U.S. patent application number 14/281765 was filed with the patent office on 2014-11-20 for treatment of amd using aav sflt-1.
This patent application is currently assigned to Avalanche Australia Pty Ltd.. The applicant listed for this patent is Avalanche Australia Pty Ltd.. Invention is credited to Thomas W. Chalberg, JR., Ian J. Constable, Chooi-May Lai, Elizabeth P. Rakoczy.
Application Number | 20140341977 14/281765 |
Document ID | / |
Family ID | 49584435 |
Filed Date | 2014-11-20 |
United States Patent
Application |
20140341977 |
Kind Code |
A1 |
Constable; Ian J. ; et
al. |
November 20, 2014 |
TREATMENT OF AMD USING AAV SFLT-1
Abstract
The present disclosure provides compositions and methods for the
prevention or treatment of ocular neovascularization, such as AMD,
in a human subject, by administering subretinally a pharmaceutical
composition comprising a pharmaceutically effective amount of a
vector comprising a nucleic acid encoding soluble Fms-related
tyrosine kinase-1 (sFlt-1) protein to the human subject.
Inventors: |
Constable; Ian J.; (Mosman
Park, AU) ; Rakoczy; Elizabeth P.; (Scarborough,
AU) ; Lai; Chooi-May; (Waterford, AU) ;
Chalberg, JR.; Thomas W.; (Redwood City, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Avalanche Australia Pty Ltd. |
Southbank |
|
AU |
|
|
Assignee: |
Avalanche Australia Pty
Ltd.
Southbank
AU
|
Family ID: |
49584435 |
Appl. No.: |
14/281765 |
Filed: |
May 19, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13889275 |
May 7, 2013 |
|
|
|
14281765 |
|
|
|
|
61647461 |
May 15, 2012 |
|
|
|
61670535 |
Jul 11, 2012 |
|
|
|
61678555 |
Aug 1, 2012 |
|
|
|
61691660 |
Aug 21, 2012 |
|
|
|
61775440 |
Mar 8, 2013 |
|
|
|
Current U.S.
Class: |
424/450 ;
424/93.2; 435/235.1; 435/320.1; 514/44R; 536/23.2 |
Current CPC
Class: |
A61K 2039/505 20130101;
C07K 2319/32 20130101; C12N 2750/14143 20130101; C07K 2317/24
20130101; A61K 35/761 20130101; C12Y 207/10 20130101; C12N 7/00
20130101; A61P 27/02 20180101; A61P 9/00 20180101; C12N 2710/14044
20130101; A61K 45/06 20130101; A61K 48/0075 20130101; C12N
2750/14141 20130101; A61P 9/14 20180101; A61K 38/45 20130101; C07K
16/081 20130101; C12Y 207/10001 20130101; C07K 16/22 20130101; C07K
2317/73 20130101; C07K 14/71 20130101; A61K 38/179 20130101; A61K
48/00 20130101; A61B 3/032 20130101; A61K 9/0048 20130101; C12N
15/86 20130101; C12N 2750/14171 20130101; A61K 31/7088 20130101;
A61P 3/10 20180101; C07K 2317/55 20130101; C12N 9/12 20130101; A61P
27/10 20180101; C12Y 207/10002 20130101; A61P 9/10 20180101; C12N
2750/14142 20130101; A61P 43/00 20180101; A61K 49/0004 20130101;
A61K 31/7088 20130101; A61K 2300/00 20130101; A61K 38/45 20130101;
A61K 2300/00 20130101; A61K 38/179 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
424/450 ;
424/93.2; 514/44.R; 435/235.1; 536/23.2; 435/320.1 |
International
Class: |
A61K 35/76 20060101
A61K035/76; C12N 9/12 20060101 C12N009/12 |
Claims
1-41. (canceled)
42. A method for the treatment or prophylaxis of ocular
neovascularization in a human subject having or at risk for
developing ocular neovascularization, the method comprising:
administering to the retina of the human subject a pharmaceutically
effective amount of a pharmaceutical composition comprising a
nucleic acid encoding sFLT-1.
43. The method of claim 42, wherein the ocular neovascularization
is associated with a condition selected from the group consisting
of: age-related macular degeneration (AMD), retinal
neovascularization, choroidal neovascularization, diabetic
retinopathy, retinal vein occlusion, diabetic macular edema,
diabetic retinal ischemia, ischemic retinopathy and diabetic
retinal edema.
44. The method of claim 43, wherein the condition is AMD.
45. The method of claim 42, wherein the pharmaceutical composition
comprises a recombinant virus, the virus selected from the group
consisting of: adeno-associated virus (AAV), adenovirus,
helper-dependent adenovirus, retrovirus, herpes simplex virus,
lentivirus, poxvirus, hemagglutination virus of Japan-liposome
(HVJ) complex, Moloney murine leukemia virus, and HIV-based
virus.
46. The method of claim 45, wherein the virus is AAV.
47. The method of claim 1, wherein the sFLT-1 nucleic acid encodes
at least 1 dimerization domain.
48. The method of claim 42, wherein a reduction in
neovascularization, as observed by a Fluorscein Angiography (FA),
follows the administering of the pharmaceutical composition.
49. The method of claim 42, wherein no superficial, anterior
segment or vitreous inflammatory signs are present in the human
subject at least 1 week after injection.
50. The method of claim 42, wherein the human subject has received
one or more treatments with a VEGF inhibitor prior to the
administering of the pharmaceutical composition.
51. The method of claim 42, wherein the human subject has not
previously received treatment with a VEGF inhibitor before the
administering of the pharmaceutical composition.
52. The method of claim 42, wherein the human subject does not
require treatment with a VEGF inhibitor for at least 30 days after
the administering of the pharmaceutical composition.
53. The method of claim 42, wherein the administering of the
pharmaceutical composition is performed at a frequency less than 3
times a year in the human subject.
54. The method of claim 42, further comprising removing vitreous
gel prior to or within one week of the administering of the
pharmaceutical composition.
55. The method of claim 42, wherein said removing comprises the use
of a vitrectomy system comprising a cannula having a 20-27 gauge
bore size.
56. The method of claim 42, wherein said pharmaceutical composition
is administered using a cannula having a 27-45 gauge bore size.
57. A pharmaceutical composition comprising recombinant viruses or
plasmids comprising a nucleic acid comprising at least 1 promoter
sequence operatively linked to an sFLT-1 transgene sequence,
wherein the promoter sequence and the sFLT-1 transgene sequence are
separated by a UTR sequence.
58. The pharmaceutical composition of claim 57, wherein the
promoter sequence and the sFLT-1 transgene sequence are separated
by a sequence greater than 300 base pairs.
59. The pharmaceutical composition of claim 57, wherein the nucleic
acid sequence comprises at least 3 linker sequences each comprising
at least 50 base pairs.
60. A pharmaceutical composition comprising nucleic acid elements
in the following order: a. a promoter sequence selected from the
group consisting of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ
ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8,
SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID
No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17,
SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID
No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26,
SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID
No. 31 and SEQ ID No. 32; b. a sequence encoding a VEGF inhibitor
selected from the group consisting of SEQ ID No. 102, SEQ ID No.
103, SEQ ID No. 104, SEQ ID No. 105, SEQ ID No. 106, SEQ ID No.
107, SEQ ID No. 108 and SEQ ID No. 122; c. an intron sequence
consisting of SEQ ID No. 48, SEQ ID No. 115, SEQ ID No. 116, SEQ ID
No. 117, SEQ ID No. 118, SEQ ID No. 119 and SEQ ID No. 120; d. a
UTR sequence selected from the group consisting of SEQ ID No. 91,
SEQ ID No. 2, SEQ ID No. 92, SEQ ID No. 93, SEQ ID No. 94, SEQ ID
No. 95, SEQ ID No. 96, SEQ ID No. 97, SEQ ID No. 98, SEQ ID No. 99,
SEQ ID No. 100, and SEQ ID No. 101; and e. a termination sequence
selected from the group consisting of SEQ ID No. 49, SEQ ID No. 50,
SEQ ID No. 51, SEQ ID No. 52, SEQ ID No. 53, SEQ ID No. 54, and SEQ
ID No. 55.
61. A unit dose of a pharmaceutical composition comprising
recombinant viruses of 1.times.10.sup.6 to about 1.times.10.sup.15
vector genomes, wherein the recombinant viruses comprise a nucleic
acid encoding sFLT-1 operatively linked to a promoter.
Description
[0001] This application is a Continuation application of U.S.
patent application Ser. No. 13/889,275 filed on May 7, 2013; which
application claims priority under 35 USC .sctn.119(e) to U.S.
Provisional Application No. 61/647,461, filed May 15, 2012, U.S.
Provisional Application No. 61/670,535, filed Jul. 11, 2012, U.S.
Provisional Application No. 61/678,555, filed Aug. 1, 2012, U.S.
Provisional Application No. 61/775,440, filed Mar. 8, 2013, each of
which are incorporated by reference in their entirety.
SEQUENCE LISTING
[0002] This application contains a Sequence Listing which has been
submitted in ASCII format via EFS-Web and is hereby incorporated by
reference in its entirety. Said ASCII copy, created on Jun. 14,
2013, is named 43016-702.201_SL.txt and is 86,152 bytes in
size.
BACKGROUND OF THE DISCLOSURE
[0003] Age-related macular degeneration (AMD) is one of the leading
causes of vision irreversible damage in people over the age of 50
years. AMD is clinically divided into two types as "dry" and "wet".
The wet form of AMD may develop rapidly and often results in
blindness. The pathological changes of the disease may cause severe
visual impairment. The manifestations of AMD may include, but is
not limited to retinal pigment epithelial cells (RPE) dysfunction
and choroidal neovascularization (CNV) in the macular area. Fluid
leakage, RPE or neural epithelial detachment and bleeding from
ruptured blood vessels can occur in severe cases. It has been found
that many cellular factors play important roles in regulation in
CNV generation, among which may include but are not limited to
vascular endothelial growth factor (VEGF), VEGF receptor (VEGFR),
platelet-derived growth factor (PDGF), hypoxia inducible factor
(HIF), angiopoietin (Ang) and other cytokines, mitogen-activated
protein kinases (MAPK) and others.
[0004] One currently approved treatment for wet AMD is
Lucentis.RTM.. Lucentis.RTM. is an anti-angiogenesis agent and
targets all isoforms of Vascular Endothelial Growth Factor (VEGF).
Clinical studies have shown improved or stable vision in
approximately 95% of patients administered Lucentis.RTM., compared
to approximately 60% of the patients who received sham treatment.
Although Lucentis.RTM. is the first approved agent to improve
vision it requires intravitreal administrations every 4 weeks for
optimal visual benefit. Eylea.RTM. is another VEGF inhibitor that
has been approved to treat wet AMD. Eylea.RTM. also requires
frequent intravitreal injections every 4-8 weeks for optimal visual
benefit. Intravitreal routes of administration may increase risks
for serious complications such as infectious endophthalmitis and
retinal detachment, for which cumulative risk increases with
repeated administrations. Increased intraocular pressure, traumatic
cataract, and retinal tears have also been reported. Finally, with
a treatment that is delivered by an ophthalmologist, treatment
frequency determines the burden to the patient, physician, and
health system in general and to the extent possible should be
reduced. The limitations of currently available therapy for CNV
secondary to AMD have created a need in the art for alternative
approaches which address the high frequency of treatments required
and the invasiveness of the treatment procedure. Neovascularization
involving VEGF elevation can also lead to other ocular pathologies,
such as diabetic retinopathy, diabetic macular edema (DME), and
retinal vein occlusions (RVO). These diseases lead to retinal
neovascularization and vision loss. VEGF inhibitors such as
Lucentis.RTM. have demonstrated efficacy in DME and RVO, and, like
with wet AMD, require frequent intravitreal administration in order
to maintain benefit.
SUMMARY OF THE DISCLOSURE
[0005] The present disclosure provides compositions and methods for
treating CNV, such as found in the wet form of AMD, in a human
subject.
[0006] In one aspect, the present disclosure provides compositions
and methods for treating AMD in a human subject, comprising:
administering subretinally a pharmaceutical composition comprising
a pharmaceutically effective amount of a VEGF inhibitor to a human
subject in need of treatment for AMD. In one aspect, the
pharmaceutical composition comprises a recombinant virus. In
another aspect, the VEGF inhibitor comprises a nucleic acid
encoding soluble Fms-related tyrosine kinase-1 (sFLT-1)
protein.
[0007] In one aspect, the present disclosure provides compositions
and methods for the prevention of CNV in human subjects with AMD,
comprising: administering subretinally a pharmaceutical composition
comprising a pharmaceutically effective amount of a recombinant
virus comprising a nucleic acid encoding soluble Fms-related
tyrosine kinase-1 (sFLT-1) protein to a human subject in need of a
treatment for AMD.
[0008] In some aspects, the virus is selected from adeno-associated
virus (AAV), helper-dependent adenovirus, retrovirus, herpes
simplex virus, lentivirus, poxvirus, hemagglutination virus of
Japan-liposome (HVJ) complex, Moloney murine leukemia virus, and
HIV-based virus. In some aspects, the AAV capsid or inverted
terminal repeats (ITRs) is selected from the group consisting of:
AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11,
AAV12, rh10, and hybrids thereof.
[0009] In some aspects, the recombinant virus comprises a promoter
selected from cytomegalovirus (CMV) promoter, Rous sarcoma virus
(RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter,
chicken beta-actin promoter, CAG promoter, RPE65 promoter and opsin
promoter.
[0010] In some aspects, the recombinant virus comprises an
enhancer.
[0011] In some aspects, the recombinant virus comprises an intron
or chimeric intron.
[0012] In some aspects, the recombinant virus comprises a SV40 poly
A sequence.
[0013] In some aspects, the recombinant virus comprises a human
sFlt-1 protein or a functional fragment thereof.
[0014] In some aspects, the recombinant virus is generated from a
plasmid comprising either an ampicillin resistance marker or a
non-ampicillin resistance marker.
[0015] In some aspects, the recombinant virus comprises bacterial
regulatory sequences such as a T7 RNA polymerase promoter.
[0016] In some aspects, the recombinant virus lacks bacterial
regulatory sequences such as a T7 RNA polymerase promoter.
[0017] In some aspects, the recombinant virus comprises a
regulatory nucleic acid fragment that is capable of directing
selective expression of the sFlt-1 protein or a functional fragment
thereof in an eye cell.
[0018] In some aspects, the pharmaceutical composition comprises
about 1.times.10.sup.6 to about 1.times.10 recombinant viral vector
genomes, about 1.times.10.sup.7 to about 1.times.10.sup.14
recombinant viral vector genomes, about 1.times.10.sup.8 to about
1.times.10.sup.13 recombinant viral vector genomes, about
1.times.10.sup.9 to about 3.times.10.sup.12 recombinant viral
vector genomes, or about 1.times.10.sup.10 to about
3.times.10.sup.12 recombinant viral vector genomes.
[0019] In some aspects, the pharmaceutical composition is
administered via subretinal injection.
[0020] In some aspects, the method further comprises administering
to the human subject a pharmaceutically effective amount of a VEGF
inhibitor. In some aspects, the VEGF inhibitor comprises an
antibody against VEGF or a functional fragment thereof. In some
aspects, the VEGF inhibitor comprises ranibizumab. In some aspects,
the pharmaceutical composition is administered at least 5, 6, 7, or
8 days after the administering the VEGF inhibitor. In some aspects,
the pharmaceutical composition is administered within 30, 60, or 90
days of administering the VEGF inhibitor.
[0021] In some aspects, the VEGF inhibitor is administered for 1
time prior to administering the pharmaceutical composition
comprising the recombinant virus and 1 to 2 times following
administration.
[0022] In some aspects, the VEGF inhibitor is administered for at
least 2 times prior to administering the pharmaceutical composition
and 1 to 2 times following administration. In some aspects, the
VEGF inhibitor is administered over a period of 6 to 7 weeks.
[0023] In some aspects the VEGF inhibitor is an anti-VEGF antibody,
such as bevacizumab or ranibizumab. In other aspects the VEGF
inhibitor is a soluble receptor, fusion protein, or fragment
thereof, such as aflibercept or sFLT01.
[0024] In some aspects, the AMD is wet AMD.
[0025] In some aspects, AMD is dry AMD.
[0026] In some aspects, the human subject is at risk for wet
AMD.
[0027] In some aspects, the human subject presents symptoms of
early stage wet AMD.
[0028] In some aspects, at least 3, 5, 10, 15, or 20 treatments of
a different VEGF inhibitor for the treatment of AMD have been
previously administered to said human subject
[0029] In some aspects, best corrected visual acuity (BCVA) did not
improve after said treatment with ranibizumab.
[0030] In some aspects, best corrected visual acuity (BCVA), as
measured by ETDRS (Early Treatment Diabetic Retinopathy Study)
letters, improves by more than 1 line after said treatment with
ranibizumab.
[0031] In some aspects, human subject presents symptoms of early
stage dry AMD.
[0032] In some aspects, treatment is administered at a frequency of
at least biannually.
[0033] In some aspects, administering step is carried out in said
human subject where the subject is age 20, 40, 50, 55, or 65 years
or older.
[0034] In some aspects, administration is to a site outside the
fovea.
[0035] In some aspects, administration is to one or more cells of
the subretinal space of the central retina.
[0036] In some aspects, administration is to one or more cells of
the outer macula.
[0037] In some aspects, administration is to one or more cells of
the inner macula.
[0038] In some aspects, administration is to retinal pigment
epithelial cells.
[0039] In some aspects, administration does not adversely affect
central retinal function or central retinal structure.
[0040] In some aspects, administration does not increase systemic
levels of VEGF inhibitor in the human subject.
[0041] In some aspects, administration does not increase systemic
levels of sFlt-1 in the human subject.
[0042] In some aspects, administering step is carried out
simultaneously, or sequentially in both eyes
[0043] In some aspects, administering step is carried out in one
eye.
[0044] In some aspects, administering step is carried out in one
eye when fellow eye presents symptoms of AMD.
[0045] In some aspects, administering step is carried out in a
human subject resistant to penicillin.
[0046] In some aspects, administering step is carried out in a
human subject sensitive to penicillin.
[0047] In some aspects, administering step is carried out in a
human subject allergic to penicillin.
[0048] In some aspects, administering step is carried out in a
human subject not allergic to penicillin.
[0049] In some aspects, administering step causes no inflammation
of the vitreous is observed by biomicroscopy (BE) and indirect
opthalmoscopy (IOE) following the administering step.
[0050] In some aspects, administering step does not cause a
cytotoxic T cell.
[0051] In some aspects, administering step does not cause a
cytotoxic T cell response a measure by in increase in cytotoxic T
cells of less than 10% greater than the baseline range.
[0052] In some aspects, T cells do not display an activated
effector phenotype following the administering step.
[0053] In some aspects, best corrected visual acuity (BCVA)
improves by 1, 2, 3, 4 or 5 lines or more, as measured by ETDRS
(Early Treatment Diabetic Retinopathy Study) letters, following the
administering step.
[0054] In some aspects, reduction in neovascularization is observed
using Fluorscein Angiography (FA) following the administering
step
[0055] In some aspects, frequency of administration of ranibizumab
is reduced to less than 12 doses per year. In some aspects,
frequency of administration of aflibercept is reduced to less than
6 doses per year.
[0056] In some aspects, ranibizumab or aflibercept or other VEGF
inhibitor is administered with reduced frequency or no longer
administered.
[0057] In some aspects, the virus comprises a sFLT-1 gene or a
functional fragment thereof with >90% sequence homology to the
human sFLT-1 gene sequence.
[0058] In some aspects, the virus administered comprises a sFLT-1
gene, gene variant or gene fragment.
[0059] In some aspects, no vector is detected in the human
subject's tear, blood, saliva or urine samples 7, 14, 21 or 30 days
after administering the pharmaceutical composition.
[0060] In some aspects, the presence of the viral vector is
detected by qPCR or ELISA.
[0061] In some aspects, the sFLT-1 protein levels in the vitreous
of the human subject is about 500-5,000 pg/ml, about 600-4,000
pg/ml, about 800-3,000 pg/ml about 900-2,000 pg/ml, or about
1,000-1,800 pg/ml 7, 14, 21 or 30 days after administering the
pharmaceutical composition. In some aspects, the sFlt-1 protein
level, which may also be called the sFlt-1 protein concentration,
in the vitreous of the human subject is elevated at 7, 14, 31, 30,
60, 90, 180, 270 and 365 days after administering the
pharmaceutical composition.
[0062] In some aspects, the human subject shows no clinically
significant retinal toxicity as assessed by serial ophthalmic
examinations over least a two months period.
[0063] In some aspects, no superficial, anterior segment or
vitreous inflammatory signs are present in the human subject over
least a two months period.
[0064] In some aspects, the human subject does not require rescue
treatment with a VEGF inhibitor at least 120 days post
administering the recombinant viruses. In some aspects, the human
subject does not require rescue treatment with a VEGF inhibitor at
least 180 days or at least 210 days post administering the
recombinant viruses. In some aspects, the human subject does not
require rescue treatment with a VEGF inhibitor for at least 270
days after administering the recombinant viruses. In some aspects,
the human subject does not require rescue treatment with a VEGF
inhibitor for at least 365 days after administering the recombinant
viruses.
[0065] In some aspects, there is no evidence of visual acuity loss,
IOP elevation, retinal detachment, or any intraocular or systemic
immune response in said human subject at least 180 days or at least
210 days post said administering the recombinant viruses. In some
aspects, there is no evidence of visual acuity loss, IOP elevation,
retinal detachment, or any intraocular or systemic immune response
in said human subject at least 365 days after administering the
recombinant viruses.
[0066] In another aspect, the present disclosure provides a
pharmaceutical composition comprising about 1.times.10.sup.6 to
about 1.times.10.sup.15 recombinant viruses, wherein each of the
recombinant virus comprises a nucleic acid encoding soluble
Fms-related tyrosine kinase-1 (sFlt-1) protein.
[0067] In some aspects, the disclosure provides for a method for
the treatment or prophylaxis of ocular neovascularization in a
human subject comprising: administering to one or more subretinal
sites a pharmaceutically effective amount of a pharmaceutical
composition comprising a nucleic acid encoding sFLT-1 to a human
subject in need of treatment.
[0068] In some aspects, the disclosure provides for a human subject
that has or is suspected of having one or more conditions selected
from the group consisting of: age-related macular degeneration
(AMD), wet-AMD, dry-AMD, retinal neovascularization, choroidal
neovascularization and diabetic retinopathy. In some cases the
human subject has or is suspected of having one or more conditions
selected from the group consisting of: proliferative diabetic
retinopathy, retinal vein occlusion, central retinal vein
occlusion, branched retinal vein occlusion, diabetic macular edema,
diabetic retinal ischemia, ischemic retinopathy and diabetic
retinal edema.
[0069] In some aspects, the disclosure provides for a
pharmaceutical composition comprising a recombinant virus, the
virus selected from the group consisting of: adeno-associated virus
(AAV), adenovirus, helper-dependent adenovirus, retrovirus, herpes
simplex virus, lentivirus, poxvirus, hemagglutination virus of
Japan-liposome (HVJ) complex, Moloney murine leukemia virus, and
HIV-based virus.
[0070] In some aspects, the disclosure provides for a nucleic acid
encoding the sFLT-1 which is operatively linked to a promoter
selected from the group consisting of: cytomegalovirus (CMV)
promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1
alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG
promoter, RPE65 promoter and opsin promoter.
[0071] In some aspects, the disclosure provides sFLT-1 nucleic
acid, wherein the sFLT-1 encodes at least 1 dimerization domain. In
some cases the sFLT-1 nucleic acid does not contain a prokaryotic
regulatory sequence. In some cases the sFLT-1 nucleic acid does
contain a prokaryotic regulatory sequence.
[0072] In some aspects, the disclosure provides for a
pharmaceutical composition comprising a virus or a plasmid.
[0073] In some aspects, the disclosure provides for administration
of one or more treatments of a VEGF inhibitor to the human subject.
In some cases the VEGF inhibitor is administered within 30, 90, or
180 days of administration of the pharmaceutical composition. In
some cases the pharmaceutical composition of the disclosure and
VEGF inhibitor are administered at least 24 hours apart.
[0074] In some aspects, the disclosure provides for a
pharmaceutical composition administered to a human subject at least
55 years old.
[0075] In some aspects, the disclosure provides for administering
the pharmaceutical composition outside the fovea.
[0076] In some aspects, the disclosure provides for the best
corrected visual acuity (BCVA) of the human subject, to improve by
at least 1, 2, 3, 4 or 5 lines as measured by ETDRS (Early
Treatment Diabetic Retinopathy Study) letters following the
administering of the pharmaceutical composition.
[0077] In some aspects, the disclosure provides for the best
corrected visual acuity (BCVA) to decrease by fewer than 15 letters
as measured by ETDRS (Early Treatment Diabetic Retinopathy Study)
following the administering of the pharmaceutical composition.
[0078] In some aspects, the disclosure provides for administering
the pharmaceutical composition under conditions selected from the
group consisting of: administering the pharmaceutical composition
in one eye, administering the pharmaceutical composition
sequentially in two eyes, and administering the pharmaceutical
composition simultaneously in two eyes.
[0079] In some aspects, the disclosure provides for a reduction in
neovascularization as observed by a Fluorscein Angiography (FA)
follows the administering of the pharmaceutical composition.
[0080] In some aspects, the disclosure provides for no superficial,
anterior segment or vitreous inflammatory signs are present in the
human subject at least 1 week after injection.
[0081] In some aspects, the disclosure provides for no superficial,
anterior segment or vitreous inflammatory signs are present in the
human subject at 1 week or at 3, 6, 9 or 12 months after
administration of the pharmaceutical composition.
[0082] In some aspects, the disclosure provides for the human
subject not to require rescue treatment for at least 30, 60, 90,
120, 180, 270 or 365 days after the administering of the
pharmaceutical composition.
[0083] In some aspects, the disclosure provides for the human
subject to experience no visual acuity loss, IOP elevation, retinal
detachment, intraocular or systemic immune response after
administering the pharmaceutical composition.
[0084] In some aspects, the disclosure provides for no increased
anti-AAV cytotoxic T cell response is measured following the
administering step.
[0085] In some aspects, the disclosure provides for no virus
detected in the human subject's blood, saliva or urine samples, 3,
7, 14, 21 or 30 days after administering the pharmaceutical
composition.
[0086] In some aspects, the disclosure provides for sFLT-1 protein
levels in the vitreous of the human subject to he about 500-5,000
pg/ml, 7, 14, 21, 30, 60, 90, 120, 150, 180, 270 or 365 days after
administering the pharmaceutical composition in the human
subject.
[0087] In some aspects, the disclosure provides for the human
subject to receive one or more treatments with VEGF inhibitors
prior to the administering of the pharmaceutical composition.
[0088] In some aspects, the disclosure provides for the human
subject as resistant to treatment with VEGF inhibitors.
[0089] In some aspects, the disclosure provides for a human subject
who has not previously received a VEGF inhibitor before
administering the pharmaceutical composition.
[0090] In some aspects, the disclosure provides for administering
of the pharmaceutical composition at a frequency less than 3 times
a year in the human subject.
[0091] In some aspects, the disclosure provides for administering
of the pharmaceutical composition to reduce the frequency of
administration of additional VEGF inhibitor treatments in the human
subject.
[0092] In some aspects, the disclosure provides for the
concentration of sFLT-1 protein in the vitreous of the human
subject to be elevated when measured at 7, 14, 21, 30, 60, 90, 120,
150, 180, 270 or 365 days after administering of the pharmaceutical
composition.
[0093] In some aspects, the disclosure provides for a human subject
who has the vitreous gel removed prior to or within one day or one
week of the administration of the pharmaceutical composition.
[0094] In some aspects, the disclosure provides for a
pharmaceutical composition administered using a vitrectomy system
that is smaller than 20 gauge.
[0095] In some aspects, the disclosure provides for a
pharmaceutical composition administered using a vitrectomy system
that does not require sutures.
[0096] In some aspects, the disclosure provides for a
pharmaceutical composition administered using a cannula tip that is
smaller than 39 gauge.
[0097] In some aspects, the disclosure provides for a
pharmaceutical composition followed by gas/fluid exchange in the
vitreous chamber.
[0098] In some aspects, the disclosure provides for the central
retinal thickness of the subject not to increase by more than 50
microns, 100 microns, or 250 microns within 12 months following
treatment with said pharmacological agent.
[0099] In some aspects, the disclosure provides for geographic
atrophy not to progress in the diseased eye of the human subject as
compared to the diseased eyes of untreated human subjects.
[0100] In some aspects, the disclosure provides for a
pharmaceutical composition comprising recombinant viruses or
plasmids comprising a nucleic acid comprising at least 1 promoter
sequence operatively linked to a sFLT-1 transgene sequence. In some
cases the pharmaceutical composition of the disclosure comprises a
promoter sequence and the sFLT-1 transgene sequence separated by a
sequence greater than 300 base pairs. In some cases the
pharmaceutical composition of the disclosure comprises a promoter
sequence and the sFLT-1 transgene sequence separated by a UTR
sequence. In some cases the UTR sequence comprises at least 10 base
pairs. In some cases, the pharmaceutical composition comprises at
least 3 linker sequences each comprising at least 50 base
pairs.
[0101] In some aspects, the disclosure provides for a
pharmaceutical composition, wherein the sFLT-1 nucleic acid encodes
at least 1 dimerization domain.
[0102] In some aspects, the disclosure provides for a
pharmaceutical composition comprising a promoter sequence selected
from the group consisting of SEQ ID No. 17, SEQ ID No. 18, SEQ ID
No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23,
SEQ ID No. 24, SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID
No. 28, SEQ ID No. 29, SEQ ID No. 30, SEQ ID No. 31, SEQ ID No. 32,
SEQ ID No. 33, SEQ ID No. 34, SEQ ID No. 35, SEQ ID No. 36, SEQ ID
No. 37, SEQ ID No. 38, SEQ ID No. 39, SEQ ID No. 340, SEQ ID No.
41, SEQ ID No. 42, SEQ ID No. 43, SEQ ID No. 44, SEQ ID No. 45, SEQ
ID No. 46, and SEQ ID No. 47; a sequence encoding a VEGF inhibitor
selected from the group consisting of SEQ ID No. 102, SEQ ID No.
103, SEQ ID No. 104, SEQ ID No. 105, SEQ ID No. 106, SEQ ID No. 107
and SEQ ID No. 108; an intron sequence consisting of SEQ ID No. 48,
SEQ ID No. 115, SEQ ID No. 116, SEQ ID No. 117, SEQ ID No. 118, and
SEQ ID No. 119; a UTR sequence selected from the group consisting
of SEQ ID No. 91, SEQ ID No. 2, SEQ ID No. 92, SEQ ID No. 93, SEQ
ID No. 94, SEQ ID No. 95, SEQ ID No. 96, SEQ ID No. 97, SEQ ID No.
98, SEQ ID No. 99, SEQ ID No. 100, and SEQ ID No. 101; and a
termination sequence selected from the group consisting of SEQ ID
No. 49, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52, SEQ ID No. 53,
SEQ ID No. 54, and SEQ ID No. 55.
[0103] In some aspects, the disclosure provides for a unit dose of
a pharmaceutical composition comprising recombinant viruses of
1.times.10.sup.6 to 1.times.10.sup.15 vector genomes, wherein the
recombinant viruses comprise a nucleic acid encoding sFLT-1
operatively linked to a promoter. In some cases the unit dose of
the pharmaceutical composition comprises 1.times.10.sup.10 to
3.times.10.sup.12 vector genomes.
[0104] In some aspects, the disclosure provides for a method of
generating a recombinant virus in a cell, the method comprising:
introducing into a cell, a nucleic acid comprising at least 1
promoter sequence operatively linked to an sFLT-1 transgene
sequence, an ITR sequence, and UTR sequence; and purifying the
recombinant virus. In some cases the UTR sequence is a human UTR
sequence. In some cases, the nucleic acid sequence does not contain
a beta-lactam antibiotic resistance sequence. In some cases the
recombinant virus produces sFLT-1 protein in the range of
100-10,000 pg/mL when measured at 72 hours following transduction
of HEK293 cells at a multiplicity of infection (MOI) of
1.times.10.sup.6. In some cases, the recombinant virus inhibits
proliferation of human umbilical vascular endothelial (HUVEC)
cells.
[0105] In some aspects, the disclosure provides for a cell for
generating recombinant viral vector, the cell comprising at least 1
promoter polynucleotide sequence operatively linked to a sFLT-1
transgene sequence, an ITR polynucleotide sequence, and a UTR
polynucleotide sequence.
[0106] In some aspects, the disclosure provides for a nucleic acid
comprising a sequence encoding sFLT-1 for use in treatment or
prophylaxis of ocular neovascularization in a human; wherein said
use comprises administering directly to a human subject in need
thereof, to one or more sub retinal sites in said human subject, an
effective amount of a pharmaceutical composition; wherein said
pharmaceutical composition comprises said nucleic acid.
[0107] In some aspects, the disclosure provides the nucleic acid
for use, wherein said sFLT-1 is an inhibitor of VEGF and wherein
said treating or reducing the likelihood of ocular
neovascularization occurs as a result of VEGF inhibition.
[0108] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the pharmaceutical composition is capable of
elevating levels of sFLT-1 protein in the vitreous of the human
subject after at least 72 hours after administration of said
pharmaceutical composition to said human subject, compared to
levels of sFLT-1 protein in the vitreous of said human prior to
said administration.
[0109] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the nucleic acid comprising said sFLT-1
comprises a recombinant virus, the virus selected from the group
consisting of: adeno-associated virus (AAV), adenovirus,
helper-dependent adenovirus, retrovirus, herpes simplex virus,
lentivirus, poxvirus, hemagglutination virus of Japan-liposome
(HVJ) complex, Moloney murine leukemia virus, and HIV-based
virus.
[0110] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the nucleic acid encoding the sFLT-1 is
operatively linked to a promoter selected from the group consisting
of: cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV)
promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken
beta-actin promoter, CAG promoter, RPE65 promoter and opsin
promoter.
[0111] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the nucleic acid is packaged by a virus or is
plasmid DNA.
[0112] In some aspects, the disclosure provides for the nucleic
acid for use, said use further comprising administration of one or
more additional VEGF inhibitors to the human subject in need of
treatment or reduction, optionally wherein said additional VEGF
inhibitor is ranibizumab or bevacizumab.
[0113] In some aspects, the disclosure provides for the nucleic
acid for use, said use comprising administering said pharmaceutical
composition to a human subject at least 50, 55, or 65 years
old.
[0114] In some aspects, the disclosure provides for the nucleic
acid for use, said use comprising administering said pharmaceutical
composition outside the fovea.
[0115] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the best corrected visual acuity (BCVA) of
the human subject in need of treatment, improves by at least 1, 2,
3, 4 or 5 lines as measured by ETDRS (Early Treatment Diabetic
Retinopathy Study) letters following the administering of an
effective amount of the pharmaceutical composition.
[0116] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the administering of the pharmaceutical
composition is performed at a frequency at least once per 3, 6, 9,
12, 18, or 24 months in a human subject in need of treatment.
[0117] In some aspects, the disclosure provides for the nucleic
acid for use, wherein the administering of the pharmaceutical
composition is performed at a frequency less than 3 times a year in
the human subject or is performed at a frequency reducing the
frequency of administration of additional VEGF inhibitor treatments
in the human subject.
[0118] In some aspects, the disclosure provides for a unit dose of
pharmaceutical composition comprising about 1.times.10.sup.6 to
1.times.10.sup.15 or 1.times.10.sup.10 to 3.times.10.sup.12 vector
genomes. In some aspects, the recombinant viruses comprise a
nucleic acid encoding sFLT-1, or a functional fragment thereof,
operatively linked to a promoter.
[0119] In some aspects, the disclosure provides for a method for
the treatment or prophylaxis of ocular neovascularization in a
human subject comprising: administering to one or more subretinal
sites a pharmaceutically effective amount of a pharmaceutical
composition comprising a nucleic acid encoding a VEGF inhibitor to
a human subject in need of treatment. In some aspects, the VEGF
inhibitor is an anti-VEGF antibody or a functional fragment
thereof. In some aspects, the VEGF inhibitor is a soluble receptor,
fusion protein, or a functional fragment thereof
INCORPORATION BY REFERENCE
[0120] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0121] The novel features of the disclosure are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present disclosure will be obtained
by reference to the following detailed description that sets forth
illustrative aspects, in which the principles of the disclosure are
utilized, and the accompanying drawings of which:
[0122] FIG. 1 depicts the schematic representation of an exemplary
plasmid.
[0123] FIG. 2 depicts expression, secretion and biological activity
of sFLT-1 from rAAV.sflt-1-transduced cells. (a) Western blot
analysis of conditioned media from Ad.sFlt-1-transduced 293 cells
(lane 1), rAAV.sFlt-1-transduced D407 cells (lane 2),
rAAV.sFlt-1-transduced 293 cells (lane 3), and AAV.gfp-transduced
D407 cells (lane 4). (b) Inhibition of VEGF-induced HUVEC
proliferation by conditioned media from rAAV.sFlt-1-transduced
cells. HUVECs were cultured in starvation medium (column 1), in
medium containing recombinant VEGF (column 2), in medium containing
VEGF and 40 .mu.L conditioned medium from rAAV.sFlt-1-transduced
293 cells (column 3), in medium containing VEGF and 80 .mu.L
conditioned medium from rAAV.sFlt-1-transduced 293 cells (column
4), and in medium containing VEGF and 80 .mu.L conditioned medium
from rAAV.gfp-transduced 293 cells (column 5). (*P<0.02,
**P<0.005 for differences between rAAV.sFlt-1 plus VEGF, and
VEGF only.
[0124] FIG. 3A depicts graph showing human sFlt-1 (hsFLT-1)
expression in the vitreous of monkeys injected in the left eyes
with rAAV.sFlt-1 (Monkey 8514, 8530, 8523, 8524 and 999), rAAV.gfp
(Monkey 8297 and 8532), in both eyes with recombinant sFLT-1
protein (Monkey 8294) and control uninjected monkey (control).
Control and monkeys 8294 and 999 were euthanized at 3 months post
injection, Monkey 8524 was euthanized at 9 months post injection
and monkeys 8297, 8532, 8514, 8530 and 8523 were euthanized at 12
months post injection. * denotes sFLT-1 protein levels that are
significantly higher in the rAAV.sFlt-1 injected eyes (p<0.05).
FIG. 3B depicts graphs showing hsFLT-1 levels in the
rAAV.sFlt-1-injected (999, 8524, 8523, 8530 and 8514),
rAAV.gfp-injected (8297 and 8532), recombinant sFlt-1
protein-injected (8294) and uninjected (control) monkeys at
different times post injection.
[0125] FIGS. 4A-4F depict Immune Cell Subset Populations in mouse
eyes following subretinal injection of rAAV-sFlt-1 at the different
times post injection. (A) Total immune cell numbers; (B) CD45
number; (C) CD11b numbers; (D) CD4 numbers; (E) CD8 numbers; (F)
CD19 numbers.
[0126] FIGS. 5A-5E depict Immune Cell Subset Populations in mouse
spleens following subretinal injection of rAAV-sFlt-1 at the
different times post injection. (A) CD45 numbers; (B) CD11b
numbers; (C) CD4 numbers; (D) CD8 numbers; (E) CD19 numbers.
[0127] FIGS. 6A-6B depict IFN-.gamma. production in
mitogen-stimulated CD4+ and CD8+ T cells from rAAV.sFlt-1 mice at
different times post injection. (A) IFN-.gamma. production in
mitogen-stimulated CD4+ cells; (B) IFN-.gamma. production in
mitogen-stimulated CD8+ cells.
[0128] FIGS. 7A to 7D depict various exemplary replication origin
sequences.
[0129] FIGS. 8A to 8F depict the sequences of various exemplary
promoters.
