaac cctccaagcc
tttccttgct gtcaaccgtg ctttgttcga cttggttatc 1200tctggtgtcc
gtctgccttt gtctttgacc gaccgtgtct tgaagctgct gggcaactcc
1260cgtgacctga agatgctgcg taacctggat actacgcaat ccctggctac
tatctttggc 1320ttctacacag cccccgacta catcttccgt aatgacgagt
tgatggccct ggctaaccgt 1380atgggcgagg ttgataaggg tttgttcccc
gttgatgctc gtctgattga ttgggaattg 1440tacctgcgta agattcacct
ggctggtttg aaccgttacg ccttgaagga gcgtaaggtt 1500tactctttga
agacagcccg tcagcgtaag aaggcagctt aa 15424513PRTMarinobacter
aquaeolei 4Met Ala Ile Gln Gln Val His His Ala Asp Thr Ser Ser Ser
Lys Val 1 5 10 15 Leu Gly Gln Leu Arg Gly Lys Arg Val Leu Ile Thr
Gly Thr Thr Gly 20 25 30 Phe Leu Gly Lys Val Val Leu Glu Arg Leu
Ile Arg Ala Val Pro Asp 35 40 45 Ile Gly Ala Ile Tyr Leu Leu Ile
Arg Gly Asn Lys Arg His Pro Asp 50 55 60 Ala Arg Ser Arg Phe Leu
Glu Glu Ile Ala Thr Ser Ser Val Phe Asp 65 70 75 80 Arg Leu Arg Glu
Ala Asp Ser Glu Gly Phe Asp Ala Phe Leu Glu Glu 85 90 95 Arg Ile
His Cys Val Thr Gly Glu Val Thr Glu Ala Gly Phe Gly Ile 100 105 110
Gly Gln Glu Asp Tyr Arg Lys Leu Ala Thr Glu Leu Asp Ala Val Ile 115
120 125 Asn Ser Ala Ala Ser Val Asn Phe Arg Glu Glu Leu Asp Lys Ala
Leu 130 135 140 Ala Ile Asn Thr Leu Cys Leu Arg Asn Ile Ala Gly Met
Val Asp Leu 145 150 155 160 Asn Pro Lys Leu Ala Val Leu Gln Val Ser
Thr Cys Tyr Val Asn Gly 165 170 175 Met Asn Ser Gly Gln Val Thr Glu
Ser Val Ile Lys Pro Ala Gly Glu 180 185 190 Ala Val Pro Arg Ser Pro
Asp Gly Phe Tyr Glu Ile Glu Glu Leu Val 195 200 205 Arg Leu Leu Gln
Asp Lys Ile Glu Asp Val Gln Ala Arg Tyr Ser Gly 210 215 220 Lys Val
Leu Glu Arg Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn 225 230 235
240 Arg Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu
245 250 255 Gln Leu Leu Met Lys Ala Leu Asn Gly Arg Thr Leu Thr Ile
Leu Arg 260 265 270 Pro Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ala
Pro Gly Trp Ile 275 280 285 Glu Gly Val Lys Val Ala Asp Ala Ile Ile
Leu Ala Tyr Ala Arg Glu 290 295 300 Lys Val Thr Leu Phe Pro Gly Lys
Arg Ser Gly Ile Ile Asp Val Ile 305 310 315 320 Pro Val Asp Leu Val
Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala 325 330 335 Leu Gly Glu
Pro Gly Arg Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly 340 345 350 Gly
Asn Pro Ile Ser Leu Gly Glu Phe Ile Asp His Leu Met Ala Glu 355 360
365 Ser Lys Ala Asn Tyr Ala Ala Tyr Asp His Leu Phe Tyr Arg Gln Pro
370 375 380 Ser Lys Pro Phe Leu Ala Val Asn Arg Ala Leu Phe Asp Leu
Val Ile 385 390 395 400 Ser Gly Val Arg Leu Pro Leu Ser Leu Thr Asp
Arg Val Leu Lys Leu 405 410 415 Leu Gly Asn Ser Arg Asp Leu Lys Met
Leu Arg Asn Leu Asp Thr Thr 420 425 430 Gln Ser Leu Ala Thr Ile Phe
Gly Phe Tyr Thr Ala Pro Asp Tyr Ile 435 440 445 Phe Arg Asn Asp Glu
Leu Met Ala Leu Ala Asn Arg Met Gly Glu Val 450 455 460 Asp Lys Gly
Leu Phe Pro Val Asp Ala Arg Leu Ile Asp Trp Glu Leu 465 470 475 480
Tyr Leu Arg Lys Ile His Leu Ala Gly Leu Asn Arg Tyr Ala Leu Lys 485
490 495 Glu Arg Lys Val Tyr Ser Leu Lys Thr Ala Arg Gln Arg Lys Lys
Ala 500 505 510 Ala 51539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 26 5atggctactc aacaacaaca gaacggtgca
tctgcatccg gcgtcttgga acaacttcgt 60ggaaagcacg ttcttatcac aggtactacc
ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta ctgttccgga
tattggaggt attcatctgc tgattcgtgg caataaacgt 180catccagccg
ctcgtgaacg tttcctgaac gaaattgcgt cctcctccgt cttcgaacgt
240ttgcgtcacg atgataatga agccttcgag accttcttgg aagaacgtgt
tcactgtatt 300accggtgagg ttactgaatc ccgttttggt ttgacacctg
aacgttttcg tgctttggcc 360ggtcaggttg acgcttttat taacagcgct
gcaagcgtga gttttcgtga gcaattggat 420aaagccctga aaatcaacac
cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac 480tccgctatgg
cggtcattca ggtttccact tgttacgtta acggtaaaaa ctccggtcaa
540attaccgaat ccgtcattaa atcggctggc gaatccattc cccgttccac
tgacggttac 600tacgagatcg aagaattggt ccatctgttg caagacaaga
tttccgatgt taaagctcgt 660tactccggca aagttctgga gaaaaaattg
gttgatttgg gtattcgtga ggccaataat 720tacggatggt ccgacaccta
cacattcacc aaatggttgg gtgaacaact gctgatgaag 780gccttgtctg
gtcgttcttt gactattgtg cgtccctcta ttattgagtc cgctttggaa
840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg atgccattat
cttggcttat 900gcccgtgaaa aagttagcct gttccctgga aaacgttccg
gcattattga tgttattcct 960gtcgatttgg ttgcgaactc catcatcttg
tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta tttatcaatg
ttgcagcggt ggttctaatc caatctccct gggtaagttc 1080attgattatt
tgatggccga ggctaagacc aactatgctg cctacgatca actgttttat
1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat tgtttgacgt
tgttgttggt 1200ggtatgcgtg ttcctctttc tattgccggt aaagctatgc
gtttggctgg tcaaaatcgt 1260gagttgaaag tgcttaagaa ccttgatacg
acccgttccc ttgcaaccat ttttggcttc 1320tatactgctc ccgactatat
cttccgtaac gatagcttga tggccctggc ttctcgtatg 1380ggtgaattgg
atcgtgttct tttcccagtt gatgctcgtc aaattgattg gcagttgtac
1440ttgtgtaaaa ttcatttggg tggtctgaac cgttacgctt tgaaggaacg
taaactgtat 1500tctttgcgtg ctgctgatac tcgtaaaaaa accgcctaa
15396512PRTArtificial SequenceArtificial polypeptide for FAR
variant 26 6Met Ala Thr Gln Gln Gln Gln Asn Gly Ala Ser Ala Ser Gly
Val Leu 1 5 10 15 Glu Gln Leu Arg Gly Lys His Val Leu Ile Thr Gly
Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys Leu Ile
Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu Ile Arg
Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe Leu Asn
Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg His Asp
Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95 Val His
Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100 105 110
Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile Asn 115
120 125 Ser Ala Ala Ser Val Ser Phe Arg Glu Gln Leu Asp Lys Ala Leu
Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala Leu Ala
Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val Ser Thr
Cys Tyr Val Asn Gly Lys 165 170 175 Asn Ser Gly Gln Ile Thr Glu Ser
Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser Thr Asp
Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu Gln Asp
Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Lys 210 215 220 Val Leu
Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225 230 235
240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu Gln
245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr Ile Val
Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ser Pro
Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile Ile Leu
Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly Lys Arg
Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu Val Ala
Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser Gly Ser
Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345 350 Asn
Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Met Ala Glu Ala 355 360
365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg Pro Thr
370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp Val Val
Val Gly 385 390 395 400 Gly Met Arg Val Pro Leu Ser Ile Ala Gly Lys
Ala Met Arg Leu Ala 405 410 415 Gly Gln Asn Arg Glu Leu Lys Val Leu
Lys Asn Leu Asp Thr Thr Arg 420 425 430 Ser Leu Ala Thr Ile Phe Gly
Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp Ser Leu
Met Ala Leu Ala Ser Arg Met Gly Glu Leu Asp 450 455 460 Arg Val Leu
Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470 475 480
Leu Cys Lys Ile His Leu Gly Gly Leu Asn Arg Tyr Ala Leu Lys Glu 485
490 495 Arg Lys Leu Tyr Ser Leu Arg Ala Ala Asp Thr Arg Lys Lys Thr
Ala 500 505 510 71539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 92 7atggcgactc aacaacaaca
gaacggtgca
tctgcatccg gcgtcttgga acaacttcgt 60ggaaagcacg ttcttatcac aggtactacc
ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta ctgttccgga
tattggaggt attcatctgc tgattcgtgg caataaacgt 180catccagccg
ctcgtgaacg tttcctgaac gaaattgcgt cctcctccgt cttcgaacgt
240ttgcgtcacg atgataatga agccttcgag accttcttgg aagaacgtgt
tcactgtatt 300accggtgagg ttactgaatc ccgttttggt ttgacacctg
aacgttttcg tgctttggcc 360ggtcaggttg acgcttttat taacagcgct
gcaagcgtga gttttcgtga gcaattggat 420aaagccctga aaatcaacac
cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac 480tccgctatgg
cggtcattca ggtttccact tgttacgtta acggtaaaaa ctccggtcaa
540attaccgaat ccgtcattaa atcggctggc gaatccattc cccgttccac
tgacggttac 600tacgagatcg aagaattggt ccatctgttg caagacaaga
tttccgatgt taaagctcgt 660tactccggca aagttctgga gaaaaaattg
gttgatttgg gtattcgtga ggccaataat 720tacggatggt ccgacaccta
cacattcacc aaatggttgg gtgaacaact gctgatgaag 780gccttgtctg
gtcgttcttt gactattgtg cgtccctcta ttattgagtc cgctttggaa
840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg atgccattat
cttggcttat 900gcccgtgaaa aagttagcct gttccctgga aaacgttccg
gcattattga tgttattcct 960gtcgatttgg ttgcgaactc catcatcttg
tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta tttatcaatg
ttgcagcggt ggttctaatc caatctccct gggtaagttc 1080attgattatt
tgatggccga ggctaagacc aactatgctg cctacgatca actgttttat
1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat tgtttgacgt
tgttgttggt 1200ggtatgcgtg ttgtcctttc tattgccggt aaagctatgc
gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa ccttgatacg
acccgttccc ttgcaaccat ttttggcttc 1320tatactgctc ccgactatat
cttccgtaac gatagcttga tggccctggc tcagcgtatg 1380ggtgaattgg
atcgtgttct tttcccagtt gatgctcgtc aaattgattg gcagttgtac
