U.S. patent application number 14/326624 was filed with the patent office on 2014-10-30 for alteration of oil traits in plants.
The applicant listed for this patent is E I DU PONT DE NEMOURS AND COMPANY, PIONEER HI-BRED INTERNATIONAL INC. Invention is credited to WILLIAM B ALLEN, Rebecca E Cahoon, Sabine U Epelbaum, Changjiang Li, Igor Cunha De Oliveira, Hajime Sakai, Bo Shen, Mitchell C Tarczynski.
Application Number | 20140325704 14/326624 |
Document ID | / |
Family ID | 23165423 |
Filed Date | 2014-10-30 |
United States Patent
Application |
20140325704 |
Kind Code |
A1 |
ALLEN; WILLIAM B ; et
al. |
October 30, 2014 |
ALTERATION OF OIL TRAITS IN PLANTS
Abstract
The preparation and use of nucleic acid fragments useful in
altering the oil phenotype in plants are disclosed. Chimeric
construct incorporating such nucleic acid fragments and suitable
regulatory sequences can be used to create transgenic plants having
altered lipid profiles. Methods for altering the oil phenotype in
plants using such nucleic acid fragments also are disclosed.
Inventors: |
ALLEN; WILLIAM B;
(Urbandale, IA) ; Cahoon; Rebecca E; (Lincoln,
NE) ; Epelbaum; Sabine U; (Wilmington, DE) ;
Li; Changjiang; (Beijing, CN) ; Oliveira; Igor Cunha
De; (Bairro Jardim Marajoara Sao Paulo, BR) ; Sakai;
Hajime; (Newark, DE) ; Shen; Bo; (Johnston,
IA) ; Tarczynski; Mitchell C; (West Des Moines,
IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
E I DU PONT DE NEMOURS AND COMPANY
PIONEER HI-BRED INTERNATIONAL INC |
Wilmington
Johnston |
DE
IA |
US
US |
|
|
Family ID: |
23165423 |
Appl. No.: |
14/326624 |
Filed: |
July 9, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12429498 |
Apr 24, 2009 |
8785726 |
|
|
14326624 |
|
|
|
|
11526171 |
Sep 22, 2006 |
|
|
|
12429498 |
|
|
|
|
10183687 |
Jun 27, 2002 |
7157621 |
|
|
11526171 |
|
|
|
|
60301913 |
Jun 29, 2001 |
|
|
|
Current U.S.
Class: |
800/281 ;
435/320.1; 800/298; 800/306; 800/312; 800/320; 800/320.1;
800/320.2; 800/320.3; 800/322 |
Current CPC
Class: |
C12N 15/8247 20130101;
C07K 14/415 20130101 |
Class at
Publication: |
800/281 ;
435/320.1; 800/298; 800/320.1; 800/312; 800/320.3; 800/320.2;
800/306; 800/320; 800/322 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Claims
1. A chimeric construct comprising an isolated nucleic acid
operably linked to at least one regulatory sequence, wherein the
isolated nucleic acid comprises a nucleic acid sequence encoding a
polypeptide having an amino acid sequence of at least 95% sequence
identity based on the Clustal method of alignment when compared to
SEQ ID NO: 477, wherein said polypeptide is capable of altering oil
phenotype in a plant, and wherein the isolated nucleic acid and the
at least one regulatory sequence are not found together in
nature.
2. A plant comprising in its genome the chimeric construct of claim
1.
3. The plant of claim 2 wherein said plant is selected from the
group consisting of corn, soybean, wheat, rice, canola, I, sorghum,
sunflower, and coconut.
4. A method for altering oil phenotype in a plant which comprises:
(a) transforming a plant with the chimeric construct of claim 1;
(b) growing the transformed plant under conditions suitable for
expression of the chimeric construct; and (c) selecting those
transformed plants whose oil phenotype has been altered compared to
the oil phenotype of an untransformed plant.
5. The method of claim 4 wherein the plant is selected from the
group consisting of corn, soybean, wheat, rice, canola, Brassica,
sorghum, sunflower, and coconut.
6. The chimeric construct of claim 1, wherein the polypeptide has
an amino acid sequence of at least 98% sequence identity based on
the Clustal method of alignment when compared to SEQ ID NO:
477.
7. The chimeric construct of claim 1, wherein the polypeptide has
an amino acid sequence of at least 99% sequence identity based on
the Clustal method of alignment when compared to SEQ ID NO:
477.
8. The chimeric construct of claim 1, wherein the polypeptide
comprises the amino acid sequence of SEQ ID NO: 477.
9. The chimeric construct of claim 1, wherein the nucleic acid
comprises the nucleic acid sequence of SEQ ID NO: 476.
10. A seed comprising in its genome the chimeric construct of claim
1.
11. The seed of claim 10, wherein said seed is selected from the
group consisting of corn, soybean, wheat, rice, canola, Brassica,
sorghum, sunflower, and coconut.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Divisional of U.S. patent application
Ser. No. 12/429,498, filed Apr. 24, 2009, now pending, which is a
continuation of U.S. patent application Ser. No. 11/526,171, filed
Sep. 22, 2006, now abandoned, which is a Continuation-in-Part of
U.S. patent application Ser. No. 10/183,687, filed Jun. 27, 2002,
now U.S. Pat. No. 7,157,621, issued on Jan. 2, 2007, which claims
the priority benefit of U.S. Provisional Application No.
60/301,913, filed Jun. 29, 2001, the disclosure of each is hereby
incorporated by reference in its entirety.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named 20140709_BB1458USDIV_SequenceListing created on
Jul. 2, 2014 and having a size of 1,087 kilobytes and is filed
concurrently with the specification. The sequence listing contained
in this ASCII formatted document is part of the specification and
is herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention is in the field of plant breeding and
genetics and, in particular, relates to the alteration of oil
phenotype in plants through the controlled expression of selective
genes.
BACKGROUND OF THE INVENTION
[0004] Plant lipids have a variety of industrial and nutritional
uses and are central to plant membrane function and climatic
adaptation. These lipids represent a vast array of chemical
structures, and these structures determine the physiological and
industrial properties of the lipid. Many of these structures result
either directly or indirectly from metabolic processes that alter
the degree of unsaturation of the lipid. Different metabolic
regimes in different plants produce these altered lipids, and
either domestication of exotic plant species or modification of
agronomically adapted species is usually required to produce
economically large amounts of the desired lipid.
[0005] There are serious limitations to using mutagenesis to alter
fatty acid composition. Screens will rarely uncover mutations that
a) result in a dominant ("gain-of-function") phenotype, b) are in
genes that are essential for plant growth, and c) are in an enzyme
that is not rate-limiting and that is encoded by more than one
gene. In cases where desired phenotypes are available in mutant
corn lines, their introgression into elite lines by traditional
breeding techniques is slow and expensive, since the desired oil
compositions are likely the result of several recessive genes.
[0006] Recent molecular and cellular biology techniques offer the
potential for overcoming some of the limitations of the mutagenesis
approach, including the need for extensive breeding. Some of the
particularly useful technologies are seed-specific expression of
foreign genes in transgenic plants [see Goldberg et al (1989) Cell
56:149-160], and the use of antisense RNA to inhibit plant target
genes in a dominant and tissue-specific manner [see van der Krol et
al (1988) Gene 72:45-50]. Other advances include the transfer of
foreign genes into elite commercial varieties of commercial
oilcrops, such as soybean [Chee et al (1989) Plant Physiol.
91:1212-1218; Christou et al (1989) Proc. Natl. Acad. Sci. U.S.A.
86:7500-7504; Hinchee et al (1988) Bio/Technology 6:915-922; EPO
publication 0 301 749 A2], rapeseed [De Block et al (1989) Plant
Physiol. 91:694-701], and sunflower [Everett et al (1987)
Bio/Technology 5:1201-1204], and the use of genes as restriction
fragment length polymorphism (RFLP) markers in a breeding program,
which makes introgression of recessive traits into elite lines
rapid and less expensive [Tanksley et al (1989) Bio/Technology
7:257-264]. However, application of each of these technologies
requires identification and isolation of commercially-important
genes.
[0007] The regulation of transcription of most eukaryotic genes is
coordinated through sequence-specific binding of proteins to the
promoter region located upstream of the gene. Many of these
protein-binding sequences have been conserved during evolution and
are found in a wide variety of organisms. One such feature is the
"CCAAT" sequence element. (Edwards et al, 1998, Plant Physiol.
117:1015-1022). CCAAT boxes are a feature of gene promoters in many
eukaryotes including several plant gene promoters.
[0008] HAP proteins constitute a large family of transcription
factors first identified in yeast. They combine to from a
heteromeric protein complex that activates transcription by binding
to CCAAT boxes in eukaryotic promoters. The orthologous Hap
proteins display a high degree of evolutionary conservation in
their functional domains in all species studied to date (Li et al,
1991).
[0009] WO 00/28058 published on May 18, 2000 describes Hap3-type
CCAAT-box binding transcriptional activator polynucleotides and
polypeptides, especially, the leafy cotyledon 1 transcriptional
activator (LEC1) polynucleotides and polypeptides.
[0010] WO 99/67405 describes leafy cotyledon1 genes and their
uses.
[0011] The human, murine and plant homologues of CCAAT-binding
proteins have been isolated and characterized based on their
sequence similarity with their yeast counterparts (Li et al, 1991).
This high degree of sequence homology translates remarkably into
functional interchangeability among orthologue proteins of
different species (Sinha et al, 1995). Unlike yeast, multiple forms
of each HAP homolog have been identified in plants (Edwards et al,
1998).
[0012] Molecular and genetic analysis revealed HAP members to be
involved in the control of diverse and critical biological
processes ranging from development and cell cycle regulation to
metabolic control and homeostasis (Lotan et al, 1998; Lopez et al,
1996). In yeast, HAPs are involved in the transcriptional control
of metabolic relevant processes such as the regulation of catabolic
depression of cyc1 and other genes involved in respiration (Becker
et al., 1991).
[0013] In mammalian systems, several reports describe HAPs as
direct or indirect regulators of several important genes involved
in lipid biosynthesis such as fatty acid synthase (Roder et al,
1997), farnesyl diphosphate (FPP) synthase (Jackson et al, 1995;
Ericsson et al, 1996), glycerol-3-phosphate acyltransferase (GPA,
Jackson et al, 1997), acetyl-CoA carboxylase (ACC, Lopez et al,
1996) and 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) synthase
(Jackson et al, 1995), among others.
[0014] In addition, other CCAAT-binding transcription factors have
also been reported to be involved in different aspects of the
control of lipid biosynthesis and adipocyte growth and
differentiation in mammalian systems (see McKnight et al,
1989).
[0015] It appears that the currently available evidence to date
points to a family of proteins of the CCAAT-binding transcription
factors as important modulators of metabolism and lipid
biosynthesis in mammalian systems. Such a determination has not
been made for plant systems.
