Method For The In Vitro Diagnosis Or Prognosis Of Testicular Cancer

Abstract

A method for in vitro diagnosis of testicular cancer includes (i) obtaining a biological sample from a patient suspected of having testicular cancer, (ii) performing an assay to determine the methylation status of CpG dinucleotides in a genomic DNA target sequence, the DNA target sequence being the 5' LTR U3 promoter sequence of the ERVWE1 locus, optionally further including an activator sequence directly upstream of the 5' LTR U3 promoter sequence, and (iii) diagnosing the patient with testicular cancer when the DNA target sequence is hypomethylated as compared to a methylation status indicative of the absence of testicular cancer.

Description

[0001] This is a Division of application Ser. No. 12/918,126 filed Aug. 18, 2010, which is a National Stage entry of PCT/FR2009/050388 filed Mar. 10, 2009, which claims priority to FR 0851621 filed Mar. 12, 2008. The disclosure of the prior applications is hereby incorporated by reference herein in its entirety.

[0002] Testicular cancer represents 1 to 2% of cancers in men, and 3.5% of urological tumors. It is the most common tumor in young men, and rare before 15 years of age and after 50 years of age. The risk is highest in patients who are seropositive for HIV. Seminoma is the most common form of testicular cancer (40%), but many other types of cancer exist, among which are embryonic carcinoma (20%), teratocarcinoma (30%) and choriocarcinoma (1%).

[0003] The diagnosis of testicular cancer is first clinical: it often presents in the form of a hard and irregular swelling of the testicle. An ultrasound confirms the intratesticular tumor and Doppler ultrasound demonstrates the increase in vascularization in the tumor. In some cases, a magnetic resonance examination (testicular MRI) can be useful. A thoracic, abdominal and pelvic scan makes it possible to investigate whether there is any lymph node involvement of the cancer. A blood sample for assaying tumor markers is virtually systematic. It makes it possible to orient the diagnosis of the type of tumor. Two main tumor markers are used and assayed in the blood: .beta.-HCG and .alpha.-foetoprotein. However, these markers are not very specific and, furthermore, if the concentration of these markers is at physiological levels, this does not mean that there is an absence of tumor. At the current time, the final diagnosis and final prognosis are given after ablation of the affected testicle (orchidectomy), which constitutes the first stage of treatment. Next, depending on the type of cancer and on its stage, a complementary treatment by radiotherapy or chemotherapy is applied. There is therefore a real need for having markers which are specific for testicular cancer and which, in addition, make it possible to establish as early a diagnosis and prognosis as possible.

[0004] The rare event represented by the infection of a germline cell by an exogenous provirus results in the integration, into the host's genome, of a proviral DNA or provirus, which becomes an integral part of the genetic inheritance of the host. This endogenous provirus (HERV) is therefore transmissible to the next generation in Mendelien fashion. It is estimated that there are approximately a hundred or so HERV families representing approximately 8% of the human genome. Each of the families has from several tens to thousands of loci, which are the result of intracellular retrotranspositions of transcriptionally active copies. The loci of the contemporary HERV families are all replication-defective, which signifies loss of the infectious properties and therefore implies an exclusively vertical (Mendelien) transmission mode.

[0005] HERV expression has been particularly studied in three specific contexts, placentation, autoimmunity and cancer, which are associated with cell differentiation or with the modulation of immunity. It has thus been shown that the envelope glycoprotein of the ERVWE1 locus of the HERV-W family is involved in the fusion process resulting in syncytiotrophoblast formation. It has, moreover, been suggested that the Rec protein, which is a splice variant of the env gene of HERV-K, could be involved in the testicular tumorogenesis process. However, the following question has not yet been answered: are HERVs players or markers in pathological contexts?

[0006] The present inventors have now discovered and demonstrated that nucleic acid sequences belonging to loci of the HERV-W family are associated with testicular cancer and that these sequences are molecular markers for the pathological condition. The sequences identified are U3 retroviral promoter sequences of 5' LTRs (Long Terminal Repeats) which are hypomethylated in a cancerous biological sample.

[0007] In mammals, DNA can be methylated on the cytosines preceding a guanine (CpG doublet). This involves the transfer of a methyl group from S-adenosyl methionine to a cytosine residue so as to form 5-methylcytosine. The methylation of CpG doublets located in a promoter sequence generally results in an underexpression, or even a lack of expression, of the associated gene. Conversely, if the CpG doublets contained in a promoter sequence are hypomethylated, the expression of the associated gene is favored. The role of methylation in carcinogenesis has been recently studied. Thus, hypermethylation on the CpG doublets can result in the underexpression of a tumor suppressor gene, whereas, conversely, hypomethylation of CpG doublets can cause the activation of protooncogenes.

[0008] The subject of the present invention is therefore a method for in vitro, diagnosis or prognosis of testicular cancer, in a biological sample from a patient suspected of suffering from testicular cancer, characterized in that it comprises a step of detecting the presence or absence of methylation of CpG dinucleotides in at least one genomic DNA target sequence of the sample, the target sequence being selected from at least one of the sequences identified in SEQ ID Nos. 1 to 7 or from at least one sequence which exhibits at least 99% identity, preferably at least 99.5% identity, and advantageously at least 99.6% identity, with one of the sequences identified in SEQ ID Nos. 1 to 7 and the sequences complementary thereto.

[0009] The percentage identity described above has been determined while taking into consideration the nucleotide diversity in the genome. It is known that nucleotide variability is higher in the regions of the genome that are rich in repeat sequences than in the regions which do not contain repeat sequences. By way of example, D. A. Nickerson et al.,.sup.[1] have shown a diversity of approximately 0.3% (0.32%) in regions containing repeat sequences.

[0010] The sequences SEQ ID Nos. 1 to 6 correspond, respectively, to the sequences of the U3 retroviral promoters of the HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 loci, and SEQ ID No. 7 corresponds to the sequence of the activator plus the sequence of the U3 region of ERVWE1.

[0011] The sample from the patient will generally comprise cells (such as the testicular cells). They may be present in a tissue sample (such as the testicular tissue) or be found in the circulation. In general, the sample is a testicular tissue extract or a biological fluid, such as blood, serum, plasma, urine or else seminal fluid.

[0012] More particularly, the method comprises:

(i) extraction of the genomic DNA to be analyzed from the sample, (ii) treatment of the extracted genomic DNA with one or more reagents so as to convert the cytosine bases, of the CpG dinucleotides, which are nonmethylated at position 5, into uracil, (iii) at least one amplification of the treated DNA by bringing into contact with at least two primers, (iv) determination, on the basis of the presence or absence of methylation of the cytosines of the CpG dinucleotides, of a methylation state of said target sequence or of a value which reflects the methylation state of the target sequence, for example the ratio of the number of methylated cytosines of the CpG dinucleotides/total number of cytosines of the CpG dinucleotides. In particular, if the ratio, corresponding to a percentage methylation, is less than or equal to 80%, preferably less than or equal to 60%, and advantageously less than or equal to 30%, this can be correlated with a presumption of testicular cancer.

[0013] If necessary, the method comprises a second amplification step after the amplification step described in (iii), which consists in bringing the amplicons obtained in (iii) into contact with at least two primers in order to amplify the target sequence.

[0014] The term "target sequence" is intended to mean a sequence or the sequences of a set of clones.

[0015] The determination, in the DNA, of the degree of methylation is carried out by any suitable technique. The methylation state or status of a DNA sequence can be established by methods using methylation-sensitive restriction enzymes or by methods involving a chemical modification of the DNA with sodium bisulfite, hydrogen sulfite or disulfite, preferably with a solution of sodium bisulfite, which converts the nonmethylated cytosines into uracils while at the same time not modifying the 5-methylcytosines. The analysis of the methylation can be carried out by conventional methods, such as sequencing, hybridization or PCR. Several methods of analysis use the ammonium bisulfite conversion technique, such as bisulfite sequencing PCR (conversion with ammonium bisulfite, amplification of the sequence of interest and sequencing), MSP (Methylation Specific PCR) and MSO (Methylation Specific Oligonucleotide Microarray) using DNA chips specific for the modified DNA. All these methods are well known to those skilled in the art and mention may be made, by way of illustration, of S. E. Cottrell .sup.[2].

[0016] Thus, in step (ii) of the abovementioned method, the treatment of the genomic DNA comprises the use of a solution selected from the group consisting of hydrogen sulfite, disulfite and bisulfite, and combinations thereof; preferably, a solution of sodium bisulfite.

[0017] In one embodiment of the invention, the method for in vitro diagnosis and/or prognosis of testicular cancer comprises:

(i) extraction of the DNA to be analyzed from the sample from the patient, (ii) determination, in the DNA to be analyzed, of the degree (percentage) of methylation of the cytosines of the CpG dinucleotides included in at least one of the DNA sequences identified in SEQ ID Nos. 1 to 7 or in at least one sequence which exhibits at least 99% identity, preferably at least 99.5%, advantageously at least 99.6% identity, with a sequence identified in SEQ ID Nos. 1 to 7, and (iii) comparison of the degree (percentage) of methylation of the cytosines in one or more DNA sequences as defined in (ii) with the degree (percentage) of methylation of said cytosines of said sequence(s) present in the DNA extracted from a noncancerous biological sample; if the degree of methylation in the DNA to be analyzed is determined as being less than the degree of methylation in the DNA extracted from the noncancerous biological sample, this can be correlated with the diagnosis or prognosis of a testicular cancer.

[0018] The term "hypomethylated sequence" is therefore intended to mean a DNA sequence comprising one or more CpG doublets, in which a cytosine of at least one CpG dinucleotide or doublet is not methylated at position 5 (i.e. which does not contain a CH.sub.3 radical at the fifth position of the cytosine base) in comparison with the same DNA sequence derived from the same type of noncancerous sample. In order to determine the methylation state or status of a target sequence, the following ratio can be calculated:

number of methylated cytosines of the CpG dinucleotides/total number of cytosines of the CpG dinucleotides. If the ratio, corresponding to a percentage methylation, is less than or equal to 80%, preferably less than or equal to 60%, and advantageously less than or equal to 30%, this can be correlated with a presumption of testicular cancer.

[0019] The subject of the invention is also an isolated nucleic acid sequence consisting of at least one DNA sequence selected from the sequences identified in SEQ ID Nos. 1 to 7 or from at least one sequence which exhibits at least 99% identity (preferably at least 99.5% or 99.6% identity) with one of the sequences identified in SEQ ID Nos. 1 to 7 and the sequences complementary thereto. The abovementioned sequences which are associated with testicular cancer are used as molecular markers for testicular cancer.

FIGURES

[0020] FIG. 1 represents the principle of the WTA method for amplifying RNAs.

[0021] FIG. 2 represents a synoptic scheme of the nature and the sequence of the various steps for preprocessing DNA-chip data according to the RMA method.

[0022] FIG. 3 illustrates the nomenclature, the position and the structure of the HERV-W loci overexpressed and exhibiting a loss of methylation in the tumoral testicle.

[0023] FIG. 4 is a histogram representing the increase in expression of five loci (HW4TT, HW2TT, HW13TT, HWXTT and HW21TT), respectively, in three pairs of testicular samples (testicle 1, testicle 2 and testicle 3), based on a comparative tumor sample/healthy sample quantification. The loci are represented along the x-axis and the factors of increase of expression between tumor tissue and healthy tissue are represented along the y-axis.

[0024] FIGS. 5 to 10 represent the methylation status of the U3 region of unique LTR or of the 5' LTR of the various loci, respectively HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 in the healthy testicle (normal) and in the tumoral testicle derived from the same patient, after amplification and analysis of the sequences obtained.

EXAMPLES

Example 1

Identification of HERV-W loci Expressed in Cancerous Tissues

[0025] Method:

[0026] The identification of expressed HERV-W loci is based on the design of a high-density DNA chip in the GeneChip format proposed by the company Affymetrix. It is a specially developed, custom-made chip, the probes of which correspond to HERV-W loci. The sequences of the HERV-W family were identified from the GenBank nucleic databank using the Blast algorithm (Altschul et al., 1990) with the sequence of the ERVWE1 locus, located on chromosome 7 at 7q21.2 and encoding the protein called syncytin. The sequences homologous to HERV-W were compared to a library containing reference sequences of the HERV-W family (ERVWE1) cut up into functional regions (LTR, gag, pol and env), using the RepeatMasker software (A. F. A. Smit and P. Green). These elements constitute the HERVgDB bank.

[0027] The probes making up the high-density chip were defined on a criterion of uniqueness of their sequences in the HERVgDB bank. The HERV-W proviral and solitary LTRs contained in the HERVgDB bank were extracted. Each of these sequences was broken down into a set of sequences of 25 nucleotides (25-mers) constituting it, i.e. as many potential probes. The evaluation of the uniqueness of each probe was carried out by means of a similarity search with all the 25-mers generated for all the LTRs of the family under consideration. This made it possible to identify all the 25-mers of unique occurrence for each family of HERV. Next, some of these 25-mers were retained as probes. For each U3 or U5 target region, a set of probes was formed on the basis of the probes identified as unique.

[0028] The samples analyzed using the HERV high-density chip correspond to RNAs extracted from tumors and to RNAs extracted from the healthy tissues adjacent to these tumors. The tissues analyzed are: uterus, colon, lung, breast, testicle, prostate and ovary. Placental RNAs (health tissue only) were also analyzed. For each sample, 400 ng of total RNA were amplified by means of an unbiased transcriptional method known as WTA. The principle of WTA amplification is the following: primers (RP-T7) comprising a random sequence and a T7 promoter sequence are hybridized to the transcripts; double-standard cDNAs are synthesized and serve as a template for transcriptional amplification by the T7 RNA polymerase; the antisense RNAs generated are converted to double-stranded cDNAs which are then fragmented and labeled by introducing biotinylated nucleotide analogs at the 3'OH ends using terminal transferase (TdT) (cf. FIG. 1).