1440ttgtgtaaaa ttcatttggg tggtctgaac cgttacgctt tgaaggaacg
taaactgtat 1500tcttcgcgtg ctgctgatac tgacgataaa accgcctaa
15398512PRTArtificial SequenceArtificial polypeptide for FAR
variant 92 8Met Ala Thr Gln Gln Gln Gln Asn Gly Ala Ser Ala Ser Gly
Val Leu 1 5 10 15 Glu Gln Leu Arg Gly Lys His Val Leu Ile Thr Gly
Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys Leu Ile
Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu Ile Arg
Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe Leu Asn
Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg His Asp
Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95 Val His
Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100 105 110
Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile Asn 115
120 125 Ser Ala Ala Ser Val Ser Phe Arg Glu Gln Leu Asp Lys Ala Leu
Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala Leu Ala
Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val Ser Thr
Cys Tyr Val Asn Gly Lys 165 170 175 Asn Ser Gly Gln Ile Thr Glu Ser
Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser Thr Asp
Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu Gln Asp
Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Lys 210 215 220 Val Leu
Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225 230 235
240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu Gln
245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr Ile Val
Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ser Pro
Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile Ile Leu
Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly Lys Arg
Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu Val Ala
Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser Gly Ser
Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345 350 Asn
Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Met Ala Glu Ala 355 360
365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg Pro Thr
370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp Val Val
Val Gly 385 390 395 400 Gly Met Arg Val Val Leu Ser Ile Ala Gly Lys
Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys Val Leu
Lys Asn Leu Asp Thr Thr Arg 420 425 430 Ser Leu Ala Thr Ile Phe Gly
Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp Ser Leu
Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg Val Leu
Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470 475 480
Leu Cys Lys Ile His Leu Gly Gly Leu Asn Arg Tyr Ala Leu Lys Glu 485
490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp Lys Thr
Ala 500 505 510 91539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 129 9atggcgactc aacaacagca
gaacggtgca tctgcatccg gcgtcttgga aattcttcgt 60ggaaagcacg ttcttatcac
aggtactacc ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta
ctgttccgga tattggaggt attcatctgc tgattcgtgg caataaacgt
180catccagccg ctggcgaacg tttcctgaac gaaattgcgt cctcctccgt
cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag accttcttgg
aagaacgtgt tcactgtatt 300accggtgagg ttactgaatc ccgttttggt
ttgacacctg agcgttttcg tgctttggcc 360ggtcaggttg acgcttttat
tcatagcgct gcaagcgtga gttttcgtga gcaattggat 420aaagccctga
aaatcaacac cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac
480tccgctatgg cggtcattca ggtttccact tgttacgtta acggtaaaac
ctccggtcaa 540attaccgaat ccgtcattaa atcggctggc gaatccattc
cccgttccac tgacggttac 600tacgagatcg aagaattggt ccatctgttg
caagacaaga tttccgatgt taaagctcgt 660tactccggcc gtgttatgga
gaaaaaattg gttgatttgg gtattcgtga ggccaataat 720tacggatggt
ccgacaccta cacattcacc aaatggttgg gtgaacaact gctgatgaag
780gccttgtctg gtcgttcttt gactattgtg cgtccctcta ttattgagtc
cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg
atgccattat cttggcttat 900gcccgtgaaa aagttagcct gttccctgga
aaacgttccg gcattattga tgttattcct 960gtcgatttgg ttgcgaactc
catcatcttg tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta
tttatcaatg ttgcagcggt ggttctaatc caatctccct gggtaagttc
1080attgattatt tgatggccga ggctaagacc aactatgctg cctacgatca
actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat
tgtttgacgt tgttgttggt 1200ggtatgcgtg ttgtcctttc tattgccggt
aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa
ccttgatacg acccgtaaac ttgcaaccat ttttggcttc 1320tatactgctc
ccgactatat cttccgtaac gatagcttga tggccctggc tcagcgtatg
1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc aaattgattg
gcagttgtac 1440ttgtgtaaaa ttcatttgcg tggtctgaac cgttacgctt
tgaaggaacg taaactgtat 1500tcttcgcgtg ctgctgatac tgacgataaa
accgcctaa 153910512PRTArtificial SequenceArtificial polypeptide for
FAR variant 129 10Met Ala Thr Gln Gln Gln Gln Asn Gly Ala Ser Ala
Ser Gly Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys His Val Leu Ile
Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys
Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu
Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Gly Glu Arg Phe
Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg
His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95
Val His Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100
105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile
His 115 120 125 Ser Ala Ala Ser Val Ser Phe Arg Glu Gln Leu Asp Lys
Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala
Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val
Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Thr Ser Gly Gln Ile Thr
Glu Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser
Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu
Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Arg 210 215 220
Val Met Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225
230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr
Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro
Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile
Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly
Lys Arg Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu
Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser
Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345
350 Asn Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Met Ala Glu Ala
355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg
Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp
Val Val Val Gly 385 390 395 400 Gly Met Arg Val Val Leu Ser Ile Ala
Gly Lys Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys
Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile
Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp
Ser Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg
Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470
475 480 Leu Cys Lys Ile His Leu Arg Gly Leu Asn Arg Tyr Ala Leu Lys
Glu 485 490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp
Lys Thr Ala 500 505 510 111539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 85 11atggcgactc aacaacaaca
gaacggtgca tctgcatccg gcgtcttgga acaacttcgt 60ggaaagcacg ttcttatcac
aggtactacc ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta
ctgttccgga tattggaggt attcatctgc tgattcgtgg caataaacgt
180catccagccg ctcgtgaacg tttcctgaac gaaattgcgt cctcctccgt
cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag accttcttgg
aagaacgtgt tcactgtatt 300accggtgagg ttactgaatc ccgttttggt
ttgacacctg aacgttttcg tgctttggcc 360ggtcaggttg acgcttttat
taacagcgct gcaagcgtga gttttcgtga gcaattggat 420aaagccctga
aaatcaacac cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac
480tccgctatgg cggtcattca ggtttccact tgttacgtta acggtaaaaa
ctccggtcaa 540attaccgaat ccgtcattaa atcggctggc gaatccattc
cccgttccac tgacggttac 600tacgagatcg aagaattggt ccatctgttg
caagacaaga tttccgatgt taaagctcgt 660tactccggca aagttctgga
gaaaaaattg gttgatttgg gtattcgtga ggccaataat 720tacggatggt
ccgacaccta cacattcacc aaatggttgg gtgaacaact gctgatgaag
780gccttgtctg gtcgttcttt gactattgtg cgtccctcta ttattgagtc
cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg
atgccattat cttggcttat 900gcccgtgaaa aagttagcct gttccctgga
aaacgttccg gcattattga tgttattcct 960gtcgatttgg ttgcgaactc
catcatcttg tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta
tttatcaatg ttgcagcggt ggttctaatc caatctccct gggtaagttc
1080attgattatt tgatggccga ggctaagacc aactatgctg cctacgatca
actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat
tgtttgacgt tgttgttggt 1200ggtatgcgtg ttgtcctttc tattgccggt
aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa
ccttgatacg acccgttccc ttgcaaccat ttttggcttc 1320tatactgctc
ccgactatat cttccgtaac gatagcttga tggccctggc ttctcgtatg
1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc aaattgattg
gcagttgtac 1440ttgtgtaaaa ttcatttggg tggtctgaac cgttacgctt
tgaaggaacg taaactgtat 1500tctttgcgtg ctgctgatac tcgtaaaaaa
accgcctaa 153912512PRTArtificial SequenceArtificial polypeptide for
FAR variant 85 12Met Ala Thr Gln Gln Gln Gln Asn Gly Ala Ser Ala
Ser Gly Val Leu 1 5 10 15 Glu Gln Leu Arg Gly Lys His Val Leu Ile
Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys
Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu
Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe
Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg
His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95
Val His Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100
