U.S. patent application number 14/327640 was filed with the patent office on 2014-10-30 for plants with increased yield.
The applicant listed for this patent is BASF Plant Science GmbH. Invention is credited to Oliver Blasing, Piotr Puzio, Gerhard Ritte, Hardy Schon, Oliver Thimm.
Application Number | 20140325706 14/327640 |
Document ID | / |
Family ID | 39924969 |
Filed Date | 2014-10-30 |
United States Patent
Application |
20140325706 |
Kind Code |
A1 |
Blasing; Oliver ; et
al. |
October 30, 2014 |
PLANTS WITH INCREASED YIELD
Abstract
The present invention provides a method for producing a plant
with increased yield as compared to a corresponding wild type plant
comprising increasing or generating one or more activities in a
plant or a part thereof. The present invention further relates to
nucleic acids enhancing or improving one or more traits of a
transgenic plant, and cells, progenies, seeds and pollen derived
from such plants or parts, as well as methods of making and methods
of using such plant cell(s) or plant(s), progenies, seed(s) or
pollen. Particularly, the improved trait(s) are manifested in an
increased yield, preferably by improving one or more yield-related
trait(s), e.g. low temperature tolerance.
Inventors: |
Blasing; Oliver; (Potsdam,
DE) ; Puzio; Piotr; (Mariakerke (Gent), BE) ;
Thimm; Oliver; (Berlin, DE) ; Ritte; Gerhard;
(Potzdam, DE) ; Schon; Hardy; (Berlin,
DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BASF Plant Science GmbH |
Ludwigshafen |
|
DE |
|
|
Family ID: |
39924969 |
Appl. No.: |
14/327640 |
Filed: |
July 10, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12678892 |
Mar 18, 2010 |
8809059 |
|
|
PCT/EP2008/062494 |
Sep 19, 2008 |
|
|
|
14327640 |
|
|
|
|
Current U.S.
Class: |
800/289 ;
435/320.1; 435/419; 800/290; 800/298 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12N 15/8271 20130101; C12N 15/8261 20130101; C12N 15/8273
20130101 |
Class at
Publication: |
800/289 ;
800/290; 800/298; 435/320.1; 435/419 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 21, 2007 |
EP |
07116983.3 |
Oct 30, 2007 |
EP |
07119635.6 |
Mar 20, 2008 |
EP |
08153046.1 |
May 30, 2008 |
EP |
08157331.3 |
Aug 13, 2008 |
EP |
08162290.4 |
Claims
1. A method for producing a transgenic plant with increased yield
compared to a corresponding non-transformed wild type plant,
comprising: (a) transforming a plant, plant cell, or plant part
with a nucleic acid selected from the group consisting of: (i) a
nucleic acid comprising any of the nucleotide sequences provided in
column 5 or 7 of Table I; (ii) a nucleic acid encoding a
polypeptide comprising any of the amino acid sequences provided in
column 5 or 7 of Table II; (iii) a nucleic acid having at least 80%
sequence identity with any of the nucleotide sequences provided in
column 5 or 7 of Table I; (iv) a nucleic acid encoding a
polypeptide having at least 80% sequence identity with any of the
amino acid sequences provided in column 5 or 7 of Table II; and (v)
a nucleic acid which hybridizes with the nucleic acid of (a) or (b)
under stringent hybridization conditions comprising hybridization
in 4.times.sodium chloride/sodium citrate (SSC) at 65.degree. C. or
4.times.SSC and 50% formamide at 42.degree. C., followed by one or
more wash steps in 0.1.times.SSC at 65.degree. C. or 0.2.times.SSC
at 50.degree. C. or 65.degree. C.; (b) obtaining a transgenic plant
from said transformed plant, plant cell, or plant part; and
optionally (c) selecting a transgenic plant having increased yield
compared to a corresponding non-transformed wild type plant.
2. The method of claim 1, further comprising obtaining a seed or
progeny from said transgenic plant, wherein said seed or progeny
comprises said nucleic acid and has increased yield compared to a
corresponding non-transformed wild type plant.
3. The method of claim 1, wherein the transgenic plant exhibits
increased yield compared to a corresponding non-transformed wild
type plant under standard growth conditions.
4. The method of claim 1, wherein the transgenic plant exhibits
increased yield compared to a corresponding non-transformed wild
type plant under stress conditions.
5. The method of claim 1, wherein the plant, plant cell, or plant
part is obtained from a monocotyledonous plant or a dicotyledonous
plant.
6. A transgenic plant obtained by the method of claim 1, or a seed
or progeny of said transgenic plant, wherein said plant, seed or
progeny comprises said nucleic acid.
7. A nucleic acid construct comprising: (a) a nucleic acid selected
from the group consisting of: (i) a nucleic acid comprising any of
the nucleotide sequences provided in column 5 or 7 of Table I; (ii)
a nucleic acid encoding a polypeptide comprising any of the amino
acid sequences provided in column 5 or 7 of Table II; (iii) a
nucleic acid having at least 80% sequence identity with any of the
nucleotide sequences provided in column 5 or 7 of Table I; (iv) a
nucleic acid encoding a polypeptide having at least 80% sequence
identity with any of the amino acid sequences provided in column 5
or 7 of Table II; and (v) a nucleic acid which hybridizes with the
nucleic acid of (a) or (b) under stringent hybridization conditions
comprising hybridization in 4.times.sodium chloride/sodium citrate
(SSC) at 65.degree. C. or 4.times.SSC and 50% formamide at
42.degree. C., followed by one or more wash steps in 0.1.times.SSC
at 65.degree. C. or 0.2.times.SSC at 50.degree. C. or 65.degree.
C., (b) one or more regulatory sequences operably linked to the
nucleic acid of (a).
8. A vector comprising the nucleic acid construct of claim 7.
9. A transgenic plant, plant cell, plant tissue or plant part
comprising the nucleic acid construct of claim 7.
10. The transgenic plant, plant cell, plant tissue or plant part of
claim 9, wherein said transgenic plant, plant cell, plant tissue or
plant part is obtained by transforming a plant, plant cell, plant
tissue or plant part with said nucleic acid construct.
11. The transgenic plant of claim 9, wherein said transgenic plant
exhibits an improved yield-related trait compared to a
corresponding non-transformed wild type plant.
12. The transgenic plant of claim 9, wherein said transgenic plant
exhibits an improved nutrient use efficiency and/or abiotic stress
tolerance compared to a corresponding non-transformed wild type
plant.
13. The transgenic plant of claim 9, wherein said transgenic plant
exhibits an increased tolerance to low temperature compared to a
corresponding non-transformed wild type plant.
14. The transgenic plant of claim 9, wherein said transgenic plant
exhibits an increased harvestable yield compared to a corresponding
non-transformed wild type plant.
15. The transgenic plant of claim 9, wherein said transgenic plant
exhibits an increased yield compared to a corresponding
non-transformed wild type plant, wherein said increased yield is
calculated on a per plant basis or in relation to a specific arable
area.
16. The transgenic plant, plant cell, plant tissue or plant part of
claim 9, wherein said transgenic plant is a monocotyledonous plant
or a dicotyledonous plant, and wherein said plant cell, plant
tissue or plant part is obtained from a monocotyledonous plant or a
dicotyledonous plant.
17. A method for enhancing a yield-related trait in a plant
compared to a corresponding control plant, comprising: (a)
transforming the nucleic acid construct of claim 7 into a plant,
plant cell, or plant part; (b) selecting a transgenic plant having
an enhanced yield-related trait compared to a corresponding
non-transformed control plant.
18. The method of claim 17, wherein the plant, plant cell, or plant
part is obtained from a monocotyledonous plant or a dicotyledonous
plant.
19. The method of claim 17, wherein the enhanced yield-related
trait comprises increased yield, enhanced tolerance to abiotic
environmental stress and/or increased nutrient use efficiency.
20. The method of claim 17, wherein the enhanced tolerance to
abiotic environmental stress comprises an increased drought
tolerance, an increased low temperature tolerance, an increased
heat tolerance and/or an increased salt stress tolerance compared
to a corresponding non-transformed control plant.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 12/678,892 filed Mar. 18, 2010, which is a
national stage application (under 35 U.S.C. .sctn.371) of
PCT/EP2008/062494, filed Sep. 19, 2008, which claims benefit of
European application 07116983.3, filed Sep. 21, 2007, European
application 07119635.6, filed Oct. 30, 2007, European application
08153046.1, filed Mar. 20, 2008, European application 08157331.3,
filed May 30, 2008 and European application 08162290.4, filed Aug.
13, 2008. The entire contents of each of these applications are
hereby incorporated by reference herein in their entirety.
SUBMISSION OF SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
filed in electronic format via EFS-Web and hereby incorporated by
reference into the specification in its entirety. The name of the
text file containing the Sequence Listing is
Sequence_Listing.sub.--074021.sub.--0116.sub.--01. The size of the
text file is 55,926 KB, and the text file was created on Jul. 9,
2014.
FIELD OF THE INVENTION
[0003] The present invention disclosed herein provides a method for
producing a plant with increased yield as compared to a
corresponding wild type plant comprising increasing or generating
one or more activities in a plant or a part thereof. The present
invention further relates to nucleic acids enhancing or improving
one or more traits of a transgenic plant, and cells, progenies,
seeds and pollen derived from such plants or parts, as well as
methods of making and methods of using such plant cell(s) or
plant(s), progenies, seed(s) or pollen. Particularly, said improved
trait(s) are manifested in an increased yield, preferably by
improving one or more yield-related trait(s), e.g. low temperature
tolerance.
BACKGROUND OF THE INVENTION
[0004] Under field conditions, plant performance, for example in
terms of growth, development, biomass accumulation and seed
generation, depends on a plant's tolerance and acclimation ability
to numerous environmental conditions, changes and stresses. Since
the beginning of agriculture and horticulture, there was a need for
improving plant traits in crop cultivation. Breeding strategies
foster crop properties to withstand biotic and abiotic stresses, to
improve nutrient use efficiency and to alter other intrinsic crop
specific yield parameters, i.e. increasing yield by applying
technical advances
[0005] Plants are sessile organisms and consequently need to cope
with various environmental stresses. Biotic stresses such as plant
pests and pathogens on the one hand, and abiotic environmental
stresses on the other hand are major limiting factors for plant
growth and productivity (Boyer, Plant Productivity and Environment,
Science 218, 443-448 (1982); Bohnert et al., Adaptations to
Environmental Stresses, Plant Ce117(7), 1099-1111 (1995)), thereby
limiting plant cultivation and geographical distribution. Plants
exposed to different stresses typically have low yields of plant
material, like seeds, fruit or other produces. Crop losses and crop
yield losses caused by abiotic and biotic stresses represent a
significant economic and political factor and contribute to food
shortages, particularly in many underdeveloped countries.
[0006] Conventional means for crop and horticultural improvements
today utilize selective breeding techniques to identify plants with
desirable characteristics. Advances in molecular biology have
allowed to modify the germplasm of plants in a specific way.--For
example, the modification of a single gene, resulted in several
cases in a significant increase in e.g. stress tolerance (Wang et
al., 2003) as well as other yield-related traits. There is a need
to identify genes which confer resistance to various combinations
of stresses or which confer improved yield under suboptimal growth
conditions. There is still a need to identify genes which confer
the overall capacity to improve yield of plants.
[0007] Thus, there is a need to identify genes which confer
increased yield of a plant.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIGS. 1a and 1b. Vector VC-MME220-1 (SEQ ID NO: 1) or
VC-MME220-1qcz (SEQ ID NO: 6064) used for cloning gene of interest
for non-targeted expression.
[0009] FIGS. 2a and 2b. Vector VC-MME221-1 (SEQ ID NO: 2) or
VC-MME221-1qcz (SEQ ID NO: 6069) used for cloning gene of interest
for non-targeted expression.
[0010] FIGS. 3a and 3b. Vector VC-MME354-1 (SEQ ID NO: 3) or
VC-MME354-1QCZ (SEQ ID NO: 6055) used for cloning gene of interest
for plastidic targeted expression.
[0011] FIGS. 4a and 4b. Vector VC-MME432-1 (SEQ ID NO: 5) or
VC-MME432-1qcz (SEQ ID NO: 6065) used for cloning gene of interest
for plastidic targeted expression.
[0012] FIGS. 5a and 5b. Vector VC-MME489-1p (SEQ ID NO: 15) or
VC-MME489-1QCZ (SEQ ID NO: 6079) used for cloning gene of interest
for non-targeted expression and cloning of a targeting
sequence.
[0013] FIG. 6. Vector pMTX0270p (SEQ ID NO: 16) used for cloning of
a targeting sequence.
[0014] FIG. 7. Vector pMTX155 (SEQ ID NO: 6054) used for used for
cloning gene of interest for non-targeted expression.
[0015] FIG. 8. Vector VC-MME356-1 QCZ (SEQ ID NO: 6057) used for
mitochondric targeted expression.
[0016] FIG. 9. Vector VC-MME301-1QCZ (SEQ ID NO: 6059) used for
non-targeted expression in preferentially seeds.
[0017] FIG. 10. Vector pMTX461korrp (SEQ ID NO: 6060) used for
plastidic targeted expression in preferentially seeds.
[0018] FIG. 11. Vector VC-MME462-1 QCZ (SEQ ID NO: 6062) used for
mitochondric targeted expression in preferentially seeds.
[0019] FIG. 12. Vector VC-MME431-1qcz (SEQ ID NO: 6067) used for
mitochondric targeted expression.
[0020] FIG. 13. Vector pMTX447korr (SEQ ID NO: 6070) used for
plastidic targeted expression.
[0021] FIG. 14. Vector VC-MME445-1qcz (SEQ ID NO: 6072) used for
mitochondric targeted expression.
[0022] FIG. 15. Vector VC-MME289-1qcz (SEQ ID NO: 6074) used for
non-targeted expression in preferentially seeds.
[0023] FIG. 16. Vector VC-MME464-1qcz (SEQ ID NO: 6075) used for
plastidic targeted expression in preferentially seeds.
[0024] FIG. 17. Vector VC-MME465-1qcz (SEQ ID NO: 6077) used for
mitochondric targeted expression in preferentially seeds.
DETAILED DESCRIPTION OF THE INVENTION
[0025] Accordingly, in a first embodiment, the present invention
provides a method for producing a plant with increased yield as
compared to a corresponding wild type plant comprising at least the
following step: increasing or generating one or more activities
selected from the group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein.
[0026] The term "yield" as used herein generally refers to a
measurable produce from a plant, particularly a crop. Yield and
yield increase (in comparison to a non-transformed starting or
wild-type plant) can be measured in a number of ways, and it is
understood that a skilled person will be able to apply the correct
meaning in view of the particular embodiments, the particular crop
concerned and the specific purpose or application concerned.
[0027] Preferably, the preferred enhanced or improved yield
characteristics of a plant described herein according to the
present invention can be achieved in the absence or presence of
stress conditions.
[0028] The meaning of "yield" is, thus, mainly dependent on the
crop of interest and the intended application, and it is
understood, that the skilled person will understand in each
particular case what is meant from the circumstances of the
description.
[0029] For the purposes of the description of the present
invention, enhanced or increased "yield" refers to one or more
yield parameters selected from the group consisting of biomass
yield, dry biomass yield, aerial dry biomass yield, underground dry
biomass yield, fresh-weight biomass yield, aerial fresh-weight
biomass yield, underground fresh-weight biomass yield; enhanced
yield of harvestable parts, either dry or fresh-weight or both,
either aerial or underground or both; enhanced yield of crop fruit,
either dry or fresh-weight or both, either aerial or underground or
both; and preferably enhanced yield of seeds, either dry or
fresh-weight or both, either aerial or underground or both.
[0030] The term "yield" as used herein generally refers to a
measurable produce from a plant, particularly a crop.
[0031] Yield and yield increase (in comparison to an origin or
wild-type plant) can be measured in a number of ways. It is
understood that a skilled person will be able to apply the correct
meaning in view of the particular embodiments, the particular crop
concerned and the specific purpose or application concerned.
[0032] For example, the present invention provides methods for
producing transgenic plant cells or plants with can show an
increased yield-related trait, e.g. an increased tolerance to
environmental stress and/or increased intrinsic yield and/or
biomass production as compared to a corresponding (e.g.
non-transformed) wild type or starting plant by increasing or
generating one or more of said activities mentioned above.
[0033] In one embodiment, an increase in yield refers to increased
harvestable yield, biomass yield and/or an increased seed
yield.
[0034] "Yield" as described herein refers in one embodiment to
harvestable yield of a plant. The yield of a plant can depend on
the specific plant/crop of interest as well as its intended
application (such as food production, feed production, processed
food production, bio-fuel, biogas or alcohol production, or the
like) of interest in each particular case. Thus, in one embodiment,
yield is calculated as harvest index (expressed as a ratio of the
weight of the respective harvestable parts divided by the total
biomass), harvestable parts weight per area (acre, square meter, or
the like); and the like.
[0035] In one embodiment, "yield" refers to biomass yield, e.g. to
dry weight biomass yield and/or fresh-weight biomass yield. Biomass
yield refers to the aerial or underground parts of a plant,
depending on the specific circumstances (test conditions, specific
crop of interest, application of interest, and the like). In one
embodiment, biomass yield refers to the aerial and underground
parts. Biomass yield may be calculated as fresh-weight, dry weight
or a moisture adjusted basis. Biomass yield may be calculated on a
per plant basis or in relation to a specific area (e.g. biomass
yield per acre/square meter/or the like).
[0036] In other embodiment, "yield" refers to seed yield which can
be measured by one or more of the following parameters: number of
seeds or number of filled seeds (per plant or per area (acre/square
meter/or the like)); seed filling rate (ratio between number of
filled seeds and total number of seeds); number of flowers per
plant; seed biomass or total seeds weight (per plant or per area
(acre/square meter/or the like); thousand kernel weight (TKW;
extrapolated from the number of filled seeds counted and their
total weight; an increase in TKW may be caused by an increased seed
size, an increased seed weight, an increased embryo size, and/or an
increased endosperm). Other parameters allowing to measure seed
yield are also known in the art. Seed yield may be determined on a
dry weight or on a fresh weight basis, or typically on a moisture
adjusted basis, e.g. at 15.5 percent moisture.
[0037] Said increased yield in accordance with the present
invention can typically be achieved by enhancing or improving, in
comparison to an origin or wild-type plant, one or more
yield-related traits of the plant. Such yield-related traits of a
plant the improvement of which results in increased yield comprise,
without limitation, the increase of the intrinsic yield capacity of
a plant, improved nutrient use efficiency, and/or increased stress
tolerance, in particular increased abiotic stress tolerance.
[0038] Accordingly, in one embodiment, the yield-related trait
conferring an increase of the plant's yield is an increase of the
intrinsic yield capacity of a plant and can be, for example,
manifested by improving the specific (intrinsic) seed yield (e.g.
in terms of increased seed/grain size, increased ear number,
increased seed number per ear, improvement of seed filling,
improvement of seed composition, embryo and/or endosperm
improvements, or the like); modification and improvement of
inherent growth and development mechanisms of a plant (such as
plant height, plant growth rate, pod number, pod position on the
plant, number of internodes, incidence of pod shatter, efficiency
of nodulation and nitrogen fixation, efficiency of carbon
assimilation, improvement of seedling vigour/early vigour, enhanced
efficiency of germination (under stressed or non-stressed
conditions), improvement in plant architecture, cell cycle
modifications, photosynthesis modifications, various signaling
pathway modifications, modification of transcriptional regulation,
modification of translational regulation, modification of enzyme
activities, and the like); and/or the like.
[0039] Accordingly, in one embodiment, the yield-related trait
conferring an increase of the plant's yield is an improvement or
increase of stress tolerance of a plant and can be for example
manifested by improving or increasing a plant's tolerance against
stress, particularly abiotic stress. In the present application,
abiotic stress refers generally to abiotic environmental conditions
a plant is typically confronted with, including conditions which
are typically referred to as "abiotic stress" conditions including,
but not limited to, drought (tolerance to drought may be achieved
as a resuit of improved water use efficiency), heat, low
temperatures and cold conditions (such as freezing and chilling
conditions), salinity, osmotic stress, shade, high plant density,
mechanical stress, oxidative stress, and the like.
[0040] Accordingly, in one embodiment of the present invention, an
increased plant yield is mediated by increasing the "nutrient use
efficiency of a plant", e.g. by improving the use efficiency of
nutrients including, but not limited to, phosphorus, potassium, and
nitrogen.
[0041] For example, there is a need for plants that are capable to
use nitrogen more efficiently so that less nitrogen is required for
growth and therefore resulting in the improved level of yield under
nitrogen deficiency conditions. Further, higher yields may be
obtained with current or standard levels of nitrogen use.
[0042] Accordingly, in one embodiment of the present invention,
plant yield is increased by increasing nitrogen use efficiency of a
plant or a part thereof. Thus, it is a further object of this
invention to provide a plant, which show an enhanced nitrogen use
efficiency, and/or exhibit, under conditions of limited nitrogen
supply, an increased yield, as compared to a corresponding wild
type plant.
[0043] Because of the high costs of nitrogen fertilizer in relation
to the revenues for agricultural products, and additionally its
deleterious effect on the environment, it is desirable to develop
strategies to reduce nitrogen input and/or to optimize nitrogen
uptake and/or utilization of a given nitrogen availability while
simultaneously maintaining optimal yield, productivity and quality
of plants, preferably cultivated plants, e.g. crops. Also it is
desirable to maintain the yield of crops with lower fertilizer
input and/or higher yield on soils of similar or even poorer
quality.
[0044] Enhanced NUE of the plant can be determined and quantified
according to the following method:
[0045] Transformed plants are grown in pots in a growth chamber
(Svalof Weibull, Svalov, Sweden). In case the plants are
Arabidopsis thaliana seeds thereof are sown in pots containing a
1:1 (v:v) mixture of nutrient depleted soil ("Einheitserde Typ 0",
30% clay, Tantau, Wansdorf Germany) and sand. Germination is
induced by a four day period at 4.degree. C., in the dark.
Subsequently the plants are grown under standard growth conditions.
In case the plants are Arabidopsis thaliana, the standard growth
conditions are: photoperiod of 16 h light and 8 h dark, 20.degree.
C., 60% relative humidity, and a photon flux density of 200 .mu.E.
In case the plants are Arabidopsis thaliana they are watered every
second day with a N-depleted nutrient solution. After 9 to 10 days
the plants are individualized. After a total time of 29 to 31 days
the plants are harvested and rated by the fresh weight of the
aerial parts of the plants, preferably the rosettes.
[0046] In a further embodiment, the tolerance to drought is
determined according to the method described in the examples.
[0047] Accordingly, in one embodiment, the present invention
relates to a method for increasing the yield, comprising the
following steps: [0048] (a) measuring the N content in the soil,
and [0049] (b) determining, whether the N-content in the soil is
optimal or suboptimal for the growth of an origin or wild type
plant, e.g. a crop, and [0050] (c1) growing the plant of the
invention in said soil, if the N-content is suboptimal for the
growth of the origin or wild type plant, or [0051] (c2) growing the
plant of the invention in the soil and comparing the yield with the
yield of a standard, an origin or a wild type plant and selecting
and growing the plant, which shows the highest yield, if the
N-content is optimal for the origin or wild type plant.
[0052] In a further embodiment of the present invention, plant
yield is increased by increasing the plant's stress
tolerance(s).
[0053] Generally, the term "increased tolerance to stress" can be
defined as survival of plants, and/or higher yield production,
under stress conditions as compared to a non-transformed wild type
or starting plant.
[0054] During its life-cycle, a plant is generally confronted with
a diversity of environmental conditions. Any such conditions, which
may, under certain circumstances, have an impact on plant yield,
are herein referred to as "stress" condition. Environmental
stresses may generally be divided into biotic and abiotic
(environmental) stresses. Unfavorable nutrient conditions are
sometimes also referred to as "environmental stress". The present
invention does also contemplate solutions for this kind of
environmental stress, e.g. referring to increased nutrient use
efficiency.
[0055] In a further embodiment of the present invention, plant
yield is increased by increasing the abiotic stress tolerance(s) of
a plant or a part thereof.
[0056] For the purposes of the description of the present
invention, the terms "enhanced tolerance to abiotic stress",
"enhanced resistance to abiotic environmental stress", "enhanced
tolerance to environmental stress", "improved adaptation to
environmental stress" and other variations and expressions similar
in its meaning are used interchangeably and refer, without
limitation, to an improvement in tolerance to one or more abiotic
environmental stress(es) as described herein and as compared to a
corresponding origin or wild type plant or a part thereof.
[0057] The term abiotic stress tolerance(s) refers for example low
temperature tolerance, drought tolerance, heat tolerance, salt
stress tolerance and others.
[0058] Stress tolerance in plants like low temperature, drought,
heat and salt stress tolerance can have a common theme important
for plant growth, namely the availability of water. Plants are
typically exposed during their life cycle to conditions of reduced
environmental water content. The protection strategies are similar
to those of chilling tolerance.
[0059] Accordingly, in one embodiment of the present invention,
said yield-related trait relates to an increased water use
efficiency of the plant of the invention and/or an increased
tolerance to drought conditions of the plant of the invention.
[0060] In one embodiment of the present invention drought stress
means any environmental stress which leads to a lack of water in
plants or reduction of water supply to plants, including a
secondary stress by low temperature and/or salt, and/or a primary
stress during drought or heat, e.g. desiccation etc.
[0061] Increased tolerance to drought conditions can be determined
and quantified according to the following method.
[0062] Transformed plants are grown individually in pots in a
growth chamber (York Industriekalte GmbH, Mannheim, Germany).
Germination is induced. In case the plants are Arabidopsis thaliana
sown seeds are kept at 4.degree. C., in the dark, for 3 days in
order to induce germination. Subsequently conditions are changed
for 3 days to 20.degree. C./6.degree. C. day/night temperature with
a 16/8 h day-night cycle at 150 .mu.E/m.sup.2s. Subsequently the
plants are grown under standard growth conditions. In case the
plants are Arabidopsis thaliana, the standard growth conditions
are: photoperiod of 16 h light and 8 h dark, 20.degree. C., 60%
relative humidity, and a photon flux density of 200 .mu.E. Plants
are grown and cultured until they develop leaves. In case the
plants are Arabidopsis thaliana they are watered daily until they
were approximately 3 weeks old. Starting at that time drought was
imposed by withholding water. After the non-transformed wild type
plants show visual symptoms of injury, the evaluation starts and
plants are scored for symptoms of drought symptoms and biomass
production comparison to wild type and neighboring plants for 5-6
days in succession.
[0063] In a further embodiment, the tolerance to drought, e.g. the
tolerance to cycling drought is determined according to the method
described in the examples.
[0064] In a preferred embodiment, the tolerance to drought is a
tolerance to cycling drought.
[0065] Accordingly, in one embodiment, the present invention
relates to a method for increasing the yield, comprising the
following steps: [0066] (a) determining, whether the water supply
in the area for planting is optimal or suboptimal for the growth of
an origin or wild type plant, e.g. a crop, and/or determining the
visual symptoms of injury of plants growing in the area for
planting; and [0067] (b1) growing the plant of the invention in
said soil, if the water supply is suboptimal for the growth of an
origin or wild type plant or visual symptoms for drought can be
found at a standard, origin or wild type plant growing in the area;
or [0068] (b2) growing the plant of the invention in the soil and
comparing the yield with the yield of a standard, an origin or a
wild type plant and selecting and growing the plant, which shows
the highest yield, if the water supply is optimal for the origin or
wild type plant.
[0069] Visual symptoms of injury stating for one or any combination
of two, three or more of the following features: [0070] a) wilting
[0071] b) leaf browning [0072] c) loss of turgor, which results in
drooping of leaves or needles stems, and flowers, [0073] d)
drooping and/or shedding of leaves or needles, [0074] e) the leaves
are green but leaf angled slightly toward the ground compared with
controls, [0075] f) leaf blades begun to fold (curl) inward, [0076]
g) premature senescence of leaves or needles, [0077] h) loss of
chlorophyll in leaves or needles and/or yellowing.
[0078] In a further embodiment of the present invention, said
yield-related trait of the plant of the invention is an increased
tolerance to heat conditions of said plant.
[0079] In-another embodiment of the present invention, said
yield-related trait of the plant of the invention is an increased
low temperature tolerance of said plant, e.g. comprising freezing
tolerance and/or chilling tolerance.
[0080] Low temperatures impinge on a plethora of biological
processes. They retard or inhibit almost all metabolic and cellular
processes The response of plants to low temperature is an important
determinant of their ecological range. The problem of coping with
low temperatures is exacerbated by the need to prolong the growing
season beyond the short summer found at high latitudes or
altitudes.
[0081] Most plants have evolved adaptive strategies to protect
themselves against low temperatures. Generally, adaptation to low
temperature may be divided into chilling tolerance, and freezing
tolerance.
[0082] Chilling tolerance is naturally found in species from
temperate or boreal zones and allows survival and an enhanced
growth at low but non-freezing temperatures. Species from tropical
or subtropical zones are chilling sensitive and often show wilting,
chlorosis or necrosis, slowed growth and even death at temperatures
around 10.degree. C. during one or more stages of development.
Accordingly, improved or enhanced "chilling tolerance" or
variations thereof refers herein to improved adaptation to low but
non-freezing temperatures around 10.degree. C., preferably
temperatures between 1 to 18.degree. C., more preferably
4-14.degree. C., and most preferred 8 to 12.degree. C.; hereinafter
called "chilling temperature".
[0083] Freezing tolerance allows survival at near zero to
particularly subzero temperatures. It is believed to be promoted by
a process termed cold-acclimation which occurs at low but
non-freezing temperatures and provides increased freezing tolerance
at subzero temperatures. In addition, most species from temperate
regions have life cycles that are adapted to seasonal changes of
the temperature. For those plants, low temperatures may also play
an important role in plant development through the process of
stratification and vernalisation. It becomes obvious that a
clear-cut distinction between or definition of chilling tolerance
and freezing tolerance is difficult and that the processes may be
overlapping or interconnected.
[0084] Improved or enhanced "freezing tolerance" or variations
thereof refers herein to improved adaptation to temperatures near
or below zero, namely preferably temperatures below 4.degree. C.,
more preferably below 3 or 2.degree. C., and particularly preferred
at or below 0 (zero).degree. C. or below -4.degree. C., or even
extremely low temperatures down to -10.degree. C. or lower;
hereinafter called "freezing temperature.
[0085] "Improved adaptation" to environmental stress like e.g.
freezing and/or chilling temperatures refers herein to an improved
plant performance resulting in an increased yield, particularly
with regard to one or more of the yield related traits as defined
in more detail above.
[0086] Accordingly, the plant of the invention may in one
embodiment show an early seedling growth after exposure to low
temperatures to an chilling-sensitive wild type or origin,
improving in a further embodiment seed germination rates. The
process of seed germination strongly depends on environmental
temperature and the properties of the seeds determine the level of
activity and performance during germination and seedling emergence
when being exposed to low temperature. The method of the invention
further provides in one embodiment a plant which show under
chilling condition an reduced delay of leaf development.
[0087] In one embodiment the method of the invention relates to a
production of a tolerant major crop, e.g. corn (maize), bean, rice,
soy bean, cotton, tomato, banana, cucumber or potato because most
major crops are chilling-sensitive.
[0088] Enhanced tolerance to low temperature may, for example, be
determined according to the following method:
[0089] Transformed plants are grown in pots in a growth chamber
(e.g. York, Mannheim, Germany). In case the plants are Arabidopsis
thaliana seeds thereof are sown in pots containing a 3.5:1 (v:v)
mixture of nutrient rich soil (GS90, Tantau, Wansdorf, Germany) and
sand. Plants are grown under standard growth conditions. In case
the plants are Arabidopsis thaliana, the standard growth conditions
are: photoperiod of 16 h light and 8 h dark, 20.degree. C., 60%
relative humidity, and a photon flux density of 200
.mu.mol/m.sup.2s. Plants are grown and cultured. In case the plants
are Arabidopsis thaliana they are watered every second day. After 9
to 10 days the plants are individualized. Cold (e.g. chilling at
11-12.degree. C.) is applied 14 days after sowing until the end of
the experiment. After a total growth period of 29 to 31 days the
plants are harvested and rated by the fresh weight of the aerial
parts of the plants, in the case of Arabidopsis preferably the
rosettes.
[0090] Accordingly, in one embodiment, the present invention
relates to a method for increasing yield, comprising the following
steps: [0091] (a) determining, whether the temperature in the area
for planting is optimal or suboptimal for the growth of an origin
or wild type plant, e.g. a crop; and [0092] (b1) growing the plant
of the invention in said soil; if the temperature is suboptimal low
for the growth of an origin or wild type plant growing in the area;
or [0093] (b2) growing the plant of the invention in the soil and
comparing the yield with the yield of a standard, an origin or a
wild type plant and selecting and growing the plant, which shows
the highest yield, if the temperature is optimal for the origin or
wild type plant;
[0094] In a further embodiment of the present invention,
yield-related trait may also be increased salinity tolerance (salt
tolerance), tolerance to osmotic stress, increased shade tolerance,
increased tolerance to a high plant density, increased tolerance to
mechanical stresses, and/or increased tolerance to oxidative
stress.
[0095] Accordingly, in one embodiment of the present invention,
yield is increased by improving one or more of the yield-related
traits as defined herein.
[0096] Thus, the present invention provides a method for producing
a transgenic plant showing an increased yield-related trait as
compared to a corresponding origin or wild type plant, by
increasing or generating one or more activities ("activities")
selected from the group consisting of (DL)glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein.
[0097] Thus, in one embodiment, the present invention provides a
method for producing a plant showing an increased stress
resistance, particularly abiotic stress resistance, as compared to
a corresponding origin or wild type plant, by increasing or
generating one or more said activities. In another embodiment, the
abiotic stress resistance achieved in accordance with the methods
of the present invention, and shown by the transgenic plant of the
invention; is increased low temperature tolerance, particularly
increased tolerance to chilling. In another embodiment, the abiotic
stress resistance achieved in accordance with the methods of the
present invention, and shown by the transgenic plant of the
invention; is increased drought tolerance, particularly increased
tolerance to cycling drought.
[0098] In another embodiment, the present invention provides a
method for producing a plant; showing an increased intrinsic yield,
as compared to a corresponding origin or wild type plant, by
increasing or generating one or more said activities.
[0099] In another embodiment, the present invention provides a
method for producing a plant; showing an increased nutrient use
efficiency, as compared to a corresponding origin or wild type
plant, by increasing or generating one or more said activities. In
another embodiment, the nutrient use efficiency achieved in
accordance with the methods of the present invention, and shown by
the transgenic plant of the invention; is increased nitrogen use
efficiency.
[0100] Thus, in one further embodiment of the present invention, a
method is provided for producing a transgenic plant; progenies,
seeds, and/or pollen derived from such plant; each showing an
increased an increased low temperature tolerance, particularly
chilling tolerance, as compared to a corresponding, e.g.
non-transformed, wild type plant cell or plant, by increasing or
generating one or more of said activities.
[0101] Thus, in one further embodiment of the present invention, a
method is provided for producing a transgenic plant; progenies,
seeds, and/or pollen derived from such plant; each showing an
increased an increased low temperature tolerance as well as
nitrogen use efficiency (NUE) and/or increased intrinsic yield
and/or cycling drought tolerance, particularly chilling tolerance,
and draught tolerance as compared to a corresponding, e.g.
non-transformed, wild type plant cell or plant, by increasing or
generating one or more of said activities.
[0102] Thus, in one further embodiment of the present invention, a
method is provided for producing a transgenic plant; progenies,
seeds, and/or pollen derived from such plant; each showing an
increased an increased low temperature tolerance as well as
nitrogen use efficiency (NUE) and increased cycling drought
tolerance or increased intrinsic yield, particularly chilling
tolerance, and draught tolerance and increase biomass as compared
to a corresponding, e.g. non-transformed, wild type plant cell or
plant, by increasing or generating one or more of said
activities.
[0103] Thus, in one further embodiment of the present invention, a
method is provided for producing a transgenic plant; progenies,
seeds, and/or pollen derived from such plant; each showing an
increased an increased low temperature tolerance as well as
nitrogen use efficiency (NUE) or increased cycling drought
tolerance and increased intrinsic yield, particularly chilling
tolerance, and draught tolerance and increase biomass as compared
to a corresponding, e.g. non-transformed, wild type plant cell or
plant, by increasing or generating one or more of said
activities.
[0104] Thus, in one further embodiment of the present invention, a
method is provided for producing a transgenic plant; progenies,
seeds, and/or pollen derived from such plant; each showing an
increased an increased low temperature tolerance as well as
nitrogen use efficiency (NUE) and increased cycling drought
tolerance and increased intrinsic yield, particularly chilling
tolerance, and draught tolerance and increase biomass as compared
to a corresponding, e.g. non-transformed, wild type plant cell or
plant, by increasing or generating one or more of said
activities.
[0105] Furthermore, in one embodiment, the present invention
provides a transgenic plant showing one or more increased
yield-related trait as compared to a corresponding, e.g.
non-transformed, origin or wild type plant cell or plant, by
increasing or generating one or more activities selected from the
above mentioned group of activities.
[0106] Further, the present invention relates to method for
producing a plant with increased yield as compared to a
corresponding wild type plant comprising at least one of the steps
selected from the group consisting of: [0107] (i) increasing or
generating the activity of a polypeptide comprising a polypeptide,
a consensus sequence or at least one polypeptide motif as depicted
in column 5 or 7 of table II or of table IV, respectively; [0108]
(ii) increasing or generating the activity of an expression product
of a nucleic acid molecule comprising a polynucleotide as depicted
in column 5 or 7 of table I, and [0109] (iii) increasing or
generating the activity of a functional equivalent of (i) or
(ii).
[0110] In one embodiment, the increase or generation of said one or
more activities is conferred by one or more nucleic acid sequences
comprising a polynucleotide selected from the group as shown in
table I, column 5 or 7. Accordingly, the increase or generation of
said one or more activities is for example conferred by one or more
expression products of said nucleic acid molecule, e.g. proteins.
Accordingly, in the present invention described above, the increase
or generation of said one or more activities is for example
conferred by one or more protein(s) each comprising a polypeptide
selected from the group as depicted in table II, column 5 and
7.
[0111] For the purposes of the description of the present
invention, the proteins having an activity selected from the group
consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoAtransferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein, protein(s) comprising a
polypeptide encoded by one or more nucleic acid sequences as shown
in table I, column 5 or 7, or protein(s) comprising a polypeptide
as depicted in table II, column 5 and 7, are also referred to as
"Yield Related Proteins" or "YRPs".
[0112] Accordingly, the genes of the present invention or used in
accordance with the present invention which encode a protein having
an activity selected from the group consisting of
(DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein, which encode a protein
comprising a polypeptide encoded for by a nucleic acid sequence as
shown in table I, column 5 or 7, and/or which encode a protein
comprising a polypeptide as depicted in table II, column 5 and 7,
are also referred to as "YRP encoding genes".
[0113] Thus, in one embodiment, the present invention provides a
method for producing a plant showing increased yield as compared to
a corresponding origin or wild type plant, by increasing or
generating one or more activities selected from the group
consisting of (DL)glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein, which is conferred by one or
more nucleic acid sequences comprising a polynucleotide selected
from the group as shown in table I, column 5 or 7 or by one or more
proteins each comprising a polypeptide encoded by one or more
nucleic acid sequences selected from the group as shown in table I,
column 5 or 7 or by one or more protein(s) each comprising a
polypeptide selected from the group as depicted in table II, column
5 and 7. As mentioned, the increase yield can be mediated by one or
more yield-related traits. Thus, the method of the invention
relates to the production of a plant showing said one or more
yield-related traits.
[0114] Thus, the present invention provides a method for producing
a plant showing an increased nutrient use efficiency, e.g. nitrogen
use efficiency (NUE), increased stress resistance particularly
abiotic stress resistance, increased nutrient use efficiency,
increased water use efficiency, and/or an increased stress
resistance, particularly abiotic stress resistance, particular low
temperature tolerance or draught tolerance or an increased
intrinsic yield.
[0115] In one embodiment, said activity selected from the group
consisting of: (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein is increased by increasing the
amount and/or specific activity of one or more proteins having said
activity, e.g. or of one of more polypeptides as depicted in table
II, column 5 and 7.
[0116] Further, he present invention relates to a method for
producing a plant with increased yield as compared to a
corresponding origin or wild type transgenic plant, which comprises
[0117] (a) increasing or generating, in a plant cell nucleus, a
plant cell, a plant or a part thereof, one or more activities
selected from the group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein; and [0118] (b) cultivating or
growing the plant cell, the plant or the part thereof under
conditions which permit the development of the plant cell, the
plant or the part thereof; and [0119] (c) recovering a plant
showing increased yield as compared to a corresponding, e.g.
non-transformed, origin or wild type plant; [0120] (d) and
optionally, selecting the plant or a part thereof, showing
increased yield, preferably improved nutrient use efficiency and/or
abiotic stress resistance, as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a transgenic plant or a part
thereof which shows visual symptoms of deficiency and/or death.
[0121] Furthermore, the present invention also relates to a method
for the identification of a plant with an increased yield
comprising screening a population of one or more plant cell nuclei,
plant cells, plant tissues or plants or parts thereof for an
activity selected from the group consisting of
(DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein, comparing the level of
activity with the activity level in a reference; identifying one or
more plant cell nuclei, plant cells, plant tissues or plants or
parts thereof with the activity increased compared to the
reference, optionally producing a plant from the identified plant
cell nuclei, cell or tissue.
[0122] In one further embodiment, the present invention also
relates to a method for the identification of a plant with an
increased yield comprising screening a population of one or more
plant cell nuclei, plant cells, plant tissues or plants or parts
thereof for the expression level of an nucleic acid coding for an
polypeptide conferring an activity selected from the group
consisting of (DL)glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein, comparing the level of
expression with a reference; identifying one or more plant cell
nuclei, plant cells, plant tissues or plants or parts thereof with
the expression level increased compared to the reference,
optionally producing a plant from the identified plant cell nuclei,
cell or tissue.
[0123] In another embodiment, the present invention relates to a
method for increasing yield of a population of plants, comprising
checking the growth temperature(s) in the area for planting,
comparing the temperatures with the optimal growth temperature of a
plant species or a variety considered for planting, planting and
growing the plant of the invention if the growth temperature is not
optimal for the planting and growing of the plant species or the
variety considered for planting. The method can be repeated in
parts or in whole once or more.
[0124] In one embodiment, it was an object of the present invention
to develop a process for improving the adaptation to environmental
stress, particularly adaptation to low temperature, i.e. enhancing
the tolerance to low temperature comprising but not limited to
enhancing chilling tolerance and/or freezing tolerance, in a
photosynthetic active organism, which are reflected alone or
altogether in such increased abiotic stress adaptation and/or a
process for an increased yield under conditions of abiotic stress,
particularly low temperature.
[0125] It was found that this object is achieved by providing a
process according to the present invention described herein.
[0126] It was further an object of the present invention to provide
a plant cell and/or a plant with enhanced tolerance to abiotic
environmental stress, particularly low temperature, and/or showing
under conditions of abiotic environmental stress like low
temperature an increased yield, as compared to a corresponding,
e.g. non-transformed, wild type or starting plant cell and/or
plant.
[0127] It was found that this object is achieved by providing a
plant cell and/or plant according to the present invention
described herein.
[0128] In one embodiment of the present invention, these traits are
achieved by a process for an enhanced tolerance to abiotic
environmental stress in a photosynthetic active organism,
preferably a plant, as compared to a corresponding
(non-transformed) wild type or starting photosynthetic active
organism.
[0129] "Improved adaptation" to environmental stress like e.g.
freezing and/or chilling temperatures refers to an improved plant
performance.
[0130] Accordingly, for the purposes of the description of the
present invention, the term "low temperature" with respect to low
temperature stress on a photosynthetic active organism, preferably
a plant and most preferred a crop plant, refers to any of the low
temperature conditions as described above, preferably chilling
and/or freezing temperatures as defined above, as the context
requires.
[0131] In a further embodiment, "enhanced tolerance to abiotic
environmental stress" in a photosynthetic active organism means
that the photosynthetic active organism, preferably a plant, when
confronted with abiotic environmental stress conditions as
mentioned above, e.g. like low temperature conditions including
chilling and freezing temperatures or drought, exhibits an enhanced
yield, e.g. a yield as mentioned above, e.g. a seed yield or
biomass yield, as compared to a corresponding (non-transformed)
wild type or starting photosynthetic active organism.
[0132] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced dry biomass yield as compared to
a corresponding, e.g. non-transformed, wild type photosynthetic
active organism. In an embodiment thereof, the term "enhanced
tolerance to abiotic environmental stress" in a photosynthetic
active organism means that the photosynthetic active organism,
preferably a plant, when confronted with abiotic environmental
stress conditions like low temperature conditions including
chilling and freezing temperatures, exhibits an enhanced aerial dry
biomass yield as compared to a corresponding, e.g. non-transformed,
wild type photosynthetic active organism.
[0133] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced underground dry biomass yield as
compared to a corresponding, e.g. non-transformed, wild type
photosynthetic active organism.
[0134] In another embodiment thereof, the term "enhanced tolerance
to abiotic environmental stress" in a photosynthetic active
organism means that the photosynthetic active organism, preferably
a plant, when confronted with abiotic environmental stress
conditions like low temperature conditions including chilling and
freezing temperatures, exhibits an enhanced fresh weight biomass
yield as compared to a corresponding, e.g. non-transformed, wild
type photosynthetic active organism.
[0135] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced aerial fresh weight biomass
yield as compared to a corresponding, e.g. non-transformed, wild
type photosynthetic active organism.
[0136] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced underground fresh weight biomass
yield as compared to a corresponding, e.g. non-transformed, wild
type photosynthetic active organism.
[0137] In another embodiment thereof, the term "enhanced tolerance
to abiotic environmental stress" in a photosynthetic active
organism means that the photosynthetic active organism, preferably
a plant, when confronted with abiotic environmental stress
conditions like low temperature conditions including chilling and
freezing temperatures, exhibits an enhanced yield of harvestable
parts of a plant as compared to a corresponding, e.g.
non-transformed, wild type photosynthetic active organism.
[0138] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of dry harvestable parts
of a plant as compared to a corresponding, e.g. non-transformed,
wild type photosynthetic active organism.
[0139] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of dry aerial harvestable
parts of a plant as compared to a corresponding, e.g.
non-transformed, wild type photosynthetic active organism.
[0140] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of underground dry
harvestable parts of a plant as compared to a corresponding, e.g.
non-transformed, wild type photosynthetic active organism.
[0141] In another embodiment thereof, the term "enhanced tolerance
to abiotic environmental stress" in a photosynthetic active
organism means that the photosynthetic active organism, preferably
a plant, when confronted with abiotic environmental stress
conditions like low temperature conditions including chilling and
freezing temperatures, exhibits an enhanced yield of fresh weight
harvestable parts of a plant as compared to a corresponding, e.g.
non-transformed, wild type photosynthetic active organism.
[0142] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of aerial fresh weight
harvestable parts of a plant as compared to a corresponding, e.g.
non-transformed, wild type photosynthetic active organism.
[0143] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of underground fresh
weight harvestable parts of a plant as compared to a corresponding,
e.g. non-transformed, wild type photosynthetic active organism.
[0144] In a further embodiment, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of the crop fruit as
compared to a corresponding, e.g. non-transformed, wild type
photosynthetic active organism.
[0145] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of the fresh crop fruit as
compared to a corresponding, e.g. non-transformed, wild type
photosynthetic active organism.
[0146] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of the dry crop fruit as
compared to a corresponding, e.g. non-transformed, wild type
photosynthetic active organism.
[0147] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced grain dry weight as compared to
a corresponding, e.g. non-transformed, wild type photosynthetic
active organism. In a further embodiment, the term "enhanced
tolerance to abiotic environmental stress" in a photosynthetic
active organism means that the photosynthetic active organism,
preferably a plant, when confronted with abiotic environmental
stress conditions like low temperature conditions including
chilling and freezing temperatures, exhibits an enhanced yield of
seeds as compared to a corresponding, e.g. non-transformed, wild
type photosynthetic active organism.
[0148] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of fresh weight seeds as
compared to a corresponding, e.g. non-transformed, wild type
photosynthetic active organism.
[0149] In an embodiment thereof, the term "enhanced tolerance to
abiotic environmental stress" in a photosynthetic active organism
means that the photosynthetic active organism, preferably a plant,
when confronted with abiotic environmental stress conditions like
low temperature conditions including chilling and freezing
temperatures, exhibits an enhanced yield of dry seeds as compared
to a corresponding, e.g. non-transformed, wild type photosynthetic
active organism.
[0150] In another embodiment of the present invention, these traits
are achieved by a process for an increased yield under conditions
of environmental stress, particularly abiotic environmental stress,
in a photosynthetic active organism, preferably a plant, as
compared to a corresponding (non-transformed) wild type or starting
photosynthetic active organism.
[0151] In one embodiment thereof, the term "increased yield" means
that the photosynthetic active organism, especially a plant,
exhibits an increased yield, e.g. exhibits an increased growth
rate, under conditions of abiotic environmental stress, compared to
the corresponding wild-type photosynthetic active organism.
[0152] An increased growth rate may be reflected inter alia by or
confers an increased biomass production of the whole plant, or an
increased biomass production of the aerial parts of a plant, or by
an increased biomass production of the underground parts of a
plant, or by an increased biomass production of parts of a plant,
like stems, leaves, blossoms, fruits, and/or seeds.
[0153] In an embodiment thereof, increased yield includes higher
fruit yields, higher seed yields, higher fresh matter production,
and/or higher dry matter production.
[0154] In another embodiment thereof, the term "increased yield"
means that the photosynthetic active organism, preferably plant,
exhibits an prolonged growth under conditions of abiotic
environmental stress, as compared to the corresponding, e.g.
non-transformed, wild type photosynthetic active organism. A
prolonged growth comprises survival and/or continued growth of the
photosynthetic active organism, preferably plant, at the moment
when the non-transformed wild type photosynthetic active organism
shows visual symptoms of deficiency and/or death.
[0155] Accordingly, in a preferred embodiment, the present
invention provides a method for producing a transgenic plant cell
with increased yield, e.g. tolerance to abiotic environmental
stress and/or another increased yield-related trait, as compared to
a corresponding, e.g. non-transformed, wild type plant cell by
increasing or generating one or more activities selected from the
group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein.
[0156] In one embodiment of the invention the proteins having an
activity selected from the group consisting of
(DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein and the polypeptides as
depicted in table II, column 5 and 7 are named "LTRRP" or "Yield
Related Proteins" ("YRPs"). Both terms shall have the same meaning
and are interchangeable.
[0157] In another preferred embodiment a photosynthetic active
organism, especially a plant, shows increased yield under
conditions of abiotic environmental stress, e.g. a plant, shows an
enhanced tolerance to abiotic environmental stress or another
yield-related trait.
[0158] In another embodiment this invention fulfills the need to
identify new, unique genes capable of conferring increased yield,
e.g. with an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
increased yield-related trait, to photosynthetic active organism,
preferably plants, upon expression or over-expression of endogenous
and/or exogenous genes.
[0159] In another embodiment thereof this invention fulfills the
need to identify new, unique genes capable of conferring increased
yield, e.g. with an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another increased yield-related trait, to photosynthetic active
organism, preferably plants, upon expression or over-expression of
endogenous genes.
[0160] In another embodiment thereof this invention fulfills the
need to identify new, unique genes capable of conferring increased
yield, e.g. with an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another increased yield-related trait, to photosynthetic active
organism, preferably plants, upon expression or over-expression of
exogenous genes.
[0161] In another embodiment this invention fulfills the need to
identify new, unique genes capable of conferring an enhanced
tolerance to abiotic environmental stress in combination with an
increase of yield to photosynthetic active organism, preferably
plants, upon expression or over-expression of endogenous and/or
exogenous genes.
[0162] Accordingly, the present invention relates to a method for
producing a for example transgenic photosynthetic active organism
or a part thereof, or a plant cell, a plant or a part thereof e.g.
for the generation of such a plant, with increased yield, e.g. with
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another increased
yield-related trait as compared to a corresponding for example
non-transformed wild type photosynthetic active organism or a part
thereof, or a plant cell, a plant or a part thereof, which
comprises [0163] (a) increasing or generating one or more
activities selected from the group consisting of
(DL)glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate phosphatase,
3-methyl-2-oxobutanoate hydroxymethyltransferase, alcohol
acetyltransferase, amino acid permease, aminomethyltransferase,
ammonium transporter, aquaporin, Arabinose transport system
ATP-binding protein, Argininosuccinate synthase, aspartate
aminotransferase, B1906-protein, B3410-protein, cardiolipin
synthetase, CoA-transferase-like protein (NAD(P)-binding), cobalt
transport protein, DNA and protein binding protein for controlling
the proteome at post-transcriptional level, Enoyl CoA hydratase,
enoyl-CoA hydratase, enoyl-CoA isomerase, ethanolamine kinase,
formate acetyltransferase 1, glucitol/sorbitol-specific enzyme IIA
component protein, glutamine synthetase, glutathione S-transferase,
glycerol dehydrogenase, Glycogen synthesis initiator protein,
GTP-binding protein, Heat shock protein, hexose transporter,
holo-[acyl-carrier-protein] synthase, inorganic phosphate
transporter, lanosterol synthase, Molybdenum-binding subunit of
aldehyde oxidases and xanthine dehydrogenases, multidrug resistance
protein, multiple drug resistance protein, NADH
dehydrogenase/NAD(P)H nitroreductase, oxidoreductase,
peptidyl-prolyl cis-trans isomerase, Peroxisomal targeting signal 2
receptor, Phosphoadenosine phosphosulfate reductase, Phosphocarrier
protein, Pirin-like protein, precorrin-6y methylase, protein
required for degradation of glycoproteins, pyrimidine
deaminase/reductase, Regulator of cell morphogenesis and NO
signaling, serine acetyltransferase, signalosome complex subunit,
SLR1094-protein, subunit of TORC1, thiol-specific monooxygenase,
transcriptional regulatory protein, transketolase, two-module
transport protein, uridine diphosphateN-acetylglucosamine
transporter, yer175w-a-protein, yhr213w-a-protein, YML079W-protein,
YMR157c-protein, YNL024C-protein, and YNR040W-protein in a
photosynthetic active organism or a part thereof, e.g. a plant
cell, a plant or a part thereof, and [0164] (b) growing the
photosynthetic active organism or a part thereof, e.g. a plant
cell, a plant or a part thereof under conditions which permit the
development of a photosynthetic active organism or a part thereof,
preferably a plant cell, a plant or a part thereof, with increased
yield, e.g. with an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type photosynthetic
active organism or a part thereof, preferably a plant cell, a plant
or a part thereof.
[0165] In an further embodiment, the present invention relates to a
method for producing a transgenic plant cell nucleus, a transgenic
plant cell, a transgenic plant or a part thereof, resulting in
increased yield as compared to a corresponding non-transformed wild
type plant cell, a transgenic plant or a part thereof, which
comprises [0166] (a) increasing or generating, in said plant cell
nucleus, plant cell, plant or part thereof, one or more activities
selected from the group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein; [0167] (b) growing a plant
cell, a plant or a part thereof under conditions, preferably in
presence or absence of nutrient deficiency and/or abiotic stress,
which permits the development of a plant cell, a plant or a part
thereof, showing increased yield as compared to a corresponding
non-transformed wild type plant cell, a transgenic plant or a part
thereto, and [0168] (c) selecting the plant cell, a plant or a part
thereof, showing increased yield, preferably improved nutrient use
efficiency and/or abiotic stress resistance, as compared to a
corresponding non-transformed wild type plant cell, a transgenic
plant or a part thereof which shows visual symptoms of deficiency
and/or death under said conditions.
[0169] In an embodiment the present invention relates to a method
for producing a, e.g. transgenic, photosynthetic active organism or
a part thereof, preferably a plant cell, a plant or a part thereof
with increased yield, e.g. with an increased yield-related trait,
for example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another increased yield-related trait as compared to a
corresponding e.g. non-transformed wild type photosynthetic active
organism or a part thereof, preferably a plant cell, a plant or a
part thereof, which comprises [0170] (a) increasing or generating
one or more activities selected from the group consisting of:
(DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, 61906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphateN-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein in a photosynthetic active
organism or a part thereof, preferably a plant cell, a plant or a
part thereof, [0171] (b) growing the photosynthetic active organism
or a part thereof, preferably a plant cell, a plant or a part
thereof together with e.g. non-transformed wild type photosynthetic
active organism or a part thereof, preferably a plant, e.g. under
conditions of abiotic environmental stress [0172] (c) selecting the
photosynthetic active organism or a part thereof, preferably a
plant cell, a plant or a part thereof, with increased yield, e.g.
with an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
increased yield-related trait, as compared to a corresponding, e.g.
non-transformed, wild type photosynthetic active organism or a part
thereof, preferably a plant cell, a plant or a part thereof, after
the, e.g. non-transformed, wild type photosynthetic active organism
or a part thereof, preferably a plant cell, a plant or a part
thereof, show visual symptoms of deficiency and/or death.
[0173] In one embodiment throughout the description abiotic
environmental stress, refers to low temperature stress.
[0174] In one embodiment the present invention relates to a method
for producing an, e.g. transgenic, photosynthetic active organism
or a part thereof, preferably a plant cell, a plant or a part
thereof, e.g. for the generation of said plant, with increased
yield, e.g. with an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type photosynthetic
active organism or a part thereof, preferably a plant cell, a plant
or a part thereof, which comprises [0175] (a) increasing or
generating the activity of a protein as shown in table II, column 3
or encoded by the nucleic acid sequences as shown in table I,
column 5, in photosynthetic active organism or a part thereof,
preferably a plant cell nucleus, a plant cell, a plant or a part
thereof, and [0176] (b) growing the photosynthetic active organism
or a part thereof, preferably a plant cell, a plant or a part
thereof under conditions which permit the development of a plant
with increased yield, e.g. with an increased yield-related trait,
for example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type photosynthetic
active organism or a part thereof, preferably a plant.
[0177] In one embodiment, said activity, e.g. the activity of said
protein as shown in table II, column 3 or encoded by the nucleic
acid sequences as shown in table I, column 5, is increased in the
part of a cell as indicated in table II or table I in column 6.
[0178] The method of the invention comprises in one embodiment the
following steps:
(i) increasing or generating of the expression of; and/or (ii)
increasing or generating the expression of an expression product;
and/or (iii) increasing or generating one or more activities of an
expression product encoded by; at least one nucleic acid molecule
comprising a nucleic acid molecule selected from the group
consisting of: [0179] (a) a nucleic acid molecule encoding the
polypeptide shown in column 5 or 7 of table II; [0180] (b) a
nucleic acid molecule shown in column 5 or 7 of table I; [0181] (c)
a nucleic acid molecule, which, as a result of the degeneracy of
the genetic code, can be derived from a polypeptide sequence
depicted in column 5 or 7 of table II and confers an increased
yield as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a transgenic plant or a part thereof; [0182] (d) a
nucleic acid molecule having at least 30% identity with the nucleic
acid molecule sequence of a polynucleotide comprising the nucleic
acid molecule shown in column 5 or 7 of table I and confers an
increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a transgenic plant or a part
thereof; [0183] (e) a nucleic acid molecule encoding a polypeptide
having at least 30% identity with the amino acid sequence of the
polypeptide encoded by the nucleic acid molecule of (a) to (c) and
having the activity represented by a nucleic acid molecule
comprising a polynucleotide as depicted in column 5 of table I and
confers an increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a transgenic plant or a part
thereof; [0184] (f) a nucleic acid molecule which hybridizes with a
nucleic acid molecule of (a) to (c) under stringent hybridization
conditions and confers an increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a
transgenic plant or a part thereof; [0185] (g) a nucleic acid
molecule encoding a polypeptide which can be isolated with the aid
of monoclonal or polyclonal antibodies made against a polypeptide
encoded by one of the nucleic acid molecules of (a) to (e) and
having the activity represented by the nucleic acid molecule
comprising a polynucleotide as depicted in column 5 of table I;
[0186] (h) a nucleic acid molecule encoding a polypeptide
comprising the consensus sequence or one or more polypeptide motifs
as shown in column 7 of table IV and preferably having the activity
represented by a nucleic acid molecule comprising a polynucleotide
as depicted in column 5 of table II or IV; [0187] (i) a nucleic
acid molecule encoding a polypeptide having the activity
represented by a protein as depicted in column 5 of table II and
conferring increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a transgenic plant or a part
thereof; [0188] (j) nucleic acid molecule which comprises a
polynucleotide, which is obtained by amplifying a cDNA library or a
genomic library using the primers in column 7 of table III and
preferably having the activity represented by a nucleic acid
molecule comprising a polynucleotide as depicted in column 5 of
table II or IV; and [0189] (k) a nucleic acid molecule which is
obtainable by screening a suitable nucleic acid library under
stringent hybridization conditions with a probe comprising a
complementary sequence of a nucleic acid molecule of (a) or (b) or
with a fragment thereof, having at least 15 nt, preferably 20 nt,
30 nt, 50 nt, 100 nt, 200 nt, or 500 nt, 1000 nt, 1500 nt, 2000 nt
or 3000 nt of a nucleic acid molecule complementary to a nucleic
acid molecule sequence characterized in (a) to (e) and encoding a
polypeptide having the activity represented by a protein comprising
a polypeptide as depicted in column 5 of table II.
[0190] Furthermore, the present invention relates to a method for
producing a transgenic plant with increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant, transforming
a plant cell or a plant cell nucleus or a plant tissue to produce
such a plant, with a nucleic acid molecule comprising a nucleic
acid molecule selected from the group consisting of: [0191] (a) a
nucleic acid molecule encoding the polypeptide shown in column 5 or
7 of table II; [0192] (b) a nucleic acid molecule shown in column 5
or 7 of table I; [0193] (c) a nucleic acid molecule, which, as a
result of the degeneracy of the genetic code, can be derived from a
polypeptide sequence depicted in column 5 or 7 of table II and
confers an increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a transgenic plant or a part
thereof; [0194] (d) a nucleic acid molecule having at least 30%
identity with the nucleic acid molecule sequence of a
polynucleotide comprising the nucleic acid molecule shown in column
5 or 7 of table I and confers an increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a
transgenic plant or a part thereof; [0195] (e) a nucleic acid
molecule encoding a polypeptide having at least around 30% identity
with the amino acid sequence of the polypeptide encoded by the
nucleic acid molecule of (a) to [0196] (c) and having the activity
represented by a nucleic acid molecule comprising a polynucleotide
as depicted in column 5 of table I and confers an increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a transgenic plant or a part thereof; [0197] (f) a
nucleic acid molecule which hybridizes with a nucleic acid molecule
of (a) to (c) under stringent hybridization conditions and confers
an increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a transgenic plant or a part
thereof; [0198] (g) a nucleic acid molecule encoding a polypeptide
which can be isolated with the aid of monoclonal or polyclonal
antibodies made against a polypeptide encoded by one of the nucleic
acid molecules of (a) to (e) and having the activity represented by
the nucleic acid molecule comprising a polynucleotide as depicted
in column 5 of table I; [0199] (h) a nucleic acid molecule encoding
a polypeptide comprising the consensus sequence or one or more
polypeptide motifs as shown in column 7 of table IV and preferably
having the activity represented by a nucleic acid molecule
comprising a polynucleotide as depicted in column 5 of table II or
IV; [0200] (i) a nucleic acid molecule encoding a polypeptide
having the activity represented by a protein as depicted in column
5 of table II and conferring increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a
transgenic plant or a part thereof; [0201] (j) nucleic acid
molecule which comprises a polynucleotide, which is obtained by
amplifying a cDNA library or a genomic library using the primers in
column 7 of table III and preferably having the activity
represented by a nucleic acid molecule comprising a polynucleotide
as depicted in column 5 of table II or IV; and [0202] (k) a nucleic
acid molecule which is obtainable by screening a suitable nucleic
acid library under stringent hybridization conditions with a probe
comprising a complementary sequence of a nucleic acid molecule of
(a) or (b) or with a fragment thereof, having at least 50 nt of a
nucleic acid molecule complementary to a nucleic acid molecule
sequence characterized in (a) to (e) and encoding a polypeptide
having the activity represented by a protein comprising a
polypeptide as depicted in column 5 of table II, and regenerating a
transgenic plant from that transformed plant cell nucleus, plant
cell or plant tissue with increased yield.
[0203] A modification, i.e. an increase, can be caused by
endogenous or exogenous factors. For example, an increase in
activity in an organism or a part thereof can be caused by adding a
gene product or a precursor or an activator or an agonist to the
media or nutrition or can be caused by introducing said subjects
into a organism, transient or stable. Furthermore such an increase
can be reached by the introduction of the inventive nucleic acid
sequence or the encoded protein in the correct cell compartment for
example into the nucleus or cytoplasmic respectively or into
plastids either by transformation and/or targeting. For the
purposes of the description of the present invention, the terms
"cytoplasmic" and "non-targeted" shall indicate, that the nucleic
acid of the invention is expressed without the addition of an
non-natural transit peptide encoding sequence. A non-natural
transit peptide encoding sequence is a sequence which is not a
natural part of a nucleic acid of the invention, e.g. of the
nucleic acids depicted in table I column 5 or 7, but is rather
added by molecular manipulation steps as for example described in
the example under "plastid targeted expression". Therefore the
terms "cytoplasmic" and "non-targeted" shall not exclude a targeted
localisation to any cell compartment for the products of the
inventive nucleic acid sequences by their naturally occurring
sequence properties within the background of the transgenic
organism. The sub-cellular location of the mature polypeptide
derived from the enclosed sequences can be predicted by a skilled
person for the organism (plant) by using software tools like
TargetP (Emanuelsson et al., (2000), Predicting sub-cellular
localization of proteins based on their N-terminal amino acid
sequence, J. Mol. Biol. 300, 1005-1016), ChloroP (Emanuelsson et
al. (1999), ChloroP, a neural network-based method for predicting
chloroplast transit peptides and their cleavage sites, Protein
Science, 8: 978-984.) or other predictive software tools
(Emanuelsson et al. (2007), Locating proteins in the cell using
TargetP, SignalP, and related tools, Nature Protocols 2,
953-971).
[0204] Accordingly, the present invention relates to a method for
producing a, e.g. transgenic plant cell, a plant or a part thereof,
with increased yield, e.g. with an increased yield-related trait,
for example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof, which comprises [0205] (a) increasing or
generating one or more activities selected from the group
consisting of (DL)glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphateN-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein in an organelle, especially in
the plastid of a plant cell, and [0206] (b) growing the plant cell
under conditions which permit the development of a plant with
increased yield, e.g. with an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant.
[0207] In one embodiment, an activity as disclosed herein as being
conferred by a polypeptide shown in table II is increase or
generated in the plastid, e.g. an organelle, if in column 6 of each
table I the term "plastidic" is listed for said polypeptide.
[0208] In another embodiment the present invention relates to a
method for producing an, e.g. transgenic, plant cell, a plant or a
part thereof with increased yield, e.g. with an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another increased yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a plant or a part thereof, which comprises [0209]
(a) increasing or generating one or more activities selected from
the group consisting of (DL)glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphateN-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein in the cytoplasm of a plant
cell, and [0210] (b) growing the plant cell under conditions which
permit the development of a plant with increased yield, e.g. with
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another increased
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant.
[0211] In one embodiment, an activity as disclosed herein as being
conferred by a polypeptide shown in table II is increase or
generated in the cytoplasm, if in column 6 of each table I the term
"cytoplasmic" is listed for said polypeptide.
[0212] In one embodiment, the activity of SLR1348 as disclosed
herein as being conferred by a polypeptide shown in table II, as
hit 44 is increase or generated in the mitochondria.
[0213] In one embodiment the present invention relates to a method
for producing an e.g. transgenic, plant cell, a plant or a part
thereof with increased yield, e.g. with an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another increased yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, a plant or a part thereof, which comprises [0214] (a)
increasing or generating the activity of a protein as shown in
table II, column 3 encoded by the nucleic acid sequences as shown
in table I, column 5 or 7, in the cellular compartment as indicated
in column 6 of said tables, and [0215] (b) growing the plant cell
under conditions which permit the development of a plant with
increased yield, e.g. with an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant.
[0216] In one embodiment the present invention relates to a method
for producing an e.g. transgenic, plant cell, a plant or a part
thereof with increased yield, e.g. with an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another increased yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, a plant or a part thereof, which comprises [0217] (a)
increasing or generating the activity of a protein as shown in
table II, column 3 encoded by the nucleic acid sequences as shown
in table I, column 5 or 7, in an organelle, especially in the
plastid of a plant cell, and [0218] (b) growing the plant cell
under conditions which permit the development of a plant with
increased yield, e.g. with an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another increased yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant.
[0219] In one embodiment, an activity of polypeptide shown in table
II is increase or generated in the plastid, if in column 6 of table
I the term "plastid" is listed for said polypeptide.
[0220] In one embodiment the present invention relates to a method
for producing a, e.g. transgenic, plant cell, a plant or a part
thereof with increased yield, e.g. with an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another increased yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, a plant or a part thereof, which comprises [0221] (a)
increasing or generating the activity of a protein as shown in
table II, column 3 encoded by the nucleic acid sequences as shown
in table I, column 5 or 7, in the cytoplasm of a plant cell, and
[0222] (b) growing the plant cell under conditions which permit the
development of a plant with increased yield, e.g. with an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another increased yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant.
[0223] In one embodiment, an activity of polypeptide shown in table
II is increase or generated in the cytoplasm, if in column 6 of
table I the term "cytoplasm" is listed for said polypeptide.
[0224] In one embodiment, an activity of polypeptide shown in table
II is increase or generated in the cytoplasm and other
compartments, e.g. plastids and/or mitochondria, of a plant cell,
if in column 6 of table I the term "cytoplasm" is listed for said
polypeptide.
[0225] In one embodiment the present invention relates to a method
for producing a, e.g. transgenic, plant cell, a plant or a part
thereof with increased yield, e.g. with an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another increased yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, a plant or a part thereof, which comprises [0226] (a)
increasing or generating the activity of a protein as shown in
table II, column 3 encoded by the nucleic acid sequences as shown
in table I, column 5 or 7, in the mitoyhondria of a plant cell, and
[0227] (b) growing the plant cell under conditions which permit the
development of a plant with increased yield, e.g. with an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another increased yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant.
[0228] In one embodiment, an activity of polypeptide shown in table
II is increase or generated in the mitochondria, if in column 6 of
table I the term "mitochondria" is listed for said polypeptide.
[0229] In another embodiment the present invention is related to a
method for producing an e.g. transgenic, plant cell, a plant or a
part thereof with increased yield, e.g. with an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another increased yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a plant or a part thereof, which comprises [0230]
(a1) increasing or generating one or more activities selected from
the group consisting of (DL)glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphateN-acetylglucosamine transporter, yen 75w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein in an organelle of a plant
cell, or [0231] (a2) increasing or generating the activity of a
protein as shown in table II, column 3 encoded by the nucleic acid
sequences as shown in table I, column 5 or 7, which are joined to a
nucleic acid sequence encoding a transit peptide in a plant cell;
or [0232] (a3) increasing or generating the activity of a protein
as shown in table II, column 3 encoded by the nucleic acid
sequences as shown in table I, column 5 or 7, which are joined to a
nucleic acid sequence encoding an organelle localization sequence,
especially a chloroplast localization sequence, in a plant cell,
and [0233] (b) growing the plant cell under conditions which permit
the development of a plant with increased yield, e.g. with an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another increased
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant.
[0234] In another embodiment, the present invention relates to a
method for producing a transgenic plant cell, a plant or a part
thereof with increased yield, e.g. with an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another increased yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, a plant or a part thereof, which comprises [0235] (a1)
increasing or generating the activity of a protein as shown in
table II, column 3 encoded by the nucleic acid sequences as shown
in table I, column 5 or 7, in an organelle of a plant through the
transformation of the organelle, or [0236] (a2) increasing or
generating the activity of a protein as shown in table II, column 3
encoded by the nucleic acid sequences as shown in table I, column 5
or 7 in the plastid of a plant, or in one or more parts thereof
through the transformation of the plastids; and [0237] (b) growing
the plant cell under conditions which permit the development of a
plant with enhanced tolerance to abiotic environmental stress
and/or increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant.
[0238] Consequently, the present invention also refers to a method
for producing a plant with increased yield, e.g. based on an
increased or improved yield-related trait, as compared to a
corresponding wild type plant comprising at least one of the steps
selected from the group consisting of: [0239] (i) increasing or
generating the activity of a polypeptide comprising a polypeptide,
a consensus sequence or at least one polypeptide motif as depicted
in column 5 or 7 of table II or of table IV, respectively; [0240]
(ii) increasing or generating the activity of an expression product
of a nucleic acid molecule comprising a polynucleotide as depicted
in column 5 or 7 of table I, and [0241] (iii) increasing or
generating the activity of a functional equivalent of (i) or
(ii).
[0242] In principle the nucleic acid sequence encoding a transit
peptide can be isolated from every organism such as microorganisms
such as algae or plants containing plastids preferably
chloroplasts. A "transit peptide" is an amino acid sequence, whose
encoding nucleic acid sequence is translated together with the
corresponding structural gene. That means the transit peptide is an
integral part of the translated protein and forms an amino terminal
extension of the protein. Both are translated as so called
"pre-protein". In general the transit peptide is cleaved off from
the pre-protein during or just after import of the protein into the
correct cell or ganelle such as a plastid to yield the mature
protein. The transit peptide ensures correct localization of the
mature protein by facilitating the transport of proteins through
intracellular membranes.
[0243] Nucleic acid sequences encoding a transit peptide can be
derived from a nucleic acid sequence encoding a protein finally
resided in the plastid and stemming from an organism selected from
the group consisting of the genera Acetabularia, Arabidopsis,
Brassica, Capsicum, Chlamydomonas, Cururbita, Dunaliella, Euglena,
Flayeria, Glycine, Helianthus, Hordeum, Lemna, Lolium, Lycopersion,
Malus, Medicago, Mesembryanthemum, Nicotiana, Oenotherea, Oryza,
Petunia, Phaseolus, Physcomitrella, Pinus, Pisum, Raphanus, Silene,
Sinapis, Solanum, Spinacea, Stepvia, Synechococcus, Triticum and
Zea.
[0244] For example, such transit peptides, which are beneficially
used in the inventive process, are derived from the nucleic acid
sequence encoding a protein selected from the group consisting of
ribulose bisphosphate carboxylase/oxygenase,
5-enolpyruvyl-shikinnate-3-phosphate synthase, acetolactate
synthase, chloroplast ribosomal protein CS17, Cs protein,
ferredoxin, plastocyanin, ribulose bisphosphate carboxylase
activase, tryptophan synthase, acyl carrier protein, plastid
chaperonin-60, cytochrome c552, 22-kDA heat shock protein, 33-kDa
0xygen-evolving enhancer protein 1, ATP synthase y subunit, ATP
synthase .delta. subunit, chlorophyll-a/b-binding proteinII-1,
Oxygen-evolving enhancer protein 2, Oxygen-evolving enhancer
protein 3, photosystem I: P21, photosystem I: P28, photosystem I:
P30, photosystem I: P35, photosystem I: P37, glycerol-3-phosphate
acyltransferases, chlorophyll a/b binding protein, CAB2 protein,
hydroxymethyl-bilane synthase, pyruvate-orthophosphate dikinase,
CAB3 protein, plastid ferritin, ferritin, early light-inducible
protein, glutamate-1-semialdehyde aminotransferase,
protochlorophyllide reductase, starch-granule-bound amylase
synthase, light-harvesting chlorophyll a/b-binding protein of
photosystem II, major pollen allergen Lol p 5a, plastid CIpB
ATP-dependent protease, superoxide dismutase, ferredoxin NADP
oxidoreductase, 28-kDa ribonucleoprotein, 31-kDa ribonucleoprotein,
33-kDa ribonucleoprotein, acetolactate synthase, ATP synthase
CF.sub.0 subunit 1, ATP synthase CF.sub.0 subunit 2, ATP synthase
CF.sub.0 subunit 3, ATP synthase CF.sub.0 subunit 4, cytochrome f,
ADP-glucose pyrophosphorylase, glutamine synthase, glutamine
synthase 2, carbonic anhydrase, GapA protein, heat-shock-protein
hsp21, phosphate translocator, plastid CIpA ATP-dependent protease,
plastid ribosomal protein CL24, plastid ribosomal protein CL9,
plastid ribosomal protein PsCL18, plastid ribosomal protein PsCL25,
DAHP synthase, starch phosphorylase, root acyl carrier protein II,
betaine-aldehyde dehydrogenase, GapB protein, glutamine synthetase
2, phosphoribulokinase, nitrite reductase, ribosomal protein L12,
ribosomal protein L13, ribosomal protein L21, ribosomal protein
L35, ribosomal protein L40, triose
phosphate-3-phosphoglyerate-phosphate translocator,
ferredoxin-dependent glutamate synthase, glyceraldehyde-3-phosphate
dehydrogenase, NADP-dependent malic enzyme and NADP-malate
dehydrogenase.
[0245] In one embodiment the nucleic acid sequence encoding a
transit peptide is derived from a nucleic acid sequence encoding a
protein finally resided in the plastid and stemming from an
organism selected from the group consisting of the species
Acetabularia mediterranea, Arabidopsis thaliana, Brassica
campestris, Brassica napus, Capsicum annuum, Chlannydonnonas
reinhardtii, Cururbita moschata, Dunaliella salina, Dunaliella
tertiolecta, Euglena gracilis, Flayeria trinervia, Glycine max,
Helianthus annuus, Hordeum vulgare, Lemna gibba, Lolium perenne,
Lycopersion esculentum, Malus domestica, Medicago falcata, Medicago
sativa, Mesembryanthemum crystallinum, Nicotiana plumbaginifolia,
Nicotiana sylvestris, Nicotiana tabacum, Oenotherea hookeri, Oryza
sativa, Petunia hybrida, Phaseolus vulgaris, Physconnitrella
patens, Pinus tunbergii, Pisum sativum, Raphanus sativus, Silene
pratensis, Sinapis alba, Solanum tuberosum, Spinacea oleracea,
Stevia rebaudiana, Synechococcus, Synechocystis, Triticum aestivum
and Zea mays.
[0246] Nucleic acid sequences are encoding transit peptides are
disclosed by von Heijne et al. (Plant Molecular Biology Reporter, 9
(2), 104, (1991)), which are hereby incorporated by reference.
Table V shows some examples of the transit peptide sequences
disclosed by von Heijne et al.
[0247] According to the disclosure of the invention especially in
the examples the skilled worker is able to link other nucleic acid
sequences disclosed by von Heijne et al. to the nucleic acid
sequences shown in table I, columns 5 and 7, e.g. for the nucleic
acid molecules for which in column 6 of table I the term
"plastidic" is indicated.
[0248] Nucleic acid sequences encoding transit peptides are derived
from the genus Spinacia such as chloroplast 30S ribosomal protein
PSrp-1, root acyl carrier protein II, acyl carrier protein, ATP
synthase: .gamma. subunit, ATP synthase: .delta. subunit, cytochrom
f, ferredoxin I, ferredoxin NADP oxidoreductase (=FNR), nitrite
reductase, phosphoribulokinase, plastocyanin or carbonic anhydrase.
The skilled worker will recognize that various other nucleic acid
sequences encoding transit peptides can easily isolated from
plastid-localized proteins, which are expressed from nuclear genes
as precursors and are then targeted to plastids. Such transit
peptides encoding sequences can be used for the construction of
other expression constructs. The transit peptides advantageously
used in the inventive process and which are part of the inventive
nucleic acid sequences and proteins are typically 20 to 120 amino
acids, preferably 25 to 110, 30 to 100 or 35 to 90 amino acids,
more preferably 40 to 85 amino acids and most preferably 45 to 80
amino acids in length and functions post-translational to direct
the protein to the plastid preferably to the chloroplast. The
nucleic acid sequences encoding such transit peptides are localized
upstream of nucleic acid sequence encoding the mature protein. For
the correct molecular joining of the transit peptide encoding
nucleic acid and the nucleic acid encoding the protein to be
targeted it is sometimes necessary to introduce additional base
pairs at the joining position, which forms restriction enzyme
recognition sequences useful for the molecular joining of the
different nucleic acid molecules. This procedure might lead to very
few additional amino acids at the N-terminal of the mature imported
protein, which usually and preferably do not interfere with the
protein function. In any case, the additional base pairs at the
joining position which forms restriction enzyme recognition
sequences have to be chosen with care, in order to avoid the
formation of stop codons or codons which encode amino acids with a
strong influence on protein folding, like e.g. proline. It is
preferred that such additional codons encode small structural
flexible amino acids such as glycine or alanine.
[0249] As mentioned above the nucleic acid sequences coding for the
proteins as shown in table II, column 3 or 5 and its homologs as
disclosed in table I, columns 7 can be joined to a nucleic acid
sequence encoding a transit peptide, e.g. if for the nucleic acid
molecule in column 6 of table I the term "plastidic" is indicated.
This nucleic acid sequence encoding a transit peptide ensures
transport of the protein to the respective organelle, especially
the plastid.
[0250] The nucleic acid sequence of the gene to be expressed and
the nucleic acid sequence encoding the transit peptide are operably
linked. Therefore the transit peptide is fused in frame to the
nucleic acid sequence coding for proteins as shown in table II,
column 3 or 5 and its homologs as disclosed in table I, columns 5,
e.g. if for the nucleic acid molecule in column 6 of table I the
term "plastidic" is indicated.
[0251] The term "organelle" according to the invention shall mean
for example "mitochondria" or preferably "plastid" (throughout the
specification the "plural" shall comprise the "singular" and vice
versa). The term "plastid" according to the invention are intended
to include various forms of plastids including proplastids,
chloroplasts, chromoplasts, gerontoplasts, leucoplasts,
amyloplasts, elaioplasts and etioplasts, preferably chloroplasts.
They all have as a common ancestor the aforementioned
proplasts.
[0252] Other transit peptides are disclosed by Schmidt et al. (J.
Biol. Chem. 268 (36), 27447 (1993)), Della-Cioppa et al. (Plant.
Physiol. 84, 965 (1987)), de Castro Silva Filho et al. (Plant Mol.
Biol. 30, 769 (1996)), Zhao et al. (J. Biol. Chem. 270 (11), 6081
(1995)), Romer et al. (Biochem. Biophys. Res. Commun. 196 (3), 1414
(1993)), Keegstra et al. (Annu. Rev. Plant Physiol. Plant Mol.
Biol. 40, 471 (1989)), Lubben et al. (Photosynthesis Res. 17, 173
(1988)) and Lawrence et al. (J. Biol. Chem. 272 (33), 20357
(1997)). A general review about targeting is disclosed by Kermode
Allison R. in Critical Reviews in Plant Science 15 (4), 285 (1996)
under the title "Mechanisms of Intracellular Protein Transport and
Targeting in Plant Cells.".
[0253] Favored transit peptide sequences, which are used in the
inventive process and which form part of the inventive nucleic acid
sequences are generally enriched in hydroxyylated amino acid
residues (serine and threonine), with these two residues generally
constituting 20 to 35% of the total. They often have an
amino-terminal region empty of Gly, Pro, and charged residues.
Furthermore they have a number of small hydrophobic amino acids
such as valine and alanine and generally acidic amino acids are
lacking. In addition they generally have a middle region rich in
Ser, Thr, Lys and Arg. Overall they have very often a net positive
charge.
[0254] Alternatively, nucleic acid sequences coding for the transit
peptides may be chemically synthesized either in part or wholly
according to structure of transit peptide sequences disclosed in
the prior art. Said natural or chemically synthesized sequences can
be directly linked to the sequences encoding the mature protein or
via a linker nucleic acid sequence, which may be typically less
than 500 base pairs, preferably less than 450, 400, 350, 300, 250
or 200 base pairs, more preferably less than 150, 100, 90, 80, 70,
60, 50, 40 or 30 base pairs and most preferably less than 25, 20,
15, 12, 9, 6 or 3 base pairs in length and are in frame to the
coding sequence. Furthermore favorable nucleic acid sequences
encoding transit peptides may comprise sequences derived from more
than one biological and/or chemical source and may include a
nucleic acid sequence derived from the amino-terminal region of the
mature protein, which in its native state is linked to the transit
peptide. In a preferred embodiment of the invention said
amino-terminal region of the mature protein is typically less than
150 amino acids, preferably less than 140, 130, 120, 110, 100 or 90
amino acids, more preferably less than 80, 70, 60, 50, 40, 35, 30,
25 or 20 amino acids and most preferably less than 19, 18, 17, 16,
15, 14, 13, 12, 11 or 10 amino acids in length. But even shorter or
longer stretches are also possible. In addition target sequences,
which facilitate the transport of proteins to other cell
compartments such as the vacuole, endoplasmic reticulum, Golgi
complex, glyoxysomes, peroxisomes or mitochondria may be also part
of the inventive nucleic acid sequence.
[0255] The proteins translated from said inventive nucleic acid
sequences are a kind of fusion proteins that means the nucleic acid
sequences encoding the transit peptide, for example the ones shown
in table V, for example the last one of the table, are joint to the
nucleic acid sequences shown in table I, columns 5 and 7, e.g. if
for the nucleic acid molecule in column 6 of table I the term
"plastidic" is indicated. The person skilled in the art is able to
join said sequences in a functional manner. Advantageously the
transit peptide part is cleaved off from the protein part shown in
table II, columns 5 and 7 during the transport preferably into the
plastids. All products of the cleavage of the preferred transit
peptide shown in the last line of table V have preferably the
N-terminal amino acid sequences QIA CSS or QIA EFQLTT in front of
the start methionine of the protein mentioned in table II, columns
5 and 7. Other short amino acid sequences of an range of 1 to 20
amino acids preferable 2 to 15 amino acids, more preferable 3 to 10
amino acids most preferably 4 to 8 amino acids are also possible in
front of the start methionine of the protein mentioned in table II,
columns 5 and 7. In case of the amino acid sequence QIA CSS the
three amino acids in front of the start methionine are stemming
from the LIC (=ligation independent cloning) cassette. Said short
amino acid sequence is preferred in the case of the expression of
Escherichia coli genes. In case of the amino acid sequence QIA
EFQLTT the six amino acids in front of the start methionine are
stemming from the LIC cassette. Said short amino acid sequence is
preferred in the case of the expression of Saccharomyces cerevisiae
genes. The skilled worker knows that other short sequences are also
useful in the expression of the genes mentioned in table I, columns
5 and 7. Furthermore the skilled worker is aware of the fact that
there is not a need for such short sequences in the expression of
the genes.
TABLE-US-00001 TABLE V Examples of transit peptides disclosed by
von Heijne et al. Trans SEQ ID Pep Organism Transit Peptide NO:
Reference 1 Acetabularia MASIMMNKSVVLSKECAKPLATPK 17 Mol. Gen.
mediterranea VTLNKRGFATTIATKNREMMVWQP Genet. 218, FNNKMFETFSFLPP
445 (1989) 2 Arabidopsis MAASLQSTATFLQSAKIATAPSRG 18 EMBO J. 8,
thaliana SSHLRSTQAVGKSFGLETSSARLT 3187 (1989)
CSFQSDFKDFTGKCSDAVKIAGFA LATSALVVSGASAEGAPK 3 Arabidopsis
MAQVSRICNGVQNPSLICNLSKSS 19 Mol. Gen. thaliana
QRKSPLSVSLKTQQHPRAYPISSS Genet. 210, WGLKKSGMTLIGSELRPLKVMSSV 437
(1987) STAEKASEIVLQPIREISGLIKLP 4 Arabidopsis
MAAATTTTTTSSSISFSTKPSPSS 20 Plant Phys- thaliana
SKSPLPISRFSLPFSLNPNKSSSS iol. 85, SRRRGIKSSSPSSISAVLNTTTNV 1110
(1987) TTTPSPTKPTKPETFISRFAPDQP RKGA 5 Arabidopsis
MITSSLTCSLQALKLSSPFAHGST 21 J. Biol. thaliana
PLSSLSKPNSFPNHRMPALVPV Chem. 265, 2763 (1990) 6 Arabidopsis
MASLLGTSSSAIWASPSLSSPSSKP 22 EMBO J. 9, thaliana
SSSPICFRPGKLFGSKLNAGIQI 1337 (1990) RPKKNRSRYHVSVMNVATEINSTE
QVVGKFDSKKSARPVYPFAAI 7 Arabidopsis MASTALSSAIVGTSFIRRSPAPISL 23
Plant Phys- thaliana RSLPSANTQSLFGLKSGTARGG iol. 93, 572 RVVAM
(1990) 8 Arabidopsis MAASTMALSSPAFAGKAVNLSPAA 24 Nucl. Acids
thaliana SEVLGSGRVTNRKTV Res. 14, 4051 (1986) 9 Arabidopsis
MAAITSATVTIPSFTGLKLAVSSK 25 Gene 65, 59 thaliana
PKTLSTISRSSSATRAPPKLALKS (1988) SLKDFGVIAVATAASIVLAGNAMA
MEVLLGSDDGSLAFVPSEFT 10 Arabidopsis MAAAVSTVGAINRAPLSLNGSGSG 26
Nucl. Acids thaliana AVSAPASTFLGKKVVTVSRFAQSN Res. 17,
KKSNGSFKVLAVKEDKQTDGDRWR 2871 (1989) GLAYDTSDDQIDI 11 Arabidopsis
MKSSMLSSTAWTSPAQATMVAPF 27 Plant Mol. thaliana
TGLKSSASFPVTRKANNDITSITS Biol. 11, NGGRVSC 745 (1988) 12
Arabidopsis MAASGTSATFRASVSSAPSSSSQL 28 Proc. Natl. thaliana
THLKSPFKAVKYTPLPSSRSKSSS Acad. Sci. FSVSCTIAKDPPVLMAAGSDPALW USA,
86, QRPDSFGRFGKFGGKYVPE 4604 (1989) 13 Brassica
MSTTFCSSVCMQATSLAATTRISF 29 Nucl. Acids campestris
QKPALVSTTNLSFNLRRSIPTRFS Res. 15, ISCAAKPETVEKVSKIVKKQLSLK 7197
(1987) DDQKVVAE 14 Brassica MATTFSASVSMQATSLATTTRISF 30 Eur. J.
Bio- napus QKPVLVSNHGRTNLSFNLSRTRLSI chem. 174, SC 287 (1988) 15
Chlamydomonas MQALSSRVNIAAKPQRAQRLVVRA 31 Plant Mol. reinhardtii
EEVKAAPKKEVGPKRGSLVK Biol. 12, 463 (1989) 16 Cucurbita
MAELIQDKESAQSAATAAAASSGY 32 FEBS Lett. moschata ERRNEPAHSRK- 238,
424 FLEVRSEEELLSCIKK (1988) 17 Spinacea MSTINGCLTSISPSRTQLKNTSTL 33
J. Biol. oleracea RPTFIANSRVNPSSSVPPSLIRNQ Chem. 265,
PVFAAPAPIITPTL (10) 5414 (1990) 18 Spinacea
MTTAVTAAVSFPSTKTTSLSARCS 34 Curr. Genet. oleracea
SVISPDKISYKKVPLYYRNVSATG 13, 517 KMGPIRAQIASDVEAPPPAPAK- (1988)
VEKMS 19 Spinacea MTTAVTAAVSFPSTKTTSLSARSS 35 oleracea
SVISPDKISYKKVPLYYRNVSATG KMGPIRA
[0256] Alternatively to the targeting of the sequences shown in
table II, columns 5 and 7 preferably of sequences in general
encoded in the nucleus with the aid of the targeting sequences
mentioned for example in table V alone or in combination with other
targeting sequences preferably into the plastids, the nucleic acids
of the invention can directly be introduced into the plastidal
genome, e.g. for which in column 6 of table II the term "plastidic"
is indicated. Therefore in a preferred embodiment the nucleic acid
sequences shown in table I, columns 5 and 7 are directly introduced
and expressed in plastids, particularly if in column 6 of table I
the term "plastidic" is indicated.
[0257] The term "introduced" in the context of this specification
shall mean the insertion of a nucleic acid sequence into the
organism by means of a "transfection", "transduction" or preferably
by "transformation".
[0258] A plastid, such as a chloroplast, has been "transformed" by
an exogenous (preferably foreign) nucleic acid sequence if nucleic
acid sequence has been introduced into the plastid that means that
this sequence has crossed the membrane or the membranes of the
plastid. The foreign DNA may be integrated (covalently linked) into
plastid DNA making up the genome of the plastid, or it may remain
not integrated (e.g., by including a chloroplast origin of
replication). "Stably" integrated DNA sequences are those, which
are inherited through plastid replication, thereby transferring new
plastids, with the features of the integrated DNA sequence to the
progeny.
[0259] For expression a person skilled in the art is familiar with
different methods to introduce the nucleic acid sequences into
different organelles such as the preferred plastids. Such methods
are for example disclosed by Maiga P. (Annu. Rev. Plant Biol. 55,
289 (2004)), Evans T. (WO 2004/040973), McBride K. E. et al. (U.S.
Pat. No. 5,455,818), Daniell H. et al. (U.S. Pat. No. 5,932,479 and
U.S. Pat. No. 5,693,507) and Straub J. M. et al. (U.S. Pat. No.
6,781,033). A preferred method is the transformation of
microspore-derived hypocotyl or cotyledonary tissue (which are
green and thus contain numerous plastids) leaf tissue and
afterwards the regeneration of shoots from said transformed plant
material on selective medium. As methods for the transformation
bombarding of the plant material or the use of independently
replicating shuttle vectors are well known by the skilled worker.
But also a PEG-mediated transformation of the plastids or
Agrobacterium transformation with binary vectors is possible.
Useful markers for the transformation of plastids are positive
selection markers for example the chloramphenicol-, streptomycin-,
kanamycin-, neomycin-, amikamycin-, spectinomycin-, triazine-
and/or lincomycin-tolerance genes. As additional markers named in
the literature often as secondary markers, genes coding for the
tolerance against herbicides such as phosphinothricin
(=glufosinate, BASTA.TM., Liberty.TM., encoded by the bar gene),
glyphosate (.dbd.N-(phosphonomethyl)glycine, Roundup.TM., encoded
by the 5-enolpyruvylshikinnate-3-phosphate synthase gene=epsps),
sulfonylureas (like Staple.TM., encoded by the acetolactate
synthase (ALS) gene), imidazolinones [=IMI, like imazethapyr,
imazamox, Clearfield.TM., encoded by the acetohydroxyacid synthase
(AHAS) gene, also known as acetolactate synthase (ALS) gene] or
bromoxynil (=Buctril.TM., encoded by the oxy gene) or genes coding
for antibiotics such as hygromycin or G418 are useful for further
selection. Such secondary markers are useful in the case when most
genome copies are transformed. In addition negative selection
markers such as the bacterial cytosine deaminase (encoded by the
codA gene) are also useful for the transformation of plastids.
[0260] Thus, in one embodiment, an activity disclosed herein as
being conferred by a polypeptide shown in table II is increase or
generated by linking the polypeptide disclosed in table II or a
polypeptide conferring the same said activity with an targeting
signal as herein described, if in column 6 of table II the term
"plastidic" is listed for said polypeptide. For example, the
polypeptide described can be linked to the targeting signal shown
in table VII.
[0261] Accordingly, in the method of the invention for producing a
transgenic plant with increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant, comprising
transforming a plant cell or a plant cell nucleus or a plant tissue
with the mentioned nucleic acid molecule, said nucleic acid
molecule selected from said mentioned group encodes for a
polypeptide conferring said activity being linked to a targeting
signal as mentioned herein, e.g. as mentioned in table VII, e.g. if
in column 6 of table II the term "plastidic" is listed for the
encoded polypeptide.
[0262] To increase the possibility of identification of
transformants it is also desirable to use reporter genes other then
the aforementioned tolerance genes or in addition to said genes.
Reporter genes are for example .beta.-galactosidase-,
.beta.-glucuronidase-(GUS), alkaline phosphatase- and/or
green-fluorescent protein-genes (GFP).
[0263] By transforming the plastids the intraspecies specific
transgene flow is blocked, because a lot of species such as corn,
cotton and rice have a strict maternal inheritance of plastids. By
placing the genes specified in table I, columns 5 and 7, e.g. if
for the nucleic acid molecule in column 6 of table I the term
"plastidic" is indicated, or active fragments thereof in the
plastids of plants, these genes will not be present in the pollen
of said plants.
[0264] A further embodiment of the invention relates to the use of
so called "chloroplast localization sequences", in which a first
RNA sequence or molecule is capable of transporting or
"chaperoning" a second RNA sequence, such as a RNA sequence
transcribed from the sequences depicted in table I, columns 5 and 7
or a sequence encoding a protein, as depicted in table II, columns
5 and 7, from an external environment inside a cell or outside a
plastid into a chloroplast. In one embodiment the chloroplast
localization signal is substantially similar or complementary to a
complete or intact viroid sequence, e.g. if for the polypeptide in
column 6 of table II the term "plastidic" is indicated. The
chloroplast localization signal may be encoded by a DNA sequence,
which is transcribed into the chloroplast localization RNA. The
term "viroid" refers to a naturally occurring single stranded RNA
molecule (Flores, C. R. Acad Sci III. 324 (10), 943 (2001)).
Viroids usually contain about 200-500 nucleotides and generally
exist as circular molecules. Examples of viroids that contain
chloroplast localization signals include but are not limited to
ASBVd, PLMVd, CChMVd and ELVd. The viroid sequence or a functional
part of it can be fused to the sequences depicted in table I,
columns 5 and 7 or a sequence encoding a protein, as depicted in
table II, columns 5 and 7 in such a manner that the viroid sequence
transports a sequence transcribed from a sequence as depicted in
table I, columns 5 and 7 or a sequence encoding a protein as
depicted in table II, columns 5 and 7 into the chloroplasts, e.g.
e.g. if for said nucleic acid molecule or polynucleotide in column
6 of table I or II the term "plastidic" is indicated. A preferred
embodiment uses a modified ASBVd (Navarro et al., Virology. 268
(1), 218 (2000)).