[0029] For each sample, 16 .mu.g of biotin-labeled amplification products were hybridized to a DNA chip according to the protocol recommended by the company Affymetrix. The chips were then washed and labeled, according to the recommended protocol. Finally, the chips were read by a scanner in order to acquire the image of their fluorescence. The image analysis carried out using the GCOS software makes it possible to obtain numerical values of fluorescence intensity which are preprocessed according to the RMA method (cf.: FIG. 2) before being able to carry out a statistical analysis in order to identify the HERV loci specifically expressed in certain samples.

[0030] Comparison of the means of more than two classes of samples was carried out by the SAM procedure applied to a Fisher test.

[0031] Results:

[0032] The processing of the data generated by the analysis on DNA chip using this method made it possible to identify six sets of probes corresponding to an overexpression in just one sample: the tumoral testicle. These six sets of probes are specific for six precise loci referenced HW4TT, HW2TT, HW13TT, HWXTT, HW21TT and ERVWE1 (cf.: FIG. 3). The information relating to the abovementioned loci are summarized in Table 1 below.

TABLE-US-00001 TABLE 1 Locus SEQ ID No: Chromosome Position* HW4TT 8 4 41982184:41989670 HW2TT 9 2 17383689:17391462 HW13TT 10 13 68693759:68699228 HWXTT 11 X 113026618:113027400 HW21TT 12 21 27148627:27156168 ERVWE1 13 7 91935221:91945670 *Position given in relation to ensemble version No. 39 (June 2006) (NCBI No. 36) http://www.ensembl.org/Homo_sapiens/index.html

[0033] The HW13TT locus is a chimeric provirus of HERV-W/L type resulting from the recombination of an HERV-W provirus and an HERV-L provirus. This chimera is such that the 5' region made up of the sequence starting from the beginning of the 5' LTR to the end of the determined gag fragment is of W type and the 3' region made up of the sequence starting from the subsequent pol fragment to the end of the 3' LTR (U3-R only) is of L type. This results in a fusion of the 3' gag W-5' pol L regions.

Example 2

Validation of the loci Overexpressed in the Tumoral Testicle and Determination of the Associated Induction Factor

[0034] Principle:

[0035] The six loci identified as overexpressed in the tumoral testicle by means of the high-density HERV chip were validated by real-time RT-PCR on three pairs of testicular samples. The specificity of this overexpression is evaluated by analyzing samples originating from other tissues. To this end, specific amplification systems were developed and used for the loci identified, as described in Table 2 below.

TABLE-US-00002 TABLE 2 Locus Sense primer (SEQ ID No:) Antisense primer (SEQ ID No:) G6PD gene TGCAGATGCTGTGTCTGG (14) CGTACTGGCCCAGGACC (15) HW4TT GGTTCGTGCTAATTGAGCTG (16) ATGGTGGCAAGCTTCTTGTT (17) HW2TT TGAGCTTTCCCTCACTGTCC (18) TGTTCGGCTTGATTAGGATG (19) HW13TT CATGGCCCAATATTCCATTC (20) GGTCCTTGTTCACAGAACTCC (21) HWXTT CCGCTCCTGATTGGACTAAA (22) CGTGGGTCAAGGAAGAGAAC (23) HW21TT ATGACCCGCAGCTTCTAACAG (24) CTCCGCTCACAGAGCTCCTA (25)

[0036] The expression of these loci is standardized with respect to that of a suitable housekeeping gene: G6PD. This quantification of expression was carried out using an Mx3005P real-time RT-PCR machine, marketed by the company Stratagene.

[0037] Results:

[0038] The study of the three pairs of testicular samples indicates that all the putative loci identified, with the exception of HWXTT, the expression of which could not be quantified in the second testicular RNA pair, are overexpressed in the tumoral testicle compared with the health tissue (cf.: FIG. 4).

[0039] The analysis of pairs of samples originating from other tissues (colon, uterus, breast, ovary, lung and prostate) shows that the overexpression phenomenon is restricted to the tumoral testicle. Consequently, the expression of the five identified loci assumes the nature of a marker specific for testicular cancer.

Example 3

Epigenetic Control of Transcription

[0040] Principle:

[0041] DNA methylation is an epigenetic modification which takes place, in eukaryotics, by the addition of a methyl group to the cytosines of 5'-CpG dinucleotides, and results in transcriptional repression when this modification occurs within the nucleotide sequence of a promoter. Apart from a few exceptions, human endogenous sequences of retroviral origin are restricted, owing to this methylation process, to a silent transcriptional state in the cells of the organism under physiological conditions.

[0042] In order to analyze the methylation status of the unique LTR or of the 5' LTR of the five loci, the "bisulfite sequencing PCR" method was used. This method makes it possible, on the basis of sequencing a representative sample of the population, to identify the methylation state of each CG dinucleotide on each of the sequences within the tissue studied.

[0043] Since the methylation information is lost during the amplification steps, it is advisable to translate the methylation information actually within the nucleotide sequence by means of the method of treating the genomic DNA with sodium bisulfite. The action of the bisulfite (sulfonation), followed by hydrolytic deamination and then alkaline desulfonation, in fact makes it possible to modify all the cytosines contained in the genomic DNA, into uracil. The speed of deamination of sulfonated cytosines (C) is, however, much higher than that of the sulfonated 5-methyl-Cs. It is therefore possible, by limiting the reaction time to 16 hours, to convert strictly the non-methylated cytosines to uracil (U), while at the same time preserving the cytosines which have a methyl group. After the sodium bisulfite treatment, the sequence of interest is amplified from the genomic DNA derived from the tumoral testicular section and from that derived from the adjacent healthy testicular section, by polymerase chain reaction (PCR) in two stages. The first PCR enables a specific selection of the sequence of interest, the second, "nested", PCR makes it possible to amplify this sequence.

[0044] Since the DNA sequence had been modified by the bisulfate, the design of the primers took into account the code change (C to U), and the primers were selected so as to hybridize to a region containing no CpG (their methylation state, and therefore their conversion state, being a priori unknown).

[0045] The sequences of the primers used are described in Tables 3 to 8 below.

TABLE-US-00003 TABLE 3 HW4TT locus Sense primer 5' .fwdarw. 3' Antisense primer 5' .fwdarw. 3' Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR CCAACATCACTAACACAACCT (26) GGGAGTTAGTAAGGGGTTTG (27) Nested PCR CAACCTATTAAACAAAACTAAATT (28) AGATTTAATAGAGTGAAAATAGAGTTT (29)

TABLE-US-00004 TABLE 4 HW2TT locus Sense primer 5' .fwdarw. 3' Antisense primer 5' .fwdarw. 3' Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTATTAGTTTAGGGGATAGTTG (30) ACACAATAAACAACCTACTAAAT (31) Nested PCR GAGGGTAAGTGGTGATAAA (32) AACCTACTAAATCCAAAAAAA (33)

TABLE-US-00005 TABLE 5 HW13TT locus Sense primer 5' .fwdarw. 3' Antisense primer 5' .fwdarw. 3' Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TAGGATTTTAGGTTTATTGTTA (34) AAAAATAAAATATTAAACC (35) Nested PCR ATATGTGGGAGTGAGAGATA (36) CAACAACAAACAATAATAATAA (37)

TABLE-US-00006 TABLE 6 HWXTT locus Sense primer 5' .fwdarw. 3' Antisense primer 5' .fwdarw. 3' Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTGAGTTTTTTTATTGATAGTG (38) TCTAAATCCTATTTTCCTACT (39) Nested PCR GTTTTTTTATTGATAGTGAGAGAT (40) TAACAAACCTTTAATCCAAT (41)

TABLE-US-00007 TABLE 7 HW21TT locus Sense primer 5' .fwdarw. 3' Antisense primer 5' .fwdarw. 3' Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR TTTAGTGAGGATGATGTAATAT (42) CAACTTAATAAAAATAAACCCA (43) Nested PCR ATAATGTTTTAGTAAGTGTTGGAT (44) ACAATTACAAACCTTTAACC (45)

TABLE-US-00008 TABLE 8 ERVWE1 locus Sense primer 5' .fwdarw. 3' Antisense primer 5' .fwdarw. 3' Amplification (SEQ ID No.:) (SEQ ID No.:) First PCR AATTCATTCAACATCCATTC (46) GGTTTAATATTATTTATTATTTTGGA (47) Nested PCR CTCTTACCTTCCTATACTCTCTAAA (48) AGAGTGTAGTTGTAAGATTTAATAGAGT (49)

[0046] After extraction on a gel and purification, the amplicons are cloned into plasmids, and the latter are used to transform competent bacteria. About twelve plasmid DNA mini preparations are carried out using the transformed bacteria and the amplicons contained in the plasmids are sequenced. The sequences obtained are then analyzed (cf.: FIGS. 5 to 10).

[0047] Results:

[0048] The analysis of the 5' region of the transcripts of the loci identified was carried out by means of the 5' Race technique. It in particular made it possible to show that the transcription is started at the beginning of the R region of the proviral 5' LTR. This reflects the existence of a promoter role for the U3 region of the proviral 5' LTR.

[0049] 1. Methylation state of the U3 sequences of the 5' LTR of the HW4TT locus:

[0050] The U3 sequence of the 5' LTR of the HW4TT locus of reference contains 5 CpG sites:

[0051] a) in the sample of healthy testicular tissue: out of 12 sequences analyzed, 9 are completely methylated. The other 3 each time exhibit 1 CpG nonmethylated out of the 5 contained in the U3 region. This therefore represents an overall methylation of the U3 region of the 5' LTR of the HW4TT locus amounting to 95% in the healthy testicular sample;

[0052] b) in the sample of tumoral testicular tissue: out of 12 sequences analyzed, 5 (i.e. 41.66% of the sequences) are completely demethylated, 3 sequences have 4 CpGs out of 5 nonmethylated, 2 sequences have 2 CpGs out of 5 nonmethylated, 1 sequence has 1 CpG out of 5 nonmethylated, and 1 sequence remains completely methylated. This therefore represents an overall methylation of the U3 region of the 5' LTR of the HW4TT locus amounting to 30% in the tumoral testicular sample.

[0053] 2. Methylation state of the U3 sequences of the 5' LTR of the HW2TT locus:

[0054] The U3 sequence of the 5' LTR of the HW2TT locus of reference contains 5 CpG sites:

[0055] a) in the sample of healthy testicular tissue: out of 12 sequences analyzed, 9 are completely methylated, 1 has its 2.sup.nd CpG nonmethylated, 1 has the CpG at position 4 nonmethylated, 1 has the CpGs at positions 4 and 5 nonmethylated, and 3 sequences have point mutations on one or two CpGs (one in position 3, one in position 5 and one in positions 4 and 5), very probably reflecting PCR artifacts. This therefore represents an overall methylation of the U3 region of the 5' LTR of the HW2TT locus amounting to 92.9% in the healthy testicular sample;

[0056] b) in the sample of tumoral testicular tissue: out of 12 sequences analyzed, 6 are completely demethylated, 5 sequences have one or two methylated CpG(s) (1 at position 1, 1 other at position 5, 1 on positions 1 and 5, 2 at positions 4 and 5 and 1 at position 3). Finally, one sequence has 4 CpGs methylated out of 5 (positions 1, 2, 4 and 5). This corresponds to an overall methylation of the U3 region of the 5' LTR of the HW2TT locus amounting to 20% in the tumoral testicular sample.

[0057] 3. Methylation state of the U3 sequences of the 5' LTR of the HW13TT locus:

[0058] The U3 sequence of the 5' LTR of the HW13TT locus of reference contains 3 CpG sites:

[0059] a) in the sample of healthy testicular tissue: an additional CpG, compared with the reference sequence, is found in 4 of the 10 clones studied for this locus. It is located between CpGs 2 and 3 and is methylated. In the other 6 clones, this site is mutated compared with the reference sequence. The other 3 CpGs of the U3 region are methylated in the 10 sequences analyzed. This therefore represents an overall methylation of the U3 region of the 5' LTR of the HW13TT locus amounting to 100% in the healthy testicular sample;

[0060] b) in the sample of tumoral testicular tissue: the additional CpG indicated above is also found. It is demethylated in 4 of the 10 sequences analyzed, mutated in 3 other sequences, and its methylation state is indeterminate in the last 3 sequences. 7 sequences out of 10 are completely demethylated and the other 3 are methylated on the 2.sup.nd and on the 3.sup.rd CpG. This corresponds to an overall methylation of the U3 region of the 5' LTR of the HW13TT locus amounting to 20% in the tumoral testicular sample.

[0061] 4. Methylation state of the U3 sequences of the solitary LTR of the HWXTT locus:

[0062] The U3 sequence of the 5' LTR of the HWXTT locus of reference contains 6 CpG sites:

[0063] a) in the sample of healthy testicular tissue: the 8 sequences analyzed are completely methylated, which corresponds to a methylation percentage of 100% in the healthy testicular sample;

[0064] b) in the sample of tumoral testicular tissue: the 9 sequences analyzed are completely demethylated, which corresponds to a methylation percentage of 0%.