SUMMARY OF THE INVENTION
[0016] This invention concerns an isolated nucleotide fragment
comprising a nucleic acid sequence selected from the group
consisting of:
[0017] (a) a nucleic acid sequence encoding a first polypeptide
having receptor-like protein kinase activity, the first polypeptide
having at least 85% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of SEQ ID NOs:2 or 4;
[0018] (b) a nucleic acid sequence encoding a third polypeptide
having MAP kinase-kinase-kinase activity, the third polypeptide
having at least 70% identity based on the Clustal method of
alignment when compared to a fourth polypeptide selected from the
group consisting of SEQ ID NOs:6, 8, 10, 12, 14, 16, 493, 495, or
497;
[0019] (c) a nucleic acid sequence encoding a fifth polypeptide
having Hap2-like transcription factor activity, the fifth
polypeptide having at least 70% identity based on the Clustal
method of alignment when compared to a sixth polypeptide selected
from the group consisting of SEQ ID NOs:18, 20, 22, 26, 28, 30, 32,
34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 62, 64, 66, 68,
70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 461,
463, 465, 467, or 469;
[0020] (d) a nucleic acid sequence encoding a seventh polypeptide
having Hap5-like transcription factor activity, the seventh
polypeptide having at least 80% identity based on the Clustal
method of alignment when compared to an eighth polypeptide selected
from the group consisting of SEQ ID NOs:100, 102, 104, 106, 108,
110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134,
136, 138, 140, 142, or 144, or 474;
[0021] (e) a nucleic acid sequence encoding a ninth polypeptide
having LIP15-like transcription factor activity, the ninth
polypeptide having at least 85% identity based on the Clustal
method of alignment when compared to a tenth polypeptide selected
from the group consisting of SEQ ID NOs:148, 152, or 154;
[0022] (f) a nucleic acid sequence encoding an eleventh polypeptide
caleosin-like activity, the eleventh polypeptide having at least
70% identity based on the Clustal method of alignment when compared
to a twelfth polypeptide selected from the group consisting of SEQ
ID NOs:158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180,
182, 184, 186, 188, 190, 192, 194, 196, 198, 499, 501, 503, 505,
507, 509, 511, 513, 515, 517, 519, 521, 523, 525, or 527; or
[0023] (g) a nucleic acid sequence encoding a thirteenth
polypeptide having ATP citrate lyase activity, the thirteenth
polypeptide having at least 94% identity based on the Clustal
method of alignment when compared to a fourteenth polypeptide
selected from the group consisting of SEQ ID NOs:200, 202, 204,
206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, or
232;
[0024] (h) a nucleic acid sequence encoding a fifteenth polypeptide
having SNF1-like activity, the fifteenth polypeptide having at
least 90% identity based on the Clustal method of alignment when
compared to a sixteenth polypeptide selected from the group
consisting of SEQ ID NOs:244, 256, or 258;
[0025] (i) a nucleic acid sequence encoding a seventeenth
polypeptide having Hap3/Lec1-like activity, the seventeenth
polypeptide having at least 70% identity based on the Clustal
method of alignment when compared to a eighteenth polypeptide
selected from the group consisting of SEQ ID NOs:260, 262, 264, or
266 ,
[0026] (j) a nucleic acid sequence encoding a nineteenth
polypeptide having CKC-like transcription factor activity, the
nineteenth polypeptide having at least 88% identity based on the
Clustal method of alignment when compared to an twentieth
polypeptide selected from the group consisting of SEQ ID NOs:310,
312, 316, 318, 320, 328, 330, 332, 338, 342, 344, 348, 352, 354,
358, 362, 477, 479, 481, 483, 485, 487, 489, or 491.
[0027] Also of interest are the complements of such nucleotide
fragment as well as the use of such fragments or a part thereof in
antisense inhibition or co-suppression in a transformed plant.
[0028] In a second embodiment, this invention concerns chimeric
constructs comprising such fragments, plants comprising such
chimeric genes in their genome, seeds obtained from such plants and
oil obtained from these seeds.
[0029] In a third embodiment, this invention concerns a method for
altering oil phenotype in a plant which comprises:
[0030] (a) transforming a plant with a chimeric construct the
invention,
[0031] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0032] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0033] In a fourth embodiment, this invention concerns a method for
altering oil phenotype in a plant which comprises:
[0034] (a) transforming a plant with a chimeric construct
comprising isolated nucleotide fragment comprising a nucleic acid
sequence selected from the group consisting of: [0035] (i) a
nucleic acid sequence encoding a plant SNF1 protein kinase having
at least 60% identity based on the Clustal method of alignment when
compared to a second polypeptide selected from the group consisting
of even SEQ ID NOs: from 234 to 258 and SEQ ID NOs:400-409; [0036]
(ii) the complement of the nucleic acid sequence of (i); [0037]
(iii) the sequence of (i) or (ii) or a part thereof which is useful
in antisense inhibition or co-suppression in a transformed plant;
[0038] (iv) a nucleic acid sequence encoding a plant Hap3/Lec1
transcription factor having at least 60% identity based on the
Clustal method of alignment when compared to a second polypeptide
selected from the group consisting of even SEQ ID NOs: from 260 to
278, and SEQ ID NOs:411 and 412; [0039] (v) the complement of the
nucleic acid sequence of (iv); [0040] (vi) the sequence of (iv) or
(v) or a part thereof which is useful in antisense inhibition or
co-suppression in a transformed plant; [0041] (vii) a nucleic acid
sequence encoding a plant Lec1-related CCAAT binding transcription
factor having at least 60% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of even SEQ ID NOs: from 280 to 308, and SEQ ID
NOs:413-418; [0042] (viii) the complement of the nucleic acid
sequence of (vii); [0043] (ix) the sequence of (vii) or (viii) or a
part thereof which is useful in antisense inhibition or
co-suppression in a transformed plant; [0044] (x) a nucleic acid
sequence encoding a plant Aintegumenta-like transcription factor
having at least 60% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of even SEQ ID NOs: from 310 to 364, and SEQ ID
NOs:419-429; [0045] (xi) the complement of the nucleic acid
sequence of (x); [0046] (xii) the sequence of (x) or (xi) or a part
thereof which is useful in antisense inhibition or co-suppression
in a transformed plant;
[0047] wherein said nucleic acid sequence is operably linked to at
least one regulatory sequence;
[0048] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0049] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0050] In a fifth embodiment, this invention concerns a method for
altering oil phenotype in a plant which comprises:
[0051] (a) transforming a plant with a chimeric construct
comprising an isolated nucleic acid fragment operably linked to at
least one regulatory sequence wherein said fragment has a nucleic
acid sequence encoding a polypeptide having a sequence identity of
at least 60% based on the Clustal method of alignment when compared
to a polypeptide selected from the group consisting of even SEQ ID
NOs: from 2 to 364, and SEQ ID NOs:365-429 and 528-532, and all odd
SEQ ID NOs: from 477 to 527;
[0052] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0053] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0054] In a sixth embodiment, this invention concerns method of
mapping genetic variations related to altered oil phenotypes in a
plant comprising:
[0055] (a) crossing two plant varieties; and
[0056] (b) evaluating genetic variations with respect to nucleic
acid sequences set forth in the odd SEQ ID NOs: from 1 to 363, and
in even SEQ ID NOs: from 476 to 526, in progeny plants resulting
from the cross of step (a) wherein the evaluation is made using a
method selected from the group consisting of: RFLP analysis, SNP
analysis, and PCR-based analysis.
[0057] In a seventh embodiment, this invention concerns a method of
molecular breeding to obtain altered oil phenotypes in a plant
comprising:
[0058] (a) crossing two plant varieties; and
[0059] (b) evaluating genetic variations with respect to nucleic
acid sequences set forth in the odd SEQ ID NOs: from 1 to 363, and
in even SEQ ID NOs: from 476 to 526, in progeny plants resulting
from the cross of step (a) wherein the evaluation is made using a
method selected from the group consisting of: RFLP analysis, SNP
analysis, and PCR-based analysis.
[0060] In an eighth embodiment, this invention concerns a method
for altering oil phenotype in a plant which comprises:
[0061] (a) transforming a plant with a chimeric construct
comprising isolated nucleotide fragment comprising a nucleic acid
sequence selected from the group consisting of:
[0062] (i) a nucleic acid sequence encoding a plant Hap3/Lec1
transcription factor having at least 70% identity based on the
Clustal method of alignment when compared to a second polypeptide
selected from the group consisting of SEQ ID NOs:260, 262, 264,
268, 270, 272, 274, 276, 278, 411, 412. or 459;
[0063] (ii) the complement of the nucleic acid sequence of
(iv);
[0064] (iii) the sequence of (iv) or (v) or a part thereof which is
useful in antisense inhibition or co-suppression in a transformed
plant;
[0065] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0066] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0067] In a ninth embodiment, this invention concerns a method to
isolate nucleic acid fragments associated with altering oil
phenotype in a plant which comprises:
[0068] (a) comparing even SEQ ID NOs: from 2 to 364, and SEQ ID
NOs:365-429 and 528-532, and all odd SEQ ID NOs: from 477 to 527
with other polypeptide sequences for the purpose of identifying
polypeptides associated with altering oil phenotype in a plant;
[0069] (b) identifying the conserved sequences(s) or 4 or more
amino acids obtained in step (a);
[0070] (c) making region-specific nucleotide probe(s) or
oligomer(s) based on the conserved sequences identified in step
(b); and
[0071] (d) using the nucleotide probe(s) or oligomer(s) of step (c)
to isolate sequences associated with altering oil phenotype by
sequence dependent protocols.
BRIEF DESCRIPTION OF SEQUENCE LISTINGS
[0072] The invention can be more fully understood from the
following detailed description and the accompanying drawings and
Sequence Listing which form a part of this application.
[0073] Table 1 lists the polypeptides that are described herein,
the designation of the cDNA clones that comprise the nucleic acid
fragments encoding polypeptides representing all or a substantial
portion of these polypeptides, and the corresponding identifier
(SEQ ID NO:) as used in the attached Sequence Listing. The sequence
descriptions and Sequence Listing attached hereto comply with the
rules governing nucleotide and/or amino acid sequence disclosures
in patent applications as set forth in 37 C.F.R.
.sctn.1.821-1.825.
