U.S. patent application number 14/172865 was filed with the patent office on 2014-11-27 for methods and compositions for treatment and diagnosis of fibrosis, tumor invasion, angiogenesis, and metastasis.
This patent application is currently assigned to GILEAD BIOLOGICS, INC.. The applicant listed for this patent is GILEAD BIOLOGICS, INC.. Invention is credited to Vivian E. BARRY, Donna Hiroko Tokuoka BIERMANN, Carlos Aurelio GARCIA, Alison Kay HOLZER, Derek MARSHALL, Scott Alan MCCAULEY, Scott OGG, Miho OYASU, Hector RODRIGUEZ, Victoria SMITH, Peter VAN VLASSELAER.
Application Number | 20140349309 14/172865 |
Document ID | / |
Family ID | 40094743 |
Filed Date | 2014-11-27 |
United States Patent
Application |
20140349309 |
Kind Code |
A1 |
SMITH; Victoria ; et
al. |
November 27, 2014 |
METHODS AND COMPOSITIONS FOR TREATMENT AND DIAGNOSIS OF FIBROSIS,
TUMOR INVASION, ANGIOGENESIS, AND METASTASIS
Abstract
The present disclosure provides innovative methodology and
related compositions and kits for preventing and treating various
diseases associated with abnormal cell proliferation, angiogenesis
and fibrosis, by using an inhibitor of processed forms of lysyl
oxidase or lysyl oxidase-like proteins, an inhibitor of LOX and an
inhibitor of a LOXL, or a synergistic combination of an inhibitor
of LOX or LOXL combined with other therapeutic agents. Also
provided are innovative methods for selecting agents that prevent
or inhibit tumor invasion, angiogenesis and metastasis, by
contacting cells that are in an epithelial-mesenchymal transition
(EMT) state with a candidate agent and detecting a change in the
EMT state of the cells. Methods and related compositions and kits
for diagnosing or monitoring various diseases associated with
abnormal cell proliferation, angiogenesis and fibrosis, by using
molecules or agents that specifically recognize processed forms of
LOX or LOXL are also provided. Also provided herein are methods and
related compositions, medical devices, systems and kits for
preventing or treating various diseases and conditions associated
with fibrosis with compositions comprising inhibitors of LOX or
LOXL. Such diseases or conditions include pathological
cardiovascular conditions and diseases such as hypertension,
hypertensive heart disease, myocardial infarction, atherosclerosis,
and restenosis, liver fibrosis, kidney fibrosis, lung fibrosis,
dermal scaring, keloid formation, and Alzheimer's disease.
Inventors: |
SMITH; Victoria;
(Burlingame, CA) ; OGG; Scott; (San Francisco,
CA) ; VAN VLASSELAER; Peter; (Portola Valley, CA)
; BARRY; Vivian E.; (San Francisco, CA) ;
MARSHALL; Derek; (Pacifica, CA) ; HOLZER; Alison
Kay; (Redwood City, CA) ; RODRIGUEZ; Hector;
(Brisbane, CA) ; OYASU; Miho; (San Mateo, CA)
; MCCAULEY; Scott Alan; (Brisbane, CA) ; GARCIA;
Carlos Aurelio; (San Lorenzo, CA) ; BIERMANN; Donna
Hiroko Tokuoka; (San Mateo, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GILEAD BIOLOGICS, INC. |
Foster City |
CA |
US |
|
|
Assignee: |
GILEAD BIOLOGICS, INC.
Foster City
CA
|
Family ID: |
40094743 |
Appl. No.: |
14/172865 |
Filed: |
February 4, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12185054 |
Aug 1, 2008 |
8679485 |
|
|
14172865 |
|
|
|
|
60963246 |
Aug 2, 2007 |
|
|
|
60963282 |
Aug 2, 2007 |
|
|
|
60963214 |
Aug 2, 2007 |
|
|
|
60963248 |
Aug 2, 2007 |
|
|
|
60963249 |
Aug 2, 2007 |
|
|
|
Current U.S.
Class: |
435/7.4 |
Current CPC
Class: |
A61P 13/12 20180101;
A61P 1/04 20180101; C07K 2317/77 20130101; A61K 45/06 20130101;
A61P 21/00 20180101; A61P 35/00 20180101; A61P 13/08 20180101; A61P
11/00 20180101; C07K 2317/30 20130101; A61K 2039/505 20130101; A61K
39/3955 20130101; A61P 19/00 20180101; A61P 3/10 20180101; A61P
9/10 20180101; A61P 15/00 20180101; C07K 2317/34 20130101; A61P
35/04 20180101; G01N 33/57423 20130101; A61P 9/00 20180101; A61P
17/00 20180101; C07K 2317/33 20130101; C07K 2317/76 20130101; C07K
2317/565 20130101; A61P 25/00 20180101; C07K 2317/24 20130101; A61P
13/10 20180101; A61P 9/12 20180101; C12Q 1/6886 20130101; A61P 1/18
20180101; A61P 1/16 20180101; C07K 16/40 20130101; G01N 2333/90633
20130101; G01N 33/57438 20130101; A61P 43/00 20180101; A61P 19/04
20180101; A61P 17/02 20180101; C07K 2317/92 20130101; G01N 33/57484
20130101; A61P 25/28 20180101 |
Class at
Publication: |
435/7.4 |
International
Class: |
G01N 33/574 20060101
G01N033/574 |
Claims
1.-94. (canceled)
95. A method for diagnosing cancer in a subject, comprising:
contacting a sample obtained from an individual with an anti-LOXL2
antibody; detecting the binding of the anti-LOXL2 antibody to an
anti-LOXL2 antibody/LOXL2 complex; wherein an increase in the level
of an anti-LOXL2 antibody/LOXL2 complex compared to a reference
sample indicates the presence of cancer.
96. The method of claim 95, wherein the sample is sputum, blood,
serum, plasma, or urine.
97. The method of claim 95, wherein the cancer is selected from the
group consisting of lung cancer, breast cancer, colorectal cancer,
pancreatic cancer, prostate cancer, skin cancer, bone cancer,
ovarian cancer, liver cancer, anal cancer, bile duct cancer,
esophageal cancer, leukemia, lymphoma, bladder cancer, uterine
cancer, brain cancer, kidney cancer, cancer of the head and neck,
cancer of the stomach, myeloma, testicular cancer, germ cell tumor,
neuroendocrine tumor, cervical cancer, and gastrointestinal
cancer.
98. The method of claim 95, wherein the cancer is selected from the
group consisting of pancreatic, liver, and lung cancers.
99. The method of claim 95, wherein the cancer is a pancreatic
cancer.
100. The method of claim 95, wherein the cancer is liver
cancer.
101. The method of claim 95, wherein the cancer is lung cancer.
102. The method of claim 95, wherein the cancer is metastatic
cancer.
103. The method of claim 95, wherein the anti-LOXL2 antibody binds
to any one of SEQ ID NO: 3, 5, 7, 11, or 16.
104. The method of claim 95, wherein anti-LOXL2 antibody binds to
both active LOXL2.
105. The method of claim 104, wherein the active LOXL2 is a mature
form of LOXL2 after proteolytic processing of the
preproprotein.
106. The method of claim 95, wherein the anti-LOXL2 antibody is
humanized or human.
107. The method of claim 95, wherein the binding of the anti-LOXL2
antibody to the anti-LOXL2 antibody/LOXL2 complex is detected by
enzyme-linked immunosorbent assays (ELISA).
108. A method for diagnosing cancer metastasis in a subject,
comprising: contacting a sample obtained from an individual with an
anti-LOXL2 antibody; detecting the binding of the anti-LOXL2
antibody to an anti-LOXL2 antibody/LOXL2 complex; wherein an
increase in the level of an anti-LOXL2 antibody/LOXL2 complex
compared to a reference sample indicates the presence of metastatic
tumor growth.
109. The method of claim 108, wherein the liquid sample is sputum,
blood, serum, plasma, or urine.
110. The method of claim 108, wherein the anti-LOXL2 antibody binds
to any one of SEQ ID NO: 3, 5, 7, 11, or 16.
111. The method of claim 108, wherein anti-LOXL2 antibody binds to
both active LOXL2.
112. The method of claim 111, wherein the active LOXL2 is a mature
form of LOXL2 after proteolytic processing of the
preproprotein.
113. The method of claim 108, wherein the anti-LOXL2 antibody is
humanized or human.
114. The method of claim 108, wherein the binding of the anti-LOXL2
antibody to the anti-LOXL2 antibody/LOXL2 complex is detected by
enzyme-linked immunosorbent assays (ELISA).
Description
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/963,282, entitled "Methods for Selecting
Inhibitors of Tumor Invasion, Angiogenesis, and Metastasis," filed
Aug. 2, 2007 (Attorney Docket No. 35120-704.101); U.S. Provisional
Application No. 60/963,249, entitled "Treatment of Diseases With
Inhibitors of Active Lysyl Oxidase," filed Aug. 2, 2007 (Attorney
Docket No. 35120-706.101); U.S. Provisional Application No.
60/963,214, entitled "Treatment of Diseases Through Inhibition of
Both Lysyl Oxidase and Lysyl Oxidase-Like Proteins," filed Aug. 2,
2007 (Attorney Docket No. 35120-706.102); U.S. Provisional
Application No. 60/963,248, entitled "Diagnosis or Monitoring of
Diseases by Assessing Active Lysyl Oxidase Levels or Activity,"
filed Aug. 2, 2007 (Attorney Docket No. 35120-706.103); and U.S.
Provisional Application No. 60/963,246, entitled "Combination
Therapy Including Lysyl Oxidase Modulators," filed Aug. 2, 2007
(Attorney Docket No. 35120-707.101), and is related to co-pending
U.S. patent application entitled "LOX and LOXL2 Inhibitors and Uses
Thereof" (Attorney Docket No. 35120-715.201), filed Aug. 1, 2008,
Ser. No. ______, and PCT Patent Application entitled "LOX and LOXL2
Inhibitors and Uses Thereof" (Attorney Docket No. 35120-715.601),
filed Aug. 1, 2008, Ser. No. ______, each of which applications is
incorporated herein in its entirety by reference.
BACKGROUND
1. Cancer
[0002] Cancer is a serious public health problem in the United
States and other developed countries. Currently, one in four deaths
in the United States is due to cancer. Cancer therapy involves
treating patients with chemotherapeutic drugs to kill tumor cells.
However, subsets of tumor cells are frequently resistant to drug
therapy and survive to re-populate at sites of origin and at
distant metastatic sites, leading to detectable disease recurrence
and morbidity. Many carcinoma tumor cells that have the properties
of increased invasive and metastatic capacity, and altered drug
resistance, are thought to have undergone a morphological
transformation encompassing or similar to EMT
(epithelial-mesenchymal transition). Cells undergoing EMT lose the
normal adhesive properties of epithelial cells and undergo a
spectrum of changes including loss of E-cadherin expression and
expression of mesenchymal markers, increased motility, increased
invasiveness, and increased resistance to cell death.
[0003] The leading therapies for cancer are currently surgery,
radiation and chemotherapy. Chemotherapeutic approaches such as
antitumor antibiotics, alkylating agents, nitrosourea compounds,
vinca alkaloids, steroid hormones, and anti-metabolites form the
bulk of therapies available to oncologists. Despite advances in the
field of cancer treatment, cancer remains a major health
problem.
2. Angiogenesis
[0004] Angiogenesis, the formation of new blood vessels out of
pre-existing capillaries, is a sequence of events that is of key
importance in a broad array of physiologic and pathologic
processes. Normal tissue growth, such as in embryonic development,
wound healing, and the menstrual cycle, is characterized by
dependence on new vessel formation for the supply of oxygen and
nutrients as well as removal of waste products. A large number of
different and unrelated diseases are also associated with formation
of new vasculature. Among certain pathologies are conditions in
which angiogenesis is low, and should be enhanced to improve
disease conditions. More frequently, however, excessive
angiogenesis is an important characteristic of various pathologies,
including pathologies characterized or associated with an abnormal
or uncontrolled proliferation of cells. Pathologies which involve
excessive angiogenesis include, for example, cancer (both solid and
hematologic tumors), cardiovascular diseases (such as
atherosclerosis and restenosis), chronic inflammation (rheumatoid
arthritis, Crohn's disease), diabetes (diabetic retinopathy),
psoriasis, endometriosis, neovascular glaucoma and adiposity. These
conditions may benefit from chemotherapeutic inhibition of
angiogenesis.
[0005] Generally speaking, the angiogenic process entails the
proliferation and migration of a normally quiescent endothelium,
the controlled proteolysis of the pericellular matrix, and the
synthesis of new extracellular matrix components by developing
capillaries. The establishment of new intra- and intercellular
contacts and the morphological differentiation of endothelial cells
to capillary-like tubular networks provide support for their
subsequent maturation, branching, remodeling and selective
regression to form a highly organized, functional microvascular
network. The autocrine, paracrine and amphicrine interactions of
the vascular endothelium with its surrounding stromal components,
as well as with the pro-angiogenic and angiostatic cytokines and
growth factors orchestrating physiologic angiogenesis, are normally
tightly regulated both spatially and temporally.
[0006] Angiogenesis is crucial to the growth of neoplastic tissues.
For more than 100 years, tumors have been observed to be more
vascular than normal tissues. Several experimental studies have
suggested that both primary tumor growth and metastasis require
neovascularization. In contrast to the well orchestrated process
described above for normal tissue growth, the pathologic
angiogenesis necessary for active tumor growth is generally
sustained and persistent, with the initial acquisition of the
angiogenic phenotype being a common mechanism for the development
of a variety of solid and hematopoietic tumor types. Tumors that
are unable to recruit and sustain a vascular network typically
remain dormant as asymptomatic lesions in situ. Metastasis is also
angiogenesis-dependent: for a tumor cell to metastasize
successfully, it generally gains access to the vasculature in the
primary tumor, survive the circulation, arrest in the
microvasculature of the target organ, exit from this vasculature,
grow in the target organ, and induce angiogenesis at the target
site. Thus, angiogenesis appears to be necessary at the beginning
as well as the completion of the metastatic cascade.
[0007] The criticality of angiogenesis to the growth and metastasis
of neoplasms thus provides an optimal potential target for
chemotherapeutic efforts. Appropriate anti-angiogenic agents may
act directly or indirectly to influence tumor-associated
angiogenesis either by delaying its onset (i.e., blocking an
"angiogenic switch") or by blocking the sustained and focal
neovascularization that is characteristic of many tumor types.
Anti-angiogenesis therapies directed against the tumor-associated
endothelium and the multiple molecular and cellular processes and
targets implicated in sustained pathologic angiogenesis are being
actively evaluated for their safety and efficacy in multiple
clinical trials. However, there has been limited success to date
with the discovery and/or identification of safe and/or effective
anti-angiogenic agents.
3. Fibrosis
[0008] Fibrosis is the abnormal accumulation of fibrous tissue that
can occur as a part of the wound-healing process in damaged tissue.
Such tissue damage may result from physical injury, inflammation,
infection, exposure to toxins, and other causes. Examples of
fibrosis include dermal scar formation, keloids, liver fibrosis,
lung fibrosis (e.g., silicosis, asbestosis), kidney fibrosis
(including diabetic nephropathy), scleroderma, and
glomerulosclerosis.
[0009] Liver (hepatic) fibrosis, for example, occurs as a part of
the wound-healing response to chronic liver injury. Fibrosis occurs
as a complication of haemochromatosis, Wilson's disease,
alcoholism, schistosomiasis, viral hepatitis, bile duct
obstruction, exposure to toxins, and matabolic disorders. This
formation of scar tissue is believed to represent an attempt by the
body to encapsulate the injured tissue. Liver fibrosis is
characterized by the accumulation of extracellular matrix that can
be distinguished qualitatively from that in normal liver. Left
unchecked, hepatic fibrosis progresses to cirrhosis (defined by the
presence of encapsulated nodules), liver failure, and death.
[0010] As summarized by Li and Friedman (Gastroenterol. Hepatol.
14:618-633, 1999), actual and proposed therapeutic strategies for
liver fibrosis include removal of the underlying cause (e.g., toxin
or infectious agent), suppression of inflammation (using, e.g.,
corticosteroids, IL-1 receptor antagonists, or other agents),
down-regulation of stellate cell activation using, e.g., gamma
interferon or antioxidants), promotion of matrix degradation, or
promotion of stellate cell apoptosis. Despite recent progress, many
of these strategies are still in the experimental stage, and
existing therapies are aimed at suppressing inflammation rather
than addressing the underlying biochemical processes. Thus, there
remains a need in the art for materials and methods for treating
fibrosis, including liver and lung fibrosis.
[0011] There is a need in the art for improved methods for treating
cancer, diseases associated with abnormal or undesirable
angiogenesis and fibrosis. The present disclosure addresses this
need and provides related advantages.
SUMMARY
I. Treatment by Inhibiting Processed LOX or LOXL
[0012] The present disclosure provides innovative methodology and
related compositions and kits for preventing and treating various
diseases associated with abnormal cell proliferation, angiogenesis
and fibrosis, by using an inhibitor of lysyl oxidase (LOX) or lysyl
oxidase-like protein(s) (LOXL). The LOX or LOXL may be a
full-length or processed form. The full-length LOX or LOXL is a
proenzyme or propeptide form (ie without the signal sequence)
whereas the processed form, or cleavage form is a mature form. Both
full-length and processed forms of LOX or LOXL can be active. The
LOX or LOXL can be a secreted form, which can also be active. The
inhibition of LOX or LOXL is effective in preventing and treating
tumor invasion and metastasis, and for treating diseases associated
with abnormal angiogenesis and fibrotic diseases.
[0013] In one embodiment, methods are provided for treating or
preventing tumor invasion or metastasis in a subject in vivo,
comprising: administering to the subject an effective amount of an
inhibitor of active LOX or LOXL.
[0014] In another embodiment, methods are provided for reducing
tumor growth in a subject in vivo, comprising: administering to the
subject an effective amount of an inhibitor of processed LOX or
LOXL such that the tumor growth is reduced by at least 25%, 50%,
75%, 90%, or 95%. In some embodiments, the tumor is a metastatic
tumor.
[0015] In yet another embodiment, methods are provided for
increasing or enhancing the chances of survival of a subject with
metastatic tumor, comprising: administering to a subject in need
thereof an effective amount of an inhibitor of processed LOX or
LOXL protein, thereby increasing or enhancing the chances of
survival of the subject treated by a certain period of time. For
example, the survival of the subject may be increased by at least
10 days, 1 month, 3 months, 6 months, 1 year, 1.5 years, 2 years, 3
years, 4 years, 5 years, 8 years, or even 10 years.
[0016] The LOX or LOXL may be a mature form of the LOX or LOXL
after proteolytic processing or cleavage. Examples of LOXL include
but are not limited to LOXL1, LOXL2, LOXL3, and LOXL4. In some
embodiments, the inhibitor of LOX or LOXL may be an inhibitor of
active LOX, LOXL2 or LOXL4. In some of these embodiments, the
inhibitor of LOX or LOXL inhibits both active LOX and LOXL2.
[0017] The LOX or LOXL inhibitor may be, for example, an antibody
against LOX or LOXL, a small molecule inhibitor, siRNA, shRNA or an
antisense polynucleotide against LOX or LOXL. The inhibitors may be
noncompetitive inhibitors.
II. Treatment by Inhibition of Both LOX and LOXL
[0018] The present disclosure also provides innovative methodology
and related compositions and kits for preventing and treating
various diseases associated with abnormal cell proliferation,
angiogenesis and fibrosis, through inhibition of both lysyl oxidase
(LOX) and one or more lysyl oxidase-like proteins (LOXL).
Simultaneous inhibition of both LOX and LOXL is effective in
preventing or treating invasion and metastasis of a wide variety of
tumors, and for treating diseases associated with abnormal
angiogenesis and fibrotic diseases.
[0019] In one embodiment, methods are provided for treating or
preventing tumor invasion or metastasis in a subject in vivo,
comprising: administering to the subject an effective amount of an
inhibitor of LOX and an inhibitor of LOXL.
[0020] In another embodiment, methods are provided for reducing
tumor growth in a subject in vivo, comprising: administering to the
subject an effective amount of an inhibitor of LOX and an inhibitor
of a LOXL such that the tumor growth is reduced by at least 25%,
50%, 75%, 90%, or even 95%. According to some embodiments, the
tumor is a metastatic tumor.
[0021] In yet another embodiment, methods are provided for
increasing or enhancing the chances of survival of a subject with a
metastatic tumor, comprising: administering to a subject in need
thereof an effective amount of an inhibitor of LOX and an inhibitor
of a LOXL, thereby increasing or enhancing the chances of survival
of the subject treated by a certain period of time. For example,
the survival of the subject is increased by at least 10 days, 1
month, 3 months, 6 months, 1 year, 1.5 years, 2 years, 3 years, 4
years, 5 years, 8 years, or even 10 years.
[0022] The inhibitor of LOX and the inhibitor of the LOXL can be
different, each specifically inhibiting LOX and LOXL, respectively.
Alternatively, the inhibitor of LOX and the inhibitor of LOXL can
be the same molecule which inhibits both LOX and LOXL. The LOXL may
be, for example, LOXL1, 2, 3, or 4. In some embodiments, the LOXL
is LOXL2 or 4. In certain embodiments, the LOXL is LOXL2.
[0023] The LOX or LOXL may be a full-length or processed form. The
LOX or LOXL may be a proenzyme form or a mature form, and both
forms can be active. The LOX or LOXL can be a secreted form, which
can also be active. The processed form of the LOX or LOXL is a form
after proteolytic processing or cleavage.
[0024] Examples of LOXL include but are not limited to LOXL1,
LOXL2, LOXL3, and LOXL4. In some embodiments, the inhibitor of LOX
or LOXL may be an inhibitor of active LOX, LOXL2 or LOXL4. In some
of these embodiments, the inhibitor of LOX or LOXL inhibits both
active LOX and LOXL2.
[0025] The LOX or LOXL inhibitor may be, for example, an antibody
against LOX or LOXL, a small molecule inhibitor, siRNA, shRNA or an
antisense polynucleotide against LOX or LOXL. The inhibitors may be
noncompetitive inhibitors.
III. Combination Therapy
[0026] The present disclosure further provides compositions, kits,
methods for preventing and treating diseases associated with
abnormal cell proliferation, angiogenesis and fibrosis, such as
cancer, tumors, diabetic retinopathy, macular degeneration, liver
fibrosis, kidney fibrosis, lung fibrosis, scleroderma,
atherosclerosis, and Alzheimer's disease by using modulators (e.g.,
activators/agonists or inhibitors/antagonists) of lysyl oxidase
(LOX) or lysyl oxidase-like proteins (LOXL).
[0027] Inhibitors of LOX or LOXL may be combined with other
therapeutic agents, such as chemotherapeutic agents,
anti-neoplastic biologics, anti-angiogenetic agents, and
anti-fibrotic agents, to prevent or treat these diseases or
conditions. It is believed that inhibition of LOX or LOXL could
slow or halt the progression of the epithelial-mesenchymal
transition (EMT) in tumor cells, or induce a mesenchymal-epithelial
transition (MET) to a less tumorigenic state, thereby rendering the
tumor or diseased cells more susceptible to chemotherapeutic drugs,
anti-neoplastic biologics, anti-angiogenetic agents, and
anti-fibrotic agents. A synergistic combination of an inhibitor of
LOX or LOXL with another therapeutic agent is useful for preventing
or inhibiting tumor invasion and metastasis, inhibiting growth of
primary tumors by sensitizing the tumor cells to the cytotoxic
effects of the therapeutic agent, and also for efficaciously
prevention or treatment of cancer.
IV. Selection of Agents
[0028] In another aspect, the present disclosure provides
innovative methods for selecting agents that prevent or inhibit
tumor invasion, angiogenesis and metastasis. According to the
present disclosure, inhibition of lysyl oxidase (LOX) or lysyl
oxidase-like protein (LOXL) may slow or halt the progression of the
epithelial-mesenchymal transition (EMT) in tumor cells, or induce a
mesenchymal-epithelial transition (MET) to a less tumorigenic
state, thereby preventing or inhibiting the invasion, angiogenesis
and metastasis of the tumor, and rendering the primary tumor cells
more susceptible to other therapeutic intervention, such as
irradiation, chemotherapeutic drugs, anti-neoplastic biologics,
anti-angiogenetic agents, and anti-fibrotic agents.
[0029] In one embodiment, methods are provided for selecting an
inhibitor of tumor invasion, angiogenesis or metastasis,
comprising: contacting cells that are in an EMT state with an
inhibitor of LOX or a LOXL; detecting a change in the EMT state of
the cells, wherein reduction of the EMT state or a shift from the
EMT to a MET state indicates that the LOX or LOXL inhibitor is an
inhibitor of tumor invasion, angiogenesis or metastasis.
V. Diagnosis
[0030] In yet another aspect, the present disclosure provides
innovative methodology and related compositions and kits for
diagnosing or monitoring various diseases associated with abnormal
cell proliferation, angiogenesis and fibrosis, by using molecules
or agents that specifically recognize active or mature forms of
lysyl oxidase or lysyl oxidase-like proteins. The inventors believe
the processed LOX or LOXL are important biomarkers for tumor
invasion and metastasis, and for diseases associated with abnormal
angiogenesis and fibrotic diseases. The processed forms of LOX or
LOXL can be active. The LOX or LOXL may be a proenzyme form or a
mature form. The LOX or LOXL can also be a secreted form, which can
also be active.
[0031] In one embodiment, methods are provided for diagnosing or
monitoring cancer metastasis in a subject, comprising: assessing
processed LOX or LOXL levels or activity in the blood or in a
tumor, whereby a change in processed LOX or LOXL levels or activity
in the blood or in the tumor in comparison with a reference sample
indicates the presence of metastatic tumor growth. The change may
be an increase or a decrease in processed LOX or LOXL levels or
activity. Generally, an increase in processed LOX or LOXL levels or
activity in the blood or tumor sample, as compared to a reference
sample, indicates the presence of metastatic tumor growth.
[0032] In another embodiment, methods are provided for monitoring a
subject's response to a therapy including a modulator of LOX/LOXL
such as the treatment of cancer, tumors, angiogenesis, and fibrotic
diseases. In another embodiment, the method comprises: detecting a
change in the level of collagen telopeptides or hydroxyproline
content in the subject after administration of a modulator of LOX
or LOXL to the subject, wherein the change indicates that the LOX
or LOXL modulator has a therapeutic effect on the subject. The
change can be an increase or decrease. For example, a decrease in
collagen telopeptides or hydroxyproline content can be indicative
of a therapeutic effect.
[0033] The method comprises detecting a change in the level
C-reactive protein, or other acute-phase reactants, in the subject
after administration of a modulator of LOX or LOXL to the subject,
wherein the change indicates that the LOX or LOXL modulator has a
therapeutic effect on the subject. The change may be an increase or
a decrease in C-reactive protein levels. Generally, a decrease in
C-reactive protein levels indicates a decrease in LOX activity.
VI. Treatment of Fibrosis
[0034] In another aspect, methods are provided for preventing,
treating, or ameliorating fibrosis in a subject in vivo, comprising
administering to the subject an effective amount of an inhibitor of
a lysyl oxidase (LOX) or lysyl oxidase-like protein (LOXL). The
inhibitor of LOX or LOXL may be an inhibitor of an active form of
LOX or LOXL.
[0035] Exemplary forms of fibrosis include, but are not limited to,
cardiac fibrosis, liver fibrosis, kidney fibrosis, lung fibrosis,
dermal scarring and keloids, and Alzheimer's disease. In still
further embodiments, cardiac fibrosis is associated with
hypertension, hypertensive heart disease (HHD), myocardial
infarction (MI), atherosclerosis, and restenosis.
[0036] The kidney fibrosis may include, but not be limited to,
diabetic nephropathy, vesicoureteral reflux, tubulointerstitial
renal fibrosis, glomerulonephritis or glomerular nephritis (GN),
focal segmental glomerulosclerosis, membranous glomerulonephritis,
or mesangiocapillary GN. The liver fibrosis may include, but not be
limited to, cirrhosis, and associated conditions such as chronic
viral hepatitis, non-alcoholic fatty liver disease (NAFLD),
alcoholic steatohepatitis (ASH), non-alcoholic steatohepatitis
(NASH), primary biliary cirrhosis (PBC), biliary cirrhosis,
autoimmune hepatitis). Lung fibrosis may include idiopathic
pulmonary fibrosis (IPF) or cryptogenic fibrosing alveolitis,
chronic fibrosing interstitial pneumonia, interstitial lung disease
(ILD), and diffuse parenchymal lung disease (DPLD)). Cardiac
fibrosis, congestive heart failure, cardiomyopathy, post-myocardial
infarction defects in heart function; atherosclerosis; rheumatoid
arthritis; glaucoma; age-related macular degeneration (wet AMD and
dry AMD); emphysema, chronic obstructive pulmonary disease (COPD);
multiple sclerosis; and chronic asthma may also be prevented,
treated, or ameliorated with compositions of described herein.
[0037] Also provided herein are compositions, devices, systems, and
kits for delivering inhibitors of LOX/LOXL locally to the site of
fibrosis. Medical devices such as catheters and stents may be used
to deliver locally, thus substantially reducing the risk of
toxicity or other side effects associated with systemic delivery of
such inhibitors of LOX/LOXL.
[0038] The inhibitors of LOX/LOXL may be delivered to a subject
prior to, concurrently, or post a pathological cardiac condition or
disease, such as hypertension, hypertensive heart disease (HHD),
myocardial infarction (MI), atherosclerosis, and restenosis, to
prevent the onset of, to reduce the risk of, or to retreat
pathological fibrosis associated with such a pathological cardiac
condition or disease. For example, an inhibitor of LOX/LOXL may be
administered at least 1 hr, 2 hrs, 3 hrs, 5 hrs, or 10 hrs, or 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days after the
onset of such a pathological cardiac condition or disease.
[0039] The LOX or LOXL may be a full-length or processed form. The
LOX or LOXL may be a proenzyme form or a mature form, and both
forms can be active. The LOX or LOXL can be a secreted form, which
can also be active. The processed form of the LOX or LOXL is a form
after proteolytic processing or cleavage.
[0040] Examples of LOXL include but are not limited to LOXL1,
LOXL2, LOXL3, and LOXL4. In some embodiments, the inhibitor of LOX
or LOXL may be an inhibitor of active LOX, LOXL2 or LOXL4. In some
of these embodiments, the inhibitor of LOX or LOXL inhibits both
active LOX and LOXL2.