[0065] 5. Methylation state of the U3 sequences of the 5' LTR of the HW21TT locus:

[0066] The U3 sequence of the 5' LTR of the HW21TT locus of reference contains 7 CpG sites:

[0067] a) in the sample of healthy testicular tissue: the 10 sequences analyzed all have 6 CpGs methylated out of 7; for 6 of the sequences, the 1.sup.st CpG is nonmethylated and for the other 4 sequences, the 4.sup.th CpG is nonmethylated. This therefore represents an overall methylation of the U3 region of the 5' LTR of the HW21TT locus amounting to 85.7% in the healthy testicular sample;

[0068] b) in the sample of tumoral testicular tissue: out of 8 sequences analyzed, 6 are completely demethylated, 2 others exhibit a profile identical to one of those found in the healthy testicular tissue, namely 6 CpGs methylated and the 1.sup.st CpG nonmethylated. This corresponds to an overall methylation of the U3 region of the 5' LTR of the HW21TT locus amounting to 21.4% in the tumoral testicular sample.

[0069] 6. Methylation state of the sequences of the activator of the U3 of the 5' LTR of the ERVWE1 locus:

[0070] The ERVWE1 locus comprises, in addition to its U3 promoter region, a known activator located directly upstream of the 5' LTR, and which contains two CpG sites (CpG 1 and 2). The U3 sequence of the 5' LTR of the ERVWE1 locus of reference contains, for its part, 5 CpG sites (CpGs 3 to 7):

[0071] a) in the sample of healthy testicular tissue: out of 10 sequences analyzed, 5 sequences have CpGs 1 and 2 (activator) and 5 (U3) nonmethylated, 1 sequence has CpGs 2 and 5 nonmethylated, 2 sequences have CpGs 1 (activator) and 7 (U3) nonmethylated, 1 sequence has CpG 7 only nonmethylated and, finally, 1 is completely methylated for the 7 CpGs. In total, this corresponds to a methylation percentage of 68.57% in the healthy testicular sample;

[0072] b) in the sample of tumoral testicular tissue: out of the 10 sequences analyzed, only 3 sequences exhibit, for each one, a unique methylated CpG (CpG 4 or CpG5 or CpG6), the other 7 sequences are completely demethylated, which corresponds to a methylation percentage of 4.29%.

[0073] The very high level of methylation of the U3 retroviral promoters of the loci considered, in the healthy tissue, indicates a repression of the transcriptional expression by an epigenetic mechanism. On the other hand, the low level of methylation of these same promoters in the tumoral tissue reflects a lifting of transcriptional inhibition, the result of which is the significantly higher expression demonstrated by means of the high-density HERV DNA chip and by means of the real-time RT-PCR. Thus, the U3 retroviral promoters of the loci considered appear to be specific markers for the tumoral nature of the testicle.

LITERATURE REFERENCES

[0074] [1] Nickerson D. A. et al., DNA sequence diversity in a 9.7-kb region of the human lipoprotein lipase gene, Nature Genetics, Vol. 19, pp 233-240 (1998). [2] Cottrell S. E., Molecular diagnostic applications of DNA methylation technology, Clinical Biochemistry 37, pp 595-604 (2004).

