U.S. patent application number 14/190983 was filed with the patent office on 2014-11-06 for nucleic acid particles, methods and use thereof.
This patent application is currently assigned to Massachusetts Institute of Technology. The applicant listed for this patent is Massachusetts Institute of Technology. Invention is credited to Paula T. Hammond, Jong Bum Lee, Young Hoon Roh.
Application Number | 20140328931 14/190983 |
Document ID | / |
Family ID | 50342473 |
Filed Date | 2014-11-06 |
United States Patent
Application |
20140328931 |
Kind Code |
A1 |
Hammond; Paula T. ; et
al. |
November 6, 2014 |
NUCLEIC ACID PARTICLES, METHODS AND USE THEREOF
Abstract
The present invention provides, among other things, a particle
which includes a core comprised of self-assembled one or more
nucleic acid molecules, the core being characterized by an ability
to adopt at least two configurations: a first configuration having
a first greatest dimension greater than 2 .mu.m and; a second
configuration having a second greatest dimension less than 500 nm,
wherein addition of a film coating converts the core from its first
configuration to its second configuration. Methods of making and
using of provided particles are also disclosed.
Inventors: |
Hammond; Paula T.; (Newton,
MA) ; Lee; Jong Bum; (Cambridge, MA) ; Roh;
Young Hoon; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Massachusetts Institute of Technology |
Cambridge |
MA |
US |
|
|
Assignee: |
Massachusetts Institute of
Technology
Cambridge
MA
|
Family ID: |
50342473 |
Appl. No.: |
14/190983 |
Filed: |
February 26, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61769731 |
Feb 26, 2013 |
|
|
|
Current U.S.
Class: |
424/490 ;
424/649; 435/91.2; 514/34; 514/44A |
Current CPC
Class: |
C12N 15/88 20130101;
C12Q 1/6844 20130101; C12N 15/111 20130101; A61K 31/713 20130101;
A61K 9/167 20130101; C12P 19/34 20130101; A61K 9/50 20130101; A61K
9/5089 20130101; C12N 15/113 20130101; C12N 2320/32 20130101; A61K
45/06 20130101; C12N 2310/14 20130101 |
Class at
Publication: |
424/490 ;
514/44.A; 514/34; 424/649; 435/91.2 |
International
Class: |
A61K 9/16 20060101
A61K009/16; C12N 15/113 20060101 C12N015/113; C12P 19/34 20060101
C12P019/34; A61K 31/713 20060101 A61K031/713; A61K 45/06 20060101
A61K045/06 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support under Grant
No. DMR-0705234 awarded by the National Science Foundation. The
government has certain rights in the invention.
Claims
1. A particle, comprising: a core comprised of self-assembled one
or more nucleic acid molecules, the core being characterized by an
ability to adopt at least two configurations: a first configuration
having a first greatest dimension greater than 2 .mu.m and; a
second configuration having a second greatest dimension less than
500 nm, wherein addition of a film coating converts the core from
its first configuration to its second configuration.
2. The particle of claim 1, wherein the core contains a single
nucleic acid molecule.
3. The particle of claim 1, wherein the core is comprised of a
plurality of nucleic acid molecules.
4. The particle of claim 3, wherein individual nucleic acid
molecules within the core have different nucleic acid
sequences.
5. The particle of claim 3, wherein all nucleic acid molecules
within the core have substantially the same nucleic acid
sequence.
6. The particle of claim 3, wherein nucleic acid molecules within
the core have sequences that share at least one common sequence
element.
7. The particle of claim 1, wherein at least one nucleic acid
molecule within the core has a nucleotide sequence that comprises
multiple copies of at least a first sequence element.
8. The particle of claim 1, wherein at least one nucleic acid
molecule within the core has a nucleotide sequence that comprises
multiple copies of each of at least a first and a second sequence
element.
9. The particle of claim 8, wherein the at least one nucleic acid
molecule has a nucleotide sequence that comprises alternating
copies of the first and second sequence elements.
10. The particle of claim 8, wherein the at least one nucleic acid
molecule has a nucleotide sequence that comprises multiple copies
of each of three or more sequence elements.
11. The particle of claim 1, wherein at least one nucleic acid
molecule has a nucleotide sequence that includes one or more
sequence elements found in a natural source.
12. The particle of claim 11, wherein the at least one nucleic acid
molecule has a nucleotide sequence that includes a first sequence
element that is found in a first natural source and a second
sequence element that is found in a second natural source.
13. The particle of claim 12, wherein the first and second natural
sources are the same.
14. The particle of claim 12, wherein the first and second natural
sources are different.
15. The particle of claim 1, wherein at least one nucleic acid
molecule in the core has a nucleotide sequence that represents an
assemblage of sequence elements found in one or more source nucleic
acid molecules.
16. The particle of claim 15, wherein the at least one nucleic acid
molecule has a nucleotide sequence that represents an assemblage of
at least two different sequence elements found in two different
source nucleic acid molecules.
17. The particle of claim 1, wherein at least a portion of the
nucleic acid molecules within a core is cleavable.
18. The particle of claim 1, wherein the nucleic acid molecules
within a core comprise single-stranded, double-stranded,
triple-stranded nucleic acids or combination thereof.
19. The particle of claim 1, wherein the nucleic acid molecules
within a core are arranged in a crystalline structure comprising
lamellar sheets.
20. The particle of claim 1, wherein the nucleic acid molecules
within a core are formed via amplification by rolling circle
amplification (RCA), rolling circle transcription (RCT) or
both.
21. The particle of claim 1, wherein the nucleic acid molecules
within a core comprise a stem-loop or linear structure.
22. The particle of claim 1, wherein the core comprises about
1.times.10.sup.3 to 1.times.10.sup.8 copies of a sequence
element.
23. The particle of claim 1, wherein the core comprises at least
1.times.10.sup.6 copies of a sequence element.
24. The particle of claim 1, wherein the nucleic acid molecules
have a molecular weight of at least about 1.times.10.sup.10 g/mol,
about 1.times.10.sup.9 g/mol, about 1.times.10.sup.8 g/mol, about
1.times.10.sup.7 g/mol, about 1.times.10.sup.6 g/mol, or about
1.times.10.sup.5 g/mol.
25. The particle of claim 1, wherein the core has a negative or
positive surface charge.
26. The particle of claim 1, further comprising one or more agents
for delivery within the core.
27. The particle of claim 26, wherein the agent comprises a
chemotherapeutic agent selected from the group consisting of
doxorubicin, carboplatin, cisplatin, cyclophosphamide, docetaxel,
erlotinib, etoposide, fluorouracil, gemcitabine, imatinib mesylate,
irinotecan, methotrexate, paclitaxel, sorafinib, sunitinib,
topotecan, vincristine, vinblastine and combination thereof.
28. The particle of claim 1, wherein the first greatest dimension
of the core is greater than 2 .mu.m, 1 .mu.m, 500 nm, 200 nm, 100
nm or 50 nm.
29. The particle of claim 1, wherein the second greatest dimension
of the core is less than 500 nm, 200 nm, 100 nm, 50 nm, 20 nm or 10
nm.
30. The particle of claim 1, further comprising a film coated on
the core, so that the core has its second configuration.
31. The particle of claim 30, wherein the film is or comprises a
material selected from the group consisting of an organic material,
an inorganic material, or combination thereof.
32. The particle of claim 30, wherein the film is or comprises a
polymer.
33. The particle of claim 32, wherein the film is or comprises a
lipid.
34. The particle of claim 30, wherein the film is or comprises at
least one polyelectrolyte layer.
35. The particle of claim 34, wherein the polyelectrolye layer is
degradable or non-degradable.
36. The particle of claim 34, wherein the polyelectrolyte layer is
or comprises a polycation or polyanion.
37. The particle of claim 36, wherein the polycation is selected
from the group consisting of polyethylenimine, poly(L-lysine)
(PLL), poly(lactic acid) (PLA), derivatives and combination
thereof.
38. The particle of claim 30, wherein the film comprises a
layer-by-layer (LBL) film.
39. The particle of claim 38, wherein the LBL film comprises
multiple polyelectrolyte layers.
40. The particle of claim 39, wherein the LBL film comprises
multiple polyelectrolyte layers of alternating charges.
41. The particle of claim 30, wherein the film further comprises
one or more agents.
42. The particle of claim 30, wherein the coated particle has a
positive or negative surface charge.
43. A particle, comprising: a core comprised of one or more nucleic
acid molecules self-assembled in a crystalline structure comprising
lamellar sheets.
44. A method for forming a particle comprising: assembling one or
more nucleic acid molecules into a core with a crystalline
structure comprising lamellar sheets.
45. A method for forming a particle comprising: assembling one or
more nucleic acid molecules into a core, wherein the core has a
first greatest dimension greater than 2 .mu.m, and coating the core
with a film, wherein the coated core has a second greatest
dimension less than 500 nm.
46. The method of claim 45, further comprising forming the nucleic
acid molecules via rolling circle amplification (RCA), rolling
circle transcription (RCT) or both.
47. The method of claim 46, wherein the step of forming comprises
using a circular nucleic acid template.
48. The method of claim 47, wherein the step of forming comprises
hybridizing the circular nucleic acid template with a primer.
49. The method of claim 48, wherein the primer is complementary to
a portion of the circular nucleic acid template.
50. The method of claim 47, wherein the step of forming further
comprises amplifying the circular nucleic acid template using an
enzyme.
51. The method of claim 50, wherein the enzyme is .PHI.29 DNA
polymerase, T7 polymerase or both.
52. The method of claim 45, wherein the step of coating comprises
mixing the core in a coating solution.
53. The method of claim 52, wherein the coating solution comprises
polyethylenimine.
54. The method of claim 45, wherein the step of coating further
comprises sequentially assembling additional layers.
55. A method for using a particle: administering or implanting a
particle of claim 1 to a subject.
56. The method of claim 55, further comprising exposing the
particle to a cleavage agent so that the nucleic acid molecules are
cleaved into copies of nucleic acids.
57. The method of claim 56, wherein the cleavage agent is an enzyme
selected from the group consisting of nuclease, Dicer, DNAase,
RNAase and combination thereof.
58. The method of claim 57, further comprising releasing the
cleaved copies of nucleic acids.
59. The method of claim 55, wherein the particles are used for
dysregulation of genes.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to and the benefit of, U.S.
provisional patent application Ser. No. 61/769,731, filed on Feb.
26, 2013, the entire contents of which are herein incorporated by
reference.
BACKGROUND
[0003] RNA interference (RNAi) is a powerful tool for suppressing
gene expression, and much research has been directed at efforts to
develop an efficient delivery method for small interference RNA
(siRNA). Conventional complexation or encapsulation of siRNA with
polymers or lipids can often require multi-step synthesis of
carriers or relatively ineffectual encapsulation processes;
furthermore, such approaches often involve introducing a
significant amount of an additional component, which can lead to
greater potential for immunogenic response or toxicity. In
addition, the amount of siRNA per carrier is limited due to the
rigidity of double stranded siRNA, low surface charge of individual
siRNA, and low loading efficiency, making RNAi encapsulation
particularly challenging. Furthermore, RNAi requires specialized
synthesis and is often available in small quantities at high cost,
making it a very costly cargo that is delivered with fairly low
efficiency carriers. Thus, there is a continuing need for new
insights on improved technologies for efficient delivery of nucleic
acids such as siRNA.
SUMMARY
[0004] The present invention, among other things, describes
particles including a core of self-assembled one or more nucleic
acid molecules. In some embodiments, nucleic acid molecules within
a particle core are formed via elongation by rolling circle
amplification (RCA) and/or rolling circle transcription (RCT). In
some embodiments, provided particles may contain a core that is
coated by a film so that the particles are condensed to achieve a
smaller particle size. Provided compositions and methods can be
particularly useful for delivery of high loads of nucleic acids,
optionally with any other agents.
DEFINITIONS
[0005] In order for the present disclosure to be more readily
understood, certain terms are first defined below.