[0130] FIGS. 9A to 9C depict the sequence of various exemplary
introns, poly A sequences, and ITR regions.
[0131] FIGS. 9D to 9F depict the sequence of various exemplary
linker sequences.
[0132] FIGS. 9G to 9H depict the sequence of various exemplary UTR
sequences.
[0133] FIGS. 10A to 10C depict the sequence encoding various
exemplary anti-VEGF proteins.
[0134] FIG. 11A depicts the amino acid sequence of sFLT-1. FIG. 11B
depicts the amino acid sequence of sFLT-1 domain 2, a functional
fragment of sFLT-1. FIG. 11C depicts the nucleotide sequence of
VEGF inhibitor.
[0135] FIGS. 12A to 12B depict the sequences of various exemplary
antibiotic resistance genes.
[0136] FIG. 13 depicts the PK of one exemplary composition
(rAAV.sFlt-1), wherein it reaches optimal anti-VEGF expression at
6-8 weeks. RBZ is a standard care of anti-VEGF, such as
ranibizumab. "RBZ rescue" means rescue treatment.
[0137] FIG. 14 depicts ophthalmologic assessment of the patients.
Inflammation was evaluated by biomicroscopy (BE) and indirect
ophthalmoscopy (JOE). Unrem: unremarkable.
[0138] FIGS. 15A and 15B depict visual acuity results.
[0139] FIG. 16 depicts the measurement of retina thickness of a
patient who was given 24 previous Lucentis injections.
[0140] FIG. 17 depicts biodistribution: qPCR for sFLT-1 sequence
(copy number detected).
[0141] FIG. 18 depicts biodistribution: AAV capsid measured by
ELISA, AAV titer in capsids/mL.
[0142] FIG. 19 depicts biodistribution of sFLT-1 measured by ELISA.
Shown are human sFLT-1 concentration (pg/mL).
[0143] FIGS. 20A and 20B depict OCT assessments of patients
administered with either low dose rAAV.sFlt-1 (R1, R2, R4) or high
dose of rAAV.sFlt-1 (R5, R6 and R8).
[0144] FIGS. 21A and 21B depict visual acuity results of human
subjects treated with rAAV.sFlt-1 vs. untreated control patients at
180 days following treatment.
[0145] FIGS. 22A and 22B depict visual acuity results of human
subjects treated with rAAV.sFlt-1 vs. untreated control patients at
1 year after treatment.
[0146] FIG. 23 depicts a table of human subjects who received
Lucentis rescue injections (VEGF inhibitor readministration) by
week in a clinical study of rAAV.sFlt-1.
[0147] FIG. 24 depicts visual acuity and SD-OCT images by week for
a human subject treated with rAAV.sFlt-1 in a clinical study of
rAAV.sFlt-1.
[0148] FIGS. 25A and 25B depicts data on production of human sFlt-1
protein in human embryonic kidney 293 (HEK293) cells as detected by
ELISA. rAAV.sFlt-1 was produced using plasmid transfection in
HEK293 cells. A second construct, rAAV(bv).sFlt-1, was produced
using recombinant baculovirus in Sf9 insect cells. sFlt-1 protein
concentration was measured via ELISA after 72 at various MOI.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0149] The present disclosure provides compositions and methods for
the prevention or treatment of ocular neovascularization, such as
AMD, in a human subject, by administering subretinally a
pharmaceutical composition comprising a pharmaceutically effective
amount of a vector comprising a nucleic acid encoding soluble
Fms-related tyrosine kinase-1 (sFlt-1) protein to the human
subject.
[0150] Several aspects of the disclosure are described below with
reference to example applications for illustration. It should be
understood that numerous specific details, relationships, and
methods are set forth to provide a full understanding of the
disclosure. One having ordinary skill in the relevant art, however,
will readily recognize that the disclosure can be practiced without
one or more of the specific details or with other methods. The
present disclosure is not limited by the illustrated ordering of
acts or events, as some acts may occur in different orders and/or
concurrently with other acts or events. Furthermore, not all
illustrated acts or events are required to implement a methodology
in accordance with the present disclosure.
[0151] The terminology of the present disclosure is for the purpose
of describing particular cases only and is not intended to be
limiting of compositions, methods and compositions of this
disclosure.
[0152] The compositions and methods of this disclosure as described
herein may employ, unless otherwise indicated, conventional
techniques and descriptions of molecular biology (including
recombinant techniques), cell biology, biochemistry,
immunochemistry and ophthalmic techniques, which are within the
skill of those who practice in the art. Such conventional
techniques include methods for observing and analyzing the retina,
or vision in a subject, cloning and propagation of recombinant
virus, formulation of a pharmaceutical composition, and biochemical
purification and immunochemistry. Specific illustrations of
suitable techniques can be had by reference to the examples herein.
However, equivalent conventional procedures can, of course, also be
used. Such conventional techniques and descriptions can be found in
standard laboratory manuals such as Green, et al., Eds., Genome
Analysis: A Laboratory Manual Series (Vols. I-IV) (1999); Weiner,
et al., Eds., Genetic Variation: A Laboratory Manual (2007);
Dieffenbach, Dveksler, Eds., PCR Primer: A Laboratory Manual
(2003); Bowtell and Sambrook, DNA Microarrays: A Molecular Cloning
Manual (2003); Mount, Bioinformatics: Sequence and Genome Analysis
(2004); Sambrook and Russell, Condensed Protocols from Molecular
Cloning: A Laboratory Manual (2006); and Sambrook and Russell,
Molecular Cloning: A Laboratory Manual (2002) (all from Cold Spring
Harbor Laboratory Press); Stryer, L., Biochemistry (4th Ed.) W.H.
Freeman, N.Y. (1995); Gait, "Oligonucleotide Synthesis: A Practical
Approach" IRL Press, London (1984); Nelson and Cox, Lehninger,
Principles of Biochemistry, 3rd Ed., W.H. Freeman Pub., New York
(2000); and Berg et al., Biochemistry, 5th Ed., W.H. Freeman Pub.,
New York (2002), all of which are herein incorporated by reference
in their entirety for all purposes. Before the present
compositions, research tools and methods are described, it is to be
understood that this disclosure is not limited to the specific
methods, compositions, targets and uses described, as such may, of
course, vary. It is also to be understood that the terminology used
herein is for the purpose of describing particular aspects only and
is not intended to limit the scope of the present disclosure, which
will be limited only by appended claims.
[0153] As used herein, the singular forms "a", "an" and "the" are
intended to include the plural forms as well, unless the context
clearly indicates otherwise. Furthermore, to the extent that the
terms "including", "includes", "having", "has", "with", or variants
thereof are used in either the detailed description and/or the
claims, such terms are intended to be inclusive in a manner similar
to the term "comprising".
[0154] Ranges can be expressed herein as from "about" one
particular value, and/or to "about" another particular value. When
such a range is expressed, another case includes from the one
particular value and/or to the other particular value. Similarly,
when values are expressed as approximations, by use of the
antecedent "about," it will be understood that the particular value
forms another case. It will be further understood that the
endpoints of each of the ranges are significant both in relation to
the other endpoint, and independently of the other endpoint. The
term "about" as used herein refers to a range that is 15% plus or
minus from a stated numerical value within the context of the
particular usage. For example, about 10 would include a range from
8.5 to 11.5. The term "about" also accounts for typical error or
imprecision in measurement of values.
I. AMD
[0155] AMD is the leading cause of blindness in patients over the
age of 50 and it is characterized by progressive degeneration of
the photoreceptors, outer retina, and retinal pigment epithelium at
the macula. The advanced "wet" form (neovascular or exudative) of
AMD is less common, but may frequently cause a rapid and often
substantial loss of central vision in patients. In the wet form of
AMD, choroidal neovascularization forms and develops into a network
of vessels that may grow under and through the retinal pigment
epithelium. As this is accompanied by leakage of plasma and/or
hemorrhage into the subretinal space, there could be severe sudden
loss of central vision if this occurs in the macula.
[0156] The term "AMD" if not otherwise specified, can be either dry
AMD or wet AMD. The present disclosure contemplates treatment or
prevention of AMD, wet AMD and/or dry AMD.
[0157] As is previously known in the art, AMD has been shown to
have no single cause. This highly complex disease may result from
variable contributions including but not limited to age, genetic
predisposition, and environment or combination thereof. In humans,
for example, established epidemiologic risk factors may include but
are not limited to cigarette smoking, diet, female sex, Caucasian
race, and a family history of AMD. Because AMD is rare in
individuals younger than 50 years, the only required risk factor is
age, which implicates the multitude of cellular changes that
accompany normal aging in the pathogenesis of AMD.
[0158] The etiologic complexity of AMD is reflected by the relative
paucity of effective therapies, preventive strategies, and good
animal models with which to study it. Due to the complexity and
incomplete characterization of the disease, AMD is incompletely
modeled in animals. This is in part due to anatomical differences
in animal and primate retinas, as well as the protracted time
needed for the disease to develop. Evidence from human molecular
genetic and animal studies support the notion that altered
homeostasis of a multitude of mechanisms responsible for normal
photoreceptor--RPE physiology can precipitate the disease. At least
on the molecular level, the disease can be explored in animal
models and, in some cases, even in those whose gene defects are not
the primary causes of AMD in humans.
[0159] Previous genetic studies as well as in depth pathological
analysis, reveals that no simple inheritance pattern for AMD, and
no one pathology is common to various AMD animal models. While
nonhuman primate models are known in the art to better approximate
CNV in humans, than mice or rat models, fundamental differences in
retinal anatomy, histology and even genetics of nonhuman primates
yield different species specific pathologies.
[0160] Further, and as describe herein, laser photocoagulation may
be used to induce CNV, one AMD like symptom in animal models. In
some cases, laser treatment ruptures the Bruch's membrane and
evokes a fibrovascular proliferative response that originates in
the choroid. This response is the basis for modeling choroidal
neovascularization in late-stage AMD and was developed in rhesus
and cynomolgus macaques.
[0161] Using an argon laser, spots are kept small and induced with
sufficient power to rupture the Bruch's membrane. This is
funduscopically visible as a bubble at the time of
photocoagulation. Photocoagulation induces thrombosis of choroidal
vessels followed by re-endothelialization 48 hours later and growth
of new vessels into the subretinal space by a week. Because newly
formed vessels are more permeable, neovascular development can be
monitored with fluorescein angiography to assess vessel
leakage.
[0162] Spontaneous neovascular involution (indicated by decreased
fluorescein leakage) commences at approximately 3 to 7 weeks and
then gradually progresses (over a period of approximately 2 to 13
months) until leakage is no longer apparent at the site.
[0163] The extent of new vessel growth compared to poorly
vascularized scarring can be variable in all models and is
influenced by species, location of injury in the retina, and
intensity of the laser beam. The inherent variability in
differences of treatment from species to species further supports
the idea that no one animal model fully recapitulates AMD in
humans.
[0164] Therapies for AMD have changed during the past few years,
with the availability of aptamers, antibodies, and soluble receptor
decoys that bind the protein VEGF. The VEGF protein or VEGF ligand,
has been shown to stimulate the formation of new blood vessels
(i.e. angiogenesis) through binding to cellular receptors,
including the VEGF receptor. As known in the art, anti-VEGF agents
may prevent, to some extent, the neovascularization and
angiogenesis that occurs in wet AMD. Intraocular injection of
Macugen.RTM. or Lucentis.RTM. or Eylea.RTM. (anti-VEGF agents) is
costly, and in most cases the treatment must be repeated every four
to six weeks or every eight weeks in the case of Eylea.RTM.. For
example, Lucentis is a VEGF antibody fragment which costs about
$1950/inj. Monthly. Avastin (VEGF Antibody) is used off label, and
Eylea (VEGF trap) costs about, $1850/inj and is administered every
second month. All of these medicines share common problems of
decreasing pharmacokinetic profile and thus require repeat ocular
injections.
[0165] There is a need in the art for a practical, economically
viable, longer lasting treatment strategy. The disclosure provides
for a novel therapeutic to address some of these needs.
[0166] The present disclosure provides an anti-VEGF molecule, such
as sFLT-1, delivered by any suitable vector, (e.g. recombinant
viral system) to the retina of a human subject having or suspected
of having AMD or related neovascular retinal diseases. In some
cases, sFLT-1 may be potent direct binding protein of VEGF. In some
cases, sFLT-1 may also block or inhibit VEGF activity.
[0167] For example, as known in the art, sFLT-1 (as described
further herein) has been observed to bind to the VEGF protein dimer
with a Kd=10 pM.
[0168] The present invention also provides compositions and methods
related to rAAV mediated gene delivery into the eye. Long term gene
expression in dog eyes (>8 years) has been observed with AAV
based system. sFLT-1 mRNA expression in the retina is maintained at
least for 18 months. Three human trials for Leber's congenital
amarousis have been conducted that demonstrated the safety of an
AAV based delivery system in the context of a retinal degenerative
disease such as LCA.
II. VEGF and Fms-Related Tyrosine Kinase-1 (sFLT-1) Protein
A. VEGF
[0169] Vascular endothelial growth factor (herein referred to as
"VEGF" or "VEGF ligand") is a potent endothelial cell-specific
mitogen that plays a key role in physiological blood vessel
formation. In some cases, VEGF activity results from the binding of
VEGF ligand to one or more VEGF receptors in a cell. The binding of
VEGF ligand to VEGF receptor may have numerous downstream cellular
and biochemical effects, including but not limited to angiogenesis
in tissues. VEGF has been implicated in virtually every type of
angiogenic or neovascular disorder, including those associated with
cancer, ischemia, and inflammation. Additionally, VEGF has been
implicated in eye diseases, including but not limited to ischemic
retinopathy, intraocular neovascularization, age-related macular
degeneration (AMD), wet-AMD, dry-AMD, retinal neovascularization,
diabetic macular edema, diabetic retina ischemia, diabetic retinal
edema, proliferative diabetic retinopathy, retinal vein occlusion,
central retinal vein occlusion, branched retinal vein occlusion.
Further, anti-VEGF treatments, including the compositions and
methods of this disclosure as described herein, may be used in the
treatment of one or more of these diseases described herein.
[0170] Recent data suggests that VEGF is the principal angiogenic
growth factor in the pathogenesis of the wet form of AMD.
[0171] VEGF, a 46-kDa homodimeric glycopeptide, is expressed by
several different ocular cell types including but not limited to
pigment epithelial cells, pericytes, vascular endothelial cells,
neuroglia and ganglion cells., In some cases, VEGF is express in
specific spatial and temporal patterns during retinal development.
In some cases, the human isoforms of VEGF may include proteins of
206, 189, 183, 165, 148, 145, and 121 amino acids per monomer,
however the predominant human VEGF isoforms include but are not
limited to VEGF121, VEGF165, VEGF189 and VEGF206. These proteins
are produced by alternative splicing of the VEGF mRNA and differ in
their ability to bind to heparin and to the specific VEGF receptors
or coreceptors (neuropilins). The domain encoded by exons 1-5 of
the VEGF gene contains information required for the recognition of
the known VEGF receptors KDR/FLK-1 and FLT-1. This domain is
present in all of the VEGF isoforms. VEGF acts via these receptors,
which are high-affinity receptor tyrosine kinases, leading to
endothelial cell proliferation, migration, and increased
vasopermeability.
[0172] VEGF is one of the several factors involved in the complex
process of angiogenesis and has a very high specificity for
vascular endothelial cells. VEGF is a regulator of physiological
angiogenesis during processes such as embryogenesis, skeletal
growth and reproductive function, but it has also been implicated
in pathological angiogenesis associated with disease such as in
cancer, placental disorders and other conditions. The potential
biological effects of VEGF may be mediated by specific fms-like
membrane spanning receptors, FLT-1 and FLK-1/KDR. In some cases,
these naturally occurring binding partners of VEGF may effect
binding of VEGF to VEGF receptors, thus modulating activation of
the VEGF receptor and subsequent downstream pathways.
[0173] As related to cancer, several VEGF inhibitors, including a
humanized monoclonal antibody to VEGF (rhuMab VEGF), an
anti-VEGFR-2 antibody, small molecules inhibiting VEGFR-2 signal
transduction and a soluble VEGF receptor have shown some
therapeutic properties.
[0174] As related to intraocular neovascular diseases, such as
diabetic retinopathy, retinal vein occlusions, or age related
macular degeneration, some VEGF antagonists have shown therapeutic
effects, despite the need for frequent administration.
B. Anti-VEGF
[0175] The recombinant virus of the present disclosure comprises
the sequence encoding an anti-VEGF protein, including, but not
limited to the VEGF-binding proteins or functional fragments
thereof disclosed in U.S. Pat. Nos. 5,712,380, 5,861,484 and
7,071,159 and VEGF-binding fusion proteins disclosed in U.S. Pat.
No. 7,635,474. An anti-VEGF protein may also include the sFLT-1
protein as described herein.
[0176] The recombinant viruses or plasmids of the present
disclosure may comprise the sequence encoding an anti-VEGF protein,
including the naturally occurring protein sFlt-1, as described in
U.S. Pat. No. 5,861,484 and that sequence described by SEQ ID NO:
109. It also includes, but is not limited to functional fragments
thereof, including sequences of sFlt-1 domain 2 or those set forth
in SEQ ID NO: 121, as well as related constructs, such as the
VEGF-binding fusion proteins disclosed in U.S. Pat. No. 7,635,474.
An anti-VEGF protein may also include the sFLT-1 protein as
described herein. These sequences can be expressed from DNA
encoding such sequences using the genetic code, a standard
technique that is understood by those skilled in the art. As can be
appreciated by those with skill in the art, due to the degeneracy
of the genetic code, anti-VEGF protein sequences can be readily
expressed from a number of different DNA sequences.
[0177] "sFlt-1 protein" herein refers to a polypeptide sequence, or
functional fragment thereof, with at least 90%, or more, homology
to the naturally occurring human sFLT-1 sequence, such that the
sFlt-1 protein or polypeptide binds to VEGF and/or the VEGF
receptor. Homology refers to the % conservation of residues of an
alignment between two sequences (e.g. as Naturally occurring human
sFLT-1 protein may include any suitable variants of sFLT-1,
including, but not limited to functional fragments, sequences
comprising insertions, deletions, substitutions, pseudofragments,
pseudogenes, splice variants or artificially optimized sequences.
In some cases, "sFLT-1 protein" may be at least about 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or 100%
homologous to the naturally occurring human sFLT-1 protein
sequence. In some cases, "sFLT-1 protein" may be at most about 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or 100%
homologous to the naturally occurring human sFLT-1 protein
sequence. In some cases, "sFLT-1 protein" may be at least about
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or
100% spatially homologous to the naturally occurring human sFLT-1
protein conformation. In some cases, "sFLT-1 protein" may be at
most about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%,
99.99% or 100% spatially homologous to the naturally occurring
human sFLT-1 protein conformation.
[0178] Further, the soluble truncated form of the VEGF receptor
FLT-1, sFLT-1, is the only known endogenous specific inhibitor of
VEGF. In nature, it is generated by alternative mRNA splicing and
lacks the membrane-proximal immunoglobulin-like domain, the
transmembrane spanning region and the intracellular tyrosine-kinase
domain. Structurally, FLT-1 and sFLT-1 protein may both comprise
multiple functional domains. In some variants, FLT and sFLT
proteins commonly share 6 interlinked domain; 3 domains involved in
dimerization of the protein and 3 domains involved in the binding
of a ligand, such as VEGF.
[0179] sFLT-1 is a soluble truncated form of the FLT-1 and it is
expressed endogenously. As described herein, "soluble" FLT-1, or
sFLT-1 refers to FLT-1 that is not restricted to the cellular
membrane. Unbound sFLT-1 may diffuse freely in extracellular space
or solution.
[0180] sFLT-1 is the only known endogenous specific inhibitor of
VEGF. This interaction is specific and can be competed away with
100-fold excess unlabeled VEGF. In some cases, the angiostatic
activity of sFLT-1 may result from inhibition of VEGF by two
mechanisms: i) sequestration of VEGF, to which it binds with high
affinity, and ii) formation of inactive heterodimers with
membrane-spanning isoforms of the VEGF receptors FLTt-1 and
FLK-1/KDR. As known in the art, in vitro binding assays have
indicate that sFLT-1 binds VEGF with high affinity and may also
inhibit VEGF driven proliferation of human umbilical vein
endothelial cells. In animal models for cancer, sFLT-1 inhibits
tumor growth. In some cases, sFLT-1 may function in a
substoichiometric or dominant negative manner, as excess VEGF in
the extracellular space may be prevented from binding and
subsequently activating the VEGF receptor. These properties of
sFLT-1 have been described in Kendall and Thomas, 1993; Proc Natl
Acad Sci. 90: 10705-10709, which is incorporated herein by
reference in its entirety. As is known in the art, functional
fragments of sFLT-1 can be used in place of the full-length
protein. More specifically, the VEGF binding domain (domain 2), or
alternatively domain 2 of sFLT-1 plus domain 3 from sFLT1, KDR, or
another family member, can be used to bind and inactivate VEGF.
Such functional fragments are described in Wiesmann et al., 1997;
Cell, 91: 695-704, which is incorporated herein by reference in its
entirety. The terms "sFLT-1" and "a functional fragment of sFLT-1"
are equivalent and used here interchangeably.
III. Vectors and Recombinant Viruses
[0181] The compositions and methods of the disclosure provide for
the delivery of a nucleic acid encoding an anti-VEGF (e.g. sFLT-1
proteins) to cells in a human subject or patient in need thereof.
In some cases, delivery of the nucleic acid may be referred to as
gene therapy.
[0182] The composition and methods of the disclosure provide for
any suitable method for delivery of the anti-VEGF nucleic acid
(e.g. sFLT-1). In some cases, delivery of the nucleic acid may be
performed using any suitable "vector" (sometimes also referred to
as "gene delivery" or "gene transfer vehicle). Vector, delivery
vehicle, gene delivery vehicle or gene transfer vehicle, may refer
to any suitable macromolecule or complex of molecules comprising a
polynucleotide to be delivered to a target cell. In some cases, a
target cell may be any cell to which the nucleic acid or gene is
delivered. The polynucleotide to be delivered may comprise a coding
sequence of interest in gene therapy, such as the sFLT-1 gene.
[0183] For example, suitable vectors may include but are not
limited to, viral vectors such as adenoviruses, adeno-associated
viruses (AAV), and retroviruses, liposomes, other lipid-containing
complexes, and other macromolecular complexes capable of mediating
delivery of a polynucleotide to a target cell.
[0184] In some cases, a vector may be an organic or inorganic
molecule. In some cases, a vector may be small molecule (i.e. <5
kD), or a macromolecule (i.e. >5 kD). For example a vector may
include but is not limited to inert, non-biologically active
molecules such as metal particles. In some cases, a vector may be
gold particles.
[0185] In some cases a vector may comprise a biologically active
molecule. For example, vectors may comprise polymerized
macromolecules such as dendrimers.
[0186] In some cases, a vector may comprise a recombinant viral
vector that incorporates one or more nucleic acids. As described
herein, nucleic acids may refer to polynucleotides. Nucleic acid
and polynucleotide may be used interchangeably. In some cases
nucleic acids may comprise DNA or RNA.
[0187] In some cases, nucleic acids may include DNA or RNA for the
expression of sFLT-1. In some cases RNA nucleic acids may include
but are not limited to a transcript of a gene of interest (e.g.
sFLT-1), introns, untranslated regions, termination sequences and
the like. In other cases, DNA nucleic acids may include but are not
limited to sequences such as hybrid promoter gene sequences, strong
constitutive promoter sequences, the gene of interest (e.g.
sFLT-1), untranslated regions, termination sequences and the like.
In some cases, a combination of DNA and RNA may be used.
[0188] As described in the disclosure herein, the term "expression
construct" is meant to include any type of genetic construct
containing a nucleic acid or polynucleotide coding for gene
products in which part or all of the nucleic acid encoding sequence
is capable of being transcribed. The transcript may be translated
into a protein. In some cases it may be partially translated or not
translated. In certain aspects, expression includes both
transcription of a gene and translation of mRNA into a gene
product. In other aspects, expression only includes transcription
of the nucleic acid encoding genes of interest.
[0189] In one aspect, the present disclosure provides a recombinant
virus, such as adeno-associated virus (rAAV) as a vector to mediate
the expression of sFLT-1.
[0190] In some cases, the viral vector of the disclosure may be
measured as pfu (plaque forming units). In some cases, the pfu of
recombinant virus, or viral vector of the compositions and methods
of the disclosure may be about 10.sup.8 to about 5.times.10.sup.10
pfu. In some cases, recombinant viruses of this disclosure are at
least about 1.times.10.sup.8, 2.times.10.sup.8, 3.times.10.sup.8,
4.times.10.sup.8, 5.times.10.sup.8, 6.times.10.sup.8,
7.times.10.sup.8, 8.times.10.sup.8, 9.times.10.sup.8,
1.times.10.sup.9, 2.times.10.sup.9, 3.times.10.sup.10,
4.times.10.sup.9, 5.times.10.sup.9, 6.times.10.sup.9,
7.times.10.sup.9, 8.times.10.sup.9, 9.times.10.sup.9,
1.times.10.sup.10, 2.times.10.sup.10, 3.times.10.sup.10,
4.times.10.sup.10, and 5.times.10.sup.10 pfu. In some cases,
recombinant viruses of this disclosure are at most about
1.times.10.sup.8, 2.times.10.sup.8, 3.times.10.sup.8,
4.times.10.sup.8, 5.times.10.sup.8, 6.times.10.sup.8,
7.times.10.sup.8, 8.times.10.sup.8, 9.times.10.sup.8,
1.times.10.sup.9, 2.times.10.sup.9, 3.times.10.sup.9,
4.times.10.sup.9, 5.times.10.sup.9, 6.times.10.sup.9,
7.times.10.sup.9, 8.times.10.sup.9, 9.times.10.sup.9,
1.times.10.sup.10, 2.times.10.sup.10, 3.times.10.sup.10,
4.times.10.sup.10, and 5.times.10.sup.10 pfu.
[0191] In some cases, the viral vector of the disclosure may be
measured as vector genomes. In some cases, recombinant viruses of
this disclosure are 1.times.10.sup.10 to 3.times.10.sup.12 vector
genomes. In some cases, recombinant viruses of this disclosure are
1.times.10.sup.9 to 3.times.10.sup.13 vector genomes. In some
cases, recombinant viruses of this disclosure are 1.times.10.sup.8
to 3.times.10.sup.14 vector genomes. In some cases, recombinant
viruses of the disclosure are at least about 1.times.10.sup.1,
1.times.10.sup.2, 1.times.10.sup.3, 1.times.10.sup.4,
1.times.10.sup.5, 1.times.10.sup.6, 1.times.10.sup.7,
1.times.10.sup.8, 1.times.10.sup.9, 1.times.10.sup.10,
1.times.10.sup.11, 1.times.10.sup.12, 1.times.10.sup.13,
1.times.10.sup.14, 1.times.10.sup.15, 1.times.10.sup.16,
1.times.10.sup.17, and 1.times.10.sup.18 vector genomes. In some
cases, recombinant viruses of this disclosure are 1.times.10.sup.8
to 3.times.10.sup.14 vector genomes. In some cases, recombinant
viruses of the disclosure are at most about 1.times.10.sup.1,
1.times.10.sup.2, 1.times.10.sup.3, 1.times.10.sup.4,
1.times.10.sup.5, 1.times.10.sup.6, 1.times.10.sup.7,
1.times.10.sup.8, 1.times.10.sup.9, 1.times.10.sup.10,
1.times.10.sup.11, 1.times.10.sup.12, 1.times.10.sup.13,
1.times.10.sup.14, 1.times.10.sup.15, 1.times.10.sup.16,
1.times.10.sup.17, and 1.times.10.sup.18 vector genomes.
[0192] In some cases, the viral vector of the disclosure may be
measured using multiplicity of infection (MOI). In some cases, MOI
may refer to the ratio, or multiple of vector or viral genomes to
the cells to which the nucleic may be delivered. In some cases, the
MOI may be 1.times.10.sup.6. In some cases, the MOI may be
1.times.10.sup.5-1.times.10.sup.7. In some cases, the MOI may be
1.times.10.sup.4-1.times.10.sup.8. In some cases, recombinant
viruses of the disclosure are at least about 1.times.10.sup.1,
1.times.10.sup.2, 1.times.10.sup.3, 1.times.10.sup.4,
1.times.10.sup.5, 1.times.10.sup.6, 1.times.10.sup.7,
1.times.10.sup.8, 1.times.10.sup.9, 1.times.10.sup.10,
1.times.10.sup.11, 1.times.10.sup.12, 1.times.10.sup.13,
1.times.10.sup.14, 1.times.10.sup.15, 1.times.10.sup.16,
1.times.10.sup.17, and 1.times.10.sup.18 MOI. In some cases,
recombinant viruses of this disclosure are 1.times.10.sup.8 to
3.times.10.sup.14 MOI. In some cases, recombinant viruses of the
disclosure are at most about 1.times.10.sup.1, 1.times.10.sup.2,
1.times.10.sup.3, 1.times.10.sup.4, 1.times.10.sup.5,
1.times.10.sup.6, 1.times.10.sup.7, 1.times.10.sup.8,
1.times.10.sup.9, 1.times.10.sup.10, 1.times.10.sup.11,
1.times.10.sup.12, 1.times.10.sup.13, 1.times.10.sup.14,
1.times.10.sup.15, 1.times.10.sup.16, 1.times.10.sup.17, and
1.times.10.sup.18 MOI.
[0193] In some aspects the nucleic acid may be delivered without
the use of a virus (i.e. with a non-viral vector), and may be
measured as the quantity of nucleic acid. Generally, any suitable
amount of nucleic acid may be used with the compositions and
methods of this disclosure. In some cases, nucleic acid may be at
least about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300
pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 .mu.g, 10
.mu.g, 100 .mu.g, 200 .mu.g, 300 .mu.g, 400 .mu.g, 500 .mu.g, 600
.mu.g, 700 .mu.g, 800 .mu.g, 900 .mu.g, 1 ng, 10 ng, 100 ng, 200
ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng, 1 mg,
10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800
mg, 900 mg 1 g, 2 g, 3 g, 4 g, or 5 g. In some cases, nucleic acid
may be at most about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200
pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1
.mu.g, 10 .mu.g, 100 .mu.g, 200 .mu.g, 300 .mu.g, 400 .mu.g, 500
.mu.g, 600 .mu.g, 700 .mu.g, 800 .mu.g, 900 .mu.g, 1 ng, 10 ng, 100
ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng,
1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700
mg, 800 mg, 900 mg, 1 g, 2 g, 3 g, 4 g, or 5 g.
[0194] In some aspects, a self-complementary vector (sc) may be
used. The use of self-complementary AAV vectors may bypass the
requirement for viral second-strand DNA synthesis and may lead to
greater rate of expression of the transgene protein, as provided by
Wu, Hum Gene Ther. 2007, 18(2):171-82, incorporated by reference
herein.
[0195] In some aspects, several AAV vectors may be generated to
enable selection of the most optimal serotype, promoter, and
transgene.
[0196] In some cases, the vector can be a targeted vector,
especially a targeted vector that selectively binds to a specific
cell, such as cancer cells or tumor cells or eye cells. Viral
vectors for use in the disclosure can include those that exhibit
low toxicity to a target cell and induce production of
therapeutically useful quantities of the anti-VEGF protein in a
cell specific manner.
[0197] The compositions and methods of the disclosure provide for
any suitable viral nucleic acid delivery systems including but not
limited to use of at least one of an adeno-associated virus (AAV),
adenovirus, helper-dependent adenovirus, retrovirus, herpes simplex
virus, lentivirus, poxvirus, hemagglutination virus of
Japan-liposome (HVJ) complex, Moloney murine leukemia virus, and
HIV-based virus. Preferably, the viral vector comprises a strong
eukaryotic promoter operably linked to the polynucleotide e.g., a
cytomegalovirus (CMV) promoter.
[0198] Generally, any suitable viral vectors may be engineered to
be optimized for use with the compositions and methods of the
disclosure. For example, viral vectors derived from adenovirus (Ad)
or adeno-associated virus (AAV) may be used. Both human and
non-human viral vectors can be used and the recombinant viral
vector can be altered such that it may be replication-defective in
humans. Where the vector is an adenovirus, the vector can comprise
a polynucleotide having a promoter operably linked to a gene
encoding the anti-VEGF protein and is replication-defective in
humans.
[0199] To combine advantageous properties of two viral vector
systems, hybrid viral vectors may be used to deliver a nucleic acid
encoding a sFLT-1 protein to a target cell or tissue. Standard
techniques for the construction of hybrid vectors are well-known to
those skilled in the art. Such techniques can be found, for
example, in Sambrook, et al., In Molecular Cloning: A laboratory
manual. Cold Spring Harbor, N.Y. or any number of laboratory
manuals that discuss recombinant DNA technology. Double-stranded
AAV genomes in adenoviral capsids containing a combination of AAV
and adenoviral ITRs may be used to transduce cells. In another
variation, an AAV vector may be placed into a "gutless",
"helper-dependent" or "high-capacity" adenoviral vector.
Adenovirus/AAV hybrid vectors are discussed in Lieber et al., J.
Virol. 73:9314-9324, 1999. Retrovirus/adenovirus hybrid vectors are
discussed in Zheng et al., Nature Biotechnol. 18:176-186, 2000.
[0200] Retroviral genomes contained within an adenovirus may
integrate within the target cell genome and effect stable gene
expression.
[0201] Replication-defective recombinant adenoviral vectors can be
produced in accordance with known techniques. See, Quantin, et al.,
Proc. Natl. Acad. Sci. USA, 89:2581-2584 (1992);
Stratford-Perricadet, et al., J. Clin. Invest., 90:626-630 (1992);
and Rosenfeld, et al., Cell, 68:143-155 (1992).
[0202] Additionally preferred vectors may include but are not
limited to viral vectors, fusion proteins and chemical conjugates.
Retroviral vectors include Moloney murine leukemia viruses and
HIV-based viruses. In some cases a HIV-based viral vector may be
used, wherein the HIV-based viral vector comprises at least two
vectors wherein the gag and pol genes are from an HIV genome and
the env gene is from another virus. DNA viral vectors may be used.
These vectors include pox vectors such as orthopox or avipox
vectors, herpesvirus vectors such as a herpes simplex I virus (HSV)
vector [Geller, A. I. et al., J. Neurochem, 64: 487 (1995); Lim,
F., et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed.
(Oxford Univ. Press, Oxford England) (1995); Geller, A. I. et al.,
Proc Natl. Acad. Sci.: U.S.A.: 90 7603 (1993); Geller, A. I., et
al., Proc Natl. Acad. Sci USA: 87:1149 (1990)], Adenovirus Vectors
[LeGal LaSalle et al., Science, 259:988 (1993); Davidson, et al.,
Nat. Genet. 3: 219 (1993); Yang, et al., J. Virol. 69: 2004 (1995)]
and Adeno-associated Virus Vectors [Kaplitt, M. G., et al., Nat.
Genet. 8:148 (1994)], incorporated by reference herein.
[0203] Other viral vectors that can be used in accordance with the
present disclosure include herpes simplex virus (HSV)-based
vectors. HSV vectors deleted of one or more immediate early genes
(IE) are advantageous because they are generally non-cytotoxic,
persist in a state similar to latency in the target cell, and
afford efficient target cell transduction. Recombinant HSV vectors
can incorporate approximately 30 kb of heterologous nucleic
acid.
[0204] Retroviruses, such as C-type retroviruses and lentiviruses,
may also be used in the disclosure. For example, retroviral vectors
may be based on murine leukemia virus (MLV), as provided by Hu and
Pathak, Pharmacol. Rev. 52:493511, 2000 and Fong et al., Crit. Rev.
Ther. Drug Carrier Syst. 17:1-60, 2000, incorporated by reference
herein. MLV-based vectors may contain up to 8 kb of heterologous
(therapeutic) DNA in place of the viral genes. The heterologous DNA
may include a tissue-specific promoter and a anti-VEGF protein
nucleic acid. In methods of delivery to neoplastic cells, it may
also encode a ligand to a tissue specific receptor.
[0205] Additional retroviral vectors may be used including but not
limited to replication-defective lentivirus-based vectors,
including human immunodeficiency (HIV)-based vectors, as provided
by Vigna and Naldini, J. Gene Med. 5:308-316, 2000 and Miyoshi et
al., J. Virol. 72:8150-8157, 1998, incorporated by reference
herein. Lentiviral vectors may be advantageous in that they are
capable of infecting both actively dividing and non-dividing cells.
They may also be highly efficient at transducing human epithelial
cells.
[0206] Lentiviral vectors for use in the disclosure may be derived
from human and non-human (including SIV) lentiviruses. Examples of
lentiviral vectors include nucleic acid sequences required for
vector propagation as well as a tissue-specific promoter operably
linked to an anti-VEGF protein gene. Nucleic acid sequences may
include the viral LTRs, a primer binding site, a polypurine tract,
att sites, and an encapsidation site.
[0207] A lentiviral vector may be packaged into any suitable
lentiviral capsid. The substitution of one particle protein with
another from a different virus is referred to as "pseudotyping".
The vector capsid may contain viral envelope proteins from other
viruses, including murine leukemia virus (MLV) or vesicular
stomatitis virus (VSV). The use of the VSV G-protein yields a high
vector titer and results in greater stability of the vector virus
particles.
[0208] Alphavirus-based vectors, such as those made from semliki
forest virus (SFV) and sindbis virus (SIN), may also be used in the
disclosure. Use of alphaviruses is described in Lundstrom, K.,
Intervirology 43:247-257, 2000 and Perri et al., Journal of
Virology 74:9802-9807, 2000, incorporated by reference herein.
[0209] Recombinant, replication-defective alphavirus vectors may be
advantageous because they are capable of high-level heterologous
(therapeutic) gene expression, and can infect a wide target cell
range. Alphavirus replicons may be targeted to specific cell types
by displaying on their virion surface a functional heterologous
ligand or binding domain that would allow selective binding to
target cells expressing a cognate binding partner. Alphavirus
replicons may establish latency, and therefore long-term
heterologous nucleic acid expression in a target cell. The
replicons may also exhibit transient heterologous nucleic acid
expression in the target cell.
[0210] Pox viral vectors may introduce a gene into the cell's
cytoplasm. Avipox virus vectors may result in only a short term
expression of the gene or nucleic acid. Adenovirus vectors,
adeno-associated virus vectors and herpes simplex virus (HSV)
vectors may be used with the compositions and methods of the
disclosure. The adenovirus vector may result in a shorter term
expression (e.g., less than about a month) than adeno-associated
virus, in some aspects, and may exhibit much longer expression. The
particular vector chosen may depend upon the target cell and the
condition being treated.
[0211] Adeno-associated viruses (AAV) are small non-enveloped
single-stranded DNA viruses. They are non-pathogenic human
parvoviruses and may be dependent on helper viruses, including
adenovirus, herpes simplex virus, vaccinia virus and CMV, for
replication. Exposure to wild-type (wt) AAV is not associated or
known to cause any human pathologies and is common in the general
population, usually occurring in the first decade of life in
association with an adenoviral infection.
[0212] As described herein, "AAV" refers to Adeno-associated virus
"rAAV" refers to a recombinant adeno-associated virus.
[0213] In some cases, the wild-type AAV encodes rep and cap genes.
The rep gene is required for viral replication and the cap gene is
required for synthesis of capsid proteins. Through a combination of
alternative translation start and splicing sites, the small genome
may be able to express four rep and three cap gene products. The
rep gene products and sequences in the inverted terminal repeats
(145 by ITRs, which flank the genome) may be critical in this
process. To date, 11 serotypes of AAV have been isolated. AAV2 may
be used with composition and methods of the disclosure. The
compositions and methods of the disclosure provide for use of any
suitable AAV serotype. In some aspects, the AAV is selected from
the group consisting of: AAV1, AAV2, AAV2.5, AAV3, AAV4, AAV5,
AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, rh10, and hybrids
thereof.