[0265] In a further specific embodiment the protein to be expressed
in the plastids such as the proteins depicted in table II, columns
5 and 7, e.g. if for the polypeptide in column 6 of table II the
term "plastidic" is indicated, are encoded by different nucleic
acids. Such a method is disclosed in WO 2004/040973, which shall be
incorporated by reference. WO 2004/040973 teaches a method, which
relates to the translocation of an RNA corresponding to a gene or
gene fragment into the chloroplast by means of a chloroplast
localization sequence. The genes, which should be expressed in the
plant or plants cells, are split into nucleic acid fragments, which
are introduced into different compartments in the plant e.g. the
nucleus, the plastids and/or mitochondria. Additionally plant cells
are described in which the chloroplast contains a ribozyme fused at
one end to an RNA encoding a fragment of a protein used in the
inventive process such that the ribozyme can trans-splice the
translocated fusion RNA to the RNA encoding the gene fragment to
form and as the case may be reunite the nucleic acid fragments to
an intact mRNA encoding a functional protein for example as
disclosed in table II, columns 5 and 7.
[0266] In another embodiment of the invention the nucleic acid
sequences as shown in table I, columns 5 and 7, e.g. if in column 6
of table I the term "plastidic" is indicated, used in the inventive
process are transformed into plastids, which are metabolic active.
Those plastids should preferably maintain at a high copy number in
the plant or plant tissue of interest, most preferably the
chloroplasts found in green plant tissues, such as leaves or
cotyledons or in seeds.
[0267] In another embodiment of the invention the nucleic acid
sequences as shown in table I, columns 5 and 7, e.g. if in column 6
of table I the term "mitochondric" is indicated, used in the
inventive process are transformed into mitochondria, which are
metabolic active.
in the cytsol or cytoplasm or in an organelle such as a plastid or
mitochondria or both
[0268] For a good expression in the plastids the nucleic acid
sequences as shown in table I, columns 5 and 7, e.g. if in column 6
of table I the term "plastidic" is indicated, are introduced into
an expression cassette using a preferably a promoter and
terminator, which are active in plastids preferably a chloroplast
promoter. Examples of such promoters include the psbA promoter from
the gene from spinach or pea, the rbcL promoter, and the atpB
promoter from corn.
[0269] The terms "Comprises"/"comprising" and grammatical
variations thereof when used in this specification are to be taken
to specify the presence of stated features, integers, steps or
components or groups thereof, but not to preclude the presence or
addition of one or more other features, integers, steps, components
or groups thereof.
[0270] In accordance with the invention, the term "plant cell" or
the term "organism" as understood herein relates always to a plant
cell or a organelle thereof, preferably a plastid, more preferably
chloroplast.
[0271] As used herein, "plant" is meant to include not only a whole
plant but also a part thereof i.e., one or more cells, and tissues,
including for example, leaves, stems, shoots, roots, flowers,
fruits and seeds.
[0272] Surprisingly it was found, that the transgenic expression of
the Saccharomyces cerevisiae, E. coli, Synechocystis or A. thaliana
protein as shown in table II, column 3 in a plant such as A.
thaliana for example, conferred increased yield, e.g. with an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, increased nutrient use efficiency,
increased drought tolerance, low temperature tolerance and/or
another increased yield-related trait to the transgenic plant cell,
plant or a part thereof as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0273] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 39, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
38, or a homolog of said nucleic acid molecule or polypeptide, e.g.
in case the activity of the Escherichia coli nucleic acid molecule
or a polypeptide, respectively, comprising the nucleic acid SEQ ID
NO. 38 or polypeptide SEQ ID NO. 39, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 38 or polypeptide SEQ ID NO. 39,
respectively, is increased or generated or if the activity
"pyrimidine deaminase/reductase" is increased or generated in a
plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0274] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 39, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
38, a homolog of said nucleic acid molecule or polypeptide, e.g. in
case the activity of the Escherichia coli nucleic acid molecule or
a polypeptide comprising the nucleic acid SEQ ID NO. 38 or
polypeptide SEQ ID NO. 39, respectively, is increased or generated,
e.g. if the activity of a nucleic acid molecule or a polypeptide
comprising the nucleic acid or polypeptide or the consensus
sequence or the polypeptide motif, as depicted in table I, II or
IV, column 7 in the respective same line as the nucleic acid
molecule SEQ ID NO. 38 or polypeptide SEQ ID NO. 39, respectively,
is increased or generated or if the activity "pyrimidine
deaminase/reductase" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0275] Particularly, an increase of yield from 1.1-fold to
1.361-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding on-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0276] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 39, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
38, or a homolog of said nucleic acid molecule or polypeptide, e.g.
in case the activity of the Escherichia coli nucleic acid molecule
or a polypeptide comprising the nucleic acid SEQ ID NO. 38 or
polypeptide SEQ ID NO. 39, respectively, is increased or generated,
e.g. if the activity of a nucleic acid molecule or a polypeptide
comprising the nucleic acid or polypeptide or the consensus
sequence or the polypeptide motif, as depicted in table I, II or
IV, column 7 in the respective same line as the nucleic acid
molecule SEQ ID NO. 38 or polypeptide SEQ ID NO. 39, respectively,
is increased or generated or if the activity "pyrimidine
deaminase/reductase" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0277] Particularly, an increase of yield from 1.05-fold to
1.610-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0278] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 39, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
38, a homolog of said nucleic acid molecule or polypeptide, e.g. in
case the activity of the Escherichia coli nucleic acid molecule or
a polypeptide comprising the nucleic acid SEQ ID NO. 38 or
polypeptide SEQ ID NO. 39, respectively, is increased or generated,
e.g. if the activity of a nucleic acid molecule or a polypeptide
comprising the nucleic acid or polypeptide or the consensus
sequence or the polypeptide motif, as depicted in table I, II or
IV, column 7 in the respective same line as the nucleic acid
molecule SEQ ID NO. 38 or polypeptide SEQ ID NO. 39, respectively,
is increased or generated or if the activity "pyrimidine
deaminase/reductase" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0279] Particularly, an increase of yield from 1.05-fold to
1.168-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0280] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 148, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
147, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide, respectively, comprising the nucleic
acid SEQ ID NO. 147 or polypeptide SEQ ID NO. 148, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 147 or polypeptide SEQ ID
NO. 148, respectively, is increased or generated or if the activity
"oxidoreductase" is increased or generated in a plant cell, plant
or part thereof, especially if localized cytoplasmic, an increased
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0281] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 148, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
147, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide comprising the nucleic acid SEQ ID NO.
147 or polypeptide SEQ ID NO. 148, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 147 or polypeptide SEQ ID NO. 148,
respectively, is increased or generated or if the activity
"oxidoreductase" is increased or generated in a plant cell, plant
or part thereof, especially, if the polypeptide is cytoplasmic
localized, an increased tolerance to abiotic environmental stress,
in particular increased low temperature tolerance, compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0282] Particularly, an increase of yield from 1.1-fold to
1.357-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0283] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 148, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
147, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide comprising the nucleic acid SEQ ID NO.
147 or polypeptide SEQ ID NO. 148, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 147 or polypeptide SEQ ID NO. 148,
respectively, is increased or generated or if the activity
"oxidoreductase" is increased or generated in a plant cell, plant
or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0284] Particularly, an increase of yield from 1.05-fold to
1.209-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0285] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 148, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
147, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide comprising the nucleic acid SEQ ID NO.
147 or polypeptide SEQ ID NO. 148, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 147 or polypeptide SEQ ID NO. 148,
respectively, is increased or generated or if the activity
"oxidoreductase" is increased or generated in a plant cell, plant
or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0286] Particularly, an increase of yield from 1.05-fold to
1.088-fold, for example plus at least 100% thereof, under
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0287] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 173, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
172, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide, respectively, comprising the nucleic
acid SEQ ID NO. 172 or polypeptide SEQ ID NO. 173, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 172 or polypeptide SEQ ID
NO. 173, respectively, is increased or generated or if the activity
"glycerol dehydrogenase" is increased or generated in a plant cell,
plant or part thereof, especially if localized cytoplasmic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0288] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 173, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
172, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide comprising the nucleic acid SEQ ID NO.
172 or polypeptide SEQ ID NO. 173, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 172 or polypeptide SEQ ID NO. 173,
respectively, is increased or generated or if the activity
"glycerol dehydrogenase" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0289] Particularly, an increase of yield from 1.1-fold to
1.353-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0290] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 173, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
172, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide comprising the nucleic acid SEQ ID NO.
172 or polypeptide SEQ ID NO. 173, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 172 or polypeptide SEQ ID NO. 173,
respectively, is increased or generated or if the activity
"glycerol dehydrogenase" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0291] Particularly, an increase of yield from 1.05-fold to
1.457-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0292] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 173, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
172, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Escherichia coli nucleic acid
molecule or a polypeptide comprising the nucleic acid SEQ ID NO.
172 or polypeptide SEQ ID NO. 173, respectively, is increased or
generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 172 or polypeptide SEQ ID NO. 173,
respectively, is increased or generated or if the activity
"glycerol dehydrogenase" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0293] Particularly, an increase of yield from 1.05-fold to
1.191-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0294] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 383, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
382, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide, respectively, comprising the
nucleic acid SEQ ID NO. 382 or polypeptide SEQ ID NO. 383,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 382 or polypeptide SEQ
ID NO. 383, respectively, is increased or generated or if the
activity "uridine diphosphate-N-acetylglucosamine transporter" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0295] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 383, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
382, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 382 or polypeptide SEQ ID NO. 383, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 382 or polypeptide SEQ ID NO. 383,
respectively, is increased or generated or if the activity "uridine
diphosphate-N-acetylglucosamine transporter" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is cytoplasmic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.575-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0296] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 383, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
382, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 382 or polypeptide SEQ ID NO. 383, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 382 or polypeptide SEQ ID NO. 383,
respectively, is increased or generated or if the activity "uridine
diphosphate-N-acetylglucosamine transporter" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred.
[0297] Particularly, an increase of yield from 1.05-fold to
1.370-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0298] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 383, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
382, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 382 or polypeptide SEQ ID NO. 383, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 382 or polypeptide SEQ ID NO. 383,
respectively, is increased or generated or if the activity "uridine
diphosphate-N-acetylglucosamine transporter" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased intrinsic yield
as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred.
[0299] Particularly, an increase of yield from 1.05-fold to
1.306-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0300] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 407, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
406, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide, respectively, comprising the
nucleic acid SEQ ID NO. 406 or polypeptide SEQ ID NO. 407,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 406 or polypeptide SEQ
ID NO. 407, respectively, is increased or generated or if the
activity "DNA and protein binding protein for controlling the
proteome at post-transcriptional level" is increased or generated
in a plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0301] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 407, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
406, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 406 or polypeptide SEQ ID NO. 407, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 406 or polypeptide SEQ ID NO. 407,
respectively, is increased or generated or if the activity "DNA and
protein binding protein for controlling the proteome at
post-transcriptional level" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0302] Particularly, an increase of yield from 1.1-fold to
1.300-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0303] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 407, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
406, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 406 or polypeptide SEQ ID NO. 407, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 406 or polypeptide SEQ ID NO. 407,
respectively, is increased or generated or if the activity "DNA and
protein binding protein for controlling the proteome at
post-transcriptional level" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0304] Particularly, an increase of yield from 1.05-fold to
1.340-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding on-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0305] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 918, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
917, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide, respectively, comprising the
nucleic acid SEQ ID NO. 917 or polypeptide SEQ ID NO. 918,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 917 or polypeptide SEQ
ID NO. 918, respectively, is increased or generated or if the
activity "protein required for degradation of glycoproteins" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0306] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 918, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
917, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 917 or polypeptide SEQ ID NO. 918, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 917 or polypeptide SEQ ID NO. 918,
respectively, is increased or generated or if the activity "protein
required for degradation of glycoproteins" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is cytoplasmic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.697-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0307] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 918, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
917, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 917 or polypeptide SEQ ID NO. 918, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 917 or polypeptide SEQ ID NO. 918,
respectively, is increased or generated or if the activity "protein
required for degradation of glycoproteins" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred. Particularly, an increase of yield from 1.05-fold to
1.469-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0308] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 918, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
917, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 917 or polypeptide SEQ ID NO. 918, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 917 or polypeptide SEQ ID NO. 918,
respectively, is increased or generated or if the activity "protein
required for degradation of glycoproteins" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased intrinsic yield
as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
Particularly, an increase of yield from 1.05-fold to 1.369-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0309] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 953, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
952, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide, respectively, comprising the
nucleic acid SEQ ID NO. 952 or polypeptide SEQ ID NO. 953,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 952 or polypeptide SEQ
ID NO. 953, respectively, is increased or generated or if the
activity "aquaporin" is increased or generated in a plant cell,
plant or part thereof, especially if localized cytoplasmic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0310] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 953, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
952, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 952 or polypeptide SEQ ID NO. 953, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 952 or polypeptide SEQ ID NO. 953,
respectively, is increased or generated or if the activity
"aquaporin" is increased or generated in a plant cell, plant or
part thereof, especially, if the polypeptide is cytoplasmic
localized, an increased tolerance to abiotic environmental stress,
in particular increased low temperature tolerance, compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0311] Particularly, an increase of yield from 1.1-fold to
1.353-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0312] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 953, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
952, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 952 or polypeptide SEQ ID NO. 953, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 952 or polypeptide SEQ ID NO. 953,
respectively, is increased or generated or if the activity
"aquaporin" is increased or generated in a plant cell, plant or
part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0313] Particularly, an increase of yield from 1.05-fold to
1.525-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0314] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 953, or encoded
by a nucleic acid molecule comprising the nucleic acid SEQ ID NO.
952, or a homolog of said nucleic acid molecule or polypeptide,
e.g. in case the activity of the Saccharomyces cerevisiae nucleic
acid molecule or a polypeptide comprising the nucleic acid SEQ ID
NO. 952 or polypeptide SEQ ID NO. 953, respectively, is increased
or generated, e.g. if the activity of a nucleic acid molecule or a
polypeptide comprising the nucleic acid or polypeptide or the
consensus sequence or the polypeptide motif, as depicted in table
I, II or IV, column 7 in the respective same line as the nucleic
acid molecule SEQ ID NO. 952 or polypeptide SEQ ID NO. 953,
respectively, is increased or generated or if the activity
"aquaporin" is increased or generated in a plant cell, plant or
part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0315] Particularly, an increase of yield from 1.05-fold to
1.162-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0316] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1321, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1320, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 1320 or polypeptide SEQ ID
NO. 1321, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
1320 or polypeptide SEQ ID NO. 1321, respectively, is increased or
generated or if the activity "inorganic phosphate transporter" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0317] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1321, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1320, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 1320 or polypeptide SEQ ID NO. 1321,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 1320 or polypeptide
SEQ ID NO. 1321, respectively, is increased or generated or if the
activity "inorganic phosphate transporter" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is cytoplasmic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.405-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0318] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1321, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1320, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 1320 or polypeptide SEQ ID NO. 1321,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 1320 or polypeptide
SEQ ID NO. 1321, respectively, is increased or generated or if the
activity "inorganic phosphate transporter" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred. Particularly, an increase of yield from 1.05-fold to
1.597-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0319] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1321, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1320, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 1320 or polypeptide SEQ ID NO. 1321,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 1320 or polypeptide
SEQ ID NO. 1321, respectively, is increased or generated or if the
activity "inorganic phosphate transporter" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased intrinsic yield
as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
Particularly, an increase of yield from 1.05-fold to 1.327-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0320] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 1648 or polypeptide SEQ ID
NO. 1649, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
1648 or polypeptide SEQ ID NO. 1649, respectively, is increased or
generated or if the activity "ammonium transporter" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0321] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 1648 or polypeptide SEQ ID NO. 1649,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 1648 or polypeptide
SEQ ID NO. 1649, respectively, is increased or generated or if the
activity "ammonium transporter" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.808-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0322] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 1648 or polypeptide SEQ ID NO. 1649,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 1648 or polypeptide
SEQ ID NO. 1649, respectively, is increased or generated or if the
activity "ammonium transporter" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.593-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0323] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 1649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 1648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 1648 or polypeptide SEQ ID NO. 1649,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 1648 or polypeptide
SEQ ID NO. 1649, respectively, is increased or generated or if the
activity "ammonium transporter" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0324] Particularly, an increase of yield from 1.05-fold to
1.214-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0325] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2066, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2065, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 2065 or polypeptide SEQ ID
NO. 2066, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
2065 or polypeptide SEQ ID NO. 2066, respectively, is increased or
generated or if the activity "YNR040W-protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0326] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2066, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2065, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 2065 or polypeptide SEQ ID NO. 2066,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2065 or polypeptide
SEQ ID NO. 2066, respectively, is increased or generated or if the
activity "YNR040W-protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0327] Particularly, an increase of yield from 1.1-fold to
1.390-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0328] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2066, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2065, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 2065 or polypeptide SEQ ID NO. 2066,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2065 or polypeptide
SEQ ID NO. 2066, respectively, is increased or generated or if the
activity "YNR040W-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0329] Particularly, an increase of yield from 1.05-fold to
1.069-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0330] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2066, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2065, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 2065 or polypeptide SEQ ID NO. 2066,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2065 or polypeptide
SEQ ID NO. 2066, respectively, is increased or generated or if the
activity "YNR040W-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased drought tolerance as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased cycling drought tolerance is conferred.
[0331] Particularly, an increase of yield from 1.05-fold to
1.496-fold, for example plus at least 100% thereof, under abiotic
stress conditions, e.g. in the under drought conditions, in
particular cycling drought conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0332] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2082, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2081, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 2081 or polypeptide SEQ ID
NO. 2082, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
2081 or polypeptide SEQ ID NO. 2082, respectively, is increased or
generated or if the activity "glutamine synthetase" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0333] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2082, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2081, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 2081 or polypeptide SEQ ID NO. 2082,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2081 or polypeptide
SEQ ID NO. 2082, respectively, is increased or generated or if the
activity "glutamine synthetase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0334] Particularly, an increase of yield from 1.1-fold to
1.451-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0335] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2082, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2081, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 2081 or polypeptide SEQ ID NO. 2082,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2081 or polypeptide
SEQ ID NO. 2082, respectively, is increased or generated or if the
activity "glutamine synthetase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0336] Particularly, an increase of yield from 1.05-fold to
1.237-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0337] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2082, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2081, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 2081 or polypeptide SEQ ID NO. 2082,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2081 or polypeptide
SEQ ID NO. 2082, respectively, is increased or generated or if the
activity "glutamine synthetase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0338] Particularly, an increase of yield from 1.05-fold to
1.236-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0339] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2407, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2406, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 2406 or polypeptide SEQ ID NO. 2407,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2406 or polypeptide
SEQ ID NO. 2407, respectively, is increased or generated or if the
activity "formate acetyltransferase 1" is increased or generated in
a plant cell, plant or part thereof, especially if localized
plastidic and/or cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0340] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2407, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2406, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2406 or polypeptide SEQ ID NO. 2407, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2406 or polypeptide SEQ ID
NO. 2407, respectively, is increased or generated or if the
activity "formate acetyltransferase 1" is increased or generated in
a plant cell, plant or part thereof, especially, if the polypeptide
is plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0341] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.1-fold to 1.391-fold,
for example plus at least 100% thereof, under conditions of low
temperature is conferred compared to a corresponding non-modified,
e.g. non-transformed, wild type plant cell, a plant or a part
thereof.
[0342] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2407, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2406, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2406 or polypeptide SEQ ID NO. 2407, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2406 or polypeptide SEQ ID
NO. 2407, respectively, is increased or generated or if the
activity "formate acetyltransferase 1" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is plastidic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0343] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.05-fold to 1.397-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0344] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2407, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2406, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2406 or polypeptide SEQ ID NO. 2407, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2406 or polypeptide SEQ ID
NO. 2407, respectively, is increased or generated or if the
activity "formate acetyltransferase 1" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is plastidic and/or cytoplasmic localized, an increased intrinsic
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0345] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.05-fold to 1.260, for
example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0346] Particularly, expressing without combining said sequence or
molecule with a further targeting or signal sequence, e.g. without
a further target sequence or signal sequence, an increase of yield
from 1.05-fold to 1.286-fold, for example plus at least 100%
thereof, under standard conditions (intrinsic yield), e.g. in the
absence of nutrient deficiency as well as stress conditions is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0347] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2407, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2406, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2406 or polypeptide SEQ ID NO. 2407, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2406 or polypeptide SEQ ID
NO. 2407, respectively, is increased or generated or if the
activity "formate acetyltransferase 1" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is plastidic localized, an increased drought tolerance as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased cycling drought tolerance is conferred.
[0348] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.05-fold to 1.276-fold,
for example plus at least 100% thereof, under abiotic stress
conditions, e.g. under drought conditions, in particular cycling
drought conditions, is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0349] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2564, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 2564 or polypeptide SEQ ID NO. 2565,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2564 or polypeptide
SEQ ID NO. 2565, respectively, is increased or generated or if the
activity "enoyl-CoA hydratase" is increased or generated in a plant
cell, plant or part thereof, especially if localized cytoplasmic,
an increased yield as compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0350] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2564, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2564 or polypeptide SEQ ID NO. 2565, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2564 or polypeptide SEQ ID
NO. 2565, respectively, is increased or generated or if the
activity "enoyl-CoA hydratase" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0351] Particularly, an increase of yield from 1.1-fold to
1.224-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0352] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2564, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2564 or polypeptide SEQ ID NO. 2565, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2564 or polypeptide SEQ ID
NO. 2565, respectively, is increased or generated or if the
activity "enoyl-CoA hydratase" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased drought tolerance as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased cycling drought tolerance is conferred.
[0353] Particularly, an increase of yield from 1.05-fold to
1.244-fold, for example plus at least 100% thereof, under abiotic
stress conditions, e.g. under drought conditions, in particular
cycling drought conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0354] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2842, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2841, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 2841 or polypeptide SEQ ID NO. 2842,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2841 or polypeptide
SEQ ID NO. 2842, respectively, is increased or generated or if the
activity "glucitol/sorbitol-specific enzyme IIA component protein"
is increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0355] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2842, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2841, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2841 or polypeptide SEQ ID NO. 2842, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2841 or polypeptide SEQ ID
NO. 2842, respectively, is increased or generated or if the
activity "glucitol/sorbitol-specific enzyme IIA component protein"
is increased or generated in a plant cell, plant or part thereof,
especially, if the polypeptide is plastidic localized, an increased
tolerance to abiotic environmental stress, in particular increased
low temperature tolerance, compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. Particularly, an increase of yield
from 1.1-fold to 1.462-fold, for example plus at least 100%
thereof, under conditions of low temperature is conferred compared
to a corresponding non-modified, e.g. non-transformed, wild type
plant cell, a plant or a part thereof.
[0356] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2842, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2841, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2841 or polypeptide SEQ ID NO. 2842, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2841 or polypeptide SEQ ID
NO. 2842, respectively, is increased or generated or if the
activity "glucitol/sorbitol-specific enzyme IIA component protein"
is increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
nutrient use efficiency as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
nitrogen use efficiency is conferred.
[0357] Particularly, an increase of yield from 1.05-fold to
1.140-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0358] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2842, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2841, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2841 or polypeptide SEQ ID NO. 2842, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2841 or polypeptide SEQ ID
NO. 2842, respectively, is increased or generated or if the
activity "glucitol/sorbitol-specific enzyme IIA component protein"
is increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
intrinsic yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0359] Particularly, an increase of yield from 1.05-fold to
1.133-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0360] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2842, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2841, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2841 or polypeptide SEQ ID NO. 2842, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2841 or polypeptide SEQ ID
NO. 2842, respectively, is increased or generated or if the
activity "glucitol/sorbitol-specific enzyme IIA component protein"
is increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
drought tolerance as compared to a corresponding non-modified, e.g.
a non-transformed, wild type plant cell, a plant or a part thereof
is conferred. In one embodiment an increased cycling drought
tolerance is conferred.
[0361] Particularly, an increase of yield from 1.05-fold to
1.192-fold, for example plus at least 100% thereof, under abiotic
stress conditions, e.g. under drought conditions, in particular
cycling drought conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0362] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2880, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2879, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 2879 or polypeptide SEQ ID NO. 2880,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 2879 or polypeptide
SEQ ID NO. 2880, respectively, is increased or generated or if the
activity "aminomethyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0363] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2880, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2879, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2879 or polypeptide SEQ ID NO. 2880, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2879 or polypeptide SEQ ID
NO. 2880, respectively, is increased or generated or if the
activity "aminomethyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0364] Particularly, an increase of yield from 1.1-fold to
1.289-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0365] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2880, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2879, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2879 or polypeptide SEQ ID NO. 2880, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2879 or polypeptide SEQ ID
NO. 2880, respectively, is increased or generated or if the
activity "aminomethyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0366] Particularly, an increase of yield from 1.05-fold to
1.104-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0367] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 2880, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 2879, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 2879 or polypeptide SEQ ID NO. 2880, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 2879 or polypeptide SEQ ID
NO. 2880, respectively, is increased or generated or if the
activity "aminomethyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased drought tolerance as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased cycling drought tolerance is conferred.
[0368] Particularly, an increase of yield from 1.05-fold to
1.233-fold, for example plus at least 100% thereof, under abiotic
stress conditions, e.g. under drought conditions, in particular
cycling drought conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0369] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3110, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3109, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 3109 or polypeptide SEQ ID NO. 3110,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 3109 or polypeptide
SEQ ID NO. 3110, respectively, is increased or generated or if the
activity "Phosphocarrier protein" is increased or generated in a
plant cell, plant or part thereof, especially if localized
plastidic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0370] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3110, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3109, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 3109 or polypeptide SEQ ID NO. 3110, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 3109 or polypeptide SEQ ID
NO. 3110, respectively, is increased or generated or if the
activity "Phosphocarrier protein" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0371] Particularly, an increase of yield from 1.1-fold to
1.304-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0372] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3110, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3109, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 3109 or polypeptide SEQ ID NO. 3110, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 3109 or polypeptide SEQ ID
NO. 3110, respectively, is increased or generated or if the
activity "Phosphocarrier protein" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0373] Particularly, an increase of yield from 1.05-fold to
1.160-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0374] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3404, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3403, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 3403 or polypeptide SEQ ID NO. 3404,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 3403 or polypeptide
SEQ ID NO. 3404, respectively, is increased or generated or if the
activity "two-module transport protein" is increased or generated
in a plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0375] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3404, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3403, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 3403 or polypeptide SEQ ID NO. 3404, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 3403 or polypeptide SEQ ID
NO. 3404, respectively, is increased or generated or if the
activity "two-module transport protein" is increased or generated
in a plant cell, plant or part thereof, especially, if the
polypeptide is cytoplasmic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0376] Particularly, an increase of yield from 1.1-fold to
1.696-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0377] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3404, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3403, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 3403 or polypeptide SEQ ID NO. 3404, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 3403 or polypeptide SEQ ID
NO. 3404, respectively, is increased or generated or if the
activity "two-module transport protein" is increased or generated
in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased intrinsic yield
as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0378] Particularly, an increase of yield from 1.05-fold to
1.435-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0379] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3404, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3403, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 3403 or polypeptide SEQ ID NO. 3404, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 3403 or polypeptide SEQ ID
NO. 3404, respectively, is increased or generated or if the
activity "two-module transport protein" is increased or generated
in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased drought
tolerance as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased cycling drought tolerance
is conferred.
[0380] Particularly, an increase of yield from 1.05-fold to
1.128-fold, for example plus at least 100% thereof, under abiotic
stress conditions, e.g. under drought conditions, in particular
cycling drought conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0381] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3442, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3441, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 3441 or polypeptide SEQ ID NO. 3442,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 3441 or polypeptide
SEQ ID NO. 3442, respectively, is increased or generated or if the
activity "GTP-binding protein" is increased or generated in a plant
cell, plant or part thereof, especially if localized cytoplasmic,
an increased yield as compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0382] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3442, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3441, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 3441 or polypeptide SEQ ID NO. 3442, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 3441 or polypeptide SEQ ID
NO. 3442, respectively, is increased or generated or if the
activity "GTP-binding protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0383] Particularly, an increase of yield from 1.1-fold to
1.611-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0384] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3979, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3978, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 3978 or polypeptide SEQ ID
NO. 3979, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
3978 or polypeptide SEQ ID NO. 3979, respectively, is increased or
generated or if the activity "Peroxisomal targeting signal 2
receptor" is increased or generated in a plant cell, plant or part
thereof, especially if localized plastidic, an increased yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred.
[0385] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3979, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3978, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 3978 or polypeptide SEQ ID NO. 3979,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 3978 or polypeptide
SEQ ID NO. 3979, respectively, is increased or generated or if the
activity "Peroxisonnal targeting signal 2 receptor" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0386] Particularly, an increase of yield from 1.1-fold to
1.274-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0387] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3979, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3978, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 3978 or polypeptide SEQ ID NO. 3979,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 3978 or polypeptide
SEQ ID NO. 3979, respectively, is increased or generated or if the
activity "Peroxisomal targeting signal 2 receptor" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred.
[0388] Particularly, an increase of yield from 1.05-fold to
1.305-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0389] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 3979, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 3978, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 3978 or polypeptide SEQ ID NO. 3979,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 3978 or polypeptide
SEQ ID NO. 3979, respectively, is increased or generated or if the
activity "Peroxisomal targeting signal 2 receptor" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased intrinsic yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased yield under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred.
[0390] Particularly, an increase of yield from 1.05-fold to
1.476-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0391] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4048, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4047, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4047 or polypeptide SEQ ID
NO. 4048, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4047 or polypeptide SEQ ID NO. 4048, respectively, is increased or
generated or if the activity "yer175w-a-protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0392] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4048, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4047, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4047 or polypeptide SEQ ID NO. 4048,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4047 or polypeptide
SEQ ID NO. 4048, respectively, is increased or generated or if the
activity "yer175w-a-protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0393] Particularly, an increase of yield from 1.1-fold to
2.340-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0394] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4048, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4047, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4047 or polypeptide SEQ ID NO. 4048,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4047 or polypeptide
SEQ ID NO. 4048, respectively, is increased or generated or if the
activity "yer175w-a-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0395] Particularly, an increase of yield from 1.05-fold to
1.370-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0396] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4052, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4051, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4051 or polypeptide SEQ ID
NO. 4052, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4051 or polypeptide SEQ ID NO. 4052, respectively, is increased or
generated or if the activity "hexose transporter" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0397] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4052, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4051, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4051 or polypeptide SEQ ID NO. 4052,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4051 or polypeptide
SEQ ID NO. 4052, respectively, is increased or generated or if the
activity "hexose transporter" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.271-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0398] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4052, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4051, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4051 or polypeptide SEQ ID NO. 4052,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4051 or polypeptide
SEQ ID NO. 4052, respectively, is increased or generated or if the
activity "hexose transporter" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0399] Particularly, an increase of yield from 1.05-fold to
1.256-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0400] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4052, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4051, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4051 or polypeptide SEQ ID NO. 4052,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4051 or polypeptide
SEQ ID NO. 4052, respectively, is increased or generated or if the
activity "hexose transporter" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0401] Particularly, an increase of yield from 1.05-fold to
1.398-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0402] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4052, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4051, or a homolog of said nucleic acid molecule or
polypeptide, e.g, in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4051 or polypeptide SEQ ID NO. 4052,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4051 or polypeptide
SEQ ID NO. 4052, respectively, is increased or generated or if the
activity "hexose transporter" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased drought tolerance as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased cycling drought tolerance is conferred.
[0403] Particularly, an increase of yield from 1.05-fold to
1.324-fold, for example plus at least 100% thereof, under abiotic
stress conditions, e.g. under drought conditions, in particular
cycling drought conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0404] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4132, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4131, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4131 or polypeptide SEQ ID
NO. 4132, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4131 or polypeptide SEQ ID NO. 4132, respectively, is increased or
generated or if the activity "2-deoxyglucose-6-phosphate
phosphatase" is increased or generated in a plant cell, plant or
part thereof, especially if localized plastidic, an increased yield
as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0405] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4132, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4131, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4131 or polypeptide SEQ ID NO. 4132,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4131 or polypeptide
SEQ ID NO. 4132, respectively, is increased or generated or if the
activity "2-deoxyglucose-6-phosphate phosphatase" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.215-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0406] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4218, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4217, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4217 or polypeptide SEQ ID
NO. 4218, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4217 or polypeptide SEQ ID NO. 4218, respectively, is increased or
generated or if the activity "lanosterol synthase" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0407] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4218, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4217, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4217 or polypeptide SEQ ID NO. 4218,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4217 or polypeptide
SEQ ID NO. 4218, respectively, is increased or generated or if the
activity "lanosterol synthase" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0408] Particularly, an increase of yield from 1.1-fold to
1.387-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0409] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4492, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4491, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4491 or polypeptide SEQ ID
NO. 4492, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4491 or polypeptide SEQ ID NO. 4492, respectively, is increased or
generated or if the activity "yhr213w-a-protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0410] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4492, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4491, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4491 or polypeptide SEQ ID NO. 4492,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4491 or polypeptide
SEQ ID NO. 4492, respectively, is increased or generated or if the
activity "yhr213w-a-protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0411] Particularly, an increase of yield from 1.1-fold to
1.570-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0412] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4492, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4491, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4491 or polypeptide SEQ ID NO. 4492,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4491 or polypeptide
SEQ ID NO. 4492, respectively, is increased or generated or if the
activity "yhr213w-a-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0413] Particularly, an increase of yield from 1.05-fold to
1.407-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0414] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4496, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4495, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4495 or polypeptide SEQ ID
NO. 4496, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4495 or polypeptide SEQ ID NO. 4496, respectively, is increased or
generated or if the activity "(DL)-glycerol-3-phosphatase" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0415] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4496, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4495, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4495 or polypeptide SEQ ID NO. 4496,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4495 or polypeptide
SEQ ID NO. 4496, respectively, is increased or generated or if the
activity "(DL)-glycerol-3-phosphatase" is increased or generated in
a plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0416] Particularly, an increase of yield from 1.1-fold to
1.523-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0417] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4496, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4495, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4495 or polypeptide SEQ ID NO. 4496,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4495 or polypeptide
SEQ ID NO. 4496, respectively, is increased or generated or if the
activity "(DL)-glycerol-3-phosphatase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0418] Particularly, an increase of yield from 1.05-fold to
1.498-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0419] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4496, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4495, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4495 or polypeptide SEQ ID NO. 4496,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4495 or polypeptide
SEQ ID NO. 4496, respectively, is increased or generated or if the
activity "(DL)-glycerol-3-phosphatase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is cytoplasmic localized, an increased intrinsic yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0420] Particularly, an increase of yield from 1.05-fold to
1.383-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0421] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4559, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4558, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4558 or polypeptide SEQ ID
NO. 4559, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4558 or polypeptide SEQ ID NO. 4559, respectively, is increased or
generated or if the activity "transcriptional regulatory protein"
is increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0422] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4559, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4558, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4558 or polypeptide SEQ ID NO. 4559,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4558 or polypeptide
SEQ ID NO. 4559, respectively, is increased or generated or if the
activity "transcriptional regulatory protein" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0423] Particularly, an increase of yield from 1.1-fold to
1.296-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0424] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4559, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4558, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4558 or polypeptide SEQ ID NO. 4559,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4558 or polypeptide
SEQ ID NO. 4559, respectively, is increased or generated or if the
activity "transcriptional regulatory protein" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased intrinsic yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred.
[0425] In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
Particularly, an increase of yield from 1.05-fold to 1.175-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0426] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4590, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4589, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4589 or polypeptide SEQ ID
NO. 4590, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4589 or polypeptide SEQ ID NO. 4590, respectively, is increased or
generated or if the activity "Glycogen synthesis initiator protein"
is increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0427] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4590, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4589, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4589 or polypeptide SEQ ID NO. 4590,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4589 or polypeptide
SEQ ID NO. 4590, respectively, is increased or generated or if the
activity "Glycogen synthesis initiator protein" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0428] Particularly, an increase of yield from 1.1-fold to
1.48-fold, for example plus at least 100% thereof, under conditions
of low temperature is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0429] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4590, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4589, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4589 or polypeptide SEQ ID NO. 4590,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4589 or polypeptide
SEQ ID NO. 4590, respectively, is increased or generated or if the
activity "Glycogen synthesis initiator protein" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased intrinsic yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased yield under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred.
[0430] Particularly, an increase of yield from 1.05-fold to
1.065-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0431] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4623, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4622, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 4622 or polypeptide SEQ ID
NO. 4623, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
4622 or polypeptide SEQ ID NO. 4623, respectively, is increased or
generated or if the activity "aspartate aminotransferase" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0432] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4623, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4622, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4622 or polypeptide SEQ ID NO. 4623,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4622 or polypeptide
SEQ ID NO. 4623, respectively, is increased or generated or if the
activity "aspartate aminotransferase" is increased or generated in
a plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0433] Particularly, an increase of yield from 1.1-fold to
1.848-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0434] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4623, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4622, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4622 or polypeptide SEQ ID NO. 4623,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4622 or polypeptide
SEQ ID NO. 4623, respectively, is increased or generated or if the
activity "aspartate aminotransferase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.172-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0435] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 4623, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 4622, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 4622 or polypeptide SEQ ID NO. 4623,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 4622 or polypeptide
SEQ ID NO. 4623, respectively, is increased or generated or if the
activity "aspartate aminotransferase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is cytoplasmic localized, an increased intrinsic yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0436] Particularly, an increase of yield from 1.05-fold to
1.329-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0437] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5071, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5070, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 5070 or polypeptide SEQ ID
NO. 5071, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
5070 or polypeptide SEQ ID NO. 5071, respectively, is increased or
generated or if the activity "YML079W-protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic and/or cytoplasmic, an increased yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred.
[0438] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5071, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5070, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5070 or polypeptide SEQ ID NO. 5071,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5070 or polypeptide
SEQ ID NO. 5071, respectively, is increased or generated or if the
activity "YML079W-protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0439] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.1-fold to 1.331-fold,
for example plus at least 100% thereof, under conditions of low
temperature is conferred compared to a corresponding non-modified,
e.g. non-transformed, wild type plant cell, a plant or a part
thereof.
[0440] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5071, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5070, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5070 or polypeptide SEQ ID NO. 5071,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5070 or polypeptide
SEQ ID NO. 5071, respectively, is increased or generated or if the
activity "YML079W-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0441] Particularly, expressing without combining said sequence or
molecule with a further targeting or signal sequence, e.g. without
a further heterologous target sequence or signal sequence as
described herein, an increase of yield from 1.05-fold to 1.057
(cytoplasmic)-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0442] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5071, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5070, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5070 or polypeptide SEQ ID NO. 5071,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5070 or polypeptide
SEQ ID NO. 5071, respectively, is increased or generated or if the
activity "YML079W-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred. Particularly, expressing under the control of a
plastidic signal sequence, an increase of yield from 1.05-fold to
1.066-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0443] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5103, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5102, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 5102 or polypeptide SEQ ID
NO. 5103, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
5102 or polypeptide SEQ ID NO. 5103, respectively, is increased or
generated or if the activity "YMR157c-protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0444] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5103, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5102, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5102 or polypeptide SEQ ID NO. 5103,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5102 or polypeptide
SEQ ID NO. 5103, respectively, is increased or generated or if the
activity "YMR157c-- protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0445] Particularly, an increase of yield from 1.1-fold to
1.267-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0446] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5103, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5102, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5102 or polypeptide SEQ ID NO. 5103,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5102 or polypeptide
SEQ ID NO. 5103, respectively, is increased or generated or if the
activity "YMR157c-- protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0447] Particularly, an increase of yield from 1.05-fold to
1.211-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0448] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5116, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5115, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 5115 or polypeptide SEQ ID
NO. 5116, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
5115 or polypeptide SEQ ID NO. 5116, respectively, is increased or
generated or if the activity "YNL024C-protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0449] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5116, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5115, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5115 or polypeptide SEQ ID NO. 5116,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5115 or polypeptide
SEQ ID NO. 5116, respectively, is increased or generated or if the
activity "YNL024C-protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0450] Particularly, an increase of yield from 1.1-fold to
1.376-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0451] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5116, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5115, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5115 or polypeptide SEQ ID NO. 5116,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5115 or polypeptide
SEQ ID NO. 5116, respectively, is increased or generated or if the
activity "YNL024C-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0452] Particularly, an increase of yield from 1.05-fold to
1.068-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0453] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5160, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5159, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 5159 or polypeptide SEQ ID
NO. 5160, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
5159 or polypeptide SEQ ID NO. 5160, respectively, is increased or
generated or if the activity "Argininosuccinate synthase" is
increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic and/or cytoplasmic, an increased
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0454] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5160, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5159, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5159 or polypeptide SEQ ID NO. 5160,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5159 or polypeptide
SEQ ID NO. 5160, respectively, is increased or generated or if the
activity "Argininosuccinate synthase" is increased or generated in
a plant cell, plant or part thereof, especially, if the polypeptide
is plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0455] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.1-fold to 1.300-fold,
for example plus at least 100% thereof, under conditions of low
temperature is conferred compared to a corresponding non-modified,
e.g. non-transformed, wild type plant cell, a plant or a part
thereof.
[0456] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5160, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5159, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5159 or polypeptide SEQ ID NO. 5160,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5159 or polypeptide
SEQ ID NO. 5160, respectively, is increased or generated or if the
activity "Argininosuccinate synthase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0457] Expressing without combining said sequence or molecule with
a further targeting or signal sequence, e.g. without a further
heterologous target sequence or signal sequence as described
herein, an increase of yield from 1.05-fold to 1.172
(cytoplasmic)-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0458] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5160, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5159, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5159 or polypeptide SEQ ID NO. 5160,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5159 or polypeptide
SEQ ID NO. 5160, respectively, is increased or generated or if the
activity "Argininosuccinate synthase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is plastidic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0459] In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0460] Particularly, expressing under the control of a plastidic
signal sequence, an increase of yield from 1.05-fold to 1.091-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0461] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5747, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5746, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 5746 or polypeptide SEQ ID
NO. 5747, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
5746 or polypeptide SEQ ID NO. 5747, respectively, is increased or
generated or if the activity "subunit of TORC1" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0462] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5747, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5746, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5746 or polypeptide SEQ ID NO. 5747,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5746 or polypeptide
SEQ ID NO. 5747, respectively, is increased or generated or if the
activity "subunit of TORC1" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0463] Particularly, an increase of yield from 1.1-fold to
2.471-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0464] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5747, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5746, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5746 or polypeptide SEQ ID NO. 5747,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5746 or polypeptide
SEQ ID NO. 5747, respectively, is increased or generated or if the
activity "subunit of TORC1" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.169-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0465] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5747, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5746, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5746 or polypeptide SEQ ID NO. 5747,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5746 or polypeptide
SEQ ID NO. 5747, respectively, is increased or generated or if the
activity "subunit of TORC1" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0466] Particularly, an increase of yield from 1.05-fold to
1.326-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0467] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5757, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5756, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 5756 or polypeptide SEQ ID
NO. 5757, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
5756 or polypeptide SEQ ID NO. 5757, respectively, is increased or
generated or if the activity "Phosphoadenosine phosphosulfate
reductase" is increased or generated in a plant cell, plant or part
thereof, especially if localized plastidic, an increased yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred.
[0468] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5757, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5756, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5756 or polypeptide SEQ ID NO. 5757,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5756 or polypeptide
SEQ ID NO. 5757, respectively, is increased or generated or if the
activity "Phosphoadenosine phosphosulfate reductase" is increased
or generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.303-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0469] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 5757, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 5756, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 5756 or polypeptide SEQ ID NO. 5757,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 5756 or polypeptide
SEQ ID NO. 5757, respectively, is increased or generated or if the
activity "Phosphoadenosine phosphosulfate reductase" is increased
or generated in a plant cell, plant or part thereof, especially if
the polypeptide is plastidic localized, an increased intrinsic
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0470] Particularly, an increase of yield from 1.05-fold to
1.219-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0471] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6087, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6086, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 6086 or polypeptide SEQ ID NO. 6087,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 6086 or polypeptide
SEQ ID NO. 6087, respectively, is increased or generated or if the
activity "Enoyl CoA hydratase" is increased or generated in a plant
cell, plant or part thereof, especially if localized plastidic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0472] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6087, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6086, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6086 or polypeptide SEQ ID NO. 6087, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6086 or polypeptide SEQ ID
NO. 6087, respectively, is increased or generated or if the
activity "Enoyl CoA hydratase" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0473] Particularly, an increase of yield from 1.1-fold to
1.336-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0474] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6087, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6086, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6086 or polypeptide SEQ ID NO. 6087, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6086 or polypeptide SEQ ID
NO. 6087, respectively, is increased or generated or if the
activity "Enoyl CoA hydratase" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0475] Particularly, an increase of yield from 1.05-fold to
1.117-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0476] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6582, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6581, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 6581 or polypeptide SEQ ID NO. 6582,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 6581 or polypeptide
SEQ ID NO. 6582, respectively, is increased or generated or if the
activity "B1906-protein" is increased or generated in a plant cell,
plant or part thereof, especially if localized cytoplasmic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0477] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6582, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6581, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6581 or polypeptide SEQ ID NO. 6582, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6581 or polypeptide SEQ ID
NO. 6582, respectively, is increased or generated or if the
activity "B1906-protein" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0478] Particularly, an increase of yield from 1.1-fold to
1.290-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0479] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6582, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6581, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6581 or polypeptide SEQ ID NO. 6582, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6581 or polypeptide SEQ ID
NO. 6582, respectively, is increased or generated or if the
activity "B1906-protein" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0480] Particularly, an increase of yield from 1.05-fold to
1.321-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0481] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6582, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6581, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6581 or polypeptide SEQ ID NO. 6582, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6581 or polypeptide SEQ ID
NO. 6582, respectively, is increased or generated or if the
activity "B1906-protein" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0482] Particularly, an increase of yield from 1.05-fold to
1.092-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0483] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6610, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6609, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 6609 or polypeptide SEQ ID NO. 6610,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 6609 or polypeptide
SEQ ID NO. 6610, respectively, is increased or generated or if the
activity "CoAtransferase-like protein (NAD(P)-binding)" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0484] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6610, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6609, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6609 or polypeptide SEQ ID NO. 6610, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6609 or polypeptide SEQ ID
NO. 6610, respectively, is increased or generated or if the
activity "CoA-transferase-like protein (NAD(P)-binding)" is
increased or generated in a plant cell, plant or part thereof,
especially, if the polypeptide is cytoplasmic localized, an
increased tolerance to abiotic environmental stress, in particular
increased low temperature tolerance, compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0485] Particularly, an increase of yield from 1.1-fold to
1.328-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0486] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6610, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6609, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6609 or polypeptide SEQ ID NO. 6610, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6609 or polypeptide SEQ ID
NO. 6610, respectively, is increased or generated or if the
activity "CoA-transferase-like protein (NAD(P)-binding)" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is cytoplasmic localized, an
increased nutrient use efficiency as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
nitrogen use efficiency is conferred. Particularly, an increase of
yield from 1.05-fold to 1.261-fold, for example plus at least 100%
thereof, under conditions of nitrogen deficiency is conferred
compared to a corresponding non-modified, e.g. non-transformed,
wild type plant cell, a plant or a part thereof.
[0487] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6610, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6609, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6609 or polypeptide SEQ ID NO. 6610, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6609 or polypeptide SEQ ID
NO. 6610, respectively, is increased or generated or if the
activity "CoA-transferase-like protein (NAD(P)-binding)" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is cytoplasmic localized, an
increased intrinsic yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
yield under standard conditions (intrinsic yield), e.g. in the
absence of nutrient deficiency as well as stress conditions, is
conferred.
[0488] Particularly, an increase of yield from 1.05-fold to
1.121-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0489] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6950, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6949, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 6949 or polypeptide SEQ ID NO. 6950,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 6949 or polypeptide
SEQ ID NO. 6950, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially if localized cytoplasmic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0490] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6950, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6949, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6949 or polypeptide SEQ ID NO. 6950, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6949 or polypeptide SEQ ID
NO. 6950, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0491] Particularly, an increase of yield from 1.1-fold to
1.230-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0492] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6950, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6949, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6949 or polypeptide SEQ ID NO. 6950, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6949 or polypeptide SEQ ID
NO. 6950, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0493] Particularly, an increase of yield from 1.05-fold to
1.202-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0494] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 6950, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 6949, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 6949 or polypeptide SEQ ID NO. 6950, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 6949 or polypeptide SEQ ID
NO. 6950, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0495] Particularly, an increase of yield from 1.05-fold to
1.074-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0496] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7079, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7078, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 7078 or polypeptide SEQ ID NO. 7079,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 7078 or polypeptide
SEQ ID NO. 7079, respectively, is increased or generated or if the
activity "Pirin-like protein" is increased or generated in a plant
cell, plant or part thereof, especially if localized cytoplasmic,
an increased yield as compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0497] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7079, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7078, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7078 or polypeptide SEQ ID NO. 7079, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7078 or polypeptide SEQ ID
NO. 7079, respectively, is increased or generated or if the
activity "Pirin-like protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0498] Particularly, an increase of yield from 1.1-fold to
1.381-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0499] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7079, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7078, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7078 or polypeptide SEQ ID NO. 7079, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7078 or polypeptide SEQ ID
NO. 7079, respectively, is increased or generated or if the
activity "Pirin-like protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0500] Particularly, an increase of yield from 1.05-fold to
1.533-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0501] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7079, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7078, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7078 or polypeptide SEQ ID NO. 7079, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7078 or polypeptide SEQ ID
NO. 7079, respectively, is increased or generated or if the
activity "Pirin-like protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0502] Particularly, an increase of yield from 1.05-fold to
1.082-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0503] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7271, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7270, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 7270 or polypeptide SEQ ID NO. 7271,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 7270 or polypeptide
SEQ ID NO. 7271, respectively, is increased or generated or if the
activity "Heat shock protein" is increased or generated in a plant
cell, plant or part thereof, especially if localized plastidic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0504] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7271, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7270, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7270 or polypeptide SEQ ID NO. 7271, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7270 or polypeptide SEQ ID
NO. 7271, respectively, is increased or generated or if the
activity "Heat shock protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0505] Particularly, an increase of yield from 1.1-fold to
1.394-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0506] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7271, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7270, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7270 or polypeptide SEQ ID NO. 7271, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7270 or polypeptide SEQ ID
NO. 7271, respectively, is increased or generated or if the
activity "Heat shock protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0507] Particularly, an increase of yield from 1.05-fold to
1.191-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0508] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7468, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7467, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 7467 or polypeptide SEQ ID NO. 7468,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 7467 or polypeptide
SEQ ID NO. 7468, respectively, is increased or generated or if the
activity "B3410-protein" is increased or generated in a plant cell,
plant or part thereof, especially if localized cytoplasmic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0509] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7468, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7467, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7467 or polypeptide SEQ ID NO. 7468, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7467 or polypeptide SEQ ID
NO. 7468, respectively, is increased or generated or if the
activity "B3410-protein" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0510] Particularly, an increase of yield from 1.1-fold to
1.420-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0511] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7468, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7467, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7467 or polypeptide SEQ ID NO. 7468, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7467 or polypeptide SEQ ID
NO. 7468, respectively, is increased or generated or if the
activity "B3410-protein" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0512] Particularly, an increase of yield from 1.05-fold to
1.286-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0513] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7468, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7467, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7467 or polypeptide SEQ ID NO. 7468, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7467 or polypeptide SEQ ID
NO. 7468, respectively, is increased or generated or if the
activity "B3410-protein" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0514] Particularly, an increase of yield from 1.05-fold to
1.167-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0515] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7493, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7492, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 7492 or polypeptide SEQ ID NO. 7493,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 7492 or polypeptide
SEQ ID NO. 7493, respectively, is increased or generated or if the
activity "Regulator of cell morphogenesis and NO signaling" is
increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0516] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7493, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7492, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7492 or polypeptide SEQ ID NO. 7493, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7492 or polypeptide SEQ ID
NO. 7493, respectively, is increased or generated or if the
activity "Regulator of cell morphogenesis and NO signaling" is
increased or generated in a plant cell, plant or part thereof,
especially, if the polypeptide is plastidic localized, an increased
tolerance to abiotic environmental stress, in particular increased
low temperature tolerance, compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0517] Particularly, an increase of yield from 1.1-fold to
1.489-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0518] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7493, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7492, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7492 or polypeptide SEQ ID NO. 7493, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7492 or polypeptide SEQ ID
NO. 7493, respectively, is increased or generated or if the
activity "Regulator of cell morphogenesis and NO signaling" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
nutrient use efficiency as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
nitrogen use efficiency is conferred.
[0519] Particularly, an increase of yield from 1.05-fold to
1.232-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0520] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7493, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7492, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7492 or polypeptide SEQ ID NO. 7493, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7492 or polypeptide SEQ ID
NO. 7493, respectively, is increased or generated or if the
activity "Regulator of cell morphogenesis and NO signaling" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
intrinsic yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0521] In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0522] Particularly, an increase of yield from 1.05-fold to
1.137-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0523] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 7591 or polypeptide SEQ ID NO. 7592,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 7591 or polypeptide
SEQ ID NO. 7592, respectively, is increased or generated or if the
activity "glutathione S-transferase" is increased or generated in a
plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0524] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7591 or polypeptide SEQ ID NO. 7592, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7591 or polypeptide SEQ ID
NO. 7592, respectively, is increased or generated or if the
activity "glutathione 5-transferase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.293-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0525] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7591 or polypeptide SEQ ID NO. 7592, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7591 or polypeptide SEQ ID
NO. 7592, respectively, is increased or generated or if the
activity "glutathione 5-transferase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0526] Particularly, an increase of yield from 1.05-fold to
1.406-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0527] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7591 or polypeptide SEQ ID NO. 7592, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7591 or polypeptide SEQ ID
NO. 7592, respectively, is increased or generated or if the
activity "glutathione 5-transferase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0528] Particularly, an increase of yield from 1.05-fold to
1.208-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0529] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7671, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7670, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 7670 or polypeptide SEQ ID NO. 7671,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 7670 or polypeptide
SEQ ID NO. 7671, respectively, is increased or generated or if the
activity "serine acetyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially if localized
Mitochondric, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0530] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7671, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7670, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7670 or polypeptide SEQ ID NO. 7671, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7670 or polypeptide SEQ ID
NO. 7671, respectively, is increased or generated or if the
activity "serine acetyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is Mitochondric localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0531] Particularly, an increase of yield from 1.1-fold to
1.413-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0532] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7671, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7670, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7670 or polypeptide SEQ ID NO. 7671, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7670 or polypeptide SEQ ID
NO. 7671, respectively, is increased or generated or if the
activity "serine acetyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
Mitochondric localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0533] Particularly, an increase of yield from 1.05-fold to
1.268-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0534] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 7671, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 7670, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 7670 or polypeptide SEQ ID NO. 7671, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 7670 or polypeptide SEQ ID
NO. 7671, respectively, is increased or generated or if the
activity "serine acetyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
Mitochondric localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0535] Particularly, an increase of yield from 1.05-fold to
1.376-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0536] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8237, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8236, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 8236 or polypeptide SEQ ID
NO. 8237, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
8236 or polypeptide SEQ ID NO. 8237, respectively, is increased or
generated or if the activity "amino acid permease" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0537] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8237, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8236, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 8236 or polypeptide SEQ ID NO. 8237,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 8236 or polypeptide
SEQ ID NO. 8237, respectively, is increased or generated or if the
activity "amino acid permease" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0538] Particularly, an increase of yield from 1.1-fold to
1.298-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0539] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8237, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8236, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 8236 or polypeptide SEQ ID NO. 8237,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 8236 or polypeptide
SEQ ID NO. 8237, respectively, is increased or generated or if the
activity "amino acid permease" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0540] Particularly, an increase of yield from 1.05-fold to
1.156-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0541] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8564, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8563, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Arabidopsis thaliana
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 8563 or polypeptide SEQ ID NO. 8564,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 8563 or polypeptide
SEQ ID NO. 8564, respectively, is increased or generated or if the
activity "signalosome complex subunit" is increased or generated in
a plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0542] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8564, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8563, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Arabidopsis thaliana
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8563 or polypeptide SEQ ID NO. 8564, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8563 or polypeptide SEQ ID
NO. 8564, respectively, is increased or generated or if the
activity "signalosome complex subunit" is increased or generated in
a plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0543] Particularly, an increase of yield from 1.1-fold to
1.610-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0544] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8564, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8563, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Arabidopsis thaliana
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8563 or polypeptide SEQ ID NO. 8564, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8563 or polypeptide SEQ ID
NO. 8564, respectively, is increased or generated or if the
activity "signalosome complex subunit" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is cytoplasmic localized, an increased intrinsic yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0545] Particularly, an increase of yield from 1.05-fold to
1.385-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0546] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 8648 or polypeptide SEQ ID NO. 8649,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 8648 or polypeptide
SEQ ID NO. 8649, respectively, is increased or generated or if the
activity "multidrug resistance protein" is increased or generated
in a plant cell, plant or part thereof, especially if localized
plastidic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0547] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8648 or polypeptide SEQ ID NO. 8649, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8648 or polypeptide SEQ ID
NO. 8649, respectively, is increased or generated or if the
activity "multidrug resistance protein" is increased or generated
in a plant cell, plant or part thereof, especially, if the
polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.293-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0548] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8648 or polypeptide SEQ ID NO. 8649, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8648 or polypeptide SEQ ID
NO. 8649, respectively, is increased or generated or if the
activity "multidrug resistance protein" is increased or generated
in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred. Particularly, an increase of yield from 1.05-fold to
1.616-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0549] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8649, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8648, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8648 or polypeptide SEQ ID NO. 8649, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8648 or polypeptide SEQ ID
NO. 8649, respectively, is increased or generated or if the
activity "multidrug resistance protein" is increased or generated
in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased intrinsic yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased yield under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred. Particularly, an increase
of yield from 1.05-fold to 1.401-fold, for example plus at least
100% thereof, under standard conditions (intrinsic yield), e.g. in
the absence of nutrient deficiency as well as stress conditions, is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0550] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8761, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8760, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 8760 or polypeptide SEQ ID NO. 8761,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 8760 or polypeptide
SEQ ID NO. 8761, respectively, is increased or generated or if the
activity "Arabinose transport system ATP-binding protein" is
increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0551] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8761, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8760, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8760 or polypeptide SEQ ID NO. 8761, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8760 or polypeptide SEQ ID
NO. 8761, respectively, is increased or generated or if the
activity "Arabinose transport system ATP-binding protein" is
increased or generated in a plant cell, plant or part thereof,
especially, if the polypeptide is plastidic localized, an increased
tolerance to abiotic environmental stress, in particular increased
low temperature tolerance, compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. Particularly, an increase of yield
from 1.1-fold to 1.341-fold, for example plus at least 100%
thereof, under conditions of low temperature is conferred compared
to a corresponding non-modified, e.g. non-transformed, wild type
plant cell, a plant or a part thereof.
[0552] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8761, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8760, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8760 or polypeptide SEQ ID NO. 8761, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8760 or polypeptide SEQ ID
NO. 8761, respectively, is increased or generated or if the
activity "Arabinose transport system ATP-binding protein" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
nutrient use efficiency as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
nitrogen use efficiency is conferred. Particularly, an increase of
yield from 1.05-fold to 1.318-fold, for example plus at least 100%
thereof, under conditions of nitrogen deficiency is conferred
compared to a corresponding non-modified, e.g. non-transformed,
wild type plant cell, a plant or a part thereof.
[0553] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8761, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8760, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO.
[0554] 8760 or polypeptide SEQ ID NO. 8761, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8760 or polypeptide SEQ ID
NO. 8761, respectively, is increased or generated or if the
activity "Arabinose transport system ATP-binding protein" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is plastidic localized, an increased
intrinsic yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0555] In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0556] Particularly, an increase of yield from 1.05-fold to
1.136-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0557] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8862, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8861, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 8861 or polypeptide SEQ ID NO. 8862,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 8861 or polypeptide
SEQ ID NO. 8862, respectively, is increased or generated or if the
activity "precorrin-6y methylase" is increased or generated in a
plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0558] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8862, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8861, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8861 or polypeptide SEQ ID NO. 8862, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8861 or polypeptide SEQ ID
NO. 8862, respectively, is increased or generated or if the
activity "precorrin-6y methylase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.310-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0559] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8862, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8861, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8861 or polypeptide SEQ ID NO. 8862, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8861 or polypeptide SEQ ID
NO. 8862, respectively, is increased or generated or if the
activity "precorrin-6y methylase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.582-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0560] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 8862, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 8861, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 8861 or polypeptide SEQ ID NO. 8862, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 8861 or polypeptide SEQ ID
NO. 8862, respectively, is increased or generated or if the
activity "precorrin-6y methylase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred. Particularly, an increase of yield
from 1.05-fold to 1.178-fold, for example plus at least 100%
thereof, under standard conditions (intrinsic yield), e.g. in the
absence of nutrient deficiency as well as stress conditions, is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0561] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9047, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9046, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 9046 or polypeptide SEQ ID NO. 9047,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9046 or polypeptide
SEQ ID NO. 9047, respectively, is increased or generated or if the
activity "cobalt transport protein" is increased or generated in a
plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0562] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9047, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9046, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9046 or polypeptide SEQ ID NO. 9047, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9046 or polypeptide SEQ ID
NO. 9047, respectively, is increased or generated or if the
activity "cobalt transport protein" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.415-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0563] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9047, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9046, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9046 or polypeptide SEQ ID NO. 9047, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9046 or polypeptide SEQ ID
NO. 9047, respectively, is increased or generated or if the
activity "cobalt transport protein" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.432-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0564] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9047, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9046, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9046 or polypeptide SEQ ID NO. 9047, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9046 or polypeptide SEQ ID
NO. 9047, respectively, is increased or generated or if the
activity "cobalt transport protein" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0565] Particularly, an increase of yield from 1.05-fold to
1.383-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0566] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9281, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9280, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 9280 or polypeptide SEQ ID NO. 9281,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9280 or polypeptide
SEQ ID NO. 9281, respectively, is increased or generated or if the
activity "SLR1094-protein" is increased or generated in a plant
cell, plant or part thereof, especially if localized cytoplasmic,
an increased yield as compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0567] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9281, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9280, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9280 or polypeptide SEQ ID NO. 9281, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9280 or polypeptide SEQ ID
NO. 9281, respectively, is increased or generated or if the
activity "SLR1094-protein" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0568] Particularly, an increase of yield from 1.1-fold to
1.352-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0569] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9281, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9280, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9280 or polypeptide SEQ ID NO. 9281, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9280 or polypeptide SEQ ID
NO. 9281, respectively, is increased or generated or if the
activity "SLR1094-protein" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0570] Particularly, an increase of yield from 1.05-fold to
1.104-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0571] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9308, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9307, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 9307 or polypeptide SEQ ID NO. 9308,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9307 or polypeptide
SEQ ID NO. 9308, respectively, is increased or generated or if the
activity "oxidoreductase" is increased or generated in a plant
cell, plant or part thereof, especially if localized cytoplasmic,
an increased yield as compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0572] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9308, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9307, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9307 or polypeptide SEQ ID NO. 9308, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9307 or polypeptide SEQ ID
NO. 9308, respectively, is increased or generated or if the
activity "oxidoreductase" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0573] Particularly, an increase of yield from 1.1-fold to
1.361-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0574] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9308, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9307, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9307 or polypeptide SEQ ID NO. 9308, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9307 or polypeptide SEQ ID
NO. 9308, respectively, is increased or generated or if the
activity "oxidoreductase" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is
conferred.
[0575] Particularly, an increase of yield from 1.05-fold to
1.441-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0576] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9308, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9307, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Synechocystis sp.
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 9307 or polypeptide SEQ ID NO. 9308, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 9307 or polypeptide SEQ ID
NO. 9308, respectively, is increased or generated or if the
activity "oxidoreductase" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0577] Particularly, an increase of yield from 1.05-fold to
1.103-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0578] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9431, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9430, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 9430 or polypeptide SEQ ID
NO. 9431, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
9430 or polypeptide SEQ ID NO. 9431, respectively, is increased or
generated or if the activity "cardiolipin synthetase" is increased
or generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0579] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9431, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9430, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9430 or polypeptide SEQ ID NO. 9431,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9430 or polypeptide
SEQ ID NO. 9431, respectively, is increased or generated or if the
activity "cardiolipin synthetase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.503-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0580] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9431, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9430, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9430 or polypeptide SEQ ID NO. 9431,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9430 or polypeptide
SEQ ID NO. 9431, respectively, is increased or generated or if the
activity "cardiolipin synthetase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred. Particularly, an increase of yield
from 1.05-fold to 1.200-fold, for example plus at least 100%
thereof, under standard conditions (intrinsic yield), e.g. in the
absence of nutrient deficiency as well as stress conditions is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0581] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9480, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9479, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 9479 or polypeptide SEQ ID
NO. 9480, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
9479 or polypeptide SEQ ID NO. 9480, respectively, is increased or
generated or if the activity "ethanolamine kinase" is increased or
generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0582] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9480, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9479, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9479 or polypeptide SEQ ID NO. 9480,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9479 or polypeptide
SEQ ID NO. 9480, respectively, is increased or generated or if the
activity "ethanolamine kinase" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.167-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0583] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9480, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9479, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9479 or polypeptide SEQ ID NO. 9480,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9479 or polypeptide
SEQ ID NO. 9480, respectively, is increased or generated or if the
activity "ethanolamine kinase" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.117-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0584] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9501, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9500, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 9500 or polypeptide SEQ ID
NO. 9501, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
9500 or polypeptide SEQ ID NO. 9501, respectively, is increased or
generated or if the activity "enoyl-CoA isomerase" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0585] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9501, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9500, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9500 or polypeptide SEQ ID NO. 9501,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9500 or polypeptide
SEQ ID NO. 9501, respectively, is increased or generated or if the
activity "enoyl-CoA isomerase" is increased or generated in a plant
cell, plant or part thereof, especially, if the polypeptide is
plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.306-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0586] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9501, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9500, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9500 or polypeptide SEQ ID NO. 9501,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9500 or polypeptide
SEQ ID NO. 9501, respectively, is increased or generated or if the
activity "enoyl-CoA isomerase" is increased or generated in a plant
cell, plant or part thereof, especially if the polypeptide is
plastidic localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred. Particularly, an increase of yield from 1.05-fold to
1.229-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0587] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9554, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9553, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 9553 or polypeptide SEQ ID
NO. 9554, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
9553 or polypeptide SEQ ID NO. 9554, respectively, is increased or
generated or if the activity "holo-[acyl-carrier-protein] synthase"
is increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0588] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9554, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9553, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9553 or polypeptide SEQ ID NO. 9554,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9553 or polypeptide
SEQ ID NO. 9554, respectively, is increased or generated or if the
activity "holo-[acylcarrier-protein] synthase" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.276-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0589] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9554, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9553, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9553 or polypeptide SEQ ID NO. 9554,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9553 or polypeptide
SEQ ID NO. 9554, respectively, is increased or generated or if the
activity "holo-[acylcarrier-protein] synthase" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred.
[0590] Particularly, an increase of yield from 1.05-fold to
1.226-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0591] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9554, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9553, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9553 or polypeptide SEQ ID NO. 9554,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9553 or polypeptide
SEQ ID NO. 9554, respectively, is increased or generated or if the
activity "holo-[acylcarrier-protein] synthase" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased intrinsic yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased yield under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred. Particularly, an increase
of yield from 1.05-fold to 1.276-fold, for example plus at least
100% thereof, under standard conditions (intrinsic yield), e.g. in
the absence of nutrient deficiency as well as stress conditions is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0592] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9575, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9574, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 9574 or polypeptide SEQ ID
NO. 9575, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
9574 or polypeptide SEQ ID NO. 9575, respectively, is increased or
generated or if the activity "transketolase" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0593] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9575, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9574, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9574 or polypeptide SEQ ID NO. 9575,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9574 or polypeptide
SEQ ID NO. 9575, respectively, is increased or generated or if the
activity "transketolase" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is plastidic
localized, an increased tolerance to abiotic environmental stress,
in particular increased low temperature tolerance, compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. Particularly, an
increase of yield from 1.1-fold to 1.287-fold, for example plus at
least 100% thereof, under conditions of low temperature is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0594] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 9575, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 9574, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 9574 or polypeptide SEQ ID NO. 9575,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 9574 or polypeptide
SEQ ID NO. 9575, respectively, is increased or generated or if the
activity "transketolase" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is plastidic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred. Particularly, an increase of yield from 1.05-fold to
1.245-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0595] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10405, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10404, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 10404 or polypeptide SEQ ID NO. 10405,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 10404 or polypeptide
SEQ ID NO. 10405, respectively, is increased or generated or if the
activity "NADH dehydrogenase/NAD(P)H nitroreductase" is increased
or generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0596] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10405, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10404, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10404 or polypeptide SEQ ID NO. 10405, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10404 or polypeptide SEQ ID
NO. 10405, respectively, is increased or generated or if the
activity "NADH dehydrogenase/NAD(P)H nitroreductase" is increased
or generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0597] Particularly, an increase of yield from 1.1-fold to
1.585-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0598] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10405, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10404, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10404 or polypeptide SEQ ID NO. 10405, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10404 or polypeptide SEQ ID
NO. 10405, respectively, is increased or generated or if the
activity "NADH dehydrogenase/NAD(P)H nitroreductase" is increased
or generated in a plant cell, plant or part thereof, especially if
the polypeptide is plastidic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred. Particularly, an increase of yield from 1.05-fold to
1.166-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0599] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10405, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10404, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10404 or polypeptide SEQ ID NO. 10405, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10404 or polypeptide SEQ ID
NO. 10405, respectively, is increased or generated or if the
activity "NADH dehydrogenase/NAD(P)H nitroreductase" is increased
or generated in a plant cell, plant or part thereof, especially if
the polypeptide is plastidic localized, an increased intrinsic
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
Particularly, an increase of yield from 1.05-fold to 1.200-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0600] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10504, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10503, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 10503 or polypeptide SEQ ID NO. 10504,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 10503 or polypeptide
SEQ ID NO. 10504, respectively, is increased or generated or if the
activity "multiple drug resistance protein" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0601] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10504, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10503, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10503 or polypeptide SEQ ID NO. 10504, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10503 or polypeptide SEQ ID
NO. 10504, respectively, is increased or generated or if the
activity "multiple drug resistance protein" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.426-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0602] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 10591 or polypeptide SEQ ID NO. 10592,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 10591 or polypeptide
SEQ ID NO. 10592, respectively, is increased or generated or if the
activity "peptidyl-prolyl cis-trans isomerase" is increased or
generated in a plant cell, plant or part thereof, especially if
localized plastidic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0603] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10591 or polypeptide SEQ ID NO. 10592, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10591 or polypeptide SEQ ID
NO. 10592, respectively, is increased or generated or if the
activity "peptidyl-prolyl cis-trans isomerase" is increased or
generated in a plant cell, plant or part thereof, especially, if
the polypeptide is plastidic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred. Particularly, an increase of yield from
1.1-fold to 1.480-fold, for example plus at least 100% thereof,
under conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0604] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10591 or polypeptide SEQ ID NO. 10592, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10591 or polypeptide SEQ ID
NO. 10592, respectively, is increased or generated or if the
activity "peptidyl-prolyl cis-trans isomerase" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred.
[0605] Particularly, an increase of yield from 1.05-fold to
1.339-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0606] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10592, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10591, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 10591 or polypeptide SEQ ID NO. 10592, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 10591 or polypeptide SEQ ID
NO. 10592, respectively, is increased or generated or if the
activity "peptidyl-prolyl cis-trans isomerase" is increased or
generated in a plant cell, plant or part thereof, especially if the
polypeptide is plastidic localized, an increased intrinsic yield as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased yield under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions, is conferred. Particularly, an increase
of yield from 1.05-fold to 1.188-fold, for example plus at least
100% thereof, under standard conditions (intrinsic yield), e.g. in
the absence of nutrient deficiency as well as stress conditions is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0607] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10935, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 10934, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 10934 or polypeptide SEQ ID
NO. 10935, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
10934 or polypeptide SEQ ID NO. 10935, respectively, is increased
or generated or if the activity "3-methyl-2-oxobutanoate
hydroxymethyltransferase" is increased or generated in a plant
cell, plant or part thereof, especially if localized cytoplasmic,
an increased yield as compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0608] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 10935, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO.
[0609] 10934, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 10934 or polypeptide SEQ ID NO. 10935,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 10934 or polypeptide
SEQ ID NO. 10935, respectively, is increased or generated or if the
activity "3-methyl-2-oxobutanoate hydroxymethyltransferase" is
increased or generated in a plant cell, plant or part thereof,
especially, if the polypeptide is cytoplasmic localized, an
increased tolerance to abiotic environmental stress, in particular
increased low temperature tolerance, compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0610] Particularly, an increase of yield from 1.1-fold to
1.429-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0611] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11462, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11461, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 11461 or polypeptide SEQ ID
NO. 11462, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
11461 or polypeptide SEQ ID NO. 11462, respectively, is increased
or generated or if the activity "alcohol acetyltransferase" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0612] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11462, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11461, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11461 or polypeptide SEQ ID NO. 11462,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11461 or polypeptide
SEQ ID NO. 11462, respectively, is increased or generated or if the
activity "alcohol acetyltransferase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0613] Particularly, an increase of yield from 1.1-fold to
1.416-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0614] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11502, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11501, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 11501 or polypeptide SEQ ID
NO. 11502, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
11501 or polypeptide SEQ ID NO. 11502, respectively, is increased
or generated or if the activity "thiol-specific monooxygenase" is
increased or generated in a plant cell, plant or part thereof,
especially if localized cytoplasmic, an increased yield as compared
to a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0615] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11502, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11501, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11501 or polypeptide SEQ ID NO. 11502,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11501 or polypeptide
SEQ ID NO. 11502, respectively, is increased or generated or if the
activity "thiol-specific monooxygenase" is increased or generated
in a plant cell, plant or part thereof, especially, if the
polypeptide is cytoplasmic localized, an increased tolerance to
abiotic environmental stress, in particular increased low
temperature tolerance, compared to a corresponding non-modified,
e.g. a non-transformed, wild type plant cell, a plant or a part
thereof is conferred.
[0616] Particularly, an increase of yield from 1.1-fold to
1.621-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0617] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11502, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11501, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11501 or polypeptide SEQ ID NO. 11502,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11501 or polypeptide
SEQ ID NO. 11502, respectively, is increased or generated or if the
activity "thiol-specific monooxygenase" is increased or generated
in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased nutrient use
efficiency as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased nitrogen use efficiency
is conferred. Particularly, an increase of yield from 1.05-fold to
1.330-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0618] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11502, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11501, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11501 or polypeptide SEQ ID NO. 11502,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11501 or polypeptide
SEQ ID NO. 11502, respectively, is increased or generated or if the
activity "thiol-specific monooxygenase" is increased or generated
in a plant cell, plant or part thereof, especially if the
polypeptide is cytoplasmic localized, an increased intrinsic yield
as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
Particularly, an increase of yield from 1.05-fold to 1.258-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0619] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11564, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 11564 or polypeptide SEQ ID NO. 11565,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11564 or polypeptide
SEQ ID NO. 11565, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially if localized cytoplasmic, an
increased yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0620] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11564, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO.
[0621] 11564 or polypeptide SEQ ID NO. 11565, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 11564 or polypeptide SEQ ID
NO. 11565, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially, if the polypeptide is
cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0622] Particularly, an increase of yield from 1.1-fold to
1.230-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0623] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11564, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 11564 or polypeptide SEQ ID NO. 11565, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 11564 or polypeptide SEQ ID
NO. 11565, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased nutrient use efficiency as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased nitrogen use efficiency is conferred.
[0624] Particularly, an increase of yield from 1.05-fold to
1.202-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0625] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11565, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11564, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 11564 or polypeptide SEQ ID NO. 11565, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 11564 or polypeptide SEQ ID
NO. 11565, respectively, is increased or generated or if the
activity "Molybdenum-binding subunit of aldehyde oxidases and
xanthine dehydrogenases" is increased or generated in a plant cell,
plant or part thereof, especially if the polypeptide is cytoplasmic
localized, an increased intrinsic yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred. In one embodiment an
increased yield under standard conditions (intrinsic yield), e.g.
in the absence of nutrient deficiency as well as stress conditions,
is conferred.
[0626] Particularly, an increase of yield from 1.05-fold to
1.074-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0627] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11696, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11695, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide, respectively, comprising
the nucleic acid SEQ ID NO. 11695 or polypeptide SEQ ID NO. 11696,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11695 or polypeptide
SEQ ID NO. 11696, respectively, is increased or generated or if the
activity "glycerol dehydrogenase" is increased or generated in a
plant cell, plant or part thereof, especially if localized
cytoplasmic, an increased yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0628] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11696, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11695, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 11695 or polypeptide SEQ ID NO. 11696, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 11695 or polypeptide SEQ ID
NO. 11696, respectively, is increased or generated or if the
activity "glycerol dehydrogenase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.353-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0629] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11696, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11695, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 11695 or polypeptide SEQ ID NO. 11696, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 11695 or polypeptide SEQ ID
NO. 11696, respectively, is increased or generated or if the
activity "glycerol dehydrogenase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.457-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0630] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11696, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11695, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Escherichia coli
nucleic acid molecule or a polypeptide comprising the nucleic acid
SEQ ID NO. 11695 or polypeptide SEQ ID NO. 11696, respectively, is
increased or generated, e.g. if the activity of a nucleic acid
molecule or a polypeptide comprising the nucleic acid or
polypeptide or the consensus sequence or the polypeptide motif, as
depicted in table I, II or IV, column 7 in the respective same line
as the nucleic acid molecule SEQ ID NO. 11695 or polypeptide SEQ ID
NO. 11696, respectively, is increased or generated or if the
activity "glycerol dehydrogenase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred.
[0631] Particularly, an increase of yield from 1.05-fold to
1.191-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0632] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11908, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11907, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 11907 or polypeptide SEQ ID
NO. 11908, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
11907 or polypeptide SEQ ID NO. 11908, respectively, is increased
or generated or if the activity "protein required for degradation
of glycoproteins" is increased or generated in a plant cell, plant
or part thereof, especially if localized cytoplasmic, an increased
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0633] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11908, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11907, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11907 or polypeptide SEQ ID NO. 11908,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11907 or polypeptide
SEQ ID NO. 11908, respectively, is increased or generated or if the
activity "protein required for degradation of glycoproteins" is
increased or generated in a plant cell, plant or part thereof,
especially, if the polypeptide is cytoplasmic localized, an
increased tolerance to abiotic environmental stress, in particular
increased low temperature tolerance, compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred.
[0634] Particularly, an increase of yield from 1.1-fold to
1.697-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0635] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11908, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11907, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11907 or polypeptide SEQ ID NO. 11908,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11907 or polypeptide
SEQ ID NO. 11908, respectively, is increased or generated or if the
activity "protein required for degradation of glycoproteins" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is cytoplasmic localized, an
increased nutrient use efficiency as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
nitrogen use efficiency is conferred.
[0636] Particularly, an increase of yield from 1.05-fold to
1.469-fold, for example plus at least 100% thereof, under
conditions of nitrogen deficiency is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0637] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11908, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11907, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11907 or polypeptide SEQ ID NO. 11908,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11907 or polypeptide
SEQ ID NO. 11908, respectively, is increased or generated or if the
activity "protein required for degradation of glycoproteins" is
increased or generated in a plant cell, plant or part thereof,
especially if the polypeptide is cytoplasmic localized, an
increased intrinsic yield as compared to a corresponding
non-modified, e.g. a non-transformed, wild type plant cell, a plant
or a part thereof is conferred. In one embodiment an increased
yield under standard conditions (intrinsic yield), e.g. in the
absence of nutrient deficiency as well as stress conditions, is
conferred.
[0638] Particularly, an increase of yield from 1.05-fold to
1.369-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0639] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11945, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11944, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 11944 or polypeptide SEQ ID
NO. 11945, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
11944 or polypeptide SEQ ID NO. 11945, respectively, is increased
or generated or if the activity "ammonium transporter" is increased
or generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0640] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11945, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11944, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11944 or polypeptide SEQ ID NO. 11945,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11944 or polypeptide
SEQ ID NO. 11945, respectively, is increased or generated or if the
activity "ammonium transporter" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, an increase of yield from 1.1-fold to
1.808-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0641] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11945, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO.
[0642] 11944, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11944 or polypeptide SEQ ID NO. 11945,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11944 or polypeptide
SEQ ID NO. 11945, respectively, is increased or generated or if the
activity "ammonium transporter" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.593-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0643] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 11945, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 11944, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 11944 or polypeptide SEQ ID NO. 11945,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 11944 or polypeptide
SEQ ID NO. 11945, respectively, is increased or generated or if the
activity "ammonium transporter" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0644] In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
Particularly, an increase of yield from 1.05-fold to 1.214-fold,
for example plus at least 100% thereof, under standard conditions
(intrinsic yield), e.g. in the absence of nutrient deficiency as
well as stress conditions is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0645] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12358, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12357, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 12357 or polypeptide SEQ ID
NO. 12358, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
12357 or polypeptide SEQ ID NO. 12358, respectively, is increased
or generated or if the activity "Argininosuccinate synthase" is
increased or generated in a plant cell, plant or part thereof,
especially if localized plastidic and/or cytoplasmic, an increased
yield as compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0646] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12358, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12357, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 12357 or polypeptide SEQ ID NO. 12358,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 12357 or polypeptide
SEQ ID NO. 12358, respectively, is increased or generated or if the
activity "Argininosuccinate synthase" is increased or generated in
a plant cell, plant or part thereof, especially, if the polypeptide
is plastidic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred. Particularly, expressing under the control of a
plastidic signal sequence, an increase of yield from 1.1-fold to
1.300-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0647] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12358, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12357, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 12357 or polypeptide SEQ ID NO. 12358,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 12357 or polypeptide
SEQ ID NO. 12358, respectively, is increased or generated or if the
activity "Argininosuccinate synthase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
iscytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Expressing without combining said sequence or molecule with a
further targeting or signal sequence, e.g. without a further
heterologous target sequence or signal sequence as described herein
an increase of yield from 1.05-fold to 1.172-fold, for example plus
at least 100% thereof, under conditions of nitrogen deficiency is
conferred compared to a corresponding non-modified, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[0648] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12358, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12357, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 12357 or polypeptide SEQ ID NO. 12358,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 12357 or polypeptide
SEQ ID NO. 12358, respectively, is increased or generated or if the
activity "Argininosuccinate synthase" is increased or generated in
a plant cell, plant or part thereof, especially if the polypeptide
is plastidic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred. In one
embodiment an increased yield under standard conditions (intrinsic
yield), e.g. in the absence of nutrient deficiency as well as
stress conditions, is conferred. Particularly, expressing under the
control of a plastidic signal sequence, an increase of yield from
1.05-fold to 1.091-fold, for example plus at least 100% thereof,
under standard conditions
[0649] (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0650] Accordingly, in one embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12937, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12936, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide, respectively,
comprising the nucleic acid SEQ ID NO. 12936 or polypeptide SEQ ID
NO. 12937, respectively, is increased or generated, e.g. if the
activity of a nucleic acid molecule or a polypeptide comprising the
nucleic acid or polypeptide or the consensus sequence or the
polypeptide motif, as depicted in table I, II or IV, column 7 in
the respective same line as the nucleic acid molecule SEQ ID NO.
12936 or polypeptide SEQ ID NO. 12937, respectively, is increased
or generated or if the activity "glutamine synthetase" is increased
or generated in a plant cell, plant or part thereof, especially if
localized cytoplasmic, an increased yield as compared to a
corresponding non-modified, e.g. a non-transformed, wild type plant
cell, a plant or a part thereof is conferred.
[0651] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12937, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12936, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 12936 or polypeptide SEQ ID NO. 12937,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 12936 or polypeptide
SEQ ID NO. 12937, respectively, is increased or generated or if the
activity "glutamine synthetase" is increased or generated in a
plant cell, plant or part thereof, especially, if the polypeptide
is cytoplasmic localized, an increased tolerance to abiotic
environmental stress, in particular increased low temperature
tolerance, compared to a corresponding non-modified, e.g. a
non-transformed, wild type plant cell, a plant or a part thereof is
conferred.
[0652] Particularly, an increase of yield from 1.1-fold to
1.451-fold, for example plus at least 100% thereof, under
conditions of low temperature is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0653] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12937, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12936, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 12936 or polypeptide SEQ ID NO. 12937,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 12936 or polypeptide
SEQ ID NO. 12937, respectively, is increased or generated or if the
activity "glutamine synthetase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased nutrient use efficiency as
compared to a corresponding non-modified, e.g. a non-transformed,
wild type plant cell, a plant or a part thereof is conferred. In
one embodiment an increased nitrogen use efficiency is conferred.
Particularly, an increase of yield from 1.05-fold to 1.237-fold,
for example plus at least 100% thereof, under conditions of
nitrogen deficiency is conferred compared to a corresponding
non-modified, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[0654] In a further embodiment, in case the activity of a
polypeptide according to the polypeptide SEQ ID NO. 12937, or
encoded by a nucleic acid molecule comprising the nucleic acid SEQ
ID NO. 12936, or a homolog of said nucleic acid molecule or
polypeptide, e.g. in case the activity of the Saccharomyces
cerevisiae nucleic acid molecule or a polypeptide comprising the
nucleic acid SEQ ID NO. 12936 or polypeptide SEQ ID NO. 12937,
respectively, is increased or generated, e.g. if the activity of a
nucleic acid molecule or a polypeptide comprising the nucleic acid
or polypeptide or the consensus sequence or the polypeptide motif,
as depicted in table I, II or IV, column 7 in the respective same
line as the nucleic acid molecule SEQ ID NO. 12936 or polypeptide
SEQ ID NO. 12937, respectively, is increased or generated or if the
activity "glutamine synthetase" is increased or generated in a
plant cell, plant or part thereof, especially if the polypeptide is
cytoplasmic localized, an increased intrinsic yield as compared to
a corresponding non-modified, e.g. a non-transformed, wild type
plant cell, a plant or a part thereof is conferred.
[0655] In one embodiment an increased yield under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions, is conferred.
[0656] Particularly, an increase of yield from 1.05-fold to
1.236-fold, for example plus at least 100% thereof, under standard
conditions (intrinsic yield), e.g. in the absence of nutrient
deficiency as well as stress conditions is conferred compared to a
corresponding non-modified, e.g. non-transformed, wild type plant
cell, a plant or a part thereof.
[0657] The ratios indicated above particularly refer to an
increased yield actually measured as increase of biomass,
especially as fresh weight biomass of aerial parts.
[0658] For the purposes of the invention, as a rule the plural is
intended to encompass the singular and vice versa.
[0659] Unless otherwise specified, the terms "polynucleotides",
"nucleic acid" and "nucleic acid molecute" are interchangeably in
the present context. Unless otherwise specified, the terms
"peptide", "polypeptide" and "protein" are interchangeably in the
present context. The term "sequence" may relate to polynucleotides,
nucleic acids, nucleic acid molecules, peptides, polypeptides and
proteins, depending on the context in which the term "sequence" is
used. The terms "gene(s)", "polynucleotide", "nucleic acid
sequence", "nucleotide sequence", or "nucleic acid molecule(s)" as
used herein refers to a polymeric form of nucleotides of any
length, either ribonucleotides or deoxyribonucleotides. The terms
refer only to the primary structure of the molecule.
[0660] Thus, the terms "gene(s)", "polynucleotide", "nucleic acid
sequence", "nucleotide sequence", or "nucleic acid molecule(s)" as
used herein include double- and single-stranded DNA and/or RNA.
They also include known types of modifications, for example,
methylation, "caps", substitutions of one or more of the naturally
occurring nucleotides with an analog. Preferably, the DNA or RNA
sequence comprises a coding sequence encoding the herein defined
polypeptide.
[0661] A "coding sequence" is a nucleotide sequence, which is
transcribed into an RNA, e.g. a regulatory RNA, such as a miRNA, a
ta-siRNA, cosuppression molecule, an RNAi, a ribozyme, etc. or into
a mRNA which is translated into a polypeptide when placed under the
control of appropriate regulatory sequences. The boundaries of the
coding sequence are determined by a translation start codon at the
5'-terminus and a translation stop codon at the 3'-terminus. A
coding sequence can include, but is not limited to mRNA, cDNA,
recombinant nucleotide sequences or genomic DNA, while introns may
be present as well under certain circumstances.
[0662] As used in the present context a nucleic acid molecule may
also encompass the untranslated sequence located at the 3' and at
the 5' end of the coding gene region, for example at least 500,
preferably 200, especially preferably 100, nucleotides of the
sequence upstream of the 5' end of the coding region and at least
100, preferably 50, especially preferably 20, nucleotides of the
sequence downstream of the 3' end of the coding gene region. In the
event for example the antisense, RNAi, snRNA, dsRNA, siRNA, miRNA,
ta-siRNA, co-suppression molecule, ribozyme etc. technology is used
coding regions as well as the 5'- and/or 3'-regions can
advantageously be used.
[0663] However, it is often advantageous only to choose the coding
region for cloning and expression purposes.
[0664] "Polypeptide" refers to a polymer of amino acid (amino acid
sequence) and does not refer to a specific length of the molecule.
Thus, peptides and oligopeptides are included within the definition
of polypeptide. This term does also refer to or include
post-translational modifications of the polypeptide, for example,
glycosylations, acetylations, phosphorylations and the like.
Included within the definition are, for example, polypeptides
containing one or more analogs of an amino acid (including, for
example, unnatural amino acids, etc.), polypeptides with
substituted linkages, as well as other modifications known in the
art, both naturally occurring and non-naturally occurring.
[0665] The term "table I" used in this specification is to be taken
to specify the content of table I A and table I B. The term "table
II" used in this specification is to be taken to specify the
content of table II A and table II B. The term "table I A" used in
this specification is to be taken to specify the content of table I
A. The term "table I B" used in this specification is to be taken
to specify the content of table I B. The term "table II A" used in
this specification is to be taken to specify the content of table
II A. The term "table II B" used in this specification is to be
taken to specify the content of table II B. In one preferred
embodiment, the term "table I" means table I B. In one preferred
embodiment, the term "table II" means table II B.
[0666] The terms "comprise" or "comprising" and grammatical
variations thereof when used in this specification are to be taken
to specify the presence of stated features, integers, steps or
connponents or groups thereof, but not to preclude the presence or
addition of one or more other features, integers, steps, components
or groups thereof.
[0667] In accordance with the invention, a protein or polypeptide
has the "activity of an protein as shown in table II, column 3" if
its de novo activity, or its increased expression directly or
indirectly leads to and confers increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another increased yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, plant or part thereof and the protein has the
above mentioned activities of a protein as shown in table II,
column 3. Throughout the specification the activity or preferably
the biological activity of such a protein or polypeptide or an
nucleic acid molecule or sequence encoding such protein or
polypeptide is identical or similar if it still has the biological
or enzymatic activity of a protein as shown in table II, column 3,
or which has at least 10% of the original enzymatic activity,
preferably 20%, 30%, 40%, 50%, particularly preferably 60%, 70%,
80% most particularly preferably 90%, 95%, 98%, 99% in comparison
to a protein as shown in table II, column 3 of S. cerevisiae or E.
coli or Synechocystis sp. or A. thaliana. In another embodiment the
biological or enzymatic activity of a protein as shown in table II,
column 3, has at least 101% of the original enzymatic activity,
preferably 110%, 120%, %, 150%, particularly preferably 150%, 200%,
300% in comparison to a protein as shown in table II, column 3 of
S. cerevisiae or E. coli or Synechocystis sp. or A. thaliana.
[0668] The terms "increased", "raised", "extended", "enhanced",
"improved" or "amplified" relate to a corresponding change of a
property in a plant, an organism, a part of an organism such as a
tissue, seed, root, leave, flower etc. or in a cell and are
interchangeable. Preferably, the overall activity in the volume is
increased or enhanced in cases if the increase or enhancement is
related to the increase or enhancement of an activity of a gene
product, independent whether the amount of gene product or the
specific activity of the gene product or both is increased or
enhanced or whether the amount, stability or translation efficacy
of the nucleic acid sequence or gene encoding for the gene product
is increased or enhanced.
[0669] The terms "increase" relate to a corresponding change of a
property an organism or in a part of a plant, an organism, such as
a tissue, seed, root, leave, flower etc. or in a cell. Preferably,
the overall activity in the volume is increased in cases the
increase relates to the increase of an activity of a gene product,
independent whether the amount of gene product or the specific
activity of the gene product or both is increased or generated or
whether the amount, stability or translation efficacy of the
nucleic acid sequence or gene encoding for the gene product is
increased.
[0670] Under "change of a property" it is understood that the
activity, expression level or amount of a gene product or the
metabolite content is changed in a specific volume relative to a
corresponding volume of a control, reference or wild type,
including the de novo creation of the activity or expression.
[0671] The terms "increase" include the change of said property in
only parts of the subject of the present invention, for example,
the modification can be found in compartment of a cell, like a
organelle, or in a part of a plant, like tissue, seed, root, leave,
flower etc. but is not detectable if the overall subject, i.e.
complete cell or plant, is tested.
[0672] Accordingly, the term "increase" means that the specific
activity of an enzyme as well as the amount of a compound or
metabolite, e.g. of a polypeptide, a nucleic acid molecule of the
invention or an encoding mRNA or DNA, can be increased in a
volume.
[0673] The terms "wild type", "control" or "reference" are
exchangeable and can be a cell or a part of organisms such as an
organelle like a chloroplast or a tissue, or an organism, in
particular a plant, which was not modified or treated according to
the herein described process according to the invention.
Accordingly, the cell or a part of organisms such as an organelle
like a chloroplast or a tissue, or an organism, in particular a
plant used as wild type, control or reference corresponds to the
cell, organism, plant or part thereof as much as possible and is in
any other property but in the result of the process of the
invention as identical to the subject matter of the invention as
possible. Thus, the wild type, control or reference is treated
identically or as identical as possible, saying that only
conditions or properties might be different which do not influence
the quality of the tested property.
[0674] Preferably, any comparison is carried out under analogous
conditions. The term "analogous conditions" means that all
conditions such as, for example, culture or growing conditions,
soil, nutrient, water content of the soil, temperature, humidity or
surrounding air or soil, assay conditions (such as buffer
composition, temperature, substrates, pathogen strain,
concentrations and the like) are kept identical between the
experiments to be compared.
[0675] The "reference", "control", or "wild type" is preferably a
subject, e.g. an organelle, a cell, a tissue, an organism, in
particular a plant, which was not modified or treated according to
the herein described process of the invention and is in any other
property as similar to the subject matter of the invention as
possible. The reference, control or wild type is in its genome,
transcriptome, proteome or metabolome as similar as possible to the
subject of the present invention. Preferably, the term "reference-"
"control-" or "wild type-"-organelle,-cell, -tissue or -organism,
in particular plant, relates to an organelle, cell, tissue or
organism, in particular plant, which is nearly genetically
identical to the organelle, cell, tissue or organism, in particular
plant, of the present invention or a part thereof preferably 95%,
more preferred are 98%, even more preferred are 99.00%, in
particular 99.10%, 99.30%, 99.50%, 99.70%, 99.90%, 99.99%, 99.999%
or more. Most preferable the "reference", "control", or "wild type"
is a subject, e.g. an organelle, a cell, a tissue, an organism, in
particular a plant, which is genetically identical to the organism,
in particular plant, cell, a tissue or organelle used according to
the process of the invention except that the responsible or
activity conferring nucleic acid molecules or the gene product
encoded by them are amended, manipulated, exchanged or introduced
according to the inventive process.
[0676] In case, a control, reference or wild type differing from
the subject of the present invention only by not being subject of
the process of the invention can not be provided, a control,
reference or wild type can be an organism in which the cause for
the modulation of an activity conferring the enhanced tolerance to
abiotic environmental stress and/or increased yield as compared to
a corresponding, e.g. non-transformed, wild type plant cell, plant
or part thereof or expression of the nucleic acid molecule of the
invention as described herein has been switched back or off, e.g.
by knocking out the expression of responsible gene product, e.g. by
antisense inhibition, by inactivation of an activator or agonist,
by activation of an inhibitor or antagonist, by inhibition through
adding inhibitory antibodies, by adding active compounds as e.g.
hormones, by introducing negative dominant mutants, etc. A gene
production can for example be knocked out by introducing
inactivating point mutations, which lead to an enzymatic activity
inhibition or a destabilization or an inhibition of the ability to
bind to cofactors etc.
[0677] Accordingly, preferred reference subject is the starting
subject of the present process of the invention. Preferably, the
reference and the subject matter of the invention are compared
after standardization and normalization, e.g. to the amount of
total RNA, DNA, or protein or activity or expression of reference
genes, like housekeeping genes, such as ubiquitin, actin or
ribosomal proteins.
[0678] The increase or modulation according to this invention can
be constitutive, e.g. due to a stable permanent transgenic
expression or to a stable mutation in the corresponding endogenous
gene encoding the nucleic acid molecule of the invention or to a
modulation of the expression or of the behavior of a gene
conferring the expression of the polypeptide of the invention, or
transient, e.g. due to an transient transformation or temporary
addition of a modulator such as a agonist or antagonist or
inducible, e.g. after transformation with a inducible construct
carrying the nucleic acid molecule of the invention under control
of a inducible promoter and adding the inducer, e.g. tetracycline
or as described herein below.
[0679] The increase in activity of the polypeptide amounts in a
cell, a tissue, an organelle, an organ or an organism, preferably a
plant, or a part thereof preferably to at least 5%, preferably to
at least 20% or at to least 50%, especially preferably to at least
70%, 80%, 90% or more, very especially preferably are to at least
100%, 150% or 200%, most preferably are to at least 250% or more in
comparison to the control, reference or wild type. In one
embodiment the term increase means the increase in amount in
relation to the weight of the organism or part thereof (w/w).
[0680] In one embodiment the increase in activity of the
polypeptide amounts in an organelle such as a plastid. In another
embodiment the increase in activity of the polypeptide amounts in
the cytoplasm.
[0681] The specific activity of a polypeptide encoded by a nucleic
acid molecule of the present invention or of the polypeptide of the
present invention can be tested as described in the examples. In
particular, the expression of a protein in question in a cell, e.g.
a plant cell in comparison to a control is an easy test and can be
performed as described in the state of the art.
[0682] The term "increase" includes, that a compound or an
activity, especially an activity, is introduced into a cell, the
cytoplasm or a sub-cellular compartment or organelle de novo or
that the compound or the activity, especially an activity, has not
been detected before, in other words it is "generated".