TABLE-US-00001 TABLE 1 Genes Involved in Alteration of Oil Traits
in Plants Gene Name Clone Plant SEQ ID NO Receptor-like protein
cho1c.pk003.p17:fis maize [Zea mays] 1, 2 kinase Receptor-like
protein ceb3.pk0012.a7 maize [Zea mays] 3, 4 kinase MEK3
cho1c.pk003.n23 maize [Zea mays] 5, 6 MEK3 p0125.czaab60rb:fis
maize [Zea mays] 7, 8 MEK3 rlr24.pk0032.e10 rice [Oryza sativa] 9,
10 MEK3 rlr24.pk0032.e10:fis rice [Oryza sativa] 496, 497 MEK3
r10n.pk096.h23 rice [Oryza sativa] 11, 12 MEK3 r10n.pk096.h23:fis
rice [Oryza sativa] 494, 495 MEK3 src3c.pk018.d10 soybean [Glycine
13, 14 max] MEK3 sr3c.pk011.g22 soybean [Glycine 15, 16 max] MEK3
sr3c.pk011.g22:fis soybean [Glycine 492, 493 max] Hap2a
transcription factor ncs.pk0013.c4 Catalpa [Catalpa 17, 18
speciosa] Hap2c-like transcription etr1c.pk006.f9 cattail [Typha
19, 20 factor latifolia] Hap2a transcription factor
vmb1na.pk015.d18:fis grape [Vitis sp.] 21, 22 Hap2a transcription
factor vpl1c.pk008.o5:fis grape [Vitis sp.] 23, 24 Hap2c-like
transcription vdb1c.pk001.m5:fis grape [Vitis sp.] 25, 26 factor
Hap2 transcription factor cho1c.pk004.b19:fis maize [Zea mays] 27,
28 Hap2 transcription factor p0015.cdpgu90r:fis maize [Zea mays]
29, 30 Hap2a transcription factor cta1n.pk0070.f3:fis maize [Zea
mays] 31, 32 Hap2a-like transcription cco1n.pk0014.d4:fis maize
[Zea mays] 33, 34 factor Hap2a-like transcription
cco1n.pk086.d20:fis maize [Zea mays] 35, 36 factor Hap2b
transcription factor p0126.cnlau71r:fis maize [Zea mays] 37, 38
Hap2b-like transcription p0104.cabav52r maize [Zea mays] 39, 40
factor Hap2c transcription factor cho1c.pk007.l21:fis maize [Zea
mays] 41, 42 Hap2c-like transcription contig of: maize [Zea mays]
43, 44 factor cca.pk0026.d6 cen3n.pk0061.e10:fis cen3n.pk0135.c2
cho1c.pk001.n24 p0092.chwae40r Hap2c-like transcription
cpf1c.pk006.e3:fis maize [Zea mays] 45, 46 factor Hap2c-like
transcription contig of: maize [Zea mays] 47, 48 factor
cr1n.pk0080.g6 p0003.cgpge51r Hap2c-like transcription
p0015.cpdfm55r:fis maize [Zea mays] 49, 50 factor Hap2c-like
transcription p0083.cldct11r:fis maize [Zea mays] 51, 52 factor
Hap2c-like transcription p0083.cldeu68r:fis maize [Zea mays] 53, 54
factor Hap2a transcription factor pps1c.pk001.h3:fis prickly poppy
55, 56 [Argemone mexicana] Hap2c-like transcription
pps1c.pk007.j21:fis prickly poppy 57, 58 factor [Argemone mexicana]
Hap2 transcription factor rr1.pk0030.f7:fis rice [Oryza sativa] 59,
60 Hap2a transcription factor rls72.pk0023.c8:fis rice [Oryza
sativa] 61, 62 Hap2a-like transcription rca1n.pk002.c15 rice [Oryza
sativa] 63, 64 factor Hap2a-like transcription rds3c.pk001.g9 rice
[Oryza sativa] 65, 66 factor Hap2b transcription factor
rca1n.pk002.j3:fis rice [Oryza sativa] 67, 68 Hap2c-like
transcription rca1n.pk029.n22:fis rice [Oryza sativa] 69, 70 factor
Hap2c-like transcription rl0n.pk131.j17 rice [Oryza sativa] 71, 72
factor Hap2a transcription factor sdp3c.pk018.b9:fis soybean
[Glycine 73, 74 max] Hap2a transcription factor sfl1.pk0102.h8
soybean [Glycine 75, 76 max] Hap2a transcription factor
srr3c.pk001.l10:fis soybean [Glycine 77, 78 max] Hap2a-like
transcription sdp2c.pk003.o5:fis soybean [Glycine 79, 80 factor
max] Hap2b transcription factor sif1c.pk001.m16:fis soybean
[Glycine 81, 82 max] Hap2c-like transcription src1c.pk003.o16:fis
soybean [Glycine 83, 84 factor max] Hap2c-like transcription
src3c.pk012.m6:fis soybean [Glycine 85, 86 factor max] Hap2c-like
transcription hss1c.pk011.h10:fis sunflower 87, 88 factor
[Helianthus sp.] Hap2 transcription factor wr1.pk0094.f2:fis
wheat-common 89, 90 [Triticum aestivum] Hap2a-like transcription
wre1n.pk0143.h2:fis wheat-common 91, 92 factor [Triticum aestivum]
Hap2b transcription factor wds1f.pk002.p21:fis wheat-common 93, 94
[Triticum aestivum] Hap2c transcription factor contig of:
wheat-common 95, 96 wdilc.pk002.b10 [Triticum aestivum]
wr1.pk0153.c7:fis Hap2c-like transcription wre1n.pk0066.e4:fis
wheat-common 97, 98 factor [Triticum aestivum] Hap5c-like
transcription ect1c.pk001.k17:fis Canna [Canna 99, 100 factor
edulis] Hap5a-like transcription vrr1c.pk004.o20:fis grape [Vitis
sp.] 101, 102 factor Hap5a-like transcription clm1f.pk001.k17:fis
maize [Zea mays] 103, 104 factor Hap5b-like transcription
cde1n.pk003.a5:fis maize [Zea mays] 105, 106 factor Hap5b-like
transcription cen3n.pk0164.a10:fis maize [Zea mays] 107, 108 factor
Hap5b-like transcription p0118.chsbc77r maize [Zea mays] 109, 110
factor Hap5c-like transcription cco1n.pk055.o18:fis maize [Zea
mays] 111, 112 factor Hap5c-like transcription cho1c.pk001.l23:fis
maize [Zea mays] 113, 114 factor Hap5c-like transcription
cse1c.pk001.h6:fis maize [Zea mays] 115, 116 factor Hap5a-like
transcription rlm3n.pk005.d20:fis rice [Oryza sativa] 117, 118
factor Hap5b-like transcription rr1.pk0003.a3:fis rice [Oryza
sativa] 119, 120 factor Hap5b-like transcription rr1.pk0039.d4:fis
rice [Oryza sativa] 121, 122 factor Hap5c-like transcription
rca1n.pk021.b20:fis rice [Oryza sativa] 123, 124 factor Hap5a-like
transcription sdp2c.pk029.k17:fis soybean [Glycine 125, 126 factor
max] Hap5a-like transcription sdp2c.pk044.e5:fis soybean [Glycine
127, 128 factor max] Hap5b-like transcription sgs4c.pk004.j2
soybean [Glycine 129, 130 factor max] Hap5b-like transcription
src3c.pk002.h4:fis soybean [Glycine 131, 132 factor max] Hap5b-like
transcription src3c.pk009.b15:fis soybean [Glycine 133, 134 factor
max] Hap5b-like transcription src3c.pk019.d4:fis soybean [Glycine
135, 136 factor max] Hap5c-like transcription sls1c.pk032.j4:fis
soybean [Glycine 137, 138 factor max] Hap5 transcription factor
wdk2c.pk009.e4:fis wheat-common 139, 140 [Triticum aestivum]
Hap5a-like transcription contig of: wheat-common 141, 142 factor
wlm96.pk036.j11 [Triticum aestivum] wlm96.pk060.d5:fis Hap5c-like
transcription wle1n.pk0076.h7:fis wheat-common 143, 144 factor
[Triticum aestivum] LIP 15 transcription factor cco1n.pk068.f18:fis
maize [Zea mays] 145, 146 LIP 15 transcription factor
cco1n.pk089.g17:fis maize [Zea mays] 147, 148 LIP 15 transcription
factor rls6.pk0066.c9:fis rice [Oryza sativa] 149, 150 LIP 15
transcription factor sdp4c.pk009.e3:fis soybean [Glycine 151, 152
max] LIP 15 transcription factor sdp3c.pk019.n1:fis soybean
[Glycine 153, 154 max] LIP 15 transcription factor
wl1n.pk0114.f9:fis wheat-common 155, 156 [Triticum aestivum] Ca2+
EF Hand Protein ccase-b.pk0003.b9:fis maize [Zea mays] 157, 158
Ca2+ EF Hand Protein ceb5.pk0081.b4 maize [Zea mays] 159, 160 Ca2+
EF Hand Protein cbn10.pk0064.e6 maize [Zea mays] 161, 162 Ca2+ EF
Hand Protein cml1c.pk001.e2 maize [Zea mays] 163, 164 Ca2+ EF Hand
Protein cml1c.pk001.e2:fis maize [Zea mays] 498, 499 Ca2+ EF Hand
Protein cpd1c.pk008.e21 maize [Zea mays] 165, 166 Ca2+ EF Hand
Protein cpd1c.pk008.e21:fis maize [Zea mays] 500, 501 Ca2+ EF Hand
Protein cta1n.pk0074.h11 maize [Zea mays] 167, 168 Ca2+ EF Hand
Protein cta1n.pk0074.h11:fis maize [Zea mays] 502, 503 Ca2+ EF Hand
Protein p0031.ccmbc81r maize [Zea mays] 169, 170 Ca2+ EF Hand
Protein p0031.ccmbc81r:fis maize [Zea mays] 504, 505 Ca2+ EF Hand
Protein p0134.carah47r maize [Zea mays] 171, 172 Ca2+ EF Hand
Protein p0134.carah47r:fis maize [Zea mays] 506, 507 Ca2+ EF Hand
Protein rca1n.pk021.i20 rice [Oryza sativa] 173, 174 Ca2+ EF Hand
Protein rca1n.pk004.j14:fis rice [Oryza sativa] 175, 176 Ca2+ EF
Hand Protein rca1n.pk026.m9 rice [Oryza sativa] 177, 178 Ca2+ EF
Hand Protein rsl1n.pk013.g2:fis rice [Oryza sativa] 179, 180 Ca2+
EF Hand Protein sfl1.pk131.j19 soybean [Glycine 181, 182 max] Ca2+
EF Hand Protein sfl1.pk131.j19:fis soybean [Glycine 512, 513 max]
Ca2+ EF Hand Protein sfl1.pk135.g3 soybean [Glycine 183, 184 max]
Ca2+ EF Hand Protein sfl1.pk135.g3:fis soybean [Glycine 514, 515
max] Ca2+ EF Hand Protein sgc5c.pk001.h16 soybean [Glycine 185, 186
max] Ca2+ EF Hand Protein sls1c.pk020.h24 soybean [Glycine 187, 188
max] Ca2+ EF Hand Protein sls1c.pk020.h24:fis soybean [Glycine 516,
517 max] Ca2+ EF Hand Protein sr1.pk0041.a11 soybean [Glycine 189,
190 max] Ca2+ EF Hand Protein sr1.pk0041.a11:fis soybean [Glycine
518, 519 max] Ca2+ EF Hand Protein sr1.pk0049.c2 soybean [Glycine
191, 192 max] Ca2+ EF Hand Protein sr1.pk0049.c2:fis soybean
[Glycine 520, 521 max] Ca2+ EF Hand Protein wdk5c.pk006.m13
wheat-common 193, 194 [Triticum aestivum] Ca2+ EF Hand Protein
wdk5c.pk006.m13:fis wheat-common 522, 523 [Triticum aestivum] Ca2+
EF Hand Protein wdk9n.pk001.k5 wheat-common 195, 196 [Triticum
aestivum] Ca2+ EF Hand Protein wdk9n.pk001.k5:fis wheat-common 524,