[0006] In this application, the use of "or" means "and/or" unless
stated otherwise. As used in this application, the term "comprise"
and variations of the term, such as "comprising" and "comprises,"
have their understood meaning in the art of patent drafting and are
inclusive rather than exclusive, for example, of additional
additives, components, integers or steps. As used in this
application, the terms "about" and "approximately" have their
art-understood meanings; use of one vs the other does not
necessarily imply different scope. Unless otherwise indicated,
numerals used in this application, with or without a modifying term
such as "about" or "approximately", should be understood to cover
normal fluctuations appreciated by one of ordinary skill in the
relevant art. In certain embodiments, the term "approximately" or
"about" refers to a range of values that fall within 25%, 20%, 19%,
18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%,
4%, 3%, 2%, 1%, or less in either direction (greater than or less
than) of a stated reference value unless otherwise stated or
otherwise evident from the context (except where such number would
exceed 100% of a possible value).
[0007] "Associated": As used herein, the term "associated"
typically refers to two or more entities in physical proximity with
one another, either directly or indirectly (e.g., via one or more
additional entities that serve as a linking agent), to form a
structure that is sufficiently stable so that the entities remain
in physical proximity under relevant conditions, e.g.,
physiological conditions. In some embodiments, associated entities
are covalently linked to one another. In some embodiments,
associated entities are non-covalently linked. In some embodiments,
associated entities are linked to one another by specific
non-covalent interactions (i.e., by interactions between
interacting ligands that discriminate between their interaction
partner and other entities present in the context of use, such as,
for example, streptavidin/avidin interactions, antibody/antigen
interactions, etc.). Alternatively or additionally, a sufficient
number of weaker non-covalent interactions can provide sufficient
stability for moieties to remain associated. Exemplary non-covalent
interactions include, but are not limited to, affinity
interactions, metal coordination, physical adsorption, host-guest
interactions, hydrophobic interactions, pi stacking interactions,
hydrogen bonding interactions, van der Waals interactions, magnetic
interactions, electrostatic interactions, dipole-dipole
interactions, etc.
[0008] "Biodegradable": As used herein, the term "biodegradable" is
used to refer to materials that, when introduced into cells, are
broken down by cellular machinery (e.g., enzymatic degradation) or
by hydrolysis into components that cells can either reuse or
dispose of without significant toxic effect(s) on the cells. In
certain embodiments, components generated by breakdown of a
biodegradable material do not induce inflammation and/or other
adverse effects in vivo. In some embodiments, biodegradable
materials are enzymatically broken down. Alternatively or
additionally, in some embodiments, biodegradable materials are
broken down by hydrolysis. In some embodiments, biodegradable
polymeric materials break down into their component and/or into
fragments thereof (e.g., into monomeric or submonomeric species).
In some embodiments, breakdown of biodegradable materials
(including, for example, biodegradable polymeric materials)
includes hydrolysis of ester bonds. In some embodiments, breakdown
of materials (including, for example, biodegradable polymeric
materials) includes cleavage of urethane linkages.
[0009] "Hydrolytically degradable": As used herein, the term
"hydrolytically degradable" is used to refer to materials that
degrade by hydrolytic cleavage. In some embodiments, hydrolytically
degradable materials degrade in water. In some embodiments,
hydrolytically degradable materials degrade in water in the absence
of any other agents or materials. In some embodiments,
hydrolytically degradable materials degrade completely by
hydrolytic cleavage, e.g., in water. By contrast, the term
"non-hydrolytically degradable" typically refers to materials that
do not fully degrade by hydrolytic cleavage and/or in the presence
of water (e.g., in the sole presence of water).
[0010] "Nucleic acid": The term "nucleic acid" as used herein,
refers to a polymer of nucleotides. In some embodiments, nucleic
acids are or contain deoxyribonucleic acids (DNA); in some
embodiments, nucleic acids are or contain ribonucleic acids (RNA).
In some embodiments, nucleic acids include naturally-occurring
nucleotides (e.g., adenosine, thymidine, guanosine, cytidine,
uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and
deoxycytidine). Alternatively or additionally, in some embodiments,
nucleic acids include non-naturally-occurring nucleotides
including, but not limited to, nucleoside analogs (e.g.,
2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine,
3-methyl adenosine, C5-propynylcytidine, C5-propynyluridine,
C5-bromouridine, C5-fluorouridine, C5-iodouridine,
C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine,
8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and
2-thiocytidine), chemically modified bases, biologically modified
bases (e.g., methylated bases), intercalated bases, modified sugars
(e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and
hexose), or modified phosphate groups. In some embodiments, nucleic
acids include phosphodiester backbone linkages; alternatively or
additionally, in some embodiments, nucleic acids include one or
more non-phosphodiester backbone linkages such as, for example,
phosphorothioates and 5'-N-phosphoramidite linkages. In some
embodiments, a nucleic acid is an oligonucleotide in that it is
relatively short (e.g., less that about 5000, 4000, 3000, 2000,
1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 250, 200, 150,
100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, 10 or fewer
nucleotides in length)
[0011] "Physiological conditions": The phrase "physiological
conditions", as used herein, relates to the range of chemical
(e.g., pH, ionic strength) and biochemical (e.g., enzyme
concentrations) conditions likely to be encountered in the
intracellular and extracellular fluids of tissues. For most
tissues, the physiological pH ranges from about 7.0 to 7.4.
[0012] "Polyelectrolyte": The term "polyelectrolyte", as used
herein, refers to a polymer which under a particular set of
conditions (e.g., physiological conditions) has a net positive or
negative charge. In some embodiments, a polyelectrolyte is or
comprises a polycation; in some embodiments, a polyelectrolyte is
or comprises a polyanion. Polycations have a net positive charge
and polyanions have a net negative charge. The net charge of a
given polyelectrolyte may depend on the surrounding chemical
conditions, e.g., on the pH.
[0013] "Polypeptide": The term "polypeptide" as used herein, refers
to a string of at least three amino acids linked together by
peptide bonds. In some embodiments, a polypeptide comprises
naturally-occurring amino acids; alternatively or additionally, in
some embodiments, a polypeptide comprises one or more non-natural
amino acids (i.e., compounds that do not occur in nature but that
can be incorporated into a polypeptide chain; see, for example,
http://www.cco.caltech.edu/.sup..about.dadgrp/Unnatstruct.gif,
which displays structures of non-natural amino acids that have been
successfully incorporated into functional ion channels) and/or
amino acid analogs as are known in the art may alternatively be
employed). In some embodiments, one or more of the amino acids in a
protein may be modified, for example, by the addition of a chemical
entity such as a carbohydrate group, a phosphate group, a farnesyl
group, an isofarnesyl group, a fatty acid group, a linker for
conjugation, functionalization, or other modification, etc.
[0014] "Polysaccharide": The term "polysaccharide" refers to a
polymer of sugars. Typically, a polysaccharide comprises at least
three sugars. In some embodiments, a polypeptide comprises natural
sugars (e.g., glucose, fructose, galactose, mannose, arabinose,
ribose, and xylose); alternatively or additionally, in some
embodiments, a polypeptide comprises one or more non-natural amino
acids (e.g., modified sugars such as 2'-fluororibose,
2'-deoxyribose, and hexose).
[0015] "Reference nucleic acid": The term "reference nucleic acid",
as used herein, refers to any known nucleic acid molecule with
which a nucleic acid molecule of interest is compared.
[0016] "Sequence element": The term "sequence element", as used
herein, refers to a discrete portion of nucleotide sequence,
recognizable to one skilled in the art. In many embodiments, a
sequence element comprises a series of at least 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 116, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000,
4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more contiguous
nucleotides in a polymer. In some embodiments, a sequence element
is recognizable because it is found in a different nucleic acid
molecule, with which a nucleic acid molecule of interest is being
compared. Those of ordinary skill in the art are well aware of
methodologies and resources available for the comparison of nucleic
acid sequences. In some embodiments, a nucleic acid molecule of
interest has a nucleotide sequence that is selected or designed to
contain, or otherwise contains, one or more particular sequence
elements that is/are found in one or more (optionally
predetermined) reference or source nucleic acids.
[0017] "Small molecule": As used herein, the term "small molecule"
is used to refer to molecules, whether naturally-occurring or
artificially created (e.g., via chemical synthesis), that have a
relatively low molecular weight. Typically, small molecules are
monomeric and have a molecular weight of less than about 1500
g/mol. Preferred small molecules are biologically active in that
they produce a local or systemic effect in animals, preferably
mammals, more preferably humans. In certain preferred embodiments,
the small molecule is a drug. Preferably, though not necessarily,
the drug is one that has already been deemed safe and effective for
use by the appropriate governmental agency or body. For example,
drugs for human use listed by the FDA under 21 C.F.R.
.sctn..sctn.330.5, 331 through 361, and 440 through 460; drugs for
veterinary use listed by the FDA under 21 C.F.R. .sctn..sctn.500
through 589, incorporated herein by reference, are all considered
acceptable for use in accordance with the present application.
[0018] "Source nucleic acid": The term "source nucleic acid" is
used herein to refer to a known nucleic acid molecule whose
nucleotide sequence includes at least one sequence element of
interest. In some embodiments, a source nucleic acid is a natural
nucleic acid in that it occurs in a context (e.g., within an
organism) as exists in nature (e.g., without manipulation by the
hand of man). In some embodiments, a source nucleic acid is not a
natural nucleic acid in that its nucleotide sequences includes one
or more portions, linkages, or elements that do not occur in the
same arrangement in nature and/or were designed, selected, or
assembled through action of the hand of man.
[0019] "Substantially": As used herein, the term "substantially",
and grammatic equivalents, refer to the qualitative condition of
exhibiting total or near-total extent or degree of a characteristic
or property of interest. One of ordinary skill in the art will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result.
[0020] "Treating": As used herein, the term "treating" refers to
partially or completely alleviating, ameliorating, relieving,
inhibiting, preventing (for at least a period of time), delaying
onset of, reducing severity of, reducing frequency of and/or
reducing incidence of one or more symptoms or features of a
particular disease, disorder, and/or condition. In some
embodiments, treatment may be administered to a subject who does
not exhibit symptoms, signs, or characteristics of a disease and/or
exhibits only early symptoms, signs, and/or characteristics of the
disease, for example for the purpose of decreasing the risk of
developing pathology associated with the disease. In some
embodiments, treatment may be administered after development of one
or more symptoms, signs, and/or characteristics of the disease.
BRIEF DESCRIPTION OF THE DRAWING
[0021] The Drawing, comprised of several Figures, is for
illustration purposes only, not for limitation.
[0022] FIG. 1. Schematic drawing of the process of rolling circle
transcription (RCT) for the self-assembled RNAi-microsponge used in
accordance with certain embodiments of the present invention. To
perform RCT, circular DNA needs to be synthesized first. Linear
ssDNA that includes antisense and sense sequences of
anti-luciferase siRNA is hybridized with equal molar of short DNA
strand containing T7 promoter sequence. The nick in the circular
DNA was chemically closed by T4 DNA ligase. By RCT of the closed
circular DNA, multiple tandem repeats of hairpin RNA structures
from both antisense and sense sequences are generated to be able to
form spherical sponge-like structure.
[0023] FIG. 2. Characterization of the RNAi-microsponge. a, SEM
image of RNAi-microsponge. Scale bar: 5 .mu.m. b, Fluorescence
microscope image of RNAi-microsponges after staining with SYBR II,
RNA specific dye. Scale bars: 10 .mu.m and 5 .mu.m (Inset). c, d,
SEM images of RNAi-microsponges after sonication. Low magnification
image of RNAi-microsponges (c). Scale bars: 10 .mu.m and 500 nm
(Inset). High magnification image of RNAi-microsponge (d). Scale
bar: 500 nm.