[0683] Accordingly, in the following, the term "increasing" also
comprises the term "generating" or "stimulating". The increased
activity manifests itself in increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another increased yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, plant or part thereof.
[0684] The sequence of B0414 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as pyrimidine deaminase/reductase.
[0685] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "pyrimidine deaminase/reductase" from
Escherichia coli or its functional equivalent or its homolog, e.g.
the increase of [0686] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said B0414 or a functional
equivalent or a homologue thereof as shown depicted in column 7 of
table I, preferably a homologue or functional equivalent as shown
depicted in column 7 of table I B, and being depicted in the same
respective line as said B0414; or [0687] (b) a polypeptide
comprising a polypeptide, a consensus sequence or a polypeptide
motif as shown depicted in column 5 of table II and column 7 of
table IV, respectively, and being depicted in the same respective
line as said B0414 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B0414, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0688] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "pyrimidine
deaminase/reductase", preferably it is the molecule of section (a)
or (b) of this paragraph.
[0689] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "pyrimidine
deaminase/reductase", is increased cytoplasmic.
[0690] The sequence of B2931 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as oxidoreductase.
[0691] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "oxidoreductase" from Escherichia coli or
its functional equivalent or its homolog, e.g. the increase of
[0692] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B2931 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B2931; or [0693] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B2931 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B2931, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0694] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "oxidoreductase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0695] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "oxidoreductase", is
increased cytoplasmic.
[0696] The sequence of B3945 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as glycerol dehydrogenase.
[0697] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "glycerol dehydrogenase" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0698] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3945 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B3945; or [0699] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table Hand column 7 of table IV,
respectively, and being depicted in the same respective line as
said B3945 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3945, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0700] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "glycerol
dehydrogenase", preferably it is the molecule of section (a) or (b)
of this paragraph.
[0701] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "glycerol
dehydrogenase", is increased cytoplasmic.
[0702] The sequence of Yel004w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as uridine diphosphate-N-acetylglucosamine
transporter.
[0703] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "uridine diphosphate-N-acetylglucosamine
transporter" from Saccharomyces cerevisiae or its functional
equivalent or its homolog, e.g. the increase of [0704] (a) a gene
product of a gene comprising the nucleic acid molecule as shown in
column 5 of table I, and being depicted in the same respective line
as said Yel004w or a functional equivalent or a homologue thereof
as shown depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table 1B,
and being depicted in the same respective line as said Yel004w; or
[0705] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table Hand column 7 of table IV, respectively, and being depicted
in the same respective line as said Yel004w or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said Yel004w, as mentioned herein, for increasing yield,
e.g. increasing one or more yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example
increasing drought tolerance and/or low temperature tolerance
and/or increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0706] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "uridine
diphosphate-N-acetylglucosamine transporter", preferably it is the
molecule of section (a) or (b) of this paragraph.
[0707] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "uridine
diphosphate-Nacetylglucosannine transporter", is increased
cytoplasmic.
[0708] The sequence of Yer177w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as DNA and protein binding protein for
controlling the proteome at post-transcriptional level.
[0709] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "DNA and protein binding protein for
controlling the proteome at post-transcriptional level" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0710] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yer177w
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yer177w; or [0711] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table Hand
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yer177w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yer177w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0712] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "DNA and protein binding
protein for controlling the proteome at post-transcriptional
level", preferably it is the molecule of section (a) or (b) of this
paragraph.
[0713] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "DNA and protein binding
protein for controlling the proteome at post-transcriptional
level", is increased cytoplasmic.
[0714] The sequence of Yhr204w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as protein required for degradation of
glycoproteins.
[0715] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "protein required for degradation of
glycoproteins" from Saccharomyces cerevisiae or its functional
equivalent or its homolog, e.g. the increase of [0716] (a) a gene
product of a gene comprising the nucleic acid molecule as shown in
column 5 of table I, and being depicted in the same respective line
as said Yhr204w or a functional equivalent or a homologue thereof
as shown depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said Yhr204w; or
[0717] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said Yhr204w or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said Yhr204w, as mentioned herein, for increasing yield,
e.g. increasing one or more yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example
increasing drought tolerance and/or low temperature tolerance
and/or increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0718] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "protein required for
degradation of glycoproteins", preferably it is the molecule of
section (a) or (b) of this paragraph.
[0719] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "protein required for
degradation of glycoproteins", is increased cytoplasmic.
[0720] The sequence of YI1053c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as aquaporin.
[0721] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "aquaporin" from Saccharomyces cerevisiae
or its functional equivalent or its homolog, e.g. the increase of
[0722] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said Yll053c or a functional equivalent or
a homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table 1B, and being depicted in the same respective
line as said Yll053c; or [0723] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table Hand column 7 of table IV,
respectively, and being depicted in the same respective line as
said Yll053c or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said Yll053c, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0724] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "aquaporin", preferably
it is the molecule of section (a) or (b) of this paragraph.
[0725] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "aquaporin", is
increased cytoplasmic.
[0726] The sequence of Yml123c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as inorganic phosphate transporter.
[0727] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "inorganic phosphate transporter" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0728] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yml123c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yml123c; or [0729] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yml123c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yml123c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0730] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "inorganic phosphate
transporter", preferably it is the molecule of section (a) or (b)
of this paragraph.
[0731] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "inorganic phosphate
transporter", is increased cytoplasmic.
[0732] The sequence of Ynl142w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as ammonium transporter.
[0733] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "ammonium transporter" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0734] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ynl142w or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ynl142w; or [0735] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ynl142w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ynl142w, As mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0736] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "ammonium transporter",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0737] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "ammonium transporter",
is increased cytoplasmic.
[0738] The sequence of Ynr040w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as YNR040W-protein.
[0739] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "YNR040W-protein" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0740] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ynr040w or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ynr040w; or [0741] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ynr040w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ynr040w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0742] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "YNR040W-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0743] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "YNR040W-protein", is
increased cytoplasmic.
[0744] The sequence of Ypr035w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as glutamine synthetase.
[0745] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "glutamine synthetase" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0746] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ypr035w or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ypr035w; or [0747] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ypr035w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ypr035w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0748] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "glutamine synthetase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0749] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "glutamine synthetase",
is increased cytoplasmic.
[0750] The sequence of B0903 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as formate acetyltransferase 1.
[0751] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "formate acetyltransferase 1" from
Escherichia coli or its functional equivalent or its homolog, e.g.
the increase of [0752] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said B0903 or a functional
equivalent or a homologue thereof as shown depicted in column 7 of
table I, preferably a homologue or functional equivalent as shown
depicted in column 7 of table I B, and being depicted in the same
respective line as said B0903; or [0753] (b) a polypeptide
comprising a polypeptide, a consensus sequence or a polypeptide
motif as shown depicted in column 5 of table II and column 7 of
table IV, respectively, and being depicted in the same respective
line as said B0903 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B0903, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0754] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "formate
acetyltransferase 1", preferably it is the molecule of section (a)
or (b) of this paragraph.
[0755] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "formate
acetyltransferase 1", is increased as indicated in column 6 of
table I, e.g. plastidic or plastidic and/or cytoplasmic.
[0756] The sequence of B1393 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as enoyl-CoA hydratase.
[0757] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "enoyl-CoA hydratase" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0758] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B1393 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B1393; or [0759] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B1393 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B1393, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0760] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "enoyl-CoA hydratase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0761] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "enoyl-CoA hydratase",
is increased cytoplasmic.
[0762] The sequence of B2704 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as glucitol/sorbitol-specific enzyme IIA
component protein.
[0763] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "glucitol/sorbitol-specific enzyme IIA
component protein" from Escherichia coli or its functional
equivalent or its homolog, e.g. the increase of [0764] (a) a gene
product of a gene comprising the nucleic acid molecule as shown in
column 5 of table I, and being depicted in the same respective line
as said B2704 or a functional equivalent or a homologue thereof as
shown depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said B2704; or
[0765] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said B2704 or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said B2704, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0766] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a
"glucitol/sorbitol-specific enzyme IIA component protein",
preferably it is the molecule of section (a) or (b) of this
paragraph. In one embodiment, said molecule, which activity is to
be increased in the process of the invention and which is the gene
product with an activity as described as a
"glucitol/sorbitol-specific enzyme IIA component protein", is
increased plastidic.
[0767] The sequence of B2905 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as aminomethyltransferase.
[0768] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "aminomethyltransferase" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0769] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B2905 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B2905; or [0770] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B2905 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B2905, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0771] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a
"aminomethyltransferase", preferably it is the molecule of section
(a) or (b) of this paragraph.
[0772] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a
"aminomethyltransferase", is increased cytoplasmic.
[0773] The sequence of B3206 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Phosphocarrier protein.
[0774] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Phosphocarrier protein" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0775] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3206 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B3206; or [0776] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B3206 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3206, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0777] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Phosphocarrier
protein", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0778] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Phosphocarrier
protein", is increased plastidic.
[0779] The sequence of B3659 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as two-module transport protein.
[0780] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "two-module transport protein" from
Escherichia coli or its functional equivalent or its homolog, e.g.
the increase of [0781] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said B3659 or a functional
equivalent or a homologue thereof as shown depicted in column 7 of
table I, preferably a homologue or functional equivalent as shown
depicted in column 7 of table I B, and being depicted in the same
respective line as said B3659; or [0782] (b) a polypeptide
comprising a polypeptide, a consensus sequence or a polypeptide
motif as shown depicted in column 5 of table II and column 7 of
table IV, respectively, and being depicted in the same respective
line as said B3659 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3659, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0783] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "two-module transport
protein", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0784] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "two-module transport
protein", is increased cytoplasmic.
[0785] The sequence of B3871 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as GTP-binding protein.
[0786] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "GTP-binding protein" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0787] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3871 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B3871; or [0788] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B3871 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3871, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0789] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "GTP-binding protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0790] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "GTP-binding protein",
is increased cytoplasmic.
[0791] The sequence of Ydr142c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Peroxisomal targeting signal 2
receptor.
[0792] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Peroxisomal targeting signal 2 receptor"
from Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0793] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Ydr142c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ydr142c; or [0794] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ydr142c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ydr142c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0795] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Peroxisomal targeting
signal 2 receptor", preferably it is the molecule of section (a) or
(b) of this paragraph.
[0796] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Peroxisomal targeting
signal 2 receptor", is increased plastidic.
[0797] The sequence of Yer175w-a from Saccharomyces cerevisiae,
e.g. as shown in column 5 of table I, is published (e.g. sequences
from S. cerevisiae have been published in Goffeau et al., Science
274 (5287), 546 (1996), sequences from E. coli have been published
in Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as yer175w-a-protein.
[0798] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "yer175w-a-protein" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0799] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Yer175w-a or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yer175w-a; or [0800]
(b) a polypeptide comprising a polypeptide, a consensus sequence or
a polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yer175w-a or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yer175w-a, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0801] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "yer175w-a-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0802] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "yer175w-a-protein", is
increased cytoplasmic.
[0803] The sequence of Ygr289c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as hexose transporter.
[0804] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "hexose transporter" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0805] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ygr289c or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ygr289c; or [0806] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ygr289c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ygr289c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0807] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "hexose transporter",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0808] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "hexose transporter", is
increased plastidic.
[0809] The sequence of Yhr044c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as 2-deoxyglucose-6-phosphate
phosphatase.
[0810] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "2-deoxyglucose-6-phosphate phosphatase"
from Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0811] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yhr044c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yhr044c; or [0812] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yhr044c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yhr044c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0813] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a
"2-deoxyglucose-6-phosphate phosphatase", preferably it is the
molecule of section (a) or (b) of this paragraph.
[0814] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a
"2-deoxyglucose-6-phosphate phosphatase", is increased
plastidic.
[0815] The sequence of YHR072W from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as lanosterol synthase.
[0816] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "lanosterol synthase" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0817] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said YHR072W or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YHR072W; or [0818] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YHR072W or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YHR072W, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0819] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "lanosterol synthase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0820] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "lanosterol synthase",
is increased cytoplasmic.
[0821] The sequence of Yhr213w-a from Saccharomyces cerevisiae,
e.g. as shown in column 5 of table I, is published (e.g. sequences
from S. cerevisiae have been published in Goffeau et al., Science
274 (5287), 546 (1996), sequences from E. coli have been published
in Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as yhr213w-a-protein.
[0822] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "yhr213w-a-protein" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0823] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Yhr213w-a or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yhr213w-a; or [0824]
(b) a polypeptide comprising a polypeptide, a consensus sequence or
a polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yhr213w-a or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yhr213w-a, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0825] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "yhr213w-a-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0826] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "yhr213w-a-protein", is
increased cytoplasmic.
[0827] The sequence of Yil053w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as (DL)-glycerol-3-phosphatase.
[0828] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "(DL)-glycerol-3-phosphatase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0829] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yil053w
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table 1B, and being
depicted in the same respective line as said Yil053w; or [0830] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table Hand
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yil053w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yil053w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0831] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a
"(DL)-glycerol-3-phosphatase", preferably it is the molecule of
section (a) or (b) of this paragraph.
[0832] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a
"(DL)-glycerol-3-phosphatase", is increased cytoplasmic.
[0833] The sequence of Yjl103c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as transcriptional regulatory protein.
[0834] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "transcriptional regulatory protein" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0835] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yjl103c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yjl103c; or [0836] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yjl103c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yjl103c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0837] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "transcriptional
regulatory protein", preferably it is the molecule of section (a)
or (b) of this paragraph.
[0838] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "transcriptional
regulatory protein", is increased plastidic.
[0839] The sequence of Yjl137c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Glycogen synthesis initiator protein.
[0840] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Glycogen synthesis initiator protein"
from Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0841] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yjl137c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yjl137c; or [0842] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yjl137c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yjl137c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0843] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Glycogen synthesis
initiator protein", preferably it is the molecule of section (a) or
(b) of this paragraph.
[0844] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Glycogen synthesis
initiator protein", is increased plastidic.
[0845] The sequence of Ylr027c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as aspartate aminotransferase.
[0846] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "aspartate aminotransferase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0847] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Ylr027c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ylr027c; or [0848] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ylr027c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ylr027c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0849] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "aspartate
aminotransferase", preferably it is the molecule of section (a) or
(b) of this paragraph.
[0850] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "aspartate
aminotransferase", is increased cytoplasmic.
[0851] The sequence of Yml079w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as YML079W-protein.
[0852] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "YML079W-protein" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0853] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Yml079w or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yml079w; or [0854] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yml079w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yml079w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0855] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "YML079W-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0856] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "YML079W-protein", is
increased as indicated in column 6 of table I, e.g. plastidic or
cytoplasmic.
[0857] The sequence of Ymm157c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as YMR157c-protein.
[0858] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "YMR157c-protein" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0859] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ymm157c or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ymm157c; or [0860] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ymm157c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ymm157c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0861] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "YMR157c-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0862] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "YMR157c-protein", is
increased plastidic.
[0863] The sequence of Ynl024c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as YNL024C-protein.
[0864] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "YNL024C-protein" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0865] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ynl024c or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ynl024c; or [0866] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ynl024c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ynl024c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0867] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "YNL024C-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0868] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "YNL024C-protein", is
increased plastidic.
[0869] The sequence of Yol058w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Argininosuccinate synthase.
[0870] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Argininosuccinate synthase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0871] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said Yol058w
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Yol058w; or [0872] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Yol058w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Yol058w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0873] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Argininosuccinate
synthase", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0874] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Argininosuccinate
synthase", is increased as indicated in column 6 of table I, e.g.
plastidic or cytoplasmic.
[0875] The sequence of Yp1180w from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as subunit of TORC1.
[0876] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "subunit of TORC1" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0877] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ypl180w or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ypl180w; or [0878] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said Ypl180w or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
Ypl180w, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0879] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "subunit of TORC1",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0880] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "subunit of TORC1", is
increased cytoplasmic.
[0881] The sequence of Ypr167c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Phosphoadenosine phosphosulfate
reductase.
[0882] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Phosphoadenosine phosphosulfate
reductase" from Saccharomyces cerevisiae or its functional
equivalent or its homolog, e.g. the increase of [0883] (a) a gene
product of a gene comprising the nucleic acid molecule as shown in
column 5 of table I, and being depicted in the same respective line
as said Ypr167c or a functional equivalent or a homologue thereof
as shown depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said Ypr167c; or
[0884] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said Ypr167c or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said Ypr167c, as mentioned herein, for increasing yield,
e.g. increasing one or more yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example
increasing drought tolerance and/or low temperature tolerance
and/or increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0885] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Phosphoadenosine
phosphosulfate reductase", preferably it is the molecule of section
(a) or (b) of this paragraph.
[0886] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Phosphoadenosine
phosphosulfate reductase", is increased plastidic.
[0887] The sequence of B0036 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Enoyl CoA hydratase.
[0888] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Enoyl CoA hydratase" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0889] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B0036 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B0036; or [0890] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B0036 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B0036, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0891] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Enoyl CoA hydratase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0892] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Enoyl CoA hydratase",
is increased plastidic.
[0893] The sequence of B1906 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as B1906-protein.
[0894] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "B1906-protein" from Escherichia coli or
its functional equivalent or its homolog, e.g. the increase of
[0895] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B1906 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B1906; or [0896] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B1906 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B1906, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0897] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "B1906-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0898] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "B1906-protein", is
increased cytoplasmic.
[0899] The sequence of B2371 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as CoA-transferase-like protein
(NAD(P)-binding).
[0900] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "CoA-transferase-like protein
(NAD(P)-binding)" from Escherichia coli or its functional
equivalent or its homolog, e.g. the increase of [0901] (a) a gene
product of a gene comprising the nucleic acid molecule as shown in
column 5 of table I, and being depicted in the same respective line
as said B2371 or a functional equivalent or a homologue thereof as
shown depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said B2371; or
[0902] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said B2371 or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said B2371, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0903] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "CoA-transferase-like
protein (NAD(P)-binding)", preferably it is the molecule of section
(a) or (b) of this paragraph.
[0904] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "CoA-transferase-like
protein (NAD(P)-binding)", is increased cytoplasmic.
[0905] The sequence of B2881 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Molybdenum-binding subunit of aldehyde
oxidases and xanthine dehydrogenases.
[0906] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Molybdenum-binding subunit of aldehyde
oxidases and xanthine dehydrogenases" from Escherichia coli or its
functional equivalent or its homolog, e.g. the increase of [0907]
(a) a gene product of a gene comprising the nucleic acid molecule
as shown in column 5 of table I, and being depicted in the same
respective line as said B2881 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B2881; or [0908] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B2881 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B2881, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0909] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Molybdenum-binding
subunit of aldehyde oxidases and xanthine dehydrogenases",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0910] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Molybdenum-binding
subunit of aldehyde oxidases and xanthine dehydrogenases", is
increased cytoplasmic.
[0911] The sequence of B3106 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Pirin-like protein.
[0912] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Pirin-like protein" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0913] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3106 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B3106; or [0914] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B3106 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3106, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0915] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Pirin-like protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0916] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Pirin-like protein", is
increased cytoplasmic.
[0917] The sequence of B3400 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Heat shock protein.
[0918] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Heat shock protein" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [0919] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3400 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B3400; or [0920] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B3400 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3400, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0921] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Heat shock protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0922] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Heat shock protein", is
increased plastidic.
[0923] The sequence of B3410 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as B3410-protein.
[0924] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "B3410-protein" from Escherichia coli or
its functional equivalent or its homolog, e.g. the increase of
[0925] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3410 or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B3410; or [0926] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B3410 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B3410, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0927] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "B3410-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0928] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "B3410-protein", is
increased cytoplasmic.
[0929] The sequence of B4209 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Regulator of cell morphogenesis and NO
signaling.
[0930] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Regulator of cell morphogenesis and NO
signaling" from Escherichia coli or its functional equivalent or
its homolog, e.g. the increase of [0931] (a) a gene product of a
gene comprising the nucleic acid molecule as shown in column 5 of
table I, and being depicted in the same respective line as said
B4209 or a functional equivalent or a homologue thereof as shown
depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said B4209; or
[0932] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said B4209 or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said B4209, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0933] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Regulator of cell
morphogenesis and NO signaling", preferably it is the molecule of
section (a) or (b) of this paragraph.
[0934] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Regulator of cell
morphogenesis and NO signaling", is increased plastidic.
[0935] The sequence of SLL1545 from Synechocystis sp., e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as glutathione S-transferase.
[0936] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "glutathione S-transferase" from
Synechocystis sp. or its functional equivalent or its homolog, e.g.
the increase of [0937] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said SLL1545 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said SLL1545; or [0938] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said SLL1545 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
SLL1545, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0939] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "glutathione
S-transferase", preferably it is the molecule of section (a) or (b)
of this paragraph.
[0940] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "glutathione
S-transferase", is increased cytoplasmic.
[0941] The sequence of SLR1348 from Synechocystis sp., e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as serine acetyltransferase.
[0942] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "serine acetyltransferase" from
Synechocystis sp. or its functional equivalent or its homolog, e.g.
the increase of [0943] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said SLR1348 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said SLR1348; or [0944] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said SLR1348 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or tunetional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
SLR1348, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0945] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "serine
acetyltransferase", preferably it is the molecule of section (a) or
(b) of this paragraph.
[0946] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "serine
acetyltransferase", is increased Mitochondric.
[0947] The sequence of YGR191W from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as amino acid permease.
[0948] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "amino acid permease" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [0949] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said YGR191W or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YGR191W; or [0950] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YGR191W or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YGR191W, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0951] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "amino acid permease",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0952] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "amino acid permease",
is increased plastidic.
[0953] The sequence of AT1G22920 from Arabidopsis thaliana, e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as signalosome complex subunit.
[0954] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "signalosome complex subunit" from
Arabidopsis thaliana or its functional equivalent or its homolog,
e.g. the increase of [0955] (a) a gene product of a gene comprising
the nucleic acid molecule as shown in column 5 of table I, and
being depicted in the same respective line as said AT1G22920 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said AT1G22920; or [0956]
(b) a polypeptide comprising a polypeptide, a consensus sequence or
a polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said AT1 G22920 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
AT1G22920, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[0957] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "signalosome complex
subunit", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0958] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "signalosome complex
subunit", is increased cytoplasmic.
[0959] The sequence of B1600 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as multidrug resistance protein.
[0960] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "multidrug resistance protein" from
Escherichia coli or its functional equivalent or its homolog, e.g.
the increase of [0961] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said B1600 or a functional
equivalent or a homologue thereof as shown depicted in column 7 of
table I, preferably a homologue or functional equivalent as shown
depicted in column 7 of table I B, and being depicted in the same
respective line as said B1600; or [0962] (b) a polypeptide
comprising a polypeptide, a consensus sequence or a polypeptide
motif as shown depicted in column 5 of table II and column 7 of
table IV, respectively, and being depicted in the same respective
line as said B1600 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B1600, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0963] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "multidrug resistance
protein", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0964] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "multidrug resistance
protein", is increased plastidic.
[0965] The sequence of B1900 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Arabinose transport system ATP-binding
protein.
[0966] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Arabinose transport system ATP-binding
protein" from Escherichia coli or its functional equivalent or its
homolog, e.g. the increase of [0967] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said B1900 or
a functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said B1900; or [0968] (b) a
polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said B1900 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said B1900,
as mentioned herein, for increasing yield, e.g. increasing one or
more yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0969] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Arabinose transport
system ATP-binding protein", preferably it is the molecule of
section (a) or (b) of this paragraph.
[0970] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Arabinose transport
system ATP-binding protein", is increased plastidic.
[0971] The sequence of SLL0099 from Synechocystis sp., e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as precorrin-6y methylase.
[0972] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "precorrin-6y methylase" from
Synechocystis sp. or its functional equivalent or its homolog, e.g.
the increase of [0973] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said SLL0099 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said SLL0099; or [0974] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said SLL0099 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
SLL0099, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0975] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "precorrin-6y
methylase", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0976] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "precorrin-6y
methylase", is increased cytoplasmic.
[0977] The sequence of SLL0383 from Synechocystis sp., e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as cobalt transport protein.
[0978] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "cobalt transport protein" from
Synechocystis sp. or its functional equivalent or its homolog, e.g.
the increase of [0979] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said SLL0383 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said SLL0383; or [0980] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said SLL0383 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
SLL0383, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0981] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "cobalt transport
protein", preferably it is the molecule of section (a) or (b) of
this paragraph.
[0982] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "cobalt transport
protein", is increased cytoplasmic.
[0983] The sequence of SLR1094 from Synechocystis sp., e.g. as
shown in column 5 of table I, is published, and its activity is
described as SLR1094-protein.
[0984] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "SLR1094-protein" from Synechocystis sp.
or its functional equivalent or its homolog, e.g. the increase of
[0985] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said SLR1094 or a functional equivalent or
a homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said SLR1094; or [0986] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said SLR1094 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said SLR1094, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0987] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "SLR1094-protein",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0988] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "SLR1094-protein", is
increased cytoplasmic.
[0989] The sequence of SLR1520 from Synechocystis sp., e.g. as
shown in column 5 of table I, is published, and/or its activity is
described as oxidoreductase.
[0990] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "oxidoreductase" from Synechocystis sp.
or its functional equivalent or its homolog, e.g. the increase of
[0991] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said SLR1520 or a functional equivalent or
a homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said SLR1520; or [0992] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said SLR1520 or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said SLR1520, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0993] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "oxidoreductase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[0994] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "oxidoreductase", is
increased cytoplasmic.
[0995] The sequence of YDL142C from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as cardiolipin synthetase.
[0996] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "cardiolipin synthetase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [0997] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said YDL142C
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YDL142C; or [0998] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YDL142C or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YDL142C, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[0999] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "cardiolipin
synthetase", preferably it is the molecule of section (a) or (b) of
this paragraph.
[1000] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "cardiolipin
synthetase", is increased cytoplasmic.
[1001] The sequence of YDR147W from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as ethanolamine kinase.
[1002] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "ethanolamine kinase" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [1003] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said YDR147W or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YDR147W; or [1004] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YDR147W or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YDR147W, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1005] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "ethanolamine kinase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[1006] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "ethanolamine kinase",
is increased cytoplasmic.
[1007] The sequence of YLR284c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as enoyl-CoA isomerase.
[1008] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "enoyl-CoA isomerase" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [1009] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said YLR284c or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YLR284c; or [1010] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YLR284c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YLR284c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1011] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "enoyl-CoA isomerase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[1012] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "enoyl-CoA isomerase",
is increased plastidic.
[1013] The sequence of YPL148C from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as holo-[acyl-carrier-protein] synthase.
[1014] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "holo-[acyl-carrier-protein] synthase"
from Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [1015] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said YPL148C
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YPL148C; or [1016] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YPL148C or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YPL148C, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1017] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a
"holo-[acyl-carrier-protein] synthase", preferably it is the
molecule of section (a) or (b) of this paragraph.
[1018] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a
"holo-[acyl-carrier-protein] synthase", is increased plastidic.
[1019] The sequence of YPR074c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as transketolase.
[1020] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "transketolase" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [1021] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said YPR074c or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YPRO74C; or [1022] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YPRO74C or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YPRO74C, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1023] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "transketolase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[1024] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "transketolase", is
increased plastidic.
[1025] The sequence of B1008 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as NADH dehydrogenase/NAD(P)H
nitroreductase.
[1026] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "NADH dehydrogenase/NAD(P)H
nitroreductase" from Escherichia coli or its functional equivalent
or its homolog, e.g. the increase of [1027] (a) a gene product of a
gene comprising the nucleic acid molecule as shown in column 5 of
table I, and being depicted in the same respective line as said
B1008 or a functional equivalent or a homologue thereof as shown
depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said B1008; or
[1028] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said B1008 or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said B1008, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[1029] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "NADH
dehydrogenase/NAD(P)H nitroreductase", preferably it is the
molecule of section (a) or (b) of this paragraph.
[1030] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "NADH
dehydrogenase/NAD(P)H nitroreductase", is increased plastidic.
[1031] The sequence of B1529 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as multiple drug resistance protein.
[1032] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "multiple drug resistance protein" from
Escherichia coli or its functional equivalent or its homolog, e.g.
the increase of [1033] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said B1529 or a functional
equivalent or a homologue thereof as shown depicted in column 7 of
table I, preferably a homologue or functional equivalent as shown
depicted in column 7 of table I B, and being depicted in the same
respective line as said B1529; or [1034] (b) a polypeptide
comprising a polypeptide, a consensus sequence or a polypeptide
motif as shown depicted in column 5 of table II and column 7 of
table IV, respectively, and being depicted in the same respective
line as said B1529 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B1529, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1035] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "multiple drug
resistance protein", preferably it is the molecule of section (a)
or (b) of this paragraph.
[1036] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "multiple drug
resistance protein", is increased plastidic.
[1037] The sequence of B3347 from Escherichia coli, e.g. as shown
in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as peptidyl-prolyl cis-trans isomerase.
[1038] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "peptidyl-prolyl cis-trans isomerase"
from Escherichia coli or its functional equivalent or its homolog,
e.g. the increase of [1039] (a) a gene product of a gene comprising
the nucleic acid molecule as shown in column 5 of table I, and
being depicted in the same respective line as said B3347 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said B3347; or [1040] (b) a
polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said B3347 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said B3347,
as mentioned herein, for increasing yield, e.g. increasing one or
more yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1041] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "peptidyl-prolyl
cis-trans isomerase", preferably it is the molecule of section (a)
or (b) of this paragraph.
[1042] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "peptidyl-prolyl
cis-trans isomerase", is increased plastidic.
[1043] The sequence of YBR176W from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as 3-methyl-2-oxobutanoate
hydroxynnethyltransferase.
[1044] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "3-methyl-2-oxobutanoate
hydroxymethyltransferase" from Saccharomyces cerevisiae or its
functional equivalent or its homolog, e.g. the increase of [1045]
(a) a gene product of a gene comprising the nucleic acid molecule
as shown in column 5 of table I, and being depicted in the same
respective line as said YBR176W or a functional equivalent or a
homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said YBR176W; or [1046] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said YBR176W or a functional equivalent or a homologue thereof as
depicted in column 7 of table II, preferably a homologue or
functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said YBR176W, as
mentioned herein, for increasing yield, e.g. increasing one or more
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1047] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "3-methyl-2-oxobutanoate
hydroxymethyltransferase", preferably it is the molecule of section
(a) or (b) of this paragraph.
[1048] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "3-methyl-2-oxobutanoate
hydroxymethyltransferase", is increased cytoplasmic.
[1049] The sequence of YGR177c from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as alcohol acetyltransferase.
[1050] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "alcohol acetyltransferase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [1051] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said YGR177c
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YGR177c; or [1052] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YGR177c or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YGR177c, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1053] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "alcohol
acetyltransferase", preferably it is the molecule of section (a) or
(b) of this paragraph.
[1054] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "alcohol
acetyltransferase", is increased cytoplasmic.
[1055] The sequence of YHR176W from Saccharomyces cerevisiae, e.g.
as shown in column 5 of table I, is published (e.g. sequences from
S. cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as thiol-specific monooxygenase.
[1056] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "thiol-specific monooxygenase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [1057] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said YHR176W
or a functional equivalent or a homologue thereof as shown depicted
in column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said YHR176W; or [1058] (b)
a polypeptide comprising a polypeptide, a consensus sequence or a
polypeptide motif as shown depicted in column 5 of table II and
column 7 of table IV, respectively, and being depicted in the same
respective line as said YHR176W or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
YHR176W, as mentioned herein, for increasing yield, e.g. increasing
one or more yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1059] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "thiol-specific
monooxygenase", preferably it is the molecule of section (a) or (b)
of this paragraph.
[1060] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "thiol-specific
monooxygenase", is increased cytoplasmic.
[1061] The sequence of B2881.sub.--2 from Escherichia coli, e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as Molybdenum-binding subunit of aldehyde
oxidases and xanthine dehydrogenases.
[1062] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Molybdenum-binding subunit of aldehyde
oxidases and xanthine dehydrogenases" from Escherichia coli or its
functional equivalent or its homolog, e.g. the increase of [1063]
(a) a gene product of a gene comprising the nucleic acid molecule
as shown in column 5 of table I, and being depicted in the same
respective line as said B2881.sub.--2 or a functional equivalent or
a homologue thereof as shown depicted in column 7 of table I,
preferably a homologue or functional equivalent as shown depicted
in column 7 of table I B, and being depicted in the same respective
line as said B2881.sub.--2; or [1064] (b) a polypeptide comprising
a polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said B2881.sub.--2 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said B2881.sub.--2,
as mentioned herein, for increasing yield, e.g. increasing one or
more yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1065] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Molybdenum-binding
subunit of aldehyde oxidases and xanthine dehydrogenases",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[1066] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Molybdenum-binding
subunit of aldehyde oxidases and xanthine dehydrogenases", is
increased cytoplasmic.
[1067] The sequence of B3945.sub.--2 from Escherichia coli, e.g. as
shown in column 5 of table I, is published (e.g. sequences from S.
cerevisiae have been published in Goffeau et al., Science 274
(5287), 546 (1996), sequences from E. coli have been published in
Blattner et al., Science 277 (5331), 1453 (1997)), and/or its
activity is described as glycerol dehydrogenase.
[1068] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "glycerol dehydrogenase" from Escherichia
coli or its functional equivalent or its homolog, e.g. the increase
of [1069] (a) a gene product of a gene comprising the nucleic acid
molecule as shown in column 5 of table I, and being depicted in the
same respective line as said B3945.sub.--2 or a functional
equivalent or a homologue thereof as shown depicted in column 7 of
table I, preferably a homologue or functional equivalent as shown
depicted in column 7 of table I B, and being depicted in the same
respective line as said B3945.sub.--2; or [1070] (b) a polypeptide
comprising a polypeptide, a consensus sequence or a polypeptide
motif as shown depicted in column 5 of table II and column 7 of
table IV, respectively, and being depicted in the same respective
line as said B3945.sub.--2 or a functional equivalent or a
homologue thereof as depicted in column 7 of table II, preferably a
homologue or functional equivalent as depicted in column 7 of table
II B, and being depicted in the same respective line as said
B3945.sub.--2, as mentioned herein, for increasing yield, e.g.
increasing one or more yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[1071] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "glycerol
dehydrogenase", preferably it is the molecule of section (a) or (b)
of this paragraph.
[1072] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "glycerol
dehydrogenase", is increased cytoplasmic.
[1073] The sequence of Yhr204w.sub.--2 from Saccharomyces
cerevisiae, e.g. as shown in column 5 of table I, is published
(e.g. sequences from S. cerevisiae have been published in Goffeau
et al., Science 274 (5287), 546 (1996), sequences from E. coli have
been published in Blattner et al., Science 277 (5331), 1453
(1997)), and/or its activity is described as protein required for
degradation of glycoproteins.
[1074] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "protein required for degradation of
glycoproteins" from Saccharomyces cerevisiae or its functional
equivalent or its homolog, e.g. the increase of [1075] (a) a gene
product of a gene comprising the nucleic acid molecule as shown in
column 5 of table I, and being depicted in the same respective line
as said Yhr204w.sub.--2 or a functional equivalent or a homologue
thereof as shown depicted in column 7 of table I, preferably a
homologue or functional equivalent as shown depicted in column 7 of
table I B, and being depicted in the same respective line as said
Yhr204w.sub.--2; or [1076] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said Yhr204w.sub.--2 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said Yhr204w.sub.--2,
as mentioned herein, for increasing yield, e.g. increasing one or
more yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1077] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "protein required for
degradation of glycoproteins", preferably it is the molecule of
section (a) or (b) of this paragraph.
[1078] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "protein required for
degradation of glycoproteins", is increased cytoplasmic.
[1079] The sequence of Ynl142w.sub.--2 from Saccharomyces
cerevisiae, e.g. as shown in column 5 of table I, is published
(e.g. sequences from S. cerevisiae have been published in Goffeau
et al., Science 274 (5287), 546 (1996), sequences from E. coli have
been published in Blattner et al., Science 277 (5331), 1453
(1997)), and/or its activity is described as ammonium
transporter.
[1080] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "ammonium transporter" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [1081] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ynl142w.sub.--2 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ynl142w.sub.--2; or
[1082] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said Ynl142w.sub.--2 or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said Ynl142w.sub.--2, as mentioned herein, for increasing
yield, e.g. increasing one or more yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example
increasing drought tolerance and/or low temperature tolerance
and/or increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[1083] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "ammonium transporter",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[1084] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "ammonium transporter",
is increased cytoplasmic.
[1085] The sequence of Yol058w.sub.--2 from Saccharomyces
cerevisiae, e.g. as shown in column 5 of table I, is published
(e.g. sequences from S. cerevisiae have been published in Goffeau
et al., Science 274 (5287), 546 (1996), sequences from E. coli have
been published in Blattner et al., Science 277 (5331), 1453
(1997)), and/or its activity is described as Argininosuccinate
synthase.
[1086] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "Argininosuccinate synthase" from
Saccharomyces cerevisiae or its functional equivalent or its
homolog, e.g. the increase of [1087] (a) a gene product of a gene
comprising the nucleic acid molecule as shown in column 5 of table
I, and being depicted in the same respective line as said
Yol058w.sub.--2 or a functional equivalent or a homologue thereof
as shown depicted in column 7 of table I, preferably a homologue or
functional equivalent as shown depicted in column 7 of table I B,
and being depicted in the same respective line as said
Yol058w.sub.--2; or [1088] (b) a polypeptide comprising a
polypeptide, a consensus sequence or a polypeptide motif as shown
depicted in column 5 of table II and column 7 of table IV,
respectively, and being depicted in the same respective line as
said Yol058w.sub.--2 or a functional equivalent or a homologue
thereof as depicted in column 7 of table II, preferably a homologue
or functional equivalent as depicted in column 7 of table II B, and
being depicted in the same respective line as said Yol058w.sub.--2,
as mentioned herein, for increasing yield, e.g. increasing one or
more yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, and/as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof in
plant cell, plant or part thereof, as mentioned, especially for an
enhanced tolerance to abiotic environmental stress, or increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield.
[1089] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "Argininosuccinate
synthase", preferably it is the molecule of section (a) or (b) of
this paragraph.
[1090] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "Argininosuccinate
synthase", is increased as indicated in column 6 of table I, e.g.
plastidic or cytoplasmic.
[1091] The sequence of Ypr035w.sub.--2 from Saccharomyces
cerevisiae, e.g. as shown in column 5 of table I, is published
(e.g. sequences from S. cerevisiae have been published in Goffeau
et al., Science 274 (5287), 546 (1996), sequences from E. coli have
been published in Blattner et al., Science 277 (5331), 1453
(1997)), and/or its activity is described as glutamine
synthetase.
[1092] Accordingly, in one embodiment, the process of the present
invention comprises increasing or generating the activity of a gene
product with the activity "glutamine synthetase" from Saccharomyces
cerevisiae or its functional equivalent or its homolog, e.g. the
increase of [1093] (a) a gene product of a gene comprising the
nucleic acid molecule as shown in column 5 of table I, and being
depicted in the same respective line as said Ypr035w.sub.--2 or a
functional equivalent or a homologue thereof as shown depicted in
column 7 of table I, preferably a homologue or functional
equivalent as shown depicted in column 7 of table I B, and being
depicted in the same respective line as said Ypr035w.sub.--2; or
[1094] (b) a polypeptide comprising a polypeptide, a consensus
sequence or a polypeptide motif as shown depicted in column 5 of
table II and column 7 of table IV, respectively, and being depicted
in the same respective line as said Ypr035w.sub.--2 or a functional
equivalent or a homologue thereof as depicted in column 7 of table
II, preferably a homologue or functional equivalent as depicted in
column 7 of table II B, and being depicted in the same respective
line as said Ypr035w.sub.--2, as mentioned herein, for increasing
yield, e.g. increasing one or more yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example
increasing drought tolerance and/or low temperature tolerance
and/or increasing nutrient use efficiency, and/as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof in plant cell, plant or part thereof, as mentioned,
especially for an enhanced tolerance to abiotic environmental
stress, or increased yield, or an enhanced tolerance to abiotic
environmental stress and increased yield.
[1095] Accordingly, in one embodiment, the molecule which activity
is to be increased in the process of the invention is the gene
product with an activity of described as a "glutamine synthetase",
preferably it is the molecule of section (a) or (b) of this
paragraph.
[1096] In one embodiment, said molecule, which activity is to be
increased in the process of the invention and which is the gene
product with an activity as described as a "glutamine synthetase",
is increased cytoplasmic.
[1097] Surprisingly, it was observed that an increasing or
generating of at least one gene conferring an activity selected
from the group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoAtransferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein or of a gene comprising a
nucleic acid sequence described in column 5 of table I, in a plant,
e.g. A. thaliana, conferred with increased yield, e.g. with an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait in the transformed plants as compared to a
corresponding, e.g. non-transformed, wild type plant, especially an
enhanced tolerance to abiotic environmental stress, or an increased
yield, or an enhanced tolerance to abiotic environmental stress and
increased yield
[1098] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 38 in A. thaliana, for
example with the activity of a "pyrimidine deaminase/reductase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "pyrimidine deaminase/reductase" and being encoded by
a gene comprising the nucleic acid sequence SEQ ID NO.: 38 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 38 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "pyrimidine
deaminase/reductase", conferred an increased yield, for example a
low temperature tolerance.
[1099] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 147 in A. thaliana, for
example with the activity of a "oxidoreductase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "oxidoreductase"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 147 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
147 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a
"oxidoreductase", conferred an increased yield, for example a low
temperature tolerance.
[1100] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 172 in A. thaliana, for
example with the activity of a "glycerol dehydrogenase", conferred
an increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to
the wild type control. It was further observed that increasing or
generating the activity of a gene product with said activity of a
"glycerol dehydrogenase" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 172 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 172 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "glycerol dehydrogenase", conferred an
increased yield, for example a low temperature tolerance.
[1101] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 382 in A. thaliana, for
example with the activity of a "uridine
diphosphate-N-acetylglucosamine transporter", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "uridine
diphosphate-N-acetylglucosamine transporter" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 382 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 382 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "uridine
diphosphate-N-acetylglucosamine transporter", conferred an
increased yield, for example a low temperature tolerance.
[1102] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 406 in A. thaliana, for
example with the activity of a "DNA and protein binding protein for
controlling the proteome at post-transcriptional level", conferred
an increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to
the wild type control. It was further observed that increasing or
generating the activity of a gene product with said activity of a
"DNA and protein binding protein for controlling the proteome at
post-transcriptional level" and being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 406 in A. thaliana conferred
an tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 406 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "DNA and protein binding protein for
controlling the proteome at post-transcriptional level", conferred
an increased yield, for example a low temperature tolerance.
[1103] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 917 in A. thaliana, for
example with the activity of a "protein required for degradation of
glycoproteins", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "protein required for degradation of
glycoproteins" and being encoded by a gene comprising the nucleic
acid sequence SEQ ID NO.: 917 in A. thaliana conferred an tolerance
to abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 917 localized as indicated in table I, column
6, e.g. cytoplasmic in A. thaliana, for example with the activity
of a "protein required for degradation of glycoproteins", conferred
an increased yield, for example a low temperature tolerance.
[1104] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 952 in A. thaliana, for
example with the activity of a "aquaporin", conferred an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "aquaporin" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
952 in A. thaliana conferred an tolerance to abiotic environmental
stress, e.g. increase low temperature tolerance compared with the
wild type control. In particular, it was observed that increasing
or generating the activity of a gene product being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 952 localized
as indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "aquaporin", conferred an
increased yield, for example a low temperature tolerance.
[1105] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 1320 in A. thaliana, for
example with the activity of a "inorganic phosphate transporter",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "inorganic phosphate transporter" and being encoded
by a gene comprising the nucleic acid sequence SEQ ID NO.: 1320 in
A. thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 1320 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "inorganic phosphate
transporter", conferred an increased yield, for example a low
temperature tolerance.
[1106] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 1648 in A. thaliana, for
example with the activity of a "ammonium transporter", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "ammonium
transporter" and being encoded by a gene comprising the nucleic
acid sequence SEQ ID NO.: 1648 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 1648 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "ammonium transporter", conferred an
increased yield, for example a low temperature tolerance.
[1107] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 2065 in A. thaliana, for
example with the activity of a "YNR040W-protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"YNR040W-protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 2065 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 2065 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "YNR040W-protein", conferred an increased
yield, for example a low temperature tolerance.
[1108] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 2081 in A. thaliana, for
example with the activity of a "glutamine synthetase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "glutamine
synthetase" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 2081 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 2081 localized as indicated in table I, column
6, e.g. cytoplasmic in A. thaliana, for example with the activity
of a "glutamine synthetase", conferred an increased yield, for
example a low temperature tolerance. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
2406 in A. thaliana, for example with the activity of a "formate
acetyltransferase 1", conferred an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "formate acetyltransferase 1"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 2406 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
2406 localized as indicated in table I, column 6, e.g. plastidic or
plastidic and/or cytoplasmic in A. thaliana, for example with the
activity of a "formate acetyltransferase 1", conferred an increased
yield, for example a low temperature tolerance. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 2564 in A. thaliana, for example with the
activity of a "enoyl-CoA hydratase", conferred an increased yield,
e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "enoyl-CoA hydratase" and
being encoded by a gene comprising the nucleic acid sequence SEQ ID
NO.: 2564 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
2564 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a "enoyl-CoA
hydratase", conferred an increased yield, for example a low
temperature tolerance.
[1109] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 2841 in A. thaliana, for
example with the activity of a "glucitol/sorbitol-specific enzyme
IIA component protein", conferred an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "glucitol/sorbitol-specific
enzyme IIA component protein" and being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 2841 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 2841 localized as
indicated in table I, column 6, e.g. plastidic in A. thaliana, for
example with the activity of a "glucitol/sorbitol-specific enzyme
IIA component protein", conferred an increased yield, for example a
low temperature tolerance.
[1110] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 2879 in A. thaliana, for
example with the activity of a "aminomethyltransferase", conferred
an increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to
the wild type control. It was further observed that increasing or
generating the activity of a gene product with said activity of a
"aminomethyltransferase" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 2879 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 2879 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "aminomethyltransferase", conferred an
increased yield, for example a low temperature tolerance.
[1111] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 3109 in A. thaliana, for
example with the activity of a "Phosphocarrier protein", conferred
an increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to
the wild type control. It was further observed that increasing or
generating the activity of a gene product with said activity of a
"Phosphocarrier protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 3109 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 3109 localized as indicated in
table I, column 6, e.g. plastidic in A. thaliana, for example with
the activity of a "Phosphocarrier protein", conferred an increased
yield, for example a low temperature tolerance.
[1112] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 3403 in A. thaliana, for
example with the activity of a "two-module transport protein",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "two-module transport protein" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 3403 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 3403 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "two-module transport protein",
conferred an increased yield, for example a low temperature
tolerance.
[1113] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 3441 in A. thaliana, for
example with the activity of a "GTP-binding protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "GTP-binding
protein" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 3441 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 3441 localized as indicated in table I, column
6, e.g. cytoplasmic in A. thaliana, for example with the activity
of a "GTP-binding protein", conferred an increased yield, for
example a low temperature tolerance. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
3978 in A. thaliana, for example with the activity of a
"Peroxisomal targeting signal 2 receptor", conferred an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "Peroxisomal targeting
signal 2 receptor" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 3978 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 3978 localized as indicated in
table I, column 6, e.g. plastidic in A. thaliana, for example with
the activity of a "Peroxisomal targeting signal 2 receptor",
conferred an increased yield, for example a low temperature
tolerance.
[1114] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4047 in A. thaliana, for
example with the activity of a "yer175w-a-protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"yer175w-a-protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 4047 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 4047 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "yer175w-a-protein", conferred an increased
yield, for example a low temperature tolerance.
[1115] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4051 in A. thaliana, for
example with the activity of a "hexose transporter", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "hexose
transporter" and being encoded by a gene comprising the nucleic
acid sequence SEQ ID NO.: 4051 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 4051 localized as indicated in
table I, column 6, e.g. plastidic in A. thaliana, for example with
the activity of a "hexose transporter", conferred an increased
yield, for example a low temperature tolerance.
[1116] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4131 in A. thaliana, for
example with the activity of a "2-deoxyglucose-6-phosphate
phosphatase", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "2-deoxyglucose-6-phosphate phosphatase" and
being encoded by a gene comprising the nucleic acid sequence SEQ ID
NO.: 4131 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
4131 localized as indicated in table I, column 6, e.g. plastidic in
A. thaliana, for example with the activity of a
"2-deoxyglucose-6-phosphate phosphatase", conferred an increased
yield, for example a low temperature tolerance.
[1117] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4217 in A. thaliana, for
example with the activity of a "lanosterol synthase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "lanosterol
synthase" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 4217 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 4217 localized as indicated in table I, column
6, e.g. cytoplasmic in A. thaliana, for example with the activity
of a "lanosterol synthase", conferred an increased yield, for
example a low temperature tolerance. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
4491 in A. thaliana, for example with the activity of a
"yhr213w-a-protein", conferred an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "yhr213w-a-protein" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
4491 in A. thaliana conferred an tolerance to abiotic environmental
stress, e.g. increase low temperature tolerance compared with the
wild type control. In particular, it was observed that increasing
or generating the activity of a gene product being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 4491
localized as indicated in table I, column 6, e.g. cytoplasmic in A.
thaliana, for example with the activity of a "yhr213w-a-protein",
conferred an increased yield, for example a low temperature
tolerance. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 4495 in A.
thaliana, for example with the activity of a
"(DL)-glycerol-3-phosphatase", conferred an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "(DL)-glycerol-3-phosphatase"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 4495 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
4495 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a
"(DL)-glycerol-3-phosphatase", conferred an increased yield, for
example a low temperature tolerance.
[1118] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4558 in A. thaliana, for
example with the activity of a "transcriptional regulatory
protein", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "transcriptional regulatory protein" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
4558 in A. thaliana conferred an tolerance to abiotic environmental
stress, e.g. increase low temperature tolerance compared with the
wild type control. In particular, it was observed that increasing
or generating the activity of a gene product being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 4558
localized as indicated in table I, column 6, e.g. plastidic in A.
thaliana, for example with the activity of a "transcriptional
regulatory protein", conferred an increased yield, for example a
low temperature tolerance.
[1119] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4589 in A. thaliana, for
example with the activity of a "Glycogen synthesis initiator
protein", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "Glycogen synthesis initiator protein" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
4589 in A. thaliana conferred an tolerance to abiotic environmental
stress, e.g. increase low temperature tolerance compared with the
wild type control. In particular, it was observed that increasing
or generating the activity of a gene product being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 4589
localized as indicated in table I, column 6, e.g. plastidic in A.
thaliana, for example with the activity of a "Glycogen synthesis
initiator protein", conferred an increased yield, for example a low
temperature tolerance.
[1120] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 4622 in A. thaliana, for
example with the activity of a "aspartate aminotransferase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "aspartate aminotransferase" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 4622 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 4622 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "aspartate aminotransferase",
conferred an increased yield, for example a low temperature
tolerance.
[1121] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 5070 in A. thaliana, for
example with the activity of a "YML079W-protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"YML079W-protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 5070 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 5070 localized as indicated in
table I, column 6, e.g. plastidic or cytoplasmic in A. thaliana,
for example with the activity of a "YML079W-protein", conferred an
increased yield, for example a low temperature tolerance. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 5102 in A. thaliana, for example
with the activity of a "YMR157c-protein", conferred an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "YMR157c-protein" and
being encoded by a gene comprising the nucleic acid sequence SEQ ID
NO.: 5102 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
5102 localized as indicated in table I, column 6, e.g. plastidic in
A. thaliana, for example with the activity of a "YMR157c-protein",
conferred an increased yield, for example a low temperature
tolerance.
[1122] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 5115 in A. thaliana, for
example with the activity of a "YNL024C-protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"YNL024C-protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 5115 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 5115 localized as indicated in
table I, column 6, e.g. plastidic in A. thaliana, for example with
the activity of a "YNL024C-protein", conferred an increased yield,
for example a low temperature tolerance. In particular, it was
observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 5159 in A. thaliana, for example with the
activity of a "Argininosuccinate synthase", conferred an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "Argininosuccinate
synthase" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 5159 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 5159 localized as indicated in table I, column
6, e.g. plastidic or cytoplasmic in A. thaliana, for example with
the activity of a "Argininosuccinate synthase", conferred an
increased yield, for example a low temperature tolerance.
[1123] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 5746 in A. thaliana, for
example with the activity of a "subunit of TORC1", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "subunit of
TORC1" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 5746 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 5746 localized as indicated in table I, column
6, e.g. cytoplasmic in A. thaliana, for example with the activity
of a "subunit of TORC1", conferred an increased yield, for example
a low temperature tolerance.
[1124] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 5756 in A. thaliana, for
example with the activity of a "Phosphoadenosine phosphosulfate
reductase", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "Phosphoadenosine phosphosulfate reductase" and
being encoded by a gene comprising the nucleic acid sequence SEQ ID
NO.: 5756 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
5756 localized as indicated in table I, column 6, e.g. plastidic in
A. thaliana, for example with the activity of a "Phosphoadenosine
phosphosulfate reductase", conferred an increased yield, for
example a low temperature tolerance.
[1125] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 6086 in A. thaliana, for
example with the activity of a "Enoyl CoA hydratase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "Enoyl CoA
hydratase" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 6086 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 6086 localized as indicated in table I, column
6, e.g. plastidic in A. thaliana, for example with the activity of
a "Enoyl CoA hydratase", conferred an increased yield, for example
a low temperature tolerance. In particular, it was observed that
increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
6581 in A. thaliana, for example with the activity of a
"B1906-protein", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "B1906-protein" and being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 6581 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 6581 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "B1906-protein", conferred an
increased yield, for example a low temperature tolerance.
[1126] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 6609 in A. thaliana, for
example with the activity of a "CoA-transferase-like protein
(NAD(P)-binding)", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "CoA-transferase-like protein (NAD(P)-binding)"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 6609 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
6609 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a
"CoA-transferase-like protein (NAD(P)-binding)", conferred an
increased yield, for example a low temperature tolerance.
[1127] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 6949 in A. thaliana, for
example with the activity of a "Molybdenum-binding subunit of
aldehyde oxidases and xanthine dehydrogenases", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases" and being encoded by a gene comprising the nucleic
acid sequence SEQ ID NO.: 6949 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 6949 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "Molybdenum-binding subunit of aldehyde
oxidases and xanthine dehydrogenases", conferred an increased
yield, for example a low temperature tolerance.
[1128] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 7078 in A. thaliana, for
example with the activity of a "Pirin-like protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "Pirin-like
protein" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 7078 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 7078 localized as indicated in table I, column
6, e.g. cytoplasmic in A. thaliana, for example with the activity
of a "Pirin-like protein", conferred an increased yield, for
example a low temperature tolerance.
[1129] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 7270 in A. thaliana, for
example with the activity of a "Heat shock protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "Heat shock
protein" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 7270 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 7270 localized as indicated in table I, column
6, e.g. plastidic in A. thaliana, for example with the activity of
a "Heat shock protein", conferred an increased yield, for example a
low temperature tolerance.
[1130] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 7467 in A. thaliana, for
example with the activity of a "B3410-protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "B3410-protein"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 7467 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
7467 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a "B3410-protein",
conferred an increased yield, for example a low temperature
tolerance. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 7492 in A.
thaliana, for example with the activity of a "Regulator of cell
morphogenesis and NO signaling", conferred an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "Regulator of cell
morphogenesis and NO signaling" and being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.:
[1131] 7492 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
7492 localized as indicated in table I, column 6, e.g. plastidic in
A. thaliana, for example with the activity of a "Regulator of cell
morphogenesis and NO signaling", conferred an increased yield, for
example a low temperature tolerance. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
7591 in A. thaliana, for example with the activity of a
"glutathione 5-transferase", conferred an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "glutathione 5-transferase"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 7591 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
7591 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a "glutathione
S-transferase", conferred an increased yield, for example a low
temperature tolerance.
[1132] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 7670 in A. thaliana, for
example with the activity of a "serine acetyltransferase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "serine acetyltransferase" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 7670 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control.
[1133] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 7670 localized as indicated
in table I, column 6, e.g. Mitochondric in A. thaliana, for example
with the activity of a "serine acetyltransferase", conferred an
increased yield, for example a low temperature tolerance.
[1134] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 8236 in A. thaliana, for
example with the activity of a "amino acid permease", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "amino acid
permease" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 8236 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 8236 localized as indicated in table I, column
6, e.g. plastidic in A. thaliana, for example with the activity of
a "amino acid permease", conferred an increased yield, for example
a low temperature tolerance. In particular, it was observed that
increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
8563 in A. thaliana, for example with the activity of a
"signalosome complex subunit", conferred an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "signalosome complex subunit"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 8563 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
8563 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a "signalosome
complex subunit", conferred an increased yield, for example a low
temperature tolerance.
[1135] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 8648 in A. thaliana, for
example with the activity of a "multidrug resistance protein",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "multidrug resistance protein" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 8648 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 8648 localized as
indicated in table I, column 6, e.g. plastidic in A. thaliana, for
example with the activity of a "multidrug resistance protein",
conferred an increased yield, for example a low temperature
tolerance.
[1136] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 8760 in A. thaliana, for
example with the activity of a "Arabinose transport system
ATP-binding protein", conferred an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "Arabinose transport system
ATP-binding protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 8760 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 8760 localized as indicated in
table I, column 6, e.g. plastidic in A. thaliana, for example with
the activity of a "Arabinose transport system ATP-binding protein",
conferred an increased yield, for example a low temperature
tolerance.
[1137] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 8861 in A. thaliana, for
example with the activity of a "precorrin-6y methylase", conferred
an increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to
the wild type control. It was further observed that increasing or
generating the activity of a gene product with said activity of a
"precorrin-6y methylase" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 8861 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 8861 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "precorrin-6y methylase", conferred an
increased yield, for example a low temperature tolerance.
[1138] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 9046 in A. thaliana, for
example with the activity of a "cobalt transport protein",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "cobalt transport protein" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 9046 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 9046 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "cobalt transport protein",
conferred an increased yield, for example a low temperature
tolerance.
[1139] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 9280 in A. thaliana, for
example with the activity of a "SLR1094-protein", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"SLR1094-protein" and being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 9280 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 9280 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "SLR1094-protein", conferred an increased
yield, for example a low temperature tolerance. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 9307 in A. thaliana, for example with the
activity of a "oxidoreductase", conferred an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "oxidoreductase" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
9307 in A. thaliana conferred an tolerance to abiotic environmental
stress, e.g. increase low temperature tolerance compared with the
wild type control. In particular, it was observed that increasing
or generating the activity of a gene product being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 9307
localized as indicated in table I, column 6, e.g. cytoplasmic in A.
thaliana, for example with the activity of a "oxidoreductase",
conferred an increased yield, for example a low temperature
tolerance. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 9430 in A.
thaliana, for example with the activity of a "cardiolipin
synthetase", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "cardiolipin synthetase" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 9430 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 9430 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "cardiolipin synthetase",
conferred an increased yield, for example a low temperature
tolerance. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 9479 in A.
thaliana, for example with the activity of a "ethanolamine kinase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "ethanolamine kinase" and being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 9479 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 9479 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "ethanolamine kinase", conferred
an increased yield, for example a low temperature tolerance.
[1140] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 9500 in A. thaliana, for
example with the activity of a "enoyl-CoA isomerase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "enoyl-CoA
isomerase" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 9500 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 9500 localized as indicated in table I, column
6, e.g. plastidic in A. thaliana, for example with the activity of
a "enoyl-CoA isomerase", conferred an increased yield, for example
a low temperature tolerance.
[1141] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 9553 in A. thaliana, for
example with the activity of a "holo-[acyl-carrier-protein]
synthase", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "holo-[acyl-carrier-protein] synthase" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
9553 in A. thaliana conferred an tolerance to abiotic environmental
stress, e.g. increase low temperature tolerance compared with the
wild type control. In particular, it was observed that increasing
or generating the activity of a gene product being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 9553
localized as indicated in table I, column 6, e.g. plastidic in A.
thaliana, for example with the activity of a
"holo-[acyl-carrier-protein] synthase", conferred an increased
yield, for example a low temperature tolerance.
[1142] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 9574 in A. thaliana, for
example with the activity of a "transketolase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "transketolase"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 9574 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
9574 localized as indicated in table I, column 6, e.g. plastidic in
A. thaliana, for example with the activity of a "transketolase",
conferred an increased yield, for example a low temperature
tolerance. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 10404 in A.
thaliana, for example with the activity of a "NADH
dehydrogenase/NAD(P)H nitroreductase", conferred an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "NADH
dehydrogenase/NAD(P)H nitroreductase" and being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 10404 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 10404 localized as
indicated in table I, column 6, e.g. plastidic in A. thaliana, for
example with the activity of a "NADH dehydrogenase/NAD(P)H
nitroreductase", conferred an increased yield, for example a low
temperature tolerance.
[1143] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 10503 in A. thaliana, for
example with the activity of a "multiple drug resistance protein",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "multiple drug resistance protein" and being encoded
by a gene comprising the nucleic acid sequence SEQ ID NO.: 10503 in
A. thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 10503 localized as
indicated in table I, column 6, e.g. plastidic in A. thaliana, for
example with the activity of a "multiple drug resistance protein",
conferred an increased yield, for example a low temperature
tolerance.
[1144] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 10591 in A. thaliana, for
example with the activity of a "peptidyl-prolyl cis-trans
isomerase", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "peptidyl-prolyl cis-trans isomerase" and being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
10591 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
10591 localized as indicated in table I, column 6, e.g. plastidic
in A. thaliana, for example with the activity of a "peptidyl-prolyl
cis-trans isomerase", conferred an increased yield, for example a
low temperature tolerance.
[1145] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 10934 in A. thaliana, for
example with the activity of a "3-methyl-2-oxobutanoate
hydroxymethyltransferase", conferred an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to the wild type control. It was
further observed that increasing or generating the activity of a
gene product with said activity of a "3-methyl-2-oxobutanoate
hydroxymethyltransferase" and being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 10934 in A. thaliana
conferred an tolerance to abiotic environmental stress, e.g.
increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 10934 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "3-methyl-2-oxobutanoate
hydroxymethyltransferase", conferred an increased yield, for
example a low temperature tolerance.
[1146] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 11461 in A. thaliana, for
example with the activity of a "alcohol acetyltransferase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "alcohol acetyltransferase" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 11461 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 11461 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "alcohol acetyltransferase",
conferred an increased yield, for example a low temperature
tolerance.
[1147] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 11501 in A. thaliana, for
example with the activity of a "thiol-specific monooxygenase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "thiol-specific monooxygenase" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 11501 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 11501 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "thiol-specific monooxygenase",
conferred an increased yield, for example a low temperature
tolerance.
[1148] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 11564 in A. thaliana, for
example with the activity of a "Molybdenum-binding subunit of
aldehyde oxidases and xanthine dehydrogenases", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a
"Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases" and being encoded by a gene comprising the nucleic
acid sequence SEQ ID NO.: 11564 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 11564 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "Molybdenum-binding subunit of aldehyde
oxidases and xanthine dehydrogenases", conferred an increased
yield, for example a low temperature tolerance. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 11695 in A. thaliana, for example with the
activity of a "glycerol dehydrogenase", conferred an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to the wild type control.
It was further observed that increasing or generating the activity
of a gene product with said activity of a "glycerol dehydrogenase"
and being encoded by a gene comprising the nucleic acid sequence
SEQ ID NO.: 11695 in A. thaliana conferred an tolerance to abiotic
environmental stress, e.g. increase low temperature tolerance
compared with the wild type control. In particular, it was observed
that increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
11695 localized as indicated in table I, column 6, e.g. cytoplasmic
in A. thaliana, for example with the activity of a "glycerol
dehydrogenase", conferred an increased yield, for example a low
temperature tolerance.
[1149] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 11907 in A. thaliana, for
example with the activity of a "protein required for degradation of
glycoproteins", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "protein required for degradation of
glycoproteins" and being encoded by a gene comprising the nucleic
acid sequence SEQ ID NO.: 11907 in A. thaliana conferred an
tolerance to abiotic environmental stress, e.g. increase low
temperature tolerance compared with the wild type control. In
particular, it was observed that increasing or generating the
activity of a gene product being encoded by a gene comprising the
nucleic acid sequence SEQ ID NO.: 11907 localized as indicated in
table I, column 6, e.g. cytoplasmic in A. thaliana, for example
with the activity of a "protein required for degradation of
glycoproteins", conferred an increased yield, for example a low
temperature tolerance. In particular, it was observed that
increasing or generating the activity of a gene product being
encoded by a gene comprising the nucleic acid sequence SEQ ID NO.:
11944 in A. thaliana, for example with the activity of a "ammonium
transporter", conferred an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to the wild type control. It was further observed
that increasing or generating the activity of a gene product with
said activity of a "ammonium transporter" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 11944 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 11944 localized as
indicated in table I, column 6, e.g. cytoplasmic in A. thaliana,
for example with the activity of a "ammonium transporter",
conferred an increased yield, for example a low temperature
tolerance.
[1150] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 12357 in A. thaliana, for
example with the activity of a "Argininosuccinate synthase",
conferred an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to the wild type control. It was further observed that
increasing or generating the activity of a gene product with said
activity of a "Argininosuccinate synthase" and being encoded by a
gene comprising the nucleic acid sequence SEQ ID NO.: 12357 in A.
thaliana conferred an tolerance to abiotic environmental stress,
e.g. increase low temperature tolerance compared with the wild type
control. In particular, it was observed that increasing or
generating the activity of a gene product being encoded by a gene
comprising the nucleic acid sequence SEQ ID NO.: 12357 localized as
indicated in table I, column 6, e.g. plastidic or cytoplasmic in A.
thaliana, for example with the activity of a "Argininosuccinate
synthase", conferred an increased yield, for example a low
temperature tolerance.
[1151] In particular, it was observed that increasing or generating
the activity of a gene product being encoded by a gene comprising
the nucleic acid sequence SEQ ID NO.: 12936 in A. thaliana, for
example with the activity of a "glutamine synthetase", conferred an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to the wild type
control. It was further observed that increasing or generating the
activity of a gene product with said activity of a "glutamine
synthetase" and being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 12936 in A. thaliana conferred an tolerance to
abiotic environmental stress, e.g. increase low temperature
tolerance compared with the wild type control. In particular, it
was observed that increasing or generating the activity of a gene
product being encoded by a gene comprising the nucleic acid
sequence SEQ ID NO.: 12936 localized as indicated in table I,
column 6, e.g. cytoplasmic in A. thaliana, for example with the
activity of a "glutamine synthetase", conferred an increased yield,
for example a low temperature tolerance
[1152] It was further observed that increasing or generating the
activity of a nucleic acid molecule derived from the nucleic acid
molecule shown in Table VIIIa in A. thaliana conferred increased
nutrient use efficiency, e.g. an increased the nitrogen use
efficiency, compared with the wild type control. Thus, in one
embodiment, a nucleic acid molecule indicated in Table VIIIa or its
homolog as indicated in Table I or the expression product is used
in the method of the present invention to increased nutrient use
efficiency, e.g. to increased the nitrogen use efficiency, of the a
plant compared with the wild type control.
[1153] It was further observed that increasing or generating the
activity of a nucleic acid molecule derived from the nucleic acid
molecule shown in Table VIIIb in A. thaliana conferred increased
stress tolerance, e.g. increased low temperature tolerance,
compared with the wild type control. Thus, in one embodiment, a
nucleic acid molecule indicated in Table VIIIb or its homolog as
indicated in Table I or the expression product is used in the
method of the present invention to increase stress tolerance, e.g.
increase low temperature, of a plant compared with the wild type
control.
[1154] It was further observed that increasing or generating the
activity of a nucleic acid molecule derived from the nucleic acid
molecule shown in Table VIIIc in A. thaliana conferred increased
stress tolerance, e.g. increased cycling drought tolerance,
compared with the wild type control. Thus, in one embodiment, a
nucleic acid molecule indicated in Table VIIIc or its homolog as
indicated in Table I or the expression product is used in the
method of the present invention to increase stress tolerance, e.g.
increase cycling drought tolerance, of a plant compared with the
wild type control.
[1155] It was further observed that increasing or generating the
activity of a nucleic acid molecule derived from the nucleic acid
molecule shown in Table VIIId in A. thaliana conferred increase in
intrinsic yield, e.g. increased biomass under standard conditions,
e.g. increased biomass under non-deficiency or non-stress
conditions, compared with the wild type control. Thus, in one
embodiment, a nucleic acid molecule indicated in Table VIIId or its
homolog as indicated in Table I or the expression product is used
in the method of the present invention to increase intrinsic yield,
e.g. to increase yield under standard conditions, e.g. increase
biomass under non-deficiency or non-stress conditions, of a plant
compared with the wild type control.
[1156] The term "expression" refers to the transcription and/or
translation of a codogenic gene segment or gene. As a rule, the
resulting product is an mRNA or a protein. However, expression
products can also include functional RNAs such as, for example,
antisense, nucleic acids, tRNAs, snRNAs, rRNAs, RNAi, siRNA,
ribozymes etc. Expression may be systemic, local or temporal, for
example limited to certain cell types, tissues organs or organelles
or time periods.
[1157] In one embodiment, the process of the present invention
comprises one or more of the following steps [1158] (a) stabilizing
a protein conferring the increased expression of a protein encoded
by the nucleic acid molecule of the invention or of the polypeptid
of the invention having the herein-mentioned activity selected from
the group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein and conferring increased
yield, e.g. with an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof; [1159] (b) stabilizing a mRNA conferring the
increased expression of a protein encoded by the nucleic acid
molecule of the invention or its homologs or of a mRNA encoding the
polypeptide of the present invention having the herein-mentioned
activity selected from the group consisting of said activities
mentioned in (a) and conferring increased yield, e.g. with an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof;
[1160] (c) increasing the specific activity of a protein conferring
the increased expression of a protein encoded by the nucleic acid
molecule of the invention or of the polypeptide of the present
invention or decreasing the inhibitory regulation of the
polypeptide of the invention; [1161] (d) generating or increasing
the expression of an endogenous or artificial transcription factor
mediating the expression of a protein conferring the increased
expression of a protein encoded by the nucleic acid molecule of the
invention or of the polypeptide of the invention having the
herein-mentioned activity selected from the group consisting of
said activities mentioned in (a) and conferring increased yield,
e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof;
[1162] (e) stimulating activity of a protein conferring the
increased expression of a protein encoded by the nucleic acid
molecule of the present invention or a polypeptide of the present
invention having the herein-mentioned activity selected from the
group consisting of said .alpha.-tivities mentioned in (a) and
conferring increased yield, e.g. an increased yield-related trait,
for example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof by adding one or more exogenous inducing factors to
the organism or parts thereof; [1163] (f) expressing a transgenic
gene encoding a protein conferring the increased expression of a
polypeptide encoded by the nucleic acid molecule of the present
invention or a polypeptide of the present invention, having the
herein-mentioned activity selected from the group consisting of
said activities mentioned in (a) and conferring increased yield,
e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof;
and/or [1164] (g) increasing the copy number of a gene conferring
the increased expression of a nucleic acid molecule encoding a
polypeptide encoded by the nucleic acid molecule of the invention
or the polypeptide of the invention having the herein-mentioned
activity selected from the group consisting of said activities
mentioned in (a) and conferring increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
traitas compared to a corresponding, e.g. non-transformed, wild
type plant cell, plant or part thereof; [1165] (h) increasing the
expression of the endogenous gene encoding the polypeptide of the
invention or its homologs by adding positive expression or removing
negative expression elements, e.g. homologous recombination can be
used to either introduce positive regulatory elements like for
plants the 35S enhancer into the promoter or to remove repressor
elements form regulatory regions. Further gene conversion methods
can be used to disrupt repressor elements or to enhance to activity
of positive elements--positive elements can be randomly introduced
in plants by T-DNA or transposon mutagenesis and lines can be
identified in which the positive elements have been integrated near
to a gene of the invention, the expression of which is thereby
enhanced; and/or [1166] (i) modulating growth conditions of the
plant in such a manner, that the expression or activity of the gene
encoding the protein of the invention or the protein itself is
enhanced; [1167] (j) selecting of organisms with especially high
activity of the proteins of the invention from natural or from
mutagenized resources and breeding them into the target organisms,
e.g. the elite crops.
[1168] Preferably, said mRNA is the nucleic acid molecule of the
present invention and/or the protein conferring the increased
expression of a protein encoded by the nucleic acid molecule of the
present invention alone or linked to a transit nucleic acid
sequence or transit peptide encoding nucleic acid sequence or the
polypeptide having the herein mentioned activity, e.g. conferring
with increased yield, e.g. with an increased yield-related trait,
for example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof after increasing the expression or activity of the
encoded polypeptide or having the activity of a polypeptide having
an activity as the protein as shown in table II column 3 or its
homologs.
[1169] In general, the amount of mRNA or polypeptide in a cell or a
compartment of an organism correlates with the amount of encoded
protein and thus with the overall activity of the encoded protein
in said volume. Said correlation is not always linear, the activity
in the volume is dependent on the stability of the molecules or the
presence of activating or inhibiting co-factors. Further, product
and educt inhibitions of enzymes are well known and described in
textbooks, e.g. Stryer, Biochemistry.
[1170] In general, the amount of mRNA, polynucleotide or nucleic
acid molecule in a cell or a compartment of an organism correlates
with the amount of encoded protein and thus with the overall
activity of the encoded protein in said volume. Said correlation is
not always linear, the activity in the volume is dependent on the
stability of the molecules, the degradation of the molecules or the
presence of activating or inhibiting co-factors. Further, product
and educt inhibitions of enzymes are well known, e.g. Zinser et al.
"Enzyminhibitoren"/Enzyme inhibitors".
[1171] The activity of the abovementioned proteins and/or
polypeptides encoded by the nucleic acid molecule of the present
invention can be increased in various ways. For example, the
activity in an organism or in a part thereof, like a cell, is
increased via increasing the gene product number, e.g. by
increasing the expression rate, like introducing a stronger
promoter, or by increasing the stability of the mRNA expressed,
thus increasing the translation rate, and/or increasing the
stability of the gene product, thus reducing the proteins decayed.
Further, the activity or turnover of enzymes can be influenced in
such a way that a reduction or increase of the reaction rate or a
modification (reduction or increase) of the affinity to the
substrate results, is reached. A mutation in the catalytic centre
of an polypeptide of the invention, e.g. as enzyme, can modulate
the turn over rate of the enzyme, e.g. a knock out of an essential
amino acid can lead to a reduced or completely knock out activity
of the enzyme, or the deletion or mutation of regulator binding
sites can reduce a negative regulation like a feedback inhibition
(or a substrate inhibition, if the substrate level is also
increased). The specific activity of an enzyme of the present
invention can be increased such that the turn over rate is
increased or the binding of a co-factor is improved. Improving the
stability of the encoding mRNA or the protein can also increase the
activity of a gene product. The stimulation of the activity is also
under the scope of the term "increased activity".
[1172] Moreover, the regulation of the abovementioned nucleic acid
sequences may be modified so that gene expression is increased.
This can be achieved advantageously by means of heterologous
regulatory sequences or by modifying, for example mutating, the
natural regulatory sequences which are present. The advantageous
methods may also be combined with each other.
[1173] In general, an activity of a gene product in an organism or
part thereof, in particular in a plant cell or organelle of a plant
cell, a plant, or a plant tissue or a part thereof or in a
microorganism can be increased by increasing the amount of the
specific encoding mRNA or the corresponding protein in said
organism or part thereof. "Amount of protein or mRNA" is understood
as meaning the molecule number of polypeptides or mRNA molecules in
an organism, especially a plant, a tissue, a cell or a cell
compartment. "Increase" in the amount of a protein means the
quantitative increase of the molecule number of said protein in an
organism, especially a plant, a tissue, a cell or a cell
compartment such as an organelle like a plastid or mitochondria or
part thereof--for example by one of the methods described herein
below--in comparison to a wild type, control or reference.
[1174] The increase in molecule number amounts preferably to at
least 1%, preferably to more than 10%, more preferably to 30% or
more, especially preferably to 50%, 70% or more, very especially
preferably to 100%, most preferably to 500% or more. However, a de
novo expression is also regarded as subject of the present
invention.
[1175] A modification, i.e. an increase, can be caused by
endogenous or exogenous factors. For example, an increase in
activity in an organism or a part thereof can be caused by adding a
gene product or a precursor or an activator or an agonist to the
media or nutrition or can be caused by introducing said subjects
into a organism, transient or stable. Furthermore such an increase
can be reached by the introduction of the inventive nucleic acid
sequence or the encoded protein in the correct cell compartment for
example into the nucleus or cytoplasm respectively or into plastids
either by transformation and/or targeting.
[1176] For the purposes of the description of the present
invention, the term "cytoplasmic" shall indicate, that the nucleic
acid of the invention is expressed without the addition of an
non-natural transit peptide encoding sequence. A non-natural
transient peptide encoding sequence is a sequence which is not a
natural part of a nucleic acid of the invention but is rather added
by molecular manipulation steps as for example described in the
example under "plastid targeted expression". Therefore the term
"cytoplasmic" shall not exclude a targeted localisation to any cell
compartment for the products of the inventive nucleic acid
sequences by their naturally occurring sequence properties.
[1177] In one embodiment the increased yield, e.g. increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell in the plant or a part thereof, e.g. in a cell, a
tissue, a organ, an organelle, the cytoplasm etc., is achieved by
increasing the endogenous level of the polypeptide of the
invention. Accordingly, in an embodiment of the present invention,
the present invention relates to a process wherein the gene copy
number of a gene encoding the polynucleotide or nucleic acid
molecule of the invention is increased. Further, the endogenous
level of the polypeptide of the invention can for example be
increased by modifying the transcriptional or translational
regulation of the polypeptide.
[1178] In one embodiment the increased yield, e.g. increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait of the plant or part thereof can be altered by targeted or
random mutagenesis of the endogenous genes of the invention. For
example homologous recombination can be used to either introduce
positive regulatory elements like for plants the 35S enhancer into
the promoter or to remove repressor elements form regulatory
regions. In addition gene conversion like methods described by
Kochevenko and Willmitzer (Plant Physiol. 132 (1), 174 (2003)) and
citations therein can be used to disrupt repressor elements or to
enhance to activity of positive regulatory elements.
[1179] Furthermore positive elements can be randomly introduced in
(plant) genomes by T-DNA or transposon mutagenesis and lines can be
screened for, in which the positive elements have been integrated
near to a gene of the invention, the expression of which is thereby
enhanced. The activation of plant genes by random integrations of
enhancer elements has been described by Hayashi et al. (Science
258,1350 (1992)) or Weigel et al. (Plant Physiol. 122, 1003 (2000))
and others recited therein.
[1180] Reverse genetic strategies to identify insertions (which
eventually carrying the activation elements) near in genes of
interest have been described for various cases e.g. Krysan et al.
(Plant Cell 11, 2283 (1999)); Sessions et al. (Plant Cell 14, 2985
(2002)); Young et al. (Plant Physiol. 125, 513 (2001)); Koprek et
al. (Plant J. 24, 253 (2000)); Jeon et al. (Plant J. 22, 561
(2000)); Tissier et al. (Plant Cell 11, 1841 (1999)); Speulmann et
al. (Plant Cell 11, 1853 (1999)). Briefly material from all plants
of a large T-DNA or transposon mutagenized plant population is
harvested and genomic DNA prepared. Then the genomic DNA is pooled
following specific architectures as described for example in Krysan
et al. (Plant Cell 11, 2283 (1999)). Pools of genomics DNAs are
then screened by specific multiplex PCR reactions detecting the
combination of the insertional mutagen (e.g. T-DNA or Transposon)
and the gene of interest. Therefore PCR reactions are run on the
DNA pools with specific combinations of T-DNA or transposon border
primers and gene specific primers. General rules for primer design
can again be taken from Krysan et al. (Plant Cell 11, 2283 (1999)).
Rescreening of lower levels DNA pools lead to the identification of
individual plants in which the gene of interest is activated by the
insertional mutagen.
[1181] The enhancement of positive regulatory elements or the
disruption or weakening of negative regulatory elements can also be
achieved through common mutagenesis techniques: The production of
chemically or radiation mutated populations is a common technique
and known to the skilled worker. Methods for plants are described
by Koorneef et al. (Mutat Res. Mar. 93 (1) (1982)) and the
citations therein and by Lightner and Caspar in "Methods in
Molecular Biology" Vol. 82. These techniques usually induce point
mutations that can be identified in any known gene using methods
such as TILLING (Colbert et al., Plant Physiol, 126, (2001)).
[1182] Accordingly, the expression level can be increased if the
endogenous genes encoding a polypeptide conferring an increased
expression of the polypeptide of the present invention, in
particular genes comprising the nucleic acid molecule of the
present invention, are modified via homologous recombination,
Tilling approaches or gene conversion. It also possible to add as
mentioned herein targeting sequences to the inventive nucleic acid
sequences.
[1183] Regulatory sequences, if desired, in addition to a target
sequence or part thereof can be operatively linked to the coding
region of an endogenous protein and control its transcription and
translation or the stability or decay of the encoding mRNA or the
expressed protein. In order to modify and control the expression,
promoter, UTRs, splicing sites, processing signals, polyadenylation
sites, terminators, enhancers, repressors, post transcriptional or
posttranslational modification sites can be changed, added or
amended. For example, the activation of plant genes by random
integrations of enhancer elements has been described by Hayashi et
al. (Science 258, 1350 (1992)) or Weigel et al. (Plant Physiol.
122, 1003 (2000)) and others recited therein. For example, the
expression level of the endogenous protein can be modulated by
replacing the endogenous promoter with a stronger transgenic
promoter or by replacing the endogenous 3'UTR with a 3'UTR, which
provides more stability without amending the coding region.
Further, the transcriptional regulation can be modulated by
introduction of an artificial transcription factor as described in
the examples. Alternative promoters, terminators and UTR are
described below.
[1184] The activation of an endogenous polypeptide having
above-mentioned activity, e.g. having the activity of a protein as
shown in table II, column 3 or of the polypeptide of the invention,
e.g. conferring increased yield, e.g. increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, plant or part thereof after increase of expression or
activity in the cytoplasm and/or in an organelle like a plastid,
can also be increased by introducing a synthetic transcription
factor, which binds close to the coding region of the gene encoding
the protein as shown in table II, column 3 and activates its
transcription. A chimeric zinc finger protein can be constructed,
which comprises a specific DNA-binding domain and an activation
domain as e.g. the VP16 domain of Herpes Simplex virus. The
specific binding domain can bind to the regulatory region of the
gene encoding the protein as shown in table II, column 3. The
expression of the chimeric transcription factor in a organism, in
particular in a plant, leads to a specific expression of the
protein as shown in table II, column 3. The methods thereto are
known to a skilled person and/or disclosed e.g. in WO01/52620,
Oriz, Proc. Natl. Acad. Sci. USA, 99, 13290 (2002) or Guan, Proc.
Natl. Acad. Sci. USA 99, 13296 (2002).
[1185] In one further embodiment of the process according to the
invention, organisms are used in which one of the abovementioned
genes, or one of the abovementioned nucleic acids, is mutated in a
way that the activity of the encoded gene products is less
influenced by cellular factors, or not at all, in comparison with
the not mutated proteins. For example, well known regulation
mechanism of enzyme activity are substrate inhibition or feed back
regulation mechanisms. Ways and techniques for the introduction of
substitution, deletions and additions of one or more bases,
nucleotides or amino acids of a corresponding sequence are
described herein below in the corresponding paragraphs and the
references listed there, e.g. in Sambrook et al., Molecular
Cloning, Cold Spring Harbour, N.Y., 1989. The person skilled in the
art will be able to identify regulation domains and binding sites
of regulators by comparing the sequence of the nucleic acid
molecule of the present invention or the expression product thereof
with the state of the art by computer software means which comprise
algorithms for the identifying of binding sites and regulation
domains or by introducing into a nucleic acid molecule or in a
protein systematically mutations and assaying for those mutations
which will lead to an increased specific activity or an increased
activity per volume, in particular per cell.
[1186] It can therefore be advantageous to express in an organism a
nucleic acid molecule of the invention or a polypeptide of the
invention derived from a evolutionary distantly related organism,
as e.g. using a prokaryotic gene in a eukaryotic host, as in these
cases the regulation mechanism of the host cell may not weaken the
activity (cellular or specific) of the gene or its expression
product.
[1187] The mutation is introduced in such a way that increased
yield, e.g. increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait are not adversely affected.
[1188] Less influence on the regulation of a gene or its gene
product is understood as meaning a reduced regulation of the
enzymatic activity leading to an increased specific or cellular
activity of the gene or its product. An increase of the enzymatic
activity is understood as meaning an enzymatic activity, which is
increased by at least 10%, advantageously at least 20, 30 or 40%,
especially advantageously by at least 50, 60 or 70% in comparison
with the starting organism. This leads to increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof.
[1189] The invention provides that the above methods can be
performed such that yield, e.g. a yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example
drought tolerance and/or low temperature tolerance and/or nutrient
use efficiency, intrinsic yield and/or another mentioned
yield-related traits increased, wherein particularly the tolerance
to low temperature is increased. In a further embodiment the
invention provides that the above methods can be performed such
that the tolerance to abiotic stress, particularly the tolerance to
low temperature and/or water use efficiency, and at the same time,
the nutrient use efficiency, particularly the nitrogen use
efficiency is increased. In another embodiment the invention
provides that the above methods can be performed such that the
yield is increased in the absence of nutrient deficiencies as well
as the absence of stress conditions. In a further embodiment the
invention provides that the above methods can be performed such
that the nutrient use efficiency, particularly the nitrogen use
efficiency, and the yield, in the absence of nutrient deficiencies
as well as the absence of stress conditions, is increased. In a
preferred embodiment the invention provides that the above methods
can be performed such that the tolerance to abiotic stress,
particularly the tolerance to low temperature and/or water use
efficiency, and at the same time, the nutrient use efficiency,
particularly the nitrogen use efficiency, and the yield in the
absence of nutrient deficiencies as well as the absence of stress
conditions, is increased.
[1190] The invention is not limited to specific nucleic acids,
specific polypeptides, specific cell types, specific host cells,
specific conditions or specific methods etc. as such, but may vary
and numerous modifications and variations therein will be apparent
to those skilled in the art. It is also to be understood that the
terminology used herein is for the purpose of describing specific
embodiments only and is not intended to be limiting.
[1191] The present invention also relates to isolated nucleic acids
comprising a nucleic acid molecule selected from the group
consisting of: [1192] (a) a nucleic acid molecule encoding the
polypeptide shown in column 7 of table II B, application no. 1;
[1193] (b) a nucleic acid molecule shown in column 7 of table I B,
application no. 1; [1194] (c) a nucleic acid molecule, which, as a
result of the degeneracy of the genetic code, can be derived from a
polypeptide sequence depicted in column 5 or 7 of table II,
application no. 1, and confers increased yield, e.g. increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a plant or a part thereof; [1195] (d) a nucleic
acid molecule having at least 30% identity, preferably at least
40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%,
99.5%, with the nucleic acid molecule sequence of a polynucleotide
comprising the nucleic acid molecule shown in column 5 or 7 of
table I, application no. 1, and confers increased yield, e.g.
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1196] (e) a nucleic acid molecule encoding a polypeptide having at
least 30% identity, preferably at least 40%, 50%, 60%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, with the amino acid
sequence of the polypeptide encoded by the nucleic acid molecule of
(a), (b), (c) or (d) and having the activity represented by a
nucleic acid molecule comprising a polynucleotide as depicted in
column 5 of table I, application no. 1, and confers increased
yield, e.g. increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1197] (f) nucleic acid molecule which hybridizes with a nucleic
acid molecule of (a), (b), (c), (d) or [1198] (e) under stringent
hybridization conditions and confers increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1199] (g) a nucleic acid molecule encoding a polypeptide which can
be isolated with the aid of monoclonal or polyclonal antibodies
made against a polypeptide encoded by one of the nucleic acid
molecules of (a), (b), (c), (d), (e) or (f) and having the activity
represented by the nucleic acid molecule comprising a
polynucleotide as depicted in column 5 of table I, application no.
1; [1200] (h) a nucleic acid molecule encoding a polypeptide
comprising the consensus sequence or one or more polypeptide motifs
as shown in column 7 of table IV, application no. 1, and preferably
having the activity represented by a protein comprising a
polypeptide as depicted in column 5 of table II or IV, application
no. 1; [1201] (i) a nucleic acid molecule encoding a polypeptide
having the activity represented by a protein as depicted in column
5 of table II, application no. 1, and confers increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1202] (j) nucleic acid molecule which comprises a polynucleotide,
which is obtained by amplifying a cDNA library or a genomic library
using the primers in column 7 of table III, application no. 1, and
e.g. having the activity represented by a protein comprising a
polypeptide as depicted in column 5 of table II or IV, application
no. 1; and [1203] (k) a nucleic acid molecule which is obtainable
by screening a suitable nucleic acid library, especially a cDNA
library and/or a genomic library, under stringent hybridization
conditions with a probe comprising a complementary sequence of a
nucleic acid molecule of (a) or (b) or with a fragment thereof,
having at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200
nt, 500 nt, 750 nt or 1000 nt of a nucleic acid molecule
complementary to a nucleic acid molecule sequence characterized in
(a) to (e) and encoding a polypeptide having the activity
represented by a protein comprising a polypeptide as depicted in
column 5 of table II, application no. 1.
[1204] In one embodiment, the nucleic acid molecule according to
(a), (b), (c), (d), (e), (f), (g), (h), (i), (j) and (k) is at
least in one or more nucleotides different from the sequence
depicted in column 5 or 7 of table I A, application no. 1, and
preferably which encodes a protein which differs at least in one or
more amino acids from the protein sequences depicted in column 5 or
7 of table II A, application no. 1.
[1205] In one embodiment the invention relates to homologs of the
aforementioned sequences, which can be isolated advantageously from
yeast, fungi, viruses, algae, bacteria, such as Acetobacter
(subgen. Acetobacter) aceti; Acidithiobacillus ferrooxidans;
Acinetobacter sp.; Actinobacillus sp; Aeromonas salmonicida;
Agrobacterium tumefaciens; Aquifex aeolicus; Arcanobacterium
pyogenes; Aster yellows phytoplasma; Bacillus sp.; Bifidobacterium
sp.; Borrelia burgdorferi; Brevibacterium linens; Brucella
melitensis; Buchnera sp.; Butyrivibrio fibrisolvens; Campylobacter
jejuni; Caulobacter crescentus; Chlamydia sp.; Chlamydophila sp.;
Chlorobium limicola; Citrobacter rodentium; Clostridium sp.;
Comamonas testosteroni; Corynebacterium sp.; Coxiella burnetii;
Deinococcus radiodurans; Dichelobacter nodosus; Edwardsiella
ictaluri; Enterobacter sp.; Erysipelothrix rhusiopathiae; E. coli;
Flavobacterium sp.; Francisella tularensis; Frankia sp. Cpl1;
Fusobacterium nucleatum; Geobacillus stearothermophilus;
Gluconobacter oxydans; Haemophilus sp.; Helicobacter pylori;
Klebsiella pneumoniae; Lactobacillus sp.; Lactococcus lactis;
Listeria sp.; Mannheimia haemolytica; Mesorhizobium loti;
Methylophaga thalassica; Microcystis aeruginosa; Microscilla sp.
PRE1; Moraxella sp. TA144; Mycobacterium sp.; Mycoplasma sp.;
Neisseria sp.; Nitrosomonas sp.; Nostoc sp. PCC 7120;
Novosphingobium aromaticivorans; Oenococcus oeni; Pantoea citrea;
Pasteurella multocida; Pediococcus pentosaceus; Phormidium
foveolarum; Phytoplasma sp.; Plectonema boryanum; Prevotella
ruminicola; Propionibacterium sp.; Proteus vulgaris; Pseudomonas
sp.; Ralstonia sp.; Rhizobium sp.; Rhodococcus equi; Rhodothermus
marinus; Rickettsia sp.; Riemerella anatipestifer; Ruminococcus
flavefaciens; Salmonella sp.; Selenomonas ruminantium; Serratia
entomophila; Shigella sp.; Sinorhizobium meliloti; Staphylococcus
sp.; Streptococcus sp.; Streptomyces sp.; Synechococcus sp.;
Synechocystis sp. PCC 6803; Thermotoga maritima; Treponema sp.;
Ureaplasma urealyticum; Vibrio cholerae; Vibrio parahaemolyticus;
Xylella fastidiosa; Yersinia sp.; Zymomonas mobilis, preferably
Salmonella sp. or E. coli or plants, preferably from yeasts such as
from the genera Saccharomyces, Pichia, Candida, Hansenula,
Torulopsis or Schizosaccharonnyces
or plants such as A. thaliana, maize, wheat, rye, oat, triticale,
rice, barley, soybean, peanut, cotton, borage, sunflower, linseed,
primrose, rapeseed, canola and turnip rape, manihot, pepper,
sunflower, tagetes, solanaceous plant such as potato, tobacco,
eggplant and tomato, Vicia species, pea, alfalfa, bushy plants such
as coffee, cacao, tea, Salix species, trees such as oil palm,
coconut, perennial grass, such as ryegrass and fescue, and forage
crops, such as alfalfa and clover and from spruce, pine or fir for
example. More preferably homologs of aforementioned sequences can
be isolated from S. cerevisiae, E. coli or Synechocystis sp. or
plants, preferably Brassica napus, Glycine max, Zea mays, cotton or
Oryza sativa.
[1206] The proteins of the present invention are preferably
produced by recombinant DNA techniques. For example, a nucleic acid
molecule encoding the protein is cloned into an expression vector,
for example in to a binary vector, the expression vector is
introduced into a host cell, for example the A. thaliana wild type
NASO N906 or any other plant cell as described in the examples see
below, and the protein is expressed in said host cell. Examples for
binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA,
pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant
Mol. Biol. 25, 989 (1994), and Hellens et al, Trends in Plant
Science 5, 446 (2000)).
[1207] In one embodiment the protein of the present invention is
preferably produced in an compartment of the cell, e.g. in the
plastids. Ways of introducing nucleic acids into plastids and
producing proteins in this compartment are known to the person
skilled in the art have been also described in this application. In
one embodiment, the polypeptide of the invention is a protein
localized after expression as indicated in column 6 of table II,
e.g. non-targeted, in the cytsol or cytoplasm or in an organelle
such as a plastid or mitochondria or both, for example it is fused
to a transit peptide as described above for plastidic
localisation.
[1208] In another embodiment the protein of the present invention
is produced without further targeting singal (e.g. as mentioned
herein), e.g. in the cytoplasm of the cell. Ways of producing
proteins in the cytoplasm are known to the person skilled in the
art. Ways of producing proteins without artificial targeting are
known to the person skilled in the art.
[1209] Advantageously, the nucleic acid sequences according to the
invention or the gene construct together with at least one reporter
gene are cloned into an expression cassette, which is introduced
into the organism via a vector or directly into the genome. This
reporter gene should allow easy detection via a growth,
fluorescence, chemical, bioluminescence or tolerance assay or via a
photometric measurement. Examples of reporter genes which may be
mentioned are antibiotic- or herbicide-tolerance genes, hydrolase
genes, fluorescence protein genes, bioluminescence genes, sugar or
nucleotide metabolic genes or biosynthesis genes such as the Ura3
gene, the Ilv2 gene, the luciferase gene, the .beta.-galactosidase
gene, the gfp gene, the 2-desoxyglucose-6-phosphate phosphatase
gene, the .beta.-glucuronidase gene, .beta.-lactamase gene, the
neomycin phosphotransferase gene, the hygromycin phosphotransferase
gene, a mutated acetohydroxyacid synthase (AHAS) gene (also known
as acetolactate synthase (ALS) gene), a gene for a D-amino acid
metabolizing enzmye or the BASTA (=gluphosinate-tolerance) gene.
These genes permit easy measurement and quantification of the
transcription activity and hence of the expression of the genes. In
this way genome positions may be identified which exhibit differing
productivity.
[1210] In a preferred embodiment a nucleic acid construct, for
example an expression cassette, comprises upstream, i.e. at the 5'
end of the encoding sequence, a promoter and downstream, i.e. at
the 3' end, a polyadenylation signal and optionally other
regulatory elements which are operably linked to the intervening
encoding sequence with one of the nucleic acids of SEQ ID NO as
depicted in table I, column 5 and 7. By an operable linkage is
meant the sequential arrangement of promoter, encoding sequence,
terminator and optionally other regulatory elements in such a way
that each of the regulatory elements can fulfill its function in
the expression of the encoding sequence in due manner. In one
embodiment the sequences preferred for operable linkage are
targeting sequences for ensuring subcellular localization in
plastids. However, targeting sequences for ensuring subcellular
localization in the mitochondrium, in the endoplasmic reticulum
(=ER), in the nucleus, in oil corpuscles or other compartments may
also be employed as well as translation promoters such as the 5'
lead sequence in tobacco mosaic virus (Gallie et al., Nucl. Acids
Res. 15 8693 (1987)).
[1211] A nucleic acid construct, for example an expression cassette
may, for example, contain a constitutive promoter or a
tissue-specific promoter (preferably the USP or napin promoter) the
gene to be expressed and the ER retention signal. For the ER
retention signal the KDEL amino acid sequence (lysine, aspartic
acid, glutamic acid, leucine) or the KKX amino acid sequence
(lysine-lysine-X-stop, wherein X means every other known amino
acid) is preferably employed.
[1212] For expression in a host organism, for example a plant, the
expression cassette is advantageously inserted into a vector such
as by way of example a plasmid, a phage or other DNA which allows
optimal expression of the genes in the host organism. Examples of
suitable plasmids are: in E. coli pLG338, pACYC184, pBR series such
as e.g. pBR322, pUC series such as pUC18 or pUC19, M113mp series,
pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290,
pIN-III.sup.113-B1, .lamda.gt11 or pBdCl; in Streptomyces pIJ101,
pIJ364, pIJ702 or pIJ361; in Bacillus pUB110, pC194 or pBD214; in
Corynebacterium pSA77 or pAJ667; in fungi pALS1, pIL2 or pBB116;
other advantageous fungal vectors are described by Romanos M. A. et
al., Yeast 8, 423 (1992) and by van den Hondel, C.A.M.J.J. et al.
[(1991) "Heterologous gene expression in filamentous fungi"] as
well as in "More Gene Manipulations" in "Fungi" in Bennet J. W.