Sequence CWU 1

1

491255DNAHomo sapiens 1tgagaaacag gactagttag atttcctagg ccaactaaga atccctaagc ctagctggga 60aggtgatcgc atccaccttt aaacacgggc ttgcaactta gctcacacct gaccaatcag 120gtagtaaaga gagctcacta aaatgctaat taggcaaaaa caggaggtaa agaaatagcc 180aatcatctat tgcctgacac cacacgggga gggacaatga ttgggatata aacccaggaa 240ttcgagctgg caacg 2552247DNAHomo sapiens 2tgagacacag gactagctgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccac atccaccttt aaacacgggg tttacaactt agctcacacc cagccaatca 120gagagctcac taaaatgcta attaggcaaa aacaggaggt aaagaaatag ccaatcatct 180attgcctgag agcacagcgg gagggacaag gattgggata taaacccagg cattcgagct 240ggcaacg 2473241DNAHomo sapiens 3tgagagacag ctggatttcc taggccgact aagaatccct aagcctagct gggaaggtga 60ccgcatccac ctttaaacac agggcttgca acttagctca cacccaacca atcagagagc 120tcactaaaat gctaattagg caaaaacagg aggtaaagaa atagcaagtc atctattgcc 180tgagagcaca gtgggaggga caaggaccag gatataaacc caggcatttg agccagcaac 240g 2414248DNAHomo sapiens 4tgagagacag gactaactgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccgc atccatcttt aaacacgggg cttgaaactt agctcacacc taaccagtca 120gagagctcac taaaatgcta attaggcaaa aaacaggagg taaagaaata gccaatcatc 180tattgcctga gagcacagcg ggagggacaa ggatcgggat ataaacccag gcattcgagc 240cagcaatg 2485255DNAHomo sapiens 5tgagagacag gactagctgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccgc ttccaccttt aaacacgggg cttgcaactt agctcacacc cgaccaatca 120gatagtaaag agagcacact aaaatgctaa ttaggcaaaa acaggaggta aagaaatagc 180caatcatcta ttgcctgaga gcaaagcggg agggacaatg atcgggatag aaacccaggc 240attcaagccg gaatg 2556247DNAHomo sapiens 6tgagagacag gactagctgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccac gtccaccttt aaacacgggg cttgcaactt agctcacacc tgaccaatca 120gagagctcac taaaatgcta attaggcaaa gacaggaggt aaagaaatag ccaatcatct 180attgcctgag agcacagcag gagggacaac aatcgggata taaacccagg cattcgagct 240ggcaaca 2477314DNAHomo sapiens 7ccctggggcg ggcttccttt ctgggatgag ggcaaaacgc ctggagatac agcaattatc 60ttgcaactga gagacaggac tagctggatt tcctaggccg actaagaatc cctaagccta 120gctgggaagg tgaccacgtc cacctttaaa cacggggctt gcaacttagc tcacacctga 180ccaatcagag agctcactaa aatgctaatt aggcaaagac aggaggtaaa gaaatagcca 240atcatctatt gcctgagagc acagcaggag ggacaacaat cgggatataa acccaggcat 300tcgagctggc aaca 31487774DNAHomo sapiens 8tgagacacag gactagctgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccac atccaccttt aaacacgggg tttacaactt agctcacacc cagccaatca 120gagagctcac taaaatgcta attaggcaaa aacaggaggt aaagaaatag ccaatcatct 180attgcctgag agcacagcgg gagggacaag gattgggata taaacccagg cattcgagct 240ggcaacggca accccctttg ggtctcctcc ctttgcatag gagctctgtt ttcactctat 300taagtcttgc aactgcactc ttctggtccg tgtttcttac cgcttgagct gagctttccc 360tcactgtcca ccactgctgt tttgccaccg tcacaggccc accgctgact tccattcttc 420tggatctagc aggctgtcca ctgtgctcct gatccagcga ggcgcccatt gccgctcccg 480attgggctaa aggcttgcca ttgttcctgc atggctacgt gcctgggttc atcctaatca 540agccgaacac tagtcactgg gttccacggt tctcttccat gacccacgac ttctaataga 600actataacac tcacctcatg gcccaagatt ccattccttg gaatccatga ggccaagaac 660cccaggtcag agaacacgag gcttgccacc atcttggaag tggccccacc accatcttgg 720gagctctggg agcaaggacc cccggtaaca ttttggcgac cacaaaggga catccaaagt 780ggtgagtaat attggaccac tttcacttgc tattctgttc tatccttcct tagaactgga 840ggaaaatacc aggcacaggc acctgtcagc cagttaaaaa caattagcgt cgccgccaca 900cttaagactc aggtgtgagg ctatctgggg aaagactttc taacaacccc caacccatct 960agtggggatg ttggtctgcc tggagacagc ttccactttc aattttcttg gggaagccga 1020gggctcacta gaggcagaca gctgttgtcc caaactccgg gcagtagccg gttgagatca 1080tggtgcagcc aggagtctct actcagcagt cgccgatgca tgtgccccta ccttcccttc 1140tgacccatac atcctgagtc ccgactgtga ctttcttgaa agtgtagccc caaaattctc 1200cttacctctg aatctacttc ctctgatccc tgcctcctgg gtactaatga ttcagacttt 1260catttcctct agcaagttgt gtctccaaag ggatctaagg aggctctacg ctgcatcctt 1320aggcacctag gctataaccc aaggagtctt atccctggtg tccctcccga tttgggtata 1380caactctcaa catgggcagt tatgtaggac ccattcccca ccacacttgc cagggcccca 1440agtttgtaat ggctaagaga gagacacaga gagagagaga gagatggaga gagagacaag 1500gagggagtca aagagaaaaa gaaagaaaaa gaaatagtag aaaaaaaagt gtgccctatt 1560cctttaaaag ccagggtaaa tttaaaacct gtaattgata attgaaggtc ttctccgtga 1620ccctgtaaca ctccaatgcc attttgttgt cagtgtaaat aagggcatag cccaaaagca 1680ctgaggtcac tgacaacccg tagctttccc atcaaaaatc cttaacccag taatccgcgg 1740atgggccaaa tgcattcagt cggtagcagc aaccgctttg ctaaaagtag aaaagtaact 1800tttagaggaa acctcattgt gagcgcacac ctcaccagtt cagaattatt ctaagtcaaa 1860aaaaaaaaaa gcaaaaaggt aacttactaa ctcaaaaatc ttaaagtata ggtctatcat 1920attagaaaag ggtaatgtaa ctccaaccac tgataattcc cttaacccag cagatttcct 1980aacaggggat ttaaaactta attaccatac aaaggtccca ccagacctag gaggaactcc 2040cttcaggaca ggacgataaa cggttcctcc caggtgattg aggaaaaaaa ccacaatggg 2100tattcagtaa ttgatacaga gactcatgtg gaagcagtta gaaaaattgc ctaataattg 2160gtctcctcaa acgtgtaagc tgtttgcact cagccaagcc ttaaagtact tacagaatca 2220aaaagactct gaatcctgac tcaaaaggtt tgctacaccc tctgtgaaac aaatttgcat 2280aagaactgtt gtttatggga aggcatcttg atggggcagc tgggttgtta tgaaatactc 2340aggaccccag cccggctcta ggactcaccc ctgagcgcaa aaggcaatgt tgggcacgct 2400ggtaaaggac cactagaatc cagcagcccg gacccctttc tttgtggtca agagaggcgg 2460gaaaacaggt gcaggactgc tacatcagtg agcataacta atccagtaag cagaggtcca 2520tgggtggtta tgcaccctgg aaaagaatac gcattaggcc cttagaggat gctctaggac 2580taatgctcat cggaaaatga ctaggggtgc tgacatccct atgttctttt ttcagatggg 2640aaacgttcct cccaccccaa ggcaaaaaac acccctaaga tgtattttgg agaattagga 2700ccaatttgac cctcagacac taagaaagaa atgacttaca ttcttctgca gtaccatgat 2760atcctcttca agggggagaa acctggcctc ctgagagaag tataaattat aacaccatct 2820tacagtgaga cctcttctgt agaaaggagg gcaaatggag tgaagtgcaa actttccttt 2880cattaagaga caactcgcaa ttatgtaaaa agtgtgattt atgccctaca gaaagccctc 2940agtctacctc cctatcccag ggtccccccg attcctttcc caactaataa ggacccccct 3000tttacccaaa tggtccaaag gagatagatg aagggataaa caatgaacca aacagtgcca 3060atattccctg attatgcccc ctccaggcag tgggaggagg agaattcggc ccagccagag 3120tgcatgtacc tttttttttc tctcagactt aaagcaaatt aaaatagacc taggtaaatt 3180ctcagataac cctgatggct atattgatgt tttacaaggg ttaggacaat cctttgctct 3240gacatggaga gatataatgt tactgctaaa tcagacacta accccaaatg agagaagtgt 3300caccatagct gcagcccaag agtttggcaa tctctggtat ctcagtcagg tcaatgatag 3360gatgacaaca gaggaaaggg aatgattccc cacaggccag caggcagttc tcagtgtaga 3420ccctcactgg gacacagaat aagaacatgg agatcggtgc cgcagatatt tgctaacttg 3480cgtgctagga ctaaggaaaa ctaggaagaa gcctatgaat tattcagtga tgtccactat 3540aacacaggga aaggaagaaa atcatactgc ctttccggaa atactaaggg aggcattgag 3600gaagcatacc tctctgtcac ctgactgtat tgaagtccaa ctaatcttaa aggatatgtt 3660tatcactcag tcagctgcag acattagaaa aaacttcaaa agtccacctt aggcccagag 3720caaaacttag aaaccctatt gaacttgtta acctcagttt tttataatag agatcaggag 3780gagcaggcgg aacaggacaa acaggattaa aaaaagacca ccgctttagt catggccctc 3840aggcaagtgg actttggaag ctctggaaaa gggaaaagct gggcaaattg aatgcctaat 3900agggcttgct tccagtgtgg tctacaagga cacttaaaaa aagattgtcc aagtagaaat 3960aagctgcccc ttcgtccatg cctcttatgt caagggaatc actggaaggc ccattgcccc 4020aggggaggaa ggtcctctga gtcagaagcc actaaccaga tgatccagca gcaggactaa 4080gggtgcccag ggcaagcccc agcccatgcc atcaccctca cagagccccg ggtatgcttg 4140accattgagg gccaggaggt taactgtctc ctgaacactg gcacagcctt ctcagtctta 4200ctttcctgtc ccggacaact gtcctccaga tctgtcacta tctgagcggt cctaggacag 4260ccagtcacta gatatttctc ccagccacta agttgtgact ggggaacttt actcttttca 4320catgcttttc taattatgcc tgaaagcccc actcctttgt tagggagaga cattctagca 4380aaagcagggg ccattataca tctgaacata ggagaaggaa cacccgtttg ttgtcacctg 4440cttgaggaag gaattaatgc tgaagtctgg gcaacagaag gacaatatgg atgagcaaag 4500aatgcccatc ctgttcaagt taaattaaag gattccgcct cctttcccta ccaaaggcaa 4560taccccctta gacccgaggc ccaacaagga ctccaaaaga ttgttaagga cctaaaagcc 4620caaggcctag taaaaccatg caatagcccc tgccatactc caattttagg agtaaggaaa 4680cccaacggac agtggaggtt agtgcaagaa ctcaggatta tcaatgaggc tgttgttcct 4740ctatacccag ctgtacctaa cccttataca gtgctttccc aaataccaga ggaagcagag 4800tggtttacag tcctggacct taaggatgcc tttttctgca tccctgtacg tcctgactct 4860caattcttgt ttgcctttga agatcctttg aacccaacgt ctcaactcac ctggactgtt 4920ttaccccaag ggttcaagga tagcccccat ctatttggcc aggcattagc ccaagacttg 4980agccaattct catacctgga cactcttatc cttcggtatg gggatgattt aattttagct 5040acccattcag aaacgttgtg ccatcaagcc acccaagtgc tcttaaattt cctcgctacc 5100tgtggctaca ggtttccaaa cgaaaggctc agctctgctc acagcaggtt aaatacttag 5160ggctaaaatt atccaaaggc accagggccc tcagtgagga acgtatccag cctatactgg 5220cttattctca tcccaaaacc ctaaagcaac taagagcatt ccttggcata acaggctgct 5280gctgaatatg gattcccagg tacagtgaaa tagccaggcc attatacaca ctaattaagg 5340aaactcagaa agccaatacc catttagtaa gatggacacc ttaagcagaa gcggctttcc 5400aggccttaaa gaaggcccta acccaagccc cagtggtaag cttgccaaca gggcaagact 5460tttctttata tgtcacagaa gaaacaggaa tagctctagg agtccttaca caggtctgag 5520ggatgagctt gcaacccatg gcatacctga gtaaggaaac tgatgtagtg gcaaagggtt 5580ggcctcattg tttacgggta gtggcagcag tagcagtctt agtatctgaa gtagttaaaa 5640taatacaggg aagagatctt actgtgtgaa catctcatga tgtgaatggc atagtcactg 5700ctaaaggaga cttgtggctg tcagacaact gtttacttaa ataccaggct ctattacttg 5760aagggccagt gctgcgactg tgcacttgtg caactcttaa cccagacaca tttcttccag 5820acaatgaaga aaagatagaa cataactgcc aacaagtaat tgctcaaacc tatgccactc 5880gaggggacct tttagaggtt cccttgactg atcccaacct caacttgtat actgatggaa 5940gttcctctgt agaaaaagga ctttgaaaag tggggtatgc agtggtcagt gataatggaa 6000tacttgaaag taatcccctc actccaggaa ctagtgctca gctggcagaa ctaatagccc 6060tcactcgggc actagaatta ggagaagaga aaagggtaaa tatatacaga ctctaagtat 6120gcttacctag tcctccatgc ccatgcagca atatggagag aaagggaatt cctaatttcc 6180aagggaacac ctatccaaca tcaggaagcc attaggagat tactattggc tgtacagaaa 6240cataaagagg tggcaatctt acactgccgg tgtcaccaga aaggaaagga aagggaaata 6300gaaaggaacc accaagcgga tattgaagcc aaaagagccg caaggcagga ccctccatta 6360gaaatgctta tagaaggacc cctagtatgg ggtaatcccc tccaggaaac caagccccag 6420tactcagaag aagaaataga atgaggaacc tcacaagcac atagtttcct cccctcagga 6480tggctagcca ctgaagaagg aaaaatactt ttgcctgcag ctaaccaatg gaaattactt 6540aaaacccttc accaaacatt tcccttaggc attgatagca cccatcagat ggccaaatta 6600ttatttactg gaccaggcct tttcaaaact atcaagcaga tagtcagggc ctgtaaagtg 6660tgccaaacaa gtaatcccct gcactgcagg ccatacattt caatccctgt atctttaacc 6720tccttgttaa gtttgtctct tccagaatca aagctgtaaa actacaaata gttcttcaaa 6780tggagcccca gatgtagtcc atgactaaga tctaccgcgg acccctggac aagcctgcta 6840gcccatgctc tgatgttaat gacatggaag gcacccctcc cgaggaaatc gcaactgcac 6900aacccctatt acaccccaat tcagcaggaa gcagttagag cattcatcag ccaacctccc 6960caacagcact tgggttttcc tattgagagg gggtactgag agacaggact agctggatgt 7020cctaggctga ctaagaatcc ctaagcctag ctgggaaggt gaccacatcc acctttaaat 7080acggggcttg caacctagct cacacccaac agatcagaga gctcgttaaa atgctaatta 7140ggcaaaaaca ggaggtaaag aaatagccaa tcatctattg cctgagagca cagcaggagg 7200gacaaggatt gggatataat cccaggcatt cgagctggca acagcaaccc cctttgggtc 7260ccctcccttt gtatgggagc tgttttcact ctatttcact ctattaaatc ttgcaactgc 7320actcttctgg tgcatgtttg ttactgcttg agctgaactt tcactcgcca tctaccactg 7380ctgttttgcc gccgtcgcag acccactgct gacttccatt cttctggatc cagcagggtg 7440tccactgtgc tcctgatcca gtgaggcacc cattgccgct cccgatctgg ctaaaggctt 7500gccattgttc ctgcatcgct aagtgcctgg gttcgtccta atcaagctga acactagtca 7560ctgggttcca cagttctctt ccatgaccca cgacttctaa tagagctata acactcacct 7620tatggcccaa gattccattc cttggaatcc atgaggccaa aaaccccagg tcagagaaca 7680tgagacttgc caccatgttg aagtggcctg ctgccatttt ggaagtggcc caccaccatc 7740ttgggagctc tgggagcaag gacccctggt aaca 777497487DNAHomo sapiens 9tgagaaacag gactagttag atttcctagg ccaactaaga atccctaagc ctagctggga 60aggtgatcgc atccaccttt aaacacgggc ttgcaactta gctcacacct gaccaatcag 120gtagtaaaga gagctcacta aaatgctaat taggcaaaaa caggaggtaa agaaatagcc 180aatcatctat tgcctgacac cacacgggga gggacaatga ttgggatata aacccaggaa 240ttcgagctgg caacggcaac tccctttggg tctcctctca ttgtatggga gctctgtttt 300cactctatta aatcttgcaa ctgcacactc ttctggtctg tgtttgttat ggcttgagct 360gagcttttgc tggctgtcca ccactgctgt ttgctgccgt cgcagacccc ttgctgactc 420ccacccctgc ggatctggca gggtgtctgc tgcgctcctg atccagccag gcacccactg 480ctgctcccaa tcaggctaaa ggcttgccat tgttcctgca tggctaagtg cccgggttcg 540tgctaattga gctgaacact agtcgctggg ttccacagtt ctcttccgtg acccacagct 600tctaatagag ctataacact cactgcatgg cccaacattc cattccttgg aatctgtgag 660gccaagaacc cccggtcaga gaacaagaag cttgccacca tcttggaagc agcccgccac 720cattttggga gctctaagaa caaggacccc ccagtaacat tttggtgacc acgaagggac 780ctccaaagca gtgagtaata ttgaaccact tccgcttgct attctgtcct aaccttcctt 840agaattggag gaaaataccg ggcacctgtc ggccagttaa gaacgattag cgtggccgcc 900agacttaaga ctctggtgtg aggctgtctg ggaaagggct ttctaacaac ccccaaccct 960tccgggttgg gagctttggt ctgcctggaa ccagcttcca ctttcaattt tcctggggaa 1020tccaagggct gactagaggc agaaagctgt catcccgaac tcctggcatt agacagttga 1080gatcgtggcg cagccagaag tctctactca acagtcaccc atgcgtgcac ccctaccttt 1140ccttctaacc catacctccc gggtcccaac catgactttc ttgaaagtgt agcccctaaa 1200ttctctttac ctctaaatct acttcttctc atccctgctt cctaggtact aatggttcag 1260actttcattt cctctagcaa gttctatctc cagagggatc taaggaaggg atctatgctg 1320tgtccttagg cccctaggct atgaacccag agagtcttct ccctgttatc tctccccatt 1380taggcataca gctctcaaca tggacagtta tgtgggaccc attccctacc acccttgcca 1440gggccccaag ttttcaaagg gctagaagaa aaaagagaga aagagagaga gaggcagagg 1500ggagagaaag agagagagac aaagagggag tcaaagagag atagaaagag aaagatagaa 1560ctagtaaaga aaaaaagtat gccccattcc tttaaaagcc agggtaaatt taaaacctat 1620aattgataat tgaaggtctt ctccatgacc ctataacact ccaataccac cttgttttca 1680gtgtaaacaa gggtgtagcc cgaaaacact gagaccactg acaacccata gccttcctat 1740caaaaatcct taacccagga acccatggat ggcccaaatg cattcaatct gtagcagcaa 1800ctgctttgct aacagaagaa agtagaaaag taacttttag agaaaacctc attgtgagca 1860cacctcacca gttcagaatt attctaagtc aaaaaagcaa aaaggtagct tactaactca 1920aaaatcttaa agtatggggt tattctgtta gaaaaaggtg atttaacatt aaccactgaa 1980aattccctta acccagcagg tttcctaatg ggatttaaat cttcattacc atacaaaggt 2040ccgaccagac ccagcaggaa ctccctttag gacaggatga tagatggttc ctcctgggtg 2100attgaggggg tgaaaaacca caatgggtgt tcagtaattg atagggagac tcttgtggaa 2160ggagagttag gaaaattgcc taataattgg tctgctcaaa tgtgcgagct gtttgcactc 2220agccaagcct taaagtactt acagaatcaa aaagactcta tctcaatcct gactcaaaat 2280gttacctaca ccatctctga catgaatttg cataagaact gttgtttatg ggaatgcatc 2340ttgatggggc agctgggttg ttatgaaata ctcaggaacc cagcccaggt ctagaattca 2400cctctgagcg caaaggcaat gttggccatg ctggtaaagg accactagaa tccaggagcc 2460tggacccctt tctttgtggt caagaaaggc gggaaaacag gtgcaggact gctacatcag 2520agagcataac aaatccgata agcagagttc catgagtggt taagcaccct ggaaaggaac 2580tcacctctga gtgcaaaggc aatgttaggc acaccagtaa aggaccacta gaatccagca 2640gcccagaccc ctttctttgt gatcaagaaa ggcgggaaaa ggggtgcagg actgctacat 2700cagtgagcgt aactaatctg ataagcagaa gtccatgggt ggttacgcac cctggaaagg 2760aataagcatt aggaccacag aggacactct aagactaatg ctcattggaa aatgactagg 2820ggtgctggca tccctatgtt tttttttcag atgggaaaca ttccccccaa ggcaaaaacg 2880cccataagat atattctgga gaattcggcc cagagtgtat gtatcttttt tccctgtcag 2940acttgaagca aacctaggta aattatcaga tagccctgat ggctatattg atgctttaca 3000agggttagga caatcctttg atctaacatg gagagatata ctgttactgc tagatcagac 3060actaatccca aatgaaagaa gtgccaccat aactgcagcc agagagtttg atgatctctg 3120gtatctcagt caggtcaatg ataggatgac aacagaagaa agaaaacaat tccccacagg 3180ccagcaggca gttcccagcg tagaccttca ttgggacaca gaatcagaac atggagattg 3240gtgccgcaga catttactaa cttgcgcgct agaagcacta aggaaaacta ggaagaagcc 3300tatgaattat tcaatgatgt ccactataac acagggaaag gaagaaaatc ctactgcctt 3360tctggagaga ctaagggagg cattgagaaa gcatacctct ctgtcacctg actctattga 3420aggccaacta atcttaaagg ataagttttc cactcagtca gctgcagaca ttagaaaaaa 3480acttcaaaag tctgcgttag gccgggagca aaacttagaa accctattga acttggcaac 3540ctcagttttt tatgatagag atcaggagga tcaggtggaa tggacaaatg agattttaaa 3600aaaaggccac cactttagtc atggccctca ggcaagcaga ctttggacac tctggaaaag 3660ggaaaagctg ggcaaatcga atgcctaata agacttgctt ccagtgtggt ctacaaggac 3720actttaaaaa agattgtcca aatagaaata agccaccccc tcgtccatgc tccttatgtc 3780aagggaatca ctggaaggcc tactgcccca ggggatgaag gtcctctgag tcagaagcca 3840ctaaccagat gattcagccc caggactcag ggtgcccagg gcaagcgcca gcctatgcca 3900tcaccctcac agagccctgg gtatgcttga ccattgaggg tcaggaggtt aactatctcc 3960tggacactgg cgtggccttc tcagtcttac tctcctgtcc cggacaactg tcctccagat 4020ctgtcactat ccgagggttt ctacgacagc cagccactag atacttctcc cagccactaa 4080gttgtgactg gggaactcta ctcttttcac atgtttttct aattatgcct gaaagcccca 4140ctcctttgtt agggaaagac attctagcaa aagcaggggc cattatacac ctgaacatag 4200gagaaggaac acctgtttgt tgtcccctgc ttgaagaagg aattaatcct gaagtctgga 4260caacagaagg acaatacaga tgagcaacaa atgcctgtcc tgttcaagtt aaactaaagg 4320attatgcctc ctttccctac caaaggcagt acccccttag acccgaggcc caacaaggac 4380tccaaaagat tgttaaggac ctaaaagctc aaagcctagc aaaaccatgc agtagcccct 4440gcaatactcc aattttagga gtacagaaaa ccaacagaca gtggaggtta gtgcaagatc 4500tcaggattat caatgaggct gttgttccta acccttatac tctgctttcc caaataccag 4560aagaagcaga gtggtttaca gtcctggacc ttaaggatgg ctttttctgc atccctgtac 4620atcctgactc tcaattcttg tttgcctttg gagatccttc gaacccaatg tctcaactca 4680gcttgactgt tttaccccaa gggttcaggg atagccccca tctagttggc caagcattag 4740ccgagccagt tctcctacct ggacactctt gtcctctggt acatggatga tttattttta 4800gctgcccgtt cagaaacctt gtgccatcaa gccacccaag tgctcttaaa tttcctcgcc 4860acctgtggct acaaggtttc caaaccaaag gctcagctct gctcacagca ggttaaatac