105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile
Asn 115 120 125 Ser Ala Ala Ser Val Ser Phe Arg Glu Gln Leu Asp Lys
Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala
Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val
Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Asn Ser Gly Gln Ile Thr
Glu Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser
Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu
Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Lys 210 215 220
Val Leu Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225
230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr
Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro
Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile
Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly
Lys Arg Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu
Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser
Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345
350 Asn Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Met Ala Glu Ala
355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg
Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp
Val Val Val Gly 385 390 395 400 Gly Met Arg Val Val Leu Ser Ile Ala
Gly Lys Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys
Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430 Ser Leu Ala Thr Ile
Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp
Ser Leu Met Ala Leu Ala Ser Arg Met Gly Glu Leu Asp 450 455 460 Arg
Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470
475 480 Leu Cys Lys Ile His Leu Gly Gly Leu Asn Arg Tyr Ala Leu Lys
Glu 485 490 495 Arg Lys Leu Tyr Ser Leu Arg Ala Ala Asp Thr Arg Lys
Lys Thr Ala 500 505 510 131539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 118 13atggcgactc aacaacagca
gaacggtgca tctgcatccg gcgtcttgga acaacttcgt 60ggaaagcacg ttcttatcac
aggtactacc ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta
ctgttccgga tattggaggt attcatctgc tgattcgtgg caataaacgt
180catccagccg ctcgtgaacg tttcctgaac gaaattgcgt cctcctccgt
cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag accttcttgg
aagaacgtgt tcactgtatt 300accggtgagg ttactgaatc ccgttttggt
ttgacacctg agcgttttcg tgctttggcc 360ggtcaggttg acgcttttat
taacagcgct gcaagcgtga gttttcgtga gcaattggat 420aaagccctga
aaatcaacac cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac
480tccgctatgg cggtcattca ggtttccact tgttacgtta acggtaaaaa
ctccggtcaa 540attaccgaat ccgtcattaa atcggctggc gaatccattc
cccgttccac tgacggttac 600tacgagatcg aagaattggt ccatctgttg
caagacaaga tttccgatgt taaagctcgt 660tactccggca aagttctgga
gaaaaaattg gttgatttgg gtattcgtga ggccaataat 720tacggatggt
ccgacaccta cacattcacc aaatggttgg gtgaacaact gctgatgaag
780gccttgtctg gtcgttcttt gactattgtg cgtccctcta ttattgagtc
cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg
atgccattat cttggcttat 900gcccgtgaaa aagttagcct gttccctgga
aaacgttccg gcattattga tgttattcct 960gtcgatttgg ttgcgaactc
catcatcttg tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta
tttatcaatg ttgcagcggt ggttctaatc caatctccct gggtaagttc
1080attgattatt tgatggccga ggctaagacc aactatgctg cctacgatca
actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat
tgtttgacgt tgttgttggt 1200ggtatgcgtg ttgtcctttc tattgccggt
aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa
ccttgatacg acccgtaaac ttgcaaccat ttttggcttc 1320tatactgctc
ccgactatat cttccgtaac gatagcttga tggccctggc tcagcgtatg
1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc aaattgattg
gcagttgtac 1440ttgtgtaaaa ttcatttggg tggtctgaac cgttacgctt
tgaaggaacg taaactgtat 1500tcttcgcgtg ctgctgatac tgacgataaa
accgcctaa 153914512PRTArtificial SequenceArtificial polypeptide for
FAR variant 118 14Met Ala Thr Gln Gln Gln Gln Asn Gly Ala Ser Ala
Ser Gly Val Leu 1 5 10 15 Glu Gln Leu Arg Gly Lys His Val Leu Ile
Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys
Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu
Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe
Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg
His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95
Val His Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100
105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile
Asn 115 120 125 Ser Ala Ala Ser Val Ser Phe Arg Glu Gln Leu Asp Lys
Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala
Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val
Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Asn Ser Gly Gln Ile Thr
Glu Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser
Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu
Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Lys 210 215 220
Val Leu Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225
230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr
Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro
Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile
Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly
Lys Arg Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu
Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser
Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345
350 Asn Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Met Ala Glu Ala
355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg
Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp
Val Val Val Gly 385 390 395 400 Gly Met Arg Val Val Leu Ser Ile Ala
Gly Lys Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys
Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile
Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp
Ser Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg
Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470
475 480 Leu Cys Lys Ile His Leu Gly Gly Leu Asn Arg Tyr Ala Leu Lys
Glu 485 490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp
Lys Thr Ala 500 505 510 151539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 15atggcgactc aacaacagaa caacggtgca
tctgcatccg gcgtcttgga aattcttcgt 60ggaaagcacg ttcttatcac aggtactacc
ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta ctgttccgga
tattggaggt attcatctgc tgattcgtgg caataaacgt 180catccagccg
ctggcgaacg tttcctgaac gaaattgcgt cctcctccgt cttcgaacgt
240ttgcgtcacg atgataatga agccttcgag accttcttgg aagaacgtgt
tcactgtatt 300accggtgagg ttactgaatc ccgttttggt ttgacacctg
agcgttttcg tgctttggcc 360ggtcaggttg acgcttttat tcatagcgct
gcaagcgtga actttcgtga gcaattggat 420aaagccctga aaatcaacac
cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac 480tccgctatgg
cggtcattca ggtttccact tgttacgtta acggtaaaac ctccggtcaa
540attaccgaat ccgtcattaa atcggctggc gaatccattc cccgttccac
tgacggttac 600tacgagatcg aagaattggt ccatctgttg caagacaaga
tttccgatgt taaagctcgt 660tactccggcc gtgttatggg gaaaaaattg
gttgatttgg gtattcgtga ggccaataat 720tacggatggt ccgacaccta
cacattcacc aaatggttgg gtgaacaact gctgatgaag 780gccttgtctg
gtcgttcttt gactattgtg cgtccctcta ttattgagtc cgctttggaa
840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg atgccattat
cttggcttat 900gcccgtgaaa aagttagcct gttccctgga aaacgttccg
gcattattga tgttattcct 960gtcgatttgg ttgcgaactc catcatcttg
tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta tttatcaatg
ttgcagcggt ggttctaatc caatctccct gggtaagttc 1080attgattatt
tgaacgccga ggctaagacc aactatgctg cctacgatca actgttttat
1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat tgtttgacgt
tgttgttggt 1200gtcatgcgtg ttgtcctttc tattgccggt aaagctatgc
gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa ccttgatacg
acccgtaaac ttgcaaccat ttttggcttc 1320tatactgctc ccgactatat
cttccgtaac gatagcttga tggccctggc tcagcgtatg 1380ggtgaattgg
atcgtgttct tttcccagtt gatgctcgtc aaattgattg gcagttgtac
1440ttgtgtaaaa ttcatttgcg tggtctgaac cgttacgctt tgaaggaacg
taaactgtat 1500tcttcgcgtg ctgctgatac tgacgataaa accgcctaa
153916512PRTArtificial SequenceArtificial polypeptide for FAR
variant 16Met Ala Thr Gln Gln Gln Asn Asn Gly Ala Ser Ala Ser Gly
Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys His Val Leu Ile Thr Gly
Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys Leu Ile
Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu Ile Arg
Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Gly Glu Arg Phe Leu Asn
Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg His Asp
Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95 Val His
Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100 105 110
Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile His 115
120 125 Ser Ala Ala Ser Val Asn Phe Arg Glu Gln Leu Asp Lys Ala Leu
Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala Leu Ala
Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val Ser Thr
Cys Tyr Val Asn Gly Lys 165 170 175 Thr Ser Gly Gln Ile Thr Glu Ser
Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser Thr Asp
Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu Gln Asp
Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Arg 210 215 220 Val Met
Gly Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225 230 235
240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu Gln
245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr Ile Val
Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ser Pro
Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile Ile Leu
Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly Lys Arg
Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu Val Ala
Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser Gly Ser
Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345 350 Asn
Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Asn Ala Glu Ala 355 360
365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg Pro Thr
370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp Val Val
Val Gly 385 390 395 400 Val Met Arg Val Val Leu Ser Ile Ala Gly Lys
Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys Val Leu
Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile Phe Gly
Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp Ser Leu
Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg Val Leu
Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470 475 480
Leu Cys Lys Ile His Leu Arg Gly Leu Asn Arg Tyr Ala Leu Lys Glu 485
490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp Lys Thr
Ala 500 505 510 171539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 17atggcgactc aacaacagaa caacggtgca
tctgcatccg gcgtcttgga aattcttcgt 60ggaaagcacg ttcttatcac aggtactacc
ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta ctgttccgga
tattggaggt attcatctgc tgattcgtgg caataaacgt 180catccagccg
ctcgcgaacg tttcctgaac gaaattgcgt cctcctccgt cttcgaacgt
240ttgcgtcacg atgataatga agccttcgag accttcttgg aagaacgtgt
tcactgtatt 300accggtgaga ttactgaatc ccgttttggt ttgacacctg
agcgttttcg tgctttggcc 360ggtcaggttg acgcttttat tcatagcgct
gcaagcgtga actttcgtga gcaattggat 420aaagccctga aaatcaacac
cttgtgtctt gaaaatgttg ctgctcttgc agaattgaac 480tccgctatgg
cggtcattca ggtttccact tgttacgtta acggtaaaac ctccggtcaa
540attaccgaat ccgtcattaa atcggctggc gaatccattc cccgttccac
tgacggttac 600tacgagatcg aagaattggt ccatctgttg caagacaaga
tttccgatgt taaagctcgt 660tactccggcc gtgttatggg gaaaaaattg
gttgatttgg gtattcgtga ggccaataat 720tacggatggt ccgacaccta
cacattcacc aaatggttgg gtgaacaact gctgatgaag 780gccttgtctg
gtcgttcttt gactattgtg cgtccctcta ttattgagtc cgctttggaa
840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg atgccattat
cttggcttat 900gcccgtgaaa aagttagcct gttccctgga aaacgttccg
gcattattga tgttattcct 960gtcgatttgg ttgcgaactc catcatcttg
tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta tttatcaatg
ttgcagcggt ggttctaatc caatctccct gggtaagttc 1080attgattatt
tgaacgccga ggctaagacc aactatgctg cctacgatca actgttttat
1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat tgtttgacgt
tgttgttggt 1200gtcatgcgtg ttgtcctttc tattgcccgc aaagctatgc
gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa ccttgatacg
acccgtaaac ttgcaaccat ttttggcttc 1320tatactgctc ccgactatat
cttccgtaac gatagcttga tggccctggc tcagcgtatg 1380ggtgaattgg
atcgtgttct tttcccagtt gatgctcgtc aaattgattg gcagttgtac
1440ttgtgtaaaa ttcatttgcg tggtctgaac cgttacgctt tgaaggaacg
taaactgtat 1500tcttcgcgtg ctgctgatac tgacgataaa accgcctaa
153918512PRTArtificial SequenceArtificial polypeptide for FAR
variant 18Met Ala Thr Gln Gln Gln Asn Asn Gly Ala Ser Ala Ser Gly
Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys His Val Leu Ile Thr Gly
Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys Leu Ile
Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu Ile Arg
Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe Leu Asn
Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg His Asp
Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95 Val His
Cys Ile Thr Gly Glu Ile Thr Glu Ser Arg Phe Gly Leu Thr 100 105 110
Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile His 115
120 125 Ser Ala Ala Ser Val Asn Phe Arg Glu Gln Leu Asp Lys Ala Leu
Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala Leu Ala
Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val Ser Thr
Cys Tyr Val Asn Gly Lys 165 170 175 Thr Ser Gly Gln Ile Thr Glu Ser
Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser Thr Asp
Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu Gln Asp
Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Arg 210 215 220 Val Met
Gly Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225 230 235
240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu Gln
245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr Ile Val
Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ser Pro
Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile Ile Leu
Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly Lys Arg
Ser Gly Ile Ile Asp Val Ile Pro 305 310 315 320 Val Asp Leu Val Ala
Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser Gly Ser
Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345 350 Asn
Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Asn Ala Glu Ala 355 360
365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg Pro Thr
370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp Val Val
Val Gly 385 390 395 400 Val Met Arg Val Val Leu Ser Ile Ala Arg Lys
Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys Val Leu
Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile Phe Gly
Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp Ser Leu
Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg Val Leu
Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470 475 480
Leu Cys Lys Ile His Leu Arg Gly Leu Asn Arg Tyr Ala Leu Lys Glu 485
490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp Lys Thr
Ala 500 505
510 191539DNAArtificial SequenceArtificial polynucleotide for FAR
variant 405 19atggcgactc aacaacagaa caacggtgca tctgcatccg
gcgtcttgga aattcttcgt 60ggaaagcacg ttcttatcac aggtactacc ggatttttgg
gcaaagtggt tctggaaaag 120ttgattcgta ctgttccgga tattggaggt
attcatctgc tgattcgtgg caataaacgt 180catccagccg ctcgcgaacg
tttcctgaac gaaattgcgt cctcctccgt cttcgaacgt 240ttgcgtcacg
atgataatga agccttcgag accttcttgg aagaacgtgt tcactgtatt
300accggtgaga ttactgaatc ccgttttggt ttgacacctg agcgttttcg
tgctttggcc 360ggtcaggttg acgcttttat tcatagcgct gcaagcgtga
actttcgtga gcaattggat 420aaagccctga aaatcaacac cttgtgtctt
gaaaatgttg ctgcacttgc agaattgaac 480tccgctatgg cggtcattca
ggtttccact tgttacgtta acggtaaaac ctccggtcaa 540attaccgaat
ccgtcattaa atcggctggc gaatccattc cccgttccac tgacggttac
600tacgagatcg aagaattggt ccatctgttg caagacaaga tttccgatgt
taaagctcgt 660tactccggcc gtgttatggg gaaaaaattg gttgatttgg
gtattcgtga ggccaataat 720tacggatggt ccgacaccta cacattcacc
aaatggttgg gtgaacaact gctgatgaag 780gccttgtctg gtcgttcttt
gactattgtg cgtccctcta ttattgagtc cgctttggaa 840gaaccttccc
ctggttggat cgaaggcgtt aaagttgccg atgccattat cttggcttat
900gcccgtgaaa aagttagcct gttccctgga aaacgttccg gcattattga
ttttattcct 960gtcgatttgg ttgcgaactc catcatcttg tctctggctg
aggcgttgtc tggttctggt 1020caacgtcgta tttatcaatg ttgcagcggt
ggttctaatc caatctccct gggtaagttc 1080attgattatt tgaacgccga
ggctaagacc aactatgctg cctacgatca actgttttat 1140cgtcgtccta
ctaaaccttt cgtcgccgtg aaccgtaaat tgtttgacgt tgttgttggt
1200gtcatgcgtg ttgtcctttc tattgcccgc aaagctatgc gtttggctgg
tgtaaatcgt 1260gagttgaaag tgcttaagaa ccttgatacg acccgtaaac
ttgcaaccat ttttggcttc 1320tatactgctc ccgactatat cttccgtaac
gatagcttga tggccctggc tcagcgtatg 1380ggtgaattgg atcgtgttct
tttcccagtt gatgctcgtc aaattgattg gcagttgtac 1440ttgtgtaaaa
ttcatttgcg tggtctgaac cgttacgctt tgaaggaacg taaactgtat
1500tcttcgcgtg ctgctgatac tgacgataaa accgcctaa
153920512PRTArtificial SequenceArtificial polypeptide for FAR
variant 405 20Met Ala Thr Gln Gln Gln Asn Asn Gly Ala Ser Ala Ser
Gly Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys His Val Leu Ile Thr
Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys Leu
Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu Ile
Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe Leu
Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg His
Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95 Val
His Cys Ile Thr Gly Glu Ile Thr Glu Ser Arg Phe Gly Leu Thr 100 105
110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile His
115 120 125 Ser Ala Ala Ser Val Asn Phe Arg Glu Gln Leu Asp Lys Ala
Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala Leu
Ala Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val Ser
Thr Cys Tyr Val Asn Gly Lys 165 170 175 Thr Ser Gly Gln Ile Thr Glu
Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser Thr
Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu Gln
Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Arg 210 215 220 Val
Met Gly Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225 230
235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu
Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr Ile
Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ser
Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile Ile
Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly Lys
Arg Ser Gly Ile Ile Asp Phe Ile Pro 305 310 315 320 Val Asp Leu Val
Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser Gly
Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345 350
Asn Pro Ile Ser Leu Gly Lys Phe Ile Asp Tyr Leu Asn Ala Glu Ala 355
360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg Pro
Thr 370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp Val