& Lasure L. L., eds., pp. 396-428, Academic Press, San Diego,
and in "Gene transfer systems and vector development for
filamentous fungi" [van den Hondel, C.A.M.J.J. & Punt, P. J.
(1991) in: Applied Molecular Genetics of Fungi, Peberdy, J. F. et
al., eds., pp. 1-28, Cambridge University Press: Cambridge].
Examples of advantageous yeast promoters are 2 .mu.M, pAG-1, YEp6,
YEp13 or pEMBLYe23. Examples of algal or plant promoters are
pLGV23, pGHlac.sup.+, pBIN19, pAK2004, pVKH or pDH51 (see Schmidt,
R. and Willmitzer, L., Plant Cell Rep. 7, 583 (1988))). The vectors
identified above or derivatives of the vectors identified above are
a small selection of the possible plasmids. Further plasmids are
well known to those skilled in the art and may be found, for
example, in "Cloning Vectors" (Eds. Pouwels P. H. et al. Elsevier,
Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). Suitable plant
vectors are described inter alia in "Methods in Plant Molecular
Biology and Biotechnology" (CRC Press, Ch. 6/7, pp. 71-119).
Advantageous vectors are known as shuttle vectors or binary vectors
which replicate in E. coli and Agrobacterium.
[1213] By vectors is meant with the exception of plasmids all other
vectors known to those skilled in the art such as by way of example
phages, viruses such as SV40, CMV, baculovirus, adenovirus,
transposons, IS elements, phasmids, phagemids, cosmids, linear or
circular DNA. These vectors can be replicated autonomously in the
host organism or be chromosomally replicated, chromosomal
replication being preferred.
[1214] In a further embodiment of the vector the expression
cassette according to the invention may also advantageously be
introduced into the organisms in the form of a linear DNA and be
integrated into the genome of the host organism by way of
heterologous or homologous recombination. This linear DNA may be
composed of a linearized plasmid or only of the expression cassette
as vector or the nucleic acid sequences according to the
invention.
[1215] In a further advantageous embodiment the nucleic acid
sequence according to the invention can also be introduced into an
organism on its own.
[1216] If in addition to the nucleic acid sequence according to the
invention further genes are to be introduced into the organism, all
together with a reporter gene in a single vector or each single
gene with a reporter gene in a vector in each case can be
introduced into the organism, whereby the different vectors can be
introduced simultaneously or successively.
[1217] The vector advantageously contains at least one copy of the
nucleic acid sequences according to the invention and/or the
expression cassette (=gene construct) according to the
invention.
[1218] The invention further provides an isolated recombinant
expression vector comprising a nucleic acid encoding a polypeptide
as depicted in table II, column 5 or 7, wherein expression of the
vector in a host cell results in increased yield, e.g. increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to a wild type variety of the host cell.
[1219] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector,
wherein additional DNA segments can be ligated into the viral
genome. Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g. bacterial vectors
having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g. non-episomal mammalian vectors) are
integrated into the genome of a host cell or a organelle upon
introduction into the host cell, and thereby are replicated along
with the host or organelle genome. Moreover, certain vectors are
capable of directing the expression of genes to which they are
operatively linked. Such vectors are referred to herein as
"expression vectors." In general, expression vectors of utility in
recombinant DNA techniques are often in the form of plasmids. In
the present specification, "plasmid" and "vector" can be used
interchangeably as the plasmid is the most commonly used form of
vector. However, the invention is intended to include such other
forms of expression vectors, such as viral vectors (e.g.,
replication defective retroviruses, adenoviruses, and
adeno-associated viruses), which serve equivalent functions.
[1220] The recombinant expression vectors of the invention comprise
a nucleic acid of the invention in a form suitable for expression
of the nucleic acid in a host cell, which means that the
recombinant expression vectors include one or more regulatory
sequences, selected on the basis of the host cells to be used for
expression, which is operatively linked to the nucleic acid
sequence to be expressed. As used herein with respect to a
recombinant expression vector, "operatively linked" is intended to
mean that the nucleotide sequence of interest is linked to the
regulatory sequence(s) in a manner which allows for expression of
the nucleotide sequence (e.g. in an in vitro
transcription/translation system or in a host cell when the vector
is introduced into the host cell). The term "regulatory sequence"
is intended to include promoters, enhancers, and other expression
control elements (e.g. polyadenylation signals). Such regulatory
sequences are described, for example, in Goeddel, Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego,
Calif. (1990), and Gruber and Crosby, in: Methods in Plant
Molecular Biology and Biotechnology, eds. Glick and Thompson,
Chapter 7, 89-108, CRC Press; Boca Raton, Fla., including the
references therein. Regulatory sequences include those that direct
constitutive expression of a nucleotide sequence in many types of
host cells and those that direct expression of the nucleotide
sequence only in certain host cells or under certain conditions. It
will be appreciated by those skilled in the art that the design of
the expression vector can depend on such factors as the choice of
the host cell to be transformed, the level of expression of
polypeptide desired, etc. The expression vectors of the invention
can be introduced into host cells to thereby produce polypeptides
or peptides, including fusion polypeptides or peptides, encoded by
nucleic acids as described herein (e.g., LTRRPs, mutant forms of
LTRRPs, fusion polypeptides, "Yield Related Proteins" or "YRPs"
etc.).
[1221] The recombinant expression vectors of the invention can be
designed for expression of the polypeptide of the invention in
plant cells. For example, LTRRP or YRP genes can be expressed in
plant cells (see Schmidt R., and Willmitzer L., Plant Cell Rep. 7
(1988);
[1222] Plant Molecular Biology and Biotechnology, C Press, Boca
Raton, Fla., Chapter 6/7, p. 71-119 (1993); White F. F., Jenes B.
et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol.
1, Engineering and Utilization, eds. Kung and Wu R., 128-43,
Academic Press: 1993; Potrykus, Annu. Rev. Plant Physiol. Plant
Molec. Biol. 42, 205 (1991) and references cited therein). Suitable
host cells are discussed further in Goeddel, Gene Expression
Technology: Methods in Enzymology 185, Academic Press: San Diego,
Calif. (1990). Alternatively, the recombinant expression vector can
be transcribed and translated in vitro, for example using T7
promoter regulatory sequences and T7 polymerase.
[1223] Expression of polypeptides in prokaryotes is most often
carried out with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
polypeptides. Fusion vectors add a number of amino acids to a
polypeptide encoded therein, usually to the amino terminus of the
recombinant polypeptide but also to the C-terminus or fused within
suitable regions in the polypeptides. Such fusion vectors typically
serve three purposes: 1) to increase expression of a recombinant
polypeptide; 2) to increase the solubility of a recombinant
polypeptide; and 3) to aid in the purification of a recombinant
polypeptide by acting as a ligand in affinity purification. Often,
in fusion expression vectors, a proteolytic cleavage site is
introduced at the junction of the fusion moiety and the recombinant
polypeptide to enable separation of the recombinant polypeptide
from the fusion moiety subsequent to purification of the fusion
polypeptide. Such enzymes, and their cognate recognition sequences,
include Factor Xa, thrombin, and enterokinase.
[1224] By way of example the plant expression cassette can be
installed in the pRT transformation vector ((a) Toepfer et al.,
Methods Enzymol. 217, 66 (1993), (b) Toepfer et al., Nucl. Acids.
Res. 15, 5890 (1987)). Alternatively, a recombinant vector
(=expression vector) can also be transcribed and translated in
vitro, e.g. by using the T7 promoter and the T7 RNA polymerase.
[1225] Expression vectors employed in prokaryotes frequently make
use of inducible systems with and without fusion proteins or fusion
oligopeptides, wherein these fusions can ensue in both N-terminal
and C-terminal manner or in other useful domains of a protein. Such
fusion vectors usually have the following purposes: 1) to increase
the RNA expression rate; 2) to increase the achievable protein
synthesis rate; 3) to increase the solubility of the protein; 4) or
to simplify purification by means of a binding sequence usable for
affinity chromatography. Proteolytic cleavage points are also
frequently introduced via fusion proteins, which allow cleavage of
a portion of the fusion protein and purification. Such recognition
sequences for proteases are recognized, e.g. factor Xa, thrombin
and enterokinase.
[1226] Typical advantageous fusion and expression vectors are pGEX
(Pharmacia Biotech Inc; Smith D. B. and Johnson K. S., Gene 67, 31
(1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5
(Pharmacia, Piscataway, N.J.) which contains glutathione
S-transferase (GST), maltose binding protein or protein A.
[1227] In one embodiment, the coding sequence of the polypeptide of
the invention is cloned into a pGEX expression vector to create a
vector encoding a fusion polypeptide comprising, from the
N-terminus to the C-terminus, GST-thrombin cleavage site-X
polypeptide. The fusion polypeptide can be purified by affinity
chromatography using glutathione-agarose resin. Recombinant PK
LTRRP or YRP unfused to GST can be recovered by cleavage of the
fusion polypeptide with thrombin. Other examples of E. coli
expression vectors are pTrc (Amann et al., Gene 69, 301 (1988)) and
pET vectors (Studier et al., Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89;
Stratagene, Amsterdam, The Netherlands).
[1228] Target gene expression from the pTrc vector relies on host
RNA polymerase transcription from a hybrid trp-lac fusion promoter.
Target gene expression from the pET 11d vector relies on
transcription from a T7 gn10-lac fusion promoter mediated by a
co-expressed viral RNA polymerase (T7 gn1). This viral polymerase
is supplied by host strains BL21(DE3) or HMS174(DE3) from a
resident I prophage harboring a T7 gn1 gene under the
transcriptional control of the lacUV 5 promoter.
[1229] In an further embodiment of the present invention, the LTRRP
or YRPs are expressed in plants and plants cells such as
unicellular plant cells (e.g. algae) (see Falciatore et al., Marine
Biotechnology 1 (3), 239 (1999) and references therein) and plant
cells from higher plants (e.g., the spermatophytes, such as crop
plants), for example to regenerate plants from the plant cells. A
nucleic acid molecule coding for LTRRP or YRP as depicted in table
II, column 5 or 7 may be "introduced" into a plant cell by any
means, including transfection, transformation or transduction,
electroporation, particle bombardment, agroinfection, and the like.
One transformation method known to those of skill in the art is the
dipping of a flowering plant into an Agrobacteria solution, wherein
the Agrobacteria contains the nucleic acid of the invention,
followed by breeding of the transformed gametes.
[1230] Other suitable methods for transforming or transfecting host
cells including plant cells can be found in Sambrook et al.,
Molecular Cloning: A Laboratory Manual. 2.sup.nd, ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989, and other laboratory manuals such as Methods in
Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, ed:
Gartland and Davey, Humana Press, Totowa, N.J. As increased
tolerance to abiotic environmental stress and/or yield is a general
trait wished to be inherited into a wide variety of plants like
maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut,
cotton, rapeseed and canola, manihot, pepper, sunflower and
tagetes, solanaceous plants like potato, tobacco, eggplant, and
tomato, Vicia species, pea, alfalfa, bushy plants (coffee, cacao,
tea), Salix species, trees (oil palm, coconut), perennial grasses,
and forage crops, these crop plants are also preferred target
plants for a genetic engineering as one further embodiment of the
present invention. Forage crops include, but are not limited to
Wheatgrass, Canarygrass, Bromegrass, Wildrye Grass, Bluegrass,
Orchardgrass, Alfalfa, Salfoin, Birdsfoot Trefoil, Alsike Clover,
Red Clover and Sweet Clover.
[1231] In one embodiment of the present invention, transfection of
a nucleic acid molecule coding for LTRRP or YRP as depicted in
table II, column 5 or 7 into a plant is achieved by Agrobacterium
mediated gene transfer. Agrobacterium mediated plant transformation
can be performed using for example the GV3101(pMP90) (Koncz and
Schell, Mol. Gen. Genet. 204, 383 (1986)) or LBA4404 (Clontech)
Agrobacterium tumefaciens strain. Transformation can be performed
by standard transformation and regeneration techniques (Deblaere et
al., Nucl. Acids Res. 13, 4777 (1994), Gelvin, Stanton B. and
Schilperoort Robert A, Plant Molecular Biology Manual, 2.sup.nd
Ed.--Dordrecht: Kluwer Academic Publ., 1995.--in Sect., Ringbuc
Zentrale Signatur: BT11-P ISBN 0-7923-2731-4; Glick Bernard R.,
Thompson John E., Methods in Plant Molecular Biology and
Biotechnology, Boca Raton: CRC Press, 1993 360 S., ISBN
0-8493-5164-2). For example, rapeseed can be transformed via
cotyledon or hypocotyl transformation (Moloney et al., Plant Cell
Report 8, 238 (1989); De Block et al., Plant Physiol. 91, 694
(1989)). Use of antibiotics for Agrobacterium and plant selection
depends on the binary vector and the Agrobacterium strain used for
transformation. Rapeseed selection is normally performed using
kanamycin as selectable plant marker. Agrobacterium mediated gene
transfer to flax can be performed using, for example, a technique
described by Mlynarova et al., Plant Cell Report 13, 282 (1994).
Additionally, transformation of soybean can be performed using for
example a technique described in European Patent No. 424 047, U.S.
Pat. No. 5,322,783, European Patent No. 397 687, U.S. Pat. No.
5,376,543 or U.S. Pat. No. 5,169,770. Transformation of maize can
be achieved by particle bombardment, polyethylene glycol mediated
DNA uptake or via the silicon carbide fiber technique. (See, for
example, Freeling and Walbot "The maize handbook" Springer Verlag
New York (1993) ISBN 3-540-97826-7). A specific example of maize
transformation is found in U.S. Pat. No. 5,990,387, and a specific
example of wheat transformation can be found in PCT Application No.
WO 93/07256.
[1232] According to the present invention, the introduced nucleic
acid molecule coding for LTRRP or YRP as depicted in table II,
column 5 or 7 may be maintained in the plant cell stably if it is
incorporated into a non-chromosomal autonomous replicon or
integrated into the plant chromosomes or organelle genome.
Alternatively, the introduced LTRRP or YRP may be present on an
extra-chromosomal non-replicating vector and be transiently
expressed or transiently active.
[1233] In one embodiment, a homologous recombinant microorganism
can be created wherein the LTRRP or YRP is integrated into a
chromosome, a vector is prepared which contains at least a portion
of a nucleic acid molecule coding for LTRRP or YRP as depicted in
table II, column 5 or 7 into which a deletion, addition, or
substitution has been introduced to thereby alter, e.g.,
functionally disrupt, the LTRRP or YRP gene. For example, the LTRRP
or YRP gene is a yeast gene, like a gene of S. cerevisiae, or of
Synechocystis, or a bacterial gene, like an E. coli gene, but it
can be a homolog from a related plant or even from a mammalian or
insect source. The vector can be designed such that, upon
homologous recombination, the endogenous nucleic acid molecule
coding for LTRRP or YRP as depicted in table II, column 5 or 7 is
mutated or otherwise altered but still encodes a functional
polypeptide (e.g., the upstream regulatory region can be altered to
thereby alter the expression of the endogenous LTRRP or YRP). In a
preferred embodiment the biological activity of the protein of the
invention is increased upon homologous recombination. To create a
point mutation via homologous recombination, DNA-RNA hybrids can be
used in a technique known as chimeraplasty (Cole-Strauss et al.,
Nucleic Acids Research 27 (5), 1323 (1999) and Kmiec, Gene Therapy
American Scientist. 87 (3), 240 (1999)). Homologous recombination
procedures in Physcomitrella patens are also well known in the art
and are contemplated for use herein.
[1234] Whereas in the homologous recombination vector, the altered
portion of the nucleic acid molecule coding for LTRRP or YRP as
depicted in table II, column 5 or 7 is flanked at its 5' and 3'
ends by an additional nucleic acid molecule of the LTRRP or YRP
gene to allow for homologous recombination to occur between the
exogenous LTRRP or YRP gene carried by the vector and an endogenous
LTRRP or YRP gene, in a microorganism or plant. The additional
flanking LTRRP or YRP nucleic acid molecule is of sufficient length
for successful homologous recombination with the endogenous gene.
Typically, several hundreds of base pairs up to kilobases of
flanking DNA (both at the 5' and 3' ends) are included in the
vector. See, e.g., Thomas K. R., and Capecchi M. R., Cell 51, 503
(1987) for a description of homologous recombination vectors or
Strepp et al., PNAS, 95 (8), 4368 (1998) for cDNA based
recombination in Physcomitrella patens. The vector is introduced
into a microorganism or plant cell (e.g. via polyethylene glycol
mediated DNA), and cells in which the introduced LTRRP or YRP gene
has homologously recombined with the endogenous LTRRP or YRP gene
are selected using artknown techniques.
[1235] Whether present in an extra-chromosomal non-replicating
vector or a vector that is integrated into a chromosome, the
nucleic acid molecule coding for LTRRP or YRP as depicted in table
II, column 5 or 7 preferably resides in a plant expression
cassette. A plant expression cassette preferably contains
regulatory sequences capable of driving gene expression in plant
cells that are operatively linked so that each sequence can fulfill
its function, for example, termination of transcription by
polyadenylation signals. Preferred polyadenylation signals are
those originating from Agrobacterium tumefaciens t-DNA such as the
gene 3 known as .alpha.-topine synthase of the Ti-plasmid pTiACH5
(Gielen et al., EMBO J. 3, 835 (1984)) or functional equivalents
thereof but also all other terminators functionally active in
plants are suitable. As plant gene expression is very often not
limited on transcriptional levels, a plant expression cassette
preferably contains other operatively linked sequences like
translational enhancers such as the overdrive-sequence containing
the 5''-untranslated leader sequence from tobacco mosaic virus
enhancing the polypeptide per RNA ratio (Gallie et al., Nucl. Acids
Research 15, 8693 (1987)). Examples of plant expression vectors
include those detailed in: Becker D. et al., Plant Mol. Biol. 20,
1195 (1992); and Bevan M. W., Nucl. Acid. Res. 12, 8711 (1984); and
"Vectors for Gene Transfer in Higher Plants" in: Transgenic Plants,
Vol. 1, Engineering and Utilization, eds. Kung and Wu R., Academic
Press, 1993, S. 15-38.
[1236] "Transformation" is defined herein as a process for
introducing heterologous DNA into a plant cell, plant tissue, or
plant. It may occur under natural or artificial conditions using
various methods well known in the art. Transformation may rely on
any known method for the insertion of foreign nucleic acid
sequences into a prokaryotic or eukaryotic host cell. The method is
selected based on the host cell being transformed and may include,
but is not limited to, viral infection, electroporation,
lipofection, and particle bombardment. Such "transformed" cells
include stably transformed cells in which the inserted DNA is
capable of replication either as an autonomously replicating
plasmid or as part of the host chromosome. They also include cells
which transiently express the inserted DNA or RNA for limited
periods of time. Transformed plant cells, plant tissue, or plants
are understood to encompass not only the end product of a
transformation process, but also transgenic progeny thereof.
[1237] The terms "transformed," "transgenic," and "recombinant"
refer to a host organism such as a bacterium or a plant into which
a heterologous nucleic acid molecule has been introduced. The
nucleic acid molecule can be stably integrated into the genome of
the host or the nucleic acid molecule can also be present as an
extra-chromosomal molecule. Such an extra-chromosomal molecule can
be auto-replicating. Transformed cells, tissues, or plants are
understood to encompass not only the end product of a
transformation process, but also transgenic progeny thereof. A
"non-transformed", "non-transgenic" or "non-recombinant" host
refers to a wild-type organism, e.g. a bacterium or plant, which
does not contain the heterologous nucleic acid molecule.
[1238] A "transgenic plant", as used herein, refers to a plant
which contains a foreign nucleotide sequence inserted into either
its nuclear genome or organelle genome. It encompasses further the
offspring generations i.e. the T1-, T2- and consecutively
generations or BC1-, BC2- and consecutively generation as well as
crossbreeds thereof with non-transgenic or other transgenic
plants.
[1239] The host organism (=transgenic organism) advantageously
contains at least one copy of the nucleic acid according to the
invention and/or of the nucleic acid construct according to the
invention.
[1240] In principle all plants can be used as host organism.
Preferred transgenic plants are, for example, selected from the
families Aceraceae, Anacardiaceae, Apiaceae, Asteraceae,
Brassicaceae, Cactaceae, Cucurbitaceae, Euphorbiaceae, Fabaceae,
Malvaceae, Nymphaeaceae, Papaveraceae, Rosaceae, Salicaceae,
Solanaceae, Arecaceae, Bromeliaceae, Cyperaceae, Iridaceae,
Liliaceae, Orchidaceae, Gentianaceae, Labiaceae, Magnoliaceae,
Ranunculaceae, Carifolaceae, Rubiaceae, Scrophulariaceae,
Caryophyllaceae, Ericaceae, Polygonaceae, Violaceae, Juncaceae or
Poaceae and preferably from a plant selected from the group of the
families Apiaceae, Asteraceae, Brassicaceae, Cucurbitaceae,
Fabaceae, Papaveraceae, Rosaceae, Solanaceae, Liliaceae or Poaceae.
Preferred are crop plants such as plants advantageously selected
from the group of the genus peanut, oilseed rape, canola,
sunflower, safflower, olive, sesame, hazelnut, almond, avocado,
bay, pumpkin/squash, linseed, soya, pistachio, borage, maize,
wheat, rye, oats, sorghum and millet, triticale, rice, barley,
cassava, potato, sugarbeet, egg plant, alfalfa, and perennial
grasses and forage plants, oil palm, vegetables (brassicas, root
vegetables, tuber vegetables, pod vegetables, fruiting vegetables,
onion vegetables, leafy vegetables and stem vegetables), buckwheat,
Jerusalem artichoke, broad bean, vetches, lentil, dwarf bean,
lupin, clover and Lucerne for mentioning only some of them.
[1241] In one embodiment of the invention transgenic plants are
selected from the group comprising cereals, soybean, rapeseed
(including oil seed rape, especially canola and winter oil seed
rape), cotton sugarcane and potato, especially corn, soy, rapeseed
(including oil seed rape, especially canola and winter oil seed
rape), cotton, wheat and rice.
[1242] In another embodiment of the invention the transgenic plant
is a gymnosperm plant, especially a spruce, pine or fir.
[1243] In one embodiment, the host plant is selected from the
families Aceraceae, Anacardiaceae, Apiaceae, Asteraceae,
Brassicaceae, Cactaceae, Cucurbitaceae, Euphorbiaceae, Fabaceae,
Malvaceae, Nynnphaeaceae, Papaveraceae, Rosaceae, Salicaceae,
Solanaceae, Arecaceae, Bromeliaceae, Cyperaceae, Iridaceae,
Liliaceae, Orchidaceae, Gentianaceae, Labiaceae, Magnoliaceae,
Ranunculaceae, Carifolaceae, Rubiaceae, Scrophulariaceae,
Caryophyllaceae, Ericaceae, Polygonaceae, Violaceae, Juncaceae or
Poaceae and preferably from a plant selected from the group of the
families Apiaceae, Asteraceae, Brassicaceae, Cucurbitaceae,
Fabaceae, Papaveraceae, Rosaceae, Solanaceae, Liliaceae or Poaceae.
Preferred are crop plants and in particular plants mentioned herein
above as host plants such as the families and genera mentioned
above for example preferred the species Anacardium occidentale,
Calendula officinalis, Carthamus tinctorius, Cichorium intybus,
Cynara scolymus, Helianthus annus, Tagetes lucida, Tagetes erecta,
Tagetes tenuifolia; Daucus carota; Corylus avellana, CoryLus
colurna, Borago officinalis; Brassica napus, Brassica rapassp.,
Sinapis arvensis Brassica juncea, Brassica juncea var. juncea,
Brassica juncea var. crispifolia, Brassica juncea var. foliosa,
Brassica nigra, Brassica sinapioides, Melanosinapis communis,
Brassica oleracea, Arabidopsis thaliana, Anana comosus, Ananas
ananas, Bromelia comosa, Carica papaya, Cannabis sative, Ipomoea
batatus, Ipomoea pandurata, Convolvulus batatas, Convolvulus
tiliaceus, Ipomoea fastlgiata, Ipomoea tiliacea, Ipomoea triloba,
Convolvulus panduratus, Beta vulgaris, Beta vulgaris var altissima,
Beta vulgaris var. vulgaris, Beta maritima, Beta vulgaris var.
perennis, Beta vulgaris var. conditiva, Beta vulgaris var.
esculenta, Cucurbita maxima, Cucurbita mixta, Cucurbita pepo,
Cucurbita moschata, Olea europaea, Manihot utllissirna, Janipha
manihot, Jatropha manihot, Manihot aipil, Manihot dulcis, Manihot
manihot, Manihot melanobasis, Manihot esculenta, nus communis,
Pisum sativum, Pisum arvense, Pisum humile, Medicago sativa,
Medicago falcata, Medicago varia, Glycine max Dokhos soja, Glycine
gracilis, Glycine hispida, Phaseolus max, Soja hispda, Soja max,
Cocos nucifera, Pelargonium grossulariodes, Oleum cocoas, Laurus
Persea ameficana, Arachis hypogaea, Linum usitatissirnum, Linum
humile, Linum austriacum, Linum bienne, Linum angustifolium, Linum
catharticum, Linum flavum, Linum grandiflorum, AdenolMum
grandiflorum, Linum Linum narbonense, Linum perenne, Linum perenne
var. lewisii, Linum pratense, Linum trtgynum, Punica granatum,
Gossypium hirsuturn, Gossypium arboreum, Gossypium barbadense,
Gossypium herbaceum, Gossypium thurberi, Musa nana, Musa acuminata,
Musa paradisiaca, Musa spp., guineensis, Papaver orientate, Papaver
rhoeas, Papaver dubium, Sesamum indicum, Piper aduncum, Piper
amaiago, Piper augustifolium, Piper auritum, Piper betel, Piper
cubeba, Piper longum, Piper nigrum, Piper retrofractum, Artanthe
adunca, Artanthe etongata, Peperomia etongata, Piper elongatum,
Steffensia etongata, Hordeum vulgare, Hordeum jubatum, Hordeum
murinum, Hordeum secalinum, Hordeum distichon Hordeum aegiceras,
Hordeum hexastichon., Hordeum hexastichum, Hordeum irregulare,
Hordeum sativum, Hordeum secalinum, Avena sativa, Avena fatua,
Avena byzantina, Avena fatua var. sativa, Avena hybrida, Sorghum
bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgare,
Andropogon drummondii, Holcus bicolor, Holcus sorghum, Sorghum
aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum
cernuum, Sorghum dochna, Sorghum drummondii, Sorghum durra, Sorghum
guineense, Sorghum tanceolatum, Sorghum nervosum, Sorghum
saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum,
Sorghum vulgare, Holcus halepensis, Sorghum miliaceum millet,
Panicum militaceum, Zea mays, Triticum aestivum, Triticum durum,
Triticum turgidum, Triticum hybernum, Triticum macha, Triticum
sativum or Triticum vulgare, Cofea spp., Coffea arabica, Coffea
canephora, Coffea liberica, Capsicum annuum, Capsicum annuum var.
glabriusculum, Capsicum frutescens, Capsicum annuum, Nicotiana
tabacum, Solanum tuberosum, Solanum melongena, Lycopersicon
esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme,
Solanum integrifolium, Solanum lycopersicum Theobroma cacao or
Camellia sinensis. Anacardiaceae such as the genera Pistacia,
Mangifera, Anacardium e.g. the species Pistacia vera [pistachios,
Pistazie], Mangifer indica [Mango] or Anacardium occidentale
[Cashew]; Asteraceae such as the genera Calendula, Carthamus,
Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta,
Tagetes, Valeriana e.g. the species Calendula officinags
[Marigold], Carthamus tinctorius [safflower], Centaurea cyanus
[cornflower], Cichorium intybus [blue daisy], Cynara scolymus
[Artichoke], Helianthus annus [sunflower], Lactuca sativa, Lactuca
crispa, Lactuca esculenta, Lactuca scariola L. ssp. sativa, Lactuca
scariola L. var. integrata, Lactuca scariola L. var. integrifolia,
Lactuca sativa subsp. roman, Locusta communis, Valeriana locusta
[lettuce], Tagetes lucida, Tagetes erecta or Tagetes tenuifolia
[Marigold]; Apiaceae such as the genera Daucus e.g. the species
Daucus carota [carrot]; Betulaceae such as the genera Corylus e.g.
the species Corylus avellana or Corylus colurna [hazelnut];
Boraginaceae such as the genera Borago e.g. the species Borago
officinalis [borage]; Brassicaceae such as the genera Brassica,
Melanosinapis, Sinapis, Arabadopsis e.g. the species Brassica
napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape],
Sinapis arvensis Brassica juncea, Brassica juncea var. juncea,
Brassica juncea var. crispifolia, Brassica juncea var. foliosa,
Brassica nigra, Brassica sinapioides, Melanosinapis communis
[mustard], Brassica oteracea [fodder beet] or Arabidopsis thaliana;
Bromeliaceae such as the genera Anana, Bromelia e.g. the species
Anana comosus, Ananas ananas or Bromelia comosa [pineapple];
Caricaceae such as the genera Carica e.g. the species Carica papaya
[papaya]; Cannabaceae such as the genera Cannabis e.g. the species
Cannabis sative [hemp], Convolvulaceae such as the genera Ipomea,
Convolvulus e.g. the species Ipomoea batatus, Ipomoea pandurata,
Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fasttgiata,
Ipomoea tiliacea, Ipomoea triloba or Convolvulus panduratus [sweet
potato, Man of the Earth, wild potato], Chenopodiaceae such as the
genera Beta, i.e. the species Beta vulgaris, Beta vulgaris var.
altissima, Beta vulgaris var. Vulgaris, Beta maritima, Beta
vulgaris var. perennis, Beta vulgaris var conditiva or Beta
vulgaris var. esculenta [sugar beet]; Cucurbitaceae such as the
genera Cucubita e.g. the species Cucurbita maxima, Cucurbita mixta,
Cucurbita pepo or Cucurbita moschata [pumpkin, squash];
Elaeagnaceae such as the genera Elaeagnus e.g. the species Olea
europaea [olive]; Ericaceae such as the genera Kalmia e.g. the
species Kalmia latifolia, Kalmia angustifolia, Kalmia microphylla,
Kalmia polifolia, Kalmia occidentalis, Cistus chamaerhodendros or
Kalmia lucida [American laurel, broad-leafed laurel, calico bush,
spoon wood, sheep laurel, alpine laurel, bog laurel, western
bog-laurel, swamp-laurel]; Euphorbiaceae such as the genera
Manihot, Janipha, Jatropha, Ricinus e.g. the species Manihot
utilissima, Janipha manihot, Jatropha manihot, Manihot aipll,
Manihot dulcis, Manihot manihot, Manihot melanobasis, Manihot
esculenta [manihot, arrowroot, tapioca, cassava] or Ricinus
communis [castor bean, Castor Oil Bush, Castor Oil Plant, Palma
Christi, Wonder Tree]; Fabaceae such as the genera Pisum, Albizia,
Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa,
Medicajo, Glycine, Dolichos, Phaseolus, Soja e.g. the species Pisum
sativum, Pisum arvense, Pisum humlle [pea], Albizia berteriana,
Albizia julibrissin, Albizia lebbeck, Acacia berteriana, Acacia
littoralis, Albizia berteriana, Albizzia berteriana, Cathormion
berteriana, Feudlea berteriana, Inga fragrans, Pithecellobium
berterianum, Pithecellobium fragrans, Pithecolobium berterianum,
Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Albizia
nemu, Feudleea julibrissin, Mimosa julibrissin, Mimosa speciosa,
Sericanrda julibrissin, Acacia lebbeck, Acacia macrophylla, Albizia
lebbek, Feuilleea lebbeck, Mimosa lebbeck, Mimosa speciosa [bastard
logwood, silk tree, East Indian Walnut], Medicago sativa, Medicago
falcata, Medicago varia [alfalfa] Glycine max Dokhos soja, Glycine
gracilis, Glycine hispida, Phaseolus max, Soja hispida or Soja max
[soybean]; Geraniaceae such as the genera Pelargonium, Cocos, Oleum
e.g. the species Cocos nucifera, Pelargonium grossulariodes or
Oleum cocoas [coconut]; Gramineae such as the genera Saccharum e.g.
the species Saccharum officinarum; Juglandaceae such as the genera
Juglans, Wallia e.g. the species Juglans regia, Juglans
ailanthifolia, Juglans sieboldiana, Juglans cinerea, Wallia
cinerea, Juglans Juglans californica, Juglans hindsii, Juglans
intermedia, Juglans jamaicensis, Juglans major, Juglans macrocarpa,
Juglans nigra or Wallia nigra [walnut, black walnut, common walnut,
persian walnut, white walnut, butternut, black walnut]; Lauraceae
such as the genera Persea, Laurus e.g. the species laurel Laurus
nobilis [bay, laurel, bay laurel, sweet bay], Persea ameficana
Persea ameficana, Persea gratissima or Persea persea [avocado];
Leguminosae such as the genera Arachis e.g. the species Arachis
hypogaea [peanut]; Linaceae such as the genera Linum, Adenolinum
e.g. the species Linum usitatissimum, Linum humlle, Linum
austriacum, Linum bienne, Linum angustifolium, Linum catharticum,
Linum flavum, Linum grandiflorum, Adenolinum grandiflorum, Linum
lewisii, Linum narbonense, Linum perenne, Linum perenne var.
lewisii, Linum pratense or Linum trigynum [flax, linseed];
Lythrarieae such as the genera Punica e.g. the species Punica
granatum [pomegranate]; Malvaceae such as the genera Gossypium e.g.
the species Gossypium hirsutum, Gossypium arboreum, Gossypium
barbadense, Gossypium herbaceum or Gossypium thurberi [cotton];
Musaceae such as the genera Musa e.g. the species Musa nana, Musa
acuminata, Musa paradisiaca, Musa spp. [banana]; Onagraceae such as
the genera Camissonia, Oenothera e.g. the species Oenothera biennis
or Camissonia brevipes [primrose, evening primrose]; Palmae such as
the genera Elacis e.g. the species Elaeis guineensis [oil plam];
Papaveraceae such as the genera Papaver e.g. the species Papaver
orientate, Papaver rhoeas, Papaver dubium [poppy, oriental poppy,
corn poppy, field poppy, shirley poppies, field poppy, long-headed
poppy, long-pod poppy]; Pedaliaceae such as the genera Sesamum e.g.
the species Sesarnurn indicum [sesame]; Piperaceae such as the
genera Piper, Artanthe, Peperomia, Steffensia e.g. the species
Piper aduncurn, Piper arnalago, Piper angustifolium, Piper auritum,
Piper betel, Piper cubeba, Piper longum, Piper nigrurn, Piper
retrofracturn, Artanthe adunca, Artanthe elongata, Peperomia
elongata, Piper elongatum, Steffensia elongata. [Cayenne pepper,
wild pepper]; Poaceae such as the genera Hordeum, Secale, Avena,
Sorghum, Andropogon, Holcus, Panicum, Oryza, Zea, Triticum e.g. the
species Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum
secalinum, Hordeum distichon Hordeum aegiceras, Hordeum
hexastichon, Hordeum hexastichum, Hordeum irregulare, Hordeum
sativum, Hordeum secalinum [barley, pearl barley, foxtail barley,
wall barley, meadow barley], Secale cereale [rye], Avena sativa,
Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena
hybrida [oat], Sorghum bicolor, Sorghum halepense, Sorghum
saccharatum, Sorghum vulgare, Andropogon drummondii Holcus bicolor,
Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum
caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondil
Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum
nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum
verticilliflorum, Sorghum vulgare, Holcus halepensis, Sorghum
miliaceum millet, Panicum militaceurn [Sorghum, millet], Oryza
sativa, Oryza latifolia [rice], Zea mays [corn, maize] Triticum
aestivum, Triticum durum, Triticum turgidum, Triticum hybernum,
Triticum macha, Triticum sativum or Triticum vulgare [wheat, bread
wheat, common wheat], Proteaceae such as the genera Macadamia e.g.
the species Macadamia intergrifolia [macadamia]; Rubiaceae such as
the genera Coffea e.g. the species Cofea spp., Coffea arabica,
Coffea canephora or Coffea liberica [coffee]; Scrophulariaceae such
as the genera Verbascum e.g. the species Verbascum blattaria,
Verbascum chabai, Verbascum densiflorum, Verbascum lagurus,
Verbascum longifolium, Verbascum lychnitis, Verbascum nigrum,
Verbascum olympicum, Verbascum phlomodes, Verbascum phoenicum,
Verbascum pulverulentum or Verbascum thapsus [mullein, white moth
mullein, nettle-leaved mullein, dense-flowered mullein, silver
mullein, long-leaved mullein, white mullein, dark mullein, greek
mullein, orange mullein, purple mullein, hoary mullein, great
mullein]; Solanaceae such as the genera Capsicum, Nicotiana,
Solanum, Lycopersicon e.g. the species Capsicum annuum, Capsicum
annuum var. glabriusculum, Capsicum frutescens [pepper], Capsicum
annuum [paprika], Nicotiana tabacum, Nicotiana alata, Nicotiana
attenuata, Nicotiana glauca, Nicotiana langsdorffii, Nicotiana
obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, Nicotiana
rustica, Nicotiana sylvestris [tobacco], Solanum tuberosum
[potato], Solanum melongena [egg-plant] (Lycopersicon esculentum,
Lycopersicon lycopersicum., Lycopersicon pyriforme, Solanum
integrifolium or Solanum lycopersicum[tomato]; Sterculiaceae such
as the genera Theobroma e.g. the species Theobroma cacao [cacao];
Theaceae such as the genera Camellia e.g. the species Camellia
sinensis) [tea].
[1244] The introduction of the nucleic acids according to the
invention, the expression cassette or the vector into organisms,
plants for example, can in principle be done by all of the methods
known to those skilled in the art. The introduction of the nucleic
acid sequences gives rise to recombinant or transgenic
organisms.
[1245] Unless otherwise specified, the terms "polynucleotides",
"nucleic acid" and "nucleic acid molecule" as used herein are
interchangeably. Unless otherwise specified, the terms "peptide",
"polypeptide" and "protein" are interchangeably in the present
context. The term "sequence" may relate to polynucleotides, nucleic
acids, nucleic acid molecules, peptides, polypeptides and proteins,
depending on the context in which the term "sequence" is used. The
terms "gene(s)", "polynucleotide", "nucleic acid sequence",
"nucleotide sequence", or "nucleic acid molecule(s)" as used herein
refers to a polymeric form of nucleotides of any length, either
ribonucleotides or deoxyribonucleotides. The terms refer only to
the primary structure of the molecule.
[1246] Thus, the terms "gene(s)", "polynucleotide", "nucleic acid
sequence", "nucleotide sequence", or "nucleic acid molecule(s)" as
used herein include double- and single-stranded DNA and RNA. They
also include known types of modifications, for example,
methylation, "caps", substitutions of one or more of the naturally
occurring nucleotides with an analog. Preferably, the DNA or RNA
sequence of the invention comprises a coding sequence encoding the
herein defined polypeptide.
[1247] The genes of the invention, coding for an activity selected
from the group consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein are also called "LTRRP gene"
or interchangeable "YRP gene".
[1248] A "coding sequence" is a nucleotide sequence, which is
transcribed into mRNA and/or translated into a polypeptide when
placed under the control of appropriate regulatory sequences. The
boundaries of the coding sequence are determined by a translation
start codon at the 5'-terminus and a translation stop codon at the
3'-terminus. The triplets taa, tga and tag represent the (usual)
stop codons which are interchangeable. A coding sequence can
include, but is not limited to mRNA, cDNA, recombinant nucleotide
sequences or genomic DNA, while introns may be present as well
under certain circumstances.
[1249] The transfer of foreign genes into the genome of a plant is
called transformation. In doing this the methods described for the
transformation and regeneration of plants from plant tissues or
plant cells are utilized for transient or stable transformation.
Suitable methods are protoplast transformation by poly(ethylene
glycol)-induced DNA uptake, the "biolistic" method using the gene
cannon--referred to as the particle bombardment method,
electroporation, the incubation of dry embryos in DNA solution,
microinjection and gene transfer mediated by Agrobacterium. Said
methods are described by way of example in Jenes B. et al.,
Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1,
Engineering and Utilization, eds. Kung S. D and Wu R., Academic
Press (1993) 128-143 and in Potrykus, Annu. Rev. Plant Physiol.
Plant Molec. Biol. 42, 205 (1991). The nucleic acids or the
construct to be expressed is preferably cloned into a vector which
is suitable for transforming Agrobacterium tumefaciens, for example
pBin19 (Bevan et al., Nucl. Acids Res. 12, 8711 (1984)).
Agrobacteria transformed by such a vector can then be used in known
manner for the transformation of plants, in particular of crop
plants such as by way of example tobacco plants, for example by
bathing bruised leaves or chopped leaves in an agrobacterial
solution and then culturing them in suitable media. The
transformation of plants by means of Agrobacterium tumefaciens is
described, for example, by Hofgen and Willmitzer in Nucl. Acid Res.
16, 9877 (1988) or is known inter alia from White F. F., Vectors
for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1,
Engineering and Utilization, eds. Kung S. D. and Wu R., Academic
Press, 1993, pp. 15-38.
[1250] Agrobacteria transformed by an expression vector according
to the invention may likewise be used in known manner for the
transformation of plants such as test plants like Arabidopsis or
crop plants such as cereal crops, corn, oats, rye, barley, wheat,
soybean, rice, cotton, sugar beet, canola, sunflower, flax, hemp,
potatoes, tobacco, tomatoes, carrots, paprika, oilseed rape,
tapioca, cassava, arrowroot, tagetes, alfalfa, lettuce and the
various tree, nut and vine species, in particular oil-containing
crop plants such as soybean, peanut, castor oil plant, sunflower,
corn, cotton, flax, oilseed rape, coconut, oil palm, safflower
(Carthamus tinctorius) or cocoa bean, or in particular corn, wheat,
soybean, rice, cotton and canola, e.g. by bathing bruised leaves or
chopped leaves in an agrobacterial solution and then culturing them
in suitable media.
[1251] The genetically modified plant cells may be regenerated by
all of the methods known to those skilled in the art. Appropriate
methods can be found in the publications referred to above by Kung
S. D. and Wu R., Potrykus or Hofgen and Willmitzer.
[1252] Accordingly, a further aspect of the invention relates to
transgenic organisms transformed by at least one nucleic acid
sequence, expression cassette or vector according to the invention
as well as cells, cell cultures, tissue, parts--such as, for
example, leaves, roots, etc. in the case of plant organisms--or
reproductive material derived from such organisms. The terms "host
organism", "host cell", "recombinant (host) organism" and
"transgenic (host) cell" are used here interchangeably. Of course
these terms relate not only to the particular host organism or the
particular target cell but also to the descendants or potential
descendants of these organisms or cells. Since, due to mutation or
environmental effects certain modifications may arise in successive
generations, these descendants need not necessarily be identical
with the parental cell but nevertheless are still encompassed by
the term as used here.
[1253] For the purposes of the invention "transgenic" or
"recombinant" means with regard for example to a nucleic acid
sequence, an expression cassette (=gene construct, nucleic acid
construct) or a vector containing the nucleic acid sequence
according to the invention or an organism transformed by the
nucleic acid sequences, expression cassette or vector according to
the invention all those constructions produced by genetic
engineering methods in which either [1254] (a) the nucleic acid
sequence depicted in table I, application no. 1, column 5 or 7 or
its derivatives or parts thereof; or [1255] (b) a genetic control
sequence functionally linked to the nucleic acid sequence described
under (a), for example a 3'- and/or 5'-genetic control sequence
such as a promoter or terminator, or [1256] (c) (a) and (b); are
not found in their natural, genetic environment or have been
modified by genetic engineering methods, wherein the modification
may by way of example be a substitution, addition, deletion,
inversion or insertion of one or more nucleotide residues. Natural
genetic environment means the natural genomic or chromosomal locus
in the organism of origin or inside the host organism or presence
in a genomic library. In the case of a genomic library the natural
genetic environment of the nucleic acid sequence is preferably
retained at least in part. The environment borders the nucleic acid
sequence at least on one side and has a sequence length of at least
50 bp, preferably at least 500 bp, particularly preferably at least
1,000 bp, most particularly preferably at least 5,000 bp. A
naturally occurring expression cassette--for example the naturally
occurring combination of the natural promoter of the nucleic acid
sequence according to the invention with the corresponding
gene--turns into a transgenic expression cassette when the latter
is modified by unnatural, synthetic ("artificial") methods such as
by way of example a mutagenation. Appropriate methods are described
by way of example in U.S. Pat. No. 5,565,350 or WO 00/15815.
[1257] Suitable organisms or host organisms for the nucleic acid,
expression cassette or vector according to the invention are
advantageously in principle all organisms, which are suitable for
the expression of recombinant genes as described above. Further
examples which may be mentioned are plants such as Arabidopsis,
Asteraceae such as Calendula or crop plants such as soybean,
peanut, castor oil plant, sunflower, flax, corn, cotton, flax,
oilseed rape, coconut, oil palm, safflower (Carthamus tinctorius)
or cocoa bean.
[1258] In one embodiment of the invention host plants for the
nucleic acid, expression cassette or vector according to the
invention are selected from the group comprising corn, soy, oil
seed rape (including canola and winter oil seed rape), cotton,
wheat and rice.
[1259] A further object of the invention relates to the use of a
nucleic acid construct, e.g. an expression cassette, containing one
or more DNA sequences encoding one or more polypeptides shown in
table II or comprising one or more nucleic acid molecules as
depicted in table I or encoding or DNA sequences hybridizing
therewith for the transformation of plant cells, tissues or parts
of plants.
[1260] In doing so, depending on the choice of promoter, the
nucleic acid molecules or sequences shown in table I or II can be
expressed specifically in the leaves, in the seeds, the nodules, in
roots, in the stem or other parts of the plant. Those transgenic
plants overproducing sequences, e.g. as depicted in table I, the
reproductive material thereof, together with the plant cells,
tissues or parts thereof are a further object of the present
invention.
[1261] The expression cassette or the nucleic acid sequences or
construct according to the invention containing nucleic acid
molecules or sequences according to table I can, moreover, also be
employed for the transformation of the organisms identified by way
of example above such as bacteria, yeasts, filamentous fungi and
plants.
[1262] Within the framework of the present invention, increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait relates to, for example, the
artificially acquired trait of increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait, by comparison with the non-genetically modified initial
plants e.g. the trait acquired by genetic modification of the
target organism, and due to functional over-expression of one or
more polypeptide (sequences) of table II, e.g. encoded by the
corresponding nucleic acid molecules as depicted in table I, column
5 or 7, and/or homologs, in the organisms according to the
invention, advantageously in the transgenic plant according to the
invention or produced according to the method of the invention, at
least for the duration of at least one plant generation.
[1263] A constitutive expression of the polypeptide sequences of
table II, encoded by the corresponding nucleic acid molecule as
depicted in table I, column 5 or 7 and/or homologs is, moreover,
advantageous. On the other hand, however, an inducible expression
may also appear desirable. Expression of the polypeptide sequences
of the invention can be either direct to the cytoplasm or the
organelles, preferably the plastids of the host cells, preferably
the plant cells.
[1264] The efficiency of the expression of the sequences of the of
table II, encoded by the corresponding nucleic acid molecule as
depicted in table I, column 5 or 7 and/or homologs can be
determined, for example, in vitro by shoot meristem propagation. In
addition, an expression of the sequences of table II, encoded by
the corresponding nucleic acid molecule as depicted in table I,
column 5 or 7 and/or homologs modified in nature and level and its
effect on yield, e.g. on an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, but also on
the metabolic pathways performance can be tested on test plants in
greenhouse trials.
[1265] An additional object of the invention comprises transgenic
organisms such as transgenic plants transformed by an expression
cassette containing sequences of as depicted in table I, column 5
or 7 according to the invention or DNA sequences hybridizing
therewith, as well as transgenic cells, tissue, parts and
reproduction material of such plants. Particular preference is
given in this case to transgenic crop plants such as by way of
example barley, wheat, rye, oats, corn, soybean, rice, cotton,
sugar beet, oilseed rape and canola, sunflower, flax, hemp,
thistle, potatoes, tobacco, tomatoes, tapioca, cassava, arrowroot,
alfalfa, lettuce and the various tree, nut and vine species.
[1266] In one embodiment of the invention transgenic plants
transformed by an expression cassette containing or comprising
nucleic acid molecules or sequences as depicted in table I, column
5 or 7, in particular of table IIB, according to the invention or
DNA sequences hybridizing therewith are selected from the group
comprising corn, soy, oil seed rape (including canola and winter
oil seed rape), cotton, wheat and rice.
[1267] For the purposes of the invention plants are mono- and
dicotyledonous plants, mosses or algae, especially plants, for
example in one embodiment monocotyledonous plants, or for example
in another embodiment dicotyledonous plants. A further refinement
according to the invention are transgenic plants as described above
which contain a nucleic acid sequence or construct according to the
invention or a expression cassette according to the invention.
[1268] However, transgenic also means that the nucleic acids
according to the invention are located at their natural position in
the genome of an organism, but that the sequence, e.g. the coding
sequence or a regulatory sequence, for example the promoter
sequence, has been modified in comparison with the natural
sequence. Preferably, transgenic/recombinant is to be understood as
meaning the transcription of one or more nucleic acids or molecules
of the invention and being shown in table I, occurs at a
non-natural position in the genome. In one embodiment, the
expression of the nucleic acids or molecules is homologous. In
another embodiment, the expression of the nucleic acids or
molecules is heterologous. This expression can be transiently or of
a sequence integrated stably into the genome. The term "transgenic
plants" used in accordance with the invention also refers to the
progeny of a transgenic plant, for example the T1, T2, T3 and
subsequent plant generations or the BC1, BC2, BC3 and subsequent
plant generations. Thus, the transgenic plants according to the
invention can be raised and selfed or crossed with other
individuals in order to obtain further transgenic plants according
to the invention. Transgenic plants may also be obtained by
propagating transgenic plant cells vegetatively. The present
invention also relates to transgenic plant material, which can be
derived from a transgenic plant population according to the
invention. Such material includes plant cells and certain tissues,
organs and parts of plants in all their manifestations, such as
seeds, leaves, anthers, fibers, tubers, roots, root hairs, stems,
embryo, calli, cotelydons, petioles, harvested material, plant
tissue, reproductive tissue and cell cultures, which are derived
from the actual transgenic plant and/or can be used for bringing
about the transgenic plant. Any transformed plant obtained
according to the invention can be used in a conventional breeding
scheme or in in vitro plant propagation to produce more transformed
plants with the same characteristics and/or can be used to
introduce the same characteristic in other varieties of the same or
related species. Such plants are also part of the invention. Seeds
obtained from the transformed plants genetically also contain the
same characteristic and are part of the invention. As mentioned
before, the present invention is in principle applicable to any
plant and crop that can be transformed with any of the
transformation method known to those skilled in the art.
[1269] Advantageous inducible plant promoters are by way of example
the PRP1 promoter (Ward et al., Plant. Mol. Biol. 22361 (1993)), a
promoter inducible by benzenesulfonamide (EP 388 186), a promoter
inducible by tetracycline (Gatz et al., Plant J. 2, 397 (1992)), a
promoter inducible by salicylic acid (WO 95/19443), a promoter
inducible by abscisic acid
[1270] (EP 335 528) and a promoter inducible by ethanol or
cyclohexanone (WO 93/21334). Other examples of plant promoters
which can advantageously be used are the promoter of cytoplasmic
FBPase from potato, the ST-LSI promoter from potato (Stockhaus et
al., EMBO J. 8, 2445 (1989)), the promoter of phosphoribosyl
pyrophosphate amidotransferase from Glycine max (see also gene bank
accession number U87999) or a nodiene-specific promoter as
described in EP 249 676.
[1271] Particular advantageous are those promoters which ensure
expression upon onset of abiotic stress conditions. Particular
advantageous are those promoters which ensure expression upon onset
of low temperature conditions, e.g. at the onset of chilling and/or
freezing temperatures as defined hereinabove, e.g. for the
expression of nucleic acid molecules as shown in table VIII b.
Advantageous are those promoters which ensure expression upon
conditions of limited nutrient availability, e.g. the onset of
limited nitrogen sources in case the nitrogen of the soil or
nutrient is exhausted, e.g. for the expression of the nucleic acid
molecules or their gene products as shown in table VIIIa.
Particular advantageous are those promoters which ensure expression
upon onset of water deficiency, as defined hereinabove, e.g. for
the expression of the nucleic acid molecules or their gene products
as shown in table VIIIc. Particular advantageous are those
promoters which ensure expression upon onset of standard growth
conditions, e.g. under condition without stress and deficient
nutrient provision, e.g. for the expression of the nucleic acid
molecules or their gene products as shown in table VIIId.
[1272] Such promoters are known to the person skilled in the art or
can be isolated from genes which are induced under the conditions
mentioned above. In one embodiment, seed-specific promoters may be
used for monocotylodonous or dicotylodonous plants.
[1273] In principle all natural promoters with their regulation
sequences can be used like those named above for the expression
cassette according to the invention and the method according to the
invention. Over and above this, synthetic promoters may also
advantageously be used. In the preparation of an expression
cassette various DNA fragments can be manipulated in order to
obtain a nucleotide sequence, which usefully reads in the correct
direction and is equipped with a correct reading frame. To connect
the DNA fragments (=nucleic acids according to the invention) to
one another adaptors or linkers may be attached to the fragments.
The promoter and the terminator regions can usefully be provided in
the transcription direction with a linker or polylinker containing
one or more restriction points for the insertion of this sequence.
Generally, the linker has 1 to 10, mostly 1 to 8, preferably 2 to
6, restriction points. In general the size of the linker inside the
regulatory region is less than 100 bp, frequently less than 60 bp,
but at least 5 bp. The promoter may be both native or homologous as
well as foreign or heterologous to the host organism, for example
to the host plant. In the 5'-3' transcription direction the
expression cassette contains the promoter, a DNA sequence which
shown in table I and a region for transcription termination.
Different termination regions can be exchanged for one another in
any desired fashion.
[1274] As also used herein, the terms "nucleic acid" and "nucleic
acid molecule" are intended to include DNA molecules (e.g. cDNA or
genomic DNA) and RNA molecules (e.g. mRNA) and analogs of the DNA
or RNA generated using nucleotide analogs. This term also
encompasses untranslated sequence located at both the 3' and 5'
ends of the coding region of the gene--at least about 1000
nucleotides of sequence upstream from the 5' end of the coding
region and at least about 200 nucleotides of sequence downstream
from the 3' end of the coding region of the gene. The nucleic acid
molecule can be single-stranded or double-stranded, but preferably
is double-stranded DNA.
[1275] An "isolated" nucleic acid molecule is one that is
substantially separated from other nucleic acid molecules, which
are present in the natural source of the nucleic acid. That means
other nucleic acid molecules are present in an amount less than 5%
based on weight of the amount of the desired nucleic acid,
preferably less than 2% by weight, more preferably less than 1% by
weight, most preferably less than 0.5% by weight. Preferably, an
"isolated" nucleic acid is free of some of the sequences that
naturally flank the nucleic acid (i.e., sequences located at the 5'
and 3' ends of the nucleic acid) in the genomic DNA of the organism
from which the nucleic acid is derived. For example, in various
embodiments, the isolated yield increasing, for example, low
temperature resistance and/or tolerance related protein (LTRRP or
YRP) encoding nucleic acid molecule can contain less than about 5
kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide
sequences which naturally flank the nucleic acid molecule in
genomic DNA of the cell from which the nucleic acid is derived.
Moreover, an "isolated" nucleic acid molecule, such as a cDNA
molecule, can be free from some of the other cellular material with
which it is naturally associated, or culture medium when produced
by recombinant techniques, or chemical precursors or other
chemicals when chemically synthesized.
[1276] A nucleic acid molecule of the present invention, e.g., a
nucleic acid molecule encoding an LTRRP or YRP or a portion thereof
which confers increased yield, e.g. an increased yield-related
trait, e.g. an enhanced tolerance to abiotic environmental stress
and/or increased nutrient use efficiency and/or enhanced cycling
drought tolerance in plants, can be isolated using standard
molecular biological techniques and the sequence information
provided herein. For example, an A. thaliana LTRRP or YRP encoding
cDNA can be isolated from a A. thaliana c-DNA library or a
Synechocystis sp., A. thaliana, Brassica napus, Glycine max, Zea
mays or Oryza sativa, LTRRP or YRP encoding cDNA can be isolated
from a Synechocystis sp., A. thaliana, Brassica napus, Glycine max,
Zea mays or Oryza sativa, c-DNA library respectively using all or
portion of one of the sequences shown in table I. Moreover, a
nucleic acid molecule encompassing all or a portion of one of the
sequences of table I can be isolated by the polymerase chain
reaction using oligonucleotide primers designed based upon this
sequence. For example, mRNA can be isolated from plant cells (e.g.,
by the guanidinium-thiocyanate extraction procedure of Chirgwin et
al., Biochemistry 18, 5294 (1979)) and cDNA can be prepared using
reverse transcriptase (e.g., Moloney MLV reverse transcriptase,
available from Gibco/BRL, Bethesda, Md.; or AMV reverse
transcriptase, available from Seikagaku America, Inc.,
[1277] St. Petersburg, Fla.). Synthetic oligonucleotide primers for
polymerase chain reaction amplification can be designed based upon
one of the nucleotide sequences shown in table I. A nucleic acid
molecule of the invention can be amplified using cDNA or,
alternatively, genomic DNA, as a template and appropriate
oligonucleotide primers according to standard PCR amplification
techniques. The nucleic acid molecule so amplified can be cloned
into an appropriate vector and characterized by DNA sequence
analysis. Furthermore, oligonucleotides corresponding to a LTRRP or
YRP encoding nucleotide sequence can be prepared by standard
synthetic techniques, e.g., using an automated DNA synthesizer. In
a embodiment, an isolated nucleic acid molecule of the invention
comprises one of the nucleotide sequences or molecules as shown in
table I encoding the LTRRP or YRP (i.e., the "coding region"), as
well as a 5' untranslated sequence and 3' untranslated sequence.
Moreover, the nucleic acid molecule of the invention can comprise
only a portion of the coding region of one of the sequences or
molecules of a nucleic acid of table I, for example, a fragment
which can be used as a probe or primer or a fragment encoding a
biologically active portion of a LTRRP or YRP.
[1278] Portions of proteins encoded by the LTRRP or YRP encoding
nucleic acid molecules of the invention are preferably biologically
active portions described herein. As used herein, the term
"biologically active portion of" a LTRRP or YRP is intended to
include a portion, e.g. a domain/motif, of increased yield, e.g.
increased or enhanced an yield related trait, e.g. increased the
low temperature resistance and/or tolerance related protein that
participates in an enhanced nutrient use efficiency e.g. NUE
efficiency, and/or increased intrinsic yield in a plant. To
determine whether a LTRRP or YRP, or a biologically active portion
thereof, results in an increased yield, e.g. increased or enhanced
an yield related trait, e.g. increased the low temperature
resistance and/or tolerance related protein that participates in an
enhanced nutrient use efficiency, e.g. NUE efficiency and/or
increased intrinsic yield in a plant, an analysis of a plant
comprising the LTRRP or YRP may be performed. Such analysis methods
are well known to those skilled in the art, as detailed in the
Examples. More specifically, nucleic acid fragments encoding
biologically active portions of a LTRRP or YRP can be prepared by
isolating a portion of one of the sequences of the nucleic acid of
table I expressing the encoded portion of the LTRRP or YRP or
peptide (e.g., by recombinant expression in vitro) and assessing
the activity of the encoded portion of the LTRRP or YRP or peptide.
Biologically active portions of a LTRRP or YRP are encompassed by
the present invention and include peptides comprising amino acid
sequences derived from the amino acid sequence of a LTRRP or YRP
encoding gene, or the amino acid sequence of a protein homologous
to a LTRRP or YRP, which include fewer amino acids than a full
length LTRRP or YRP or the full length protein which is homologous
to a LTRRP or YRP, and exhibits at least some enzymatic or
biological activity of a LTRRP or YRP. Typically, biologically
active portions (e.g., peptides which are, for example, 5, 10, 15,
20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino acids in
length) comprise a domain or motif with at least one activity of a
LTRRP or YRP. Moreover, other biologically active portions in which
other regions of the protein are deleted, can be prepared by
recombinant techniques and evaluated for one or more of the
activities described herein. Preferably, the biologically active
portions of a LTRRP or YRP include one or more selected
domains/motifs or portions thereof having biological activity.
[1279] The term "biological active portion" or "biological
activity" means a polypeptide as depicted in table II, column 3 or
a portion of said polypeptide which still has at least 10% or 20%,
preferably 30%, 40%, 50% or 60%, especially preferably 70%, 75%,
80%, 90% or 95% of the enzymatic or biological activity of the
natural or starting enzyme or protein.
[1280] [0134.1.1.1] In the process according to the invention
nucleic acid sequences or molecules can be used, which, if
appropriate, contain synthetic, non-natural or modified nucleotide
bases, which can be incorporated into DNA or RNA. Said synthetic,
non-natural or modified bases can for example increase the
stability of the nucleic acid molecule outside or inside a cell.
The nucleic acid molecules of the invention can contain the same
modifications as aforementioned.
[1281] As used in the present context the term "nucleic acid
molecule" may also encompass the untranslated sequence or molecule
located at the 3' and at the 5' end of the coding gene region, for
example at least 500, preferably 200, especially preferably 100,
nucleotides of the sequence upstream of the 5' end of the coding
region and at least 100, preferably 50, especially preferably 20,
nucleotides of the sequence downstream of the 3' end of the coding
gene region. It is often advantageous only to choose the coding
region for cloning and expression purposes.
[1282] Preferably, the nucleic acid molecule used in the process
according to the invention or the nucleic acid molecule of the
invention is an isolated nucleic acid molecule. In one embodiment,
the nucleic acid molecule of the invention is the nucleic acid
molecule used in the process of the invention.
[1283] An "isolated" polynucleotide or nucleic acid molecule is
separated from other polynucleotides or nucleic acid molecules,
which are present in the natural source of the nucleic acid
molecule. An isolated nucleic acid molecule may be a chromosomal
fragment of several kb, or preferably, a molecule only comprising
the coding region of the gene. Accordingly, an isolated nucleic
acid molecule of the invention may comprise chromosomal regions,
which are adjacent 5' and 3' or further adjacent chromosomal
regions, but preferably comprises no such sequences which naturally
flank the nucleic acid molecule sequence in the genomic or
chromosomal context in the organism from which the nucleic acid
molecule originates (for example sequences which are adjacent to
the regions encoding the 5'- and 3'-UTRs of the nucleic acid
molecule). In various embodiments, the isolated nucleic acid
molecule used in the process according to the invention may, for
example comprise less than approximately 5 kb, 4 kb, 3 kb, 2 kb, 1
kb, 0.5 kb or 0.1 kb nucleotide sequences which naturally flank the
nucleic acid molecule in the genomic DNA of the cell from which the
nucleic acid molecule originates.
[1284] The nucleic acid molecules used in the process, for example
the polynucleotide of the invention or of a part thereof can be
isolated using molecular-biological standard techniques and the
sequence information provided herein. Also, for example a
homologous sequence or homologous, conserved sequence regions at
the DNA or amino acid level can be identified with the aid of
comparison algorithms. The former can be used as hybridization
probes under standard hybridization techniques (for example those
described in Sambrook et al., Molecular Cloning: A Laboratory
Manual. 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989) for isolating
further nucleic acid sequences useful in this process.
[1285] A nucleic acid molecule encompassing a complete sequence of
the nucleic acid molecules used in the process, for example the
polynucleotide of the invention, or a part thereof may additionally
be isolated by polymerase chain reaction, oligonucleotide primers
based on this sequence or on parts thereof being used. For example,
a nucleic acid molecule comprising the complete sequence or part
thereof can be isolated by polymerase chain reaction using
oligonucleotide primers which have been generated on the basis of
this very sequence. For example, mRNA can be isolated from cells
(for example by means of the guanidinium thiocyanate extraction
method of Chirgwin et al., Biochemistry 18, 5294 (1979)) and cDNA
can be generated by means of reverse transcriptase (for example
Moloney, MLV reverse transcriptase, available from Gibco/BRL,
Bethesda, Md., or AMV reverse transcriptase, obtainable from
Seikagaku America, Inc., St. Petersburg, Fla.).
[1286] Synthetic oligonucleotide primers for the amplification,
e.g. as shown in table III, column 7, by means of polymerase chain
reaction can be generated on the basis of a sequence shown herein,
for example the sequence shown in table I, columns 5 and 7 or the
sequences derived from table II, columns 5 and 7.
[1287] Moreover, it is possible to identify a conserved protein by
carrying out protein sequence alignments with the polypeptide
encoded by the nucleic acid molecules of the present invention, in
particular with the sequences encoded by the nucleic acid molecule
shown in column 5 or 7 of table I, from which conserved regions,
and in turn, degenerate primers can be derived. Conserved regions
are those, which show a very little variation in the amino acid in
one particular position of several homologs from different origin.
The consensus sequence and polypeptide motifs shown in column 7 of
table IV, are derived from said alignments. Moreover, it is
possible to identify conserved regions from various organisms by
carrying out protein sequence alignments with the polypeptide
encoded by the nucleic acid of the present invention, in particular
with the sequences encoded by the polypeptide molecule shown in
column 5 or 7 of table II, from which conserved regions, and in
turn, degenerate primers can be derived. In one advantageous
embodiment, in the method of the present invention the activity of
a polypeptide comprising or consisting of a consensus sequence or a
polypeptide motif shown in table
[1288] IV, column 7 is increased and in one another embodiment, the
present invention relates to a polypeptide comprising or consisting
of a consensus sequence or a polypeptide motif shown in table IV,
column 7 whereby less than 20, preferably less than 15 or 10,
preferably less than 9, 8, 7, or 6, more preferred less than 5 or
4, even more preferred less then 3, even more preferred less then
2, even more preferred 0 of the amino acids positions indicated can
be replaced by any amino acid. In one embodiment not more than 15%,
preferably 10%, even more preferred 5%, 4%, 3%, or 2%, most
preferred 1% or 0% of the amino acid position indicated by a letter
are/is replaced another amino acid. In one embodiment less than 20,
preferably less than 15 or 10, preferably less than 9, 8, 7, or 6,
more preferred less than 5 or 4, even more preferred less than 3,
even more preferred less than 2, even more preferred 0 amino acids
are inserted into a consensus sequence or protein motif.
[1289] The consensus sequence was derived from a multiple alignment
of the sequences as listed in table II. The letters represent the
one letter amino acid code and indicate that the amino acids are
conserved in at least 80% of the aligned proteins, whereas the
letter X stands for amino acids, which are not conserved in at
least 80% of the aligned sequences. The consensus sequence starts
with the first conserved amino acid in the alignment, and ends with
the last conserved amino acid in the alignment of the investigated
sequences. The number of given X indicates the distances between
conserved amino acid residues, e.g. Y-x(21,23)--F means that
conserved tyrosine and phenylalanine residues in the alignment are
separated from each other by minimum 21 and maximum 23 amino acid
residues in the alignment of all investigated sequences.
[1290] Conserved domains were identified from all sequences and are
described using a subset of the standard Prosite notation, e.g. the
pattern Y-x(21,23)-[FW] means that a conserved tyrosine is
separated by minimum 21 and maximum 23 amino acid residues from
either a phenylalanine or tryptophane. Patterns had to match at
least 80% of the investigated proteins. Conserved patterns were
identified with the software tool MEME version 3.5.1 or manually.
MEME was developed by Timothy L. Bailey and Charles Elkan, Dept. of
Computer Science and Engeneering, University of California, San
Diego, USA and is described by Timothy L. Bailey and Charles Elkan
(Fitting a mixture model by expectation maximization to discover
motifs in biopolymers, Proceedings of the Second International
Conference on Intelligent Systems for Molecular Biology, pp. 28-36,
AAAI Press, Menlo Park, Calif., 1994). The source code for the
stand-alone program is public available from the San Diego
Supercomputer centre (meme.sdsc.edu). For identifying common motifs
in all sequences with the software tool MEME, the following
settings were used:-maxsize 500000, -nmotifs 15, -evt 0.001, -nnaxw
60, -distance 1e-3, -minsites number of sequences used for the
analysis. Input sequences for MEME were non-aligned sequences in
Fasta format. Other parameters were used in the default settings in
this software version. Prosite patterns for conserved domains were
generated with the software tool Pratt version 2.1 or manually.
Pratt was developed by Inge Jonassen, Dept. of Informatics,
University of Bergen, Norway and is described by Jonassen et al.
(I. Jonassen, J. F. Collins and D. G. Higgins, Finding flexible
patterns in unaligned protein sequences, Protein Science 4 (1995),
pp. 1587-1595; I. Jonassen, Efficient discovery of conserved
patterns using a pattern graph, Submitted to CABIOS Febr. 1997].
The source code (ANSI C) for the stand-alone program is public
available, e.g. at establisched Bioinformatic centers like EBI
(European Bioinformatics Institute). For generating patterns with
the software tool Pratt, following settings were used: PL (max
Pattern Length): 100, PN (max Nr of Pattern Symbols): 100, PX (max
Nr of consecutive x's): 30, FN (max Nr of flexible spacers): 5, FL
(max Flexibility): 30, FP (max Flex.Product): 10, ON (max number
patterns): 50. Input sequences for Pratt were distinct regions of
the protein sequences exhibiting high similarity as identified from
software tool MEME. The minimum number of sequences, which have to
match the generated patterns (CM, min Nr of Seqs to Match) was set
to at least 80% of the provided sequences. Parameters not mentioned
here were used in their default settings. The Prosite patterns of
the conserved domains can be used to search for protein sequences
matching this pattern. Various established Bioinformatic centres
provide public internet portals for using those patterns in
database searches (e.g. PIR (Protein Information Re-- source,
located at Georgetown University Medical Center) or ExPASy (Expert
Protein Analysis System)). Alternatively, stand-alone software is
available, like the program Fuzzpro, which is part of the EMBOSS
software package. For example, the program Fuzzpro not only allows
to search for an exact pattern-protein match but also allows to set
various ambiguities in the performed search.
[1291] The alignment was performed with the software ClustalW
(version 1.83) and is described by Thompson et al. (Nucleic Acids
Research 22, 4673 (1994)). The source code for the stand-alone
program is public available from the European Molecular Biology
Laboratory; Heidelberg, Germany. The analysis was performed using
the default parameters of ClustalW v1.83 (gap open penalty: 10.0;
gap extension penalty: 0.2; protein matrix: Gonnet; protein/DNA
endgap: -1; protein/DNA gapdist: 4).
[1292] Degenerated primers can then be utilized by PCR for the
amplification of fragments of novel proteins having above-mentioned
activity, e.g. conferring increased yield, e.g. the increased
yield-related trait, in particular, the enhanced tolerance to
abiotic environmental stress, e.g. low temperature tolerance,
cycling drought tolerance, water use efficiency, nutrient (e.g.
nitrogen) use efficiency and/or increased intrinsic yield as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, plant or part thereof after increasing the expression or
activity or having the activity of a protein as shown in table II,
column 3 or further functional homologs of the polypeptide of the
invention from other organisms.
[1293] These fragments can then be utilized as hybridization probe
for isolating the complete gene sequence. As an alternative, the
missing 5' and 3' sequences can be isolated by means of RACE-PCR. A
nucleic acid molecule according to the invention can be amplified
using cDNA or, as an alternative, genomic DNA as template and
suitable oligonucleotide primers, following standard PCR
amplification techniques. The nucleic acid molecule amplified thus
can be cloned into a suitable vector and characterized by means of
DNA sequence analysis. Oligonucleotides, which correspond to one of
the nucleic acid molecules used in the process can be generated by
standard synthesis methods, for example using an automatic DNA
synthesizer.
[1294] Nucleic acid molecules which are advantageously for the
process according to the invention can be isolated based on their
homology to the nucleic acid molecules disclosed herein using the
sequences or part thereof as or for the generation of a
hybridization probe and following standard hybridization techniques
under stringent hybridization conditions. In this context, it is
possible to use, for example, isolated one or more nucleic acid
molecules of at least 15, 20, 25, 30, 35, 40, 50, 60 or more
nucleotides, preferably of at least 15, 20 or 25 nucleotides in
length which hybridize under stringent conditions with the
above-described nucleic acid molecules, in particular with those
which encompass a nucleotide sequence of the nucleic acid molecule
used in the process of the invention or encoding a protein used in
the invention or of the nucleic acid molecule of the invention.
Nucleic acid molecules with 30, 50, 100, 250 or more nucleotides
may also be used.
[1295] The term "homology" means that the respective nucleic acid
molecules or encoded proteins are functionally and/or structurally
equivalent. The nucleic acid molecules that are homologous to the
nucleic acid molecules described above and that are derivatives of
said nucleic acid molecules are, for example, variations of said
nucleic acid molecules which represent modifications having the
same biological function, in particular encoding proteins with the
same or substantially the same biological function. They may be
naturally occurring variations, such as sequences from other plant
varieties or species, or mutations. These mutations may occur
naturally or may be obtained by mutagenesis techniques. The allelic
variations may be naturally occurring allelic variants as well as
synthetically produced or genetically engineered variants.
Structurally equivalents can, for example, be identified by testing
the binding of said polypeptide to antibodies or computer based
predictions. Structurally equivalent have the similar immunological
characteristic, e.g. comprise similar epitopes.
[1296] By "hybridizing" it is meant that such nucleic acid
molecules hybridize under conventional hybridization conditions,
preferably under stringent conditions such as described by, e.g.,
Sambrook (Molecular Cloning; A Laboratory Manual, 2.sup.nd Edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989)) or in Current Protocols in Molecular Biology, John Wiley
& Sons, N.Y. (1989), 6.3.1-6.3.6.
[1297] According to the invention, DNA as well as RNA molecules of
the nucleic acid of the invention can be used as probes. Further,
as template for the identification of functional homologues
Northern blot assays as well as Southern blot assays can be
performed. The
[1298] Northern blot assay advantageously provides further
information about the expressed gene product: e.g. expression
pattern, occurrence of processing steps, like splicing and capping,
etc. The Southern blot assay provides additional information about
the chromosomal localization and organization of the gene encoding
the nucleic acid molecule of the invention.
[1299] A preferred, non-limiting example of stringent hybridization
conditions are hybridizations in 6.times. sodium chloride/sodium
citrate (.dbd.SSC) at approximately 45.degree. C., followed by one
or more wash steps in 0.2.times.SSC, 0.1% SDS at 50 to 65.degree.
C., for example at 50.degree. C., 55.degree. C. or 60.degree. C.
The skilled worker knows that these hybridization conditions differ
as a function of the type of the nucleic acid and, for example when
organic solvents are present, with regard to the temperature and
concentration of the buffer. The temperature under "standard
hybridization conditions" differs for example as a function of the
type of the nucleic acid between 42.degree. C. and 58.degree. C.,
preferably between 45.degree. C. and 50.degree. C. in an aqueous
buffer with a concentration of 0.1.times., 0.5 x, 1.times.,
2.times., 3.times., 4.times. or 5.times.SSC (pH 7.2). If organic
solvent(s) is/are present in the above-mentioned buffer, for
example 50% formamide, the temperature under standard conditions is
approximately 40.degree. C., 42.degree. C. or 45.degree. C. The
hybridization conditions for DNA:DNA hybrids are preferably for
example 0.1.times.SSC and 20.degree. C., 25.degree. C., 30.degree.
C., 35.degree. C., 40.degree. C. or 45.degree. C., preferably
between 30.degree. C. and 45.degree. C. The hybridization
conditions for DNA:RNA hybrids are preferably for example
0.1.times.SSC and 30.degree. C., 35.degree. C., 40.degree. C.,
45.degree. C., 50.degree. C. or 55.degree. C., preferably between
45.degree. C. and 55.degree. C. The abovementioned hybridization
temperatures are determined for example for a nucleic acid
approximately 100 bp (=base pairs) in length and a G+C content of
50% in the absence of formamide. The skilled worker knows to
determine the hybridization conditions required with the aid of
textbooks, for example the ones mentioned above, or from the
following textbooks: Sambrook et al., "Molecular Cloning", Cold
Spring Harbor Laboratory, 1989; Hames and Higgins
[1300] (Ed.) 1985, "Nucleic Acids Hybridization: A Practical
Approach", IRL Press at Oxford University Press, Oxford; Brown
(Ed.) 1991, "Essential Molecular Biology: A Practical Approach",
IRL Press at Oxford University Press, Oxford.
[1301] A further example of one such stringent hybridization
condition is hybridization at 4.times.SSC at 65.degree. C.,
followed by a washing in 0.1.times.SSC at 65.degree. C. for one
hour. Alternatively, an exemplary stringent hybridization condition
is in 50% formamide, 4.times.SSC at 42.degree. C. Further, the
conditions during the wash step can be selected from the range of
conditions delimited by low-stringency conditions (approximately
2.times.SSC at 50.degree. C.) and high-stringency conditions
(approxinnately 0.2.times.SSC at 50.degree. C., preferably at
65.degree. C.) (20.times.SSC: 0.3 M sodium citrate, 3 M NaCl, pH
7.0). In addition, the temperature during the wash step can be
raised from low-stringency conditions at room temperature,
approximately 22.degree. C., to higher-stringency conditions at
approximately 65.degree. C. Both of the parameters salt
concentration and temperature can be varied simultaneously, or else
one of the two parameters can be kept constant while only the other
is varied. Denaturants, for example formamide or SDS, may also be
employed during the hybridization. In the presence of 50%
formamide, hybridization is preferably effected at 42.degree. C.
Relevant factors like 1) length of treatment, 2) salt conditions,
3) detergent conditions, 4) competitor DNAs, 5) temperature Zand 6)
probe selection can be combined case by case so that not all
possibilities can be mentioned herein.
Thus, in a preferred embodiment, Northern blots are prehybridized
with Rothi-Hybri-Quick buffer (Roth, Karlsruhe) at 68.degree. C.
for 2 h. Hybridization with radioactive labelled probe is done
overnight at 68.degree. C. Subsequent washing steps are performed
at 68.degree. C. with 1.times.SSC. For Southern blot assays the
membrane is prehybridized with Rothi-Hybri-Quick buffer (Roth,
Karlsruhe) at 68.degree. C. for 2 h. The hybridzation with
radioactive labelled probe is conducted over night at 68.degree. C.
Subsequently the hybridization buffer is discarded and the filter
shortly washed using 2.times.SSC; 0.1% SDS. After discarding the
washing buffer new 2.times.SSC; 0.1% SDS buffer is added and
incubated at 68.degree. C. for 15 minutes. This washing step is
performed twice followed by an additional washing step using
1.times.SSC; 0.1% SDS at 68.degree. C. for 10 min.
[1302] Some examples of conditions for DNA hybridization (Southern
blot assays) and wash step are shown herein below:
[1303] (1) Hybridization conditions can be selected, for example,
from the following conditions: [1304] (a) 4.times.SSC at 65.degree.
C., [1305] (b) 6.times.SSC at 45.degree. C., [1306] (c)
6.times.SSC, 100 mg/ml denatured fragmented fish sperm DNA at
68.degree. C., [1307] (d) 6.times.SSC, 0.5% SDS, 100 mg/ml
denatured salmon sperm DNA at 68.degree. C., [1308] (e)
6.times.SSC, 0.5% SDS, 100 mg/ml denatured fragmented salmon sperm
DNA, 50% form amide at 42.degree. C., [1309] (f) 50% formamide,
4.times.SSC at 42.degree. C., [1310] (g) 50% (v/v) formamide, 0.1%
bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM
sodium phosphate buffer pH 6.5, 750 mM NaCl, 75 mM sodium citrate
at 42.degree. C., [1311] (h) 2.times. or 4.times.SSC at 50.degree.
C. (low-stringency condition), or [1312] (i) 30 to 40% formamide,
2.times. or 4.times.SSC at 42.degree. C. (low-stringency
condition).
[1313] (2) Wash steps can be selected, for example, from the
following conditions:
(a) 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at 50.degree.
C.
(b) 0.1.times.SSC at 65.degree. C.
(c) 0.1.times.SSC, 0.5% SDS at 68.degree. C.
[1314] (d) 0.1.times.SSC, 0.5% SDS, 50% formamide at 42.degree.
C.
(e) 0.2.times.SSC, 0.1% SDS at 42.degree. C.
[1315] (f) 2.times.SSC at 65.degree. C. (low-stringency
condition).
[1316] Polypeptides having above-mentioned activity, i.e.
conferring increased yield, e.g. an increased yield-related trait
as mentioned herein, e.g. increased abiotic stress tolerance, e.g.
low temperature tolerance, e.g. with increased nutrient use
efficiency, and/or water use efficiency and/or increased intrinsic
yield as compared to a corresponding, e.g. non-transformed, wild
type plant cell, plant or part thereof, derived from other
organisms, can be encoded by other DNA sequences which hybridize to
the sequences shown in table I, columns 5 and 7 under relaxed
hybridization conditions and which code on expression for peptides
conferring the increased yield, e.g. an increased yield-related
trait as mentioned herein, e.g. increased abiotic stress tolerance,
e.g. low temperature tolerance or enhanced cold tolerance, e.g.
with increased nutrient use efficiency, and/or water use efficiency
and/or increased intrinsic yield, as compared to a corresponding,
e.g. non-transformed, wild type plant cell, plant or part
thereof.
[1317] Further, some applications have to be performed at low
stringency hybridization conditions, without any consequences for
the specificity of the hybridization. For example, a Southern blot
analysis of total DNA could be probed with a nucleic acid molecule
of the present invention and washed at low stringency (55.degree.
C. in 2.times.SSPE, 0.1% SDS). The hybridization analysis could
reveal a simple pattern of only genes encoding polypeptides of the
present invention or used in the process of the invention, e.g.
having the herein-mentioned activity of enhancing the increased
yield, e.g. an increased yield-related trait as mentioned herein,
e.g. increased abiotic stress tolerance, e.g. increased low
temperature tolerance or enhanced cold tolerance, e.g. with
increased nutrient use efficiency, and/or water use efficiency
and/or increased intrinsic yield, as compared to a corresponding,
e.g. non-transformed, wild type plant cell, plant or part thereof.
A further example of such low-stringent hybridization conditions is
4.times.SSC at 50.degree. C. or hybridization with 30 to 40%
formamide at 42.degree. C. Such molecules comprise those which are
fragments, analogues or derivatives of the polypeptide of the
invention or used in the process of the invention and differ, for
example, by way of amino acid and/or nucleotide deletion(s),
insertion(s), substitution (s), addition(s) and/or recombination
(s) or any other modification(s) known in the art either alone or
in combination from the above-described amino acid sequences or
their underlying nucleotide sequence(s). However, it is preferred
to use high stringency hybridization conditions.
[1318] Hybridization should advantageously be carried out with
fragments of at least 5, 10, 15, 20, 25, 30, 35 or 40 bp,
advantageously at least 50, 60, 70 or 80 bp, preferably at least
90, 100 or 110 bp. Most preferably are fragments of at least 15,
20, 25 or 30 bp. Preferably are also hybridizations with at least
100 bp or 200, very especially preferably at least 400 bp in
length. In an especially preferred embodiment, the hybridization
should be carried out with the entire nucleic acid sequence with
conditions described above.
[1319] The terms "fragment", "fragment of a sequence" or "part of a
sequence" mean a truncated sequence of the original sequence
referred to. The truncated sequence (nucleic acid or protein
sequence) can vary widely in length; the minimum size being a
sequence of sufficient size to provide a sequence with at least a
comparable function and/or activity of the original sequence or
molecule referred to or hybridizing with the nucleic acid molecule
of the invention or used in the process of the invention under
stringent conditions, while the maximum size is not critical. In
some applications, the maximum size usually is not substantially
greater than that required to provide the desired activity and/or
function(s) of the original sequence.
[1320] Typically, the truncated amino acid sequence or molecule
will range from about 5 to about 310 amino acids in length. More
typically, however, the sequence will be a maximum of about 250
amino acids in length, preferably a maximum of about 200 or 100
amino acids. It is usually desirable to select sequences of at
least about 10, 12 or 15 amino acids, up to a maximum of about 20
or 25 amino acids.
[1321] The term "epitope" relates to specific immunoreactive sites
within an antigen, also known as antigenic determinates. These
epitopes can be a linear array of monomers in a polymeric
composition--such as amino acids in a protein--or consist of or
comprise a more complex secondary or tertiary structure. Those of
skill will recognize that immunogens (i.e., substances capable of
eliciting an immune response) are antigens; however, some antigen,
such as haptens, are not immunogens but may be made immunogenic by
coupling to a carrier molecute. The term "antigen" includes
references to a substance to which an antibody can be generated
and/or to which the antibody is specifically immunoreactive.
[1322] [0157.1.1.1] In one embodiment the present invention relates
to a epitope of the polypeptide of the present invention or used in
the process of the present invention and confers an increased
yield, e.g. an increased yield-related trait as mentioned herein,
e.g. increased abiotic stress tolerance, e.g. low temperature
tolerance or enhanced cold tolerance, e.g. with increased nutrient
use efficiency, and/or water use efficiency and/or increased
intrinsic yield etc., as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof.
[1323] The term "one or several amino acids" relates to at least
one amino acid but not more than that number of amino acids, which
would result in a homology of below 50% identity. Preferably, the
identity is more than 70% or 80%, more preferred are 85%, 90%, 91%,
92%, 93%, 94% or 95%, even more preferred are 96%, 97%, 98%, or 99%
identity.
[1324] Further, the nucleic acid molecule of the invention
comprises a nucleic acid molecule, which is a complement of one of
the nucleotide sequences of above mentioned nucleic acid molecules
or a portion thereof. A nucleic acid molecule or its sequence which
is complementary to one of the nucleotide molecules or sequences
shown in table I, columns 5 and 7 is one which is sufficiently
complementary to one of the nucleotide molecules or sequences shown
in table I, columns 5 and 7 such that it can hybridize to one of
the nucleotide sequences shown in table I, columns 5 and 7, thereby
forming a stable duplex. Preferably, the hybridization is performed
under stringent hybrization conditions. However, a complement of
one of the herein disclosed sequences is preferably a sequence
complement thereto according to the base pairing of nucleic acid
molecules well known to the skilled person. For example, the bases
A and G undergo base pairing with the bases T and U or C, resp. and
visa versa. Modifications of the bases can influence the
base-pairing partner.
[1325] The nucleic acid molecule of the invention comprises a
nucleotide sequence which is at least about 30%, 35%, 40% or 45%,
preferably at least about 50%, 55%, 60% or 65%, more preferably at
least about 70%, 80%, or 90%, and even more preferably at least
about 95%, 97%, 98%, 99% or more homologous to a nucleotide
sequence shown in table I, columns 5 and 7, or a portion thereof
and preferably has above mentioned activity, in particular having a
increasing-yield activity, e.g. increasing an yield-related trait,
for example enhancing tolerance to abiotic environmental stress,
for example increasing drought tolerance and/or low temperature
tolerance and/or increasing nutrient use efficiency, increased
intrinsic yield and/or another mentioned yield-related trait after
increasing the activity or an activity of a gene as shown in table
I or of a gene product, e.g. as shown in table II, column 3, by for
example expression either in the cytsol or cytoplasm or in an
organelle such as a plastid or mitochondria or both, preferably in
plastids.
[1326] In one embodiment, the nucleic acid molecules marked in
table I, column 6 with "plastidic" or gene products encoded by said
nucleic acid molecules are expressed in combination with a
targeting signal as described herein.
[1327] The nucleic acid molecule of the invention comprises a
nucleotide sequence or molecule which hybridizes, preferably
hybridizes under stringent conditions as defined herein, to one of
the nucleotide sequences or molecule shown in table I, columns 5
and 7, or a portion thereof and encodes a protein having
above-mentioned activity, e.g. conferring an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, increased intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof by for
example expression either in the cytsol or in an organelle such as
a plastid or mitochondria or both, preferably in plastids, and
optionally, the activity selected from the group consisting of
(DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein.
[1328] Moreover, the nucleic acid molecule of the invention can
comprise only a portion of the coding region of one of the
sequences shown in table I, columns 5 and 7, for example a fragment
which can be used as a probe or primer or a fragment encoding a
biologically active portion of the polypeptide of the present
invention or of a polypeptide used in the process of the present
invention, i.e. having above-mentioned activity, e.g. conferring an
increased yield, e.g. with an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, increased
intrinsic yield and/or another mentioned yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, plant or part thereof f its activity is increased by for
example expression either in the cytsol or in an or ganelle such as
a plastid or mitochondria or both, preferably in plastids. The
nucleotide sequences determined from the cloning of the present
protein-according-to-the-invention-encoding gene allows for the
generation of probes and primers designed for use in identifying
and/or cloning its homologues in other cell types and organisms.
The probe/primer typically comprises substantially purified
oligonucleotide. The oligonucleotide typically comprises a region
of nucleotide sequence that hybridizes under stringent conditions
to at least about 12, 15 preferably about 20 or 25, more preferably
about 40, 50 or 75 consecutive nucleotides of a sense strand of one
of the sequences set forth, e.g., in table I, columns 5 and 7, an
anti-sense sequence of one of the sequences, e.g., set forth in
table I, columns 5 and 7, or naturally occurring mutants thereof.
Primers based on a nucleotide of invention can be used in PCR
reactions to clone homologues of the polypeptide of the invention
or of the polypeptide used in the process of the invention, e.g. as
the primers described in the examples of the present invention,
e.g. as shown in the exampies. A PCR with the primers shown in
table Ill, column 7 will result in a fragment of the gene product
as shown in table II, column 3.
[1329] Primer sets are interchangeable. The person skilled in the
art knows to combine said primers to result in the desired product,
e.g. in a full length clone or a partial sequence. Probes based on
the sequences of the nucleic acid molecule of the invention or used
in the process of the present invention can be used to detect
transcripts or genomic sequences encoding the same or homologous
proteins. The probe can further comprise a label group attached
thereto, e.g. the label group can be a radioisotope, a fluorescent
compound, an enzyme, or an enzyme co-factor. Such probes can be
used as a part of a genomic marker test kit for identifying cells
which express an polypeptide of the invention or used in the
process of the present invention, such as by measuring a level of
an encoding nucleic acid molecule in a sample of cells, e.g.,
detecting mRNA levels or determining, whether a genomic gene
comprising the sequence of the polynucleotide of the invention or
used in the processes of the present invention has been mutated or
deleted.
[1330] The nucleic acid molecule of the invention encodes a
polypeptide or portion thereof which includes an amino acid
sequence which is sufficiently homologous to the amino acid
sequence shown in table II, columns 5 and 7 such that the protein
or portion thereof maintains the ability to participate in
increasing yield, e.g. increasing a yield-related trait, for
example enhancing tolerance to abiotic environmental stress, for
example increasing drought tolerance and/or low temperature
tolerance and/or increasing nutrient use efficiency, increasing
intrinsic yield and/or another mentioned yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, plant or part thereof, in particular increasing the activity
as mentioned above or as described in the examples in plants is
comprised.
[1331] As used herein, the language "sufficiently homologous"
refers to proteins or portions thereof which have amino acid
sequences which include a minimum number of identical or equivalent
amino acid residues (e.g., an amino acid residue which has a
similar side chain as an amino acid residue in one of the sequences
of the polypeptide of the present invention) to an amino acid
sequence shown in table II, columns 5 and 7 such that the protein
or portion thereof is able to participate in increasing yield, e.g.
increasing a yield-related trait, for example enhancing tolerance
to abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, increasing intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof. For
examples having the activity of a protein as shown in table II,
column 3 and as described herein.
[1332] In one embodiment, the nucleic acid molecule of the present
invention comprises a nucleic acid that encodes a portion of the
protein of the present invention. The protein is at least about
30%, 35%, 40%, 45% or 50%, preferably at least about 55%, 60%, 65%
or 70%, and more preferably at least about 75%, 80%, 85%, 90%, 91%,
92%, 93% or 94% and most preferably at least about 95%, 97%, 98%,
99% or more homologous to an entire amino acid sequence of table
II, columns 5 and 7 and having above-mentioned activity, e.g.
conferring an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, plant or part thereof by for example expression either in the
cytsol or in an organelle such as a plastid or mitochondria or
both, preferably in plastids.
[1333] Portions of proteins encoded by the nucleic acid molecule of
the invention are preferably biologically active, preferably having
above-mentioned annotated activity, e.g. conferring an increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof after
increase of activity.
[1334] As mentioned herein, the term "biologically active portion"
is intended to include a portion, e.g., a domain/motif, that
confers an increased yield, e.g. an increased yield-related trait,
for example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, plant or
part thereof or has an immunological activity such that it is binds
to an antibody binding specifically to the polypeptide of the
present invention or a polypeptide used in the process of the
present invention for increasing yield, e.g. increasing a
yield-related trait, for example enhancing tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, increasing intrinsic yield and/or another mentioned
yield-related traitas compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof.
[1335] The invention further relates to nucleic acid molecules that
differ from one of the nucleotide sequences shown in table I A,
columns 5 and 7 (and portions thereof) due to degeneracy of the
genetic code and thus encode a polypeptide of the present
invention, in particular a polypeptide having above mentioned
activity, e.g. as that polypeptides depicted by the sequence shown
in table II, columns 5 and 7 or the functional homologues.
Advantageously, the nucleic acid molecule of the invention
comprises, or in an other embodiment has, a nucleotide sequence
encoding a protein comprising, or in an other embodiment having, an
amino acid sequence shown in table II, columns 5 and 7 or the
functional homologues. In a still further embodiment, the nucleic
acid molecule of the invention encodes a full length protein which
is substantially homologous to an amino acid sequence shown in
table II, columns 5 and 7 or the functional homologues. However, in
one embodiment, the nucleic acid molecule of the present invention
does not consist of the sequence shown in table I, preferably table
IA, columns 5 and 7.
[1336] In addition, it will be appreciated by those skilled in the
art that DNA sequence polymorphisms that lead to changes in the
amino acid sequences may exist within a population. Such genetic
polymorphism in the gene encoding the polypeptide of the invention
or comprising the nucleic acid molecule of the invention may exist
among individuals within a population due to natural variation.
[1337] As used herein, the terms "gene" and "recombinant gene"
refer to nucleic acid molecules comprising an open reading frame
encoding the polypeptide of the invention or comprising the nucleic
acid molecule of the invention or encoding the polypeptide used in
the process of the present invention, preferably from a crop plant
or from a microorgansim useful for the method of the invention.
Such natural variations can typically result in 1 to 5% variance in
the nucleotide sequence of the gene. Any and all such nucleotide
variations and resulting amino acid polymorphisms in genes encoding
a polypeptide of the invention or comprising a the nucleic acid
molecule of the invention that are the result of natural variation
and that do not alter the functional activity as described are
intended to be within the scope of the invention.
[1338] Nucleic acid molecules corresponding to natural variants
homologues of a nucleic acid molecule of the invention, which can
also be a cDNA, can be isolated based on their homology to the
nucleic acid molecules disclosed herein using the nucleic acid
molecule of the invention, or a portion thereof, as a hybridization
probe according to standard hybridization techniques under
stringent hybridization conditions.
[1339] Accordingly, in another embodiment, a nucleic acid molecule
of the invention is at least 15, 20, 25 or 30 nucleotides in
length. Preferably, it hybridizes under stringent conditions to a
nucleic acid molecule comprising a nucleotide sequence of the
nucleic acid molecule of the present invention or used in the
process of the present invention, e.g. comprising the sequence
shown in table I, columns 5 and 7. The nucleic acid molecule is
preferably at least 20, 30, 50, 100, 250 or more nucleotides in
length.
[1340] The term "hybridizes under stringent conditions" is defined
above. In one embodiment, the term "hybridizes under stringent
conditions" is intended to describe conditions for hybridization
and washing under which nucleotide sequences at least 30%, 40%, 50%
or 65% identical to each other typically remain hybridized to each
other. Preferably, the conditions are such that sequences at least
about 70%, more preferably at least about 75% or 80%, and even more
preferably at least about 85%, 90% or 95% or more identical to each
other typically remain hybridized to each other.
[1341] Preferably, nucleic acid molecule of the invention that
hybridizes under stringent conditions to a sequence shown in table
I, columns 5 and 7 corresponds to a naturally-occurring nucleic
acid molecule of the invention. As used herein, a
"naturally-occurring" nucleic acid molecule refers to an RNA or DNA
molecule having a nucleotide sequence that occurs in nature (e.g.,
encodes a natural protein). Preferably, the nucleic acid molecule
encodes a natural protein having above-mentioned activity, e.g.
conferring increasing yield, e.g. increasing a yield-related trait,
for example enhancing tolerance to abiotic environmental stress,
for example increasing drought tolerance and/or low temperature
tolerance and/or increasing nutrient use efficiency, increasing
intrinsic yield and/or another mentioned yield-related trait after
increasing the expression or activity thereof or the activity of a
protein of the invention or used in the process of the invention by
for example expression the nucleic acid sequence of the gene
product in the cytsol and/or in an organelle such as a plastid or
mitochondria, preferably in plastids.
[1342] In addition to naturally-occurring variants of the sequences
of the polypeptide or nucleic acid molecule of the invention as
well as of the polypeptide or nucleic acid molecule used in the
process of the invention that may exist in the population, the
skilled artisan will further appreciate that changes can be
introduced by mutation into a nucleotide sequence of the nucleic
acid molecule encoding the polypeptide of the invention or used in
the process of the present invention, thereby leading to changes in
the amino acid sequence of the encoded said polypeptide, without
altering the functional ability of the polypeptide, preferably not
decreasing said activity.
[1343] For example, nucleotide substitutions leading to amino acid
substitutions at "non-essential" amino acid residues can be made in
a sequence of the nucleic acid molecule of the invention or used in
the process of the invention, e.g. shown in table I, columns 5 and
7.
[1344] A "non-essential" amino acid residue is a residue that can
be altered from the wild-type sequence of one without altering the
activity of said polypeptide, whereas an "essential" amino acid
residue is required for an activity as mentioned above, e.g.
leading to increasing yield, e.g. increasing a yield-related trait,
for example enhancing tolerance to abiotic environmental stress,
for example increasing drought tolerance and/or low temperature
tolerance and/or increasing nutrient use efficiency, increasing
intrinsic yield and/or another mentioned yield-related trait as
compared to a corresponding, e.g. non-transformed, wild type plant
cell, plant or part thereof in an organism after an increase of
activity of the polypeptide. Other amino acid residues, however,
(e.g., those that are not conserved or only semi-conserved in the
domain having said activity) may not be essential for activity and
thus are likely to be amenable to alteration without altering said
activity.