4920ttagggctaa aattatccaa aggcaccagg gccctcagtg aggaatgtat ccagcctgta 4980ttggcttatc ctcatcccaa aaccctaaag caactaagag ggttccttgg cataacaggt 5040ttctgccaaa tgtggattcc caggtacggt gaaatagcca ggccattata taccctaatt 5100aaggaaactc agaaagccaa cacccattta ttaagatgga cacctgaagc agaagcagct 5160ttccaggccc taaagaaggc cctaacccaa gccccagtgt taagcttgcc aacggggaag 5220acttttcttt atatgtcaca gaaaaaacag gaatagctct aggagtcctt agacaggtcc 5280aagggatgag cttgcaacct gtggcatacc tgagtaagga aattgatgta gttgcaaagg 5340gttgacctca ttgtttacag gtagtggcgg cagtagcagt cttagtatct gaagcagtta 5400aaataataca gggaagagat cttactgtgt ggacatctca tgatgtaaac ggcgtactca 5460cttctaaagg agacttgtgg ctgtcagaca accgtttact taaatatcag gctctattac 5520ttgaagggcc agtgctgcga ctgcccactt gttcaactct taacccagcc acatttcttt 5580cagacaatga agaaaagata gaacataact gtcaacaggt gattgctcaa acctacggcg 5640ctcgagggga ccttctagag gttcccttga ctgatcccaa cctcaacttg tatactgatg 5700gaagctcctt tgtagaaaaa ggactttgaa aggtggggta tgcagtggtc agtgataatg 5760gaatacttga aagtaattcc ttcactccag gaactagtgc tcagctggca gaactaatag 5820ccctcactca ggcactagaa ttaggagaag gaaaaagggt aaatatatat gcagactcta 5880agtatgctta cccagtcctc cacgcccaca cagcaatatg gagagatagg aaattcctaa 5940cttctgaggg aacaccgatc aaacatcagg aagccattag gagattatta ttggctgtac 6000agaaacctaa agaggtggca gtcttacact gctggggtca tcagaaagga aaggaaaagg 6060aaatagaaag gaaccaccaa gtggatattg aagccaaaag agccacaagg caggccctcc 6120attagaaatg cttatagaag gatccctagt atggggtaat cccctccggg aaaccaagcc 6180ccagtactca gcaggagaaa tagacacgag gacatagttt cctcccctca ggatggctag 6240ccaccgaaaa agggaaaata cttttgcctg cagctaatca atggaaatta cttaaaaccc 6300ttcaccaaac ctttcacttg ggcatggata gcatctatca gatggccaat ttattattta 6360ctggaccagg ccttttcaaa actatcaagc agatagtcag ggcctgtgaa atgtgccaaa 6420gaaataatcc cctgcacttc aagccataca tttcaatccc tgtatcttta acctcctgtt 6480gtttgtctct tccagactca aagctgtaaa actgcaaatg gttcctcata tggagcccca 6540gatgcagtcc atgactaaga tctaccacag agccctagac cggcctgtta gcccatgctc 6600cgatgttgat gacatcaaag gcacaccttc cgaggaaatc tcaactgcac gacccctact 6660aagccccaat tcagcaggaa gcagttaaga gcagtcgttg gctaacatcc ccaatagtat 6720gtgggttttc ctgttgagag gggggactga gagacaggac tagctggatt tcctaggcca 6780actaagaatc cctaagccta gttgggaagg tgaccgcatc cacctttaaa cacggggctt 6840gcaacttagc tcacacccga ccaatcaggt agtaaagaga gctcactaaa atgctaatta 6900ggcaaaaaca agaggtaaag aaatagccaa tcatctatcg cctgagagca cagtggggag 6960ggacaatgat cgggatataa acccaggcat tcgggccggc aacggcaacc cccattgcgt 7020cccctcccat tgtatgggag ctctgttttc attctattaa atcttgcaac tgcacactct 7080tctggtctat gtttgttatg gctcgagctg agctttcgct cgctgtccac cactgctgtt 7140tgccgccatc gcagacccac cactgacttc cacctctgca gatctggcag ggtgtccgct 7200gtgctcctga cccagcgagc cacccattgc tgctcccaat caggctaaag gcttgccatt 7260gttcctgcat ggctaagagc ccagggttcg tcctaatcga gctgaacgct agtagctggg 7320ttccacagtt ctcttccgtg acccacggct cctaatagag ctataacact caccacatgg 7380cccaaggttc cattcattgg aatccgtgag gccaagaacc cccggtcaga gaacaagaag 7440cttgccacca tcttggaagc tctaaaaaca gagacacccc agtaaca 7487105470DNAHomo sapiens 10tgagagacag ctggatttcc taggccgact aagaatccct aagcctagct gggaaggtga 60ccgcatccac ctttaaacac agggcttgca acttagctca cacccaacca atcagagagc 120tcactaaaat gctaattagg caaaaacagg aggtaaagaa atagcaagtc atctattgcc 180tgagagcaca gtgggaggga caaggaccag gatataaacc caggcatttg agccagcaac 240ggcaacctcc tttgagtccc ctccctttgt ataggagctc tgttttcact gtgtttcact 300ctattaaatc ttgcaattgc actcttctgg tccatatttg tcacggcttg agctgagctt 360tcacttgccg tccaccacta ctgtttgctg ctgtcacaga cccgccgctg actcccatcc 420cgctgctgac tcccatccct ccggatccgg cagggtgtcc gctgtgctcc tgatccagca 480agactcccat tgccactccc gatagtgcta aaggcttgcc attgttcctg catggctaag 540tgcctgggtt cgtcctaatc cagctgaaca ctagtcactg ggttccacgg ttctcttcca 600tgacccgcgg cttctaatag agctataaca ctcaccacat ggcccaatat tccattcctt 660ggaatccgtg aggccaagaa ccccaggtca gagaacacga ggcttgccac catcttggaa 720gcagcctgcc accatcttgg aagtggctca ccaccgtctt gggagttctg tgaacaagga 780cccctggtaa cattttggcg accacgaagg gacatccaaa gctgtgagta atattggacc 840actttcgctt gctattctgt tctatcctta gaactggagg aaaatactgg gcacctgtcg 900ccagttaaaa atgattagca tggccgccgg acttaagact caggtgtgag gctatctggg 960aaagggcttt ctaacaaccc ccaagccttc tgttgggaac tttggtctgc ctggagccag 1020cttccacttt caattttctt ggggaagcca agggctgact ggaggcagaa agctgttgtc 1080ccgaactccc ggcagtagcc ggttgagatc atggcgcagc cagaagtctc tactcggcag 1140tcgcccatgc gtgcgccctt acctttcctt ctgaattata cctccggggt cccgactccg 1200actttcttga gagtttagcc ccaaaattct ccttacctct gaatctactt cctttgatcc 1260ctgcctcctg cctcctaggt actaatagtt cagactttca tttcctctag caagttgtgt 1320ctccaaaggg atctaaggag gctctatgct gtgtccttag gcacctaggc tataacccag 1380ggagtcttat ccctggtatc cctcccgatt taggtataca gctcttgaca tgggcagtta 1440tgtgggacct gttccccacc acccttgtga gggccccaag tttgtaatgg ctaagaaaga 1500gagacggaga gagagagaga cggagaaaga gacaaagagg gagtcaaaga gaaaaagaaa 1560gaaaaagata gaaatagtta aaaaaaaaaa aaagtgtgcc ctattccttt aaaagccagg 1620gtaaatttaa aacctgtaat tgataattgc cactttgttg tcagtgtaaa taagggcgta 1680gcaaatcctt aacccagtaa cccgcggata ggccaaatgc attcagtcgg tagcggcaac 1740agctttgcta aaagtagaaa agtaactttt agaggaaacc tcattgtgag cacacctcac 1800cagttcagag ttattctaag taaaaaaaaa aaaaaaaaaa aaagcaaaaa ggtagcttac 1860taactcaata atcttaaagt atggggctac tatgctagaa aagggtaatg taactccaac 1920cactgataac tcccttaacc cagcagattt cctaacaggg gatttaaatc ttaattacca 1980cacgaaggtc cgaccagacc taggaggaac tcccttcagc acaggacgat agatggttcc 2040tcccaggtga ctgaggaaaa aactacaatg ggtattcagt aattggtatg gagactcttg 2100tggaagcaga gttaaaaatt tgcctaataa ttggtctcct caaatgtgcg agctgtttgc 2160actcagccaa gccttaaagt acttacagaa tcaaaagact atctcaatcc tgactcaaaa 2220ggttagctac acagtctctg aaatgaattt gcagaagaac tgttgtttat gggaatgcat 2280cttgatgggg cagctgggtt gttatgaaat actcaggaac ccagcccagc tctaggactc 2340accgctgagc gcaaaggcaa tgttgggcac gctggtaaag gaccactaga atccagcagc 2400ccaggcccct ttctttgtgg tcaagaaagg caggaaaagg agtgcagaac tgctacattg 2460gtgagcgtaa ctaatccaat aagcagaggt ccatgagtgg ttatgcacgc tggaaaagaa 2520taagcattag gcccttagag gatgctctag gactaatgct catcggaaaa tgactagggg 2580tgctggcatc cttatgttct ttcttcagat gggaaacgtt ccccccaagg caaaagcgcc 2640cctaagatgt attctggaga attagaacca atttgaccct cagatgtcaa gaaagaaacg 2700acttatattc ttctgcagta ctgcctggcc acgatatcct cttcaagggg gagaaacctg 2760gcctcctgag ggaagtacaa attataacac catcttacag ctagacctct tttgtagaaa 2820agaaggcaaa tggagtgaag tgccatatgt gcaaactttc ttttcattaa gagacaactc 2880acaattatgt aaaaagtgtg gtttatgtct tacaggaagc cctcagagtc tacctcccta 2940tcccagcatt cccccgactc cttccccaac taataagcac cacccttgaa cccaaacagt 3000ccaaaaggag atagacaaac aggtaaacaa tgaaccaaag agtgtcagta ttccccgatt 3060atgccccttc caagcagtgg gaggaggaga attcggccca gccagagtgc atgtaccttt 3120ttctctctca gacttaacgc aaattaaaat agacttaggt aaattctcag ataaccctga 3180tggctacatt gatgttttac aagggttagg gcaatccttt gatctgacat ggagagatat 3240aatgttactg ctaaatcaga cactaacccc aaatgagaga agtgccgccg taactgcagc 3300ccgagagttt ggtgatctct ggtatctcag tcaggtcaat gataggatga caacagagaa 3360aagagaacga ttccccacag gccagcaggc agtttccagt gtagaccctc attaggacac 3420agaatcagaa catggagatt ggtgccacag atatttgcta acttgagtgc tagaaggact 3480aaggaaaact aggaagaagc ctatgaatta ttcagtgatg tccactataa cacaaggaaa 3540ggaagaaaat cctactgcct ttctggagag agtaagggag gcattaagga agcatacctc 3600cctgtcacct gactctattg aaggccaact aatcttaaag gataagtttg tcactcagtt 3660agctgcagac attagaaaaa aacttcaaaa gtccgactta ggcctggagt acggctgagt 3720gcccaatttg gcagcaggca agaccaacac tgagcccttc atatggcacc atgctttgtg 3780gtgatcagcc aactacttga tggcaggttg attatattgg acatctttca tcagagaaat 3840ggcagtggtt tgtccttcct ggaatagaca cttattctcg atatgggttt gtctatcctg 3900caggcaatgc ttctgccagg agtaccatct gtggactcat ggaaagcctt atccaccatc 3960atggcattcc acacagcatt gcctctaaac aaggcactta ttttatagct aaggaagtgt 4020ggcagtgggc tcatgctcat ggaattcact gattgtatct tgttgcccat tatcttaaag 4080cagctggatt gatagaacag tggaaaggcc atttgaaatc acaattacac caccaactag 4140gtgacaatac tttgcagggc tcggcaaagt tctcttgaag gctgagtatg tcctgaatca 4200gcatccaata tatggtactg tttccctcat agccagcatt cacaggccta agaatcaagg 4260ggtagaagta gaagtggcac cactcaccat cactcctagt gacccactag caaaaatttt 4320acttccagtt cccccaacat tatgttctgc tggccttagt tccagaggga agaattctgc 4380caccagtcga cacaagaatg ataccattaa actgaaagtt aaaattgcca cctggccact 4440ttgggctcct cccacctcta agtcaacagg tcaagaaagg agttacagtg ttgacttggg 4500tgattgacct ggactatcaa gatgaaatca ggttactact ccacagtgga ggtaaggaag 4560aatatgtgtg gaatacagga gatcccttag gccgtctttt agtactacca tgccctgtga 4620ttaaggtcag tggaaaacta caacaatcca atctaggcag gactacaaat ggcccagact 4680cttcaggaat gaagggttgg gtgacttcac caggtaaaaa aataacagcc tgctgaggtg 4740ctagctgaag gcaaagggaa tacagaatgg ttagtagaaa aaggtagtca tcaataccag 4800ctatgaccac aagaccagtt gcagaaatga gacctgtaat tgtcatgtgg atttcctcct 4860tacatgtttg tgcatgtata