525 [Triticum aestivum] Ca2+ EF Hand Protein wdr1f.pk003.b21
wheat-common 197, 198 [Triticum aestivum] Ca2+ EF Hand Protein
wdr1f.pk003.b21:fis wheat-common 526, 527 [Triticum aestivum] ATP
Citrate Lyase cdo1c.pk001.c1:fis maize [Zea mays] 199, 200 subunit
1 ATP Citrate Lyase ctn1c.pk002.o4 maize [Zea mays] 201, 202
subunit 2 ATP Citrate Lyase p0032.crcav77r:fis maize [Zea mays]
203, 204 subunit 2 ATP Citrate Lyase p0037.crwbs90r:fis maize [Zea
mays] 205, 206 subunit 1 ATP Citrate Lyase r10n.pk0015.a4:fis rice
[Oryza sativa] 207, 208 subunit 1 ATP Citrate Lyase rlr2.pk0012.d2
rice [Oryza sativa] 209, 210 subunit 1 ATP Citrate Lyase
rr1.pk097.f22:fis rice [Oryza sativa] 211, 212 subunit 1 ATP
Citrate Lyase rls6.pk0033.a9:fis rice [Oryza sativa] 213, 214
subunit 2 ATP Citrate Lyase sdp2c.pk023.n6:fis soybean [Glycine
215, 216 subunit 2 max] ATP Citrate Lyase sfl1.pk0029.h10:fis
soybean [Glycine 217, 218 subunit 1 max] ATP Citrate Lyase
sic1c.pk003.o13:fis soybean [Glycine 219, 220 subunit 2 max] ATP
Citrate Lyase sls1c.pk010.l1:fis soybean [Glycine 221, 222 subunit
1 max] ATP Citrate Lyase sls2c.pk007.c23:fis soybean [Glycine 223,
224 subunit 2 max] ATP Citrate Lyase src2c.pk009.g9:fis soybean
[Glycine 225, 226 subunit 2 max] ATP Citrate Lyase
wde1f.pk003.h2:fis wheat-common 227, 228 subunit 2 [Triticum
aestivum] ATP Citrate Lyase wia1c.pk001.d20:fis wheat-common 229,
230 subunit 1 [Triticum aestivum] ATP Citrate Lyase
wlm96.pk035.j11:fis wheat-common 231, 232 subunit 2 [Triticum
aestivum] SNF1 cen3n.pk0044.b8:fis maize [Zea mays] 233, 234 SNF1
p0016.ctsbf56rb maize [Zea mays] 235, 236 SNF1 p0118.chsbh89r maize
[Zea mays] 237, 238 SNF1 contig of: maize [Zea mays] 239, 240
cen3n.pk0123.g6 cho1lc.pk021.k16 cmm.pk007.c3
p0019.clwab.75rb p0119.cmtmj75r p0123.cammbc73r p0126.cnlds35r SNF1
contig of: rice [Oryza sativa] 241, 242 rda.pk0007.g3
rr1.pk0008.e12 rr1.pk0047.g12 SNF1 rr1.pk0047.g12:fis rice [Oryza
sativa] 243, 244 SNF1 sdr1f.pk001.p7 soybean [Glycine 247, 248 max]
SNF1 sgs4c.pk006.g6 soybean [Glycine 249, 250 max] SNF1
sgs4c.pk006.n21 soybean [Glycine 251, 252 max] SNF1 sgs4c.pk016.e10
soybean [Glycine 245, 246 max] SNF1 srr1c.pk001.i24:fis soybean
[Glycine 253, 254 max] SNF1 wdk2c.pk018.c16:fis wheat-common 255,
256 [Triticum aestivum] SNF1 wlm96.pk0007.e4:fis wheat-common 257,
258 [Triticum aestivum] Lec1-embryonic type eas1c.pk003.e16
amaranth 259, 260 [Amaranthus retroflexus] Lec1-embryonic type
fds1n.pk008.m14 balsam pear 261, 262 [Momordica charantia]
Lec1-embryonic type p0015.cdpgp75rb:fis maize [Zea mays] 263, 264
Lec1-embryonic type p0083.clder12r:fis maize [Zea mays] 265, 266
Lec1-embryonic type pps1c.pk002.l19 prickly poppy 267, 268
[Argemone mexicana] Lec1-embryonic type Contig of: soybean [Glycine
269, 270 scb1c.pk004.j10 max] se1.pk0042.d8:fis Lec1-embryonic type
se2.11d12:fis soybean [Glycine 271, 272 max] Lec1-embryonic type
ses2w.pk0015.a4:fis soybean [Glycine 273, 274 max] Lec1-embryonic
type vs1n.pk013.m13:fis vernonia [Vernonia 275, 276 mespilifolia]
Lec1-embryonic type wdk3c.pk023.h15:fis wheat-common 277, 278
[Triticum aestivum] Lec1-related CCAAT ect1c.pk007.p18:fis Canna
[Canna 279, 280 binding protein edulis] Lec1-related CCAAT
fds.pk0003.h5:fis balsam pear 281, 282 binding protein [Momordica
charantia] Lec1-related CCAAT eef1c.pk004.c8:fis eucalyptus 283,
284 binding protein [Eucalyptus grandis] Lec1-related CCAAT
cbn10.pk0005.e6:fis maize [Zea mays] 285, 286 binding protein
Lec1-related CCAAT p0006.cbysa51r:fis maize [Zea mays] 287, 288
binding protein Lec1-related CCAAT rl0n.pk0061.c8:fis rice [Oryza
sativa] 289, 290 binding protein Lec1-related CCAAT
rsl1n.pk002.g10:fis rice [Oryza sativa] 291, 292 binding protein
Lec1-related CCAAT ses4d.pk0037.e3:fis soybean [Glycine 293, 294
binding protein max] Lec1-related CCAAT src2c.pk003.i13:fis soybean
[Glycine 295, 296 binding protein max] Lec1-related CCAAT
src2c.pk011.m12:fis soybean [Glycine 297, 298 binding protein max]
Lec1-related CCAAT src2c.pk025.b3:fis soybean [Glycine 299, 300
binding protein max] Lec1-related CCAAT src3c.pk028.j21:fis soybean
[Glycine 301, 302 binding protein max] Lec1-related CCAAT
wkm1c.pk0002.d7:fis wheat-common 303, 304 binding protein [Triticum
aestivum] Lec1-related CCAAT wlk8.pk0001.e10:fis wheat-common 305,
306 binding protein [Triticum aestivum] Lec1-related CCAAT
wlm96.pk037.k9:fis wheat-common 307, 308 binding protein [Triticum
aestivum] CKC type fds1n.pk015.l15 balsam pear 309, 310
6(Aintegumenta) [Momordica charantia] CKC type fds1n.pk015.l15:fis
balsam pear 476, 477 6(Aintegumenta) [Momordica charantia] CKC type
contig of: castor bean 311, 312 2(Aintegumenta) ece1c.pk003.g23
[Ricinus ece1c.pk005.j13 communis] CKC type ece1c.pk003.g23:fis
castor bean 478, 479 2(Aintegumenta) [Ricinus communis] CKC type
ids.pk0022.b6 garden balsam 313, 314 8(Aintegumenta) [Impatiens
balsamia] CKC type contig of: maize [Zea mays] 315, 316
1(Aintegumenta) cpd1c.pk011.i5 p0086.cbsaa24r:fis CKC type
cpd1c.pk011.i5:fis maize [Zea mays] 317, 318 1(Aintegumenta) CKC
type cde1c.pk003.o22:fis maize [Zea mays] 319, 320 2(Aintegumenta)
CKC type cho1c.pk003.f17:fis maize [Zea mays] 321, 322
2(Aintegumenta) CKC type contig of: maize [Zea mays] 323, 324
5(Aintegumenta) cds1f.pk003.b12 clm1f.pk002.o13:fis CKC type
p0015.cdpfn03r maize [Zea mays] 325, 326 3(Aintegumenta) CKC type
contig of: maize [Zea mays] 327, 328 3(Aintegumenta)
cc71se-a.pk0002.e11 p0027.cgsag51r:fis CKC type p0031.ccmau15r:fis
maize [Zea mays] 329, 330 6(Aintegumenta) CKC type cc71se- maize
[Zea mays] 331, 332 8(Aintegumenta) b.pk0018.e4:fis CKC type
cpj1c.pk005.m20:fis maize [Zea mays] 333, 334 7(Aintegumenta) CKC
type ncs.pk0013.a9:fis Catalpa speciosa 484, 485 7(Aintegumenta)
CKC type egh1c.pk005.k20:fis maize [Zea mays] 486, 487
8(Aintegumenta) CKC type cen7f.pk002.m15 maize [Zea mays] 335, 336
8(Aintegumenta) CKC type cde1c.pk003.n23:fis maize [Zea mays] 488,
489 8(Aintegumenta) CKC type rsl1n.pk006.n24:fis rice [Oryza
sativa] 337, 338 8(Aintegumenta) CKC type contig of: rice [Oryza
sativa] 339, 340 8(Aintegumenta) rca1n.pk019.p10 rsl1n.pk002.j2:fis
CKC type rdi2c.pk009.a15 rice [Oryza sativa] 341, 342
1(Aintegumenta) CKC type sds1f.pk001.f7:fis soybean [Glycine 343,
344 2(Aintegumenta) max] CKC type se3.pk0034.a3 soybean [Glycine
345, 346 2(Aintegumenta) max] CKC type ses2w.pk0035.a9:fis soybean
[Glycine 347, 348 6(Aintegumenta) max] CKC type
ses4d.pk0043.d10:fis soybean [Glycine 349, 350 4(Aintegumenta) max]
CKC type scb1c.pk004.n19:fis soybean [Glycine 351, 352
5(Aintegumenta) max] CKC type ses4d.pk0006.a12:fis soybean [Glycine
353, 354 5(Aintegumenta) max] CKC type sgs1c.pk004.f19:fis soybean
[Glycine 355, 356 5(Aintegumenta) max] CKC type sic1c.pk003.o18:fis
soybean [Glycine 357, 358 8(Aintegumenta) max] CKC type
sde4c.pk0001.a2 soybean [Glycine 359, 360 8(Aintegumenta) max] CKC
type sde4c.pk0001.a2:fis soybean [Glycine 490, 491 8(Aintegumenta)
max] CKC type ses2w.pk0012.d10:fis soybean [Glycine 361, 362
3(Aintegumenta) max] CKC type contig of: wheat-common 363, 364
1(Aintegumenta) wde1f.pk001h1 [Triticum aestivum]
wr1.pk148.f7:fis
[0074] The Sequence Listing contains the one letter code for
nucleotide sequence characters and the three letter codes for amino
acids as defined in conformity with the IUPAC-IUBMB standards
described in Nucleic Acids Res. 13:3021-3030 (1985) and in the
Biochemical J. 219 (No. 2):345-373 (1984) which are herein
incorporated by reference. The symbols and format used for
nucleotide and amino acid sequence data comply with the rules set
forth in 37 C.F.R. .sctn.1.822.
DETAILED DESCRIPTION OF THE INVENTION
[0075] All patents, patent applications and publications which are
referred to herein are incorporated by reference in their
entirety.
[0076] As used herein, an "isolated nucleic acid fragment" is a
polymer of RNA or DNA that is single- or double-stranded,
optionally containing synthetic, non-natural or altered nucleotide
bases. An isolated nucleic acid fragment in the form of a polymer
of DNA may be comprised of one or more segments of cDNA, genomic
DNA or synthetic DNA. Nucleotides (usually found in their
5'-monophosphate form) are referred to by their single letter
designation as follows: "A" for adenylate or deoxyadenylate (for
RNA or DNA, respectively), "C" for cytidylate or deoxycytidylate,
"G" for guanylate or deoxyguanylate, "U" for uridylate, "T" for
deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C
or T), "K" for g or T, "H" for A or C or T, "I" for inosine, and
"N" for any nucleotide.