[1345] Further, a person skilled in the art knows that the codon
usage between organisms can differ. Therefore, he may adapt the
codon usage in the nucleic acid molecule of the present invention
to the usage of the organism or the cell compartment for example of
the plastid or mitochondria in which the polynucleotide or
polypeptide is expressed.
[1346] Accordingly, the invention relates to nucleic acid molecules
encoding a polypeptide having above-mentioned activity, in an
organisms or parts thereof by for example expression either in the
cytsol or in an organelle such as a plastid or mitochondria or
both, preferably in plastids that contain changes in amino acid
residues that are not essential for said activity. Such
polypeptides differ in amino acid sequence from a sequence
contained in the sequences shown in table II, columns 5 and 7 yet
retain said activity described herein. The nucleic acid molecule
can comprise a nucleotide sequence encoding a polypeptide, wherein
the polypeptide comprises an amino acid sequence at least about 50%
identical to an amino acid sequence shown in table II, columns 5
and 7 and is capable of participation in increasing yield, e.g.
increasing a yield-related trait, for example enhancing tolerance
to abiotic environmental stress, for example increasing drought
tolerance and/or low temperature tolerance and/or increasing
nutrient use efficiency, increasing intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof after
increasing its activity, e.g. its expression by for example
expression either in the cytsol or in an organelle such as a
plastid or mitochondria or both, preferably in plastids.
Preferably, the protein encoded by the nucleic acid molecule is at
least about 60% identical to the sequence shown in table II,
columns 5 and 7, more preferably at least about 70% identical to
one of the sequences shown in table II, columns 5 and 7, even more
preferably at least about 80%, 90%, 95% homologous to the sequence
shown in table II, columns 5 and 7, and most preferably at least
about 96%, 97%, 98%, or 99% identical to the sequence shown in
table II, columns 5 and 7.
[1347] To determine the percentage homology (=identity, herein used
interchangeably) of two amino acid sequences or of two nucleic acid
molecules, the sequences are written one underneath the other for
an optimal comparison (for example gaps may be inserted into the
sequence of a protein or of a nucleic acid in order to generate an
optimal alignment with the other protein or the other nucleic
acid).
[1348] The amino acid residues or nucleic acid molecules at the
corresponding amino acid positions or nucleotide positions are then
compared. If a position in one sequence is occupied by the same
amino acid residue or the same nucleic acid molecule as the
corresponding position in the other sequence, the molecules are
homologous at this position (i.e. amino acid or nucleic acid
"homology" as used in the present context corresponds to amino acid
or nucleic acid "identity". The percentage homology between the two
sequences is a function of the number of identical positions shared
by the sequences (i.e. % homology=number of identical
positions/total number of positions.times.100). The terms
"homology" and "identity" are thus to be considered as
synonyms.
[1349] For the determination of the percentage homology (=identity)
of two or more amino acids or of two or more nucleotide sequences
several computer software programs have been developed. The
homology of two or more sequences can be calculated with for
example the software fasta, which presently has been used in the
version fasta 3 (W. R. Pearson and D. J. Lipman, PNAS 85, 2444
(1988); W. R. Pearson, Methods in Enzymology 183, 63 (1990); W.
[1350] R. Pearson and D. J. Lipman, PNAS 85, 2444 (1988); W. R.
Pearson, Enzymology 183, 63 (1990)). Another useful program for the
calculation of homologies of different sequences is the standard
blast program, which is included in the Biomax pedant software
(Biomax, Munich, Federal Republic of Germany). This leads
unfortunately sometimes to suboptimal results since blast does not
always include complete sequences of the subject and the querry.
Nevertheless as this program is very efficient it can be used for
the comparison of a huge number of sequences. The following
settings are typically used for such a comparisons of sequences: -p
Program Name [String]; -d Database [String]; default=nr; -i Query
File [File In]; default=stdin; -e Expectation value (E) [Real];
default=10.0; -m alignment view options: 0=pairwise;
1=query-anchored showing identities; 2=query-anchored no
identities; 3=flat query-anchored, show identities; 4=flat
query-anchored, no identities; 5=query-anchored no identities and
blunt ends; 6=flat query-anchored, no identities and blunt ends;
7=XML Blast output; 8=tabular; 9 tabular with comment lines
[Integer]; default=0; -o BLAST report Output File [File Out]
Optional; default=stdout; --F Filter query sequence (DUST with
blastn, SEG with others) [String]; default=T; -G Cost to open a gap
(zero invokes default behavior) [Integer]; default=0; -E Cost to
extend a gap (zero invokes default behavior) [Integer]; default=0;
--X X dropoff value for gapped alignment (in bits) (zero invokes
default behavior); blastn 30, megablast 20, tblastx 0, all others
15 [Integer]; default=0; --I Show GI's in deflines [T/F]; default
.dbd.F; -q Penalty for a nucleotide mismatch (blastn only)
[Integer]; default=-3; -r Reward for a nucleotide match (blastn
only) [Integer]; default=1; -v Number of database sequences to show
one-line descriptions for (V) [Integer]; default=500; -b Number of
database sequence to show alignments for (B) [Integer];
default=250; -f Threshold for extending hits, default if zero;
blastp 11, blastn 0, blastx 12, tblastn 13; tblastx 13, megablast 0
[Integer]; default=0; -g Perfom gapped alignment (not available
with tblastx) [T/F]; default=T; -Q Query Genetic code to use
[Integer];
[1351] default=1; -D DB Genetic code (for tblast[nx] only)
[Integer]; default=1; -a Number of processors to use [Integer];
default=1; --O SeqAlign file [File Out] Optional; -J Believe the
query defline [T/F]; default .dbd.F; -M Matrix [String];
default=BLOSUM62; --W Word size, default if zero (blastn 11,
megablast 28, all others 3) [Integer]; default=0; -z Effective
length of the database (use zero for the real size) [Real];
default=0; -K Number of best hits from a region to keep (off by
default, if used a value of 100 is recommended) [Integer];
default=0; --P 0 for multiple hit, 1 for single hit [Integer];
default=0; --Y Effective length of the search space (use zero for
the real size) [Real]; default=0; --S Query strands to search
against database (for blast[nx], and tblastx); 3 is both, 1 is top,
2 is bottom [Integer]; default=3; -T Produce HTML output [T/F];
default .dbd.F; --I Restrict search of database to list of GI's
[String] Optional; -U Use lower case filtering of FASTA sequence
[T/F] Optional; default .dbd.F; -y X dropoff value for ungapped
extensions in bits (0.0 invokes default behavior); blastn 20,
megablast 10, all others 7 [Real]; default=0.0; -Z X dropoff value
for final gapped alignment in bits (0.0 invokes default behavior);
blastn/megablast 50, tblastx 0, all others 25 [Integer]; default=0;
--R PSI-TBLASTN checkpoint file [File In] Optional; -n MegaBlast
search [T/F]; default .dbd.F; -L Location on query sequence
[String] Optional; -A Multiple Hits window size, default if zero
(blastn/megablast 0, all others 40 [Integer]; default=0; -w Frame
shift penalty (OOF algorithm for blastx) [Integer]; default=0; -t
Length of the largest intron allowed in tblastn for linking HSPs (0
disables linking) [Integer]; default=0.
[1352] Results of high quality are reached by using the algorithm
of Needleman and Wunsch or Smith and Waterman. Therefore programs
based on said algorithms are preferred. Advantageously the
comparisons of sequences can be done with the program PileUp (J.
Mol. Evolution., 25, 351 (1987), Higgins et al., CABIOS 5, 151
(1989)) or preferably with the programs "Gap" and "Needle", which
are both based on the algorithms of Needleman and Wunsch (J. Mol.
Biol. 48; 443 (1970)), and "BestFit", which is based on the
algorithm of Smith and Waterman (Adv. Appl. Math. 2; 482 (1981)).
"Gap" and "BestFit" are part of the GCG softwarepackage (Genetics
Computer Group, 575 Science Drive, Madison, Wis., USA 53711 (1991);
Altschul et al., (Nucleic Acids Res. 25, 3389 (1997)), "Needle" is
part of the The European Molecular Biology Open Software Suite
(EMBOSS) (Trends in Genetics 16 (6), 276 (2000)). Therefore
preferably the calculations to determine the percentages of
sequence homology are done with the programs "Gap" or "Needle" over
the whole range of the sequences. The following standard
adjustments for the comparison of nucleic acid sequences were used
for "Needle": matrix: EDNAFULL, Gap_penalty: 10.0, Extend_penalty:
0.5. The following standard adjustments for the comparison of
nucleic acid sequences were used for "Gap": gap weight: 50, length
weight: 3, average match: 10.000, average mismatch: 0.000.
[1353] For example a sequence, which has 80% homology with sequence
SEQ ID NO: 38 at the nucleic acid level is understood as meaning a
sequence which, upon comparison with the sequence SEQ ID NO: 38 by
the above program "Needle" with the above parameter set, has a 80%
homology.
[1354] Homology between two polypeptides is understood as meaning
the identity of the amino acid sequence over in each case the
entire sequence length which is calculated by comparison with the
aid of the above program "Needle" using Matrix: EBLOSUM62,
Gap_penalty: 8.0, Extend_penalty: 2.0.
[1355] For example a sequence which has a 80% homology with
sequence SEQ ID NO: 39 at the protein level is understood as
meaning a sequence which, upon comparison with the sequence SEQ ID
NO: 39 by the above program "Needle" with the above parameter set,
has a 80% homology.
[1356] Functional equivalents derived from the nucleic acid
sequence as shown in table I, columns 5 and 7 according to the
invention by substitution, insertion or deletion have at least 30%,
35%, 40%, 45% or 50%, preferably at least 55%, 60%, 65% or 70% by
preference at least 80%, especially preferably at least 85% or 90%,
91%, 92%, 93% or 94%, very especially preferably at least 95%, 97%,
98% or 99% homology with one of the polypeptides as shown in table
II, columns 5 and 7 according to the invention and encode
polypeptides having essentially the same properties as the
polypeptide as shown in table II, columns 5 and 7. Functional
equivalents derived from one of the polypeptides as shown in table
II, columns 5 and 7 according to the invention by substitution,
insertion or deletion have at least 30%, 35%, 40%, 45% or 50%,
preferably at least 55%, 60%, 65% or 70% by preference at least
80%, especially preferably at least 85% or 90%, 91%, 92%, 93% or
94%, very especially preferably at least 95%, 97%, 98% or 99%
homology with one of the polypeptides as shown in table II, columns
5 and 7 according to the invention and having essentially the same
properties as the polypeptide as shown in table II, columns 5 and
7.
[1357] "Essentially the same properties" of a functional equivalent
is above all understood as meaning that the functional equivalent
has above mentioned acitivty, by for example expression either in
the cytsol or in an organelle such as a plastid or mitochondria or
both, preferably in plastids while increasing the amount of
protein, activity or function of said functional equivalent in an
organism, e.g. a microorgansim, a plant or plant tissue or animal
tissue, plant or animal cells or a part of the same.
[1358] A nucleic acid molecule encoding an homologous to a protein
sequence of table II, columns 5 and 7 can be created by introducing
one or more nucleotide substitutions, additions or deletions into a
nucleotide sequence of the nucleic acid molecule of the present
invention, in particular of table I, columns 5 and 7 such that one
or more amino acid substitutions, additions or deletions are
introduced into the encoded protein. Mutations can be introduced
into the encoding sequences of table I, columns 5 and 7 by standard
techniques, such as site-directed mutagenesis and PCR-mediated
mutagenesis.
[1359] Preferably, conservative amino acid substitutions are made
at one or more predicted non-essential amino acid residues. A
"conservative amino acid substitution" is one in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophane), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophane, histidine).
[1360] Thus, a predicted nonessential amino acid residue in a
polypeptide of the invention or a polypeptide used in the process
of the invention is preferably replaced with another amino acid
residue from the same family. Alternatively, in another embodiment,
mutations can be introduced randomly along all or part of a coding
sequence of a nucleic acid molecule of the invention or used in the
process of the invention, such as by saturation mutagenesis, and
the resultant mutants can be screened for activity described herein
to identify mutants that retain or even have increased above
mentioned activity, e.g. conferring increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, intrinsic yield and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, plant or part thereof.
[1361] Following mutagenesis of one of the sequences as shown
herein, the encoded protein can be expressed recombinantly and the
activity of the protein can be determined using, for example,
assays described herein (see Examples).
[1362] The highest homology of the nucleic acid molecule used in
the process according to the invention was found for the following
database entries by Gap search.
[1363] Homologues of the nucleic acid sequences used, with the
sequence shown in table I, columns 5 and 7, comprise also allelic
variants with at least approximately 30%, 35%, 40% or 45% homology,
by preference at least approximately 50%, 60% or 70%, more
preferably at least approximately 90%, 91%, 92%, 93%, 94% or 95%
and even more preferably at least approximately 96%, 97%, 98%, 99%
or more homology with one of the nucleotide sequences shown or the
abovementioned derived nucleic acid sequences or their homologues,
derivatives or analogues or parts of these. Allelic variants
encompass in particular functional variants which can be obtained
by deletion, insertion or substitution of nucleotides from the
sequences shown, preferably from table I, columns 5 and 7, or from
the derived nucleic acid sequences, the intention being, however,
that the enzyme activity or the biological activity of the
resulting proteins synthesized is advantageously retained or
increased.
[1364] In one embodiment of the present invention, the nucleic acid
molecule of the invention or used in the process of the invention
comprises the sequences shown in any of the table I, columns 5 and
7. It is preferred that the nucleic acid molecule comprises as
little as possible other nucleotides not shown in any one of table
I, columns 5 and 7. In one embodiment, the nucleic acid molecule
comprises less than 500, 400, 300, 200, 100, 90, 80, 70, 60, 50 or
40 further nucleotides. In a further embodiment, the nucleic acid
molecule comprises less than 30, 20 or 10 further nucleotides. In
one embodiment, the nucleic acid molecule use in the process of the
invention is identical to the sequences shown in table I, columns 5
and 7.
[1365] Also preferred is that the nucleic acid molecule used in the
process of the invention encodes a polypeptide comprising the
sequence shown in table II, columns 5 and 7. In one embodiment, the
nucleic acid molecule encodes less than 150, 130, 100, 80, 60, 50,
40 or 30 further amino acids. In a further embodiment, the encoded
polypeptide comprises less than 20, 15, 10, 9, 8, 7, 6 or 5 further
amino acids. In one embodiment used in the inventive process, the
encoded polypeptide is identical to the sequences shown in table
II, columns 5 and 7.
[1366] In one embodiment, the nucleic acid molecule of the
invention or used in the process encodes a polypeptide comprising
the sequence shown in table II, columns 5 and 7 comprises less than
100 further nucleotides. In a further embodiment, said nucleic acid
molecule comprises less than 30 further nucleotides. In one
embodiment, the nucleic acid molecule used in the process is
identical to a coding sequence of the sequences shown in table I,
columns 5 and 7.
[1367] Polypeptides (=proteins), which still have the essential
biological or enzymatic activity of the polypeptide of the present
invention conferring increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, plant or part thereof i.e. whose activity is
essentially not reduced, are polypeptides with at least 10% or 20%,
by preference 30% or 40%, especially preferably 50% or 60%, very
especially preferably 80% or 90 or more of the wild type biological
activity or enzyme activity, advantageously, the activity is
essentially not reduced in comparison with the activity of a
polypeptide shown in table II, columns 5 and 7 expressed under
identical conditions.
[1368] Homologues of table I, columns 5 and 7 or of the derived
sequences of table II, columns 5 and 7 also mean truncated
sequences, cDNA, single-stranded DNA or RNA of the coding and
noncoding DNA sequence. Homologues of said sequences are also
understood as meaning derivatives, which comprise noncoding regions
such as, for example, UTRs, terminators, enhancers or promoter
variants. The promoters upstream of the nucleotide sequences stated
can be modified by one or more nucleotide substitution(s),
insertion(s) and/or deletion(s) without, however, interfering with
the functionality or activity either of the promoters, the open
reading frame (.dbd.ORF) or with the 3'-regulatory region such as
terminators or other 3'-regulatory regions, which are far away from
the ORF. It is furthermore possible that the activity of the
promoters is increased by modification of their sequence, or that
they are replaced completely by more active promoters, even
promoters from heterologous organisms. Appropriate promoters are
known to the person skilled in the art and are mentioned herein
below.
[1369] In addition to the nucleic acid molecules encoding the LTRRP
or YRPs described above, another aspect of the invention pertains
to negative regulators of the activity of a nucleic acid molecules
selected from the group according to table I, column 5 and/or 7,
preferably column 7. Antisense polynucleotides thereto are thought
to inhibit the downregulating activity of those negative regulators
by specifically binding the target polynucleotide and interfering
with transcription, splicing, transport, translation, and/or
stability of the target polynucleotide. Methods are described in
the prior art for targeting the antisense polynucleotide to the
chromosomal DNA, to a primary RNA transcript, or to a processed
mRNA. Preferably, the target regions include splice sites,
translation initiation codons, translation termination codons, and
other sequences within the open reading frame.
[1370] The term "antisense," for the purposes of the invention,
refers to a nucleic acid comprising a polynucleotide that is
sufficiently complementary to all or a portion of a gene, primary
transcript, or processed mRNA, so as to interfere with expression
of the endogenous gene. "Complementary" polynucleotides are those
that are capable of base pairing according to the standard
Watson-Crick complementarity rules. specifically, purines will base
pair with pyrimidines to form a combination of guanine paired with
cytosine (G:C) and adenine paired with either thymine (A:T) in the
case of DNA, or adenine paired with uracil (A:U) in the case of
RNA. It is understood that two polynucleotides may hybridize to
each other even if they are not completely complementary to each
other, provided that each has at least one region that is
substantially complementary to the other. The term "antisense
nucleic acid" includes single stranded RNA as well as
double-stranded DNA expression cassettes that can be transcribed to
produce an antisense RNA. "Active" antisense nucleic acids are
antisense RNA molecules that are capable of selectively hybridizing
with a negative regulator of the activity of a nucleic acid
molecules encoding a polypeptide having at least 80% sequence
identity with the polypeptide selected from the group according to
table II, column 5 and/or 7, preferably column 7.
[1371] The antisense nucleic acid can be complementary to an entire
negative regulator strand, or to only a portion thereof. In an
embodiment, the antisense nucleic acid molecule is antisense to a
"noncoding region" of the coding strand of a nucleotide sequence
encoding a LTRRP or YRP. The term "noncoding region" refers to 5'
and 3' sequences that flank the coding region that are not
translated into amino acids (i.e., also referred to as 5' and 3'
untranslated regions). The anti-sense nucleic acid molecule can be
complementary to only a portion of the noncoding region of LTRRP or
YRP mRNA. For example, the antisense oligonucleotide can be
complementary to the region surrounding the translation start site
of LTRRP or YRP mRNA. An antisense oligonucleotide can be, for
example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides
in length. Typically, the antisense molecules of the present
invention comprise an RNA having 60-100% sequence identity with at
least 14 consecutive nucleotides of a noncoding region of one of
the nucleic acid of table I. Preferably, the sequence identity will
be at least 70%, more preferably at least 75%, 80%, 85%, 90%, 95%,
98% and most preferably 99%.
[1372] An antisense nucleic acid of the invention can be
constructed using chemical synthesis and enzymatic ligation
reactions using procedures known in the art. For example, an
antisense nucleic acid (e.g., an antisense oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or
variously modified nucleotides designed to increase the biological
stability of the molecules or to increase the physical stability of
the duplex formed between the antisense and sense nucleic acids,
e.g., phosphorothioate derivatives and acridine substituted
nucleotides can be used. Examples of modified nucleotides which can
be used to generate the antisense nucleic acid include
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl)-uracil,
5-carboxymethylanninomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylanninomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
5-methyl-2-thiouracil, 3-(3-amino-3-N2-carboxypropyl)-uracil, acp3
and 2,6-dianninopurine. Alternatively, the antisense nucleic acid
can be produced biologically using an expression vector into which
a nucleic acid has been subcloned in an antisense orientation
(i.e., RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest,
described further in the following subsection).
[1373] In yet another embodiment, the antisense nucleic acid
molecule of the invention is an alpha-anomeric nucleic acid
molecule. An alpha-anomeric nucleic acid molecule forms specific
double-stranded hybrids with complementary RNA in which, contrary
to the usual bunits, the strands run parallel to each other
(Gaultier et al., Nucleic Acids. Res. 15, 6625 (1987)). The
antisense nucleic acid molecule can also comprise a
2'-o-methylribonucleotide (Inoue et al., Nucleic Acids Res. 15,
6131 (1987)) or a chimeric RNA-DNA analogue (Inoue et al., FEBS
Lett. 215, 327 (1987)).
[1374] The antisense nucleic acid molecules of the invention are
typically administered to a cell or generated in situ such that
they hybridize with or bind to cellular mRNA and/or genomic DNA.
The hybridization can be by conventional nucleotide complementarity
to form a stable duplex, or, for example, in the case of an
antisense nucleic acid molecule which binds to DNA duplexes,
through specific interactions in the major groove of the double
helix. The anti-sense molecule can be modified such that it
specifically binds to a receptor or an antigen expressed on a
selected cell surface, e.g., by linking the antisense nucleic acid
molecule to a peptide or an antibody which binds to a cell surface
receptor or antigen. The antisense nucleic acid molecule can also
be delivered to cells using the vectors described herein. To
achieve sufficient intracellular concentrations of the antisense
molecules, vector constructs in which the antisense nucleic acid
molecule is placed under the control of a strong prokaryotic,
viral, or eukaryotic (including plant) promoter are preferred.
[1375] As an alternative to antisense polynucleotides, ribozymes,
sense polynucleotides, or double stranded RNA (dsRNA) can be used
to reduce expression of a LTRRP or YRP polypeptide. By "ribozyme"
is meant a catalytic RNA-based enzyme with ribonuclease activity
which is capable of cleaving a single-stranded nucleic acid, such
as an mRNA, to which it has a complementary region. Ribozymes
(e.g., hammerhead ribozymes described in Haselhoff and Gerlach,
Nature 334, 585 (1988)) can be used to catalytically cleave LTRRP
or YRP mRNA transcripts to thereby inhibit translation of LTRRP or
YRP mRNA. A ribozyme having specificity for a LTRRP or YRP-encoding
nucleic acid can be designed based upon the nucleotide sequence of
a LTRRP or YRP cDNA, as disclosed herein or on the basis of a
heterologous sequence to be isolated according to methods taught in
this invention. For example, a derivative of a Tetrahymena L-19 IVS
RNA can be constructed in which the nucleotide sequence of the
active site is complementary to the nucleotide sequence to be
cleaved in a LTRRP or YRP-encoding mRNA. See, e.g. U.S. Pat. Nos.
4,987,071 and 5,116,742 to Cech et al. Alternatively, LTRRP or YRP
mRNA can be used to select a catalytic RNA having a specific
ribonuclease activity from a pool of RNA molecules. See, e.g.
Bartel D., and Szostak J. W., Science 261, 1411 (1993). In
preferred embodiments, the ribozyme will contain a portion having
at least 7, 8, 9, 10, 12, 14, 16, 18 or 20 nucleotides, and more
preferably 7 or 8 nucleotides, that have 100% complementarity to a
portion of the target RNA. Methods for making ribozymes are known
to those skilled in the art. See, e.g. U.S. Pat. Nos. 6,025,167,
5,773,260 and 5,496,698.
[1376] The term "dsRNA," as used herein, refers to RNA hybrids
comprising two strands of RNA. The dsRNAs can be linear or circular
in structure. In a preferred embodiment, dsRNA is specific for a
polynucleotide encoding either the polypeptide according to table
II or a polypeptide having at least 70% sequence identity with a
polypeptide according to table II. The hybridizing RNAs may be
substantially or completely complementary. By "substantially
complementary," is meant that when the two hybridizing RNAs are
optimally aligned using the BLAST program as described above, the
hybridizing portions are at least 95% complementary. Preferably,
the dsRNA will be at least 100 base pairs in length. Typically, the
hybridizing RNAs will be of identical length with no over hanging
5' or 3' ends and no gaps. However, dsRNAs having 5' or 3'
overhangs of up to 100 nucleotides may be used in the methods of
the invention.
[1377] The dsRNA may comprise ribonucleotides or ribonucleotide
analogs, such as 2'-O-methyl ribosyl residues, or combinations
thereof. See, e.g. U.S. Pat. Nos. 4,130,641 and 4,024,222. A dsRNA
polyriboinosinic acid:polyribocytidylic acid is described in U.S.
Pat. No. 4,283,393. Methods for making and using dsRNA are known in
the art. One method comprises the simultaneous transcription of two
complementary DNA strands, either in vivo, or in a single in vitro
reaction mixture. See, e.g. U.S. Pat. No. 5,795,715. In one
embodiment, dsRNA can be introduced into a plant or plant cell
directly by standard transformation procedures. Alternatively,
dsRNA can be expressed in a plant cell by transcribing two
complementary RNAs.
[1378] Other methods for the inhibition of endogenous gene
expression, such as triple helix formation (Moser et al., Science
238, 645 (1987), and Cooney et al., Science 241, 456 (1988)) and
co-suppression (Napoli et al., The Plant Cell 2,279, 1990,) are
known in the art. Partial and full-length cDNAs have been used for
the c-o-suppression of endogenous plant genes. See, e.g. U.S. Pat.
Nos. 4,801,340, 5,034,323, 5,231,020, and 5,283,184; Van der Kroll
et al., The Plant Cell 2, 291, (1990); Smith et al., Mol. Gen.
Genetics 224, 477 (1990), and Napoli et al., The Plant Cell 2, 279
(1990).
[1379] For sense suppression, it is believed that introduction of a
sense polynucleotide blocks transcription of the corresponding
target gene. The sense polynucleotide will have at least 65%
sequence identity with the target plant gene or RNA. Preferably,
the percent identity is at least 80%, 90%, 95% or more. The
introduced sense polynucleotide need not be full length relative to
the target gene or transcript. Preferably, the sense polynucleotide
will have at least 65% sequence identity with at least 100
consecutive nucleotides of one of the nucleic acids as depicted in
table I, application no. 1. The regions of identity can comprise
introns and/or exons and untranslated regions. The introduced sense
polynucleotide may be present in the plant cell transiently, or may
be stably integrated into a plant chromosome or extra-chromosomal
replicon.
[1380] Further, object of the invention is an expression vector
comprising a nucleic acid molecule comprising a nucleic acid
molecule selected from the group consisting of: [1381] (a) a
nucleic acid molecule encoding the polypeptide shown in column 5 or
7 of table II, application no. 1; [1382] (b) a nucleic acid
molecule shown in column 5 or 7 of table I, application no. 1;
[1383] (c) a nucleic acid molecule, which, as a result of the
degeneracy of the genetic code, can be derived from a polypeptide
sequence depicted in column 5 or 7 of table II, and confers an
increased yield, e.g. an increased yield-related trait, for example
enhanced tolerance to abiotic environmental stress, for example an
increased drought tolerance and/or low temperature tolerance and/or
an increased nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof; [1384] (d) a nucleic acid molecule having at
least 30% identity, preferably at least 40%, 50%, 60%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% with the nucleic acid
molecule sequence of a polynucleotide comprising the nucleic acid
molecule shown in column 5 or 7 of table I, and confers increased
yield, e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, intrinsic yield and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1385] (e) a nucleic acid molecule encoding a polypeptide having at
least 30% identity, preferably at least 40%, 50%, 60%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, with the amino acid
sequence of the polypeptide encoded by the nucleic acid molecule of
(a), (b), (c) or (d) and having the activity represented by a
nucleic acid molecule comprising a polynucleotide as depicted in
column 5 of table I, and confers increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a plant or a part thereof; [1386] (f) nucleic acid
molecule which hybridizes with a nucleic acid molecule of (a), (b),
(c), (d) or (e) under stringent hybridization conditions and
confers increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof; [1387] (g) a nucleic acid molecule encoding a
polypeptide which can be isolated with the aid of monoclonal or
polyclonal antibodies made against a polypeptide encoded by one of
the nucleic acid molecules of (a), (b), (c), (d), (e) or (f) and
having the activity represented by the nucleic acid molecule
comprising a polynucleotide as depicted in column 5 of table I,
application no. 1; [1388] (h) a nucleic acid molecule encoding a
polypeptide comprising the consensus sequence or one or more
polypeptide motifs as shown in column 7 of table IV, and preferably
having the activity represented by a protein comprising a
polypeptide as depicted in column 5 of table II or IV, application
no. 1; [1389] (i) a nucleic acid molecule encoding a polypeptide
having the activity represented by a protein as depicted in column
5 of table II, and confers increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a plant or a part thereof; [1390] (j) nucleic acid
molecule which comprises a polynucleotide, which is obtained by
amplifying a cDNA library or a genomic library using the primers in
column 7 of table III, and for example having the activity
represented by a protein comprising a polypeptide as depicted in
column 5 of table II or IV, application no. 1; and [1391] (k) a
nucleic acid molecule which is obtainable by screening a suitable
nucleic acid library, especially a cDNA library and/or a genomic
library, under stringent hybridization conditions with a probe
comprising a complementary sequence of a nucleic acid molecule of
(a) or (b) or with a fragment thereof, having at least 15 nt,
preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt, 500 nt, 750 or 1000
nt of a nucleic acid molecule complementary to a nucleic acid
molecule sequence characterized in (a) to (e) and encoding a
polypeptide having the activity represented by a protein comprising
a polypeptide as depicted in column 5 of table II, application no.
1.
[1392] The invention further provides an isolated recombinant
expression vector comprising a LTRRP or YRP encoding nucleic acid
as described above, wherein expression of the vector or LTRRP or
YRP encoding nucleic acid, respectively in a host cell results in
an increased yield, e.g. an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to
the corresponding, e.g. non-transformed, wild type of the host
cell. As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector,
wherein additional DNA segments can be ligated into the viral
genome. Further types of vectors can be linearized nucleic acid
sequences, such as transposons, which are pieces of DNA which can
copy and insert themselves. There have been 2 types of transposons
found: simple transposons, known as Insertion Sequences and
composite transposons, which can have several genes as well as the
genes that are required for transposition. Certain vectors are
capable of autonomous replication in a host cell into which they
are introduced (e.g., bacterial vectors having a bacterial origin
of replication and episomal mammalian vectors). Other vectors
(e.g., non-episomal mammalian vectors) are integrated into the
genome of a host cell upon introduction into the host cell, and
thereby are replicated along with the host genome. Moreover,
certain vectors are capable of directing the expression of genes to
which they are operatively linked. Such vectors are referred to
herein as "expression vectors". In general, expression vectors of
utility in recombinant DNA techniques are often in the form of
plasmids. In the present specification, "plasmid" and "vector" can
be used interchangeably as the plasmid is the most commonly used
form of vector. However, the invention is intended to include such
other forms of expression vectors, such as viral vectors (e.g.,
replication defective retroviruses, adenoviruses and
adeno-associated viruses), which serve equivalent functions.
[1393] A plant expression cassette preferably contains regulatory
sequences capable of driving gene expression in plant cells and
operably linked so that each sequence can fulfill its function, for
example, termination of transcription by polyadenylation signals.
Preferred polyadenylation signals are those originating from
Agrobacterium tumefaciens T-DNA such as the gene 3 known as
octopine synthase of the Ti-plasmid pTiACH5 (Gielen et al., EMBO J.
3, 835 1(984)) or functional equivalents thereof but also all other
terminators functionally active in plants are suitable. As plant
gene expression is very often not limited on transcriptional
levels, a plant expression cassette preferably contains other
operably linked sequences like translational enhancers such as the
overdrive-sequence containing the 5''-untranslated leader sequence
from tobacco mosaic virus enhancing the protein per RNA ratio
(Gallie et al., Nucl. Acids Research 15, 8693 (1987)).
[1394] Plant gene expression has to be operably linked to an
appropriate promoter conferring gene expression in a timely, cell
or tissue specific manner. Preferred are promoters driving
constitutive expression (Benfey et al., EMBO J. 8, 2195 (1989))
like those derived from plant viruses like the 35S CaMV (Franck et
al., Cell 21, 285 (1980)), the 19S CaMV (see also U.S. Pat. No.
5,352,605 and PCT Application No. WO 84/02913) or plant promoters
like those from Rubisco small subunit described in U.S. Pat. No.
4,962,028.
[1395] Additional advantageous regulatory sequences are, for
example, included in the plant promoters such as CaMV/35S (Franck
et al., Cell 21 285 (1980)), PRP1 (Ward et al., Plant. Mol. Biol.
22, 361 (1993)), SSU, OCS, lib4, usp, STLS1, B33, LEB4, nos,
ubiquitin, napin or phaseolin promoter. Also advantageous in this
connection are inducible promoters such as the promoters described
in EP 388 186 (benzyl sulfonamide inducible), Gatz et al., Plant J.
2, 397 (1992) (tetracyclin inducible), EP-A-0 335 528 (abscisic
acid inducible) or WO 93/21334 (ethanol or cyclohexenol inducible).
Additional useful plant promoters are the cytoplasmic FBPase
promotor or ST-LSI promoter of potato (Stockhaus et al., EMBO J. 8,
2445 (1989)), the phosphorybosyl phyrophoshate amido transferase
promoter of Glycine max (gene bank accession No. U87999) or the
noden specific promoter described in EP-A-0 249 676. Additional
particularly advantageous promoters are seed specific promoters
which can be used for monocotyledones or dicotyledones and are
described in U.S. Pat. No. 5,608,152 (napin promoter from
rapeseed), WO 98/45461 (phaseolin promoter from Arabidopsis), U.S.
Pat. No. 5,504,200 (phaseolin promoter from Phaseolus vulgaris), WO
91/13980 (Bce4 promoter from Brassica) and Baeumlein et al., Plant
J., 2 (2), 233 (1992) (LEB4 promoter from leguminosa). Said
promoters are useful in dicotyledones. The following promoters are
useful for example in monocotyledones Ipt-2- or Ipt-1-promoter from
barley (WO 95/15389 and WO 95/23230) or hordein promoter from
barley. Other useful promoters are described in WO 99/16890. It is
possible in principle to use all natural promoters with their
regulatory sequences like those mentioned above for the novel
process. It is also possible and advantageous in addition to use
synthetic promoters.
[1396] The gene construct may also comprise further genes which are
to be inserted into the organisms and which are for example
involved in stress tolerance and yield increase. It is possible and
advantageous to insert and express in host organisms regulatory
genes such as genes for inducers, repressors or enzymes which
intervene by their enzymatic activity in the regulation, or one or
more or all genes of a biosynthetic pathway. These genes can be
heterologous or homologous in origin. The inserted genes may have
their own promoter or else be under the control of same promoter as
the sequences of the nucleic acid of table I or their homologs.
[1397] The gene construct advantageously comprises, for expression
of the other genes present, additionally 3' and/or 5' terminal
regulatory sequences to enhance expression, which are selected for
optimal expression depending on the selected host organism and gene
or genes.
[1398] These regulatory sequences are intended to make specific
expression of the genes and protein expression possible as
mentioned above. This may mean, depending on the host organism, for
example that the gene is expressed or over-expressed only after
induction, or that it is immediately expressed and/or
over-expressed.
[1399] The regulatory sequences or factors may moreover preferably
have a beneficial effect on expression of the introduced genes, and
thus increase it. It is possible in this way for the regulatory
elements to be enhanced advantageously at the transcription level
by using strong transcription signals such as promoters and/or
enhancers. However, in addition, it is also possible to enhance
translation by, for example, improving the stability of the
mRNA.
[1400] Other preferred sequences for use in plant gene expression
cassettes are targeting-sequences necessary to direct the gene
product in its appropriate cell compartment (for review see
Kermode, Crit. Rev. Plant Sci. 15 (4), 285 (1996) and references
cited therein) such as the vacuole, the nucleus, all types of
plastids like amyloplasts, chloroplasts, chromoplasts, the
extracellular space, mitochondria, the endoplasmic reticulum, oil
bodies, peroxisomes and other compartments of plant cells.
[1401] Plant gene expression can also be facilitated via an
inducible promoter (for review see Gatz, Annu. Rev. Plant Physiol.
Plant Mol. Biol. 48, 89 (1997)). Chemically inducible promoters are
especially suitable if gene expression is wanted to occur in a time
specific manner.
[1402] Table VI lists several examples of promoters that may be
used to regulate transcription of the nucleic acid coding sequences
of the present invention.
TABLE-US-00002 TABLE VI Examples of tissue-specific and inducible
promoters in plants Expression Reference Cor78 - Cold, drought,
salt, Ishitani, et al., Plant Cell 9, 1935 ABA, wounding-inducible
(1997), Yamaguchi-Shinozaki and Shinozaki, Plant Cell 6, 251 (1994)
Rci2A - Cold, dehydration- Capel et al., Plant Physiol 115,
inducible 569 (1997) Rd22 - Drought, salt Yamaguchi-Shinozaki and
Shinozaki, Mol. Gen. Genet. 238, 17 (1993) Cor15A - Cold,
dehydration, Baker et al., Plant Mol. Biol. 24, ABA 701 (1994) GH3-
Auxin inducible Liu et al., Plant Cell 6, 645 (1994) ARSK1-Root,
salt inducible Hwang and Goodman, Plant J. 8, 37 (1995) PtxA -
Root, salt inducible GenBank accession X67427 SbHRGP3 - Root
specific Ahn et al., Plant Cell 8, 1477 (1998). KST1 - Guard cell
specific Plesch et al., Plant Journal. 28(4), 455- (2001) KAT1 -
Guard cell specific Plesch et al., Gene 249, 83 (2000), Nakamura et
al., Plant Physiol. 109, 371 (1995) salicylic acid inducible PCT
Application No. WO 95/19443 tetracycline inducible Gatz et al.,
Plant J. 2, 397 (1992) Ethanol inducible PCT Application No. WO
93/21334 Pathogen inducible PRP1 Ward et al., Plant. Mol. Biol. 22,
361- (1993) Heat inducible hsp80 U.S. Pat. No. 5,187,267 Cold
inducible alpha-amylase PCT Application No. WO 96/12814
Wound-inducible pinII European Patent No. 375 091 RD29A -
salt-inducible Yamaguchi-Shinozalei et al. Mol. Gen. Genet. 236,
331 (1993) Plastid-specific viral RNA- PCT Application No. WO
95/16783, PCT polymerase Application WO 97/06250
[1403] Other promoters, e.g. super-promoter (Ni et al., Plant
Journal 7, 661 (1995)), Ubiquitin promoter (Callis et al., J. Biol.
Chem., 265, 12486 (1990); U.S. Pat. No. 5,510,474; U.S. Pat. No.
6,020,190; Kawalleck et al., Plant. Molecular Biology, 21, 673
(1993)) or 34 S promoter (GenBank Accession numbers M59930 and
X16673) were similar useful for the present invention and are known
to a person skilled in the art. Developmental stage-preferred
promoters are preferentially expressed at certain stages of
development. Tissue and organ preferred promoters include those
that are preferentially expressed in certain tissues or organs,
such as leaves, roots, seeds, or xylem. Examples of tissue
preferred and organ preferred promoters include, but are not
limited to fruit-preferred, ovule-preferred, male tissue-preferred,
seed-preferred, integument-preferred, tuber-preferred,
stalk-preferred, pericarp-preferred, and leaf-preferred,
stigmapreferred, pollen-preferred, anther-preferred, a
petal-preferred, sepal-preferred, pedicelpreferred,
silique-preferred, stem-preferred, root-preferred promoters, and
the like. Seed preferred promoters are preferentially expressed
during seed development and/or germination. For example, seed
preferred promoters can be embryo-preferred, endosperm preferred,
and seed coat-preferred. See Thompson et al., BioEssays 10, 108
(1989). Examples of seed preferred promoters include, but are not
limited to, cellulose synthase (celA), Cinn1, gamma-zein,
globulin-1, maize 19 kD zein (cZ19B1), and the like.
[1404] Other promoters useful in the expression cassettes of the
invention include, but are not limited to, the major chlorophyll
a/b binding protein promoter, histone promoters, the Ap3 promoter,
the .beta.-conglycin promoter, the napin promoter, the soybean
lectin promoter, the maize 15 kD zein promoter, the 22 kD zein
promoter, the 27 kD zein promoter, the g-zein promoter, the waxy,
shrunken 1, shrunken 2 and bronze promoters, the Znn13 promoter
(U.S. Pat. No. 5,086,169), the maize polygalacturonase promoters
(PG) (U.S. Pat. Nos. 5,412,085 and 5,545,546), and the SGB6
promoter (U.S. Pat. No. 5,470,359), as well as synthetic or other
natural promoters.
[1405] Additional flexibility in controlling heterologous gene
expression in plants may be obtained by using DNA binding domains
and response elements from heterologous sources (i.e., DNA binding
domains from non-plant sources). An example of such a heterologous
DNA binding domain is the LexA DNA binding domain (Brent and
Ptashne, Cell 43, 729 (1985)).
[1406] The invention further provides a recombinant expression
vector comprising a LTRRP or YRP DNA molecule of the invention
cloned into the expression vector in an antisense orientation. That
is, the DNA molecule is operatively linked to a regulatory sequence
in a manner that allows for expression (by transcription of the DNA
molecule) of an RNA molecule that is antisense to a LTRRP or YRP
mRNA. Regulatory sequences operatively linked to a nucleic acid
molecule cloned in the antisense orientation can be chosen which
direct the continuous expression of the antisense RNA molecule in a
variety of cell types. For instance, viral promoters and/or
enhancers, or regulatory sequences can be chosen which direct
constitutive, tissue specific, or cell type specific expression of
antisense RNA. The antisense expression vector can be in the form
of a recombinant plasmid, phagemid, or attenuated virus wherein
antisense nucleic acids are produced under the control of a high
efficiency regulatory region. The activity of the regulatory region
can be determined by the cell type into which the vector is
introduced. For a discussion of the regulation of gene expression
using antisense genes, see Weintraub H. et al., Reviews--Trends in
Genetics, Vol. 1(1), 23 (1986) and Mol et al., FEBS Letters 268,
427 (1990).
[1407] Another aspect of the invention pertains to isolated LTRRP
or YRPs, and biologically active portions thereof. An "isolated" or
"purified" polypeptide or biologically active portion thereof is
free of some of the cellular material when produced by recombinant
DNA techniques, or chemical precursors or other chemicals when
chemically synthesized. The language "substantially free of
cellular material" includes preparations of LTRRP or YRP in which
the polypeptide is separated from some of the cellular components
of the cells in which it is naturally or recombinantly produced. In
one embodiment, the language "substantially free of cellular
material" includes preparations of a LTRRP or YRP having less than
about 30% (by dry weight) of non-LTRRP or YRP material (also
referred to herein as a "contaminating polypeptide"), more
preferably less than about 20% of non-LTRRP or YRP material, still
more preferably less than about 10% of non-LTRRP or YRP material,
and most preferably less than about 5% non-LTRRP or YRP
material.
[1408] When the LTRRP or YRP or biologically active portion thereof
is recombinantly produced, it is also preferably substantially free
of culture medium, i.e., culture medium represents less than about
20%, more preferably less than about 10%, and most preferably less
than about 5% of the volume of the polypeptide preparation. The
language "substantially free of chemical precursors or other
chemicals" includes preparations of LTRRP or YRP in which the
polypeptide is separated from chemical precursors or other
chemicals that are involved in the synthesis of the polypeptide. In
one embodiment, the language "substantially free of chemical
precursors or other chemicals" includes preparations of a LTRRP or
YRP having less than about 30% (by dry weight) of chemical
precursors or non-LTRRP or YRP chemicals, more preferably less than
about 20% chemical precursors or non-LTRRP or YRP chemicals, still
more preferably less than about 10% chemical precursors or
non-LTRRP or YRP chemicals, and most preferably less than about 5%
chemical precursors or non-LTRRP or YRP chemicals. In preferred
embodiments, isolated polypeptides, or biologically active portions
thereof, lack contaminating polypeptides from the same organism
from which the LTRRP or YRP is derived. Typically, such
polypeptides are produced by recombinant expression of, for
example, a S. cerevisiae, E. coli or A. thaliana, Brassica napus,
Glycine max, Zea mays or Oryza sativa, LTRRP or YRP, in an
microorganism like S. cerevisiae, E. coli, C. glutamicum, ciliates,
algae, fungi or plants, provided that the polypeptide is
recombinant expressed in an organism being different to the
original organism.
[1409] The nucleic acid molecules, polypeptides, polypeptide
homologs, fusion polypeptides, primers, vectors, and host cells
described herein can be used in one or more of the following
methods: identification of S. cerevisiae, E. coli or A. thaliana,
Brassica napus, Glycine max, Zea mays or Oryza sativa, and related
organisms; mapping of genomes of organisms related to S.
cerevisiae, Ecoli, identification and localization of S.
cerevisiae, E. coli or A. thaliana, Brassica napus, Glycine max,
Zea mays or Oryza sativa, sequences of interest; evolutionary
studies; determination of LTRRP or YRP regions required for
function; modulation of a LTRRP or YRP activity; modulation of the
metabolism of one or more cell functions; modulation of the
transmembrane transport of one or more compounds; modulation of
yield, e.g. of a yield-related trait, e.g. of tolerance to abiotic
environmental stress, e.g. to low temperature tolerance, drought
tolerance, water use efficiency, nutrient use efficiency and/or
intrinsic yield; and modulation of expression of LTRRP or YRP
nucleic acids.
[1410] The LTRRP or YRP nucleic acid molecules of the invention are
also useful for evolutionary and polypeptide structural studies.
The metabolic and transport processes in which the molecules of the
invention participate are utilized by a wide variety of prokaryotic
and eukaryotic cells; by comparing the sequences of the nucleic
acid molecules of the present invention to those encoding similar
enzymes from other organisms, the evolutionary relatedness of the
organisms can be assessed. Similarly, such a comparison permits an
assessment of which regions of the sequence are conserved and which
are not, which may aid in determining those regions of the
polypeptide that are essential for the functioning of the enzyme.
This type of determination is of value for polypeptide engineering
studies and may give an indication of what the polypeptide can
tolerate in terms of mutagenesis without losing function.
[1411] Manipulation of the LTRRP or YRP nucleic acid molecules of
the invention may result in the production of SRPs having
functional differences from the wild-type LTRRP or YRPs. These
polypeptides may be improved in efficiency or activity, may be
present in greater numbers in the cell than is usual, or may be
decreased in efficiency or activity.
[1412] There are a number of mechanisms by which the alteration of
a LTRRP or YRP of the invention may directly affect yield, e.g.
yield-related trait, for example tolerance to abiotic environmental
stress, for example drought tolerance and/or low temperature
tolerance, and/or nutrient use efficiency, intrinsic yield and/or
another mentioned yield-related trait.
[1413] The effect of the genetic modification in plants regarding
yield, e.g. yield-related trait, for example tolerance to abiotic
environmental stress, for example drought tolerance and/or low
temperature tolerance, and/or nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait can be assessed
by growing the modified plant under less than suitable conditions
and then analyzing the growth characteristics and/or metabolism of
the plant. Such analysis techniques are well known to one skilled
in the art, and include dry weight, fresh weight, polypeptide
synthesis, carbohydrate synthesis, lipid synthesis,
evapotranspiration rates, general plant and/or crop yield,
flowering, reproduction, seed setting, root growth, respiration
rates, photosynthesis rates, etc. (Applications of HPLC in
Biochemistry in: Laboratory Techniques in Biochemistry and
Molecular Biology, Vol. 17; Rehm et al., 1993 Biotechnology, Vol.
3, Chapter III: Product recovery and purification, page 469-714,
VCH: Weinheim; Belter P. A. et al., 1988, Bioseparations:
downstream processing for biotechnology, John Wiley and Sons;
Kennedy J. F., and Cabral J.M.S., 1992, Recovery processes for
biological materials, John Wiley and Sons; Shaeiwitz J. A. and
Henry J. D., 1988, Biochemical separations, in UImann's
Encyclopedia of Industrial Chemistry, Vol. B3, Chapter 11, page
1-27, VCH: Weinheim; and Dechow F. J., 1989, Separation and
purification techniques in biotechnology, Noyes Publications).
[1414] For example, yeast expression vectors comprising the nucleic
acids disclosed herein, or fragments thereof, can be constructed
and transformed into S. cerevisiae using standard protocols. The
resulting transgenic cells can then be assayed for generation or
alteration of their yield, e.g. their yield-related traits, for
example tolerance to abiotic environmental stress, for example
drought tolerance and/or low temperature tolerance, and/or nutrient
use efficiency, intrinsic yield and/or another mentioned
yield-related trait. Similarly, plant expression vectors comprising
the nucleic acids disclosed herein, or fragments thereof, can be
constructed and transformed into an appropriate plant cell such as
Arabidopsis, soy, rape, maize, cotton, rice, wheat, Medicago
truncatula, etc., using standard protocols. The resulting
transgenic cells and/or plants derived therefrom can then be
assayed for generation or alteration of their yield, e.g. their
yield-related traits, for example tolerance to abiotic
environmental stress, for example drought tolerance and/or low
temperature tolerance, and/or nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait.
[1415] The engineering of one or more genes according to table I
and coding for the LTRRP or YRP of table II of the invention may
also result in LTRRP or YRPs having altered activities which
indirectly and/or directly impact the tolerance to abiotic
environmental stress of algae, plants, ciliates, fungi, or other
microorganisms like C. glutamicum.
[1416] Additionally, the sequences disclosed herein, or fragments
thereof, can be used to generate knockout mutations in the genomes
of various organisms, such as bacteria, mammalian cells, yeast
cells, and plant cells (Girke, T., The Plant Journal 15, 39
(1998)). The resultant knockout cells can then be evaluated for
their ability or capacityfor increasing yield, e.g. increasing a
yield-related trait, for example enhancing tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, increasing intrinsic yield and/or another mentioned
yield-related trait, their response to various abiotic
environmental stress conditions, and the effect on the phenotype
and/or genotype of the mutation. For other methods of gene
inactivation, see U.S. Pat. No. 6,004,804 and Puttaraju et al.,
Nature Biotechnology 17, 246 (1999).
[1417] The aforementioned mutagenesis strategies for LTRRP or YRPs
resulting in increasing yield, e.g. increasing a yield-related
trait, for example enhancing tolerance to abiotic environmental
stress, for example increasing drought tolerance and/or low
temperature tolerance and/or increasing nutrient use efficiency,
increasing intrinsic yield and/or another mentioned yield-related
trait are not meant to be limiting; variations on these strategies
will be readily apparent to one skilled in the art. Using such
strategies, and incorporating the mechanisms disclosed herein, the
nucleic acid and polypeptide molecules of the invention may be
utilized to generate algae, ciliates, plants, fungi, or other
microorganisms like C. glutamicum expressing mutated LTRRP or YRP
nucleic acid and polypeptide molecules such that the tolerance to
abiotic environmental stress and/or yield is improved.
[1418] The present invention also provides antibodies that
specifically bind to a LTRRP or YRP, or a portion thereof, as
encoded by a nucleic acid described herein. Antibodies can be made
by many well-known methods (see, e.g. Harlow and Lane, "Antibodies;
A Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., (1988)). Briefly, purified antigen can be injected
into an animal in an amount and in intervals sufficient to elicit
an immune response. Antibodies can either be purified directly, or
spleen cells can be obtained from the animal. The cells can then
fused with an immortal cell line and screened for antibody
secretion. The antibodies can be used to screen nucleic acid clone
libraries for cells secreting the antigen. Those positive clones
can then be sequenced. See, for example, Kelly et al.,
Bio/Technology 10, 163 (1992); Bebbington et al., Bio/Technology
10, 169 (1992).
[1419] The phrases "selectively binds" and "specifically binds"
with the polypeptide refer to a binding reaction that is
determinative of the presence of the polypeptide in a heterogeneous
population of polypeptides and other biologics. Thus, under
designated immunoassay conditions, the specified antibodies bound
to a particular polypeptide do not bind in a significant amount to
other polypeptides present in the sample. Selective binding of an
antibody under such conditions may require an antibody that is
selected for its specificity for a particular polypeptide. A
variety of immunoassay formats may be used to select antibodies
that selectively bind with a particular polypeptide. For example,
solid-phase ELISA immunoassays are routinely used to select
antibodies selectively immunoreactive with a polypeptide. See
Harlow and Lane, "Antibodies, A Laboratory Manual," Cold Spring
Harbor Publications, New York, (1988), for a description of
immunoassay formats and conditions that could be used to determine
selective binding.
[1420] In some instances, it is desirable to prepare monoclonal
antibodies from various hosts. A description of techniques for
preparing such monoclonal antibodies may be found in Stites et al.,
eds., "Basic and Clinical Immunology," (Lange Medical Publications,
Los Altos, Calif., Fourth Edition) and references cited therein,
and in Harlow and Lane, "Antibodies, A Laboratory Manual," Cold
Spring Harbor Publications, New York, (1988).
[1421] Gene expression in plants is regulated by the interaction of
protein transcription factors with specific nucleotide sequences
within the regulatory region of a gene. One example of
transcription factors are polypeptides that contain zinc finger
(ZF) motifs. Each ZF module is approximately 30 amino acids long
folded around a zinc ion. The DNA recognition domain of a ZF
protein is a a-helical structure that inserts into the major grove
of the DNA double helix. The module contains three amino acids that
bind to the DNA with each amino acid contacting a single base pair
in the target DNA sequence. ZF motifs are arranged in a modular
repeating fashion to form a set of fingers that recognize a
contiguous DNA sequence. For example, a three-fingered ZF motif
will recognize 9 bp of DNA. Hundreds of proteins have been shown to
contain ZF motifs with between 2 and 37 ZF modules in each protein
(Isalan M. et al., Biochemistry 37 (35), 12026 (1998); Moore M. et
al., Proc. Natl. Acad. Sci. USA 98 (4), 1432 (2001) and Moore M. et
al., Proc. Natl. Acad. Sci. USA 98 (4), 1437 (2001); U.S. Pat. No.
6,007,988 and U.S. Pat. No. 6,013,453).
[1422] The regulatory region of a plant gene contains many short
DNA sequences (cis-acting elements) that serve as recognition
domains for transcription factors, including ZF proteins. Similar
recognition domains in different genes allow the coordinate
expression of several genes encoding enzymes in a metabolic pathway
by common transcription factors. Variation in the recognition
domains among members of a gene family facilitates differences in
gene expression within the same gene family, for example, among
tissues and stages of development and in response to environmental
conditions.
[1423] Typical ZF proteins contain not only a DNA recognition
domain but also a functional domain that enables the ZF protein to
activate or repress transcription of a specific gene.
Experimentally, an activation domain has been used to activate
transcription of the target gene (U.S. Pat. No. 5,789,538 and
patent application WO 95/19431), but it is also possible to link a
transcription repressor domain to the ZF and thereby inhibit
transcription (patent applications WO 00/47754 and WO 01/002019).
It has been reported that an enzymatic function such as nucleic
acid cleavage can be linked to the ZF (patent application WO
00/20622).
[1424] The invention provides a method that allows one skilled in
the art to isolate the regulatory region of one or more LTRRP or
YRP encoding genes from the genome of a plant cell and to design
zinc finger transcription factors linked to a functional domain
that will interact with the regulatory region of the gene. The
interaction of the zinc finger protein with the plant gene can be
designed in such a manner as to alter expression of the gene and
preferably thereby to confer increasing yield, e.g. increasing a
yield-related trait, for example enhancing tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, increasing intrinsic yield and/or another mentioned
yield-related trait.
[1425] In particular, the invention provides a method of producing
a transgenic plant with a LTRRP or YRP coding nucleic acid, wherein
expression of the nucleic acid(s) in the plant results in
increasing yield, e.g. increasing a yield-related trait, for
example enhancing tolerance to abiotic environmental stress, for
example increasing drought tolerance and/or low temperature
tolerance and/or increasing nutrient use efficiency, increasing
intrinsic yield and/or another mentioned yield-related trait as
compared to a wild type plant comprising: (a) transforming a plant
cell with an expression vector comprising a LTRRP or YRP encoding
nucleic acid, and (b) generating from the plant cell a transgenic
plant with enhanced tolerance to abiotic environmental stress
and/or increased yield as compared to a wild type plant. For such
plant transformation, binary vectors such as pBinAR can be used
(Hofgen and Willmitzer, Plant Science 66, 221 (1990)). Moreover
suitable binary vectors are for example pBIN19, pBI101, pGPTV or
pPZP (Hajukiewicz P. et al., Plant Mol. Biol., 25, 989 (1994)).
[1426] Construction of the binary vectors can be performed by
ligation of the cDNA into the T-DNA. 5' to the cDNA a plant
promoter activates transcription of the cDNA. A polyadenylation
sequence is located 3' to the cDNA. Tissue-specific expression can
be achieved by using a tissue specific promoter as listed above.
Also, any other promoter element can be used. For constitutive
expression within the whole plant, the CaMV 35S promoter can be
used. The expressed protein can be targeted to a cellular
compartment using a signal peptide, for example for plastids,
mitochondria or endoplasmic reticulum (Kermode, Crit. Rev. Plant
Sci. 4 (15), 285 (1996)). The signal peptide is cloned 5' in frame
to the cDNA to archive subcellular localization of the fusion
protein. One skilled in the art will recognize that the promoter
used should be operatively linked to the nucleic acid such that the
promoter causes transcription of the nucleic acid which results in
the synthesis of a mRNA which encodes a polypeptide.
[1427] Alternate methods of transfection include the direct
transfer of DNA into developing flowers via electroporation or
Agrobacterium mediated gene transfer. Agrobacterium mediated plant
transformation can be performed using for example the GV3101(pMP90)
(Koncz and Schell, Mol. Gen. Genet. 204, 383 (1986)) or LBA4404
(Ooms et al., Plasmid, 7, 15 (1982); Hoekema et al., Nature, 303,
179 (1983)) Agrobacterium tumefaciens strain. Transformation can be
performed by standard transformation and regeneration techniques
(Deblaere et al., Nucl. Acids. Res. 13, 4777 (1994); Gelvin and
Schilperoort, Plant Molecular Biology Manual, 2nd Ed.--Dordrecht:
Kluwer Academic Publ., 1995. --in Sect., Ringbuc Zentrale Signatur:
BT11-P ISBN 0-7923-2731-4; Glick B. R. and Thompson J. E., Methods
in Plant Molecular Biology and Biotechnology, Boca Raton: CRC
Press, 1993. --360 S., ISBN 0-8493-5164-2). For example, rapeseed
can be transformed via cotyledon or hypocotyl transformation
(Moloney et al., Plant Cell Reports 8, 238 (1989); De Block et al.,
Plant Physiol. 91, 694 (1989)). Use of antibiotics for
Agrobacterium and plant selection depends on the binary vector and
the Agrobacterium strain used for transformation. Rapeseed
selection is normally performed using kanamycin as selectable plant
marker. Agrobacterium mediated gene transfer to flax can be
performed using, for example, a technique described by Mlynarova et
al., Plant Cell Report 13, 282 (1994)). Additionally,
transformation of soybean can be performed using for example a
technique described in European Patent No. 424 047, U.S. Pat. No.
5,322,783, European Patent No. 397 687, U.S. Pat. No. 5,376,543 or
U.S. Pat. No. 5,169,770. Transformation of maize can be achieved by
particle bombardment, polyethylene glycol mediated DNA uptake or
via the silicon carbide fiber technique (see, for example, Freeling
and Walbot "The maize handbook" Springer Verlag: New York (1993)
ISBN 3-540-97826-7). A specific example of maize transformation is
found in U.S. Pat. No. 5,990,387 and a specific example of wheat
transformation can be found in PCT Application No. WO 93/07256.
[1428] Growing the modified plants under defined N-conditions, in
an especial embodiment under abiotic environmental stress
conditions, and then screening and analyzing the growth
characteristics and/or metabolic activity assess the effect of the
genetic modification in plants on increasing yield, e.g. increasing
a yield-related trait, for example enhancing tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, increasing intrinsic yield and/or another mentioned
yield-related trait. Such analysis techniques are well known to one
skilled in the art.
[1429] They include beneath to screening (Rompp Lexikon
Biotechnologie, Stuttgart/New York: Georg Thieme Verlag 1992,
"screening" p. 701) dry weight, fresh weight, protein synthesis,
carbohydrate synthesis, lipid synthesis, evapotranspiration rates,
general plant and/or crop yield, flowering, reproduction, seed
setting, root growth, respiration rates, photosynthesis rates, etc.
(Applications of HPLC in Biochemistry in: Laboratory Techniques in
Biochemistry and Molecular Biology, Vol. 17; Rehm et al., 1993
Biotechnology, Vol. 3, Chapter III: Product recovery and
purification, page 469-714, VCH: Weinheim; Belter, P. A. et al.,
1988 Bioseparations: downstream processing for biotechnology, John
Wiley and Sons; Kennedy J. F. and Cabral J.M.S., 1992 Recovery
processes for biological materials, John Wiley and Sons; Shaeiwitz
J. A. and Henry J. D., 1988 Biochemical separations, in: Ullmann's
Encyclopedia of Industrial Chemistry, Vol. B3, Chapter 11, page
1-27, VCH: Weinheim; and Dechow F. J. (1989) Separation and
purification techniques in biotechnology, Noyes Publications).
[1430] In one embodiment, the present invention relates to a method
for the identification of a gene product conferring in increasing
yield, e.g. increasing a yield-related trait, for example enhancing
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, increasing intrinsic yield
and/or another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type cell in a cell of an
organism for example plant, comprising the following steps: [1431]
(a) contacting, e.g. hybridizing, some or all nucleic acid
molecules of a sample, e.g. cells, tissues, plants or
microorganisms or a nucleic acid library, which can contain a
candidate gene encoding a gene product conferring increasing yield,
e.g. increasing a yield-related trait, for example enhancing
tolerance to abiotic environmental stress, for example increasing
drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, increasing i, with a nucleic
acid molecule as shown in column 5 or 7 of table I A or B, or a
functional homologue thereof; [1432] (b) identifying the nucleic
acid molecules, which hybridize under relaxed stringent conditions
with said nucleic acid molecule, in particular to the nucleic acid
molecule sequence shown in column 5 or 7 of table I, and,
optionally, isolating the full length cDNA clone or complete
genomic clone; [1433] (c) identifying the candidate nucleic acid
molecules or a fragment thereof in host cells, preferably in a
plant cell; [1434] (d) increasing the expressing of the identified
nucleic acid molecules in the host cells for which enhanced
tolerance to abiotic environmental stress and/or increased yield
are desired; [1435] (e) assaying the level of enhanced tolerance to
abiotic environmental stress and/or increased yield of the host
cells; and [1436] (f) identifying the nucleic acid molecule and its
gene product which confers increasing yield, e.g. increasing a
yield-related trait, for example enhancing tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, increasing intrinsic yield and/or another mentioned
yield-related trait in the host cell compared to the wild type.
[1437] Relaxed hybridization conditions are: After standard
hybridization procedures washing steps can be performed at low to
medium stringency conditions usually with washing conditions of
40.degree.-55.degree. C. and salt conditions between 2.times.SSC
and 0.2.times.SSC with 0.1% SDS in comparison to stringent washing
conditions as e.g. 60.degree. to 68.degree. C. with 0.1% SDS.
Further examples can be found in the references listed above for
the stringent hybridization conditions. Usually washing steps are
repeated with increasing stringency and length until a useful
signal to noise ratio is detected and depend on many factors as the
target, e.g. its purity, GC-content, size etc, the probe, e.g. its
length, is it a RNA or a DNA probe, salt conditions, washing or
hybridization temperature, washing or hybridization time etc.
[1438] In another embodiment, the present invention relates to a
method for the identification of a gene product the expression of
which confers increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
intrinsic yield and/or another mentioned yield-related trait in a
cell, comprising the following steps: [1439] (a) identifying a
nucleic acid molecule in an organism, which is at least 20%,
preferably 25%, more preferably 30%, even more preferred are 35%.
40% or 50%, even more preferred are 60%, 70% or 80%, most preferred
are 90% or 95% or more homolog to the nucleic acid molecule
encoding a protein comprising the polypeptide molecule as shown in
column 5 or 7 of table II, or comprising a consensus sequence or a
polypeptide motif as shown in column 7 of table IV, or being
encoded by a nucleic acid molecule comprising a polynucleotide as
shown in column 5 or 7 of table I application no. 1, or a homologue
thereof as described herein, for example via homology search in a
data bank; [1440] (b) enhancing the expression of the identified
nucleic acid molecules in the host cells; [1441] (c) assaying the
level of enhancement of in increasing yield, e.g. increasing a
yield-related trait, for example enhancing tolerance to abiotic
environmental stress, for example increasing drought tolerance
and/or low temperature tolerance and/or increasing nutrient use
efficiency, increasing intrinsic yield and/or another mentioned
yield-related trait in the host cells; and [1442] (d) identifying
the host cell, in which the enhanced expression confers in
increasing yield, e.g. increasing a yield-related trait, for
example enhancing tolerance to abiotic environmental stress, for
example increasing drought tolerance and/or low temperature
tolerance and/or increasing nutrient use efficiency, increasing
intrinsic yield and/or another mentioned yield-related trait in the
host cell compared to a wild type.
[1443] Further, the nucleic acid molecule disclosed herein, in
particular the nucleic acid molecule shown column 5 or 7 of table I
A or B, may be sufficiently homologous to the sequences of related
species such that these nucleic acid molecules may serve as markers
for the construction of a genomic map in related organism or for
association mapping. Furthermore natural variation in the genomic
regions corresponding to nucleic acids disclosed herein, in
particular the nucleic acid molecule shown column 5 or 7 of table I
A or B, or homologous thereof may lead to variation in the activity
of the proteins disclosed herein, in particular the proteins
comprising polypeptides as shown in column 5 or 7 of table II A or
B, or comprising the consensus sequence or the polypeptide motif as
shown in column 7 of table IV, and their homolgous and in
consequence in a natural variation of an increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, and/or another mentioned yield-related
trait.
[1444] In consequence natural variation eventually also exists in
form of more active allelic variants leading already to a relative
increase in yield, e.g. an increase in an yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example drought tolerance and/or low temperature tolerance and/or
nutrient use efficiency, and/or another mentioned yield-related
trait. Different variants of the nucleic acids molecule disclosed
herein, in particular the nucleic acid comprising the nucleic acid
molecule as shown column 5 or 7 of table I A or B, which
corresponds to different levels of increased yield, e.g. different
levels of increased yield-related trait, for example different
enhancing tolerance to abiotic environmental stress, for example
increased drought tolerance and/or low temperature tolerance and/or
increasing nutrient use efficiency, increasing intrinsic yield
and/or another mentioned yield-related trait, can be indentified
and used for marker assisted breeding for an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, and/or another mentioned yield-related
trait.
[1445] Accordingly, the present invention relates to a method for
breeding plants with an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, and/or increased intrinsic yield and/or another
yield-related trait, comprising [1446] (a) selecting a first plant
variety with an increased yield, e.g. an increased yield-related
trait, for example enhanced tolerance to abiotic environmental
stress, for example an increased drought tolerance and/or low
temperature tolerance and/or an increased nutrient use efficiency,
and/or increased intrinsic yield and/or anotanother yield-related
trait based on increased expression of a nucleic acid of the
invention as disclosed herein, in particular of a nucleic acid
molecule comprising a nucleic acid molecule as shown in column 5 or
7 of table I A or B, or a polypeptide comprising a polypeptide as
shown in column 5 or 7 of table II A or B, or comprising a
consensus sequence or a polypeptide motif as shown in column 7 of
table IV, or a homologue thereof as described herein; [1447] (b)
associating the level of increased yield, e.g. increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, intrinsic yield and/or another mentioned yield-related
trait with the expression level or the genomic structure of a gene
encoding said polypeptide or said nucleic acid molecule; [1448] (c)
crossing the first plant variety with a second plant variety, which
significantly differs in its level of increased yield, e.g.
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, and/or another mentioned yield-related
trait; and [1449] (d) identifying, which of the offspring varieties
has got increased levels of an increased yield, e.g. an increased
yield-related trait, for example enhanced tolerance to abiotic
environmental stress, for example an increased drought tolerance
and/or low temperature tolerance and/or an increased nutrient use
efficiency, and/or another mentioned yield-related trait by the
expression level of said polypeptide or nucleic acid molecule or
the genomic structure of the genes encoding said polypeptide or
nucleic acid molecule of the invention.
[1450] In one embodiment, the expression level of the gene
according to step (b) is increased.
[1451] Yet another embodiment of the invention relates to a process
for the identification of a compound conferring an increased yield,
e.g. an increased yield-related trait, for example enhanced
tolerance to abiotic environmental stress, for example an increased
drought tolerance and/or low temperature tolerance and/or an
increased nutrient use efficiency, and/or another mentioned
yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof in
a plant cell, a plant or a part thereof, a plant or a part thereof,
comprising the steps: [1452] (a) culturing a plant cell; a plant or
a part thereof maintaining a plant expressing the polypeptide as
shown in column 5 or 7 of table II, or being encoded by a nucleic
acid molecule comprising a polynucleotide as shown in column 5 or 7
of table I, or a homologue thereof as described herein or a
polynucleotide encoding said polypeptide and conferring with
increased yield, e.g. with an increased yield-related trait, for
example enhanced tolerance to abiotic environmental stress, for
example an increased drought tolerance and/or low temperature
tolerance and/or an increased nutrient use efficiency, intrinsic
yield and/or another mentioned yield-related trait as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof; a non-transformed wild type plant or a part
thereof and providing a readout system capable of interacting with
the polypeptide under suitable conditions which permit the
interaction of the polypeptide with this readout system in the
presence of a chemical compound or a sample comprising a plurality
of chemical compounds and capable of providing a detectable signal
in response to the binding of a chemical compound to said
polypeptide under conditions which permit the expression of said
readout system and of the protein as shown in column 5 or 7 of
table II, or being encoded by a nucleic acid molecule comprising a
polynucleotide as shown in column 5 or 7 of table I application no.
1, or a homologue thereof as described herein; and [1453] (b)
identifying if the chemical compound is an effective agonist by
detecting the presence or absence or decrease or increase of a
signal produced by said readout system.
[1454] Said compound may be chemically synthesized or
microbiologically produced and/or comprised in, for example,
samples, e.g., cell extracts from, e.g., plants, animals or
microorganisms, e.g. pathogens. Furthermore, said compound(s) may
be known in the art but hitherto not known to be capable of
suppressing the polypeptide of the present invention. The reaction
mixture may be a cell free extract or may comprise a cell or tissue
culture. Suitable set ups for the process for identification of a
compound of the invention are known to the person skilled in the
art and are, for example, generally described in Alberts et al.,
Molecular Biology of the Cell, third edition (1994), in particular
Chapter 17. The compounds may be, e.g., added to the reaction
mixture, culture medium, injected into the cell or sprayed onto the
plant.
[1455] If a sample containing a compound is identified in the
process, then it is either possible to isolate the compound from
the original sample identified as containing the compound capable
of activating or enhancing or increasing the yield, e.g.
yield-related trait, for example tolerance to abiotic environmental
stress, for example drought tolerance and/or low temperature
tolerance and/or increased nutrient use efficiency, and/or another
mentioned yield-related trait as compared to a corresponding, e.g.
non-transformed, wild type, or one can further subdivide the
original sample, for example, if it consists of a plurality of
different compounds, so as to reduce the number of different
substances per sample and repeat the method with the subdivisions
of the original sample. Depending on the complexity of the samples,
the steps described above can be performed several times,
preferably until the sample identified according to the said
process only comprises a limited number of or only one
substance(s). Preferably said sample comprises substances of
similar chemical and/or physical properties, and most preferably
said substances are identical. Preferably, the compound identified
according to the described method above or its derivative is
further formulated in a form suitable for the application in plant
breeding or plant cell and tissue culture.
[1456] The compounds which can be tested and identified according
to said process may be expression libraries, e.g., cDNA expression
libraries, peptides, proteins, nucleic acids, antibodies, small
organic compounds, hormones, peptidomimetics, PNAs or the like
(Milner, Nature Medicine 1, 879 (1995); Hupp, Cell 83, 237 (1995);
Gibbs, Cell 79, 193 (1994), and references cited supra). Said
compounds can also be functional derivatives or analogues of known
inhibitors or activators. Methods for the preparation of chemical
derivatives and analogues are well known to those skilled in the
art and are described in, for example, Beilstein, Handbook of
Organic Chemistry, Springer, New York Inc., 175 Fifth Avenue, New
York, N.Y. 10010 U.S.A. and Organic Synthesis, Wiley, New York,
USA. Furthermore, said derivatives and analogues can be tested for
their effects according to methods known in the art. Furthermore,
peptidomimetics and/or computer aided design of appropriate
derivatives and analogues can be used, for example, according to
the methods described above. The cell or tissue that may be
employed in the process preferably is a host cell, plant cell or
plant tissue of the invention described in the embodiments
hereinbefore.
[1457] Thus, in a further embodiment the invention relates to a
compound obtained or identified according to the method for
identifying an agonist of the invention said compound being an
antagonist of the polypeptide of the present invention.
[1458] Accordingly, in one embodiment, the present invention
further relates to a compound identified by the method for
identifying a compound of the present invention.
[1459] In one embodiment, the invention relates to an antibody
specifically recognizing the compound or agonist of the present
invention.
[1460] The invention also relates to a diagnostic composition
comprising at least one of the aforementioned nucleic acid
molecules, antisense nucleic acid molecule, RNAi, snRNA, dsRNA,
siRNA, miRNA, ta-siRNA, co-suppression molecule, ribozyme, vectors,
proteins, antibodies or compounds of the invention and optionally
suitable means for detection.
[1461] The diagnostic composition of the present invention is
suitable for the isolation of mRNA from a cell and contacting the
mRNA so obtained with a probe comprising a nucleic acid probe as
described above under hybridizing conditions, detecting the
presence of mRNA hybridized to the probe, and thereby detecting the
expression of the protein in the cell. Further methods of detecting
the presence of a protein according to the present invention
comprise immunotechniques well known in the art, for example enzyme
linked immunoadsorbent assay. Furthermore, it is possible to use
the nucleic acid molecules according to the invention as molecular
markers or primers in plant breeding. Suitable means for detection
are well known to a person skilled in the art, e.g. buffers and
solutions for hybridization assays, e.g. the afore-mentioned
solutions and buffers, further and means for Southern-, Western-,
Northern- etc. --blots, as e.g. described in Sambrook et al. are
known. In one embodiment diagnostic composition contain PCR primers
designed to specifically detect the presence or the expression
level of the nucleic acid molecule to be reduced in the process of
the invention, e.g. of the nucleic acid molecule of the invention,
or to discriminate between different variants or alleles of the
nucleic acid molecule of the invention or which activity is to be
reduced in the process of the invention.
[1462] In another embodiment, the present invention relates to a
kit comprising the nucleic acid molecule, the vector, the host
cell, the polypeptide, or the antisense, RNAi, snRNA, dsRNA, siRNA,
miRNA, ta-siRNA, co-suppression molecule, or ribozyme molecule, or
the viral nucleic acid molecule, the antibody, plant cell, the
plant or plant tissue, the harvestable part, the propagation
material and/or the compound and/or agonist identified according to
the method of the invention.
[1463] The compounds of the kit of the present invention may be
packaged in containers such as vials, optionally with/in buffers
and/or solution. If appropriate, one or more of said components
might be packaged in one and the same container. Additionally or
alternatively, one or more of said components might be adsorbed to
a solid support as, e.g. a nitrocellulose filter, a glass plate, a
chip, or a nylon membrane or to the well of a micro titer plate.
The kit can be used for any of the herein described methods and
embodiments, e.g. for the production of the host cells, transgenic
plants, pharmaceutical compositions, detection of homologous
sequences, identification of antagonists or agonists, as food or
feed or as a supplement thereof or as supplement for the treating
of plants, etc. Further, the kit can comprise instructions for the
use of the kit for any of said embodiments. In one embodiment said
kit comprises further a nucleic acid molecule encoding one or more
of the aforementioned protein, and/or an antibody, a vector, a host
cell, an anti-sense nucleic acid, a plant cell or plant tissue or a
plant. In another embodiment said kit comprises PCR primers to
detect and discriminate the nucleic acid molecule to be reduced in
the process of the invention, e.g. of the nucleic acid molecule of
the invention.
[1464] In a further embodiment, the present invention relates to a
method for the production of an agricultural composition providing
the nucleic acid molecule for the use according to the process of
the invention, the nucleic acid molecule of the invention, the
vector of the invention, the antisense, RNAi, snRNA, dsRNA, siRNA,
miRNA, ta-siRNA, co-suppression molecule, ribozyme, or antibody of
the invention, the viral nucleic acid molecule of the invention, or
the polypeptide of the invention or comprising the steps of the
method according to the invention for the identification of said
compound or agonist; and formulating the nucleic acid molecule, the
vector or the polypeptide of the invention or the agonist, or
compound identified according to the methods or processes of the
present invention or with use of the subject matters of the present
invention in a form applicable as plant agricultural
composition.
[1465] In another embodiment, the present invention relates to a
method for the production of the plant culture composition
comprising the steps of the method of the present invention; and
formulating the compound identified in a form acceptable as
agricultural composition.
[1466] Under "acceptable as agricultural composition" is
understood, that such a composition is in agreement with the laws
regulating the content of fungicides, plant nutrients, herbicides,
etc. Preferably such a composition is without any harm for the
protected plants and the animals (humans included) fed
therewith.
[1467] Throughout this application, various publications are
referenced. The disclosures of all of these publications and those
references cited within those publications in their entireties are
hereby incorporated by reference into this application in order to
more fully describe the state of the art to which this invention
pertains.
[1468] It should also be understood that the foregoing relates to
preferred embodiments of the present invention and that numerous
changes and variations may be made therein without departing from
the scope of the invention. The invention is further illustrated by
the following examples, which are not to be construed in any way as
limiting. On the contrary, it is to be clearly understood that
various other embodiments, modifications and equivalents thereof,
which, after reading the description herein, may suggest themselves
to those skilled in the art without departing from the spirit of
the present invention and/or the scope of the claims.
[1469] In one embodiment, the increased yield results in an
increase of the production of a specific ingredient including,
without limitation, an enhanced and/or improved sugar content or
sugar composition, an enhanced or improved starch content and/or
starch composition, an enhanced and/or improved oil content and/or
oil composition (such as enhanced seed oil content), an enhanced or
improved protein content and/or protein composition (such as
enhanced seed protein content), an enhanced and/or improved vitamin
content and/or vitamin composition, or the like.
[1470] Incorporated by reference are further the following
applications of which the present applications claims the priority:
EP07116983.3, EP 07119635.6, 08153046.1, EP 08157331.3, and
EP08162290.4.
[1471] Accordingly, the present invention relates to also to method
for producing a transgenic plant cell, a plant or a part thereof
with enhanced tolerance and/or resistance to abiotic environmental
stress and/or increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof by
increasing or generating, in said plant cell or plant or part
thereof, one or more activities selected from the group consisting
of (DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein.
[1472] Accordingly, the present invention relates to also to a
method for producing a transgenic plant cell, a plant or a part
thereof with enhanced tolerance and/or resistance to abiotic
environmental stress and/or increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof by increasing or generating, in said plant cell
or plant or part thereof, one or more activities of at least one
polypeptide comprising a polypeptide selected from the group
consisting of: [1473] (i) a polypeptide comprising a polypeptide, a
consensus sequence or at least one polypeptide motif as depicted in
column 5 or 7 of table II or of table IV, respectively; or [1474]
(ii) an expression product of a nucleic acid molecule comprising a
polynucleotide as depicted in column 5 or 7 of table I, [1475]
(iii) or a functional equivalent of (i) or (ii).
[1476] Accordingly, the present invention relates to further to a
method for producing a transgenic plant cell, a plant or a part
thereof with enhanced tolerance and/or resistance to abiotic
environmental stress and/or increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof by increasing or generating, in said plant cell
or plant or part thereof, one or more activities by increasing the
expression of at least one nucleic acid molecule comprising a
nucleic acid molecule selected from the group consisting of: [1477]
(a) a nucleic acid molecule encoding the polypeptide shown in
column 5 or 7 of table II; [1478] (b) a nucleic acid molecule shown
in column 5 or 7 of table I; [1479] (c) a nucleic acid molecule,
which, as a result of the degeneracy of the genetic code, can be
derived from a polypeptide sequence depicted in column 5 or 7 of
table II and confers an enhanced tolerance and/or resistance to
abiotic environmental stress and/or increased yield as compared to
a corresponding, e.g. non-transformed, wild type plant cell, a
plant or a part thereof; [1480] (d) a nucleic acid molecule having
at least 30% identity with the nucleic acid molecule sequence of a
polynucleotide comprising the nucleic acid molecule shown in column
5 or 7 of table I and confers an enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or a part thereof; [1481] (e) a nucleic acid
molecule encoding a polypeptide having at least 30% identity with
the amino acid sequence of the polypeptide encoded by the nucleic
acid molecule of (a) to (c) and having the activity represented by
a nucleic acid molecule comprising a polynucleotide as depicted in
column 5 of table I and confers an enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or a part thereof; [1482] (f) nucleic acid
molecule which hybridizes with a nucleic acid molecule of (a) to
(c) under stringent hybridization conditions and confers an
enhanced tolerance and/or resistance to abiotic environmental
stress and/or increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1483] (g) a nucleic acid molecule encoding a polypeptide which can
be isolated with the aid of monoclonal or polyclonal antibodies
made against a polypeptide encoded by one of the nucleic acid
molecules of (a) to (e) and having the activity represented by the
nucleic acid molecule comprising a polynucleotide as depicted in
column 5 of table I; [1484] (h) a nucleic acid molecule encoding a
polypeptide comprising the consensus sequence or one or more
polypeptide motifs as shown in column 7 of table IV and preferably
having the activity represented by a nucleic acid molecule
comprising a polynucleotide as depicted in column 5 of table II or
IV; [1485] (i) a nucleic acid molecule encoding a polypeptide
having the activity represented by a protein as depicted in column
5 of table II and confers enhanced tolerance and/or resistance to
abiotic environmental stress and/or increased yield as compared to
a corresponding, e.g. non-transformed, wild type plant cell, a
plant or a part thereof; [1486] (j) nucleic acid molecule which
comprises a polynucleotide, which is obtained by amplifying a cDNA
library or a genomic library using the primers in column 7 of table
III which do not start at their 5'-end with the nucleotides ATA and
preferably having the activity represented by a nucleic acid
molecule comprising a polynucleotide as depicted in column 5 of
table II or IV; and [1487] (k) a nucleic acid molecule which is
obtainable by screening a suitable nucleic acid library under
stringent hybridization conditions with a probe comprising a
complementary sequence of a nucleic acid molecule of (a) or (b) or
with a fragment thereof, having at least 15 nt, preferably 20 nt,
30 nt, 50 nt, 100 nt, 200 nt or 500 nt of a nucleic acid molecule
complementary to a nucleic acid molecule sequence characterized in
(a) to (e) and encoding a polypeptide having the activity
represented by a protein comprising a polypeptide as depicted in
column 5 of table II.
[1488] Accordingly, the present invention relates to also to the
method of the invention, wherein the one or more activities
increased or generated are selected from the group consisting of
(DL)glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate phosphatase,
3-methyl-2-oxobutanoate hydroxymethyltransferase, alcohol
acetyltransferase, amino acid permease, aminomethyltransferase,
ammonium transporter, aquaporin, Arabinose transport system
ATP-binding protein, Argininosuccinate synthase, aspartate
aminotransferase, B1906-protein, B3410-protein, cardiolipin
synthetase, CoA-transferase-like protein (NAD(P)-binding), cobalt
transport protein, DNA and protein binding protein for controlling
the proteome at post-transcriptional level, Enoyl CoA hydratase,
enoyl-CoA hydratase, enoyl-CoA isomerase, ethanolamine kinase,
formate acetyltransferase 1, glucitol/sorbitol-specific enzyme IIA
component protein, glutamine synthetase, glutathione S-transferase,
glycerol dehydrogenase, Glycogen synthesis initiator protein,
GTP-binding protein, Heat shock protein, hexose transporter,
holo-[acyl-carrier-protein] synthase, inorganic phosphate
transporter, lanosterol synthase, Molybdenum-binding subunit of
aldehyde oxidases and xanthine dehydrogenases, multidrug resistance
protein, multiple drug resistance protein, NADH
dehydrogenase/NAD(P)H nitroreductase, oxidoreductase,
peptidyl-prolyl cis-trans isomerase, Peroxisomal targeting signal 2
receptor, Phosphoadenosine phosphosulfate reductase, Phosphocarrier
protein, Pirin-like protein, precorrin-6y methylase, protein
required for degradation of glycoproteins, pyrimidine
deaminase/reductase, Regulator of cell morphogenesis and NO
signaling, serine acetyltransferase, signalosome complex subunit,
SLR1094-protein, subunit of TORC1, thiol-specific monooxygenase,
transcriptional regulatory protein, transketolase, two-module
transport protein, uridine diphosphate-N-acetylglucosamine
transporter, yer175w-a-protein, yhr213w-a-protein, YML079W-protein,
YMR157c-protein, YNL024C-protein, and YNR040W-protein.
[1489] Accordingly, the present invention relates to also to a
trangenic plant cell, a plant or a part thereof with enhanced
tolerance and/or resistance to abiotic environmental stress and/or
increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof
produced by a method of the invention.
[1490] Accordingly, the present invention relates to also to the
transgenic plant cell, a plant or a part thereof of the invention
derived from a monocotyledonous plant.
[1491] Accordingly, the present invention relates to also to the
transgenic plant cell, a plant or a part thereof of the invention
derived from a dicotyledonous plant.
[1492] Accordingly, the present invention relates to also to the
transgenic plant cell, a plant or a part thereof of the invention,
wherein the plant is selected from the group consisting of corn
(maize), wheat, rye, oat, triticale, rice, barley, soybean, peanut,
cotton, oil seed rape, including canola and winter oil seed rape,
manihot, pepper, sunflower, flax, borage, safflower, linseed,
primrose, rapeseed, turnip rape, tagetes, solanaceous plants
comprising potato, tobacco, eggplant, tomato; Vicia species, pea,
alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut,
perennial grass, forage crops and Arabidopsis thaliana.
[1493] Accordingly, the present invention relates to also to the
transgenic plant cell, a plant or a part thereof of the invention,
wherein the plant is selected from the group consisting of corn,
soy, oil seed rape (including canola and winter oil seed rape),
cotton, wheat and rice.
[1494] Accordingly, the present invention relates to also to a seed
produced by a transgenic plant of the invention, wherein the seed
is genetically homozygous for a transgene conferring enhanced
tolerance and/or resistance to abiotic environmental stress and/or
increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part
thereof.
[1495] Accordingly, the present invention relates to also to an
isolated nucleic acid molecule comprising a nucleic acid molecule
selected from the group consisting of: [1496] (a) a nucleic acid
molecule encoding the polypeptide shown in column 5 or 7 of table
II B; [1497] (b) a nucleic acid molecule shown in column 5 or 7 of
table I B; [1498] (c) a nucleic acid molecule, which, as a result
of the degeneracy of the genetic code, can be derived from a
polypeptide sequence depicted in column 5 or 7 of table II and
confers an enhanced tolerance and/or resistance to abiotic
environmental stress and/or increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof; [1499] (d) a nucleic acid molecule having at
least 30% identity with the nucleic acid molecule sequence of a
polynucleotide comprising the nucleic acid molecule shown in column
5 or 7 of table I and confers an enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or a part thereof; [1500] (e) a nucleic acid
molecule encoding a polypeptide having at least 30% identity with
the amino acid sequence of the polypeptide encoded by the nucleic
acid molecule of (a) to (c) and having the activity represented by
a nucleic acid molecule comprising a polynucleotide as depicted in
column 5 of table I and confers an enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or a part thereof; [1501] (f) nucleic acid
molecule which hybridizes with a nucleic acid molecule of (a) to
(c) under stringent hybridization conditions and confers an
enhanced tolerance and/or resistance to abiotic environmental
stress and/or increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof;
[1502] (g) a nucleic acid molecule encoding a polypeptide which can
be isolated with the aid of monoclonal or polyclonal antibodies
made against a polypeptide encoded by one of the nucleic acid
molecules of (a) to (e) and having the activity represented by the
nucleic acid molecule comprising a polynucleotide as depicted in
column 5 of table I; [1503] (h) a nucleic acid molecule encoding a
polypeptide comprising the consensus sequence or one or more
polypeptide motifs as shown in column 7 of table IV and preferably
having the activity represented by a nucleic acid molecule
comprising a polynucleotide as depicted in column 5 of table II or
IV; [1504] (i) a nucleic acid molecule encoding a polypeptide
having the activity represented by a protein as depicted in column
5 of table II and confers an enhanced tolerance and/or resistance
to abiotic environmental stress and/or increased yield as compared
to a corresponding, e.g. non-transformed, wild type plant cell, a
plant or a part thereof; [1505] (j) nucleic acid molecule which
comprises a polynucleotide, which is obtained by amplifying a cDNA
library or a genomic library using the primers in column 7 of table
III which do not start at their 5'-end with the nucleotides ATA and
preferably having the activity represented by a nucleic acid
molecule comprising a polynucleotide as depicted in column 5 of
table II or IV; and [1506] (k) a nucleic acid molecule which is
obtainable by screening a suitable nucleic acid library under
stringent hybridization conditions with a probe comprising a
complementary sequence of a nucleic acid molecule of (a) or (b) or
with a fragment thereof, having at least 15 nt, preferably 20 nt,
30 nt, 50 nt, 100 nt, 200 nt or 500 nt of a nucleic acid molecule
complementary to a nucleic acid molecule sequence characterized in
(a) to (e) and encoding a polypeptide having the activity
represented by a protein comprising a polypeptide as depicted in
column 5 of table II;
[1507] whereby the nucleic acid molecule according to (a) to (k) is
at least in one or more nucleotides different from the sequence
depicted in column 5 or 7 of table I A and preferably which encodes
a protein which differs at least in one or more amino acids from
the protein sequences depicted in column 5 or 7 of table II A.
[1508] Accordingly, the present invention also relates to a nucleic
acid construct which confers the expression of said nucleic acid
molecule of the invention, comprising one or more regulatory
elements, whereby expression of the nucleic acid in a host cell
results in enhanced tolerance and/or resistance to abiotic
environmental stress and/or increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or a part thereof.
[1509] Accordingly, the present invention also relates to a vector
comprising the nucleic acid molecule of the invention or the
nucleic acid construct of the invention, whereby expression of said
coding nucleic acid in a host cell results in enhanced tolerance
and/or resistance to abiotic environmental stress and/or increased
yield as compared to a corresponding, e.g. non-transformed, wild
type plant cell, a plant or a part thereof.
[1510] Accordingly, the present invention also relates to a host
cell, which has been transformed stably or transiently with the
vector of the invention or the nucleic acid molecule of the
invention or the nucleic acid construct of the invention and which
shows due to the transformation an enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or a part thereof.
[1511] Accordingly, the present invention also relates to a process
for producing a polypeptide, wherein the polypeptide is expressed
in a host cell of the invention.
[1512] Accordingly, the present invention also relates to a
polypeptide produced by the process of the invention or encoded by
the nucleic acid molecule of the invention whereby the polypeptide
distinguishes over the sequence as shown in table II by one or more
amino acids
[1513] Accordingly, the present invention also relates to an
antibody, which binds specifically to the polypeptide of the
invention.
[1514] Accordingly, the present invention also relates to a plant
tissue, propagation material, harvested material or a plant
comprising the host cell of the invention.
[1515] Accordingly, the present invention also relates to a process
for the identification of a compound conferring an enhanced
tolerance and/or resistance to abiotic environmental stress and/or
increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof in
a plant cell, a plant or a part thereof, a plant or a part thereof,
comprising the steps: [1516] (a) culturing a plant cell; a plant or
a part thereof maintaining a plant expressing the polypeptide
encoded by the nucleic acid molecule of the invention conferring an
enhanced tolerance and/or resistance to abiotic environmental
stress and/or increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell, a plant or a part thereof; a
non-transformed wild type plant or a part thereof and a readout
system capable of interacting with the polypeptide under suitable
conditions which permit the interaction of the polypeptide with
said readout system in the presence of a compound or a sample
comprising a plurality of compounds and capable of providing a
detectable signal in response to the binding of a compound to said
polypeptide under conditions which permit the expression of said
readout system and of the polypeptide encoded by the nucleic acid
molecule of the invention conferring an enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or a part thereof; a non-transformed wild type
plant or a part thereof; [1517] (b) identifying if the compound is
an effective agonist by detecting the presence or absence or
increase of a signal produced by said readout system.
[1518] Accordingly, the present invention also relates to a method
for the production of an agricultural composition comprising the
steps of the method of the invention and formulating the compound
identified in said method of the invention for identification of
such a compound in a form acceptable for an application in
agriculture.
[1519] Accordingly, the present invention also relates to a
composition comprising the nucleic acid molecule of any of the
invention, the polypeptide of the invention, the nucleic acid
construct of the invention, the vector of the invention, the
compound of the invention, the antibody of the invention, and
optionally an agricultural acceptable carrier.
[1520] Accordingly, the present invention also relates to an
isolated polypeptide as depicted in table II, preferably table II B
which is selected from yeast, preferably Saccharomyces cerevisiae,
or E. coli.
[1521] Accordingly, the present invention also relates to a method
of producing a transgenic plant cell, a plant or a part thereof
with enhanced tolerance and/or resistance to abiotic environmental
stress and/or increased yield compared to a corresponding non
transformed wild type plant cell, a plant or a part thereof,
wherein the enhanced tolerance and/or resistance to abiotic
environmental stress and/or increased yield is increased by
expression of a polypeptide encoded by a nucleic acid according to
the invention and results in enhanced tolerance and/or resistance
to abiotic environmental stress and/or increased yield as compared
to a corresponding, e.g. non-transformed, wild type plant cell, a
plant or a part thereof, comprising [1522] (a) transforming a plant
cell, or a part of a plant with an vector according to the
invention and [1523] (b) generating from the plant cell or the part
of a plant a transgenic plant with enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant.
[1524] Accordingly, the present invention also relates to a method
of producing a transgenic plant with increased yield compared to a
corresponding non transformed wild type plant under conditions of
low temperature by increasing or generating one or more activities
selected from the group of "Low Temperature
Resistance/Tolerance-related Proteins" (LTRRP) consisting of
(DL)-glycerol-3-phosphatase, 2-deoxyglucose-6-phosphate
phosphatase, 3-methyl-2-oxobutanoate hydroxymethyltransferase,
alcohol acetyltransferase, amino acid permease,
aminomethyltransferase, ammonium transporter, aquaporin, Arabinose
transport system ATP-binding protein, Argininosuccinate synthase,
aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein.
[1525] Accordingly, the present invention also relates to a method
according to invention comprising [1526] (a) transforming a plant
cell or a part of a plant with an vector according to the
invention; and [1527] (b) generating from the plant cell or the
part of a plant a transgenic plant with an enhanced tolerance
and/or resistance to abiotic environmental stress and/or increased
yield as compared to a corresponding, e.g. non-transformed, wild
type plant.
[1528] Accordingly, the present invention also relates to an use of
a LTRRP encoding nucleic acid molecule selected from the group
comprising the nucleic acid of the invention for preparing a plant
cell, plant or part thereof with enhanced tolerance and/or
resistance to abiotic environmental stress and/or increased yield
as compared to a corresponding, e.g. non-transformed, wild type
plant cell, a plant or part of a plant.
[1529] Accordingly, the present invention also relates to an use of
a LTRRP encoding nucleic acid molecule selected from the group
comprising the nucleic acid of the invention or parts thereof as
markers for selection of plants or plant cells with an enhanced
tolerance and/or resistance to abiotic environmental stress and/or
increased yield as compared to a corresponding, e.g.
non-transformed, wild type plant cell; a non-transformed wild type
plant or a part thereof.
[1530] Accordingly, the present invention also relates to an use of
a LTRRP encoding nucleic acid molecule selected from the group
comprising the nucleic acid of the invention or parts thereof as
markers for detection of stress tolerance in plants or plant
cells.
[1531] Accordingly, the present invention also relates to a
transgenic plant cell comprising a nucleic acid molecule encoding a
polypeptide having a activity selected from the group of LTRRP
consisting of (DL)-glycerol-3-phosphatase,
2-deoxyglucose-6-phosphate phosphatase, 3-methyl-2-oxobutanoate
hydroxymethyltransferase, alcohol acetyltransferase, amino acid
permease, aminomethyltransferase, ammonium transporter, aquaporin,
Arabinose transport system ATP-binding protein, Argininosuccinate
synthase, aspartate aminotransferase, B1906-protein, B3410-protein,
cardiolipin synthetase, CoA-transferase-like protein
(NAD(P)-binding), cobalt transport protein, DNA and protein binding
protein for controlling the proteome at post-transcriptional level,
Enoyl CoA hydratase, enoyl-CoA hydratase, enoyl-CoA isomerase,
ethanolamine kinase, formate acetyltransferase 1,
glucitol/sorbitol-specific enzyme IIA component protein, glutamine
synthetase, glutathione S-transferase, glycerol dehydrogenase,
Glycogen synthesis initiator protein, GTP-binding protein, Heat
shock protein, hexose transporter, holo-[acyl-carrier-protein]
synthase, inorganic phosphate transporter, lanosterol synthase,
Molybdenum-binding subunit of aldehyde oxidases and xanthine
dehydrogenases, multidrug resistance protein, multiple drug
resistance protein, NADH dehydrogenase/NAD(P)H nitroreductase,
oxidoreductase, peptidyl-prolyl cis-trans isomerase, Peroxisomal
targeting signal 2 receptor, Phosphoadenosine phosphosulfate
reductase, Phosphocarrier protein, Pirin-like protein, precorrin-6y
methylase, protein required for degradation of glycoproteins,
pyrimidine deaminase/reductase, Regulator of cell morphogenesis and
NO signaling, serine acetyltransferase, signalosome complex
subunit, SLR1094-protein, subunit of TORC1, thiol-specific
monooxygenase, transcriptional regulatory protein, transketolase,
two-module transport protein, uridine
diphosphate-N-acetylglucosamine transporter, yer175w-a-protein,
yhr213w-a-protein, YML079W-protein, YMR157c-protein,
YNL024C-protein, and YNR040W-protein, wherein said polypeptide
confers an enhanced tolerance and/or resistance to abiotic
environmental stress and/or increased yield as compared to a
corresponding, e.g. non-transformed, wild type plant cell, a plant
or part thereof, preferably when said polypeptide is
overexpressed.