cacttctact aagaaaatac ctttatttat ttcctttgct 4920tttcccttat caagtgacat tattaacttc atatcagcag ttaagtgtta ttaactttat 4980gtaatagcat ttcggttaat aattcacttc tggttgtatg aaggatagcc gtattaagtt 5040aggtgtaatt atgacatcat tattgtcttt atttgaagat tatgtgtaat ttcaggagat 5100gtgtatgggt tcaagttgac aagggatgga cttgtgatgg ctaatgttga gtgtcaactt 5160gactgaggat gcaaagtatt gttcctgggt gtgtctgtga gggtgttgcc aaaggagatt 5220aacatttgtg tcagtgaact gggagatgca gacccacccg caatctgggt gagcaccatg 5280taatcagctg ccagagcagc tagaataaag caagcagaag aaggtggaag gagctgactt 5340gctgagtctt ctagtattct tcgttcttct atgctggttg cttcctgccc ccaaacatca 5400gtctgcaagt tcttctgctt ttggactctt ggacttacac cagtggtttg ccagggactc 5460tcgggccttc 547011783DNAHomo sapiens 11tgagagacag gactaactgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccgc atccatcttt aaacacgggg cttgaaactt agctcacacc taaccagtca 120gagagctcac taaaatgcta attaggcaaa aaacaggagg taaagaaata gccaatcatc 180tattgcctga gagcacagcg ggagggacaa ggatcgggat ataaacccag gcattcgagc 240cagcaatggc aacccccttt gggtcccctt cccttgtatg ggagctctgt tttcactcta 300tttcactcta ttaaatcttg caactgcact cttctggtcc atgtttgtta cggctcgagc 360tgagctttgg ctcgccatcc accactgctg tttgccgccg tcgcacacct gctgctgact 420cccatccctc cggatccagc agggtgtgtc cgctgtgctc ctgatccagc gaggtgccca 480ttgccgctcc tgattggact aaaggcttgc cattgttcct gcacggctaa gtgcccgggt 540tcgtcctaat ccagctgaac actagtcact gggttccacg gttctcttcc ttgacccacg 600gcttctaata gagctataac actcaccgca tggcccaaga ttccattcct tggaatctgt 660gaggccaaga accccaggtc agagaacacg aggcttgcca ccatcttgga agcggcctgc 720caacatcttg gaagtggctc gccaccatct tgggagctct gtgagcaagg acccctggta 780aca 783127542DNAHomo sapiens 12tgagagacag gactagctgg atttcctagg ccgactaaga atccctaagc ctagctggga 60aggtgaccgc ttccaccttt aaacacgggg cttgcaactt agctcacacc cgaccaatca 120gatagtaaag agagcacact aaaatgctaa ttaggcaaaa acaggaggta aagaaatagc 180caatcatcta ttgcctgaga gcaaagcggg agggacaatg atcgggatag aaacccaggc 240attcaagccg gaatggctac cctctttggg tcccctccct ttgtatggga gctctgtttt 300cactctattc aatcttgcaa ctgcactctt ctggtccgtg tttgttacag cttgagctga 360gctttcgctc gccttccacc actgctgttt gccgccatcg cagacctgcc gtgctgactt 420ccatccctct agatctggca gggtgtccgc tgtgctcttg atccagcgag gcgcccattg 480ccgctcccga ttgggctaaa ggcttgcaat tgttcctgca cgctaagtgc ctgggttcat 540cctcatcaag ctgggttcca cggttctctt catgacccgc agcttctaac agagctataa 600aactctgtgc atggcccaag attccattcc ttggaatctg tgaggccaag aaccccaggt 660cagagaacag gaggcttgcc accatcttgg aagtggctcg ccaccatctt aggagctctg 720tgagcggaga cccccacccc ccggtaacat tttggcgacc acgaagggac ctccaaagcg 780gtgagtaata ttggatcact ttcgcttgct attctgtcct atccttcttt agaattggag 840gaaaatactg ggcacctgtc ggccagttaa aaacaattag cgtggctgcc cgacttaaga 900ctcaggtgtg aggctatctg gggaagggct ttctaacaac ccccaaccct tctgggttgg 960ggacgttggt ctgccccttc cactttcaat tttcttgggg aagccaaggg tcgactagag 1020gcagaaagct gtcgtccgga actcctggca gtagccggtt gagatcatgg cgcagccaga 1080agtctctact caacagtcgc ccatgcgtgc gctcctacct ttcctcctga cccatacctc 1140ctgggtcccg acgatgactt tcttgaaagt gtagccccaa aattctgctt acctctgaat 1200ctacttcccc tgatccctgg ctcctaggta ctaatggttc agtttcattt cctctagcaa 1260gttgtatctc caaagggatc taaggaagct ctacgctgcg tccttaggca tctaggctat 1320aaacccagga agtcttgtcc ctggtgtccc tcccgattta ggcatacagc tctcgacatg 1380ggcagttatg tgggacccgt tccccatcac ccttgtcaag gccccaagtt tgtaatggct 1440aagaggagag agagagaaag agagagagac ggaggggaga gagagagaga gagatggagg 1500ggagagagag agagagagac ggaggggaga gagagagaga gagagagacg gaggggagag 1560agagagagac ggaggggaga gagagagaga tggaggagag aaagacaaag ggagtcaaag 1620agaaaaagaa agagaaagac agaaatggta aaacaaacaa aaaacagcgt gccctattcc 1680tttaaaagcc ggggtaaatt taaaacctat aattgataat tgaaggtctt ctccatgacc 1740ctataatact ccaatactac cttgttgtca gtgtaaacaa gggcgtagcc tgaaaacact 1800gagaccactg acaacctgca gctttcctat caaaaaatcc ttaacccagt aaccggcaga 1860tgcattcaat ctgtagcagc aactgttttg ctaacagaag aaagtagaaa agtaactttt 1920agaggaaacc tcattgtgag cacaccttac cagttcagaa ttattctaag tcaaaaaagc 1980aaaaaggtag cttactaact caaaaatctt aaagtatggg gctattgtgt ttaaaaaaaa 2040aaaaaggtaa tttaacacca accactgata attctcttaa cccagcaggt ttcctaacag 2100gggatttaaa tcttaattac catacaaagg tctgaccaca cctaggagga actcccttca 2160ggacaggact atagagggtt cctcccaggt gattgaggaa aaaaccacag tgggtattca 2220gtaattgata gggagactct tgtggaagca gagttagaaa aattgcctaa taaatggtgt 2280cctcaaaagt gtgagctgtt tgcactcagc caagccttaa agtacttaca gaatcgtaaa 2340aactatctca atcctgactc aaaagtttac ttacaccctc tctgaaatga atttacataa 2400gaactgcttt tttgggaatg catcttgatg gggcagctgg gtggttatga aatactcagg 2460aaaccagccc agctctagga cacatccctg agcacaaagg caatgttggg cacgctggta 2520aaggaccact agaatccagc agcctggact cctttctttg tggtcaagaa aggcaggaaa 2580acaggtgcag gactgctaca tcagtgagca taactaatct gataagcaga gggccttggg 2640tggttacaca ccctggaaag gaattcaact ctgagcgcaa aggcaatgtt gggcacattg 2700gtaaaggacc actagaatcc agcagcccag gcccctttct ttatggtcaa gaaaggcggg 2760aaaaggggtg caggactgtt acctcggtga gcgtaactaa tccgataagc agaggtccat 2820gggtgattac gcaccctgaa aagaataagc attaggccct taaaggatgc tctaggacta 2880atgctcattg gaaaatgact aggggtgctg gcatccctat gttcttttct cagacgggaa 2940atgttctcca ccctccccaa ggcaaaaaca cccctaagat gtattctgga gaattgggac 3000caatttgacc cccagacgct aagaaagaga tgacttatgt tcttctgcag taccacctgg 3060ccacgatatc ctcttcaagg gggagaaacc tggcctcctg agggaagtat aaattataac 3120accatcttac agctagacct cttctgtaga aaggagggca aatggagtga agtgccatat 3180gtgcaaactt tcttttcatt aagagacaac ttgcaattat gtaagaagtg tgatttatgc 3240cctacaggaa gccctcagag tctacctccc taccccagca tccccctgac tccttctcca 3300actaataagg aacccccttc aacccaaacg gtccaaaagg agatagacaa aggggtaaac 3360aatgaaccaa agcgtgccaa tgttccctga ttatgccccc tctaagcagt gggaggagga 3420gaatttggcc cagccagtgt gcatgtgcct ttttctctct cagacttaaa gcaaattaaa 3480atagacctag gtaaattctc agataaccct gatggctata ttgatgtttt ataagggtta 3540ggataatcct ttgatctgac atggagagat ataatgttac tgctagatca gacactaacc 3600ccaaatgaga caagtgccgc cataactgca gcctgagagt ttggcgatct ctggtatctc 3660actcgggtca atgataggag gacaacagag gaaagagaat gattccccac agaccagcag 3720gcagttccca gtgtagaccc tcactgggac acagaatcag aacatggaca ttggtgctgc 3780agacatttgc taacttacat gctagaagga ctaaggaaaa ctaggaagaa gcctacgaat 3840tattcaatga tgtccactat aacacaggga aaggaagaaa atcctactgc ctttctggag 3900cgactaaggg aggcattgag gaagcatact tccctgtcac ctgactctat tgaaggccaa 3960ctaatcttaa aggataagtt tatcactcag tcagctgaag acattaggaa aaaacttcaa 4020aagtctgcct taggcccaga gcaaaactta gaaaccccat tgaacttggc aacctcggtt 4080ttttataata gagatcagga ggagcaggcg gaacaggaca aacggggtaa aaaaaaggcc 4140accgctttag ttatggccct caggcaagtg gactttggag gctctggaaa agggaaaagc 4200tgggcaaatc gaatgcctac tagggcttgc ttccagagtg gtctacaagg acactttgaa 4260aaagattgtc caagtagaaa taagtcgccc cttcgtccat gccccttata tcaagggaat 4320cactggaagg cccactatcc caggggacaa atgtcctctg agtcagaagc cactaaccag 4380atgatccagc agcaggactg agggtgccca gggcaagcac tagcccatgc cgtcaccctc 4440acagagcccc aggtatgctt gaccattgag ggccaggagg ttaactgtct cctggacact 4500agcacggcct tctcagtctt actctccttt cccggacaac tgtcctccag atctgtcact 4560atccgagggt tcctaggaca gtcagtcact agatacttat cccagtcact aagttgtgac 4620tggtgaactt tactcttttc acatgctttt ctaattatcc ctgaaagcac cactcccttg 4680ttagggcgag acattctagc aaaagcaggg gccattatac acctgaacat aggagaagga 4740acacctgttt gttgtcccct gcttgaggaa ggaattaatc ccgaagtctg ggcaacagaa 4800ggacaatacg gacgagcaaa gaatgcctgt gctgttcaag ttaaactaaa ggattccgcc 4860tcctttccct accaaaggca gtaccccctt agacctgagg cccaacaagg actccaaaag 4920attgttaagg acctaaaagc ccatggccta gtaaaaccat gcaatagccc ctgcaatact 4980ccaattttag gagtacagaa acccaacaga cagtggaggt tagtgcaaga tctcaggatt 5040atcattgagg ctgttgttcc tgtatagcca gctgtaccta acccttatac tctgctttcc 5100caaataccac aggaagcaga ggggtttaca gtccggggcc ttaaggacac ctttttctgc 5160atccctgtat atcctgactc tcaattcttg tttgcctttg aagatccttc aaactcaacg 5220tctcaactca cctggaatgt tttaccccaa gggttcaggg atagccccca ttagcccaag 5280acttgagcca gttcttatac ctggacactc ttgtcctttg gtacgtggat gatttacttt 5340tagccacctg ttcagaaacc ttgtgccatc aagccaccca agcactcttt aatttcctcg 5400ccacctgtgg ctacaggttt ccaaaccaaa ggctcagctc tgctcacagc aatttaaatg 5460cttagggcta aaattatcca aaggcaccag ggccctcagt gaggaaagta tccggcctat 5520actggcttat cctcatccca aaaccctaaa gcaactaaga gtgttccttg gcataacggg 5580tttctgccga atatggattc ccaggtacag cgaaatagcc agaccattat atacactaat 5640taaggaaact cagaaagcca atacccattt ggtaagatgg acacctgaag cagaagcaga 5700tttccaggcc ctaaagaagg ccctgaccca agccccagtg ttaagcttgc caatggggca 5760agacttttct ttatatgtca cagaaaaaac aggaatagct ccaggagtcc ttacgcagat 5820ccaagggacg agcctgcaac ccatggcata cctgagtaag gaaattagtg gcaaagggtt 5880ggcctcattg tttatgggta gtggcagcag tcacagtctt agtaactgaa gcagttaaaa 5940tgatacaagg aagagatctt actgtgtgga catctcatga tgtgaatggc atactcactg 6000ctaaaggaga cttgtgactg tcagacaact gtttacttaa atatcaggct ctattacttg