[0214] In some aspects, the present disclosure provides a
recombinant virus comprising a nucleic acid further comprising a
human form of the truncated, soluble VEGF receptor 1 (sFLT-1) and
is named rAAV.sFlt-1. The vector is a recombinant,
replicative-deficient adeno-associated viral (rAAV) vector, of
serotype 2. In another aspect, the vector is a recombinant,
replicative-deficient adeno-associated viral (rAAV) vector, of
serotype 2 named rAAV.sFlt-1.
[0215] AAV2 is the most characterized. rAAV2 has been shown to be
able to mediate long-term transgene expression in the eyes of many
species of animals. In rats, rAAV mediated reporter gene (green
fluorescent protein) was still present at 18 months post injection.
In monkeys, the same reported gene was present at 17 months post
injection. Similarly, high sFLT-1 protein levels were present in
the vitreous of rAAV.sFlt-1 injected monkey eyes at 15 months post
injection.
[0216] rAAV.sFlt-1 has been tested in animal models for intraocular
neovascular disorders. rAAV.sFlt-1 appeared to slow the progression
of neovascularization in animal models of corneal
neovascularization and retinal neovascularization. Interestingly
rAAV-mediated sFlt-1 indicated some inhibition of
neovascularization in a monkey model of choroidal
neovascularization (model for the wet form of age related macular
degeneration or AMD). In this study, the presence of the
rAAV.sFlt-1 construct showed low levels of expression of sFLT-1 in
the eyes of monkeys and, did not affect the well-being or retinal
function of the monkeys. There is no evidence to suggest any safety
issues associated with systemic exposure to rAAV.sFlt-1. The
overall positive findings and lack of toxicity of rAAV vectors in
these studies, as well as the findings with rAAV.sFlt-1 in
mammalian models of choroidal neovascularization/AMD provide
extensive supporting data that the vector has a favorable safety
profile when administered to the eye.
[0217] Despite the ability of rAAV.sFlt-1 to ameliorate certain
symptoms of AMD in the monkey model, sFLT-1 proteins levels are
unexpectedly low in the retina. Expression levels of sFLT-1 driven
by a constitutively active mammalian promoter have been shown in
the art to provide high levels of protein expression in numerous
cell types. While not being bound to theory, multiple possibilities
may exist for this lower than expected expression level. As a large
multi-domain protein, sFLT-1 may be susceptible to premature
proteolytic degradation, poor kinetics of expression, or non
optimal sorting. With respect to the latter, as a secreted protein,
sFLT-1, as expressed recombinantly in cell, enters the secretory
pathway. In retinal cells, including RPE cells, sFLT-1 may be
secreted either apically or basolaterally, depending on either ER
or Golgi apparatus sorting of the protein. In some cases,
non-optimal sorting may secrete the molecule to the undesired
basolateral membrane, thus decreasing the concentration of sFLT-1
molecules available to inhibit VEGF signaling and neovascular
angiogenesis on the apical surface of the RPE cell layer.
[0218] Additionally, it was unknown in the art how this
unexpectedly lower level of sFLT-1 may affect efficacy of the drug
towards treatment of the actual AMD disease in humans. While barely
elevated levels in the monkey model showed promising signs of
ameliorating symptoms of AMD, the monkey animal model for AMD
merely serves a surrogate for AMD disease. As described herein, AMD
symptoms are artificially induced (via laser) in the retina. While
this model is suitable for various analysies, the actual efficacy
of the drug in the treatment of symptoms in the monkey model is
difficult to extrapolate to treatment of disease in humans.
Unexpectedly lower protein levels as generated by the rAAV.sFlt-1
further increases difficulty in this assessment without experiments
in humans.
[0219] In addition, 3 clinical trials on Lebers Congenital
Amaurosis (LCA) are being conducted in the UK and USA using the
rAAV2 backbone. LCA is a rare inherited eye disease that appears at
birth or in the first few months of life and it is characterized by
nystagmus, sluggish or no pupillary responses, and severe vision
loss or blindness. To date, no safety issues have been reported
following injection of the rAAV2 construct into the subretinal
space of 6 participants in these two trials. Both teams involved in
the clinical trials concluded that their findings have supported
further gene therapy studies. In LCA patients.
[0220] Given the apparent technical difficulties in generating
substantially or sustained elevated levels of sFLT-1 in monkeys,
various optimization strategies may be taken to address one or more
of the technical issues underlying lower protein levels of sFlt-1
in the retina after introduction of rAAV.sFlt-1.
[0221] In some cases, optimization strategies, including ones as
provided by the composition and methods of this disclosure may
include increasing optimizing the sFlt-1 protein sequence, or
domains, introducing control elements to direct correct sorting
after expression in retinal cells, or elevating levels of sFlt-1
protein to compensate for any of these possible factors. In some
cases, the composition and methods of the disclosure provide for
specific strategies directed toward the latter, involving the
incorporation of specific nucleic acid sequences directed towards
improving the elevating protein levels in human retinans over
sFlt-1 levels as observed previously in monkey studies. As
described herein, various sequences, linkers, UTRs, introns, sFLT-1
variants or combination thereof may be used to elevate protein
levels of sFlt-1 protein in the retina after exposure to
rAAV.sFlt-1.
[0222] Vectors can comprise components or functionalities that
further modulate gene delivery and/or gene expression, or that
otherwise provide beneficial properties to the targeted cells. Such
other components include, for example, components that influence
binding or targeting to cells (including components that mediate
cell-type or tissue-specific binding); components that influence
uptake of the vector nucleic acid by the cell; components that
influence localization of the polynucleotide within the cell after
uptake (such as agents mediating nuclear localization); and
components that influence expression of the polynucleotide. Such
components also might include markers, such as detectable and/or
selectable markers that can be used to detect or select for cells
that have taken up and are expressing the nucleic acid delivered by
the vector. Such components can be provided as a natural feature of
the vector (such as the use of certain viral vectors which have
components or functionalities mediating binding and uptake), or
vectors can be modified to provide such functionalities.
[0223] Selectable markers can be positive, negative or
bifunctional. Positive selectable markers allow selection for cells
carrying the marker, whereas negative selectable markers allow
cells carrying the marker to be selectively eliminated. A variety
of such marker genes have been described, including bifunctional
(i.e., positive/negative) markers (see, e.g., Lupton, S., WO
92/08796, published May 29, 1992; and Lupton, S., WO 94/28143,
published Dec. 8, 1994). Examples of negative selectable markers
may include the inclusion of resistance genes to antibiotics, such
as ampicillin or kanamycin. Such marker genes can provide an added
measure of control that can be advantageous in gene therapy
contexts. A large variety of such vectors are known in the art and
are generally available.
[0224] In some cases, nucleic acids encoding antibiotic resistances
markers may include but are not limited to sequences such as SEQ ID
No. 110, SEQ ID No. 111, SEQ ID No. 112, SEQ ID No. 113 or SEQ ID
No. 114.
[0225] In many of the viral vectors compatible with methods of the
disclosure, one or more promoters can be included in the vector to
allow more than one heterologous gene to be expressed by the
vector. Further, the vector can comprise a sequence which encodes a
signal peptide or other moiety which facilitates expression of the
anti-VEGF protein from the target cell.
[0226] The nucleic acid encoding a gene product may be under
transcriptional control by a promoter. A "promoter", as provided
herein, refers to a suitable DNA sequence required to initiate
transcription of a gene. The phrase "under transcriptional control"
means that the promoter is in the correct location and orientation
in relation to the nucleic acid to control RNA polymerase
initiation and expression of the gene. In some cases, promoter may
include a "strong" or constitutively active promoter. For example,
the CMV promoter may be used as known in the art a constitutively
active promoter. In some cases, the CMV promoter may comprise
additional regulatory elements for promoting expression. In some
cases, the CMV promoter may comprise the initial-early CMV
promoter.
[0227] In some cases a promoter may refer to a "weak" promoter, or
sequence that yields lower levels of sFLT-1 protein than a strong
promoter. In some cases a promoter may be used such that the
promoter drives selective expression of sFLT-1. In some cases a
promoter or other regulatory elements used in combination with
other sequences as described herein may be used to drive selective
expression of sFLT-1 in an eye cell, or eye tissue.
[0228] Additionally, "promoter", 104 may also be used herein
interchangeably to refer to any additional suitable transcriptional
control modules that may be present around the initiation site for
RNA polymerases. The compositions and methods of this disclosure
may use any suitable promoters and transcriptional control modules
for expression of a transgene, 106. Additional transcriptional
control modules may include but are not limited to elements such as
HSV thymidine kinase (tk) and SV40 early transcription units.
Generally, promoters may be composed of discrete functional
modules, each consisting of approximately 7-20 by of DNA, or
20-5000 by of DNA, and contain one or more recognition sites for
transcriptional activator or repressor proteins. The composition
and methods of the disclosure provide for any suitable regulatory
sequences or combination thereof. In some cases, these
transcriptional control module sequences may be referred to or
identified as enhancer or repressor sequences.
[0229] At least one module in each promoter functions to position
the start site for RNA synthesis. One example is the TATA box.
Other example may include some promoters that lack a TATA box, such
as the promoter for the mammalian terminal deoxynucleotidyl
transferase gene and the promoter for the SV40 late genes, a
discrete element overlying the start site itself helps to fix the
place of initiation.
[0230] Additional promoter elements regulate the frequency of
transcriptional initiation. Generally, these are located in a
region 30-110 by upstream of the start site, although a number of
promoters may contain functional elements downstream of the start
site as well. The spacing between promoter elements frequently may
be flexible, so that promoter function is preserved when elements
are inverted or moved relative to one another. In the tk promoter
for example, the spacing between promoter elements can be increased
to 50 by apart before activity begins to decline. Depending on the
promoter, individual elements may position to function either
co-operatively or independently to activate transcription.
[0231] The compositions and methods of the disclosure provide for
any suitable sequences for the control of expression of a nucleic
acid sequence of interest in the targeted cell. Thus, where a human
cell is targeted, sequences may the nucleic acid coding region may
be engineered to be adjacent to and under the control of a promoter
that is capable of being expressed in a human cell. Generally, such
a promoter might include either a human or viral promoter.
[0232] In various aspects of the disclosure, the human
cytomegalovirus (CMV) immediate early gene promoter (ie-CMV), the
SV40 early promoter, the Rous sarcoma virus long terminal repeat,
.beta.-actin, rat insulin promoter and glyceraldehyde-3-phosphate
dehydrogenase can be used to obtain a high level of expression of
the coding sequence of interest (e.g. sFLT-1). The use of other
viral or mammalian cellular or bacterial phage promoters which are
well-known in the art to achieve expression of a coding sequence of
interest is contemplated as well, provided that the levels of
expression are sufficient for a given purpose. In some aspects,
prokaryotic regulatory sequences may be present in the vector, such
as the T7 RNA polymerase promoter sequence. In other aspects, the
vector is free from such regulatory sequences. By employing a
promoter with known properties, the level and pattern of expression
of the protein of interest following transfection or transformation
can be optimized.
[0233] Selection of a promoter that is regulated in response to
specific physiologic or synthetic signals can permit inducible
expression of the gene product. For example in the case where
expression of a transgene, or transgenes when a multicistronic
vector is utilized, is toxic to the cells in which the vector is
produced in, it may be desirable to prohibit or reduce expression
of one or more of the transgenes. Examples of transgenes that may
be toxic to the producer cell line are pro-apoptotic and cytokine
genes. Several inducible promoter systems are available for
production of viral vectors where the transgene product may be
toxic. The composition and methods of the disclosure provide for
any suitable combination of promoter sequence, regulatory sequences
and transgene. In some cases, a combination of sequences may result
in no toxicity to the cell. In some cases, a combination of
sequences may result in high toxicity to the cell. In some cases, a
combination of sequences may result in moderate levels of toxicity
in the cell.
[0234] The ecdysone system (Invitrogen, Carlsbad, Calif.) is one
such system for transgene expression. This system is designed to
allow regulated expression of a gene of interest in mammalian
cells. It consists of a tightly regulated expression mechanism that
allows little basal level expression of the transgene, but over
200-fold inducibility. The system is based on the heterodimeric
ecdysone receptor of Drosophila, and when ecdysone or an analog
such as muristerone A binds to the receptor, the receptor activates
a promoter to turn on expression of the downstream transgene high
levels of mRNA transcripts are attained. In this system, both
monomers of the heterodimeric receptor are constitutively expressed
from one vector, whereas the ecdysone-responsive promoter which
drives expression of the gene of interest is on another plasmid.
Engineering of this type of system into the gene transfer vector of
interest may be used in the compositions and methods of this
disclosure. Cotransfection of plasmids containing the gene of
interest and the receptor monomers in the producer cell line would
then allow for the production of the gene transfer vector without
expression of a potentially toxic transgene. At the appropriate
time, expression of the transgene could be activated with ecdysone
or muristeron A.
[0235] In some circumstances, it may be desirable to regulate
expression of a transgene in a gene therapy vector. For example,
different viral promoters with varying strengths of activity may be
utilized depending on the level of expression desired. In mammalian
cells, the CMV immediate early promoter may be used to provide
strong transcriptional activation. Modified versions of the CMV
promoter that are less potent have also been used when reduced
levels of expression of the transgene are desired. When expression
of a transgene in hematopoietic cells is desired, retroviral
promoters such as the LTRs (Long Terminal Repeat) from MLV or MMTV
are often used. Other viral promoters that may be used depending on
the desired effect include SV40, RSV LTR, HIV-1 and HIV-2 LTR,
adenovirus promoters such as from the E1A, E2A, or MLP region, AAV
LTR, cauliflower mosaic Virus, HSV-TK, and avian sarcoma virus.
[0236] In some aspects, tissue-specific promoters are used to
effect transcription in specific tissues or cells so as to reduce
potential toxicity or undesirable effects to non-targeted tissues.
For example, promoters such as the PSA, probasin, prostatic acid
phosphatase or prostate-specific glandular kallikrein (hK2) may be
used to target gene expression in the prostate. In some cases,
promoters or regulatory sequence elements may be used to direct
selective expression in eye cells or eye tissue. For example,
promoter, sequence elements or regulatory sequences found in
specific eye cell types, such as retinal pigment epithelial cells,
may be used in a suitable expression construct (e.g., the RPE65 or
VMD2 promoter).
[0237] The selection of appropriate promoters can be readily
accomplished. In some cases a high expression, or strong promoter
may be used. An example of a suitable promoter is the 763-base-pair
cytomegalovirus (CMV) promoter. The Rous sarcoma virus (RSV)
(Davis, et al., Hum Gene Ther 4:151 (1993)) and MMT promoters may
also be used. Certain proteins can be expressed using their native
promoter. Other elements that can enhance expression can also be
included such as an enhancer or a system that results in high
levels of expression such as a tat gene and tar element. This
cassette can then be inserted into a vector, e.g., a plasmid vector
such as, pUC19, pUC118, pBR322, or other known plasmid vectors,
that includes, for example, an E. coli origin of replication. See,
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory press, (1989). Promoters are discussed
infra. The plasmid vector may also include a selectable marker such
as the .beta.-lactamase gene for ampicillin resistance, provided
that the marker polypeptide does not adversely affect the
metabolism of the organism being treated. The cassette can also be
bound to a nucleic acid binding moiety in a synthetic delivery
system, such as the system disclosed in WO 95/22618, incorporated
by reference herein. Generally promoter sequences and/or any
associated regulatory sequences may comprise about at least 150 bp,
200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp,
1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 by or 10000 bp. Promoter
sequences and any associated regulatory sequences, may comprise
about at most 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700
bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 by or
10000 bp.
[0238] In some aspects, the recombinant virus or plasmid comprises
a promoter selected from cytomegalovirus (CMV) promoter, Rous
sarcoma virus (RSV) promoter, and MMT promoter, EF-1 alpha
promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter,
RPE65 promoter and opsin promoter. Generally, promoter sequences
and promoter/enhancer sequences as provided by the present
disclosure may include but are not limited to any sequences
selected from SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID
No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24,
SEQ ID No. 25, SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28, SEQ ID
No. 29, SEQ ID No. 30, SEQ ID No. 31, SEQ ID No. 32, SEQ ID No. 33,
SEQ ID No. 34, SEQ ID No. 35, SEQ ID No. 36, SEQ ID No. 37, SEQ ID
No. 38, SEQ ID No. 39, SEQ ID No. 340, SEQ ID No. 41, SEQ ID No.
42, SEQ ID No. 43, SEQ ID No. 44, SEQ ID No. 45, SEQ ID No. 46, and
SEQ ID No. 47.
[0239] In some aspects, an antibiotic marker is used in the process
for production of the recombinant virus. Antibiotic resistance
markers may be used to identify positive transgenic cells in the
generation of recombinant virus. In some aspects, the antibiotic
marker comprises a sequence encoding an antibiotic resistance gene,
such as those provided herein including but not limited to
sequences shown in FIG. 8A and FIG. 8B. For example markers
conferring resistance may include but are not limited to kanamycin,
gentamicin, ampicillin, chloramphenicol, tetracycline, doxycycline,
or hygromycin. In some aspects, the antibiotic resistance gene is a
non-beta-lactam antibiotic resistance gene such as kanamycin.
[0240] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, comprise a sequence encoding a
replication origin sequence, such as those provided herein. Origin
of replication sequences, generally provide sequence useful for
propagating a plasmid. Generally, origin of replication sequences
as provided by the present disclosure may include but are not
limited to any sequences selected from sequences as provided in
FIG. 7A, FIG. 7B, FIG. 7C and FIG. 7D.
[0241] In some aspects, an origin or origin of replication
sequences may include but is not limited to sequences such as SEQ
ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5,
SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No.
10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ
ID No. 15, SEQ ID No. 16, or SEQ ID No. 17.
[0242] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, comprise an enhancer, such as those
provided herein.
[0243] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, comprise a chimeric intron or an
intron, 105, such as those provided herein and disclosed in U.S.
Pat. No. 7,635,474, incorporated by reference herein. Intron or
chimeric intron may be used interchangeably herein. In some cases,
an intron may refer to any sequence that may be transcribed but is
not translated. In some cases, an intron may refer to any sequence
that be transcribed and is removed from a mature RNA transcript in
a cell. In some cases, an intron may comprise about at least 1 bp,
50 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700
bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 by or 5000 bp.
In some cases, an intron may comprise may comprise about at least 1
bp, 50 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp,
700 bp, 800 bp, 900 bp, 1000 bp, 2000 bp, 3000 bp, 4000 by or 5000
bp. In some cases, an intron may be about 300 bp. In some cases, an
intron may be about 200-400 bp. In some cases, a chimeric intron
may be about 100-500 bp. In some cases, an intron may be about
50-200 bp. In some cases, an intron may be either an intact
naturally occurring intron or a chimeric intron.
[0244] In some aspects, an intron may include but is not limited to
sequences such as SEQ ID No. 48, SEQ ID No. 115, SEQ ID No. 116,
SEQ ID No. 117, SEQ ID No. 118, SEQ ID No. 119 or SEQ ID No.
120.
[0245] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, comprise a poly A (polyadenylation)
sequence, 107, such as those provided herein (e.g. SV40 poly A
sequence). Generally, any suitable polyA sequence may be used for
the desired expression of the transgene (i.e. sFLT-1). For example,
in some cases, the present disclosure provides for a sequence
comprising SV40 polyA sequence, or portion of SV40 polyA sequence.
In some cases, native polyA sequences as found downstream (3'UTR)
of the human sFLT-1 gene as found in human genomic sequence may be
used. In other cases, polyA sequences as found downstream of genes
other than sFLT-1 may be used. In other cases, the present
disclosure provides for polyA sequences comprising a combination of
one or more polyA sequences or sequence elements. In some cases, no
polyA sequence is used. In some cases one or more polyA sequences
may be referred to as untranslated regions (UTRs), 3' UTRs, or
termination sequences.
[0246] In certain aspects of the disclosure, the use of internal
ribosome entry site (IRES) or foot-mouth disease virus (FMDV)
elements may be used to create multigene, or polycistronic,
messages. IRES elements are able to bypass the ribosome scanning
model of 5' methylated Cap dependent translation and begin
translation at internal sites. IRES elements from two members of
the picornavirus family (poliovirus and encephalomyocarditis) have
been described, as well an IRES from a mammalian message. IRES
elements can be linked to heterologous open reading frames.
Multiple open reading frames can be transcribed together, each
separated by an IRES, creating polycistronic messages. By virtue of
the IRES element, each open reading frame may be accessible to
ribosomes for efficient translation. Multiple genes can be
efficiently expressed using a single promoter/enhancer to
transcribe a single message. An alternative system for
co-expression of two proteins in gene therapy delivery vectors is
the FMDV 2A system. The FMDV 2A system employs a retroviral plasmid
vector in which two genes may be linked to a nucleotide sequence
encoding the 2A sequence from the picornavirus foot-and-mouth
disease virus. Transcription and translation gives rise to a
bicistronic mRNA and two independent protein products.
[0247] Any heterologous open reading frame can be linked to IRES
elements. This may include genes for secreted proteins,
multi-subunit proteins, encoded by independent genes, intracellular
or membrane-bound proteins and selectable markers. In this way,
expression of several proteins can be simultaneously engineered
into a cell with a single construct and a single selectable
marker.
[0248] A polyA sequence may comprise a length of 1-10 bp, 10-20 bp,
20-50 bp, 50-100 bp, 100-500 bp, 500 bp-1 Kb, 1 Kb-2 Kb, 2 Kb-3 Kb,
3 Kb-4 Kb, 4 Kb-5 Kb, 5 Kb-6 Kb, 6 Kb-7 Kb, 7 Kb-8 Kb, 8 Kb-9 Kb,
and 9 Kb-10 Kb in length. A polyA sequence may comprise a length of
at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10
bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp,
200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1
Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb in
length. A polyA sequence may comprise a length of at most 1 bp, 2
bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp,
40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp,
400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4
Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb in length.
[0249] In some cases, a polyA or termination sequence may include
but is not limited to sequences such as SEQ ID No. 49, SEQ ID No.
50, SEQ ID No. 51, SEQ ID No. 52, SEQ ID No. 53, SEQ ID No. 54, and
SEQ ID No. 55.
[0250] Generally, polyA sequences, as provided by the present
disclosure, may include but are not limited to any sequences
selected from PolyA Regions 1-10 as provided in FIG. 9A and FIG.
9B.
[0251] In some cases, polyA sequences may be optimized for various
parameters affecting protein expression, including but not limited
to mRNA half-life of the transgene in the cell, stability of the
mRNA of the transgene or transcriptional regulation. For example,
polyA sequences maybe altered to increase mRNA transcript of the
transgene, which may result in increased protein expression. In
some cases, the polyA sequences maybe altered to decrease the
half-life of the mRNA transcript of the transgene, which may result
in decreased protein expression.
[0252] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, comprise a polynucleotide encoding a
human sFLT-1 protein or a functional fragment thereof. In some
cases, the recombinant virus and/or plasmid used to generate
recombinant virus, comprises a nucleic acid encoding another
anti-VEGF protein or VEGF inhibitor.
[0253] In some cases, a VEGF inhibitor may include but is not
limited to sequences such as SEQ ID No. 102, SEQ ID No. 103, SEQ ID
No. 104, SEQ ID No. 105, SEQ ID No. 106, SEQ ID No. 107, SEQ ID No.
108, or SEQ ID No. 122
[0254] In some cases, nucleic acids of a VEGF inhibitor may encode
for polypeptide sequences which may include but are not limited to
polypeptide sequences such as SEQ ID No. 109 or SEQ ID No. 121.
[0255] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, comprise a regulatory nucleic acid
fragment that is capable of directing selective expression of the
sFLT-1 protein in an eye cell. In some cases, eye cells may
comprise retinal pigment epithelial cells (RPE).
[0256] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, may comprise one or more
untranslated regions (UTR) or sequences. Generally, any suitable
UTR sequence may be used for the desired optimal expression of the
transgene (i.e. sFLT-1). For example, in some cases, UTR regions or
sequences may comprise native sequences. In some cases, UTR
sequences may be sequences as found upstream (5' UTR) or downstream
(3'UTR) of the human sFLT-1 gene as found in human genomic sequence
or portions thereof. In other cases, UTR sequences may comprise
non-native sequences, such as found upstream or downstream of genes
other than sFLT-1 or comprise sequences further comprising a
combination of one or more UTR sequence elements as further
described herein. In some cases, only a 5' UTR sequence is used. In
some cases, only a 3' UTR sequence is used. In some cases, no UTR
sequences are used.
[0257] A UTR sequence may comprise a length of 1-10 bp, 10-20 bp,
20-50 bp, 50-100 bp, 100-500 bp, 500 bp-1 Kb, 1 Kb-2 Kb, 2 Kb-3 Kb,
3 Kb-4 Kb, 4 Kb-5 Kb, 5 Kb-6 Kb, 6 Kb-7 Kb, 7 Kb-8 Kb, 8 Kb-9 Kb,
and 9 Kb-10 Kb in length. A UTR sequence may comprise a length of
at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10
bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp,
200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1
Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb in
length. A UTR sequence may comprise a length of at most 1 bp, 2 bp,
3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40
bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400
bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb,
5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb in length.
[0258] Generally, UTR sequences as provided by the present
disclosure may include but are not limited to any sequences
including but to limited to SEQ ID No. 91, SEQ ID No. 2, SEQ ID No.
92, SEQ ID No. 93, SEQ ID No. 94, SEQ ID No. 95, SEQ ID No. 96, SEQ
ID No. 97, SEQ ID No. 98, SEQ ID No. 99, SEQ ID No. 100, and SEQ ID
No. 101.
[0259] In some cases, variations of either the 5'UTR and/or 3'UTR
may be optimized for a desired level of protein expression. In some
cases, 3'UTR sequences may be optimized for various parameters
affecting protein expression, including but not limited to mRNA
half-life of the transgene in the cell, stability or secondary
structure of the mRNA of the transgene or conditional regulation
(e.g. binding of various factors to modulate translation). For
example, the 3'UTR sequence maybe altered to increase the half-life
of the mRNA transcript of the transgene, which may result in
increased protein expression. In some cases, the 3'UTR sequence
maybe altered to decrease the half-life of the mRNA transcript of
the transgene, which may result in decreased protein
expression.
[0260] Generally, 3' UTRs sequences may comprise various sequence
elements. The present disclosure provides for 3' UTR sequences that
may include but are not limited to sequence elements such as one or
more polyadenylation signals, linker sequences, spacer sequences,
SECIS elements, AU-rich or ARE sequences or miRNA or RNAi binding
sequences, transcription terminator sequences, 3' termination
sequences or variants and/or combinations thereof.
[0261] In some cases, 5'UTR sequences may be optimized for various
parameters affecting protein expression, including but not limited
to mRNA half-life of the transgene in the cell, stability or
secondary structure of the mRNA of the transgene or transcriptional
regulation. For example, the 5'UTR sequences maybe altered to
increase translation efficiency of mRNA transcript of the
transgene, which may result in increased protein expression. In
some cases, the 5'UTR sequences maybe altered to decrease
translation efficiency of mRNA transcript of the transgene, which
may result in decreased protein expression.
[0262] Generally, 5' UTRs sequences may comprise various sequence
elements. The present disclosure provides for 5' UTR sequences that
may include but are not limited to sequence elements such as one or
more ribosome binding sites (RBS), linker sequences, spacer
sequences, regulatory sequences, regulatory response elements,
riboswitches, sequences that promote or inhibit translation
initiation, regulatory sequences for mRNA transport or variants
and/or combinations thereof.
[0263] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus, may comprise one or more linker or
spacer sequences. As described herein, linker sequence or spacer
sequence may be used interchangeably. Generally, a linker sequence
or spacer sequence may be any suitable sequence used to create a
non-contiguous sequence between at least two sequence elements. For
example, in one aspect of the disclosure, a linker sequence may be
found inserted between an ITR-1, 108 sequence, or ITR-2, 103, and
an antibiotic resistance gene sequence, 106 as reflected in FIG.
1A. In another example, linker sequences may be inserted adjacent
to any sequence element of the recombinant virus or the plasmid
encoding the recombinant virus including the ITR sequences, the
promoter or promoter/enhancer sequences, the intron sequence, the
transgene sequence and the poly A region sequence. Generally, any
suitable linker or spacer sequence may be used to create
non-contiguous sequences. For example, in some cases, linker
sequences may be randomly generated sequence. In some cases, linker
sequence may be non-specific sequence optimized to prevent
formation of secondary structure or intramolecular interactions
that may adversely affect protein expression. In some cases, linker
sequences may comprise any additional functional sequence elements,
including but not limited to introns, regulatory sequences,
enhancers or the like. Functional elements in linker sequences may
be used for the desired optimal production of virus and/or
expression of transgene expression. In some cases, linker sequences
are cloning sites, remnants of prior cloning sites or other
non-significant sequences and the insertion of such linkers between
any two sequence elements is optional.
[0264] Generally, linker sequence, as provided by the present
disclosure, may include but are not limited to any sequences
selected from sequences as provided in FIG. 9D, FIG. 9E and FIG.
9F.
[0265] In some cases, the length of the linker sequence may be
optimized for the desired optimal production of virus and/or
expression of transgene expression. In some cases, the length of
one or more linker sequences located at one or more sites in the
virus genome or plasmid may be varied to produce the desired
optimal protein expression. For example, a linker sequence may be
found between the intron, as described herein and the transgene
(i.e. sFLT-1). The length of the linker sequence may be varied to
produce varying effects on the transcription and subsequent
translation of the transgene in the cell.
[0266] A linker sequence may comprise a length of 1-10 bp, 10-20
bp, 20-50 bp, 50-100 bp, 100-500 bp, 500 bp-1 Kb, 1 Kb-2 Kb, 2 Kb-3
Kb, 3 Kb-4 Kb, 4 Kb-5 Kb, 5 Kb-6 Kb, 6 Kb-7 Kb, 7 Kb-8 Kb, 8 Kb-9
Kb, and 9 Kb-10 Kb in length. A linker sequence may comprise a
length of at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp,
9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90
bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp,
900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and
10 Kb in length. A linker sequence may comprise a length of at most
1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp,
30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp,
300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb,
3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb in length.
[0267] In some cases, a linker or spacer sequence may include but
is not limited to SEQ ID No. 60, SEQ ID No. 61, SEQ ID No. 62, SEQ
ID No. 63, SEQ ID No. 64, SEQ ID No. 65, SEQ ID No. 66, SEQ ID No.
67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID No. 70, SEQ ID No. 71, SEQ
ID No. 72, SEQ ID No. 73, SEQ ID No. 74, SEQ ID No. 75, SEQ ID No.
76, SEQ ID No. 77, SEQ ID No. 78, SEQ ID No. 79, SEQ ID No. 80, SEQ
ID No. 81, SEQ ID No. 82, SEQ ID No. 83, SEQ ID No. 84, SEQ ID No.
85, SEQ ID No. 86, SEQ ID No. 87, SEQ ID No. 88, SEQ ID No. 89, and
SEQ ID No. 90.
[0268] In some aspects, the recombinant virus comprises inverted
terminal repeat (ITR) sequences used for packaging the recombinant
gene expression cassette into the virion of the viral vector. In
some cases, the ITR is from adeno-associated virus (AAV). In some
cases, the ITR is from AAV serotype 2. In some cases, an ITR may
include but is not limited to SEQ ID No. 56, SEQ ID No. 57, SEQ ID
No. 58, or SEQ ID No. 59.
[0269] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus comprises nucleic acid elements in
the following order: a) a first ITR sequence; b) a promoter
sequence; c) an intron sequence; d) a first UTR sequence; e) a
sequence encoding a VEGF inhibitor; f) a second UTR sequence; g) a
poly A sequence; and h) a second ITR sequence. In some aspects of
the recombinant virus and/or plasmid used to generate the
recombinant virus, the promoter sequence comprises a
promoter/enhancer sequence. In some aspects, the sequence encoding
a VEGF inhibitor comprises a sequence encoding human sFLT-1 protein
or a functional fragment thereof. In other aspects, the plasmid
used to generate the recombinant virus further comprises an origin
of replication sequence, 102. In some aspects, the plasmid further
comprises a sequence for an antibiotic resistance gene as provided
herein.
[0270] In some aspects, the recombinant virus and/or plasmid used
to generate recombinant virus comprises nucleic acid elements in
the following order: a) a first ITR sequence; b) a first linker
sequence; c) a promoter sequence; d) a second linker sequence; e)
an intron sequence; f) a third linker sequence; g) a first UTR
sequence; h) a sequence encoding a VEGF inhibitor; i) a second UTR
sequence; j) a fourth linker sequence; k) a poly A sequence; l) a
fifth linker sequence; and m) a second ITR sequence. In some
aspects of the recombinant virus and/or plasmid used to generate
recombinant virus, the promoter sequence comprises a
promoter/enhancer sequence. In some aspects, the sequence encoding
a VEGF inhibitor comprises a sequence encoding human sFLT-1 protein
or a functional fragment thereof. In other aspects, the plasmid
used to generate the recombinant virus further comprises an origin
of replication sequence. In some aspects, the plasmid further
comprises a sequence for an antibiotic resistance gene as provided
herein.
IV. Pharmaceutical Compositions
[0271] A pharmaceutical composition is a formulation containing one
or more active ingredients as well as one or more excipients,
carriers, stabilizers or bulking agents, which is suitable for
administration to a human patient to achieve a desired diagnostic
result or therapeutic or prophylactic effect. For storage stability
and convenience of handling, a pharmaceutical composition can be
formulated as a lyophilized (i.e. freeze dried) or vacuum dried
powder which can be reconstituted with saline or water prior to
administration to a patient. Alternately, the pharmaceutical
composition can be formulated as an aqueous solution. A
pharmaceutical composition can contain a proteinaceous active
ingredient. Unfortunately, proteins can be very difficult to
stabilize, resulting in loss of protein and/or loss of protein
activity during the formulation, reconstitution (if required) and
during the storage prior to use of a protein containing
pharmaceutical composition. Stability problems can occur because of
protein denaturation, degradation, dimerization, and/or
polymerization. Various excipients, such as albumin and gelatin
have been used with differing degrees of success to try and
stabilize a protein active ingredient present in a pharmaceutical
composition. Additionally, cryoprotectants such as alcohols have
been used to reduce protein denaturation under the freezing
conditions of lyophilization.
[0272] Pharmaceutical compositions suitable for internal use
include sterile aqueous solutions or dispersions and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersion. For intravenous administration, suitable
carriers include physiological saline, bacteriostatic water, or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), and suitable
mixtures thereof. The proper fluidity can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants such as polysorbates (Tween.TM.),
sodium dodecyl sulfate (sodium lauryl sulfate), lauryl dimethyl
amine oxide, cetyltrimethylammonium bromide (CTAB), polyethoxylated
alcohols, polyoxyethylene sorbitan, octoxynol (Triton X100.TM.),
N,N-dimethyldodecylamine-N-oxide, hexadecyltrimethylammonium
bromide (HTAB), polyoxyl 10 lauryl ether, Brij 721.TM., bile salts
(sodium deoxycholate, sodium cholate), pluronic acids (F-68,
F-127), polyoxyl castor oil (Cremophor.TM.) nonylphenol ethoxylate
(Tergitol.TM.), cyclodextrins and, ethylbenzethonium chloride
(Hyamine.TM.). Prevention of the action of microorganisms can be
achieved by various antibacterial and antifungal agents, for
example, parabens, chlorobutanol, phenol, ascorbic acid,
thimerosal, and the like. In many cases, it will be preferable to
include isotonic agents, for example, sugars, polyalcohols such as
manitol, sorbitol, sodium chloride in the composition. Prolonged
absorption of the internal compositions can be brought about by
including in the composition an agent which delays absorption, for
example, aluminum monostearate and gelatin.
[0273] Sterile solutions can be prepared by incorporating the
active compound in the required amount in an appropriate solvent
with one or a combination of ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the active compound into
a sterile vehicle that contains a basic dispersion medium and the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, methods of preparation are vacuum drying and
freeze-drying that yields a powder of the active ingredient plus
any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0274] In one aspect, active compounds are prepared with carriers
that will protect the compound against rapid elimination from the
body, such as a controlled release formulation, including implants
and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No. 4,522,811,
incorporated by reference herein.
[0275] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the human subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the disclosure are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0276] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0277] The pharmaceutical compositions of the disclosure encompass
any pharmaceutically acceptable salts, esters, or salts of such
esters, or any other compound which, upon administration to an
animal comprising a human, is capable of providing (directly or
indirectly) the biologically active metabolite or residue thereof.
Accordingly, for example, the disclosure is also drawn to prodrugs
and pharmaceutically acceptable salts of the compounds of the
disclosure, pharmaceutically acceptable salts of such prodrugs, and
other bio-equivalents.
[0278] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions.
[0279] The term "pharmaceutically acceptable salt" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the disclosure: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0280] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines Metals used as cations comprise sodium, potassium,
magnesium, calcium, and the like Amines comprise
N--N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. Pharma Sci., 1977, 66, 119). The base
addition salts of said acidic compounds are prepared by contacting
the free acid form with a sufficient amount of the desired base to
produce the salt in the conventional manner. The free acid form may
be regenerated by contacting the salt form with an acid and
isolating the free acid in the conventional manner. The free acid
forms differ from their respective salt forms somewhat in certain
physical properties such as solubility in polar solvents, but
otherwise the salts are equivalent to their respective free acid
for purposes of the present disclosure.
[0281] As used herein, a "pharmaceutical addition salt" comprises a
pharmaceutically acceptable salt of an acid form of one of the
components of the compositions of the disclosure. These comprise
organic or inorganic acid salts of the amines Preferred acid salts
are the hydrochlorides, acetates, salicylates, nitrates and
phosphates. Other suitable pharmaceutically acceptable salts are
well known to those skilled in the art and comprise basic salts of
a variety of inorganic and organic acids, such as, for example,
with inorganic acids, such as for example hydrochloric acid,
hydrobromic acid, sulfuric acid or phosphoric acid; with organic
carboxylic, sulfonic, sulfo or phospho acids or N-substituted
sulfamic acids, for example acetic acid, propionic acid, glycolic
acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic
acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic
acid, gluconic acid, glucaric acid, glucuronic acid, citric acid,
benzoic acid, cinnamic acid, mandelic acid, salicylic acid,
4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic
acid, embonic acid, nicotinic acid or isonicotinic acid; and with
amino acids, such as the 20 alpha-amino acids involved in the
synthesis of proteins in Nature, for example glutamic acid or
aspartic acid, and also with phenylacetic acid, methanesulfonic
acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid,
ethane-1,2-disulfonic acid, benzenesulfonic acid,
4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid,
naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglycerate,
glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation
of cyclamates), or with other acid organic compounds, such as
ascorbic acid. Pharmaceutically acceptable salts of compounds may
also be prepared with a pharmaceutically acceptable cation.
Suitable pharmaceutically acceptable cations are well known to
those skilled in the art and comprise alkaline, alkaline earth,
ammonium and quaternary ammonium cations. Carbonates or hydrogen
carbonates are also possible. For oligonucleotides, preferred
examples of pharmaceutically acceptable salts comprise but are not
limited to: (I) salts formed with cations such as sodium,
potassium, ammonium, magnesium, calcium, polyamides such as
spermine and spermidine, and the like; (II) acid addition salts
formed with inorganic acids, for example hydrochloric acid,
hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and
the like; (III) salts formed with organic acids such as, for
example, acetic acid, oxalic acid, tartaric acid, succinic acid,
maleic acid, fumaric acid, gluconic acid, citric acid, malic acid,
ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic
acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic
acid, p-toluenesulfonic acid, naphthalenedisulfonic acid,
polygalacturonic acid, and the like; and (IV) salts formed from
elemental anions such as chlorine, bromine, and iodine.