[0024] FIG. 3. Formation of sponge-like spherical structures purely
with RNA strands. a, b, c, d, and e. SEM images of RNA products of
time-dependent RCT at 37.degree. C. for 1 h (a), 4 h (b), 8 h (c),
12 h (d), and 16 h (e). Scale bars: 5 .mu.m and 500 nm (inset). f,
Image of mature RNAi microsponges after 20 h RCT. Scale bar: 10
.mu.m. g, Schematic illustration of the formation of
RNAi-microsponges. The spherical sponge-like structure is formed
through a series of preliminary structures. A tandem copy of RNA
strands from the RCT reaction are entangled and twisted into a
fiber-like structure1. As the RNA strands grow, they begin to
organize into lamellar sheets that gradually become thicker2; as
the internal structure of the sheets begin to get very dense, some
of the RNA sheets begin to grow in the Z direction, possibly due to
limited packing area for the RNA polymer as it is produced by the
reaction. This process could generate wrinkled semi-spherical
structure on the sheet3. Finally, the entire structure begins to
pinch off to form individual particles consisting of gathered RNA
sheets4. h, Polarized optical microscopy of RNAi-microsponge. Scale
bars: 5 .mu.m and 1 .mu.m (Inset). i, X-ray diffraction pattern of
RNAi-microsponge. j, TEM images of RNAi-microsponge and schematic
representation of the proposed crystal-like ordered structure of
RNA sheet in microsponge. Scale bars: 100 nm and 500 nm
(Inset).
[0025] FIG. 4. Generating siRNA from RNAi-microsponge by RNAi
pathway and condensing RNAi-microsponge for transfection. a,
Schematic illustration of generating siRNA from RNAi-microsponges
by Dicer in RNAi pathway. b, Gel electrophoresis result after Dicer
reaction. Lane 1 and 2 indicate double stranded RNA ladder and
RNAi-microsponges (MS) after treatment with Dicer (1 unit) for 36
hours, respectively (Left). Land 1 and 2 indicate double stranded
RNA ladder and RNAi-microsponges without Dicer treatment (Right).
Lane 3 to 8 correspond to 12 h, 24 h, 36 h, and 48 h reaction with
1 unit of Dicer and 36 h reaction with 1.25 and 1.5 unit of Dicer,
respectively. Increasing the amount of Dicer did not help to
generate more siRNA (lane 7 and 8 of FIG. 4b, right). The amount of
generated siRNA from RNAi-microsponges was quantified relative to
double-stranded RNA standards. 21% of the cleavable double stranded
RNA was actually diced to siRNA because Dicer also produced the two
or three repeat RNA units that included two or three non-diced RNA
duplex. The results suggest the possibility that in a more
close-packed self-assembled structure, some portion of the RNA is
not as readily accessed by dicer. c, Particle size and zeta
potential before and after condensing RNAi-microsponge with PEI. d,
SEM image of further condensed RNAi-microsponge with PEI. Scale
bar: 500 nm. The size of RNAi-microsponge was significantly reduced
by linear PEI because the RNAi-microsponge with high charge density
would be more readily complexed with oppositely charged
polycations. The porous structure of RNAi-microsponge was
disappeared by the condensation.
[0026] FIG. 5. Transfection and gene-silencing effect. a,
Intracellular uptake of red fluorescent dye-labeled
RNAi-microsponge without PEI (top) and RNAi-microsponge/PEI
(bottom). To confirm the cellular transfection of RNA particles,
red fluorescence labeled both particles were incubated with T22
cells. Fluorescence labeled RNAi-microsponge without PEI outer
layer showed relatively less cellular uptake by the cancer cell
line, T22 cells, suggesting that the larger size and strong net
negative surface charge of RNAi-microsponge likely prevents
cellular internalization. b, Suppression of luciferase expression
by siRNA, Lipofectamine complexed with siRNA (siRNA/Lipo), siRNA
complex with PEI (siRNA/PEI), RNAi-microsponge, and
RNAi-microsponge condensed by PEI (RNAi-MS/PEI). The values outside
parentheses indicate the concentration of siRNA and siRNA for
siRNA/Lipo and siRNA/PEI. The values within parentheses indicate
the concentration of RNAi-microsponge and RNAi-microsponge for
RNAi-MS/PEI. The same amount of siRNA is theoretically produced
from RNAi-microsponges at the concentration in parentheses. c, In
vivo knockdown of firefly luciferase by RNAi-MS/PEI. Optical images
of tumours after intratumoral injection of RNAi-MS/PEI into the
left tumor of mouse and PEI solution only as a control into the
right tumor of same mouse.
[0027] FIG. 6. Secondary structure of eight repeated units produced
by RCT (using M-fold software).
[0028] FIG. 7. Confocal image of RNAi-microsponges labeled with
Cyanine 5-dUTPs. RNAi polymerization took place with rolling circle
transcription in the presence of Cyanine 5-dUTPs used as one of the
ribonucleotides to form the RNA-microsponge. The red fluorescence
from the RNAi-microsponge confirms that the microsponge is formed
of RNA.
[0029] FIG. 8. SEM images of RNAi-microsponges after incubation
with various concentrations of RNase (RNase I for single stranded
RNA and RNase III for double stranded RNA, NEB, Ipswich, Mass.).
The degradation of RNA microsponge at different concentrations of
RNase suggests that our microsponge is made of RNA. At lower
concentrations, the size of microsponges is decreased but still
protected from RNase. As the concentration increase, the
microsponges is not able to maintain the particle form by
degradation. Finally, RNA fragments of the microsponges are
completely disappeared at the higher concentration of RNase.
However, RNA microsponge is intact after incubation with high
concentration of DNase I, suggesting that circular DNA is not the
building material for microsponges. Scale bars indicate 1
.mu.m.
[0030] FIG. 9. Cartoon schematic image of the formation of
RNAi-microsponges (Top). Scanning electron microscope images of
preliminary structure of RNAi-microsponges after 12 h rolling
circle transcription (Bottom). Scale bars indicate 5 .mu.m and 1
.mu.m.
[0031] FIG. 10. Transmission electron microscope image of RNAi
microsponge. Multi-layered RNA sheets are shown in high
magnification image. Scale bar indicates 50 nm.
[0032] FIG. 11. Polarized optical microscopy images of RNAi-MS with
heating stage.
[0033] FIG. 12. Scanning electron microscope images of RNA products
by rolling circle transcription with different concentrations of
circular DNA from 100 nM (A), 30 nM(B), 10 nM(C), and 3 nM(D). With
100 nM of circular DNA, sponge-like structures from RNA products
are shown, however, microsponges are not generated with 30 nM, 10
nM, and 3 nM of circular DNA. In figure B-D, RNA products form
fiber-like structures that are similar to the products of
time-dependent experiment after 1 hour RCT (see FIG. 2A in main
text). According to results from time dependent and concentration
dependent experiments, we hypothesize that the mechanism of
formation of RNAi-microsponge is crystallization of RNA polymers
into thin lamellae by nucleation of poly-RNA when its concentration
is higher than a critical concentration beyond which individual
crystalline forms aggregate and merge into superstructures.
Therefore, the final structure is reminiscent of the lamellar
spherulite structures that are formed by highly crystalline
polymers [Formation of Spherulites in Polyethylene. Nature 194,
542-& (1962)].
[0034] FIG. 13. Distribution of the particle size of
RNAi-microsponge/PEI.
[0035] FIG. 14. In vitro knockdown of luciferase by naked siRNA,
siRNA/Lipo [siRNA/Lipofectamine (commercially available gene
delivery reagent) complexes], siRNA/PEI, RNAi-MS, RNAi-MS/PEI,
control-MS (RNA microsponge without meaningful sequence),
control-MS/PEI, and untreated cell. The results show that any
significant decrease of luciferase expression is not observed by
control-MS and control-MS/PEI, supporting that there is no
non-specific gene regulation in our experiments.
[0036] FIG. 15. In vivo knockdown of firefly luciferase by
RNAi-MS/PEI. Optical images of tumours after intratumoral injection
of RNAi-MS/PEI into the tumor of mouse with six different
wavelength.
[0037] FIG. 16. In vivo knockdown of firefly luciferase by control
RNA microsponge/PEI. Optical images of tumours after intratumoral
injection of control RNA microsponge/PEI into the tumor of mouse.
Here, control RNA microsponge dose not contain siRNA for
luciferase. A significant decrease of expression is not
observed.
[0038] FIG. 17. Cell viability assay of RNAi-microsponges.
[0039] FIG. 18. Fluorescence microscopic images of RNAi-microsponge
before (left) after incubating in 10% Serum for one day at
37.degree. C. (right). Scale bar indicates 10 .mu.m. The size of
the RNAi-microsponge is reduced, possibly by degradation of RNAse,
but still maintain the particle structure, supporting the idea that
the RNA in the RNAi-microsponges are protected from degradation
within the sponge structure.
[0040] FIG. 19. Schematic illustration of multiple components RNAi
microsponges in accordance with certain embodiments of the present
invention.
[0041] FIG. 20. Characterization of multiple components RNAi
microsponges.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0042] The present invention, among other things, describes
compositions of nucleic acid particles and methods and uses
thereof.
Particles
[0043] Particles used in accordance with various embodiments of the
present disclosure can contain a particle core, which can
optionally be coated by a film. Upon coating, a particle can be
converted from a first configuration to a second configuration.
[0044] In some embodiments, the greatest dimension of a particle
(in its first or second configuration) may be greater or less than
5 .mu.m, 2 .mu.m, 1 .mu.m, 800 nm, 500 nm, 200 nm, 100 nm, 90 nm,
80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm, 10 nm, or even 5
nm. In some embodiments, the greatest dimension a particle (in its
first or second configuration) may be in a range of any two values
above. In some embodiments, a particle in a first configuration has
the greatest dimension in a range of about 5 .mu.m to about 2 .mu.m
or about 2 .mu.m to about 1 .mu.m. In some embodiments, a particle
in a second configuration has the greatest dimension in may be in a
range of about 500 nm to about 200 nm, about 200 nm to about 100 nm
or about 100 nm to about 50 nm. In some embodiments, a particle can
be substantially spherical. In some embodiments, the dimension of a
particle is a diameter, wherein the diameter can be in a range as
mentioned above.
[0045] In various embodiments, a particle described herein can
comprise a particle core, a coating film (including one or more
layers; in some embodiments one or more polyelectrolyte layers),
and one or more agents such as diagnostic, therapeutic and/or
targeting agents.
Nucleic Acid-Containing Core
[0046] A particle core can consist of or include one or more
nucleic acid molecules. In some embodiments, a core is comprised of
a plurality of nucleic acid molecules. Individual nucleic acid
molecules within a core can have different nucleic acid sequences
or substantially the same nucleic acid sequence. In some
embodiments, nucleic acid molecule(s) within a core have sequences
that share at least one common sequence element.
[0047] In some embodiments, at least one nucleic acid molecule in a
core has a nucleotide sequence that comprises multiple copies of at
least a first sequence element. In some embodiments, at least one
nucleic acid molecule in a core has a nucleotide sequence that
comprises multiple copies of each of at least a first and a second
sequence element. In some embodiments, at least one nucleic acid
molecule has a nucleotide sequence that comprises alternating
copies of the first and second sequence elements. In some
embodiments, at least one nucleic acid molecule has a nucleotide
sequence that comprises multiple copies of each of three or more
sequence elements.
[0048] In some embodiments, at least one nucleic acid molecule has
a nucleotide sequence that includes one or more sequence elements
found in a natural source. In some embodiments, at least one
nucleic acid molecule has a nucleotide sequence that includes a
first sequence element that is found in a first natural source and
a second sequence element that is found in a second natural source.
The first and second natural sources can be the same or
difference.
[0049] In some embodiments, at least one nucleic acid molecule has
a nucleotide sequence that represents an assemblage of sequence
elements found in one or more source nucleic acid molecules. In
some embodiments, at least one nucleic acid molecule has a
nucleotide sequence that represents an assemblage of at least two
different sequence elements found in two different source nucleic
acid molecules.
[0050] In some embodiments, nucleic acid molecule(s) within a core
have nucleotide sequences that fold into higher order structures
(e.g., double and/or triple-stranded structures). In some
embodiments, nucleic acid molecule(s) within a core have nucleotide
sequences that comprise two or more complementary elements. In some
embodiments, such complementary elements can form one or more
(optionally alternative) stem-loop (e.g., hairpin) structures. In
some embodiments, nucleic acid molecule(s) within a core have
nucleotide sequences that include one or more portions that remain
single stranded (i.e., do not pair intra- or inter-molecularly with
other core nucleic acid sequence elements).