6060aagggccagt gttgcgactg tgcacttgtg caactcttaa cccagccaca ttgcttccag 6120acaatgaaga aaagatagaa cataactgtc aacaaataat tgctcaaacc tacactgctc 6180gaggggacct tttagaagtt cccttgactg atcccgatct caacttgtat actgatggaa 6240gttcctttgc agaaaaagga cttcaaaagg cggtgtatgc agtagtcctt caaaatcgaa 6300gagctttaga attgctaatc actgagagag ggggaacgtt tttattttta ggggaagaat 6360gctgttatta tgttaatcaa ttcggaatca tcaccaagaa agttaaagaa attcaagatc 6420gaatacaacg tagaacagag gagcttaaaa aacactggac cctggggcct cctcagccaa 6480tggatgccct ggattctccc cttcttagga cctctagcag ctatatttct actcctcttt 6540ggaccctgta tctttaacct ccgtgttaag tttgtctctt ccagaatcga agatgtaaaa 6600ctacaaatcg ttcttcaaat ggacccccag atgcagtcca tgactaagat ctactgagga 6660cccctggacc agcctgctag cccatgctcc aatgttaatg acattgaagg cacccctccc 6720aaggaaatct caactgcaca acccctacta tgctccaatt cagcaggaag cagttacagt 6780ggtcctcggc caacctcccc aacagcattt gtattttcct gttgggaggg ggcactgaga 6840gacaggacta gctggatttc ctaggctgac tgagaatccc taagcctagc tgggaaggtg 6900accacttcca cctttaaaca cagggcttgc aacttagctc acaccctacc aattggatag 6960taaagagagg tcactaaaat gctaattagg caaaaacagg aggtaaagaa atagccaatc 7020atccattgcc tgagagcaca gcgggaggga caatgaccag gatataaacc caggcattcc 7080agcctgcaac ggcaaccccc tttgggtccc ctctctttgt atgggagctc tgttttcact 7140ctattcaatc ttgcaactgc actcttctgg tccgtgtttg ttacggctca agctgagctt 7200ttgctcacca tccaccactg ctgtttgccg ccgttgcaga cccgtcgctg acttccatcc 7260ctccagatct ggcagggtgt ccactgtgct cctgatccag cgaggcaccc attgccactc 7320ccgatcaggc taaaggcttg ccattgttcc tgcacagcta agtgcctggg ttcgtcctaa 7380tcaagctgaa cactagtcac tgggttccat ggttctcttc catgacccat ggcttctaat 7440agagctataa cactcaccgc atggcccaag attccattcc ttggaatccg tgaggccaag 7500aaccccaggt cagagaacac gaggctgccg ccatcttgga ag 75421310288DNAHomo sapiens 13cctggggcgg gcttcctttc tgggatgagg gcaaaacgcc tggagataca gcaattatct 60tgcaactgag agacaggact agctggattt cctaggccga ctaagaatcc ctaagcctag 120ctgggaaggt gaccacgtcc acctttaaac acggggcttg caacttagct cacacctgac 180caatcagaga gctcactaaa atgctaatta ggcaaagaca ggaggtaaag aaatagccaa 240tcatctattg cctgagagca cagcaggagg gacaacaatc gggatataaa cccaggcatt 300cgagctggca acagcagccc ccctttgggt cccttccctt tgtatgggag ctgttttcat 360gctatttcac tctattaaat cttgcaactg cactcttctg gtccatgttt cttacggctc 420gagctgagct tttgctcacc gtccaccact gctgtttgcc accaccgcag acctgccgct 480gactcccatc cctctggatc ctgcagggtg tccgctgtgc tcctgatcca gcgaggcgcc 540cattgccgct cccaattggg ctaaaggctt gccattgttc ctgcacggct aagtgcctgg 600gtttgttcta attgagctga acactagtca ctgggttcca tggttctctt ctgtgaccca 660cggcttctaa tagaactata acacttacca catggcccaa gattccattc cttggaatcc 720gtgaggccaa gaactccagg tcagagaata cgaggcttgc caccatcttg gaagcggcct 780gctaccatct tggaagtggt tcaccaccat cttgggagct ctgtgagcaa ggaccccccg 840gtaacatttt ggcaaccacg aacggacatc caaagtggtg agtaatattg gaccactttc 900acttgctatt ctgtcctatc cttccttaga attggaggaa aataccgggc acttgtcggc 960cagttaaaaa cgattagtgt ggccaccgga cttaagactc aggtgtgagg ctatctgggg 1020aagggctttc taacaacccc caacccttct gggttgggga cttggtttgc ctcaagccag 1080cttccacttt cagttttctt ggggaagccg agggccgact agaggcagaa agctgtcgtc 1140ctgaactccc ggcagtagcc ggttgagatc atggtgtagc cagaagtctc aacagtcgcc 1200catgcatgca cccctatctt tccttctgac ccatacctcc tgggtcccaa ccacaacttt 1260cttcaaagtg tagccccaaa attctcctta cctctgaata tacttcctct gatccctgcc 1320tcctaggtac tattggttca gacttccatt tcctctagca agttgtatct ccaaagggat 1380ctaaggaagc tctgcgctgc gtccttaggc acctaggcta taacccaggg agtcttatcc 1440ctggtgtccc tcccaattta ggcatacagc tcttgacatg ggcagttatg taggacccac 1500tccccaccac ccttgccagg gccccaagtt tgtaaatggc tgagggaaaa gagagacaga 1560ggagagagag agaaatggag gagaaagaga gagagacaga gaggagagag agacagtgag 1620agagacagaa gagagagaga gacaaagagg agagagagag agtcaaagag agaaagaaag 1680agaaagaaat agtaaaaaac agtgtgccct attcctttaa aagccagggt aaatttaaaa 1740cctgtacttg ataattgaag gtcttctctg tgaccctata gcactccaat ccactttgtg 1800gtcagtgtaa ataagagcat aggccgaaag cactgaggcc attgacaacc cgtagcttcc 1860ctatcaaaaa tccttaaccc agtaacccgc agatggacca aatgcattca gtcggtagcg 1920caactgcttt gctaaaagta gaaaagtaac ttttagagga aacctcattg tgagcacacc 1980tcacctgttc agaattattc taataaaaaa agcaaaaagg tagcttacta actcaaaaat 2040cttaaagtat ggggctattc tgttagaaaa aggtaatgta actccaacca ctgataattc 2100ccttaaccca gcagatttcc taacgggatt taaatcttaa ttaccataca aaggtccgac 2160cagacctagg cggaactccc ttcaggacag gacgatagat ggttcctccc aggtgattga 2220ggaaaaaaac cacaatgggt attcagtaat tgatacgggg actcttgtgg aagcagagtt 2280agaaaaattg cctaataact ggtctcctca aacgtgtgag ctgtttgcac tcagccaagc 2340cttaaagtac ttacagaatc aaaagactat ctcaatcctg attcaaaagg ttagctacac 2400cctctctgta atgcatttgc ataagaactt gtttatggga atgcatcttg atggggcagc 2460tgggttgtta taaaatagga acccagccca gctctaggac tcacccctga gcgcaaaggc 2520aatgttgggc atgctggtaa aggaccacta gaatccagca gcccagaccc ctttctttgt 2580ggtcaagaaa ggcgggaaaa ggggtgcagg actgctacat cggtaagcat aactaatccg 2640ataaacagag gtccatgggt ggttacgcac cctggaaagg aactcacccc tgagcacaaa 2700ggcaatgttg ggcacgctgg taaaggacca ctagaatcca gcagcctgga cccctttctt 2760tgtggtcaag agaggcagga aaacaggtgc aggactgcaa catcagtgag cataactaat 2820tcgataagca gaggtccatg ggtggtgatg caccctggaa agaataagca ttaggaccat 2880agaggacact ccaggactaa agctcatcgg aaaatgacta gggttgctgg catccctatg 2940ttcttttttc agatgggaaa cgttccccgc aagacaaaaa cgcccctaag acgtattctg 3000gagaattggg accaatttga ccctcagaca ctaagaaaga aacgacttat attcttctgc 3060agtgccgcct ggcactcctg agggaagtat aaattataac accatcttac agctagacct 3120cttttgtaga aaaggcaaat ggagtgaagt gccataagta caaactttct tttcattaag 3180agacaactca caattatgta aaaagtgtga tttatgccct acaggaagcc ttcagagtct 3240acctccctat cccagcatcc ccgactcctt ccccaactaa taaggacccc ccttcaaccc 3300aaatggtcca aaaggagata gacaaaaggg taaacagtga accaaagagt gccaatattc 3360cccaattatg acccctccaa gcagtgggag gaagagaatt cggcccagcc agagtgcatg 3420tgcctttttc tctcccagac ttaaagcaaa taaaaacaga cttaggtaaa ttctcagata 3480accctgatgg ctatattgat gttttacaag ggttaggaca attctttgat ctgacatgga 3540gagatataat gtcactgcta aatcagacac taaccccaaa tgagagaagt gccaccataa 3600ctgcagcctg agagtttggc gatctctggt atctcagtca ggtcaatgat aggatgacaa 3660cagaggaaag agaatgattc cccacaggcc agcaggcagt tcccagtcta gaccctcatt 3720gggacacaga atcagaacat ggagattggt gctgcagaca tttgctaact tgtgtgctag 3780aaggactaag gaaaactagg aagaagtcta tgaattactc aatgatgtcc accataacac 3840agggaaggga agaaaatcct actgcctttc tggagagact aagggaggca ttgaggaagc 3900gtgcctctct gtcacctgac tcttctgaag gccaactaat cttaaagcgt aagtttatca 3960ctcagtcagc tgcagacatt agaaaaaaac ttcaaaagtc tgccgtaggc ccggagcaaa 4020acttagaaac cctattgaac ttggcaacct cggtttttta taatagagat caggaggagc 4080aggcggaaca ggacaaacgg gattaaaaaa aaggccaccg ctttagtcat gaccctcagg 4140caagtggact ttggaggctc tggaaaaggg aaaagctggg caaattgaat gcctaatagg 4200gcttgcttcc agtgcggtct acaaggacac tttaaaaaag attgtccaag tagaagtaag 4260ccgccccctc gtccatgccc cttatttcaa gggaatcact ggaaggccca ctgccccagg 4320ggacaaaggt cctctgagtc agaagccact aaccagatga tccagcagca ggactgaggg 4380tgcctggggc aagcgccatc ccatgccatc accctcacag agccctgggt atgcttgacc 4440attgagggcc aggaggttgt ctcctggaca ctggtgcggt cttcttagtc ttactcttct 4500gtcccggaca actgtcctcc agatctgtca ctatctgagg gggtcctaag acgggcagtc 4560actagatact tctcccagcc actaagttat gactggggag ctttattctt ttcacatgct 4620tttctaatta tgcttgaaag ccccactacc ttgttaggga gagacattct agcaaaagca 4680ggggccatta tacacctgaa cataggagaa ggaacacccg tttgttgtcc cctgcttgag 4740gaaggaatta atcctgaagt ctgggcaaca gaaggacaat atggacgagc aaagaatgcc 4800cgtcctgttc aagttaaact aaaggattcc acctcctttc cctaccaaag gcagtacccc 4860ctcagaccca aggcccaaca aggactccaa aagattgtta aggacctaaa agcccaaggc 4920ctagtaaaac catgcagtaa cccctgcagt actccaattt taggagtaca gaaacccaac 4980agacagtgga ggttagtgca agatctcagg attatcaatg aggctgttgt tcctctatag 5040ccagctgtac ctagccctta tactctgctt tcccaaatac cagaggaagc agagtggttt 5100acagtcctgg accttcagga tgccttcttc tgcatccctg tacatcctga ctctcaattc 5160ttgtttgcct ttgaagatac ttcaaaccca acatctcaac tcacctggac tattttaccc 5220caagggttca gggatagtcc ccatctattt ggccaggcat tagcccaaga cttgagccaa 5280tcctcatacc tggacacttg tccttcggta ggtggatgat ttacttttgg ccgcccattc 5340agaaaccttg tgccatcaag ccacccaagc gctcttcaat ttcctcgcta cctgtggcta 5400catggtttcc aaaccaaagg ctcaactctg ctcacagcag gttacttagg gctaaaatta 5460tccaaaggca ccagggccct cagtgaggaa cacatccagc ctatactggc ttatcctcat 5520cccaaaaccc taaagcaact aaggggattc cttggcgtaa taggtttctg ccgaaaatgg 5580attcccaggt atggcgaaat agccaggtca ttaaatacac taattaagga aactcagaaa 5640gccaataccc atttagtaag atggacaact gaagtagaag tggctttcca ggccctaacc 5700caagccccag tgttaagttt gccaacaggg caagactttt cttcatatgt cacagaaaaa 5760acaggaatag ctctaggagt ccttacacag atccgaggga tgagcttgca acctgtggca 5820tacctgacta aggaaattga tgtagtggca aagggttgac ctcattgttt acgggtagtg 5880gtggcagtag cagtcttagt atctgaagca gttaaaataa tacagggaag agatcttact 5940gtgtggacat ctcatgatgt gaatggcata ctcactgcta aaggagactt gtggctgtca 6000gacaactgtt tacttaaatg tcaggctcta ttacttgaag ggccagtgct gcgactgtgc 6060acttgtgcaa ctcttaaccc agccacattt cttccagaca atgaagaaaa gataaaacat 6120aactgtcaac aagtaatttc tcaaacctat gccactcgag gggacctttt agaggttcct 6180ttgactgatc ccgacctcaa cttgtatact gatggaagtt cctttgtaga aaaaggactt 6240cgaaaagtgg ggtatgcagt ggtcagtgat aatggaatac ttgaaagtaa tcccctcact 6300ccaggaacta gtgctcagct agcagaacta atagccctca cttgggcact agaattagga 6360gaagaaaaaa gggcaaatat atatacagac tctaaatatg cttacctagt cctccatgcc 6420catgcagcaa tatggaaaga aagggaattc ctaacttctg agagaacacc tatcaaacat 6480caggaagcca ttaggaaatt attattggct gtacagaaac ctaaagaggt ggcagtctta 6540cactgccggg gtcatcagaa aggaaaggaa agggaaatag aagagaactg ccaagcagat 6600attgaagcca aaagagctgc aaggcaggac cctccattag aaatgcttat aaaacaaccc 6660ctagtatagg gtaatcccct ccgggaaacc aagccccagt actcagcagg agaaacagaa 6720tggggaacct cacgaggaca gttttctccc ctcgggacgg ctagccactg aagaagggaa 6780aatacttttg cctgcaacta tccaatggaa attacttaaa acccttcatc aaacctttca 6840cttaggcatc gatagcaccc atcagatggc caaatcatta tttactggac caggcctttt 6900caaaactatc aagcagatag tcagggcctg tgaagtgtgc cagagaaata atcccctgcc 6960ttatcgccaa gctccttcag gagaacaaag aacaggccat taccctggag aagactggca 7020actgatttta cccacaagcc caaacctcag ggatttcagt atctactagt ctgggtagat 7080actttcacgg gttgggcaga ggccttcccc tgtaggacag aaaaggccca agaggtaata 7140aaggcactag ttcatgaaat aattcccaga ttcggacttc cccgaggctt acagagtgac 7200aatagccctg ctttccaggc cacagtaacc cagggagtat cccaggcgtt aggtatacga 7260tatcacttac actgcgcctg aaggccacag tcctcaggga aggtcgagaa aatgaatgaa 7320acactcaaag gacatctaaa aaagcaaacc caggaaaccc acctcacatg gcctgctctg 7380ttgcctatag ccttaaaaag aatctgcaac tttccccaaa aagcaggact tagcccatac 7440gaaatgctgt atggaaggcc cttcataacc aatgaccttg tgcttgaccc aagacagcca 7500acttagttgc agacatcacc tccttagcca aatatcaaca agttcttaaa acattacaag 7560gaacctatcc ctgagaagag ggaaaagaac tattccaccc ttgtgacatg gtattagtca 7620agtcccttcc ctctaattcc ccatccctag atacatcctg ggaaggaccc tacccagtca 7680ttttatctac cccaactgcg gttaaagtgg ctggagtgga gtcttggata catcacactt 7740gagtcaaatc ctggatactg ccaaaggaac ctgaaaatcc aggagacaac gctagctatt 7800cctgtgaacc tctagaggat ttgcgcctgc tcttcaaaca acaaccagga ggaaagtaac 7860taaaatcata aatccccatg gccctccctt atcatatttt tctctttact gttcttttac 7920cctctttcac tctcactgca ccccctccat gccgctgtat gaccagtagc tccccttacc 7980aagagtttct atggagaatg cagcgtcccg gaaatattga tgccccatcg tataggagtc 8040tttctaaggg aacccccacc ttcactgccc acacccatat gccccgcaac tgctatcact 8100ctgccactct ttgcatgcat gcaaatactc attattggac aggaaaaatg attaatccta 8160gttgtcctgg aggacttgga gtcactgtct gttggactta cttcacccaa actggtatgt 8220ctgatggggg tggagttcaa gatcaggcaa gagaaaaaca tgtaaaagaa gtaatctccc 8280aactcacccg ggtacatggc acctctagcc cctacaaagg actagatctc tcaaaactac 8340atgaaaccct ccgtacccat actcgcctgg taagcctatt taataccacc ctcactgggc 8400tccatgaggt ctcggcccaa aaccctacta actgttggat atgcctcccc ctgaacttca 8460ggccatatgt ttcaatccct gtacctgaac aatggaacaa cttcagcaca gaaataaaca 8520ccacttccgt tttagtagga cctcttgttt ccaatctgga aataacccat acctcaaacc 8580tcacctgtgt aaaatttagc aatactacat acacaaccaa ctcccaatgc atcaggtggg 8640taactcctcc cacacaaata gtctgcctac cctcaggaat attttttgtc tgtggtacct 8700cagcctatcg ttgtttgaat ggctcttcag aatctatgtg cttcctctca ttcttagtgc 8760cccctatgac catctacact gaacaagatt tatacagtta tgtcatatct aagccccgca 8820acaaaagagt acccattctt ccttttgtta taggagcagg agtgctaggt gcactaggta 8880ctggcattgg cggtatcaca acctctactc agttctacta caaactatct caagaactaa 8940atggggacat ggaacgggtc gccgactccc tggtcacctt gcaagatcaa cttaactccc 9000tagcagcagt agtccttcaa aatcgaagag ctttagactt gctaaccgct gaaagagggg 9060gaacctgttt atttttaggg gaagaatgct gttattatgt taatcaatcc ggaatcgtca 9120ctgagaaagt taaagaaatt cgagatcgaa tacaacgtag agcagaggag cttcgaaaca 9180ctggaccctg gggcctcctc agccaatgga tgccctggat tctccccttc ttaggacctc 9240tagcagctat aatattgcta ctcctctttg gaccctgtat ctttaacctc cttgttaact 9300ttgtctcttc cagaatcgaa gctgtaaaac tacaaatgga gcccaagatg cagtccaaga 9360ctaagatcta ccgcagaccc ctggaccggc ctgctagccc acgatctgat gttaatgaca 9420tcaaaggcac ccctcctgag gaaatctcag ctgcacaacc tctactacgc cccaattcag 9480caggaagcag ttagagcggt cgtcggccaa cctccccaac agcacttagg ttttcctgtt 9540gagatggggg actgagagac aggactagct ggatttccta ggctgactaa gaatccctaa 9600gcctagctgg gaaggtgacc acatccacct ttaaacacgg ggcttgcaac ttagctcaca 9660cctgaccaat cagagagctc actaaaatgc taattaggca aagacaggag gtaaagaaat 9720agccaatcat ctattgcctg agagcacagc aggagggaca atgatcggga tataaaccca 9780agtcttcgag ccggcaacgg caaccccctt tgggtcccct ccctttgtat gggagctctg 9840ttttcatgct atttcactct attaaatctt gcaactgcac tcttctggtc catgtttctt 9900acggcttgag ctgagctttc gctcgccatc caccactgct gtttgccgcc accgcagacc 9960cgccgctgac tcccatccct ctggatcatg cagggtgtcc gctgtgctcc tgatccagcg 10020aggcacccat tgccgctccc aatcgggcta aaggcttgcc attgttcctg catggctaag 10080tgcctgggtt catcctaatt gagctgaaca ctagtcactg ggttccatgg ttctcttctg 10140tgacccacag cttctaatag agctataaca ctcaccgcat ggcccaaggt tccattcctt 10200gaatccataa ggccaagaac cccaggtcag agaacacgag gcttgccacc atcttgggag 10260ctctgtgagc aaggaccccc aagtaaca 102881418DNAArtificial sequenceSynthetic Construct - amplification primer 14tgcagatgct gtgtctgg 181517DNAArtificial sequenceSynthetic Construct - amplification primer 15cgtactggcc caggacc 171620DNAArtificial sequenceSynthetic Construct - amplification primer 16ggttcgtgct aattgagctg 201720DNAArtificial sequenceSynthetic Construct - amplification primer 17atggtggcaa gcttcttgtt 201820DNAArtificial sequenceSynthetic Construct - amplification primer 18tgagctttcc ctcactgtcc 201920DNAArtificial sequenceSynthetic Construct - amplification primer 19tgttcggctt gattaggatg 202020DNAArtificial sequenceSynthetic Construct - amplification primer 20catggcccaa tattccattc 202121DNAArtificial sequenceSynthetic Construct - amplification primer 21ggtccttgtt cacagaactc c 212220DNAArtificial sequenceSynthetic Construct - amplification primer 22ccgctcctga ttggactaaa 202320DNAArtificial sequenceSynthetic Construct - amplification primer 23cgtgggtcaa ggaagagaac 202421DNAArtificial sequenceSynthetic Construct - amplification primer 24atgacccgca gcttctaaca g 212520DNAArtificial sequenceSynthetic Construct - amplification primer 25ctccgctcac agagctccta 202621DNAArtificial sequenceSynthetic Construct - amplification primer 26ccaacatcac taacacaacc t 212720DNAArtificial sequenceSynthetic Construct - amplification primer 27gggagttagt aaggggtttg 202824DNAArtificial sequenceSynthetic Construct - amplification primer 28caacctatta aacaaaacta aatt 242927DNAArtificial sequenceSynthetic Construct - amplification primer 29agatttaata gagtgaaaat agagttt 273022DNAArtificial sequenceSynthetic Construct - amplification primer 30ttattagttt aggggatagt tg 223123DNAArtificial sequenceSynthetic Construct - amplification primer 31acacaataaa caacctacta aat 233219DNAArtificial sequenceSynthetic Construct - amplification primer 32gagggtaagt ggtgataaa 193321DNAArtificial sequenceSynthetic Construct - amplification primer 33aacctactaa atccaaaaaa a 213422DNAArtificial sequenceSynthetic Construct - amplification primer 34taggatttta ggtttattgt ta 223519DNAArtificial sequenceSynthetic Construct - amplification primer 35aaaaataaaa tattaaacc 193620DNAArtificial sequenceSynthetic Construct - amplification primer 36atatgtggga gtgagagata 203722DNAArtificial sequenceSynthetic Construct - amplification primer 37caacaacaaa caataataat aa 223822DNAArtificial sequenceSynthetic Construct - amplification primer 38ttgagttttt ttattgatag tg 223921DNAArtificial sequenceSynthetic Construct - amplification primer 39tctaaatcct attttcctac t 214024DNAArtificial sequenceSynthetic Construct - amplification primer 40gtttttttat tgatagtgag agat