[1532] Accordingly, the present invention also relates to the
method, transgenic plant cell, plant or part thereof, seed,
isolated nucleic acid construct, vector, host cell, process,
polypeptide, antibody, plant tissue, propagation material,
harvested material or plant, composition, isolated polypeptide or
use according to any of the invention, wherein the tolerance to
abiotic environmental stress is selected from the group consisting
of tolerance to salt stress, drought stress, heat stress and/or low
temperature stress.
[1533] Accordingly, the present invention also relates to the
method, transgenic plant cell, plant or part thereof, seed,
isolated nucleic acid construct, vector, host cell, process,
polypeptide, antibody, plant tissue, propagation material,
harvested material or plant, composition, isolated polypeptide or
use of the invention, wherein the tolerance to abiotic stress is
low temperature stress.
[1534] Accordingly, the present invention also relates to the
method, transgenic plant cell, plant or part thereof, seed,
isolated nucleic acid construct, vector, host cell, process,
polypeptide, antibody, plant tissue, propagation material,
harvested material or plant, composition, isolated polypeptide or
use of the invention, wherein the tolerance and/or resistance to
low temperature stress is tolerance and/or resistance to chilling
stress and/or freezing stress.
[1535] Accordingly, the present invention also relates to the
method, transgenic plant cell, plant or part thereof, seed,
isolated nucleic acid construct, vector, host cell, process,
polypeptide, antibody, plant tissue, propagation material,
harvested material or plant, composition, isolated polypeptide or
use of the invention, wherein low temperature tolerance is
manifested in that the percentage of seeds germinating under such
low temperature conditions is higher than in the (non-transformed)
starting or wild-type organism.
[1536] Accordingly, the present invention also relates to a method,
transgenic plant cell, plant or part thereof, seed, isolated
nucleic acid construct, vector, host cell, process, polypeptide,
antibody, plant tissue, propagation material, harvested material or
plant, composition, isolated polypeptide or use of the invention,
wherein low temperature is such temperature that it would be
limiting for growth compared to a (non-transformed) starting or
wild-type organism.
Example 1
[1537] Engineering Arabidopsis plants with an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, and/or another mentioned yield-related
trait by over-expressing YLR protein genes, e.g. expressing genes
of the present invention.
[1538] Cloning of the sequences of the present invention as shown
in table I, column 5 and 7, for the expression in plants.
[1539] Unless otherwise specified, standard methods as described in
Sambrook et al., Molecular Cloning: A laboratory manual, Cold
Spring Harbor 1989, Cold Spring Harbor Laboratory Press are
used.
[1540] The inventive sequences as shown in table I, column 5 and 7,
were amplified by PCR as described in the protocol of the Pfu
Ultra, Pfu Turbo or Herculase DNA polymerase (Stratagene). The
composition for the protocol of the Pfu Ultra, Pfu Turbo or
Herculase DNA polymerase was as follows: 1.times.PCR buffer
(Stratagene), 0.2 mM of each dNTP, 100 ng genomic DNA of
Saccharomyces cerevisiae (strain S288C; Research Genetics, Inc.,
now Invitrogen), Escherichia coli (strain MG1655; E. coli Genetic
Stock Center), Synechocystis sp. (strain PCC6803), Azotobacter
vinelandii (strain N. R. Smith, 16), Thermus thermophilus (HB8) or
50 ng cDNA from various tissues and development stages of
Arabidopsis thaliana (ecotype Columbia), Physcomitrella patens,
Glycine max (variety Resnick), or Zea mays (variety B73, Mo17,
A188), 50 .mu.mol forward primer, 50 .mu.mol reverse primer, with
or without 1 M Betaine, 2.5 u Pfu Ultra, Pfu Turbo or Herculase DNA
polymerase.
[1541] The amplification cycles were as follows:
1 cycle of 2-3 minutes at 94-95.degree. C., then 25-36 cycles with
30-60 seconds at 94-95.degree. C., 30-45 seconds at 50-60.degree.
C. and 210-480 seconds at 72.degree. C., followed by 1 cycle of
5-10 minutes at 72.degree. C., then 4-16.degree. C.--preferably for
Saccharomyces cerevisiae, Escheric thia coli, Synechocystis sp.,
Azotobacter vinelandii, Thermus thermophilus.
[1542] In case of Arabidopsis thaliana, Brassica napus, Glycine
max, Oryza sativa, Physcomitrella patens, Zea mays the
amplification cycles were as follows:
1 cycle with 30 seconds at 94.degree. C., 30 seconds at 61.degree.
C., 15 minutes at 72.degree. C., then 2 cycles with 30 seconds at
94.degree. C., 30 seconds at 60.degree. C., 15 minutes at
72.degree. C., then 3 cycles with 30 seconds at 94.degree. C., 30
seconds at 59.degree. C., 15 minutes at 72.degree. C., then 4
cycles with 30 seconds at 94.degree. C., 30 seconds at 58.degree.
C., 15 minutes at 72.degree. C., then 25 cycles with 30 seconds at
94.degree. C., 30 seconds at 57.degree. C., 15 minutes at
72.degree. C., then 1 cycle with 10 minutes at 72.degree. C., then
finally 4-16.degree. C.
[1543] RNA were generated with the RNeasy Plant Kit according to
the standard protocol (Qiagen) and Superscript II Reverse
Transkriptase was used to produce double stranded cDNA according to
the standard protocol (Invitrogen).
[1544] ORF specific primer pairs for the genes to be expressed are
shown in table III, column 7. The following adapter sequences were
added to Saccharomyces cerevisiae ORF specific primers (see table
III) for cloning purposes:
TABLE-US-00003 i) SEQ ID NO: 7 foward primer:
5'-GGAATTCCAGCTGACCACC-3' ii) SEQ ID NO: 8 reverse primer:
5'-GATCCCCGGGAATTGCCATG-3'
[1545] These adaptor sequences allow cloning of the ORF into the
various vectors containing the Resgen adaptors, see table column E
of table VII.
[1546] The following adapter sequences were added to Saccharomyces
cerevisiae, Escherichia coli, Synechocystis sp., Azotobacter
vinelandii, Thermus thermophilus, Arabidopsis thaliana, Brassica
napus, Glycine max, Oryza sativa, Physcomitrella patens, or Zea
mays ORF specific primers for cloning purposes:
TABLE-US-00004 iii) SEQ ID NO: 9 forward primer: 5'-TTGCTCTTCC- 3'
iiii) SEQ ID NO: 10 reverse primer: 5'-TTGCTCTTCG-3'
[1547] The adaptor sequences allow cloning of the ORF into the
various vectors containing the Colic adaptors, see table column E
of table VII.
[1548] Therefore for amplification and cloning of Saccharomyces
cerevisiae SEQ ID NO: 382, a primer consisting of the adaptor
sequence i) and the ORF specific sequence SEQ ID NO: 398 and a
second primer consisting of the adaptor sequence ii) and the ORF
specific sequence SEQ ID NO: 399 were used.
[1549] For amplification and cloning of Escherichia coli SEQ ID NO:
38, a primer consisting of the adaptor sequence iii) and the ORF
specific sequence SEQ ID NO: 136 and a second primer consisting of
the adaptor sequence iiii) and the ORF specific sequence SEQ ID NO:
137 were used.
[1550] For amplification and cloning of Synechocystis sp. SEQ ID
NO: 7591, a primer consisting of the adaptor sequence iii) and the
ORF specific sequence SEQ ID NO: 7667 and a second primer
consisting of the adaptor sequence iiii) and the ORF specific
sequence SEQ ID NO: 7668 were used.
[1551] For amplification and cloning of Arabidopsis thaliana SEQ ID
NO: 8563, a primer consisting of the adaptor sequence iii) and the
ORF specific sequence SEQ ID NO: 8639 and a second primer
consisting of the adaptor sequence iiii) and the ORF specific
sequence SEQ ID NO: 8640 were used.
[1552] Following these examples every sequence disclosed in table
I, preferably column 5, can be cloned by fusing the adaptor
sequences to the respective specific primers sequences as disclosed
in table III, column 7 using the respective vectors shown in Table
VII.
TABLE-US-00005 TABLE VII Overview of the different vectors used for
cloning the ORFs and shows their SEQ IDs (column A), their vector
names (column B), the promotors they contain for expression of the
ORFs (column C), the additional artificial targeting sequence
column D), the adapter sequence (column E), the expression type
conferred by the promoter mentioned in column B (column F) and the
figure number (column G). C D E A B Promoter Target Adapter F G Seq
ID Vector Name Name Sequence Sequence Expression Type FIG. 1 VC-
Super Colic non targeted constitutive expression 1a MME220-1
preferentially in green tissues 2 VC- PcUbi Colic non targeted
constitutive expression 2a MME221-1 preferentially in green tissues
3 VC- Super FNR Resgen plastidic targeted constitutive 3a MME354-1
expression preferentially in green tissues 5 VC- Super FNR Colic
plastidic targeted constitutive 4a MME432-1 expression
preferentially in green tissues 15 VC- Super Resgen non targeted
constitutive expression 5a MME489-1p preferentially in green
tissues 16 pMTX0270p Super Colic non targeted constitutive
expression 6 preferentially in green tissues 6054 pMTX155 Big35S
Resgen non targeted constitutive expression 7 preferentially in
green tissues 6055 VC- Super FNR Resgen plastidic targeted
constitutive 3b MME354- expression preferentially in green 1QCZ
tissues 6057 VC- Super IVD Resgen mitochondric targeted
constitutive 8 MME356- expression preferentially in green 1QCZ
tissues 6059 VC- USP Resgen non targeted expression 9 MME301-
preferentially in seeds 1QCZ 6060 pMTX461korrp USP FNR Resgen
plastidic targeted expression 10 preferentially in seeds 6062 VC-
USP IVD Resgen mitochondric targeted expression 11 MME462-
preferentially in seeds 1QCZ 6064 VC- Super Colic non targeted
constitutive expression 1b MME220- preferentially in green tissues
1qcz 6065 VC- Super FNR Colic plastidic targeted constitutive 4b
MME432- expression preferentially in green 1qcz tissues 6067 VC-
Super IVD Colic mitochondric targeted constitutive 12 MME431-
expression preferentially in green 1qcz tissues 6069 VC- PcUbi
Colic non targeted constitutive expression 2b MME221-
preferentially in green tissues 1qcz 6070 pMTX447korr PcUbi FNR
Colic plastidic targeted constitutive 13 expression preferentially
in green tissues 6072 VC- PcUbi IVD Colic mitochondric targeted
constitutive 14 MME445- expression preferentially in green 1qcz
tissues 6074 VC- USP Colic non targeted expression 15 MME289-
preferentially in seeds 1qcz 6075 VC- USP FNR Colic plastidic
targeted expression 16 MME464- preferentially in seeds 1qcz 6077
VC- USP IVD Colic mitochondric targeted expression 17 MME465- in
preferentially seeds 1qcz 6079 VC- Super Resgen non targeted
constitutive expression 5b MME489- preferentially in green tissues
1QCZ
Example 1b
Construction of Binary Vectors for Non-Targeted Expression of
Proteins
[1553] "Non-targeted" expression in this context means, that no
additional targeting sequence were added to the ORF to be
expressed.
[1554] For non-targeted expression the binary vectors used for
cloning were VC-MME220-1 SEQ ID NO 1 (FIG. 1a) and VC-MME220-1qcz
SEQ ID NO 6064 (FIG. 1b) VC-MME221-1 SEQ ID NO 2 (FIG. 2a) and
VC-MME221-1qcz SEQ ID NO 6069 (FIG. 2b), and VC-MME489-1p SEQ ID NO
15 (FIG. 5a) and VC-MME489-1QCZ SEQ ID NO: 6079 (FIG. 5b),
respectively. The binary vectors used for cloning the targeting
sequence were VC-MME489-1p SEQ ID NO 15 (FIG. 5a) and
VC-MME489-1QCZ SEQ ID NO: 6079 (FIG. 5b), and pMTX0270p SEQ ID NO
16 (FIG. 6), respectively. Other useful binary vectors are known to
the skilled worker; an overview of binary vectors and their use can
be found in Hellens R., Mullineaux P. and Klee H., (Trends in Plant
Science, 5 (10), 446 (2000)). Such vectors have to be equally
equipped with appropriate promoters and targeting sequences.
Example 1c
Amplification of the Plastidic Targeting Sequence of the Gene FNR
From Spinacia oleracea and Construction of Vector for
Plastid-Targeted Expression in Preferential Green Tissues or
Preferential in Seeds
[1555] In order to amplify the targeting sequence of the FNR gene
from S. oleracea, genomic DNA was extracted from leaves of 4 weeks
old S. oleracea plants (DNeasy Plant Mini Kit, Qiagen, Hilden). The
gDNA was used as the template for a PCR.
[1556] To enable cloning of the transit sequence into the vector
VC-MME489-1 p, VC-MME489-1 QCZ and VC-MME301-1QCZ an EcoRI
restriction enzyme recognition sequence was added to both the
forward and reverse primers, whereas for cloning in the vectors
pMTX0270p, VC-MME220-1, VC-MME220-1qcz, VC-MME221-1, VC-MME221-1qcz
and VC-MME289-1qcz a Pmel restriction enzyme recognition sequence
was added to the forward primer and a Ncol site was added to the
reverse primer.
TABLE-US-00006 FNR5EcoResgen SEQ ID NO: 11 ATA GAA TTC GCA TAA ACT
TAT CTT CAT AGT TGC C FNR3EcoResgen SEQ ID NO: 12 ATA GAA TTC AGA
GGC GAT CTG GGC CCT FNR5PmeColic SEQ ID NO: 13 ATA GTT TAA ACG CAT
AAA CTT ATC TTC ATA GTT GCC FNR3NcoColic SEQ ID NO: 14 ATA CCA TGG
AAG AGC AAG AGG CGA TCT GGG CCC T
[1557] The resulting sequence SEQ ID NO: 36 amplified from genomic
spinach DNA, comprised a 5''UTR (bp 1-165), and the coding region
(bp 166-273 and 351-419). The coding sequence is interrupted by an
intronic sequence from by 274 to by 350:
TABLE-US-00007 (SEQ ID NO: 36)
gcataaacttatcttcatagttgccactccaatttgctccttgaatctc
ctccacccaatacataatccactcctccatcacccacttcactactaaa
tcaaacttaactctgtttttctctctcctcctttcatttcttattcttc
caatcatcgtactccgccatgaccaccgctgtcaccgccgctgtttctt
tcccctctaccaaaaccacctctctctccgcccgaagctcctccgtcat
ttcccctgacaaaatcagctacaaaaaggtgattcccaatttcactgtg
ttttttattaataatttgttattttgatgatgagatgattaatttgggt
gctgcaggttcctttgtactacaggaatgtatctgcaactgggaaaatg
ggacccatcagggcccagatcgcctct
[1558] The PCR fragment derived with the primers FNR5EcoResgen and
FNR3EcoResgen was digested with EcoRI and ligated in the vectors
VC-MME489-1 p or VC-MME489-1QCZ and VCMME301-1QCZ, that had also
been digested with EcoRI. The correct orientation of the FNR
targeting sequence was tested by sequencing. The vector generated
in this ligation step were VC-MME354-1 or VC-MME354-1QCZ and
pMTX461korrp, respectively.
[1559] The PCR fragment derived with the primers FNR5Pme Colic and
FNR3NcoColic was digested with Pmel and Ncol and ligated in the
vectors pMTX0270p, VC-MME220-1 or VC-MME220-1qcz, VC-MME221-1 or
VC-MME221-1qcz and VC-MME289-1qcz that had been digested with Smal
and Ncol. The vectors generated in this ligation step were
VC-MME432-1 or VC-MME432-1qcz, VC-MME464-1qcz and pMTX447korr,
respectively.
[1560] For plastidic-targeted constitutive expression in
preferentially green tissues an artifical promoter
A(ocs).sub.3AmasPmas promoter (Super pronnotor)) (Ni et al., Plant
Journal 7, 661 (1995), WO 95/14098) was used in context of the
vector VC-MME354-1 or VC-MME354-1QCZ for ORFs from Saccharomyces
cerevisiae and in context of the vector VC-MME432-1 or
VC-MME432-1qcz for ORFs from Escherichia coli, resulting in each
case in an "in-frame" fusion of the FNR targeting sequence with the
ORFs.
[1561] For plastidic-targeted expression in preferentially seeds
the USP promoter (Baumlein et al., Mol Gen Genet. 225(3):459-67
(1991)) was used in context of either the vector pMTX461 korrp for
ORFs from Saccharomyces cerevisiae or in context of the vector
VCMME464-1 qcz for ORFs from Escherichia coli, resulting in each
case in an "in-frame" fusion of the FNR targeting sequence with the
ORFs.
[1562] For plastidic-targeted constitutive expression in
preferentially green tissues and seeds the PcUbi promoter was used
in context of the vector pMTX447korr for ORFs from Saccharomyces
cerevisiae, Escherichia coli, Synechocystis sp., Azotobacter
vinelanchi, Thermus thermophilus, Arabdopsis thaliana, Brassica
napus, Glycine max, Oryza sativa, Physcomitrella patens, or Zea
mays, resulting in each case in an "in-frame" fusion of the FNR
targeting sequence with the ORFs.
Example 1d
Construction of Binary Vectors for Mitochondric-Targeted Expression
of Proteins
[1563] Amplification of the mitochondrial targeting sequence of the
gene IVD from Arabdopsis thaliana and construction of vector for
mitochondrial-targeted expression in preferential green tissues or
preferential in seeds.
[1564] In order to amplify the targeting sequence of the IVD gene
from A. thaliana, genomic DNA was extracted from leaves of A.
thaliana plants (DNeasy Plant Mini Kit, Qiagen, Hilden). The gDNA
was used as the template for a PCR.
[1565] To enable cloning of the transit sequence into the vectors
VC-MME489-1QCZ and VCMME301-1QCZ an EcoRI restriction enzyme
recognition sequence was added to both the forward and reverse
primers, whereas for cloning in the vectors VC-MME220-1qcz,
VC-MME221-1qcz and VC-MME289-1qcz a Pmel restriction enzyme
recognition sequence was added to the forward primer and a Ncol
site was added to the reverse primer.
TABLE-US-00008 IVD5EcoResgen SEQ ID NO: 6080 ATA GAA TTC ATG CAG
AGG TTT TTC TCC GC IVD3EcoResgen SEQ ID NO: 6081 ATAg AAT TCC gAA
gAA CgA gAA gAg AAA g IVD5PmeColic SEQ ID NO: 6082 ATA GTT TAA ACA
TGC AGA GGT TTT TCT CCG C IVD3NcoColic SEQ ID NO: 6083 ATA CCA TGG
AAG AGC AAA GGA GAG ACG AAG AAC GAG
[1566] The resulting sequence (SEQ ID NO: 6084) amplified from
genomic A. thaliana DNA with IVD5EcoResgen and IVD3EcoResgen
comprised 81 bp:
TABLE-US-00009 SEQ ID NO: 6084
atgcagaggtttttctccgccagatcgattctcggttacgccgtcaaga
cgcggaggaggtctttctcttctcgttcttcg
[1567] The resulting sequence (SEQ ID NO: 6085) amplified from
genomic A. thaliana DNA with IVD5Pme Colic and IVD3Nco Colic
comprised 89 bp:
TABLE-US-00010 SEQ ID NO: 6085
atgcagaggtttttctccgccagatcgattctcggttacgccgtcaaga
cgcggaggaggtctttctcttctcgttcttcgtctctcct
[1568] The PCR fragment derived with the primers IVD5EcoResgen and
IVD3EcoResgen was digested with EcoRI and ligated in the vectors
VC-MME489-1QCZ and VC-MME301-1QCZ that had also been digested with
EcoRI. The correct orientation of the IVD targeting sequence was
tested by sequencing. The vectors generated in this ligation step
were VC-MME356-1QCZ and VCMME462-1QCZ, respectively.
[1569] The PCR fragment derived with the primers IVD5PnneColic and
IVD3NcoColic was digested with Pmel and Ncol and ligated in the
vectors VC-MME220-1qcz, VC-MME221-1qcz and VCMME289-1qcz that had
been digested with SmaI and Ncol. The vectors generated in this
ligation step were VC-MME431-1qcz, VC-MME465-1qcz and
VC-MME445-1qcz, respectively.
[1570] For mitochondrial-targeted constitutive expression in
preferentially green tissues an artifical promoter
A(ocs).sub.3AmasPmas promoter (Super promoter) (Ni et al., Plant
Journal 7, 661 (1995), WO 95/14098) was used in context of the
vector VC-MME356-1QCZ for ORFs from Saccharomyces cerevisiae and in
context of the vector VC-MME431-1qcz for ORFs from Escherichia
coli, resulting in each case in an "in-frame" fusion between the
IVD sequence and the respective ORFs.
[1571] For mitochondrial-targeted constitutive expression in
preferentially seeds the USP promoter (Baumlein et al., Mol Gen
Genet. 225(3):459-67 (1991)) was used in context of the vector
VCMME462-1QCZ for ORFs from Saccharomyces cerevisiae and in context
of the vector VCMME465-1 qcz for ORFs from Escherichia coli,
resulting in each case in an "in-frame" fusion between the IVD
sequence and the respective ORFs.
[1572] For mitochondrial-targeted constitutive expression in
preferentially green tissues and seeds the PcUbi promoter was used
in context of the vector VC-MME445-1 qcz for ORFs from
Saccharomyces cerevisiae, Escherichia coli, Synechocystis sp.,
Azotobacter vinelanchi, Thermus thermophilus, Arabdopsis thaliana,
Brassica napus, Glycine max, Oryza sativa, Physcomitrella patens,
or Zea mays, resulting in each case in an "in-frame" fusion between
the IVD sequence and the respective ORFs.
[1573] Other useful binary vectors are known to the skilled worker;
an overview of binary vectors and their use can be found in Hellens
R., Mullineaux P. and Klee H., (Trends in Plant Science, 5 (10),
446 (2000)). Such vectors have to be equally equipped with
appropriate promoters and targeting sequences.
Example 1e
Cloning of Inventive Sequences as Shown in Table I, Column 5 and 7
in the Different Expression Vectors
[1574] For cloning the ORFs of SEQ ID NO: 382, from S. cerevisiae
into vectors containing the Resgen adaptor sequence the respective
vector DNA was treated with the restriction enzyme Ncol. For
cloning of ORFs from Saccharomyces cerevisiae into vectors
containing the Colic adaptor sequence, the respective vector DNA
was treated with the restriction enzymes Pacl and Ncol following
the standard protocol (MBI Fermentas). For cloning of ORFs from
Escherichia coli, Synechocystis sp., Azotobacter vinelanchi,
Thermus thermophilus, Arabidopsis thaliana, Brassica napus, Glycine
max, Oryza sativa, Physcomitrella patens, or Zea mays the vector
DNA was treated with the restriction enzymes Pacl and Ncol
following the standard protocol (MBI Fermentas). In all cases the
reaction was stopped by inactivation at 70.degree. C. for 20
minutes and purified over QIAquick or NucleoSpin Extract II columns
following the standard protocol (Qiagen or Macherey-Nagel).
[1575] Then the PCR-product representing the amplified ORF with the
respective adapter sequences and the vector DNA were treated with
T4 DNA polymerase according to the standard protocol (MBI
Fermentas) to produce single stranded overhangs with the parameters
1 unit T4 DNA polymerase at 37.degree. C. for 2-10 minutes for the
vector and 1-2 u T4 DNA polymerase at 15-17.degree. C. for 10-60
minutes for the PCR product representing SEQ ID NO: 382.
[1576] The reaction was stopped by addition of high-salt buffer and
purified over QIAquick or NucleoSpin Extract II columns following
the standard protocol (Qiagen or Macherey-Nagel).
[1577] According to this example the skilled person is able to
clone all sequences disclosed in table I, preferably column 5.
[1578] Approximately 30-60 ng of prepared vector and a defined
amount of prepared amplificate were mixed and hybridized at
65.degree. C. for 15 minutes followed by 37.degree. C. 0.1.degree.
C./1 seconds, followed by 37.degree. C. 10 minutes, followed by
0.1.degree. C./1 seconds, then 4-10.degree. C.
[1579] The ligated constructs were transformed in the same reaction
vessel by addition of competent E. coli cells (strain DH5alpha) and
incubation for 20 minutes at 1.degree. C. followed by a heat shock
for 90 seconds at 42.degree. C. and cooling to 1-4.degree. C. Then,
complete medium (SOC) was added and the mixture was incubated for
45 minutes at 37.degree. C. The entire mixture was subsequently
plated onto an agar plate with 0.05 mg/ml kanamycin and incubated
overnight at 37.degree. C.
[1580] The outcome of the cloning step was verified by
amplification with the aid of primers which bind upstream and
downstream of the integration site, thus allowing the amplification
of the insertion. The amplifications were carried out as described
in the protocol of Tag DNA polymerase (Gibco-BRL).
[1581] The amplification cycles were as follows:
1 cycle of 1-5 minutes at 94.degree. C., followed by 35 cycles of
in each case 15-60 seconds at 94.degree. C., 15-60 seconds at
50-66.degree. C. and 5-15 minutes at 72.degree. C., followed by 1
cycle of 10 minutes at 72.degree. C., then 4-16.degree. C.
[1582] Several colonies were checked, but only one colony for which
a PCR product of the expected size was detected was used in the
following steps.
[1583] A portion of this positive colony was transferred into a
reaction vessel filled with complete medium um (LB) supplemented
with kanamycin and incubated overnight at 37.degree. C.
[1584] The plasmid preparation was carried out as specified in the
Qiaprep or NucleoSpin Multi-96 Plus standard protocol (Qiagen or
Macherey-Nagel).
[1585] Generation of transgenic plants which express SEQ ID NO: 382
or any other sequence disclosed in table I, preferably column 5
1-5 ng of the plasmid DNA isolated was transformed by
electroporation or transformation into competent cells of
Agrobacterium tumefaciens, of strain GV 3101 pMP90 (Koncz and
Schell, Mol. Gen. Gent. 204, 383 (1986)). Thereafter, complete
medium (YEP) was added and the mixture was transferred into a fresh
reaction vessel for 3 hours at 28.degree. C. Thereafter, all of the
reaction mixture was plated onto YEP agar plates supplemented with
the respective antibiotics, e.g. rifampicine (0.1 mg/ml),
gentamycine (0.025 mg/ml and kanamycin (0.05 mg/ml) and incubated
for 48 hours at 28.degree. C.
[1586] The agrobacteria that contains the plasmid construct were
then used for the transformation of plants.
[1587] A colony was picked from the agar plate with the aid of a
pipette tip and taken up in 3 ml of liquid TB medium, which also
contained suitable antibiotics as described above. The preculture
was grown for 48 hours at 28.degree. C. and 120 rpm.
[1588] 400 ml of LB medium containing the same antibiotics as above
were used for the main culture. The preculture was transferred into
the main culture. It was grown for 18 hours at 28.degree. C. and
120 rpm. After centrifugation at 4 000 rpm, the pellet was
re-suspended in infiltration medium (MS medium, 10% sucrose).
[1589] In order to grow the plants for the transformation, dishes
(Piki Saat 80, green, provided with a screen bottom,
30.times.20.times.4.5 cm, from Wiesauplast, Kunststofftechnik,
Germany) were half-filled with a GS 90 substrate (standard soil,
Werkverband E. V., Germany). The dishes were watered overnight with
0.05% Proplant solution (Chimac-Apriphar, Belgium). A. thaliana C24
seeds (Nottingham Arabidopsis Stock Centre, UK; NASC Stock N906)
were scattered over the dish, approximately 1 000 seeds per dish.
The dishes were covered with a hood and placed in the
stratification facility (8 h, 110 .mu.mol/m.sup.2s.sup.1,
22.degree. C.; 16 h, dark, 6.degree. C.). After 5 days, the dishes
were placed into the short-day controlled environment chamber (8 h,
130 .mu.mol/m.sup.2s.sup.1, 22.degree. C.; 16 h, dark, 20.degree.
C.), where they remained for approximately 10 days until the first
true leaves had formed.
[1590] The seedlings were transferred into pots containing the same
substrate (Teku pots, 7 cm, LC series, manufactured by Poppelmann
GmbH & Co, Germany). Five plants were pricked out into each
pot. The pots were then returned into the short-day controlled
environment chamber for the plant to continue growing.
[1591] After 10 days, the plants were transferred into the
greenhouse cabinet (supplementary illumination, 16 h, 340
.mu.E/m.sup.2s, 22.degree. C.; 8 h, dark, 20.degree. C.), where
they were allowed to grow for further 17 days.
[1592] For the transformation, 6-week-old Arabidopsis plants, which
had just started flowering were immersed for 10 seconds into the
above-described agrobacterial suspension which had previously been
treated with 10 .mu.l Silwett L77 (Crompton S. A., Osi Specialties,
Switzerland). The method in question is described by Clough J. C.
and Bent A. F. (Plant J. 16, 735 (1998)).
[1593] The plants were subsequently placed for 18 hours into a
humid chamber. Thereafter, the pots were returned to the greenhouse
for the plants to continue growing. The plants remained in the
greenhouse for another 10 weeks until the seeds were ready for
harvesting.
[1594] Depending on the tolerance marker used for the selection of
the transformed plants the harvested seeds were planted in the
greenhouse and subjected to a spray selection or else first
sterilized and then grown on agar plates supplemented with the
respective selection agent.
[1595] Since the vector contained the bar gene as the tolerance
marker, plantlets were sprayed four times at an interval of 2 to 3
days with 0.02% BASTA.RTM. and transformed plants were allowed to
set seeds.
[1596] The seeds of the transgenic A. thaliana plants were stored
in the freezer (at -20.degree. C.).
[1597] Plant Screening (Arabidopsis) for growth under limited
nitrogen supply Two different procedures were used for screening:
[1598] Procedure 1). Per transgenic construct 4 independent
transgenic lines (=events) were tested (22-28 plants per
construct). Arabidopsis thaliana seeds are sown in pots containing
a 1:1 (v:v) mixture of nutrient depleted soil ("Einheitserde Typ
0", 30% clay, Tantau, Wansdorf Germany) and sand. Germination is
induced by a four day period at 4.degree. C., in the dark.
Subsequently the plants are grown under standard growth conditions
(photoperiod of 16 h light and 8 h dark, 20.degree. C., 60%
relative humidity, and a photon flux density of 200 .mu.E). The
plants are grown and cultured, inter alia they are watered every
second day with a N-depleted nutrient solution. The N-depleted
nutrient solution e.g. contains beneath water
TABLE-US-00011 [1598] mineral nutrient final concentration KCl 3.00
mM MgSO.sub.4 .times. 7 H.sub.2O 0.5 mM CaCl.sub.2 .times. 6
H.sub.2O 1.5 mM K.sub.2SO.sub.4 1.5 mM NaH.sub.2PO.sub.4 1.5 mM
Fe-EDTA 40 .mu.M H.sub.3BO.sub.3 25 .mu.M MnSO.sub.4 .times.
H.sub.2O 1 .mu.M ZnSO.sub.4 .times. 7 H.sub.2O 0.5 .mu.M
Cu.sub.2SO.sub.4 .times. 5 H.sub.2O 0.3 .mu.M Na.sub.2MoO.sub.4
.times. 2 H.sub.2O 0.05 .mu.M
[1599] After 9 to 10 days the plants are individualized. After a
total time of 28 to 31 days the plants are harvested and rated by
the fresh weight of the aerial parts of the plants. The biomass
increase has been measured as ratio of the fresh weight of the
aerial parts of the respective transgenic plant and the
non-transgenic wild type plant. [1600] Procedure 2). For screening
of transgenic plants a specific culture facility was used. For
highthroughput purposes plants were screened for biomass production
on agar plates with limited supply of nitrogen (adapted from
Estelle and Somerville, 1987). This screening pipeline consists of
two level. Transgenic lines are subjected to subsequent level if
biomass production was significantly improved in comparison to wild
type plants. With each level number of replicates and statistical
stringency was increased.
[1601] For the sowing, the seeds were removed from the Eppendorf
tubes with the aid of a toothpick and transferred onto the
above-mentioned agar plates, with limited supply of nitrogen (0.05
mM KNO.sub.3). In total, approximately 15-30 seeds were distributed
horizontally on each plate (12.times.12 cm).
[1602] After the seeds had been sown, plates are subjected to
stratification for 2-4 days in the dark at 4.degree. C. After the
stratification, the test plants were grown for 22 to 25 days at a
16-h-light, 8-h-dark rhythm at 20.degree. C., an atmospheric
humidity of 60% and a CO.sub.2 concentration of approximately 400
ppm. The light sources used generate a light resembling the solar
color spectrum with a light intensity of approximately 100
.mu.E/m.sup.2s. After 10 to 11 days the plants are individualized.
Improved growth under nitrogen limited conditions was assessed by
biomass production of shoots and roots of transgenic plants in
comparison to wild type control plants after 20-25 days growth.
Transgenic lines showing a significant improved biomass production
in comparison to wild type plants are subjected to following
experiment of the subsequent level on soil as described in
procedure 1, however, 3-6 lines per construct were tested (up to 60
plants per construct).
[1603] Biomass production of transgenic Arabidopsis thaliana grown
under limited nitrogen supply is shown in Table VIIIa: Biomass
production was measured by weighing plant rosettes. Biomass
increase was calculated as ratio of average weight for transgenic
plants compared to average weight of wild type control plants from
the same experiment. The mean biomass increase of transgenic
constructs is given (significance value <0.3 and biomass
increase >5% (ratio>1.05))
TABLE-US-00012 TABLE VIII-A (NUE) SeqID Target Locus Biomass
Increase 38 cytoplasmic B0414 1.610 147 cytoplasmic B2931 1.209 172
cytoplasmic B3945 1.457 382 cytoplasmic Yel004w 1.370 917
cytoplasmic Yhr204w 1.469 952 cytoplasmic Yll053c 1.525 1320
cytoplasmic Yml123c 1.597 1648 cytoplasmic Ynl142w 1.593 2081
cytoplasmic Ypr035w 1.237 2406 plastidic B0903 1.397 2841 plastidic
B2704 1.140 3978 plastidic Ydr142c 1.305 4051 plastidic Ygr289c
1.256 4495 cytoplasmic Yil053w 1.498 4622 cytoplasmic Ylr027c 1.172
5070 cytoplasmic Yml079w 1.057 5159 cytoplasmic Yol058w 1.172 5746
cytoplasmic Ypl180w 1.169 6581 cytoplasmic B1906 1.321 6609
cytoplasmic B2371 1.261 6949 cytoplasmic B2881 1.202 7078
cytoplasmic B3106 1.533 7467 cytoplasmic B3410 1.286 7492 plastidic
B4209 1.232 7591 cytoplasmic SLL1545 1.406 7670 Mitochondric
SLR1348 1.268 8648 plastidic B1600 1.616 8760 plastidic B1900 1.318
8861 cytoplasmic SLL0099 1.582 9046 cytoplasmic SLL0383 1.432 9307
cytoplasmic SLR1520 1.441 9479 cytoplasmic YDR147W 1.117 9553
plastidic YPL148C 1.226 10404 plastidic B1008 1.166 10591 plastidic
B3347 1.339 11501 cytoplasmic YHR176W 1.330 11564 cytoplasmic
B2881_2 1.202 11695 cytoplasmic B3945_2 1.457 11907 cytoplasmic
Yhr204w_2 1.469 11944 cytoplasmic Ynl142w_2 1.593 12357 cytoplasmic
Yol058w_2 1.172 (cytoplasmic) 12936 cytoplasmic Ypr035w_2 1.237
Plant Screening for Growth Under Low Temperature Conditions
[1604] In a standard experiment soil was prepared as 3.5:1 (v/v)
mixture of nutrient rich soil (GS90, Tantau, Wansdorf, Germany) and
sand. Pots were filled with soil mixture and placed into trays.
Water was added to the trays to let the soil mixture take up
appropriate amount of water for the sowing procedure. The seeds for
transgenic A. thaliana plants were sown in pots (6 cm diameter).
Pots were collected until they filled a tray for the growth
chamber. Then the filled tray was covered with a transparent lid
and transferred into the shelf system of the precooled (4.degree.
C.-5.degree. C.) growth chamber. Stratification was established for
a period of 2-3 days in the dark at 4.degree. C.-5.degree. C.
Germination of seeds and growth was initiated at a growth condition
of 20.degree. C., 60% relative humidity, 16 h photoperiod and
illumination with fluorescent light at 200 .mu.mol/m2s. Covers were
removed 7 days after sowing. BASTA selection was done at day 9
after sowing by spraying pots with plantlets from the top.
Therefore, a 0.07% (v/v) solution of BASTA concentrate (183 g/l
glufosinate-ammonium) in tap water was sprayed. Transgenic events
and wildtype control plants were distributed randomly over the
chamber. The location of the trays inside the chambers was changed
on working days from day 7 after sowing. Watering was carried out
every two days after covers were removed from the trays. Plants
were individualized 12-13 days after sowing by removing the surplus
of seedlings leaving one seedling in a pot. Cold (chilling to
11.degree. C.-12.degree. C.) was applied 14 days after sowing until
the end of the experiment. For measuring biomass performance, plant
fresh weight was determined at harvest time (29-30 days after
sowing) by cutting shoots and weighing them. Beside weighing,
phenotypic information was added in case of plants that differ from
the wild type control. Plants were in the stage prior to flowering
and prior to growth of inflorescence when harvested. Significance
values for the statistical significance of the biomass changes were
calculated by applying the `student's` t test (parameters:
two-sided, unequal variance).
[1605] Three successive experiments were conducted. In the first
experiment, one individual of each transformed line was tested.
[1606] In the second experiment, the event that had been determined
as chilling tolerant or resistant in the first experiment, i.e.
showed increased yield, in this case increased biomass production,
in comparison to wild type, were put through a confirmation screen
according to the same experimental procedures. In this experiment,
max. 10 plants of each tolerant or resistant event were grown,
treated and measured as before.
[1607] In the first two experiments, chilling tolerance or
tolerance and biomass production was compared to wild type
plants.
[1608] In the third experiment up to 20 replicates of each
confirmed tolerant event, i.e. those that had been scored as
tolerant or resistant in the second experiment, were grown, treated
and scored as before. The results thereof are summarized in table
VIII.
[1609] Table VIIIB: Biomass production of transgenic A. thaliana
after imposition of chilling stress.
[1610] Biomass production was measured by weighing plant rosettes.
Biomass increase was calculated as ratio of average weight for
trangenic plants compared to average weight of wild type control
plants. The minimum and maximum biomass increase seen within the
group of transgenic events is given for a locus with all events
showing a significance value <0.1 and a biomass increase
>1.1.
TABLE-US-00013 TABLE VIII-B (LT with min/max values ) Biomass
Biomass SeqID Target Locus Increase min Increase max 38 cytoplasmic
B0414 1.334 1.361 147 cytoplasmic B2931 1.209 1.357 172 cytoplasmic
B3945 1.192 1.353 382 cytoplasmic Yel004w 1.368 1.575 406
cytoplasmic Yer177w 1.222 1.300 917 cytoplasmic Yhr204w 1.383 1.697
952 cytoplasmic Yll053C 1.302 1.353 1320 cytoplasmic Yml123c 1.311
1.405 1648 cytoplasmic Ynl142w 1.380 1.808 2065 cytoplasmic Ynr040w
1.276 1.390 2081 cytoplasmic Ypr035w 1.370 1.451 2406 plastidic
B0903 1.326 1.391 2564 cytoplasmic B1393 1.186 1.224 2841 plastidic
B2704 1.233 1.462 2879 cytoplasmic B2905 1.246 1.289 3109 plastidic
B3206 1.193 1.304 3403 cytoplasmic B3659 1.325 1.696 3441
cytoplasmic B3871 1.233 1.611 3978 plastidic Ydr142c 1.205 1.274
4047 cytoplasmic Yer175w-a 1.502 2.340 4051 plastidic Ygr289c 1.218
1.271 4131 plastidic Yhr044c 1.215 1.215 4217 cytoplasmic YHR072W
1.387 1.387 4491 cytoplasmic Yhr213w-a 1.284 1.570 4495 cytoplasmic
Yil053w 1.463 1.523 4558 plastidic Yjl103c 1.269 1.296 4589
plastidic Yjl137c 1.395 1.48 4622 cytoplasmic Ylr027c 1.342 1.848
5070 plastidic Yml079w 1.296 1.331 5102 plastidic Ymr157c 1.190
1.267 5115 plastidic Ynl024c 1.191 1.376 5159 plastidic Yol058w
1.235 1.300 5746 cytoplasmic Ypl180w 1.247 2.471 5756 plastidic
Ypr167c 1.295 1.303 6086 plastidic B0036 1.220 1.336 6581
cytoplasmic B1906 1.137 1.290 6609 cytoplasmic B2371 1.207 1.328
6949 cytoplasmic B2881 1.157 1.230 7078 cytoplasmic B3106 1.241
1.381 7270 plastidic B3400 1.176 1.394 7467 cytoplasmic B3410 1.168
1.420 7492 plastidic B4209 1.112 1.489 7591 cytoplasmic SLL1545
1.248 1.293 7670 Mitochondric SLR1348 1.349 1.413 8236 plastidic
YGR191W 1.159 1.298 8563 cytoplasmic AT1G22920 1.149 1.610 8648
plastidic B1600 1.276 1.293 8760 plastidic B1900 1.264 1.341 8861
cytoplasmic SLL0099 1.199 1.310 9046 cytoplasmic SLL0383 1.158
1.415 9280 cytoplasmic SLR1094 1.122 1.352 9307 cytoplasmic SLR1520
1.284 1.361 9430 cytoplasmic YDL142C 1.187 1.503 9479 cytoplasmic
YDR147W 1.142 1.167 9500 plastidic YLR284C 1.150 1.306 9553
plastidic YPL148C 1.127 1.276 9574 plastidic YPR074C 1.222 1.287
10404 plastidic B1008 1.512 1.585 10503 plastidic B1529 1.119 1.426
10591 plastidic B3347 1.136 1.480 10934 cytoplasmic YBR176W 1.132
1.429 11461 cytoplasmic YGR177C 1.229 1.416 11501 cytoplasmic
YHR176W 1.167 1.621 11564 cytoplasmic B2881_2 1.157 1.230 11695
cytoplasmic B3945_2 1.192 1.353 11907 cytoplasmic Yhr204w_2 1.383
1.697 11944 cytoplasmic Ynl142w_2 1.380 1.808 12357 plastidic
Yol058w_2 1.235 1.300 12936 cytoplasmic Ypr035w_2 1.370 1.451
Plant Screening for Growth Under Cycling Drought Conditions
[1611] In the cycling drought assay repetitive stress is applied to
plants without leading to desiccation.
In a standard experiment soil is prepared as 1:1 (v/v) mixture of
nutrient rich soil (GS90, Tantau, Wansdorf, Germany) and quarz
sand. Pots (6 cm diameter) were filled with this mixture and placed
into trays. Water was added to the trays to let the soil mixture
take up appropriate amount of water for the sowing procedure (day
1) and subsequently seeds of transgenic A. thaliana plants and
their wild-type controls were sown in pots. Then the filled tray
was covered with a transparent lid and transferred into a precooled
(4.degree. C.-5.degree. C.) and darkened growth chamber.
Stratification was established for a period of 3 days in the dark
at 4.degree. C.-5.degree. C. or, alternatively, for 4 days in the
dark at 4.degree. C. Germination of seeds and growth was initiated
at a growth condition of 20.degree. C., 60% relative humidity, 16 h
photoperiod and illumination with fluorescent light at
approximately 200prino1/nn2s. Covers were removed 7-8 days after
sowing. BASTA selection was done at day 10 or day 11 (9 or 10 days
after sowing) by spraying pots with plantlets from the top. In the
standard experiment, a 0.07% (v/v) solution of BASTA concentrate
(183 g/l glufosinate-ammonium) in tap water was sprayed once or,
alternatively, a 0.02% (v/v) solution of BASTA was sprayed three
times. The wild-type control plants were sprayed with tap water
only (instead of spraying with BASTA dissolved in tap water) but
were otherwise treated identically. Plants were individualized
13-14 days after sowing by removing the surplus of seedlings and
leaving one seedling in soil. Transgenic events and wild-type
control plants were evenly distributed over the chamber.
[1612] The water supply throughout the experiment was limited and
plants were subjected to cycles of drought and re-watering.
Watering was carried out at day 1 (before sowing), day 14 or day
15, day 21 or day 22, and, finally, day 27 or day 28. For measuring
biomass production, plant fresh weight was determined one day after
the final watering (day 28 or day 29) by cutting shoots and
weighing them. Besides weighing, phenotypic information was added
in case of plants that differ from the wild type control. Plants
were in the stage prior to flowering and prior to growth of
inflorescence when harvested. Significance values for the
statistical significance of the biomass changes were calculated by
applying the `student's` t test (parameters: two-sided, unequal
variance).
[1613] Up to five lines (events) per transgenic construct were
tested in successive experimental levels (up to 4). Only constructs
that displayed positive performance were subjected to the next
experimental level. Usually in the first level five plants per
construct were tested and in the subsequent levels 30-60 plants
were tested. Biomass performance was evaluated as described above.
Data are shown for constructs that displayed increased biomass
performance in at least two successive experimental levels.
[1614] Biomass production of transgenic A. thaliana developed under
cycling drought growth conditions is shown in Table VIIIc: Biomass
production was measured by weighing plant rosettes. Biomass
increase was calculated as ratio of average weight for transgenic
plants compared to average weight of wild type control plants from
the same experiment. The mean biomass increase of transgenic
constructs is given (significance value <0.3 and biomass
increase >5% (ratio>1.05)).
TABLE-US-00014 TABLE VIII-C (CD) SeqID Target Locus Biomass
Increase 2065 cytoplasmic Ynr040w 1.496 2406 plastidic B0903 1.276
2564 cytoplasmic B1393 1.244 2841 plastidic B2704 1.192 2879
cytoplasmic B2905 1.233 3403 cytoplasmic B3659 1.128 4051 plastidic
Ygr289c 1.324
[1615] Plant screening for yield increase under standardized growth
conditions In this experiment, a plant screening for yield increase
(in this case: biomass yield increase) under standardised growth
conditions in the absence of substantial abiotic stress has been
performed. In a standard experiment soil is prepared as 3.5:1 (v/v)
mixture of nutrient rich soil (GS90, Tantau, Wansdorf, Germany) and
quarz sand. Alternatively, plants were sown on nutrient rich soil
(GS90, Tantau, Germany). Pots were filled with soil mixture and
placed into trays. Water was added to the trays to let the soil
mixture take up appropriate amount of water for the sowing
procedure. The seeds for transgenic A. thaliana plants and their
non-trangenic wild-type controls were sown in pots (6 cm diameter).
Then the filled tray was covered with a transparent lid and
transferred into a precooled (4.degree. C.-5.degree. C.) and
darkened growth chamber. Stratification was established for a
period of 3-4 days in the dark at 4.degree. C.-5.degree. C.
Germination of seeds and growth was initiated at a growth condition
of 20.degree. C., 60% relative humidity, 16 h photoperiod and
illumination with fluorescent light at approximately 200
.mu.mol/m2s. Covers were removed 7-8 days after sowing. BASTA
selection was done at day 10 or day 11 (9 or 10 days after sowing)
by spraying pots with plantlets from the top. In the standard
experiment, a 0.07% (v/v) solution of BASTA concentrate (183 g/l
glufosinate-ammonium) in tap water was sprayed once or,
alternatively, a 0.02% (v/v) solution of BASTA was sprayed three
times. The wild-type control plants were sprayed with tap water
only (instead of spraying with BASTA dissolved in tap water) but
were otherwise treated identically. Plants were individualized
13-14 days after sowing by removing the surplus of seedlings and
leaving one seedling in soil. Transgenic events and wild-type
control plants were evenly distributed over the chamber.
[1616] Watering was carried out every two days after removing the
covers in a standard experiment or, alternatively, every day. For
measuring biomass performance, plant fresh weight was determined at
harvest time (24-29 days after sowing) by cutting shoots and
weighing them. Plants were in the stage prior to flowering and
prior to growth of inflorescence when harvested. Transgenic plants
were compared to the non-transgenic wild-type control plants.
Significance values for the statistical significance of the biomass
changes were calculated by applying the `student's` t test
(parameters: two-sided, unequal variance).
[1617] Two different types of experimental procedures were
performed: [1618] Procedure 1). Per transgenic construct 3-4
independent transgenic lines (=events) were tested (22-30 plants
per construct) and biomass performance was evaluated as described
above. [1619] Procedure 2.) Up to five lines per transgenic
construct were tested in successive experimental levels (up to 4).
Only constructs that displayed positive performance were subjected
to the next experimental level. Usually in the first level five
plants per construct were tested and in the subsequent levels 30-60
plants were tested. Biomass performance was evaluated as described
above. Data from this type of experiment (Procedure 2) are shown
for constructs that displayed increased biomass performance in at
least two successive experimental levels.
[1620] Biomass production of transgenic A. thaliana grown under
standardised growth conditions is shown in TableVIIId: Biomass
production was measured by weighing plant rosettes. Biomass
increase was calculated as ratio of average weight of transgenic
plants compared to average weight of wild-type control plants from
the same experiment. The mean biomass increase of transgenic
constructs is given (significance value <0.3 and biomass
increase >5% (ratio>1.05)).
TABLE-US-00015 TABLE VIII-D (BM) SeqID Target Locus Biomass
Increase 38 cytoplasmic B0414 1.168 147 cytoplasmic B2931 1.088 172
cytoplasmic B3945 1.191 382 cytoplasmic Yel004w 1.306 406
cytoplasmic Yer177w 1.340 917 cytoplasmic Yhr204w 1.369 952
cytoplasmic Yll053C 1.162 1320 cytoplasmic Yml123c 1.327 1648
cytoplasmic Ynl142w 1.214 2065 cytoplasmic Ynr040w 1.069 2081
cytoplasmic Ypr035w 1.236 2406 plastidic B0903 1.260 2406
cytoplasmic B0903 1.286 2841 plastidic B2704 1.133 2879 cytoplasmic
B2905 1.104 3109 plastidic B3206 1.160 3403 cytoplasmic B3659 1.435
3978 plastidic Ydr142c 1.476 4047 cytoplasmic Yer175w-a 1.370 4051
plastidic Ygr289c 1.398 4491 cytoplasmic Yhr213w-a 1.407 4495
cytoplasmic Yil053w 1.383 4558 plastidic Yjl103c 1.175 4589
plastidic Yjl137c 1.065 4622 cytoplasmic Ylr027c 1.329 5070
plastidic Yml079w 1.066 5102 plastidic Ymr157c 1.211 5115 plastidic
Ynl024c 1.068 5159 plastidic Yol058w 1.091 5746 cytoplasmic Ypl180w
1.326 5756 plastidic Ypr167c 1.219 6086 plastidic B0036 1.117 6581
cytoplasmic B1906 1.092 6609 cytoplasmic B2371 1.121 6949
cytoplasmic B2881 1.074 7078 cytoplasmic B3106 1.082 7270 plastidic
B3400 1.191 7467 cytoplasmic B3410 1.167 7492 plastidic B4209 1.137
7591 cytoplasmic SLL1545 1.208 7670 Mitochondric SLR1348 1.376 8236
plastidic YGR191W 1.156 8563 cytoplasmic AT1G22920 1.385 8648
plastidic B1600 1.401 8760 plastidic B1900 1.136 8861 cytoplasmic
SLL0099 1.178 9046 cytoplasmic SLL0383 1.383 9280 cytoplasmic
SLR1094 1.104 9307 cytoplasmic SLR1520 1.103 9430 cytoplasmic
YDL142C 1.200 9500 plastidic YLR284C 1.229 9553 plastidic YPL148C
1.276 9574 plastidic YPR074C 1.245 10404 plastidic B1008 1.200
10591 plastidic B3347 1.188 11501 cytoplasmic YHR176W 1.258 11564
cytoplasmic B2881_2 1.074 11695 cytoplasmic B3945_2 1.191 11907
cytoplasmic Yhr204w_2 1.369 11944 cytoplasmic Ynl142w_2 1.214 12357
plastidic Yol058w_2 1.091 12936 cytoplasmic Ypr035w_2 1.236
Example 2
[1621] Engineering Arabidopsis plants with an increased yield, e.g.
an increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or low temperature tolerance and/or an increased
nutrient use efficiency, and/or another mentioned yield-related
trait by over-expressing, the yield-increasing, e.g. LTRRP or
YRP-protein, e.g. low temperature resistance and/or tolerance
related protein encoding genes from Saccharomyces cereviesae or
Synechocystis or E. coli using tissue-specific and/or stress
inducible promoters.
[1622] Transgenic Arabidopsis plants are created as in example 1 to
express the LTRRP or YRP, e.g. yield increasing, e.g. low
temperature resistance and/or tolerance related protein encoding
transgenes under the control of a tissue-specific and/or stress
inducible promoter.
[1623] T2 generation plants are produced and are grown under stress
conditions, preferably conditions of low temperature. Biomass
production is determined after a total time of 29 to 30 days
starting with the sowing. The transgenic Arabidopsis plant produces
more biomass than non-transgenic control plants.
Example 3
Over-Expression of the Yield-Increasing, e.g. LTRRP or YRP-Protein,
e.g. Low Temperature Resistance and/or Tolerance Related Protein,
e.g. Stress Related Genes from S. cerevisiae or E. coli or
Synechocystis Provides Tolerance of Multiple Abiotic Stresses
[1624] Plants that exhibit tolerance of one abiotic stress often
exhibit tolerance of another environmental stress. This phenomenon
of cross-tolerance is not understood at a mechanistic level
(McKersie and Leshem, 1994). Nonetheless, it is reasonable to
expect that plants exhibiting enhanced tolerance to low
temperature, e.g. chilling temperatures and/or freezing
temperatures, due to the expression of a transgene might also
exhibit tolerance to drought and/or salt and/or other abiotic
stresses. In support of this hypothesis, the expression of several
genes are up or down-regulated by multiple abiotic stress factors
including low temperature, drought, salt, osmoticum, ABA, etc.
(e.g. Hong et al., Plant Mol Biol 18, 663 (1992); Jagendorf and
Takabe, Plant Physiol 127, 1827 (2001)); Mizoguchi et al., Proc
Natl Acad Sci USA 93, 765 (1996); Zhu, Curr Opin Plant Biol 4, 401
(2001)).
[1625] To determine salt tolerance, seeds of A. thaliana are
sterilized (100% bleach, 0.1% TritonX for five minutes two times
and rinsed five times with ddH2O). Seeds were plated on
non-selection media (1/2 MS, 0.6% phytagar, 0.5 g/L MES, 1%
sucrose, 2 .mu.g/ml benamyl). Seeds are allowed to germinate for
approximately ten days. At the 4-5 leaf stage, transgenic plants
were potted into 5.5 cm diameter pots and allowed to grow
(22.degree. C., continuous light) for approximately seven days,
watering as needed. To begin the assay, two liters of 100 mM NaCl
and 1/8 MS are added to the tray under the pots. To the tray
containing the control plants, three liters of 1/8 MS are added.
The concentrations of NaCl supplementation are increased stepwise
by 50 mM every 4 days up to 200 mM. After the salt treatment with
200 mM, fresh and survival and biomass production of the plants is
determined.
[1626] To determine drought tolerance, seeds of the transgenic and
low temperature lines are germinated and grown for approximately 10
days to the 4-5 leaf stage as above. The plants are then
transferred to drought conditions and can be grown through the
flowering and seed set stages of development. Photosynthesis can be
measured using chlorophyll fluorescence as an indicator of
photosynthetic fitness and integrity of the photosystems. Survival
and plant biomass production as an indicators for seed yield is
determined.
[1627] Plants that have tolerance to salinity or low temperature
have higher survival rates and biomass production including seed
yield and dry matter production than susceptible plants.
Example 4
Engineering Alfalfa Plants with an Increased Yield, e.g. an
Increased Yield-Related Trait, for Example Enhanced Tolerance to
Abiotic Environmental Stress, for Example an Increased Drought
Tolerance and/or Low Temperature Tolerance and/or an Increased
Nutrient Use Efficiency, and/or Another Mentioned Yield-Related
Trait, e.g. Enhanced Abiotic Environmental Stress Tolerance and/or
Increased Biomass Production by Over-Expressing Yield-Increasing,
e.g. LTRRP or YRP-Protein-Coding, e.g. Low Temperature Resistance
and/or Tolerance Related Genes From S. cerevisiae or E. coli or
Synechocystis
[1628] A regenerating clone of alfalfa (Medicago sativa) is
transformed using state of the art methods (e.g. McKersie et al.,
Plant Physiol 119, 839 (1999)). Regeneration and transformation of
alfalfa is genotype dependent and therefore a regenerating plant is
required. Methods to obtain regenerating plants have been
described. For example, these can be selected from the cultivar
Rangelander (Agriculture Canada) or any other commercial alfalfa
variety as described by
[1629] Brown D. C. W. and Atanassov A. (Plant Cell Tissue Organ
Culture 4, 111 (1985)). Alternatively, the RA3 variety (University
of Wisconsin) is selected for use in tissue culture (Walker et al.,
Am. J. Bot. 65, 654 (1978)).
[1630] Petiole explants are cocultivated with an overnight culture
of Agrobacterium tumefaciens C58C1 pMP90 (McKersie et al., Plant
Physiol 119, 839 (1999)) or LBA4404 containing a binary vector.
Many different binary vector systems have been described for plant
transformation (e.g. An G., in Agrobacterium Protocols, Methods in
Molecular Biology, Vol 44, pp 47-62, Gartland K. M. A. and Davey M.
R. eds. Humana Press, Totowa, N.J.). Many are based on the vector
pBIN19 described by Bevan (Nucleic Acid Research. 12, 8711 (1984))
that includes a plant gene expression cassette flanked by the left
and right border sequences from the Ti plasmid of Agrobacterium
tumefaciens. A plant gene expression cassette consists of at least
two genes--a selection marker gene and a plant promoter regulating
the transcription of the cDNA or genomic DNA of the trait gene.
Various selection marker genes can be used including the
Arabidopsis gene encoding a mutated acetohydroxy acid synthase
(AHAS) enzyme (U.S. Pat. Nos. 5,7673,666 and 6,225,105). Similarly,
various promoters can be used to regulate the trait gene that
provides constitutive, developmental, tissue or environmental
regulation of gene transcription. In this example, the 34S promoter
(GenBank Accession numbers M59930 and X16673) is used to provide
constitutive expression of the trait gene.
[1631] The explants are cocultivated for 3 days in the dark on SH
induction medium containing 288 mg/L Pro, 53 mg/L thioproline, 4.35
g/L K.sub.2SO.sub.4, and 100 .mu.m acetosyringinone. The explants
are washed in half-strength Murashige-Skoog medium (Murashige and
Skoog, 1962) and plated on the same SH induction medium without
acetosyringinone but with a suitable selection agent and suitable
antibiotic to inhibit Agrobacterium growth. After several weeks,
somatic embryos are transferred to BOi2Y development medium
containing no growth regulators, no antibiotics, and 50 g/L
sucrose. Somatic embryos are subsequently germinated on
half-strength Murashige-Skoog medium. Rooted seedlings are
transplanted into pots and grown in a greenhouse.
[1632] T1 or T2 generation plants are produced and subjected to low
temperature experiments, e.g. as described above in example 1. For
the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to plants lacking the
transgene, e.g. corresponding non-transgenic wild type plants.
Example 5
Engineering Ryegrass Plants with an Increased Yield, e.g. an
Increased Yield-Related Trait, for Example Enhanced Tolerance to
Abiotic Environmental Stress, for Example an Increased Drought
Tolerance and/or Low Temperature Tolerance and/or an Increased
Nutrient Use Efficiency, and/or Another Mentioned Yield-Related
Trait e.g. Enhanced Stress Tolerance, Preferably Tolerance to Low
Temperature, and/or Increased Biomass Production by Over-Expressing
Yield-Increasing, e.g. LTRRP or YRP-Protein-Coding, e.g. Tolerance
to Low Temperature Related Genes from S. cerevisiae or E. coli or
Synechocystis
[1633] Seeds of several different ryegrass varieties may be used as
explant sources for transformation, including the commercial
variety Gunne available from Svalof Weibull seed company or the
variety Affinity. Seeds are surface-sterilized sequentially with 1%
Tween-20 for 1 minute, 100% bleach for 60 minutes, 3 rinses with 5
minutes each with deionized and distilled H2O, and then germinated
for 3-4 days on moist, sterile filter paper in the dark. Seedlings
are further sterilized for 1 minute with 1% Tween-20, 5 minutes
with 75% bleach, and rinsed 3 times with dd H2O, 5 min each.
[1634] Surface-sterilized seeds are placed on the callus induction
medium containing Murashige and Skoog basal salts and vitamins, 20
g/L sucrose, 150 mg/L asparagine, 500 mg/L casein hydrolysate, 3
g/L Phytagel, 10 mg/L BAP, and 5 mg/L dicamba. Plates are incubated
in the dark at 25.degree. C. for 4 weeks for seed germination and
embryogenic callus induction.
[1635] After 4 weeks on the callus induction medium, the shoots and
roots of the seedlings are trimmed away, the callus is transferred
to fresh media, maintained in culture for another 4 weeks, and then
transferred to MSO medium in light for 2 weeks. Several pieces of
callus (11-17 weeks old) are either strained through a 10 mesh
sieve and put onto callus induction medium, or cultured in 100 ml
of liquid ryegrass callus induction media (same medium as for
callus induction with agar) in a 250 ml flask. The flask is wrapped
in foil and shaken at 175 rpm in the dark at 23.degree. C. for 1
week. Sieving the liquid culture with a 40-mesh sieve collected the
cells. The fraction collected on the sieve is plated and cultured
on solid ryegrass callus induction medium for 1 week in the dark at
25.degree. C. The callus is then transferred to and cultured on MS
medium containing 1% sucrose for 2 weeks.
[1636] Transformation can be accomplished with either Agrobacterium
of with particle bombardment methods. An expression vector is
created containing a constitutive plant promoter and the cDNA of
the gene in a pUC vector. The plasmid DNA is prepared from E. coli
cells using with Qiagen kit according to manufacturer's
instruction. Approximately 2 g of embryogenic callus is spread in
the center of a sterile filter paper in a Petri dish. An aliquot of
liquid MSO with 10 g/L sucrose is added to the filter paper. Gold
particles (1.0 .mu.m in size) are coated with plasmid DNA according
to method of Sanford et al., 1993 and delivered to the embryogenic
callus with the following parameters: 500 .mu.g particles and 2
.mu.g DNA per shot, 1300 psi and a target distance of 8.5 cm from
stopping plate to plate of callus and 1 shot per plate of
callus.
[1637] After the bombardment, calli are transferred back to the
fresh callus development medium and maintained in the dark at room
temperature for a 1-week period. The callus is then transferred to
growth conditions in the light at 25.degree. C. to initiate embryo
differentiation with the appropriate selection agent, e.g. 250 nM
Arsenal, 5 mg/L PPT or 50 mg/L kanamycin. Shoots resistant to the
selection agent are appearing and once rotted are transferred to
soil.
[1638] Samples of the primary transgenic plants (T0) are analyzed
by PCR to confirm the presence of T-DNA. These results are
confirmed by Southern hybridization in which DNA is electrophoresed
on a 1% agarose gel and transferred to a positively charged nylon
membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit
(Roche Diagnostics) is used to prepare a digoxigeninlabelled probe
by PCR, and used as recommended by the manufacturer.
[1639] Transgenic T0 ryegrass plants are propagated vegetatively by
excising tillers. The transplanted tillers are maintained in the
greenhouse for 2 months until well established. The shoots are
defoliated and allowed to grow for 2 weeks.
[1640] T1 or T2 generation plants are produced and subjected to low
temperature experiments, e.g. as described above in example 1. For
the assessment of t yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to plants lacking the
transgene, e.g. corresponding non-transgenic wild type plants.
Example 6
Engineering Soybean Plants with an Increased Yield, e.g. an
Increased Yield-Related Trait, for Example Enhanced Tolerance to
Abiotic Environmental Stress, for Example an Increased Drought
Tolerance and/or Low Temperature Tolerance and/or an Increased
Nutrient Use Efficiency, and/or Another Mentioned Yield-Related
Trait e.g. Enhanced Stress Tolerance, Preferably Tolerance to Low
Temperature, and/or Increased Biomass Production by Over-Expressing
Yield-Increasing, e.g. LTRRP or YRP-Protein Coding, e.g. Tolerance
to Low Temperature Related Genes from S. cerevisiae or E. coli or
Synechocystis
[1641] Soybean is transformed according to the following
modification of the method described in the Texas A&M patent
U.S. Pat. No. 5,164,310. Several commercial soybean varieties are
amenable to transformation by this method. The cultivar Jack
(available from the Illinois Seed Foundation) is a commonly used
for transformation. Seeds are sterilized by immersion in 70% (v/v)
ethanol for 6 min and in 25% commercial bleach (NaOCl) supplemented
with 0.1% (v/v) Tween for 20 min, followed by rinsing 4 times with
sterile double distilled water. Seven-day seedlings are propagated
by removing the radicle, hypocotyl and one cotyledon from each
seedling. Then, the epicotyl with one cotyledon is transferred to
fresh germination media in petri dishes and incubated at 25.degree.
C. under a 16-h photoperiod (approx. 100 .mu.mol/m.sup.2s) for
three weeks. Axillary nodes (approx. 4 mm in length) were cut from
3-4 week-old plants. Axillary nodes are excised and incubated in
Agrobacterium LBA4404 culture.
[1642] Many different binary vector systems have been described for
plant transformation (e.g. An G., in Agrobacterium Protocols.
Methods in Molecular Biology Vol. 44, p. 47-62, Gartland K. M. A.
and Davey M. R. eds. Humana Press, Totowa, N.J.). Many are based on
the vector pBIN19 described by Bevan (Nucleic Acid Research. 12,
8711 (1984)) that includes a plant gene expression cassette flanked
by the left and right border sequences from the Ti plasmid of
Agrobacterium tumefaciens. A plant gene expression cassette
consists of at least two genes--a selection marker gene and a plant
promoter regulating the transcription of the cDNA or genomic DNA of
the trait gene. Various selection marker genes can be used
including the Arabidopsis gene encoding a mutated acetohydroxy acid
synthase (AHAS) enzyme (U.S. Pat. Nos. 5,7673,666 and 6,225,105).
Similarly, various promoters can be used to regulate the trait gene
to provide constitutive, developmental, tissue or environmental
regulation of gene transcription. In this example, the 34S promoter
(GenBank Accession numbers M59930 and X16673) can be used to
provide constitutive expression of the trait gene.
[1643] After the co-cultivation treatment, the explants are washed
and transferred to selection media supplemented with 500 mg/L
timentin. Shoots are excised and placed on a shoot elongation
medium. Shoots longer than 1 cm are placed on rooting medium for
two to four weeks prior to transplanting to soil.
[1644] The primary transgenic plants (T0) are analyzed by PCR to
confirm the presence of T-DNA. These results are confirmed by
Southern hybridization in which DNA is electrophoresed on a 1%
agarose gel and transferred to a positively charged nylon membrane
(Roche Diagnostics). The PCR DIG Probe Synthesis Kit (Roche
Diagnostics) is used to prepare a digoxigeninlabelled probe by PCR,
and used as recommended by the manufacturer.
[1645] T1 or T2 generation plants are produced and subjected to low
temperature experiments, e.g. as described above in example 1. For
the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to plants lacking the
transgene, e.g. corresponding non-transgenic wild type plants.
Example 7
Engineering Rapeseed/Canola Plants with an Increased Yield, e.g. An
Increased Yield-Related Trait, for Example Enhanced Tolerance to
Abiotic Environmental Stress, for Example an Increased Drought
Tolerance and/or Low Temperature Tolerance and/or an Increased
Nutrient Use Efficiency, and/or Another Mentioned Yield-Related
Trait, e.g. Enhanced Stress Tolerance, Preferably Tolerance to Low
Temperature, and/or Increased Biomass Production by Over-expressing
Yield-Increasing, e.g. LTRRP or YRP-Protein Coding, e.g. Tolerance
to Low Temperature Related Genes from S. cerevisiae or E. coli or
Synechocystis
[1646] Cotyledonary petioles and hypocotyls of 5-6 day-old young
seedlings are used as explants for tissue culture and transformed
according to Babic et al. (Plant Cell Rep 17, 183 (1998)). The
commercial cultivar Westar (Agriculture Canada) is the standard
variety used for transformation, but other varieties can be
used.
[1647] Agrobacterium tumefaciens LBA4404 containing a binary vector
can be used for canola transformation. Many different binary vector
systems have been described for plant transformation (e.g. An G.,
in Agrobacterium Protocols. Methods in Molecular Biology Vol. 44,
p. 47-62, Gartland K. M. A. and Davey M. R. eds. Humana Press,
Totowa, N.J.). Many are based on the vector pBIN19 described by
Bevan (Nucleic Acid Research. 12, 8711 (1984)) that includes a
plant gene expression cassette flanked by the left and right border
sequences from the Ti plasmid of Agrobacterium tumefaciens. A plant
gene expression cassette consists of at least two genes--a
selection marker gene and a plant promoter regulating the
transcription of the cDNA or genomic DNA of the trait gene. Various
selection marker genes can be used including the Arabidopsis gene
encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S.
Pat. Nos. 5,7673,666 and 6,225,105). Similarly, various promoters
can be used to regulate the trait gene to provide constitutive,
developmental, tissue or environmental regulation of gene
transcription. In this example, the 34S promoter (GenBank Accession
numbers M59930 and X16673) can be used to provide constitutive
expression of the trait gene.
[1648] Canola seeds are surface-sterilized in 70% ethanol for 2
min., and then in 30% Clorox with a drop of Tween-20 for 10 min,
followed by three rinses with sterilized distilled water. Seeds are
then germinated in vitro 5 days on half strength MS medium without
hormones, 1% sucrose, 0.7% Phytagar at 23.degree. C., 16 h light.
The cotyledon petiole explants with the cotyledon attached are
excised from the in vitro seedlings, and inoculated with
Agrobacterium by dipping the cut end of the petiole explant into
the bacterial suspension. The explants are then cultured for 2 days
on MSBAP-3 medium containing 3 mg/L BAP, 3% sucrose, 0.7% Phytagar
at 23.degree. C., 16 h light. After two days of co-cultivation with
Agrobacterium, the petiole explants are transferred to MSBAP-3
medium containing 3 mg/L BAP, cefotaxime, carbenicillin, or
timentin (300 mg/L) for 7 days, and then cultured on MSBAP-3 medium
with cefotaxime, carbenicillin, or timentin and selection agent
until shoot regeneration. When the shoots were 5-10 mm in length,
they are cut and transferred to shoot elongation medium (MSBAP-0.5,
containing 0.5 mg/L BAP). Shoots of about 2 cm in length are
transferred to the rooting medium (MSO) for root induction.
[1649] Samples of the primary transgenic plants (T0) are analyzed
by PCR to confirm the presence of T-DNA. These results are
confirmed by Southern hybridization in which DNA is electrophoresed
on a 1 agarose gel and transferred to a positively charged nylon
membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit
(Roche Diagnostics) is used to prepare a digoxigeninlabelled probe
by PCR, and used as recommended by the manufacturer.
[1650] T1 or T2 generation plants are produced and subjected to low
temperature experiments, e.g. as described above in example 1. For
the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to plants lacking the
transgene, e.g. corresponding non-transgenic wild type plants.
Example 8
Engineering Corn Plants with an Increased Yield, e.g. an Increased
Yield-Related Trait, for Example Enhanced Tolerance to Abiotic
Environmental Stress, for Example an Increased Drought Tolerance
and/or Low Temperature Tolerance and/or an Increased Nutrient Use
Efficiency, and/or Another Mentioned Yield-Related Trait, e.g.
Enhanced Stress Tolerance, Preferably Tolerance to Low Temperature,
and/or Increased Biomass Production by Over-Expressing
Yield-Increasing, e.g. LTRRP or YRP-Protein Coding, e.g. Low
Temperature Resistance and/or Tolerance Related Genes from S.
cerevisiae or E. coli or Synechocystis
[1651] Transformation of maize (Zea Mays L.) is performed with a
modification of the method described by Ishida et al. (Nature
Biotech 14745 (1996)). Transformation is genotype-dependent in corn
and only specific genotypes are amenable to transformation and
regeneration. The inbred line A188 (University of Minnesota) or
hybrids with A188 as a parent are good sources of donor material
for transformation (Fromm et al. Biotech 8, 833 (1990)), but other
genotypes can be used successfully as well. Ears are harvested from
corn plants at approximately 11 days after pollination (DAP) when
the length of immature embryos is about 1 to 1.2 mm. Immature
embryos are co-cultivated with Agrobacterium tumefaciens that carry
"super binary" vectors and transgenic plants are recovered through
organogenesis. The super binary vector system of Japan Tobacco is
described in WO patents WO 94/00977 and WO 95/06722. Vectors were
constructed as described. Various selection marker genes can be
used including the maize gene encoding a mutated acetohydroxy acid
synthase (AHAS) enzyme (U.S. Pat. No. 6,025,541). Similarly,
various promoters can be used to regulate the trait gene to provide
constitutive, developmental, tissue or environmental regulation of
gene transcription. In this example, the 34S promoter (GenBank
Accession numbers M59930 and X16673) was used to provide
constitutive expression of the trait gene.
[1652] Excised embryos are grown on callus induction medium, then
maize regeneration medium, containing imidazolinone as a selection
agent. The Petri plates are incubated in the light at 25.degree. C.
for 2-3 weeks, or until shoots develop. The green shoots are
transferred from each embryo to maize rooting medium and incubated
at 25.degree. C. for 2-3 weeks, until roots develop. The rooted
shoots are transplanted to soil in the greenhouse. T1 seeds are
produced from plants that exhibit tolerance to the imidazolinone
herbicides and which are PCR positive for the transgenes.
[1653] The T1 transgenic plants are then evaluated for their
enhanced stress tolerance, like tolerance to low temperature,
and/or increased biomass production according to the method
described in Example 1. The T1 generation of single locus
insertions of the T-DNA will segregate for the transgene in a 3:1
ratio. Those progeny containing one or two copies of the transgene
are tolerant regarding the imidazolinone herbicide, and exhibit an
increased yield, e.g. an increased yield-related trait, for example
an enhancement of stress tolerance, like tolerance to low
temperature, and/or increased biomass production than those progeny
lacking the transgenes.
[1654] T1 or T2 generation plants are produced and subjected to low
temperature experiments, e.g. as described above in example 2. For
the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to e.g. corresponding
non-transgenic wild type plants.
[1655] Homozygous T2 plants exhibited similar phenotypes. Hybrid
plants (F1 progeny) of homozygous transgenic plants and
non-transgenic plants also exhibited increased yield, e.g. an
increased yield-related trait, for example enhanced tolerance to
abiotic environmental stress, for example an increased drought
tolerance and/or an increased nutrient use efficiency, and/or
another mentioned yield-related trait, e.g. enhanced tolerance to
low temperature.
Example 9
[1656] Engineering Wheat Plants with an Increased Yield, e.g. an
Increased Yield-Related Trait, for Example Enhanced Tolerance to
Abiotic Environmental Stress, for Example an Increased Drought
Tolerance and/or Low Temperature Tolerance and/or an Increased
Nutrient Use Efficiency, and/or Another Mentioned Yield-Related
Trait, e.g. Enhanced Stress Tolerance, Preferably Tolerance to Low
Temperature, and/or Increased Biomass Production by Over-Expressing
Yield-Increasing, e.g. LTRRP or YRP-Protein Coding, e.g. Low
Temperature Resistance and/or Tolerance Related Genes From S.
cerevisiae or E. coli or Synechocystis
[1657] Transformation of wheat is performed with the method
described by Ishida et al. (Nature Biotech. 14745 (1996)). The
cultivar Bobwhite (available from CYMMIT, Mexico) is commonly used
in transformation. Immature embryos are co-cultivated with
Agrobacterium tumefaciens that carry "super binary" vectors, and
transgenic plants are recovered through organogenesis. The super
binary vector system of Japan Tobacco is described in WO patents WO
94/00977 and WO 95/06722. Vectors were constructed as described.
Various selection marker genes can be used including the maize gene
encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S.
Pat. No. 6,025,541). Similarly, various promoters can be used to
regulate the trait gene to provide constitutive, developmental,
tissue or environmental regulation of gene transcription. In this
example, the 34S promoter (GenBank Accession numbers M59930 and
X16673) was used to provide constitutive expression of the trait
gene.
[1658] After incubation with Agrobacterium, the embryos are grown
on callus induction medium, then regeneration medium, containing
imidazolinone as a selection agent. The Petri plates are incubated
in the light at 25.degree. C. for 2-3 weeks, or until shoots
develop. The green shoots are transferred from each embryo to
rooting medium and incubated at 25.degree. C. for 2-3 weeks, until
roots develop. The rooted shoots are transplanted to soil in the
greenhouse. T1 seeds are produced from plants that exhibit
tolerance to the imidazolinone herbicides and which are PCR
positive for the transgenes.
[1659] The T1 transgenic plants are then evaluated for their
enhanced tolerance to low temperature and/or increased biomass
production according to the method described in example 2. The T1
generation of single locus insertions of the T-DNA will segregate
for the transgene in a 3:1 ratio.
[1660] Those progeny containing one or two copies of the transgene
are tolerant regarding the imidazolinone herbicide, and exhibit an
increased yield, e.g. an increased yield-related trait, for example
an enhanced tolerance to low temperature and/or increased biomass
production compared to the progeny lacking the transgenes.
Homozygous T2 plants exhibit similar phenotypes.
[1661] For the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to e.g. corresponding
non-transgenic wild type plants. For example, plants with an
increased yield, e.g. an increased yield-related trait, e.g. higher
tolerance to stress, e.g. with an increased nutrient use efficiency
or an increased intrinsic yield, and e.g. with higher tolerance to
low temperature may show increased biomass production and/or dry
matter production and/or seed yield under low temperature when
compared to plants lacking the transgene, e.g. to corresponding
non-transgenic wild type plants.
Example 10
Identification of Identical and Heterologous Genes
[1662] Gene sequences can be used to identify identical or
heterologous genes from cDNA or genomic libraries. Identical genes
(e.g. full-length cDNA clones) can be isolated via nucleic acid
hybridization using for example cDNA libraries. Depending on the
abundance of the gene of interest, 100,000 up to 1,000,000
recombinant bacteriophages are plated and transferred to nylon
membranes. After denaturation with alkali, DNA is immobilized on
the membrane by e.g. UV cross linking. Hybridization is carried out
at high stringency conditions. In aqueous solution, hybridization
and washing is performed at an ionic strength of 1 M NaCl and a
temperature of 68.degree. C. Hybridization probes are generated by
e.g. radioactive (.sup.32P) nick transcription labeling (High
Prime, Roche, Mannheim, Germany). Signals are detected by
autoradiography.
[1663] Partially identical or heterologous genes that are related
but not identical can be identified in a manner analogous to the
above-described procedure using low stringency hybridization and
washing conditions. For aqueous hybridization, the ionic strength
is normally kept at 1 M NaCl while the temperature is progressively
lowered from 68 to 42.degree. C.
[1664] Isolation of gene sequences with homology (or sequence
identity/similarity) only in a distinct domain of (for example
10-20 amino acids) can be carried out by using synthetic radio
labeled oligonucleotide probes. Radiolabeled oligonucleotides are
prepared by phosphorylation of the 5-prime end of two complementary
oligonucleotides with T4 polynucleotide kinase. The complementary
oligonucleotides are annealed and ligated to form concatemers. The
double stranded concatemers are than radiolabeled by, for example,
nick transcription. Hybridization is normally performed at low
stringency conditions using high oligonucleotide
concentrations.
[1665] Oligonucleotide hybridization solution:
6.times.SSC
[1666] 0.01 M sodium phosphate
1 mM EDTA (pH 8)
0.5% SDS
[1667] 100 .mu.g/ml denatured salmon sperm DNA 0.1% nonfat dried
milk
[1668] During hybridization, temperature is lowered stepwise to
5-10.degree. C. below the estimated oligonucleotide T, or down to
room temperature followed by washing steps and autoradiography.
Washing is performed with low stringency such as 3 washing steps
using 4.times.SSC. Further details are described by Sambrook J. et
al., 1989, "Molecular Cloning: A Laboratory Manual," Cold Spring
Harbor Laboratory Press or Ausubel F. M. et al., 1994, "Current
Protocols in Molecular Biology," John Wiley & Sons.
Example 11
Identification of Identical Genes by Screening Expression Libraries
with Antibodies
[1669] c-DNA clones can be used to produce recombinant polypeptide
for example in E. coli (e.g. Qiagen QIAexpress pQE system).
Recombinant polypeptides are then normally affinity purified via
Ni-NTA affinity chromatography (Qiagen). Recombinant polypeptides
are then used to produce specific antibodies for example by using
standard techniques for rabbit immunization. Antibodies are
affinity purified using a Ni-NTA column saturated with the
recombinant antigen as described by Gu et al., BioTechniques 17,
257 (1994). The antibody can than be used to screen expression cDNA
libraries to identify identical or heterologous genes via an
immunological screening (Sambrook, J. et al., 1989, "Molecular
Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press
or Ausubel, F. M. et al., 1994, "Current Protocols in Molecular
Biology", John Wiley & Sons).
Example 12
In vivo Mutagenesis
[1670] In vivo mutagenesis of microorganisms can be performed by
passage of plasmid (or other vector) DNA through E. coli or other
microorganisms (e.g. Bacillus spp. or yeasts such as S. cerevisiae)
which are impaired in their capabilities to maintain the integrity
of their genetic information. Typical mutator strains have
mutations in the genes for the DNA repair system (e.g., mutHLS,
mutD, mutT, etc.; for reference, see Rupp W. D., DNA repair
mechanisms, in: E. coli and Salmonella, p. 2277-2294, ASM, 1996,
Washington.) Such strains are well known to those skilled in the
art. The use of such strains is illustrated, for example, in
Greener A. and Callahan M., Strategies 7, 32 (1994). Transfer of
mutated DNA molecules into plants is preferably done after
selection and testing in microorganisms. Transgenic plants are
generated according to various examples within the exemplification
of this document.
Example 13
Engineering Arabidopsis Plants with Increased Yield, e.g. an
Increased Yield-Related Trait, for Example an Enhanced Stress
Tolerance, Preferably Tolerance to Low Temperature, and/or
Increased Biomass Production by Over-Expressing LTRRP or YRP
Encoding Genes for Example from A. thaliana, Brassica napus,
Glycine max, Zea mays or Oryza sativa, Using Tissue-Specific or
Stress-Inducible Promoters
[1671] Transgenic Arabidopsis plants over-expressing LTRRP genes or
YRP genes, e.g. low temperature resistance and/or tolerance related
protein encoding genes, from for example A. thaliana, Brassica
napus, Glycine max, Zea mays and Oryza sativa are created as
described in example 1 to express the LTRRP or YRP encoding
transgenes under the control of a tissue-specific or
stress-inducible promoter. T2 generation plants are produced and
grown under stress or non-stress conditions, e.g. low temperature
conditions. Plants with an increased yield, e.g. an increased
yield-related trait, e.g. higher tolerance to stress, e.g. low
temperature, or with an increased nutrient use efficiency or an
increased intrinsic yield, show increased biomass production and/or
dry matter production and/or seed yield under low temperature
conditions when compared to plants lacking the transgene, e.g. to
corresponding non-transgenic wild type plants.
Example 14
Engineering Alfalfa Plants with Increased Yield, e.g. an Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g. Low
Temperature Resistance and/or Tolerance Related Genes for Example
from A. thaliana, Brassica napus, Glycine max, Zea mays or Oryza
sativa, for Example
[1672] A regenerating clone of alfalfa (Medicago sativa) is
transformed using the method of McKersie et al., (Plant Physiol.
119, 839 (1999)). Regeneration and transformation of alfalfa is
genotype dependent and therefore a regenerating plant is required.
Methods to obtain regenerating plants have been described. For
example, these can be selected from the cultivar Rangelander
(Agriculture Canada) or any other commercial alfalfa variety as
described by Brown and Atanassov (Plant Cell Tissue Organ Culture
4, 111 (1985)). Alternatively, the RA3 variety (University of
Wisconsin) has been selected for use in tissue culture (Walker et
al., Am. J. Bot. 65, 54 (1978)). Petiole explants are cocultivated
with an overnight culture of Agrobacterium tumefaciens C58C1 pMP90
(McKersie et al., Plant Physiol 119, 839 (1999)) or LBA4404
containing a binary vector. Many different binary vector systems
have been described for plant transformation (e.g. An G., in
Agrobacterium Protocols. Methods in Molecular Biology Vol. 44, p.
47-62, Gartland K. M. A. and Davey M. R. eds. Humana Press, Totowa,
N.J.). Many are based on the vector pBIN19 described by Bevan
(Nucleic Acid Research. 12, 8711 (1984)) that includes a plant gene
expression cassette flanked by the left and right border sequences
from the Ti plasmid of Agrobacterium tumefaciens. A plant gene
expression cassette consists of at least two genes--a selection
marker gene and a plant promoter regulating the transcription of
the cDNA or genomic DNA of the trait gene. Various selection marker
genes can be used including the Arabidopsis gene encoding a mutated
acetohydroxy acid synthase (AHAS) enzyme (U.S. Pat. Nos. 5,7673,666
and 6,225,105). Similarly, various promoters can be used to
regulate the trait gene that provides constitutive, developmental,
tissue or environmental regulation of gene transcription. In this
example, the 34S promoter (GenBank Accession numbers M59930 and
X16673) was used to provide constitutive expression of the trait
gene.
[1673] The explants are cocultivated for 3 days in the dark on SH
induction medium containing 288 mg/L Pro, 53 mg/L thioproline, 4.35
g/L K.sub.2504, and 100 .mu.m acetosyringinone. The explants were
washed in half-strength Murashige-Skoog medium (Murashige and
Skoog, 1962) and plated on the same SH induction medium without
acetosyringinone but with a suitable selection agent and suitable
antibiotic to inhibit Agrobacterium growth. After several weeks,
somatic embryos are transferred to BOi2Y development medium
containing no growth regulators, no antibiotics, and 50 g/L
sucrose. Somatic embryos are subsequently germinated on
half-strength Murashige-Skoog medium. Rooted seedlings are
transplanted into pots and grown in a greenhouse.
[1674] The T0 transgenic plants are propagated by node cuttings and
rooted in Turface growth medium. T1 or T2 generation plants are
produced and subjected to experiments comprising stress or
non-stress conditions, e.g. low temperature conditions as described
in previous examples.
[1675] For the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to e.g. corresponding
non-transgenic wild type plants.
[1676] For example, plants with an increased yield, e.g. an
increased yield-related trait, e.g. higher tolerance to stress,
e.g. with an increased nutrient use efficiency or an increased
intrinsic yield, and e.g. with higher tolerance to low temperature
may show increased biomass production and/or dry matter production
and/or seed yield under low temperature when compared to plants
lacking the transgene, e.g. to corresponding non-transgenic wild
type plants.
Example 15
Engineering Ryegrass Plants with Increased Yield, e.g. an Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g. Low
Temperature Resistance and/or Tolerance Related Genes for Example
from A. thaliana, Brassica napus, Glycine max, Zea mays or Oryza
sativa,
[1677] Seeds of several different ryegrass varieties may be used as
explant sources for transformation, including the commercial
variety Gunne available from Svalof Weibull seed company or the
variety Affinity. Seeds are surface-sterilized sequentially with 1%
Tween-20 for 1 minute, 100% bleach for 60 minutes, 3 rinses of 5
minutes each with deionized and distilled H2O, and then germinated
for 3-4 days on moist, sterile filter paper in the dark. Seedlings
are further sterilized for 1 minute with 1% Tween-20, 5 minutes
with 75% bleach, and rinsed 3 times with double destilled H2O, 5
min each.
[1678] Surface-sterilized seeds are placed on the callus induction
medium containing Murashige and Skoog basal salts and vitamins, 20
g/L sucrose, 150 mg/L asparagine, 500 mg/L casein hydrolysate, 3
g/L Phytagel, 10 mg/L BAP, and 5 mg/L dicamba. Plates are incubated
in the dark at 25.degree. C. for 4 weeks for seed germination and
embryogenic callus induction.
[1679] After 4 weeks on the callus induction medium, the shoots and
roots of the seedlings are trimmed away, the callus is transferred
to fresh media, maintained in culture for another 4 weeks, and then
transferred to MSO medium in light for 2 weeks. Several pieces of
callus (11-17 weeks old) are either strained through a 10 mesh
sieve and put onto callus induction medium, or cultured in 100 ml
of liquid ryegrass callus induction media (same medium as for
callus induction with agar) in a 250 ml flask. The flask is wrapped
in foil and shaken at 175 rpm in the dark at 23.degree. C. for 1
week. Sieving the liquid culture with a 40-mesh sieve collect the
cells. The fraction collected on the sieve is plated and cultured
on solid ryegrass callus induction medium for 1 week in the dark at
25.degree. C. The callus is then transferred to and cultured on MS
medium containing 1% sucrose for 2 weeks.
[1680] Transformation can be accomplished with either Agrobacterium
of with particle bombardment methods. An expression vector is
created containing a constitutive plant promoter and the cDNA of
the gene in a pUC vector. The plasmid DNA is prepared from E. coli
cells using with Qiagen kit according to manufacturer's
instruction. Approximately 2 g of embryogenic callus is spread in
the center of a sterile filter paper in a Petri dish. An aliquot of
liquid MSO with 10 g/l sucrose is added to the filter paper. Gold
particles (1.0 .mu.m in size) are coated with plasmid DNA according
to method of Sanford et al., 1993 and delivered to the embryogenic
callus with the following parameters: 500 .mu.g particles and 2
.mu.g DNA per shot, 1300 psi and a target distance of 8.5 cm from
stopping plate to plate of callus and 1 shot per plate of
callus.
[1681] After the bombardment, calli are transferred back to the
fresh callus development medium and maintained in the dark at room
temperature for a 1-week period. The callus is then transferred to
growth conditions in the light at 25.degree. C. to initiate embryo
differentiation with the appropriate selection agent, e.g. 250 nM
Arsenal, 5 mg/L PPT or 50 mg/L kanamycin. Shoots resistant to the
selection agent appeared and once rooted are transferred to
soil.
[1682] Samples of the primary transgenic plants (T0) are analyzed
by PCR to confirm the presence of T-DNA. These results are
confirmed by Southern hybridization in which DNA is electrophoresed
on a 1% agarose gel and transferred to a positively charged nylon
membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit
(Roche Diagnostics) is used to prepare a digoxigeninlabelled probe
by PCR, and used as recommended by the manufacturer.
[1683] Transgenic T0 ryegrass plants are propagated vegetatively by
excising tillers. The transplanted tillers are maintained in the
greenhouse for 2 months until well established. T1 or T2 generation
plants are produced and subjected to stress or non-stress
conditions, e.g. low temperature experiments, e.g. as described
above in example 1.
[1684] For the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to e.g. corresponding
non-transgenic wild type plants. For example, plants with an
increased yield, e.g. an increased yield-related trait, e.g. higher
tolerance to stress, e.g. with an increased nutrient use efficiency
or an increased intrinsic yield, and e.g. with higher tolerance to
low temperature may show increased biomass production and/or dry
matter production and/or seed yield under low temperature when
compared to plants lacking the transgene, e.g. to corresponding
non-transgenic wild type plants.
Example 16
Engineering Soybean Plants with Increased Yield, e.g. an Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g. Low
Temperature Resistance and/or Tolerance Related Genes, for Example
from A. thaliana, Brassica napus, Glycine max, Zea mays or Oryza
sativa.
[1685] Soybean is transformed according to the following
modification of the method described in the Texas A&M patent
U.S. Pat. No. 5,164,310. Several commercial soybean varieties are
amenable to transformation by this method. The cultivar Jack
(available from the Illinois Seed Foundation) is a commonly used
for transformation. Seeds are sterilized by immersion in 70% (v/v)
ethanol for 6 min and in 25% commercial bleach (NaOCl) supplemented
with 0.1% (v/v) Tween for 20 min, followed by rinsing 4 times with
sterile double distilled water. Seven-day old seedlings are
propagated by removing the radicle, hypocotyl and one cotyledon
from each seedling. Then, the epicotyl with one cotyledon is
transferred to fresh germination media in petri dishes and
incubated at 25.degree. C. under a 16 h photoperiod (approx. 100
.mu.mol/ms) for three weeks. Axillary nodes (approx. 4 mm in
length) are cut from 3-4 week-old plants. Axillary nodes are
excised and incubated in Agrobacterium LBA4404 culture.
[1686] Many different binary vector systems have been described for
plant transformation (e.g. An G., in Agrobacterium Protocols.
Methods in Molecular Biology Vol 44, p. 47-62, Gartland K. M. A.
and Davey M. R. eds. Humana Press, Totowa, N.J.). Many are based on
the vector pBIN19 described by Bevan (Nucleic Acid Research. 12,
8711 (1984)) that includes a plant gene expression cassette flanked
by the left and right border sequences from the Ti plasmid of
Agrobacterium tumefaciens. A plant gene expression cassette
consists of at least two genes--a selection marker gene and a plant
promoter regulating the transcription of the cDNA or genomic DNA of
the trait gene. Various selection marker genes can be used
including the Arabidopsis gene encoding a mutated acetohydroxy acid
synthase (AHAS) enzyme (U.S. Pat. Nos. 5,7673,666 and 6,225,105).
Similarly, various promoters can be used to regulate the trait gene
to provide constitutive, developmental, tissue or environmental
regulation of gene transcription. In this example, the 34S promoter
(GenBank Accession numbers M59930 and X16673) is used to provide
constitutive expression of the trait gene.
[1687] After the co-cultivation treatment, the explants are washed
and transferred to selection media supplemented with 500 mg/L
timentin. Shoots are excised and placed on a shoot elongation
medium. Shoots longer than 1 cm are placed on rooting medium for
two to four weeks prior to transplanting to soil.
[1688] The primary transgenic plants (T0) are analyzed by PCR to
confirm the presence of T-DNA. These results are confirmed by
Southern hybridization in which DNA is electrophoresed on a 1%
agarose gel and transferred to a positively charged nylon membrane
(Roche Diagnostics). The PCR DIG Probe Synthesis Kit (Roche
Diagnostics) is used to prepare a digoxigeninlabelled probe by PCR,
and used as recommended by the manufacturer. Soybea plants
over-expressing LTRRP genesor YRP genes, e.g. low temperature
resistance and/or tolerance related genes from A. thaliana,
Brassica napus, Glycine max, Zea mays or Oryza sativa, show
increased yield, for example, have higher seed yields.
[1689] T1 or T2 generation plants are produced and subjected to
stress and non-stress conditions, e.g. low temperature experiments,
e.g. as described above in example 1.
[1690] For the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to e.g. corresponding
non-transgenic wild type plants. For example, plants with an
increased yield, e.g. an increased yield-related trait, e.g. higher
tolerance to stress, e.g. with an increased nutrient use efficiency
or an increased intrinsic yield, and e.g. with higher tolerance to
low temperature may show increased biomass production and/or dry
matter production and/or seed yield under low temperature when
compared to plants lacking the transgene, e.g. to corresponding
non-transgenic wild type plants.
Example 17
Engineering Rapeseed/Canola Plants with Increased Yield, e.g. an
Increased Yield-Related Trait, for Example an Enhanced Stress
Tolerance, Preferably Tolerance to Low Temperature, and/or
Increased Biomass Production by Over-Expressing LTRRP Genes or YRP
Genes, e.g. Low Temperature Resistance and/or Tolerance Related
Genes for Example from A. thaliana, Brassica napus, Glycine max,
Zea mays or Oryza sativa
[1691] Cotyledonary petioles and hypocotyls of 5-6 day-old young
seedlings are used as explants for tissue culture and transformed
according to Babic et al. (Plant Cell Rep 17, 183 (1998)). The
commercial cultivar Westar (Agriculture Canada) is the standard
variety used for transformation, but other varieties can be used.
Agrobacterium tumefaciens LBA4404 containing a binary vector is
used for canola transformation. Many different binary vector
systems have been described for plant transformation (e.g. An G.,
in Agrobacterium Protocols. Methods in Molecular Biology Vol. 44,
p. 47-62, Gartland K. M. A. and Davey M. R. eds. Humana Press,
Totowa, N.J.). Many are based on the vector pBIN19 described by
Bevan (Nucleic Acid Research. 12, 8711 (1984)) that includes a
plant gene expression cassette flanked by the left and right border
sequences from the Ti plasmid of Agrobacterium tumefaciens. A plant
gene expression cassette consists of at least two genes--a
selection marker gene and a plant promoter regulating the
transcription of the cDNA or genomic DNA of the trait gene. Various
selection marker genes can be used including the Arabidopsis gene
encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S.
Pat. Nos. 5,7673,666 and 6,225,105). Similarly, various promoters
can be used to regulate the trait gene to provide constitutive,
developmental, tissue or environmental regulation of gene
transcription. In this example, the 34S promoter (GenBank Accession
numbers M59930 and X16673) is used to provide constitutive
expression of the trait gene.
[1692] Canola seeds are surface-sterilized in 70% ethanol for 2
min., and then in 30% Clorox with a drop of Tween-20 for 10 min,
followed by three rinses with sterilized distilled water. Seeds are
then germinated in vitro 5 days on half strength MS medium without
hormones, 1% sucrose, 0.7% Phytagar at 23.degree. C., 16 h light.
The cotyledon petiole explants with the cotyledon attached are
excised from the in vitro seedlings, and inoculated with
Agrobacterium by dipping the cut end of the petiole explant into
the bacterial suspension. The explants are then cultured for 2 days
on MSBAP-3 medium containing 3 mg/L BAP, 3% sucrose, 0.7% Phytagar
at 23.degree. C., 16 h light. After two days of co-cultivation with
Agrobacterium, the petiole explants are transferred to MSBAP-3
medium containing 3 mg/l BAP, cefotaxime, carbenicillin, or
timentin (300 mg/L) for 7 days, and then cultured on MSBAP-3 medium
with cefotaxime, carbenicillin, or timentin and selection agent
until shoot regeneration. When the shoots are 5-10 mm in length,
they are cut and transferred to shoot elongation medium (MSBAP-0.5,
containing 0.5 mg/L BAP). Shoots of about 2 cm in length are
transferred to the rooting medium (MSO) for root induction.