Val Val Gly 385 390 395 400 Val Met Arg Val Val Leu Ser Ile Ala Arg
Lys Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys Val
Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile Phe
Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp Ser
Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg Val
Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470 475
480 Leu Cys Lys Ile His Leu Arg Gly Leu Asn Arg Tyr Ala Leu Lys Glu
485 490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp Lys
Thr Ala 500 505 510 211539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 545 21atggcgactc aacaacagaa
caacggtgca tctgcatccg gcgtcttgga aattcttcgt 60ggaaagcacg ttcttatcac
aggtactacc ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta
ctgttccgga tattggaggt attcatctgc tgattcgtgg caataaacgt
180catccagccg ctcgcgaacg tttcctgaac gaaattgcgt cctcctccgt
cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag accttcttgg
aagaacgtgt tcactgtatt 300accggtgaga ttactgaatc ccgttttggt
ttgacacctg agcgttttcg tgctttggcc 360ggtcaggttg acgcttttat
tcatagcgct gcaagcgtga actttcgtga gcaattggat 420aaagccctga
aaatcaacac cttgtgtctt gaaaatgttg ctgcacttgc agaattgaac
480tccgctatgg cggtcattca ggtttccact tgttacgtta acggtaaaac
ctccggtcaa 540attaccgaat ccgtcattaa atcggctggc gaatccattc
cccgttccac tgacggttac 600tacgagatcg aagaattggt ccatctgttg
caagacaaga tttccgatgt taaagctcgt 660tactccggcc gtgttatggg
gaaaaaattg gttgatttgg gtattcgtga ggccaataat 720tacggatggt
ccgacaccta cacattcacc aaatggttgg gtgaacaact gctgatgaag
780gccttgtctg gtcgttcttt gactattgtg cgtccctcta ttattgagtc
cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg
atgccattat cttggcttat 900gcccgtgaaa aagttagcct gttccctgga
aaacgttccg gcattattga ttttattcct 960gtcgatttgg ttgcgaactc
catcatcttg tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta
tttatcaatg ttgcagcggt ggttctaatc caatctccct gggtaagttc
1080tttgattatt tgaacgccga ggctaagacc aactatgctg cctacgatca
actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat
tgtttgacgt tgttgttggt 1200gtcatgcgtg ttgtcctttc tattgcccgc
aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa
ccttgatacg acccgtaaac ttgcaaccat ttttggcttc 1320tatactgctc
ccgactatat cttccgtaac gatagcttga tggccctggc tcagcgtatg
1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc aaattgattg
gcagttgtac 1440ttgtgtaaaa ttcatttgcg tggtctgaac cgttacgctt
tgaagggccg taaactgtat 1500tcttcgcgtg ctgctgatac tgacgatgaa
accgcctaa 153922512PRTArtificial SequenceArtificial polypeptide for
FAR variant 545 22Met Ala Thr Gln Gln Gln Asn Asn Gly Ala Ser Ala
Ser Gly Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys His Val Leu Ile
Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys
Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu
Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe
Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg
His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95
Val His Cys Ile Thr Gly Glu Ile Thr Glu Ser Arg Phe Gly Leu Thr 100
105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile
His 115 120 125 Ser Ala Ala Ser Val Asn Phe Arg Glu Gln Leu Asp Lys
Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala
Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val
Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Thr Ser Gly Gln Ile Thr
Glu Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser
Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu
Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Arg 210 215 220
Val Met Gly Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225
230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr
Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro
Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile
Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly
Lys Arg Ser Gly Ile Ile Asp Phe Ile Pro 305 310 315 320 Val Asp Leu
Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser
Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345
350 Asn Pro Ile Ser Leu Gly Lys Phe Phe Asp Tyr Leu Asn Ala Glu Ala
355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg
Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp
Val Val Val Gly 385 390 395 400 Val Met Arg Val Val Leu Ser Ile Ala
Arg Lys Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys
Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile
Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp
Ser Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg
Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470
475 480 Leu Cys Lys Ile His Leu Arg Gly Leu Asn Arg Tyr Ala Leu Lys
Gly 485 490 495 Arg Lys Leu Tyr Ser Ser Arg Ala Ala Asp Thr Asp Asp
Glu Thr Ala 500 505 510 231539DNAArtificial SequenceArtificial
polynucleotide for FAR variant 865 23atggcgactc aacaacagaa
caacggtgca tctgcatccc tggtcttgga aattcttcgt 60ggaaagcacg ttcttatcac
aggtactacc ggatttttgg gcaaagtggt tctggaaaag 120ttgattcgta
ctgttccgga tattggaggt attcatctgc tgattcgtgg caataaacgt
180catccagccg ctcgcgaacg tttcctgaac gaaattgcgt cctcctccgt
cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag accttcttgg
aagaacgtgt tcactgtatt 300accggtgaga ttactgaatc ccgttttggt
ttgacacctg agcgttttcg tgctttggcc 360ggtcaggttg acgcttttat
tcatagcgct gcaagcgtga actttcgtga gcaattggat 420aaagccctga
aaatcaacac cttgtgtctt gaaaatgttg ctgcacttgc agaattgaac
480tccgctatgg cggtcattca ggtttccact tgttacgtta acggtaaaac
ctccggtcaa 540attaccgaat ccgtcattaa atcgaacggc gaatccattc
cccgttccac tgacggttac 600tacgagatcg aagaattggt ccatctgttg
caagacaaga tttccgatgt taaagctcat 660tactccggcc gtgttatggg
gaaaaaattg gttgatttgg gtattcgtga ggccaataat 720tacggatggt
ccgacaccta cacattcacc aaatggttgg gtgaacaact gctgatgaag
780gccttgtctg gtcgttcttt gactattgtg cgtccctcta ttattgagtc
cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt aaagttgccg
atgccattat cttggcttat 900gcccgtgaaa aagttagcct gttccctgga
aaacgttccg gcattctgga ttttattcct 960gtcgatttgg ttgcgaactc
catcatcttg tctctggctg aggcgttgtc tggttctggt 1020caacgtcgta
tttatcaatg ttgcagcggt ggttctaatc cattttccct gggtaagttc
1080tttgattatt tgaacgccga ggctaagacc aactatgctg cctacgatca
actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg aaccgtaaat
tgtttgacgt tgttgttggt 1200gtcatgcgtg ttgtcctttc tattgcccat
aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag tgcttaagaa
ccttgatacg acccgtaaac ttgcaaccat ttttggcttc 1320tatactgctc
ccgactatat cttccgtaac gatagcttga tggccctggc tcagcgtatg
1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc aaattgattg
gcagttgtac 1440ttgtgtaaaa ttcatttgcg tggtctgaac cgttacgctt
tgaagggccg taaactgtat 1500tctgcgcgtg ctgctgatac tgacgatgaa
accgcctaa 153924512PRTArtificial SequenceArtificial polypeptide for
FAR variant 865 24Met Ala Thr Gln Gln Gln Asn Asn Gly Ala Ser Ala
Ser Leu Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys His Val Leu Ile
Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys
Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu
Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe
Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg
His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95
Val His Cys Ile Thr Gly Glu Ile Thr Glu Ser Arg Phe Gly Leu Thr 100
105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile
His 115 120 125 Ser Ala Ala Ser Val Asn Phe Arg Glu Gln Leu Asp Lys
Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala
Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val
Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Thr Ser Gly Gln Ile Thr
Glu Ser Val Ile Lys Ser Asn Gly Glu Ser 180 185 190 Ile Pro Arg Ser
Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu
Gln Asp Lys Ile Ser Asp Val Lys Ala His Tyr Ser Gly Arg 210 215 220
Val Met Gly Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225
230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr
Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro
Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile
Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly
Lys Arg Ser Gly Ile Leu Asp Phe Ile Pro 305 310 315 320 Val Asp Leu
Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala Leu 325 330 335 Ser
Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser Gly Gly Ser 340 345
350 Asn Pro Phe Ser Leu Gly Lys Phe Phe Asp Tyr Leu Asn Ala Glu Ala
355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln Leu Phe Tyr Arg Arg
Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn Arg Lys Leu Phe Asp
Val Val Val Gly 385 390 395 400 Val Met Arg Val Val Leu Ser Ile Ala
His Lys Ala Met Arg Leu Ala 405 410 415 Gly Val Asn Arg Glu Leu Lys
Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430 Lys Leu Ala Thr Ile
Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435 440 445 Arg Asn Asp
Ser Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu Asp 450 455 460 Arg
Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp Gln Leu Tyr 465 470
475 480 Leu Cys Lys Ile His Leu Arg Gly Leu Asn Arg Tyr Ala Leu Lys
Gly 485 490 495 Arg Lys Leu Tyr Ser Ala Arg Ala
Ala Asp Thr Asp Asp Glu Thr Ala 500 505 510 251539DNAArtificial
SequenceArtificial polynucleotide for FAR variant 893 25atggcgactc
aacaacgtaa caacggtgca tctgcatccg gcgtcttgga aattcttcgt 60ggaaagcacg