[0041] The LOX or LOXL inhibitor may be, for example, an antibody
against LOX or LOXL, a small molecule inhibitor, siRNA, shRNA or an
antisense polynucleotide against LOX or LOXL. The inhibitors may be
noncompetitive inhibitors.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] FIG. 1 is a schematic of the LOX/LOXL genomic and protein
organization.
[0043] FIG. 2 is a sequence alignment of LOX/LOXL with predicted
and determined N- and O-glycosylation sites, bipartite nuclear
localization signals, and procollagen C-proteinase sites.
[0044] FIG. 3 illustrates the epithelial-mesenchymal transition and
its role in invasion and metastasis.
[0045] FIG. 4 is a schematic of the EMT and MET and markers for to
assess EMT or MET phenotypes of cells.
[0046] FIG. 5 is a schematic of the role of LOX/LOXL in EMT-MET
promotion or reduction, and the drug-resistance or sensitivity of
the EMT-MET cells.
[0047] FIG. 6 shows induction of EMT by transfection of MCF-7 (low
LOXL2) cells with LOXL2. (A) MCF-7 wild type (WT) cells and (B)
MCF-7-Loxl2.clone1 were stained for E-cadherin. Primary antibody:
anti-E-cadherin (10 .mu.g/ml); Secondary antibody: anti-mouse-cy3
(red); DAPI: nuclei (blue). (C) MCF-7 wild type cells and (D)
MCF-7-Loxl2.clone1 were stained with rhodamine phalloidin: actin
cytoskeleton (red) and DAPI: nuclei (blue). Wild-type MCF7 shows
epithelial phenotype, strongly E-cadherin positive (membraneous
staining) (A) and rhodamine phalloidin staining of the actin
cytoskeleton reveals a circular pattern (C). MCF7 transfected with
LOXL2 changes to a mesenchymal phenotype, losing E-cadherin
expression (B), with remodeling of the actin cytoskeleton
(elongation, spindly shaped, long actin fibers) (D).
[0048] FIG. 7 shows induction of MET-like change by depleting LOXL2
in MDA-MB-231. (A-B) MDA-MB-231 WT cells and (C--F) MDA-MB-231
shLoxl2 (C, D): pool 1; (E, F): pool 2) stable knockdown cells were
stained with rhodamine phalloidin (actin cytoskeleton stain). Cells
are elongated and spindly-shaped in WT cells (A-B) while MDA-MB-231
shLoxl2 stable knockdown cells are rounded and smaller in shape
(C--F). F-actin staining (rhodamin phalloidin) moves from fibrillar
to circular/cell rim upon LOXL2 depletion by shRNA knockdown.
[0049] FIG. 8 shows the effects of Conditioned Media (CM) derived
from stable CHO-Loxl2 cells on MCF-7 WT cells. (A-B) MCF-7 cells
grown in 30% SFII media: 150 .mu.l of SFII media (media used for
CHO-Loxl2 cells) in 350 .mu.l of regular MCF-7 complete media.
(C-D) MCF-7 cells grown in 30% Conditioned Media (CM): 150 .mu.l of
CM from CHO-Loxl2 (concentrated 22.times. from 3 day serum free CM)
in 350 .mu.l of regular MCF-7 complete media. The MCF-7 cells
treated with concentrated serum free CM from CHO-Loxl2 cells for 4
days. MCF-7 treated with conditioned media from LOXL2-expression
cells (C-D) undergoes a phenotype change compared to cells treated
with control conditioned media (CHO cells not expressing LOXL2)
(A-B), as revealed by rhodamine-phalloidin staining of the actin
cytoskeleton. Cells are elongated with long F-actin fibers, similar
to cells undergoing EMT, unlike control-treated cells that show a
more circular "actin rim" staining. These data support that the
EMT-like change induced by LOXL2 is induced by secreted
(extracellular) LOXL2. (E) illustrates effects of different
concentrations of CM derived from stable CHO-Loxl2 cells on MCF-7
WT cells and their morphological changes. Treating cells with
increasing concentrations of LOXL2-containing CM results in a
concordant increase in EMT-like phenotype change.
[0050] FIG. 9 shows anti-Loxl2 mAbs can block the EMT phenotype
observed from incubating MBA-MD-MB-231 (expresses high levels of
LOXL2) CM with MCF-7 WT cells. (A, C, E) MCF-7 WT cells with CM
from MCF-7 cells and (B, D, F) MCF-7 WT cells with CM from
MBA-MD-231 cells, with (C--F) showing cells with CM that was
pre-incubated with anti-Loxl2 mAbs prior to addition to MCF-7 cells
(C, D): mAb #418 and (E, F): mAb #423, respectively), with varying
concentration of antibody (C, E): 2 .mu.g; (D, F): 4 .mu.g).
[0051] FIG. 10 demonstrates that the specific blocking effect of
the EMT-like change from incubating MDA-MB-231 CM with MCF-7 cells.
(A) "Pre-incubation": CM, collected and cleared, was pre-incubated
with antiLoxl2 (1.5 hrs at room temperature (RT)) #418 or #422 mAb,
then applied onto MCF-7 cells for 4 days. (B) "Not pre-incubated":
CM with MDA-MB-231 cells was in the presence of anti-Loxl2 #418 or
#422 mAb (3 days) and before being collected and cleared, then
applied onto MCF-7 for 4 days. EMT-like morphology is blocked in
both (A) and (B). As a non-EMT-like control, (C) MCF-7 cells
treated with 3 day Conditioned Media (CM) from MCF-7 cells for 4
days and had a round and flattened morphology that is typical of WT
MCF-7 cells. As EMT-like controls, (D) MCF-7 cells treated with 3
day CM from MDA231 cells that was not incubated with any loxl2 mAbs
(4 day incubation) and (E) MCF-7 cells treated with 3 day CM from
MDA231 cells that was pre-incubated with an anti-actin antibody (4
day incubation). Both (D) and (E), an EMT-like morphology of
spindly shaped cells is seen.
[0052] FIG. 11 shows the induction of an EMT-like phenotype change
by treating MCF-7 (low LOXL2) with conditioned media from Hs578t
tumor cells (expresses high levels of LOXL2) and anti-Loxl2 mAbs
can block the EMT phenotype observed. (A) Conditioned media from 3
day Conditioned Media (CM) from MCF-7 cells was applied to MCF-7
cells for 4 days and had a round and flattened morphology that is
typical of WT MCF-7 cells. (B, C, D) Conditioned media from Hs-578t
cells (LOXL2 high) was applied to MCF-7 cells (LOXL2 low/negative).
(A-D) Cells stained with rhodamine-phalloidin (F-actin, red) and
DAPI (nuclei, blue). Confirming that these effects are specific to
LOXL2 and not other proteins, conditioned media was mixed with 4
.mu.g of either (C) anti .beta.-actin antibody as a negative
control or (D) anti LOXL2 antibody. EMT-like phenotype was blocked
when the conditioned media from Hs578t cells was pre-incubated with
an anti-LOXL2 antibody prior to addition to MCF7 cells (D).
Treating the CM in the same manner with an anti .beta.-actin
antibody failed to block the phenotype change in the MCF7 cells
(C), supporting that the blockade by the LOXL2 antibody was
specific and not a non-specific effect due to addition of antibody
to CM.
[0053] FIG. 12 shows SW620 cells incubated with Conditioned Media
(CM) from MDA MB 231 cells undergo EMT phenotype changes. (A-B)
SW620 cells are incubated with Conditioned Media (CM) from MDA MB
231 cells, at 20.times. and 40.times.. Arrows indicate morphology
of SW620 cells undergoing EMT-like phenotype. Cells undergo EMT
phenotype (as indicated by rhodamine phalloidin staining) changes
72 hours later. (C-D) SW620 cells incubated with Conditioned Media
(CM) from 293 wildtype cells maintain typical "normal" round
shape--72 hours later, at 20.times. and 40.times.. Conditioned
media (CM) from MDA MB 231 or 293 cells is 3 day CM.
[0054] FIG. 13 shows SW620 cells incubated with CM from
293:Loxl2.MCD transfectants. (A, C, E) shows cells undergoing EMT
phenotype (as indicated by rhodamine phalloidin staining)
changes--72 hours later (50% CM: 50% compete media). (B, C, E) are
magnifications of (A, C, E), respectively, with arrows indicating
the morphology of SW620 cells undergoing EMT-like phenotype. The
293:Loxl2.MCD were 293 cells transfected with and expressing a
fragment of LOXL2, referred to as the LOXL2-MCD, which includes the
lysyl oxidase enzymatic domain. It appears that this portion of
LOXL2 is alone sufficient to induce at least a partial EMT-like
phenotype change. Not all cells are undergoing the phenotype
change, but groups of cells that are, are clearly
distinguished.
[0055] FIG. 14 is a schematic of (A) uncleaved and intracellular
LOX/LOXL and cleaved, active LOX/LOXL and (B) active LOX/LOXL
cellular uptake and activity promotes EMT, while uptake of active
LOX/LOXL is blocked when bound to an inhibitor such as an antibody,
reducing EMT and/or increasing MET.
[0056] FIG. 15 is a graph showing surface-associated LOX activity
in 3T3 cells is inhibited by BAPN, LOX mAb, and LOX siRNA. Specific
LOX activity is evident on the cell surface of 3T3 cells
quantitated with a horseradish peroxidase-coupled fluorescent assay
method based on the oxidation of Amplex Ultra Red with a
1,5-diaminopentane substrate. LOX activity was inhibited with the
irreversible small molecule inhibitor BAPN, with a monoclonal
antibody raised against a LOX peptide, and with a siRNA
oligonucleotide specifically targeting LOX mRNA.
[0057] FIG. 16 shows 2 forms of LOXL2 predominate in cell lines.
(A) LOXL2 protein expression and secretion in cell lines. Breast
tumor cell lines: Hs578t, MDA-MB-231, MCF7; Lung tumor cell line:
A549. (B) Schematic of LOXL2 forms commonly detected.
[0058] FIG. 17 shows LOXL2 protein expression purified from CHO
cells. Myc-His tagged (C-terminal) LOXL2 was expressed in CHO
cells. 2 forms predominate (as in FIG. 16): propeptide LOXL2 and
LOXL2 cleaved between SRCR2 and SRCR3. LOXL2 is also secreted in
CHO cells.
[0059] FIG. 18 shows separation of LOXL2 species by chromatography.
(A) A chromatograph of the separated LOXL2 species. (B) A Western
blot analysis confirming separation of the LOXL2 species.
[0060] FIG. 19 shows an in vitro enzymatic assay that indicates
that both forms of LOXL2 are active.
[0061] FIG. 20 is an IC50 graph for LOXL2. Inhibition of LOXL2 was
performed in an in vitro enzymatic assay using active LOXL2 and a
LOXL2 antibody, AB0023. M1 and M20 are both AB0023. Asc=ascites
generated, unlabeled=bioreactor generated, same results. Dose
response showing decreased activity with increasing concentration
of antibody. LOXL2 preparation includes both processed forms
(propeptide and mature).
[0062] FIG. 21 is a graph demonstrating a mode of inhibition of
LOXL2. (A) AB0023 is a non-competitive inhibitor of LOXL2, whereas
(B) .beta.APN is a competitive inhibitor of LOXL2. E=enzyme,
P=product, S=substrate, I/A=inhibitor/antibody
[0063] FIG. 22 shows a minimal catalytic domain region (MCD) of
LOXL2 is enzymatically active. (A) is schematic of LOXL2 MCD
construction. (B) LOXL2 MCD is secreted efficiently. (C) LOXL2 MCD
is enzymatically active.
[0064] FIG. 23 illustrates internalization and uptake for anti-LOX
antibody. Immunofluorescence analysis of LOX in live tumor cells
was performed using antibodies. (A-B) Hs578t cells were transfected
with siNT (non-targeting knockdown control) and incubated for 3
hours with mAbs. Lox was localized in the cytosol. (C-D) Hs578t
cells were incubated for 3 hours with mAbs transfected with siLOX.
LOX protein levels were diminished, supporting depletion by siLOX.
LOX protein was also periplasmic in the cell. LOX was detected with
M37 (A, C) or M64 antibody (B, D). Similar results of
internalization and uptake of LOX12 mAbs was obtained. Thus, the
results support conclusions that staining is specific for LOX or
LOXL2.
[0065] FIG. 24 shows confluent Hs578t and anti-LOX antibody
internalization and uptake of (A) permeabilized or (B)
non-permeabilized cells. Cells were 2 days post-confluent, 4 days
after plating at 50,000 cells/well in 8 chamber slides. Cells were
incubated for 3 hours with anti-Lox M64 and detected with Alexa
488-green. Similar results of internalization and uptake of Loxl2
mAbs was obtained.
[0066] FIG. 25 illustrates internalization and uptake for anti-LOX
antibody in Hs578t transfected with siRNA and. Hs578t cells were
transfected with (A, B) siNT or (C, D) siLOX and incubated with LOX
antibody for 5 hours. Images of cells, detected with anti-Lox M64
(A, C) or anti-collagen I (B, D), were taken 7 days
post-transfection. Similar results of internalization and uptake of
Loxl2 mAbs was obtained.
[0067] FIG. 26 shows the specificity of LOX Pep2 M64. mAbs were
screened for their ability to inhibit cell invasion and migration
through (A) Collagen I and/or (B) Collagen IV matrix. (C)
Specificity of M64Mab on Hs578T cells was detected on chamber
slides (post-confluent: Day 6). (D) LOX localization compared with
collagen Hs578T cells on chamber slides (post-confluent: Day 6).
Cells were not permeablized and images were at 63.times.
magnification.
[0068] FIG. 27 shows a time-course study of Hs578T cells from Day 0
to Day 15 post-confluent.
[0069] FIG. 28 depicts immunohistochemistry (IHC) using LOXL2 and
LOX antibodies on metastatic breast tumor tissue (lymph node)
sample. IHC was performed using Breast TMA: CC08-21-002 (Cybrdi), a
metastatic nonspecific infiltrating ductal carcinoma sample, with
(A, B) LOXL2, (C, D) Ki67, a marker of cell proliferation, and (E,
F) and LOX. LOXL2 and LOX are both expressed by the tumor cells and
there is evidence of expression of both LOXL2 and LOX by stromal
cells. (brown staining) (A, C, E) 20.times. magnification; (B, E,
F) 40.times. magnification.
[0070] FIG. 29 depicts immunohistochemistry (IHC) using LOXL2 and
LOX antibodies on primary breast tumor samples. IHC was performed
using Breast TMA: CC08-21-002 (Cybrdi), a non specific infiltrating
ductal carcinoma-grade II sample, with (A, B) LOXL2, (C, D) Ki67, a
marker of cell proliferation, and (E, F) and LOX. There is
co-expression of LOXL2 and LOX in the primary breast tumor, and
LOXL2 protein is strongly detected in tumor cells and LOX protein
is primarily detected in stromal cells immediately surrounding the
tumor cells (stromal fibroblasts and/or stromal myofibroblasts).
(A, C, E) 20.times. magnification; (B, E, F) 40.times.
magnification.
[0071] FIG. 30 is a graph showing mRNA levels of LOX and LOXL2
overexpressed in tumors and fibrotic disease tissues compared to
normal tissues as measured by using DNA chips provided by
Affymetrix, Inc.
[0072] FIG. 31 depicts the expression of LOX/LOXL in lung
adenocarcinoma samples relative to expression in adjacent normal
tissue from the same patient. A) LOX, LOXL1, LOXL2, LOXL4, and B)
is the same data as A) with only LOX and LOXL2 plotted. T: tumor;
N: normal.
[0073] FIG. 32 depicts the expression of LOX/LOXL in lung
adenocarcinoma samples normalized to a housekeeping gene RPL19. The
tumor and adjacent normal samples are plotted separately, (A) LOX,
LOXL1, LOXL2, LOXL4 and (B) only LOX and LOXL2 plotted, based on
the same data as (A). T: tumor; N: normal.
[0074] FIG. 33 shows the co-expression of LOX and LOXL2 in hypoxic
MCF-7 cells. LOX and LOXL2 are both induced by hypoxia in MCF7
cells, which normally express very low levels of LOX and LOXL2
(fold upregulation vs cells grown under normoxic conditions is
plotted on the left axis). Cells were grown in a tissue culture
incubator adjusted to 2% O2, 5% CO2 for 3 days (vs. normoxia:
.about.20% O.sub.2, 5% CO.sub.2). MCF7: breast tumor cell line.
[0075] FIG. 34 shows mRNA levels of lysyl oxidase family members in
human cell lines. One-step qRT-PCR was performed on 100
ng/r.times.n RNA. MCF7, MB231, BT549, Hs578t: breast tumor cell
lines; A549: lung tumor cell line; HT1080: fibrosarcoma cell line;
HFF: fibroblast cell line.
[0076] FIG. 35 is a graph of RT PCR validation of (A) shRNA and (B)
siRNA knockdown of LOX/LOXL2 in FIGS. 36-39. (C) A migration assay
using MDA-MB 231 cells transfected with Lox, Loxl2, Lox/Loxl2 siRNA
was also performed. Lox siRNA knockdown inhibits MDA MB 231 cells
invasive properties by 52% compared to non-targeting siRNA control.
(D) Supporting Taqman data for siRNA knockdown in MDA MB 231 cells
shown in (C).
[0077] FIG. 36 is a graph showing erlotinib sensitivity of shLOXL2
cells. shLOXL2 knockdown cell line (shLOXL2.195) showed
approximately 7 fold reduction in cell viability. The calculated
1050 was compared to the control line (sh control). The parental
cell line is MDA-MB-231. Percent growth (viability) is plotted on
the left axis. Erlotinib represents the drug class EGFR inhibitors,
including gefitinib.
[0078] FIG. 37 is a graph showing methotrexate (MTX) sensitivity of
MDA-MB-231 shLOX cell line. Percent growth (viability) is plotted
on the left axis. The shLOX knockdown cell line showed
approximately a 2 fold reduction in viability as compared to the
control line (GFP control).
[0079] FIG. 38 is a graph showing cisplatin (DDP) sensitivity with
siLOX/LOXL2 or LOX antibody. (A) MDA-MB-231 siLOX and siLOXL2 cell
lines or (B) MiaCaPa 2 cell lines with anti-LOX and their
sensitivity to DDP. Viability is plotted on the left axis. The
siLOX and siLOXL2 knockdown cell lines had an approximately 25%
reduction in viability as compared to the control line
(non-targeting control). (C) The IC50 of DDP of MiaCaPa 2 and other
cell lines treated with or without anti-LOX. (D) A graph of the
growth inhibition of LOX (M64) or LOXL2 (M20) antibody alone as
compared to untreated (Unt).
[0080] FIG. 39 shows doxorubicin sensitivity of MDA-MB-231 siRNA or
shRNA cell lines. (A) siLOX, siLOXL2, and siLOX/LOXL2 cell lines.
Viability is plotted on the left axis. The siLOX, siLOXL2 and
siLOX/siLOXL2 double knockdown cell lines show increased
sensitivity to doxorubicin, with calculated IC50 showing a 27%-55%
decrease as compared to parent cell line (control). (B) A graph
showing doxorubicin sensitivity of MDA-MB-231 siLOX, siLOXL2, and
siLOX/LOXL2 knockout compared to (C) doxorubicin sensitivity of
MDA-MB-231 shLOX and shLOXL2 cell lines. Viability is plotted on
the left axis.
[0081] FIG. 40 is a graph showing mean gain of implant size from
MCF7 tumor cells and MCF7 cells transfected with LOXL2 implanted
into the subrenal capsule of nude mice. The implants were allowed
to form tumors for 16 days. Stable transfection of LOXL2 into MCF7
(MCF7-LOXL2) resulted in much larger/more aggressive primary tumors
than those observed for wild-type MCF7 cells.
[0082] FIG. 41 is a graph showing mean gain of implant size from
HT1080 tumor cell implantation into the subrenal capsule of nude
mice. Implants were allowed to form tumors for 10 days. Mice were
treated twice per week with various antibodies (30 mg/kg,
intraperitoneal injection). Each group of five mice were treated
with: AC1: negative control antibody; M64, M5, or M11: "non-LOXL2"
antibodies (anti-LOX antibodies); or AB23: LOXL2 antibody. Trend
with AB23: .about.25% smaller average tumor size in this aggressive
primary tumor model.
[0083] FIG. 42 illustrates Lysyl Oxidase Enzymology. LOX/LOXL
enzymes act via a ping-pong mechanism which can be described by
Michaelis-Menten kinetics.
[0084] FIG. 43 illustrates common modes of enzymatic
inhibition.
[0085] FIG. 44 illustrates modes of enzymatic inhibition, such as
inhibition of LOXL2.
DETAILED DESCRIPTION
I. Treatment by Inhibition of LOX or LOXL
[0086] The present disclosure provides innovative methodology and
related compositions and kits for preventing and treating various
diseases associated with abnormal cell proliferation, angiogenesis
and fibrosis, by using an inhibitor of processed form of lysyl
oxidase (LOX) or lysyl oxidase-like proteins (LOXL).
[0087] While not wishing to be bound by theory, inhibition of the
processed forms of LOX or LOXL is effective in preventing or
treating tumor invasion and metastasis, and for treating diseases
associated with abnormal angiogenesis and fibrotic diseases.
[0088] In one embodiment, methods are provided for treating or
preventing tumor invasion or metastasis in a subject in vivo,
comprising: administering to the subject an effective amount of an
inhibitor of a LOX or LOXL.
[0089] In another embodiment, methods are provided for reducing
tumor growth in a subject in vivo, comprising: administering to the
subject an effective amount of an inhibitor of a processed LOX or
LOXL such that the tumor growth is reduced by at least 25%, 50%,
75%, 90%, or 95%. According to some embodiments, the tumor may be a
metastatic tumor.
[0090] In yet another embodiment, methods are provided for
increasing or enhancing the chances of survival of a subject with
metastatic tumor, comprising: administering to a subject in need
thereof an effective amount of an inhibitor of processed LOX or
LOXL, thereby increasing or enhancing the chances of survival of
the subject treated by a certain period of time. In some
embodiments, the survival of the subject is increased by at least
10 days, 1 month, 3 months, 6 months, 1 year, 1.5 years, 2 years, 3
years, 4 years, 5 years, 8 years, or 10 years
[0091] The processed forms of LOX or LOXL can be active. The LOX or
LOXL can also be a secreted form, which can also be active. The
active LOX or LOXL may be a mature form of the LOX or LOXL after
proteolytic processing or cleavage. Examples of LOXL include but
are not limited to LOXL1, LOXL2, LOXL3, and LOXL4. In some
embodiments, the inhibitor LOX or LOXL is an inhibitor of active
LOX, LOXL2 or LOXL4. For example, the inhibitor of LOX or LOXL
inhibits both active LOX and active LOXL2.
[0092] The LOX or LOXL inhibitor may be an antibody against LOX or
LOXL, a small molecule inhibitor, siRNA, shRNA or an antisense
polynucleotide against LOX or LOXL.
[0093] In some embodiments, the LOX or LOXL inhibitor is an
antibody specifically binding to a region of LOX or LOXL having an
amino acid sequence selected from SEQ ID NOs:1-18 as shown in
Tables 1 and 2 below.
[0094] As described in more detail below and in the EXAMPLE
section, various inhibitors of active LOX or LOXL (such as small
molecules or antibodies) may be used to inhibit tumor invasion,
angiogenesis or metastasis, and for treating cancer, tumors, and
diseases associated with abnormal angiogenesis and fibrotic
diseases.
II. Treatment by Inhibition of Both LOX and LOXL
[0095] The present disclosure also provides innovative methodology
and related compositions and kits for preventing and treating
various diseases associated with abnormal cell proliferation,
angiogenesis and fibrosis, by using an inhibitor of a processed
form of lysyl oxidase (LOX) or lysyl oxidase-like proteins
(LOXL).
[0096] Simultaneous inhibition of both LOX and LOXL is effective in
preventing or treating invasion and metastasis of a wide variety of
tumors, and for treating diseases associated with abnormal
angiogenesis and fibrotic diseases.
[0097] In one embodiment, methods are provided for treating or
preventing tumor invasion or metastasis in a subject in vivo,
comprising administering to the subject an effective amount of an
inhibitor of LOX and an inhibitor of a LOXL.
[0098] In another embodiment, methods are provided for reducing
tumor growth in a subject in vivo, comprising administering to the
subject an effective amount of an inhibitor of LOX and an inhibitor
of a LOXL such that the tumor growth is reduced by at least 25%,
50%, 75%, 90%, or 95%. According to some embodiments, the tumor may
be metastatic tumor.
[0099] In yet another embodiment, methods are provided for
increasing or enhancing the chances of survival of a subject with
metastatic tumor, comprising administering to a subject in need
thereof an effective amount of an inhibitor of LOX and an inhibitor
of a LOXL, thereby increasing or enhancing the chances of survival
of the subject treated by a certain period of time. In some
embodiments, the survival of the subject is increased by at least
10 days, 1 month, 3 months, 6 months, 1 year, 1.5 years, 2 years, 3
years, 4 years, 5 years, 8 years, or 10 years.
[0100] The inhibitor of LOX and the inhibitor of the LOXL can be
different, each specifically inhibiting LOX and the LOXL,
respectively. Alternatively, the inhibitor of LOX and the inhibitor
of LOXL can be the same molecule which inhibits both LOX and the
LOXL. In some embodiments, the LOXL is LOXL1, 2, 3 or 4. In some of
these embodiments, the LOXL is LOXL2 or 4, for example, the LOXL is
LOXL2. Optionally, the inhibitor of LOX or LOXL inhibits a form of
the LOX or LOXL after proteolytic processing or cleavage. The LOX
or LOXL may be a proenzyme form or a mature form. The LOX or LOXL
may be an active form. The full length or processed forms of LOX or
LOXL can be active.
[0101] Optionally, the inhibitor of LOX or LOXL inhibits a secreted
form of the LOX or LOXL.
[0102] The LOX or LOXL inhibitor may be an antibody against LOX or
LOXL, a small molecule inhibitor, siRNA, shRNA or an antisense
polynucleotide against LOX or LOXL.
[0103] In some embodiments, the LOX or LOXL inhibitor is an
antibody specifically binding to a region of LOX or LOXL having an
amino acid sequence selected from SEQ ID NOs:1-18 as shown in
Tables 1 and 2 below.
[0104] As described in more detail below and in the EXAMPLE
section, various inhibitors of LOX or LOXL (such as small molecules
or antibodies) may be used to inhibit tumor invasion, angiogenesis
or metastasis, and for treating cancer, tumors, and diseases
associated with abnormal angiogenesis and fibrotic diseases.
III. Combination Therapy
[0105] The present disclosure also provides innovative methodology
and related compositions and kits for preventing and treating
various diseases associated with abnormal cell proliferation,
angiogenesis and fibrosis, by using a combination therapy including
a modulator of lysyl oxidase (LOX) or lysyl oxidase-like proteins
(LOXL).
[0106] As described in detail below, inhibition of LOX or LOXL
could slow or halt the progression of epithelial-mesenchymal
transition (EMT) in tumor cells, or induce a mesenchymal-epithelial
transition (MET) to a less tumorigenic state, thereby rendering the
tumor or diseased cells more susceptible to irradiation,
chemotherapeutic drugs, anti-neoplastic biologics,
anti-angiogenetic agents, and anti-fibrotic agents.
IV. Selection of Agents
[0107] The present disclosure provides innovative methods for
selecting agents that prevent or inhibit tumor invasion,
angiogenesis and metastasis. These agents can be used alone or in
combination with other therapeutic agents to prevent or treat
diseases associated with abnormal cell proliferation, angiogenesis
and fibrosis, such as cancer, tumors, diabetic retinopathy, macular
degeneration, scleroderma, liver fibrosis, kidney fibrosis, lung
fibrosis, scleroderma, atherosclerosis, and Alzheimer's
disease.
[0108] According to the present disclosure, methods are provided
for selecting an inhibitor of tumor invasion, angiogenesis or
metastasis, comprising contacting cells that are in an
epithelial-mesenchymal transition (EMT) state with an inhibitor of
lysyl oxidase (LOX) or a lysyl oxidase-like protein (LOXL);
detecting a change in the EMT state of the cells, wherein reduction
of the EMT state or a shift from the EMT to a MET state indicates
that the LOX or LOXL inhibitor is an inhibitor of fibrosis, tumor
invasion, angiogenesis or metastasis. Thus, also provided herein
are methods for using the EMT-MET assays to screen for LOX/LOXL
inhibitors that facilitate the transition from EMT to MET in tumor
cells.
[0109] While not wishing to be bound by the theory, the role of LOX
and LOXL in EMT is associated with uptake of active LOX or LOXL by
tumor cells, allowing LOX or LOXL to interact with relevant
intracellular cofactors; and inhibition of LOX or LOXL could slow
or halt the progression of EMT in tumor cells, or induce a MET to a
less tumorigenic state, thereby preventing or inhibiting the
invasion, angiogenesis and metastasis of the tumor, and rendering
the primary tumor cells more susceptible to other therapeutic
intervention, such as irradiation, chemotherapeutic drugs,
anti-neoplastic biologics, anti-angiogenetic agents, and
anti-fibrotic agents.
[0110] An EMT state of cells has the characteristics of positive
vimentin or fibronectin staining with low levels of E-cadherin
staining and an elongated and remodeled actin cytoskeleton as
revealed by phalloidin staining of F-actin. Thus, the reduction of
the EMT state or a shift from the EMT to a MET state can be
monitored by measuring or detecting a decrease in vimentin or
fibronectin staining an increase in E-cadherin staining, and/or
remodeling of the actin cytoskeleton by phalloidin staining of
F-actin.
[0111] Optionally, in vitro or in vivo tumor invasion or migration
may be used to assess EMT or MET phenotypes of the cells, as
increased invasiveness and migratory capacity are associated with
EMT. For example, an in vitro wound-healing or scratch assay may be
used to monitor the transition from EMT to MET state, as cells in a
state of EMT that are more invasive and migratory should fill the
scratch more rapidly than less invasive or migratory cells.
[0112] As described in more detail below and in the EXAMPLE
section, various LOX or LOXL inhibitors (such as small molecules or
antibodies) may be tested for their ability to inhibit tumor
invasion, angiogenesis or metastasis by using the EMT-MET
transition assay. Inhibition of the full length or processed forms
of LOX or LOXL are effective in preventing or treating tumor
invasion and metastasis. Thus, also provided therein are methods
for screening, selecting and designing candidate compounds for
inhibition of active forms of LOX or LOXL, and methods for
generating antibodies against active forms of LOX or LOXL.