[1693] Samples of the primary transgenic plants (T0) are analyzed
by PCR to confirm the presence of T-DNA. These results are
confirmed by Southern hybridization in which DNA is electrophoresed
on a 1 agarose gel and transferred to a positively charged nylon
membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit
(Roche Diagnostics) is used to prepare a digoxigeninlabelled probe
by PCR, and used as recommended by the manufacturer.
[1694] The transgenic plants are then evaluated for their increased
yield, e.g. an increased yield-related trait, e.g. higher tolerance
to stress, e.g. enhanced tolerance to low temperature and/or
increased biomass production according to the method described in
Example 2. It is found that transgenic rapeseed/canola
over-expressing LTRRP genes or YRP genes, e.g. low temperature
resistance and/or tolerance related genes, from Brassica napus,
Glycine max, Zea mays or Oryza sativa show increased yield, for
example show an increased yield, e.g. an increased yield-related
trait, e.g. higher tolerance to stress, e.g. with enhanced
tolerance to low temperature and/or increased biomass production
compared to plants without the transgene, e.g. corresponding
non-transgenic control plants.
Example 18
Engineering Corn Plants with Increased Yield, e.g. An Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g.
Tolerance to Low Temperature Related Genes for Example from A.
thaliana, Brassica napus, Glycine max, Zea mays or Oryza sativa
[1695] Transformation of corn (Zea mays L.) is performed with a
modification of the method described by Ishida et al. (Nature
Biotech 14745 (1996)). Transformation is genotype-dependent in corn
and only specific genotypes are amenable to transformation and
regeneration. The inbred line A188 (University of Minnesota) or
hybrids with A188 as a parent are good sources of donor material
for transformation (Fromm et al. Biotech 8, 833 (1990), but other
genotypes can be used successfully as well. Ears are harvested from
corn plants at approximately 11 days after pollination (DAP) when
the length of immature embryos is about 1 to 1.2 mm. Immature
embryos are co-cultivated with Agrobacterium tumefaciens that carry
"super binary" vectors and transgenic plants are recovered through
organogenesis. The super binary vector system of Japan Tobacco is
described in WO patents WO 94/00977 and WO 95/06722. Vectors are
constructed as described. Various selection marker genes can be
used including the corn gene encoding a mutated acetohydroxy acid
synthase (AHAS) enzyme (U.S. Pat. No. 6,025,541). Similarly,
various promoters can be used to regulate the trait gene to provide
constitutive, developmental, tissue or environmental regulation of
gene transcription. In this example, the 34S promoter (GenBank
Accession numbers M59930 and X16673) is used to provide
constitutive expression of the trait gene.
[1696] Excised embryos are grown on callus induction medium, then
corn regeneration medium, containing imidazolinone as a selection
agent. The Petri plates were incubated in the light at 25.degree.
C. for 2-3 weeks, or until shoots develop. The green shoots from
each embryo are transferred to corn rooting medium and incubated at
25.degree. C. for 2-3 weeks, until roots develop. The rooted shoots
are transplanted to soil in the greenhouse. T1 seeds are produced
from plants that exhibit tolerance to the imidazolinone herbicides
and are PCR positive for the transgenes.
[1697] The T1 transgenic plants are then evaluated for increased
yield, e.g. an increased yield-related trait, e.g. higher tolerance
to stress, e.g. with enhanced tolerance to low temperature and/or
increased biomass production according to the methods described in
Example 2. The T1 generation of single locus insertions of the
T-DNA will segregate for the transgene in a 1:2:1 ratio. Those
progeny containing one or two copies of the transgene (3/4 of the
progeny) are tolerant regarding the imidazolinone herbicide, and
exhibit an increased yield, e.g. an increased yield-related trait,
e.g. higher tolerance to stress, e.g. with enhanced tolerance to
low temperature and/or increased biomass production compared to
those progeny lacking the transgenes. Tolerant plants have higher
seed yields. Homozygous T2 plants exhibited similar phenotypes.
Hybrid plants (F1 progeny) of homozygous transgenic plants and
non-transgenic plants also exhibited an increased yield, e.g. an
increased yield-related trait, e.g. higher tolerance to stress,
e.g. with enhanced tolerance to low temperature and/or increased
biomass production.
Example 19
Engineering Wheat Plants with Increased Yield, e.g. An Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g. Low
Temperature Resistance and/or Tolerance Related Genes, for Example
from A. thaliana, Brassica napus, Glycine max, Zea mays or Oryza
sativa
[1698] Transformation of wheat is performed with the method
described by Ishida et al. (Nature Biotech. 14745 (1996)). The
cultivar Bobwhite (available from CYMMIT, Mexico) is commonly used
in transformation. Immature embryos are co-cultivated with
Agrobacterium tumefaciens that carry "super binary" vectors, and
transgenic plants are recovered through organogenesis. The super
binary vector system of Japan Tobacco is described in WO patents WO
94/00977 and WO 95/06722. Vectors are constructed as described.
Various selection marker genes can be used including the maize gene
encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S.
Pat. No. 6,025,541). Similarly, various promoters can be used to
regulate the trait gene to provide constitutive, developmental,
tissue or environmental regulation of gene transcription. In this
example, the 34S promoter (GenBank Accession numbers M59930 and
X16673) is used to provide constitutive expression of the trait
gene.
[1699] After incubation with Agrobacterium, the embryos are grown
on callus induction medium, then regeneration medium, containing
imidazolinone as a selection agent. The Petri plates are incubated
in the light at 25.degree. C. for 2-3 weeks, or until shoots
develop. The green shoots are transferred from each embryo to
rooting medium and incubated at 25.degree. C. for 2-3 weeks, until
roots develop. The rooted shoots are transplanted to soil in the
greenhouse. T1 seeds are produced from plants that exhibit
tolerance to the imidazolinone herbicides and which are PCR
positive for the transgenes.
[1700] The T1 transgenic plants are then evaluated for their
increased yield, e.g. an increased yield-related trait, e.g. higher
tolerance to stress, e.g. with enhanced tolerance to low
temperature and/or increased biomass production according to the
method described in example 2. The T1 generation of single locus
insertions of the T-DNA will segregate for the transgene in a 1:2:1
ratio. Those progeny containing one or two copies of the transgene
(3/4 of the progeny) are tolerant regarding the imidazolinone
herbicide, and exhibit an increased yield, e.g. an increased
yield-related trait, e.g. higher tolerance to stress, e.g. with
enhanced tolerance to low temperature and/or increased biomass
production compared to those progeny lacking the transgenes.
[1701] For the assessment of yield increase, e.g. tolerance to low
temperature, biomass production, intrinsic yield and/or dry matter
production and/or seed yield is compared to e.g. corresponding
non-transgenic wild type plants. For example, plants with an
increased yield, e.g. an increased yield-related trait, e.g. higher
tolerance to stress, e.g. with an increased nutrient use efficiency
or an increased intrinsic yield, and e.g. with higher tolerance to
low temperature may show increased biomass production and/or dry
matter production and/or seed yield under low temperature when
compared plants lacking the transgene, e.g. to corresponding
non-transgenic wild type plants.
Example 20
Engineering Rice Plants with Increased Yield Under Condition of
Transient and Repetitive Abiotic Stress, e.g. An Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g. Low
Temperature Resistance and/or Tolerance Related Genes, by
Over-Expressing Stress Related Genes from Saccharomyces cerevisiae
or E. coli or Synechocystis
Rice Transformation
[1702] The Agrobacterium containing the expression vector of the
invention is used to transform Oryza sativa plants. Mature dry
seeds of the rice japonica cultivar Nipponbare are dehusked.
Sterilization is carried out by incubating for one minute in 70%
ethanol, followed by 30 minutes in 0.2% HgCl2, followed by a 6
times 15 minutes wash with sterile distilled water. The sterile
seeds are then germinated on a medium containing 2,4-D (callus
induction medium). After incubation in the dark for four weeks,
embryogenic, scutellum-derived calli are excised and propagated on
the same medium. After two weeks, the calli are multiplied or
propagated by subculture on the same medium for another 2 weeks.
Embryogenic callus pieces are sub-cultured on fresh medium 3 days
before co-cultivation (to boost cell division activity).
Agrobacterium strain LBA4404 containing the expression vector of
the invention is used for co-cultivation. Agrobacterium is
inoculated on AB medium with the appropriate antibiotics and
cultured for 3 days at 28.degree. C. The bacteria are then
collected and suspended in liquid co-cultivation medium to a
density (OD600) of about 1. The suspension is then transferred to a
Petri dish and the calli immersed in the suspension for 15 minutes.
The callus tissues are then blotted dry on a filter paper and
transferred to solidified, co-cultivation medium and incubated for
3 days in the dark at 25.degree. C. Co-cultivated calli are grown
on 2,4-D-containing medium for 4 weeks in the dark at 28.degree. C.
in the presence of a selection agent. During this period, rapidly
growing resistant callus islands developed. After transfer of this
material to a regeneration medium and incubation in the light, the
embryogenic potential is released and shoots developed in the next
four to five weeks. Shoots are excised from the calli and incubated
for 2 to 3 weeks on an auxin-containing medium from which they are
transferred to soil. Hardened shoots are grown under high humidity
and short days in a greenhouse.
[1703] Approximately 35 independent TO rice transformants are
generated for one construct. The primary transformants are
transferred from a tissue culture chamber to a greenhouse. After a
quantitative PCR analysis to verify copy number of the T-DNA
insert, only single copy transgenic plants that exhibit tolerance
to the selection agent are kept for harvest of T1 seed. Seeds are
then harvested three to five months after transplanting. The method
yielded single locus transformants at a rate of over 50% (Aldemita
and Hodges1996, Chan et al. 1993, Hiei et al. 1994). For the
assessment of yield increase, e.g. tolerance to low temperature,
biomass production, intrinsic yield and/or dry matter production
and/or seed yield is compared to e.g. corresponding non-transgenic
wild type plants. For example, plants with an increased yield, e.g.
an increased yield-related trait, e.g. higher tolerance to stress,
e.g. with an increased nutrient use efficiency or an increased
intrinsic yield, and e.g. with higher tolerance to low temperature
may show increased biomass production and/or dry matter production
and/or seed yield under low temperature when compared plants
lacking the transgene, e.g. to corresponding non-transgenic wild
type plants.
[1704] E.g., for the cycling drought assay repetitive stress is
applied to plants without leading to desiccation. The water supply
throughout the experiment is limited and plants are subjected to
cycles of drought and re-watering. For measuring biomass
production, plant fresh weight is determined one day after the
final watering by cutting shoots and weighing them.
Example 21
Engineering Rice Plants with Increased Yield Under Condition of
Transient and Repetitive Abiotic Stress, e.g. An Increased
Yield-Related Trait, for Example an Enhanced Stress Tolerance,
Preferably Tolerance to Low Temperature, and/or Increased Biomass
Production by Over-Expressing LTRRP Genes or YRP Genes, e.g. Low
Temperature Resistance and/or Tolerance Related Genes, by
Over-Expressing Yield and Stress Related Genes for Example from A.
thaliana, Brassica napus, Glycine max, Zea mays or Oryza sativa for
Example
Rice Transformation
[1705] The Agrobacterium containing the expression vector of the
invention is used to transform Oryza sativa plants. Mature dry
seeds of the rice japonica cultivar Nipponbare are dehusked.
Sterilization is carried out by incubating for one minute in 70%
ethanol, followed by 30 minutes in 0.2% HgCl2, followed by a 6
times 15 minutes wash with sterile distilled water. The sterile
seeds are then germinated on a medium containing 2,4-D (callus
induction medium). After incubation in the dark for four weeks,
embryogenic, scutellum-derived calli are excised and propagated on
the same medium. After two weeks, the calli are multiplied or
propagated by subculture on the same medium for another 2 weeks.
Embryogenic callus pieces are sub-cultured on fresh medium 3 days
before co-cultivation (to boost cell division activity).
[1706] Agrobacterium strain LBA4404 containing the expression
vector of the invention is used for co-cultivation. Agrobacterium
is inoculated on AB medium with the appropriate antibiotics and
cultured for 3 days at 28.degree. C. The bacteria are then
collected and suspended in liquid co-cultivation medium to a
density (OD600) of about 1. The suspension is then transferred to a
Petri dish and the calli immersed in the suspension for 15 minutes.
The callus tissues are then blotted dry on a filter paper and
transferred to solidified, co-cultivation medium and incubated for
3 days in the dark at 25.degree. C. Co-cultivated calli are grown
on 2,4-D-containing medium for 4 weeks in the dark at 28.degree. C.
in the presence of a selection agent. During this period, rapidly
growing resistant callus islands developed. After transfer of this
material to a regeneration medium and incubation in the light, the
embryogenic potential is released and shoots developed in the next
four to five weeks. Shoots are excised from the calli and incubated
for 2 to 3 weeks on an auxin-containing medium from which they are
transferred to soil. Hardened shoots are grown under high humidity
and short days in a greenhouse.
[1707] Approximately 35 independent TO rice transformants are
generated for one construct. The primary transformants are
transferred from a tissue culture chamber to a greenhouse. After a
quantitative PCR analysis to verify copy number of the T-DNA
insert, only single copy transgenic plants that exhibit tolerance
to the selection agent are kept for harvest of T1 seed. Seeds are
then harvested three to five months after transplanting. The method
yielded single locus transformants at a rate of over 50% (Aldemita
and Hodges1996, Chan et al. 1993, Hiei et al. 1994). For the
assessment of yield increase, e.g. tolerance to low temperature,
biomass production, intrinsic yield and/or dry matter production
and/or seed yield is compared to e.g. corresponding non-transgenic
wild type plants. For example, plants with an increased yield, e.g.
an increased yield-related trait, e.g. higher tolerance to stress,
e.g. with an increased nutrient use efficiency or an increased
intrinsic yield, and e.g. with higher tolerance to low temperature
may show increased biomass production and/or dry matter production
and/or seed yield under low temperature when compared plants
lacking the transgene, e.g. to corresponding non-transgenic wild
type plants.
[1708] E.g., for the cycling drought assay repetitive stress is
applied to plants without leading to desiccation. The water supply
throughout the experiment is limited and plants are subjected to
cycles of drought and re-watering. For measuring biomass
production, plant fresh weight is determined one day after the
final watering by cutting shoots and weighing them. At an
equivalent degree of drought stress, tolerant plants are able to
resume normal growth whereas susceptible plants have died or suffer
significant injury resulting in shorter leaves and less dry
matter.
Example 22
Plant Screening for Growth Under Cycling Drought Conditions
[1709] In the cycling drought assay repetitive stress is applied to
plants without leading to desiccation. In a standard experiment
soil is prepared as 1:1 (v/v) mixture of nutrient rich soil (GS90,
Tantau, Wansdorf, Germany) and quarz sand. Pots (6 cm diameter)
were filled with this mixture and placed into trays. Water was
added to the trays to let the soil mixture take up appropriate
amount of water for the sowing procedure (day 1) and subsequently
seeds of transgenic A. thaliana plants and their wild-type controls
were sown in pots. Then the filled tray was covered with a
transparent lid and transferred into a precooled (4.degree.
C.-5.degree. C.) and darkened growth chamber. Stratification was
established for a period of 3 days in the dark at 4.degree.
C.-5.degree. C. or, alternatively, for 4 days in the dark at
4.degree. C. Germination of seeds and growth was initiated at a
growth condition of 20.degree. C., 60% relative humidity, 16 h
photoperiod and illumination with fluorescent light at
approximately 200 .mu.mol/m2s. Covers were removed 7-8 days after
sowing. BASTA selection was done at day 10 or day 11 (9 or 10 days
after sowing) by spraying pots with plantlets from the top. In the
standard experiment, a 0.07% (v/v) solution of BASTA concentrate
(183 g/l glufosinate-ammonium) in tap water was sprayed once or,
alternatively, a 0.02% (v/v) solution of BASTA was sprayed three
times. The wild-type control plants were sprayed with tap water
only (instead of spraying with BASTA dissolved in tap water) but
were otherwise treated identically. Plants were individualized
13-14 days after sowing by removing the surplus of seedlings and
leaving one seedling in soil. Transgenic events and wild-type
control plants were evenly distributed over the chamber.
[1710] The water supply throughout the experiment was limited and
plants were subjected to cycles of drought and re-watering.
Watering was carried out at day 1 (before sowing), day 14 or day
15, day 21 or day 22, and, finally, day 27 or day 28. For measuring
biomass production, plant fresh weight was determined one day after
the final watering (day 28 or day 29) by cutting shoots and
weighing them. Besides weighing, phenotypic information was added
in case of plants that differ from the wild type control. Plants
were in the stage prior to flowering and prior to growth of
inflorescence when harvested. Significance values for the
statistical significance of the biomass changes were calculated by
applying the `student's` t test (parameters: two-sided, unequal
variance).
[1711] Up to five lines (events) per transgenic construct were
tested in successive experimental levels (up to 4). Only constructs
that displayed positive performance were subjected to the next
experimental level. Usually in the first level five plants per
construct were tested and in the subsequent levels 30-60 plants
were tested. Biomass performance was evaluated as described above.
Data are shown for constructs that displayed increased biomass
performance in at least two successive experimental levels.
[1712] Biomass production of transgenic A. thaliana developed under
cycling drought growth conditions is shown in Table VIIIc: Biomass
production was measured by weighing plant rosettes. Biomass
increase was calculated as ratio of average weight for transgenic
plants compared to average weight of wild type control plants from
the same experiment. The mean biomass increase of transgenic
constructs is given (significance value <0.3 and biomass
increase >5% (ratio>1.05)).
Example 23
Plant Screening for Yield Increase Under Standardised Growth
Conditions (Intrinsic Yield)
[1713] In this experiment, a plant screening for yield increase (in
this case: biomass yield increase) under standardised growth
conditions in the absence of substantial abiotic stress has been
performed. In a standard experiment soil is prepared as 3.5:1 (v/v)
mixture of nutrient rich soil
[1714] (GS90, Tantau, Wansdorf, Germany) and quarz sand.
Alternatively, plants were sown on nutrient rich soil (GS90,
Tantau, Germany). Pots were filled with soil mixture and placed
into trays. Water was added to the trays to let the soil mixture
take up appropriate amount of water for the sowing procedure. The
seeds for transgenic A. thaliana plants and their non-trangenic
wild-type controls were sown in pots (6 cm diameter). Then the
filled tray was covered with a transparent lid and transferred into
a precooled (4.degree. C.-5.degree. C.) and darkened growth
chamber. Stratification was established for a period of 3-4 days in
the dark at 4.degree. C.-5.degree. C. Germination of seeds and
growth was initiated at a growth condition of 20.degree. C., 60%
relative humidity, 16 h photoperiod and illumination with
fluorescent light at approximately 200 .mu.mol/m2s. Covers were
removed 7-8 days after sowing. BASTA selection was done at day 10
or day 11 (9 or 10 days after sowing) by spraying pots with
plantlets from the top. In the standard experiment, a 0.07% (v/v)
solution of BASTA concentrate (183 g/l glufosinate-ammonium) in tap
water was sprayed once or, alternatively, a 0.02% (v/v) solution of
BASTA was sprayed three times. The wild-type control plants were
sprayed with tap water only (instead of spraying with BASTA
dissolved in tap water) but were otherwise treated identically.
Plants were individualized 13-14 days after sowing by removing the
surplus of seedlings and leaving one seedling in soil. Transgenic
events and wild-type control plants were evenly distributed over
the chamber.
[1715] Watering was carried out every two days after removing the
covers in a standard experiment or, alternatively, every day. For
measuring biomass performance, plant fresh weight was determined at
harvest time (24-29 days after sowing) by cutting shoots and
weighing them. Plants were in the stage prior to flowering and
prior to growth of inflorescence when harvested. Transgenic plants
were compared to the non-transgenic wild-type control plants.
Significance values for the statistical significance of the biomass
changes were calculated by applying the `student's` t test
(parameters: two-sided, unequal variance).
[1716] Two different types of experimental procedures were
performed: [1717] Procedure 1). Per transgenic construct 3-4
independent transgenic lines (=events) were tested (22-30 plants
per construct) and biomass performance was evaluated as described
above. [1718] Procedure 2.) Up to five lines per transgenic
construct were tested in successive experimental levels (up to 4).
Only constructs that displayed positive performance were subjected
to the next experimental level. Usually in the first level five
plants per construct were tested and in the subsequent levels 30-60
plants were tested. Biomass performance was evaluated as described
above. Data from this type of experiment (Procedure 2) are shown
for constructs that displayed increased biomass performance in at
least two successive experimental levels.
[1719] Biomass production of transgenic A. thaliana grown under
standardised growth conditions is shown in TableVIIId: Biomass
production was measured by weighing plant rosettes. Biomass
increase was calculated as ratio of average weight of transgenic
plants compared to average weight of wild-type control plants from
the same experiment. The mean biomass increase of transgenic
constructs is given (significance value <0.3 and biomass
increase >5% (ratio>1.05)).
Example 24
Plant Screening (Arabidopsis) for Growth Under Limited Nitrogen
Supply
[1720] Two different procedures were used for screening: [1721]
Procedure 1). Per transgenic construct 4 independent transgenic
lines (=events) were tested (22-28 plants per construct).
Arabidopsis thaliana seeds are sown in pots containing a 1:1 (v:v)
mixture of nutrient depleted soil ("Einheitserde Typ 0", 30% clay,
Tantau, Wansdorf Germany) and sand. Germination is induced by a
four day period at 4.degree. C., in the dark. Subsequently the
plants are grown under standard growth conditions (photoperiod of
16 h light and 8 h dark, 20.degree. C., 60% relative humidity, and
a photon flux density of 200 .mu.E). The plants are grown and
cultured, inter alia they are watered every second day with a
N-depleted nutrient solution. The N-depleted nutrient solution e.g.
contains beneath water
TABLE-US-00016 [1721] mineral nutrient final concentration KCl 3.00
mM MgSO.sub.4 .times. 7 H.sub.2O 0.5 mM CaCl.sub.2 .times. 6
H.sub.2O 1.5 mM K.sub.2SO.sub.4 1.5 mM NaH.sub.2PO.sub.4 1.5 mM
Fe-EDTA 40 .mu.M H.sub.3BO.sub.3 25 .mu.M MnSO.sub.4 .times.
H.sub.2O 1 .mu.M ZnSO.sub.4 .times. 7 H.sub.2O 0.5 .mu.M
Cu.sub.2SO.sub.4 .times. 5 H.sub.2O 0.3 .mu.M Na.sub.2MoO.sub.4
.times. 2 H.sub.2O 0.05 .mu.M
[1722] After 9 to 10 days the plants are individualized. After a
total time of 28 to 31 days the plants are harvested and rated by
the fresh weight of the aerial parts of the plants. The biomass
increase has been measured as ratio of the fresh weight of the
aerial parts of the respective transgenic plant and the
non-transgenic wild type plant. [1723] Procedure 2). For screening
of transgenic plants a specific culture facility was used. For
highthroughput purposes plants were screened for biomass production
on agar plates with limited supply of nitrogen (adapted from
Estelle and Somerville, 1987). This screening pipeline consists of
two level. Transgenic lines are subjected to subsequent level if
biomass production was significantly improved in comparison to wild
type plants. With each level number of replicates and statistical
stringency was increased.
[1724] For the sowing, the seeds were removed from the Eppendorf
tubes with the aid of a toothpick and transferred onto the
above-mentioned agar plates, with limited supply of nitrogen (0.05
mM KNO.sub.3). In total, approximately 15-30 seeds were distributed
horizontally on each plate (12.times.12 cm).
[1725] After the seeds had been sown, plates are subjected to
stratification for 2-4 days in the dark at 4.degree. C. After the
stratification, the test plants were grown for 22 to 25 days at a
16-h-light, 8-h-dark rhythm at 20.degree. C., an atmospheric
humidity of 60% and a CO.sub.2 concentration of approximately 400
ppm. The light sources used generate a light resembling the solar
color spectrum with a light intensity of approximately 100
.mu.E/m.sup.2s. After 10 to 11 days the plants are individualized.
Improved growth under nitrogen limited conditions was assessed by
biomass production of shoots and roots of transgenic plants in
comparison to wild type control plants after 20-25 days growth.
Transgenic lines showing a significant improved biomass production
in comparison to wild type plants are subjected to following
experiment of the subsequent level on soil as described in
procedure 1, however, 3-6 lines per construct were tested (up to 60
plants per construct).
[1726] Biomass production of transgenic Arabidopsis thaliana grown
under limited nitrogen supply is shown in Table VIIIa: Biomass
production was measured by weighing plant rosettes. Biomass
increase was calculated as ratio of average weight for transgenic
plants compared to average weight of wild type control plants from
the same experiment. The mean biomass increase of transgenic
constructs is given (significance value <0.3 and biomass
increase >5% (ratio>1.05)).
TABLE-US-00017 TABLE IA Nucleic acid sequence ID numbers 1. 2. 3.
4. 5. 6. 7. Application Hit Project Locus Organism Lead SEQ ID
Target SEQ IDs of Nucleic Acid Homologs 1 1 LT_OEX_1 B0414 E. coli
38 Cytoplasmic 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64,
66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98,
100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124,
126, 128, 130, 132, 134 1 2 LT_OEX_1 B2931 E. coli 147 Cytoplasmic
149, 151, 153, 155, 157, 159, 161, 163 1 3 LT_OEX_1 B3945 E. coli
172 Cytoplasmic 174, 176, 178, 180, 182, 184, 186, 188, 190, 192,
194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218,
220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244,
246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270,
272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296,
298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322,
324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348,
350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372 1 4
LT_OEX_1 YEL004W S. cerevisiae 382 Cytoplasmic 384, 386, 388, 390,
392, 394, 396 1 5 LT_OEX_1 YER177W S. cerevisiae 406 Cytoplasmic
408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432,
434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458,
460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484,
486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510,
512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536,
538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562,
564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588,
590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614,
616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640,
642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666,
668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718,
720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744,
746 1 6 LT_OEX_1 YHR204W S. cerevisiae 917 Cytoplasmic 919, 921,
923, 925, 927, 929, 931, 933, 935, 937, 939 1 7 LT_OEX_1 YLL053C S.
cerevisiae 952 Cytoplasmic 954, 956, 958, 960, 962, 964, 966, 968,
970, 972, 974, 976, 978, 980, 982, 984, 986, 988, 990, 992, 994,
996, 998, 1000, 1002, 1004, 1006, 1008, 1010, 1012, 1014, 1016,
1018, 1020, 1022, 1024, 1026, 1028, 1030, 1032, 1034, 1036, 1038,
1040, 1042, 1044, 1046, 1048, 1050, 1052, 1054, 1056, 1058, 1060,
1062, 1064, 1066, 1068, 1070, 1072, 1074, 1076, 1078, 1080, 1082,
1084, 1086, 1088, 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104,
1106, 1108, 1110, 1112, 1114, 1116, 1118, 1120, 1122, 1124, 1126,
1128, 1130, 1132, 1134, 1136, 1138, 1140, 1142, 1144, 1146, 1148,
1150, 1152, 1154, 1156, 1158, 1160, 1162, 1164, 1166, 1168, 1170,
1172, 1174, 1176, 1178, 1180, 1182, 1184, 1186, 1188, 1190, 1192,
1194, 1196, 1198, 1200, 1202, 1204, 1206, 1208, 1210, 1212 1 8
LT_OEX_1 YML123C S. cerevisiae 1320 Cytoplasmic 1322, 1324, 1326,
1328, 1330, 1332, 1334, 1336, 1338, 1340, 1342, 1344, 1346, 1348,
1350, 1352, 1354, 1356, 1358, 1360, 1362, 1364, 1366, 1368, 1370,
1372, 1374, 1376, 1378, 1380, 1382, 1384, 1386, 1388, 1390, 1392,
1394, 1396, 1398, 1400, 1402, 1404, 1406, 1408, 1410, 1412, 1414,
1416, 1418, 1420, 1422, 1424, 1426, 1428, 1430, 1432, 1434, 1436,
1438, 1440, 1442, 1444, 1446, 1448, 1450, 1452, 1454, 1456, 1458,
1460, 1462, 1464, 1466, 1468, 1470, 1472, 1474, 1476, 1478, 1480,
1482, 1484, 1486, 1488, 1490, 1492, 1494, 1496, 1498, 1500, 1502,
1504, 1506, 1508, 1510, 1512, 1514, 1516, 1518, 1520, 1522, 1524,
1526, 1528, 1530, 1532, 1534, 1536, 1538, 1540, 1542, 1544, 1546,
1548, 1550, 1552, 1554, 1556, 1558, 1560, 1562, 1564, 1566, 1568,
1570, 1572, 1574, 1576, 1578, 1580, 1582, 1584, 1586, 1588, 1590,
1592, 1594, 1596, 1598, 1600, 1602, 1604, 1606, 1608, 1610, 1612,
1614 1 9 LT_OEX_1 YNL142W S. cerevisiae 1648 Cytoplasmic 1650,
1652, 1654, 1656, 1658, 1660, 1662, 1664, 1666, 1668, 1670, 1672,
1674, 1676, 1678, 1680, 1682, 1684, 1686, 1688, 1690, 1692, 1694,
1696, 1698, 1700, 1702, 1704, 1706, 1708, 1710, 1712, 1714, 1716,
1718, 1720, 1722, 1724, 1726, 1728, 1730, 1732, 1734, 1736, 1738,
1740, 1742, 1744, 1746, 1748, 1750, 1752, 1754, 1756, 1758, 1760,
1762, 1764, 1766, 1768, 1770, 1772, 1774, 1776, 1778, 1780, 1782,
1784, 1786, 1788, 1790, 1792, 1794, 1796, 1798, 1800, 1802, 1804,
1806, 1808, 1810, 1812, 1814, 1816, 1818, 1820, 1822, 1824, 1826,
1828, 1830, 1832, 1834, 1836, 1838, 1840, 1842, 1844, 1846, 1848,
1850, 1852, 1854, 1856, 1858, 1860, 1862, 1864, 1866, 1868, 1870,
1872, 1874, 1876, 1878, 1880, 1882, 1884, 1886, 1888, 1890, 1892,
1894, 1896, 1898, 1900, 1902, 1904, 1906, 1908, 1910, 1912, 1914,
1916, 1918, 1920, 1922, 1924, 1926, 1928, 1930, 1932, 1934, 1936,
1938, 1940, 1942, 1944, 1946, 1948, 1950, 1952, 1954, 1956, 1958,
1960, 1962, 1964, 1966, 1968, 1970, 1972, 1974, 1976, 1978, 1980,
1982, 1984, 1986, 1988, 1990, 1992, 1994, 1996, 1998, 2000, 2002,
2004, 2006, 2008, 2010, 2012, 2014, 2016, 2018, 2020, 2022, 2024,
2026, 2028, 2030, 2032, 2034, 2036, 2038, 2040, 2042, 2044, 2046,
2048, 2050, 2052, 2054 1 10 LT_OEX_1 YNR040W S. cerevisiae 2065
Cytoplasmic 2067, 2069, 2071, 2073, 2075 1 11 LT_OEX_1 YPR035W S.
cerevisiae 2081 Cytoplasmic 2083, 2085, 2087, 2089, 2091, 2093,
2095, 2097, 2099, 2101, 2103, 2105, 2107, 2109, 2111, 2113, 2115,
2117, 2119, 2121, 2123, 2125, 2127, 2129, 2131, 2133, 2135, 2137,
2139, 2141, 2143, 2145, 2147, 2149, 2151, 2153, 2155, 2157, 2159,
2161, 2163, 2165, 2167, 2169, 2171, 2173, 2175, 2177, 2179, 2181,
2183, 2185, 2187, 2189, 2191, 2193, 2195, 2197, 2199, 2201, 2203,
2205, 2207, 2209, 2211, 2213, 2215, 2217, 2219, 2221, 2223, 2225,
2227, 2229, 2231, 2233, 2235, 2237, 2239, 2241, 2243, 2245, 2247,
2249, 2251, 2253, 2255, 2257, 2259, 2261, 2263, 2265, 2267, 2269,
2271, 2273, 2275, 2277, 2279, 2281, 2283, 2285, 2287, 2289, 2291,
2293, 2295, 2297, 2299, 2301, 2303, 2305, 2307, 2309, 2311, 2313,
2315, 2317, 2319, 2321, 2323, 2325, 2327, 2329, 2331, 2333, 2335,
2337, 2339, 2341, 2343, 2345 1 12a LT_OEX_1 B0903 E. coli 2406
Plastidic 2408, 2410, 2412, 2414, 2416, 2418, 2420, 2422, 2424,
2426, 2428, 2430, 2432, 2434, 2436, 2438, 2440, 2442, 2444, 2446,
2448, 2450, 2452, 2454, 2456, 2458, 2460, 2462, 2464, 2466, 2468,
2470, 2472, 2474, 2476, 2478, 2480, 2482, 2484, 2486, 2488, 2490,
2492, 2494, 2496, 2498, 2500, 2502, 2504, 2506, 2508, 2510, 2512,
2514, 2516, 2518, 2520, 2522, 2524, 2526, 2528, 2530, 2532, 2534,
2536, 2538, 2540, 2542, 2544 1 12b LT_OEX_1 B0903 E. coli 2406
Cytoplasmic 2408, 2410, 2412, 2414, 2416, 2418, 2420, 2422, 2424,
2426, 2428, 2430, 2432, 2434, 2436, 2438, 2440, 2442, 2444, 2446,
2448, 2450, 2452, 2454, 2456, 2458, 2460, 2462, 2464, 2466, 2468,
2470, 2472, 2474, 2476, 2478, 2480, 2482, 2484, 2486, 2488, 2490,
2492, 2494, 2496, 2498, 2500, 2502, 2504, 2506, 2508, 2510, 2512,
2514, 2516, 2518, 2520, 2522, 2524, 2526, 2528, 2530, 2532, 2534,
2536, 2538, 2540, 2542, 2544 1 13 LT_OEX_1 B1393 E. coli 2564
Cytoplasmic 2566, 2568, 2570, 2572, 2574, 2576, 2578, 2580, 2582,
2584, 2586, 2588, 2590, 2592, 2594, 2596, 2598, 2600, 2602, 2604,
2606, 2608, 2610, 2612, 2614, 2616, 2618, 2620, 2622, 2624, 2626,
2628, 2630, 2632, 2634, 2636, 2638, 2640, 2642, 2644, 2646, 2648,
2650, 2652, 2654, 2656, 2658, 2660, 2662, 2664, 2666, 2668, 2670,
2672, 2674, 2676, 2678, 2680, 2682, 2684, 2686, 2688, 2690, 2692,
2694, 2696, 2698, 2700, 2702, 2704, 2706, 2708, 2710, 2712, 2714,
2716, 2718, 2720, 2722, 2724, 2726, 2728, 2730, 2732, 2734, 2736,
2738, 2740, 2742, 2744, 2746, 2748, 2750, 2752, 2754, 2756, 2758,
2760, 2762, 2764, 2766, 2768, 2770, 2772, 2774, 2776, 2778, 2780,
2782, 2784, 2786, 2788, 2790, 2792, 2794, 2796, 2798, 2800, 2802 1
14 LT_OEX_1 B2704 E. coli 2841 Plastidic 2843, 2845, 2847, 2849,
2851, 2853, 2855, 2857, 2859, 2861, 2863, 2865, 2867, 2869, 2871,
2873 1 15 LT_OEX_1 B2905 E. coli 2879 Cytoplasmic 2881, 2883, 2885,
2887, 2889, 2891, 2893, 2895, 2897, 2899, 2901, 2903, 2905, 2907,
2909, 2911, 2913, 2915, 2917, 2919, 2921, 2923, 2925, 2927, 2929,
2931, 2933, 2935, 2937, 2939, 2941, 2943, 2945, 2947, 2949, 2951,
2953, 2955, 2957, 2959, 2961, 2963, 2965, 2967, 2969, 2971, 2973,
2975, 2977, 2979, 2981, 2983, 2985, 2987, 2989, 2991, 2993, 2995,
2997, 2999, 3001, 3003, 3005, 3007, 3009, 3011, 3013, 3015, 3017,
3019, 3021, 3023, 3025, 3027, 3029, 3031, 3033, 3035, 3037, 3039,
3041, 3043, 3045, 3047, 3049, 3051, 3053, 3055, 3057, 3059, 3061,
3063, 3065, 3067, 3069, 3071, 3073, 3075, 3077, 3079, 3081, 3083,
3085 1 16 LT_OEX_1 B3206 E. coli 3109 Plastidic 3111, 3113, 3115,
3117, 3119, 3121, 3123, 3125, 3127, 3129, 3131, 3133, 3135, 3137,
3139, 3141, 3143, 3145, 3147, 3149, 3151, 3153, 3155, 3157, 3159,
3161, 3163, 3165, 3167, 3169, 3171, 3173, 3175, 3177, 3179, 3181,
3183, 3185, 3187, 3189, 3191, 3193, 3195, 3197, 3199, 3201, 3203,
3205, 3207, 3209, 3211, 3213, 3215, 3217, 3219, 3221, 3223, 3225,
3227, 3229, 3231, 3233, 3235, 3237, 3239, 3241, 3243, 3245, 3247,
3249, 3251, 3253, 3255, 3257, 3259, 3261, 3263, 3265, 3267, 3269,
3271, 3273, 3275, 3277, 3279, 3281, 3283, 3285, 3287, 3289, 3291,
3293, 3295, 3297, 3299, 3301, 3303, 3305, 3307, 3309, 3311, 3313,
3315, 3317, 3319, 3321, 3323, 3325, 3327, 3329, 3331, 3333, 3335,
3337, 3339, 3341, 3343, 3345, 3347, 3349, 3351, 3353, 3355, 3357,
3359, 3361, 3363, 3365, 3367, 3369, 3371, 3373, 3375, 3377, 3379,
3381, 3383, 3385, 3387, 3389, 3391, 3393, 3395, 3397 1 17 LT_OEX_1
B3659 E. coli 3403 Cytoplasmic 3405, 3407, 3409, 3411, 3413, 3415,
3417, 3419, 3421, 3423, 3425, 3427, 3429 1 18 LT_OEX_1 B3871 E.
coli 3441 Cytoplasmic 3443, 3445, 3447, 3449, 3451, 3453, 3455,
3457, 3459, 3461, 3463, 3465, 3467, 3469, 3471, 3473, 3475, 3477,
3479, 3481, 3483, 3485, 3487, 3489, 3491, 3493, 3495, 3497, 3499,
3501, 3503, 3505, 3507, 3509, 3511, 3513, 3515, 3517, 3519, 3521,
3523, 3525, 3527, 3529, 3531, 3533, 3535, 3537, 3539, 3541, 3543,
3545, 3547, 3549, 3551, 3553, 3555, 3557, 3559, 3561, 3563, 3565,
3567, 3569, 3571, 3573, 3575, 3577, 3579, 3581, 3583, 3585, 3587,
3589, 3591, 3593, 3595, 3597, 3599, 3601, 3603, 3605, 3607, 3609,
3611, 3613, 3615, 3617, 3619, 3621, 3623, 3625, 3627, 3629, 3631,
3633, 3635, 3637, 3639, 3641, 3643, 3645, 3647, 3649, 3651, 3653,
3655, 3657, 3659, 3661, 3663, 3665, 3667, 3669, 3671, 3673, 3675,
3677, 3679, 3681, 3683, 3685, 3687, 3689, 3691, 3693, 3695, 3697,
3699, 3701, 3703, 3705, 3707, 3709, 3711, 3713, 3715, 3717, 3719,
3721, 3723, 3725, 3727, 3729, 3731, 3733, 3735, 3737, 3739, 3741,
3743, 3745, 3747, 3749, 3751, 3753, 3755, 3757, 3759, 3761, 3763,
3765, 3767, 3769, 3771, 3773, 3775, 3777, 3779, 3781, 3783, 3785,
3787, 3789, 3791, 3793, 3795, 3797, 3799, 3801, 3803, 3805, 3807,
3809, 3811, 3813, 3815, 3817, 3819, 3821, 3823, 3825, 3827, 3829,
3831, 3833, 3835, 3837, 3839, 3841, 3843, 3845, 3847, 3849, 3851,
3853, 3855, 3857, 3859, 3861, 3863, 3865, 3867, 3869, 3871, 3873,
3875, 3877, 3879, 3881, 3883, 3885, 3887, 3889, 3891, 3893, 3895,
3897, 3899, 3901, 3903, 3905, 3907, 3909, 3911, 3913, 3915, 3917,
3919, 3921, 3923, 3925, 3927, 3929, 3931, 3933, 3935, 3937, 3939,
3941, 3943, 3945, 3947, 3949, 3951, 3953 1 19 LT_OEX_1 YDR142C S.
cerevisiae 3978 Plastidic 3980, 3982, 3984, 3986, 3988, 3990, 3992,
3994, 3996, 3998, 4000, 4002, 4004, 4006, 4008, 4010, 4012, 4014,
4016, 4018, 4020, 4022, 4024, 4026, 4028, 4030, 4032, 4034 1 20
LT_OEX_1 YER175W-A S. cerevisiae 4047 Cytoplasmic -- 1 21 LT_OEX_1
YGR289C S. cerevisiae 4051 Plastidic 4053, 4055, 4057, 4059, 4061,
4063, 4065, 4067, 4069, 4071, 4073, 4075, 4077, 4079, 4081, 4083,
4085, 4087, 4089, 4091, 4093, 4095, 4097, 4099, 4101, 4103, 4105,
4107, 4109, 4111, 4113, 4115, 4117, 4119 1 22 LT_OEX_1 YHR044C S.
cerevisiae 4131 Plastidic 4133, 4135, 4137, 4139, 4141, 4143, 4145,
4147, 4149, 4151, 4153, 4155, 4157, 4159, 4161, 4163, 4165, 4167,
4169, 4171, 4173, 4175, 4177, 4179, 4181, 4183, 4185, 4187, 4189,
4191, 4193, 4195, 4197, 4199, 4201, 4203, 4205, 4207, 4209 1 23
LT_OEX_1 YHR072W S. cerevisiae 4217 Cytoplasmic 4219, 4221, 4223,
4225, 4227, 4229, 4231, 4233, 4235, 4237, 4239, 4241, 4243, 4245,
4247, 4249, 4251, 4253, 4255, 4257, 4259, 4261, 4263, 4265, 4267,
4269, 4271, 4273, 4275, 4277, 4279, 4281, 4283, 4285, 4287, 4289,
4291, 4293, 4295, 4297, 4299, 4301, 4303, 4305, 4307, 4309, 4311,
4313, 4315, 4317, 4319, 4321, 4323, 4325, 4327, 4329, 4331, 4333,
4335, 4337, 4339, 4341, 4343, 4345, 4347, 4349, 4351, 4353, 4355,
4357, 4359, 4361, 4363, 4365, 4367, 4369, 4371, 4373, 4375, 4377,
4379, 4381, 4383, 4385, 4387, 4389, 4391, 4393, 4395, 4397, 4399,
4401, 4403, 4405, 4407, 4409, 4411, 4413, 4415, 4417, 4419, 4421,
4423, 4425, 4427, 4429, 4431, 4433, 4435, 4437, 4439, 4441, 4443,
4445, 4447, 4449, 4451, 4453, 4455, 4457, 4459 1 24 LT_OEX_1
YHR213W-A S. cerevisiae 4491 Cytoplasmic -- 1 25 LT_OEX_1 YIL053W
S. cerevisiae 4495 Cytoplasmic 4497, 4499, 4501, 4503, 4505, 4507,
4509, 4511, 4513, 4515, 4517, 4519, 4521, 4523, 4525, 4527, 4529,
4531, 4533, 4535, 4537, 4539, 4541, 4543, 4545, 4547, 4549 1 26
LT_OEX_1 YJL103C S. cerevisiae 4558 Plastidic 4560, 4562, 4564,
4566, 4568, 4570, 4572, 4574, 4576, 4578 1 27 LT_OEX_1 YJL137C S.
cerevisiae 4589 Plastidic 4591, 4593, 4595, 4597, 4599, 4601, 4603,
4605, 4607, 4609, 4611 1 28 LT_OEX_1 YLR027C S. cerevisiae 4622
Cytoplasmic 4624, 4626, 4628, 4630, 4632, 4634, 4636, 4638, 4640,
4642, 4644, 4646, 4648, 4650, 4652, 4654, 4656, 4658, 4660, 4662,
4664, 4666, 4668, 4670, 4672, 4674, 4676, 4678, 4680, 4682, 4684,
4686, 4688, 4690, 4692, 4694, 4696, 4698, 4700, 4702, 4704, 4706,
4708, 4710, 4712, 4714, 4716, 4718, 4720, 4722, 4724, 4726, 4728,
4730, 4732, 4734, 4736, 4738, 4740, 4742, 4744, 4746, 4748, 4750,
4752, 4754, 4756, 4758, 4760, 4762, 4764, 4766, 4768, 4770, 4772,
4774, 4776, 4778, 4780, 4782, 4784, 4786, 4788, 4790, 4792, 4794,
4796, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4812, 4814, 4816,
4818, 4820,
4822, 4824, 4826, 4828, 4830, 4832, 4834, 4836, 4838, 4840, 4842,
4844, 4846, 4848, 4850, 4852, 4854, 4856, 4858, 4860, 4862, 4864,
4866, 4868, 4870, 4872, 4874, 4876, 4878, 4880, 4882, 4884, 4886,
4888, 4890, 4892, 4894, 4896, 4898, 4900, 4902, 4904, 4906, 4908,
4910, 4912, 4914, 4916, 4918, 4920, 4922, 4924, 4926, 4928, 4930,
4932, 4934, 4936, 4938, 4940, 4942, 4944, 4946, 4948, 4950, 4952,
4954, 4956, 4958, 4960, 4962, 4964, 4966, 4968, 4970, 4972, 4974,
4976, 4978, 4980, 4982, 4984, 4986, 4988, 4990, 4992, 4994, 4996,
4998, 5000, 5002, 5004, 5006, 5008, 5010, 5012, 5014, 5016, 5018 1
29a LT_OEX_1 YML079W S. cerevisiae 5070 Plastidic 5072, 5074, 5076,
5078, 5080, 5082, 5084, 5086, 5088, 5090, 5092, 5094, 5096 1 29b
LT_OEX_1 YML079W S. cerevisiae 5070 Cytoplasmic 5072, 5074, 5076,
5078, 5080, 5082, 5084, 5086, 5088, 5090, 5092, 5094, 5096 1 30
LT_OEX_1 YMR157C S. cerevisiae 5102 Plastidic 5104, 5106, 5108 1 31
LT_OEX_1 YNL024C S. cerevisiae 5115 Plastidic 5117, 5119, 5121,
5123, 5125, 5127, 5129, 5131, 5133, 5135, 5137, 5139, 5141, 5143,
5145, 5147, 5149, 5151 1 32a LT_OEX_1 YOL058W S. cerevisiae 5159
Plastidic 5161, 5163, 5165, 5167, 5169, 5171, 5173, 5175, 5177,
5179, 5181, 5183, 5185, 5187, 5189, 5191, 5193, 5195, 5197, 5199,
5201, 5203, 5205, 5207, 5209, 5211, 5213, 5215, 5217, 5219, 5221,
5223, 5225, 5227, 5229, 5231, 5233, 5235, 5237, 5239, 5241, 5243,
5245, 5247, 5249, 5251, 5253, 5255, 5257, 5259, 5261, 5263, 5265,
5267, 5269, 5271, 5273, 5275, 5277, 5279, 5281, 5283, 5285, 5287,
5289, 5291, 5293, 5295, 5297, 5299, 5301, 5303, 5305, 5307, 5309,
5311, 5313, 5315, 5317, 5319, 5321, 5323, 5325, 5327, 5329, 5331,
5333, 5335, 5337, 5339, 5341, 5343, 5345, 5347, 5349, 5351, 5353,
5355, 5357, 5359, 5361, 5363, 5365, 5367, 5369, 5371, 5373, 5375,
5377, 5379, 5381, 5383, 5385, 5387, 5389, 5391, 5393, 5395, 5397,
5399, 5401, 5403, 5405, 5407, 5409, 5411, 5413, 5415, 5417, 5419,
5421, 5423, 5425, 5427, 5429, 5431, 5433, 5435, 5437, 5439, 5441,
5443, 5445, 5447, 5449, 5451, 5453, 5455, 5457, 5459, 5461, 5463,
5465, 5467, 5469, 5471, 5473, 5475, 5477, 5479, 5481, 5483, 5485,
5487, 5489, 5491, 5493, 5495, 5497, 5499, 5501, 5503, 5505, 5507,
5509, 5511, 5513, 5515, 5517, 5519, 5521, 5523, 5525, 5527, 5529,
5531, 5533, 5535, 5537, 5539, 5541, 5543, 5545, 5547, 5549, 5551,
5553, 5555, 5557, 5559, 5561, 5563, 5565, 5567, 5569, 5571, 5573,
5575, 5577, 5579, 5581, 5583, 5585, 5587, 5589, 5591, 5593, 5595,
5597, 5599, 5601, 5603, 5605, 5607, 5609, 5611, 5613, 5615, 5617,
5619, 5621, 5623, 5625, 5627, 5629, 5631, 5633, 5635, 5637, 5639,
5641, 5643, 5645, 5647, 5649, 5651, 5653, 5655, 5657, 5659, 5661,
5663, 5665, 5667, 5669, 5671, 5673, 5675, 5677, 5679, 5681, 5683,
5685, 5687, 5689, 5691, 5693, 5695, 5697, 5699, 5701, 5703, 5705,
5707, 5709, 5711, 5713, 5715, 5717, 5719, 5721, 5723, 5725, 5727,
5729, 5731, 5733 1 32b LT_OEX_1 YOL058W S. cerevisiae 5159
Cytoplasmic 5161, 5163, 5165, 5167, 5169, 5171, 5173, 5175, 5177,
5179, 5181, 5183, 5185, 5187, 5189, 5191, 5193, 5195, 5197, 5199,
5201, 5203, 5205, 5207, 5209, 5211, 5213, 5215, 5217, 5219, 5221,
5223, 5225, 5227, 5229, 5231, 5233, 5235, 5237, 5239, 5241, 5243,
5245, 5247, 5249, 5251, 5253, 5255, 5257, 5259, 5261, 5263, 5265,
5267, 5269, 5271, 5273, 5275, 5277, 5279, 5281, 5283, 5285, 5287,
5289, 5291, 5293, 5295, 5297, 5299, 5301, 5303, 5305, 5307, 5309,
5311, 5313, 5315, 5317, 5319, 5321, 5323, 5325, 5327, 5329, 5331,
5333, 5335, 5337, 5339, 5341, 5343, 5345, 5347, 5349, 5351, 5353,
5355, 5357, 5359, 5361, 5363, 5365, 5367, 5369, 5371, 5373, 5375,
5377, 5379, 5381, 5383, 5385, 5387, 5389, 5391, 5393, 5395, 5397,
5399, 5401, 5403, 5405, 5407, 5409, 5411, 5413, 5415, 5417, 5419,
5421, 5423, 5425, 5427, 5429, 5431, 5433, 5435, 5437, 5439, 5441,
5443, 5445, 5447, 5449, 5451, 5453, 5455, 5457, 5459, 5461, 5463,
5465, 5467, 5469, 5471, 5473, 5475, 5477, 5479, 5481, 5483, 5485,
5487, 5489, 5491, 5493, 5495, 5497, 5499, 5501, 5503, 5505, 5507,
5509, 5511, 5513, 5515, 5517, 5519, 5521, 5523, 5525, 5527, 5529,
5531, 5533, 5535, 5537, 5539, 5541, 5543, 5545, 5547, 5549, 5551,
5553, 5555, 5557, 5559, 5561, 5563, 5565, 5567, 5569, 5571, 5573,
5575, 5577, 5579, 5581, 5583, 5585, 5587, 5589, 5591, 5593, 5595,
5597, 5599, 5601, 5603, 5605, 5607, 5609, 5611, 5613, 5615, 5617,
5619, 5621, 5623, 5625, 5627, 5629, 5631, 5633, 5635, 5637, 5639,
5641, 5643, 5645, 5647, 5649, 5651, 5653, 5655, 5657, 5659, 5661,
5663, 5665, 5667, 5669, 5671, 5673, 5675, 5677, 5679, 5681, 5683,
5685, 5687, 5689, 5691, 5693, 5695, 5697, 5699, 5701, 5703, 5705,
5707, 5709, 5711, 5713, 5715, 5717, 5719, 5721, 5723, 5725, 5727,
5729, 5731, 5733 1 33 LT_OEX_1 YPL180W S. cerevisiae 5746
Cytoplasmic 5748 1 34 LT_OEX_1 YPR167C S. cerevisiae 5756 Plastidic
5758, 5760, 5762, 5764, 5766, 5768, 5770, 5772, 5774, 5776, 5778,
5780, 5782, 5784, 5786, 5788, 5790, 5792, 5794, 5796, 5798, 5800,
5802, 5804, 5806, 5808, 5810, 5812, 5814, 5816, 5818, 5820, 5822,
5824, 5826, 5828, 5830, 5832, 5834, 5836, 5838, 5840, 5842, 5844,
5846, 5848, 5850, 5852, 5854, 5856, 5858, 5860, 5862, 5864, 5866,
5868, 5870, 5872, 5874, 5876, 5878, 5880, 5882, 5884, 5886, 5888,
5890, 5892, 5894, 5896, 5898, 5900, 5902, 5904, 5906, 5908, 5910,
5912, 5914, 5916, 5918, 5920, 5922, 5924, 5926, 5928, 5930, 5932,
5934, 5936, 5938, 5940, 5942, 5944, 5946, 5948, 5950, 5952, 5954,
5956, 5958, 5960, 5962, 5964, 5966, 5968, 5970, 5972, 5974, 5976,
5978, 5980, 5982, 5984, 5986, 5988, 5990, 5992, 5994, 5996, 5998,
6000, 6002, 6004, 6006, 6008, 6010, 6012, 6014, 6016, 6018, 6020,
6022, 6024, 6026, 6028, 6030, 6032, 6034, 6036, 6038, 6040, 6042,
6044, 6046 1 35 LT_OEX_1 B0036 E. coli 6086 Plastidic 6088, 6090,
6092, 6094, 6096, 6098, 6100, 6102, 6104, 6106, 6108, 6110, 6112,
6114, 6116, 6118, 6120, 6122, 6124, 6126, 6128, 6130, 6132, 6134,
6136, 6138, 6140, 6142, 6144, 6146, 6148, 6150, 6152, 6154, 6156,
6158, 6160, 6162, 6164, 6166, 6168, 6170, 6172, 6174, 6176, 6178,
6180, 6182, 6184, 6186, 6188, 6190, 6192, 6194, 6196, 6198, 6200,
6202, 6204, 6206, 6208, 6210, 6212, 6214, 6216, 6218, 6220, 6222,
6224, 6226, 6228, 6230, 6232, 6234, 6236, 6238, 6240, 6242, 6244,
6246, 6248, 6250, 6252, 6254, 6256, 6258, 6260, 6262, 6264, 6266,
6268, 6270, 6272, 6274, 6276, 6278, 6280, 6282, 6284, 6286, 6288,
6290, 6292, 6294, 6296, 6298, 6300, 6302, 6304, 6306, 6308, 6310,
6312, 6314, 6316, 6318, 6320, 6322, 6324, 6326, 6328, 6330, 6332,
6334, 6336, 6338, 6340, 6342, 6344, 6346, 6348, 6350, 6352, 6354,
6356, 6358, 6360, 6362, 6364, 6366, 6368, 6370, 6372, 6374, 6376,
6378, 6380, 6382, 6384, 6386, 6388, 6390, 6392, 6394, 6396, 6398,
6400, 6402, 6404, 6406, 6408, 6410, 6412, 6414, 6416, 6418, 6420,
6422, 6424, 6426, 6428, 6430, 6432, 6434, 6436, 6438, 6440, 6442,
6444, 6446, 6448, 6450, 6452, 6454, 6456, 6458, 6460, 6462, 6464,
6466, 6468, 6470, 6472, 6474, 6476, 6478, 6480, 6482, 6484, 6486,
6488, 6490, 6492, 6494, 6496, 6498, 6500, 6502, 6504, 6506, 6508,
6510, 6512, 6514, 6516, 6518, 6520, 6522, 6524, 6526, 6528, 6530,
6532, 6534, 6536, 6538, 6540, 6542 1 36 LT_OEX_1 B1906 E. coli 6581
Cytoplasmic 6583, 6585, 6587, 6589, 6591, 6593, 6595, 6597, 6599,
6601, 6603 1 37 LT_OEX_1 B2371 E. coli 6609 Cytoplasmic 6611, 6613,
6615, 6617, 6619, 6621, 6623, 6625, 6627, 6629, 6631, 6633, 6635,
6637, 6639, 6641, 6643, 6645, 6647, 6649, 6651, 6653, 6655, 6657,
6659, 6661, 6663, 6665, 6667, 6669, 6671, 6673, 6675, 6677, 6679,
6681, 6683, 6685, 6687, 6689, 6691, 6693, 6695, 6697, 6699, 6701,
6703, 6705, 6707, 6709, 6711, 6713, 6715, 6717, 6719, 6721, 6723,
6725, 6727, 6729, 6731, 6733, 6735, 6737, 6739, 6741, 6743, 6745,
6747, 6749, 6751, 6753, 6755, 6757, 6759, 6761, 6763, 6765, 6767,
6769, 6771, 6773, 6775, 6777, 6779, 6781, 6783, 6785, 6787, 6789,
6791, 6793, 6795, 6797, 6799, 6801, 6803, 6805, 6807, 6809, 6811,
6813, 6815, 6817, 6819, 6821, 6823, 6825, 6827, 6829, 6831, 6833,
6835, 6837, 6839, 6841, 6843, 6845, 6847, 6849, 6851, 6853, 6855,
6857, 6859, 6861, 6863, 6865, 6867, 6869, 6871, 6873, 6875, 6877,
6879, 6881, 6883, 6885, 6887, 6889, 6891, 6893, 6895, 6897, 6899,
6901, 6903, 6905, 6907, 6909, 6911, 6913, 6915, 6917, 6919, 6921,
6923, 6925, 6927, 6929, 6931, 6933, 6935, 6937, 6939, 6941, 6943 1
38 LT_OEX_1 B2881 E. coli 6949 Cytoplasmic 6951, 6953, 6955, 6957,
6959, 6961, 6963, 6965, 6967, 6969, 6971, 6973, 6975, 6977, 6979,
6981, 6983, 6985, 6987, 6989, 6991, 6993, 6995, 6997, 6999, 7001,
7003, 7005, 7007, 7009, 7011, 7013, 7015, 7017, 7019, 7021, 7023,
7025, 7027, 7029, 7031, 7033, 7035, 7037, 7039, 7041, 7043, 7045,
7047, 7049, 7051, 7053, 7055, 7057, 7059, 7061, 7063, 7065, 7067 1
39 LT_OEX_1 B3106 E. coli 7078 Cytoplasmic 7080, 7082, 7084, 7086,
7088, 7090, 7092, 7094, 7096, 7098, 7100, 7102, 7104, 7106, 7108,
7110, 7112, 7114, 7116, 7118, 7120, 7122, 7124, 7126, 7128, 7130,
7132, 7134, 7136, 7138, 7140, 7142, 7144, 7146, 7148, 7150, 7152,
7154, 7156, 7158, 7160, 7162, 7164, 7166, 7168, 7170, 7172, 7174,
7176, 7178, 7180, 7182, 7184, 7186, 7188, 7190, 7192, 7194, 7196,
7198, 7200, 7202, 7204, 7206, 7208, 7210, 7212, 7214, 7216, 7218,
7220, 7222, 7224, 7226, 7228, 7230, 7232, 7234, 7236, 7238, 7240,
7242, 7244, 7246, 7248, 7250, 7252, 7254, 7256, 7258, 7260, 7262,
7264 1 40 LT_OEX_1 B3400 E. coli 7270 Plastidic 7272, 7274, 7276,
7278, 7280, 7282, 7284, 7286, 7288, 7290, 7292, 7294, 7296, 7298,
7300, 7302, 7304, 7306, 7308, 7310, 7312, 7314, 7316, 7318, 7320,
7322, 7324, 7326, 7328, 7330, 7332, 7334, 7336, 7338, 7340, 7342,
7344, 7346, 7348, 7350, 7352, 7354, 7356, 7358, 7360, 7362, 7364,
7366, 7368, 7370, 7372, 7374, 7376, 7378, 7380, 7382, 7384, 7386,
7388, 7390, 7392, 7394, 7396, 7398, 7400, 7402, 7404, 7406, 7408,
7410, 7412, 7414, 7416, 7418, 7420, 7422, 7424, 7426, 7428, 7430,
7432, 7434, 7436, 7438, 7440, 7442, 7444, 7446, 7448, 7450, 7452,
7454, 7456, 7458, 7460 1 41 LT_OEX_1 B3410 E. coli 7467 Cytoplasmic
7469, 7471, 7473, 7475, 7477, 7479, 7481, 7483, 7485 1 42 LT_OEX_1
B4209 E. coli 7492 Plastidic 7494, 7496, 7498, 7500, 7502, 7504,
7506, 7508, 7510, 7512, 7514, 7516, 7518, 7520, 7522, 7524, 7526,
7528, 7530, 7532, 7534, 7536, 7538, 7540, 7542, 7544, 7546, 7548,
7550, 7552, 7554, 7556, 7558, 7560, 7562, 7564, 7566, 7568, 7570,
7572, 7574, 7576, 7578, 7580, 7582 1 43 LT_OEX_1 SLL1545
Synechocystis 7591 Cytoplasmic 7593, 7595, 7597, 7599, 7601, 7603,
7605, 7607, 7609, 7611, 7613, 7615, 7617, 7619, 7621, 7623, 7625,
7627, 7629, 7631, 7633, 7635, 7637, 7639, 7641, 7643, 7645, 7647,
7649, 7651, 7653, 7655, 7657, 7659, 7661, 7663, 7665 1 44 LT_OEX_1
SLR1348 Synechocystis 7670 Mitochondric 7672, 7674, 7676, 7678,
7680, 7682, 7684, 7686, 7688, 7690, 7692, 7694, 7696, 7698, 7700,
7702, 7704, 7706, 7708, 7710, 7712, 7714, 7716, 7718, 7720, 7722,
7724, 7726, 7728, 7730, 7732, 7734, 7736, 7738, 7740, 7742, 7744,
7746, 7748, 7750, 7752, 7754, 7756, 7758, 7760, 7762, 7764, 7766,
7768, 7770, 7772, 7774, 7776, 7778, 7780, 7782, 7784, 7786, 7788,
7790, 7792, 7794, 7796, 7798, 7800, 7802, 7804, 7806, 7808, 7810,
7812, 7814, 7816, 7818, 7820, 7822, 7824, 7826, 7828, 7830, 7832,
7834, 7836, 7838, 7840, 7842, 7844, 7846, 7848, 7850, 7852, 7854,
7856, 7858, 7860, 7862, 7864, 7866, 7868, 7870, 7872, 7874, 7876,
7878, 7880, 7882, 7884, 7886, 7888, 7890, 7892, 7894, 7896, 7898,
7900, 7902, 7904, 7906, 7908, 7910, 7912, 7914, 7916, 7918, 7920,
7922, 7924, 7926, 7928, 7930, 7932, 7934, 7936, 7938, 7940, 7942,
7944, 7946, 7948, 7950, 7952, 7954, 7956, 7958, 7960, 7962, 7964,
7966, 7968, 7970, 7972, 7974, 7976, 7978, 7980, 7982, 7984, 7986,
7988, 7990, 7992, 7994, 7996, 7998, 8000, 8002, 8004, 8006, 8008,
8010, 8012, 8014, 8016, 8018, 8020, 8022, 8024, 8026, 8028, 8030,
8032, 8034, 8036, 8038, 8040, 8042, 8044, 8046, 8048, 8050, 8052,
8054, 8056, 8058, 8060, 8062, 8064, 8066, 8068, 8070, 8072, 8074,
8076, 8078, 8080, 8082, 8084, 8086, 8088, 8090, 8092, 8094, 8096,
8098, 8100, 8102, 8104, 8106, 8108, 8110, 8112, 8114, 8116, 8118,
8120, 8122, 8124, 8126, 8128, 8130, 8132, 8134, 8136, 8138, 8140,
8142, 8144, 8146, 8148, 8150, 8152, 8154, 8156, 8158, 8160, 8162,
8164, 8166, 8168, 8170, 8172, 8174, 8176, 8178, 8180, 8182, 8184,
8186, 8188, 8190, 8192, 8194, 8196, 8198, 8200, 8202, 8204, 8206,
8208, 8210, 8212, 8214, 8216, 8218, 8220, 8222 1 45 LT_OEX_1
YGR191W S. cerevisiae 8236 Plastidic 8238, 8240, 8242, 8244, 8246,
8248, 8250, 8252, 8254, 8256, 8258, 8260, 8262, 8264, 8266, 8268,
8270, 8272, 8274, 8276, 8278, 8280, 8282, 8284, 8286, 8288, 8290,
8292, 8294, 8296, 8298, 8300, 8302, 8304, 8306, 8308, 8310, 8312,
8314, 8316, 8318, 8320, 8322, 8324, 8326, 8328, 8330, 8332, 8334,
8336, 8338, 8340, 8342, 8344, 8346, 8348, 8350, 8352, 8354, 8356,
8358, 8360, 8362, 8364, 8366, 8368, 8370, 8372, 8374, 8376, 8378,
8380, 8382, 8384, 8386, 8388, 8390, 8392, 8394, 8396, 8398, 8400,
8402, 8404, 8406, 8408, 8410, 8412, 8414, 8416, 8418, 8420, 8422,
8424, 8426, 8428, 8430, 8432, 8434, 8436, 8438, 8440, 8442, 8444,
8446, 8448, 8450, 8452, 8454, 8456, 8458, 8460, 8462, 8464, 8466,
8468, 8470, 8472, 8474, 8476, 8478, 8480, 8482, 8484, 8486, 8488,
8490, 8492, 8494, 8496, 8498, 8500, 8502, 8504, 8506, 8508, 8510,
8512, 8514, 8516, 8518, 8520, 8522, 8524, 8526, 8528, 8530, 8532,
8534, 8536, 8538, 8540, 8542, 8544, 8546, 8548, 8550, 8552, 8554,
8556 1 46 LT_OEX_1 AT1G22920 A. thaliana 8563 Cytoplasmic 8565,
8567, 8569, 8571, 8573, 8575, 8577, 8579, 8581, 8583, 8585, 8587,
8589, 8591, 8593, 8595, 8597, 8599, 8601, 8603, 8605, 8607, 8609,
8611, 8613, 8615, 8617, 8619, 8621, 8623, 8625, 8627, 8629, 8631,
8633, 8635 1 47 LT_OEX_1 B1600 E. coli 8648 Plastidic 8650, 8652,
8654, 8656, 8658, 8660, 8662, 8664, 8666, 8668, 8670, 8672, 8674,
8676, 8678, 8680, 8682, 8684, 8686, 8688, 8690, 8692, 8694, 8696,
8698, 8700, 8702, 8704, 8706, 8708, 8710, 8712, 8714, 8716, 8718,
8720, 8722, 8724, 8726, 8728, 8730, 8732, 8734, 8736, 8738, 8740,
8742, 8744, 8746, 8748, 8750, 8752, 8754 1 48 LT_OEX_1 B1900 E.
coli 8760 Plastidic 8762, 8764, 8766, 8768, 8770, 8772, 8774, 8776,
8778, 8780, 8782, 8784, 8786, 8788, 8790, 8792, 8794, 8796, 8798,
8800, 8802, 8804, 8806, 8808, 8810, 8812, 8814, 8816, 8818, 8820,
8822, 8824, 8826, 8828, 8830, 8832, 8834, 8836, 8838, 8840, 8842,
8844, 8846, 8848 1 49 LT_OEX_1 SLL0099 Synechocystis 8861
Cytoplasmic 8863, 8865, 8867, 8869, 8871, 8873, 8875, 8877, 8879,
8881, 8883, 8885, 8887, 8889, 8891, 8893, 8895, 8897, 8899, 8901,
8903, 8905, 8907, 8909, 8911, 8913, 8915, 8917, 8919, 8921, 8923,
8925, 8927, 8929, 8931, 8933, 8935, 8937, 8939, 8941, 8943, 8945,
8947, 8949, 8951, 8953, 8955, 8957, 8959, 8961, 8963, 8965, 8967,
8969, 8971, 8973, 8975, 8977, 8979, 8981, 8983, 8985, 8987, 8989,
8991, 8993, 8995, 8997, 8999, 9001, 9003, 9005, 9007, 9009, 9011,
9013, 9015, 9017, 9019, 9021, 9023, 9025, 9027, 9029, 9031, 9033,
9035, 9037, 9039 1 50 LT_OEX_1 SLL0383 Synechocystis 9046
Cytoplasmic 9048, 9050, 9052, 9054, 9056, 9058, 9060, 9062, 9064,
9066, 9068, 9070, 9072, 9074, 9076, 9078, 9080, 9082, 9084, 9086,
9088, 9090, 9092, 9094, 9096, 9098, 9100, 9102, 9104, 9106, 9108,
9110, 9112, 9114, 9116, 9118, 9120, 9122, 9124, 9126, 9128, 9130,
9132, 9134, 9136, 9138, 9140, 9142, 9144, 9146, 9148, 9150, 9152,
9154, 9156, 9158, 9160, 9162, 9164, 9166, 9168, 9170, 9172, 9174,
9176, 9178, 9180, 9182, 9184, 9186, 9188, 9190, 9192, 9194, 9196,
9198, 9200,
9202, 9204, 9206, 9208, 9210, 9212, 9214, 9216, 9218, 9220, 9222,
9224, 9226, 9228, 9230, 9232, 9234, 9236, 9238, 9240, 9242, 9244,
9246, 9248, 9250, 9252, 9254, 9256, 9258, 9260, 9262, 9264, 9266,
9268, 9270, 9272, 9274 1 51 LT_OEX_1 SLR1094 Synechocystis 9280
Cytoplasmic 9282, 9284, 9286, 9288, 9290, 9292, 9294, 9296, 9298 1
52 LT_OEX_1 SLR1520 Synechocystis 9307 Cytoplasmic 9309, 9311,
9313, 9315, 9317, 9319, 9321, 9323, 9325, 9327, 9329, 9331, 9333,
9335, 9337, 9339, 9341, 9343, 9345, 9347, 9349, 9351, 9353, 9355,
9357, 9359, 9361, 9363, 9365, 9367, 9369, 9371, 9373, 9375, 9377,
9379, 9381, 9383, 9385, 9387, 9389, 9391, 9393, 9395, 9397, 9399,
9401, 9403, 9405, 9407, 9409, 9411, 9413, 9415, 9417, 9419, 9421,
9423 1 53 LT_OEX_1 YDL142C S. cerevisiae 9430 Cytoplasmic 9432,
9434, 9436, 9438, 9440, 9442, 9444, 9446, 9448, 9450, 9452, 9454,
9456, 9458, 9460, 9462, 9464, 9466, 9468, 9470, 9472 1 54 LT_OEX_1
YDR147W S. cerevisiae 9479 Cytoplasmic 9481, 9483, 9485 1 55
LT_OEX_1 YLR284C S. cerevisiae 9500 Plastidic 9502, 9504, 9506,
9508, 9510, 9512, 9514, 9516, 9518, 9520, 9522, 9524, 9526, 9528,
9530, 9532, 9534, 9536, 9538, 9540, 9542, 9544, 9546 1 56 LT_OEX_1
YPL148C S. cerevisiae 9553 Plastidic 9555, 9557, 9559, 9561, 9563,
9565 1 57 LT_OEX_1 YPR074C S. cerevisiae 9574 Plastidic 9576, 9578,
9580, 9582, 9584, 9586, 9588, 9590, 9592, 9594, 9596, 9598, 9600,
9602, 9604, 9606, 9608, 9610, 9612, 9614, 9616, 9618, 9620, 9622,
9624, 9626, 9628, 9630, 9632, 9634, 9636, 9638, 9640, 9642, 9644,
9646, 9648, 9650, 9652, 9654, 9656, 9658, 9660, 9662, 9664, 9666,
9668, 9670, 9672, 9674, 9676, 9678, 9680, 9682, 9684, 9686, 9688,
9690, 9692, 9694, 9696, 9698, 9700, 9702, 9704, 9706, 9708, 9710,
9712, 9714, 9716, 9718, 9720, 9722, 9724, 9726, 9728, 9730, 9732,
9734, 9736, 9738, 9740, 9742, 9744, 9746, 9748, 9750, 9752, 9754,
9756, 9758, 9760, 9762, 9764, 9766, 9768, 9770, 9772, 9774, 9776,
9778, 9780, 9782, 9784, 9786, 9788, 9790, 9792, 9794, 9796, 9798,
9800, 9802, 9804, 9806, 9808, 9810, 9812, 9814, 9816, 9818, 9820,
9822, 9824, 9826, 9828, 9830, 9832, 9834, 9836, 9838, 9840, 9842,
9844, 9846, 9848, 9850, 9852, 9854, 9856, 9858, 9860, 9862, 9864,
9866, 9868, 9870, 9872, 9874, 9876, 9878, 9880, 9882, 9884, 9886,
9888, 9890, 9892, 9894, 9896, 9898, 9900, 9902, 9904, 9906, 9908,
9910, 9912, 9914, 9916, 9918, 9920, 9922, 9924, 9926, 9928, 9930,
9932, 9934, 9936, 9938, 9940, 9942, 9944, 9946, 9948, 9950, 9952,
9954, 9956, 9958, 9960, 9962, 9964, 9966, 9968, 9970, 9972, 9974,
9976, 9978, 9980, 9982, 9984, 9986, 9988, 9990, 9992, 9994, 9996,
9998, 10000, 10002, 10004, 10006, 10008, 10010, 10012, 10014,
10016, 10018, 10020, 10022, 10024, 10026, 10028, 10030, 10032,
10034, 10036, 10038, 10040, 10042, 10044, 10046, 10048, 10050,
10052, 10054, 10056, 10058, 10060, 10062, 10064, 10066, 10068,
10070, 10072, 10074, 10076, 10078, 10080, 10082, 10084, 10086,
10088, 10090, 10092, 10094, 10096, 10098, 10100, 10102, 10104,
10106, 10108, 10110, 10112, 10114, 10116, 10118, 10120, 10122,
10124, 10126, 10128, 10130, 10132, 10134, 10136, 10138, 10140,
10142, 10144, 10146, 10148, 10150, 10152, 10154, 10156, 10158,
10160, 10162, 10164, 10166, 10168, 10170, 10172, 10174, 10176,
10178, 10180, 10182, 10184, 10186, 10188, 10190, 10192, 10194,
10196, 10198, 10200, 10202, 10204, 10206, 10208, 10210, 10212,
10214, 10216, 10218, 10220, 10222, 10224, 10226, 10228, 10230,
10232, 10234, 10236, 10238, 10240, 10242, 10244, 10246, 10248,
10250, 10252, 10254, 10256, 10258, 10260, 10262, 10264, 10266,
10268, 10270, 10272, 10274, 10276, 10278, 10280, 10282, 10284,
10286, 10288, 10290, 10292, 10294, 10296, 10298, 10300, 10302,
10304, 10306, 10308, 10310, 10312, 10314, 10316, 10318, 10320,
10322, 10324, 10326, 10328, 10330, 10332, 10334, 10336, 10338,
10340, 10342, 10344, 10346, 10348, 10350, 10352, 10354, 10356,
10358, 10360, 10362, 10364, 10366, 10368, 10370, 10372, 10374,
10376, 10378, 10380, 10382, 10384, 10386, 10388 1 58 LT_OEX_1 B1008
E. coli 10404 Plastidic 10406, 10408, 10410, 10412, 10414, 10416,
10418, 10420, 10422, 10424, 10426, 10428, 10430, 10432, 10434,
10436, 10438, 10440, 10442, 10444, 10446, 10448, 10450, 10452,
10454, 10456, 10458, 10460, 10462, 10464, 10466, 10468, 10470,
10472, 10474, 10476, 10478, 10480, 10482, 10484, 10486, 10488,
10490, 10492, 10494 1 59 LT_OEX_1 B1529 E. coli 10503 Plastidic
10505, 10507, 10509, 10511, 10513, 10515, 10517, 10519, 10521,
10523, 10525, 10527, 10529, 10531, 10533, 10535, 10537, 10539,
10541, 10543, 10545, 10547, 10549, 10551, 10553, 10555, 10557,
10559, 10561, 10563, 10565, 10567, 10569, 10571, 10573, 10575,
10577, 10579, 10581, 10583 1 60 LT_OEX_1 B3347 E. coli 10591
Plastidic 10593, 10595, 10597, 10599, 10601, 10603, 10605, 10607,
10609, 10611, 10613, 10615, 10617, 10619, 10621, 10623, 10625,
10627, 10629, 10631, 10633, 10635, 10637, 10639, 10641, 10643,
10645, 10647, 10649, 10651, 10653, 10655, 10657, 10659, 10661,
10663, 10665, 10667, 10669, 10671, 10673, 10675, 10677, 10679,
10681, 10683, 10685, 10687, 10689, 10691, 10693, 10695, 10697,
10699, 10701, 10703, 10705, 10707, 10709, 10711, 10713, 10715,
10717, 10719, 10721, 10723, 10725, 10727, 10729, 10731, 10733,
10735, 10737, 10739, 10741, 10743, 10745, 10747, 10749, 10751,
10753, 10755, 10757, 10759, 10761, 10763, 10765, 10767, 10769,
10771, 10773, 10775, 10777, 10779, 10781, 10783, 10785, 10787,
10789, 10791, 10793, 10795, 10797, 10799, 10801, 10803, 10805,
10807, 10809, 10811, 10813, 10815, 10817, 10819, 10821, 10823,
10825, 10827, 10829, 10831, 10833, 10835, 10837, 10839, 10841,
10843, 10845, 10847, 10849, 10851, 10853, 10855, 10857, 10859,
10861, 10863, 10865, 10867, 10869, 10871, 10873, 10875, 10877,
10879, 10881, 10883, 10885, 10887, 10889, 10891, 10893, 10895,
10897, 10899, 10901, 10903, 10905, 10907, 10909, 10911, 10913,
10915, 10917, 10919, 10921, 10923, 10925, 10927 1 61 LT_OEX_1
YBR176W S. cerevisiae 10934 Cytoplasmic 10936, 10938, 10940, 10942,
10944, 10946, 10948, 10950, 10952, 10954, 10956, 10958, 10960,
10962, 10964, 10966, 10968, 10970, 10972, 10974, 10976, 10978,
10980, 10982, 10984, 10986, 10988, 10990, 10992, 10994, 10996,
10998, 11000, 11002, 11004, 11006, 11008, 11010, 11012, 11014,
11016, 11018, 11020, 11022, 11024, 11026, 11028, 11030, 11032,
11034, 11036, 11038, 11040, 11042, 11044, 11046, 11048, 11050,
11052, 11054, 11056, 11058, 11060, 11062, 11064, 11066, 11068,
11070, 11072, 11074, 11076, 11078, 11080, 11082, 11084, 11086,
11088, 11090, 11092, 11094, 11096, 11098, 11100, 11102, 11104,
11106, 11108, 11110, 11112, 11114, 11116, 11118, 11120, 11122,
11124, 11126, 11128, 11130, 11132, 11134, 11136, 11138, 11140,
11142, 11144, 11146, 11148, 11150, 11152, 11154, 11156, 11158,
11160, 11162, 11164, 11166, 11168, 11170, 11172, 11174, 11176,
11178, 11180, 11182, 11184, 11186, 11188, 11190, 11192, 11194,
11196, 11198, 11200, 11202, 11204, 11206, 11208, 11210, 11212,
11214, 11216, 11218, 11220, 11222, 11224, 11226, 11228, 11230,
11232, 11234, 11236, 11238, 11240, 11242, 11244, 11246, 11248,
11250, 11252, 11254, 11256, 11258, 11260, 11262, 11264, 11266,
11268, 11270, 11272, 11274, 11276, 11278, 11280, 11282, 11284,
11286, 11288, 11290, 11292, 11294, 11296, 11298, 11300, 11302,
11304, 11306, 11308, 11310, 11312, 11314, 11316, 11318, 11320,
11322, 11324, 11326, 11328, 11330, 11332, 11334, 11336, 11338,
11340, 11342, 11344, 11346, 11348, 11350, 11352, 11354, 11356,
11358, 11360, 11362, 11364, 11366, 11368, 11370, 11372, 11374,
11376, 11378, 11380, 11382, 11384, 11386, 11388, 11390, 11392,
11394, 11396, 11398, 11400, 11402, 11404, 11406, 11408, 11410,
11412, 11414, 11416, 11418, 11420, 11422, 11424, 11426, 11428,
11430, 11432, 11434, 11436, 11438, 11440, 11442, 11444, 11446,
11448, 11450, 11452 1 62 LT_OEX_1 YGR177C S. cerevisiae 11461
Cytoplasmic 11463, 11465, 11467, 11469, 11471, 11473, 11475, 11477,
11479, 11481, 11483, 11485 1 63 LT_OEX_1 YHR176W S. cerevisiae
11501 Cytoplasmic 11503, 11505, 11507, 11509, 11511, 11513, 11515,
11517, 11519, 11521, 11523, 11525, 11527, 11529, 11531, 11533,
11535, 11537, 11539, 11541, 11543, 11545, 11547 1 64 LT_OEX_1
B2881_2 E. coli 11564 Cytoplasmic 11566, 11568, 11570, 11572,
11574, 11576, 11578, 11580, 11582, 11584, 11586, 11588, 11590,
11592, 11594, 11596, 11598, 11600, 11602, 11604, 11606, 11608,
11610, 11612, 11614, 11616, 11618, 11620, 11622, 11624, 11626,
11628, 11630, 11632, 11634, 11636, 11638, 11640, 11642, 11644,
11646, 11648, 11650, 11652, 11654, 11656, 11658, 11660, 11662,
11664, 11666, 11668, 11670, 11672, 11674, 11676, 11678, 11680,
11682, 11684 1 65 LT_OEX_1 B3945_2 E. coli 11695 Cytoplasmic 11697,
11699, 11701, 11703, 11705, 11707, 11709, 11711, 11713, 11715,
11717, 11719, 11721, 11723, 11725, 11727, 11729, 11731, 11733,
11735, 11737, 11739, 11741, 11743, 11745, 11747, 11749, 11751,
11753, 11755, 11757, 11759, 11761, 11763, 11765, 11767, 11769,
11771, 11773, 11775, 11777, 11779, 11781, 11783, 11785, 11787,
11789, 11791, 11793, 11795, 11797, 11799, 11801, 11803, 11805,
11807, 11809, 11811, 11813, 11815, 11817, 11819, 11821, 11823,
11825, 11827, 11829, 11831, 11833, 11835, 11837, 11839, 11841,
11843, 11845, 11847, 11849, 11851, 11853, 11855, 11857, 11859,
11861, 11863, 11865, 11867, 11869, 11871, 11873, 11875, 11877,
11879, 11881, 11883, 11885, 11887, 11889, 11891, 11893, 11895,
11897 1 66 LT_OEX_1 YHR204W_2 S. cerevisiae 11907 Cytoplasmic
11909, 11911, 11913, 11915, 11917, 11919, 11921, 11923, 11925,
11927, 11929, 11931 1 67 LT_OEX_1 YNL142W_2 S. cerevisiae 11944
Cytoplasmic 11946, 11948, 11950, 11952, 11954, 11956, 11958, 11960,
11962, 11964, 11966, 11968, 11970, 11972, 11974, 11976, 11978,
11980, 11982, 11984, 11986, 11988, 11990, 11992, 11994, 11996,
11998, 12000, 12002, 12004, 12006, 12008, 12010, 12012, 12014,
12016, 12018, 12020, 12022, 12024, 12026, 12028, 12030, 12032,
12034, 12036, 12038, 12040, 12042, 12044, 12046, 12048, 12050,
12052, 12054, 12056, 12058, 12060, 12062, 12064, 12066, 12068,
12070, 12072, 12074, 12076, 12078, 12080, 12082, 12084, 12086,
12088, 12090, 12092, 12094, 12096, 12098, 12100, 12102, 12104,
12106, 12108, 12110, 12112, 12114, 12116, 12118, 12120, 12122,
12124, 12126, 12128, 12130, 12132, 12134, 12136, 12138, 12140,
12142, 12144, 12146, 12148, 12150, 12152, 12154, 12156, 12158,
12160, 12162, 12164, 12166, 12168, 12170, 12172, 12174, 12176,
12178, 12180, 12182, 12184, 12186, 12188, 12190, 12192, 12194,
12196, 12198, 12200, 12202, 12204, 12206, 12208, 12210, 12212,
12214, 12216, 12218, 12220, 12222, 12224, 12226, 12228, 12230,
12232, 12234, 12236, 12238, 12240, 12242, 12244, 12246, 12248,
12250, 12252, 12254, 12256, 12258, 12260, 12262, 12264, 12266,
12268, 12270, 12272, 12274, 12276, 12278, 12280, 12282, 12284,
12286, 12288, 12290, 12292, 12294, 12296, 12298, 12300, 12302,
12304, 12306, 12308, 12310, 12312, 12314, 12316, 12318, 12320,
12322, 12324, 12326, 12328, 12330, 12332, 12334, 12336, 12338,
12340, 12342, 12344, 12346 1 68a LT_OEX_1 YOL058W_2 S. cerevisiae
12357 Plastidic 12359, 12361, 12363, 12365, 12367, 12369, 12371,
12373, 12375, 12377, 12379, 12381, 12383, 12385, 12387, 12389,
12391, 12393, 12395, 12397, 12399, 12401, 12403, 12405, 12407,
12409, 12411, 12413, 12415, 12417, 12419, 12421, 12423, 12425,
12427, 12429, 12431, 12433, 12435, 12437, 12439, 12441, 12443,
12445, 12447, 12449, 12451, 12453, 12455, 12457, 12459, 12461,
12463, 12465, 12467, 12469, 12471, 12473, 12475, 12477, 12479,
12481, 12483, 12485, 12487, 12489, 12491, 12493, 12495, 12497,
12499, 12501, 12503, 12505, 12507, 12509, 12511, 12513, 12515,
12517, 12519, 12521, 12523, 12525, 12527, 12529, 12531, 12533,
12535, 12537, 12539, 12541, 12543, 12545, 12547, 12549, 12551,
12553, 12555, 12557, 12559, 12561, 12563, 12565, 12567, 12569,
12571, 12573, 12575, 12577, 12579, 12581, 12583, 12585, 12587,
12589, 12591, 12593, 12595, 12597, 12599, 12601, 12603, 12605,
12607, 12609, 12611, 12613, 12615, 12617, 12619, 12621, 12623,
12625, 12627, 12629, 12631, 12633, 12635, 12637, 12639, 12641,
12643, 12645, 12647, 12649, 12651, 12653, 12655, 12657, 12659,
12661, 12663, 12665, 12667, 12669, 12671, 12673, 12675, 12677,
12679, 12681, 12683, 12685, 12687, 12689, 12691, 12693, 12695,
12697, 12699, 12701, 12703, 12705, 12707, 12709, 12711, 12713,
12715, 12717, 12719, 12721, 12723, 12725, 12727, 12729, 12731,
12733, 12735, 12737, 12739, 12741, 12743, 12745, 12747, 12749,
12751, 12753, 12755, 12757, 12759, 12761, 12763, 12765, 12767,
12769, 12771, 12773, 12775, 12777, 12779, 12781, 12783, 12785,
12787, 12789, 12791, 12793, 12795, 12797, 12799, 12801, 12803,
12805, 12807, 12809, 12811, 12813, 12815, 12817, 12819, 12821,
12823, 12825, 12827, 12829, 12831, 12833, 12835, 12837, 12839,
12841, 12843, 12845, 12847, 12849, 12851, 12853, 12855, 12857,
12859, 12861, 12863, 12865, 12867, 12869, 12871, 12873, 12875,
12877, 12879, 12881, 12883, 12885, 12887, 12889, 12891, 12893,
12895, 12897, 12899, 12901, 12903, 12905, 12907, 12909, 12911,
12913, 12915, 12917, 12919, 12921, 12923 1 68b LT_OEX_1 YOL058W_2
S. cerevisiae 12357 Cytoplasmic 12359, 12361, 12363, 12365, 12367,
12369, 12371, 12373, 12375, 12377, 12379, 12381, 12383, 12385,
12387, 12389, 12391, 12393, 12395, 12397, 12399, 12401, 12403,
12405, 12407, 12409, 12411, 12413, 12415, 12417, 12419, 12421,
12423, 12425, 12427, 12429, 12431, 12433, 12435, 12437, 12439,
12441, 12443, 12445, 12447, 12449, 12451, 12453, 12455, 12457,
12459, 12461, 12463, 12465, 12467, 12469, 12471, 12473, 12475,
12477, 12479, 12481, 12483, 12485, 12487, 12489, 12491, 12493,
12495, 12497, 12499, 12501, 12503, 12505, 12507, 12509, 12511,
12513, 12515, 12517, 12519, 12521, 12523, 12525, 12527, 12529,
12531, 12533, 12535, 12537, 12539, 12541, 12543, 12545, 12547,
12549, 12551, 12553, 12555, 12557, 12559, 12561, 12563, 12565,
12567, 12569, 12571, 12573, 12575, 12577, 12579, 12581, 12583,
12585, 12587, 12589, 12591, 12593, 12595, 12597, 12599, 12601,
12603, 12605, 12607, 12609, 12611, 12613, 12615, 12617, 12619,
12621, 12623, 12625, 12627, 12629, 12631, 12633, 12635, 12637,
12639, 12641, 12643, 12645, 12647, 12649, 12651, 12653, 12655,
12657, 12659, 12661, 12663, 12665, 12667, 12669, 12671, 12673,
12675, 12677, 12679, 12681, 12683, 12685, 12687, 12689, 12691,
12693, 12695, 12697, 12699, 12701, 12703, 12705, 12707, 12709,
12711, 12713, 12715, 12717, 12719, 12721, 12723, 12725, 12727,
12729, 12731, 12733, 12735, 12737, 12739, 12741, 12743, 12745,
12747, 12749, 12751, 12753, 12755, 12757, 12759, 12761, 12763,
12765, 12767, 12769, 12771, 12773, 12775, 12777, 12779, 12781,
12783, 12785, 12787, 12789, 12791, 12793, 12795, 12797, 12799,
12801, 12803, 12805, 12807, 12809, 12811, 12813, 12815, 12817,
12819, 12821, 12823, 12825, 12827, 12829, 12831, 12833, 12835,
12837, 12839, 12841, 12843, 12845, 12847, 12849, 12851, 12853,
12855, 12857, 12859, 12861, 12863, 12865, 12867, 12869, 12871,
12873, 12875, 12877, 12879, 12881, 12883, 12885, 12887, 12889,
12891, 12893, 12895, 12897, 12899, 12901, 12903, 12905, 12907,
12909, 12911, 12913, 12915, 12917, 12919, 12921, 12923
1 69 LT_OEX_1 YPR035W_2 S. cerevisiae 12936 Cytoplasmic 12938,
12940, 12942, 12944, 12946, 12948, 12950, 12952, 12954, 12956,
12958, 12960, 12962, 12964, 12966, 12968, 12970, 12972, 12974,
12976, 12978, 12980, 12982, 12984, 12986, 12988, 12990, 12992,
12994, 12996, 12998, 13000, 13002, 13004, 13006, 13008, 13010,
13012, 13014, 13016, 13018, 13020, 13022, 13024, 13026, 13028,
13030, 13032, 13034, 13036, 13038, 13040, 13042, 13044, 13046,
13048, 13050, 13052, 13054, 13056, 13058, 13060, 13062, 13064,
13066, 13068, 13070, 13072, 13074, 13076, 13078, 13080, 13082,
13084, 13086, 13088, 13090, 13092, 13094, 13096, 13098, 13100,
13102, 13104, 13106, 13108, 13110, 13112, 13114, 13116, 13118,
13120, 13122, 13124, 13126, 13128, 13130, 13132, 13134, 13136,
13138, 13140, 13142, 13144, 13146, 13148, 13150, 13152, 13154,
13156, 13158, 13160, 13162, 13164, 13166, 13168, 13170, 13172,
13174, 13176, 13178, 13180, 13182, 13184, 13186, 13188, 13190,
13192, 13194, 13196, 13198, 13200, 13202
TABLE-US-00018 TABLE IB Nucleic acid sequence ID numbers 5. 1. 2.