ttcttatcac aggtactacc ggatttttgg gcaaagtggt tctggaaaag
120ttgattcgta ctgttccgga tattggaggt attcatctgc tgattcgtgg
caataaacgt 180catccagccg ctcgcgaacg tttcctgaac gaaattgcgt
cctcctccgt cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag
accttcttgg aagaacgtgt tcactgtatt 300accggtgaga ttactgaatc
ccattttggt ttgacacctg agcgttttcg tgctttggcc 360ggtcaggttg
acgcttttat tcatagcgct gcaagcgtga actttcgtga gcaattggat
420aaagccctga aaatcaacac cttgtgtctt gaaaatgttg ctgcacttgc
agaattgaac 480tccgctatgg cggtcattca ggtttccact tgttacgtta
acggtaaaac ctccggtcaa 540attaccgaat ccgtcattaa atcggctggc
gaatccattc cccgttccac tgacggttac 600tacgagatcg aagaattggt
ccatctgttg caagacaaga tttccgatgt taaagctcgt 660tactccggcc
gtgttatggg gaaaaaattg gttgatttgg gtattcgtga ggccaataat
720tacggatggt ccgacaccta cacattcacc aaatggttgg gtgaacaact
gctgatgaag 780gccttgtctg gtcgttcttt gactattgtg cgtccctcta
ttattgagtc cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt
aaagttgccg atgccattat cttggcttat 900gcccgtgaaa aagttagcct
gttccctgga aaacgttccg gcattattga ttttattcct 960gtcgatttgg
ttgcgaactc catcatcttg tctctggctg aggcgttgtc tggttctggt
1020caacgtcgta tttatcaatg ttgcagcggt ggttctaatc cactgtccct
gggtaagttc 1080tttgattatt tgaacgccga ggctaagacc aactatgctg
cctacgatca actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg
aaccgtaaat tgtttgacgt tgttgttggt 1200gtcatgcgtg ttgtcctttc
tattgcccgc aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag
tgcttaagaa ccttgatacg acccgtaaac ttgcaaccat ttttggcttc
1320tatactgctc ccgactatat cttccgtaac gatagcttga tggccctggc
tcagcgtatg 1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc
aaattgattg gcagttgtac 1440ttgtgtaaaa ttcatttgcg tggtctgaac
cgttacgctt tgaagggccg taaactgtat 1500tcttcgcgtg ctgctgatac
tgacgatgaa accgcctaa 153926512PRTArtificial SequenceArtificial
polypeptide for FAR variant 893 26Met Ala Thr Gln Gln Arg Asn Asn
Gly Ala Ser Ala Ser Gly Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys
His Val Leu Ile Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val
Val Leu Glu Lys Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly
Ile His Leu Leu Ile Arg Gly Asn Lys Arg His Pro Ala Ala 50 55 60
Arg Glu Arg Phe Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65
70 75 80 Leu Arg His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu
Glu Arg 85 90 95 Val His Cys Ile Thr Gly Glu Ile Thr Glu Ser His
Phe Gly Leu Thr 100 105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln
Val Asp Ala Phe Ile His 115 120 125 Ser Ala Ala Ser Val Asn Phe Arg
Glu Gln Leu Asp Lys Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu
Glu Asn Val Ala Ala Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met
Ala Val Ile Gln Val Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Thr
Ser Gly Gln Ile Thr Glu Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185
190 Ile Pro Arg Ser Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His
195 200 205 Leu Leu Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser
Gly Arg 210 215 220 Val Met Gly Lys Lys Leu Val Asp Leu Gly Ile Arg
Glu Ala Asn Asn 225 230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe
Thr Lys Trp Leu Gly Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser
Gly Arg Ser Leu Thr Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser
Ala Leu Glu Glu Pro Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys
Val Ala Asp Ala Ile Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val
Ser Leu Phe Pro Gly Lys Arg Ser Gly Ile Ile Asp Phe Ile Pro 305 310
315 320 Val Asp Leu Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala
Leu 325 330 335 Ser Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser
Gly Gly Ser 340 345 350 Asn Pro Leu Ser Leu Gly Lys Phe Phe Asp Tyr
Leu Asn Ala Glu Ala 355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln
Leu Phe Tyr Arg Arg Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn
Arg Lys Leu Phe Asp Val Val Val Gly 385 390 395 400 Val Met Arg Val
Val Leu Ser Ile Ala Arg Lys Ala Met Arg Leu Ala 405 410 415 Gly Val
Asn Arg Glu Leu Lys Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430
Lys Leu Ala Thr Ile Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435
440 445 Arg Asn Asp Ser Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu
Asp 450 455 460 Arg Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp
Gln Leu Tyr 465 470 475 480 Leu Cys Lys Ile His Leu Arg Gly Leu Asn
Arg Tyr Ala Leu Lys Gly 485 490 495 Arg Lys Leu Tyr Ser Ser Arg Ala
Ala Asp Thr Asp Asp Glu Thr Ala 500 505 510 271539DNAArtificial
SequenceArtificial polynucleotide for FAR variant 1029 27atggcgactt
atcaacgtaa caacggtgca tctgcatccg gcgtcttgga aattcttcgt 60ggaaagcacg
ttcttatcac aggtactacc ggatttttgg gcaaagtggt tctggaaaag
120ttgattcgta ctgttccgga tattggaggt attcatctgc tgattcgtgg
caataaacgt 180catcaggccg ctcgcgaacg tttcctgaac gaaattgcgt
cctcctccgt cttcgaacgt 240ttgcgtcacg atgataatga agccttcgag
accttcttgg aagaacgtgt tcactgtatt 300accggtgaga ttactgaatc
ccattttggt ttgacacctg agcgttttcg tgctttggcc 360ggtcaggttg
acgcttttat tcatagcgct gcaagcgtga actttcgtga gcaattggat
420aaagccctga aaatcaacac cttgtgtctt gaaaatgttg ctgcacttgc
agaattgaac 480tccgctatgg cggtcattca ggtttccact tgttacgtta
acggtaaaac ctccggtcaa 540attaccgaat ccgtcattaa atcggctggc
gaatccattc cccgttccac tgacggttac 600tacgagatcg aagaattggt
ccatctgttg caagacaaga tttccgatgt taaagctcgt 660tactccggcc
gtgttatggg gaaaaaattg gttgatttgg gtattcgtga ggccaataat
720tacggatggt ccgacaccta cacattcacc aaatggttgg gtgaacaact
gctgatgaag 780gccttgtctg gtcgttcttt gactattgtg cgtccctcta
ttattgagtc cgctttggaa 840gaaccttccc ctggttggat cgaaggcgtt
aaagttgccg atgccattat cttggcttat 900gcccgtgaaa aagttagcct
gttccctgga aaacgttccg gcattctgga ttttattcct 960gtcgatttgg
ttgcgaactc catcatcttg tctctggctg aggcgttgtc tggttctggt
1020caacgtcgta tttatcaatg ttgcagcggt ggttctaatc cactgtccct
gggtaagttc 1080tttgattatt tgaacgccga ggctaagacc aactatgctg
cctacgatca actgttttat 1140cgtcgtccta ctaaaccttt cgtcgccgtg
aaccgtaaat tgtttgacgt tgttgttggt 1200gtcatgcgtg ttgtcctttc
tattgcccat aaagctatgc gtttggctgg tgtaaatcgt 1260gagttgaaag
tgcttaagaa ccttgatacg acccgtaaac ttgcaaccat ttttggcttc
1320tatactgctc ccgactatat cttccgtaac gatagcttga tggccctggc
tcagcgtatg 1380ggtgaattgg atcgtgttct tttcccagtt gatgctcgtc
aaattgattg gcagttgtac 1440ttgtgtaaaa ttcatttgcg tggtctgaac
cgttacgctt tgaagggccg taaactgtat 1500tcttcgcgtg ctgctgatca
tgacgatgaa attgcctaa 153928512PRTArtificial SequenceArtificial
polypeptide for FAR variant 1029 28Met Ala Thr Tyr Gln Arg Asn Asn
Gly Ala Ser Ala Ser Gly Val Leu 1 5 10 15 Glu Ile Leu Arg Gly Lys
His Val Leu Ile Thr Gly Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val
Val Leu Glu Lys Leu Ile Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly
Ile His Leu Leu Ile Arg Gly Asn Lys Arg His Gln Ala Ala 50 55 60
Arg Glu Arg Phe Leu Asn Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65
70 75 80 Leu Arg His Asp Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu
Glu Arg 85 90 95 Val His Cys Ile Thr Gly Glu Ile Thr Glu Ser His
Phe Gly Leu Thr 100 105 110 Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln
Val Asp Ala Phe Ile His 115 120 125 Ser Ala Ala Ser Val Asn Phe Arg
Glu Gln Leu Asp Lys Ala Leu Lys 130 135 140 Ile Asn Thr Leu Cys Leu
Glu Asn Val Ala Ala Leu Ala Glu Leu Asn 145 150 155 160 Ser Ala Met
Ala Val Ile Gln Val Ser Thr Cys Tyr Val Asn Gly Lys 165 170 175 Thr
Ser Gly Gln Ile Thr Glu Ser Val Ile Lys Ser Ala Gly Glu Ser 180 185
190 Ile Pro Arg Ser Thr Asp Gly Tyr Tyr Glu Ile Glu Glu Leu Val His
195 200 205 Leu Leu Gln Asp Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser
Gly Arg 210 215 220 Val Met Gly Lys Lys Leu Val Asp Leu Gly Ile Arg
Glu Ala Asn Asn 225 230 235 240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe
Thr Lys Trp Leu Gly Glu Gln 245 250 255 Leu Leu Met Lys Ala Leu Ser
Gly Arg Ser Leu Thr Ile Val Arg Pro 260 265 270 Ser Ile Ile Glu Ser
Ala Leu Glu Glu Pro Ser Pro Gly Trp Ile Glu 275 280 285 Gly Val Lys
Val Ala Asp Ala Ile Ile Leu Ala Tyr Ala Arg Glu Lys 290 295 300 Val
Ser Leu Phe Pro Gly Lys Arg Ser Gly Ile Leu Asp Phe Ile Pro 305 310
315 320 Val Asp Leu Val Ala Asn Ser Ile Ile Leu Ser Leu Ala Glu Ala
Leu 325 330 335 Ser Gly Ser Gly Gln Arg Arg Ile Tyr Gln Cys Cys Ser
Gly Gly Ser 340 345 350 Asn Pro Leu Ser Leu Gly Lys Phe Phe Asp Tyr
Leu Asn Ala Glu Ala 355 360 365 Lys Thr Asn Tyr Ala Ala Tyr Asp Gln
Leu Phe Tyr Arg Arg Pro Thr 370 375 380 Lys Pro Phe Val Ala Val Asn
Arg Lys Leu Phe Asp Val Val Val Gly 385 390 395 400 Val Met Arg Val
Val Leu Ser Ile Ala His Lys Ala Met Arg Leu Ala 405 410 415 Gly Val
Asn Arg Glu Leu Lys Val Leu Lys Asn Leu Asp Thr Thr Arg 420 425 430
Lys Leu Ala Thr Ile Phe Gly Phe Tyr Thr Ala Pro Asp Tyr Ile Phe 435
440 445 Arg Asn Asp Ser Leu Met Ala Leu Ala Gln Arg Met Gly Glu Leu
Asp 450 455 460 Arg Val Leu Phe Pro Val Asp Ala Arg Gln Ile Asp Trp
Gln Leu Tyr 465 470 475 480 Leu Cys Lys Ile His Leu Arg Gly Leu Asn
Arg Tyr Ala Leu Lys Gly 485 490 495 Arg Lys Leu Tyr Ser Ser Arg Ala
Ala Asp His Asp Asp Glu Ile Ala 500 505 510 298PRTArtificial
SequenceArtificial polypeptide 29Thr Gly Xaa Xaa Gly Xaa Xaa Gly 1
5 30311PRTBermanella marisrubri 30Met Ser Gln Tyr Ser Ala Phe Ser