[0282] Pharmaceutical compositions of the present disclosure
comprise, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that comprise, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0283] Certain compositions of the present disclosure also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
co-administration of a nucleic acid and a carrier compound,
generally with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extra circulatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is co-administered with polyinosinic acid, dextran
sulphate, polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'disulfonic acid (Miyao et
al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al.,
Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
[0284] The vector or recombinant viruses (virions) can be
incorporated into pharmaceutical compositions for administration to
mammalian patients, particularly humans. The vector or virions can
be formulated in nontoxic, inert, pharmaceutically acceptable
aqueous carriers, preferably at a pH ranging from 3 to 8, more
preferably ranging from 6 to 8. Such sterile compositions will
comprise the vector or virion containing the nucleic acid encoding
the therapeutic molecule dissolved in an aqueous buffer having an
acceptable pH upon reconstitution.
[0285] In some aspects, the pharmaceutical composition provided
herein comprise a therapeutically effective amount of a vector or
virion in admixture with a pharmaceutically acceptable carrier
and/or excipient, for example saline, phosphate buffered saline,
phosphate and amino acids, polymers, polyols, sugar, buffers,
preservatives and other proteins. Exemplary amino acids, polymers
and sugars and the like are octylphenoxy polyethoxy ethanol
compounds, polyethylene glycol monostearate compounds,
polyoxyethylene sorbitan fatty acid esters, sucrose, fructose,
dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol,
galactitol, xylitol, lactose, trehalose, bovine or human serum
albumin, citrate, acetate, Ringer's and Hank's solutions, cysteine,
arginine, carnitine, alanine, glycine, lysine, valine, leucine,
polyvinylpyrrolidone, polyethylene and glycol. Preferably, this
formulation is stable for at least six months at 4.degree. C.
[0286] In some aspects, the pharmaceutical composition provided
herein comprises a buffer, such as phosphate buffered saline (PBS)
or sodium phosphate/sodium sulfate, tris buffer, glycine buffer,
sterile water and other buffers known to the ordinarily skilled
artisan such as those described by Good et al. (1966) Biochemistry
5:467. The pH of the buffer in which the pharmaceutical composition
comprising the anti-VEGF contained in the adenoviral vector
delivery system, may be in the range of 6.5 to 7.75, 7 to 7.5, or
7.2 to 7.4. The pH of the formulation may range from about 3.0 to
about 12.0. The pH of the immunogenic composition may be at least
about 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 pH units. The pH of the
immunogenic composition may be at most about 3, 4, 5, 6, 7, 8, 9,
10, 11 or 12 pH units.
[0287] In some aspects, the pharmaceutical composition provided
herein comprises substances which increase the viscosity of the
suspension, such as sodium carboxymethyl cellulose, sorbitol, or
dextran, in the amount about 1-10 percent, such as 1, 2, 3, 4, 5,
6, 7, 8, 9, or 10 percent.
[0288] Certain aspects of the disclosure provide pharmaceutical
compositions containing one or more recombinant virus and one or
more other chemotherapeutic agents.
[0289] Examples of such chemotherapeutic agents comprise, but are
not limited to, anticancer drugs such as daunorubicin,
dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard,
chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine,
6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine
(5-FUdR), methotrexate (MIX), colchicine, vincristine, vinblastine,
etoposide, teniposide, cisplatin and diethylstilbestrol (DES). See,
generally, The Merck Manual of Diagnosis and Therapy, 15th Ed.,
Berkow et al., eds., 1987, Rahway, N.J., pages 1206-1228).
[0290] Anti-inflammatory drugs, comprising but not limited to
nonsteroidal anti-inflammatory drugs and corticosteroids, and
antiviral drugs, comprising but not limited to ribivirin,
vidarabine, acyclovir and ganciclovir, may also be combined in
compositions of the disclosure (The Merck Manual of Diagnosis and
Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages
2499-2506 and 46-49, respectively). Other non-antisense
chemotherapeutic agents are also within the scope of this
disclosure. Two or more combined compounds may be used together or
sequentially.
[0291] In another related aspect, compositions of the disclosure
may contain one or more recombinant viruses, particularly sFLT-1
with different sequences. Two or more combined viruses may be used
together or sequentially.
[0292] In another aspect, the present disclosure provides a unit
dose of a pharmaceutical composition comprising about
1.times.10.sup.6 about 1.times.10.sup.15 viral genomes, wherein the
viruses comprises a nucleic acid encoding sFLT-1.
[0293] In some cases, the unit dose of the pharmaceutical
composition of the disclosure may be measured as pfu (plaque
forming units). In some cases, the pfu of the unit dose of the
pharmaceutical composition of the disclosure may be about
1.times.10.sup.8 to about 5.times.10.sup.10 pfu. In some cases, the
pfu of the unit dose of the pharmaceutical composition of the
disclosure is at least about 1.times.10.sup.8, 2.times.10.sup.8,
3.times.10.sup.8, 4.times.10.sup.8, 5.times.10.sup.8,
6.times.10.sup.8, 7.times.10.sup.8, 8.times.10.sup.8,
9.times.10.sup.8, 1.times.10.sup.9, 2.times.10.sup.9,
3.times.10.sup.9, 4.times.10.sup.9, 5.times.10.sup.9,
6.times.10.sup.9, 7.times.10.sup.9, 8.times.10.sup.9,
9.times.10.sup.9, 1.times.10.sup.10, 2.times.10.sup.10,
3.times.10.sup.10, 4.times.10.sup.10, and 5.times.10.sup.10 pfu. In
some cases, the pfu of the unit dose of the pharmaceutical
composition of the disclosure is at most about 1.times.10.sup.8,
2.times.10.sup.8, 3.times.10.sup.8, 4.times.10.sup.8,
5.times.10.sup.8, 6.times.10.sup.8, 7.times.10.sup.8,
8.times.10.sup.8, 9.times.10.sup.8, 1.times.10.sup.9,
2.times.10.sup.9, 3.times.10.sup.9, 4.times.10.sup.9,
5.times.10.sup.9, 6.times.10.sup.9, 7.times.10.sup.9,
8.times.10.sup.9, 9.times.10.sup.9, 1.times.10.sup.10,
2.times.10.sup.10, 3.times.10.sup.10, 4.times.10.sup.10, and
5.times.10.sup.10 pfu.
[0294] In some cases, the viral vector of the disclosure may be
measured as vector genomes. In some cases, the unit dose of the
pharmaceutical composition of the disclosure is 1.times.10.sup.10
to 3.times.10.sup.12 vector genomes. In some cases, the unit dose
of the pharmaceutical composition of the disclosure is
1.times.10.sup.9 to 3.times.10.sup.13 vector genomes. In some
cases, the unit dose of the pharmaceutical composition of the
disclosure is 1.times.10.sup.10 to 1.times.10.sup.11 vector
genomes. In some cases, the unit dose of the pharmaceutical
composition of the disclosure is 1.times.10.sup.8 to
3.times.10.sup.14 vector genomes. In some cases, the unit dose of
the pharmaceutical composition of the disclosure is at least about
1.times.10.sup.1, 1.times.10.sup.2, 1.times.10.sup.3,
1.times.10.sup.4, 1.times.10.sup.5, 1.times.10.sup.6,
1.times.10.sup.7, 1.times.10.sup.8, 1.times.10.sup.9,
1.times.10.sup.10, 1.times.10.sup.11, 1.times.10.sup.12,
1.times.10.sup.13, 1.times.10.sup.14, 1.times.10.sup.15,
1.times.10.sup.16, 1.times.10.sup.17, and 1.times.10.sup.18 vector
genomes. In some cases, the unit dose of the pharmaceutical
composition of the disclosure is 1.times.10.sup.8 to
3.times.10.sup.14 vector genomes. In some cases, the unit dose of
the pharmaceutical composition of the disclosure is at most about
1.times.10.sup.1, 1.times.10.sup.2, 1.times.10.sup.3,
1.times.10.sup.4, 1.times.10.sup.5, 1.times.10.sup.6,
1.times.10.sup.7, 1.times.10.sup.8, 1.times.10.sup.9,
1.times.10.sup.10, 1.times.10.sup.11, 1.times.10.sup.12,
1.times.10.sup.13, 1.times.10.sup.14, 1.times.10.sup.15,
1.times.10.sup.16, 1.times.10.sup.17, and 1.times.10.sup.18 vector
genomes.
[0295] In some cases, the unit dose of the pharmaceutical
composition of the disclosure may be measured using multiplicity of
infection (MOI). In some cases, MOI may refer to the ratio, or
multiple of vector or viral genomes to the cells to which the
nucleic may be delivered. In some cases, the MOI may be
1.times.10.sup.6. In some cases, the MOI may be
1.times.10.sup.5-1.times.10.sup.7. In some cases, the MOI may be
1.times.10.sup.4-1.times.10.sup.8. In some cases, recombinant
viruses of the disclosure are at least about 1.times.10.sup.1,
1.times.10.sup.2, 1.times.10.sup.3, 1.times.10.sup.4,
1.times.10.sup.5, 1.times.10.sup.6, 1.times.10.sup.7,
1.times.10.sup.8, 1.times.10.sup.9, 1.times.10.sup.10,
1.times.10.sup.11, 1.times.10.sup.12, 1.times.10.sup.13,
1.times.10.sup.14, 1.times.10.sup.15, 1.times.10.sup.16,
1.times.10.sup.17, and 1.times.10.sup.18 MOI. In some cases,
recombinant viruses of this disclosure are 1.times.10.sup.8 to
3.times.10.sup.14 MOI. In some cases, recombinant viruses of the
disclosure are at most about 1.times.10.sup.1, 1.times.10.sup.2,
1.times.10.sup.3, 1.times.10.sup.4, 1.times.10.sup.5,
1.times.10.sup.6, 1.times.10.sup.7, 1.times.10.sup.8,
1.times.10.sup.9, 1.times.10.sup.10, 1.times.10.sup.11,
1.times.10.sup.12, 1.times.10.sup.13, 1.times.10.sup.14,
1.times.10.sup.15, 1.times.10.sup.16, 1.times.10.sup.17, and
1.times.10.sup.18 MOI.
[0296] In some aspects the nucleic acid may be delivered without
the use of a virus (i.e. with a non-viral vector), and may be
measured as the quantity of nucleic acid. Generally, any suitable
amount of nucleic acid may be used with the compositions and
methods of this disclosure. In some cases, the amount of nucleic
acid may be at least about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100
pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg,
1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700
ng, 800 ng, 900 ng, 1 .mu.g, 10 .mu.g, 100 .mu.g, 200 .mu.g, 300
.mu.g, 400 .mu.g, 500 .mu.g, 600 .mu.g, 700 .mu.g, 800 .mu.g, 900
.mu.g, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg,
700 mg, 800 mg, 900 mg 1 g, 2 g, 3 g, 4 g, or 5 g. In some cases,
nucleic acid may be at most about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg,
100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900
pg, 1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng,
700 ng, 800 ng, 900 ng, 1 .mu.g, 10 .mu.g, 100 .mu.g, 200 .mu.g,
300 .mu.g, 400 .mu.g, 500 .mu.g, 600 .mu.g, 700 .mu.g, 800 .mu.g,
900 .mu.g, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600
mg, 700 mg, 800 mg, 900 mg, 1 g, 2 g, 3 g, 4 g, or 5 g.
[0297] In some aspects, the pharmaceutical composition comprises
about 1.times.10.sup.6 to about 1.times.10.sup.15 recombinant
viruses, about 1.times.10.sup.7 to about 1.times.10 recombinant
viruses, about 1.times.10.sup.8 to about 1.times.10.sup.13
recombinant viruses, about 1.times.10.sup.9 to about
3.times.10.sup.12 recombinant viruses, or about 1.times.10.sup.10
to about 3.times.10.sup.12 recombinant viruses.
Kits
[0298] Compositions and reagents useful for the present disclosure
may be packaged in kits to facilitate application of the present
disclosure. In some aspects, the present method provides for a kit
comprising a recombinant nucleic acid of the disclosure. In some
aspects, the present method provides for a kit comprising a
recombinant virus of the disclosure. The instructions could be in
any desired form, including but not limited to, printed on a kit
insert, printed on one or more containers, as well as
electronically stored instructions provided on an electronic
storage medium, such as a computer readable storage medium. Also
optionally included is a software package on a computer readable
storage medium that permits the user to integrate the information
and calculate a control dose.
[0299] In another aspect, the present disclosure provides a kit
comprising the pharmaceutical compositions provided herein. In yet
another aspect, the disclosure provides kits in the treatment of
diseases such as, for example: AMD, DME, RVO, angiogenesis related
diseases, cancer, autoimmune diseases, infectious disease
organisms, and the like.
[0300] In one aspect, a kit comprises: (a) a recombinant virus
provided herein, and (b) instructions to administer to cells or an
individual a therapeutically effective amount of the recombinant
virus. In some aspects, the kit may comprise pharmaceutically
acceptable salts or solutions for administering the recombinant
virus. Optionally, the kit can further comprise instructions for
suitable operational parameters in the form of a label or a
separate insert. For example, the kit may have standard
instructions informing a physician or laboratory technician to
prepare a dose of recombinant virus.
[0301] Optionally, the kit may further comprise a standard or
control information so that a patient sample can be compared with
the control information standard to determine if the test amount of
recombinant virus is a therapeutic amount consistent with for
example, a shrinking of a tumor. Optionally, the kit could further
comprise devices for administration, such as a syringe, filter
needle, extension tubing, cannula, and subretinal injector.
[0302] Recombinant viruses may be generated by any suitable means.
The methods and compositions and of the disclosure provide for
generation of recombinant virus through various means, including
the use of transgenic cells, which may include mammalian cells,
insect cells, animal cells or fungal cells.
[0303] For example, in some aspects, recombinant viruses may be
generated through transfection of insect cells via recombinant
baculovirus. In some cases, recombinant baculovirus may be
generated as an intermediate, whereby the baculovirus may contain
sequences necessary for the generation of other viruses such as AAV
or rAAV2 viruses. In some cases one or more baculoviruses may be
used in the generation of recombinant viruses used for the
composition and methods of treatment of this disclosure. In some
cases insect cells such as Sf9, High-Five or Sf21 cell lines may be
used. In some cases, cell lines may be generated using transient
methods (i.e. infection with not stably integrated transgenes.) In
other cases, cell lines may be generated through the generation of
stable cell lines ((i.e. infection with transgenes stably
integrated into the host cell genome.) In other aspects, the
pharmaceutical composition provided herein is manufactured using
adherent human embryonic kidney 293 (HEK293) cells. In an
alternative aspect, the pharmaceutical composition provided herein
is manufactured using suspension-adapted HEK293 cells. In another
aspect, the pharmaceutical composition provided herein is
manufactured using the baculovirus expression system (BVES) in
insect cells. In some aspects, the vector is produced using
herpes-helper virus. In some aspects, the vector is produced using
producer-clone methods. In some aspects, the vector is produced
using Ad-AAV.
[0304] Generally, any suitable method may be used in the
biochemical purification of recombinant viruses for use in a
pharmaceutical composition as described herein. Recombinant viruses
may be harvested directly from cells, or from the culture media
surrounding host cells. Virus may be purified using various
biochemical means, such as gel filtration, filtration,
chromatography, affinity purification, gradient
ultracentrifugation, or size exclusion methods. Recombinant virus
may be tested for content (i.e., identity), purity, or potency
(i.e., activity) using any suitable means, before formulation into
a pharmaceutical composition. Method may include but are not
limited to immunoassays, ELISA, SDS-PAGE, western blot, Northern
blot, Southern blot or PCR, HUVEC assays and the like.
V. Method of Treatment
[0305] In another aspect, the present disclosure provided a method
for treating a pathological angiogenesis related disease,
comprising administering a pharmaceutically effective amount of the
pharmaceutical compositions provided herein to a human subject in
need of such treatment. In some aspects, the disease is selected
from the group of ocular neovascular diseases consisting of:
age-related macular degeneration (AMD), wet-AMD, dry-AMD, retinal
neovascularization, choroidal neovascularization diabetic
retinopathy, proliferative diabetic retinopathy, retinal vein
occlusion, central retinal vein occlusion, branched retinal vein
occlusion, diabetic macular edema, diabetic retinal ischemia,
ischemic retinopathy and diabetic retinal edema.
[0306] In some cases, dry AMD may be treated. In some cases, dry
AMD may be referred to as central geographic atrophy, characterized
by atrophy of the retinal pigment epithelial later below the retina
and subsequent loss of photoreceptors in the central part of the
eye. The composition and methods of this disclosure provide for the
treatment of any and all forms of AMD.
[0307] In another aspect, the present disclosure provides a method
for prophylactic treatment of AMD or ocular neovascular diseases as
described herein, comprising administering a pharmaceutically
effective amount of the pharmaceutical compositions provided herein
to a human subject in need of such treatment. The present
disclosure may be used to treat patients at risk of developing AMD,
or presenting early symptoms of the disease. This may include
treatment of eyes either simultaneously or sequentially.
Simultaneous treatment may mean that the treatment is administered
to each eye at the same time or that both eyes are treated during
the same visit to a treating physician or other healthcare
provider. It has been documented that patients have a higher risk
of developing AMD in a healthy fellow eye of an eye that presents
symptoms of AMD, or in patients who have a genetic predisposition
toward developing AMD. The present disclosure can be used as a
prophylactic treatment in prevention of AMD in the fellow eye.
[0308] While the mechanism underlying the increased risk for the
progression of ocular neovascular disease in a fellow eye is
unknown, there are multiple studies in the art detailing this
elevated risk. For example, in one such large scale study, of 110
fellow eyes observed that progressed to advanced AMD, choroidal
neovascularization (CNV) developed in 98 eyes and foveal geographic
atrophy (GA) in 15 eyes. Qphthalmolgica, 2011; 226(3):110-8. doi:
10.1159/000329473. Curr Opin Ophthalmol. 1998 June; 9(3):38-46. No
non-ocular characteristic (age, gender, history of hypertension or
smoking) or ocular feature of the study eye at baseline (lesion
composition, lesion size, or visual acuity) was predictive of
progression to advanced AMD in this cohort. However, statistical
analysis indicates that AMD symptoms of the first eye, including
drusen size, focal hyperpigmentation, and nonfoveal geographic
atrophy had significant independent relationships in assessing risk
of developing of AMD in the fellow eye. Recent studies have
indicated that of ocular characteristics, genetic factors and
certain environmental factors may play a role in the increased risk
of developing AMD in the fellow eye. JAMA Ophthalmol. 2013 Apr. 1;
131(4):448-55. doi: 10.1001/jamaophthalmol.2013.2578. Given the
well characterized elevated risk of AMD development in untreated
fellow eyes, there is need in the art of methods for preventing
onset and subsequent vision loss due to the disease.
[0309] The term "subject," or "individual" or "patient" as used
herein in reference to individuals having a disease or disorder or
are suspected of having a disease or disorder, and the like.
Subject, individual or patent may be used interchangeably in the
disclosure and encompass mammals and non-mammals. Examples of
mammals include, but are not limited to, any member of the
Mammalian class: humans, non-human primates such as chimpanzees,
and other apes and monkey species; farm animals such as cattle,
horses, sheep, goats, swine; domestic animals such as rabbits,
dogs, and cats; laboratory animals including rodents, such as rats,
mice and guinea pigs, and the like. Examples of non-mammals
include, but are not limited to, birds, fish and the like. In some
aspects of the methods and compositions provided herein, the mammal
is a human.
[0310] The term "subject" or "individual" also includes humans
suffering from the disorder or disease, age 20 and older.
Unexpectedly, the present disclosure can be used in a range of
patient ages. This includes younger patients not generally
associated with AMD disease, which presents more frequently in
patients over the age of 65. Human subjects, or patients of the
disclosure may include ages at least about 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100. Human subjects, or
patients of the disclosure may include ages at most about 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100.
[0311] In some aspects, the term "subject," or "individual"
includes patients with varying responses to penicillin, such as
resistance or sensitivity to its effects or patients who show or
lack symptoms of allergic response to the drug.
A. Method of Delivery
[0312] In some aspects, the pharmaceutical composition is
administered to subretinal sites using any direction method. In
some cases, the delivery method may be by injection, such as those
described in US Pat Pub. No. 2010008170, which is incorporated by
reference in its entirety. In some cases, direct administration to
subretinal sites includes injection of a liquid pharmaceutical
composition via syringe. In another example, direct administration
may involve injection via a cannula or other suitable instrument
for delivery for a vector or recombinant virus. In other examples,
direct administration may comprise an implant further comprising a
suitable vector for delivery of transgenes such as sFLT-1. In some
cases the implant may be either directly implanted in or near the
retina.
[0313] The central retina, macula, and fovea regions of the retina
are unique amongst mammals to primates. Furthermore, there are
distinct differences in the anatomy and subsequent pathogenesis of
AMD between primate and humans. The central retina is the area of
the retina surrounding the posterior pole between the vascular
arcades of a primate eye, which includes the fovea, macula, and
surrounding area. The macula is near the center of the retina and
has a diameter of approximately 1.5 mm. This area contains the
highest concentration of both rod and cone photoreceptors. At the
center of the macula is the fovea, a small pit that contains the
largest concentration of cone photoreceptors. The macula and fovea
regions of the retina also contain underlying RPE cells. These
regions of the retina are responsible for perception of fine detail
(acuity) and color. As this region is responsible for the most
important part of human vision (fine vision), safe and effective
targeting of the vector to the subretinal space of the macula and
fovea is desired. In some cases, a pharmaceutical composition of
the disclosure is administered in the central retina. In some
cases, it is administered in the central retina outside the
fovea.
[0314] Briefly, the general method for delivering a vector to the
subretinal space of the macula and fovea may be illustrated by the
following brief outline. This example is merely meant to illustrate
certain features of the method, and is in no way meant to be
limiting.
[0315] Generally, the vector can be delivered in the form of a
suspension injected intraocularly (subretinally) under direct
observation using an operating microscope. This procedure may
involve vitrectomy followed by injection of vector suspension using
a fine cannula through one or more small retinotomies into the
subretinal space.
[0316] Briefly, an infusion cannula can be sutured in place to
maintain a normal globe volume by infusion (of e.g. saline)
throughout the operation. A vitrectomy is performed using a cannula
of appropriate bore size (for example 20 to 27 gauge), wherein the
volume of vitreous gel that is removed is replaced by infusion of
saline or other isotonic solution from the infusion cannula. The
vitrectomy is advantageously performed because (1) the removal of
its cortex (the posterior hyaloid membrane) facilitates penetration
of the retina by the cannula; (2) its removal and replacement with
fluid (e.g. saline) creates space to accommodate the intraocular
injection of vector, and (3) its controlled removal reduces the
possibility of retinal tears and unplanned retinal detachment.
[0317] In some aspects, the vector is directly injected into the
subretinal space within the central retina, by utilizing a cannula
of the appropriate bore size (e.g. 27-45 gauge), thus creating a
bleb in the subretinal space. In other aspects, the subretinal
injection of vector suspension is preceded by subretinal injection
of a small volume (e.g. about 0.1 to about 0.5 ml) of an
appropriate fluid (such as saline or Ringer's solution) into the
subretinal space within the central retina. This initial injection
into the subretinal space establishes an initial fluid bleb within
the subretinal space, causing localized retinal detachment at the
location of the initial bleb. This initial fluid bleb can
facilitate targeted delivery of vector suspension to the subretinal
space (by defining the plane of injection prior to vector
delivery), and minimize possible vector administration into the
choroid and the possibility of vector injection or reflux into the
vitreous cavity. In some aspects, this initial fluid bleb can be
further injected with fluids comprising one or more vector
suspensions and/or one or more additional therapeutic agents by
administration of these fluids directly to the initial fluid bleb
with either the same or additional fine bore cannulas.
[0318] Intraocular administration of the vector suspension and/or
the initial small volume of fluid can be performed using a fine
bore cannula (e.g. 27-45 gauge) attached to a syringe. In some
aspects, the plunger of this syringe may be driven by a mechanized
device, such as by depression of a foot pedal. The fine bore
cannula is advanced through the sclerotomy, across the vitreous
cavity and into the retina at a site pre-determined in each subject
according to the area of retina to be targeted (within the central
retina). In one aspect, administration is performed to a site
outside the fovea. Under direct visualization the vector suspension
is injected mechanically under the neurosensory retina causing a
localized retinal detachment with a self-sealing non-expanding
retinotomy. As noted above, the vector can be either directly
injected into the subretinal space creating a bleb within the
central retina or the vector can be injected into an initial bleb
within the central retina, causing it to expand (and expanding the
area of retinal detachment). In some aspects, the injection of
vector suspension is followed by injection of another fluid into
the bleb.
[0319] Without wishing to be bound by theory, the rate and location
of the subretinal injection(s) can result in localized shear forces
that can damage the macula, fovea and/or underlying RPE cells. The
subretinal injections may be performed at a rate that minimizes or
avoids shear forces. In some aspects, the vector is injected over
about 15-17 minutes. In some aspects, the vector is injected over
about 17-20 minutes. In some aspects, the vector is injected over
about 20-22 minutes. In some aspects, the vector is injected over
about 1 minute or over about 1-3 minutes or in less than one
minute. In some aspects, the vector is injected at a rate of about
35 to about 65 .mu.l/min or 65 .mu.l/min to about 150 .mu.l/min. In
some aspects, the vector is injected at a rate of about 35
.mu.l/min. In some aspects, the vector is injected at a rate of
about 40 .mu.l/min. In some aspects, the vector is injected at a
rate of about 45 .mu.l/min. In some aspects, the vector is injected
at a rate of about 50 .mu.l/ml. In some aspects, the vector is
injected at a rate of about 55 .mu.l/min. In some aspects, the
vector is injected at a rate of about 60 .mu.l/ml. In some aspects,
the vector is injected at a rate of about 65 .mu.l/min. In some
aspects, the vector is injected at a rate of about 100 .mu.l/min.
One of ordinary skill in the art would recognize that the rate and
time of injection of the bleb may be directed by, for example, the
volume of the vector or size of the bleb necessary to create
sufficient retinal detachment to access the cells of central
retina, the size of the cannula used to deliver the vector, and the
ability to safely maintain the position of the cannula of the
disclosure.
[0320] One or multiple (e.g. 2, 3, or more) blebs can be created.
Generally, the total volume of bleb or blebs created by the methods
and systems of the disclosure cannot exceed the fluid volume of the
eye, for example about 4 ml in a typical human subject. The total
volume of each individual bleb is preferably at about 0.1-0.2 ml.
One of ordinary skill in the art will appreciate that in creating
the bleb according to the methods and systems of the disclosure
that the appropriate intraocular pressure must be maintained in
order to avoid damage to the ocular structures. The size of each
individual bleb may be, for example, about 50 .mu.l to about 100
.mu.l, about 50 .mu.l to about 200 .mu.l, about 0.1 to about 0.2
ml, about 0.1 to about 0.3 ml, or >0.3 ml.
[0321] In order to safely and efficiently transduce areas of target
retina (e.g. the central retina) outside the edge of the original
location of the bleb, in some cases it may be desirable to
manipulate the bleb to reposition the bleb to the target area for
transduction. Manipulation of the bleb can occur by the dependency
of the bleb that is created by the volume of the bleb,
repositioning of the eye containing the bleb, repositioning of the
head of the human with an eye or eyes containing one or more blebs,
and/or by means of a fluid-air exchange. This is particularly
relevant to the central retina since this area generally resists
detachment by subretinal injection.
[0322] In some aspects fluid-air exchange is utilized following
subretinal injection; fluid from the infusion cannula is
temporarily replaced by air, e.g. from blowing air onto the surface
of the retina. As the volume of the air displaces saline fluid from
the vitreous cavity, the bleb is kept in place without efflux into
the vitreous cavity. By positioning the eye globe appropriately,
the bleb of subretinal vector in some cases can be manipulated to
involve adjacent areas (e.g. the macula and/or fovea). In some
cases, the mass of the bleb is sufficient to cause it to gravitate,
even without use of the fluid-air exchange. Movement of the bleb
may be further be facilitated by altering the position of the human
subject's head, so as to allow the bleb to gravitate to the desired
location in the eye. Once the desired configuration of the bleb is
achieved, fluid is returned to the vitreous cavity. The fluid is an
appropriate fluid, e.g., fresh saline. Generally, the subretinal
vector may be left in situ without retinopexy to the retinotomy and
without intraocular tamponade, and the retina will spontaneously
reattach within about 48 hours.
[0323] Subretinal administration of AAV-2 for treatment of an
ocular disease has been demonstrated in treatment of the rare
genetic disease, Leber's Congenital Amaurosis ("LCA"). The
pathology of LCA and the LCA patient population are different from
those of wet-AMD and therefore it was not expected that treatment
of wet AMD with gene therapy, and in particular, with AAV-2, would
be safe and effective prior to the rAAV.sFLT clinical study.
Specifically, LCA is a degenerative genetic disease caused by
insufficient expression of the retinal protein RPE-65. It causes
slow deterioration of vision in babies and young children that
leads to total blindness by young adulthood, generally prior to age
25 to 30. By contrast, as described here previously, wet AMD is
caused by growth of new blood vessels in the retina late in life,
generally beginning between age 65-75. The presence of new vessels
raises the concern that AAV particles, the transgene or the
transgene product, would be transported outside the eye in greater
amounts than was shown in the LCA study. Additionally, the immune
system and immune response to foreign substances changes as
patients age creating uncertainly prior to study results disclosed
in Example 12 that treatment of wet AMD with a viral vector such as
rAAV.sFLT-1 would be safe and effective.
B. Effect of Treatment
[0324] In some aspects, a single injection of the pharmaceutical
composition of the present disclosure into the affected eye not
only has the benefits of the Lucentis.RTM. treatment, but may also
require only one single injection.
[0325] The pharmaceutical composition of the present disclosure can
stop leakage in existing blood vessels and can inhibit further new
vessel formation in the subretinal space of patients suffering from
CNV secondary to AMD for at least 18 months, and in some aspects
the activity continues for 3-5 years. Inhibition of leakage and new
vessel formation prevents the development of blindness in affected
patients.
[0326] In some aspects, the sFLT-1 protein levels in the vitreous
of said human subject is about 500-5,000 pg/ml, about 600-4,000
pg/ml, about 800-3,000 pg/ml about 900-2,000 pg/ml, or about
1,000-1,800 pg/ml, 500-700 pg/ml, 700-1,000 pg/ml, 1,000-1200
pg/ml, 1200-1,500 pg/ml, 1,800-2000 pg/ml. In some cases, protein
levels in the vitreous of the human subject is at least about 100,
200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300,
1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300 or 2400
pg/ml. In some cases, protein levels in the vitreous of the human
subject is at most about 100, 200, 300, 400, 500, 600, 700, 800,
900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900,
2000, 2100, 2200, 2300 or 2400 pg/ml.
[0327] In some cases, protein "levels" may refer to any quantity or
relative quantity of protein. In some cases, level may be measured
as a concentration (e.g. pM, nM, uM etc.), a molality (e.g. m), as
a mass (e.g. pg, ug, ng etc.) or any suitable measurement. In some
cases, a unitless measurement may indicate a level.
[0328] In some cases, protein levels may be measured at least about
0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2, 3, 4, 5, 6, 7,
14, 21 or 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300,
325, 350 or 365 days after administering said pharmaceutical
composition. In some cases, protein levels may be measured at most
about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2, 3, 4, 5,
6, 7, 14, 21 or 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275,
300, 325, 350 or 365 days after administering said pharmaceutical
composition. In some cases, protein levels are measured at least 72
hours after administering said pharmaceutical composition.
[0329] Administration of the pharmaceutical composition of the
present disclosure general leads to no side effects or adverse
events.
[0330] In some aspects, no vector is detected in the human
subject's tear, blood, saliva or urine samples 7, 14, 21 or 30 days
after administering said pharmaceutical composition. In some
aspects, the presence of the viral vector is detected by qPCR or
ELBA as known in the art.
[0331] In some cases, no vector is detected in the human subject s
tear, blood, saliva or urine samples at least about 0.1, 0.2, 0.3,
0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2, 3, 4, 5, 6, 7, 14, 21 or 30,
50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350 or
365 days after administering said pharmaceutical composition. In
some cases, no vector is detected in the human subject's tear,
blood, saliva or urine samples at most about 0.1, 0.2, 0.3, 0.4,
0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2, 3, 4, 5, 6, 7, 14, 21 or 30, 50,
75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350 or 365
days after administering said pharmaceutical composition. In some
cases, no vector is detected in the human subject's tear, blood,
saliva or urine samples are measured at least 72 hours after
administering said pharmaceutical composition.
[0332] In some aspects, the human subject shows no clinically
significant retinal toxicity as assessed by serial ophthalmic
examinations over at least about a 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
or 12 month months period. In some aspects, the human subject shows
no clinically significant retinal toxicity as assessed by serial
ophthalmic examinations over at most about a 2, 3, 4, 5, 6, 7, 8,
9, 10, 11 or 12 month months period.
[0333] In some aspects, no superficial, anterior segment or
vitreous inflammatory signs are present in the human subject over
least a two months period. In some cases, no superficial, anterior
segment or vitreous inflammatory signs are present in the human
subject at 1 week or at 3, 6, 9 or 12 months after administration
of the pharmaceutical composition.
[0334] In some aspects, no inflammatory signs are seen including a
cytotoxic T cell response within about a 10% of normal range
following administering step. In some aspects, there is no increase
in T-cell response as measured by ELISpot. In some aspects, T cells
do not express HLA-DR or Ki67, and do not develop an activated
effector phenotype, as described in Lai et al. 2011; Gene Therapy,
which is herein incorporated by reference in its entirety. In some
aspects, no inflammation of the vitreous is observed by
biomicroscopy (BE) and indirect opthalmoscopy (IOE) following the
administering step. In some aspects, trace inflammation of the
vitreous that resolved within 10 days is observed by biomicroscopy
(BE) and indirect opthalmoscopy (IOE) following the administering
step. In some aspects, the human subject does not require rescue
treatment at least 120 days post administration. In some aspects,
the human subject does not require rescue treatment for at least 30
days, at least 60 days, at least 90 days, at least 120 days at
least 180 days, at least 270 days or at least 365 days after
administration.
[0335] As used herein, rescue treatment refers to an administration
of a dose of a VEGF inhibitor after the initial administration of
the pharmaceutical composition described in the present disclosure.
A rescue treatment is administered to boost the amount of VEGF
inhibition in the eye patient in order to arrest or reverse signs
and symptoms of disease progression. The decision to administer a
rescue treatment may be based on predetermined diagnostic criteria,
as in the clinical study described in Example 12, or on a
physcian's clinical judgment that signs of active disease are
present in a patient.
[0336] In some aspects, there is no evidence of visual acuity loss,
IOP elevation, retinal detachment, or any intraocular or systemic
immune response in said human subject at least 120 days post
administration. In some aspects, there is no evidence of visual
acuity loss, IOP elevation, retinal detachment, or any intraocular
or systemic immune response in said human subject at least 30 days,
at least 60 days, at least 90 days, at least 120 days at least 180
days, at least 270 days or at least 365 days after administration.
In some aspects, there is no evidence of visual acuity loss, IOP
elevation, retinal detachment, or any intraocular or systemic
immune response in said human subject at most 30 days, at least 60
days, at least 90 days, at least 120 days at least 180 days, at
least 270 days or at least 365 days after administration.
[0337] In some aspects, a patient's best corrected visual acuity
(BCVA) improves by 1, 2, 3, 4, 5 or more lines.
[0338] In some aspects, a reduction in neovascularization as
assessed by Fluorscein Angiography (FA) follows the administering
step.
[0339] In some cases, retinal thickness may be measured to examine
the effects of treatment. In some cases, the central retinal
thickness of the human subject does not increase by more than 50
microns, 100 microns, or 250 microns within 12 months following
treatment with the pharmaceutical composition of the disclosure. In
some cases, the central retinal thickness of the human subject
decreases by at least 50 microns, 100 microns, 200 microns, 250
microns, 300 microns, 400 microns, 500 microns, 600 microns within
3 months, 6 months or 9 months 12 months following treatment with
the pharmaceutical composition of the disclosure. The decrease in
the central retinal thickness of the human subject may be measured
comparing the central retinal thickness at point in time to a
baseline measurement taken at or within 1, 3, 7 or 10 days of the
administration of the pharmaceutical composition of the
disclosure.
C. Combination Treatment with VEGF Inhibitors
[0340] In some aspects, the method further comprises administering
to the human subject a pharmaceutically effective amount of a VEGF
inhibitor.
[0341] In some aspects, the VEGF inhibitor comprises an antibody
against VEGF or a functional fragment thereof. In some aspects, the
VEGF inhibitor comprises ranibizumab. In other aspects the VEGF
inhibitor is a soluble receptor, fusion protein, or fragment
thereof, such as aflibercept or sFLT01. In some aspects, the
pharmaceutical composition is administered at least 1, 2, 3, 4, 5,
6, 7, or 8 days after the administering of said VEGF inhibitor. In
some aspects, the pharmaceutical composition is administered at
most 1, 2, 3, 4, 5, 6, 7, or 8 days after the administering of said
VEGF inhibitor. In some aspects, the pharmaceutical composition is
administered within 90 days after the administering of said VEGF
inhibitor.
[0342] In some aspects, the patient is treated under a protocol
such as outlined in FIG. 13. After the protein expressed by the
recombinant virus is expressed at a suitable level, (or "on"), the
patients are followed with criteria-based re-treatment: [0343] If
disease recurs, ranibizumab re-treatment is allowed [0344] Expect
5-8 re-treatments per year with control group [0345] In treatment
group, expect equivalent vision with substantial decrease in number
of re-treatments.
[0346] The patient is eligible for re-treatment if signs of active
CNV are present: [0347] Based upon objective criteria as evaluated
by masked personnel (technician and ophthalmologist) [0348]
Re-treatment criteria are based upon substantial experience with
"as needed" (PRN) treatment in previous trials with anti-VEGF
agents.
[0349] Re-treatment is warranted based on signs of active disease;
such as: [0350] >10 Early Treatment Diabetic Retinopathy Study
(ETDRS) letter loss from human subject's previous visit
(attributable to retinal causes), OR a decrease of >5 ETDRS
letters from previous visit in conjunction with patient perception
of functional loss; [0351] Any increased, new, or persistent
subsensory, sub-Retinal Pigment Epithelial (RPE), or intraretinal
fluid on OCT; [0352] Signs of increased CNV leakage via FA.
[0353] In some aspects, the VEGF inhibitor is administered for at
least 1 time prior to administering the said pharmaceutical
composition and an additional 1 or 2 times at about 30 day
intervals following said administration to prevent disease
progression while protein expression increase to suitable levels.
In some aspects, the VEGF inhibitor is administered for at least 2
times prior to administering said pharmaceutical composition. In
some aspects, the VEGF inhibitor is administered over a period of 6
to 7 weeks following administration of said pharmaceutical
composition.
[0354] In some aspects, the frequency of administration of VEGF
inhibitor is reduced by less than a year or stopped altogether.
[0355] In some aspects, the present disclosure is used after 3 or
more treatments of VEGF inhibitors. In some aspects, the present
disclosure is used after observation that AMD patients show no
improvement in BCVA after use of other VEGF inhibitors.
D. Other Combination Treatments
[0356] In another preferred aspect, treatment of a patient
comprises administration one or more of the pharmaceutical
compositions provided herein, in conjunction with other therapies,
for example, chemotherapy, radiation, surgery, anti-inflammatory
agents, selected vitamins and the like. The other agents can be
administered, prior to, after or co-administered with the
pharmaceutical compositions.
[0357] Aspects of the disclosure may be practiced without the
theoretical aspects presented. Moreover, the theoretical aspects
are presented with the understanding that Applicants do not seek to
be bound by the theory presented.
[0358] While preferred aspects of the present disclosure have been
shown and described herein, it will be obvious to those skilled in
the art that such aspects are provided by way of example only.