3. 4. Lead 6. 7. Application Hit Project Locus Organism SEQ ID
Target SEQ IDs of Nucleic Acid Homologs 1 1 LT_OEX_1 B0414 E. coli
38 Cytoplasmic -- 1 2 LT_OEX_1 B2931 E. coli 147 Cytoplasmic -- 1 3
LT_OEX_1 B3945 E. coli 172 Cytoplasmic -- 1 4 LT_OEX_1 YEL004W S.
cerevisiae 382 Cytoplasmic -- 1 5 LT_OEX_1 YER177W S. cerevisiae
406 Cytoplasmic 748, 750, 752, 754, 756, 758, 760, 762, 764, 766,
768, 770, 772, 774, 776, 778, 780, 782, 784, 786, 788, 790, 792,
794, 796, 798, 800, 802, 804, 806, 808, 810, 812, 814, 816, 818,
820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842, 844,
846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866, 868, 870,
872, 874, 876, 878, 880, 882, 884, 886, 888, 890, 892, 894, 896,
898, 900, 902, 904, 906 1 6 LT_OEX_1 YHR204W S. cerevisiae 917
Cytoplasmic -- 1 7 LT_OEX_1 YLL053C S. cerevisiae 952 Cytoplasmic
1214, 1216, 1218, 1220, 1222, 1224, 1226, 1228, 1230, 1232, 1234,
1236, 1238, 1240, 1242, 1244, 1246, 1248, 1250, 1252, 1254, 1256,
1258, 1260, 1262, 1264, 1266, 1268, 1270, 1272, 1274, 1276, 1278,
1280, 1282, 1284, 1286, 1288, 1290, 1292, 1294, 1296, 1298, 1300,
1302, 1304, 1306, 1308, 1310, 1312, 1314, 13269, 13271, 13273 1 8
LT_OEX_1 YML123C S. cerevisiae 1320 Cytoplasmic 1616, 1618, 1620,
1622, 1624, 1626, 1628, 1630, 1632, 1634 1 9 LT_OEX_1 YNL142W S.
cerevisiae 1648 Cytoplasmic 2056 1 10 LT_OEX_1 YNR040W S.
cerevisiae 2065 Cytoplasmic -- 1 11 LT_OEX_1 YPR035W S. cerevisiae
2081 Cytoplasmic 2347, 2349, 2351, 2353, 2355, 2357, 2359, 2361,
2363, 2365, 2367, 2369, 2371, 2373, 2375, 2377, 2379, 2381, 2383,
2385, 2387, 2389, 2391, 2393 1 12a LT_OEX_1 B0903 E. coli 2406
Plastidic -- 1 12b LT_OEX_1 B0903 E. coli 2406 Cytoplasmic -- 1 13
LT_OEX_1 B1393 E. coli 2564 Cytoplasmic 2804, 2806, 2808, 2810,
2812, 2814, 2816, 2818, 2820, 2822, 2824, 2826, 2828, 2830, 2832,
2834 1 14 LT_OEX_1 B2704 E. coli 2841 Plastidic -- 1 15 LT_OEX_1
B2905 E. coli 2879 Cytoplasmic 3087, 3089, 3091, 3093, 3095, 3097,
3099 1 16 LT_OEX_1 B3206 E. coli 3109 Plastidic -- 1 17 LT_OEX_1
B3659 E. coli 3403 Cytoplasmic -- 1 18 LT_OEX_1 B3871 E. coli 3441
Cytoplasmic 3955, 3957, 3959, 3961, 3963 1 19 LT_OEX_1 YDR142C S.
cerevisiae 3978 Plastidic 4036, 13265 1 20 LT_OEX_1 YER175W-A S.
cerevisiae 4047 Cytoplasmic -- 1 21 LT_OEX_1 YGR289C S. cerevisiae
4051 Plastidic -- 1 22 LT_OEX_1 YHR044C S. cerevisiae 4131
Plastidic -- 1 23 LT_OEX_1 YHR072W S. cerevisiae 4217 Cytoplasmic
4461, 4463, 4465, 4467, 4469, 4471, 4473, 4475, 4477, 4479 1 24
LT_OEX_1 YHR213W-A S. cerevisiae 4491 Cytoplasmic -- 1 25 LT_OEX_1
YIL053W S. cerevisiae 4495 Cytoplasmic -- 1 26 LT_OEX_1 YJL103C S.
cerevisiae 4558 Plastidic -- 1 27 LT_OEX_1 YJL137C S. cerevisiae
4589 Plastidic -- 1 28 LT_OEX_1 YLR027C S. cerevisiae 4622
Cytoplasmic 5020, 5022, 5024, 5026, 5028, 5030, 5032, 5034, 5036,
5038, 5040, 5042, 5044, 5046, 5048, 5050, 5052, 5054, 5056, 5058,
5060 1 29a LT_OEX_1 YML079W S. cerevisiae 5070 Plastidic -- 1 29b
LT_OEX_1 YML079W S. cerevisiae 5070 Cytoplasmic -- 1 30 LT_OEX_1
YMR157C S. cerevisiae 5102 Plastidic -- 1 31 LT_OEX_1 YNL024C S.
cerevisiae 5115 Plastidic -- 1 32a LT_OEX_1 YOL058W S. cerevisiae
5159 Plastidic 5735, 5737, 5739 1 32b LT_OEX_1 YOL058W S.
cerevisiae 5159 Cytoplasmic 5735, 5737, 5739 1 33 LT_OEX_1 YPL180W
S. cerevisiae 5746 Cytoplasmic -- 1 34 LT_OEX_1 YPR167C S.
cerevisiae 5756 Plastidic 6048 1 35 LT_OEX_1 B0036 E. coli 6086
Plastidic 6544, 6546, 6548, 6550, 6552, 6554, 6556, 6558, 6560,
6562, 6564, 6566, 6568, 6570, 6572, 6574 1 36 LT_OEX_1 B1906 E.
coli 6581 Cytoplasmic -- 1 37 LT_OEX_1 B2371 E. coli 6609
Cytoplasmic -- 1 38 LT_OEX_1 B2881 E. coli 6949 Cytoplasmic 7069,
7071 1 39 LT_OEX_1 B3106 E. coli 7078 Cytoplasmic -- 1 40 LT_OEX_1
B3400 E. coli 7270 Plastidic -- 1 41 LT_OEX_1 B3410 E. coli 7467
Cytoplasmic -- 1 42 LT_OEX_1 B4209 E. coli 7492 Plastidic -- 1 43
LT_OEX_1 SLL1545 Synechocystis 7591 Cytoplasmic -- 1 44 LT_OEX_1
SLR1348 Synechocystis 7670 Mitochondric 8224, 8226, 8228 1 45
LT_OEX_1 YGR191W S. cerevisiae 8236 Plastidic -- 1 46 LT_OEX_1
AT1G22920 A. thaliana 8563 Cytoplasmic 8637 1 47 LT_OEX_1 B1600 E.
coli 8648 Plastidic -- 1 48 LT_OEX_1 B1900 E. coli 8760 Plastidic
-- 1 49 LT_OEX_1 SLL0099 Synechocystis 8861 Cytoplasmic -- 1 50
LT_OEX_1 SLL0383 Synechocystis 9046 Cytoplasmic -- 1 51 LT_OEX_1
SLR1094 Synechocystis 9280 Cytoplasmic -- 1 52 LT_OEX_1 SLR1520
Synechocystis 9307 Cytoplasmic -- 1 53 LT_OEX_1 YDL142C S.
cerevisiae 9430 Cytoplasmic -- 1 54 LT_OEX_1 YDR147W S. cerevisiae
9479 Cytoplasmic -- 1 55 LT_OEX_1 YLR284C S. cerevisiae 9500
Plastidic -- 1 56 LT_OEX_1 YPL148C S. cerevisiae 9553 Plastidic --
1 57 LT_OEX_1 YPR074C S. cerevisiae 9574 Plastidic 10390, 10392 1
58 LT_OEX_1 B1008 E. coli 10404 Plastidic -- 1 59 LT_OEX_1 B1529 E.
coli 10503 Plastidic -- 1 60 LT_OEX_1 B3347 E. coli 10591 Plastidic
-- 1 61 LT_OEX_1 YBR176W S. cerevisiae 10934 Cytoplasmic 11454 1 62
LT_OEX_1 YGR177C S. cerevisiae 11461 Cytoplasmic -- 1 63 LT_OEX_1
YHR176W S. cerevisiae 11501 Cytoplasmic 11549, 11551, 11553, 11555,
11557 1 64 LT_OEX_1 B2881_2 E. coli 11564 Cytoplasmic 11686, 11688
1 65 LT_OEX_1 B3945_2 E. coli 11695 Cytoplasmic -- 1 66 LT_OEX_1
YHR204W_2 S. cerevisiae 11907 Cytoplasmic -- 1 67 LT_OEX_1
YNL142W_2 S. cerevisiae 11944 Cytoplasmic 12348 1 68a LT_OEX_1
YOL058W_2 S. cerevisiae 12357 Plastidic 12925, 12927, 12929 1 68b
LT_OEX_1 YOL058W_2 S. cerevisiae 12357 Cytoplasmic 12925, 12927,
12929 1 69 LT_OEX_1 YPR035W_2 S. cerevisiae 12936 Cytoplasmic
13204, 13206, 13208, 13210, 13212, 13214, 13216, 13218, 13220,
13222, 13224, 13226, 13228, 13230, 13232, 13234, 13236, 13238,
13240, 13242, 13244, 13246, 13248, 13250
TABLE-US-00019 TABLE IIA Amino acid sequence ID numbers 5. Lead
Appli- 1. 2. 3. 4. SEQ 6. 7. cation Hit Project Locus Organism ID
Target SEQ IDs of Polypeptide Homologs 1 1 LT_OEX_1 B0414 E. coli
39 Cyto- 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69, 71, 73, plasmic 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97,
99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,
125, 127, 129, 131, 133, 135 1 2 LT_OEX_1 B2931 E. coli 148 Cyto-
150, 152, 154, 156, 158, 160, 162, 164 plasmic 1 3 LT_OEX_1 B3945
E. coli 173 Cyto- 175, 177, 179, 181, 183, 185, 187, 189, 191, 193,
195, 197, 199, plasmic 201, 203, 205, 207, 209, 211, 213, 215, 217,
219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243,
245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269,
271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295,
297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321,
323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373 1 4
LT_OEX_1 YEL004W S. cerevisiae 383 Cyto- 385, 387, 389, 391, 393,
395, 397 plasmic 1 5 LT_OEX_1 YER177W S. cerevisiae 407 Cyto- 409,
411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, plasmic
435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459,
461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485,
487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563,
565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589,
591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615,
617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641,
643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693,
695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719,
721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745,
747 1 6 LT_OEX_1 YHR204W S. cerevisiae 918 Cyto- 920, 922, 924,
926, 928, 930, 932, 934, 936, 938, 940 plasmic 1 7 LT_OEX_1 YLL053C
S. cerevisiae 953 Cyto- 955, 957, 959, 961, 963, 965, 967, 969,
971, 973, 975, 977, 979, plasmic 981, 983, 985, 987, 989, 991, 993,
995, 997, 999, 1001, 1003, 1005, 1007, 1009, 1011, 1013, 1015,
1017, 1019, 1021, 1023, 1025, 1027, 1029, 1031, 1033, 1035, 1037,
1039, 1041, 1043, 1045, 1047, 1049, 1051, 1053, 1055, 1057, 1059,
1061, 1063, 1065, 1067, 1069, 1071, 1073, 1075, 1077, 1079, 1081,
1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103,
1105, 1107, 1109, 1111, 1113, 1115, 1117, 1119, 1121, 1123, 1125,
1127, 1129, 1131, 1133, 1135, 1137, 1139, 1141, 1143, 1145, 1147,
1149, 1151, 1153, 1155, 1157, 1159, 1161, 1163, 1165, 1167, 1169,
1171, 1173, 1175, 1177, 1179, 1181, 1183, 1185, 1187, 1189, 1191,
1193, 1195, 1197, 1199, 1201, 1203, 1205, 1207, 1209, 1211, 1213 1
8 LT_OEX_1 YML123C S. cerevisiae 1321 Cyto- 1323, 1325, 1327, 1329,
1331, 1333, 1335, 1337, 1339, 1341, plasmic 1343, 1345, 1347, 1349,
1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365, 1367, 1369, 1371,
1373, 1375, 1377, 1379, 1381, 1383, 1385, 1387, 1389, 1391, 1393,
1395, 1397, 1399, 1401, 1403, 1405, 1407, 1409, 1411, 1413, 1415,
1417, 1419, 1421, 1423, 1425, 1427, 1429, 1431, 1433, 1435, 1437,
1439, 1441, 1443, 1445, 1447, 1449, 1451, 1453, 1455, 1457, 1459,
1461, 1463, 1465, 1467, 1469, 1471, 1473, 1475, 1477, 1479, 1481,
1483, 1485, 1487, 1489, 1491, 1493, 1495, 1497, 1499, 1501, 1503,
1505, 1507, 1509, 1511, 1513, 1515, 1517, 1519, 1521, 1523, 1525,
1527, 1529, 1531, 1533, 1535, 1537, 1539, 1541, 1543, 1545, 1547,
1549, 1551, 1553, 1555, 1557, 1559, 1561, 1563, 1565, 1567, 1569,
1571, 1573, 1575, 1577, 1579, 1581, 1583, 1585, 1587, 1589, 1591,
1593, 1595, 1597, 1599, 1601, 1603, 1605, 1607, 1609, 1611, 1613,
1615 1 9 LT_OEX_1 YNL142W S. cerevisiae 1649 Cyto- 1651, 1653,
1655, 1657, 1659, 1661, 1663, 1665, 1667, 1669, plasmic 1671, 1673,
1675, 1677, 1679, 1681, 1683, 1685, 1687, 1689, 1691, 1693, 1695,
1697, 1699, 1701, 1703, 1705, 1707, 1709, 1711, 1713, 1715, 1717,
1719, 1721, 1723, 1725, 1727, 1729, 1731, 1733, 1735, 1737, 1739,
1741, 1743, 1745, 1747, 1749, 1751, 1753, 1755, 1757, 1759, 1761,
1763, 1765, 1767, 1769, 1771, 1773, 1775, 1777, 1779, 1781, 1783,
1785, 1787, 1789, 1791, 1793, 1795, 1797, 1799, 1801, 1803, 1805,
1807, 1809, 1811, 1813, 1815, 1817, 1819, 1821, 1823, 1825, 1827,
1829, 1831, 1833, 1835, 1837, 1839, 1841, 1843, 1845, 1847, 1849,
1851, 1853, 1855, 1857, 1859, 1861, 1863, 1865, 1867, 1869, 1871,
1873, 1875, 1877, 1879, 1881, 1883, 1885, 1887, 1889, 1891, 1893,
1895, 1897, 1899, 1901, 1903, 1905, 1907, 1909, 1911, 1913, 1915,
1917, 1919, 1921, 1923, 1925, 1927, 1929, 1931, 1933, 1935, 1937,
1939, 1941, 1943, 1945, 1947, 1949, 1951, 1953, 1955, 1957, 1959,
1961, 1963, 1965, 1967, 1969, 1971, 1973, 1975, 1977, 1979, 1981,
1983, 1985, 1987, 1989, 1991, 1993, 1995, 1997, 1999, 2001, 2003,
2005, 2007, 2009, 2011, 2013, 2015, 2017, 2019, 2021, 2023, 2025,
2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045, 2047,
2049, 2051, 2053, 2055 1 10 LT_OEX_1 YNR040W S. cerevisiae 2066
Cyto- 2068, 2070, 2072, 2074, 2076 plasmic 1 11 LT_OEX_1 YPR035W S.
cerevisiae 2082 Cyto- 2084, 2086, 2088, 2090, 2092, 2094, 2096,
2098, 2100, 2102, plasmic 2104, 2106, 2108, 2110, 2112, 2114, 2116,
2118, 2120, 2122, 2124, 2126, 2128, 2130, 2132, 2134, 2136, 2138,
2140, 2142, 2144, 2146, 2148, 2150, 2152, 2154, 2156, 2158, 2160,
2162, 2164, 2166, 2168, 2170, 2172, 2174, 2176, 2178, 2180, 2182,
2184, 2186, 2188, 2190, 2192, 2194, 2196, 2198, 2200, 2202, 2204,
2206, 2208, 2210, 2212, 2214, 2216, 2218, 2220, 2222, 2224, 2226,
2228, 2230, 2232, 2234, 2236, 2238, 2240, 2242, 2244, 2246, 2248,
2250, 2252, 2254, 2256, 2258, 2260, 2262, 2264, 2266, 2268, 2270,
2272, 2274, 2276, 2278, 2280, 2282, 2284, 2286, 2288, 2290, 2292,
2294, 2296, 2298, 2300, 2302, 2304, 2306, 2308, 2310, 2312, 2314,
2316, 2318, 2320, 2322, 2324, 2326, 2328, 2330, 2332, 2334, 2336,
2338, 2340, 2342, 2344, 2346 1 12a LT_OEX_1 B0903 E. coli 2407
Plas- 2409, 2411, 2413, 2415, 2417, 2419, 2421, 2423, 2425, 2427,
tidic 2429, 2431, 2433, 2435, 2437, 2439, 2441, 2443, 2445, 2447,
2449, 2451, 2453, 2455, 2457, 2459, 2461, 2463, 2465, 2467, 2469,
2471, 2473, 2475, 2477, 2479, 2481, 2483, 2485, 2487, 2489, 2491,
2493, 2495, 2497, 2499, 2501, 2503, 2505, 2507, 2509, 2511, 2513,
2515, 2517, 2519, 2521, 2523, 2525, 2527, 2529, 2531, 2533, 2535,
2537, 2539, 2541, 2543, 2545 1 12b LT_OEX_1 B0903 E. coli 2407
Cyto- 2409, 2411, 2413, 2415, 2417, 2419, 2421, 2423, 2425, 2427,
plasmic 2429, 2431, 2433, 2435, 2437, 2439, 2441, 2443, 2445, 2447,
2449, 2451, 2453, 2455, 2457, 2459, 2461, 2463, 2465, 2467, 2469,
2471, 2473, 2475, 2477, 2479, 2481, 2483, 2485, 2487, 2489, 2491,
2493, 2495, 2497, 2499, 2501, 2503, 2505, 2507, 2509, 2511, 2513,
2515, 2517, 2519, 2521, 2523, 2525, 2527, 2529, 2531, 2533, 2535,
2537, 2539, 2541, 2543, 2545 1 13 LT_OEX_1 B1393 E. coli 2565 Cyto-
2567, 2569, 2571, 2573, 2575, 2577, 2579, 2581, 2583, 2585, plasmic
2587, 2589, 2591, 2593, 2595, 2597, 2599, 2601, 2603, 2605, 2607,
2609, 2611, 2613, 2615, 2617, 2619, 2621, 2623, 2625, 2627, 2629,
2631, 2633, 2635, 2637, 2639, 2641, 2643, 2645, 2647, 2649, 2651,
2653, 2655, 2657, 2659, 2661, 2663, 2665, 2667, 2669, 2671, 2673,
2675, 2677, 2679, 2681, 2683, 2685, 2687, 2689, 2691, 2693, 2695,
2697, 2699, 2701, 2703, 2705, 2707, 2709, 2711, 2713, 2715, 2717,
2719, 2721, 2723, 2725, 2727, 2729, 2731, 2733, 2735, 2737, 2739,
2741, 2743, 2745, 2747, 2749, 2751, 2753, 2755, 2757, 2759, 2761,
2763, 2765, 2767, 2769, 2771, 2773, 2775, 2777, 2779, 2781, 2783,
2785, 2787, 2789, 2791, 2793, 2795, 2797, 2799, 2801, 2803 1 14
LT_OEX_1 B2704 E. coli 2842 Plas- 2844, 2846, 2848, 2850, 2852,
2854, 2856, 2858, 2860, 2862, tidic 2864, 2866, 2868, 2870, 2872,
2874 1 15 LT_OEX_1 B2905 E. coli 2880 Cyto- 2882, 2884, 2886, 2888,
2890, 2892, 2894, 2896, 2898, 2900, plasmic 2902, 2904, 2906, 2908,
2910, 2912, 2914, 2916, 2918, 2920, 2922, 2924, 2926, 2928, 2930,
2932, 2934, 2936, 2938, 2940, 2942, 2944, 2946, 2948, 2950, 2952,
2954, 2956, 2958, 2960, 2962, 2964, 2966, 2968, 2970, 2972, 2974,
2976, 2978, 2980, 2982, 2984, 2986, 2988, 2990, 2992, 2994, 2996,
2998, 3000, 3002, 3004, 3006, 3008, 3010, 3012, 3014, 3016, 3018,
3020, 3022, 3024, 3026, 3028, 3030, 3032, 3034, 3036, 3038, 3040,
3042, 3044, 3046, 3048, 3050, 3052, 3054, 3056, 3058, 3060, 3062,
3064, 3066, 3068, 3070, 3072, 3074, 3076, 3078, 3080, 3082, 3084,
3086 1 16 LT_OEX_1 B3206 E. coli 3110 Plas- 3112, 3114, 3116, 3118,
3120, 3122, 3124, 3126, 3128, 3130, tidic 3132, 3134, 3136, 3138,
3140, 3142, 3144, 3146, 3148, 3150, 3152, 3154, 3156, 3158, 3160,
3162, 3164, 3166, 3168, 3170, 3172, 3174, 3176, 3178, 3180, 3182,
3184, 3186, 3188, 3190, 3192, 3194, 3196, 3198, 3200, 3202, 3204,
3206, 3208, 3210, 3212, 3214, 3216, 3218, 3220, 3222, 3224, 3226,
3228, 3230, 3232, 3234, 3236, 3238, 3240, 3242, 3244, 3246, 3248,
3250, 3252, 3254, 3256, 3258, 3260, 3262, 3264, 3266, 3268, 3270,
3272, 3274, 3276, 3278, 3280, 3282, 3284, 3286, 3288, 3290, 3292,
3294, 3296, 3298, 3300, 3302, 3304, 3306, 3308, 3310, 3312, 3314,
3316, 3318, 3320, 3322, 3324, 3326, 3328, 3330, 3332, 3334, 3336,
3338, 3340, 3342, 3344, 3346, 3348, 3350, 3352, 3354, 3356, 3358,
3360, 3362, 3364, 3366, 3368, 3370, 3372, 3374, 3376, 3378, 3380,
3382, 3384, 3386, 3388, 3390, 3392, 3394, 3396, 3398 1 17 LT_OEX_1
B3659 E. coli 3404 Cyto- 3406, 3408, 3410, 3412, 3414, 3416, 3418,
3420, 3422, 3424, plasmic 3426, 3428, 3430 1 18 LT_OEX_1 B3871 E.
coli 3442 Cyto- 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3458,
3460, 3462, plasmic 3464, 3466, 3468, 3470, 3472, 3474, 3476, 3478,
3480, 3482, 3484, 3486, 3488, 3490, 3492, 3494, 3496, 3498, 3500,
3502, 3504, 3506, 3508, 3510, 3512, 3514, 3516, 3518, 3520, 3522,
3524, 3526, 3528, 3530, 3532, 3534, 3536, 3538, 3540, 3542, 3544,
3546, 3548, 3550, 3552, 3554, 3556, 3558, 3560, 3562, 3564, 3566,
3568, 3570, 3572, 3574, 3576, 3578, 3580, 3582, 3584, 3586, 3588,
3590, 3592, 3594, 3596, 3598, 3600, 3602, 3604, 3606, 3608, 3610,
3612, 3614, 3616, 3618, 3620, 3622, 3624, 3626, 3628, 3630, 3632,
3634, 3636, 3638, 3640, 3642, 3644, 3646, 3648, 3650, 3652, 3654,
3656, 3658, 3660, 3662, 3664, 3666, 3668, 3670, 3672, 3674, 3676,
3678, 3680, 3682, 3684, 3686, 3688, 3690, 3692, 3694, 3696, 3698,
3700, 3702, 3704, 3706, 3708, 3710, 3712, 3714, 3716, 3718, 3720,
3722, 3724, 3726, 3728, 3730, 3732, 3734, 3736, 3738, 3740, 3742,
3744, 3746, 3748, 3750, 3752, 3754, 3756, 3758, 3760, 3762, 3764,
3766, 3768, 3770, 3772, 3774, 3776, 3778, 3780, 3782, 3784, 3786,
3788, 3790, 3792, 3794, 3796, 3798, 3800, 3802, 3804, 3806, 3808,
3810, 3812, 3814, 3816, 3818, 3820, 3822, 3824, 3826, 3828, 3830,
3832, 3834, 3836, 3838, 3840, 3842, 3844, 3846, 3848, 3850, 3852,
3854, 3856, 3858, 3860, 3862, 3864, 3866, 3868, 3870, 3872, 3874,
3876, 3878, 3880, 3882, 3884, 3886, 3888, 3890, 3892, 3894, 3896,
3898, 3900, 3902, 3904, 3906, 3908, 3910, 3912, 3914, 3916, 3918,
3920, 3922, 3924, 3926, 3928, 3930, 3932, 3934, 3936, 3938, 3940,
3942, 3944, 3946, 3948, 3950, 3952, 3954 1 19 LT_OEX_1 YDR142C S.
cerevisiae 3979 Plas- 3981, 3983, 3985, 3987, 3989, 3991, 3993,
3995, 3997, 3999, tidic 4001, 4003, 4005, 4007, 4009, 4011, 4013,
4015, 4017, 4019, 4021, 4023, 4025, 4027, 4029, 4031, 4033, 4035 1
20 LT_OEX_1 YER175W-A S. cerevisiae 4048 Cyto- -- plasmic 1 21
LT_OEX_1 YGR289C S. cerevisiae 4052 Plas- 4054, 4056, 4058, 4060,
4062, 4064, 4066, 4068, 4070, 4072, tidic 4074, 4076, 4078, 4080,
4082, 4084, 4086, 4088, 4090, 4092, 4094, 4096, 4098, 4100, 4102,
4104, 4106, 4108, 4110, 4112, 4114, 4116, 4118, 4120 1 22 LT_OEX_1
YHR044C S. cerevisiae 4132 Plas- 4134, 4136, 4138, 4140, 4142,
4144, 4146, 4148, 4150, 4152, tidic 4154, 4156, 4158, 4160, 4162,
4164, 4166, 4168, 4170, 4172, 4174, 4176, 4178, 4180, 4182, 4184,
4186, 4188, 4190, 4192, 4194, 4196, 4198, 4200, 4202, 4204, 4206,
4208, 4210 1 23 LT_OEX_1 YHR072W S. cerevisiae 4218 Cyto- 4220,
4222, 4224, 4226, 4228, 4230, 4232, 4234, 4236, 4238, plasmic 4240,
4242, 4244, 4246, 4248, 4250, 4252, 4254, 4256, 4258, 4260, 4262,
4264, 4266, 4268, 4270, 4272, 4274, 4276, 4278, 4280, 4282, 4284,
4286, 4288, 4290, 4292, 4294, 4296, 4298, 4300, 4302, 4304, 4306,
4308, 4310, 4312, 4314, 4316, 4318, 4320, 4322, 4324, 4326, 4328,
4330, 4332, 4334, 4336, 4338, 4340, 4342, 4344, 4346, 4348, 4350,
4352, 4354, 4356, 4358, 4360, 4362, 4364, 4366, 4368, 4370, 4372,
4374, 4376, 4378, 4380, 4382, 4384, 4386, 4388, 4390, 4392, 4394,
4396, 4398, 4400, 4402, 4404, 4406, 4408, 4410, 4412, 4414, 4416,
4418, 4420, 4422, 4424, 4426, 4428, 4430, 4432, 4434, 4436, 4438,
4440, 4442, 4444, 4446, 4448, 4450, 4452, 4454, 4456, 4458, 4460 1
24 LT_OEX_1 YHR213W-A S. cerevisiae 4492 Cyto- -- plasmic 1 25
LT_OEX_1 YIL053W S. cerevisiae 4496 Cyto- 4498, 4500, 4502, 4504,
4506, 4508, 4510, 4512, 4514, 4516, plasmic 4518, 4520, 4522, 4524,
4526, 4528, 4530, 4532, 4534, 4536, 4538, 4540, 4542, 4544, 4546,
4548, 4550 1 26 LT_OEX_1 YJL103C S. cerevisiae 4559 Plas- 4561,
4563, 4565, 4567, 4569, 4571, 4573, 4575, 4577, 4579 tidic
1 27 LT_OEX_1 YJL137C S. cerevisiae 4590 Plas- 4592, 4594, 4596,
4598, 4600, 4602, 4604, 4606, 4608, 4610, tidic 4612 1 28 LT_OEX_1
YLR027C S. cerevisiae 4623 Cyto- 4625, 4627, 4629, 4631, 4633,
4635, 4637, 4639, 4641, 4643, plasmic 4645, 4647, 4649, 4651, 4653,
4655, 4657, 4659, 4661, 4663, 4665, 4667, 4669, 4671, 4673, 4675,
4677, 4679, 4681, 4683, 4685, 4687, 4689, 4691, 4693, 4695, 4697,
4699, 4701, 4703, 4705, 4707, 4709, 4711, 4713, 4715, 4717, 4719,
4721, 4723, 4725, 4727, 4729, 4731, 4733, 4735, 4737, 4739, 4741,
4743, 4745, 4747, 4749, 4751, 4753, 4755, 4757, 4759, 4761, 4763,
4765, 4767, 4769, 4771, 4773, 4775, 4777, 4779, 4781, 4783, 4785,
4787, 4789, 4791, 4793, 4795, 4797, 4799, 4801, 4803, 4805, 4807,
4809, 4811, 4813, 4815, 4817, 4819, 4821, 4823, 4825, 4827, 4829,
4831, 4833, 4835, 4837, 4839, 4841, 4843, 4845, 4847, 4849, 4851,
4853, 4855, 4857, 4859, 4861, 4863, 4865, 4867, 4869, 4871, 4873,
4875, 4877, 4879, 4881, 4883, 4885, 4887, 4889, 4891, 4893, 4895,
4897, 4899, 4901, 4903, 4905, 4907, 4909, 4911, 4913, 4915, 4917,
4919, 4921, 4923, 4925, 4927, 4929, 4931, 4933, 4935, 4937, 4939,
4941, 4943, 4945, 4947, 4949, 4951, 4953, 4955, 4957, 4959, 4961,
4963, 4965, 4967, 4969, 4971, 4973, 4975, 4977, 4979, 4981, 4983,
4985, 4987, 4989, 4991, 4993, 4995, 4997, 4999, 5001, 5003, 5005,
5007, 5009, 5011, 5013, 5015, 5017, 5019 1 29a LT_OEX_1 YML079W S.
cerevisiae 5071 Plas- 5073, 5075, 5077, 5079, 5081, 5083, 5085,
5087, 5089, 5091, tidic 5093, 5095, 5097 1 29b LT_OEX_1 YML079W S.
cerevisiae 5071 Cyto- 5073, 5075, 5077, 5079, 5081, 5083, 5085,
5087, 5089, 5091, plasmic 5093, 5095, 5097 1 30 LT_OEX_1 YMR157C S.
cerevisiae 5103 Plas- 5105, 5107, 5109 tidic 1 31 LT_OEX_1 YNL024C
S. cerevisiae 5116 Plas- 5118, 5120, 5122, 5124, 5126, 5128, 5130,
5132, 5134, 5136, tidic 5138, 5140, 5142, 5144, 5146, 5148, 5150,
5152 1 32a LT_OEX_1 YOL058W S. cerevisiae 5160 Plas- 5162, 5164,
5166, 5168, 5170, 5172, 5174, 5176, 5178, 5180, tidic 5182, 5184,
5186, 5188, 5190, 5192, 5194, 5196, 5198, 5200, 5202, 5204, 5206,
5208, 5210, 5212, 5214, 5216, 5218, 5220, 5222, 5224, 5226, 5228,
5230, 5232, 5234, 5236, 5238, 5240, 5242, 5244, 5246, 5248, 5250,
5252, 5254, 5256, 5258, 5260, 5262, 5264, 5266, 5268, 5270, 5272,
5274, 5276, 5278, 5280, 5282, 5284, 5286, 5288, 5290, 5292, 5294,
5296, 5298, 5300, 5302, 5304, 5306, 5308, 5310, 5312, 5314, 5316,
5318, 5320, 5322, 5324, 5326, 5328, 5330, 5332, 5334, 5336, 5338,
5340, 5342, 5344, 5346, 5348, 5350, 5352, 5354, 5356, 5358, 5360,
5362, 5364, 5366, 5368, 5370, 5372, 5374, 5376, 5378, 5380, 5382,
5384, 5386, 5388, 5390, 5392, 5394, 5396, 5398, 5400, 5402, 5404,
5406, 5408, 5410, 5412, 5414, 5416, 5418, 5420, 5422, 5424, 5426,
5428, 5430, 5432, 5434, 5436, 5438, 5440, 5442, 5444, 5446, 5448,
5450, 5452, 5454, 5456, 5458, 5460, 5462, 5464, 5466, 5468, 5470,
5472, 5474, 5476, 5478, 5480, 5482, 5484, 5486, 5488, 5490, 5492,
5494, 5496, 5498, 5500, 5502, 5504, 5506, 5508, 5510, 5512, 5514,
5516, 5518, 5520, 5522, 5524, 5526, 5528, 5530, 5532, 5534, 5536,
5538, 5540, 5542, 5544, 5546, 5548, 5550, 5552, 5554, 5556, 5558,
5560, 5562, 5564, 5566, 5568, 5570, 5572, 5574, 5576, 5578, 5580,
5582, 5584, 5586, 5588, 5590, 5592, 5594, 5596, 5598, 5600, 5602,
5604, 5606, 5608, 5610, 5612, 5614, 5616, 5618, 5620, 5622, 5624,
5626, 5628, 5630, 5632, 5634, 5636, 5638, 5640, 5642, 5644, 5646,
5648, 5650, 5652, 5654, 5656, 5658, 5660, 5662, 5664, 5666, 5668,
5670, 5672, 5674, 5676, 5678, 5680, 5682, 5684, 5686, 5688, 5690,
5692, 5694, 5696, 5698, 5700, 5702, 5704, 5706, 5708, 5710, 5712,
5714, 5716, 5718, 5720, 5722, 5724, 5726, 5728, 5730, 5732, 5734 1
32b LT_OEX_1 YOL058W S. cerevisiae 5160 Cyto- 5162, 5164, 5166,
5168, 5170, 5172, 5174, 5176, 5178, 5180, plasmic 5182, 5184, 5186,
5188, 5190, 5192, 5194, 5196, 5198, 5200, 5202, 5204, 5206, 5208,
5210, 5212, 5214, 5216, 5218, 5220, 5222, 5224, 5226, 5228, 5230,
5232, 5234, 5236, 5238, 5240, 5242, 5244, 5246, 5248, 5250, 5252,
5254, 5256, 5258, 5260, 5262, 5264, 5266, 5268, 5270, 5272, 5274,
5276, 5278, 5280, 5282, 5284, 5286, 5288, 5290, 5292, 5294, 5296,
5298, 5300, 5302, 5304, 5306, 5308, 5310, 5312, 5314, 5316, 5318,
5320, 5322, 5324, 5326, 5328, 5330, 5332, 5334, 5336, 5338, 5340,
5342, 5344, 5346, 5348, 5350, 5352, 5354, 5356, 5358, 5360, 5362,
5364, 5366, 5368, 5370, 5372, 5374, 5376, 5378, 5380, 5382, 5384,
5386, 5388, 5390, 5392, 5394, 5396, 5398, 5400, 5402, 5404, 5406,
5408, 5410, 5412, 5414, 5416, 5418, 5420, 5422, 5424, 5426, 5428,
5430, 5432, 5434, 5436, 5438, 5440, 5442, 5444, 5446, 5448, 5450,
5452, 5454, 5456, 5458, 5460, 5462, 5464, 5466, 5468, 5470, 5472,
5474, 5476, 5478, 5480, 5482, 5484, 5486, 5488, 5490, 5492, 5494,
5496, 5498, 5500, 5502, 5504, 5506, 5508, 5510, 5512, 5514, 5516,
5518, 5520, 5522, 5524, 5526, 5528, 5530, 5532, 5534, 5536, 5538,
5540, 5542, 5544, 5546, 5548, 5550, 5552, 5554, 5556, 5558, 5560,
5562, 5564, 5566, 5568, 5570, 5572, 5574, 5576, 5578, 5580, 5582,
5584, 5586, 5588, 5590, 5592, 5594, 5596, 5598, 5600, 5602, 5604,
5606, 5608, 5610, 5612, 5614, 5616, 5618, 5620, 5622, 5624, 5626,
5628, 5630, 5632, 5634, 5636, 5638, 5640, 5642, 5644, 5646, 5648,
5650, 5652, 5654, 5656, 5658, 5660, 5662, 5664, 5666, 5668, 5670,
5672, 5674, 5676, 5678, 5680, 5682, 5684, 5686, 5688, 5690, 5692,
5694, 5696, 5698, 5700, 5702, 5704, 5706, 5708, 5710, 5712, 5714,
5716, 5718, 5720, 5722, 5724, 5726, 5728, 5730, 5732, 5734 1 33
LT_OEX_1 YPL180W S. cerevisiae 5747 Cyto- 5749 plasmic 1 34
LT_OEX_1 YPR167C S. cerevisiae 5757 Plas- 5759, 5761, 5763, 5765,
5767, 5769, 5771, 5773, 5775, 5777, tidic 5779, 5781, 5783, 5785,
5787, 5789, 5791, 5793, 5795, 5797, 5799, 5801, 5803, 5805, 5807,
5809, 5811, 5813, 5815, 5817, 5819, 5821, 5823, 5825, 5827, 5829,
5831, 5833, 5835, 5837, 5839, 5841, 5843, 5845, 5847, 5849, 5851,
5853, 5855, 5857, 5859, 5861, 5863, 5865, 5867, 5869, 5871, 5873,
5875, 5877, 5879, 5881, 5883, 5885, 5887, 5889, 5891, 5893, 5895,
5897, 5899, 5901, 5903, 5905, 5907, 5909, 5911, 5913, 5915, 5917,
5919, 5921, 5923, 5925, 5927, 5929, 5931, 5933, 5935, 5937, 5939,
5941, 5943, 5945, 5947, 5949, 5951, 5953, 5955, 5957, 5959, 5961,
5963, 5965, 5967, 5969, 5971, 5973, 5975, 5977, 5979, 5981, 5983,
5985, 5987, 5989, 5991, 5993, 5995, 5997, 5999, 6001, 6003, 6005,
6007, 6009, 6011, 6013, 6015, 6017, 6019, 6021, 6023, 6025, 6027,
6029, 6031, 6033, 6035, 6037, 6039, 6041, 6043, 6045, 6047 1 35
LT_OEX_1 B0036 E. coli 6087 Plas- 6089, 6091, 6093, 6095, 6097,
6099, 6101, 6103, 6105, 6107, tidic 6109, 6111, 6113, 6115, 6117,
6119, 6121, 6123, 6125, 6127, 6129, 6131, 6133, 6135, 6137, 6139,
6141, 6143, 6145, 6147, 6149, 6151, 6153, 6155, 6157, 6159, 6161,
6163, 6165, 6167, 6169, 6171, 6173, 6175, 6177, 6179, 6181, 6183,
6185, 6187, 6189, 6191, 6193, 6195, 6197, 6199, 6201, 6203, 6205,
6207, 6209, 6211, 6213, 6215, 6217, 6219, 6221, 6223, 6225, 6227,
6229, 6231, 6233, 6235, 6237, 6239, 6241, 6243, 6245, 6247, 6249,
6251, 6253, 6255, 6257, 6259, 6261, 6263, 6265, 6267, 6269, 6271,
6273, 6275, 6277, 6279, 6281, 6283, 6285, 6287, 6289, 6291, 6293,
6295, 6297, 6299, 6301, 6303, 6305, 6307, 6309, 6311, 6313, 6315,
6317, 6319, 6321, 6323, 6325, 6327, 6329, 6331, 6333, 6335, 6337,
6339, 6341, 6343, 6345, 6347, 6349, 6351, 6353, 6355, 6357, 6359,
6361, 6363, 6365, 6367, 6369, 6371, 6373, 6375, 6377, 6379, 6381,
6383, 6385, 6387, 6389, 6391, 6393, 6395, 6397, 6399, 6401, 6403,
6405, 6407, 6409, 6411, 6413, 6415, 6417, 6419, 6421, 6423, 6425,
6427, 6429, 6431, 6433, 6435, 6437, 6439, 6441, 6443, 6445, 6447,
6449, 6451, 6453, 6455, 6457, 6459, 6461, 6463, 6465, 6467, 6469,
6471, 6473, 6475, 6477, 6479, 6481, 6483, 6485, 6487, 6489, 6491,
6493, 6495, 6497, 6499, 6501, 6503, 6505, 6507, 6509, 6511, 6513,
6515, 6517, 6519, 6521, 6523, 6525, 6527, 6529, 6531, 6533, 6535,
6537, 6539, 6541, 6543 1 36 LT_OEX_1 B1906 E. coli 6582 Cyto- 6584,
6586, 6588, 6590, 6592, 6594, 6596, 6598, 6600, 6602, plasmic 6604
1 37 LT_OEX_1 B2371 E. coli 6610 Cyto- 6612, 6614, 6616, 6618,
6620, 6622, 6624, 6626, 6628, 6630, plasmic 6632, 6634, 6636, 6638,
6640, 6642, 6644, 6646, 6648, 6650, 6652, 6654, 6656, 6658, 6660,
6662, 6664, 6666, 6668, 6670, 6672, 6674, 6676, 6678, 6680, 6682,
6684, 6686, 6688, 6690, 6692, 6694, 6696, 6698, 6700, 6702, 6704,
6706, 6708, 6710, 6712, 6714, 6716, 6718, 6720, 6722, 6724, 6726,
6728, 6730, 6732, 6734, 6736, 6738, 6740, 6742, 6744, 6746, 6748,
6750, 6752, 6754, 6756, 6758, 6760, 6762, 6764, 6766, 6768, 6770,
6772, 6774, 6776, 6778, 6780, 6782, 6784, 6786, 6788, 6790, 6792,
6794, 6796, 6798, 6800, 6802, 6804, 6806, 6808, 6810, 6812, 6814,
6816, 6818, 6820, 6822, 6824, 6826, 6828, 6830, 6832, 6834, 6836,
6838, 6840, 6842, 6844, 6846, 6848, 6850, 6852, 6854, 6856, 6858,
6860, 6862, 6864, 6866, 6868, 6870, 6872, 6874, 6876, 6878, 6880,
6882, 6884, 6886, 6888, 6890, 6892, 6894, 6896, 6898, 6900, 6902,
6904, 6906, 6908, 6910, 6912, 6914, 6916, 6918, 6920, 6922, 6924,
6926, 6928, 6930, 6932, 6934, 6936, 6938, 6940, 6942, 6944 1 38
LT_OEX_1 B2881 E. coli 6950 Cyto- 6952, 6954, 6956, 6958, 6960,
6962, 6964, 6966, 6968, 6970, plasmic 6972, 6974, 6976, 6978, 6980,
6982, 6984, 6986, 6988, 6990, 6992, 6994, 6996, 6998, 7000, 7002,
7004, 7006, 7008, 7010, 7012, 7014, 7016, 7018, 7020, 7022, 7024,
7026, 7028, 7030, 7032, 7034, 7036, 7038, 7040, 7042, 7044, 7046,
7048, 7050, 7052, 7054, 7056, 7058, 7060, 7062, 7064, 7066, 7068 1
39 LT_OEX_1 B3106 E. coli 7079 Cyto- 7081, 7083, 7085, 7087, 7089,
7091, 7093, 7095, 7097, 7099, plasmic 7101, 7103, 7105, 7107, 7109,
7111, 7113, 7115, 7117, 7119, 7121, 7123, 7125, 7127, 7129, 7131,
7133, 7135, 7137, 7139, 7141, 7143, 7145, 7147, 7149, 7151, 7153,
7155, 7157, 7159, 7161, 7163, 7165, 7167, 7169, 7171, 7173, 7175,
7177, 7179, 7181, 7183, 7185, 7187, 7189, 7191, 7193, 7195, 7197,
7199, 7201, 7203, 7205, 7207, 7209, 7211, 7213, 7215, 7217, 7219,
7221, 7223, 7225, 7227, 7229, 7231, 7233, 7235, 7237, 7239, 7241,
7243, 7245, 7247, 7249, 7251, 7253, 7255, 7257, 7259, 7261, 7263,
7265 1 40 LT_OEX_1 B3400 E. coli 7271 Plas- 7273, 7275, 7277, 7279,
7281, 7283, 7285, 7287, 7289, 7291, tidic 7293, 7295, 7297, 7299,
7301, 7303, 7305, 7307, 7309, 7311, 7313, 7315, 7317, 7319, 7321,
7323, 7325, 7327, 7329, 7331, 7333, 7335, 7337, 7339, 7341, 7343,
7345, 7347, 7349, 7351, 7353, 7355, 7357, 7359, 7361, 7363, 7365,
7367, 7369, 7371, 7373, 7375, 7377, 7379, 7381, 7383, 7385, 7387,
7389, 7391, 7393, 7395, 7397, 7399, 7401, 7403, 7405, 7407, 7409,
7411, 7413, 7415, 7417, 7419, 7421, 7423, 7425, 7427, 7429, 7431,
7433, 7435, 7437, 7439, 7441, 7443, 7445, 7447, 7449, 7451, 7453,
7455, 7457, 7459, 7461 1 41 LT_OEX_1 B3410 E. coli 7468 Cyto- 7470,
7472, 7474, 7476, 7478, 7480, 7482, 7484, 7486 plasmic 1 42
LT_OEX_1 B4209 E. coli 7493 Plas 7495, 7497, 7499, 7501, 7503,
7505, 7507, 7509, 7511, 7513, tidic 7515, 7517, 7519, 7521, 7523,
7525, 7527, 7529, 7531, 7533, 7535, 7537, 7539, 7541, 7543, 7545,
7547, 7549, 7551, 7553, 7555, 7557, 7559, 7561, 7563, 7565, 7567,
7569, 7571, 7573, 7575, 7577, 7579, 7581, 7583 1 43 LT_OEX_1
SLL1545 Synechocystis 7592 Cyto- 7594, 7596, 7598, 7600, 7602,
7604, 7606, 7608, 7610, 7612, plasmic 7614, 7616, 7618, 7620, 7622,
7624, 7626, 7628, 7630, 7632, 7634, 7636, 7638, 7640, 7642, 7644,
7646, 7648, 7650, 7652, 7654, 7656, 7658, 7660, 7662, 7664, 7666 1
44 LT_OEX_1 SLR1348 Synechocystis 7671 Mito- 7673, 7675, 7677,
7679, 7681, 7683, 7685, 7687, 7689, 7691, chon- 7693, 7695, 7697,
7699, 7701, 7703, 7705, 7707, 7709, 7711, dric 7713, 7715, 7717,
7719, 7721, 7723, 7725, 7727, 7729, 7731, 7733, 7735, 7737, 7739,
7741, 7743, 7745, 7747, 7749, 7751, 7753, 7755, 7757, 7759, 7761,
7763, 7765, 7767, 7769, 7771, 7773, 7775, 7777, 7779, 7781, 7783,
7785, 7787, 7789, 7791, 7793, 7795, 7797, 7799, 7801, 7803, 7805,
7807, 7809, 7811, 7813, 7815, 7817, 7819, 7821, 7823, 7825, 7827,
7829, 7831, 7833, 7835, 7837, 7839, 7841, 7843, 7845, 7847, 7849,
7851, 7853, 7855, 7857, 7859, 7861, 7863, 7865, 7867, 7869, 7871,
7873, 7875, 7877, 7879, 7881, 7883, 7885, 7887, 7889, 7891, 7893,
7895, 7897, 7899, 7901, 7903, 7905, 7907, 7909, 7911, 7913, 7915,
7917, 7919, 7921, 7923, 7925, 7927, 7929, 7931, 7933, 7935, 7937,
7939, 7941, 7943, 7945, 7947, 7949, 7951, 7953, 7955, 7957, 7959,
7961, 7963, 7965, 7967, 7969, 7971, 7973, 7975, 7977, 7979, 7981,
7983, 7985, 7987, 7989, 7991, 7993, 7995, 7997, 7999, 8001, 8003,
8005, 8007, 8009, 8011, 8013, 8015, 8017, 8019, 8021, 8023, 8025,
8027, 8029, 8031, 8033, 8035, 8037, 8039, 8041, 8043, 8045, 8047,
8049, 8051, 8053, 8055, 8057, 8059, 8061, 8063, 8065, 8067, 8069,
8071, 8073, 8075, 8077, 8079, 8081, 8083, 8085, 8087, 8089, 8091,
8093, 8095, 8097, 8099, 8101, 8103, 8105, 8107, 8109, 8111, 8113,
8115, 8117, 8119, 8121, 8123, 8125, 8127, 8129, 8131, 8133, 8135,
8137, 8139, 8141, 8143, 8145, 8147, 8149, 8151, 8153, 8155, 8157,
8159, 8161, 8163, 8165, 8167, 8169, 8171, 8173, 8175, 8177, 8179,
8181, 8183, 8185, 8187, 8189, 8191, 8193, 8195, 8197, 8199, 8201,
8203, 8205, 8207, 8209, 8211, 8213, 8215, 8217, 8219, 8221, 8223 1
45 LT_OEX_1 YGR191W S. cerevisiae 8237 Plas- 8239, 8241, 8243,
8245, 8247, 8249, 8251, 8253, 8255, 8257, tidic 8259, 8261, 8263,
8265, 8267, 8269, 8271, 8273, 8275, 8277, 8279, 8281, 8283, 8285,
8287, 8289, 8291, 8293, 8295, 8297, 8299, 8301, 8303, 8305, 8307,
8309, 8311, 8313, 8315, 8317, 8319, 8321, 8323, 8325, 8327, 8329,
8331, 8333, 8335, 8337, 8339, 8341, 8343, 8345, 8347, 8349, 8351,
8353, 8355, 8357, 8359, 8361, 8363, 8365, 8367, 8369, 8371, 8373,
8375, 8377, 8379, 8381, 8383, 8385, 8387, 8389, 8391, 8393, 8395,
8397, 8399, 8401, 8403, 8405, 8407, 8409, 8411, 8413, 8415, 8417,
8419, 8421, 8423, 8425, 8427, 8429, 8431, 8433, 8435, 8437, 8439,
8441, 8443, 8445, 8447, 8449, 8451, 8453, 8455, 8457, 8459, 8461,
8463, 8465, 8467, 8469, 8471, 8473, 8475, 8477, 8479, 8481, 8483,
8485, 8487, 8489, 8491, 8493, 8495, 8497, 8499, 8501, 8503, 8505,
8507, 8509, 8511, 8513, 8515, 8517, 8519, 8521, 8523, 8525, 8527,
8529, 8531, 8533, 8535, 8537, 8539, 8541, 8543, 8545, 8547, 8549,
8551, 8553, 8555, 8557 1 46 LT_OEX_1 AT1G22920 A. thaliana 8564
Cyto- 8566, 8568, 8570, 8572, 8574, 8576, 8578, 8580, 8582, 8584,
plasmic 8586, 8588, 8590, 8592, 8594, 8596, 8598, 8600, 8602, 8604,
8606, 8608, 8610, 8612, 8614, 8616, 8618, 8620, 8622, 8624,
8626, 8628, 8630, 8632, 8634, 8636 1 47 LT_OEX_1 B1600 E. coli 8649
Plas- 8651, 8653, 8655, 8657, 8659, 8661, 8663, 8665, 8667, 8669,
tidic 8671, 8673, 8675, 8677, 8679, 8681, 8683, 8685, 8687, 8689,
8691, 8693, 8695, 8697, 8699, 8701, 8703, 8705, 8707, 8709, 8711,
8713, 8715, 8717, 8719, 8721, 8723, 8725, 8727, 8729, 8731, 8733,
8735, 8737, 8739, 8741, 8743, 8745, 8747, 8749, 8751, 8753, 8755 1
48 LT_OEX_1 B1900 E. coli 8761 Plas- 8763, 8765, 8767, 8769, 8771,
8773, 8775, 8777, 8779, 8781, tidic 8783, 8785, 8787, 8789, 8791,
8793, 8795, 8797, 8799, 8801, 8803, 8805, 8807, 8809, 8811, 8813,
8815, 8817, 8819, 8821, 8823, 8825, 8827, 8829, 8831, 8833, 8835,
8837, 8839, 8841, 8843, 8845, 8847, 8849 1 49 LT_OEX_1 SLL0099
Synechocystis 8862 Cyto- 8864, 8866, 8868, 8870, 8872, 8874, 8876,
8878, 8880, 8882, plasmic 8884, 8886, 8888, 8890, 8892, 8894, 8896,
8898, 8900, 8902, 8904, 8906, 8908, 8910, 8912, 8914, 8916, 8918,
8920, 8922, 8924, 8926, 8928, 8930, 8932, 8934, 8936, 8938, 8940,
8942, 8944, 8946, 8948, 8950, 8952, 8954, 8956, 8958, 8960, 8962,
8964, 8966, 8968, 8970, 8972, 8974, 8976, 8978, 8980, 8982, 8984,
8986, 8988, 8990, 8992, 8994, 8996, 8998, 9000, 9002, 9004, 9006,
9008, 9010, 9012, 9014, 9016, 9018, 9020, 9022, 9024, 9026, 9028,
9030, 9032, 9034, 9036, 9038, 9040 1 50 LT_OEX_1 SLL0383
Synechocystis 9047 Cyto- 9049, 9051, 9053, 9055, 9057, 9059, 9061,
9063, 9065, 9067, plasmic 9069, 9071, 9073, 9075, 9077, 9079, 9081,
9083, 9085, 9087, 9089, 9091, 9093, 9095, 9097, 9099, 9101, 9103,
9105, 9107, 9109, 9111, 9113, 9115, 9117, 9119, 9121, 9123, 9125,
9127, 9129, 9131, 9133, 9135, 9137, 9139, 9141, 9143, 9145, 9147,
9149, 9151, 9153, 9155, 9157, 9159, 9161, 9163, 9165, 9167, 9169,
9171, 9173, 9175, 9177, 9179, 9181, 9183, 9185, 9187, 9189, 9191,
9193, 9195, 9197, 9199, 9201, 9203, 9205, 9207, 9209, 9211, 9213,
9215, 9217, 9219, 9221, 9223, 9225, 9227, 9229, 9231, 9233, 9235,
9237, 9239, 9241, 9243, 9245, 9247, 9249, 9251, 9253, 9255, 9257,
9259, 9261, 9263, 9265, 9267, 9269, 9271, 9273, 9275 1 51 LT_OEX_1
SLR1094 Synechocystis 9281 Cyto- 9283, 9285, 9287, 9289, 9291,
9293, 9295, 9297, 9299 plasmic 1 52 LT_OEX_1 SLR1520 Synechocystis
9308 Cyto- 9310, 9312, 9314, 9316, 9318, 9320, 9322, 9324, 9326,
9328, plasmic 9330, 9332, 9334, 9336, 9338, 9340, 9342, 9344, 9346,
9348, 9350, 9352, 9354, 9356, 9358, 9360, 9362, 9364, 9366, 9368,
9370, 9372, 9374, 9376, 9378, 9380, 9382, 9384, 9386, 9388, 9390,
9392, 9394, 9396, 9398, 9400, 9402, 9404, 9406, 9408, 9410, 9412,
9414, 9416, 9418, 9420, 9422, 9424 1 53 LT_OEX_1 YDL142C S.
cerevisiae 9431 Cyto- 9433, 9435, 9437, 9439, 9441, 9443, 9445,
9447, 9449, 9451, plasmic 9453, 9455, 9457, 9459, 9461, 9463, 9465,
9467, 9469, 9471, 9473 1 54 LT_OEX_1 YDR147W S. cerevisiae 9480
Cyto- 9482, 9484, 9486 plasmic 1 55 LT_OEX_1 YLR284C S. cerevisiae
9501 Plas- 9503, 9505, 9507, 9509, 9511, 9513, 9515, 9517, 9519,
9521, tidic 9523, 9525, 9527, 9529, 9531, 9533, 9535, 9537, 9539,
9541, 9543, 9545, 9547 1 56 LT_OEX_1 YPL148C S. cerevisiae 9554
Plas- 9556, 9558, 9560, 9562, 9564, 9566 tidic 1 57 LT_OEX_1
YPR074C S. cerevisiae 9575 Plas- 9577, 9579, 9581, 9583, 9585,
9587, 9589, 9591, 9593, 9595, tidic 9597, 9599, 9601, 9603, 9605,
9607, 9609, 9611, 9613, 9615, 9617, 9619, 9621, 9623, 9625, 9627,
9629, 9631, 9633, 9635, 9637, 9639, 9641, 9643, 9645, 9647, 9649,
9651, 9653, 9655, 9657, 9659, 9661, 9663, 9665, 9667, 9669, 9671,
9673, 9675, 9677, 9679, 9681, 9683, 9685, 9687, 9689, 9691, 9693,
9695, 9697, 9699, 9701, 9703, 9705, 9707, 9709, 9711, 9713, 9715,
9717, 9719, 9721, 9723, 9725, 9727, 9729, 9731, 9733, 9735, 9737,
9739, 9741, 9743, 9745, 9747, 9749, 9751, 9753, 9755, 9757, 9759,
9761, 9763, 9765, 9767, 9769, 9771, 9773, 9775, 9777, 9779, 9781,
9783, 9785, 9787, 9789, 9791, 9793, 9795, 9797, 9799, 9801, 9803,
9805, 9807, 9809, 9811, 9813, 9815, 9817, 9819, 9821, 9823, 9825,
9827, 9829, 9831, 9833, 9835, 9837, 9839, 9841, 9843, 9845, 9847,
9849, 9851, 9853, 9855, 9857, 9859, 9861, 9863, 9865, 9867, 9869,
9871, 9873, 9875, 9877, 9879, 9881, 9883, 9885, 9887, 9889, 9891,
9893, 9895, 9897, 9899, 9901, 9903, 9905, 9907, 9909, 9911, 9913,
9915, 9917, 9919, 9921, 9923, 9925, 9927, 9929, 9931, 9933, 9935,
9937, 9939, 9941, 9943, 9945, 9947, 9949, 9951, 9953, 9955, 9957,
9959, 9961, 9963, 9965, 9967, 9969, 9971, 9973, 9975, 9977, 9979,
9981, 9983, 9985, 9987, 9989, 9991, 9993, 9995, 9997, 9999, 10001,
10003, 10005, 10007, 10009, 10011, 10013, 10015, 10017, 10019,
10021, 10023, 10025, 10027, 10029, 10031, 10033, 10035, 10037,
10039, 10041, 10043, 10045, 10047, 10049, 10051, 10053, 10055,
10057, 10059, 10061, 10063, 10065, 10067, 10069, 10071, 10073,
10075, 10077, 10079, 10081, 10083, 10085, 10087, 10089, 10091,
10093, 10095, 10097, 10099, 10101, 10103, 10105, 10107, 10109,
10111, 10113, 10115, 10117, 10119, 10121, 10123, 10125, 10127,
10129, 10131, 10133, 10135, 10137, 10139, 10141, 10143, 10145,
10147, 10149, 10151, 10153, 10155, 10157, 10159, 10161, 10163,
10165, 10167, 10169, 10171, 10173, 10175, 10177, 10179, 10181,
10183, 10185, 10187, 10189, 10191, 10193, 10195, 10197, 10199,
10201, 10203, 10205, 10207, 10209, 10211, 10213, 10215, 10217,
10219, 10221, 10223, 10225, 10227, 10229, 10231, 10233, 10235,
10237, 10239, 10241, 10243, 10245, 10247, 10249, 10251, 10253,
10255, 10257, 10259, 10261, 10263, 10265, 10267, 10269, 10271,
10273, 10275, 10277, 10279, 10281, 10283, 10285, 10287, 10289,
10291, 10293, 10295, 10297, 10299, 10301, 10303, 10305, 10307,
10309, 10311, 10313, 10315, 10317, 10319, 10321, 10323, 10325,
10327, 10329, 10331, 10333, 10335, 10337, 10339, 10341, 10343,
10345, 10347, 10349, 10351, 10353, 10355, 10357, 10359, 10361,
10363, 10365, 10367, 10369, 10371, 10373, 10375, 10377, 10379,
10381, 10383, 10385, 10387, 10389 1 58 LT_OEX_1 B1008 E. coli 10405
Plas- 10407, 10409, 10411, 10413, 10415, 10417, 10419, 10421, tidic
10423, 10425, 10427, 10429, 10431, 10433, 10435, 10437, 10439,
10441, 10443, 10445, 10447, 10449, 10451, 10453, 10455, 10457,
10459, 10461, 10463, 10465, 10467, 10469, 10471, 10473, 10475,
10477, 10479, 10481, 10483, 10485, 10487, 10489, 10491, 10493,
10495 1 59 LT_OEX_1 B1529 E. coli 10504 Plas- 10506, 10508, 10510,
10512, 10514, 10516, 10518, 10520, tidic 10522, 10524, 10526,
10528, 10530, 10532, 10534, 10536, 10538, 10540, 10542, 10544,
10546, 10548, 10550, 10552, 10554, 10556, 10558, 10560, 10562,
10564, 10566, 10568, 10570, 10572, 10574, 10576, 10578, 10580,
10582, 10584 1 60 LT_OEX_1 B3347 E. coli 10592 Plas- 10594, 10596,
10598, 10600, 10602, 10604, 10606, 10608, tidic 10610, 10612,
10614, 10616, 10618, 10620, 10622, 10624, 10626, 10628, 10630,
10632, 10634, 10636, 10638, 10640, 10642, 10644, 10646, 10648,
10650, 10652, 10654, 10656, 10658, 10660, 10662, 10664, 10666,
10668, 10670, 10672, 10674, 10676, 10678, 10680, 10682, 10684,
10686, 10688, 10690, 10692, 10694, 10696, 10698, 10700, 10702,
10704, 10706, 10708, 10710, 10712, 10714, 10716, 10718, 10720,
10722, 10724, 10726, 10728, 10730, 10732, 10734, 10736, 10738,
10740, 10742, 10744, 10746, 10748, 10750, 10752, 10754, 10756,
10758, 10760, 10762, 10764, 10766, 10768, 10770, 10772, 10774,
10776, 10778, 10780, 10782, 10784, 10786, 10788, 10790, 10792,
10794, 10796, 10798, 10800, 10802, 10804, 10806, 10808, 10810,
10812, 10814, 10816, 10818, 10820, 10822, 10824, 10826, 10828,
10830, 10832, 10834, 10836, 10838, 10840, 10842, 10844, 10846,
10848, 10850, 10852, 10854, 10856, 10858, 10860, 10862, 10864,
10866, 10868, 10870, 10872, 10874, 10876, 10878, 10880, 10882,
10884, 10886, 10888, 10890, 10892, 10894, 10896, 10898, 10900,
10902, 10904, 10906, 10908, 10910, 10912, 10914, 10916, 10918,
10920, 10922, 10924, 10926, 10928 1 61 LT_OEX_1 YBR176W S.
cerevisiae 10935 Cyto- 10937, 10939, 10941, 10943, 10945, 10947,
10949, 10951, plasmic 10953, 10955, 10957, 10959, 10961, 10963,
10965, 10967, 10969, 10971, 10973, 10975, 10977, 10979, 10981,
10983, 10985, 10987, 10989, 10991, 10993, 10995, 10997, 10999,
11001, 11003, 11005, 11007, 11009, 11011, 11013, 11015, 11017,
11019, 11021, 11023, 11025, 11027, 11029, 11031, 11033, 11035,
11037, 11039, 11041, 11043, 11045, 11047, 11049, 11051, 11053,
11055, 11057, 11059, 11061, 11063, 11065, 11067, 11069, 11071,
11073, 11075, 11077, 11079, 11081, 11083, 11085, 11087, 11089,
11091, 11093, 11095, 11097, 11099, 11101, 11103, 11105, 11107,
11109, 11111, 11113, 11115, 11117, 11119, 11121, 11123, 11125,
11127, 11129, 11131, 11133, 11135, 11137, 11139, 11141, 11143,
11145, 11147, 11149, 11151, 11153, 11155, 11157, 11159, 11161,
11163, 11165, 11167, 11169, 11171, 11173, 11175, 11177, 11179,
11181, 11183, 11185, 11187, 11189, 11191, 11193, 11195, 11197,
11199, 11201, 11203, 11205, 11207, 11209, 11211, 11213, 11215,
11217, 11219, 11221, 11223, 11225, 11227, 11229, 11231, 11233,
11235, 11237, 11239, 11241, 11243, 11245, 11247, 11249, 11251,
11253, 11255, 11257, 11259, 11261, 11263, 11265, 11267, 11269,
11271, 11273, 11275, 11277, 11279, 11281, 11283, 11285, 11287,
11289, 11291, 11293, 11295, 11297, 11299, 11301, 11303, 11305,
11307, 11309, 11311, 11313, 11315, 11317, 11319, 11321, 11323,
11325, 11327, 11329, 11331, 11333, 11335, 11337, 11339, 11341,
11343, 11345, 11347, 11349, 11351, 11353, 11355, 11357, 11359,
11361, 11363, 11365, 11367, 11369, 11371, 11373, 11375, 11377,
11379, 11381, 11383, 11385, 11387, 11389, 11391, 11393, 11395,
11397, 11399, 11401, 11403, 11405, 11407, 11409, 11411, 11413,
11415, 11417, 11419, 11421, 11423, 11425, 11427, 11429, 11431,
11433, 11435, 11437, 11439, 11441, 11443, 11445, 11447, 11449,
11451, 11453 1 62 LT_OEX_1 YGR177C S. cerevisiae 11462 Cyto- 11464,
11466, 11468, 11470, 11472, 11474, 11476, 11478, plasmic 11480,
11482, 11484, 11486 1 63 LT_OEX_1 YHR176W S. cerevisiae 11502 Cyto-
11504, 11506, 11508, 11510, 11512, 11514, 11516, 11518, plasmic
11520, 11522, 11524, 11526, 11528, 11530, 11532, 11534, 11536,
11538, 11540, 11542, 11544, 11546, 11548 1 64 LT_OEX_1 B2881_2 E.
coli 11565 Cyto- 11567, 11569, 11571, 11573, 11575, 11577, 11579,
11581, plasmic 11583, 11585, 11587, 11589, 11591, 11593, 11595,
11597, 11599, 11601, 11603, 11605, 11607, 11609, 11611, 11613,
11615, 11617, 11619, 11621, 11623, 11625, 11627, 11629, 11631,
11633, 11635, 11637, 11639, 11641, 11643, 11645, 11647, 11649,
11651, 11653, 11655, 11657, 11659, 11661, 11663, 11665, 11667,
11669, 11671, 11673, 11675, 11677, 11679, 11681, 11683, 11685 1 65
LT_OEX_1 B3945_2 E. coli 11696 Cyto- 11698, 11700, 11702, 11704,
11706, 11708, 11710, 11712, plasmic 11714, 11716, 11718, 11720,
11722, 11724, 11726, 11728, 11730, 11732, 11734, 11736, 11738,
11740, 11742, 11744, 11746, 11748, 11750, 11752, 11754, 11756,
11758, 11760, 11762, 11764, 11766, 11768, 11770, 11772, 11774,
11776, 11778, 11780, 11782, 11784, 11786, 11788, 11790, 11792,
11794, 11796, 11798, 11800, 11802, 11804, 11806, 11808, 11810,
11812, 11814, 11816, 11818, 11820, 11822, 11824, 11826, 11828,
11830, 11832, 11834, 11836, 11838, 11840, 11842, 11844, 11846,
11848, 11850, 11852, 11854, 11856, 11858, 11860, 11862, 11864,
11866, 11868, 11870, 11872, 11874, 11876, 11878, 11880, 11882,
11884, 11886, 11888, 11890, 11892, 11894, 11896, 11898 1 66
LT_OEX_1 YHR204W_2 S. cerevisiae 11908 Cyto- 11910, 11912, 11914,
11916, 11918, 11920, 11922, 11924, plasmic 11926, 11928, 11930,
11932 1 67 LT_OEX_1 YNL142W_2 S. cerevisiae 11945 Cyto- 11947,
11949, 11951, 11953, 11955, 11957, 11959, 11961, plasmic 11963,
11965, 11967, 11969, 11971, 11973, 11975, 11977, 11979, 11981,
11983, 11985, 11987, 11989, 11991, 11993, 11995, 11997, 11999,
12001, 12003, 12005, 12007, 12009, 12011, 12013, 12015, 12017,
12019, 12021, 12023, 12025, 12027, 12029, 12031, 12033, 12035,
12037, 12039, 12041, 12043, 12045, 12047, 12049, 12051, 12053,
12055, 12057, 12059, 12061, 12063, 12065, 12067, 12069, 12071,
12073, 12075, 12077, 12079, 12081, 12083, 12085, 12087, 12089,
12091, 12093, 12095, 12097, 12099, 12101, 12103, 12105, 12107,
12109, 12111, 12113, 12115, 12117, 12119, 12121, 12123, 12125,
12127, 12129, 12131, 12133, 12135, 12137, 12139, 12141, 12143,
12145, 12147, 12149, 12151, 12153, 12155, 12157, 12159, 12161,
12163, 12165, 12167, 12169, 12171, 12173, 12175, 12177, 12179,
12181, 12183, 12185, 12187, 12189, 12191, 12193, 12195, 12197,
12199, 12201, 12203, 12205, 12207, 12209, 12211, 12213, 12215,
12217, 12219, 12221, 12223, 12225, 12227, 12229, 12231, 12233,
12235, 12237, 12239, 12241, 12243, 12245, 12247, 12249, 12251,
12253, 12255, 12257, 12259, 12261, 12263, 12265, 12267, 12269,
12271, 12273, 12275, 12277, 12279, 12281, 12283, 12285, 12287,
12289, 12291, 12293, 12295, 12297, 12299, 12301, 12303, 12305,
12307, 12309, 12311, 12313, 12315, 12317, 12319, 12321, 12323,
12325, 12327, 12329, 12331, 12333, 12335, 12337, 12339, 12341,
12343, 12345, 12347 1 68a LT_OEX_1 YOL058W_2 S. cerevisiae 12358
Plas- 12360, 12362, 12364, 12366, 12368, 12370, 12372, 12374, tidic
12376, 12378, 12380, 12382, 12384, 12386, 12388, 12390, 12392,
12394, 12396, 12398, 12400, 12402, 12404, 12406, 12408, 12410,
12412, 12414, 12416, 12418, 12420, 12422, 12424, 12426, 12428,
12430, 12432, 12434, 12436, 12438, 12440, 12442, 12444, 12446,
12448, 12450, 12452, 12454, 12456, 12458, 12460, 12462, 12464,
12466, 12468, 12470, 12472, 12474, 12476, 12478, 12480, 12482,
12484, 12486, 12488, 12490, 12492, 12494, 12496, 12498, 12500,
12502, 12504, 12506, 12508, 12510, 12512, 12514, 12516, 12518,
12520, 12522, 12524, 12526, 12528, 12530, 12532, 12534, 12536,
12538, 12540, 12542, 12544, 12546, 12548, 12550, 12552, 12554,
12556, 12558, 12560, 12562, 12564, 12566, 12568, 12570, 12572,
12574, 12576, 12578, 12580, 12582,
12584, 12586, 12588, 12590, 12592, 12594, 12596, 12598, 12600,
12602, 12604, 12606, 12608, 12610, 12612, 12614, 12616, 12618,
12620, 12622, 12624, 12626, 12628, 12630, 12632, 12634, 12636,
12638, 12640, 12642, 12644, 12646, 12648, 12650, 12652, 12654,
12656, 12658, 12660, 12662, 12664, 12666, 12668, 12670, 12672,
12674, 12676, 12678, 12680, 12682, 12684, 12686, 12688, 12690,
12692, 12694, 12696, 12698, 12700, 12702, 12704, 12706, 12708,
12710, 12712, 12714, 12716, 12718, 12720, 12722, 12724, 12726,
12728, 12730, 12732, 12734, 12736, 12738, 12740, 12742, 12744,
12746, 12748, 12750, 12752, 12754, 12756, 12758, 12760, 12762,
12764, 12766, 12768, 12770, 12772, 12774, 12776, 12778, 12780,
12782, 12784, 12786, 12788, 12790, 12792, 12794, 12796, 12798,
12800, 12802, 12804, 12806, 12808, 12810, 12812, 12814, 12816,
12818, 12820, 12822, 12824, 12826, 12828, 12830, 12832, 12834,
12836, 12838, 12840, 12842, 12844, 12846, 12848, 12850, 12852,
12854, 12856, 12858, 12860, 12862, 12864, 12866, 12868, 12870,
12872, 12874, 12876, 12878, 12880, 12882, 12884, 12886, 12888,
12890, 12892, 12894, 12896, 12898, 12900, 12902, 12904, 12906,
12908, 12910, 12912, 12914, 12916, 12918, 12920, 12922, 12924 1 68b
LT_OEX_1 YOL058W_2 S. cerevisiae 12358 Cyto- 12360, 12362, 12364,
12366, 12368, 12370, 12372, 12374, plasmic 12376, 12378, 12380,
12382, 12384, 12386, 12388, 12390, 12392, 12394, 12396, 12398,
12400, 12402, 12404, 12406, 12408, 12410, 12412, 12414, 12416,
12418, 12420, 12422, 12424, 12426, 12428, 12430, 12432, 12434,
12436, 12438, 12440, 12442, 12444, 12446, 12448, 12450, 12452,
12454, 12456, 12458, 12460, 12462, 12464, 12466, 12468, 12470,
12472, 12474, 12476, 12478, 12480, 12482, 12484, 12486, 12488,
12490, 12492, 12494, 12496, 12498, 12500, 12502, 12504, 12506,
12508, 12510, 12512, 12514, 12516, 12518, 12520, 12522, 12524,
12526, 12528, 12530, 12532, 12534, 12536, 12538, 12540, 12542,
12544, 12546, 12548, 12550, 12552, 12554, 12556, 12558, 12560,
12562, 12564, 12566, 12568, 12570, 12572, 12574, 12576, 12578,
12580, 12582, 12584, 12586, 12588, 12590, 12592, 12594, 12596,
12598, 12600, 12602, 12604, 12606, 12608, 12610, 12612, 12614,
12616, 12618, 12620, 12622, 12624, 12626, 12628, 12630, 12632,
12634, 12636, 12638, 12640, 12642, 12644, 12646, 12648, 12650,
12652, 12654, 12656, 12658, 12660, 12662, 12664, 12666, 12668,
12670, 12672, 12674, 12676, 12678, 12680, 12682, 12684, 12686,
12688, 12690, 12692, 12694, 12696, 12698, 12700, 12702, 12704,
12706, 12708, 12710, 12712, 12714, 12716, 12718, 12720, 12722,
12724, 12726, 12728, 12730, 12732, 12734, 12736, 12738, 12740,
12742, 12744, 12746, 12748, 12750, 12752, 12754, 12756, 12758,
12760, 12762, 12764, 12766, 12768, 12770, 12772, 12774, 12776,
12778, 12780, 12782, 12784, 12786, 12788, 12790, 12792, 12794,
12796, 12798, 12800, 12802, 12804, 12806, 12808, 12810, 12812,
12814, 12816, 12818, 12820, 12822, 12824, 12826, 12828, 12830,
12832, 12834, 12836, 12838, 12840, 12842, 12844, 12846, 12848,
12850, 12852, 12854, 12856, 12858, 12860, 12862, 12864, 12866,
12868, 12870, 12872, 12874, 12876, 12878, 12880, 12882, 12884,
12886, 12888, 12890, 12892, 12894, 12896, 12898, 12900, 12902,
12904, 12906, 12908, 12910, 12912, 12914, 12916, 12918, 12920,
12922, 12924 1 69 LT_OEX_1 YPR035W_2 S. cerevisiae 12937 Cyto-
12939, 12941, 12943, 12945, 12947, 12949, 12951, 12953, plasmic
12955, 12957, 12959, 12961, 12963, 12965, 12967, 12969, 12971,
12973, 12975, 12977, 12979, 12981, 12983, 12985, 12987, 12989,
12991, 12993, 12995, 12997, 12999, 13001, 13003, 13005, 13007,
13009, 13011, 13013, 13015, 13017, 13019, 13021, 13023, 13025,
13027, 13029, 13031, 13033, 13035, 13037, 13039, 13041, 13043,
13045, 13047, 13049, 13051, 13053, 13055, 13057, 13059, 13061,
13063, 13065, 13067, 13069, 13071, 13073, 13075, 13077, 13079,
13081, 13083, 13085, 13087, 13089, 13091, 13093, 13095, 13097,
13099, 13101, 13103, 13105, 13107, 13109, 13111, 13113, 13115,
13117, 13119, 13121, 13123, 13125, 13127, 13129, 13131, 13133,
13135, 13137, 13139, 13141, 13143, 13145, 13147, 13149, 13151,
13153, 13155, 13157, 13159, 13161, 13163, 13165, 13167, 13169,
13171, 13173, 13175, 13177, 13179, 13181, 13183, 13185, 13187,
13189, 13191, 13193, 13195, 13197, 13199, 13201, 13203
TABLE-US-00020 TABLE IIB Amino acid sequence ID numbers 5. Appli-
1. 2. 3. 4. Lead 6. 7. cation Hit Project Locus Organism SEQ ID
Target SEQ IDs of Polypeptide Homologs 1 1 LT_OEX_1 B0414 E. coli
39 Cytoplasmic -- 1 2 LT_OEX_1 B2931 E. coli 148 Cytoplasmic -- 1 3
LT_OEX_1 B3945 E. coli 173 Cytoplasmic -- 1 4 LT_OEX_1 YEL004W S.
cerevisiae 383 Cytoplasmic -- 1 5 LT_OEX_1 YER177W S. cerevisiae
407 Cytoplasmic 749, 751, 753, 755, 757, 759, 761, 763, 765, 767,
769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795, 797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819,
821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841, 843, 845,
847, 849, 851, 853, 855, 857, 859, 861, 863, 865, 867, 869, 871,
873, 875, 877, 879, 881, 883, 885, 887, 889, 891, 893, 895, 897,
899, 901, 903, 905, 907 1 6 LT_OEX_1 YHR204W S. cerevisiae 918
Cytoplasmic -- 1 7 LT_OEX_1 YLL053C S. cerevisiae 953 Cytoplasmic
1215, 1217, 1219, 1221, 1223, 1225, 1227, 1229, 1231, 1233, 1235,
1237, 1239, 1241, 1243, 1245, 1247, 1249, 1251, 1253, 1255, 1257,
1259, 1261, 1263, 1265, 1267, 1269, 1271, 1273, 1275, 1277, 1279,
1281, 1283, 1285, 1287, 1289, 1291, 1293, 1295, 1297, 1299, 1301,
1303, 1305, 1307, 1309, 1311, 1313, 1315, 13270, 13272, 13274 1 8
LT_OEX_1 YML123C S. cerevisiae 1321 Cytoplasmic 1617, 1619, 1621,
1623, 1625, 1627, 1629, 1631, 1633, 1635 1 9 LT_OEX_1 YNL142W S.
cerevisiae 1649 Cytoplasmic 2057 1 10 LT_OEX_1 YNR040W S.
cerevisiae 2066 Cytoplasmic -- 1 11 LT_OEX_1 YPR035W S. cerevisiae
2082 Cytoplasmic 2348, 2350, 2352, 2354, 2356, 2358, 2360, 2362,
2364, 2366, 2368, 2370, 2372, 2374, 2376, 2378, 2380, 2382, 2384,
2386, 2388, 2390, 2392, 2394 1 12a LT_OEX_1 B0903 E. coli 2407
Plastidic -- 1 12b LT_OEX_1 B0903 E. coli 2407 Cytoplasmic -- 1 13
LT_OEX_1 B1393 E. coli 2565 Cytoplasmic 2805, 2807, 2809, 2811,
2813, 2815, 2817, 2819, 2821, 2823, 2825, 2827, 2829, 2831, 2833,
2835 1 14 LT_OEX_1 B2704 E. coli 2842 Plastidic -- 1 15 LT_OEX_1
B2905 E. coli 2880 Cytoplasmic 3088, 3090, 3092, 3094, 3096, 3098,
3100 1 16 LT_OEX_1 B3206 E. coli 3110 Plastidic -- 1 17 LT_OEX_1
B3659 E. coli 3404 Cytoplasmic -- 1 18 LT_OEX_1 B3871 E. coli 3442
Cytoplasmic 3956, 3958, 3960, 3962, 3964 1 19 LT_OEX_1 YDR142C S.
cerevisiae 3979 Plastidic 4037, 13266 1 20 LT_OEX_1 YER175W-A S.
cerevisiae 4048 Cytoplasmic -- 1 21 LT_OEX_1 YGR289C S. cerevisiae
4052 Plastidic -- 1 22 LT_OEX_1 YHR044C S. cerevisiae 4132
Plastidic -- 1 23 LT_OEX_1 YHR072W S. cerevisiae 4218 Cytoplasmic
4462, 4464, 4466, 4468, 4470, 4472, 4474, 4476, 4478, 4480 1 24
LT_OEX_1 YHR213W-A S. cerevisiae 4492 Cytoplasmic -- 1 25 LT_OEX_1
YIL053W S. cerevisiae 4496 Cytoplasmic -- 1 26 LT_OEX_1 YJL103C S.
cerevisiae 4559 Plastidic -- 1 27 LT_OEX_1 YJL137C S. cerevisiae
4590 Plastidic -- 1 28 LT_OEX_1 YLR027C S. cerevisiae 4623
Cytoplasmic 5021, 5023, 5025, 5027, 5029, 5031, 5033, 5035, 5037,
5039, 5041, 5043, 5045, 5047, 5049, 5051, 5053, 5055, 5057, 5059,
5061 1 29a LT_OEX_1 YML079W S. cerevisiae 5071 Plastidic -- 1 29b
LT_OEX_1 YML079W S. cerevisiae 5071 Cytoplasmic -- 1 30 LT_OEX_1
YMR157C S. cerevisiae 5103 Plastidic -- 1 31 LT_OEX_1 YNL024C S.
cerevisiae 5116 Plastidic -- 1 32a LT_OEX_1 YOL058W S. cerevisiae
5160 Plastidic 5736, 5738, 5740 1 32b LT_OEX_1 YOL058W S.
cerevisiae 5160 Cytoplasmic 5736, 5738, 5740 1 33 LT_OEX_1 YPL180W
S. cerevisiae 5747 Cytoplasmic -- 1 34 LT_OEX_1 YPR167C S.
cerevisiae 5757 Plastidic 6049 1 35 LT_OEX_1 B0036 E. coli 6087
Plastidic 6545, 6547, 6549, 6551, 6553, 6555, 6557, 6559, 6561,
6563, 6565, 6567, 6569, 6571, 6573, 6575 1 36 LT_OEX_1 B1906 E.
coli 6582 Cytoplasmic -- 1 37 LT_OEX_1 B2371 E. coli 6610
Cytoplasmic -- 1 38 LT_OEX_1 B2881 E. coli 6950 Cytoplasmic 7070,
7072 1 39 LT_OEX_1 B3106 E. coli 7079 Cytoplasmic -- 1 40 LT_OEX_1
B3400 E. coli 7271 Plastidic -- 1 41 LT_OEX_1 B3410 E. coli 7468
Cytoplasmic -- 1 42 LT_OEX_1 B4209 E. coli 7493 Plastidic -- 1 43
LT_OEX_1 SLL1545 Synechocystis 7592 Cytoplasmic -- 1 44 LT_OEX_1
SLR1348 Synechocystis 7671 Mitochondric 8225, 8227, 8229 1 45
LT_OEX_1 YGR191W S. cerevisiae 8237 Plastidic -- 1 46 LT_OEX_1
AT1G22920 A. thaliana 8564 Cytoplasmic 8638 1 47 LT_OEX_1 B1600 E.
coli 8649 Plastidic -- 1 48 LT_OEX_1 B1900 E. coli 8761 Plastidic
-- 1 49 LT_OEX_1 SLL0099 Synechocystis 8862 Cytoplasmic -- 1 50
LT_OEX_1 SLL0383 Synechocystis 9047 Cytoplasmic -- 1 51 LT_OEX_1
SLR1094 Synechocystis 9281 Cytoplasmic -- 1 52 LT_OEX_1 SLR1520
Synechocystis 9308 Cytoplasmic -- 1 53 LT_OEX_1 YDL142C S.
cerevisiae 9431 Cytoplasmic -- 1 54 LT_OEX_1 YDR147W S. cerevisiae
9480 Cytoplasmic -- 1 55 LT_OEX_1 YLR284C S. cerevisiae 9501
Plastidic -- 1 56 LT_OEX_1 YPL148C S. cerevisiae 9554 Plastidic --
1 57 LT_OEX_1 YPR074C S. cerevisiae 9575 Plastidic 10391, 10393 1
58 LT_OEX_1 B1008 E. coli 10405 Plastidic -- 1 59 LT_OEX_1 B1529 E.
coli 10504 Plastidic -- 1 60 LT_OEX_1 B3347 E. coli 10592 Plastidic
-- 1 61 LT_OEX_1 YBR176W S. cerevisiae 10935 Cytoplasmic 11455 1 62
LT_OEX_1 YGR177C S. cerevisiae 11462 Cytoplasmic -- 1 63 LT_OEX_1
YHR176W S. cerevisiae 11502 Cytoplasmic 11550, 11552, 11554, 11556,
11558 1 64 LT_OEX_1 B2881_2 E. coli 11565 Cytoplasmic 11687, 11689
1 65 LT_OEX_1 B3945_2 E. coli 11696 Cytoplasmic -- 1 66 LT_OEX_1
YHR204W_2 S. cerevisiae 11908 Cytoplasmic -- 1 67 LT_OEX_1
YNL142W_2 S. cerevisiae 11945 Cytoplasmic 12349 1 68a LT_OEX_1
YOL058W 2 S. cerevisiae 12358 Plastidic 12926, 12928, 12930 1 68b
LT_OEX_1 YOL058W_2 S. cerevisiae 12358 Cytoplasmic 12926, 12928,
12930 1 69 LT_OEX_1 YPR035W_2 S. cerevisiae 12937 Cytoplasmic
13205, 13207, 13209, 13211, 13213, 13215, 13217, 13219, 13221,
13223, 13225, 13227, 13229, 13231, 13233, 13235, 13237, 13239,
13241, 13243, 13245, 13247, 13249, 13251
TABLE-US-00021 TABLE III Primer nucleic acid sequence ID numbers 5.
7. Appli- 1. 2. 3. 4. Lead 6. SEQ IDs cation Hit Project Locus
Organism SEQ ID Target of Primers 1 1 LT_OEX_1 B0414 E. coli 38
Cytoplasmic 136, 137 1 2 LT_OEX_1 B2931 E. coli 147 Cytoplasmic
165, 166 1 3 LT_OEX_1 B3945 E. coli 172 Cytoplasmic 374, 375 1 4
LT_OEX_1 YEL004W S. cerevisiae 382 Cytoplasmic 398, 399 1 5
LT_OEX_1 YER177W S. cerevisiae 406 Cytoplasmic 908, 909 1 6
LT_OEX_1 YHR204W S. cerevisiae 917 Cytoplasmic 941, 942 1 7
LT_OEX_1 YLL053C S. cerevisiae 952 Cytoplasmic 1316, 1317 1 8
LT_OEX_1 YML123C S. cerevisiae 1320 Cytoplasmic 1636, 1637 1 9
LT_OEX_1 YNL142W S. cerevisiae 1648 Cytoplasmic 2058, 2059 1 10
LT_OEX_1 YNR040W S. cerevisiae 2065 Cytoplasmic 2077, 2078 1 11
LT_OEX_1 YPR035W S. cerevisiae 2081 Cytoplasmic 2395, 2396 1 12a
LT_OEX_1 B0903 E. coli 2406 Plastidic 2546, 2547 1 12b LT_OEX_1
B0903 E. coli 2406 Cytoplasmic 2546, 2547 1 13 LT_OEX_1 B1393 E.
coli 2564 Cytoplasmic 2836, 2837 1 14 LT_OEX_1 B2704 E. coli 2841
Plastidic 2875, 2876 1 15 LT_OEX_1 B2905 E. coli 2879 Cytoplasmic
3101, 3102 1 16 LT_OEX_1 B3206 E. coli 3109 Plastidic 3399, 3400 1
17 LT_OEX_1 B3659 E. coli 3403 Cytoplasmic 3431, 3432 1 18 LT_OEX_1
B3871 E. coli 3441 Cytoplasmic 3965, 3966 1 19 LT_OEX_1 YDR142C S.
cerevisiae 3978 Plastidic 4038, 4039 1 20 LT_OEX_1 YER175W-A S.
cerevisiae 4047 Cytoplasmic 4049, 4050 1 21 LT_OEX_1 YGR289C S.
cerevisiae 4051 Plastidic 4121, 4122 1 22 LT_OEX_1 YHR044C S.
cerevisiae 4131 Plastidic 4211, 4212 1 23 LT_OEX_1 YHR072W S.
cerevisiae 4217 Cytoplasmic 4481, 4482 1 24 LT_OEX_1 YHR213W-A S.
cerevisiae 4491 Cytoplasmic 4493, 4494 1 25 LT_OEX_1 YIL053W S.
cerevisiae 4495 Cytoplasmic 4551, 4552 1 26 LT_OEX_1 YJL103C S.
cerevisiae 4558 Plastidic 4580, 4581 1 27 LT_OEX_1 YJL137C S.
cerevisiae 4589 Plastidic 4613, 4614 1 28 LT_OEX_1 YLR027C S.
cerevisiae 4622 Cytoplasmic 5062, 5063 1 29a LT_OEX_1 YML079W S.
cerevisiae 5070 Plastidic 5098, 5099 1 29b LT_OEX_1 YML079W S.
cerevisiae 5070 Cytoplasmic 5098, 5099 1 30 LT_OEX_1 YMR157C S.
cerevisiae 5102 Plastidic 5110, 5111 1 31 LT_OEX_1 YNL024C S.
cerevisiae 5115 Plastidic 5153, 5154 1 32a LT_OEX_1 YOL058W S.
cerevisiae 5159 Plastidic 5741, 5742 1 32b LT_OEX_1 YOL058W S.
cerevisiae 5159 Cytoplasmic 5741, 5742 1 33 LT_OEX_1 YPL180W S.
cerevisiae 5746 Cytoplasmic 5750, 5751 1 34 LT_OEX_1 YPR167C S.
cerevisiae 5756 Plastidic 6050, 6051 1 35 LT_OEX_1 B0036 E. coli
6086 Plastidic 6576, 6577 1 36 LT_OEX_1 B1906 E. coli 6581
Cytoplasmic 6605, 6606 1 37 LT_OEX_1 B2371 E. coli 6609 Cytoplasmic
6945, 6946 1 38 LT_OEX_1 B2881 E. coli 6949 Cytoplasmic 7073, 7074
1 39 LT_OEX_1 B3106 E. coli 7078 Cytoplasmic 7266, 7267 1 40
LT_OEX_1 B3400 E. coli 7270 Plastidic 7462, 7463 1 41 LT_OEX_1
B3410 E. coli 7467 Cytoplasmic 7487, 7488 1 42 LT_OEX_1 B4209 E.
coli 7492 Plastidic 7584, 7585 1 43 LT_OEX_1 SLL1545 Synechocystis
7591 Cytoplasmic 7667, 7668 1 44 LT_OEX_1 SLR1348 Synechocystis
7670 Mitochondric 8230, 8231 1 45 LT_OEX_1 YGR191W S. cerevisiae
8236 Plastidic 8558, 8559 1 46 LT_OEX_1 AT1G22920 A. thaliana 8563
Cytoplasmic 8639, 8640 1 47 LT_OEX_1 B1600 E. coli 8648 Plastidic
8756, 8757 1 48 LT_OEX_1 B1900 E. coli 8760 Plastidic 8850, 8851 1
49 LT_OEX_1 SLL0099 Synechocystis 8861 Cytoplasmic 9041, 9042 1 50
LT_OEX_1 SLL0383 Synechocystis 9046 Cytoplasmic 9276, 9277 1 51
LT_OEX_1 SLR1094 Synechocystis 9280 Cytoplasmic 9300, 9301 1 52
LT_OEX_1 SLR1520 Synechocystis 9307 Cytoplasmic 9425, 9426 1 53
LT_OEX_1 YDL142C S. cerevisiae 9430 Cytoplasmic 9474, 9475 1 54
LT_OEX_1 YDR147W S. cerevisiae 9479 Cytoplasmic 9487, 9488 1 55
LT_OEX_1 YLR284C S. cerevisiae 9500 Plastidic 9548, 9549 1 56
LT_OEX_1 YPL148C S. cerevisiae 9553 Plastidic 9567, 9568 1 57
LT_OEX_1 YPR074C S. cerevisiae 9574 Plastidic 10394, 10395 1 58
LT_OEX_1 B1008 E. coli 10404 Plastidic 10496, 10497 1 59 LT_OEX_1
B1529 E. coli 10503 Plastidic 10585, 10586 1 60 LT_OEX_1 B3347 E.
coli 10591 Plastidic 10929, 10930 1 61 LT_OEX_1 YBR176W S.
cerevisiae 10934 Cytoplasmic 11456, 11457 1 62 LT_OEX_1 YGR177C S.
cerevisiae 11461 Cytoplasmic 11487, 11488 1 63 LT_OEX_1 YHR176W S.
cerevisiae 11501 Cytoplasmic 11559, 11560 1 64 LT_OEX_1 B2881_2 E.
coli 11564 Cytoplasmic 11690, 11691 1 65 LT_OEX_1 B3945_2 E. coli
11695 Cytoplasmic 11899, 11900 1 66 LT_OEX_1 YHR204W_2 S.
cerevisiae 11907 Cytoplasmic 11933, 11934 1 67 LT_OEX_1 YNL142W_2
S. cerevisiae 11944 Cytoplasmic 12350, 12351 1 68a LT_OEX_1
YOL058W_2 S. cerevisiae 12357 Plastidic 12931, 12932 1 68b LT_OEX_1
YOL058W_2 S. cerevisiae 12357 Cytoplasmic 12931, 12932 1 69
LT_OEX_1 YPR035W_2 S. cerevisiae 12936 Cytoplasmic 13252, 13253
TABLE-US-00022 TABLE IV Consensus amino acid sequence ID numbers 5.
Appli- 1. 2. 3. 4. Lead 6. 7. cation Hit Project Locus Organism SEQ
ID Target SEQ IDs of Consensus/Pattern Sequences 1 1 LT_OEX_1 B0414
E. coli 39 Cytoplasmic 138, 139, 140, 141, 142, 143, 144, 145, 146
1 2 LT_OEX_1 B2931 E. coli 148 Cytoplasmic 167, 168, 169, 170, 171
1 3 LT_OEX_1 B3945 E. coli 173 Cytoplasmic 376, 377, 378, 379, 380,
381 1 4 LT_OEX_1 YEL004W S. cerevisiae 383 Cytoplasmic 400, 401,
402, 403, 404, 405 1 5 LT_OEX_1 YER177W S. cerevisiae 407
Cytoplasmic 910, 911, 912, 913, 914, 915, 916 1 6 LT_OEX_1 YHR204W
S. cerevisiae 918 Cytoplasmic 943, 944, 945, 946, 947, 948, 949,
950, 951 1 7 LT_OEX_1 YLL053C S. cerevisiae 953 Cytoplasmic 1318,
1319 1 8 LT_OEX_1 YML123C S. cerevisiae 1321 Cytoplasmic 1638,
1639, 1640, 1641, 1642, 1643, 1644, 1645, 1646, 1647 1 9 LT_OEX_1
YNL142W S. cerevisiae 1649 Cytoplasmic 2060, 2061, 2062, 2063, 2064
1 10 LT_OEX_1 YNR040W S. cerevisiae 2066 Cytoplasmic 2079, 2080 1
11 LT_OEX_1 YPR035W S. cerevisiae 2082 Cytoplasmic 2397, 2398,
2399, 2400, 2401, 2402, 2403, 2404, 2405 1 12a LT_OEX_1 B0903 E.
coli 2407 Plastidic 2548, 2549, 2550, 2551, 2552, 2553, 2554, 2555,
2556, 2557, 2558, 2559, 2560, 2561, 2562, 2563 1 12b LT_OEX_1 B0903
E. coli 2407 Cytoplasmic 2548, 2549, 2550, 2551, 2552, 2553, 2554,
2555, 2556, 2557, 2558, 2559, 2560, 2561, 2562, 2563 1 13 LT_OEX_1
B1393 E. coli 2565 Cytoplasmic 2838, 2839, 2840 1 14 LT_OEX_1 B2704
E. coli 2842 Plastidic 2877, 2878 1 15 LT_OEX_1 B2905 E. coli 2880
Cytoplasmic 3103, 3104, 3105, 3106, 3107, 3108 1 16 LT_OEX_1 B3206
E. coli 3110 Plastidic 3401, 3402 1 17 LT_OEX_1 B3659 E. coli 3404
Cytoplasmic 3433, 3434, 3435, 3436, 3437, 3438, 3439, 3440 1 18
LT_OEX_1 B3871 E. coli 3442 Cytoplasmic 3967, 3968, 3969, 3970,
3971, 3972, 3973, 3974, 3975, 3976, 3977 1 19 LT_OEX_1 YDR142C S.
cerevisiae 3979 Plastidic 4040, 4041, 4042, 4043, 4044, 4045, 4046
1 20 LT_OEX_1 YER175W- S. cerevisiae 4048 Cytoplasmic -- A 1 21
LT_OEX_1 YGR289C S. cerevisiae 4052 Plastidic 4123, 4124, 4125,
4126, 4127, 4128, 4129, 4130 1 22 LT_OEX_1 YHR044C S. cerevisiae
4132 Plastidic 4213, 4214, 4215, 4216 1 23 LT_OEX_1 YHR072W S.
cerevisiae 4218 Cytoplasmic 4483, 4484, 4485, 4486, 4487, 4488,
4489, 4490 1 24 LT_OEX_1 YHR213W- S. cerevisiae 4492 Cytoplasmic --
A 1 25 LT_OEX_1 YIL053W S. cerevisiae 4496 Cytoplasmic 4553, 4554,
4555, 4556, 4557 1 26 LT_OEX_1 YJL103C S. cerevisiae 4559 Plastidic
4582, 4583, 4584, 4585, 4586, 4587, 4588 1 27 LT_OEX_1 YJL137C S.
cerevisiae 4590 Plastidic 4615, 4616, 4617, 4618, 4619, 4620, 4621
1 28 LT_OEX_1 YLR027C S. cerevisiae 4623 Cytoplasmic 5064, 5065,
5066, 5067, 5068, 5069 1 29a LT_OEX_1 YML079W S. cerevisiae 5071
Plastidic 5100, 5101 1 29b LT_OEX_1 YML079W S. cerevisiae 5071
Cytoplasmic 5100, 5101 1 30 LT_OEX_1 YMR157C S. cerevisiae 5103
Plastidic 5112, 5113, 5114 1 31 LT_OEX_1 YNL024C S. cerevisiae 5116
Plastidic 5155, 5156, 5157, 5158 1 32a LT_OEX_1 YOL058W S.
cerevisiae 5160 Plastidic 5743, 5744, 5745 1 32b LT_OEX_1 YOL058W
S. cerevisiae 5160 Cytoplasmic 5743, 5744, 5745 1 33 LT_OEX_1
YPL180W S. cerevisiae 5747 Cytoplasmic 5752, 5753, 5754, 5755 1 34
LT_OEX_1 YPR167C S. cerevisiae 5757 Plastidic 6052, 6053 1 35
LT_OEX_1 B0036 E. coli 6087 Plastidic 6578, 6579, 6580 1 36
LT_OEX_1 B1906 E. coli 6582 Cytoplasmic 6607, 6608 1 37 LT_OEX_1
B2371 E. coli 6610 Cytoplasmic 6947, 6948 1 38 LT_OEX_1 B2881 E.
coli 6950 Cytoplasmic 7075, 7076, 7077 1 39 LT_OEX_1 B3106 E. coli
7079 Cytoplasmic 7268, 7269 1 40 LT_OEX_1 B3400 E. coli 7271
Plastidic 7464, 7465, 7466 1 41 LT_OEX_1 B3410 E. coli 7468
Cytoplasmic 7489, 7490, 7491 1 42 LT_OEX_1 B4209 E. coli 7493
Plastidic 7586, 7587, 7588, 7589, 7590 1 43 LT_OEX_1 SLL1545
Synechocystis 7592 Cytoplasmic 7669 1 44 LT_OEX_1 SLR1348
Synechocystis 7671 Mitochondric 8232, 8233, 8234, 8235 1 45
LT_OEX_1 YGR191W S. cerevisiae 8237 Plastidic 8560, 8561, 8562 1 46
LT_OEX_1 AT1G22920 A. thaliana 8564 Cytoplasmic 8641, 8642, 8643,
8644, 8645, 8646, 8647 1 47 LT_OEX_1 B1600 E. coli 8649 Plastidic
8758, 8759 1 48 LT_OEX_1 B1900 E. coli 8761 Plastidic 8852, 8853,
8854, 8855, 8856, 8857, 8858, 8859, 8860 1 49 LT_OEX_1 SLL0099
Synechocystis 8862 Cytoplasmic 9043, 9044, 9045 1 50 LT_OEX_1
SLL0383 Synechocystis 9047 Cytoplasmic 9278, 9279 1 51 LT_OEX_1
SLR1094 Synechocystis 9281 Cytoplasmic 9302, 9303, 9304, 9305, 9306
1 52 LT_OEX_1 SLR1520 Synechocystis 9308 Cytoplasmic 9427, 9428,
9429 1 53 LT_OEX_1 YDL142C S. cerevisiae 9431 Cytoplasmic 9476,
9477, 9478 1 54 LT_OEX_1 YDR147W S. cerevisiae 9480 Cytoplasmic
9489, 9490, 9491, 9492, 9493, 9494, 9495, 9496, 9497, 9498, 9499 1
55 LT_OEX_1 YLR284C S. cerevisiae 9501 Plastidic 9550, 9551, 9552 1
56 LT_OEX_1 YPL148C S. cerevisiae 9554 Plastidic 9569, 9570, 9571,
9572, 9573 1 57 LT_OEX_1 YPR074C S. cerevisiae 9575 Plastidic
10396, 10397, 10398, 10399, 10400, 10401, 10402, 10403 1 58
LT_OEX_1 B1008 E. coli 10405 Plastidic 10498, 10499, 10500, 10501,
10502 1 59 LT_OEX_1 B1529 E. coli 10504 Plastidic 10587, 10588,
10589, 10590 1 60 LT_OEX_1 B3347 E. coli 10592 Plastidic 10931,
10932, 10933 1 61 LT_OEX_1 YBR176W S. cerevisiae 10935 Cytoplasmic
11458, 11459, 11460 1 62 LT_OEX_1 YGR177C S. cerevisiae 11462
Cytoplasmic 11489, 11490, 11491, 11492, 11493, 11494, 11495, 11496,
11497, 11498, 11499, 11500 1 63 LT_OEX_1 YHR176W S. cerevisiae
11502 Cytoplasmic 11561, 11562, 11563 1 64 LT_OEX_1 B2881_2 E. coli
11565 Cytoplasmic 11692, 11693, 11694 1 65 LT_OEX_1 B3945_2 E. coli
11696 Cytoplasmic 11901, 11902, 11903, 11904, 11905, 11906 1 66
LT_OEX_1 YHR204W_ S. cerevisiae 11908 Cytoplasmic 11935, 11936,
11937, 11938, 11939, 11940, 11941, 11942, 2 11943 1 67 LT_OEX_1
YNL142W_ S. cerevisiae 11945 Cytoplasmic 12352, 12353, 12354,
12355, 12356 2 1 68a LT_OEX_1 YOL058W_ S. cerevisiae 12358
Plastidic 12933, 12934, 12935 2 1 68b LT_OEX_1 YOL058W_ S.
cerevisiae 12358 Cytoplasmic 12933, 12934, 12935 2 1 69 LT_OEX_1
YPR035W_ S. cerevisiae 12937 Cytoplasmic 13254, 13255, 13256,
13257, 13258, 13259, 13260, 13261, 2 13262
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140325706A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140325706A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References