[0077] The terms "subfragment that is functionally equivalent" and
"functionally equivalent subfragment" are used interchangeably
herein. These terms refer to a portion or subsequence of an
isolated nucleic acid fragment in which the ability to alter gene
expression or produce a certain phenotype is retained whether or
not the fragment or subfragment encodes an active enzyme. For
example, the fragment or subfragment can be used in the design of
chimeric genes to produce the desired phenotype in a transformed
plant. Chimeric genes can be designed for use in co-suppression or
antisense by linking a nucleic acid fragment or subfragment
thereof, whether or not it encodes an active enzyme, in the
appropriate orientation relative to a plant promoter sequence.
[0078] The terms "homology", "homologous", "substantially similar"
and "corresponding substantially" are used interchangeably herein.
They refer to nucleic acid fragments wherein changes in one or more
nucleotide bases does not affect the ability of the nucleic acid
fragment to mediate gene expression or produce a certain phenotype.
These terms also refer to modifications of the nucleic acid
fragments of the instant invention such as deletion or insertion of
one or more nucleotides that do not substantially alter the
functional properties of the resulting nucleic acid fragment
relative to the initial, unmodified fragment. It is therefore
understood, as those skilled in the art will appreciate, that the
invention encompasses more than the specific exemplary
sequences.
[0079] Moreover, the skilled artisan recognizes that substantially
similar nucleic acid sequences encompassed by this invention are
also defined by their ability to hybridize, under moderately
stringent conditions (for example, 0.5.times.SSC, 0.1% SDS,
60.degree. C.) with the sequences exemplified herein, or to any
portion of the nucleotide sequences reported herein and which are
functionally equivalent to the promoter of the invention.
Stringency conditions can be adjusted to screen for moderately
similar fragments, such as homologous sequences from distantly
related organisms, to highly similar fragments, such as genes that
duplicate functional enzymes from closely related organisms.
Post-hybridization washes determine stringency conditions. One set
of preferred conditions involves a series of washes starting with
6.times.SSC, 0.5% SDS at room temperature for 15 min, then repeated
with 2.times.SSC, 0.5% SDS at 45.degree. C. for 30 min, and then
repeated twice with 0.2.times.SSC, 0.5% SDS at 50.degree. C. for 30
min. A more preferred set of stringent conditions involves the use
of higher temperatures in which the washes are identical to those
above except for the temperature of the final two 30 min washes in
0.2.times.SSC, 0.5% SDS was increased to 60.degree. C. Another
preferred set of highly stringent conditions involves the use of
two final washes in 0.1.times.SSC, 0.1% SDS at 65.degree. C.
[0080] With respect to the degree of substantial similarity between
the target (endogenous) mRNA and the RNA region in the construct
having homology to the target mRNA, such sequences should be at
least 25 nucleotides in length, preferably at least 50 nucleotides
in length, more preferably at least 100 nucleotides in length,
again more preferably at least 200 nucleotides in length, and most
preferably at least 300 nucleotides in length; and should be at
least 80% identical, preferably at least 85% identical, more
preferably at least 90% identical, and most preferably at least 95%
identical.
[0081] Sequence alignments and percent similarity calculations may
be determined using a variety of comparison methods designed to
detect homologous sequences including, but not limited to, the
Megalign program of the LASARGENE bioinformatics computing suite
(DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences
are performed using the Clustal method of alignment (Higgins and
Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP
PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise
alignments and calculation of percent identity of protein sequences
using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and
DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2,
GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4.
[0082] A "substantial portion" of an amino acid or nucleotide
sequence comprises an amino acid or a nucleotide sequence that is
sufficient to afford putative identification of the protein or gene
that the amino acid or nucleotide sequence comprises. Amino acid
and nucleotide sequences can be evaluated either manually by one
skilled in the art, or by using computer-based sequence comparison
and identification tools that employ algorithms such as BLAST
(Basic Local Alignment Search Tool; Altschul et al (1993) J. Mol.
Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/). In
general, a sequence of ten or more contiguous amino acids or thirty
or more contiguous nucleotides is necessary in order to putatively
identify a polypeptide or nucleic acid sequence as homologous to a
known protein or gene. Moreover, with respect to nucleotide
sequences, gene-specific oligonucleotide probes comprising 30 or
more contiguous nucleotides may be used in sequence-dependent
methods of gene identification (e.g., Southern hybridization) and
isolation (e.g., in situ hybridization of bacterial colonies or
bacteriophage plaques). In addition, short oligonucleotides of 12
or more nucleotides may be used as amplification primers in PCR in
order to obtain a particular nucleic acid fragment comprising the
primers. Accordingly, a "substantial portion" of a nucleotide
sequence comprises a nucleotide sequence that will afford specific
identification and/or isolation of a nucleic acid fragment
comprising the sequence. The instant specification teaches amino
acid and nucleotide sequences encoding polypeptides that comprise
one or more particular plant proteins. The skilled artisan, having
the benefit of the sequences as reported herein, may now use all or
a substantial portion of the disclosed sequences for purposes known
to those skilled in this art. Accordingly, the instant invention
comprises the complete sequences as reported in the accompanying
Sequence Listing, as well as substantial portions of those
sequences as defined above.
[0083] "Codon degeneracy" refers to divergence in the genetic code
permitting variation of the nucleotide sequence without effecting
the amino acid sequence of an encoded polypeptide. Accordingly, the
instant invention relates to any nucleic acid fragment comprising a
nucleotide sequence that encodes all or a substantial portion of
the amino acid sequences set forth herein. The skilled artisan is
well aware of the "codon-bias" exhibited by a specific host cell in
usage of nucleotide codons to specify a given amino acid.
Therefore, when synthesizing a nucleic acid fragment for improved
expression in a host cell, it is desirable to design the nucleic
acid fragment such that its frequency of codon usage approaches the
frequency of preferred codon usage of the host cell.
[0084] "Synthetic nucleic acid fragments" can be assembled from
oligonucleotide building blocks that are chemically synthesized
using procedures known to those skilled in the art. These building
blocks are ligated and annealed to form larger nucleic acid
fragments which may then be enzymatically assembled to construct
the entire desired nucleic acid fragment. "Chemically synthesized",
as related to a nucleic acid fragment, means that the component
nucleotides were assembled in vitro. Manual chemical synthesis of
nucleic acid fragments may be accomplished using well established
procedures, or automated chemical synthesis can be performed using
one of a number of commercially available machines. Accordingly,
the nucleic acid fragments can be tailored for optimal gene
expression based on optimization of the nucleotide sequence to
reflect the codon bias of the host cell. The skilled artisan
appreciates the likelihood of successful gene expression if codon
usage is biased towards those codons favored by the host.
Determination of preferred codons can be based on a survey of genes
derived from the host cell where sequence information is
available.
[0085] "Gene" refers to a nucleic acid fragment that expresses a
specific protein, including regulatory sequences preceding (5'
non-coding sequences) and following (3' non-coding sequences) the
coding sequence. "Native gene" refers to a gene as found in nature
with its own regulatory sequences. The term "chimeric gene" and
"chimeric construct" are used interchangeably herein. A chimeric
construct comprises an artificial combination of nucleic acid
fragments, e.g., regulatory and coding sequences that are not found
together in nature. For example, a chimeric construct may comprise
regulatory sequences and coding sequences that are derived from
different sources, or regulatory sequences and coding sequences
derived from the same source, but arranged in a manner different
than that found in nature. A "foreign" gene refers to a gene not
normally found in the host organism, but that is introduced into
the host organism by gene transfer. Foreign genes can comprise
native genes inserted into a non-native organism, or chimeric
genes. A "transgene" is a gene that has been introduced into the
genome by a transformation procedure.
[0086] "Coding sequence" refers to a DNA sequence that codes for a
specific amino acid sequence. "Regulatory sequences" refer to
nucleotide sequences located upstream (5' non-coding sequences),
within, or downstream (3' non-coding sequences) of a coding
sequence, and which influence the transcription, RNA processing or
stability, or translation of the associated coding sequence.
Regulatory sequences may include, but are not limited to,
promoters, translation leader sequences, introns, and
polyadenylation recognition sequences.
[0087] "Promoter" refers to a DNA sequence capable of controlling
the expression of a coding sequence or functional RNA. The promoter
sequence consists of proximal and more distal upstream elements,
the latter elements often referred to as enhancers. Accordingly, an
"enhancer" is a DNA sequence which can stimulate promoter activity
and may be an innate element of the promoter or a heterologous
element inserted to enhance the level or tissue-specificity of a
promoter. Promoters may be derived in their entirety from a native
gene, or be composed of different elements derived from different
promoters found in nature, or even comprise synthetic DNA segments.
It is understood by those skilled in the art that different
promoters may direct the expression of a gene in different tissues
or cell types, or at different stages of development, or in
response to different environmental conditions. Promoters which
cause a gene to be expressed in most cell types at most times are
commonly referred to as "constitutive promoters". New promoters of
various types useful in plant cells are constantly being
discovered; numerous examples may be found in the compilation by
Okamuro and Goldberg, (1989) Biochemistry of Plants 15:1-82. It is
further recognized that since in most cases the exact boundaries of
regulatory sequences have not been completely defined, DNA
fragments of some variation may have identical promoter
activity.
[0088] An "intron" is an intervening sequence in a gene that does
not encode a portion of the protein sequence. Thus, such sequences
are transcribed into RNA but are then excised and are not
translated. The term is also used for the excised RNA sequences. An
"exon" is a portion of the sequence of a gene that is transcribed
and is found in the mature messenger RNA derived from the gene, but
is not necessarily a part of the sequence that encodes the final
gene product.
[0089] The "translation leader sequence" refers to a DNA sequence
located between the promoter sequence of a gene and the coding
sequence. The translation leader sequence is present in the fully
processed mRNA upstream of the translation start sequence. The
translation leader sequence may affect processing of the primary
transcript to mRNA, mRNA stability or translation efficiency.
Examples of translation leader sequences have been described
(Turner, R. and Foster, G. D. (1995) Molecular Biotechnology
3:225).
[0090] The "3' non-coding sequences" refer to DNA sequences located
downstream of a coding sequence and include polyadenylation
recognition sequences and other sequences encoding regulatory
signals capable of affecting mRNA processing or gene expression.
The polyadenylation signal is usually characterized by affecting
the addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht et al, (1989) Plant Cell 1:671-680.
[0091] "RNA transcript" refers to the product resulting from RNA
polymerase-catalyzed transcription of a DNA sequence. When the RNA
transcript is a perfect complementary copy of the DNA sequence, it
is referred to as the primary transcript or it may be a RNA
sequence derived from post-transcriptional processing of the
primary transcript and is referred to as the mature RNA. "Messenger
RNA (mRNA)" refers to the RNA that is without introns and that can
be translated into protein by the cell. "cDNA" refers to a DNA that
is complementary to and synthesized from a mRNA template using the
enzyme reverse transcriptase. The cDNA can be single-stranded or
converted into the double-stranded form using the Klenow fragment
of DNA polymerase I. "Sense" RNA refers to RNA transcript that
includes the mRNA and can be translated into protein within a cell
or in vitro. "Antisense RNA" refers to an RNA transcript that is
complementary to all or part of a target primary transcript or mRNA
and that blocks the expression of a target gene (U.S. Pat. No.
5,107,065). The complementarity of an antisense RNA may be with any
part of the specific gene transcript, i.e., at the 5' non-coding
sequence, 3' non-coding sequence, introns, or the coding sequence.
"Functional RNA" refers to antisense RNA, ribozyme RNA, or other
RNA that may not be translated but yet has an effect on cellular
processes. The terms "complement" and "reverse complement" are used
interchangeably herein with respect to mRNA transcripts, and are
meant to define the antisense RNA of the message.