[0051] In some embodiments, at least one nucleic acid molecules in
a core contains at least one cleavage site. In some embodiments, a
cleavage site is a bond or location susceptible to cleavage by a
cleaving agent such as a chemical, an enzyme (e.g., nuclease,
dicer, DNAase and RNAase), radiation, temperature, etc. In some
embodiments, the cleaving agent is a sequence specific cleaving
agent in that it selectively cleaves nucleic acid molecules at a
particular site or sequence.
[0052] In some embodiments, at least one nucleic acid molecules in
a core contains at least one cleavage site susceptible to cleavage
after delivery or localization of a particle as described herein to
a target site of interest. In some embodiment, nucleic acid
molecule(s) in a core have a plurality of cleavage sites and/or are
otherwise arranged and constructed so that multiple copies of a
particular nucleic acid of interest are released at the target
site, upon delivery of a particle as described herein.
[0053] In some embodiments, nucleic acid molecule(s) within a core
have a self-assembled structure and/or are characterized by an
ability to self-assemble in that it/they fold(s) into a stable
three-dimensional structure, typically including one or more
non-covalent interactions that occur between or among different
moieties within the nucleic acid, without requiring assistance of
non-nucleic acid entities. In some embodiments, nucleic acid
molecule(s) within a core are arranged in a crystalline structure
comprising lamellar sheets. In some embodiments, a core comprises
or consists of one or more entangled nucleic acid molecules.
[0054] In some embodiments, nucleic acid molecule(s) in a core have
a molecular weight greater than about 1.times.10.sup.10 g/mol,
about 1.times.10.sup.9 g/mol, about 1.times.10.sup.8 g/mol, about
1.times.10.sup.7 g/mol, about 1.times.10.sup.6 g/mol, or about
1.times.10.sup.5 g/mol.
[0055] As described herein, in some embodiments, nucleic acid
molecule(s) in a core includes multiple copies of at least one
sequence element (e.g., concatenated in one or more long nucleic
acid molecules whose sequence comprises or consists of multiple
copies of the sequence element, and/or as discrete nucleic acid
molecules each of which has a sequence that comprises or consists
of the element, or a combination of both) whose length is within
the range between a lower length of at least 5, 10, 15, 20, 25, 30,
35, 40, 45, or more and an upper length of not more than 10000,
9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000, 1000, 900, 800,
700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30 or
less, wherein the upper length is greater than the lower
length.
[0056] Particles described herein are characterized by a high
loading of nucleic acids. In some embodiments, a particle core
comprises at least about 1.times.10.sup.3, about 1.times.10.sup.4,
about 1.times.10.sup.5, about 1.times.10.sup.6, about
1.times.10.sup.7, about 1.times.10.sup.8, about 1.times.10.sup.9,
or about 1.times.10.sup.10 copies of a particular sequence element
of interests. In some embodiments, a particle core comprises copies
of a particular sequence element of interests in a range of about
1.times.10.sup.3 to about 1.times.10.sup.4, about 1.times.10.sup.4
to about 1.times.10.sup.5, about 1.times.10.sup.5 to about
1.times.10.sup.6, about 1.times.10.sup.6 to about 1.times.10.sup.7,
about 1.times.10.sup.7 to about 11.times.10.sup.8, about
11.times.10.sup.8 to about 11.times.10.sup.9, or about
11.times.10.sup.9 to about 11.times.10.sup.10. In some embodiments,
a particle core comprises copies of a particular sequence element
of interests in a range of about 1.times.10.sup.3 to about
1.times.10.sup.10, about 1.times.10.sup.4 to about 1.times.10.sup.8
or about 1.times.10.sup.5 to about 1.times.10.sup.7. In some
embodiments, a particle core comprises copies of a particular
sequence element of interests in a range of any two values
above.
[0057] Nucleic acid molecules can carry positive or negative
charges. Alternatively, they can be neutral. In some embodiments, a
nucleic acid-containing particle core may have a positive or
negative surface charge.
[0058] In some embodiments, nucleic acid molecules for use in a
nucleic acid core as described herein comprise or consist of
deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide
nucleic acid (PNA), morpholino and locked nucleic acid (LNA),
glycol nucleic acid (GNA) and/or threose nucleic acid (TNA).
[0059] In some embodiments, utilized nucleic acid molecules
comprise or consist of one or more oliogonucleotides (ODN), DNA
aptamers, DNAzymes, siRNAs, shRNAs, RNA aptamers RNAzymes, miRNAs
or combination thereof.
[0060] In some embodiments, nucleic acid molecules for use in
accordance with the present invention have nucleotide sequence(s)
that include(s) one or more coding sequences; one or more
non-coding sequences, and/or combinations thereof.
[0061] In some embodiments, a coding sequence includes a gene
sequence encoding a protein. Exemplary proteins include, but are
not limited to brain derived neurotrophic factor (BDNF), glial
derived neurotrophic factor (GDNF), neurotrophic factor 3 (NT3),
fibroblast growth factor (FGF), transforming growth factor (TGF),
platelet transforming growth factor, milk growth factor,
endothelial growth factors (EGF), endothelial cell-derived growth
factors (ECDGF), alpha-endothelial growth factors, beta-endothelial
growth factor, neurotrophic growth factor, nerve growth factor
(NGF), vascular endothelial growth factor (VEGF), 4-1 BB receptor
(4-1BBR), TRAIL (TNF-related apoptosis inducing ligand), artemin
(GFRalpha3-RET ligand), BCA-1 (B cell-attracting chemokinel), B
lymphocyte chemoattractant (BLC), B cell maturation protein (BCMA),
brain-derived neurotrophic factor (BDNF), bone growth factor such
as osteoprotegerin (OPG), bone-derived growth factor, megakaryocyte
derived growth factor (MGDF), keratinocyte growth factor (KGF),
thrombopoietin, platelet-derived growth factor (PGDF),
megakaryocyte derived growth factor (MGDF), keratinocyte growth
factor (KGF), platelet-derived growth factor (PGDF), bone
morphogenetic protein 2 (BMP2), BRAK, C-10, Cardiotrophin 1 (CT1),
other chemokines, interleukins and combinations thereof.
Coating Films
[0062] Particles provided by the present invention may include a
coating film on a nucleic acid-containing core. In some
embodiments, a film substantially covers at least one surface of a
particle core. In some embodiments, a film substantially
encapsulates a core.
[0063] A film can have an average thickness in various ranges. In
some embodiments, an averaged thickness is about or less than 200
nm, 100 nm, 50 nm, 40 nm, 30 nm, 20 nm, 15 nm, 10 nm, 5 nm, 1 nm,
0.5 nm, or 0.1 nm. In some embodiments, an averaged thickness is in
a range from about 0.1 nm to about 100 nm, about 0.5 nm to about 50
nm, or about 5 nm to about 20 nm. In some embodiments, an averaged
thickness is in a range of any two values above.
[0064] In some embodiments, a coating film include one or more
layers. A plurality of layers each can respectively contain one or
more materials. According to various embodiments of the present
disclosure, a layer can consist of or comprise metal (e.g., gold,
silver, and the like), semi-metal or non-metal, and
metal/semi-metal/non-metal oxides such as silica (SiO.sub.2). In
certain embodiments, a layer can consist of or comprise a magnetic
material (e.g., iron oxide).
[0065] Additionally or alternatively, materials of a layer can be
polymers. For example, a layer can be polyethyleneimine as
demonstrated in Example 1. In some embodiments, a layer is or
includes one or more polymers, particularly polymers that which
have been approved for use in humans by the U.S. Food and Drug
Administration (FDA) under 21 C.F.R. .sctn.177.2600, including, but
not limited to, polyesters (e.g. polylactic acid,
poly(lactic-co-glycolic acid), polycaprolactone, polyvalerolactone,
poly(1,3-dioxan-2-one)); polyanhydrides (e.g. poly(sebacic
anhydride)); polyethers (e.g., polyethylene glycol); polyurethanes;
polymethacrylates; polyacrylates; polycyanoacrylates; copolymers of
PEG and poly(ethylene oxide) (PEO). In some embodiments, a polymer
is a lipid.
[0066] In some embodiments, a layer is or includes at least a
degradable material. Such a degradable material can be
hydrolytically degradable, biodegradable, thermally degradable,
enzymatically degradable, and/or photolytically degradable
polyelectrolytes. In some embodiments, degradation may enable
release of one or more agents associated with a particle described
herein.
[0067] Degradable polymers known in the art, include, for example,
certain polyesters, polyanhydrides, polyorthoesters,
polyphosphazenes, polyphosphoesters, certain polyhydroxyacids,
polypropylfumerates, polycaprolactones, polyamides, poly(amino
acids), polyacetals, polyethers, biodegradable polycyanoacrylates,
biodegradable polyurethanes and polysaccharides. For example,
specific biodegradable polymers that may be used include but are
not limited to polylysine (e.g., poly(L-lysine) (PLL)), poly(lactic
acid) (PLA), poly(glycolic acid) (PGA), poly(caprolactone) (PCL),
poly(lactide-co-glycolide) (PLG), poly(lactide-co-caprolactone)
(PLC), and poly(glycolide-co-caprolactone) (PGC). Another exemplary
degradable polymer is poly(beta-amino esters), which may be
suitable for use in accordance with the present application.
[0068] In some embodiments, layer-by-layer (LBL) films can be used
alternatively or in addition to other layers to coat a particle
core in accordance with the present invention. A LBL film may have
any of a variety of film architectures (e.g., numbers of layers,
thickness of individual layers, identity of materials within films,
nature of surface chemistry, presence and/or degree of incorporated
materials, etc), as appropriate to the design and application of a
coated particle core as described herein. In certain embodiments, a
LBL film may has a single layer.
[0069] LBL films may be comprised of multilayer units in which
alternating layers have opposite charges, such as alternating
anionic and cationic layers. Alternatively or additionally, LBL
films for use in accordance with the present invention may be
comprised of (or include one or more) multilayer units in which
adjacent layers are associated via other non-covalent interactions.
Exemplary non-covalent interactions include, but are not limited to
ionic interactions, hydrogen bonding interactions, affinity
interactions, metal coordination, physical adsorption, host-guest
interactions, hydrophobic interactions, pi stacking interactions,
van der Waals interactions, magnetic interactions, dipole-dipole
interactions and combinations thereof. Detailed description of LBL
films can be found in U.S. Pat. No. 7,112,361, the contents of
which are incorporated herein by reference. Features of the
compositions and methods described in the patent may be applied in
various combinations in the embodiments described herein.
[0070] In some embodiments, a layer can have or be modified to have
one or more functional groups. Apart from changing the surface
charge by introducing or modifying surface functionality,
functional groups (within or on the surface of a layer) can be used
for association with any agents (e.g., detectable agents, targeting
agents, or PEG).
Agents
[0071] In some embodiments, the present invention provides
compositions that comprise one or more agents. In some embodiments,
one or more agents are associated independently with a core, a film
coating the core, or both. For example, agents can be covalently
linked to or hybridized to a nucleic acid-containing core, and/or
encapsulated in a coating film of a particle described herein. In
certain embodiments, an agent can be associated with one or more
individual layers of an LBL film that is coated on a core,
affording the opportunity for exquisite control of loading and/or
release from the film.
[0072] In theory, any agents including, for example, therapeutic
agents (e.g. antibiotics, NSAIDs, glaucoma medications,
angiogenesis inhibitors, neuroprotective agents), cytotoxic agents,
diagnostic agents (e.g. contrast agents; radionuclides; and
fluorescent, luminescent, and magnetic moieties), prophylactic
agents (e.g. vaccines), and/or nutraceutical agents (e.g. vitamins,
minerals, etc.) may be associated with the LBL film disclosed
herein to be released.