V. Diagnosis
[0113] The present disclosure provides innovative methodology and
related compositions and kits for diagnosing or monitoring various
diseases associated with abnormal cell proliferation, angiogenesis
and fibrosis, by using molecules or agents that specifically
recognize a processed form of lysyl oxidase (LOX) or lysyl
oxidase-like proteins (LOXL). Without being bound by theory, the
processed forms of LOX or LOXL are important biomarkers for tumor
invasion and metastasis, and for diseases associated with abnormal
angiogenesis and fibrotic diseases.
[0114] In one embodiment, methods are provided for diagnosing or
monitoring cancer metastasis in a subject, comprising assessing
processed LOX or LOXL levels or activity in the blood or in a
tumor, whereby a change in processed LOX or LOXL levels or activity
in the blood or in the tumor in comparison with a reference sample,
indicates the presence of metastatic tumor growth. The change may
be an increase or a decrease in processed LOX or LOXL levels or
activity. Generally, an increase in processed LOX or LOXL levels or
activity in the blood or tumor sample, as compared to a reference
sample, indicates the presence of metastatic tumor growth.
[0115] As described in more detail below, levels of processed LOX
or LOXL can be assessed by various methods including but are not
limited to immunohistochemistry by using antibodies that
specifically bind to the processed form of LOX or LOXL. Enzymatic
activity of active LOX or LOXL can be measured by using various
methods including but not limited to chromogenic and fluorometric
assays.
VI. Treatment of Fibrosis
[0116] Also provided herein are compositions, methods, and kits for
preventing and treating various diseases associated with fibrosis,
by using an inhibitor of an active form of lysyl oxidase (LOX) or
lysyl oxidase-like proteins (LOXL).
[0117] In one aspect, a method is provided for treating a
pathological cardiac condition or disease in a subject, comprising:
administering to the subject an effective amount of an inhibitor of
LOX or LOXL. For example, the pathological cardiac condition or
disease may be hypertension, hypertensive heart disease (HHD),
myocardial infarction (MI), atherosclerosis, or restenosis.
[0118] In another aspect, a method is provided for preventing a
pathological cardiac condition or disease in a subject, comprising:
administering to the subject an effective amount of an inhibitor of
LOX or LOXL prior to, concurrently, or post an adverse cardiac
event. The adverse cardiac event may be myocardial infarction, such
as acute myocardial infarction.
[0119] The inhibitor of LOX or LOXL may be administered prior to,
concurrently, or post the adverse cardiac event. For example, the
inhibitor may be administered at least 1 hr, 2 hrs, 3 hrs, 5 hrs,
or 10 hrs, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
days after myocardial infarction.
[0120] The inhibitor of LOX or LOXL may be delivered to the subject
locally to the site of fibrosis caused by the adverse cardiac
event.
[0121] In yet another aspect, a device is provided for preventing
or treating a pathological cardiac condition or disease in a
subject, comprising: a component comprising an inhibitor of LOX or
LOXL. The component may be a stent incorporating an inhibitor of
LOX or LOXL, which may be a small molecule with a molecular weight
below 500 Dalton, such as .beta.-aminoproprionitrile (BAPN). The
inhibitor may be coated on the stent.
[0122] Alternatively, the device may comprise a catheter for
delivering the inhibitor of LOX or LOXL locally to the site of
cardiac fibrosis caused by the adverse cardiac event.
[0123] In still another aspect, a kit is provided comprising: a
pharmaceutical composition comprising an inhibitor of LOX or LOXL
in a pharmaceutically acceptable excipient; and instructions for
how to treat or prevent a pathological cardiac condition or disease
using the pharmaceutical composition.
[0124] Also provided are methods, compositions, and kits for
treating or preventing a disease associated with fibrosis in a
subject, comprising: administering to the subject an effective
amount of an inhibitor of LOX or LOXL. The disease associated with
fibrosis can be selected from liver fibrosis, kidney fibrosis, lung
fibrosis, dermal scaring and keloid formation, and Alzheimer's
disease.
[0125] The inhibitor of LOX or LOXL may be an inhibitor of an
active LOX or LOXL. The active LOX or LOXL may be a mature form of
the LOX or LOXL after proteolytic processing or cleavage. Examples
of LOXL include but are not limited to LOXL1, LOXL2, LOXL3, and
LOXL4. The inhibitor LOX or LOXL can be an inhibitor of active LOX,
LOXL2 or LOXL4. In some embodiments, the inhibitor LOX or LOXL
inhibits both active LOX and active LOXL2.
[0126] The LOX or LOXL inhibitor may be an antibody against LOX or
LOXL, a small molecule inhibitor, siRNA, shRNA or an antisense
polynucleotide against LOX or LOXL.
[0127] In certain embodiments, the LOX or LOXL inhibitor is an
antibody specifically binding to a region of LOX or LOXL having an
amino acid sequence selected from the group consisting of SEQ ID
NOs:1-18, as shown in Tables 1 and 2 below.
[0128] As described in more detail below and in the examples,
various inhibitors of LOX or LOXL (such as small molecules or
antibodies) may be used.
1. Lysyl Oxidase and Lysyl Oxidase-Like Proteins
[0129] As used herein, the term "lysyl oxidase" refers to an enzyme
that catalyzes the following reaction:
peptidyl-L-lysyl-peptide+O.sub.2+H.sub.2O.fwdarw.peptidyl-allysyl-peptide-
+NH.sub.3+H.sub.2O.sub.2. Other synonyms for lysyl oxidase (EC
1.4.3.13) include protein-lysine 6-oxidase and
protein-L-lysine:oxygen 6-oxidoreductase (deaminating). See, e.g.,
Harris et al., Biochim. Biophys. Acta 341:332-44 (1974); Rayton et
al., J. Biol. Chem. 254:621-26 (1979); Stassen, Biophys. Acta
438:49-60 (1976). A copper-containing quinoprotein with a lysyl
adduct of tyrosyl quinone at its active center, lysyl oxidase
catalyzes the oxidation of peptidyl lysine to result in the
formation of peptidyl alpha-aminoadipic-delta-semialdehyde. Once
formed, this semialdehyde can spontaneously condense with
neighboring aldehydes or with other lysyl groups to from intra- and
interchain cross-links. See, e.g., Rucker et al., Am. J. Clin.
Nutr. 67:996 S-1002S (1998). An example of lysyl oxidase or lysyl
oxidase-like protein include the enzyme having an amino acid
sequence substantially identical to a polypeptide expressed or
translated from one of the following sequences: EMBL/GenBank
accessions: M94054; AAA59525.1--mRNA; S45875; AAB23549.1--mRNA;
S78694; AAB21243.1--mRNA; AF039291; AAD02130.1--mRNA; BC074820;
AAH74820.1--mRNA; BC074872; AAH74872. --mRNA; M84150;
AAA59541.1--Genomic DNA. One embodiment of LOX is human lysyl
oxidase (hLOX) preproprotein.
[0130] Examples of a lysyl oxidase like enzyme or protein are
described in Molnar et al., Biochim Biophys Acta. 1647:220-24
(2003); Csiszar, Prog. Nucl. Acid Res. 70:1-32 (2001); and in WO
01/83702 published on Nov. 8, 2001, all of which are herein
incorporated by reference. (It is noted that in these 3
publications, "LOXL1" was referred to as "LOXL" whereas in the
present disclosure "LOXL" is referred to a lysyl oxidase-like
protein in general, not just LOXL1.) These enzymes include LOXL1,
encoded by mRNA deposited at GenBank/EMBL BC015090; AAH15090.1;
LOXL2, encoded by mRNA deposited at GenBank/EMBL U89942; LOXL3,
encoded by mRNA deposited at GenBank/EMBL AF282619; AAK51671.1; and
LOXL4, encoded by mRNA deposited at GenBank/EMBL AF338441;
AAK71934.1.
[0131] "Lysyl oxidase" or LOX also encompasses a functional
fragment or a derivative that still substantially retains its
enzymatic activity catalyzing the deamination of lysyl residues.
Typically, a functional fragment or derivative retains at least 50%
of its lysyl oxidation activity. In some embodiments, a functional
fragment or derivative retains at least 60%, 70%, 80%, 90%, 95%,
99% or 100% of its lysyl oxidation activity. It is also intended
that a lysyl oxidase can include conservative amino acid
substitutions that do not substantially alter its activity.
Suitable conservative substitutions of amino acids are known to
those of skill in this art and may be made generally without
altering the biological activity of the resulting molecule. Those
of skill in this art recognize that, in general, single amino acid
substitutions in non-essential regions of a polypeptide do not
substantially alter biological activity. See, e.g., Watson, et al.,
Molecular Biology of the Gene, 4th Edition, 1987, The
Benjamin/Cummings Pub. Co., p. 224.
[0132] Details of some examples lysyl oxidase or lysyl oxidase-like
proteins are provided below
[0133] Lysyl oxidase is a copper containing amine oxidase that
oxidizes primary amine substrates to reactive aldehydes. Lysyl
oxidase catalyzes oxidative deamination of peptidyl lysine and
hydroxylysine residues in collagens, and peptidyl lysine residues
in elastin, and is essential for the formation of the extracellular
matrix. The resulting peptidyl aldehydes spontaneously condense and
undergo oxidation reactions to form the lysine-derived covalent
cross-links required for the normal structural integrity of the
extracellular matrix. Hydrogen peroxide (H.sub.2O.sub.2) and
ammonium are released in quantities stoichiometric with the
peptidyl aldehyde product. See, e.g., Kagan et al., J. Cell.
Biochem 88:660-672 (2003).
[0134] The main activity of LOX is the oxidation of specific lysine
residues in collagen and elastin outside of the cell, however, it
may also act intracellularly, where it may regulate gene expression
(Li et al., Proc. Natl. Acad. Sci. USA 94:12817-12822 (1997),
Giampuzzi et al., J. Biol. Chem. 275:36341-36349 (2000)) In
addition, LOX induces chemotaxis of monocytes, fibroblasts and
smooth muscle cells (Lazarus et al., Matrix Biol. 14:727-731 (1995)
Nelson et al., Proc. Soc. Exp. Biol. Med. 188:346-352 (1988)). LOX
itself is induced by a number of growth factors and steroids such
as TGF-.beta., TNF-.alpha. and interferon (Csiszar, Prog. Nucl.
Acid Res. 70:1-32 (2001)). Recent studies have attributed other
roles to LOX in diverse biological functions such as developmental
regulation, tumor suppression, cell motility, and cellular
senescence. The diverse role of LOX, and its recently discovered
amino oxidase family, LOX-like (LOXL), may play important roles
with their intracellular and extracellular localization.
[0135] Five different lysyl oxidases are known to exist in both
humans and mice, LOX and four LOX related, or LOX-like proteins
(LOXL, LOXL2, LOXL3, LOXL4), referred to collectively as "LOX/LOXL"
for the purposes of this disclosure. The five forms of lysyl
oxidases reside on five different chromosomes. These family members
show some overlap in structure and function, but appear to have
distinct functions as well. For example, targeted LOX deletion by
mutagenesis appears to be lethal at parturition in mice (Hornstra
et al., J. Biol. Chem. 278:14387-14393 (2003)), whereas LOXL
deficiency causes no severe developmental phenotype (Bronson et
al., Neurosci. Lett. 390:118-122 (2005)).
[0136] LOX has highly conserved protein domains, conserved in
several species including human, mouse, rat, chicken, fish and
Drosophila. The human LOX family has a highly conserved C-terminal
region containing the 205 amino acid LOX catalytic domain. The
conserved region contains the copper binding (Cu), conserved
cytokine receptor like domain (CRL), and the lysyl-tyrosylquinone
cofactor site (LTQ). The predicted extracellular signal sequences
are represented by the hatched boxes. Twelve cysteine residues are
also similarly conserved, wherein two of them reside within the
prepropeptide region and ten are in the catalytically active
processed form of LOX (Csiszar, Prog. Nucl. Acid Res. 70:1-32
(2001)). The conserved region also includes a fibronectin binding
domain.
[0137] The prepropeptide region of LOX contains the signal peptide,
and is cleaved, the cleavage site predicted to be between
Cys21-Ala22, to generate a signal sequence peptide and a 48 kDa
amino acid propeptide form of LOX, also referred herein as
full-length form. The propeptide is N-glycosylated during passage
through the Golgi that is secreted into the extracellular
environment where the proenzyme, or propeptide, is cleaved between
Gly168-Asp169 by a metalloendoprotease, a procollagen C-proteinase,
which are products of the Bmp1, Tll1 and Tll2 genes, to produce a
processed or mature form of the enzyme. BMP I (bone morphogenetic
protein I) is a procollagen C-proteinase that processes the
propeptide to yield a functional 30 kDa enzyme and an 18 kDa
propeptide. The sequence coding for the propeptide is moderately
(60-70%) conserved, whereas the sequence coding for the C-terminal
30 kDa region of the proenzyme in which the active site is located
is highly conserved (approximately 95%). (Kagan and Li, J. Cell.
Biochem. 88:660-672 (2003); Kagan et al., J. Cell Biochem.
59:329-38 (1995)). The N-glycosyl units are also subsequently
removed.
[0138] Similar potential signal peptides have been predicted at the
amino terminus of LOXL, LOXL2, LOXL3, and LOXL4. The predicted
signal cleavage sites are between Gly25-Gln26 for LOXL, between
Ala25-Gln26, for LOXL2, and between Gly25-Ser26 for LOXL3. The
consensus for BMP-1 cleavage in procollagens and pro-LOX is between
Ala/Gly-Asp, and often followed by an acidic or charged residue. A
potential cleavage site to generate processed LOXL is
Gly303-Asp304, however, it is then followed by an atypical Pro.
LOXL3 also has a potential cleavage site at Gly447-Asp448, which is
followed by an Asp, processing at this site may yield a mature
peptide of similar size to mature LOX. A potential cleavage site of
BMP-1 was also identified within LOXL4, at residues Ala569-Asp570
(Kim et al., J. Biol. Chem. 278:52071-52074 (2003)). LOXL2 may also
be proteolytically cleaved analogously to the other members of the
LOXL family and secreted into media (Akiri et al., Cancer Res.
63:1657-1666 (2003)).
[0139] A feature not known to be common amongst LOX and LOXL is the
scavenger receptor cysteine rich (SRCR) domains. LOX and LOXL lack
SRCR domains, whereas LOXL2, LOXL3, and LOXL4 each have four SRCR
domains at the N-terminus. SRCR domains are found in secreted,
transmembrane, or extracellular matrix proteins. SRCR domains are
also known to mediate ligand binding in a number of secreted and
receptor proteins (Hoheneste et al., Nat. Struct. Biol. 6:228-232
(1999); Sasaki et al., EMBO J. 17:1606-1613 (1998)). Another domain
unique to LOXL is the presence of a proline rich domain (Molnar et
al., Biochimica Biophsyica Acta 1647:220-224 (2003)).
[0140] Tissue distribution may also differ amongst LOX and the
various LOXL. LOX is highly expressed in the heart, placenta,
testis, lung, kidney and uterus, but marginally in the brain and
liver. LOXL1 is expressed in the placenta, kidney, muscle, heart,
lung, and pancreas, and as with LOX, has much lower expressing in
the brain and liver (Kim et al., J. Biol. Chem. 270:7176-7182
(1995)). LOXL2 is highly expressed in the uterus, placenta, and
other organs, but similar to LOX and LOXL, lowly expressed in the
brain and liver (Jourdan Le-Saux et al., J. Biol. Chem.
274:12939:12944 (1999)). LOXL3 is highly expressed in the testis,
spleen, and prostate, moderately in placenta, and not in the liver,
whereas LOXL4 is highly expressed in the liver (Huang et al.,
Matrix Biol. 20:153-157 (2001); Maki and Kivirikko, Biochem. J.
355:381-387 (2001); Jourdan Le-Saux et al., Genomics 74:211-218
(2001); Asuncion et al., Matrix Biol. 20:487-491 (2001)).
[0141] The expression, or implication of LOX and the different LOXL
proteins, in diseases may also vary. This may be due to a number of
reasons, such as the difference in tissue distribution, processing,
domains, regulation of activity, as well as other differences
between the proteins. For example, LOX and LOXL are implicated in
fibrotic diseases as both LOX and LOXL are highly expressed in
myo-fibroblasts around fibrotic areas (Kagen, Pathol. Res. Pract.
190:910-919 (1994); Murawaki et al., Hepatology 14:1167-1173
(1991); Siegel et al., Proc. Natl. Acad. Sci. USA 75:2945-2949
(1978); Jourdan Le-Saux et al., Biochem. Biophys. Res. Comm.
199:587-592 (1994); Kim et al., J. Cell Biochem. 72:181-188
(1999)). LOX and the various LOXL are also implicated in a number
of cancers. For example, LOXL1 and LOXL4 have been shown to be
epigenetically silenced and can inhibit ras/extracellular
signal-regulated kinase signaling pathway in human bladder cancer
(Wu et al., Cancer Res. 67:4123-4129 (2007)). Others have shown
selective upregulation and amplification of the LOXL4 gene in head
and neck squamous cell carcinoma (Gorough et al., J. Pathol.
212:74-82 (2007)). LOX and LOXL2 have also been implicated in a
number of tumors, such as colon and esophageal cancers (Csiszar,
Prog. Nucl. Acid Res. 70:1-32 (2001)). In breast cancer, LOX and
the LOXL family members have been linked to the cancer (Kirschmann
et al., Cancer Res. 62:448-4483 (2002)).
2. Screening for Modulators of Active LOX/LOXL
[0142] Modulators of active LOX/LOXL can also be selected by using
a wide variety of screening assays. The active LOX/LOXL, after
secretion and proteolytic cleavage of the preproprotein, can be
selected by using a wide variety of screening assays. In one
embodiment, methods are provided for selecting a compound that
binds to an active LOX/LOXL, comprising incubating a candidate
binding compound with a polypeptide of an active LOX or LOXL; and
determining if binding has occurred.
[0143] In another embodiment, methods are provided for identifying
a modulator, e.g., activators/agonists or inhibitors/antagonists of
an active LOX/LOXL, comprising incubating a candidate compound with
active LOX/LOXL; assaying a biological activity of the active
LOX/LOXL; and determining if the biological activity of the active
LOX/LOXL has been altered.
[0144] In another embodiment, methods are provided for identifying
activators or inhibitors of active LOX/LOXL, comprising incubating
a candidate compound in a cell culture containing active LOX/LOXL;
and detecting the change of biological activity of the cells in the
culture, wherein the change of the biological activity of the cells
in the culture is indicative for an activator or inhibitors of
active LOX/LOXL. The change in biological activity may be a
LOX/LOXL specific function, LOX/LOXL enzymatic activity, or levels
of LOX/LOXL. In some embodiments, the biological activity is a
cellular function, such as migration, EMT/MET, or others and the
change is compared to control or reference sample(s). For example,
controls may be negative control samples may include a culture with
decrease levels of active LOX/LOXL to which the candidate compound
is added or a culture with the same amount of active LOX/LOXL but
no candidate compound added. In some embodiments, separate cultures
containing different amounts of active LOX/LOXL are contacted with
a candidate compound. For example, if a change in biological
activity is observed, and if the change is greater in the culture
having higher amounts of active LOX/LOXL, the compound is
identified as an activator of active LOX/LOXL.
[0145] In another example, expressing significant amount of LOX
and/or LOXL can be used as a source for active LOX/LOXL for the
screening assays described herein, whereas whole cell lysate would
contain not only active LOX and/or LOXL but also inactive LOX
and/or LOXL.
[0146] The compound or plurality of compounds may be chemically
synthesized or microbiologically produced and/or comprised in, for
example, samples, e.g., cell extracts from, e.g., plants, animals
or microorganisms. Furthermore, the compound(s) may be known in the
art but hitherto not known to be capable of suppressing or
activating active LOX/LOXL. The reaction mixture may be a cell free
extract or may comprise a cell or tissue culture: Suitable set ups
for the method of the disclosure are known to the person skilled in
the art and are, for example, generally described in Alberts et
al., Molecular Biology of the Cell, third edition (1994) and in the
appended examples. A plurality of compounds may be, e.g., added to
the reaction mixture, culture medium, injected into a cell or
otherwise applied to a transgenic animal. The cell or tissue that
may be employed in the method of the disclosure is a host cell,
mammalian cell or non-human transgenic animal of the
disclosure.
[0147] If a sample containing a compound or a plurality of
compounds is identified in the method of the disclosure, then it is
either possible to isolate the compound from the original sample
identified as containing the compound capable of suppressing or
activating active LOX/LOXL, or one can further subdivide the
original sample, for example, if it consists of a plurality of
different compounds, so as to reduce the number of different
substances per sample and repeat the method with the subdivisions
of the original sample. Depending on the complexity of the samples,
the steps described above can be performed several times, for
example, until the sample identified according to the method of the
disclosure only comprises a limited number of or only one
substance(s). In some embodiments the sample comprises substances
of similar chemical and/or physical properties, and in some
embodiments, the substances are identical.
[0148] Several methods are known to the person skilled in the art
for producing and screening large libraries to identify compounds
having specific affinity for a target, such as active LOX/LOXL.
These methods include the phage-display method in which randomized
peptides are displayed from phage and screened by affinity
chromatography to an immobilized receptor; see, e.g., WO 91/17271,
WO 92/01047, U.S. Pat. No. 5,223,409.
[0149] In another approach, combinatorial libraries of polymers
immobilized on a chip are synthesized using photolithography; see,
e.g., U.S. Pat. No. 5,143,854, WO 90/15070 and WO 92/10092. The
immobilized polymers are contacted with a labeled receptor and
scanned for label to identify polymers binding to the receptor. The
synthesis and screening of peptide libraries on continuous
cellulose membrane supports that can be used for identifying
binding ligands of the polypeptide of the disclosure and thus
possible inhibitors and activators is described, for example, in
Kramer, Methods Mol. Biol. 87 (1998), 25-39. This method can also
be used, for example, for determining the binding sites and the
recognition motifs in the active LOX/LOXL. In like manner, the
substrate specificity of the DnaK chaperon was determined and the
contact sites between human interleukin-6 and its receptor; see
Rudiger, EMBO J. 16 (1997), 1501-1507 and Weiergraber, FEBS Lett.
379 (1996), 122-126, respectively.
[0150] Furthermore, the above-mentioned methods can be used for the
construction of binding epitopes derived from the active LOX/LOXL.
A similar approach was successfully described for peptide antigens
of the anti-p24 (HIV-1) monoclonal antibody; see Kramer, Cell 91
(1997), 799-809. A general route to fingerprint analyses of
peptide-antibody interactions using the clustered amino acid
peptide library was described in Kramer, Mol. Immunol. 32 (1995),
459-465. In addition, antagonists of the active LOX/LOXL can be
derived and identified from monoclonal antibodies that specifically
react with the polypeptide of the disclosure in accordance with the
methods as described in Doring, Mol. Immunol. 31 (1994),
1059-1067.
[0151] More recently, WO 98/25146 described further methods for
screening libraries of complexes for compounds having a desired
property, e.g., the capacity to agonize, bind to, or antagonize a
polypeptide or its cellular receptor. The complexes in such
libraries comprise a compound under test, a tag recording at least
one step in synthesis of the compound, and a tether susceptible to
modification by a reporter molecule. Modification of the tether is
used to signify that a complex contains a compound having a desired
property. The tag can be decoded to reveal at least one step in the
synthesis of such a compound. Other methods for identifying
compounds which interact with the polypeptides according to the
disclosure or nucleic acid molecules encoding such molecules are,
for example, the in vitro screening with the phage display system
as well as filter binding assays or "real time" measuring of
interaction using, for example, the BIAcore apparatus
(Pharmacia).
[0152] All these methods can be used in accordance with the present
disclosure to identify activators/agonists and
inhibitors/antagonists of the active LOX/LOXL or related
polypeptide.
[0153] Various sources for the basic structure of such an activator
or inhibitor can be employed and comprise, for example, mimetic
analogs of the polypeptides of the disclosure. Mimetic analogs of
the polypeptide of the disclosure or biologically active fragments
thereof can be generated by, for example, substituting the amino
acids that are expected to be essential for the biological activity
with, e.g., stereoisomers, i.e. D-amino acids; see e.g., Tsukida,
J. Med. Chem. 40 (1997), 3534-3541. Furthermore, in case fragments
are used for the design of biologically active analogs pro-mimetic
components can be incorporated into a peptide to reestablish at
least some of the conformational properties that may have been lost
upon removal of part of the original polypeptide; see, e.g.,
Nachman, Regul. Pept. 57 (1995), 359-370. Furthermore, the active
LOX/LOXL can be used to identify synthetic chemical peptide
mimetics that bind to or can function as a ligand, substrate,
binding partner or the receptor of the polypeptide of the
disclosure as effectively as does the natural polypeptide; see,
e.g., Engleman, J. Clin. Invest. 99 (1997), 2284-2292. For example,
folding simulations and computer redesign of structural motifs of
the active LOX/LOXL can be performed using appropriate computer
programs (Olszewski, Proteins 25 (1996), 286-299; Hoffman, Comput.
Appl. Biosci. 11 (1995), 675-679). Computer modeling of protein
folding can be used for the conformational and energetic analysis
of detailed peptide and protein models (Monge, J. Mol. Biol. 247
(1995), 995-1012; Renouf Adv. Exp. Med. Biol. 376 (1995), 37-45).
The appropriate programs can be used for the identification of
interactive sites of the Lysyl Oxidase polypeptide and its
interacting proteins by computer assisted searches for
complementary peptide sequences (Fassina, Immunomethods 5 (1994),
114-120). Further appropriate computer systems for the design of
protein and peptides are described in the prior art, for example in
Berry, Biochem. Soc. Trans. 22 (1994), 1033-1036; Wodak, Ann. N.Y.
Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry 25 (1986),
5987-5991. The results obtained from the above-described computer
analysis can be used for, e.g., the preparation of peptide mimetics
of the protein of the disclosure or fragments thereof. Such
pseudopeptide analogues of the natural amino acid sequence of the
protein may very efficiently mimic the parent protein (Benkirane,
J. Biol. Chem. 271 (1996), 33218-33224). For example, incorporation
of easily available achiral o-amino acid residues into a protein of
the disclosure or a fragment thereof results in the substitution of
amide bonds by polymethylene units of an aliphatic chain, thereby
providing a convenient strategy for constructing a peptide mimetic
(Banerjee, Biopolymers 39 (1996), 769-777). Superactive
peptidomimetic analogues of small peptide hormones in other systems
are described in the prior art (Zhang, Biochem. Biophys. Res.
Commun. 224 (1996), 327-331). Appropriate peptide mimetics of a
modulator of an active LOX/LOXL can also be identified by the
synthesis of peptide mimetic combinatorial libraries through
successive amide alkylation and testing the resulting compounds,
e.g., for their binding and immunological properties. Methods for
the generation and use of peptidomimetic combinatorial libraries
are described in the prior art, for example in Ostresh, Methods in
Enzymology 267 (1996), 220-234 and Dorney, Bioorg. Med. Chem. 4
(1996), 709-715. Furthermore, a three-dimensional and/or
crystallographic structure of the polypeptide of the disclosure can
be used for the design of peptide mimetic inhibitors of the
biological activity of the polypeptide of the disclosure (Rose,
Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4
(1996), 1545-1558).
[0154] The structure-based design and synthesis of
low-molecular-weight synthetic molecules that mimic the activity of
the native biological polypeptide is further described in, e.g.,
Dowd, Nature Biotechnol. 16 (1998), 190-195; Kieber-Emmons, Current
Opinion Biotechnol. 8 (1997), 435-441; Moore, Proc. West Pharmacol.
Soc. 40 (1997), 115-119; Mathews, Proc. West Pharmacol. Soc. 40
(1997), 121-125; Mukhija, European J. Biochem. 254 (1998),
433-438.
[0155] It is also well known to the person skilled in the art, that
it is possible to design, synthesize and evaluate mimetics of small
organic compounds that, for example, can act as a substrate or
ligand to the active LOX/LOXL or the related polypeptide. For
example, it has been described that D-glucose mimetics of hapalosin
exhibited similar efficiency as hapalosin in antagonizing multidrug
resistance assistance-associated protein in cytotoxicity; see Dinh,
J. Med. Chem. 41 (1998), 981-987.
[0156] The inhibitors disclosed herein, such as antibodies, can
bind to LOX/LOXL and can be competitive inhibitors, uncompetitive
inhibitors or non-competitive inhibitors. With respect to
competitive inhibition, an inhibitor usually bears structural
similarity to substrate. Inhibition will be noticeable at low
substrate concentrations, but can be overcome at high substrate
concentrations. With respect to uncompetitive inhibition, an
inhibitor binds at site that becomes available after substrate is
bound at the active site. Inhibition will be most noticeable at
high substrate concentration. With respect to non-competitive
inhibition, an inhibitor binds at site away from substrate binding
site and relative inhibition will generally be the same at all
substrate concentrations. In one embodiment, an antibody or antigen
binding fragment thereof, described herein specifically binds both
full-length and processed LOX or LOXL2. In one aspect, both
full-length and processed LOX or LOXL2 are active forms of the
enzyme.
3. Antibodies Against LOX/LOXL
[0157] As used herein, the term "antibody" means an isolated or
recombinant binding agent that comprises the necessary variable
region sequences to specifically bind an antigenic epitope.
Therefore, an antibody is any form of antibody or fragment thereof
that exhibits the desired biological activity, e.g., binding the
specific target antigen. Thus, it is used in the broadest sense and
specifically covers monoclonal antibodies (including full-length
monoclonal antibodies), polyclonal antibodies, human antibodies,
humanized antibodies, chimeric antibodies, nanobodies, diabodies,
multispecific antibodies (e.g., bispecific antibodies), and
antibody fragments including but not limited to scFv, Fab, and
Fab.sub.2, so long as they exhibit the desired biological activity.
The term "human antibody" therefore refers to antibodies containing
sequences of human origin, except for possible non-human CDR
regions, and does not imply that the full structure of an Ig
molecule be present, only that the antibody has minimal immunogenic
effect in a human.
[0158] "Antibody fragments" comprise a portion of an intact
antibody, for example, the antigen binding or variable region of
the intact antibody. Examples of antibody fragments include Fab,
Fab', F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng. 8(10): 1057-1062 (1995)); single-chain
antibody molecules; and multispecific antibodies formed from
antibody fragments. Papain digestion of antibodies produces two
identical antigen-binding fragments, called "Fab" fragments, each
with a single antigen-binding site, and a residual "Fc" fragment, a
designation reflecting the ability to crystallize readily. Pepsin
treatment yields an F(ab').sub.2 fragment that has two
antigencombining sites and is still capable of cross-linking
antigen.
[0159] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This region
consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association. It is in this
configuration that the three CDRS of each variable domain interact
to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0160] The "Fab" fragment also contains the constant domain of the
light chain and the first constant domain (CHO of the heavy chain.