Numerous variations, changes, and substitutions will now occur to
those skilled in the art without departing from the disclosure. It
should be understood that various alternatives to the aspects of
the disclosure described herein may be employed in practicing the
disclosure. It is intended that the following claims define the
scope of the disclosure and that methods and structures within the
scope of these claims and their equivalents be covered thereby.
[0359] The effective dose of the nucleic acid will be a function of
the particular expressed protein, the particular disease to be
targeted, the patient and his or her clinical condition, weight,
age, sex, etc.
EXAMPLES
[0360] It will be understood by those of skill in the art that
numerous and various modifications can be made to yield essentially
similar results without departing from the spirit of the present
disclosure. All of the references referred to herein are
incorporated by reference in their entirety for the subject matter
discussed. The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
disclosure.
[0361] It must be explained, if not specified, that the percentage
of following examples are all weight percent content wt %.
Example 1
rAAV.sFlt-1
[0362] One example recombinant virus is rAAV.sFlt-1. It encodes a
vector and a human form of the truncated, soluble VEGF receptor 1
(sFLT-1). The vector is a recombinant, replicative-deficient
adeno-associated viral (rAAV) vector, of serotype 2.
[0363] The rAAV.sFlt-1 was manufactured under Good Manufacturing
Practices (cGMP). At the manufacture site, the final product was
aliquoted into sterile, low-virus-binding microcentrifuge tubes
(individually wrapped, low-retention, sterilised flat cap vials)
according to the protocol requirements (i.e. 200 .mu.l of
1.times.10.sup.10 or 1.times.10.sup.11 viral genomes) and stored at
-80.degree. C. to await final product release. Each vial contained
enough vector for use in a single patient (100 .mu.l to be
administered).
[0364] The recombinant virus, rAAV.sFlt-1, is a recombinant
adeno-associated virus 2 (rAAV2) vector carrying the soluble VEGFR
receptor 1 (VEGFR1) or sFLT-1 driven by the human cytomegalovirus
(CMV) promoter. The rAAV.sFlt-1 vector and intact AAV2 genome used
as the backbone was prepared as described in Lai et. al. Gene
Therapy 2002 vol. 9 (12) 804-813). The rAAV2 vector is devoid of
viral coding sequences, i.e., rep and cap have been replaced with
an expression cassette for the therapeutic gene. The active moiety
of rAAV.sFlt-1 is sFlt-1. sFLT-1 is the soluble truncated form of
the vascular endothelial growth factor receptor 1 (VEGFR1 or Flt-1)
which occurs naturally. sFLT-1 is the only known endogenous
specific inhibitor of VEGF. sFLT-1 is generated by alternative
splicing and it lacks the membrane-proximal immunoglobulin-like
domain, the transmembrane spanning region and the intracellular
tyrosine-kinase domain. Hence, it contains only the first six
extracellular immunoglobulin-like loops followed by 31 unique amino
acid residues. sFLT-1 was first identified in human umbilical vein
endothelial cells (HUVEC), but it has since been found to occur
naturally in the placenta and circulating systematically in
pregnant women. The sFLT-1 used in generating rAAV.sFlt-1 contains
an open reading frame encoding only the first six extracellular
immunoglobulin-like domains of the full length membrane-spanning
FLT-1, followed by a unique 31-amino acid long C-terminal
extension, representing the alternatively splices, secreted soluble
FLT-1 isoform described earlier.
[0365] While the ITR has been shown to possess mild promoter
activity, for maximum levels of transgene expression, the cassette
generally includes a promoter/enhancer combination, a small intron
sequence, the cDNA of the therapeutic gene, and a polyadenylation
signal. In rAAV.sFlt-1, the human CMV major immediate early gene
enhancer/promoter and a chimeric intron were placed upstream of the
sFLT-1 cDNA. A simian virus 40 polyadenylation (SV40 poly A) signal
was placed downstream of the sFLT-1 cDNA.
[0366] Binding of sFLT-1 to VEGF in vitro has been widely
demonstrated. The ability of sFLT-1 to inhibit VEGF-driven
angiogenesis has attracted considerable attention for its potential
clinical application, but no evidence of efficacy or suitability in
humans was shown prior to the clinical study of rAAV.sFlt-1
described in Example 12. The angiostatic activity of sFLT-1 results
from inhibition of VEGF by two mechanisms: i) sequestration of
VEGF, to which it binds with high affinity, and ii) formation of
inactive heterodimers with membrane-spanning isoforms of the VEGF
receptors Flt-1 and KDR/Flk-1.
Nucleotide Sequence and Diagram of Plasmid Vector Used to Generate
rAAV.sFlt-1
[0367] rAAV.sFlt-1 was generated by triple transfection of human
embryonic kidney 293 cells with DNA from the pSSV.CI.hsFlt-1
plasmid vector and helper plasmids, as is known in the art (Xiao et
al., 1998. J Virololgy, 72(3): 2224-2232). rAAV.sFlt-1 was purified
using a sequential process of nuclei isolation, density gradient
centrifugation and heparin sulfate affinity column chromatography.
A diagrammatic representation of the sFLT-1 plasmid vector is given
in FIG. 1.
Formulation
[0368] rAAV.sFlt-1 was formulated in sterile phosphate buffered
saline (pH7) at 2 concentrations: 1.times.1010 vector genome/100
.mu.L (low dose) and 1.times.1011 vector genome/100 .mu.L (high
dose) in sterile low-virus-binding microcentrifuge tubes. The
formulation is preservative-free and is for one-thaw, single use by
subretinal injection only.
rAAV(bv).sFlt-1
[0369] A second example recombinant virus is rAAV(bv).sFlt-1.
rAAV(bv).sFlt-1 is a recombinant, replicative-deficient
adeno-associated viral (rAAV) vector, of serotype 2 that is
produced using a baculovirus expression system (BEVS) in Sf9 insect
cells, and encodes a human form of the truncated, soluble VEGF
receptor 1 (sFLT-1). The vector was produced using infection in Sf9
cells with two recombinant baculovirsues, Bac-inRep-inCap and
Bac-sFlt-1. Bac-sFlt-1 was derived from bacmid DNA that was
generated from transformation of electrocompetent cells with an 8.7
kb plasmid, AVA01-pFB-CMV-sFlt, which was cloned from the
Frag001m-BHKan and the plasmid backbone V109-pFB-AAV-CMV-SV40pA-Kan
using standard molecular biology techniques, as described in
Maniatis et al., and as further described below. Frag001m was
formed from the following sequential nucleic acid elements which
were chemically synthesized by Blue Heron Biotech, LLC (Bothell,
Wash.) and cloned into a BHKan backbone: an ITR (AAV serotype 2),
CMV-IE promoter, chimeric intron, 5' untranslated region (UTR),
sFlt-1 coding sequence, SV40 polyA region, ITR (AAV serotype 2).
The plasmid V109-pFB-AAV-CMV-SV40 pA-Kan was obtained from Virovek,
Inc. (Hayward, Calif.). The plasmid contained a kanamycin
antibiotic resistance gene, a ColE1 origin and a recombinant AAV
cassette, which contained a CMV-IE promoter, an intron, multiple
cloning sequences and a SV40 polyA region, flanked by inverted
terminal repeats (ITRs) from AAV serotype 2. This rAAV cassette was
flanked by a gentamicin resistance gene and Tn7L attachment sites.
AVA01-pFB-CMV-sFlt did not contain a T7 RNA polymerase promoter or
other prokaryotic regulatory sequence. Bac-inRep-inCap is a
recombinant baculovirus containing expression cassettes for rep and
cap genes from AAV serotype 2.
rAAV(bv).sFlt-1 Production in Baculovirus
[0370] rAAV(bv).sFlt-1 was produced in baculovirus according to the
methods described in U.S. patent application Ser. No. 12/297,958
and more specifically as follows: Sf9 cells were grown at
28.degree. C. to about 107 cells/ml in SF900 II SFM media
containing 100 units/ml of penicillin and 100 .mu.g/ml
streptomycin, and diluted to about 5.times.106 cells/ml prior to
infection. Bac-inRep-inCap and Bac-sFlt-1, each at m.o.i. of one
were used to infect the cells at 28.degree. C. for 3 days to
produce AAV type 2 vectors. After 3 days of infection, cell pellets
were collected by centrifugation at 2,000 rpm for 15 min in a
tabletop centrifuge. The cell pellets were lysed in lysis buffer as
described by Urabe et al., Hum Gene Ther. 1; 13(16):1935-43 (2002)
and cellular nucleic acids (DNA and RNA) were digested by benzonase
(Sigma, St. Louis, Mo.). The cell lysates were cleared by
centrifugation at 8,000 rpm for 30 min in an Avanti J-25 centrifuge
(Beckman, Fullerton, Calif.) and then loaded onto an SW28
centrifuge tube containing 5 ml of 1.55 g/cc, and 10 ml of 1.32
g/cc of CsCl solutions. After centrifugation at 28,000 rpm for
about 16 hours at 15.degree. C., the rAAV-containing fraction was
collected by puncturing the centrifuge tube using a syringe needle
and subjected to a second round of CsCl ultracentrifugation. The
rAAV-containing fraction was collected again by puncturing the
centrifuge tube using a syringe needle and dialyzed in PBS buffer
to remove the salts and detergents. Vector titers were determined
by quantitative real-time PCR assay according to manufacturer's
protocol (Applied Biosystems, Foster City, Calif.).s
Example 2
In Vitro Inhibition of VEGF-Induced Endothelial Cell
Proliferation
[0371] Studies were performed to assess VEGF-induction of human
umbilical vein endothelial cell (HUVEC) proliferation and to
determine whether VEGF-induced HUVEC proliferation would be
inhibited by rAAV-mediated sFLT-1. The presence of sFLT-1 in
transduced cells was first confirmed by Western blot analysis of
conditioned media (FIG. 2, panel a). Conditioned medium from
rAAV.sFlt-1-transduced and rAAV.gfp-transduced 293 cells were added
to VEGF-treated HUVECs in increasing dilutions. A control
starvation medium (normal HUVEC growth medium without bovine
endothelial growth factor) only was also included. Heparin was
added to each well at 100 .mu.g/mL. The relative VEGF-induced
proliferation of HUVECS treated with VEGF and the different
conditioned media was assayed by addition 25 .mu.L of
3-(4,5-dimethythiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 5
mg/mL, Sigma) to each well for 4 hours at 37.degree. C. The
secreted sFLT-1 encoded by the rAAV vector in 40 .mu.L of
conditioned medium from rAAV.sFlt-1-transduced 293 cells was
confirmed to inhibit VEGF-induced proliferation of HUVECS by 32%.
Doubling the volume of conditioned medium resulted in complete
inhibition with cell growth equivalent to basal levels similar to
culture in starvation medium (FIG. 2, panel b).
In vitro Assessment of rAAV.sFt-1 Vector Potency
[0372] Studies were performed to assess the potency of AAV vectors
encoding the recombinant human sFlt-1 gene by quantifying human
sFlt-1 protein expression of transduced human embryonic kidney 293
(HEK293) cells by ELISA. Human embryonic kidney 293 cells were
obtained from the American Type Culture Collection (Rockville, Md.,
USA) and cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco,
Grand Island, N.Y., USA) with 10% Fetal bovine serum (FBS, GIBCO)
and 1.times. Penicillin-Streptomycin-Glutamine. All cultures were
maintained at 37.degree. C. and 5% CO2 in a humidified
atmosphere.
[0373] The HEK293 cells were seeded at 8E4 or 1.5E5 cells/24 well
and transduced at 60-90% confluency with the recombinant AAV
vectors at a multiplicity of infection (MOI) ranging from
1.times.10.sup.3-1.times.10.sup.6 in DMEM medium supplemented with
2% FBS. After 72 hours, post-transduction, conditioned media were
collected. Aliquots of the conditioned media were prepared for
ELISA using reagents and according to standard instructions from
the R&D Systems SVR100B Quantikine ELISA Human sVEGF R1/sFlt-1
kit. (R&D Systems, Minneapolis, Minn.). Samples, standards and
controls were prepared according to the ELISA kit instructions with
the R&D Systems ELISA reagents and then transferred to an ELISA
plate pre-coated with an antibody to sVEGF R1/sFlt-1 and incubated
for two hours at room temperature on a horizontal orbital
microplate shaker. After incubation, anti-sVEGF R1 Conjugate (two
hours), substrate solution (30 minutes) and stop solution were
sequentially applied to each well with aspiration and wash steps
between each according to standard ELISA assay procedures. The
optical density (OD) of the samples, standards and controls was
measured within 30 minutes of stopping the substrate reaction with
an ELISA plate reader. The concentration of sFlt-1 in pg/mL was
calculated using SoftmaxPro software using the OD measurements from
the ELISA plate reader.
[0374] Results of the studies for rAAV.sFlt-1 and rAAV(bv).sFlt-1
are presented in FIG. 25A and FIG. 25B. The concentration of sFlt-1
protein expressed by HEK293 cells 72 hours after transduction with
rAAV.sFlt-1 and rAAV(bv).sFlt-1 ranged from 100-1,000 pg/mL at an
MOI of 1.times.10.sup.4, 100-10,000 pg/mL at an MOI of
1.times.10.sup.5 and 1,000-10,000 pg/mL at an MOI of
1.times.10.sup.6.
Example 3
rAAV.sFlt-1 Studies in Mice
[0375] Transgenic mice (trVEGF029) with slow, but stable retinal
neovascularization induced by transgenic expression of human VEGF
from photoreceptor cells were used as a model for retinal
neovascularization. Two separate studies with these mice have been
conducted.
[0376] In the first mouse study, 13 transgenic mice were assessed
for ocular neovascular changes before and after administration of
the rAAV.sFlt-1 vector (1.times.10.sup.11 vector particles) in one
eye and control vector in the contralateral eye. Eyes were assessed
for neovascular changes using fluorescein angiography at one, three
and eight months after injection. The extent, intensity and stage
of neovascularization were graded (0-4) by three observers, masked
to the treatment received in the eyes examined There was a
statistically significant overall reduction in the neovascular
grading from a median grade of `3` (before injection) to a median
grade of `1` at one month after injection (P=0.012). This reduction
was maintained at three months (median=1; P=0.001) and at eight
months (median=1; P=0.001) after injection with rAAV.sFlt-1.
Injection of rAAV.sFlt-1 vector resulted in the long-term (at least
eight months) regression of neovascular vessels in 85% (11 of 13)
of treated eyes compared to 8% (1 of 13) in the control
vector-treated eyes.
[0377] Histological examination of the eyes in this preclinical
study revealed that disturbance or loss of photoreceptors was
significantly (P<0.01) more pronounced in control
vector-injected eyes compared to eyes injected with rAAV.sFlt-1.
Expression of sFLT-1 was also confirmed by reverse
transcriptase-polymerase chain reaction analysis of tissue samples;
mRNA for sFLT-1 was detected in all four eyes tested. No
rAAV.sFlt-1 vector-specific adverse effects were noted in the eye
injected with rAAV.sFlt-1 when compared to the eye injected with
the control (rAAV.gfp) vector.
[0378] In the second study, conducted in trVEGF02 transgenic mice,
the aim of the study was to determine whether subretinal injection
of rAAV.sFlt-1 resulted in any cell-mediated immune responses that
could negatively impact on long-term expression of sFLT-1 or cause
immune response-associated damage to the retina. In this study, 50
trVEGF02 transgenic mice were given subretinal injections of
rAAV.sFlt-1 (8.times.109 viral particles) or phosphate-buffered
saline (PBS) in one eye. The retinas of 30 mice from either the
rAAV.sFlt-1 or control treatment groups were then assessed at one
week and one month post-injection for the presence of immune cells
(leucocytes, macrophages and B- and T-lymphocytes). Flow cytometric
examination of the posterior eye cup showed that at one week
post-injection there was a statistically significant increase in
CD45+ leucocytes (6.6-fold increase compared to control; P<0.05)
and CD11b+ macrophages (5.7-fold increase compared to control;
P<0.036). However, there were no differences in CD19+, CD8+ and
CD4+(B- and T-lymphocytes) at this time point. At one month
post-injection, there were no differences in cell numbers between
leucocyte subsets (i.e. CD45+, CD19+, CD11b+, CD8+ or CD4+ cells)
in the mouse eyes treated with rAAV.sFlt-1 or the PBS control,
suggesting that the infiltration of leucocytes and macrophages was
transient. Flow cytometric evaluation of lymphocyte subsets of the
spleens from these mice at the one-week and one-month time points
showed no significant differences in the numbers of lymphocytes.
This finding suggests that there was no systemic immune response
observed, albeit a transient, localized immune response had been
shown in the retina.
[0379] In this second study, histological examination of the eyes
from five of the mice injected with either rAAV.sFlt-1 or PBS
revealed no observable immune-response associated destruction or
sequelae in the retinas of any of the mice examined.
[0380] To assess the impact of rAAV.sFlt-1 on the level of
neovascularization in this transgenic mouse model (trVEGF02) of
retinal neovascularization, the retinas of the mice injected with
either rAAV.sFlt-1 or PBS were also graded independently by two
different assessors at two months after treatment. Overall, there
was a significant reduction in mean neovascularization grades
(before injection: 1.46.+-.0.58; after injection: 0.81.+-.0.57;
P<0.00015) in the rAAV.sFlt-1-injected eyes whereas there was a
significant increase in mean neovascularization grades (before
injection: 1.08.+-.0.56; after injection: 1.63.+-.0.96; P<0.018)
in the PBS control-injected eyes.
[0381] The findings from this second mouse study clearly indicate
that treatment with rAAV.sFlt-1 appeared to reverse the progressive
increase in neovascularization observed in this mouse model of
retinal neovascularization and AMD. Furthermore, only a limited,
localized, inflammatory response was observed one week after
subretinal injection with rAAV.sFlt-1 and resolved at one month.
This immune response did not appear to compromise the long-term
therapeutic efficacy of rAAV.sFlt-1 in the retina.
[0382] The transgenic mice models described in this Example 3
demonstrate that the pharmaceutical compositions disclosed herein
can be used for the treatment and/or prophylaxis of other retinal
vascular diseases in which VEGF inhibition is implicated. These
include diabetic macular edema, diabetic retina ischemia, diabetic
retinal edema, proliferative diabetic retinopathy, retinal vein
occlusion, central retinal vein occlusion and branched retinal vein
occlusion. in clinical studies some VEGF inhibitors, such as
Lucentis, have been shown to effectively treat certain of these
diseases including diabetic macular edema and retinal vein
occlusion. The efficacy of rAAV.sFlt-1 demonstrated in these mouse
models indicates rAAV.sFlt-1 is also effective in treating these
VEGF mediated diseases.
Example 4
rAAV.sFlt-1 Study in Rats
[0383] In the rat rAAV.sFlt-1 study, two models of ocular
neovascularization were used: cautery-induced corneal
neovascularization and laser photocoagulation-induced choroidal
neovascularization (CNV). In the corneal neovascularization model,
22 rats were injected with rAAV.sFlt-1 vector (8.times.10.sup.8
viral particles) in the anterior chamber of one eye and with
control vector (rAAV.gfp) in the contralateral eye, followed by
cauterization of the cornea. The eyes were then examined for
neovascularization four days after cautery, using slit-lamp
photography. A significantly lower rate of corneal vascularization
was found in the rAAV.sFlt-1-treated eyes compared to the
control-treated eyes (27% and 63%, respectively; P=0.009).
Histological examination of the eyes showed that no corneal blood
vessels were observed in the majority of cauterized,
rAAV.sFlt-1-treated eyes. Histological examination also revealed
that cellular infiltration of the corneal stromal layer was more
pronounced in the control vector-injected eyes compared to the
rAAV.sFlt-1-treated eyes. In addition, there was obvious edema and
corneal stroma swelling in the control vector-treated eyes whereas
there was no evidence of significant tissue swelling in
rAAV.sFlt-1-treated eyes.
[0384] In the laser photocoagulation-induced CNV model, 10 rats
were injected subretinally with rAAV.sFlt-1 vector (8.times.108
viral particles) in one eye, and a control vector (rAAV.gfp) in the
contralateral eye. Laser photocoagulation was used to induce CNV
one month after injection. Five weeks after laser photocoagulation,
eyes were examined for CNV using fluorescein angiography. Only 41%
of the laser-treated areas showed leakage in the rAAV.sFlt-1
treated eyes compared to 60% in the control vector-treated eyes
(P=0.002). Sixteen weeks after laser-induced CNV, the
rAAV.sFlt-1-treated eyes still showed significantly lower
neovascularization than control eyes. Histological examination of
the eyes in the areas immediately adjacent to the injection sites
revealed a normal retinal pigmented epithelium and normal outer
segments and outer nuclear layer. These findings suggested there
was no obvious toxicity associated with sFLT-1 expression.
Electroretinograms also indicated normal functioning of
rAAV.sFlt-1-treated eyes. Most of the rAAV.sFlt-1 and control
vector-treated laser lesions developed subretinal cellular
membranes. However, the lesions in eyes treated with rAAV.sFlt-1
generally had less proliferating endothelial cells, reflecting the
fluorescein angiography findings, and indicating that the rate of
angiogenesis (i.e. neovascularization) was reduced in
rAAV.sFlt-1-treated eyes.
rAAV.sFlt-1 and rAAV(bv).sFlt-1 Study in Rat Model of Diabetes
[0385] To further assess the safety and efficacy of rAAV.sFlt-1 and
rAAV(bv).sFlt-1 for the treatment of diabetic retinopathy (DR) and
diabetic macular edema (DME), an experiment in a rat model of
diabetes is conducted.
[0386] Vision loss in diabetic patients is mediated by
inflammation, leading to the eventual breakdown of the
blood-retinal-barrier and subsequent vascular leakage, resulting in
macular edema. The streptozotocin (STZ)-diabetic rat model displays
a well-characterized pattern of vascular leakage, in which VEGF is
strongly upregulated as early as 2 weeks. (Miyamoto, K., et al.
Proc Natl Acad Sci USA 96, 10836-10841 (1999). Current approaches
to treating animal models of DR demonstrate only a partial
resolution of vascular leakage.
[0387] Diabetes is induced in Brown Norway rats by intraperitoneal
injection of streptozotocin (50 mg/kg). Diabetes is confirmed and
monitored by blood glucose measurements. Rats with blood glucose
>350 mg/dl are considered diabetic. Eight days following onset
of diabetes, rats are treated by subretinal injection (n=12 eyes
per group) with 5 .mu.L containing either 1.times.10.sup.10 or
5.times.10.sup.10 vg of rAAV.sFlt-1 or rAAV(bv).sFlt-1 using
established techniques as described in Chalberg, T. W. et al.,
Invest Ophthalmol Vis Sci 46, 2140-2146 (2005). AAV2.GFP
(5.times.10.sup.10 vg) and vehicle are be injected as controls.
Non-diabetic and diabetic no-treatment groups are also used as
controls.
[0388] The effect of the rAAV(bv).sFlt-1 expressing sFLT-1 on
vascular leakage is measure at 60 days. Retinal vascular leakage is
measured by the FITC-albumin leakage method following the injection
using the FITC-conjugated albumin as tracer. The FITC-albumin
leakage method directly measures the leakage of FITC-albumin
leaking into the retina from the circulation and is a commonly used
method to measure retinal vascular permeability. Retinal vascular
leakage in injected eyes will be compared to non-diabetic controls,
untreated and vehicle-treated diabetic eyes, and wildtype AAV
serotypes 2 and 8.
[0389] Results: rAAV(bv).sFlt-1 expressing sFLT-1 reduces vascular
leakage in the STZ-diabetic rat whereas injection of AAV2.GFP and
other controls does not.
Example 5
rAAV.sFlt-1 Study in Monkeys
[0390] The efficacy and safety of rAAV.sFlt-1 was also examined in
a nonhuman primate (macaque) model of AMD using laser
photocoagulation to induce CNV. One challenge in developing
treatments for AMD in humans is that nonhuman primates do not
develop AMD. Laser photocoagulation induced CNV simulates some
symptoms of AMD, but the underlying biological process is healing
of an acute injury rather than progression of a chronic disease and
thus may not be predictive of the performance of any particular
treatment for CNV in humans with AMD or other CNV based diseases.
Nonetheless, because human eyes are anatomically more similar to
nonhuman primate eyes than nonprimate eyes, nonhuman primates are
frequently studied to assess toxicity and histological response to
a potential treatment or other intervention.
[0391] In the first study on nonhuman primates, five macaque
monkeys were injected subretinally with rAAV.sFlt-1
(4.times.10.sup.12 viral particles) in one eye, and a control
vector (rAAV.gfp) in the contralateral eye. The eye health of the
monkeys was periodically assessed after subretinal injection. There
was no apparent complication related directly to subretinal
injection of either the control or rAAVsFlt-1 vector. A transient
conjunctival irritation and vitreous haze was noted in the week
following injection, which cleared by the second week. Subretinal
injection was unsuccessful in the right eye of one of the monkeys;
therefore this animal was not subjected to further evaluation.
[0392] Subretinal injection of 40-100 .mu.L of rAAV suspension
lifted the retina, creating a bleb that housed the vector between
the pigment epithelium and the photoreceptor layer in a localized
manner. This bleb self-corrected within 24 to 48 hours. Except for
a minor disturbance to the retinal pigment epithelium at the point
of needle penetration, no other retinal abnormalities were observed
for the duration of the follow-up (3 to 17 months post-injection).
No other abnormalities or adverse events were observed; at no time
was retinal detachment associated with the surgery.
[0393] To assess the long-term therapeutic efficacy of rAAVsFlt-1,
the four injected monkeys were then subjected to intense laser
photocoagulation 16 months after treatment with the vectors. Eight
lesions were induced using laser in each eye, and the eyes then
monitored for CNV at two and four weeks after laser treatment.
After laser photocoagulation, only three of the four monkeys were
analyzable, therefore, efficacy data was collected for three
animals. None of three monkey eyes treated with rAAVsFlt-1
developed CNV-related lesions and only weak fluorescein staining
was observed, indicating minimum leakage/neovascularization. All
contralateral eyes treated with control vector developed
CNV-related lesions.
[0394] In a follow-up study aimed at assessing the safety and
toxicity of rAAV.sFlt-1 injected into the subretinal space, eight
monkeys were used: five were injected in their left eyes with
rAAV.sFlt-1, two injected in their left eyes with rAAV.gfp, one
injected in both eyes with recombinant Flt-1 protein and one was
kept as uninjected control. The monkeys were examined preinjection
and post injection by color fundus photography, fluorescein
angiography and electroretinography. Blood was collected routinely
for assaying sFLT-1 levels and peripheral blood lymphocytes were
isolated for flow cytometry to assess immune cell subset response.
At time of sacrifice (3, 9 and 12 months post injection), tissues
were collected for i) biodistribution studies on the rAAV.sFlt-1
vector using real-time polymerase chain reaction on extracted
genomic DNA; ii) hsFlt-1 protein and AAV2 capsid protein level
quantitation by ELISA; and iii) histology of the eyes.
[0395] Color fundus photography, fluorescein angiography and
electroretinography did not detect any adverse effect on the eye
following injection. Plasma sFLT-1 level did not show any
rAAV.sFlt-1 injection-related rise in level in any of the male or
female monkeys examines Except for an optic nerve sample, the
rAAV.sFlt-1 sequence was not detected in the genomic DNA of any of
the other tissues sampled (lymph nodes, spleen, liver, brain,
brain, heart, spleen, cornea). Haematoxylin and eosin stained
paraffin-embedded sections of the eyes appeared normal.
[0396] While non-human primate anatomy is more similar to human
anatomy than the anatomy of smaller mammals such as mice,
limitations do exist which make studies in non-human primates
intriguing, but not predictive of clinical results in humans. As
noted above, the study in this example uses a laser injury model in
which the animal has otherwise healthy retinal tissue. The retinal
tissue was not degraded over time as in disease retinal tissue nor
are the disease specific pathogenic factors present. Non-human
primates frequently differ from humans with respect to
biodistribution, pharmacokinetics and dose dependencies, antibody
titer, immune response and inflammatory response in ways that are
not predictable. Additional differences include the ILM (inner
limiting membrane) and the volume of the vitreous chamber, which is
approximately four times larger in humans than the nonhuman
primates used in this study. The human inner limiting membrane, a
barrier that acts to limit transport between the retina and the
vitreous, is a more a more profound and effective barrier than the
ILM of a monkey.
Example 6
Safety Studies
[0397] In these studies, sFLT-1 protein was measured in the
vitreous and plasma of animals using an enzyme linked immunosorbent
assay kit for sFLT-1 protein detection. sFLT-1 protein level was
upregulated in vitreous and eyes of animals injected with
rAAV.sFlt-1. FIG. 3A shows the vitreous sFLT-1 protein level in
monkey eyes injected with rAAV.sFlt-1 (left eye) and control eye
injected with rAAV.gfp and uninjected eyes (right eye). sFLT-1
protein levels were significantly higher in four out of the five
rAAV.sFlt-1 injected eyes. Table 5.3.1 shows the sFLT-1 protein
level in the mouse eyes that were not injected and that were
injected with rAAV.sFlt-1 and enucleated at one month post
injection. Overexpression of sFLT-1 in the eyes of mice and
vitreous of monkeys did not have any adverse effect on their
overall well-being. In monkeys, sFLT-1 overexpression in the
vitreous did not have any effect on their retinal function and did
not have any clinically or histologically evident toxic effects on
the eyes. The significantly higher sFLT-1 protein levels in the
rAAV.sFlt-1 injected eyes suggests long-term rAAV-mediated hsFLT-1
expression and supports previous data on detection of viral mRNA
sequence and presence of rAAV-mediated gfp expression in monkey
retina 17 months post injection.
jh
TABLE-US-00001 TABLE 1 Summarizing hsFLT-1 protein levels in
rAAV.sFlt-1-injected mouse eyes and uninjected mouse eyes at 1
month post injection. Animal Time post species and injection sFLT-1
protein level number of eyes Treatment (week) (pg/mL) Mouse (n = 1)
uninjected NA 101.4 .+-. 4.8 Mouse (n = 1) uninjected NA 91.0 .+-.
10.9 Mouse (n = 1) uninjected NA 113.4 .+-. 6.3 Mouse (n = 1)
uninjected NA 160.2 .+-. 8.9 Mouse (n = 1) rAAV.sFlt-1 injected 4
1034.7 .+-. 44.3 Mouse (n = 1) rAAV.sFlt-1 injected 4 610.3 .+-.
16.3 Mouse (n = 1) rAAV.sFlt-1 injected 4 1417.2 .+-. 50 Mouse (n =
1) rAAV.sFlt-1 injected 4 >max
[0398] Plasma hsFLT-1 levels in the monkeys did not show any trend
at the different sampling times (FIG. 3B). This suggests that the
injection of rAAV.sFlt-1 did not have an obvious effect on the
plasma hsFLT-1 level. The fluctuating levels did not have any
effect on the well-being of the monkeys.
TABLE-US-00002 TABLE 2 Immunogenicity Studies Species/ Method of
Duration of GLP Strain administration dosing Doses compliance
C57Bl/6 subretinal 1, 2 and 8 .times. 10.sup.9 vector No mice 4
weeks genomes Monkeys subretinal 12 months 8 .times. 10.sup.11
vector No genomes Table 2: Summary of animal strain, injection
route, duration and dose of rAAV.sFlt-1 used in immunogenicity
studies
Example 7
Immunogenicity Studies on Mice
[0399] The cellular immune response to rAAV.sFlt-1 therapy was
assessed in the mouse eye one, two and four weeks post injection
using flow cytometry. Infiltrating leucocytes were identified on
the basis of CD45 expression and classified as
monocytes/granulocytes, B cells, CD4.sup.+ T cells and CD8.sup.+ T
cells on the basis of CD11b, CD19, CD4 and CD8 expression,
respectively. The posterior eye cup was collected from five mice in
each group (rAAV.sFlt-1-injected, PBS-injected, uninjected control)
and pooled for analysis. As shown in FIG. 4A, there was no
difference in the number of cells recovered from each group of mice
over the course of this experiment. However, there was a
significant increase in the number of CD45.sup.+ cells one and two
weeks post injection that disappeared by four weeks (FIG. 4B).
Almost all of the increase seen at one week could be attributed to
an increase in CD11b.sup.+ cells (FIG. 4C), since there was no
difference in the number of CD4.sup.+, CD8.sup.+, and CD19.sup.+
cells (FIGS. 4D-F). At two weeks though, there was no longer a
significant difference in the number of CD11b.sup.+ present in the
eyes of AAV.sFlt-1 injected mice; instead, there was a significant
increase in the number of CD4.sup.+ and CD8.sup.+ T cells and a
possible trend towards an increase in B cells. The number of
CD4.sup.+ and CD8.sup.+ cells fell sharply at four weeks yet
remained significantly increased compared to the PBS-injected and
uninjected mice. In contrast, there was no change in the number of
CD11b.sup.+, CD4.sup.+, CD8.sup.+ and CD19.sup.+ cells in the
spleen during the course of this experiment (FIGS. 5A-E).
[0400] The function of the T cells infiltrating the retina was
examined more closely by stimulating them with PMA/ionomycin or
anti-CD3 and measuring intracellular IFN-.gamma. production by flow
cytometry. FIG. 6 shows that compared to uninjected controls, a
small proportion of both CD4.sup.+ and CD8.sup.+ T cells were
primed to produce IFN-.gamma. after the injection of rAAV.sFlt-1.
The frequency of IFN-.gamma. producing cells did not vary
significantly over the course of the experiment despite an apparent
increase amongst CD8.sup.+ T cells on day 3 (FIG. 6B). Lower levels
of IFN-.gamma. were measured when the T cells were restimulated
with a class I MHC-restricted epitope of rAAV capsid protein and
some IFN-.gamma. was also detected in the absence of any
stimulation (data not shown). Taken together, these results
indicate a small proportion of the T cells infiltrating the eyes of
rAAV.sFlt-1-injected mice had been recently activated to produce
IFN-.gamma., but this did not vary amongst either T cell subset
during the course of this experiment.
[0401] The data presented for these experiments on the infiltration
of immune cells into the eyes of AAV-sFLT-1 injected mice clearly
show two waves of cell infiltration. There was an early wave of
CD11b.sup.+ cells at 1 week followed by a wave of CD4.sup.+ and
CD8.sup.+ T cells at 2 weeks. Importantly, neither wave of
infiltration was still present at 4 weeks, suggesting the
infiltration had resolved itself. Importantly, sFLT-1 protein
production was did not wane at this point, and indeed, continued to
be expressed at very high levels.
[0402] The data on IFN-.gamma. production indicated that around 5%
of the CD4.sup.+ and CD8.sup.+ T were recently primed, and this
frequency did not vary over the course of the experiment. Hu. et al
first described the breakdown of the blood-retinal barrier by
activated T cells, and the data presented here is consistent with
the infiltration of activated CD4.sup.+ and CD8.sup.+ cells.
However, there was no evidence of an increase in the number of
capsid-specific T cells amongst this population since restimulation
with specific peptide only revealed low and levels of IFN-.gamma.
production that did not change over the course of the experiment.
Taken together, these observations suggest that the initial insult
that occurred with injection of rAAV.sFlt-1 produced a short-lived
wave of immune cell infiltration that resolved itself within four
weeks, but failed to elicit an ongoing immune response that could
harm the tissues of the eye or affect sFLT-1 expression.
Example 8
Immunogenicity Studies on Monkeys
[0403] Immune response following subretinal injection of
rAAV.sFlt-1 or rAAV.gfp was analyzed using a panel of antibodies
that would identify changes in immune cell subset populations. The
results are summarized in FIG. 4. In some monkeys, very small
changes in immune cell subset populations were observed but they
were not statistically significant. Despite this, this was followed
by a more in-depth study of circulating cells. Specifically, we
assessed the possibility that either the vector (rAAV) or the
inserted gene product (sFLT-1) may cause immune activation.
Activation of B cells and T cells was investigated (FIG. 5 and FIG.
6). Other lymphocyte populations were also analyzed to determine
whether the therapy caused any observable differences that may be
indicative of direct activation or a response to activation.
Analysis was conducted using a combination of classic markers
(Pitcher, 2002 #129), as well as a novel phenotypic analysis
described in a recently published report (Miller, 2008 #126). Using
a small subset of phenotypic markers (HLA-DR, Ki-67, and Bcl-2) we
investigated whether following administration of rAAV-sFLT-1 CD4+
or CD8+ T cells and/or B cells showed signs of activation. In the
studies published by Miller and colleagues, activated T cells
display an activated effector phenotype characterized by the
expression of the differentiation marker HLA-DR and the cell cycle
associated nuclear antigen Ki-67, which is used as a marker for
proliferation. Resting T cells do not express Ki-67, whereas
cycling or recently divided T cells upregulate Ki-67 expression. A
level of Ki-67 expression is normally detected as part of
homeostatic cell cycling.
Example 9
Biodistribution of rAAV.sFlt-1
[0404] Genomic DNA was extracted from tissues collected (optic
nerve, lymph node, brain, heart, lungs, spleen, liver, cornea)
immediately after euthanasia of monkeys. Real time polymerase chain
reaction was performed on the genomic DNA to determine whether the
rAAV.sFlt-1 vector construct injected in the subretinal space would
be present elsewhere. Based on comparison of Ct values between
known amounts of control plasmid pssv.C1.sflt-1 DNA, the
rAAV.sFlt-1 construct was found at low gene copy number in the
optic nerve of one injected eye and not in any of the other tissues
samples. This suggests that rAAV.sFlt-1 injected into the
subretinal space remains mainly within the eye. Table 4 is a
summary of the Ct values from genomic DNA extracted from monkeys
that were not injected or injected with rAAV.sFlt-1- and
rAAV.gfp.