[0073] In some embodiments, compositions described herein include
one or more therapeutic agents. Exemplary agents include, but are
not limited to, small molecules (e.g. cytotoxic agents), nucleic
acids (e.g., siRNA, RNAi, and microRNA agents), proteins (e.g.
antibodies), peptides, lipids, carbohydrates, hormones, metals,
radioactive elements and compounds, drugs, vaccines, immunological
agents, etc., and/or combinations thereof. In some embodiments, a
therapeutic agent to be delivered is an agent useful in combating
inflammation and/or infection.
[0074] In some embodiments, a therapeutic agent is or comprises a
small molecule and/or organic compound with pharmaceutical
activity. In some embodiments, a therapeutic agent is a
clinically-used drug. In some embodiments, a therapeutic agent is
or comprises an antibiotic, anti-viral agent, anesthetic,
anticoagulant, anti-cancer agent, inhibitor of an enzyme, steroidal
agent, anti-inflammatory agent, anti-neoplastic agent, antigen,
vaccine, antibody, decongestant, antihypertensive, sedative, birth
control agent, progestational agent, anti-cholinergic, analgesic,
anti-depressant, anti-psychotic, .beta.-adrenergic blocking agent,
diuretic, cardiovascular active agent, vasoactive agent,
anti-glaucoma agent, neuroprotectant, angiogenesis inhibitor,
etc.
[0075] In some embodiments, a therapeutic agent may be a mixture of
pharmaceutically active agents. For example, a local anesthetic may
be delivered in combination with an anti-inflammatory agent such as
a steroid. Local anesthetics may also be administered with
vasoactive agents such as epinephrine. To give but another example,
an antibiotic may be combined with an inhibitor of the enzyme
commonly produced by bacteria to inactivate the antibiotic (e.g.,
penicillin and clavulanic acid).
[0076] In some embodiments, a therapeutic agent may be an
antibiotic. Exemplary antibiotics include, but are not limited to,
.beta.-lactam antibiotics, macrolides, monobactams, rifamycins,
tetracyclines, chloramphenicol, clindamycin, lincomycin, fusidic
acid, novobiocin, fosfomycin, fusidate sodium, capreomycin,
colistimethate, gramicidin, minocycline, doxycycline, bacitracin,
erythromycin, nalidixic acid, vancomycin, and trimethoprim. For
example, .beta.-lactam antibiotics can be ampicillin, aziocillin,
aztreonam, carbenicillin, cefoperazone, ceftriaxone, cephaloridine,
cephalothin, cloxacillin, moxalactam, penicillin G, piperacillin,
ticarcillin and any combination thereof.
[0077] An antibiotic used in accordance with the present disclosure
may be bacteriocidial or bacteriostatic. Other anti-microbial
agents may also be used in accordance with the present disclosure.
For example, anti-viral agents, anti-protazoal agents,
anti-parasitic agents, etc. may be of use.
[0078] In some embodiments, a therapeutic agent may be or comprise
an anti-inflammatory agent. Anti-inflammatory agents may include
corticosteroids (e.g., glucocorticoids), cycloplegics,
non-steroidal anti-inflammatory drugs (NSAIDs), immune selective
anti-inflammatory derivatives (ImSAIDs), and any combination
thereof. Exemplary NSAIDs include, but not limited to, celecoxib
(Celebrex.RTM.); rofecoxib (Vioxx.RTM.), etoricoxib (Arcoxia.RTM.),
meloxicam (Mobic.RTM.), valdecoxib, diclofenac (Voltaren.RTM.,
Cataflam.RTM.), etodolac (Lodine.RTM.), sulindac (Clinori.RTM.),
aspirin, alclofenac, fenclofenac, diflunisal (Dolobid.RTM.),
benorylate, fosfosal, salicylic acid including acetylsalicylic
acid, sodium acetylsalicylic acid, calcium acetylsalicylic acid,
and sodium salicylate; ibuprofen (Motrin), ketoprofen, carprofen,
fenbufen, flurbiprofen, oxaprozin, suprofen, triaprofenic acid,
fenoprofen, indoprofen, piroprofen, flufenamic, mefenamic,
meclofenamic, niflumic, salsalate, rolmerin, fentiazac, tilomisole,
oxyphenbutazone, phenylbutazone, apazone, feprazone, sudoxicam,
isoxicam, tenoxicam, piroxicam (Feldene.RTM.), indomethacin
(Indocin.RTM.), nabumetone (Relafen.RTM.), naproxen
(Naprosyn.RTM.), tolmetin, lumiracoxib, parecoxib, licofelone
(ML3000), including pharmaceutically acceptable salts, isomers,
enantiomers, derivatives, prodrugs, crystal polymorphs, amorphous
modifications, co-crystals and combinations thereof.
[0079] Those skilled in the art will recognize that this is an
exemplary, not comprehensive, list of agents that can be released
using compositions and methods in accordance with the present
disclosure. In addition to a therapeutic agent or alternatively,
various other agents may be associated with a coated device in
accordance with the present disclosure.
Methods and Uses
[0080] The present invention among other things provide methods of
making and using particles described herein. In some embodiments,
nucleic acid molecules as described may self-assemble into a core.
Optionally, such a core can be coated with a film, wherein the core
is characterized by being converted from a first configuration to a
second configuration upon coating.
[0081] Those of ordinary skill in the art will appreciate that
nucleic acid molecules for use in particle cores in accordance with
the present invention may be prepared by any available technology.
In some aspects, the present invention encompasses the recognition
that rolling circle amplification (RCA) and/or rolling circle
transcription (RCT) can be a particularly useful methodology for
production of nucleic acid molecules for use herein. Exemplary RCA
strategies include, for example, single-primer initiated RCA and by
various two-primer amplification methods such as ramification
amplification (RAM), hyperbranched RCA, cascade RCA, and
exponential RCA. In certain embodiments, RNA-containing molecules
can be produced via rolling circle transcription (RCT).
[0082] The present invention specifically encompasses the
recognition that RCA/RCT may be particularly useful for production
of long nucleic acid molecules, and/or furthermore may generate
nucleic acid molecules. Those skilled in the art will appreciate
that a nucleic acid molecule produced by RCA/RCT will typically
have a nucleotide sequence comprising or consisting of multiple
copies of the complement of the circular template being
amplified.
[0083] In some embodiments, a template used for RCA/RCT as
described herein is or comprises deoxyribonucleic acid (DNA),
ribonucleic acid (RNA), peptide nucleic acid (PNA), morpholino and
locked nucleic acid (LNA), glycol nucleic acid (GNA) and/or threose
nucleic acid (TNA).
[0084] In some embodiments, a template used for RCA/RCT as
described herein has a nucleotide sequence that includes one or
more coding sequences, one or more non-coding sequences, and/or
combinations thereof.
[0085] In some particular embodiments of RCA/RCT contemplated
herein, a polymerase selected from the group consisting of .PHI.29
DNA polymerase and T7 is utilized to perform the RCA/RCT (see, for
example, Example 1).
[0086] More details of RCA can be found in US Patent Application
No. 2010/0189794, the contents of which are incorporated herein by
reference. Features of the compositions and methods described in
the application may be applied in various combinations in the
embodiments described herein. In some embodiments, a first
single-stranded nucleic acid molecule is formed by RCA. In some
embodiments, the first single-stranded nucleic acid molecule is
formed with the aid of a first primer and a nucleic acid
polymerase. In some embodiments, a second single-stranded nucleic
acid molecule is formed by amplifying the first single-stranded
nucleic acid with the aid of a second primer and a polymerase. In
some embodiments, a third single-stranded nucleic acid molecule is
formed by amplifying the second single-stranded nucleic acid
molecule with the aid of a third primer and a polymerase.
[0087] A RCA can be repeated with as many primers as desired, e.g.,
4, 5, 6, 7, 8, 9, 10 or more primers can be used. In some
embodiments, a plurality of primers can be added to templates to
form nucleic acid molecules, wherein the plurality can comprise at
least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 primers. In some
embodiments, more than 100 primers are used. In some embodiments,
random fragments of short nucleic acid fragments, e.g., comprising
digested or otherwise degraded DNAs, are used as non-specific
primers to prime the formation of nucleic acid molecules using
rolling circle amplification. As described herein and will be
appreciated by those of skill in the art, polymerization reaction
conditions can be adjusted as desired to form nucleic acid
molecules and self-assembled particles. For example, reaction
conditions that favor stringent nucleic acid hybridization, e.g.,
high temperature, can be used to favor more specific primer binding
during amplification.
[0088] In some aspects, the present invention specifically
encompasses the recognition that LBL assembly may be particularly
useful for coating a particle core described herein. There are
several advantages to coat particle cores using LBL assembly
techniques including mild aqueous processing conditions (which may
allow preservation of biomolecule function); nanometer-scale
conformal coating of surfaces; and the flexibility to coat objects
of any size, shape or surface chemistry, leading to versatility in
design options. According to the present disclosure, one or more
LBL films can be assembled and/or deposited on a core to convert it
to a condensed configuration with a smaller size. In some
embodiments, a coated core having one or more agents for delivery
associated with the LBL film, such that decomposition of layers of
the LBL films results in release of the agents. In some
embodiments, assembly of an LBL film may involve one or a series of
dip coating steps in which a core is dipped in coating solutions.
Additionally or alternatively, it will be appreciated that film
assembly may also be achieved by spray coating, dip coating, brush
coating, roll coating, spin casting, or combinations of any of
these techniques.
[0089] In some embodiments, particles described herein including
nucleic acid-containing core can be subjected to a cleavage agent,
so that nucleic acid molecules are cleaved into multiple copies of
a particular nucleic acid of interest and such copies can be
released.
[0090] In some embodiments, at least one nucleic acid in a nucleic
acid core contains at least one cleavage site. In some embodiments,
a cleavage site is a bond or location susceptible to cleavage by a
cleaving agent such as a chemical, an enzyme, radiation,
temperature, etc. In some embodiments, the cleaving agent is a
sequence specific cleaving agent in that it selectively cleaves
nucleic acid molecules at a particular site or sequence.
[0091] In some embodiments, at least one nucleic acid in a nucleic
acid core contains at least one cleavage site susceptible to
cleavage after delivery or localization of a particle as described
herein to a target site of interest. In some embodiment, nucleic
acid(s) in a core have a plurality of cleavage sites and/or are
otherwise arranged and constructed so that multiple copies of a
particular nucleic acid of interest are released at the target
site, upon delivery of a particle as described herein.
[0092] In some embodiments, particles are provided with a nucleic
acid core that comprises one or more sequence elements that targets
a particular disease, disorder, or condition of interest (e.g.,
cancer, infection, etc). For example, provided particles and
methods can be useful for dysregulation of genes.
[0093] In some embodiments, particles are provided with a nucleic
acid core that comprises a plurality of different sequence
elements, for example targeting the same disease, disorder or
condition of interest. To give but one example, in some
embodiments, particles are provided with a nucleic acid core that
comprises a plurality of sequence elements, each of which targets a
different cancer pathway, for example, as an siRNA that inhibits
expression of a protein whose activity contributes to or supports
the pathway.
[0094] The present invention encompasses the recognition that
particles can be designed and/or prepared to simultaneously deliver
to a target site (e.g., to a cancer cell) a plurality of different
nucleic acid agents (e.g., siRNAs), each of which is directed to a
different specific molecular target of interest (e.g., an mRNA
encoding a cancer-related protein). The present invention further
encompasses the recognition that the described technology permits
facile and close control of relative amounts of such different
nucleic acid agents that are or can be delivered (e.g.,
substantially simultaneously) to the site. To give but one example,
RCA/RCT templates can be designed and/or assembled with desired
relative numbers of copies of different sequences of interest
(e.g., complementary to different siRNAs of interest), so as to
achieve precise control over the stoichiometry of delivered
siRNA(s). In some embodiments, such control achieves synergistic
effects (e.g., with respect to inhibiting tumor growth).
[0095] In some embodiments, provided particles are administered or
implanted using methods known in the art, including invasive,
surgical, minimally invasive and non-surgical procedures, depending
on the subject, target sites, and agent(s) to be delivered.