Fab fragments differ from Fab' fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH.sub.1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments which have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0161] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa and lambda, based on the amino acid sequences
of their constant domains. Depending on the amino acid sequence of
the constant domain of their heavy chains, immunoglobulins can be
assigned to different classes. There are five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these
may be further divided into subclasses (isotypes), e.g., IgG1,
IgG2, IgG3, IgG4, IgA, and IgA2.
[0162] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of antibody, wherein these domains are
present in a single polypeptide chain. In some embodiments, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains, which enables the sFv to form the
desired structure for antigen binding. For a review of sFv, see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994).
[0163] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90:6444-6448 (1993).
[0164] An "isolated" antibody is one that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In some embodiments, the
antibody will be purified (1) to greater than 95% by weight of
antibody as determined by the Lowry method, for example, more than
99% by weight, (2) to a degree sufficient to obtain at least 15
residues of N-terminal or internal amino acid sequence by use of a
spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under
reducing or nonreducing conditions using Coomassie blue or silver
stain. Isolated antibody includes the antibody in situ within
recombinant cells since at least one component of the antibody's
natural environment will not be present. Ordinarily, however,
isolated antibody will be prepared by at least one purification
step.
[0165] In some embodiments the anti-LOX/LOXL antibody is a
humanized antibody or a human antibody. Humanized forms of
non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding subsequences of antibodies)
which contain minimal sequence derived from non-human
immunoglobulin. Humanized antibodies include human
immununoglobulins (recipient antibody) in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In some instances, Fv framework
residues of the human immunoglobulin are replaced by corresponding
non-human residues. Humanized antibodies may also comprise residues
that are found neither in the recipient antibody nor in the
imported CDR or framework sequences. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin consensus sequence.
[0166] The humanized antibody optimally also will comprise at least
a portion of an immunoglobulin constant region (Fc), typically that
of a human immunoglobulin (Jones et al., Nature, 321:522-525
(1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta,
Curr. Op. Struct. Biol. 2:593-596 (1992)). Methods for humanizing
non-human antibodies are well known in the art.
[0167] Generally, a humanized antibody has one or more amino acid
residues introduced into it from a source that is non-human. These
non-human amino acid residues are often referred to as "import" or
"donor" residues, which are typically taken from an "import" or
"donor" variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al.,
Nature, 321:522 525 (1986); Riechmann et al., Nature, 332:323 327
(1988)); Verhoeyen et al. Science, 239:1534 1536 (1988)), by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies include chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0168] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
(Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)). The techniques of Cole et al.
and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J.
Immunol., 147(1):86-95 (1991)). Similarly, human antibodies can be
made by introducing human immunoglobulin loci into transgenic
animals, e.g., mice in which the endogenous immunoglobulin genes
have been partially or completely inactivated. Upon challenge,
human antibody production is observed, which closely resembles that
seen in humans in all respects, including gene rearrangement,
assembly, and antibody repertoire. This approach is described, for
example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825;
5,625,126; 5,633,425; 5,661,016, and in the following scientific
publications: Marks et al., Bio/Technology 10, 779-783 (1992);
Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368,
812 13 (1994); Fishwald et al., Nature Biotechnology 14, 845-51
(1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and
Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).
[0169] The antibodies may also be affinity matured using known
selection and/or mutagenesis methods as described above. In some
embodiments, affinity matured antibodies have an affinity which is
five times, more than ten times, more than twenty times, or even
more than thirty times greater than the starting antibody
(generally murine, rabbit, chicken, humanized or human) from which
the matured antibody is prepared.
[0170] The anti-LOX/LOXL antibody may also be a bispecific
antibody. Bispecific antibodies are monoclonal, any may be human or
humanized antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for LOX, the other one is for any other antigen,
for example, for a cell-surface protein or receptor or receptor
subunit. In additional embodiments, one of the binding
specificities is for LOX, and the other is for a LOXL protein;
e.g., LOXL2 or LOXL4.
[0171] The anti-LOX/LOXL antibody may also be an immunoconjugate.
Such immunoconjugates comprise an anti-LOX antibody conjugated to a
cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an
enzymatically active toxin of bacterial, fungal, plant, or animal
origin, or fragments thereof), or a radioactive isotope (i.e., a
radioconjugate).
[0172] An antibody that "specifically binds to" or is "specific
for" a particular polypeptide or an epitope on a particular
polypeptide is one that binds to that particular polypeptide or
epitope on a particular polypeptide without substantially binding
to any other polypeptide or polypeptide epitope. In some
embodiments, the antibody of the present disclosure specifically
binds to a human LOX/LOXL (such as hLOX and hLOXL1-4) with
dissociation constant K.sub.d equal to or lower than 100 nM,
optionally lower than 10 nM, optionally lower than 1 nM, optionally
lower than 0.5 nM, optionally lower than 0.1 nM, optionally lower
than 0.01 nM, or optionally lower than 0.005 nM, in the form of
monoclonal antibody, scFv, Fab, or other form of antibody measured
at a temperature of about 4.degree. C., 25.degree. C., 37.degree.
C. or 42.degree. C.
[0173] Optionally, the antibody of the present disclosure binds to
one or more proteolytic cleavage sites of LOX or LOXL, such as the
cleavage site for processing a mature form of LOX/LOXL, thereby
effectively blocking processing of the LOX or LOXL to reduce the
level of active LOX or LOXL.
[0174] Optionally, the antibody of the present disclosure
specifically and selectively binds to the full-length form of LOX,
with a greater binding affinity, for example, at least 10 times, at
least 100 times, or even at least 1000 times greater, than the
binding affinity to the preproprotein of human LOX, the mature or
processed human LOX, or other lysyl oxidase-like or lysyl
oxidase-related proteins (e.g., LOXL1, LOXL2, LOXL3, and LOXL4; see
Molnar et al. (2003) Biochim Biophys. Acta. 1647:220-224; Csiszar,
Prog. Nucl. Acid Res. 70:1-32 (2001); and WO 01/83702 published on
Nov. 8, 2001).
[0175] Optionally, the antibody of the present disclosure
specifically and selectively binds to the mature or processed form
of LOX, with a greater binding affinity, for example, at least 10
times, at least 100 times, or even at least 1000 times greater,
than the binding affinity to the preproprotein of human LOX, the
full-length form of human LOX, or other lysyl oxidase-like or lysyl
oxidase-related proteins (e.g., LOXL1, LOXL2, LOXL3, and LOXL4; see
Molnar et al. (2003) Biochim Biophys. Acta. 1647:220-224).
[0176] In some embodiments, the antibody specifically binds to an
epitope in a region of hLOX selected from SEQ ID NOs: 1-18.
[0177] Optionally, the antibody of the present disclosure binds to
both human LOX and human LOXL2, with a greater binding affinity,
for example, 10 times, at least 100 times, or even at least 1000
times greater, than the binding affinity to other lysyl
oxidase-like or lysyl oxidase-related proteins (e.g., LOXL1, LOXL3,
and LOXL4; see Molnar et al. (2003) Biochim Biophys. Acta.
1647:220-224).
[0178] Optionally, the antibody of the present disclosure not only
binds to LOX or LOXL but also reduces or inhibits uptake or
internalization of LOX or LOXL (e.g., via integrin beta 1 or other
cellular receptors or proteins. It is believed that such an
antibody could reduce EMT and thus is useful for the applications
disclosed herein.
[0179] Optionally, the antibody of the present disclosure not only
binds to LOX or LOXL but also reduces or inhibits the lysyl oxidase
enzymatic activity of LOX or LOXL. It is believed that such an
antibody could reduce EMT and thus is useful for the applications
disclosed herein.
[0180] Binding of LOX/LOXL with other proteins, such as cellular
receptors (e.g. uptake receptor integrin beta1), BTK (burton
agammagloublinemia tyrosine kinase), or other integrins is also
performed using the aforementioned assay, wherein instead of ECM
proteins are used, cellular receptors (e.g. uptake receptor
integrin beta1), BTK (burton agammagloublinemia tyrosine kinase) or
other integrins are used.
[0181] Those LOX/LOXL antibodies that inhibit LOX/LOXL binding to
ECM proteins, cellular receptors, and integrins, are selected as
candidates for further development.
[0182] LOX/LOXL enzymes act via a ping-pong mechanism which can be
described by Michaelis-Menten kinetics (FIG. 41). The LOX/LOXL
antibodies of the present disclosure can be competitive inhibitors,
uncompetitive inhibitors or non-competitive inhibitors of LOX/LOXL.
The mechanism of action antibodies that act as competitive
inhibitors, uncompetitive inhibitors and non-competitive inhibitors
is illustrated in FIG. 42. With respect to competitive inhibition,
an inhibitor usually bears structural similarity to substrate.
Inhibition will be noticeable at low substrate concentrations, but
can be overcome at high substrate concentrations. With respect to
uncompetitive inhibition, an inhibitor binds at site that becomes
available after substrate is bound at the active site. Inhibition
will be most noticeable at high substrate concentration. With
respect to non-competitive inhibition, an inhibitor binds at site
away from substrate binding site. Relative inhibition will
generally be the same at all substrate concentrations. Thus,
inhibitors can be LOX/LOXL antibodies, such as LOXL2, which are
competitive inhibitors, uncompetitive inhibitors or non-competitive
inhibitors (FIG. 43).
4. Polynucleotides Targeting LOX/LOXL
[0183] Inhibitors of LOX or LOXL levels or activity can be effected
using an antisense polynucleotide capable of specifically
hybridizing with an mRNA transcript encoding LOX or LOXL.
[0184] Optionally, the polynucleotide inhibitors of the present
disclosure can reduce or inhibits uptake or internalization of LOX
or LOXL. It is believed that such a polynucleotide inhibitor could
reduce EMT and thus is useful for the applications disclosed
herein.
[0185] Optionally, the polynucleotide inhibitors of the present
disclosure can reduce or inhibit the lysyl oxidase enzymatic
activity of LOX or LOXL. It is believed that such a polynucleotide
inhibitor could reduce EMT and thus is useful for the applications
disclosed herein.
[0186] Design of antisense molecules which can be used to
efficiently down-regulate LOX or LOXL2 is typically effected while
considering two aspects factors used in the antisense approach. The
first aspect is delivery of the oligonucleotide into the cytoplasm
of the appropriate cells, while the second aspect is design of an
oligonucleotide which specifically binds the designated mRNA within
cells in a way which inhibits translation thereof.
[0187] Several considerations are typically taken into account when
designing antisense oligonucleotides. For efficient in vivo
inhibition of gene expression using antisense oligonucleotides or
analogs, the oligonucleotides or analogs typically fulfill the
following requirements (i) sufficient specificity in binding to the
target sequence; (ii) solubility in water; (iii) stability against
intra- and extracellular nucleases; (iv) capability of penetration
through the cell membrane; and (v) when used to treat an organism,
low toxicity. Algorithms for identifying those sequences with the
highest predicted binding affinity for their target mRNA based on a
thermodynamic cycle that accounts for the energy of structural
alterations in both the target mRNA and the oligonucleotide are
available, for example, as described in Walton et al. Biotechnol
Bioeng 65:1-9 (1999).
[0188] Such algorithms have been successfully used to implement an
antisense approach in cells. For example, the algorithm developed
by Walton et al. enabled scientists to successfully design
antisense oligonucleotides for rabbit .beta.-globin (RBG) and mouse
tumor necrosis factor-.alpha. (TNF .alpha.) transcripts. The same
research group has also reported that the antisense activity of
rationally selected oligonucleotides against three model target
mRNAs (human lactate dehydrogenase A and B and rat gp130) in cell
culture as evaluated by a kinetic PCR technique proved effective in
almost all cases, including tests against three different targets
in two cell types with phosphodiester and phosphorothioate
oligonucleotide chemistries.
[0189] In addition, several approaches for designing and predicting
efficiency of specific oligonucleotides using an in vitro system
are also published (Matveeva et al., Nature Biotechnology 16:
1374-1375 (1998)).
[0190] An antisense molecule which can be used with the present
disclosure includes a polynucleotide or a polynucleotide analog of
at least 10 bases, for example, between 10 and 15, between 15 and
20 bases, at least 17, at least 18, at least 19, at least 20, at
least 22, at least 25, at least 30, or even at least 40 bases which
is hybridizable in vivo, under physiological conditions, with a
portion of a polynucleotide strand encoding a polypeptide at least
50% homologous to SEQ ID NO:1, 4, 5 or 7 or at least 75% homologous
to an N-terminal portion thereof as determined using the BestFit
software of the Wisconsin sequence analysis package, utilizing the
Smith and Waterman algorithm, where gap creation penalty equals 8
and gap extension penalty equals 2.
[0191] The antisense oligonucleotides used by the present
disclosure can be expressed from a nucleic acid construct
administered into the tissue, in which case inducible promoters can
be used such that antisense expression can be switched on and off,
or alternatively such oligonucleotides can be chemically
synthesized and administered directly into the tissue, as part of,
for example, a pharmaceutical composition.
[0192] The ability of chemically synthesizing oligonucleotides and
analogs thereof having a selected predetermined sequence offers
means for downmodulating gene expression. Four types of gene
expression modulation strategies may be considered.
[0193] At the transcription level, antisense or sense
oligonucleotides or analogs that bind to the genomic DNA by strand
displacement or the formation of a triple helix, may prevent
transcription. At the transcript level, antisense oligonucleotides
or analogs that bind target mRNA molecules lead to the enzymatic
cleavage of the hybrid by intracellular RNase H. In this case, by
hybridizing to the targeted mRNA, the oligonucleotides or
oligonucleotide analogs provide a duplex hybrid recognized and
destroyed by the RNase H enzyme. Alternatively, such hybrid
formation may lead to interference with correct splicing. As a
result, in both cases, the number of the target mRNA intact
transcripts ready for translation is reduced or eliminated.
[0194] At the translation level, antisense oligonucleotides or
analogs that bind target mRNA molecules prevent, by steric
hindrance, binding of essential translation factors (ribosomes), to
the target mRNA, a phenomenon known in the art as hybridization
arrest, disabling the translation of such mRNAs.
[0195] Unmodified oligonucleotides are typically impractical for
use as antisense sequences since they have short in vivo
half-lives, during which they are degraded rapidly by nucleases.
Furthermore, they are often difficult to prepare in more than
milligram quantities. In addition, such oligonucleotides are
usually poor cell membrane penetrants. Thus, oligonucleotide
analogs are usually devised in a suitable manner.
[0196] For example, problems arising in connection with
double-stranded DNA (dsDNA) recognition through triple helix
formation have been diminished by a clever "switch back" chemical
linking, whereby a sequence of polypurine on one strand is
recognized, and by "switching back," a homopurine sequence on the
other strand can be recognized. Also, good helix formation has been
obtained by using artificial bases, thereby improving binding
conditions with regard to ionic strength and pH.
[0197] RNA oligonucleotides may also be used for antisense
inhibition as they form a stable RNA-RNA duplex with the target,
suggesting efficient inhibition. However, due to their low
stability, RNA oligonucleotides are typically expressed inside the
cells using vectors designed for this purpose. This approach may be
used when attempting to target an mRNA that encodes an abundant and
long-lived protein.
[0198] Antisense therapeutics can be used to treat many
life-threatening diseases with a number of advantages over
traditional drugs. Traditional drugs typically intervene after a
disease-causing protein is formed. Antisense therapeutics, however,
can block mRNA transcription/translation and intervene before a
protein is formed, and since antisense therapeutics target only one
specific mRNA, they can be more effective with fewer side effects
than current protein-inhibiting therapy.
[0199] Several clinical trials have demonstrated safety,
feasibility and activity of antisense oligonucleotides. For
example, antisense oligonucleotides suitable for the treatment of
cancer have been successfully used (Holmund et al., Curr. Opin.
Mol. Ther. 1:372-385 (1999)), while treatment of hematological
malignancies via antisense oligonucleotides targeting c-myb gene,
p53 and Bc1-2 had entered clinical trials and had been shown to be
tolerated by patients (Gerwitz, Curr. Opin. Mol. Ther. 1: 297-306
(1999)).
[0200] More recently, antisense-mediated suppression of human
heparanase gene expression has been reported to inhibit pleural
dissemination of human cancer cells in a mouse model (Uno et al.,
Cancer Res 61:7855-60 (2001)).
[0201] The first antisense drug was recently approved by the FDA.
The drug, Fomivirsen, was developed by Isis, and is indicated for
local treatment of cytomegalovirus in patients with AIDS who are
intolerant of or have a contraindication to other treatments for
CMV retinitis or who were insufficiently responsive to previous
treatments for CMV retinitis (Pharmacotherapy News Network).
[0202] Thus, the current consensus is that recent developments in
the field of antisense technology which, as described above, have
led to the generation of highly accurate antisense design
algorithms and a wide variety of oligonucleotide delivery systems,
enable an ordinarily skilled artisan to design and implement
antisense approaches suitable for downregulating expression of
known sequences without having to resort to undue trial and error
experimentation.
[0203] Another mechanism for inhibiting LOX or LOXL is RNA
interference (RNAi), an approach which utilizes small interfering
dsRNA (siRNA or small hairpin RNA, shRNA) molecules that are
homologous to the target mRNA and lead to its degradation (Carthew,
Curr. Opin. Cell. Biol. 13: 244-248 (2001)). For example, infection
of diverse types of cancer cells with expression of a LOXL2
specific shRNA is effective in altering both their morphology and
invasiveness.
[0204] RNA interference is typically a two-step process. In the
first step, which is termed as the initiation step, input dsRNA is
digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA),
probably by the action of Dicer, a member of the RNase III family
of dsRNA-specific ribonucleases, which processes (cleaves) dsRNA
(introduced directly or via a transgene or a virus) in an
ATP-dependent manner. Successive cleavage events degrade the RNA to
19-21 bp duplexes (siRNA), each with 2-nucleotide 3' overhangs
(Hutvagner and Zamore, Curr. Opin. Genet. Dev. 12: 225-232 (2002);
Bernstein, Nature 409:363-366 (2001)).
[0205] In the effector step, the siRNA duplexes bind to a nuclease
complex to form the RNA-induced silencing complex (RISC). An
ATP-dependent unwinding of the siRNA duplex is required for
activation of the RISC. The active RISC then targets the homologous
transcript by base pairing interactions and typically cleaves the
mRNA into approximately 12 nucleotide fragments from the 3'
terminus of the siRNA (Hutvagner and Zamore, Curr. Opin. Genet.
Dev. 12: 225-232 (2002); Hammond et al., Nat. Rev. Gen. 2:110-119
(2001); Sharp, Genes. Dev. 15:485-490 (2001)). Although the
mechanism of cleavage is still to be elucidated, research indicates
that each RISC contains a single siRNA and an RNase (Hutvagner and
Zamore, Curr. Opin. Genet. Dev. 12: 225-232 (2002)).
[0206] Because of the remarkable potency of RNAi, an amplification
step within the RNAi pathway has been suggested. Amplification
could occur by copying of the input dsRNAs which would generate
more siRNAs, or by replication of the siRNAs formed.
[0207] Alternatively or additionally, amplification could be
effected by multiple turnover events of the RISC (Hutvagner and
Zamore, Curr. Opin. Genet. Dev. 12: 225-232 (2002); Hammond et al.,
Nat. Rev. Gen. 2:110-119 (2001); Sharp, Genes. Dev. 15:485-490
(2001)). RNAi is also described in Tuschl, Chem. Biochem. 2:
239-245 (2001); Cullen, Nat. Immunol. 3:597-599 (2002); and Brantl,
Biochem. Biophys. Act. 1575:15-25 (2002).
[0208] Synthesis of RNAi molecules suitable for use with the
present disclosure can be effected as follows. First, the LOX or
LOXL mRNA sequence is scanned downstream of the AUG start codon for
AA dinucleotide sequences. Occurrence of each AA and the 3'
adjacent 19 nucleotides is recorded as potential siRNA target
sites. The siRNA target sites are selected from the open reading
frame, as untranslated regions (UTRs) are richer in regulatory
protein binding sites. UTR-binding proteins and/or translation
initiation complexes may interfere with binding of the siRNA
endonuclease complex (Tuschl, Chem. Biochem. 2: 239-245 (2001)). It
will be appreciated though, that siRNAs directed at untranslated
regions may also be effective, as demonstrated for GAPDH wherein
siRNA directed at the 5' UTR mediated about 90% decrease in
cellular GAPDH mRNA and completely abolished protein level
(www.ambion.com/techlib/tn/91/912.html). Second, potential target
sites are compared to an appropriate genomic database (e.g., human,
mouse, rat etc.) using any sequence alignment software, such as the
BLAST software available from the NCBI server
(www.ncbi.nlm.nih.gov/BLAST/). Putative target sites which exhibit
significant homology to other coding sequences are filtered
out.
[0209] Qualifying target sequences are selected as template for
siRNA synthesis. Selected sequences can include those with low G/C
content as these have been shown to be more effective in mediating
gene silencing as compared to those with G/C content higher than
55%. Several target sites can be selected along the length of the
target gene for evaluation. For better evaluation of the selected
siRNAs, a negative control is used in conjunction. Negative control
siRNA can include the same nucleotide composition as the siRNAs but
lack significant homology to the genome. Thus, a scrambled
nucleotide sequence of the siRNA may be used, provided it does not
display any significant homology to any other gene.
[0210] The siRNA molecules of the present disclosure can be
transcribed from expression vectors which can facilitate stable
expression of the siRNA transcripts once introduced into a host
cell. These vectors are engineered to express shRNAs, which are
processed in vivo into siRNA molecules capable of carrying out
gene-specific silencing (Brummelkamp et al., Science 296:550-553
(2002); Paddison et al., Genes Dev. 16:948-958 (2002); Paul et al.,
Nature Biotech. 20: 505-508 (2002); Yu et al., Proc. Natl. Acad.
Sci. USA 99:6047-6052 (2002)).
[0211] ShRNAs are single-stranded polynucleotides with a hairpin
loop structure. The single-stranded polynucleotide has a loop
segment linking the 3' end of one strand in the double-stranded
region and the 5' end of the other strand in the double-stranded
region. The double-stranded region is formed from a first sequence
that is hybridizable to a target sequence, such as a polynucleotide
encoding LOX or LOXL, or a LOX or LOXL mRNA, and a second sequence
that is complementary to the first sequence, thus the first and
second sequence form a double stranded region to which the linking
sequence connects the ends of to form the hairpin loop structure.
The first sequence can be hybridizable to any portion of a
polynucleotide encoding LOX/LOXL. The double-stranded stem domain
of the shRNA comprises a restriction endonuclease site.
[0212] The stem-loop structure of shRNAs can have optional
nucleotide overhands, such as 2-bp overhands, for example, 3'
UU-overhangs. While there may be variation, stems typically range
from approximately 15 to 49, approximately 15 to 35, approximately
19 to 35, approximately 21 to 31 bp, or approximately 21 to 29 bp,
and the loops can range from approximately 4 to 30 bp, for example,
about 4 to 23 bp.
[0213] For expression of shRNAs within cells, plasmid vectors
containing either the polymerase III H1-RNA or U6 promoter, a
cloning site for the stem-looped RNA insert, and a 4 5-thymidine
transcription termination signal can be employed. The Polymerase
III promoters generally have well-defined initiation and stop sites
and their transcripts lack poly(A) tails. The termination signal
for these promoters is defined by the polythymidine tract, and the
transcript is typically cleaved after the second uridine. Cleavage
at this position generates a 3' UU overhang in the expressed shRNA,
which is similar to the 3' overhangs of synthetic siRNAs.
Additional methods for expressing the shRNA in mammalian cells are
described in the references cited above.
[0214] An example of a suitable expression vector is the
pSUPER.TM., which includes the polymerase-III H1-RNA gene promoter
with a well defined start of transcription and a termination signal
consisting of five thymidines in a row (T5) (Brummelkamp et al.,
Science 296:550-553 (2002)). The cleavage of the transcript at the
termination site is at a site following the second uridine, thus
yielding a transcript which resembles the ends of synthetic siRNAs,
which also contain nucleotide overhangs. siRNA is cloned such that
it includes the sequence of interest, i.e., LOX or LOXL separated
by a short spacer from the reverse complement of the same sequence.
The resulting transcript folds back on itself to form a stem-loop
structure, which mediates LOX or LOXL RNAi. Another suitable siRNA
expression vector encodes the sense and antisense siRNA under the
regulation of separate polIII promoters (Miyagishi and Taira,
Nature Biotech. 20:497-500 (2002)). The siRNA, generated by this
vector also includes a five thymidine (T5) termination signal.
[0215] Since approaches for introducing synthetic siRNA into cells
by lipofection can result in low transfection efficiencies in some
cell types and/or short-term persistence of silencing effects,
vector mediated methods have been developed.
[0216] Thus, siRNA molecules utilized by the present disclosure can
be delivered into cell using retroviruses. Delivery of siRNA using
retroviruses provides several advantages over methods, such as
lipofection, since retroviral delivery typically is more efficient,
uniform and immediately selects for stable "knock-down" cells
(Devroe and Silver, BMC Biotechnol. 2:15 (2002)).
[0217] Recent scientific publications have validated the efficacy
of such short double stranded RNA molecules in inhibiting target
mRNA expression and thus have clearly demonstrated the therapeutic
potential of such molecules. For example, RNAi has been utilized to
inhibit expression of hepatitis C (McCaffrey et al., Nature
418:38-39 (2002)), HIV-1 (Jacque et al., Nature 418:435-438
(2002)), cervical cancer cells (Jiang and Milner, Oncogene
21:6041-6048 (2002)) and leukemic cells (Wilda et al., Oncogene 21,
5716-5724 (2002)).
5. Anti-Neoplastic or Anti-Fibrotic Agents
[0218] According to the present disclosure, an inhibitor of LOX or
LOXL can be combined with a chemotherapeutic agent to sensitize the
tumor cells (e.g., transition from the EMT state to the MET state)
to the chemotherapeutic agent, thus not only preventing or
inhibiting tumor invasion and metastasis but also inhibiting
primary tumor growth.
[0219] As used herein the term "chemotherapeutic agent" or
"chemotherapeutic" (or "chemotherapy", in the case of treatment
with a chemotherapeutic agent) is meant to encompass any
non-proteinaceous (i.e., non-peptidic) chemical compound useful in
the treatment of cancer. Examples of chemotherapeutic agents
include alkylating agents such as thiotepa and cyclophosphamide
(CYTOXAN.TM.); alkyl sulfonates such as busulfan, improsulfan and
piposulfan; aziridines such as benzodopa, carboquone, meturedopa,
and uredopa; ethylenimines and methylamelamines including
altretamine, triethylenemelamine, triethylenephosphoramide,
triethylenethiophosphoramide and trimethylolomelamine; acetogenins
(e.g., bullatacin and bullatacinone); a camptothecin (including
synthetic analogue topotecan); bryostatin; callystatin; CC-1065
(including its adozelesin, carzelesin and bizelesin synthetic
analogues); cryptophycins (articularly cryptophycin 1 and
cryptophycin 8); dolastatin; duocarmycin (including the synthetic
analogues, KW-2189 and CBI-TMI); eleutherobin; pancratistatin; a
sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan,
novembichin, phenesterine, prednimustine, trofosfamide, uracil
mustard; nitrosoureas such as carmustine, chlorozotocin,
foremustine, lomustine, nimustine, ranimustine; antibiotics such as
the enediyne antibiotics (e.g. calicheamicin, especially
calicheamicin gamma1I and calicheamicin phiI1, see, e.g., Agnew,
Chem. Intl. Ed. Engl., 33: 183-186 (1994); dynemicin, including
dynemicin A; bisphosphonates, such as clodronate; an esperamicin;
as well as neocarzinostatin chromophore and related chromoprotein
enediyne antibiotic chromomophores), aclacinomysins, actinomycin,
authramycin, azaserine, bleomycins, cactinomycin, carabicin,
caminomycin, carzinophilin, chromomycins, dactinomycin,
daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubincin
(Adramycin.TM.) (including morpholino-doxorubicin,
cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and
deoxydoxorubicin), epirubicin, esorubicin, idarubicin,
marcellomycin, mitomycins such as mitomycin C, mycophenolic acid,
nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin,
quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin,
ubenimex, zinostatin, zorubicin; anti-metabolites such as
methotrexate and 5-fluorouracil (5-FU); folic acid analogues such
as demopterin, methotrexate, pteropterin, trimetrexate; purine
analogs such as fludarabine, 6-mercaptopurine, thiamiprine,
thioguanine; pyrimidine analogues such as ancitabine, azacitidine,
6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine,
enocitabine, floxuridine; androgens such as calusterone,
dromostanolone propionate, epitiostanol, mepitiostane,
testolactone; anti-adrenals such as aminoglutethimide, mitotane,
trilostane; folic acid replinisher such as frolinic acid;
aceglatone; aldophosphamide glycoside; aminolevulinic acid;
eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate;
defofamine; demecolcine; diaziquone; elfornithine; elliptinium
acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea;
lentinan; lonidamine; maytansinoids such as maytansine and
ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine;
pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic
acid; 2-ethylhydrazide; procarbazine; PSK.TM.; razoxane; rhizoxin;
sizofiran; spirogermanium; tenuazonic acid; triaziquone;
2,2',2''-trichlorotriethylamine; trichothecenes (e.g., T-2 toxin,
verracurin A, roridin A and anguidine); urethane; vindesine;
dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman;
gacytosine; cytosine arabinoside ("Ara-C"); cyclophosphamide;
thiopeta; taxoids, e.g. paclitaxel (TAXOL.TM., Bristol Meyers
Squibb Oncology, Princeton, N.J.) and docetaxel (TAXOTERE.TM..,
Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine
(Gemzar.TM.); 6-thioguanine; mercaptopurine; methotrexate; platinum
analogs such as cisplatin and carboplatin; vinblastine; platinum;
etoposide (VP-16); ifosfamide; mitroxantrone; vancristine;
vinorelbine (Navelbine.TM.); novantrone; teniposide; edatrexate;
daunomycin; aminopterin; xeoloda; ibandronate; CPT-11;
topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO);
retinoids such as retinoic acid; capecitabine; and pharmaceutically
acceptable salts, acids or derivatives of any of the above. Also
included in the definition of "chemotherapeutic agent" are
anti-hormonal agents that act to regulate or inhibit hormone action
on tumors such as anti-estrogens and selective estrogen receptor
modulators (SERMs), including, for example, tamoxifen (including
Nolvadex.TM.), raloxifene, droloxifene, 4-hydroxytamoxifen,
trioxifene, keoxifene, LY117018, onapristone, and toremifene
(Fareston.TM.); inhibitors of the enzyme aromatase, which regulates
estrogen production in the adrenal glands, such as, for example,
4(5)-imidazoles, aminoglutethimide, megestrol acetate (Megace.TM.),
exemestane, formestane, fadrozole, vorozole (Rivisor.TM.),
letrozole (Femara.TM.), and anastrozole (Arimidex.TM.); and
anti-androgens such as flutamide, nilutamide, bicalutamide,
leuprolide, and goserelin; and pharmaceutically acceptable salts,
acids or derivatives of any of the above.