TABLE-US-00003 TABLE 3 Ct values and Ct standard deviation values
for the different genomic DNA and control plasmid DNA samples
analyzed. Sample ID Ct Mean Ct Std Dev No DNA 0 copy 40.83970125
0.08415232 pssv.C1.hsFlt-1 (0.045 ng) 6000000 copies 18.17500393
0.522299978 pssv.C1.hsFLT-1 (0.009.ng) 1000000 copies 22.5311632
0.318372962 pssv.C1.hsFLT-1 (0.0009 ng) 100000 copies 26.23701276
0.183232131 pssv.C1.hsFLT-1 (0.00009 ng) 10000 copies 25.2483849
0.164140658 pssv.C1.hsFLT-1 (0.000009 ng) 1000copies 29.4265616
0.415926721 Control uninjected monkey 1 LE Optic nerve 42.11 0.573
2 RE Optic nerve 43.58 0.323 3 axillary LN 45.86 1.319 4 cervical
LN N/A N/A 5 spleen 40.71 0.093 6 liver 44.16 0.604 Monkey 999:
rAAV.sFlt-1 injected, euthanized 3 mo p.i. 7 LE optic nerve 39.13
0.137 8 RE optic nerve 42.25 0.153 9 axillary LN 40.87 0.728 10
submandibular LN 40.54 0.453 11 spleen N/A N/A 12 liver 41.23 0.388
Monkey 8294: sFLT-1 protein injected, euthanized 3 mo p.i. 13 LE
optic nerve 42.15 0.545 14 RE optic nerve 42.67 0.411 15 axillary
LN 43.92 0.304 16 submandibular LN N/A N/A 17 spleen N/A N/A 18
liver 40.45 0.981 Monkey 8524: rAAV.sFlt-1 injected, euthanized 9
mo p.i. 19 left cornea 39.72 0.975 20 right cornea N/A N/A 21
axillary LN 44.12 0.216 22 cervical LN N/A N/A 23 spleen 37.91
0.668 24 liver 41.8 0.648 Monkey 8514: rAAV.sFlt-1 injected,
euthanized 12 mo p.i. 25 right optic nerve 39.96 0.609 26 left
optic nerve 28.9 0.057 27 axillary LN 40.08 0.221 28 cervical LN
41.27 0.063 29 spleen 39.22 0.196 30 liver 40.79 0.367 31 brain
41.14 0.798 32 heart 42.19 0.265 33 lungs 40.11 2.093 Monkey 8523:
rAAV.sFlt-1 injected, euthanized 12 mo p.i. 34 left optic nerve
37.27 0.838 35 right optic nerve 37.92 1.181 36 axillary LN 38.55
0.895 37 cervical LN 39.68 0.583 39 spleen 36.44 0.519 40 liver
39.94 0.768 41 8523 brain 40.29 0.397 42 8523 heart 41.28 0.877 43
8523 lungs 41.71 1.186 Monkey 8530: rAAV.sFlt-1 injected,
euthanized 12 mo p.i. 44 left optic nerve 38.52 0.777 45 right
optic nerve 40.67 1.354 46 axillary LN 42.49 0.841 47 cervical LN
38.55 0.895 48 spleen 36.44 0.519 49 liver 39.94 0.768 50 brain
40.29 0.397 51 heart 41.67 1.787 52 lungs 39.29 1.474 Monkey 8532:
rAAV.sFlt-1 injected, euthanized 12 mo p.i. 53 left optic nerve
35.07 1.06 54 right optic nerve 38.14 0.665 55 axillary LN 40.23
1.171 56 cervical LN 40.82 0.496 57 spleen 40.09 0.195 58 liver
40.63 1.1052 59 brain 38.68 0.295 60 heart 40.04 0.685 Monkey 8297:
rAAV.sFlt-1 injected, euthanized 12 mo p.i. 61 left optic nerve
39.84 1.034 62 right optic nerve 42.17 1.247 63 axillary LN 41.19
2.174 64 cervical LN 41.38 2.040 65 spleen 39.09 1.273 66 liver
41.36 0.683 67 brain 37.84 1.243 68 heart 40.74 0.868 69 lungs
42.60 0.276
Example 10
Efficacy Studies on a Mouse Model of Retinal Neovascularization
[0405] Transgenic mice generated through VEGF upregulation in the
photoreceptors cells were used in the study. One eye was injected
with rAAV.sFlt-1 and the contralateral eye was injected with
rAAV.gfp. The extent, intensity, and stage of neovascularization
were graded by masked observers based on an agreed scale. The
results shown that there was a statistically significant overall
reduction in neovascularization grades from a median of 3 (severe)
to a median of 1 (mild) at one month post injection (P=0.012). This
low level of fluorescein leakage was maintained at three (median=1;
P=0.001) and eight months (median 1; P=0.001) post-rAAV.sFlt-1
injection suggesting the long-term, sustained therapeutic effect of
rAAV.sFlt-1.
TABLE-US-00004 TABLE 4 Grading of eyes before and after AAV.sFlt-1
and AAV.gfp injection and photoreceptor numbers/rows at 8 months
post-injection Grades at time (months) Photo- Rows of Animal post
injection receptor photo- ID .sup.a0 1 3 8 numbers receptors
Regression 243 L 1 0 0 0 68.8 .+-. 14.1 .sup.b 4-8 Moderate 243 R 1
3 3 3 0 0 None 244 L 2 1 1 1 72.8 .+-. 18.8 .sup.b 3-7 Moderate 244
R 1 3 2 1 5.8 .+-. 3.1 0-1 None 247 L 2 2 0 0 80.8 .+-. 31.0 .sup.b
3-8 Significant 247 R 1 1 1 1 28.3 .+-. 33.3 0-4 None 249 L 3 1 1 1
0 0 Significant 249 R 3 3 3 4 7.2 .+-. 13.1 0-1 None 250 L 3 1 1 1
65.1 .+-. 24.4 .sup.b 3-8 Significant 250 R 3 3 3 3 0 0 None 251 L
3 2 1 1 0 0 Significant 251 R 3 3 3 4 0 0 None 253 L 3 2 1 1 73.8
.+-. 20.39 .sup.b 5-7 Significant 253 R 3 2 3 2 20 .+-. 30.3 0-2
Moderate 254 L 3 1 0 0 61.8 .+-. 14.3 .sup.b 4-6 Significant 254 R
2 2 2 2 8.8 .+-. 9.6 0-1 None 324 L 1 1 1 1 ND ND None 324 R 1 1 1
1 ND ND None 326 L 2 1 1 1 ND ND Moderate 326 R 2 2 2 2 ND ND None
327 L 2 2 0 0 ND ND Significant 327 R 2 3 2 2 ND ND None 329 L 3 2
2 2 ND ND Moderate 329 R 2 2 2 2 ND ND None 330 L 3 3 2 3 ND ND
None 330 R 3 3 3 3 ND ND None L = left eye injected with
AAV.sFlt-1, R = right eye injected with AAV.GFP, ND = not done
.sup.a3 days prior to injection with AAV vectors. .sup.b
Statistically significant difference in photoreceptor numbers (p
< 0.01)
Example 11
Efficacy Studies on a Monkey Model of Laser-Induced Choroidal
Neovascularization
[0406] Five monkeys were injected in one eye with rAAV.sFlt-1 and
in the other with rAAV.gfp. Subretinal injection was unsuccessful
in the right eye of one of the monkeys; therefore this animal was
not subjected to further evaluation. Subretinal injection of 40-100
.mu.l of rAAV suspension lifted the retina, creating a bleb that
housed the vector between the pigment epithelium and the
photoreceptor layer in a localized manner. This bleb self-corrected
within 24 to 48 hours. Except for a minor disturbance to the
retinal pigment epithelium at the point of needle penetration, no
other retinal abnormalities were observed for the duration of the
follow-up (3 to 17 months post-injection). No other abnormalities
or adverse events were observed; at no time was retinal detachment
associated with the surgery.
[0407] To assess the long-term therapeutic efficacy of rAAVsFlt-1,
the four injected monkeys were then subjected to intense laser
photocoagulation 16 months after treatment with the vectors. Eight
lesions were induced using laser in each eye, and the eyes then
monitored for choroidal neovascularization at two and four weeks
after laser treatment. After laser photocoagulation, only three of
the four monkeys were analyzable, therefore, efficacy data was
collected for three animals. None of the three monkey eyes treated
with rAAVsFlt-1 developed choroidal neovascularization-related
lesions and only weak fluorescein staining was observed, indicating
minimum leakage/neovascularization. All contralateral eyes treated
with control vector developed choroidal neovascularization-related
lesions. Efficacy data for the three animals are presented in Table
5.
TABLE-US-00005 TABLE 5 Effect of subretinal administration of
rAAV.sFlt-1 or control (rAAV.gfp) vector on laser-induced CNV in
macaque monkeys CNV Lesions after Fluorescein Fundus
Angiography.sup..dagger. Time of laser- Right Eye Left Eye Monkey
induced CNV (rAAV.sFlt-1) (rAAV.gfp) No. (months)* 2 Weeks 4 Weeks
2 Weeks 4 Weeks 1 16 0/8 0/8 1/8 6/8 2 16 0/8 0/8 0/8 3/8 4 16 0/8
0/8 0/8 2/8 *CNV was induced at 16 months after subretinal
injection of rAAVs. .sup..dagger.Number of macular lesions with
neovascularization (fluorescein leakage) after laser
photocoagulation. The retinal function of the monkeys was assessed
by electroretinography. Amplitudes and implicit times from the
responses of the injected eye and uninjected contralateral eye were
calculated and compared pre-injection and at different times
following injection. The results showed that injection of
rAAV.sFlt-1, the recombinant sFLT-1 protein or rAAV.gfp did not
have any adverse effect on the retinal function of the monkeys.
Example 12
[0408] The standard of care in treating wet AMD involves frequent
intraocular injection of recombinant anti-VEGF proteins every 4-8
weeks. A rAAV construct has been developed for a potent
(Kd.about.10 pM), naturally occurring anti-VEGF protein, soluble
Fms-related tyrosine kinase-1 (sFlt-1), for the treatment of wet
AMD. rAAV.sFlt-1 was produced in accordance with FDA and ICH
guidelines at the UNC Vector Core Human Application Laboratory. An
eight patient controlled study on the safety and efficacy of
rAAV.sFlt-1 was conducted. Eligibility, inclusion and exclusion
criteria for the study were as follows:
[0409] Eligibility Criteria [0410] Ages Eligible for Study: 65
Years and older [0411] Genders Eligible for Study: Both [0412]
Accepts Healthy Volunteers: No
[0413] Inclusion Criteria: [0414] Age greater than or equal to 65
years; [0415] Subfoveal CNV secondary to AMD and with best
corrected visual acuity of 20/80-20/400 or better in the other eye;
[0416] Fluorescein angiogram of the study eye must show evidence of
a leaking subfoveal choroidal neovascular lesion; [0417] Must be a
candidate for anti-VEGF intravitreal injections; [0418] The entire
dimension of the lesion must not exceed 12 Macular Photocoagulation
Study disc areas; [0419] No previous retinal treatment of
photodynamic therapy or laser; [0420] Able to provide informed
consent; [0421] Participant has clinically acceptable laboratory
and ECG at the time of enrolment; and [0422] Able to comply with
protocol requirements, including follow-up visits.
[0423] Exclusion Criteria: [0424] Liver enzymes >2.times. upper
limit of normal; [0425] Clinical evidence of active infection of
any type, including adenovirus, hepatitis A, B, or C, or HIV virus;
[0426] Any prior treatment for AMD in the study/control eye,
excluding anti-VEGF injections; [0427] A tear in the retinal
pigmented epithelium; [0428] Extensive submacular scar tissue;
[0429] Significant retinal disease other than subfoveal CNV AMD,
such as diabetic retinopathy or retinal vascular occlusion; [0430]
Significant non-retinal disease such as ocular atrophy or
cataracts; [0431] Known allergy to fluorescein; [0432] Current use
of prednisolone, other anti-inflammatory steroids or immune
suppression drugs. Non-steroidal drugs such as aspirin are allowed;
[0433] Any other significant disease or disorder which, in the
opinion of the Investigator, may either put the participants at
risk because of participation in the study, or may influence the
result of the study, or the participant's ability to participate in
the study; [0434] Participants who have participated in another
research study involving an investigational product in the past 12
weeks; and [0435] Penicillin sensitivity.
[0436] Administration procedure: The pharmaceutical composition
containing rAAV.sFlt-1 was administered to study subjects in a
setting appropriate for subretinal injection according to the
following procedure:
1. The subject's periocular skin and eyelid margins and eye lashes
were cleaned with 5% povidone iodine prior to draping; 2. A sterile
whole body drape was placed followed by an additional eye drape. 3.
Inserted eyelid speculum, ensuring that it is well positioned
underneath the eyelids to direct the eyelashes away from the field
and protected by eye drape. 4. Inserted 3.times.23 G or 25 G
vitrectomy ports; 5. Connected saline infusion to 1st port; 6.
Inserted fiber optic into 2nd port; 7. A 36 G-41 G subretinal
cannula was connected to drug syringe via microconnector in the 3rd
port; 8. Under microscopic control, 100 microlitres is injected
under the retina; 9. Following injection, instruments and ports
were withdrawn; 10. Chloramphenicol ointment was applied; 11.
Atropine 1% drop from sterile single use container was instilled;
and 12. An eye pad and eye shield were applied.
[0437] The results of the rAAV.sFlt-1 study are summarized
herein.
The eight enrolled subjects (mean age 77 years) all had active
subfoveal choroidal neovascularization, with visual acuity of 20/40
to 20/400, and had previously received between 1 and 25
intravitreal injections of ranibizumab. The patients were randomly
distributed into three groups, a control group and two experimental
groups. All patients received intravitreal injections of
ranibizumab on day 1 and day 30 of the study. On day 7,
1.times.10.sup.10 vector genomes of rAAV.sFlt-1 in 100 .mu.l volume
was administered via subretinal injection to the first experimental
group and 1.times.10.sup.11 vector genomes of rAAV.sFlt-1 in 100
.mu.l volume was administered via subretinal injection to the
second experimental group. In all six cases for patients in the
experimental groups, the bleb of sub-retinal fluid resolved within
4 hours. After 24 hours, most of the air in the vitreous had
absorbed and only the retinal injection site remained visible. One
patient developed a minor hemorrhage associated with the procedure
that did not affect vision. As expected following vitrectomy, there
was a transient increase in neutrophil counts that returned to
normal by 14 days post injection. Vector sequence was found in the
tears of one subject at one day post injection that cleared by day
30. Other than this single occurrence, AAV2 was not detected in any
of the subjects' blood, saliva or urine samples either by qPCR or
ELISA to date. Background levels of the naturally occurring sFLT-1
protein showed a high baseline variation in the urine, serum, and
saliva with no increase following treatment. sFLT-1 levels in the
vitreous also varied among subjects (975-2085 pg/ml). Blood
biochemistry, complete blood count, and T-cell response, remained
without any significant change compared to baseline. Subretinal
injection of rAAV.sFlt-1 showed no clinically significant retinal
toxicity as assessed by serial ophthalmic examinations over a two
month period. No superficial, anterior segment or vitreous
inflammatory signs were present in any of the subjects. There was
no evidence of visual acuity loss, IOP elevation, retinal
detachment, or any intraocular or systemic immune response in any
of the patients. A summary of anti-VEGF treatments, both initial
and rescue, are summarized for each patient in Table 6.
TABLE-US-00006 TABLE 6 Summary of Ranibizumab Injections by Patient
Day Day Day Day Day Day Day Day Day Day Day Day Day Day Subject 0
30 60 90 120 150 180 210 224 252 280 308 336 364 R1001 X X 0 0 0 0
0 No No 0 0 0 0 0 visit visit R1002 X X 0 0 0 0 0 0 0 No 0 0 0 0
visit R1003 X X 0 X X 0 0 X 0 X 0 0 X 0 (control) R1004 X X 0 0 0 0
0 0 0 0 0 0 0 X R1005 X X 0 0 0 0 0 No 0 0 0 0 0 0 visit R1006 X X
0 X No 0 0 0 0 0 0 0 0 0 visit R1007 X X 0 0 0 X 0 0 0 0 0 0 0 0
(control) R1008 X X 0 X 0 0 No 0 0 0 0 0 0 0 visit Note: Per
protocol, injections at Day 0 and Day 30 were mandatory for all
patients in the study\\
[0438] Notably, none of the patients in the experimental groups
required rescue treatment at day 60 and most of the patients in the
lower dose experimental group required 0 rescue treatments at day
90, day 120, day 150, day 180 or day 210 or day 270 or day 365 (1
year). The control patient required multiple rescue treatments.
These results are unexpected and extend the promise of gene therapy
for the large cohort of elderly patients suffering from wet AMD.
Generally, patients treated with current anti-VEGF therapy, such as
intravitreal injections of a VEGF inhibitor protein or other
anti-VEGF agent will require additional injections in 30, 60 or 90
days.
[0439] Maximum expression levels of sFLT-1 in a study subject or a
patient are reached six to eight weeks after subretinal
administration of rAAV.sFLT-1. During this so called "ramp-up"
period, at least one, two or three intravitreal injections of an
anti-VEGF agent are injected at 15 to 45 day intervals, and
preferably about 30 day intervals, to prevent disease progression.
It is preferred to administer the first intravitreal injection of
an anti-VEGF agent between 1 to 30 days, and preferably between 5
to 10 days, prior to administration of rAAV.sFlt-1 to allow for
absorption of the intravitreally injected anti-VEGF agent (Lucentis
or Avastin or Eylea or other non sFLT agents). If this first
intravitreal injection is administered less than 24 hours prior to
subretinal administration of rAAV.sFLT, it may be washed out of the
vitreous during the subretinal injection procedure leading to a
sub-therapeutic anti-VEGF agent concentration and disease
progression.
[0440] After the completion of the ramp period, patients who
express sufficient sFLT-1 to treat or prevent progression of their
AMD may not need additional intravitreal anti-VEGF injections
although it is expect that they will remain under the care of a
physician. Patients are monitored and treated on an as-needed basis
based on objective criteria, such as an increased center point
retinal thickness measurement with an optical coherence
tomography.
[0441] In this study, patients in the control and both experimental
groups were evaluated for signs of active choroidal
neovascularization on an approximately monthly basis and retreated
with intravitreal ranibizumab if any of the following criteria was
met: [0442] >10 Early Treatment Diabetic Retinopathy Study
(ETDRS) letter loss from subject's previous visit (attributable to
retinal causes), OR a decrease of >5 ETDRS letters from previous
visit in conjunction with patient perception of functional loss;
[0443] Any increased, new, or persistent subsensory, sub-Retinal
Pigment Epithelial (RPE), or intraretinal fluid on OCT; [0444]
Signs of increased CNV leakage via FA.
Example 13
Optical Coherence Tomography (OCT)
[0445] Spectral Domain Optical Coherence Tomography (SD-OCT) was
performed using approved equipment (Heidelberg Spectralis.RTM.
SD-OCT) and standard techniques to monitor center point retinal
thickness and fluid leakage in the retina of patients.
[0446] Optical Coherence Tomography (OCT) is a non-contact medical
imaging technology similar to ultrasound and MRI. With OCT,
reflected light is used to produce detailed cross-sectional and 3D
images of the eye. The SPECTRALIS.RTM. SD-OCT simultaneously
measures multiple wavelengths of reflected light across a spectrum,
hence the name spectral domain. The increased speed and number of
scans translates into higher resolution and a better chance of
observing disease. In patients with wet AMD, the detection of new
retinal fluid or a clinically significant increase in retinal
thickness may be detected by SD-OCT. (Adhi et al., Curr Opin
Ophthalmol. 2013 May; 24(3):213-21; Malamos et al., Invest
Ophthalmol Vis Sci. 2009 October; 50(10):4926-33). Detection of
these symptoms in a patient with AMD indicates disease progression
that warrants treatment with an anti-VEGF therapy such as Lucentis
or Eylea.
[0447] The retinal health and symptoms of AMD progression of each
subject in the study were monitored via SD-OCT. At least 6 radial
scans through the macula, each approximately 6 mm in length, were
taken; and OCT images/scans were collected at each specified visit.
The SD-OCT images were evaluated for the presence of intraretinal
fluid by a masked reader and the central retinal thickness was
measured using Heidelberg Heyex SD-OCT software. The central
retinal thickness results for each visit for 8 patients are
presented below in Table 7.
TABLE-US-00007 TABLE 7 Mean Change in Central Retinal Thickness
from Baseline at Day 0 in microns by dosing group Study Day 14 28
56 84 112 140 168 196 224 252 280 308 336 364 Control -101 24 -194
-178 -176 -199 -131 -124 -186 -190 -198 -172 -157 -138 Low dose
-140 -115 -161 -189 -173 -163 -157 -147 -149 -155 -161 -144 -127
-134 High -254 -245 -266 -254 -245 -239 -235 -209 -219 -225 -215
-239 -246 -245 Dose
[0448] As shown in table 7, the mean central retinal thickness of
the subjects in all dosing cohorts decreased after administration
of the intravitreal injections of the anti-VEGF protein (Lucentis)
at the beginning of the study as required by protocol. As expected,
the central retinal thickness of the patients in the control group
starts to increase and fluid can be seen on SD-OCT images within
30-90 days of the administration of the anti-VEGF protein.
Unexpectedly, the central retinal thickness of the subjects in the
low and high dosing groups is generally well controlled by
rAAV.sFlt-1 and does not increase over time. New intraretinal fluid
does not occur in the retinas of the low dose group subjects or the
high dose group subjects. This is shown by OCT, for example, in
FIG. 24. At 12 months, the central retinal thickness of subjects
treated with rAAV.sFlt-1 did not increase by more than 50 microns,
or by more than 100 microns, or by more than 250 microns within 12
months of administration of a pharmaceutical composition comprising
rAAV.sFlt-1. When compared against baseline, the central retinal
thickness of human subjects treated with rAAV.sFlt-1 decreased by
50 microns or in some cases by 100 microns or in some cases, by 200
microns. This decrease was observed within 8 weeks of administering
sFlt-1 and was maintained at 3 months, 6 months, 9 months and 12
months. This result is surprising and is unknown in in the clinical
treatment of AMD and ocular neovascularization in human subjects.
More generally, without additional administrations of an anti-VEGF
protein or other VEGF inhibitor, intraretinal fluid and an increase
in central retinal thickness will be observed with 30 days, 60
days, 90 days or 180 days of an initial anti-VEGF treatment.
Fluorescein Angiography (FA)
[0449] FA was performed using a standard technique. Transit images
are taken of the study eye. Mid and late phase images are taken of
the study and non-study eye; and FA is be obtained at each
specified visit.
Biodistribution Studies
[0450] Dissemination of vector was investigated by polymerase chain
reaction (PCR) amplification of vector genomes isolated from
samples of tears, plasma, urine and saliva. Biodistribution of
vector and sFLT-1 was investigated by ELISA for sFLT-1 and AAV2
capsids in plasma, tears and saliva. Extraction of DNA
[0451] Samples (100-300 ul) were pipetted onto Sample Collection
Cards (Qiagen, Valencia, Calif.) or sterile foam tip applicators.
DNA was extracted from each sample as per manufacturer's protocol.
Purified DNA was dissolved in 50 ul of elution buffer. The amount
of DNA present was determined by spectrophotometry.
Detection of rAAV.sFlt-1 by Real Time PCR
[0452] Genomic DNA samples (0.5-1 .mu.g) were screened for the
presence of the AAV.sFlt-1 vector using the TaqMan.RTM. Gene
Expression Assays (Applied Biosystems, U.S.A.). The assay consists
of a pair of unlabeled PCR primers which amplifies a fragment
between the AAV2 and the sFLT-1 sequences, and a TaqMan.RTM. probe
with a FAM.TM. or VIC.RTM. dye label and minor groove binder moiety
on the 5' end, and non-fluorescent quencher dye on the 3' end. The
cycling conditions were 1 hold for 2 minutes at 50.degree. C. and
another hold at 95.degree. C. for 20 seconds, followed by 45 cycles
of 95.degree. C. for 3 seconds and 60.degree. C. for 30
seconds.
[0453] Samples positive for the rAAV.sFlt-1 fragment were further
tested and the gene copy number of rAAV.sFlt-1 present were
quantified by real time polymerase chain reaction (PCR). Between
0.5-1.0 ug of extracted DNA were amplified in 20-ul reaction mixes
containing Platinum SYBR Green qPCR Supermix-UDG (Invitrogen,
Carlsbad, Calif., USA) and 0.5 uM of each primer using the IQ5
Bio-Rad real-time PCR system (Bio-Rad, Hercules, Calif., USA). A
similar set of samples spiked with plasmid DNA containing the
target sequence was set up in parallel as the spiked samples. The
primer pair used (forward: CACTAGTCCAGTGTGGTGGA (SEQ ID NO:123);
reverse: AGCCAGGAGACAACCACTTC (SEQ ID NO:124)) was designed with
the aid of Primer3 Output (Whitehead Institute, MA, USA) to amplify
the region from the vector cDNA into the sFLT-1 gene using the
Rotorgene (Corbett). The cycling conditions that were used were: 2
min 50.0.degree. C., 2 min 95.0.degree. C. and 60 three-step cycles
of 95.0.degree. C. 20 s, 60.0.degree. C. for 20 s and 72.0.degree.
C. for 20 s. A standard curve was generated in each run from
10-fold dilutions of plasmid DNA (pSSV.sFlt-1) which had the same
target vector sequence. Each sample was analyzed in triplicate.
Quantifying sFlt-1 Protein Concentration by ELISA
[0454] The concentration of sFLT-1 present in the plasma, tears and
saliva were measured quantitatively by ELISA using a Quantikine
ELISA kit (R&D Systems, Minneapolis, Minn.) which was based on
the sandwich immunoassay technique. The samples (100 ul) were added
to the 96-well plate coated with a monoclonal antibody specific for
VEGF R1/sFLT-1 and allowed to incubate for 2 hours. Any unbound
sFLT-1 was removed by washing with a buffer. Following incubation
with an enzyme-linked polyclonal antibody specific for VEGF
R1/sFLT-1, the excess of antibody-enzyme conjugate was washed off
and the samples were then be incubated with a substrate solution.
Enzyme-catalyzed chromogen formation was quantified by measuring
the visible absorbance at 450 nm. The concentrations of sFLT-1 (in
pg/ml) in the samples were calculated from the absorbance value
using a calibration curve plotted with recombinant human
sFLT-1.
Detection of AAV2 by ELISA
[0455] Presence of AAV2 capsid in the plasma, tears, urine and
saliva was analyzed using the AAV2 Titration ELISA Kit (American
Research Products, Inc., Belmont, Mass., USA). This kit is based on
a sandwich ELISA technique and uses a mouse monoclonal antibody
specific for a conformational epitope on assembled AAV particles.
This monoclonal antibody is coated onto microplate strips and is
used to capture AAV particles from the specimen. Captured AAV
particles were detected in two steps. First a biotin-conjugated
monoclonal antibody to AAV was bound to the immune complex. In the
second step streptavidin peroxidase conjugate reacts with the
biotin molecules. Addition of substrate solution results in a color
reaction which was proportional to specifically bound virus
particles. The absorbance was measured photometrically at 450 nm.
The kit control provided contains an AAV particle preparation of
empty capsids and it allowed the quantitative determination of
samples of an unknown particle titer. Samples (100 ul) were added
to the plates and the assay was to be carried out according to the
manufacturer's protocol.
Detection of Neutralizing AAV-2 Antibody
[0456] Plasma was assayed for the ability to block the transduction
of HEK293 cells with AAV2.gfp. Patient's plasma was serially
diluted in normal mouse serum in multi-well plates. AAV2.gfp was
added to each well and plates were incubated at 37.degree. C. for 1
hour before addition to HEK293 cells in triplicate. The
neutralizing antibody titer was expressed as the plasma dilution
that resulted in 50% inhibition of transduction by AAV2-gfp.
Maximum gfp activity was represented by vector diluted in normal
mouse serum; maximum inhibition was represented by medium only in
normal mouse serum. Baseline plasma from each subject was assayed
alongside each post-op sample. Green cells from transduction of
293T cells with AAV2.gfp were counted in the test wells after 48
hours and compared with the number of green cells in the baseline
serum sample.
Detection of Anti-AAV2 Antibodies
[0457] To detect plasma antibodies to AAV2 capsid, enhanced
protein-binding ELISA plates were coated with 10.sup.9 vg/ml of
AAV2 (Vector Core Facility, North Carolina) at 4.degree. C.
overnight. The plates were be blocked at 37.degree. C. for 2 hours
and then are incubated at 4.degree. C. overnight with serially
diluted anti-AAV2 monoclonal antibody (Industries International,
Concord, Mass.) or 1:50, 1:100, 1:200, or 1:400 dilutions of
patient plasma. The plates were incubated with horse radish
peroxidase (HRP)-conjugated anti-human Ig at 37.degree. C. for 2
hours, then with tetramethyl benzidine (TMP) substrate and hydrogen
peroxide (H2O2). The reaction was stopped by phosphoric acid
(H3PO4) and read at 450 nm on a plate reader. The titer of
anti-AAV2 antibodies were calculated based on the standard curve of
the commercial antibody determined in parallel. Each value was
determined in triplicate.
Geographic Atrophy
[0458] The human study subjects were examined for signs of
geographic atrophy in their treated and untreated eyes according to
standard techniques. Increases geographic atrophy was not observed
in patients treated with rAAV.sFlt-1 at 3 months, 6 months, 9
months, or 12 months. It is hypothesized that the treatment may
stop progression of geographic atrophy in a treated eye for up to
15 months, 18 months, 24 months, 36 months, 5 years and 10
years.
Example 14
[0459] To further test the safety and efficacy of rAAV.sFlt-1 for
the treatment of wet AMD and choroidal neovascularization, forty
(40) additional subjects were enrolled in a controlled clinical
study. As in Example 12, rAAV.sFlt-1 was produced in accordance
with FDA and ICH guidelines at the UNC Vector Core Human
Application Laboratory. Eligibility, inclusion and exclusion
criteria for the study were as follows:
[0460] Eligibility: [0461] Ages Eligible for Study: 55 Years and
older [0462] Genders Eligible for Study: Both [0463] Accepts
Healthy Volunteers: No
[0464] Inclusion Criteria: [0465] Age greater than or equal to 55
years; [0466] Subfoveal CNV secondary to AMD and with best
corrected visual acuity in the study eye of 20/30-20/400 and 20/200
or better in the other eye; [0467] Fluorescein angiogram of the
study eye must show evidence of a leaking subfoveal choroidal
neovascular lesion; or choroidal neovascularization currently under
active management with anti-VEGF therapy; [0468] Must be a
candidate for anti-VEGF intravitreal injections; [0469] The entire
dimension of the lesion must not exceed 12 Macular
Photocoagulation
[0470] Study disc areas; [0471] No previous retinal treatment of
photodynamic therapy or laser; [0472] Able to provide informed
consent; [0473] Participant has clinically acceptable laboratory
parameters and ECG at the time of enrollment; and [0474] Able to
comply with protocol requirements, including follow-up visits.
[0475] Exclusion Criteria: [0476] Liver enzymes >2.times. upper
limit of normal; [0477] Clinical evidence of active infection of
any type, including adenovirus, hepatitis A, B, or C, or HIV virus;
or documented history of hepatitis B or hepatitis C; [0478] Any
prior treatment for AMD in the study/control eye, excluding
anti-VEGF injections; [0479] A tear in the retinal pigmented
epithelium; [0480] Extensive sub-fovial scarring, extensive
geographic atrophy, or thick subretinal blood in the study eye as
determined by the investigator; [0481] Significant retinal disease
other than subfoveal CNV AMD, such as diabetic retinopathy or
retinal vascular occlusion, that could compromise vision in the
study eye; [0482] Significant non-retinal disease such as ocular
atrophy or significant cataract in the study eye, including central
corneal scarring that affects visual acuity, glaucoma with field
defects, or any measurable uveitis; [0483] Known allergy to
fluorescein; [0484] Current use of prednisolone, other
anti-inflammatory steroids or immune suppression drugs. Inhaled
steroids and non-steroidal drugs such as aspirin are allowed;
[0485] Any other significant disease or disorder which, in the
opinion of the Investigator, may either put the participants at
risk because of participation in the study, or may influence the
result of the study, or the participant's ability to participate in
the study; [0486] Participants who have participated in another
research study involving an investigational product in the past 12
weeks; and [0487] Penicillin sensitivity confirmed by participant
medical records.
[0488] Initial enrolled subjects had active subfoveal choroidal
neovascularization, with visual acuity in the study eye of 20/30 to
20/400, and had previously received between 0 and 25 intravitreal
injections of ranibizumab. The patients were randomly distributed
into a control group or an experimental group until a total of 14
patients control patients and 26 experiments patients were
enrolled. All patients received intravitreal injections of
ranibizumab on day 1 and day 30 of the study. On day 7,
1.times.10.sup.11 vector genomes of rAAV.sFlt-1 in 100 ul volume
was administered via subretinal injection to the experimental
group.
[0489] As in the study in Example 12, maximum expression levels of
sFLT-1 in a study subject or a patient were reached six to eight
weeks after subretinal administration of rAAV.sFLT-1. During this
so called "ramp-up" period, at least one, two or three intravitreal
injections of an anti-VEGF agent were injected at 15 to 45 day
intervals, and preferably about 30 day intervals, to prevent
disease progression. It is preferred to administer the first
intravitreal injection of an anti-VEGF agent between 1 to 30 days,
and preferably between 5 to 10 days, prior to administration of
rAAV.sFLT-1 to allow for absorption of the intravitreally injected
anti-VEGF agent (Lucentis or Avastin or Eylea or other non sFLT
agents). If this first intravitreal injection is administered less
than 24 hours prior to subretinal administration of rAAV.sFLT, it
may be washed out of the vitreous during the subretinal injection
procedure leading to a sub-therapeutic anti-VEGF agent
concentration and disease progression.
[0490] After the completion of the ramp period, patients who
expressed sufficient sFLT-1 to treat or prevent progression of
their AMD or other symptoms of choroidal neovascularization did not
need additional intravitreal anti-VEGF injections although it is
expected that they will remain under the care of a physician.
[0491] In this study recited in this example, patients in the
control and experimental groups were evaluated for signs of active
choroidal neovascularization on an approximately monthly basis and
retreated with intravitreal ranibizumab if any of the following
criteria was met: [0492] >10 Early Treatment Diabetic
Retinopathy Study (ETDRS) letter loss from subject's previous visit
(attributable to retinal causes), OR a decrease of >5 ETDRS
letters from previous visit in conjunction with patient perception
of functional loss; [0493] Any increased, new, or persistent
subsensory, sub-Retinal Pigment Epithelial (RPE), or intraretinal
fluid on OCT; [0494] Signs of increased CNV leakage via FA.
Example 15
[0495] To test the safety and efficacy of rAAV.sFlt-1 for the
prevention or prophylaxis of the ocular neovascular disease Age
Related Macular degeneration (AMD), an additional controlled
clinical study with forty (150) patients is conducted.
rAAV(bv).sFlt-1 is produced in accordance with FDA and ICH
guidelines at Lonza Houston, Inc. (Houston, Tex.). Eligibility,
inclusion and exclusion criteria for the study were as follows:
[0496] Eligibility: [0497] Ages Eligible for Study: 50 Years and
older [0498] Genders Eligible for Study: Both [0499] Accepts
Healthy Volunteers: Yes
[0500] Inclusion Criteria: [0501] Patients with nonexudative AMD
(either categories 2, 3 or 4 according to the AREDS criteria; in
group 4 the eyes with no-advanced AMD will be included); Patients
with AMD classified as either "wet" or "dry" are included; [0502]
Age between 50 and 90 years; [0503] Able to understand and comply
with the requirements of the trial; [0504] Visual acuity
>0.4;
[0505] Exclusion Criteria: [0506] Currently enrolled in an
ophthalmic clinical trial; [0507] Eyes with concomitant macular or
choroidal disorders other than AMD and with indefinite signs of
AMD; [0508] Eyes with a diagnosis of exudative AMD with active
subretinal neovascularization (SRNV) or CNV lesions requiring laser
photocoagulation in the study eye; [0509] Subjects with significant
ocular lens opacities causing vision decrease; [0510] Subjects with
amblyopia; [0511] Subjects with optic nerve disease (neuropathy,
atrophy, papilledema), unstable glaucoma as defined by intraocular
pressures greater than 25 mm Hg, 3 or more glaucoma medications,
C/D of 0.8 or greater and visual fields consistent with glaucoma;
history of retina-vitreous surgery, degenerative myopia, active
posterior intraocular inflammatory disease, chronic use of topical
ocular steroid medications, vasoproliferative retinopathies (other
than AMD), rhegmatogenous retinal detachment, and inherited macular
dystrophies; [0512] Subjects with demand type pacemakers or
epilepsy; [0513] Subjects with uncontrolled hypertension (defined
as diastolic of 90 or greater and systolic of 150 or greater);
[0514] Subjects with recent history (within the previous year) of
cerebral vascular disease; [0515] manifested with transient
ischemic attacks (TIA's) or cerebral vascular accidents (CVA's);
[0516] Subjects with a history of AIDS; [0517] Subjects who have
had intraocular surgery in trial eye within 3 months prior to
enrolling in the trial; [0518] Patients who are unwilling to adhere
to visit examination schedules;
[0519] Primary Outcome Measures:
[0520] MPOD and multifocal electroretinograms [Time Frame: 1 year]
[Designated as safety issue: Yes]
[0521] Secondary Outcome Measures:
[0522] The safety and efficacy of rAAV(bv).sFlt-1 in reducing the
risk of the development of advanced AMD. [Time Frame: 1 year]
[Designated as safety issue: Yes]
TABLE-US-00008 TABLE 9 Experimental Design Arms Arms Assigned
Interventions Active Comparator: Group I Drug: of rAAV(bv).sFlt-1 1
.times. 10.sup.10 vector genomes of rAAV(bv).sFlt-1 in 100 ul 1
.times. 10.sup.10 vector genomes of rAAV.sFlt-1 in volume is
administered via subretinal injection to the 100 ul volume is
administered via subretinal experimental group within 30-90 day
intervals for 36 injection to the experimental group. months Active
Comparator: Group II Drug: of rAAV(bv).sFlt-1 1 .times. 10.sup.11
vector genomes of rAAV(bv).sFlt-1 in 100 ul 1 .times. 10.sup.11
vector genomes of rAAV.sFlt-1 in volume is administered via
subretinal injection to the 100 ul volume is administered via
subretinal experimental group within 180-365 day intervals for 36
injection to the experimental group. months Placebo Comparator:
Group Placebo Drug Placebo: Saline solution Drug Placebo: Saline
solution Drug Placebo: Saline solution, until one year. Patients on
placebo showing early stages of AMD may receive rAAV(bv).sFlt-1
Active Comparator: Ranibizumab 0.3 mg Drug: Ranibizumab Patients
receive ranibizumab 0.3 mg monthly Sterile solution for
intravitreal injection. administered intravitreally for 36 months.
Other Name: Lucentis
Example 16
[0523] To test the safety and efficacy of rAAV.sFlt-1 for the
treatment of the ocular neovascular disease Diabetic Macular Edema
(DME), an additional controlled clinical study with forty (40)
patients is conducted. rAAV(bv).sFlt-1 is produced in accordance
with FDA and ICH guidelines at Lonza Houston, Inc. (Houston, Tex.).
Eligibility, inclusion and exclusion criteria for the study were as
follows:
[0524] Eligibility: [0525] Ages Eligible for Study: 18 Years and
older [0526] Genders Eligible for Study: Both [0527] Accepts
Healthy Volunteers: No
[0528] General Inclusion Criteria: [0529] Subjects are eligible if
the following criteria are met: [0530] Willingness to provide
written informed consent and, at U.S. sites, Health Insurance
Portability and
[0531] Accountability Act (HIPAA) authorization, and in other
countries, as applicable according to national laws. [0532]
Diabetes mellitus (Type 1 or 2). [0533] Retinal thickening
secondary to diabetes mellitus (DME) involving the center of the
fovea with central macular thickness .gtoreq.275 .mu.m in the
center subfield as assessed on optical coherence tomography (OCT).
[0534] Best corrected visual acuity (BCVA) score in the study eye
of 20/40 to 20/320 approximate Snellen equivalent using the Early
Treatment Diabetic Retinopathy Study (ETDRS) protocol at an initial
testing distance of 4 meters. [0535] Decrease in vision determined
to be primarily the result of DME and not to other causes. [0536]
Ability (in the opinion of the investigator) and willingness to
return for all scheduled visits and assessments.
[0537] Exclusion Criteria: [0538] History of vitreoretinal surgery
in the study eye. [0539] Panretinal photocoagulation (PRP) or
macular laser photocoagulation in the study eye within 3 months of
screening. [0540] Proliferative diabetic retinopathy (PDR) in the
study eye, with the exception of inactive, regressed PDR. [0541]
Iris neovascularization, vitreous hemorrhage, traction retinal
detachment, or preretinal fibrosis involving the macula in the
study eye. [0542] Vitreomacular traction or epiretinal membrane in
the study eye. [0543] Ocular inflammation (including trace or
above) in the study eye. [0544] History of idiopathic or autoimmune
uveitis in either eye. [0545] Structural damage to the center of
the macula in the study eye that is likely to preclude improvement
in VA following the resolution of macular edema, including atrophy
of the retinal pigment epithelium (RPE), subretinal fibrosis, or
organized hard-exudate plaque. [0546] Ocular disorders in the study
eye that may confound interpretation of study results, including
retinal vascular occlusion, retinal detachment, macular hole, or
choroidal neovascularization (CNV) of any cause (eg, age-related
macular degeneration (AMD), ocular histoplasmosis, or pathologic
myopia). [0547] Cataract surgery in the study eye within 3 months,
yttrium-aluminum-garnet (YAG) laser capsulotomy within the past 2
months, or any other intraocular surgery within the 90 days
preceding Day 0. [0548] Uncontrolled glaucoma or previous
filtration surgery in the study eye. [0549] Uncontrolled blood
pressure. [0550] History of cerebral vascular accident or
myocardial infarction within 3 months prior to Day 0. [0551]
Uncontrolled diabetes mellitus. [0552] Renal failure requiring
dialysis or renal transplant. [0553] History of other disease,
metabolic dysfunction, physical examination finding, or clinical
laboratory finding giving reasonable suspicion of a disease or
condition that contraindicates the use an investigational drug,
might affect interpretation of the results of the study, or renders
the subject at high risk from treatment complications.