[0092] The term "endogenous RNA" refers to any RNA which is encoded
by any nucleic acid sequence present in the genome of the host
prior to transformation with the recombinant construct of the
present invention, whether naturally-occurring or non-naturally
occurring, i.e., introduced by recombinant means, mutagenesis,
etc.
[0093] The term "non-naturally occurring" means artificial, not
consistent with what is normally found in nature.
[0094] The term "operably linked" refers to the association of
nucleic acid sequences on a single nucleic acid fragment so that
the function of one is regulated by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of regulating the expression of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of
the promoter). Coding sequences can be operably linked to
regulatory sequences in a sense or antisense orientation. In
another example, the complementary RNA regions of the invention can
be operably linked, either directly or indirectly, 5' to the target
mRNA, or 3' to the target mRNA, or within the target mRNA, or a
first complementary region is 5' and its complement is 3' to the
target mRNA.
[0095] The term "expression", as used herein, refers to the
production of a functional end-product. Expression of a gene
involves transcription of the gene and translation of the mRNA into
a precursor or mature protein. "Antisense inhibition" refers to the
production of antisense RNA transcripts capable of suppressing the
expression of the target protein. "Co-suppression" refers to the
production of sense RNA transcripts capable of suppressing the
expression of identical or substantially similar foreign or
endogenous genes (U.S. Pat. No. 5,231,020).
[0096] "Mature" protein refers to a post-translationally processed
polypeptide; i.e., one from which any pre- or propeptides present
in the primary translation product have been removed. "Precursor"
protein refers to the primary product of translation of mRNA; i.e.,
with pre- and propeptides still present. Pre- and propeptides may
be but are not limited to intracellular localization signals.
[0097] "Stable transformation" refers to the transfer of a nucleic
acid fragment into a genome of a host organism, including both
nuclear and organellar genomes, resulting in genetically stable
inheritance. In contrast, "transient transformation" refers to the
transfer of a nucleic acid fragment into the nucleus, or
DNA-containing organelle, of a host organism resulting in gene
expression without integration or stable inheritance. Host
organisms containing the transformed nucleic acid fragments are
referred to as "transgenic" organisms. The preferred method of cell
transformation of rice, corn and other monocots is the use of
particle-accelerated or "gene gun" transformation technology (Klein
et al, (1987) Nature (London) 327:70-73; U.S. Pat. No. 4,945,050),
or an Agrobacterium-mediated method using an appropriate Ti plasmid
containing the transgene (Ishida Y. et al, 1996, Nature Biotech.
14:745-750). The term "transformation" as used herein refers to
both stable transformation and transient transformation.
[0098] Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described more fully
in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning:
A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold
Spring Harbor, 1989 (hereinafter "Sambrook").
[0099] The term "recombinant" means, for example, that a nucleic
acid sequence is made by an artificial combination of two otherwise
separated segments of sequence, e.g., by chemical synthesis or by
the manipulation of isolated nucleic acids by genetic engineering
techniques. A "recombinant DNA construct" comprises an isolated
polynucleotide operably linked to at least one regulatory sequence.
The term also embraces an isolated polynucleotide comprising a
region encoding all or part of a functional RNA and at least one of
the naturally occurring regulatory sequences directing expression
in the source (e.g., organism) from which the polynucleotide was
isolated, such as, but not limited to, an isolated polynucleotide
comprising a nucleotide sequence encoding a herbicide resistant
target gene and the corresponding promoter and 3' end sequences
directing expression in the source from which sequences were
isolated.
[0100] A "transgene" is a recombinant DNA construct that has been
introduced into the genome by a transformation procedure.
[0101] As used herein, "contig" refers to a nucleotide sequence
that is assembled from two or more constituent nucleotide sequences
that share common or overlapping regions of sequence homology. For
example, the nucleotide sequences of two or more nucleic acid
fragments can be compared and aligned in order to identify common
or overlapping sequences. Where common or overlapping sequences
exist between two or more nucleic acid fragments, the sequences
(and thus their corresponding nucleic acid fragments) can be
assembled into a single contiguous nucleotide sequence.
[0102] "PCR" or "Polymerase Chain Reaction" is a technique for the
synthesis of large quantities of specific DNA segments, consists of
a series of repetitive cycles (Perkin Elmer Cetus Instruments,
Norwalk, Conn.). Typically, the double stranded DNA is heat
denatured, the two primers complementary to the 3' boundaries of
the target segment are annealed at low temperature and then
extended at an intermediate temperature. One set of these three
consecutive steps is referred to as a cycle.
[0103] The terms "recombinant construct", "expression construct",
"recombinant expression construct", "chimeric construct" and
"chimeric gene" are used interchangeably herein. Such construct may
be itself or may be used in conjunction with a vector. If a vector
is used then the choice of vector is dependent upon the method that
will be used to transform host plants as is well known to those
skilled in the art. For example, a plasmid vector can be used. The
skilled artisan is well aware of the genetic elements that must be
present on the vector in order to successfully transform, select
and propagate host cells comprising any of the isolated nucleic
acid fragments of the invention. The skilled artisan will also
recognize that different independent transformation events will
result in different levels and patterns of expression (Jones et al,
(1985) EMBO J. 4:2411-2418; De Almeida et al, (1989) Mol. Gen.
Genetics 218:78-86), and thus that multiple events must be screened
in order to obtain lines displaying the desired expression level
and pattern. Such screening may be accomplished by Southern
analysis of DNA, Northern analysis of mRNA expression, Western
analysis of protein expression, or phenotypic analysis.
[0104] Co-suppression constructs in plants previously have been
designed by focusing on overexpression of a nucleic acid sequence
having homology to an endogenous mRNA, in the sense orientation,
which results in the reduction of all RNA having homology to the
overexpressed sequence (see Vaucheret et al (1998) Plant J
16:651-659; and Gura (2000) Nature 404:804-808). The overall
efficiency of this phenomenon is low, and the extent of the RNA
reduction is widely variable. Recent work has described the use of
"hairpin" structures that incorporate all, or part, of an mRNA
encoding sequence in a complementary orientation that results in a
potential "stem-loop" structure for the expressed RNA (PCT
Publication WO 99/53050 published on Oct. 21, 1999). This increases
the frequency of co-suppression in the recovered transgenic plants.
Another variation describes the use of plant viral sequences to
direct the suppression, or "silencing", of proximal mRNA encoding
sequences (PCT Publication WO 98/36083 published on Aug. 20, 1998).
Both of these co-suppressing phenomena have not been elucidated
mechanistically, although recent genetic evidence has begun to
unravel this complex situation (Elmayan et al (1998) Plant Cell
10:1747-1757).
[0105] Alternatively, a chimeric gene designed to express antisense
RNA for all or part of the instant nucleic acid fragment can be
constructed by linking the gene or gene fragment in reverse
orientation to plant promoter sequences. Either the co-suppression
or antisense chimeric genes could be introduced into plants via
transformation wherein expression of the corresponding endogenous
genes are reduced or eliminated.
[0106] Molecular genetic solutions to the generation of plants with
altered gene expression have a decided advantage over more
traditional plant breeding approaches. Changes in plant phenotypes
can be produced by specifically inhibiting expression of one or
more genes by antisense inhibition or cosuppression (U.S. Pat. Nos.
5,190,931, 5,107,065 and 5,283,323). An antisense or cosuppression
construct would act as a dominant negative regulator of gene
activity. While conventional mutations can yield negative
regulation of gene activity these effects are most likely
recessive. The dominant negative regulation available with a
transgenic approach may be advantageous from a breeding
perspective. In addition, the ability to restrict the expression of
a specific phenotype to the reproductive tissues of the plant by
the use of tissue specific promoters may confer agronomic
advantages relative to conventional mutations which may have an
effect in all tissues in which a mutant gene is ordinarily
expressed.
[0107] The person skilled in the art will know that special
considerations are associated with the use of antisense or
cosuppression technologies in order to reduce expression of
particular genes. For example, the proper level of expression of
sense or antisense genes may require the use of different chimeric
constructs utilizing different regulatory elements known to the
skilled artisan. Once transgenic plants are obtained by one of the
methods described above, it will be necessary to screen individual
transgenics for those that most effectively display the desired
phenotype. Accordingly, the skilled artisan will develop methods
for screening large numbers of transformants. The nature of these
screens will generally be chosen on practical grounds. For example,
one can screen by looking for changes in gene expression by using
antibodies specific for the protein encoded by the gene being
suppressed, or one could establish assays that specifically measure
enzyme activity. A preferred method will be one which allows large
numbers of samples to be processed rapidly, since it will be
expected that a large number of transformants will be negative for
the desired phenotype.
[0108] Loss of function mutant phenotypes may be identified for the
instant cDNA clones either by targeted gene disruption protocols or
by identifying specific mutants for these genes contained in a
maize population carrying mutations in all possible genes
(Ballinger and Benzer (1989) Proc. Natl. Acad. Sci USA
86:9402-9406; Koes et al (1995) Proc. Natl. Acad. Sci USA
92:8149-8153; Bensen et al (1995) Plant Cell 7:75-84). The latter
approach may be accomplished in two ways. First, short segments of
the instant nucleic acid fragments may be used in polymerase chain
reaction protocols in conjunction with a mutation tag sequence
primer on DNAs prepared from a population of plants in which
Mutator transposons or some other mutation-causing DNA element has
been introduced (see Bensen, supra). The amplification of a
specific DNA fragment with these primers indicates the insertion of
the mutation tag element in or near the plant gene encoding the
instant polypeptides. Alternatively, the instant nucleic acid
fragment may be used as a hybridization probe against PCR
amplification products generated from the mutation population using
the mutation tag sequence primer in conjunction with an arbitrary
genomic site primer, such as that for a restriction enzyme
site-anchored synthetic adaptor. With either method, a plant
containing a mutation in the endogenous gene encoding the instant
polypeptides can be identified and obtained. This mutant plant can
then be used to determine or confirm the natural function of the
instant polypeptides disclosed herein.
[0109] The terms Hap3, Lec1, and Hap3/Lec1 are used interchangeably
herein and refer to a class of transcription factors. The Hap3/Lec1
class is part of a broader family that includes other transcription
factors such as Hap5, Hap2, and Lec1-CCAAT. The terms Hap3-like,
Lec1-like, Hap3/Lec1-like, Hap5-like, Hap2-like, Lec1-CCAAT-like,
etc. refer to any transcription factors that share sequence
identity as disclosed herein and/or functionality with the
nucleotide sequences and the corresponding amino acid sequences
encoded by such nucleotide sequences disclosed in the present
invention.
[0110] Similarly, LIP15, SNF1, and CKC Aintegumenta are also
transcription factors that are believed to alter oil phenotypes in
plants. it is believed that MAP kinase 3, receptor-like protein
kinase, calcium EF-hand protein and ATP citrate lyase are members
of protein families that also influence oil accumulation in plants.
The suffix "-like" added to any named nucleic acid or amino acid
sequence of the aforementioned families refers to additional
members of the respective families that share sequence identity as
disclosed herein and/or functionality with the nucleotide sequences
and the corresponding amino acid sequences encoded by such
nucleotide sequences disclosed in the present invention.