[0220] In some embodiments, the anti-neoplastic agent in
combination with the LOX/LOXL modulator is a tyrosine kinase
inhibitor. For example, ZD1839 (Iressa.TM. of AstraZeneca K.K.)
shows a competitive effect for ATP in ATP binding site of EGFR
(epidermal growth factor receptor) tyrosine kinase, and inhibits
tyrosine kinase activity by inhibiting autophosphorylation of
tyrosine kinase.
[0221] As a result, the anticancer effect is expressed by blocking
an EGFR-equipping signal transduction (ligands such as epidermal
growth factor (EGF) are bound to the extracellular domain of EGFR,
followed by activation of EGFR tyrosine kinase in the intracellular
domain, causing not only autophosphorylation of EGFR but also
phosphorylation of various intracellular target proteins, then
transducing the proliferation signals from the cancer cell surface
to nucleus, resulting in proliferation, infiltration, metastasis,
and angiogenesis of cancer cells.
[0222] IMC-C225 or cetuximab (Erbitux.TM.) which is an
EGFR-targeting monoclonal antibody) recognizes the receptor part of
EGFR on a cell membrane surface and inhibits the
autophosphorylation of EGFR thereby inhibiting the tyrosine kinase
activity. Herceptin, a monoclonal antibody against Her2/Neu which
is homologous to EGFR, and imatinib mesylate (GLEEVEC.TM., formerly
STI-571) can inhibit both tyrosine kinase activities of BCR-Abl and
c-kit (non-patent document No. 2). Sorafenib (Nexavar.TM.) is a
small molecular inhibitor of Raf kinase, PDGF (platelet-derived
growth factor), VEGF receptor 2 & 3 kinases and c-Kit.
[0223] As used herein, monoclonal antibodies against tumor antigens
are antibodies elicited against antigens expressed by tumors and
leukemic cells, for example, tumor-specific antigens. The
monoclonal antibody also includes fully human and humanized
antibody.
[0224] Other examples of therapeutic antibodies for cancer therapy
include Trastuzumab (HERCEPTIN.TM.; Overexpression of HER2 protein
is associated with more aggressive disease and poorer prognosis in
the clinic); Rituximab (RITUXAN.TM.) that is raised against CD20 on
lymphoma cells and selectively deplete normal and maligant
CD20.sup.+ pre-B and mature B cells; Alemtuzumab (CAMPATH.TM.), a
monoclonal antibody that specifically targets CD52 antigen that is
found on B and T lymphocytes and used for the treatment of chronic
lymphocytic leukemia (CLL) and lymphoma; and Gemtuzumab zogamicin
(MYLOTARG.TM.), an antibody conjugate that combines a specific
antibody against CD33 with a chemotherapeutic drug (zogamicin) and
is indicated for the treatment of relapsed adult acute myelocytic
leukemia.
[0225] In another embodiment, anti-angiogenic agent is combined
with a LOX/LOXL inhibitor to treat cancer and other diseases
associated with abnormal or undesirable angiogenesis. Examples of
anti-angiogenic agents include, but are not limited to, retinoid
acid and derivatives thereof, 2-methoxyestradiol, ANGIOSTATINT.TM.,
ENDOSTATIN.TM., suramin, squalamine, tissue inhibitor of
metalloproteinase-I, tissue inhibitor of metalloproteinase-2,
plasminogen activator inhibitor-1, plasminogen activator
inhibitor-2, cartilage-derived inhibitor, paclitaxel, platelet
factor 4, protamine sulphate (clupeine), sulphated chitin
derivatives (prepared from queen crab shells), sulphated
polysaccharide peptidoglycan complex (sp-pg), staurosporine,
modulators of matrix metabolism, including for example, proline
analogs ((1-azetidine-2-carboxylic acid (LACA), cishydroxyproline,
d,I-3,4-dehydroproline, thiaproline, .alpha.-dipyridyl,
.beta.-aminopropionitrile fumarate,
4-propyl-5-(4-pyridinyl)-2(3h)-oxazolone; methotrexate,
mitoxantrone, heparin, interferons, 2 macroglobulin-serum, chimp-3,
chymostatin, .beta.-cyclodextrin tetradecasulfate, eponemycin;
fumagillin, gold sodium thiomalate, d-penicillamine (CDPT),
beta.-1-anticollagenase-serum, alpha.2-antiplasmin, bisantrene,
lobenzarit disodium, n-2-carboxyphenyl-4-chloroanthronilic acid
disodium or "CCA", thalidomide; angiostatic steroid,
cargboxynaminolmidazole; metalloproteinase inhibitors such as BB94.
Other anti-angiogenesis agents include antibodies, for example,
monoclonal antibodies against these angiogenic growth factors:
bFGF, aFGF, FGF-5, VEGF isoforms, VEGF-C, HGF/SF and Ang-1/Ang-2.
Ferrara N. and Alitalo, K. "Clinical application of angiogenic
growth factors and their inhibitors" (1999) Nature Medicine
5:1359-1364. Other anti-angiogenesis agents may include inhibitors
of VEGF transcription.
[0226] Exemplary anti-fibrotic agents include, but are not limited
to the compounds such as .beta.-aminoproprionitrile (BAPN), as well
as the compounds disclosed in U.S. Pat. No. 4,965,288 to
Palfreyman, et al., issued Oct. 23, 1990, entitled "Inhibitors of
lysyl oxidase, relating to inhibitors of lysyl oxidase and their
use in the treatment of diseases and conditions associated with the
abnormal deposition of collagen; U.S. Pat. No. 4,997,854 to Kagan,
et al., issued Mar. 5, 1991, entitled "Anti-fibrotic agents and
methods for inhibiting the activity of lysyl oxidase in situ using
adjacently positioned diamine analogue substrate," relating to
compounds which inhibit LOX for the treatment of various
pathological fibrotic states, which are herein incorporated by
reference. Further exemplary inhibitors are described in U.S. Pat.
No. 4,943,593 to Palfreyman, et al., issued Jul. 24, 1990, entitled
"Inhibitors of lysyl oxidase," relating to compounds such as
2-isobutyl-3-fluoro-, chloro-, or bromo-allylamine; as well as,
e.g., U.S. Pat. No. 5,021,456; U.S. Pat. No. 5,5059,714; U.S. Pat.
No. 5,120,764; U.S. Pat. No. 5,182,297; U.S. Pat. No. 5,252,608
(relating to 2-(1-naphthyloxymethyl)-3-fluoroallylamine); and U.S.
Patent Application No. 2004/0248871, which are herein incorporated
by reference. Exemplary anti-fibrotic agents also include the
primary amines reacting with the carbonyl group of the active site
of the lysyl oxidases, including those which produce, after binding
with the carbonyl, a product stabilized by resonance, such as the
following primary amines: ethylenediamine, hydrazine,
phenylhydrazine, and their derivatives, semicarbazide, and urea
derivatives, aminonitriles, such as .beta.-aminopropionitrile
(BAPN), or 2-nitroethylamine, unsaturated or saturated haloamines,
such as 2-bromo-ethylamine, 2-chloroethylamine,
2-trifluoroethylamine, 3-bromopropylamine, p-halobenzylamines,
selenohomocysteine lactone. In another embodiment, the
anti-fibrotic agents are copper chelating agents, penetrating or
not penetrating the cells. Additional exemplary compounds include
indirect inhibitors such compounds blocking the aldehyde
derivatives originating from the oxidative deamination of the lysyl
and hydroxylysyl residues by the lysyl oxidases, such as the
thiolamines, for example, D-penicillamine, or its analogues such as
2-amino-5-mercapto-5-methylhexanoic acid,
D-2-amino-3-methyl-3-((2-acetamidoethyl)dithio)butanoic acid,
p-2-amino-3-methyl-3-((2-aminoethyl)dithio)butanoic acid,
sodium-4-((p-1-dimethyl-2-amino-2-carboxyethyl)dithio)butane
sulphinate, 2-acetamidoethyl-2-acetamidoethanethiol sulphanate,
sodium-4-mercaptobutanesulphinate trihydrate.
6. Formulations, Kits and Routes of Administration
[0227] Therapeutic compositions comprising compounds identified as
LOX/LOXL modulators using the disclosed methods are also
contemplated. In one embodiment, provided herein is a therapeutic
composition for prophylaxis and treatment of metastatic tumor
growth, the composition comprising a therapeutically effective
amount of a LOX/LOXL inhibitor in a pharmaceutically acceptable
carrier substance; wherein the inhibitor inhibits lysyl oxidase or
lysyl oxidase-like protein, such as LOXL-2, wherein the amount of
the inhibitor is effective in preventing and treating metastatic
tumor growth. In another embodiment, provided herein is a
therapeutic composition for prophylaxis and treatment of metastatic
tumor growth comprising a therapeutically effective amount of a
LOX/LOXL inhibitor in a pharmaceutically acceptable carrier in
combination with radiation, surgery, chemotherapy, or an anticancer
biologic which is not the LOX/LOXL inhibitor.
[0228] As used herein, the term "therapeutically effective amount"
or "effective amount" refers to an amount of a therapeutic agent
that when administered alone or in combination with another
therapeutic agent to a cell, tissue, or subject is effective to
prevent or ameliorate the disease condition or the progression of
the disease. A therapeutically effective dose further refers to
that amount of the compound sufficient to result in amelioration of
symptoms, e.g., treatment, healing, prevention or amelioration of
the relevant medical condition, or an increase in rate of
treatment, healing, prevention or amelioration of such conditions.
When applied to an individual active ingredient administered alone,
a therapeutically effective dose refers to that ingredient alone.
When applied to a combination, a therapeutically effective dose
refers to combined amounts of the active ingredients that result in
the therapeutic effect, whether administered in combination,
serially or simultaneously. For example, when in vivo
administration of a LOX/LOXL antibody is employed, normal dosage
amounts may vary from about 10 ng/kg to up to 100 mg/kg of mammal
body weight or more per day, for example, about 1 .mu.g/kg/day to
50 mg/kg/day, optionally about 100 .mu.g/kg/day to 20 mg/kg/day,
500 .mu.g/kg/day to 10 mg/kg/day, or 1 mg/kg/day to 10 mg/kg/day,
depending upon the route of administration.
[0229] Various pharmaceutical compositions and techniques for their
preparation and use will be known to those of skill in the art in
light of the present disclosure. For a detailed listing of suitable
pharmacological compositions and associated administrative
techniques one may refer to the detailed teachings herein, which
may be further supplemented by texts such as Remington: The Science
and Practice of Pharmacy 20th Ed. (Lippincott, Williams &
Wilkins 2003).
[0230] The compositions further include pharmaceutically acceptable
materials, composition or vehicle, such as a liquid or solid
filler, diluent, excipient, solvent or encapsulating material,
i.e., carriers. These carriers are involved in transporting the
subject chemical from one organ, or portion of the body, to another
organ, or portion of the body. Each carrier should be "acceptable"
in the sense of being compatible with the other ingredients of the
formulation and not injurious to the patient. Some examples of
materials which can serve as pharmaceutically-acceptable carriers
include: sugars, such as lactose, glucose and sucrose; starches,
such as corn starch and potato starch; cellulose, and its
derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose and cellulose acetate; powdered tragacanth; malt;
gelatin; talc; excipients, such as cocoa butter and suppository
waxes; oils, such as peanut oil, cottonseed oil, safflower oil,
sesame oil, olive oil, corn oil and soybean oil; glycols, such as
propylene glycol; polyols, such as glycerin, sorbitol, mannitol and
polyethylene glycol; esters, such as ethyl oleate and ethyl
laurate; agar; buffering agents, such as magnesium hydroxide and
aluminum hydroxide; alginic acid; pyrogen-free water; isotonic
saline; Ringer's solution; ethyl alcohol; phosphate buffer
solutions; and other non-toxic compatible substances employed in
pharmaceutical formulations. Wetting agents, emulsifiers and
lubricants, such as sodium lauryl sulfate and magnesium stearate,
as well as coloring agents, release agents, coating agents,
sweetening, flavoring and perfuming agents, preservatives and
antioxidants can also be present in the compositions.
[0231] Another aspect of the present disclosure relates to kits for
carrying out the combined administration of the LOX/LOXL modulator
with the other therapeutic agent. In one embodiment, the kit
comprises a LOX/LOXL inhibitor formulated in a pharmaceutical
carrier, and at least one therapeutic agent that is not the
LOX/LOXL inhibitor, formulated as appropriate, in one or more
separate pharmaceutical preparations.
[0232] The formulation and delivery methods will generally be
adapted according to the site and the disease to be treated.
Exemplary formulations include, but are not limited to, those
suitable for parenteral administration, e.g., intravenous,
intra-arterial, intramuscular, or subcutaneous administration,
including formulations encapsulated in micelles, liposomes or
drug-release capsules (active agents incorporated within a
biocompatible coating designed for slow-release); ingestible
formulations; formulations for topical use, such as creams,
ointments and gels; and other formulations such as inhalants,
aerosols and sprays. The dosage of the compounds of the disclosure
will vary according to the extent and severity of the need for
treatment, the activity of the administered composition, the
general health of the subject, and other considerations well known
to the skilled artisan.
[0233] Agents as described herein can be incorporated into
pharmaceutical compositions suitable for administration. Such
compositions typically comprise the agent and a pharmaceutically
acceptable carrier. Supplementary active compounds can also be
incorporated into the compositions.
[0234] In yet other embodiments, the agents described herein are
delivered locally. Localized delivery allows for the delivery of
the agent non-systemically, for example, to the site of fibrosis,
to reduce the entire body of the subject as compared to systemic
delivery. Such local delivery may be achieved through the use of
various medically implanted devices including, but not limited to,
stents and catheters. Methods for coating, implanting, embedding,
and otherwise attaching desired agents to medical devices such as
stents and catheters are established in the art and contemplated
herein.
[0235] Implanted stents have been used to carry medicinal agents,
such as thrombolytic agents. U.S. Pat. No. 5,163,952 discloses a
thermal memoried expanding plastic stent device formulated to carry
a medicinal agent in the material of the stent itself U.S. Pat. No.
5,092,877 discloses a stent of a polymeric material which may have
a coating associated with the delivery of compounds. Other patents
which are directed to devices of the class utilizing bio-degradable
and bio-sorbable polymers include U.S. Pat. No. 4,916,193, U.S.
Pat. No. 4,994,071. By way of example, U.S. Pat. No. 5,304,121,
discloses a coating applied to a stent consisting of a hydrogel
polymer and a preselected compounds such as cell growth inhibitors
or heparin. Methods of making a coated intravascular stent carrying
a therapeutic material are described in U.S. Pat. No. 5,464,650
wherein a polymer coating material is dissolved in a solvent and
the therapeutic material dispersed in the solvent. The solvent is
then evaporated after application.
[0236] U.S. Pat. No. 6,120,536 describes additional types of
coatings for use with a wide variety of prosthetic devices,
including stents. Examples of additional medical or prosthetic
devices that may be useful with the agents described herein
include, but are not limited to, blood exchanging devices, vascular
access ports, central venous catheters, cardiovascular catheters,
extracorpeal circuits, vascular grafts, pumps, heart valves, and
cardiovascular sutures. Regardless of detailed embodiments as
described herein, applicability of the disclosure should not be
considered limited with respect to implant design, implant location
or materials of construction. The use of devices coated with the
agents described herein, including stents and catheters, allows for
the agents to be delivered to specific or localized sites. Such
site-specific delivery can provide a means for use of dosages and
drugs such as beta-aminopropionitrile (BAPN) and related compounds
or other amine oxidase inhibitors (such as those small molecule
inhibitors of LOX/LOXL described above) that are not otherwise
amenable to systemic delivery due to solubility, systemic toxicity
concerns, or other issues. By way of example, BAPN is known to be
useful for LOX inhibition, but this compound is highly toxic,
presenting problems for its effective use when administered
systemically. The use of a stent, catheter, or other medical device
for delivery of an active agent or compound such as BAPN permits
use of the compound at effective dosages in a targeted or localized
manner, thus decreasing the systemic toxic effects associated with
such compounds and current routes of administration.
7. Composition Indications
[0237] The pharmaceutical formulations according to the present
disclosure may be used to treat a wide variety of diseases.
[0238] As used herein, "prevention" includes to prophylaxis,
prevention of onset of symptoms, prevention of progression of a
disease or disorder associated with fibrosis or correlated with
LOX/LOXL activity. As used herein, "inhibition," "treatment,"
"treating," and "ameliorating" are used interchangeably and refer
to, for example, stasis of symptoms, prolongation of survival,
partial or full amelioration of symptoms, and partial or full
eradication of a condition, disease or disorder associated with
fibrosis or correlated with LOX/LOXL activity.
[0239] Compositions may be administered to a patient (e.g., a
mammal such as a human or a non-human animal such as a primate,
rodent, cow, horse, pig, sheep, etc.) in therapeutically effective
amounts which are effective for producing a desired therapeutic
effect by inhibiting a disease or disorder such as those described
herein which are associated with fibrosis or LOX/LOXL activity, at
a reasonable benefit/risk ratio applicable to any medical
treatment. For human administration of the present compositions,
the compositions may be formulated using methodology known by one
of ordinary skill in the art. A therapeutically effective amount is
an amount that achieves at least partially a desired therapeutic or
prophylactic effect in an organ or tissue. In one example, the
amount of an inhibitor of LOX/LOXL necessary to bring about
prevention and/or therapeutic treatment of a disease or disorder is
not fixed per se. The amount of an inhibitor of LOX/LOXL
administered will vary with the type of disease or disorder,
extensiveness of the disease or disorder, and size of the mammal
suffering from the disease or disorder.
[0240] A response is achieved when the patient experiences partial
or total alleviation, or reduction of signs or symptoms of illness,
and specifically includes, without limitation, prolongation of
survival. The expected progression-free survival times may be
measured in months to years, depending on prognostic factors
including the number of relapses, stage of disease, and other
factors. Prolonging survival includes without limitation times of
at least 1 month, about at least 2 months, about at least 3 months,
about at least 4 months, about at least 6 months, about at least 1
year, about at least 2 years, about at least 3 years, or more.
Overall survival may also be measured in months to years. The
patient's symptoms may remain static or may decrease.
[0241] Nonlimiting indications that may be treated using the
pharmaceutical formulations of the present disclosure include those
involving undesirable or uncontrolled cell proliferation. Such
indications include benign tumors, various types of cancers such as
primary tumors and tumor metastasis, restenosis (e.g. coronary,
carotid, and cerebral lesions), hematological disorders, abnormal
stimulation of endothelial cells (atherosclerosis), insults to body
tissue due to surgery, abnormal wound healing, abnormal
angiogenesis, diseases that produce fibrosis of tissue, macular
degeneration, liver fibrosis, kidney fibrosis, lung fibrosis,
scleroderma, atherosclerosis, and Alzheimer's disease, repetitive
motion disorders, disorders of tissues that are not highly
vascularized, and proliferative responses associated with organ
transplants.
[0242] Generally, cells in a benign tumor retain their
differentiated features and do not divide in a completely
uncontrolled manner. A benign tumor is usually localized and
nonmetastatic. Specific types of benign tumors that can be treated
using the present disclosure include, but are not limited to,
hemangiomas, hepatocellular adenoma, cavernous haemangioma, focal
nodular hyperplasia, acoustic neuromas, neurofibroma, bile duct
adenoma, bile duct cystanoma, fibroma, lipomas, leiomyomas,
mesotheliomas, teratomas, myxomas, nodular regenerative
hyperplasia, trachomas and pyogenic granulomas.
[0243] In a malignant tumor cells become undifferentiated, do not
respond to the body's growth control signals, and multiply in an
uncontrolled manner. The malignant tumor is invasive and capable of
spreading to distant sites (metastasizing). Malignant tumors are
generally divided into two categories: primary and secondary.
Primary tumors arise directly from the tissue in which they are
found. A secondary tumor, or metastasis, is a tumor which
originated elsewhere in the body but has now spread to a distant
organ. The common routes for metastasis are direct growth into
adjacent structures, spread through the vascular or lymphatic
systems, and tracking along tissue planes and body spaces
(peritoneal fluid, cerebrospinal fluid, etc.)
[0244] Primary and metastatic tumors that may be treated by the
methods disclosed herein may include, but not be limited to, lung
cancer (including, but not limited to, lung adenocarcinoma,
squamous cell carcinoma, large cell carcinoma, bronchioloalveolar
carcinoma, non-small-cell carcinoma, small cell carcinoma,
mesothelioma); breast cancer (including, but not limited to, ductal
carcinoma, lobular carcinoma, inflammatory breast cancer, clear
cell carcinoma, mucinous carcinoma,); colorectal cancer (including,
but not limited to, colon cancer, rectal cancer); anal cancer;
pancreatic cancer (including, but not limited to, pancreatic
adenocarcinoma, islet cell carcinoma, neuroendocrine tumors);
prostate cancer; ovarian carcinoma (including, but not limited to,
ovarian epithelial carcinoma or surface epithelial-stromal tumour
including serous tumour, endometrioid tumor and mucinous
cystadenocarcinoma, sex-cord-stromal tumor); liver and bile duct
carcinoma (including, but not limited to, hepatocelluar carcinoma,
cholangiocarcinoma, hemangioma); esophageal carcinoma (including,
but not limited to, esophageal adenocarcinoma and squamous cell
carcinoma); non-Hodgkin's lymphoma; bladder carcinoma; carcinoma of
the uterus (including, but not limited to, endometrial
adenocarcinoma, uterine papillary serous carcinoma, uterine
clear-cell carcinoma, uterine sarcomas and leiomyosarcomas, mixed
mullerian tumors); glioma, glioblastoma, medullablastoma, and other
tumors of the brain; kidney cancers (including, but not limited to,
renal cell carcinoma, clear cell carcinoma, Wilm's tumor); cancer
of the head and neck (including, but not limited to, squamous cell
carcinomas); cancer of the stomach (including, but not limited to,
stomach adenocarcinoma, gastrointestinal stromal tumor); multiple
myeloma; testicular cancer; germ cell tumor; neuroendocrine tumor;
cervical cancer; carcinoids of the gastrointestinal tract, breast,
and other organs; and signet ring cell carcinoma.
[0245] Mesenchymal tumors may include, but not be limited to,
sarcomas, fibrosarcomas, haemangioma, angiomatosis,
haemangiopericytoma, pseudoangiomatous stromal hyperplasia,
myofibroblastoma, fibromatosis, inflammatory myofibroblastic
tumour, lipoma, angiolipoma, granular cell tumour, neurofibroma,
schwannoma, angiosarcoma, liposarcoma, rhabdomyosarcoma,
osteosarcoma, leiomyoma, and leiomysarcoma.
[0246] Specific types of cancers or malignant tumors, either
primary or secondary, that can be treated using this disclosure
also include, but are not limited to, skin cancer, bone cancer,
brain cancer, cancer of the larynx, gall bladder, pancreas,
parathyroid, thyroid, adrenal, neural tissue, head and neck,
bronchi, basal cell carcinoma, squamous cell carcinoma of both
ulcerating and papillary type, metastatic skin carcinoma, osteo
sarcoma, Ewing's sarcoma, veticulum cell sarcoma, myeloma, giant
cell tumor, small-cell lung tumor, gallstones, islet cell tumor,
primary brain tumor, acute and chronic lymphocytic and granulocytic
tumors, hairy-cell tumor, adenoma, hyperplasia, medullary
carcinoma, pheochromocytoma, mucosal neuronms, intestinal
ganglloneuromas, hyperplastic corneal nerve tumor, marfanoid
habitus tumor, seminoma, ovarian tumor, leiomyomater tumor,
cervical dysplasia and in situ carcinoma, neuroblastoma,
retinoblastoma, soft tissue sarcoma, malignant carcinoid, topical
skin lesion, mycosis fungoide, rhabdomyosarcoma, Kaposi's sarcoma,
osteogenic and other sarcoma, malignant hypercalcemia, renal cell
tumor, polycythermia vera, adenocarcinoma, glioblastoma multiforma,
leukemias, lymphomas, malignant melanomas, epidermoid carcinomas,
and other carcinomas and sarcomas.
[0247] Hematologic disorders include abnormal growth of blood cells
which can lead to dysplastic changes in blood cells and hematologic
malignancies such as various leukemias. Examples of hematologic
disorders include but are not limited to acute myeloid leukemia,
acute promyelocytic leukemia, acute lymphoblastic leukemia, chronic
myelogenous leukemia, the myelodysplastic syndromes, and sickle
cell anemia.
[0248] Acute myeloid leukemia (AML) is the most common type of
acute leukemia that occurs in adults. Several inherited genetic
disorders and immunodeficiency states are associated with an
increased risk of AML. These include disorders with defects in DNA
stability, leading to random chromosomal breakage, such as Bloom's
syndrome, Fanconi's anemia, Li-Fraumeni kindreds,
ataxia-telangiectasia, and X-linked agammaglobulinemia.
[0249] Acute promyelocytic leukemia (APML) represents a distinct
subgroup of AML. This subtype is characterized by promyelocytic
blasts containing the 15;17 chromosomal translocation. This
translocation leads to the generation of the fusion transcript
comprised of the retinoic acid receptor and a sequence PML.
[0250] Acute lymphoblastic leukemia (ALL) is a heterogenerous
disease with distinct clinical features displayed by various
subtypes. Reoccurring cytogenetic abnormalities have been
demonstrated in ALL. The most common cytogenetic abnormality is the
9;22 translocation. The resultant Philadelphia chromosome
represents poor prognosis of the patient.
[0251] Chronic myelogenous leukemia (CML) is a clonal
myeloproliferative disorder of a pluripotent stem cell. CML is
characterized by a specific chromosomal abnormality involving the
translocation of chromosomes 9 and 22, creating the Philadelphia
chromosome. Ionizing radiation is associated with the development
of CML.
[0252] The myelodysplastic syndromes (MDS) are heterogeneous clonal
hematopoietic stem cell disorders grouped together because of the
presence of dysplastic changes in one or more of the hematopoietic
lineages including dysplastic changes in the myeloid, erythroid,
and megakaryocytic series. These changes result in cytopenias in
one or more of the three lineages. Patients afflicted with MDS
typically develop complications related to anemia, neutropenia
(infections), or thrombocytopenia (bleeding). Generally, from about
10% to about 70% of patients with MDS develop acute leukemia.
[0253] Treatment of abnormal cell proliferation due to insults to
body tissue during surgery may be possible for a variety of
surgical procedures, including joint surgery, bowel surgery, and
keloid scarring. Diseases that produce fibrotic tissue include
emphysema. Repetitive motion disorders that may be treated using
the present disclosure include carpal tunnel syndrome. An example
of cell proliferative disorders that may be treated using the
disclosure is a bone tumor.
[0254] The proliferative responses associated with organ
transplantation that may be treated using this disclosure include
those proliferative responses contributing to potential organ
rejections or associated complications. Specifically, these
proliferative responses may occur during transplantation of the
heart, lung, liver, kidney, and other body organs or organ
systems.
[0255] The pharmaceutical formulations described herein may be used
for the prevention or treatment of a wide variety of diseases which
have collagen cross-linking or increased fibrosis as one part of
their etiology. For example, the indication for the composition can
also include fibrosis. Fibrosis is the abnormal accumulation of
fibrous tissue that can occur as a part of the wound-healing
process in damaged tissue. Such tissue damage may result from
physical injury, inflammation, infection, exposure to toxins, and
other causes. Examples of fibrosis include dermal scar formation,
keloids, liver fibrosis, lung fibrosis (e.g., silicosis,
asbestosis), kidney fibrosis (including diabetic nephropathy), and
glomerulosclerosis. Other exmples include, but are not limited to,
emphysema and chronic obstructive pulmonary disease (COPD);
multiple sclerosis; chronic asthma; atherosclerosis; rheumatoid
arthritis; glaucoma; and age-related macular degeneration (wet AMD
and dry AMD).
Cardiovascular Fibrosis
[0256] Compositions, methods, systems, medical devices and kits are
provided herein for the treatment or prevention of cardiovascular
or cardiac fibrosis, for example, associated with cardiovascular
diseases such as congestive heart failure, cardiomyopathy,
post-myocardial infarction defects in heart function, hypertensive
heart disease (HHD), myocardial infarction (MI), atherosclerosis,
restenosis (e.g. coronary, carotid, and cerebral lesions), and
heart disease associated with cardiac ischemic events.
[0257] Expression of specific lysyl oxidases may be associated with
different stages of the inflammatory response and wound healing
after myocardial infarction. By specifically inhibiting the
particular lysyl oxidase/s associated with the downstream fibrotic
response, the detrimental consequences of cardiac remodeling and
wound healing can be avoided, while allowing the immediate post-MI
repair/healing process to occur.
[0258] The post MI-healing response can induce expression of
LOX/LOXL but if this process continues unchecked, excessive
cross-linking leads to extracellular matrix remodeling or fibrosis
that results in cardiac dysfunction. The enzymes that break down
matrices and cross-linked collagen or elastin appear to function
more slowly or less efficiently and are outpaced by crosslinking
events. As LOX/LOXL also plays a role in epithelial-mesenchymal
transition (EMT), this contributes further to cardiomyocyte
remodeling and cardiomyocyte hypertrophy, in addition to matrix
remodeling.
[0259] Initial reparative fibrosis induced by the MI may be helpful
(e.g., prevents aneurysm and related damage) and may be allowed to
proceed unhindered. However, while not wishing to be bound to a
particular theory or mechanism of action, the inventors believe
that anti-LOX/LOXL treatment initiated following this reparative
fibrosis phase could attenuate reactive (mal-adaptive) fibrosis
that leads to cardiac dysfunction. For example, anti-LOX/LOXL
treatment may be initiated 2, 4, 6, 8, 10, 12, 14, 16, 16, 20, 22,
24, 36, 48 or more hours after MI, inclusive of all integers and
times in between. Additionally, anti-LOX/LOXL treatment may be
initiated 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days
after MI. Similarly, increases in blood pressure (hypertension)
result in increased collagen deposition and reduced protein
degradation in cardiac tissue. (Berk et al., J. Clin. Invest.,
117(3): 568-575 (2007)). Anti-LOX/LOXL treatment initiated
following diagnosis and/or establishment of hypertensive heart
disease or hypertension can prevent, reduce, or ameliorate fibrosis
associated with hypertension. Such anti-LOX/LOXL treatment is
initiated 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days
after increases in hypertension or systemic blood pressure are
diagnosed or detected.