Particles described herein can be delivered to a cell, tissue,
organ of a subject. Examples of target sites include but are not
limited to the eye, pancreas, kidney, liver, stomach, muscle,
heart, lungs, lymphatic system, thyroid gland, pituitary gland,
ovaries, prostate, skin, endocrine glands, ear, breast, urinary
tract, brain or any other site in a subject.
EXEMPLIFICATION
Example 1
[0096] In this Example, an impactful approach is demonstrated to
use the DNA/RNA machinery provided by nature to generate RNAi in
polymeric form, and in a manner that actually assembles into its
own compact delivery cargo system. Thus, the RNAi is generated in
stable form with multiple copy numbers at low cost, and distributed
in a form that can readily be adapted for systemic or targeted
delivery.
[0097] In Vitro Rolling Circle Transcription by T7 RNA Polymerase
to Create RNA Microsponges
[0098] Ligased circular DNA templates (0.3 .mu.M) were incubated
with T7 RNA polymerase (5 units/.mu.L) at 37.degree. C. for 20
hours in the reaction buffer (8 mM Tris-HCl, 0.4 mM spermidine, 1.2
mM MgCl.sub.2, and 2 mM dithiothreitol) including 2 mM rNTP in
final concentration. For fluorescently labeling RNA particle,
Cyanine 5-dUTP (0.5 mM) was added. The resultant solution was
pipetted several times and then sonicated for 5 min to break
possible connection of the particles. The solution was centrifuged
at 6000 rpm for 6 min to remove the supernatant. Then, RNase free
water was added to wash the particles. The solution was sonicated
again for 1 min then centrifuged. Repeat this washing step 3 more
times to remove the reagents of RCT. Measurement of RNA microsponge
concentration was conducted by measuring fluorescence using
Quant-iT RNA BR assay kits (Invitrogen). 10 .mu.l of RNA
microsponge solution or standard solution was incubated with 190
.mu.l of working solution for 10 min at room temperature. The
fluorescence was measured at 630/660 nm by Fluorolog-3
spectrofluorometer (Horiba Jobin Yvon).
[0099] Treatment of RNAi Microsponges with Recombinant Dicer
[0100] RNAi microsponges were digested with from 1 unit to 1.5 unit
recombinant Dicer (Genlantis, San Diego, Calif.) in 12 .mu.l of
reaction solution (1 mM ATP, 5 mM MgCl2, 40% (v/v) Dicer reaction
buffer). The samples treated for different reaction time from 12 h
to 48 h were collected and were then inhibited by adding Dicer stop
solution (Genlantis, San Diego, Calif.).
[0101] Degradation Experiments of RNAi Microsponges
[0102] RNA microsponges were incubated for 24 hrs in 10% of serum
at 37.degree. C. Degradation experiments with various
concentrations of RNase were also performed for 24 hrs at
37.degree. C. (NEB, Ipswich, Mass.).
[0103] Characterization of RNAi Microsponges
[0104] JEOL JSM-6060 and JSM-6070 scanning electron microscopes
were used to obtain high resolution digital images of the RNA
microsponges. The sample was coated with Au/Pd. JEOL 2000FX
transmission electron microscope was used to obtain the internal
structure of the RNA particle. Zeiss AxioSkop 2 MAT fluorescent
microscope was used to image green fluorescently stained RNA
microsponges by SYBR II. For characterization of crystalline
structure of RNA microsponge, laboratory X-ray powder diffraction
(XRD) patterns were recorded using a PANalytical X'Pert Pro
diffractometer, fitted with a solid state X'Celerator detector. The
diffractometer uses Cu K.alpha. radiation
(.lamda.(K.alpha..sub.1)=1.5406 .ANG.,
.lamda.(K.alpha..sub.2)=1.5433 .ANG., weighted average
.lamda.=1.5418 .ANG.) and operates in Bragg geometry. The data were
collected from 5.degree. to 40.degree. at a scan rate of
0.1.degree./min.
[0105] Assembly of PEI Layer on RNAi Microsponges
[0106] For assembly of outer layer, RNA microsponges were mixed
with PEI solution, used at a final concentration of up to 5.0
mg/ml. Free PEI was easily removed by centrifugation at 13,700 rpm
for 30 min. Repeat this step 2 more times. The PEI layered RNA
particles were resuspended in PBS solution (pH 7.4) or MilliQ
water.
[0107] In Vitro siRNA Knockdown Experiments
[0108] T22 cells were maintained in growth media comprised of
Minimum Essential Media-Alpha Modification (MEM) supplemented with
10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin. 3 days
prior to knockdown experiments, cells were seeded in 6-well plates
at 30,000 cells per well. 2 days prior to transfection, each well
was co-transfected with 3.5 g each of pRL-CMV and gWIZ-Luc using
Fugene-HD according the manufacturer's instructions. 1 day prior to
transfection, cells were trypsinized and re-seeded in 96-well
plates at an initial seeding density of 2000 cells/well. Cells were
allowed to attach and proliferate for 24 hours. All knockdown
experiments were performed in triplicate. 50 .mu.L of fluorescently
labeled RNAi-MS and RNAi-MS/PEI were added to 250 .mu.L phenol-free
Opti-MEM at the final concentration of up to 21.2 fM.
Lipofectamine/siRNA complexes were formed at a 4:1 ratio (v/w).
Growth media was removed and Opti-MEM was added to cells, followed
by RNAi-microsponges or complexes in PBS, for a total volume of 150
.mu.L per well, with no less than 100 .mu.L Opti-MEM per well.
Cells were incubated with siRNA constructs for 4 hours, after which
media was removed and replaced with 10% serum-containing growth
medium. A Luciferase assay was performed as using the Dual-Glo
Luciferase Assay Kit (Promega, Madison, Wis.) and measured on a
Perkin Elmer Plate 1420 Multilabel Counter plate reader. GFP
expression was measured after quenching of the luciferase signal
with the Stop-and-Glo reagent from Promega.
[0109] In Vivo siRNA Knockdown Experiments
[0110] T22-Luc is a genetically defined mouse ovarian cancer cell
line (p53-/-, Akt, myc) that stably expresses luciferase after
infection with pMSCV-puro-Firefly luciferase viral supernatant and
selecting the cells in a medium containing 2.0 g/ml of puromycin
for 1 week. T22-Luc tumors were induced on both hind flanks of
female nude mice (5 weeks old) with a single injection of 2-5
million cells in 0.1 mL media. After the tumors grew to .about.100
mm.sup.3 in volume, intratumoral injections of RNAi-microsponges
were given in volumes of 50 uL. To determine the degree of
luciferase knockdown, D-Luciferin (Xenogen) was given via
intraveneously (tail vein injection, 25 mg/kg) and bioluminescence
images were collected on a Xenogen IVIS Spectrum Imaging System
(Xenogen, Alameda, Calif.) 10 minutes after injection. Living Image
software Version 3.0 (Xenogen) was used to acquire and quantitate
the bioluminescence imaging data sets.
[0111] Chemicals and DNA Sequences:
[0112] T7 RNA polymerase and Ribonucleotide Solution Mix were
purchased from New England Biolabs (Beverly, Mass.) in pure form at
a concentration of 50,000 units/ml and 80 mM, respectively. RNase
Inhibitor (RNAsin Plus) was purchased from Promega (Madison, Wis.)
at a concentration of 40 units/.mu.l. Linear 25,000 g/mol (M.sub.W)
polyethyleneimine (PEI) was purchased from Polysciences Inc.
(Warrington, Pa.). Other chemical reagents were purchased from
Sigma Aldrich (St. Louis, Mo.). Oligonucleotides were commercially
synthesized and PAGE purified (Integrated DNA Technologies,
Coralville, Iowa). Sequences of the oligonucleotides are listed in
Table 1. siRNA for control experiments was purchased from Dharmacon
RNAi Technologies. Dual-Glo Luciferase Assay System was purchased
from Promega (Madison, Wis.). All other cell culture reagents were
purchased from Invitrogen. GFP- and Luciferase-expressing T22 cells
were a gift of the laboratory of Phil Sharp (MIT). Vivo Tag 645 and
Cyanine 5-dUTP was purchased from Visen/PerkinElmer.
TABLE-US-00001 TABLE 1 Oligonucleotide sequences of linear ssDNA
and T7 promoter. Strand Sequence Linear ssDNA ##STR00001## Promoter
##STR00002## ##STR00003##
[0113] Circularization of Linear DNA:
[0114] 0.5 .mu.M of phosphorylated linear ssDNA
(ATAGTGAGTCGTATTAACGTACCAACAACTTACGCTGAGTACTTCGATTACTTGAAT
CGAAGTACTCAGCGTAAGTTTAGAGGCATATCCCT) was hybridized with equimolar
amounts of short DNA strands containing the T7 promoter sequence
(TAATACGACTCACTATAGGGAT) by heating at 95.degree. C. for 2 min and
slowly cooling to 25.degree. C. over 1 hour. The circular DNA is
synthesized by hybridizing a 22 base T7 promoter with a 92 base
oligonucleotide which has one larger (16 bases) and one shorter (6
bases) complementary sequence to the T7 promoter (Table 1). The
nick in the circular DNA was chemically closed by T4 DNA ligase
(Promega, Madison, Wis.), following commercial protocol.
[0115] Gel Electrophoresis:
[0116] The resultant solution after dicer treatment of the RNA
microsponges was run in a 3% agarose ready gel (Bio-Rad) at 100 V
at 25.degree. C. in Tris-acetate-EDTA (TAE) buffer (40 mM Tris, 20
mM acetic acid and 1 mM EDTA, pH 8.0, Bio-Rad) for 90 min. The gel
was then stained with 0.5 mg/ml of ethidium bromide in TAE buffer.
The gel electrophoresis image was used to calculate the number of
siRNA from RNA particle. By comparing the band intensity of cleaved
21 bp RNA strands to standard RNA strands, the amount of siRNA,
which was converted from RNAi microsponges, was calculated (Table
2). Although up to 460 ng of siRNA can be theoretically obtained
from 1 .mu.g of RNAi microsponges, the particles were
experimentally converted to 94.5 ng of siRNA by Dicer treatment
under optimal conditions.
TABLE-US-00002 TABLE 2 Peak positions and d-spadings for
RNAi-microsponge Peak position, Spacing q[.ANG..sup.-1] d[.ANG.]
0.57 11.00 1.18 5.32 1.77 3.56 2.16 2.91 1.04 6.02 2.08 3.03
Spacing was determined by Bragg's Law.
d=n.lamda./2 sin .theta.
Also, the scattering vector q was determined from the following
equation.
q=4.pi. sin .theta./.lamda.
To determine the thickness of crystallite was determined from
Scherrer's Formula.
D=2.pi.K/.DELTA.q
Here, K=0.9 is the Scherrer constant, and .DELTA.q is the radial
full width at half maximum of a given Bragg spot. D is thickness of
crystallite. .lamda. is the wavelength of the x-ray radiation
(here, .lamda. is 1.54).
TABLE-US-00003 Thickness of FWHM, .DELTA.q[.ANG..sup.-1]
Crystallite, D[.ANG.] 0.077 73.3
Here, the crystallite thickness is estimated to be .about.7.4 nm as
determined from the Scherrer equation. The 7.4 nm is close to the
theoretical length of double stranded 21 bp siRNA by considering
that one base pair corresponds to 2.6-2.9 .ANG. of length along the
strand (21.times.2.6-2.9=54.6-60.9 .ANG.). Considering that the
polymer might fold according to the structure displayed FIG. 6, the
observed thickness might correspond to the length of a double
stranded 21 bp siRNA coupled to the width of a duplexed RNA helix
of approximately 20 .ANG. [Nucleic Acids Research, 27, 949-955
(1999)]. This would theoretically amount to 74.6 to 80.9 .ANG.. In
addition, the rest of RNA strands could be easily packing to form
ordered structure since the persistence length of single-stranded
RNA is less than 1 nm. However, double stranded RNA part should be
rigid because persistence length of double stranded RNA is about 64
nm (Single-Molecule Measurements of the Persistence Length of
Double-Stranded RNA, Biophys J. 2005 April; 88(4): 2737-2744).