Val Ser Gln Ser Leu Lys Gly Lys 1 5 10 15 His Ile Phe Leu Thr Gly
Val Thr Gly Phe Leu Gly Lys Ala Ile Leu 20 25 30 Glu Lys Leu Leu
Tyr Ser Val Pro Gln Leu Ala Gln Ile His Ile Leu 35 40 45 Val Arg
Gly Gly Lys Val Ser Ala Lys Lys Arg Phe Gln His Asp Ile 50 55 60
Leu Gly Ser Ser Ile Phe Glu Arg Leu Lys Glu Gln His Gly Glu His 65
70 75 80 Phe Glu Glu Trp Val Gln Ser Lys Ile Asn Leu Val Glu Gly
Glu Leu 85 90 95 Thr Gln Pro Met Phe Asp Leu Pro Ser Ala Glu Phe
Ala Gly Leu Ala 100 105 110 Asn Gln Leu Asp Leu Ile Ile Asn Ser Ala
Ala Ser Val Asn Phe Arg 115 120 125 Glu Asn Leu Glu Lys Ala Leu Asn
Ile Asn Thr Leu Cys Leu Asn Asn 130 135 140 Ile Ile Ala Leu Ala Gln
Tyr Asn Val Ala Ala Gln Thr Pro Val Met 145 150 155 160 Gln Ile Ser
Thr Cys Tyr Val Asn Gly Phe Asn Lys Gly Gln Ile Asn 165 170 175 Glu
Glu Val Val Gly Pro Ala Ser Gly Leu Ile Pro Gln Leu Ser Gln 180 185
190 Asp Cys Tyr Asp Ile Asp Ser Val Phe Lys Arg Val His Ser Gln Ile
195 200 205 Glu Gln Val Lys Lys Arg Lys Thr Asp Ile Glu Gln Gln Glu
Gln Ala 210 215 220 Leu Ile Lys Leu Gly Ile Lys Thr Ser Gln His Phe
Gly Trp Asn Asp 225 230 235 240 Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln Leu Leu Ile Gln Lys 245 250 255 Leu Gly Lys Gln Ser Leu Thr
Ile Leu Arg Pro Ser Ile Ile Glu Ser 260 265 270 Ala Val Arg Glu Pro
Ala Pro Gly Trp Val Glu Gly Val Lys Val Ala 275 280 285 Asp Ala Leu
Ile Tyr Ala Tyr Ala Lys Gly Arg Val Ser Ile Phe Pro 290 295 300 Gly
Arg Asp Glu Gly Ile Leu 305 310 31317PRTMarinobacter aquaeolei
31Met Ala Ile Gln Gln Val His His Ala Asp Thr Ser Ser Ser Lys Val 1
5 10 15 Leu Gly Gln Leu Arg Gly Lys Arg Val Leu Ile Thr Gly Thr Thr
Gly 20 25 30 Phe Leu Gly Lys Val Val Leu Glu Arg Leu Ile Arg Ala
Val Pro Asp 35 40 45 Ile Gly Ala Ile Tyr Leu Leu Ile Arg Gly Asn
Lys Arg His Pro Asp 50 55 60 Ala Arg Ser Arg Phe Leu Glu Glu Ile
Ala Thr Ser Ser Val Phe Asp 65 70 75 80 Arg Leu Arg Glu Ala Asp Ser
Glu Gly Phe Asp Ala Phe Leu Glu Glu 85 90 95 Arg Ile His Cys Val
Thr Gly Glu Val Thr Glu Ala Gly Phe Gly Ile 100 105 110 Gly Gln Glu
Asp Tyr Arg Lys Leu Ala Thr Glu Leu Asp Ala Val Ile 115 120 125 Asn
Ser Ala Ala Ser Val Asn Phe Arg Glu Glu Leu Asp Lys Ala Leu 130 135
140 Ala Ile Asn Thr Leu Cys Leu Arg Asn Ile Ala Gly Met Val Asp Leu
145 150 155 160 Asn Pro Lys Leu Ala Val Leu Gln Val Ser Thr Cys Tyr
Val Asn Gly 165 170 175 Met Asn Ser Gly Gln Val Thr Glu Ser Val Ile
Lys Pro Ala Gly Glu 180 185 190 Ala Val Pro Arg Ser Pro Asp Gly Phe
Tyr Glu Ile Glu Glu Leu Val 195 200 205 Arg Leu Leu Gln Asp Lys Ile
Glu Asp Val Gln Ala Arg Tyr Ser Gly 210 215 220 Lys Val Leu Glu Arg
Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn 225 230 235 240 Arg Tyr
Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu 245 250 255
Gln Leu Leu Met Lys Ala Leu Asn Gly Arg Thr Leu Thr Ile Leu Arg 260
265 270 Pro Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ala Pro Gly Trp
Ile 275 280 285 Glu Gly Val Lys Val Ala Asp Ala Ile Ile Leu Ala Tyr
Ala Arg Glu 290 295 300 Lys Val Thr Leu Phe Pro Gly Lys Arg Ser Gly
Ile Ile 305 310 315 32315PRTMarinobacter adhaerens 32Met Ala Thr
Gln Gln Leu Asn Pro Asp Ala Ser Ser Lys Val Leu Glu 1 5 10 15 Arg
Leu Arg Gly Lys His Val Leu Ile Thr Gly Thr Thr Gly Phe Leu 20 25
30 Gly Lys Val Val Leu Glu Lys Leu Ile Arg Ala Val Pro Asp Ile Gly
35 40 45 Gly Ile His Leu Leu Ile Arg Gly Asn Lys Arg His Pro Asp
Ala Arg 50 55 60 Asp Arg Phe Phe Glu Glu Ile Ala Thr Ser Ser Val
Phe Asp Arg Leu 65 70 75 80 Arg Gln Asp Asp Asn Glu Ala Phe Glu Thr
Phe Ile Glu Asp Arg Val 85 90
95 His Cys Val Thr Gly Glu Val Thr Glu Pro Leu Phe Gly Leu Ser Ala
100 105 110 Asp Arg Phe Arg Lys Leu Ala Gly Gly Ile Asp Val Val Val
Asn Ser 115 120 125 Ala Ala Ser Val Asn Phe Arg Glu Glu Leu Asp Lys
Ala Leu Ala Ile 130 135 140 Asn Thr Arg Cys Leu Asp Asn Val Ala Glu
Leu Ala Arg Gln Asn Lys 145 150 155 160 Ser Leu Ala Val Leu Gln Val
Ser Thr Cys Tyr Val Asn Gly Met Asn 165 170 175 Ser Gly Gln Ile Thr
Glu Thr Val Ile Lys Pro Ala Gly Glu Ala Ile 180 185 190 Pro Arg Ser
Thr Glu Gly Tyr Tyr Glu Ile Glu Glu Leu Val Arg Leu 195 200 205 Leu
Glu Asp Lys Ile Ala Asp Val Arg Ser Arg Tyr Ser Gly Lys Ala 210 215
220 Leu Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn His Tyr
225 230 235 240 Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly
Glu Gln Leu 245 250 255 Leu Leu Lys Ala Leu Ser Gly Arg Ala Leu Thr
Ile Val Arg Pro Ser 260 265 270 Ile Ile Glu Ser Ala Leu Glu Glu Pro
Ala Pro Gly Trp Ile Glu Gly 275 280 285 Val Lys Val Ala Asp Ala Ile
Ile Leu Ala Tyr Ala Arg Glu Lys Val 290 295 300 Thr Leu Phe Pro Gly
Lys Arg Ala Gly Val Ile 305 310 315 33308PRTHahella chejuensis
33Met Lys Gln Ser Leu Thr Leu Thr Ala Phe Ala Asn Lys Asn Val Leu 1
5 10 15 Ile Thr Gly Thr Thr Gly Phe Val Gly Lys Val Val Leu Glu Lys
Leu 20 25 30 Leu Arg Ser Val Pro Thr Ile Gly Lys Ile Tyr Leu Leu
Ile Arg Gly 35 40 45 Asn Ser Lys Asn Pro Thr Ala Arg Lys Arg Phe
Gln Asn Glu Ile Ala 50 55 60 Thr Ser Ser Ile Phe Asp Thr Leu Lys
Ala Ser Gln Gly Ser Arg Phe 65 70 75 80 Glu Glu Leu Cys Glu Thr Arg
Ile His Cys Val Thr Gly Glu Val Thr 85 90 95 Glu Pro Leu Phe Gly
Leu Ser Glu Lys Asp Phe Thr Asp Leu Ala Ala 100 105 110 Asp Ile Asp
Val Ile Ile Asn Ser Ala Ala Ser Val Asn Phe Arg Glu 115 120 125 Ala
Leu Asp Gln Ala Leu Thr Ile Asn Thr Leu Cys Leu Lys Asn Ile 130 135
140 Ile Glu Leu Ser Arg Arg Ala Ala Asp Cys Pro Val Val Gln Val Ser
145 150 155 160 Thr Cys Tyr Val Asn Gly Phe Asn Gln Gly Val Met Glu
Glu Glu Ile 165 170 175 Val Ser Pro Ala Gly Glu Arg Ile Glu Arg Ser
Glu Arg Gly Tyr Tyr 180 185 190 Glu Val Glu Pro Leu Ile Ala Arg Leu
Leu Gln Asp Val Glu Gln Val 195 200 205 Ser Ala Ala Ala Ala Asp Asp
His Ser Arg Glu Lys Asp Leu Ile Asp 210 215 220 Leu Gly Ile Lys Glu
Ala Asn Lys Tyr Gly Trp Asn Asp Thr Tyr Thr 225 230 235 240 Phe Thr
Lys Trp Met Gly Glu Gln Leu Leu Met Lys Glu Leu Tyr Gly 245 250 255
Lys Thr Leu Thr Ile Leu Arg Pro Ser Ile Val Glu Ser Thr Leu Leu 260
265 270 Gly Pro Ala Pro Gly Trp Ile Glu Gly Val Lys Val Ala Asp Ala
Ile 275 280 285 Ile Leu Ala Tyr Ala Arg Glu Lys Val Ser Leu Phe Pro
Gly Lys Lys 290 295 300 Asn Ala Val Ile 305 34316PRTMarinobacter
algicola 34Met Ala Thr Gln Gln Gln Gln Asn Gly Ala Ser Ala Ser Gly
Val Leu 1 5 10 15 Glu Gln Leu Arg Gly Lys His Val Leu Ile Thr Gly
Thr Thr Gly Phe 20 25 30 Leu Gly Lys Val Val Leu Glu Lys Leu Ile
Arg Thr Val Pro Asp Ile 35 40 45 Gly Gly Ile His Leu Leu Ile Arg
Gly Asn Lys Arg His Pro Ala Ala 50 55 60 Arg Glu Arg Phe Leu Asn
Glu Ile Ala Ser Ser Ser Val Phe Glu Arg 65 70 75 80 Leu Arg His Asp
Asp Asn Glu Ala Phe Glu Thr Phe Leu Glu Glu Arg 85 90 95 Val His
Cys Ile Thr Gly Glu Val Thr Glu Ser Arg Phe Gly Leu Thr 100 105 110
Pro Glu Arg Phe Arg Ala Leu Ala Gly Gln Val Asp Ala Phe Ile Asn 115
120 125 Ser Ala Ala Ser Val Asn Phe Arg Glu Glu Leu Asp Lys Ala Leu
Lys 130 135 140 Ile Asn Thr Leu Cys Leu Glu Asn Val Ala Ala Leu Ala
Glu Leu Asn 145 150 155 160 Ser Ala Met Ala Val Ile Gln Val Ser Thr
Cys Tyr Val Asn Gly Lys 165 170 175 Asn Ser Gly Gln Ile Thr Glu Ser
Val Ile Lys Pro Ala Gly Glu Ser 180 185 190 Ile Pro Arg Ser Thr Asp
Gly Tyr Tyr Glu Ile Glu Glu Leu Val His 195 200 205 Leu Leu Gln Asp
Lys Ile Ser Asp Val Lys Ala Arg Tyr Ser Gly Lys 210 215 220 Val Leu
Glu Lys Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn 225 230 235
240 Tyr Gly Trp Ser Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu Gln
245 250 255 Leu Leu Met Lys Ala Leu Ser Gly Arg Ser Leu Thr Ile Val
Arg Pro 260 265 270 Ser Ile Ile Glu Ser Ala Leu Glu Glu Pro Ser Pro
Gly Trp Ile Glu 275 280 285 Gly Val Lys Val Ala Asp Ala Ile Ile Leu
Ala Tyr Ala Arg Glu Lys 290 295 300 Val Ser Leu Phe Pro Gly Lys Arg
Ser Gly Ile Ile 305 310 315 3552PRTArabidopsis thaliana 35Thr Met
Lys Asp Leu Gly Leu Arg Arg Ala Lys Met Tyr Gly Trp Pro 1 5 10 15
Asn Thr Tyr Val Phe Thr Lys Ala Met Gly Glu Met Met Val Gly Thr 20
25 30 Lys Arg Glu Asn Leu Ser Leu Val Leu Leu Arg Pro Ser Ile Ile
Thr 35 40 45 Ser Thr Phe Lys 50 3652PRTSimmondsia chinensis 36Thr
Met Lys Asp Met Gly Ile Glu Arg Ala Arg His Trp Gly Trp Pro 1 5 10
15 Asn Val Tyr Val Phe Thr Lys Ala Leu Gly Glu Met Leu Leu Met Gln
20 25 30 Tyr Lys Gly Asp Ile Pro Leu Thr Ile Ile Arg Pro Thr Ile
Ile Thr 35 40 45 Ser Thr Phe Lys 50 3752PRTArabidopsis thaliana
37Lys Leu Lys Glu Leu Gly Phe Glu Arg Ala Gln His Tyr Gly Trp Glu 1
5 10 15 Asn Ser Tyr Thr Phe Thr Lys Ala Ile Gly Glu Ala Val Ile His
Ser 20 25 30 Lys Arg Gly Asn Leu Pro Val Val Ile Ile Arg Pro Ser
Ile Ile Glu 35 40 45 Ser Ser Tyr Asn 50 3852PRTArabidopsis thaliana
38Thr Met Lys Asp Phe Gly Met Ala Arg Ala Lys Leu His Gly Trp Pro 1
5 10 15 Asn Thr Tyr Val Phe Thr Lys Ala Met Gly Glu Met Leu Met Gly
Lys 20 25 30 Tyr Arg Glu Asn Leu Pro Leu Val Ile Ile Arg Pro Thr
Met Ile Thr 35 40 45 Ser Thr Ile Ala 50 3952PRTArabidopsis thaliana
39Lys Met Lys Asp Leu Gly Leu Glu Arg Ala Arg Ser Tyr Gly Trp Gln 1
5 10 15 Asp Thr Tyr Val Phe Thr Lys Ala Met Gly Glu Met Met Ile Asn
Ser 20 25 30 Thr Arg Gly Asp Val Pro Val Val Ile Ile Arg Pro Ser
Val Ile Glu 35 40 45 Ser Thr Tyr Lys 50 4052PRTArabidopsis thaliana
40Lys Leu Lys Glu Leu Gly Phe Glu Arg Ala Gln His Tyr Gly Trp Glu 1
5 10 15 Asn Ser Tyr Thr Phe Thr Lys Ala Ile Gly Glu Ala Val Ile His