[0260] In some embodiments, biomarkers may be used to determine
when an inappropriate level of cross-linking might be occurring:
LOX levels have been shown to correlate with C reactive protein
(CRP), a commonly used biomarker, and treatment may begin when CRP
levels are elevated above appropriate normal levels. More directly,
methods and test kits exist to measure the release of cross-linked
collagen telopeptides in urine or blood. Elevated levels of these
collagen fragments may indicate a transition from reparative
fibrosis to reactive (mal-adaptive) fibrosis. In addition, measures
of cardiac function and output, including those associated with
efficient contraction of the ventricle, may be made.
[0261] In some embodiments, a limited duration of treatment is
envisioned. Treatment should typically be sustained only long
enough to prevent or attenuate reactive fibrosis to prevent or
reduce cardiac dysfunction. For example, short-lived Fab antibody
fragments are used when shorter durations of treatment are desired.
Alternatively, full-length antibodies that have a longer half-life
in serum may be used, with limited dosing over 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, or more weeks, inclusive of all days in between.
Standard tests of cardiac function may be used to monitor progress
and adjust dosing as necessary, along with assessment of relevant
biomarkers discussed above. Limited duration of treatment adds to
the safety of this approach.
[0262] The indications for the administration of the compositions
described herein also include fibroses found outside of
cardiovascular indications. Fibrosis is the abnormal accumulation
of fibrous tissue that can occur as a part of the wound-healing
process in damaged tissue. Such tissue damage may result from
physical injury, inflammation, infection, exposure to toxins, as
well as other causes. Examples of fibrosis include dermal scar
formation, keloids, liver fibrosis, lung fibrosis (e.g., silicosis,
asbestosis), and kidney fibrosis (including diabetic nephropathy
and glomerulosclerosis). Additionally, fibrosis and deposition of
collagen have been implicated in the formation of .beta.-amyloid
plaques, thus contributing to the development and progression of
Alzheimer's disease. The compositions described herein are also
contemplated for the treatment, prevention, and/or amelioration of
the following fibrotic conditions.
Dermal Scar and Keloid Formation
[0263] Dermal scar and keloid formation are known to involve
excessive collagen deposition and/or dysregulation of collagen
deposition. This deviation from normal fibroblast remodeling of
injured dermal tissue can result in thick and unsightly
scarring.
[0264] Keloids are known to be, in part, the result of dysregulated
wound healing and subsequent elevated collagen deposition. Keloids,
unlike the scars seen in normal wound healing, do not fade or
regress over time. Though keloids are typically benign dermal
tumors, they are unsightly and can accumulate into more problematic
skin deformations and/or lesions. (Appleton, I., et al., Apoptosis,
Necrosis, and Proliferation: Possible
[0265] Implications in the Etiology of Keloids, Am. J. Pathol.,
149(5): 1441-1447 (1996)). The accumulation of collagen in the skin
is also implicated in scleroderma, a generalized term for numerous
conditions of thickening or hardening of dermal tissue, where the
common element is the overproduction or dysregulation of collagen
in the dermal tissues by fibroblasts. (Akagi, A. et al., Expression
of Type XVI Collagen in Human Skin Fibroblasts: Enhanced Expression
in Fibrotic Skin Disease, J. Invest. Dermatol., 113: 246-250
(1999)). Given the central role of collagen deposition in fibrotic
skin diseases such as scleroderma and keloid formation, the
compositions described herein are useful in the prevention,
treatment, and/or amelioration of fibrotic skin diseases, including
but not limited to, scleroderma and keloid formation.
Liver Fibrosis
[0266] Fibrosis of the liver is implicated in the pathology of
numerous hepatic diseases. As previously noted, fibrosis occurs as
a complication of haemochromatosis, Wilson's disease, alcoholism,
schistosomiasis, viral hepatitis, bile duct obstruction, exposure
to toxins, and metabolic disorders. Left unchecked, hepatic
fibrosis progresses to cirrhosis (defined by the presence of
encapsulated nodules), liver failure, and death.
[0267] Liver fibrosis, including, but not limited to, cirrhosis,
and associated conditions such as chronic viral hepatitis,
non-alcoholic fatty liver disease (NAFLD), alcoholic
steatohepatitis (ASH), non-alcoholic steatohepatitis (NASH),
primary biliary cirrhosis (PBC), biliary cirrhosis, and autoimmune
hepatitis, may be treated by the compositions and methods disclosed
herein.
[0268] The chronic insults to the liver from such sources as
parasites and viral infection (e.g. HBV, HCV, HIV, schistosomiasis)
or the long term stress from alcohol consumption typically result
in remodeling of the liver, presumably to encapsulate the damaged
area and protect the remaining liver tissue from damage. (Li and
Friedman, Gastroenterol. Hepatol. 14:618-633, 1999). Liver fibrosis
results in extracellular matrix changes, including 3-10 fold
increases in total collagen content and replacement of the low
density basement membrane with high-density matrix, which impair
the metabolic and synthesis function of hepatocytes, hepatic
stellate cells and endothelial cells. (Girogescu, M., Non-invasive
Biochemical Markers of Liver Fibrosis, J. Gastrointestin. Liver
Dis., 15(2): 149-159 (2006)). The compositions described herein are
thus useful for the prevention, treatment, and/or amelioration of
fibrotic liver diseases, and such use is contemplated herein.
Kidney Fibrosis
[0269] Like liver fibrosis, kidney fibrosis can result from various
diseases and insults to the kidneys. Examples of such diseases and
insults include chronic kidney disease, metabolic syndrome,
vesicoureteral reflux, tubulointerstitial renal fibrosis, diabetes
(including diabetic nephropathy), and resultant glomerular
nephritis (GN), including, but not limited to, focal segmental
glomerulosclerosis and membranous glomerulonephritis,
mesangiocapillary GN.
[0270] It has become recognized that metabolic syndrome is a
cluster of abnormalities including diabetic hallmarks such as
insulin resistance, as well as central or visceral obesity and
hypertension. In nearly all cases, dysregulation of glucose results
in the stimulation of cytokine release and upregulation of
extracellular matrix deposition. Additional factors contributing to
chronic kidney disease, diabetes, metabolic syndrome, and
glomerular nephritis include hyperlipidemia, hypertension, and
proteinuria, all of which result in further damage to the kidneys
and further stimulate the extracellular matrix deposition. Thus,
regardless of the primary cause, insults to the kidneys may result
in kidney fibrosis and the concomitant loss of kidney function.
(Schena, F. and Gesualdo, L., Pathogenic Mechanisms of Diabetic
Nephropathy, J. Am. Soc. Nephrol., 16: S30-33 (2005);
Whaley-Connell, A., and Sower, J R., Chronic Kidney Disease and the
Cardiometabolic Syndrome, J. Clin. Hypert., 8(8): 546-48 (2006)).
The compositions described herein are thus useful for the
prevention, treatment, and/or amelioration of fibrotic kidney
diseases (chronic kidney disease, diabetic nephropathy, glomerular
nephritis, metabolic syndrome), and such use is contemplated
herein.
Lung Fibrosis
[0271] Fibrosis of the lung includes many syndromes and diseases.
Exemplary diseases include idiopathic pulmonary fibrosis (IPF),
idiopathic interstitial pneumonia, and acute respiratory distress
syndrome (ARDS). Lung fibrosis may also include, but not be lmited
to, cryptogenic fibrosing alveolitis, chronic fibrosing
interstitial pneumonia, interstitial lung disease (ILD), and
diffuse parenchymal lung disease (DPLD). The pathogenesis of most
lung fibroses, including the aforementioned diseases are not well
understood, however all are characterized by an influx of
inflammatory cells and a subsequent increase in the synthesis and
deposition of collagen-rich extracellular matrix. (Chua et al., Am
J. Respir. Cell. Mol. Biol., 33:9-13 (2005); Tzortzaki et al., J.
Histochem. & Cytochem., 54(6): 693-700 (2006); Armstrong et
al., Am. J. Respir. Crit. Care Med., 160: 1910-1915 (1999)). Given
the identified role of increased collagen and extracellular matrix
deposition in lung fibroses, the compositions described herein are
useful for the prevention, treatment, and/or amelioration of lung
fibroses by the inhibition of LOX/LOXL.
Alzheimer's Disease
[0272] Alzheimer's disease is a progressive neurodegenerative
disorder characterized by neuronal loss due to accumulation of
amyloid-beta plaques, and lysyl oxidase activity is also known to
be increased in Alzheimer's disease. (Gilad et al., Neurosci.
Lett., 376(3): 210-13 (2005)). Amyloid-beta contains multiple
lysine residues which represent targets for LOX/LOXL activity, thus
inhibition of LOX/LOXL can treat, prevent, or ameliorate the
accumulation of amyloid plaques in Alzheimer's disease.
Amyloid-beta plaques are also known to consist of additional
proteins. One such protein contributing to the formation and
content of amyloid-beta plaques is a collagen protein termed
CLAC-P. CLAC-P is similar to collagen Type XIII in structure but is
distributed in neurons. CLAC-P binds with amyloid-beta and
contributes to the formation of amyloid-beta plaques. (Soederberg
et al., J. Biol. Chem., 280(2): 1007-1015 (2005)). The compositions
described herein are thus useful for the prevention, treatment,
and/or amelioration of Alzheimer's disease, including, but not
limited to, the prevention of amyloid-beta plaque formation as well
as the reduction in the persistence of amyloid-beta plaques.
[0273] Abnormal angiogenesis that may be treated or prevented by
using the methods and compositions described herein include
abnormal angiogenesis accompanying rheumatoid arthritis,
ischemic-reperfusion related brain edema and injury, cortical
ischemia, ovarian hyperplasia and hypervascularity, (polycystic
ovary syndrome), endometriosis, psoriasis, diabetic retinopaphy,
and other ocular angiogenic diseases such as retinopathy of
prematurity (retrolental fibroplastic), macular degeneration,
corneal graft rejection, neuroscular glaucoma and Oster Webber
syndrome.
[0274] Diseases associated with abnormal angiogenesis require or
induce vascular growth. For example, corneal angiogenesis involves
three phases: a pre-vascular latent period, active
neovascularization, and vascular maturation and regression. The
identity and mechanism of various angiogenic factors, including
elements of the inflammatory response, such as leukocytes,
platelets, cytokines, and eicosanoids, or unidentified plasma
constituents have yet to be revealed.
[0275] In another embodiment, the pharmaceutical formulations of
the present disclosure may be used for treating diseases associated
with undesired or abnormal angiogenesis. The method comprises
administering to a patient suffering from undesired or abnormal
angiogenesis a LOX/LOXL inhibitor in combination with
anti-neoplastic agent or anti-angiogenic agent that is not the
LOX/LOXL inhibitor. The particular dosage of these agents required
to inhibit angiogenesis and/or angiogenic diseases may depend on
the severity of the condition, the route of administration, and
related factors that can be decided by the attending physician.
Generally, accepted and effective daily doses are the amount
sufficient to effectively inhibit angiogenesis and/or angiogenic
diseases.
[0276] According to this embodiment, the pharmaceutical
formulations of the present disclosure may be used to treat a
variety of diseases associated with undesirable angiogenesis such
as retinal/choroidal neuvascularization and corneal
neovascularization. Examples of retinal/choroidal
neuvascularization include, but are not limited to, Bests diseases,
myopia, optic pits, Stargarts diseases, Pagets disease, vein
occlusion, artery occlusion, sickle cell anemia, sarcoid, syphilis,
pseudoxanthoma elasticum carotid abostructive diseases, chronic
uveitis/vitritis, mycobacterial infections, Lyme's disease,
systemic lupus erythematosis, retinopathy of prematurity, Eales
disease, diabetic retinopathy, macular degeneration, Bechets
diseases, infections causing a retinitis or chroiditis, presumed
ocular histoplasmosis, pars planitis, chronic retinal detachment,
hyperviscosity syndromes, toxoplasmosis, trauma and post-laser
complications, diseases associated with rubesis (neovascularization
of the angle) and diseases caused by the abnormal proliferation of
fibrovascular or fibrous tissue including all forms of
proliferative vitreoretinopathy. Examples of corneal
neuvascularization include, but are not limited to, epidemic
keratoconjunctivitis, Vitamin A deficiency, contact lens overwear,
atopic keratitis, superior limbic keratitis, pterygium keratitis
sicca, sjogrens, acne rosacea, phylectenulosis, diabetic
retinopathy, retinopathy of prematurity, corneal graft rejection,
Mooren ulcer, Terrien's marginal degeneration, marginal
keratolysis, polyarteritis, Wegener sarcoidosis, Scleritis,
periphigoid radial keratotomy, neovascular glaucoma and retrolental
fibroplasia, syphilis, Mycobacteria infections, lipid degeneration,
chemical burns, bacterial ulcers, fungal ulcers, Herpes simplex
infections, Herpes zoster infections, protozoan infections and
Kaposi sarcoma.
[0277] In yet another embodiment, the pharmaceutical formulations
of the present disclosure may be used for treating chronic
inflammatory diseases associated with abnormal angiogenesis. The
method comprises administering to a patient suffering from a
chronic inflammatory disease associated with abnormal angiogenesis
a LOX/LOXL inhibitor in combination with anti-neoplastic agent or
anti-angiogenic agent that is not the LOX/LOXL inhibitor. The
chronic inflammation depends on continuous formation of capillary
sprouts to maintain an influx of inflammatory cells. The influx and
presence of the inflammatory cells produce granulomas and thus,
maintains the chronic inflammatory state. Inhibition of
angiogenesis using the pharmaceutical formulations of the present
disclosure may prevent the formation of the granulosmas, thereby
alleviating the disease. Examples of chronic inflammatory disease
include, but are not limited to, inflammatory bowel diseases such
as Crohn's disease and ulcerative colitis, psoriasis, sarcoidois,
and rheumatoid arthritis.
[0278] Inflammatory bowel diseases such as Crohn's disease and
ulcerative colitis are characterized by chronic inflammation and
angiogenesis at various sites in the gastrointestinal tract. For
example, Crohn's disease occurs as a chronic transmural
inflammatory disease that most commonly affects the distal ileum
and colon but may also occur in any part of the gastrointestinal
tract from the mouth to the anus and perianal area. Patients with
Crohn's disease generally have chronic diarrhea associated with
abdominal pain, fever, anorexia, weight loss and abdominal
swelling. Ulcerative colitis is also a chronic, nonspecific,
inflammatory and ulcerative disease arising in the colonic mucosa
and is characterized by the presence of bloody diarrhea. These
inflammatory bowel diseases are generally caused by chronic
granulomatous inflammation throughout the gastrointestinal tract,
involving new capillary sprouts surrounded by a cylinder of
inflammatory cells Inhibition of angiogenesis by the pharmaceutical
formulations of the present disclosure should inhibit the formation
of the sprouts and prevent the formation of granulomas. The
inflammatory bowel diseases also exhibit extra intestinal
manifestations, such as skin lesions. Such lesions are
characterized by inflammation and angiogenesis and can occur at
many sites other the gastrointestinal tract. Inhibition of
angiogenesis by the pharmaceutical formulations of the present
disclosure should reduce the influx of inflammatory cells and
prevent the lesion formation.
[0279] Sarcoidois, another chronic inflammatory disease, is
characterized as a multi-system granulomatous disorder. The
granulomas of this disease can form anywhere in the body and, thus,
the symptoms depend on the site of the granulomas and whether the
disease is active. The granulomas are created by the angiogenic
capillary sprouts providing a constant supply of inflammatory
cells. By using the pharmaceutical formulations of the present
disclosure to inhibit angionesis, such granulomas formation can be
inhibited. Psoriasis, also a chronic and recurrent inflammatory
disease, is characterized by papules and plaques of various sizes.
Treatment using the pharmaceutical formulations of the present
disclosure should prevent the formation of new blood vessels
necessary to maintain the characteristic lesions and provide the
patient relief from the symptoms.
[0280] Rheumatoid arthritis (RA) is also a chronic inflammatory
disease characterized by non-specific inflammation of the
peripheral joints. It is believed that the blood vessels in the
synovial lining of the joints undergo angiogenesis. In addition to
forming new vascular networks, the endothelial cells release
factors and reactive oxygen species that lead to pannus growth and
cartilage destruction. The factors involved in angiogenesis may
actively contribute to, and help maintain, the chronically inflamed
state of rheumatoid arthritis. Treatment using the pharmaceutical
formulations of the present disclosure alone or in conjunction with
other anti-RA agents may prevent the formation of new blood vessels
necessary to maintain the chronic inflammation and provide the RA
patient relief from the symptoms.
8. Diagnosis of Diseases
[0281] The present disclosure also provides methods for diagnosing,
monitoring, staging or detecting the diseases described above by
using agents that recognize different forms of LOX or LOXL. For
example, as described above, antibodies against different forms of
LOX or LOXL, the preproprotein, secreted, mature form, can be used
for these purposes.
[0282] As described above, mature LOX or LOXL is cleaved and can be
detected by virtue of it changes in molecular weight (immunoblot)
or by use of antibodies that detect the uncleaved vs. cleaved form
of LOX/LOXL, along with cellular localization by using various
detection methods such as immunohistochemistry (IHC).
[0283] It is believed that the extracellular matrix and conditioned
medium (e.g., See Example 4) should contain proteolytically
processed LOX or LOXL whereas uncleaved LOX/LOXL should be
localized intracellularly. Some cleaved LOX/LOXL may also be
detected inside the cell as a consequence of uptake from the
extracellular space.
[0284] Samples from individuals can be collected and analyzed by
determining inactive or active LOX levels or different forms of
LOX/LOXL levels. This analysis may be performed prior to the
initiation of treatment using lysyl oxidase-specific therapy to
identify tumors having elevated active LOX/LOXL expression or
activity. Such diagnosis analysis can be performed using any
sample, including but not limited to cells, protein or membrane
extracts of cells, biological fluids such as sputum, blood, serum,
plasma, or urine, or biological samples such as tissue samples,
formalin-fixed or frozen tissue sections.
[0285] Any suitable method for detection and analysis of inactive
and/or active LOX/LOXL can be employed. As used herein, the term
"sample" refers to a sample from a human, animal, or to a research
sample, e.g., a cell, tissue, organ, fluid, gas, aerosol, slurry,
colloid, or coagulated material. The sample may be tested in vivo,
e.g., without removal from the human or animal, or it may be tested
in vitro. The sample may be tested after processing, e.g., by
histological methods. The term "sample" may also refer to a cell,
tissue, organ, or fluid that is freshly taken from a human or
animal, or to a cell, tissue, organ, or fluid that is processed or
stored.
[0286] In one embodiment, methods are provided for diagnosing
cancer metastasis in a subject, comprising assessing active LOX or
LOXL levels or activity in the blood, whereby a change in active
LOX or LOXL levels or activity in the blood in comparison with a
reference sample, indicates the presence of metastatic tumor
growth. In some instances, the active LOX or LOXL levels or
activities in the blood may be lower than those when measured
earlier, which may indicate that the subject is at a greater risk
of cancer metastasis; that the cancer has metastasized; or that
cancer metastasis has increased.
[0287] In another embodiment, methods are provided for diagnosing
cancer metastasis in a subject having a tumor, comprising assessing
active LOX or LOXL levels or activity in the tumor, whereby a
change in active LOX or LOXL levels or activity in the tumor in
comparison with a reference sample indicates the presence of
metastatic tumor growth. In some instances, the active LOX or LOXL
levels or activities in the tumor may be higher than those when
measured earlier, which may indicate that the subject is at a
greater risk of cancer metastasis; that the cancer has
metastasized; or that cancer metastasis has increased.
[0288] The reference sample may derive from the same subject, taken
from the same tumor at a different time point or from other site of
the body, or from another individual.
[0289] Measurement of active LOX or LOXL levels may take the form
of an immunological assay, which detects the presence of active LOX
or LOXL protein with an antibody to the protein, for example, an
antibody specifically binding to active or secreted LOX or
LOXL.
[0290] Immunoassays also can be used in conjunction with laser
induced fluorescence (see, for example, Schmalzing and Nashabeh,
Electrophoresis 18:2184-93 (1997)); Bao, J. Chromatogr. B. Biomed.
Sci. 699:463-80 (1997), each of which is incorporated herein by
reference). Liposome immunoassays, such as flow-injection liposome
immunoassays and liposome immunosensors (Rongen et al., J. Immunol.
Methods 204:105-133 (1997), also can be used to determine active
LOX or LOXL levels according to a method of the disclosure).
Immunoassays, such as enzyme-linked immunosorbent assays (ELISAs),
are useful in the methods provided herein. A radioimmunoassay also
can be useful for determining whether a sample is positive for
active LOX or LOXL or for determining the level of active LOX or
LOXL. A radioimmunoassay using, for example, an iodine-125 labeled
secondary antibody, may be used.
[0291] In addition, one may measure the activity of active LOX or
LOXL, thus ignoring the amount of inactive enzyme. Enzymatic
activity of active LOX or LOXL may be measured in a number of ways,
using a soluble elastin or soluble collagen with labeled lysine as
a substrate. Details of an activity assay are given in Royce et
al., "Copper metabolism in mottled mouse mutants. The effect of
copper therapy on lysyl oxidase activity in brindled (Mohr) mice,"
Biochem J. 1982 February 15; 202(2): 369-371. Chromogenic assays
may be used. One is described in Palamakumbura, et al. "A
fluorometric assay for detection of lysyl oxidase enzyme activity
in biological samples," Anal Biochem. 2002 Jan. 15;
300(2):245-51.
[0292] Also provided here is a method for monitoring a subject's
response to a therapy including a modulator of LOX/LOXL such as the
treatment of cancer, tumors, and fibrotic diseases. The method
comprises: detecting a change in the level C-reactive protein, or
other acute-phase reactants, in the subject after administration of
a modulator of LOX or LOXL to the subject, wherein the change
indicates that the LOX or LOXL modulator has a therapeutic effect
on the subject. A C-reactive protein is an important
pharmacodynamic marker for systemic inflammation. Furthermore,
C-reactive protein is thought to enhance LOX expression (Li et al.,
Circulation Research; (2004) 95:877). Thus, without being bound by
theory, a reduced level of C-reactive protein (e.g., in the blood
sample of the subject) as compared to that prior to the
administration of the LOX or LOXL inhibitor can be indicative of
the subject's response to the therapy using an inhibitor of LOX or
LOXL. Methods includes including monitoring an increase or decrease
in levels of C-reactive protein, which would be indicative of the
subject's response to the therapy.
[0293] In another embodiment, methods are provided for monitoring a
subject's response to a therapy including a modulator of LOX/LOXL
such as the treatment of cancer, tumors, and fibrotic diseases. The
method comprises: detecting a change in the level of collagen
telopeptides or hydroxyproline content in the subject after
administration of a modulator of LOX or LOXL to the subject,
wherein the change indicates that the LOX or LOXL modulator has a
therapeutic effect on the subject. The change can be an increase or
decrease. For example, a decrease in collagen telopeptides or
hydroxyproline content can be indicative of a therapeutic
effect.
[0294] Although exemplary embodiments of the present disclosure
have been described and depicted, it will be apparent to the
artisan of ordinary skill that a number of changes, modifications,
or alterations to the disclosure as described herein may be made,
none of which depart from the spirit of the present disclosure. All
such changes, modifications, and alterations should therefore be
seen as within the scope of the present disclosure. The following
examples are offered to illustrate but not to limit the
disclosure.
EXAMPLES
Example 1
EMT/MET Assay
[0295] To detect whether a cell is in an EMT or MET state, cells
are stained with antibodies specific to cellular protein markers
for epithelial or mesenchymal states such as E-cadherin, vimentin,
fibronectin, and phalloidin to detect F-actin (FIG. 4).
Rhodamine Phalloidin Staining Protocol:
[0296] Cells were seeded 24 hours prior to day of staining; cells
should be approximately 80% confluent 24 hours later in an
8-chambered slide. The next day, the media was aspirated and the
chambers were rinsed with 1.times.PBS. Cells were then fixed with
4% Parafomaldehyde (PFA) for 20 minutes at room temperature and
then rinsed once with 1.times.PBS. For permeabilization, the cells
were treated with 0.5% Saponin (JT Baker, Phillipsburg, N.J.) in
PBS for 5 minutes at room temperature. The chambers were carefully
rinsed once with 1.times.PBS and a 1:100 dilution of rhodamine
phalloidin (Invitrogen, Carlsbad, Calif.) in PBS was added to the
cells and incubated for 15 minutes at room temperature. The
chambers were rinsed two times with 1.times.PBS and the slides were
mounted with Vectashield (Vector Laboratories, Burlingame,
Calif.).
E-Cadherin Staining Protocol:
[0297] Cells were seeded 24 hours prior to day of staining; cells
should be approximately 80% confluent the next day in an
8-chambered slide. The next day, the media was aspirated and the
chambers were rinsed with 1.times.PBS. Cells were then fixed with
ice cold methanol and then incubated for 2 minutes in -20.degree.
C. The cells were rinsed once with 1.times.PBX and 1 .mu.g/ml of
E-cadherin Ab (Calbiochem, Gibbstown, N.J.) was added to the slide
chambers. The slides were then incubated at 37.degree. C. for 1
hour. After carefully rinsing the chambers one time with
1.times.PBS, the secondary Ab (anti-mouse IgG cy3 conjugated,
Jackson Immuno Research, West Grove, Pa.) was added and incubated
at room temperature for 30-45 minutes. The chambers were rinsed two
times with 1.times.PBS and mounted with Vectashield (Vector
Laboratories, Burlingame, Calif.).
Example 2
Assay for LOX/LOXL Inhibitors that Reduce EMT/Promote MET in Cells
Endogenously Expressing Significant Levels of LOX/LOXL
[0298] BT-549, Hs5788t, MDA-MB-231, or NC1--H226 cells express
significant levels of LOX/LOXL and are in an EMT or EMT-like state.
The cells are seeded onto 8-well chamber glass slides (Nalgene Nunc
International. Rochester, N.Y.) at .about.25-50% confluence. The
cells are incubated for 18 h under hypoxic (2% oxygen), anoxic
(0.02% oxygen), or normoxic (21% oxygen) conditions.
[0299] LOX/LOXL inhibitors (e.g. anti-LOX/LOXL antibody, LOX/LOXL
siRNA, LOX/LOXL shRNA, small molecule inhibitors, such as .beta.APN
or D-penacillamine) and controls (e.g. LOX/LOXL sense
oligonucleotides, irrelevant control antibody, small molecule
vehicle such as DMSO) are added to the cell culture media. LOX/LOXL
levels are determined by RT-PCR and immunoblot analysis.
[0300] After 48-72 hours, cells are stained according to Example 1.
Cells transfected with LOX/LOXL sense oligonucleotides should
maintain EMT characteristics of positive vimentin or fibronectin
staining with low levels of E-cadherin staining and an elongated
and remodeled actin cytoskeleton as revealed by phalloidin staining
of F-actin. Cells treated with candidate LOX/LOXL inhibitors that
do not effectively target LOX/LOXL to effect MET induction of the
EMT cells should also maintain these EMT characteristics.
[0301] Cells treated with LOX/LOXL inhibitors should reduce EMT
characteristics and manifest MET characteristics of increased
E-cadherin staining and reduced or negligible vimentin or
fibronectin staining. The rhodamine-phalloidin staining of these
cells should reveal a more compact and regular actin
cytoskeleton.
[0302] Invasion/migration assays are also used to assess EMT and
MET phenotypes of the cells, as increased invasiveness and
migratory capacity are associated with EMT. (See e.g. Bedogni et
al., Cancer Res. 64:2552-2560 (2004)) Cells are serum deprived for
24 h then 10.sup.4-10.sup.6 cells are seeded in triplicate on
coated and uncoated inserts (for example, Matrigel.TM. coated
inserts from BD Biosciences), and incubated under normoxic or
oxygen-deprived conditions for 24 h (for example, LOX/LOXL
expression can differ under normoxic/hypoxic conditions as shown in
FIG. 33). Treatments with LOX/LOXL inhibitors and controls are
continued throughout the experiment.
[0303] The cells maintaining an EMT state should be invasive and
migratory, and able to invade through the Matrigel.TM.-coated
inserts, or migrate across other surface-modified inserts, more
readily in comparison to MET cells. A similar analysis is conducted
using a wound-healing or scratch assay, in which a scratch is made
using a pipet tip in a confluent lawn of cells. The scratch is
monitored over 24-96 h using a microscope. Cells in a state of EMT
that are more invasive and migratory should fill the scratch more
rapidly than less invasive or migratory cells.
[0304] Those LOX/LOXL inhibitors that reduce EMT and promotes MET
are selected as candidates for further development.
[0305] As depicted in FIGS. 26A and B a screen for mAbs that
inhibit cell invasion and migration that was performed. Final Pep2
supernatants screened were purified and concentrated (MO63 to MO82,
50 ng and 200 ng for each). MDA MB 231 cells were serum deprived
for 24 hours and were seeded at 20,000 cells/well in serum free
media. Cells were treated with triplicate sets of 50 ng and 200 ng
of antibody sera and were incubated for 48 hours. Invasive cells
were dyed with calcein AM and the fluorescence was measured on a 96
well fluorescent reader (485 nm excitation, 520 emission).
Example 3
Assay for LOX/LOXL Inhibitors that Reduce EMT/Promote MET with
Cells Transfected with LOX/LOXL
[0306] MDCK, MCF-7, or SW620 cells do not express significant
levels of LOX/LOXL and are not in an EMT state. The cells are
transfected with plasmids that express LOX/LOXL to induce EMT in
the cells (see for example FIG. 6). The transfected cells are
incubated for 18 h under normoxic (21% oxygen), hypoxic (2% oxygen)
or anoxic (0.02% oxygen) conditions. Expression of LOX/LOXL levels
are determined by RT-PCR and immunoblot analysis.
[0307] The transfected cells are treated with LOX/LOXL inhibitors
and controls, MET/EMT status determined as described in Example 2.
Expression of LOX/LOXL levels of treated cells are determined by
RT-PCR and immunoblot analysis.
[0308] Effective LOX/LOXL inhibitors should prevent the EMT state,
or induce MET, of the transfected cells. (FIG. 7) Transfected cells
treated with LOX/LOXL sense oligonucleotides should be in an EMT
state as should transfected cells without any treatment, or
treatment with controls such as an irrelevant control antibody. The
EMT/MET state of the treated transfected cells are analyzed as
described in Example 1. The cells can also be analyzed using
invasion and/or migration assays as described in Example 2.