[0554] Primary Outcome Measures: [0555] Percentage of Patients Who
Gain .gtoreq.15 Letters in Their Best Corrected Visual Acuity
(BCVA) Score From Baseline at Month 12 [Time Frame: Baseline to
Month 12] [Designated as safety issue: No]
[0556] Secondary Outcome Measures: [0557] Mean Change From Baseline
in Best Corrected Visual Acuity (BCVA) Score at Months 12, 24 and
36 [0558] Percentage of Patients With a Visual Acuity (VA) Snellen
Equivalent of 20/40 or Better at Months 12, 24 and 36. [0559] Mean
Change From Baseline in Central Foveal Thickness as measured by
SD-OCT at Months 12, 24 and 36. [0560] Reduction in Frequency of
concomitant anti-VEGF treatment ((e.g. Lucentis, Avastin, Macugen
or Eyelea) [Designated as safety issue: No]
TABLE-US-00009 [0560] TABLE 10 Experimental Design Arms for DME
Study Arms Assigned Interventions Experimental: I Low Dose Drug:
rAAV.sFlt-1 (AVA-01) 1 .times. 10.sup.10 vector genomes of
rAAV(bv).sFlt-1 in 100 ul volume 1 .times. 10.sup.10 vector genomes
of rAAV.sFlt-1 was administered via subretinal injection to the
experimental in 100 ul volume was administered via group.
subretinal injection to the experimental Follow-up phase:
Participants on rAAV.sFlt-1 are monitored group. monthly and
receive rescue treatments with intravitreal anti- VEGF therapy if
they meet the study criteria for retreatment. Experimental: II High
Dose Drug: rAAV.sFlt-1 (AVA-01) 1 .times. 10.sup.11 vector genomes
of rAAV.sFlt-1 in 100 ul volume was 1 .times. 10.sup.11 vector
genomes of rAAV.sFlt-1 administered via subretinal injection to the
experimental in 100 ul volume was administered via group.
subretinal injection to the experimental Follow-up phase:
Participants on rAAV.sFlt-1 are monitored group. monthly and
receive rescue treatments with intravitreal anti- VEGF therapy if
they meet the study criteria for retreatment. Active Comparator:
Ranibizumab injection 0.3 mg. Drug: Ranibizumab Participants
receive two initial injections of Ranibizumab at Sterile solution
for intravitreal injection. Day 0 and Day 30. Other Name: Lucentis
Follow-up phase: Participants are monitored monthly and receive
rescue treatments with Ranibizumab if they meet the study criteria
for retreatment.
[0561] Initial enrolled subjects have DME, with visual acuity in
the study eye of 20/40 to 20/320, and will have previously received
between 0 and 25 intravitreal injections of ranibizumab or
aflibercept. The patients are randomly distributed into a control
group or two experimental groups until a total of 14 patients
control patients and 13 low dose experimental patients and 13 high
dose experimental patients are enrolled. All patients received
intravitreal injections of ranibizumab on day 1 and day 30 of the
study. On day 7, 1.times.10.sup.10 or 1.times.10.sup.11 vector
genomes of rAAV(bv).sFlt-1 in 100 ul volume are administered via
subretinal injection to the experimental groups.
[0562] As in the study in Example 12, maximum expression levels of
sFLT-1 in a study subject or a patient are reached are six to eight
weeks after subretinal administration of rAAV(bv).sFLT-1. During
this so called "ramp-up" period, at least one, two or three
intravitreal injections of an anti-VEGF agent are injected at 15 to
45 day intervals, and preferably about 30 day intervals, to prevent
disease progression. It is preferred to administer the first
intravitreal injection of an anti-VEGF agent between 1 to 30 days,
and preferably between 5 to 10 days, prior to administration of
rAAV(bv).sFLT-1 to allow for absorption of the intravitreally
injected anti-VEGF agent (Lucentis or Avastin or Eylea or other non
sFLT agents). If this first intravitreal injection is administered
less than 24 hours prior to subretinal administration of
rAAV(bv).sFLT, it may be washed out of the vitreous during the
subretinal injection procedure leading to a sub-therapeutic
anti-VEGF agent concentration and disease progression.
[0563] After the completion of the ramp period, patients who
express sufficient sFLT-1 to treat or prevent progression of their
DME may not need additional intravitreal anti-VEGF injections
although it is expect that they will remain under the care of a
physician.
[0564] In this study recited in this example, patients in the
control and experimental groups are evaluated for signs of active
or new DME and neovascularization on an approximately monthly basis
and are retreated with intravitreal ranibizumab if any of the
following criteria was met: [0565] >10 Early Treatment Diabetic
Retinopathy Study (ETDRS) letter loss from subject's previous visit
(attributable to retinal causes), OR a decrease of >5 ETDRS
letters from previous visit in conjunction with patient perception
of functional loss; [0566] Any increased, new, or persistent
subsensory, sub-Retinal Pigment Epithelial (RPE), or intraretinal
fluid on OCT; [0567] Signs of increased CNV leakage via FA.
Example 17
[0568] To test the safety and efficacy of rAAV.sFlt-1 for the
treatment of the ocular neovascular disease Retinal Vein Occlusion
(RVO), an additional controlled clinical study with forty (40)
patients is conducted. The clinical study is performed with
patients of 2 cohorts, 1 cohort including patients with Central
Retinal Vein Occlusion (CRVO) and 1 cohort including Branched
Retinal Vein Occlusion (BRVO). As in Example 15, rAAV(bv).sFlt-1 is
produced in accordance with FDA and ICH guidelines at Lonza
Houston, Inc. (Houston, Tex.). Eligibility, inclusion and exclusion
criteria for the study were as follows:
[0569] Inclusion Criteria: [0570] Center-involved macular edema
secondary to central retinal vein occlusion (CRVO) or
Branch-involved macular edema secondary to BRVO for no longer than
9 months with mean central subfield thickness .gtoreq.250 .mu.m on
optical coherence tomography (OCT); [0571] Adults .gtoreq.18 years;
[0572] Early treatment diabetic retinopathy study (ETDRS) best
corrected visual acuity (BCVA) of 20/40 to 20/320 (73 to 24
letters) in the study eye;
[0573] Exclusion Criteria: [0574] Any prior treatment with
anti-VEGF agents in the study eye (Pegaptanib sodium, anecortave
acetate, bevacizumab, ranibizumab, etc.) or previous administration
of systemic anti-angiogenic medications; [0575] Prior panretinal
laser photocoagulation or macular laser photocoagulation in the
study eye [0576] CRVO disease duration >9 months from date of
diagnosis; BRVO disease duration >9 months from date of
diagnosis; [0577] Previous use of intraocular corticosteroids in
the study eye or use of periocular corticosteroids in the study eye
within the 3 months prior to Day 1; [0578] Iris neovascularization,
vitreous hemorrhage, traction retinal detachment, or preretinal
fibrosis involving the macula in either the study eye or fellow
eye;
[0579] Primary Outcome Measures: [0580] Mean Change From Baseline
in Best Corrected Visual Acuity (BCVA) Score at 6 Months. [Time
[0581] Frame: Baseline and 6 months] [Designated as safety issue:
No]. [0582] Defined study baseline range of Early Treatment
Diabetic Retinopathy Study (ETDRS) Best
[0583] Corrected Visual Acuity (BCVA) letter score of 73 to 24
(=Acuity of 20/40 to 20/320) in the study eye; a higher score
represents better functioning. Nominator=(Number of participants
who maintained vision*100); Denominator=Number of participants
analyzed.
[0584] Secondary Outcome Measures: [0585] Percentage of
Participants Who Gained .gtoreq.15 Letters in BCVA Score at Month 6
Compared With Baseline. [0586] Mean Change From Baseline in Central
Retinal Thickness (CRT) at 6 months [Time Frame: Baseline and 6
months] [Designated as safety issue: No] [0587] Reduction in
frequency of concomitant anti-VEGF treatment ((e.g. Lucentis,
Avastin, Macugen or Eyelea) [Designated as safety issue: No]
TABLE-US-00010 [0587] TABLE 11 Experimental Design Arms for
BRVO/CRVO Study Arms Assigned Interventions Experimental: 1 .times.
10.sup.10 vector genomes of rAAV.sFlt-1 Biological: 1 .times.
10.sup.10 vector genomes of in 100 ul volume is administered via
subretinal injection to rAAV.sFlt-1. Subretinal injection. the
experimental group, on Day 7. Drug: Ranibizumab injection 0.3 mg if
Follow-up phase: Participants on rAAV.sFlt-1 are monitored meet
reinjection criteria. monthly and receive rescue treatments with
intravitreal anti- VEGF therapy if they meet the study criteria for
retreatment. Experimental: 1 .times. 10.sup.11 vector genomes of
rAAV.sFlt-1 Biological: 1 .times. 10.sup.11 vector genomes of in
100 ul volume is administered via subretinal injection to
rAAV.sFlt-1. Subretinal injection. the experimental group, on Day
7. Drug: Ranibizumab injection 0.3 mg if Follow-up phase:
Participants on rAAV.sFlt-1 are monitored meet reinjection
criteria. monthly and receive rescue treatments with intravitreal
anti- VEGF therapy if they meet the study criteria for retreatment.
Active Comparator: Ranibizumab injection 0.3 mg. Drug: Ranibizumab
injection 0.3 mg Participants receive two initial injections of
Ranibizumab at Ranibizumab injection 0.3 mg in a single- Day 0 and
Day 30. dose regimen given at Day 0 and Day 30. Follow-up phase:
Participants are monitored monthly and Other Name: Lucentis receive
rescue treatments with Ranibizumab if they meet the study criteria
for retreatment.
[0588] Initial enrolled subjects have CRVO or BRVO, with visual
acuity in the study eye of 20/40 to 20/320, and will have
previously received between 0 and 25 intravitreal injections of
ranibizumab or aflibercept. The patients are randomly distributed
into a control group or two experimental groups until a total of 14
patients control patients and 13 low dose experimental patients and
13 high dose experimental patients are enrolled. All patients
received intravitreal injections of ranibizumab on day 1 and day 30
of the study. On day 7, 1.times.10.sup.10 or 1.times.10.sup.11
vector genomes of rAAV(bv).sFlt-1 in 100 ul volume are administered
via subretinal injection to the experimental groups.
[0589] As in the study in Example 14, maximum expression levels of
sFLT-1 in a study subject or a patient are reached are six to eight
weeks after subretinal administration of rAAV(bv).sFLT-1. After the
completion of the ramp period, as described in Example 14, patients
who express sufficient sFLT-1 to treat or prevent progression of
their BRVO or CRVO may not need additional intravitreal anti-VEGF
injections although it is expect that they will remain under the
care of a physician.
[0590] In this study recited in this example, patients in the
control and experimental groups are evaluated for signs of active
or new retinal vein occlusion and neovascularization on an
approximately monthly basis and are retreated with intravitreal
ranibizumab if any of the following criteria was met: [0591] >10
Early Treatment Diabetic Retinopathy Study (ETDRS) letter loss from
subject's previous visit (attributable to retinal causes), OR a
decrease of >5 ETDRS letters from previous visit in conjunction
with patient perception of functional loss; [0592] Any increased,
new, or persistent subsensory, sub-Retinal Pigment Epithelial
(RPE), or intraretinal fluid on OCT; [0593] Signs of increased CNV
leakage via FA.
Sequence CWU 1
1
114120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1atggaaaaac gccagcaacg
202881DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 2aaaaggatct aggtgaagat cctttttgat
aatctcatga ccaaaatccc ttaacgtgag 60ttttcgttcc actgagcgtc agaccccgta
gaaaagatca aaggatcttc ttgagatcct 120ttttttctgc gcgtaatctg
ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 180tgtttgccgg
atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg
240cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt
caagaactct 300gtagcaccgc ctacatacct cgctctgcta atcctgttac
cagtggctgc tgccagtggc 360gataagtcgt gtcttaccgg gttggactca
agacgatagt taccggataa ggcgcagcgg 420tcgggctgaa cggggggttc
gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 480ctgagatacc
tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg
540gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga
gcttccaggg 600ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc
acctctgact tgagcgtcga 660tttttgtgat gctcgtcagg ggggcggagc
ctatggaaaa acgccagcaa cgcggccttt 720ttacggttcc tggccttttg
ctggcctttt gctcacatgt tctttcctgc gttatcccct 780gattctgtgg
ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga
840acgaccgagc gcagcgagtc agtgagcgag gaagcggaag a
8813362DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 3gcgccacgct tcccgaaggg agaaaggcgg
acaggtatcc ggtaagcggc agggtcggaa 60caggagagcg cacgagggag cttccagggg
gaaacgcctg gtatctttat agtcctgtcg 120ggtttcgcca cctctgactt
gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 180tatggaaaaa
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg
240ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt
accgcctttg 300agtgagctga taccgctcgc cgcagccgaa cgaccgagcg
cagcgagtca gtgagcgagg 360aa 3624615DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
4aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
60ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag
120gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta
gccgtagtta 180ggccaccact tcaagaactc tgtagcaccg cctacatacc
tcgctctgct aatcctgtta 240ccagtggctg ctgccagtgg cgataagtcg
tgtcttaccg ggttggactc aagacgatag 300ttaccggata aggcgcagcg
gtcgggctga acggggggtt cgtgcacaca gcccagcttg 360gagcgaacga
cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg
420cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg
aacaggagag 480cgcacgaggg agcttccagg gggaaacgcc tggtatcttt
atagtcctgt cgggtttcgc 540cacctctgac ttgagcgtcg atttttgtga
tgctcgtcag gggggcggag cctatggaaa 600aacgccagca acgcg
61551258DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 5tgttgtttgt cggttaacgt cgacctagag
ctgcctcgcg cgtttcggtg atgacggtga 60aaacctctga cacatgcagc tcccggagac
ggtcacagct tgtctgtaag cggatgccgg 120gagcagacaa gcccgtcagg
gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat 180gacccagtca
cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag
240attgtactga gagtgcacca tatgcggtgt gaaataccgc acagatgcgt
aaggagaaaa 300taccgcatca ggcgctcttc cgcttcctcg ctcactgact
cgctgcgctc ggtcgttcgg 360ctgcggcgag cggtatcagc tcactcaaag
gcggtaatac ggttatccac agaatcaggg 420gataacgcag gaaagaacat
gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 480gccgcgttgc
tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga
540cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
gtttccccct 600ggaagctccc tcgtgcgctc tcctgttccg accctgccgc
ttaccggata cctgtccgcc 660tttctccctt cgggaagcgt ggcgctttct
caatgctcac gctgtaggta tctcagttcg 720gtgtaggtcg ttcgctccaa
gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 780tgcgccttat
ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca
840ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
tgctacagag 900ttcttgaagt ggtggcctaa ctacggctac actagaagga
cagtatttgg tatctgcgct 960ctgctgaagc cagttacctt cggaaaaaga
gttggtagct cttgatccgg caaacaaacc 1020accgctggta gcggtggttt
ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 1080tctcaagaag
atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca
1140cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
ccttttaaat 1200taaaaatgaa gttttaaatc aatctaaagt atatatgagt
aaacttggtc tgacagtt 12586674DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 6cccgtagaaa agatcaaagg
atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60ttgcaaacaa aaaaaccacc
gctaccagcg gtggtttgtt tgccggatca agagctacca 120actctttttc
cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta
180gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac
atacctcgct 240ctgctaatcc tgttaccagt ggctgctgcc agtggcgata
agtcgtgtct taccgggttg 300gactcaagac gatagttacc ggataaggcg
cagcggtcgg gctgaacggg gggttcgtgc 360acacagccca gcttggagcg
aacgacctac accgaactga gatacctaca gcgtgagcat 420tgagaaagcg
ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg
480gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta
tctttatagt 540cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt
tgtgatgctc gtcagggggg 600cggagcctat ggaaaaacgc cagcaacgcg
gcctttttac ggttcctggc cttttgctgg 660ccttttgctc acat
6747674DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 7atgtgagcaa aaggccagca aaaggccagg
aaccgtaaaa aggccgcgtt gctggcgttt 60ttccataggc tccgcccccc tgacgagcat
cacaaaaatc gacgctcaag tcagaggtgg 120cgaaacccga caggactata
aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 180tctcctgttc
cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc
240gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
cgttcgctcc 300aagctgggct gtgtgcacga accccccgtt cagcccgacc
gctgcgcctt atccggtaac 360tatcgtcttg agtccaaccc ggtaagacac
gacttatcgc cactggcagc agccactggt 420aacaggatta gcagagcgag
gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 480aactacggct
acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc
540ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg
tagcggtggt 600ttttttgttt gcaagcagca gattacgcgc agaaaaaaag
gatctcaaga agatcctttg 660atcttttcta cggg 6748830DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
8ttaataagat gatcttcttg agatcgtttt ggtctgcgcg taatctcttg ctctgaaaac
60gaaaaaaccg ccttgcaggg cggtttttcg aaggttctct gagctaccaa ctctttgaac
120cgaggtaact ggcttggagg agcgcagtca ccaaaacttg tcctttcagt
ttagccttaa 180ccggcgcatg acttcaagac taactcctct aaatcaatta
ccagtggctg ctgccagtgg 240tgcttttgca tgtctttccg ggttggactc
aagacgatag ttaccggata aggcgcagcg 300gtcggactga acggggggtt
cgtgcataca gtccagcttg gagcgaactg cctacccgga 360actgagtgtc
aggcgtggaa tgagacaaac gcggccataa cagcggaatg acaccggtaa
420accgaaaggc aggaacagga gagcgcacga gggagccgcc agggggaaac
gcctggtatc 480tttatagtcc tgtcgggttt cgccaccact gatttgagcg
tcagatttcg tgatgcttgt 540caggggggcg gagcctatgg aaaaacggct
ttgccgcggc cctctcactt ccctgttaag 600tatcttcctg gcatcttcca
ggaaatctcc gccccgttcg taagccattt ccgctcgccg 660cagtcgaacg
accgagcgta gcgagtcagt gagcgaggaa gcggaatata tcctgtatca
720catattctgc tgacgcaccg gtgcagcctt ttttctcctg ccacatgaag
cacttcactg 780acaccctcat cagtgccaac atagtaagcc agtatacact
ccgctagcgc 8309237DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 9aaacgccagc aacgcggcct ttttacggtt
cctggccttt tgctggcctt ttgctcacat 60gttctttcct gcgttatccc ctgattctgt
ggataaccgt attaccgcct ttgagtgagc 120tgataccgct cgccgcagcc
gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga 180agagcgccca
atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcag
23710456DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 10aaattgtaaa cgttaatatt ttgttaaaat
tcgcgttaaa tatttgttaa atcagctcat 60tttttaacca ataggccgaa atcggcaaaa
tcccttataa atcaaaagaa tagaccgcga 120tagggttgag tgttgttcca
gtttggaaca agagtccact attaaagaac gtggactcca 180acgtcaaagg
gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccca
240aatcaagttt tttgcggtcg aggtgccgta aagctctaaa tcggaaccct
aaagggagcc 300cccgatttag agcttgacgg ggaaagccgg cgaacgtggc
gagaaaggaa gggaagaaag 360cgaaaggagc gggcgctagg gcgctggcaa
gtgtagcggt cacgctgcgc gtaaccacca 420cacccgccgc gcttaatgcg
ccgctacagg gcgcgt 45611307DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 11ggcgcattaa
gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 60gccctagcgc
ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt
120ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc
tttacggcac 180ctcgacccca aaaaacttga ttagggtgat ggttcacgta
gtgggccatc gccctgatag 240acggtttttc gccctttgac gttggagtcc
acgttcttta atagtggact cttgttccaa 300actggaa 30712456DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
12acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg
60ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca
120cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg
ttccgattta 180gtgctttacg gcacctcgac cccaaaaaac ttgattaggg
tgatggttca cgtagtgggc 240catcgccctg atagacggtt tttcgccctt
tgacgttgga gtccacgttc tttaatagtg 300gactcttgtt ccaaactgga
acaacactca accctatctc ggtctattct tttgatttat 360aagggatttt
gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta
420acgcgaattt taacaaaata ttaacgctta caattt 4561366DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 13aatttttttt atttatgcag aggccgaggc cgcctcggcc
tctgagctat tccagaagta 60gtgagg 6614362DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
14tggacagcga acgcacacta caaccttgga tagagttagg aattagtaga cggacatact
60acagggattt aaatgataat cattctcaaa aatgacacca gataagccta aatcagataa
120cagccccaaa agcgagcttt tggggtgcct tttagacggt gctaggtttt
tgacagcaga 180taagcctaaa tcagataaca gccgaatcga taagccttag
ttggttaagg gggcaggaaa 240ttcatattga acaaatgttt agttaagtgt
agaataatca tacatcctta ttaagggcaa 300gcatactcaa gccccacaaa
gtgtgcttga aatccttgta aggggaaatc ccccttaacc 360cc
36215589DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 15ttgagatcct ttttttctgc gcgtaatctg
ctgcttgcaa acaaaaaaac caccgctacc 60agcggtggtt tgtttgccgg atcaagagct
accaactctt tttccgaagg taactggctt 120cagcagagcg cagataccaa
atactgtcct tctagtgtag ccgtagttag gccaccactt 180caagaactct
gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc
240tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt
taccggataa 300ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag
cccagcttgg agcgaacgac 360ctacaccgaa ctgagatacc tacagcgtga
gctatgagaa agcgccacgc ttcccgaagg 420gagaaaggcg gacaggtatc
cggtaagcgg cagggtcgga acaggagagc gcacgaggga 480gcttccaggg
ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact
540tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaa
58916459DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 16tttacgcgcc ctgtagcggc gcattaagcg
cggcgggtgt ggtggttacg cgcagcgtga 60ccgctacact tgccagcgcc ctagcgcccg
ctcctttcgc tttcttccct tcctttctcg 120ccacgttcgc cggctttccc
cgtcaagctc taaatcgggg gctcccttta gggttccgat 180ttagtgcttt
acggcacctc gaccccaaaa aacttgattt gggtgatggt tcacgtagtg
240ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg
ttctttaata 300gtggactctt gttccaaact tgaacaacac tcaaccctat
ctcgggctat tcttttgatt 360tataagggat tttgccgatt tcggcctatt
ggttaaaaaa tgagctgatt taacaaaaat 420ttaacgcgaa ttttaacaaa
atattaacgt ttacaattt 45917602DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 17atgcattagt
tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga 60gttccgcgtt
acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg
120cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga
ctttccattg 180acgtcaatgg gtggagtatt tacggtaaac tgcccacttg
gcagtacatc aagtgtatca 240tatgccaagt acgcccccta ttgacgtcaa
tgacggtaaa tggcccgcct ggcattatgc 300ccagtacatg accttatggg
actttcctac ttggcagtac atctacgtat tagtcatcgc 360tattaccatg
gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc
420acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt
ggcaccaaaa 480tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca
ttgacgcaaa tgggcggtag 540gcgtgtacgg tgggaggtct atataagcag
agctggttta gtgaaccgtc agatccgcta 600gc 60218741DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
18tcaatattgg ccattagcca tattattcat tggttatata gcataaatca atattggcta
60ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc
120aatatgaccg ccatgttggc attgattatt gactagttat taatagtaat
caattacggg 180gtcattagtt catagcccat atatggagtt ccgcgttaca
taacttacgg taaatggccc 240gcctggctga ccgcccaacg acccccgccc
attgacgtca ataatgacgt atgttcccat 300agtaacgcca atagggactt
tccattgacg tcaatgggtg gagtatttac ggtaaactgc 360ccacttggca
gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga
420cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact
ttcctacttg 480gcagtacatc tacgtattag tcatcgctat taccatggtg
atgcggtttt ggcagtacac 540caatgggcgt ggatagcggt ttgactcacg
gggatttcca agtctccacc ccattgacgt 600caatgggagt ttgttttggc
accaaaatca acgggacttt ccaaaatgtc gtaataaccc 660cgccccgttg
acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc
720tcgtttagtg aaccgtcaga t 74119664DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
19acgcgtacta gttattaata gtaatcaatt acggggtcat tagttcatag cccatatatg
60gagttccgcg ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc
120cgcccattga cgtcaataat gacgtatgtt cccatagtaa cgtcaatagg
gactttccat 180tgacgtcaat gggtggagta tttacggtaa actgcccact
tggcagtaca tcaagtgtat 240catatgccaa gtacgccccc tattgacgtc
aatgacggta aatggcccgc ctggcattat 300gcccagtaca tgaccttatg
ggactttcct acttggcagt acatctacgt attagtcatc 360gctattacca
tggtgatgcg gttttggcag tacatcaatg ggcgtggata gcggtttgac
420tcacggggat ttccaagtct ccaccccatt gacgtcaatg ggagtttgtt
ttgcaccaaa 480atcaacggga ctttccaaaa tgtcgtaaca actccgcccc
attgacgcaa atgggcggta 540ggcgtgtacg gtgggaggtc tatataagca
gagctcgttt agtgaaccgt cagatcgcct 600ggagacgcca tccacgctgt
tttgacctcc atagaagaca ccgggaccga tccagcctcc 660gtac
66420663DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 20acgcgtggag ctagttatta atagtaatca
attacggggt cattagttca tagcccatat 60atggagttcc gcgttacata acttacggta
aatggcccgc ctggctgacc gcccaacgac 120ccccgcccat tgacgtcaat
aatgacgtat gttcccatag taacgtcaat agggactttc 180cattgacgtc
aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg
240tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc
cgcctggcat 300tatgcccagt acatgacctt atgggacttt cctacttggc
agtacatcta cgtattagtc 360atcgctatta ccatggtgat gcggttttgg
cagtacatca atgggcgtgg atagcggttt 420gactcacggg gatttccaag
tctccacccc attgacgtca atgggagttt gttttgcacc 480aaaatcaacg
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
540gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac
cgtcagatcg 600cctggagacg ccatccacgc tgttttgacc tccatagaag
acaccgggac cgatccagcc 660tcc 66321589DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
21tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
60cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
120gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
attgacgtca 180atgggtggag tatttacggt aaactgccca cttggcagta
catcaagtgt atcatatgcc 240aagtacgccc cctattgacg tcaatgacgg
taaatggccc gcctggcatt atgcccagta 300catgacctta tgggactttc
ctacttggca gtacatctac gtattagtca tcgctattac 360catggtgatg
cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
420atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
aaaatcaacg 480ggactttcca aaatgtcgta acaactccgc cccattgacg
caaatgggcg gtaggcgtgt 540acggtgggag gtctatataa gcagagctgg
tttagtgaac cgtcagatc 58922670DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 22gcggccgcac
gcgtggagct agttattaat agtaatcaat tacggggtca ttagttcata 60gcccatatat
ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc
120ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta
acgtcaatag 180ggactttcca ttgacgtcaa tgggtggagt atttacggta
aactgcccac ttggcagtac 240atcaagtgta tcatatgcca agtacgcccc
ctattgacgt caatgacggt aaatggcccg 300cctggcatta tgcccagtac
atgaccttat gggactttcc tacttggcag tacatctacg 360tattagtcat
cgctattacc atggtgatgc ggttttggca gtacatcaat gggcgtggat
420agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat
gggagtttgt 480tttgcaccaa aatcaacggg actttccaaa atgtcgtaac
aactccgccc cattgacgca 540aatgggcggt aggcgtgtac ggtgggaggt
ctatataagc agagctcgtt tagtgaaccg 600tcagatcgcc tggagacgcc
atccacgctg ttttgacctc catagaagac accgggaccg 660atccagcctc
67023490DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 23ggcgaccgcc cagcgacccc cgcccgttga
cgtcaatagt gacgtatgtt cccatagtaa 60cgccaatagg gactttccat tgacgtcaat
gggtggagta tttacggtaa actgcccact 120tggcagtaca tcaagtgtat
catatgccaa
gtccgccccc tattgacgtc aatgacggta 180aatggcccgc ctagcattat
gcccagtaca tgaccttacg ggagtttcct acttggcagt 240acatctacgt
attagtcatc gctattacca tggtgatgcg gttttggcag tacaccaatg
300ggcgtggata gcggtttgac tcacggggat ttccaagtct ccaccccatt
gacgtcaatg 360ggagtttgtt ttggcaccaa aatcaacggg actttccaaa
atgtcgtaat aaccccgccc 420cgttgaccca aatgggcggt aggcgtgtac
ggtgggaggt ctatatagca gagctcgttt 480agtgaaccgt
49024887DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 24ttagtcatat gttacttggc agaggccgca
tggaaagtcc ctggacgtgg gacatctgat 60taatacgtga ggaggtcagc catgttcttt
ttggcaaagg actacggtca ttggacgttt 120gattggcatg ggatagggtc
agccagagtt aacagtgttc ttttggcaaa gggatacgtg 180gaaagccccg
ggccatttac agtaaactga tacggggaca aagcacagcc atatttagtc
240atgtactgct tggcagaggg tctatggaaa gtccctggac gtgggacgtc
tgattaatat 300gaaagaaggt cagccagagg tagctgtgtc ctttttggca
aagggatacg gttatgggac 360gtttgattgg actgggatag ggtcagccag
agttaacagt gttcttttgg caaaggaaac 420gtggaaagtc ccgggccatt
tacagtaaac tgatactggg acaaagtaca cccatattta 480gtcatgttct
ttttggcaaa gagcatctgg aaagtcccgg gcagcattat agtcacttgg
540cagagggaaa gggtcactca gagttaagta catctttcca gggccaatat
tccagtaaat 600tacacttagt tttatgcaaa tcagccacaa aggggatttt
cccggtcaat tatgactttt 660tccttagtca tgcggtatcc aattactgcc
aaattggcag tacatactag gtgattcact 720gacatttggc cgtcctctgg
aaagtccctg gaaaccgctc aagtactgta tcatggtgac 780tttgcatttt
tggagagcac gccccactcc accattggtc cacgtaccct atgggggagt
840ggtttatgag tatataaggg gctccggttt agaagccggg cagagcg
88725935DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 25attgacgtca ataatgacgt atgttcccat
agtaacgcca atagggactt tccattgacg 60tcaatgggtg gactatttac ggtaaactgc
ccacttggca gtacatcaag tgtatcatat 120gccaagtacg ccccctattg
acgtcaatga cggtaaatgg cccgcctggc attatgccca 180gtacatgacc
ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat
240taccatggtc gaggtgagcc ccacgttctg cttcactctc cccatctccc
ccccctcccc 300acccccaatt ttgtatttat ttatttttta attattttgt
gcagcgatgg gggcgggggg 360gggggggggg cgcgcgccag gcggggcggg
gcggggcgag gggcggggcg gggcgaggcg 420gagaggtgcg gcggcagcca
atcagagcgg cgcgctccga aagtttcctt ttatggcgag 480gcggcggcgg
cggcggccct ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgac
540gctgccttcg ccccgtgccc cgctccgccg ccgcctcgcg ccgcccgccc
cggctctgac 600tgaccgcgtt actcccacag gtgagcgggc gggacggccc
ttctcctccg ggctgtaatt 660agcgcttggt ttaatgacgg cttgtttctt
ttctgtggct gcgtgaaagc cttgaggggc 720tccgggaggg ccctttgtgc
ggggggagcg gctcggggct gtccgcgggg ggacggctgc 780cttcgggggg
gacggggcag ggcggggttc ggcttctggc gtgtgaccgg cggctctaga
840gcctctgcta accatgttca tgccttcttc tttttcctac agctcctggg
caacgtgctg 900gttattgtgc tgtctcatca ttttggcaaa gaatt
93526367DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 26gtcgaggtga gccccacgtt ctgcttcact
ctccccatct cccccccctc cccaccccca 60attttgtatt tatttatttt ttaattattt
tgtgcagcga tgggggcggg gggggggggg 120gcgcgcgcca ggcggggcgg
ggcggggcga ggggcggggc ggggcgaggc ggagaggtgc 180ggcggcagcc
aatcagagcg gcgcgctccg aaagtttcct tttatggcga ggcggcggcg
240gcggcggccc tataaaaagc gaagcgcgcg gcgggcggga gtcgctgcgt
tgccttcgcc 300ccgtgccccg ctccgcgccg cctcgcgccg cccgccccgg
ctctgactga ccgcgttact 360cccacag 36727278DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
27tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa
60ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg gggggggggg
120ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg
cggagaggtg 180cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc
ttttatggcg aggcggcggc 240ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcg
27828109DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 28ccagaaaaag tcaacacact tgtcataaag
tcccgacgaa gtaaaacaag cggaattaat 60tcaatttggc caaaaaacct agtataaaga
cgtgcatagt gtcgggaat 10929999DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 29cttcctcacg
ctgaacccct ttaaccgttt cagtggtcgt gagtcttcta atctgactgt 60gtgacgatgt
tttaaggatt tggaggattg aggaggatca cctggtcagg taaatctgaa
120atatccggat tacatcggaa gttgagcaca cggaaaaaca aaagactctt
attggattta 180gatccgtcag ccacctgctg ctgctcttca tcatcaggcg
tcttcatcgc cctgcagtgg 240gcctgacaac agcttgtgtt tattacacta
aaaactttat aaacccatca caaaccatat 300cacacagcag ggacttacct
cttcatctgt aagaaggatt tttagagttg gcagcagagc 360aacagtcagc
tctgttgcct cactaaaaga gatctttgtt tgaatctgtg acctgtccaa
420gtgtacctcg cttctcaccc actgacctct ccacaacagt gagctggttg
gcgggatgct 480aatgtttcta gttattacgt gtaaccaaac ttaaagagta
cagataaatc atttagcata 540attaaagttt tactgtcatg ttattggctg
ttaatatgat tgctgttgta agtatgtgtt 600gatcactaac aatttaatta
attaaatcaa tcattaaatt aagtttgttt ggaaaaagag 660ggaaaactca
tccactgacc acatggttct aggttcaatt ccttggagtt aaagggctaa
720tcccagagcc atttaccaaa ataataaata aatatttaaa taagacgtgc
atgcgactgc 780ggtcaccttt aaagcacaaa gttttttttg agcagtgagg
tgaactcggg tggatctgtg 840tgttcacaga gaaaaccttc tgtaagcaga
ttaaggagtc agaagttctt aatcctgaaa 900gtttagaaaa atcccagcag
cataatcttt gctgtaagtg gtttacgagc gtatataaga 960ggctgacaca
gcggcagcgg caaagagctc agggtcaca 99930626DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
30aaatcaaaag tcctcaacct ggttggaaga atattggcac tgaatggtat caataaggtt
60gctagagagg gttagaggtg cacaatgtgc ttccataaca ttttatactt ctccaatctt
120agcactaatc aaacatggtt gaatactttg tttactataa ctcttacaga
gttataagat 180ctgtgaagac agggacaggg acaataccca tctctgtctg
gttcataggt ggtatgtaat 240agatattttt aaaaataagt gagttaatga
atgagggtga gaatggaggc acagaggtat 300tagggggagg tgggccccag
agaatggtgc caaggtccag tggggtgact gggatcagct 360caggcctgac
gctggccact cccacctagc tcctttcttt ctaatctgtt ctcattctcc
420ttgggaagga ttgaggtctc tggaaaacag ccaaacaact gttatgggaa
cagcaagccc 480aaataaagcc aagcatcagg gggatctgag agctgaaagc
aacttctgtt ccccctccct 540cagctgaagg ggtggggaag ggctcccaaa
gccataactc cttttaaggg atttagaagg 600cataaaaagg cccctggctg agaact
62631173DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 31actcacgggg atttccaagt ctccacccca
ttgacgtcaa tgggagtttg ttttggcacc 60aaaatcaacg ggactttcca aaatgtcgta
ataaccccgc cccgttgacg caaatgggcg 120gtaggcgtgt acggtgggag
gtctatataa gcagagctcg tttagtgaac cgt 17332113DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
32aaaatcaacg ggactttcca aaatgtcgta ataaccccgc cccgttgacg caaatgggcg
60gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac cgt
1133321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 33gtaatacgac tcactatagg g
213419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 34taatacgact cactatagg
193567DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 35ccgattaatc ataaatatga aaaataattg
ttgcatcacc cgccaatgcg tggcttaatg 60cacatca 673619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 36attaaccctc actaaaggg 193787DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 37ctagacaagg tcgaacgagg ggcatgaccc ggtgcggggc
ttcttgcact cggcataggc 60gagtgctaag aataacgttg gcactcg
87381478DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 38tattaggcga agaggcatct agtagtagtg
gcagtggtga gaacgtgggc gctgctatag 60tgaacaatct ccagtcgatg gttaagaaga
agagtgacaa accagcagtg aatgacttgt 120ctgggtccgt gaggaaaaga
aagaagcccg acacaaagga cagtaacgtc aagaaaccca 180agaaataggg
gggacctgtt tagatgtata ggaataaaaa ctccgagatg atctcaatgt
240gtaatggagt tgtaatattg caaaggggga aaatcaagac tcaaacgtgt
gtatgagtga 300gcgtacgtat atctccgaga gtagtatgac ataatgatga