[0117] Dynamic Light Scattering (DLS) and Zeta Potential:
[0118] The size and surface charge of RNAi microsponges were
measured using Zeta PALS and Zeta Potential Analyzer software
(Brookhaven Instruments Corp., Holtsville, N.Y.). The RNAi
microsponges were diluted in Milli-Q water and all measurement were
carried out at 25.degree. C. Three measurements each with 10
sub-runs were performed for each sample. Molecular weight of RNA
microsponges, 1.36.times.10.sup.10 g/mole, was obtained from Zeta
PALS software.
[0119] Calculation of Amount of siRNA Generated from RNAi
Microsponges:
[0120] From the measured molecular weight of the RNA microsponges,
the number of periodically repeated 92 base RNA strands (from 92
base circular DNA templates) in a single RNA microsponge was
calculated as follows:
Molecular Weight of 92 base RNA strand = 28587 g / mole
##EQU00001## Number of 92 base RNA strands ( cleavable RNA strands
) in one RNA microsponge = 1.36 .times. 10 10 / 28587 = 4.76
.times. 10 5 ##EQU00001.2##
In theory, 480000 of siRNA can be maximally generated from one RNAi
microsponge. Experimentally, the amount of cleaved siRNA from one
RNA microsponge was determined using the gel electrophoresis
results.
siRNA from one RNA particle = Amount of siRNA from 1 .mu. g of RNA
microsponge / amount of 1 .mu. g of RNA microsponge = ( 0.0945 .mu.
g / 12600 .mu. g / mol ) / ( 1 .mu. g / 1.36 .times. 10 10 .mu. g /
mol ) = 102 , 000 ##EQU00002##
[0121] According to gel electrophoresis results following the Dicer
treatment, 102,000 siRNA strands were generated from one RNAi
microsponge under optimal conditions. This result shows that 21% of
potential RNAi is converted as siRNA. In our hypothesis, some
portion of the RNA is not as readily accessed by dicer in a more
close-packed self-assembled RNA structure. Therefore, multimers
such as dimer, trimer, and tetramer of repeat RNA unit as
incomplete dicing products could be produce.
[0122] Calculation of Amount of Liposome by Lipofectamine with
siRN:
[0123] The number of liposome can be calculated by the following
equation,
N.sub.liposome=N.sub.lipid/N.sub.tot
If 100 nm liposomes are unilamellar structure, the number of lipids
in a 100 nm size liposome is about 80047. With 2 mg/ml of
Lipofectamine.TM. reagent (Invitrogen) solution, which is 3:1 (w/w)
liposome formulation of DOSPA
(2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-pro-
paniminium trifluoroacetate) and DOPE
(dioleoyl-L-a-phosphatidylethanolamine), 1:4 ratio of siRNA/Lipo
(w/v) is formed.
[0124] Based on our calculation, about 150 times more number of
liposomes that are made of lipofectamine agent are needed to
deliver same number of siRNA in comparison to microsponges. For
example, to deliver 1 nmole of siRNA, 1.5 pmole of liposome is
necessary (in case of RNAi-MS, about 10 fmole of RNA-MS can deliver
1 nmole of siRNA). This is an important issue for the cell type
that does not easily allow cellular uptake and low
off-target/toxicity.
[0125] Materials for In Vitro Biological Characterization:
[0126] The siRNA was purchased from Dharmacon RNAi Technologies.
Dual-Glo Luciferase Assay System and Fugene-HD were purchased from
Promega. All other cell culture reagents were purchased from
Invitrogen. T22 cells stably expressing both GFP and firefly
luciferase, untransfected T22 cells, and pRL-CMV (Renilla
luciferase) plasmid were a gift of the laboratory of Phil Sharp
(MIT). gWIZ-Luc (Firefly luciferase) plasmid was obtained from
Aldevron. (Firefly) Branched 25,000 g/mol (M.sub.W)
polyethyleneimine (PEI) and other chemical reagents were purchased
from Sigma Aldrich. Vivo Tag 645 was purchased from
Visen/PerkinElmer.
[0127] Cell Proliferation Assay:
[0128] T22 cells were seeded at 2000 cells/well in a 96-well clear,
flat-bottomed plate and transfected according to the above
protocol. Cells were incubated with RNAi-microsponges or
RNAi-microsponge/PEI for 4 hours, after which media was removed and
replaced with 10% serum-containing growth medium. After 48 hours,
each well was treated with 20 .mu.L of MTT reagent (1 mg/mL in MEM)
for an additional 4 hours. Media was then removed and formazan
crystals were solubilized in 50:50 DMF:water with 5% SDS. After 12
hours, absorbance was read at 570 nm.
[0129] Cell Uptake Test by Confocal Microscopy:
[0130] 8-well Lab-Tek chamber slides (Thermo Fisher, Waltham,
Mass.) were treated for 20 min with human fibronectin in PBS at 0.1
mg/mL. The fibronectin was removed and T22 cells were trypsinized
and seeded in each well at a concentration of 4000 cells/well 24 h
before transfection. 50 .mu.L of fluorescently labeled RNAi-MS and
RNAi-MS/PEI were added to 250 .mu.L phenol-free Opti-MEM at the
final concentration of up to 21.2 fM. After 4 hours,
RNAi-microsponges were removed, cells were fixed with 3.7%
formaldehyde in PBS, stained with Hoechst 33342 (Pierce) and Alexa
Fluor 488.RTM. phalloidin (Invitrogen) and washed 3 times with PBS.
Imaging was done on a PerkinElmer Ultraview spinning disc confocal
(PerkinElmer, Waltham, Mass.).
[0131] Materials for In Vivo siRNA Knockdown Experiments:
[0132] T22-Luc cells were a generous gift from Dr. Deyin Xing,
Professor Philip Sharp (MIT) and Dr. Sandra Orsulic (Cedars-Sinai
medical center). Tumors from nude mice injected with Brca1
wild-type cell line C22 were used to generate T22 tumor cell lines
(Cancer Res. 2006 Sep. 15; 66(18): 8949-53). T22-Luc is a
genetically defined mouse ovarian cancer cell line (p53-/-, Akt,
myc) that stably expresses luciferase after infection with
pMSCV-puro-Firefly luciferase viral supernatant and selecting the
cells in a medium containing 2.0 g/ml of puromycin for 1 week.
[0133] Degradation Experiments of RNAi Microsponges:
[0134] For degradation test, RNA microsponges were incubated for 24
hrs in 10% of serum at 37.degree. C. (FIG. 18). We have also
carried out additional experiments with various concentrations of
RNase for 24 hrs at 37.degree. C. (FIG. 8) [RNase I (from 0.05
U/.mu.l to 5 U/.mu.l) for single stranded RNA and RNase III (from
0.02 U/.mu.l to 1.2 U/.mu.l) for double stranded RNA, NEB, Ipswich,
Mass.]. As a control, RNA microsponges were incubated with 10
U/.mu.l of DNase I (NEB, Ipswich, Mass.) for 24 hrs at 37.degree.
C.
[0135] By taking advantage of new RNA synthetic methods for the
generation of nanostructures via rational design, we utilize an
enzymatic RNA polymerization to form condensed RNA structures that
contain predetermined sequences for RNA interference by rolling
circle transcription (RCT).
[0136] Here we design and use RNA polymerase to generate elongated
pure RNA strands as polymers that can self-assemble into organized
nano- to microstructure, which is key for efficient delivery and
high cargo capacity, offering the combined benefit of low
off-target effects and low toxicity.sup.4. Using a new approach, we
utilize the T7 promoter as a primer so that extremely high
molecular weight RNA strands can be produced. As shown in FIG. 1,
long linear single stranded DNA encoding complementary sequences of
the antisense and sense sequences of anti-luciferase siRNA are
first prepared. Because both ends of the linear DNA are also
partially complementary to the T7 promoter sequence, the long
strand is hybridized with a short DNA strand containing the T7
promoter sequence to form circular DNA (see Table 1). The nick in
the circular DNA is chemically closed with a T4 DNA ligase. The
closed circular DNA is then used to produce RNA transcripts via
RCT, encoding both antisense and sense sequences of anti-luciferase
siRNA yielding hairpin RNA structures (see FIG. 6). The hairpin RNA
structures can actively silence genes when converted to siRNA by
Dicer. From In vitro RCT of the circular DNA, we can obtain
multiple tandem copies of the sequence in coils of single-stranded
and double stranded RNA transcripts. Although the products might be
compared to DNA toroidal condensates, in this case, there is not a
charged condensing element that assists in the formation of
structure.
[0137] The RNA transcripts form porous sponge-like superstructures
with nanoscopic structure readily visible in scanning electron
microscope (SEM) image (FIG. 2a). Because of the structural
similarity, we refer to the resulting RNA product as an RNA
interference (RNAi) microsponge. Unlike conventional nucleic acid
systems, our RNAi-microsponge exhibits a densely packed molecular
scale structure without the use of an additional agent. We
confirmed that the RNAi-microsponges are composed of RNA by
staining with SYBR II and labeling with Cyanine 5-dUTPs, and
observing the resulting bright green and red fluorescence,
respectively (FIG. 2b and FIG. 7). Also, we provide additional
evidence with an RNase digestion experiment at various
concentrations of RNase. The results clearly show the
rate-dependent degradation of the RNA microsponge at high
concentrations of RNase (see FIG. 8). Mono-disperse RNA
microsponges were prepared with short sonication (FIG. 2c). The
particles exhibit a uniform size of 2 .mu.m, and consistent
nano-pleated or fan-like spherical morphology. Based on the
molecular weight and concentration, each RNAi-microsponge contains
approximately a half million tandem copies of RNA strands that are
cleavable with Dicer. A higher magnification SEM image of the RNA
particles reveals that the sponge-like structure is constructed
from RNA sheets that are approximately 12.+-.4 nm thick (FIG.
2d).
[0138] To examine the formation of the sponge-like spherical
structures from their RNA strand building blocks, time-dependent
experiments were performed during the RCT polymerization. The
morphologies of the RNA superstructures were revealed by SEM after
1 h, 4 h, 8 h, 12 h, 16 h and 20 h RCT reaction time. As shown in
FIG. 3a, the RCT products first form a fiber-like structure in the
early stages of the polymerization. After additional reaction time,
a sheet-like structure is formed (FIG. 3b). At the 8 h time point,
the sheet-like structure became thicker and began to exhibit a
densely packed internal structure (FIG. 3c). Wrinkled and
semi-spherical structures begin to appear on the sheet structures
in the 12 h reaction sample (FIG. 3d and FIG. 9). After 16 h, the
morphology of the RNA polymer product transforms into
interconnected globular superstructures in which the sheets are
re-organized into a complex buckled and folded internal structure
(FIG. 3e). These spherical structures start to separate into
individual particles, and after 20 h, the final spherical
sponge-like structures were observed (FIGS. 3f and 2a). Based on
the SEM images from time-dependent experiments, a schematic cartoon
of the process of formation of sponge-like superstructure is
suggested in FIG. 3g. The final structure is reminiscent of the
lamellar spherulite structures that are formed by highly
crystalline polymers when nucleated in the bulk state or solution.
In the case of traditional synthetic polymers such as polyethylene
or polyethylene oxide, the thickness of the lamellar sheets
corresponds to the dimensions of chain-folded polymer molecules. It
is possible that as the RNA polymer is continuously generated
during the RCT reaction, and reaches very high molecular weight at
high localized concentrations, a similar ordering and assembly
process occurs here. Thus far, such a self-assembled crystalline
superstructure has not been observed for RNA polymers. The
crystalline structure of RNAi-microsponge was confirmed with
polarizing optical microscopy (POM); under crossed polarizers,
birefringence of the individual particles is observed (FIG. 3h). In
comparison to the SEM image (inset of FIG. 2c), it appears that the
RNA sheet has a crystal-like ordered structure (Inset of FIG. 3h).