[0309] Those LOX/LOXL inhibitors that reduce EMT and promote MET
are selected as candidates for further development.
Example 4
Assay for LOX/LOXL Inhibitors that Reduce EMT/Promote MET with
Cells Treated with Conditioned Media (CM)
[0310] Making CM from CHO Cells:
[0311] CHO-Loxl2 cells were seeded into a T175 flask with a volume
of 25 mls of media (MEM+10% FBS, complete). 48 hours later, the
media was replaced with 20 mls of SFMII media (cells were 90-95%
confluent at this point). The media was collected 72 hours later
and filtered in a 0.22 uM polyethylene filter. The filtered media
was concentrated 20-25 times using an amicon (15 kD cutoff)
concentrator. Nine to ten flasks of 20 mls of media was prepared to
make 8 mls of concentrated conditioned media for experiments.
Treating Cells with CM:
[0312] MCF-7 cells were seeded at 50,000 cells per well of an
8-chambered slide 1 day prior to treating with CM. Cells were
seeded with complete media (MEM+10% FBS, 1.times.L-glutamine). 500
.mu.ls of fresh conditioned media from Cho-Loxl2 cells was added to
the chambers containing MCF7 cells. The cells were incubated with
the CM for 48 hours. Conditioned media from MCF7 wildtype cells was
used as a negative control. After 48 hour incubation with CM, the
cells were stained with rhodamine phalloidin (FIG. 8).
Example 5
Anti-LOXL2 mAb Blocking Assays with Cells Treated with Conditioned
Media (CM)
[0313] MDA-MB-231 (FIGS. 9, 10, 12) or Hs578t cells (FIG. 11) were
seeded in a T75 flask at 80% confluency and cultured in DMEM, 10%
FBS, and 1.times.L-glutamine. These cells were grown for 72 hours
to acquire the CM used for experiments. After 72 hours the CM was
briefly centrifuged to eliminate dead cells and debris and was
placed onto MCF-7 cells (FIGS. 10, 11) or SW620 cells (FIG. 12)
that were previously seeded at 50,000 cells per well in an
8-chambered slide. EMT-like phenotype changes were typically seen
after 48 hour incubation with the conditioned media. MCF-7 or SW620
CM was used as a negative control. Two separate experiments were
performed to demonstrate the blocking ability of anti-loxl2 mAbs to
inhibit the phenotypic changes that occur with
epithelial-mesenchymal transition (EMT).
Experiment 1: "Pre-incubation":
[0314] One ml of CM (centrifuged to eliminate cellular debris) from
MDA-MB-231 or Hs578t cells was pre-incubated with 2 .mu.g or 4
.mu.g (final concentration) of anti-loxl2 for 1 hour and 30 minutes
prior to adding to MCF7 or SW620 cells. Anti-actin was used as a
negative mAb control. (FIG. 10E) The conditioned media was then
added to the MCF7 or SW620 cells and incubated in 37 C and 5% CO2
for 48 hours. The actin cytoskeleton of the MCF7 or SW620 cells
were stained with rhodamine phalloidin to analyze the blocking of
EMT phenotypic changes (FIG. 9).
Experiment 2: "Not-Preincubated":
[0315] MDA-MB-231 or Hs578t cells were seeded into a T25 flask at
80% confluency and cultured in DMEM, 10% FBS, and
1.times.L-glutamine. Anti-Loxl2 mAbs (4 .mu.g final concentration)
were added to each flask respectively and the flasks were incubated
with the media for 72 hours. Anti-actin was used as a negative mAb
control (FIG. 10E). The conditioned media was centrifuged to
eliminate any cellular debris and then added to the MCF7 or SW620
cells and incubated in 37 C and 5% CO2 for 48 hours. The actin
cytoskeleton of the MCF7 or SW620 cells were stained with rhodamine
phalloidin to analyze the blocking of EMT phenotypic changes (FIGS.
11, 12).
Example 6
Anti-LOXL2 mAb Blocking Assays with Cells Treated with CM from
Transfected Cells
[0316] Generation of hLOXL-2 MCD Stable Cell Line
[0317] pSecTag2hygro-hLOXL2 MCD (Minimal Catalytic domain, amino
acids TAPDLVLNAE . . . to end of reading frame+Myc+His tags) was
transfected into Hek293 cells and individual clones selected under
Hygromycin B selection. Expression was gauged via Western blot with
an anti-His antibody (see FIG. 22)
Generation of Conditioned Media for EMT Studies in SW620 Cells
[0318] hLOXL2 MCD Hek293 stable cell line #7 was plated into a T175
flask using 12E6 cells or 6E6 cells, both in 30 ml of cDMEM
(DMEM+L-glutamine+10% FBS, no Penn/Strep). The cells were grown for
72 hours and then the conditioned media was harvested for use in
the SW620/EMT experiment described below. As a control, Hek293
cells were plated out at the same densities and treated in the same
respect.
Conditioned Media from Stable Loxl2-MCD and Induction of EMT:
[0319] SW620 cells were seeded at 50,000 cells per well in an
8-chambered well slide with DMEM, 10% FBS, and 1.times.
L-glutamine. The conditioned media from cells expressing human
Loxl2-MCD was harvested for use in the SW620/EMT assay as described
above. In each chamber, 500 .mu.ls of conditioned media was added
to the respective wells. Conditioned media from 293 cells was used
as a negative control. EMT-like phenotype changes were typically
seen after 72-96 hours later. (FIG. 13)
[0320] CM from stable clones expressing human Loxl2-SRCR domains
1-2 and 3-4 did not induce EMT-like phenotype changes after 72-96
hours.
Example 7
Assay for LOX/LOXL Inhibitors with Chemotherapeutic Agents
[0321] LOX/LOXL inhibitors identified in Examples 2, 3, or 4 that
reduce EMT/promote MET are used to treat BT-549, Hs5788t,
MBA-MD231, or NC1--H226 tumor cell lines, or alternatively, cell
lines such as MCF-7 or SW620 that have been transfected to express
LOX/LOXL or treated with CM from cells expressing LOX/LOXL.
[0322] Chemotherapeutic agents such as, alkylating agents (e.g.
cisplatin, carboplatin), antimetabolites (e.g. methotrexate,
gemcitibine), anthracyclines (e.g. doxorubicin); topoisomerase
inhibitors (e.g. etoposide), mitotic inhibitors (e.g. paclitaxel),
EGFR inhibitors (e.g. erlotinib or gefitinib), or other agents,
such as, doclitaxel, anthracycline, 5-fluoruracil, are added to the
cells concomitant with, or after, treatment with the LOX/LOXL
inhibitor.
[0323] Cells treated with LOX/LOXL inhibitors and a
chemotherapeutic agent are compared to cells treated with a
chemotherapeutic agent alone using cell viability and apoptosis
assays. Cell viability is measured using CellTiter-Glo.TM.
(Promega) and apoptosis is measured using Apo-ONE.TM. (Promega),
protocols as described in the manufacturer's manual.
[0324] A dose response curve for each set of experimental
conditions (range of chemotherapeutic doses, LOX/LOXL inhibitor
dose, number of doses, time of treatment) using triplicates, is
plotted. Invasion and migration assays are also used for analysis,
to determine if any synergy is observed between a LOX/LOXL
inhibitor and chemotherapeutic drug in reducing cell invasion and
migration.
[0325] LOX/LOXL inhibitors that act in synergy with a
chemotherapeutic agent should have decrease in cell viability,
increase in number of apoptotic cells, and/or decrease in invasion
or migratory ability in comparison to cells treated with the
chemotherapeutic agent alone.
[0326] Those LOX/LOXL inhibitors that act in synergy with a
chemotherapeutic agent are selected as candidates for further
development.
Example 8
Drug Sensitivity Assays with LOX/LOXL Inhibition
[0327] 96 well plates were seeded with 7,500 cells per well and 24
hrs later the medium was replaced with medium containing various
concentrations of Cisplatin (Calbiochem, Gibbstown, N.J.),
Erlotinib (LC Laboratories, Woburn, Mass.), Paclitaxel (MP
Biomedicals, Solon, Ohio), Methotrexate (Calbiochem, Gibbstown,
N.J.), B-aminopropionitrile (Sigma-Aldrich, St. Louis, Mo.) or 250
ng/well antibody. After 5 days of continuous exposure, cultures
were rinsed and live cell number was determined using CellTiter
Glo.TM. (Promega, San Luis Obispo, Calif.) according to
manufacturer instructions. Each drug concentration had 3 samples
per cell line. (FIGS. 36, 37, 38)
[0328] For siRNA drug sensitivity studies, cells were transiently
transfected with 20 uM LOX, LOXL2, or non-targeting Stealth
Select.TM. RNAi validated oligos using the Dharmafect transfection
reagent according to manufacturer instructions (Thermo Scientific,
Lafayette, Colo.) 24 hrs prior to drug exposure. Knock down levels
following drug exposure were verified with quantitative PCR. Stable
shRNA cell lines were generated using the MISSION.COPYRGT. shRNA
Lentiviral System (Sigma-Aldrich, St. Louis, Mo.). Knock down of
LOX or LOXL2 was verified with quantitative PCR (FIG. 35).
Example 9
Antibodies to LOX and LOXL2
[0329] Antibodies recognizing LOX and LOXL2 proteins are generated
by immunizing mice with the peptides listed in Table 1. SEQ ID 1
and 8 are used to generate antibodies. The antibodies generated are
screened to determine whether the antibodies specifically recognize
the uncleaved, non-active form of LOX, the mature, active form, or
both the uncleaved and cleaved forms.
[0330] Peptides of SEQ ID 2-6 are based on the mature LOX or LOXL2
enzyme. A peptide selected from Table 1 is used to immunize mice.
BALB/c mice are injected with 160 mg of purified peptide. For the
initial injection, the peptide is mixed with Freund's complete
adjuvant (1:1) and injected subcutaneously. Subsequent injections
are intraperitoneally in the absence of adjuvant.
[0331] Serum antibody to LOX or LOXL2 is determined by an enzyme
linked immunosorbent assay (ELISA) in which the full-length or
active LOX or LOXL2 protein is bound to polystyrene plates. After
at least 2 immunizations over a period of at least 2 months, the
spleen of one mouse with a high titer antibody directed against LOX
or LOXL2 is removed and fused with cells of the P.sub.3 U.sub.1
mouse plasmacytoma cell line. The resulting clones are screened for
their ability to bind LOX or LOXL2, or both, using the full-length
as well as the active forms, in ELISA assays.
[0332] The specificity of the antibody to LOX or LOXL2,
individually or cross-reactive, is determined by ELISA. A
hybridoma-producing antibody reactive with LOX or LOXL2 is isolated
and subcloned. This hybridoma is grown in tissue culture media as
well as in ascites to serve as a source of LOX or LOXL2
antibody.
[0333] For generating human monoclonal antibody to LOX or LOXL2, as
described in EP 0239400 (Winter et al.), the above-described mouse
monoclonal is altered by substitution of its complementarity
determining regions (CDRs) into a human monoclonal antibody or
monoclonal antibody fragment. The CDRs from human heavy and light
chain Ig variable region domains are substituted with alternative
CDRs from murine variable region domains. These altered Ig variable
regions may subsequently be combined with human Ig constant regions
to create antibodies, which are totally human in composition except
for the substituted murine CDRs. Such CDR-substituted antibodies
would be predicted to be less likely to elicit an immune response
in humans compared to chimeric antibodies because the
CDR-substituted antibodies contain considerably less non-human
components. The process for humanizing monoclonal antibodies via
CDR "grafting" has been termed "reshaping." (Riechmann et al.,
Nature 332: 323-327 (1988); Verhoeyen et al., Science 239:
1534-1536 (1988)).
[0334] Transplantation of the murine LOX or LOXL2 antibody CDRs
(such as CDRs from the murine monoclonal antibodies as described in
Burbelo et al. Coll. Relat. Res. 6:153-162 (1986)) is achieved by
genetic engineering whereby CDR DNA sequences are determined by
cloning of murine heavy and light chain variable (V) region gene
segments, and are then transferred to corresponding human V regions
by site directed mutagenesis. In the final stage of the process,
human constant region gene segments of the desired isotype (usually
gamma I for CH and kappa for CL) are added and the humanized heavy
and light chain genes are co-expressed in mammalian cells to
produce soluble humanized antibody.
[0335] The transfer of these CDRs to a human antibody confers on
this antibody the antigen binding properties of the original murine
antibody. The six CDRs in the murine antibody are mounted
structurally on a V region "framework" region. The reason that
CDR-grafting is successful is that framework regions between mouse
and human antibodies may have very similar 3-D structures with
similar points of attachment for CDRS, such that CDRs can be
interchanged. Such humanized antibody homologs may be prepared, as
exemplified in Jones et al., Nature 321: 522-525 (1986); Riechmann
et al., Nature 332:323-327 (1988); Queen et al., Proc. Nat. Acad.
Sci. USA 86:10029 (1989); and Orlandi et al., Proc. Natl. Acad.
Sci. USA 86:3833 (1989).
[0336] Nonetheless, certain amino acids within framework regions
are thought to interact with CDRs and to influence overall antigen
binding affinity. The direct transfer of CDRs from a murine
antibody to produce a humanized antibody without any modifications
of the human V region frameworks often results in a partial or
complete loss of binding affinity. Thus it may be desired to alter
residues in the framework regions of the acceptor antibody in order
to obtain binding activity.
[0337] Queen et al., Proc. Nat. Acad. Sci. USA 86: 10029-10033
(1989) and WO 90/07861 (Protein Design Labs Inc.) have described
the preparation of a humanized antibody that contains modified
residues in the framework regions of the acceptor antibody by
combining the CDRs of a murine mAb (anti-Tac) with human
immunoglobulin framework and constant regions. They have
demonstrated one solution to the problem of the loss of binding
affinity that often results from direct CDR transfer without any
modifications of the human V region framework residues; their
solution involves two key steps. First, the human V framework
regions are chosen by computer analysis for optimal protein
sequence homology to the V region framework of the original murine
antibody, in this case, the anti-Tac MAb. In the second step, the
tertiary structure of the murine V region is modeled by computer in
order to visualize framework amino acid residues, which are likely
to interact with the murine CDRs and these murine amino acid
residues are then superimposed on the homologous human framework.
Their approach of employing homologous human frameworks with
putative murine contact residues resulted in humanized antibodies
with similar binding affinities to the original murine antibody
with respect to antibodies specific for the interleukin 2 receptor
(Queen et al., 1989 [supra]) and also for antibodies specific for
herpes simplex virus (HSV) (Co. et al., Proc. Nat. Acad. Sci. USA
88: 2869-2873, (1991)).
[0338] Further details of this humanization procedure are given in
U.S. Pat. No. 5,225,539 to Winter et al., U.S. Pat. No. 4,816,397
to Boss et al and U.S. Pat. No. 4,816,567 and U.S. Pat. No.
6,331,415 to Cabilly et al., all of which are known to those in the
art and are specifically incorporated by reference for purposes of
describing the exemplified preparation.
[0339] Antibodies recognizing both LOX and LOXL2 are generated by
immunizing mice as described above, with peptides having randomized
amino acids of non-conserved amino acids between LOX and LOXL2, for
example, between SEQ ID 4 and 5, and between SEQ ID 6 and 7. The
antibodies generated should be cross-selective for LOX and
LOXL2.
[0340] Those LOX/LOXL2 antibodies that are specific for LOX or
LOXL2, or cross-reactive to both LOX and LOXL2, are selected as
candidates for further development.
TABLE-US-00001 TABLE 1 LOX/LOXL2 immunogen peptides SEQ ID. GENE
SEQUENCE SELECTIVE 1 LOX SRVDGMVGDDPYNPYK Collagenase IV site 2 LOX
DTYERPRPGGRYRPG Mature peptide 3 LOXL2 RRLLRFSSQIHNNGQSDFRPKNGR
Enzyme domain 4 LOX EDTSCDYGYHRRFA Enzyme domain, cross-selective
with SEQ ID. 5 5 LOXL2 EDTECEGDIQKNYE Enzyme domain,
cross-selective with SEQ ID. 4 6 LOX DPYYIQASTYVQKMSMYNLRC Enzyme
domain, cross-selective with SEQ ID. 7 7 LOXL2
nAEMVQQTTYLEDRPMFMLQC Enzyme domain, cross-selective with SEQ ID. 6
8 LOX GSQYGPGRRRDPGA Pro-peptide
Example 10
Generation of Antibodies Cross-Reactive to LOX and LOXL Members
[0341] Antibodies cross-reactive to LOX and LOXL members are
generated by immunizing mice with peptides derived from the highly
conserved C-terminal region of the LOX/LOXL proteins, which also
encompasses the catalytic domain. Antibodies generated against this
region recognize the active form of LOX/LOXL.
[0342] Domains from which peptides to generate antibodies may be
derived from are the catalytic domain, copper-binding domain,
lysyl-tyrosylquinone co-factor domain, and cytokine receptor-like
domain. Sequences of the copper-binding domain and catalytic domain
are listed in Table 2 and are used to immunize mice as described in
Example 9. Similarly, the specificity of the antibody generated is
determined by ELISA against the full-length and processed forms of
LOX, LOXL, LOXL2, LOXL3, and LOXL4.
[0343] Peptides with randomized amino acids of non-conserved amino
acids between LOX, LOXL, LOXL2, LOXL3, and LOXL4 are also used to
immunize mice to generate antibodies that are cross-reactive with
the various forms of LOX/LOXL protein, for example LOX and LOXL, or
for all 5 LOX family members. Immunization of mice and generation
of mouse and human antibodies is described in Example 9.
[0344] The LOX/LOXL antibodies that are cross-reactive for LOX and
various LOXL members are selected as candidates for further
development.
TABLE-US-00002 TABLE 2 LOX/LOXL immunogen peptides SEQ ID. GENE
SEQUENCE DOMAIN 9 LOX WEWHSCHQHYH Cu Binding 10 LOXL WEWHSCHQHYH Cu
Binding 11 LOXL2 WIWHDCHRHYH Cu Binding 12 LOXL3 WVWHECHGHYH Cu
Binding 13 LOXL4 WVWHQCHRHYH Cu Binding 14 LOX DIDCQWIDITDVKPGNY
Catalytic domain 15 LOXL DIDCQWIDITDVQPGNY Catalytic domain 16
LOXL2 DIDCQWVDITDVPPGDY Catalytic domain 17 LOXL3 DIDCQWIDITDVKPGNY
Catalytic domain 18 LOXL4 DIDCQWVDITDVGPGNY Catalytic domain
Example 11
Generation of Antibodies Recognizing Active LOX/LOXL that Reduce
EMT/Promotes MET
[0345] EMT cells secrete active LOX/LOXL. Antibodies generated from
Examples 9 and 10 are used in treating EMT cells in Examples 2, 3
or 4. The EMT or MET characteristics of the cells are then
determined as described in Example 1. Antibodies that recognize the
active LOX/LOXL2 should reduce EMT and promote MET of the
cells.
[0346] Those LOX/LOXL antibodies that reduce EMT and promote MET of
the cells are selected as candidates for further development.
Example 12
Inhibition of LOX/LOXL Activity by Antibodies
[0347] Antibodies generated from Examples 9 or 10 are used in
LOX/LOXL activity assays as described in Fogelgren et al., J. Biol.
Chem. 280:24690-24697 (2005). Briefly, the LOX/LOXL activity assay
reaction mixture consists of 50 mM sodium borate (pH 8.2), 1.2M
urea, 40 uM Amplex Red, 0.1 units/ml horseradish peroxidase, and 10
mM 1,5-diamineopentane (cadaverine) substrate. Alternatively, the
Amplex Red assay is performed in a physiological buffer such as
phosphate buffer at pH 7.5. The protein, LOX/LOXL, is added to the
reaction mixture in the presence or absence of 500 uM BAPN or
antibodies from Examples 9 or 10, and incubated. The fluorescent
product is excited at 560 nm, and emission is read at 590 nm (e.g.
BMG Labtechnologies Inc. Polarstar Optima). LOX/LOXL in the
presence of BAPN serves as a negative control, whereas absence of
BAPN serves as a positive control. The measure of activity is based
on the amount of fluorescence.
[0348] Those LOX/LOXL antibodies that inhibit LOX/LOXL activity are
selected as candidates for further development.
Example 13
Inhibition of LOX/LOXL Binding to Other Cellular or Extracellular
Matrix Components by LOX/LOXL Antibodies
[0349] Antibodies generated from Examples 9 or 10 are used in ECM
binding assays. Solid phase binding assays are performed as
described in Fogelgren et al., J. Biol. Chem. 280:24690-24697
(2005). Wells of high protein-binding EIA/RIA microplate (Corning)
are coated with tropoelastin, Type I collagen, soluble plasma
fibronectin (pFN), insoluble cellular fibronectin (cFN), laminin,
or BSA overnight at 4.degree. C. The wells are blocked, washed, and
then incubated overnight with a tagged version of LOX/LOXL (e.g.
GST-LOX/LOXL) with or without the LOX/LOXL antibodies. The wells
are again washed and the amount of LOX/LOXL binding is detected by
a primary antibody against the tag of the LOX/LOXL (e.g. anti-GST),
followed by a peroxidase-labeled secondary antibody. The peroxidase
activity is then quantitated with a fluorogenic peroxidase
substrate kit (Pierce). The samples are performed in triplicate and
dissociation constants calculated with statistical software (e.g.
Prism3 from Graphpad, Inc.).
[0350] Binding assays are also performed in which LOX/LOXL is used
to coat the microplate wells. Antibodies from Examples 9 or 10 are
added to the wells, prior to, or concurrent with tropoelastin, Type
I collagen, pFN, cFN, or BSA. Binding is measured as described
above, where the ECM proteins are detected with their respective
antibodies, or an antibody against the tag, if a tagged form of the
ECM protein is used, to detect the amount of ECM bound.
[0351] Binding of LOX/LOXL with other proteins, such as cellular
receptors (e.g. uptake receptor integrin beta1), BTK (burton
agammagloublinemia tyrosine kinase), or other integrins is also
performed using the aforementioned assay, wherein instead of ECM
proteins are used, cellular receptors (e.g. uptake receptor
integrin beta1), BTK (burton agammagloublinemia tyrosine kinase) or
other integrins are used.
[0352] Those LOX/LOXL antibodies that inhibit LOX/LOXL binding to
ECM proteins, cellular receptors, and integrins, are selected as
candidates for further development.
Example 14
Inhibition of LOX Activity
[0353] Specific LOX activity was evident on the cell surface of
NIH3T3 cells. Activity was quantitated with a horseradish
peroxidase-coupled fluorescent assay method based on the oxidation
of Amplex Ultra Red with a 1,5-diaminopentane substrate. LOX
activity was inhibited with the irreversible small molecule
inhibitor, BAPN, with a monoclonal antibody raised against a LOX
peptide, and with a siRNA oligonucleotide specifically targeting
LOX mRNA. (FIG. 15)
[0354] NIH 3T3 cells were transfected withl00 nM of LOX siRNA
(Invitrogen Stealth, HSS106117, AUAACAGCCAGGACUCAAUCCCUGU) or
non-targeting control. 25 ul of Dharmafect.RTM. #3 (Dharmacon) was
mixed with 1 ml of OPTIMEM I.RTM. (Invitrogen) and sat for 5
minutes at room temperature. 50 ul of 20 uM siRNA was then added,
mixed and the transfection mix was incubated at room temperature
for 15 minutes. 1 ml of transfection mix was then added to a
trypsinized cell suspension in growth media containing
1.times.10.sup.6 cells and the resulting mixture was plated into a
10 cm.sup.2 culture dish. Six days after transfection, cells were
trypsinized and re-plated into 96 well plate format at 50,000
cells/well. Day seven after transfection, cells were washed
2.times. with PBS and incubated with 100 ul of the following
reaction mix: 100 uM Amplex Ultra Red.RTM. (Invitrogen), 20 mM
diaminopentane (Fluka), and 4 u/ml horseradish peroxidase (Sigma)
in PBS. BAPN and LOX mAb were added to 1 mM and 15 ug/ml final
concentrations, respectively, immediately before diaminopentane and
HRP addition. The plate was read in a Molecular Devices M5 plate
reader at 37.degree. C. The plate reader was configured to read
fluorescence (ex=544 nm, em=590 nm) in kinetics mode for
approximately 2.5 hours.
Example 15
Inhibition of LOXL2 Activity
[0355] All plates were obtained from Corning. Secondary antibody
and Pico substrate were from Pierce. Amplex red reagent was from
Invitrogen. Horse radish peroxidase (HRP), 1,5-diaminopentane,
antifoam were from Sigma. All ProteOn reagents were from Bio-Rad.
LOXL2 was from R&D systems. Antibodies used in this study were
produced at Antibody Solution or via ascites from Aragen
Biosciences. All other reagents were of the highest quality
possible.
Binding Via ELISA
[0356] Binding of antibody to LOXL2 was determined using a
luminescence based ELISA. White Corning plates were coated with 0.1
.mu.g/mL of LOXL2 or antigen of interest in 50 mM borate buffer (pH
8.0) overnight at 4.degree. C. Plates were washed using BioTek
plate washer and blocked with 5% skim milk in PBST (0.05% tween-20)
for 1 hour at room temperature. Plates were washed with PBST (0.05%
tween-20) and then used immediately or stored at 4.degree. C. in
dessicator for future use. The antibody to be tested was serially
diluted in PBST (0.01% tween-20) and 100 .mu.L of each dilution was
added per well. Plates were incubated with test article for 1 hour
at room temperature and then washed with PBST (0.05% tween-20).
Detection antibody (anti-mouse HRP conjugate) was diluted 16000
fold in 5% skim milk in PBST (0.05% tween-20) and 100 .mu.L was
applied per well. Plates were incubated for 1 hour with detection
antibody and then washed with PBST (0.05% PBST). Signal was
detected using the SuperSignal ELISA pico chemiluminescent
substrate from Pierce following the manufacturer's instructions.
Luminescence was measured using a Molecular Devices M5 plate reader
with an integration time of 500 ms capturing all wavelengths. Data
was background corrected and the dependence of luminescence signal
to antibody concentration was fit using the Langmuir isotherm
equation using the GraFit program. In instances where the antigen
concentration was similar to the dissociation constant the
quadratic equation of tight binding was used. Reported dissociation
values were obtained from the fits to these equations.
Langmuir Isotherm equation
[ PL ] = B max * [ L } K D * [ L ] ##EQU00001##
Tight Binding Equation
[0357] [ PL ] = B max * ( ? + [ S ] T + K D ) - ? 2 ? ##EQU00002##
? indicates text missing or illegible when filed ##EQU00002.2##
Binding Via SPR (Surface Plasmon Resonance)
[0358] Binding affinities were measured using a Bio-Rad ProteOn
instrument thermostated to 25.degree. C. The binding affinities
were determined using two methods, using amine coupling; one in
which the antibody was immobilized and the antigen (LOXL2) was
added, and another in which the antigen (LOXL2) was immobilized and
antibody was added. Antibody or antigen was immobilized on a GLC
chip using at 1:1 ratio of NHS to EDC provided with the ProteOn
immobilization kit. Chip was first activated with NHS/EDC a mixture
and then antigen or antibody at 1 .mu.g/mL in acetate buffer pH 4.5
was flowed over activated surface to couple. This typically yielded
a coupling of about 500 RU's. The activated chip surface was then
capped with the addition of 1M ethanolamine. Coupled chips were
stored at 4.degree. C. and regenerated with 50 mM sodium hydroxide.
Dissociation constants were determined by probing the coupled chip
with a dilution series of antibody or antigen in PBST (0.05%
tween-20). Data was acquired on all six channels available on the
ProteOn using a non-coupled channel as a reference. Collected data
was analyzed using ProteOn manager software from Bio-Rad.
Screening Assays
[0359] Antibody candidates were initially chosen based on ELISA
point tests. ELISA on multiple antigens was performed by Antibody
Solutions and antibodies showing strong ELISA signal in the antigen
of interest were selected for further characterization in enzymatic
assays. LOXL2 produces hydrogen peroxide when the substrate
1,5-diaminopentane is deaminated and the enzyme regenerated.
[0360] Antibodies were assessed for their ability to inhibit
enzymatic activity using a biochemical assay that couples the
production of peroxide (liberated by LOXL2) to HRP and measuring
the conversion of amplex red to a fluorescent product. Antibody
hybridoma supernatant (10 .mu.L) was added to 40 .mu.L enzyme
mixture (50 mM sodium borate pH 8.0, 5 units/mL HRP, 125 nM LOXL2,
10 ppm antifoam) and incubated at room temperature for 1 hour in a
96 well full area black plate. Enzymatic reaction was started with
the addition of 50 .mu.L of substrate solution (62.5 mM sodium
borate, 100 uM amplex red reagent, 20 mM 1,5-diaminopentane, 10 ppm
antifoam) and read in a Molecular Devices M5 plate reader at
37.degree. C. The plate reader was configured to read fluorescence
(ex=544 nm, em=590 nm) in kinetics mode for 1 hour. Data was
recorded as the slope of the fluorescence response to time. These
slopes were compared to a control in which hydridoma media was
added to the enzyme mixture. Slopes less than that of control were
considered inhibitors.
IC50 Determinations
[0361] Dose responses on selected antibodies were carried out
against LOXL2 using the coupled enzymatic assay described above. A
dilution series of antibody was created in PBST (0.01% tween-20)
and 10 .mu.L of this was added to 40 .mu.L of enzyme mixture (50 mM
sodium borate pH 8.0, 5 units/mL HRP, 125 nM LOXL2, 10 ppm
antifoam) and incubated at room temperature for 1 hour in a 96 well
full area black plate. Enzymatic reaction was started with the
addition of 50 .mu.L of substrate solution (62.5 mM sodium borate,
100 uM amplex red reagent, 20 mM 1,5-diaminopentane, 10 ppm
antifoam) and read in an M5 plate reader using conditions described
above. The slopes of the fluorescence response as a function of
time were plotted against antibody concentration and the data was
fit to a four parameter fit using GraFit. The midpoint of this plot
is the apparent IC50 and is the concentration at which fifty
percent of the total response is inhibited (for example, FIG.
20).
Mode of Inhibition
[0362] Mode of inhibition of antibodies against LOXL2 was conducted
using the model described below. In these experiments, the
dependence of the steady state rate on the concentration of
1,5-diaminopentane was monitored under increasing concentrations of
antibody. The purpose was to assess whether the K.sub.m for
substrate, k.sub.cat or both change in the presence of antibody.