ctgtgaatca tcgtaatctc 360acacaaaaac cccattgtcg gccatatacc
acaccaagca acaccacata tcccccggaa 420aaaaaaacgt gaaaaaaaga
aacaatcaaa actacaacct actccttgat cacacagtca 480ttgatcaagt
tacagttcct gctagggaat gaccaaggta caaatcagca ccttaatggt
540tagcacgctc tcttactctc tctcacagtc ttccggcccc tattcaaaat
tctgcacttc 600catttgaccc cagggttggg aaacagggcc acaaaagaaa
aacccgacgt gaatgaaaaa 660actaagaaaa gaaaaaaaat tatcacacca
gaaatttacc taattgggta attcccatcg 720gtgtttttcc tggattgtcg
cacgcacgca tgctgaaaaa agtgttcgag ttttgctttt 780gcctcggagt
ttcacgcaag tttttcgatc tcggaaccgg agggcggtcg ccttgttgtt
840tgtgatgtcg tgctttgggt gttctaatgt gctgttattg tgctcttttt
ttttcttctt 900tttttggtga tcatatgata ttgctcggta gattactttc
gtgtgtaggt attcttttag 960acgtttggtt attgggtaga tatgagagag
agagagtggg tgggggagga gttggttgta 1020ggagggaccc ctgggaggaa
gtgtagttga gttttccctg acgaatgaaa atacgttttt 1080gagaagataa
tacaggaaag gtgtgtcggt gaatttccat ctatccgagg atatgagtgg
1140aggagagtcg tgtgcgtgtg gttaatttag gatcagtgga acacacaaag
taactaagac 1200agagagacag agagaaaaat ctggggaaga gacaaagagt
cagagtgtgt gagttattct 1260gtattgtgaa atttttttgc ccaactacat
aatattgctg aaactaattt tacttaaaaa 1320gaaaagccaa caacgtcccc
agtaaaactt ttctataaat atcagcagtt ttccctttcc 1380tccattcctc
ttcttgtctt ttttcttact ttcccttttt tatacctttt cattatcatc
1440ctttataatt gtctaaccaa caactatata tctatcaa
147839412DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 39cccacacacc atagcttcaa aatgtttcta
ctcctttttt actcttccag attttctcgg 60actccgcgca tcgccgtacc acttcaaaac
acccaagcac agcatactaa attttccctc 120tttcttcctc tagggtgtcg
ttaattaccc gtactaaagg tttggaaaag aaaaaagaga 180ccgcctcgtt
tctttttctt cgtcgaaaaa ggcaataaaa atttttatca cgtttctttt
240tcttgaaatt ttttttttta gtttttttct ctttcagtga cctccattga
tatttaagtt 300aataaacggt cttcaatttc tcaagtttca gtttcatttt
tcttgttcta ttacaacttt 360ttttacttct tgttcattag aaagaaagca
tagcaatcta atctaagggg cg 4124028DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 40ttgacaatta
atcatcggct cgtataat 284127DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 41ttcaaatatg
tatccgctca tgagaca 2742143DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 42aactacccgt
aggtgtagtt ggcgcaagcg tccgattagc tcaggtttaa gatgtcgaga 60gtgagagtgg
gcggcttaac tttctcagtt aggcataaaa ttacgtctta aatctcgtag
120cgactaattt aataaaaatt gga 14343419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
43gcgcagcacc atggcctgaa ataacctctg aaagaggaac ttggttaggt accttctgag
60gcggaaagaa ccagctgtgg aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc
120cagcaggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccagg
tgtggaaagt 180ccccaggctc cccagcaggc agaagtatgc aaagcatgca
tctcaattag tcagcaacca 240tagtcccgcc cctaactccg cccatcccgc
ccctaactcc gcccagttcc gcccattctc 300cgccccatgg ctgactaatt
ttttttattt atgcagaggc cgaggccgcc tcggcctctg 360agctattcca
gaagtagtga ggaggctttt ttggaggcct aggcttttgc aaaaagctt
4194428DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 44gacgcttttt atcgcaactc tctactgt
284529DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45catgacaaaa acgcgtaaca aaagtgtct
29461904DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 46agccgaattc ctcctcattc ttctccaaac
ctttattgag tacctactgt gtgctggaat 60aagacaggca gggccatgcc ctcatgaagc
tgacaatcct attggtgtga ccatccccag 120gtgtgtccca ggtgtgttgc
aggtgtgtcc gaggtatgcc ccagctgtcc caggtgtgcc 180ccagctgtct
cagatgtgcc ccagctgtcc caggtgtgtc acagctgcat tgcaggtgtg
240ccccagttgc attccatgtg tgctccaagt gtgtaccagc tgtcccaggt
gtgtctcagg 300tgtgccccag ctgtatccca ggtgtgcctc agctgtctta
ggtgtgtctc aggtgcatcc 360caggtgtgtc tcagatgtgc cccagctgtc
ccaggtgtgc cccagctgtc ccaggtgtgc 420cccagctgtc tccagtgtgt
cccagctgtg ccccaggtgt gtgtcctagg tgtgcctcag 480ctgtctcagg
tgtgccccag gcatatccca ggtgtgcccc agctgtccca ggtgtgtcct
540acgtgtgcac cagctgtatc ccaggtgtgc cccaggtgtg tctcagatgg
gtcccaagtg 600ttccccaact gcatttcagg tgtctcaggt gtgcccaagc
tgtcccaggt gtgtccaaga 660tgtgccccag gtgtgtctca ggtgggtctc
aagtgcccca gctgcatttc aggtgtctca 720ggtgtgcccc ccagtgcatc
ccaggtgtgt cccaggtgtg ccccaggtgc atcccaggtg 780tgtcccaggt
gtgccccagc tgtctcaggt gtctcaggtg tgccccaggc atatcccagg
840tgtgcctcag ctctcccagg tgtgtcctac atgtgcacca gctgtatctc
aggtgtgtct 900caggtgtgcc ccagatgtgc ccccggtgtg tctcaggtgg
gtcccaagtg ttccccagct 960gcatttcaag tgtctcaggt gtgccccagg
tgtgcccccg ctgtcccagg tgtgtccaag 1020atgtacccca ggtgtgtccc
agctgtccca agtgtgtctc aggtgtgccc caggtgtgtt 1080ccaggtgttc
cccagctgtc ccagctgtcc caggtctcag gtgtgcccca ggtgtgttcc
1140aggtgttcac cagctgtccc agctgtccca ggtctcaggt gtgccccagg
tatgttgcag 1200gtgttcccca gctgtcccag ctgtcccagg tgtgtcccag
gtgttcccca ggtgtgtccc 1260agctgtccca ggtgtgtccc agatgtgccc
caggtgtacc ccaggtgttt ctcaggtgga 1320ttccaggtgt gtcccaggtg
agccccagct gtattccata tgcgtccctc tgagtggggc 1380cttggtttga
tgtagctccg gggatcttct gctccctggt cctggtgtca ccagcaactg
1440cctcttgaca atcctgcctt gcctgcaaac cccaggtgag aagaagacaa
atgactggga 1500actgacccct cagtaagcgc tggtggtctc acctacagac
ccccaggaag ctggtcactg 1560tgggcttctt ttcctctcta aattcctatt
atcaggtggt tttctttctc atttgctatt 1620ttcttaaaaa taaaaatagg
gaaaaacagc ctttgtaaat tacggtttct tccggctcca 1680tcctctccgt
caggcccaca tcccaaggaa acagcaggct tgagcctggc tgctgaagcc
1740aggggctgga tggagcagct cagaacagag ctttgagtgc ctctccagcc
aggggcccca 1800gaagcctggt ggttgtttgt ccttctcagg ggaaaagtga
ggcggcccct tggaggaagg 1860ggccgggcag aatgatctaa tcggattcca
agcagctcag ggga 190447352DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 47ctctgagctg
cttccctact cacactctgt ccacaacccc attttcctga tcatgtagta 60gaaagaaatg
gaacacaatc tttgtaaata agcccttgta aacaagcaag agctacagtg
120cttccacaag ccctactgca agccaggaat gggaacagtg gtgtgtgtgc
agcaaatgcc 180ctgagcaccc ctgtggattg gactcagaaa catggaagtg
agggtaggag gggatgatct 240aagtcctggg cccaattaag agatcagatg
gtgaagggtt tgggggcctt taaggtaagg 300aggcctgggc tgatcctgca
ggctgatata aagtcctgta accccatagg ca 35248133DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
48gtaagtatca aggttacaag acaggtttaa ggagaccaat agaaactggg cttgtcgaga
60cagagaagac tcttgcgttt ctgataggca cctattggtc ttactgacat ccactttgcc
120tttctctcca cag 13349221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 49agacatgata
agatacattg atgagtttgg acaaaccaca actagaatgc agtgaaaaaa 60atgctttatt
tgtgaaattt gtgatgctat tgctttattt gtaaccatta taagctgcaa
120taaacaagtt aacaacaaca attgcattca ttttatgttt caggttcagg
gggagatgtg 180ggaggttttt taaagcaagt aaaacctcta caaatgtggt a
22150222DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 50cagacatgat aagatacatt gatgagtttg
gacaaaccac aactagaatg cagtgaaaaa 60aatgctttat ttgtgaaatt tgtgatgcta
ttgctttatt tgtaaccatt ataagctgca 120ataaacaagt taacaacaac
aattgcattc attttatgtt tcaggttcag ggggagatgt 180gggaggtttt
ttaaagcaag taaaacctct acaaatgtgg ta 22251239DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
51ggccgcttcg agcagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa
60tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca
120ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg
tttcaggttc 180agggggagat gtgggaggtt ttttaaagca agtaaaacct
ctacaaatgt ggtaaaatc 23952222DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 52taatcagcat
accacatttg tagaggtttt acttgcttta aaaaacctcc cacacctccc 60cctgaacctg
aaacataaaa tgaatgcaat tgttgttgtt aacttgttta ttgcagctta
120taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat
ttttttcact 180gcattctagt tgtggtttgt ccaaactcat caatgtatct ta
22253142DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 53aacttgttta ttgcagctta taatggttac
aaataaagca atagcatcac aaatttcaca 60aataaagcat ttttttcact gcattctagt
tgtggtttgt ccaaactcat caatgtatct 120tatcacgtct ggtcaggtgg ca
14254132DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 54aacttgttta ttgcagctta taatggttac
aaataaagca atagcatcac aaatttcaca 60aataaagcat ttttttcact gcattctagt
tgtggtttgt ccaaactcat caatgtatct 120tatcacgtct gg
1325549DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55aataaaatat ctttattttc attacatctg
tgtgttggtt ttttgtgtg 4956341DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 56ctgcgcgctc
gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60ggtcgcccgg
cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact
120aggggttcct tgtagttaat
gattaacccg ccatgctact tatctacgcg tagataagta 180gcatggcggg
ttaatcatta actacaagga acccctagtg atggagttgg ccactccctc
240tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac
gcccgggctt 300tgcccgggcg gcctcagtga gcgagcgagc gcgcagcctt a
34157344DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 57aggctgcgcg ctcgctcgct cactgaggcc
gcccgggcaa agcccgggcg tcgggcgacc 60tttggtcgcc cggcctcagt gagcgagcga
gcgcgcagag agggagtggc caactccatc 120actaggggtt ccttgtagtt
aatgattaac ccgccatgct acttatctac gcgtagataa 180gtagcatggc
gggttaatca ttaactacaa ggaaccccta gtgatggagt tggccactcc
240ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc
gacgcccggg 300ctttgcccgg gcggcctcag tgagcgagcg agcgcgcagc ctta
34458128DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 58aggaacccct agtgatggag ttggccactc
cctctctgcg cgctcgctcg ctcactgagg 60ccgggcgacc aaaggtcgcc cgacgcccgg
gctttgcccg ggcggcctca gtgagcgagc 120gagcgcgc 12859130DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
59aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg
60ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc
120gagcgcgcag 1306045DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 60ttatgaagat
ccctcgacct gcagcccaag cttggcgtaa tcatg 456127DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 61gataaggatc ttcctagagc atggcta
2762273DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 62atgtctgccc gtatttcgcg taaggaaatc
cattatgtac tatttaaaaa acacaaactt 60ttggatgttc ggtttattct ttttctttta
cttttttatc atgggagcct acttcccgtt 120tttcccgatt tggctacatg
acatcaacca tatcagcaaa agtgatacgg gtattatttt 180tgccgctatt
tctctgttct cgctattatt ccaaccgctg tttggtctgc tttctgacaa
240actcggcctc gactctaggc ggccgcgggg atc 27363141DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
63ggaggggtgg agtcgtgacg tgaattacgt catagggtta gggaggtcct gtattagagg
60tcacgtgagt gttttgcgac attttgcgac accatgtggt cacgctgggt atttaagccc
120gagtgagcac gcagggtctc c 1416460DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 64ggatccactc
gagtggagct cgcgactagt cgattcgaat tcgatatcaa gcttatcgat
606598DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 65gcctgtacgg aagtgttact tctgctctaa
aagctgcgga attgtacccg cggccgcaat 60tcccggggat cgaaagagcc tgctaaagca
aaaaagaa 986648DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 66ccgaacccga attctgcaga
tatccagcac agtggcggcc gcttcgag 486753DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 67tagtttccat ggctacgtag ataagtagca tggcgggtta
atcattaact aca 536864DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 68tgtagttaat
gattaacccg ccatgctact tatctacgta gccatgctcg atctgaattc 60ggta
646914DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 69ggccgcgggg atcc 147011DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 70ggttcgaaca g 1171120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
71catgttcatg ccttcttctt tttcctacag ctcctgggca acgtgctggt tattgtgctg
60tctcatcatt ttggcaaaga attctgcagt cgacggtacc gcgggcccgg gatccaccgg
1207230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 72gcggccgcac gcgtgttact agttattaat
3073115DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 73cactagaagc tttattgcgg tagtttatca
cagttaaatt gctaacgcag tcagtgcttc 60tgacacaaca gtctcgaact taagctgcag
aagttggtcg tgaggcactg ggcag 1157468DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74gcctggagac gccatccacg ctgttttgac ctccatagaa
gacaccggga ccgatccagc 60ctccggac 6875133DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
75gtgtccactc ccagttcaat tacagctctt aaggctagag tacttaatac gactcactat
60aggctagcct cgagaattca cgcgtggtac cgagctcgga tccactagtc cagtgtggtg
120gaattcgggc ggg 1337664DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 76tgtatttaga
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 60ggtc
647726DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 77tagccatgct ctaggaagat cgtacc
267826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 78gaattcgagc ttgcatgcct gcaggt
267956DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 79gtgtccactc ccagttcaat tacagctctt
aaggctagag tacttctagc ctcgag 568067DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80aaatcgataa ggatcctaga gcatggctac gtagataagt
agcatggcgg gttaatcatt 60aactaca 678113DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81ggcccgggat cca 138257DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82gttgaattcg atatcggatc catcgatacc gtcgacctcg
agggggggcc cggtacc 578344DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 83caattcgccc
tatagtgagt cgtattacgc gcgcagcggc cgac 448456DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84tgtagttaat gattaacccg ccatgctact tatctacgta
gccatgctct agatct 568518DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 85agcggccgca ctcctcag
188621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 86atcgataccg tcgacccggg c
2187122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 87cagatcgcct ggagacgcca tccacgctgt
tttgacctcc atagaagaca ccgggaccga 60tccagcctcc ggactctaga ggatccggta
ctcgaggaac tgaaaaacca gaaagttaac 120tg 1228828DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88ccggaccacg tgcggaccga gcggccgc
2889115DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 89gtgtccactc ccagttcaat tacagctctt
aaggctagag tacttctagc ctcgagaatt 60cacgcgtggt accgagctcg gatccactag
tccagtgtgg tggaattcgg gcggg 1159067DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90ttatttgtga aatttgtgat gctattgctt tatttgtaac
cattataagc tgcaataaac 60aagttaa 679120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 91taataataac cgggcaggcc 2092124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
92agccgcgaga cgggcgctca gggcgcgggg ccggcggcgg cgaacgagag gacggactct
60ggcggccggg tcgttggccg cggggagcgc gggcaccggg cgagcaggcc gcgtcgcgct
120cacc 12493194DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 93ggggctcggg tgcagcggcc
agcgggcctg gcggcgagga ttacccgggg aagtggttgt 60ctcctggctg gagccgcgag
acgggcgctc agggcgcggg gccggcggcg gcgaacgaga 120ggacggactc
tggcggccgg gtcgttggcc gggggagcgc gggcaccggg cgagcaggcc
180gcgtcgcgct cacc 1949420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 94aggactcatt
aaaaagtaac 2095197DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 95ggggctcggg tgcagcggcc
agcgggcgcc tggcggcgag gattacccgg ggaagtggtt 60gtctcctggc tggagccgcg
agacgggcgc tcagggcgcg gggccggcgg cggcgaacga 120gaggacggac
tctggcggcc gggtcgttgg ccgcggggag cgcgggcacc gggcgagcag
180gccgcgtcgc gctcacc 197961000DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 96gggcgggtgc
atcaatgcgg ccgaaaaaga cacggacacg ctcccctggg acctgagctg 60gttcgcagtc
ttcccaaagg tgccaagcaa gcgtcagttc ccctcaggcg ctccaggttc
120agtgccttgt gccgagggtc tccggtgcct tcctagactt ctcgggacag
tctgaagggg 180tcaggagcgg cgggacagcg cgggaagagc aggcaagggg
agacagccgg actgcgcctc 240agtcctccgt gccaagaaca ccgtcgcgga
ggcgcggcca gcttcccttg gatcggactt 300tccgccccta gggccaggcg
gcggagcttc agccttgtcc cttccccagt ttcgggcggc 360ccccagagct
gagtaagccg ggtggaggga gtctgcaagg atttcctgag cgcgatgggc
420aggaggaggg gcaagggcaa gagggcgcgg agcaaagacc ctgaacctgc
cggggccgcg 480ctcccgggcc cgcgtcgcca gcacctcccc acgcgcgctc
ggccccgggc cacccgccct 540cgtcggcccc cgcccctctc cgtagccgca
gggaagcgag cctgggagga agaagagggt 600aggtggggag gcggatgagg
ggtgggggac cccttgacgt caccagaagg aggtgccggg 660gtaggaagtg
ggctggggaa aggttataaa tcgcccccgc cctcggctgc tcttcatcga
720ggtccgcggg aggctcggag cgcgccaggc ggacactcct ctcggctcct
ccccggcagc 780ggcggcggct cggagcgggc tccggggctc gggtgcagcg
gccagcgggc gcctggcggc 840gaggattacc cggggaagtg gttgtctcct
ggctggagcc gcgagacggg cgctcagggc 900gcggggccgg cggcggcgaa
cgagaggacg gactctggcg gccgggtcgt tggccgcggg 960gagcgcgggc
accgggcgag caggccgcgt cgcgctcacc 10009771DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 97ttgcttgtta atcaataaac cgtttaattc gtttcagttg
aactttggtc tctgcgtatt 60tctttcttat c 719834DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98attttgaagc gggaggtttg aacgcgcagc cgcc
349912DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 99ccggtcgcca cc 12100197DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
100ggggctcggg tgcagcggcc agcgggcgcc tggcggcgag gattacccgg
ggaagtggtt 60gtctcctggc tggagccgcg agacgggcgc tcagggcgcg gggccggcgg
cggcgaacga 120gaggacggac tctggcggcc gggtctttgg ccgcggggag
cgcgggcacc gggcgagcag 180gccgcgtcgc gctcacc 197101382DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
101ggggtggggg accccttgac gtcaccagaa ggaggtgccg gggtaggaag
tgggctgggg 60aaaggttata aatcgccccc gccctcggct gctcttcatc gaggtccgcg
ggaggctcgg 120agcgcgccag gcggacactc ctctcggctc ctccccggca
gcggcggcgg ctcggagcgg 180gctccggggc tcgggtgcag cggccagcgg
gcgcctggcg gcgaggatta cccggggaag 240tggttgtctc ctggctggag
ccgcgagacg ggcgctcagg gcgcggggcc ggcggcggcg 300aacgagagga
cggactctgg cggccgggtc gttggccgcg gggagcgcgg gcaccgggcg
360agcaggccgc gtcgcgctca cc 3821022064DNAHomo sapiens 102atggtcagct
actgggacac cggggtcctg ctgtgcgcgc tgctcagctg tctgcttctc 60acaggatcta
gttcaggttc aaaattaaaa gatcctgaac tgagtttaaa aggcacccag
120cacatcatgc aagcaggcca gacactgcat ctccaatgca ggggggaagc
agcccataaa 180tggtctttgc ctgaaatggt gagtaaggaa agcgaaaggc
tgagcataac taaatctgcc 240tgtggaagaa atggcaaaca attctgcagt
actttaacct tgaacacagc tcaagcaaac 300cacactggct tctacagctg
caaatatcta gctgtaccta cttcaaagaa gaaggaaaca 360gaatctgcaa
tctatatatt tattagtgat acaggtagac ctttcgtaga gatgtacagt
420gaaatccccg aaattataca catgactgaa ggaagggagc tcgtcattcc
ctgccgggtt 480acgtcaccta acatcactgt tactttaaaa aagtttccac
ttgacacttt gatccctgat 540ggaaaacgca taatctggga cagtagaaag
ggcttcatca tatcaaatgc aacgtacaaa 600gaaatagggc ttctgacctg
tgaagcaaca gtcaatgggc atttgtataa gacaaactat 660ctcacacatc
gacaaaccaa tacaatcata gatgtccaaa taagcacacc acgcccagtc
720aaattactta gaggccatac tcttgtcctc aattgtactg ctaccactcc
cttgaacacg 780agagttcaaa tgacctggag ttaccctgat gaaaaaaata
agagagcttc cgtaaggcga 840cgaattgacc aaagcaattc ccatgccaac
atattctaca gtgttcttac tattgacaaa 900atgcagaaca aagacaaagg
actttatact tgtcgtgtaa ggagtggacc atcattcaaa 960tctgttaaca
cctcagtgca tatatatgat aaagcattca tcactgtgaa acatcgaaaa
1020cagcaggtgc ttgaaaccgt agctggcaag cggtcttacc ggctctctat
gaaagtgaag 1080gcatttccct cgccggaagt tgtatggtta aaagatgggt
tacctgcgac tgagaaatct 1140gctcgctatt tgactcgtgg ctactcgtta
attatcaagg acgtaactga agaggatgca 1200gggaattata caatcttgct
gagcataaaa cagtcaaatg tgtttaaaaa cctcactgcc 1260actctaattg
tcaatgtgaa accccagatt tacgaaaagg ccgtgtcatc gtttccagac
1320ccggctctct acccactggg cagcagacaa atcctgactt gtaccgcata
tggtatccct 1380caacctacaa tcaagtggtt ctggcacccc tgtaaccata
atcattccga agcaaggtgt 1440gacttttgtt ccaataatga agagtccttt
atcctggatg ctgacagcaa catgggaaac 1500agaattgaga gcatcactca
gcgcatggca ataatagaag gaaagaataa gatggctagc 1560accttggttg
tggctgactc tagaatttct ggaatctaca tttgcatagc ttccaataaa
1620gttgggactg tgggaagaaa cataagcttt tatatcacag atgtgccaaa
tgggtttcat 1680gttaacttgg aaaaaatgcc gacggaagga gaggacctga
aactgtcttg cacagttaac 1740aagttcttat acagagacgt tacttggatt
ttactgcgga cagttaataa cagaacaatg 1800cactacagta ttagcaagca
aaaaatggcc atcactaagg agcactccat cactcttaat 1860cttaccatca
tgaatgtttc cctgcaagat tcaggcacct atgcctgcag agccaggaat
1920gtatacacag gggaagaaat cctccagaag aaagaaatta caatcagagg
tgagcactgc 1980aacaaaaagg ctgttttctc tcggatctcc aaatttaaaa
gcacaaggaa tgattgtacc 2040acacaaagta atgtaaaaca ttaa
20641031453DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 103aagcttgggc tgcaggtcga tcgactctag
aggatcgatc cccgggcgag ctcgaattcg 60caaccaccat ggtcagctac tgggacaccg
gggtcctgct gtgcgcgctg ctcagctgtc 120tgcttctcac aggatctagt
tccggaggta gacctttcgt agagatgtac agtgaaatcc 180ccgaaattat
acacatgact gaaggaaggg agctcgtcat tccctgccgg gttacgtcac
240ctaacatcac tgttacttta aaaaagtttc cacttgacac tttgatccct
gatggaaaac 300gcataatctg ggacagtaga aagggcttca tcatatcaaa
tgcaacgtac aaagaaatag 360ggcttctgac ctgtgaagca acagtcaatg
ggcatttgta taagacaaac tatctcacac 420atcgacaaac caatacaatc
atagatgtgg ttctgagtcc gtctcatgga attgaactat 480ctgttggaga
aaagcttgtc ttaaattgta cagcaagaac tgaactaaat gtggggattg
540acttcaactg ggaataccct tcttcgaagc atcagcataa gaaacttgta
aaccgagacc 600taaaaaccca gtctgggagt gagatgaaga aatttttgag
caccttaact atagatggtg 660taacccggag tgaccaagga ttgtacacct
gtgcagcatc cagtgggctg atgaccaaga 720agaacagcac atttgtcagg
gtccatgaaa agggcccggg cgacaaaact cacacatgcc 780caccgtgccc
agcacctgaa ctcctggggg gaccgtcagt cttcctcttc cccccaaaac
840ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg
gtggacgtga 900gccacgaaga ccctgaggtc aagttcaact ggtacgtgga
cggcgtggag gtgcataatg 960ccaagacaaa gccgcgggag gagcagtaca
acagcacgta ccgtgtggtc agcgtcctca 1020ccgtcctgca ccaggactgg
ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag 1080ccctcccagc
ccccatcgag aaaaccatct ccaaagccaa agggcagccc cgagaaccac
1140aggtgtacac cctgccccca tcccgggatg agctgaccaa gaaccaggtc
agcctgacct 1200gcctggtcaa aggcttctat cccagcgaca tcgccgtgga
gtgggagagc aatgggcagc 1260cggagaacaa ctacaagacc acgcctcccg
tgctggactc cgacggctcc ttcttcctct 1320atagcaagct caccgtggac
aagagcaggt ggcagcaggg gaacgtcttc tcatgctccg 1380tgatgcatga
ggctctgcac aaccactaca cgcagaagag cctctccctg tctccgggta
1440aatgagcggc cgc 14531041377DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 104atggtcagct
actgggacac cggggtcctg ctgtgcgcgc tgctcagctg tctgcttctc 60acaggatcta
gttccggaag tgataccggt agacctttcg tagagatgta cagtgaaatc
120cccgaaatta tacacatgac tgaaggaagg gagctcgtca ttccctgccg
ggttacgtca 180cctaacatca ctgttacttt aaaaaagttt ccacttgaca
ctttgatccc tgatggaaaa 240cgcataatct gggacagtag aaagggcttc
atcatatcaa atgcaacgta caaagaaata 300gggcttctga cctgtgaagc
aacagtcaat gggcatttgt ataagacaaa ctatctcaca 360catcgacaaa
ccaatacaat catagatgtg gttctgagtc cgtctcatgg aattgaacta
420tctgttggag aaaagcttgt cttaaattgt acagcaagaa ctgaactaaa
tgtggggatt 480gacttcaact gggaataccc ttcttcgaag catcagcata
agaaacttgt aaaccgagac 540ctaaaaaccc agtctgggag tgagatgaag
aaatttttga gcaccttaac tatagatggt 600gtaacccgga gtgaccaagg
attgtacacc tgtgcagcat ccagtgggct gatgaccaag 660aagaacagca
catttgtcag ggtccatgaa aaggacaaaa ctcacacatg cccaccgtgc
720ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa
acccaaggac 780accctcatga tctcccggac ccctgaggtc acatgcgtgg
tggtggacgt gagccacgaa 840gaccctgagg tcaagttcaa ctggtacgtg
gacggcgtgg aggtgcataa tgccaagaca 900aagccgcggg aggagcagta
caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 960caccaggact
ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca
1020gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc
acaggtgtac 1080accctgcccc catcccggga tgagctgacc aagaaccagg
tcagcctgac ctgcctggtc 1140aaaggcttct atcccagcga catcgccgtg
gagtgggaga gcaatgggca gccggagaac 1200aactacaaga ccacgcctcc
cgtgctggac tccgacggct ccttcttcct ctacagcaag 1260ctcaccgtgg
acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat
1320gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga
13771051444DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 105aagcttgggc tgcaggtcga tcgactctag
aggatcgatc cccgggcgag ctcgaattcg 60caaccaccat ggtcagctac tgggacaccg
gggtcctgct gtgcgcgctg ctcagctgtc 120tgcttctcac aggatctagt
tccggaggta gacctttcgt agagatgtac agtgaaatcc 180ccgaaattat
acacatgact gaaggaaggg agctcgtcat tccctgccgg gttacgtcac
240ctaacatcac tgttacttta aaaaagtttc cacttgacac tttgatccct
gatggaaaac 300gcataatctg ggacagtaga aagggcttca tcatatcaaa
tgcaacgtac aaagaaatag 360ggcttctgac ctgtgaagca acagtcaatg
ggcatttgta taagacaaac tatctcacac 420atcgacaaac caatacaatc
atagatatcc agctgttgcc caggaagtcg ctggagctgc 480tggtagggga
gaagctggtc ctcaactgca ccgtgtgggc tgagtttaac tcaggtgtca
540cctttgactg ggactaccca gggaagcagg cagagcgggg taagtgggtg
cccgagcgac 600gctcccaaca gacccacaca gaactctcca gcatcctgac
catccacaac gtcagccagc 660acgacctggg ctcgtatgtg tgcaaggcca
acaacggcat ccagcgattt cgggagagca 720ccgaggtcat tgtgcatgaa
aatggcccgg gcgacaaaac tcacacatgc ccaccgtgcc 780cagcacctga
actcctgggg ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca
840ccctcatgat ctcccggacc cctgaggtca catgcgtggt ggtggacgtg
agccacgaag 900accctgaggt caagttcaac tggtacgtgg acggcgtgga
ggtgcataat gccaagacaa 960agccgcggga ggagcagtac aacagcacgt
accgtgtggt cagcgtcctc accgtcctgc 1020accaggactg gctgaatggc
aaggagtaca agtgcaaggt ctccaacaaa gccctcccag 1080cccccatcga
gaaaaccatc tccaaagcca aagggcagcc ccgagaacca caggtgtaca
1140ccctgccccc atcccgggat gagctgacca agaaccaggt cagcctgacc
tgcctggtca 1200aaggcttcta tcccagcgac atcgccgtgg agtgggagag
caatgggcag ccggagaaca 1260actacaagac cacgcctccc gtgctggact
ccgacggctc cttcttcctc tatagcaagc 1320tcaccgtgga caagagcagg
tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg 1380aggctctgca
caaccactac acgcagaaga gcctctccct gtctccgggt aaatgagcgg 1440ccgc
1444106214PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 106Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Ser
Ala Ser Gln Asp Ile Ser Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys Val Leu Ile 35 40 45 Tyr Phe Thr Ser
Ser Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Thr Val Pro Trp 85
90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala
Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205
Phe Asn Arg Gly Glu Cys 210 107642DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 107gatattcagc
tgacccagag cccgagcagc ctgagcgcga gcgtgggcga tcgcgtgacc 60attacctgca
gcgcgagcca ggatattagc aactatctga actggtatca gcagaaaccg
120ggcaaagcgc cgaaagtgct gatttatttt accagcagcc tgcatagcgg
cgtgccgagc 180cgctttagcg gcagcggcag cggcaccgat tttaccctga
ccattagcag cctgcagccg 240gaagattttg cgacctatta ttgccagcag
tatagcaccg tgccgtggac ctttggccag 300ggcaccaaag tggaaattaa
acgcaccgtg gcggcgccga gcgtgtttat ttttccgccg 360agcgatgaac
agctgaaaag cggcaccgcg agcgtggtgt gcctgctgaa caacttttat
420ccgcgcgaag cgaaagtgca gtggaaagtg gataacgcgc tgcagagcgg
caacagccag 480gaaagcgtga ccgaacagga tagcaaagat agcacctata
gcctgagcag caccctgacc 540ctgagcaaag cggattatga aaaacataaa
gtgtatgcgt gcgaagtgac ccatcagggc 600ctgagcagcc cggtgaccaa
aagctttaac cgcggcgaat gc 642108642DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 108gatattcaat
tgactcaatc tccttcttct ttgtctgctt ctgttggtga tcgtgttact 60attacttgtt
ctgcttctca agatatttct aattatttga attggtatca acaaaaacct
120ggtaaagctc ctaaagtttt gatttatttt acttcttctt tgcattctgg
tgttccttct 180cgtttttctg gttctggttc tggtactgat tttactttga
ctatttcttc tttgcaacct 240gaagattttg ctacttatta ttgtcaacaa
tattctactg ttccttggac ttttggtcaa 300ggtactaaag ttgaaattaa
acgtactgtt gctgctcctt ctgtttttat ttttcctcct 360tctgatgaac
aattgaaatc tggtactgct tctgttgttt gtttgttgaa taatttttat
420cctcgtgaag ctaaagttca atggaaagtt gataatgctt tgcaatctgg
taattctcaa 480gaatctgtta ctgaacaaga ttctaaagat tctacttatt
ctttgtcttc tactttgact 540ttgtctaaag ctgattatga aaaacataaa
gtttatgctt gtgaagttac tcatcaaggt 600ttgtcttctc ctgttactaa
atcttttaat cgtggtgaat gt 642109450PRTArtificial SequenceDescription
of Artificial Sequence Synthetic polypeptide 109Met Val Ser Tyr Trp
Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15 Cys Leu Leu
Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30 Glu
Leu Ser Leu Lys Gly Thr Gln His Ile Ala Gly Gln Thr Leu His 35 40
45 Leu Gln Cys Arg Gly Glu Ala Ala Met Gln His Lys Trp Ser Leu Pro
50 55 60 Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys
Ser Ala 65 70 75 80 Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu
Thr Leu Asn Thr 85 90 95 Ala Gln Ala Asn His Thr Gly Phe Tyr Ser
Cys Lys Tyr Leu Ala Val 100 105 110 Pro Thr Ser Lys Lys Lys Glu Thr
Glu Ser Ala Ile Tyr Ile Phe Ile 115 120 125 Ser Asp Thr Gly Arg Pro
Phe Val Glu Met Tyr Ser Glu Ile Pro Glu 130 135 140 Ile Ile His Met
Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val 145 150 155 160 Thr
Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170
175 Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe
180 185 190 Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr
Cys Glu 195 200 205 Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr
Leu Thr His Arg 210 215 220 Gln Thr Asn Thr Ile Ile Asp Val Gln Ile
Ser Thr Pro Arg Pro Val 225 230 235 240 Lys Leu Leu Arg Gly His Thr
Leu Val Leu Asn Cys Thr Ala Thr Thr 245 250 255 Pro Leu Asn Thr Arg
Val Gln Met Thr Trp Ser Tyr Pro Asp Glu Lys 260 265 270 Asn Lys Arg
Ala Ser Val Arg Arg Arg Ile Asp Gln Ser Asn Ser His 275 280 285 Ala
Asn Ile Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys 290 295
300 Asp Lys Gly Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe Lys
305 310 315 320 Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Phe
Ile Thr Val 325 330 335 Lys His Arg Lys Gln Gln Val Leu Glu Thr Val
Ala Gly Lys Arg Ser 340 345 350 Tyr Arg Leu Ser Met Lys Val Lys Ala
Phe Pro Ser Pro Glu Val Val 355 360 365 Trp Leu Lys Asp Gly Leu Pro
Ala Thr Glu Lys Ser Ala Arg Tyr Leu 370 375 380 Thr Arg Gly Tyr Ser
Leu Ile Ile Lys Asp Val Thr Glu Glu Asp Ala 385 390 395 400 Gly Asn
Tyr Thr Ile Leu Leu Ser Ile Lys Gln Ser Asn Val Phe Lys 405 410 415
Asn Leu Thr Ala Thr Leu Ile Val Asn Val Lys Pro Gln Ile Tyr Glu 420
425 430 Lys Ala Val Ser Ser Phe Pro Asp Pro Ala Leu Tyr Pro Leu Gly
Ser 435 440 445 Arg Gln 450 110375DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 110atggccaagt
tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc cggagcggtc 60gagttctgga
ccgaccggct cgggttctcc cgggacttcg tggaggacga cttcgccggt
120gtggtccggg acgacgtgac cctgttcatc agcgcggtcc aggaccaggt
ggtgccggac 180aacaccctgg cctgggtgtg ggtgcgcggc ctggacgagc
tgtacgccga gtggtcggag 240gtcgtgtcca cgaacttccg ggacgcctcc
gggccggcca tgaccgagat cggcgagcag 300ccgtgggggc gggagttcgc
cctgcgcgac ccggccggca actgcgtgca cttcgtggcc 360gaggagcagg actga
375111375DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 111atgtctaaat taacctctgc tgttccagtg
ttaaccgccc gtgatgttgc cggtgcagtg 60gaattttgga ctgaccgttt gggtttctca
cgtgactttg tcgaagatga ttttgctggc 120gttgtgcgtg atgacgtcac
tttgttcatc tctgctgttc aggatcaggt cgtcccagac 180aacactttgg
cctgggtctg ggttcgtggt ttggacgaat tgtacgctga gtggagtgaa
240gttgtgtcta caaactttcg tgatgcatca ggtccagcta tgaccgaaat
tggcgaacaa 300ccttggggcc gtgagttcgc tttacgtgat ccagccggta
attgcgtgca cttcgttgct 360gaggagcaag attag 375112861DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
112atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
ttgccttcct 60gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca
gttgggtgca 120cgagtgggtt acatcgaact ggatctcaac agcggtaaga
tccttgagag ttttcgcccc 180gaagaacgtt ttccaatgat gagcactttt
aaagttctgc tatgtggcgc ggtattatcc 240cgtattgacg ccgggcaaga
gcaactcggt cgccgcatac actattctca gaatgacttg 300gttgagtact
caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta
360tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct
gacaacgatc 420ggaggaccga aggagctaac cgcttttttg cacaacatgg
gggatcatgt aactcgcctt 480gatcgttggg aaccggagct gaatgaagcc
ataccaaacg acgagcgtga caccacgatg 540cctgtagcaa tggcaacaac
gttgcgcaaa ctattaactg gcgaactact tactctagct 600tcccggcaac
aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
660tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga
gcgtgggtct 720cgcggtatca ttgcagcact ggggccagat ggtaagccct
cccgtatcgt agttatctac 780acgacgggga gtcaggcaac tatggatgaa
cgaaatagac agatcgctga gataggtgcc 840tcactgatta agcattggta a
861113795DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 113atgattgaac aagatggatt gcacgcaggt
tctccggccg cttgggtgga gaggctattc 60ggctatgact gggcacaaca gacaatcggc
tgctctgatg ccgccgtgtt ccggctgtca 120gcgcaggggc gcccggttct
ttttgtcaag accgacctgt ccggtgccct gaatgaactg 180caggacgagg
cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg
240ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt
gccggggcag 300gatctcctgt catctcacct tgctcctgcc gagaaagtat
ccatcatggc tgatgcaatg 360cggcggctgc atacgcttga tccggctacc
tgcccattcg accaccaagc gaaacatcgc 420atcgagcgag cacgtactcg
gatggaagcc ggtcttgtcg atcaggatga tctggacgaa 480gagcatcagg
ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac
540ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat
ggtggaaaat 600ggccgctttt ctggattcat cgactgtggc cggctgggtg
tggcggaccg ctatcaggac 660atagcgttgg ctacccgtga tattgctgaa
gagcttggcg gcgaatgggc tgaccgcttc 720ctcgtgcttt acggtatcgc
cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780gacgagttct tctga
7951142038DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 114aggtggcact tttcggggaa atgtgcgcgg
aacccctatt tgtttatttt tctaaataca 60ttcaaatatg tatccgctca tgagacaata
accctgataa atgcttcaat aatattgaaa 120aaggaagagt atgagtattc
aacatttccg tgtcgccctt attccctttt ttgcggcatt 180ttgccttcct
gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca
240gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga
tccttgagag 300ttttcgcccc gaagaacgtt ttccaatgat gagcactttt
aaagttctgc tatgtggcgc 360ggtattatcc cgtgttgacg ccgggcaaga
gcaactcggt cgccgcatac actattctca 420gaatgacttg gttgagtact
caccagtcac agaaaagcat cttacggatg gcatgacagt 480aagagaatta
tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct
540gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg
gggatcatgt 600aactcgcctt gatcgttggg aaccggagct gaatgaagcc
ataccaaacg acgagcgtga 660caccacgatg cctgcagcaa tggcaacaac
gttgcgcaaa ctattaactg gcgaactact 720tactctagct tcccggcaac
aattaataga ctggatggag gcggataaag ttgcaggacc 780acttctgcgc
tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga
840gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct
cccgtatcgt 900agttatctac acgacgggga gtcaggcaac tatggatgaa
cgaaatagac agatcgctga 960gataggtgcc tcactgatta agcattggta
actgtcagac caagtttact catatatact 1020ttagattgat ttaaaacttc
atttttaatt taaaaggatc taggtgaaga tcctttttga 1080taatctcatg
accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt
1140agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct
gctgcttgca 1200aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg
gatcaagagc taccaactct 1260ttttccgaag gtaactggct tcagcagagc
gcagatacca aatactgtcc ttctagtgta 1320gccgtagtta ggccaccact
tcaagaactc tgtagcaccg cctacatacc tcgctctgct 1380aatcctgtta
ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc
1440aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt
cgtgcacaca 1500gcccagcttg gagcgaacga cctacaccga actgagatac
ctacagcgtg agctatgaga 1560aagcgccacg cttcccgaag ggagaaaggc
ggacaggtat ccggtaagcg gcagggtcgg 1620aacaggagag cgcacgaggg
agcttccagg gggaaacgcc tggtatcttt atagtcctgt 1680cgggtttcgc
cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag
1740cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt
gctggccttt 1800tgctcacatg ttctttcctg cgttatcccc tgattctgtg
gataaccgta ttaccgcctt 1860tgagtgagct gataccgctc gccgcagccg
aacgaccgag cgcagcgagt cagtgagcga 1920ggaagcggaa gagcgcctga
tgcggtattt tctccttacg catctgtgcg gtatttcaca 1980ccgcatatgg
tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtat 2038
* * * * *