Ser 20 25 30 Lys Arg Gly Asn Leu Pro Val Val Ile Ile Arg Pro Ser
Ile Ile Glu 35 40 45 Ser Ser Tyr Asn 50 4152PRTTriticum aestivum
41Ala Met Lys Asp Leu Gly Ile Thr Arg Ala Arg His Phe Gly Trp Pro 1
5 10 15 Asn Thr Tyr Val Phe Thr Lys Ser Met Gly Glu Met Val Leu Gly
Gln 20 25 30 Leu Lys Cys Asp Leu Pro Val Val Ile Val Arg Pro Ser
Ile Ile Thr 35 40 45 Ser Val Gln Asn 50 4245PRTBombyx mori 42Met
Ile Lys Phe Ile Gly Asn His Pro Asn Thr Tyr Ala Tyr Thr Lys 1 5 10
15 Ala Leu Ala Glu Asn Leu Val Ala Glu Glu His Gly Glu Ile Pro Thr
20 25 30 Ile Ile Ile Arg Pro Ser Ile Ile Thr Ala Ser Ala Glu 35 40
45 4345PRTMus musculus 43Thr Pro Lys Leu Ile Gly Asp Arg Pro Asn
Thr Tyr Ile Tyr Thr Lys 1 5 10 15 Ala Leu Ala Glu Tyr Val Val Gln
Gln Glu Gly Ala Lys Leu Asn Val 20 25 30 Ala Ile Val Arg Pro Ser
Ile Val Gly Ala Ser Trp Lys 35 40 45 4452PRTMarinobacter algicola
44Lys Leu Val Asp Leu Gly Ile Arg Glu Ala Asn Asn Tyr Gly Trp Ser 1
5 10 15 Asp Thr Tyr Thr Phe Thr Lys Trp Leu Gly Glu Gln Leu Leu Met
Lys 20 25 30 Ala Leu Ser Gly Arg Ser Leu Thr Ile Val Arg Pro Ser
Ile Ile Glu 35 40 45 Ser Ala Leu Glu 50 45682DNAArtificial
SequenceSynthetic polynucleotide for EcoRV-NcoI region from pLS8379
45gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat cccgccgtta
60accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa
120ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact
ggtgaaaaga 180aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc
gcgcgttggc cgattcatta 240atgcagctgg cacgacaggt ttcccgactg
gaaagcgggc agtaataatt taaattggtt 300tgacagctta tcatcgactg
cacggtgcac caatgcttct ggcgtcaggc agccatcgga 360agctgtggta
tggctgtgca ggtcgtaaat cactgcataa ttcgtgtcgc tcaaggcgca
420ctcccgttct ggataatgtt ttttgcgccg acataattgt gagcgctcac
aatttctgaa 480atgagctgtt gacaattaat catccggctc gtataatgtg
tggaattgtg agcggataac 540aatttcacac aggaaacagc gccgctgaga
aaaagcgaag cggcactgct ctttaacaat 600ttatcagaca atctgtgtgg
gcactcgacc ggaattatcg attaacttta ttattaaaaa 660ttaaaggagg
aataaaccat gg 682465905DNAArtificial SequenceSynthetic
polynucleotide plasmid pLS8379 46ggcatccgct tacagacaag ctgtgaccgt
ctccgggagc tgcatgtgtc agaggttttc 60accgtcatca ccgaaacgcg cgaggcagca
gatcaattcg cgcgcgaagg cgaagcggca 120tgcatttacg ttgacaccat
cgaatggtgc aaaacctttc gcggtatggc atgatagcgc 180ccggaagaga
gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca
240gagtatgccg gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc
cagccacgtt 300tctgcgaaaa cgcgggaaaa agtggaagcg gcgatggcgg
agctgaatta cattcccaac 360cgcgtggcac aacaactggc gggcaaacag
tcgttgctga ttggcgttgc cacctccagt 420ctggccctgc acgcgccgtc
gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg 480ggtgccagcg
tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg
540gtgcacaatc ttctcgcgca acgcgtcagt gggctgatca ttaactatcc
gctggatgac 600caggatgcca ttgctgtgga agctgcctgc actaatgttc
cggcgttatt tcttgatgtc 660tctgaccaga cacccatcaa cagtattatt
ttctcccatg aagacggtac gcgactgggc 720gtggagcatc tggtcgcatt
gggtcaccag caaatcgcgc tgttagcggg cccattaagt 780tctgtctcgg
cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt
840cagccgatag cggaacggga aggcgactgg agtgccatgt ccggttttca
acaaaccatg 900caaatgctga atgagggcat cgttcccact gcgatgctgg
ttgccaacga tcagatggcg 960ctgggcgcaa tgcgcgccat taccgagtcc
gggctgcgcg ttggtgcgga tatctcggta 1020gtgggatacg acgataccga
agacagctca tgttatatcc cgccgttaac caccatcaaa 1080caggattttc
gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc
1140caggcggtga agggcaatca gctgttgccc gtctcactgg tgaaaagaaa
aaccaccctg 1200gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg
attcattaat gcagctggca 1260cgacaggttt cccgactgga aagcgggcag
tgagcgcaac gcaattaatg taagttagcg 1320cgaattgatc tggtttgaca
gcttatcatc gactgcacgg tgcaccaatg cttctggcgt 1380caggcagcca
tcggaagctg tggtatggct gtgcaggtcg taaatcactg cataattcgt
1440gtcgctcaag gcgcactccc gttctggata atgttttttg cgccgacatc
ataacggttc 1500tggcaaatat tctgaaatga gctgttgaca attaatcatc
cggctcgtat aatgtgtgga 1560attgtgagcg gataacaatt tcacacagga
aacagcgccg ctgagaaaaa gcgaagcggc 1620actgctcttt aacaatttat
cagacaatct gtgtgggcac tcgaccggaa ttatcgatta 1680actttattat
taaaaattaa agaggtatat attaatgtat cgattaaata aggaggaata
1740aaccatggat ccgagctcga gatctgcagc tggtaccata tgggaattcg
aagctttcta 1800gaacaaaaac tcatctcaga agaggatctg aatagcgccg
tcgaccatca tcatcatcat 1860cattgagttt aaacggtctc cagcttggct
gttttggcgg atgagagaag attttcagcc 1920tgatacagat taaatcagaa
cgcagaagcg gtctgataaa acagaatttg cctggcggca 1980gtagcgcggt
ggtcccacct gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg
2040atggtagtgt ggggtctccc catgcgagag tagggaactg ccaggcatca
aataaaacga 2100aaggctcagt cgaaagactg ggcctttcgt tttatctgtt
gtttgtcggt gaacgctctc 2160ctgaggcgcc tgatgcggta ttttctcctt
acgcatctgt gcggtatttc acaccgcata 2220tggtgcactc tcagtacaat
ctgctctgat gccgcatagt taagccagcc ccgacacccg 2280ccaacacccg
ctgacgagct tagtaaagcc ctcgctagat tttaatgcgg atgttgcgat
2340tacttcgcca actattgcga taacaagaaa aagccagcct ttcatgatat
atctcccaat 2400ttgtgtaggg cttattatgc acgcttaaaa ataataaaag
cagacttgac ctgatagttt 2460ggctgtgagc aattatgtgc ttagtgcatc
taacgcttga gttaagccgc gccgcgaagc 2520ggcgtcggct tgaacgaatt
gttagacatt atttgccgac taccttggtg atctcgcctt 2580tcacgtagtg
gacaaattct tccaactgat ctgcgcgcga ggccaagcga tcttcttctt
2640gtccaagata agcctgtcta gcttcaagta tgacgggctg atactgggcc
ggcaggcgct 2700ccattgccca gtcggcagcg acatccttcg gcgcgatttt
gccggttact gcgctgtacc 2760aaatgcggga caacgtaagc actacatttc
gctcatcgcc agcccagtcg ggcggcgagt 2820tccatagcgt taaggtttca
tttagcgcct caaatagatc ctgttcagga accggatcaa 2880agagttcctc
cgccgctgga cctaccaagg caacgctatg ttctcttgct tttgtcagca
2940agatagccag atcaatgtcg atcgtggctg gctcgaagat acctgcaaga
atgtcattgc 3000gctgccattc tccaaattgc agttcgcgct tagctggata
acgccacgga atgatgtcgt 3060cgtgcacaac aatggtgact tctacagcgc
ggagaatctc gctctctcca ggggaagccg 3120aagtttccaa aaggtcgttg
atcaaagctc gccgcgttgt ttcatcaagc cttacggtca 3180ccgtaaccag
caaatcaata tcactgtgtg gcttcaggcc gccatccact gcggagccgt
3240acaaatgtac ggccagcaac gtcggttcga gatggcgctc gatgacgcca
actacctctg 3300atagttgagt cgatacttcg gcgatcaccg cttccctcat
gatgtttaac tttgttttag 3360ggcgactgcc ctgctgcgta acatcgttgc
tgctccataa catcaaacat cgacccacgg 3420cgtaacgcgc ttgctgcttg
gatgcccgag gcatagactg taccccaaaa aaacagtcat 3480aacaagccat
gaaaaccgcc actgcgccgt taccaccgct gcgttcggtc aaggttctgg
3540accagttgcg tgagcgcata cgctacttgc attacagctt acgaaccgaa
caggcttatg 3600tccactgggt tcgtgccttc atccgtttcc acggtgtgcg
tcacccggca accttgggca 3660gcagcgaagt cgaggcattt ctgtcctggc
tggcgaacga gcgcaaggtt tcggtctcca 3720cgcatcgtca ggcattggcg
gccttgctgt tcttctacgg caaggtgctg tgcacggatc 3780tgccctggct
tcaggagatc ggaagacctc ggccgtcgcg gcgcttgccg gtggtgctga
3840ccccggatga agtggttcgc atcctcggtt ttctggaagg cgagcatcgt
ttgttcgccc 3900agcttctgta tggaacgggc atgcggatca gtgagggttt
gcaactgcgg gtcaaggatc 3960tggatttcga tcacggcacg atcatcgtgc
gggagggcaa gggctccaag gatcgggcct 4020tgatgttacc cgagagcttg
gcacccagcc tgcgcgagca ggggaattaa ttcccacggg 4080ttttgctgcc
cgcaaacggg ctgttctggt gttgctagtt tgttatcaga atcgcagatc
4140cggcttcagc cggtttgccg gctgaaagcg ctatttcttc cagaattgcc
atgatttttt 4200ccccacggga ggcgtcactg gctcccgtgt tgtcggcagc
tttgattcga taagcagcat 4260cgcctgtttc aggctgtcta tgtgtgactg
ttgagctgta acaagttgtc tcaggtgttc 4320aatttcatgt tctagttgct
ttgttttact ggtttcacct gttctattag gtgttacatg 4380ctgttcatct
gttacattgt cgatctgttc atggtgaaca gctttgaatg caccaaaaac
4440tcgtaaaagc tctgatgtat ctatcttttt tacaccgttt tcatctgtgc
atatggacag 4500ttttcccttt gatatgtaac ggtgaacagt tgttctactt
ttgtttgtta gtcttgatgc 4560ttcactgata gatacaagag ccataagaac
ctcagatcct tccgtattta gccagtatgt 4620tctctagtgt ggttcgttgt
ttttgcgtga gccatgagaa cgaaccattg agatcatact 4680tactttgcat
gtcactcaaa aattttgcct caaaactggt gagctgaatt tttgcagtta
4740aagcatcgtg tagtgttttt cttagtccgt tatgtaggta ggaatctgat
gtaatggttg 4800ttggtatttt gtcaccattc atttttatct ggttgttctc
aagttcggtt acgagatcca 4860tttgtctatc tagttcaact tggaaaatca
acgtatcagt cgggcggcct cgcttatcaa 4920ccaccaattt catattgctg
taagtgttta aatctttact tattggtttc aaaacccatt 4980ggttaagcct
tttaaactca tggtagttat tttcaagcat taacatgaac ttaaattcat
5040caaggctaat ctctatattt
gccttgtgag ttttcttttg tgttagttct tttaataacc 5100actcataaat
cctcatagag tatttgtttt caaaagactt aacatgttcc agattatatt
5160ttatgaattt ttttaactgg aaaagataag gcaatatctc ttcactaaaa
actaattcta 5220atttttcgct tgagaacttg gcatagtttg tccactggaa
aatctcaaag cctttaacca 5280aaggattcct gatttccaca gttctcgtca
tcagctctct ggttgcttta gctaatacac 5340cataagcatt ttccctactg
atgttcatca tctgagcgta ttggttataa gtgaacgata 5400ccgtccgttc
tttccttgta gggttttcaa tcgtggggtt gagtagtgcc acacagcata
5460aaattagctt ggtttcatgc tccgttaagt catagcgact aatcgctagt
tcatttgctt 5520tgaaaacaac taattcagac atacatctca attggtctag
gtgattttaa tcactatacc 5580aattgagatg ggctagtcaa tgataattac
tagtcctttt cctttgagtt gtgggtatct 5640gtaaattctg ctagaccttt
gctggaaaac ttgtaaattc tgctagaccc tctgtaaatt 5700ccgctagacc
tttgtgtgtt ttttttgttt atattcaagt ggttataatt tatagaataa
5760agaaagaata aaaaaagata aaaagaatag atcccagccc tgtgtataac
tcactacttt 5820agtcagttcc gcagtattac aaaaggatgt cgcaaacgct
gtttgctcct ctacaaaaca 5880gaccttaaaa ccctaaaggc ttaag
59054722DNAEscherichia coli 47ataaaataag gcttacagag aa
224822DNAEscherichia coli 48accgaaaagt gactgagcgt ac 22
* * * * *
References