Collected data was analyzed globally with Grafit using the model
shown in figure below. Parameter a describes the effect of the
compound on substrate affinity. An .alpha. value equal to one
describes a situation in which the compound binds equally well the
free enzyme and the enzyme-substrate complex (non-competitive
inhibition like). Values less than one describe an interaction in
which the compound binds the enzyme-substrate complex
(uncompetitive inhibition like). Values greater than one correspond
to the compound binding the free enzyme better than the
enzyme-substrate complex (competitive inhibition like). The .beta.
value describes the effect of the modulator on the rate of the
enzyme Inhibitors have values less than one (for a complete
inhibitor .beta.=0) and activators have values greater than one.
K.sub.A is the dissociation constant of the compound, K.sub.s is
the Michaelis constant for the substrate and k is the catalytic
rate of the enzyme. The steady state rates were determined from the
slope of the fluorescence response as a function of time as
described above. Data was plotted as the dependence of steady state
rate on the concentration of substrate (1,5-diaminopentane) at
several fixed concentrations of antibody and analyzed with GraFit.
(for example, FIG. 21A, and using a direct competitor, as shown in
FIG. 21B).
Example 16
Detection of LOX/LOXL by Immunoblot and Immunohistochemistry (IHC)
Analysis
[0363] Immunoblot (western blot) analysis was performed by lysing
cells in lysis buffer (for example, 100 mM NaH2PO4, 10 mM Tris-HCL,
8M Urea, 0.05% tween-20, pH 8.0; or EDTA, NP40, Tris, NaCl, PMSF
and "Complete mini, protease inhibitor cocktail" (Roche,
#11836153001); or "Laemmli's SDS sample buffer, 4X" (Boston
BioProducts, #BP-110R). The lysate (typically 15-25 .mu.g total
protein) was loaded onto 4-12% Tris-Glycine gels (Invitrogen
Carlsbad, Calif.) or NuPAGE Novex 4-12% Bis Tris gels (Invitrogen).
Size fractionated proteins were transferred onto PVDF membrane
(Invitrogen Carlsbad, Calif.) or Nictrocellulose membranes
(Invitrogen).
[0364] Immunoblots were blocked overnight at 4.degree. C. in 2%
BSA, 5% dry milk in PBS. Following incubation with anti-LOX/LOXL
primary antibody (monoclonal or polyclonal), blots were incubated
with secondary antibodies to enable detection, such as anti-rabbit
IgG-HRP'' (GE Healthcare or Jackson Immunoresearch Lab), anti-mouse
IgG-HRP'' (GE Healthcare), anti-goat IgG-HRP'' (Jackson
Immunoresearch Lab), or IRDye680-conjugated goat anti-mouse IgG,
IRDye680-conjugated donkey anti-rabbit IgG (Rockland Inc.),
following the manufacturers recommended conditions.
Chemiluminescent signals were developed and detected using
SuperSignal West Femto Max or Pico Max Sensitivity Substrate
(Pierece) or alternatively by using ECL anti-mouse IgG
HRP(Amersham) with detection using Chemiglow West (Alpha Innotech).
Fluorescently-labeled secondary antibodies were directly
detected.
[0365] In addition to immunoblots prepared from tissues,
commercially-available pre-loaded immunoblots containing
size-fractionated proteins isolated from a range of normal tissues
and tumor tissues (eg. from ProSci Incorporated, CA) were used for
analysis of molecular weight distribution of LOX/LOXL in normal
tissues and tumor tissues.
[0366] LOX/LOXL protein expression and cellular localization was
detected in normal tissues and tumor tissues using tissue sections
and sections of tissues arranged in tissue microarrays (eg.
available from Cybrdi, Pro Sci, and other sources). Tissue samples
were blocked for non-specific binding using BACKGROUND sniper
(Biocare Medical) following the manufacturer's instructions.
Antigen retrieval was performed in a variety of buffers, pH
conditions, and temperatures to ensure robust detection in tissue
sections. Antibodies (monoclonal or polyclonal, generated using
mice or rabbits) against LOX/LOXL are evaluated for IHC using tumor
cell lines. Suitable antibodies were incubated with tissue sections
(typically, at a concentration of 1-10 .mu.g/ml, diluted in
dilution buffer (Biocare Medical (Concord, Calif.) or DAKO
(Carpinteria, Calif.) according to manufacturer's instructions.
[0367] Detection was performed using Rabbit-Probe HRP polymer kit
(MACH2 or MACH3 by Biocare Medical or EnVision by DAKO) or
Mouse-Probe HRP polymer kit (MACH2 or MACH3 by Biocare Medical or
EnVision by DAKO) according to manufacturer's directions.
Alternatively, detection was performed using horse radish
peroxidase conjugated to anti-mouse, rabbit, or goat IgG (GE
Healthcare or Jackson Immunoresearch Lab), or Vectastain Elite ABC
kit (anti-mouse, rabbit, or goat, Vector laboratories) or an
EnVision kit (anti mouse and rabbit, DAKO), following the
manufacturers' instructions.
Example 17
Detection of 2 Forms of LOXL2
[0368] LOXL2 is cleaved and was detected by virtue of its change in
molecular weight by Western blot (FIG. 16, 17). The two forms were
separated by chromatography (FIG. 18), and the activity of both
forms tested (FIG. 19).
Example 18
Internalization and Uptake of LOX/LOXL2
[0369] Hs578t cells were cultured in DMEM containing 10% FBS and
1.times.glutamine. The cells were seeded in an 8 chamber glass
slide (BD Falcon, Franklin Lakes, N.J.) and allowed to adhere
overnight. For low confluency, cells were seeded at 30-40,000 cells
per slide. Low confluency was used for detection of Lox in the
cytosol 24 hours later. For high confluency, cells were seeded at
100,000 cells per slide. High confluency was used for detection of
Lox associated with the matrix and collagen approximately 48-72
hours later.
[0370] The following day, 1 .mu.g/ml (final concentration in
regular growth medium) of anti-Lox M64 or anti-Loxl2 M20 monoclonal
Ab (mAb) was added to the chambers. For continuous uptake, the mAbs
were incubated with cells at different timepoints: for example, 3
hour, 8 hour, 24 hour (overnight). After an appropriate amount of
continuous uptake, the media was removed and the chambers were
rinsed with 1.times.PBS. The cells were fixed in 4% PFA
(paraformaldehyde) at room temperature for 20 minutes. After
fixation, the cells were washed with 1.times.PBS at room
temperature for 5 minutes and then quenched in 50 mM ammonium
chloride at room temperature for 10 minutes. The cells were washed
again with 1.times.PBS at room temperature for 5 minutes.
[0371] The cells were permeabilized by adding saponin buffer (0.5%
Saponin/1% BSA in PBS) at room temperature for 20 minutes. The
secondary detection Ab (Alexa Fluor 488 donkey anti-mouse IgG,
Invitrogen, Carlsbad, Calif.) was added at room temperature in
saponin buffer and the cells were incubated for 30-45 minutes. The
cells were then washed 3.times. in saponin buffer. The slides were
mounted with vectashield (Vector Laboratories, Burlingame,
Calif.).
[0372] To detect collagen detection, anti-collagen antibody (1:50,
Calbiochem anti-collagen type I Rabbit polyclonal, Gibbstown, N.J.)
was incubated one hour prior to fixing the cells with 4% PFA.
Secondary Ab for collagen was donkey anti-rabbit Cy3
(ImmunoJacksonLabs, West Grove, Pa.).
siRNA Knockdown of Lox and Loxl2 in Hs578t Cells:
[0373] Hs578t cells were cultured in DMEM containing 10% FBS and
1.times.glutamine in 10 cm tissue culture plates. The cells were
grown until they were approximately 75% confluent. The transfection
reaction/mixture was set up the day the cells reached 75%
confluency. Two mixtures were made: In one 15 ml conical tube, 60
.mu.ls of 20 uM of siRNA was mixed with 1 ml of optimum (final
siRNA concentration was 100 nM). In another 15 ml conical tube, 30
.mu.ls of Dharmafect.TM. 3 (Thermo Scientific, Chicago, Ill.)
transfection reagent was mixed with 1 ml of OptiMEM.TM.. The two
tubes were incubated at room temperature for 5 minutes. After 5
minutes, the contents of both tubes were mixed into one. The mix
was carefully pipetted up and down and incubated for 20 minutes at
room temperature.
[0374] Hs578t cells were trypsinized and resuspended in 10 mls of
complete media and were added to a 10 cm tissue culture plate. For
each siRNA condition, 2 mls of the combined transfection mixture
was added to the 10 cm plate. The plates were gently swirled and
were placed in the incubator with 37 C and 5% CO2 overnight. The
media did not need to be changed and was left on the cells for many
days. For immunofluorescent studies (FIGS. 23, 24, 35), the
transfection proceeded for at least 5 days to ensure sufficient
knockdown and lowered protein levels.
Summary
[0375] The results demonstrate that at low cell confluency, LOX and
LOXL2 do not remain secreted in the extracellular matrix but
instead can be re-uptaken by tumor cells (as the antibody is
internalized). The specificity of these staining patterns (FIGS.
23, 24, 25) was supported by matched siRNA knockdown controls. At
high cell confluency, LOX and LOXL2 are now detected readily
outside the cell in the extracellular matrix, with apparently
little re-uptake. Staining patterns were supported by matched siRNA
knockdown controls. Similar results of internalization and uptake
of anti-Lox and anti-Loxl2 mAbs and their colocalization with
collagen was obtained for Loxl2 mAbs treatment of cells in place of
siRNA knockdown.
Example 19
Time Course of LOX/LOXL2 Internalization and Uptake
[0376] The time course was initiated on cells that were already
confluent (day 0). The cell line used was breast tumor cell line
Hs578t, which expresses both LOX and LOXL2.
IHC Protocol (Cells on Chamber Slides; Based on DAKO's En
Vision+System-HRP):
[0377] All the steps were done at RT (room temperature), the
primary antibody concentration was 5 .mu.g/ml for anti-LOX and 15
ug/ml for anti-LOXL2. The cells were washed with PBS (.times.3).
Then a peroxidase block (5 min) was performed before washing again
with PBS (.times.3). The cells were then incubated with primary
antibody diluted in 0.05 M Tris-HCl, pH 7.6 w/1% BSA (30 min). M64
and M20, LOX and LOXL2 monoclonal antibodies, respectively, (see
for example FIG. 26) were used. The cells were then washed with PBS
(.times.3) before being fixed with 4% PFA (10 min). the cells were
then washed again with PBS (.times.3) before adding Peroxidase
Labelled Polymer (30 min). The cells were then washed with PBS
(.times.3). The Substrate-Chromogen (20 .mu.L DAB per 1 mL
Substrate Buffer) was then added for 5-10 min. The cells were then
washed with distilled water before counterstaining with hematoxylin
(optional at times), dehydrated and permanently mounted with
Entellan.
Picro-Sirius Red (Sirius Red F3B) Staining Protocol:
[0378] Siruis Red staining was used for collagen histochemistry.
The cells were fixed with 4% PFA (10 min), however, the fixation is
not critical. The cells were then stained in Picro-Sirius Red
(Sirius Red 0.1% in saturated picric acid (Electron Microscopy
sciences, cat #26357-02) for 1 hour at RT. The cells were then
washed in 2 changes of acidified water (5 mL acetic acid in 1 L of
distilled water) before being dehydrated in graded series of
ethanol and mounted.
Results
[0379] As shown in FIG. 27, at Day 0, LOX and collagen I were
already secreted and associated with the matrix, but LOXL2 was
localized in the cytosol and was not secreted nor associated with
the matrix yet. At DayS, more LOX and collagen I was secreted, and
LOXL2 was secreted/associated with the matrix. At Day 9, LOX,
LOXL2, collagen I and Sirius red all showed similar staining
patterns, indicating LOX, LOXL2 and collagen I co-localize in the
same regions. At Day 11, a change in LOX staining pattern was
detected, indicating less LOX was being secreted and/or associated
with the matrix. LOXL2, collagen I and Sirius Red staining,
however, were still similar to each other and no real change in
staining patterns was detected. Staining patterns of all the
proteins at Day 13 and Day 15 were similar to those of Day 11.
Based on these results, there were some differences in the timing
of the secretion of LOX and LOXL2, respectively. The secretion of
LOX and LOXL2 appears to be regulated and related to cell
confluency. The timing of secretion may regulate the availability
of active, extracellular LOX and LOXL2, which in turn, may initiate
collagen cross-linking
[0380] This example, combined with other Examples disclosed herein,
demonstrate that the secretion of LOX and LOXL2 is highly
regulated. At low cell density, the data dislosed herein indicates
secreted LOX and LOXL2 are rapidly re-uptaken by cells (as the
specific LOX and LOXL2 antibodies are detected inside the cell,
suggesting that they are efficiently internalized). At high cell
density, LOX and LOXL2 are no longer re-uptaken but are found
associated with the collagen matrix (extracellular), as determined
by localization of specific LOX and LOXL2 antibodies. IHC analysis
of tumor cells and liver fibrosis cells indicate that a similar
regulation of LOX and LOXL2 can occur, with differential
distributions of intracellular and extracellular LOX/LOXL in areas
of disease.
Example 20
LOX and LOXL2 Tissue Expression
[0381] The decloaking chamber and solutions used are from
BioCareMedical (Concord, Calif.) unless otherwise stated. All
procedures were performed at room temperature unless otherwise
stated.
[0382] The decloaking chamber was filled with 500 ml of distilled
water (diH20). One slide container was filled with 200 mls of
Universal Decloaker antigen retrieval solution and another slide
container was filled with 200 mls of Hot Rinse; the tissue
microarray (TMA) slides (Cybrdi, Frederick, Md.) were placed into
the container with the decloaking solution and were then placed
into the decloaking chamber. The temperature settings were set at
80.degree. C. for 30 minutes for breast TMAs. Once the temperature
reached 90.degree. C., the slides were removed from the decloaking
antigen retrieval solution and placed into the container with hot
rinse. The temperature in the hot rinse container was brought down
slowly by exchanging 1/3 of the hot rinse with 1/3 of diH20 every
two minutes until the temperature within the container was at room
temperature. The slides were then rinsed once with diH20 and then
once in PBS with 0.1% Tween-20.
[0383] The slides were treated with Peroxidazed-1 for 5 minutes and
then rinsed one time in PBS for 2 minutes. Then, the slides were
background blocked with SNIPER for 5 to 10 minutes and then rinsed
one time in PBS for 2 minutes. Primary antibody (Ab) was diluted in
Da Vinci Green Universal Diluent. 5 .mu.g/ml of rabbit polyclonal
anti-Loxl2 antibody and 3 .mu.g/ml of monoclonal anti-Lox M64 was
used. The slides were incubated with the primary antibodies for 2
hours and were then rinsed 3 times in PBS-Tween-20, 2 minutes each
rinse. The Mach3 polymer kit was used for antigen detection by
adding mouse or rabbit probe for 20 minutes. The slides were then
rinsed once with PBS-Tween-20 and followed by the addition of mouse
or rabbit polymer for 20 minutes. The slides were then rinsed 5
times in PBS-Tween-20, 2 minutes for each wash. DAB chromagen was
added to the slides for 7 minutes and rinsed once in diH20. DAB
sparkle was added to the slides for 1 minute and rinsed once in
diH20. The slides were then counter stained with hematoxylin for 30
seconds to 1 minute and were then rinsed with water for 5 minutes
and followed by dehydration with graded alcohol. The slides were
mounted with entellan mounting media (Electron Microscopy Sciences,
Hatfield, Pa.). Tissue expression is as shown in FIGS. 28 and
29.
Example 21
LOX and LOXL2 Expression in Lung Adenocarcinoma
[0384] RT-PCR analysis of LOX and LOXL2 was performed on lung
adenocarcinoma. Analysis was performed on primary tumors, but some
were associated with metastasis or recurrence. The data are a ratio
of tumor to a matched adjacent "normal" piece of tissue that is not
necessarily completely normal, the individual transcript data for
tumor and normal are plotted in FIGS. 31 and 32. LOXL2 was
overexpressed in about 4-5 out of 10 tumors and tended to be
associated with tumors known to be associated with lymph node
metastasis or other recurrence/metastasis (TABLE 3). Primers and
probes used are listed in TABLE 4.
TABLE-US-00003 TABLE 3 Lung Adenocarcinoma Pathology Sample
male/female Lung 304T M poorly differentiated, lung pT1, NO, M1 III
21 * High LOXL2, adenocarcinoma tumor nodule "metastasis" LOXL1,
LOX 304N M 22 298T F moderately differentiated pT1, NO, MX 23 298N
F 24 386T M poorly differentiated pT2, 1B, NO, MO III 25 386N M 26
417T M poorly; non-invasive, pT2, 1B, NO, MX III 27 * high LOXL2,
LOX primary 417N M 28 423T M poorly differentiated tumor recurred 3
29 * high LOXL2, LOX 423N M 30 457T M mod. to poorly pT4, IIIB, N1,
MX 2 31 high LOXL2, high differentiated "adjacent normal" 457N M 32
620T M well differentiated pT2, NO, MX I 33 620N M 34 794T M
moderately differentiated pT1, II, NO, MX II 35 794N M 36 873T M
poorly differentiated pT2, IIB, N1, MX III 37 * high LOXL2, LOX
873N M 38 1294T F moderately differentiated NO, MX II 39 1294N F
40
TABLE-US-00004 TABLE 4 qRT-PCR Sequences Short Name Ref Seq
Sequence Probe Quencher LOX NM_002317 CTTGACTGGGGAAGGGTCTG LOX
NM_002317 AAAACGGGGCTCAAATCACG LOX NM_002317
ATCCCACCCTTGGCATTGCTTGGT FAM BHQ-1 LOXL1 NM_005576
AGCAGACTTCCTCCCCAACC LOXL1 NM_005576 CAGTAGGTCGTAGTGGCTGAAC LOXL1
NM_005576 CACGGCACACCTGGGAGTGGCAC FAM BHQ-1 LOXL2 NM_002318
GGGGTTTGTCCACAGAGCTG LOXL2 NM_002318 ACGTGTCACTGGAGAAGAGC LOXL2
NM_002318 TGGAGCAGCACCAAGAGCCAGTCT FAM BHQ-1 LOXL3 NM_032603
GTGTGCGACAAAGGCTGGAG LOXL3 NM_032603 CCGCGTTGACCCTCTTTTCG LOXL3
NM_032603 AAGCCCAGCATCCCGCAGACCAC FAM BHQ-1 LOXL4 NM_032211
CTTACCACACACATGGGTGTTTC LOXL4 NM_032211 TCAAGCACTCCGTAACTGTTGG
LOXL4 NM_032211 CCTTGGAAGCACAGACCTCGGGCA FAM BHQ-1 RPL19 NM_000981
CCGGCTGCTCAGAAGATAC RPL19 NM_000981 TTCAGGTACAGGCTGTGATACAT RPL19
NM_000981 TGGCGATCGATCTTCTTAGATTCACG FAM BHQ-1 LOX NM_010728
CAAGAGGGAAGCAGAGCCTTC LOX NM_010728 GCACCTTCTGAATGTAAGAGTCTC LOX
NM_010728 ACCAAGGAGCACGCACCACAACGA FAM BHQ-1 LOXL1 NM_010729
GGCCTTCGCCACCACCTATC LOXL1 NM_010729 GTAGTACACGTAGCCCTGTTCG LOXL1
NM_010729 CCAGCCATCCTCCTACCCGCAGCA FAM BHQ-1 LOXL2 NM_033325
GCTATGTAGAGGCCAAGTCCTG LOXL2 NM_033325 CAGTGACACCCCAGCCATTG LOXL2
NM_033325 TCCTCCTACGGTCCAGGCGAAGGC FAM BHQ-1 LOXL3 NM_013586
GCAAGGAGAGAATAGACAGAGAAG LOXL3 NM_013586 AGCATGGTGTCCTCATTCATAAAG
LOXL3 NM_013586 ACATCCACCCATCCCATCCCACCC FAM BHQ-1 LOXL4 NM_053083
CAAGACAGGTCCAGTAGAGTTAGG LOXL4 NM_053083 AGGTCTTATACCACCTGAGCAAG
LOXL4 NM_053083 ACAGAGCACAGCCGCCTCACTGGA FAM BHQ-1 RPL19 NM_009078
AGAAGGTGACCTGGATGAGAA RPL19 NM_009078 TGATACATATGGCGGTCAATCT RPL19
NM_009078 CTTCTCAGGAGATACCGGGAATCCAAG FAM BHQ-1
Example 22
Animal Model for Diabetic Nephropathy/Kidney Fibrosis
[0385] Transgenic mice which overexpress inducible cAMP early
repressor display severe diabetes and exhibit glomerular
hypertrophy, glomerular basement membrane thickening and sclerotic
lesions. These mice may be used as a model for diabetic
nephropathy. The compounds described herein can be administered to
this model system and analyzed for their ability to prevent, treat,
and/or ameliorate kidney fibrosis.
[0386] Transgenic mice are raised under established protocols and
guidelines for animal experiments. Treatment group size, regimens,
and controls are established based on previously identified doses
and administration time-points for LOX/LOXL inhibitors. Mice are
monitored and/or sacrificed at pre-determined time-points
throughout the experimental time-frame for histological and
biochemical analyses.
[0387] Histological analyses include microscopic and
immunohistochemical analyses of kidney sections. Glomerular surface
area and glomerular number are identified via established
biochemical staining and microscopic analyses. Glomerular basement
membrane thickening is determined via established methods for
electron microscopy of kidney sections.
[0388] Serum and urinary variables are also monitored for
determination of kidney activity/failure. Blood glucose and insulin
levels are determined via established methodologies including ELISA
and HPLC. Serum proteins such as creatinine and albumin are also
monitored via established assays. Urine samples are assayed for
protein levels including albumin and creatinine Established assays
are used for the detection of proteins in urine, including ELISA
and HPLC.
[0389] Utilizing an animal model system such as the diabetic
nephropathy mouse model described above, the compounds disclosed
herein may be tested for prevention, treatment, and/or amelioration
of kidney fibroses.
Example 23
Animal Model for Myocardial Ischemia/Infarction Fibrosis and ECM
Remodeling
[0390] Male Wistar rats are housed and handled per current animal
handling guidelines and protocols. Treatment group size, regimens,
and controls are established based on previously identified doses
and administration time-points for LOX/LOXL inhibitors. Rats are
subject to ischemia/reperfusion injury are monitored and/or
sacrificed at pre-determined time-points followed by x-ray, microCT
imaging, microscopic tissue examination, and immunohistochemical
analyses.
Ischemia/Reperfusion Injury Protocol
[0391] Rats are anesthetized and placed on ventilation. Hearts are
surgically exposed and a mini-pneumatic coronary occluder
(catheter-based occlusion system) is placed around the desired
coronary artery. The chest is then closed and the occluder-catheter
and venous tubing are exteriorized between the scapulae. After
surgery, the animals are allowed to recover for five days prior to
starting the ischemia/reperfusion protocol.
Ischemia
[0392] Ischemia is implemented via the occluder-catheter on a
schedule that include at least one pre-conditioning occlusion for
20 seconds followed by 5 minutes of recovery, and at least one
occlusion for 2 minutes, followed by 5 minutes of recovery.
Thereafter, occlusion time can vary up to 30 minutes. Ischemic
protocol lengths can vary, with a typical protocol length of 4
weeks. Ischemia is implemented once per week, and cardiac function
is monitored via echocardiography throughout the protocol. Rats are
euthanized at the end of the protocol, and hearts are excised and
examined for microvasculature, chamber size and function, and
extent of fibrosis. LOX/LOXL inhibitors are administered at
predetermined time points and dosages throughout the ischemia
protocol. Ascending dosages and increasing frequencies of
administration are administered in groupings sufficient to
establish dose-limiting toxicities and efficacies. Control animals
and protocols are maintained throughout all protocols.
Analyses
[0393] Ventricle size is determined via recordation of ventricle
short-axis views by echocardiography during the protocol. Diastolic
and systolic areas, defined as the minimum and maximum ventricle
cavity areas during cardiac phase are analyzed. Coronary flow and
microvasculature of the excised hearts is determined via a variety
of imaging and staining techniques including microCT and x-ray.
Fibrosis of the chambers is determined via sectioning of the
cardiac tissue and trichrome staining or other established staining
for cardiac tissue. Cross-sectional microscopy and histological
analysis is also performed for evaluation of ventricle volume,
size, and ventricle wall thinning
[0394] Utilizing an animal model system such as the cardiac ECM
remodeling system described above, the compounds described herein
can be tested for prevention, treatment, and/or amelioration of
cardiac fibrosis and cardiac ECM remodeling.
Example 24
Animal Model for Lung Fibrosis and ECM Remodeling
[0395] Bleomycin induced pulmonary fibrosis is a standard model for
assessment of lung fibrogenesis including IPF, Interstitial
Pneumonia, and ARDS. Male Wistar rats are housed and handled as per
animal handling guidelines and protocols. Treatment group size,
regimens, and controls are established based on previously
identified doses and administration time-points for LOX/LOXL
inhibitors. Rats are intra-tracheally injected with bleomycin at
established dosages (typically 5 mg/kg). Control animals are
maintained throughout the treatment period.
[0396] Following administration of bleomycin, test groups are then
administered the predetermined LOX/LOXL inhibitor and monitored
and/or sacrificed at pre-determined time-points for assessment of
lung fibroses. Test periods can vary, with an exemplary test period
being 4 weeks. Following sacrifice, rat lungs are examined for
fibrosis and collagen content. Rat lung sections are stained and
examined via established staining procedures and microscopy for the
presence and extent of fibrosis. Additionally, collagen content of
the rat lungs is determined via established assays such as a
hydroxyproline assay.
[0397] Utilizing an animal model system such as the
bleomycin-induced lung fibrosis animal model described above, the
compounds described herein can be tested for prevention, treatment,
and/or amelioration of lung fibroses.
Sequence CWU 1
1
59116PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Ser Arg Val Asp Gly Met Val Gly Asp Asp Pro Tyr
Asn Pro Tyr Lys 1 5 10 15 215PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 2Asp Thr Tyr Glu Arg Pro Arg
Pro Gly Gly Arg Tyr Arg Pro Gly 1 5 10 15 324PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 3Arg
Arg Leu Leu Arg Phe Ser Ser Gln Ile His Asn Asn Gly Gln Ser 1 5 10
15 Asp Phe Arg Pro Lys Asn Gly Arg 20 414PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 4Glu
Asp Thr Ser Cys Asp Tyr Gly Tyr His Arg Arg Phe Ala 1 5 10
514PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 5Glu Asp Thr Glu Cys Glu Gly Asp Ile Gln Lys Asn
Tyr Glu 1 5 10 621PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 6Asp Pro Tyr Tyr Ile Gln Ala Ser Thr Tyr
Val Gln Lys Met Ser Met 1 5 10 15 Tyr Asn Leu Arg Cys 20
721PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 7Asn Ala Glu Met Val Gln Gln Thr Thr Tyr Leu Glu
Asp Arg Pro Met 1 5 10 15 Phe Met Leu Gln Cys 20 814PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 8Gly
Ser Gln Tyr Gly Pro Gly Arg Arg Arg Asp Pro Gly Ala 1 5 10
911PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 9Trp Glu Trp His Ser Cys His Gln His Tyr His 1 5
10 1011PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 10Trp Glu Trp His Ser Cys His Gln His Tyr His 1 5
10 1111PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 11Trp Ile Trp His Asp Cys His Arg His Tyr His 1 5
10 1211PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 12Trp Val Trp His Glu Cys His Gly His Tyr His 1 5
10 1311PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 13Trp Val Trp His Gln Cys His Arg His Tyr His 1 5
10 1417PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 14Asp Ile Asp Cys Gln Trp Ile Asp Ile Thr Asp Val
Lys Pro Gly Asn 1 5 10 15 Tyr 1517PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 15Asp Ile Asp Cys Gln Trp
Ile Asp Ile Thr Asp Val Gln Pro Gly Asn 1 5 10 15 Tyr
1617PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 16Asp Ile Asp Cys Gln Trp Val Asp Ile Thr Asp Val
Pro Pro Gly Asp 1 5 10 15 Tyr 1717PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 17Asp Ile Asp Cys Gln Trp
Ile Asp Ile Thr Asp Val Lys Pro Gly Asn 1 5 10 15 Tyr
1817PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 18Asp Ile Asp Cys Gln Trp Val Asp Ile Thr Asp Val
Gly Pro Gly Asn 1 5 10 15 Tyr 1910PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 19Thr Ala Pro Asp Leu Val
Leu Asn Ala Glu 1 5 10 2025RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 20auaacagcca
ggacucaauc ccugu 252120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 21cttgactggg gaagggtctg
202220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22aaaacggggc tcaaatcacg 202324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
23atcccaccct tggcattgct tggt 242420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24agcagacttc ctccccaacc 202522DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 25cagtaggtcg tagtggctga ac
222623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 26cacggcacac ctgggagtgg cac 232720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27ggggtttgtc cacagagctg 202820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 28acgtgtcact ggagaagagc
202924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 29tggagcagca ccaagagcca gtct 243020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30gtgtgcgaca aaggctggag 203120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 31ccgcgttgac cctcttttcg
203223DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 32aagcccagca tcccgcagac cac 233323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33cttaccacac acatgggtgt ttc 233422DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 34tcaagcactc cgtaactgtt gg
223524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 35ccttggaagc acagacctcg ggca 243619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36ccggctgctc agaagatac 193723DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 37ttcaggtaca ggctgtgata cat
233826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 38tggcgatcga tcttcttaga ttcacg 263921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39caagagggaa gcagagcctt c 214024DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 40gcaccttctg aatgtaagag
tctc 244124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 41accaaggagc acgcaccaca acga 244220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
42ggccttcgcc accacctatc 204322DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 43gtagtacacg tagccctgtt cg
224424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 44ccagccatcc tcctacccgc agca 244522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
45gctatgtaga ggccaagtcc tg 224620DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 46cagtgacacc ccagccattg
204724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 47tcctcctacg gtccaggcga aggc 244824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
48gcaaggagag aatagacaga gaag 244924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49agcatggtgt cctcattcat aaag 245024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
50acatccaccc atcccatccc accc 245124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51caagacaggt ccagtagagt tagg 245223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52aggtcttata ccacctgagc aag 235324DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 53acagagcaca gccgcctcac tgga
245421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 54agaaggtgac ctggatgaga a 215522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
55tgatacatat ggcggtcaat ct 225627DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 56cttctcagga gataccggga
atccaag 275711PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 57Gly Gly Gly Gly Glu Lys Gly Gly Gly
Gly Gly 1 5 10 585PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 58Thr Ala Pro Asp Leu 1 5
596PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 6xHis tag 59His His His His His His 1 5
* * * * *