244120DNAArtificial sequenceSynthetic Construct - amplification primer 41taacaaacct ttaatccaat 204222DNAArtificial sequenceSynthetic Construct - amplification primer 42tttagtgagg atgatgtaat at 224322DNAArtificial sequenceSynthetic Construct - amplification primer 43caacttaata aaaataaacc ca 224424DNAArtificial sequenceSynthetic Construct - amplification primer 44ataatgtttt agtaagtgtt ggat 244520DNAArtificial sequenceSynthetic Construct - amplification primer 45acaattacaa acctttaacc 204620DNAArtificial sequenceSynthetic Construct - amplification primer 46aattcattca acatccattc 204726DNAArtificial sequenceSynthetic Construct - amplification primer 47ggtttaatat tatttattat tttgga 264825DNAArtificial sequenceSynthetic Construct - amplification primer 48ctcttacctt cctatactct ctaaa 254928DNAArtificial sequenceSynthetic Construct - amplification primer 49agagtgtagt tgtaagattt aatagagt 28

Claims

1. A method for in vitro diagnosis of testicular cancer, comprising: obtaining a biological sample from a patient suspected of having testicular cancer; performing an assay to determine the methylation status of CpG dinucleotides in a genomic DNA target sequence, the DNA target sequence being at least one sequence selected from the group consisting of sequences having at least 99% sequence identity with the full-length sequence of SEQ ID NO: 6 or 7 and the sequences fully complementary thereto; and diagnosing the patient with testicular cancer when the DNA target sequence is hypomethylated as compared to a methylation status indicative of the absence of testicular cancer, wherein the assay comprises: extracting genomic DNA from the biological sample; treating the extracted genomic DNA to convert cytosine bases of CpG dinucleotides that are nonmethylated at position 5 into uracil bases; amplifying the treated genomic DNA target sequence; and determining the methylation status of the CpG dinucleotides in the genomic DNA target sequence from the amplified genomic DNA target sequence.

2. The method of claim 1, wherein the extracted genomic DNA is treated using hydrogen sulfite, disulfite, bisulfite, or a combination thereof.

3. The method of claim 1, wherein the treated genomic DNA target sequence is amplified using at least one primer comprising a sequence selected from the group consisting of the full-length sequences of SEQ ID NOS: 46-49.

4. The method of claim 1, wherein the biological sample is a testicular tissue extract or a biological fluid.

5. The method of claim 1, wherein the biological sample is blood, serum, plasma, urine, or seminal fluid.

6. The method of claim 1, wherein the DNA target sequence is hypomethylated if 60% or less of the CpG dinucleotides are methylated.

7. The method of claim 1, wherein the DNA target sequence is hypomethylated if 30% or less of the CpG dinucleotides are methylated.

8. A method for in vitro diagnosis of testicular cancer, comprising: obtaining a biological sample from a patient suspected of having testicular cancer; performing an assay to determine the methylation status of CpG dinucleotides in a genomic DNA target sequence, the DNA target sequence being the 5' LTR U3 promoter sequence of the ERVWE1 locus, optionally further including an activator sequence directly upstream of the 5' LTR U3 promoter sequence; and diagnosing the patient with testicular cancer when the DNA target sequence is hypomethylated as compared to a methylation status indicative of the absence of testicular cancer, wherein the assay comprises: extracting genomic DNA from the biological sample; treating the extracted genomic DNA to convert cytosine bases of CpG dinucleotides that are nonmethylated at position 5 into uracil bases; amplifying the treated genomic DNA target sequence; and determining the methylation status of the CpG dinucleotides in the genomic DNA target sequence from the amplified genomic DNA target sequence.

9. The method of claim 8, wherein the extracted genomic DNA is treated using hydrogen sulfite, disulfite, bisulfite, or a combination thereof.

10. The method of claim 8, wherein the treated genomic DNA target sequence is amplified using at least one primer comprising a sequence selected from the group consisting of the full-length sequences of SEQ ID NOS: 46-49.

11. The method of claim 8, wherein the biological sample is a testicular tissue extract or a biological fluid.

12. The method of claim 8, wherein the biological sample is blood, serum, plasma, urine, or seminal fluid.

13. The method of claim 8, wherein the DNA target sequence is hypomethylated if 60% or less of the CpG dinucleotides are methylated.

14. The method of claim 8, wherein the DNA target sequence is hypomethylated if 30% or less of the CpG dinucleotides are methylated.