X-ray diffraction further confirmed the crystalline structure of
the RNAi-microsponge (FIG. 3i). The crystallite thickness is
estimated to be .about.7.4 nm as determined from the Scherrer
equation (Table 2). This finding is consistent with the thickness
from SEM images although the resolution of SEM is not as sensitive
at the nanoscale. In addition, transmission electron microscope
(TEM) images (FIG. 3j and FIG. 10) showing densely assembled RNA
sheet structures in the RNAi-microsponge support the proposed
structure, as shown in schematic form in FIG. 3j. Similar to liquid
crystal phases from duplex DNA, the high molecular weight of RNA
polymers with periodic RNA duplexes leads to the formation of
crystal-like ordered structures. The melting experiment using POM
with a heating stage show that the RNAi-microsponge is pretty
stable up to 150.degree. C. which is much higher than the melting
temperature of any double helix DNA or RNA molecules, suggesting
that the formation of the RNAi-microsponge is dominantly based on
the ordered crystalline structure of RNA polymers (FIG. 11). The
assembly of the RNA polymer was also observed when polymerized at
different concentrations of the rolling circle DNA polymerizing or
initiating units (FIG. 12). At lower concentrations, individual
branched dendritic polycrystals were formed in solution, but they
did not assemble into microparticles until a critical concentration
of DNA was achieved. The concentration dependence, the appearance
of more traditional crystalline structures at low concentration, as
well as the observed crystallite thickness of 7.4 nm for the sponge
layer structures, which corresponds to the length of the rigid 21
bp RNA repeat sequence, were all consistent with phenomena observed
for the formation of spherulitic superstructures of chain folded
lamellar sheets.
[0139] The RNAi-microsponges have a highly localized concentration
of RNA strands, as they essentially consist of near 100% potential
RNAi. For this reason, these systems should be an effective means
to deliver and generate siRNA through intracellular processing
mechanisms. The RNA structures were designed to be cleaved by the
enzyme Dicer by cutting double-stranded RNA into approximately
21-nt RNA duplexes in the cytoplasm, where it can be converted to
siRNA by the RNA-induced silencing complex (RISC) for gene
silencing (FIG. 4a). To confirm Dicer cleavage of RNAi-microsponge,
they were incubated with recombinant Dicer and the products were
analyzed by gel electrophoresis (FIG. 4b). In the presence of
recombinant Dicer, RNAi-microsponges yielded 21 bp products (FIG.
4b, left); whereas there are no RNA strands as small as the 21 bp
siRNA without Dicer treatment (lane 2 of FIG. 4b, right). Due to
the amount of cleavable RNA strands and size of RNAi-microsponge,
recombinant Dicer required at least a 36 h reaction time to
generate the maximum amount of siRNA (lane 3 to 8 of FIG. 4b,
right). 9.5% (w/w) of RNAi-microsponge was converted to siRNA,
indicating 21% of the cleavable double stranded RNA was actually
diced to siRNA (Table 3). Dicer also produced the two or three
repeat RNA units that included two or three non-diced RNA duplex
(FIG. 4b). With these results, we estimate that each individual
RNAi-microsponge can yield .about.102000 siRNA copies (see
Calculation above).
TABLE-US-00004 TABLE 3 Amount of cleaved siRNA from 1 .mu.g of
RNAi- microsponges from gel electrophoresis results. Intensity
Amount (abitrary) Std. (ng) 21 bp of 159.3 16.4 93.8 .+-. 9.7
Reference dsRNA Ladder sIRNA from 160.4 8.8 94.5 .+-. 5.2 RNA
particles
[0140] To enhance the cellular uptake of the RNA particle, the
synthetic polycation, polyethylenimine (PEI) was used to condense
the RNAi-microsponge and generate a net positively charged outer
layer. Due to the high negative charge density of the
RNAi-microsponge, cationic PEI was readily adsorbed onto the
particles by electrostatic interaction. The change of particle
surface charge (zeta potential) from -20 mV (RNAi-microsponge) to
+38 mV (RNAi-microsponge/PEI) indicates the successful assembly of
RNAi-microsponge with PEI (FIG. 4c). The size of the particles was
significantly decreased to 200 nm from the original average size of
approximately 2 .mu.m (FIG. 4c). The shrinking was also confirmed
by SEM image, showing approximately 200 nm monodisperse particles
(FIG. 4d and FIG. 13). It is worth noting that a single PEI layered
RNAi-microsponge still contains the same number of cleavable RNA
strands, thus yielding an extremely high siRNA density. To the best
of our knowledge, this represents the highest number of siRNA
molecular copies encapsulated in a nanoparticle; typically the
loading of siRNA can be challenging for standard polymeric
carriers.
[0141] To confirm the cellular transfection of RNA particle, red
fluorescence labeled RNAi-microsponge/PEI was incubated with T22
cells. RNAi-microsponge/PEI particles exhibited significant
cellular uptake by the cancer cell line, compared with the
uncondensed RNAi-microsponge (FIG. 5a). Since the RNAi-microsponge
was designed to generate siRNA for silencing of firefly luciferase
expression, the drug efficacy was determined by measuring the
fluorescence intensity of cell lysate after transfection (FIG. 5b
and FIG. 14). As expected, naked siRNA did not show any significant
gene silencing up to 100 nM siRNA, whereas RNAi-microsponge showed
slightly reduced gene expression at 980.0 fM. PEI layered
RNAi-microsponge efficiently inhibited the firefly luciferase
expression down to 42.4% at the concentration of 980 fM. The
RNAi-MS/PEI delivery system shows better silencing efficiency in
comparison to siRNA/PEI. The level of gene knockdown was also
evaluated with in vivo optical images of firefly
luciferase-expressing tumors after intratumoral injection of
RNAi-microsponge/PEI (FIG. 5c and FIG. 15). As can be seen in FIG.
5c, after 4 days the level of firefly luciferase expression in the
tumor was significantly reduced for the PEI layered
RNAi-microsponge; however, there is no significant decrease in
firefly luciferase expression with a control RNA-microsponge/PEI
that does not knock down luciferase (see FIG. 16). Note that
extremely low numbers (2.1 fmoles) of RNAi-microsponge/PEI
particles were used to achieve significant gene silencing
efficiency--roughly 3 orders of magnitude less carrier was required
to achieve the same degree of gene silencing as a conventional
particle based vehicle.sup.6. Compared to other strategies, siRNA
delivery using our RNAi-microsponges provides synergistic effects
for loading efficiency, drug efficacy, and low cytotoxicity (FIGS.
5b and 5c and FIG. 17).
[0142] We demonstrated that a new class of siRNA carrier, the
RNAi-microsponge, which introduces a new self-assembled structure
that provides a route for the effective delivery of siRNA. The RNAi
microsponge presents a means of rapidly generating large amounts of
siRNA in a form that assembles directly into a drug carrier that
can be used for direct transfection simply by coating with a
positively charged polyion. Given the high cost of therapeutic
siRNA and the need for high levels of efficiency, this approach
could lead to much more directly accessible routes to therapies
involving siRNA. The siRNA, which is highly prone to degradation
during delivery, is protected within the microsponge in the
crystalline form of polymeric RNAi. We can significantly reduce the
difficulties of achieving high loading efficiency for siRNA using
this approach. The microsponges are able to deliver the same
transfection efficiency with a three order of magnitude lower
concentration of siRNA particles when compared to typical
commercially available nanoparticle-based delivery. Furthermore,
the ease of modification of the RNA polymer composition enables the
introduction of multiple RNA species for combination therapies. The
RNAi microsponge presents a novel new materials system in general
due to its unique morphology and nanoscale structure within the
polymer particle, and provides a promising self-assembling material
that spontaneously generates a dense siRNA carrier for broad
clinical applications of RNAi delivery using the intrinsic biology
of the cell.
Example 2
[0143] In this Example, particles includes nucleic acid molecules
comprising multiple sequences are demonstrated.
[0144] To generate the RNAi combination system, we can incorporate
RNAi combinations by assembling multiple siRNA and/or microRNA
(miR) within a single RNAi microsponge. To achieve this goal,
multiple RNA species can be designed within a single circular DNA
template. Then self-assembled RNAi microsponge can be synthesized
during RCT reaction by producing multiple components from a single
circular DNA template (Engineering Strategy 1 in FIG. 19). Another
strategy is that we can design each type of siRNA sequences in a
single circular DNA template and mix all types of circular DNA
together during RCT reaction (Engineering Strategy 2 in FIG. 19).
Specific composition of multiple RNAi reagents can be incorporated
as components of circular DNA to generate the RNAi combination
system. The numbers and types of multiple components in a single
RNAi microsponge are unlimited. Possible candidates for RNAi
combination systems are siRNA, shRNA, miRNA, and Ribozyme. Note
that molar ratios between siRNA sequences can be varied depending
on their efficacy of knockdown. A variety of parameters can be
considered in the sequence design and for efficient knockdown such
as RNA geometry (secondary and tertiary structures), molar ratios
of multiple siRNA sequences, additional spacers between multiple
siRNAs in a single transcript and destabilizing G:U wobble pairs to
improve transcription efficiency.
[0145] FIG. 20 shows the existence of multiple components within a
single RNAi microsponge structure was confirmed by flow cytometry
analysis. Various RNAi microsponges were constructed based on the
molar ratios differences between two siRNA sequences by varying the
molar ratio of DNA templates. Then two molecular recognition
probes, fluorophores tags both green and red, were attached to each
RNAi microsponge. The RNAi microsponges 4G1R, 2G1R, 1G1R, 1G2R and
1G4R were decoded based on the ratio of fluorescence intensity.
FITC indicates the green channel and APC indicates the red channel.
The intensity ratio I.sub.R/I.sub.G, where I.sub.R and I.sub.G were
fluorescence intensities of green and red dye from both dyes-tagged
RNAi microsponges respectively, was changed between the ratios of
two different siRNA molecules (Figure). This result indicates that
the internal structure of RNAi mircosponges consists of two siRNA
components.
Other Embodiments and Equivalents
[0146] While the present disclosures have been described in
conjunction with various embodiments and examples, it is not
intended that they be limited to such embodiments or examples. On
the contrary, the disclosures encompass various alternatives,
modifications, and equivalents, as will be appreciated by those of
skill in the art. Accordingly, the descriptions, methods and
diagrams of should not be read as limited to the described order of
elements unless stated to that effect.
[0147] Although this disclosure has described and illustrated
certain embodiments, it is to be understood that the disclosure is
not restricted to those particular embodiments. Rather, the
disclosure includes all embodiments that are functional and/or
equivalents of the specific embodiments and features that have been
described and illustrated.
Sequence CWU 1
1
3192DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1atagtgagtc gtattaacgt accaacaact
tacgctgagt acttcgatta cttgaatcga 60agtactcagc gtaagtttag aggcatatcc
ct 92222DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2taatacgact cactataggg at
223736RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 3agggauaugc cucuaaacuu acgcugagua
cuucgauuca aguaaucgaa guacucagcg 60uaaguuguug guacguuaau acgacucacu
auagggauau gccucuaaac uuacgcugag 120uacuucgauu caaguaaucg
aaguacucag cguaaguugu ugguacguua auacgacuca 180cuauagggau
augccucuaa acuuacgcug aguacuucga uucaaguaau cgaaguacuc
240agcguaaguu guugguacgu uaauacgacu cacuauaggg auaugccucu
aaacuuacgc 300ugaguacuuc gauucaagua aucgaaguac ucagcguaag
uuguugguac guuaauacga 360cucacuauag ggauaugccu cuaaacuuac
gcugaguacu ucgauucaag uaaucgaagu 420acucagcgua aguuguuggu
acguuaauac gacucacuau agggauaugc cucuaaacuu 480acgcugagua
cuucgauuca aguaaucgaa guacucagcg uaaguuguug guacguuaau
540acgacucacu auagggauau gccucuaaac uuacgcugag uacuucgauu
caaguaaucg 600aaguacucag cguaaguugu ugguacguua auacgacuca
cuauagggau augccucuaa 660acuuacgcug aguacuucga uucaaguaau
cgaaguacuc agcguaaguu guugguacgu 720uaauacgacu cacuau 736
* * * * *
References