[0111] Surprisingly and unexpectedly, it has been found that there
are a variety of regulatory/structural nucleic acid fragments,
which heretofore have not been associated with altering oil
phenotype in plants, that appear to be useful in altering oil
phenotype in plants. In addition to the CCAAT-binding transcription
factors, other proteins which heretofore have not been associated
with altering oil phenotype in plants, have been identified. The
nucleic acids identified encode a diverse class of regulatory and
structural polypeptides whose expression correlates with altered
oil phenotypes in plants. Altering the expression of these
polypeptides would be expected to have an effect in altering oil
accumulation in plants.
[0112] Other protein classes identified herein include:
[0113] a receptor-like protein kinase;
[0114] a MAP kinase 3;
[0115] a Hap2 transcription factor;
[0116] a Hap5 transcription factor;
[0117] a LIP15 transcription factor;
[0118] a calcium-binding EF-hand protein;
[0119] an ATP citrate lyase that catalyzes the formation of
cytosolic acetyl CoA (Rangasamy and Ratledge (1999) Mol Cell Biol
19:450-460; PCT Publication No. WO 00/00619 published on Jan. 6,
2000, which discloses an Arabidopsis thaliana ATP citrate
lyase);
[0120] a SNF1 transcription factors involved in glucose
metabolism;
[0121] a Hap3/Lec1 or Lec1-CCAAT binding transcription factor;
or
[0122] a seed developmental transcription factor CKC related to an
Aintegumenta transcription factor.
[0123] They can be characterized as an isolated nucleotide fragment
comprising a nucleic acid sequence selected from the group
consisting of:
[0124] (a) a nucleic acid sequence encoding a first polypeptide
having receptor-like protein kinase activity, the first polypeptide
having at least 85% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of SEQ ID NOs:2 or 4; or
[0125] (b) a nucleic acid sequence encoding a third polypeptide
having MAP kinase-kinase-kinase activity, the third polypeptide
having at least 70% identity based on the Clustal method of
alignment when compared to a fourth polypeptide selected from the
group consisting of SEQ ID NOs:6, 8, 10, 12, 14, 16, 493, 495, or
497; or
[0126] (c) a nucleic acid sequence encoding a fifth polypeptide
having Hap2-like transcription factor activity, the fifth
polypeptide having at least 70% identity based on the Clustal
method of alignment when compared to a sixth polypeptide selected
from the group consisting of SEQ ID NOs:18, 20, 22, 26, 28, 30, 32,
34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 62, 64, 66, 68,
70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 461,
463, 465, 467, or 469; or
[0127] (d) a nucleic acid sequence encoding a seventh polypeptide
having Hap5-like transcription factor activity, the seventh
polypeptide having at least 80% identity based on the Clustal
method of alignment when compared to an eighth polypeptide selected
from the group consisting of SEQ ID NOs:100, 102, 104, 106, 108,
110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134,
136, 138, 140, 142, or 144, or 474; or
[0128] (e) a nucleic acid sequence encoding a ninth polypeptide
having LIP15-like transcription factor activity, the ninth
polypeptide having at least 85% identity based on the Clustal
method of alignment when compared to a tenth polypeptide selected
from the group consisting of SEQ ID NOs:148, 152, or 154; or
[0129] (f) a nucleic acid sequence encoding an eleventh polypeptide
caleosin-like activity, the eleventh polypeptide having at least
70% identity based on the Clustal method of alignment when compared
to a twelfth polypeptide selected from the group consisting of SEQ
ID NOs:158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180,
182, 184, 186, 188, 190, 192, 194, 196, 198, 499, 501, 503, 505,
507, 509, 511, 513, 515, 517, 519, 521, 523, 525, or 527; or
[0130] (g) a nucleic acid sequence encoding a thirteenth
polypeptide having ATP citrate lyase activity, the thirteenth
polypeptide having at least 94% identity based on the Clustal
method of alignment when compared to a fourteenth polypeptide
selected from the group consisting of SEQ ID NOs:200, 202, 204,
206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, or
232; or
[0131] (h) a nucleic acid sequence encoding a fifteenth polypeptide
having SNF1-like activity, the fifteenth polypeptide having at
least 90% identity based on the Clustal method of alignment when
compared to a sixteenth polypeptide selected from the group
consisting of SEQ ID NOs:244, 256, or 258; or
[0132] (i) a nucleic acid sequence encoding a seventeenth
polypeptide having Hap3/Lec1-like activity, the seventeenth
polypeptide having at least 70% identity based on the Clustal
method of alignment when compared to a eighteenth polypeptide
selected from the group consisting of SEQ ID NOs:260, 262, 264, or
266; or
[0133] (j) a nucleic acid sequence encoding a nineteenth
polypeptide having Aintegumenta-like transcription factor activity,
the nineteenth polypeptide having at least 88% identity based on
the Clustal method of alignment when compared to an twentieth
polypeptide selected from the group consisting of SEQ ID NOs:310,
312, 316, 318, 320, 328, 330, 332, 338, 342, 344, 348, 352, 354,
358, 362, 477, 479, 481, 483, 485, 487, 489, or 491.
[0134] It is understood by one skilled in the art that other
percent identity ranges may be useful in the above mentioned
characterization. Useful percent identities would include, but not
be limited to, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and
all integer percentages from 45 to 100%.
[0135] The complement of the nucleotide fragments of this
inventions are encompassed within the scope of this invention.
[0136] Those skilled in the art with also appreciate that the
nucleotide fragment of this invention and/or the complement thereof
can be used in whole or in part in antisense inhibition or
co-suppression of a transformed plant.
[0137] In a more preferred embodiment, the first polypeptide
mentioned above is as follows with respect to each part, the first
polypeptide in
[0138] part (a) is a receptor-like protein kinase (RLK);
[0139] part (b) is a MAP kinase 3;
[0140] part (c) is a Hap2 transcription factor;
[0141] part (d) is a Hap5 transcription factor;
[0142] part (e) is a LIP15 transcription factor;
[0143] part (f) is a calcium-binding EF-hand protein;
[0144] part (g) is an ATP citrate lyase;
[0145] part (h) is a SNF1 transcription factor
[0146] part (i) is a Hap3/Lec1 or Lec1-CCAAT binding transcription
factor
[0147] part (j) is a seed development transcription factor similar
to Aintegumenta.
[0148] Plant receptor-like protein kinases (RLKs) constitute a
large family of RLKs that are remarkable for their diversity in
their structural and functional properties and therefore open a
broad area of investigation into cellular signalling in plants with
far-reaching implications for the mechanisms by which plant cells
perceive and respond to extracellular signals. The plant
counterparts of membrane-related protein kinase activity (RLKs)
show structural similarity to animal polypeptide growth factor
receptors that contain an extracellular ligand-binding domain, a
single membrane-spanning region, and a conserved cytoplasmic domain
with protein kinase activity. Most of the equivalent animal protein
kinase receptors are Tyr kinases, whereas in plants, most of the
identified kinase receptors, belong to the family of Ser/Thr
protein kinases. Based on the structural similarity of their
extracellular region RLKs are classified into three main
categories: the S domain class, the LRR class, and the group that
carries epidermal growth factor-like repeats (Braun and Walker
(1996) Trends Biochem. 21: 70-73). A novel class of receptor
kinases containing a taumatin-like domain is related to plant
defense proteins (Wang et al (1996) Proc Natl Acad Sci USA 93:
2598-2602). The diversity of structure and array of gene expression
patterns different members of the RLK family suggest that they
respond to diverse extracellular signals and display different
physiological functions. A variety of signalling molecules
responsible for the transmission of information downstream from
animal receptor tyrosine kinases, have been revealed in animals. In
higher plants, evidence has been obtained for the existence of a
number of soluble, cytoplasmic serine protein kinases including
raf-like protein kinases, elements of the MAPkinase pathway,
protein phospatases and G-proteins. It is therefore likely that
plant RLKs are components of signalling pathways similar to those
described in animals and are involved in regulating a wide range of
cellular processes including carbohydrate partitioning (Walker
(1994) Plant Mol Biol 26: 1599-1609).
[0149] ATP-dependent citrate lyase (ACL) enzymes have been found in
bacteria (Wahlund and Tabita (1997) J Bacteriol 179: 4859-4867),
all animal tissues (Srere (1959) J Biol Chem 234: 2544-2547), some
oleaginous yeasts and molds (Guerritore and Honozet (1970)
Experientia 26: 28-30. Lowry et al (1951) J Biol Chem 193:
265-275), plants (Fritsch and Beevers (1979) Plant Physiol
63:687-691), and green algae (Chen and Gibbs (1992) Plant Physiol
98: 535-539). The function of this enzyme in eukaryotes is to
provide cytosolic acetyl-CoA for biosynthesis of fats,
cholesterols, and gangliosides, whereas in bacteria ACL has been
found only in organisms, which employ the reductive TCA cycle to
assimilate CO.sub.2 into cell material. In eukaryotes ACL is a
cytosolic enzyme that catalyses the formation of acetyl-CoA and
oxaloacetate from coenzyme A and citrate, with concomitant
hydrolysis of ATP. Animal ACL polypeptides have a molecular mass of
110-120 kDa and are encoded by a single gene. In plants and
filamentous fungi, ACL consists of two different subunits of 70 kDa
and 55 kDa, respectively. Acetyl-CoA is the precursor for fatty
acid biosynthesis in plastids of plants. Since Acetyl-CoA does not
cross the membranes of subcellular compartments, it must be
synthesized inside plastids. While the origin of plastid Acetyl-CoA
has been subject of much speculation in plant fatty acid
biosynthesis, in animals, fungi and yeast, acetyl-CoA is formed
from citrate generated in the mitochondria and exported to the
cytosol via a tricarbolxylic acid transporter and converted to
acetyl-CoA by cytosolic ACL. It has been proposed that ACL is
associated in part with the plastids of different plant species
(Rangasamy and Ratledge (2000) Plant Physiol 122:1225-1230). In
addition it has been shown that ACL activity increases
concomitantly with oil biosynthesis during seed development in
oilseed rape (Ratledge et al (1997) Lipids 32: 7-12). This suggests
that ACL activity might regulate the rate of plant fatty acid
synthesis by controlling the rate at which acetyl-CoA is provided
for ACCase, similar to what occurs with oleaginous yeasts (Evans
and Ratledge (1985) Biotech Genet Eng Rev 3: 349-375). Only
recently, researchers were able to successfully overexpress the rat
liver ACL in Tobacco leave plastids, with a concomitant increase in
total fatty acids (Rangasamy and Ratledge (2000) Plant Physiol
122:1231-1238).
[0150] Hereupon overexpression of ACL in plastid of plants, the
side of de novo fatty acid biosynthesis in plants, may lead to an
increase in fatty acid content in the target tissue, in particular
when targeted to an oil producing tissue such as the seed.
[0151] Recently a group of proteins, caleosins, which contain an
N-terminal region with a single Ca+2 binding EF-hand domain, a
central hydrophobic region with a potential membrane anchor, and a
C-terminal region with conserved protein kinase phosphorylation
sites was identified in plants (Naestadt et al (2000) Plant Mol
Biol 44: 463-476). Proteins with a single EF-hand are rare among
the EF-hand proteins described to date. In most of them, EF-hands
are paired to promote cooperative, high affinity binding of two
calcium ions within the hydrophobic pocket formed by both sites.
Most EF-hand proteins are either soluble in the cytosol or on
membranes facing the cytosol, a few are present within the lumen of
organelles in the secretory pathway (Ikura (1996) Trends in
Biochem. Sci. 26: 14-17. Lin et al (1998) J Cell Biol 141:
1515-1527). Unlike these, caleosins do not have a N-terminal signal
peptide, but include a central hydrophobic region with the
potential to form a transmembrane helix (Frandsen et al (1996) J
Biol Chem 271: 343-348). Caleosin have been found to be associated
with the oil-bodies, similar to oleosins, and also appear to be
associated with an ER subdomain at the early stages of embryo
development in Arabidopsis, when storage oil-body and storage
protein formation commence. Caleosins are encoded by multigene
families in plants and have been identified in a variety of plant
species (Chen et al (1998) Plant Cell Physiol 39: 935-941. Nuccio
and Thomas (1999) Plant Mol Biol 39: 1153-1163.). The possible
participation of caleosin in processes associated with formation of
the ER subdomain, where oil-bodies are formed makes it an
attractive candidate for attempting to increase oil content in
plants.
[0152] Lec1 homologs may be further identified by using conserved
sequence motifs. The following amino acid sequence (given in single
letter code, with "x" representing any amino acid). Under lined
amino acids are those that are conserved in Lec1 but not found in
Lec1-related proteins.
TABLE-US-00002 REQDxxMPxANVxRIMRxxLPxxAKISDDAKExIQECVSExIS
FxTxEANxRCxxxxRKTxxxE
[0153] In a further embodiment, this invention encompasses chimeric
construct comprising any of the isolated nucleic acid fragments of
the invention or complement thereof operably linked to at least one
regulatory sequence. It is also understood that chimeric constructs
comprising such fragments or complements thereof or parts of either
can be used in antisense inhibition or suppression of a transformed
plant.
[0154] Also within the scope of this invention is a plant
comprising in its genome a chimeric construct as described herein.
Chimeric constructs designed for plant expression such as those
described herein can be introduced into a plant cell in a number of
art-recognized ways. Those skilled in the art will appreciate that
the choice of method might depend on the type of plant (i.e.,
monocot or dicot) and/or organelle (i.e., nucleus, chloroplast,
mitochondria) targeted for transformation. Suitable methods for
transforming plant cells include microinjection, electroporation,
Agrobacterium mediated transformation, direct gene transfer and
particle-accelerated or "gene gun" transformation technology as is
discussed above.
[0155] Examples of plants which can be transformed include, but are
not limited to, corn, soybean, wheat, rice, canola, Brassica,
sorghum, sunflower, and coconut.
[0156] The regeneration, development and cultivation of plants from
single plant protoplast transformants or from various transformed
explants is well known in the art (Weissbach and Weissbach, In,
Methods for Plant Molecular Biology, (Eds.), Academic Press, Inc.,
San Diego, Calif. (1988)). This regeneration and growth process
typically includes the steps of selection of transformed cells,
culturing those individualized cells through the usual stages of
embryonic development through the rooted plantlet stage. Transgenic
embryos and seeds are similarly regenerated. The resulting
transgenic rooted shoots are thereafter planted in an appropriate
plant growth medium such as soil.
[0157] The development or regeneration of plants containing the
foreign, exogenous gene that encodes a protein of interest is well
known in the art. Preferably, the regenerated plants are
self-pollinated to provide homozygous transgenic plants. Otherwise,
pollen obtained from the regenerated plants is crossed to
seed-grown plants of agronomically important lines. Conversely,
pollen from plants of these important lines is used to pollinate
regenerated plants. A transgenic plant of the present invention
containing a desired polypeptide is cultivated using methods well
known to one skilled in the art.
[0158] There are a variety of methods for the regeneration of
plants from plant tissue. The particular method of regeneration
will depend on the starting plant tissue and the particular plant
species to be regenerated. Methods for transforming dicots,
primarily by use of Agrobacterium tumefaciens, and obtaining
transgenic plants have been published for cotton (U.S. Pat. No.
5,004,863, U.S. Pat. No. 5,159,135, U.S. Pat. No. 5,518,908);
soybean (U.S. Pat. No. 5,569,834, U.S. Pat. No. 5,416,011, McCabe
et. al., Bio/Technology 6:923 (1988), Christou et al., Plant
Physiol. 87:671-674 (1988)); Brassica (U.S. Pat. No. 5,463,174);
peanut (Cheng et al., Plant Cell Rep. 15:653-657 (1996), McKently
et al., Plant Cell Rep. 14:699-703 (1995)); papaya; and pea (Grant
et al., Plant Cell Rep. 15:254-258, (1995)).
[0159] Transformation of monocotyledons using electroporation,
particle bombardment, and Agrobacterium have also been reported.
Transformation and plant regeneration have been achieved in
asparagus (Bytebier et al., Proc. Natl. Acad. Sci. (USA) 84:5354,
(1987)); barley (Wan and Lemaux, Plant Physiol 104:37 (1994)); Zea
mays (Rhodes et al., Science 240:204 (1988), Gordon-Kamm et al.,
Plant Cell 2:603-618 (1990), Fromm et al., Bio/Technology 8:833
(1990), Koziel et al., Bio/Technology 11: 194, (1993), Armstrong et
al., Crop Science 35:550-557 (1995)); oat (Somers et al.,
Bio/Technology 10: 15 89 (1992)); orchard grass (Horn et al., Plant
Cell Rep. 7:469 (1988)); rice (Toriyama et al., TheorAppl. Genet.
205:34, (1986); Part et al., Plant Mol. Biol. 32:1135-1148, (1996);
Abedinia et al., Aust. J. Plant Physiol. 24:133-141 (1997); Zhang
and Wu, Theor. Appl. Genet. 76:835 (1988); Zhang et al. Plant Cell
Rep. 7:379, (1988); Battraw and Hall, Plant Sci. 86:191-202 (1992);
Christou et al., Bio/Technology 9:957 (1991)); rye (De la Pena et
al., Nature 325:274 (1987)); sugarcane (Bower and Birch, Plant J.
2:409 (1992)); tall fescue (Wang et al., Bio/Technology 10:691
(1992)), and wheat (Vasil et al., Bio/Technology 10:667 (1992);
U.S. Pat. No. 5,631,152).
[0160] Assays for gene expression based on the transient expression
of cloned nucleic acid constructs have been developed by
introducing the nucleic acid molecules into plant cells by
polyethylene glycol treatment, electroporation, or particle
bombardment (Marcotte et al., Nature 335:454-457 (1988); Marcotte
et al., Plant Cell 1:523-532 (1989); McCarty et al., Cell
66:895-905 (1991); Hattori et al., Genes Dev. 6:609-618 (1992);
Goff et al., EMBO J. 9:2517-2522 (1990)).
[0161] Transient expression systems may be used to functionally
dissect gene constructs (see generally, Maliga et al., Methods in
Plant Molecular Biology, Cold Spring Harbor Press (1995)). It is
understood that any of the nucleic acid molecules of the present
invention can be introduced into a plant cell in a permanent or
transient manner in combination with other genetic elements such as
vectors, promoters, enhancers etc.
[0162] In addition to the above discussed procedures, practitioners
are familiar with the standard resource materials which describe
specific conditions and procedures for the construction,
manipulation and isolation of macromolecules (e.g., DNA molecules,
plasmids, etc.), generation of recombinant organisms and the
screening and isolating of clones, (see for example, Sambrook et
al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Press (1989); Maliga et al., Methods in Plant Molecular Biology,
Cold Spring Harbor Press (1995); Birren et al., Genome Analysis:
Detecting Genes, 1, Cold Spring Harbor, N.Y. (1998); Birren et al.,
Genome Analysis Analyzing DNA, 2, Cold Spring Harbor, N.Y. (1998);
Plant Molecular Biology: A Laboratory Manual, eds. Clark, Springer,
New York (1997)).
[0163] Seeds obtained from such plants and oil obtained from these
seeds constitute another aspect of the present invention.
[0164] In an even further aspect, the invention concerns a method
for altering oil phenotype in a plant which comprises:
[0165] (a) transforming a plant with a chimeric construct of the
invention;
[0166] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0167] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0168] In a more specific embodiment, the invention concerns a
method for altering oil phenotype in a plant which comprises:
[0169] (a) transforming a plant with a chimeric construct
comprising isolated nucleotide fragment comprising a nucleic acid
sequence selected from the group consisting of: [0170] (i) a
nucleic acid sequence encoding a plant SNF1 protein kinase having
at least 60% identity based on the Clustal method of alignment when
compared to a second polypeptide selected from the group consisting
of even SEQ ID NOs: from 234 to 258 and SEQ ID NOs:400-409; [0171]
(ii) the complement of the nucleic acid sequence of (i); [0172]
(iii) the sequence of (i) or (ii) or a part thereof which is useful
in antisense inhibition or co-suppression in a transformed plant;
[0173] (iv) a nucleic acid sequence encoding a plant Hap3/Lec1
transcription factor having at least 60% identity based on the
Clustal method of alignment when compared to a second polypeptide
selected from the group consisting of even SEQ ID NOs: from 260 to
278, and SEQ ID NOs:411-412; [0174] (v) the complement of the
nucleic acid sequence of (iv); [0175] (vi) the sequence of (iv) or
(v) or a part thereof which is useful in antisense inhibition or
co-suppression in a transformed plant; [0176] (vii) a nucleic acid
sequence encoding a plant Lec1-related CCAAT binding transcription
factor having at least 60% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of even SEQ ID NOs: from 280 to 308, and SEQ ID
NOs:413-418; [0177] (viii) the complement of the nucleic acid
sequence of (vii); [0178] (ix) the sequence of (vii) or (viii) or a
part thereof which is useful in antisense inhibition or
co-suppression in a transformed plant; [0179] (x) a nucleic acid
sequence encoding a plant Aintegumenta-like transcription factor
having at least 60% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of even SEQ ID NOs: from 310 to 364, and SEQ ID
NO:419-429; [0180] (xi) the complement of the nucleic acid sequence
of (x); [0181] (xii) the sequence of (x) or (xi) or a part thereof
which is useful in antisense inhibition or co-suppression in a
transformed plant; [0182] wherein said nucleic acid sequence is
operably linked to at least one regulatory sequence;
[0183] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0184] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0185] It is understood by one skilled in the art that other
percent identity ranges may be useful in the above mentioned
method. Useful percent identities would include, but not be limited
to, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and all
integer percentages from 45 to 100%.
[0186] In an even further aspect, this invention concerns a method
to isolate nucleic acid fragments associated with altering oil
phenotype in a plant which comprises:
[0187] (a) comparing even SEQ ID NOs: from 2 to 364, and SEQ ID
NOs:365-429 and 528-532, and all odd SEQ ID NOs: from 477 to 527
with other polypeptide sequences for the purpose of identifying
polypeptides associated with altering oil phenotype in a plant;
[0188] (b) identifying the conserved sequences(s) or 4 or more
amino acids obtained in step (a);
[0189] (c) making region-specific nucleotide probe(s) or
oligomer(s) based on the conserved sequences identified in step
(b); and
[0190] (d) using the nucleotide probe(s) or oligomer(s) of step (c)
to isolate sequences associated with altering oil phenotype by
sequence dependent protocols.
[0191] In a most preferred aspect, this invention concerns a method
for altering oil phenotype in a plant which comprises:
[0192] (a) transforming a plant with a chimeric construct
comprising an isolated nucleic acid fragment operably linked to at
least one regulatory sequence wherein said fragment has a nucleic
acid sequence encoding a polypeptide having a sequence identity of
at least 60% based on the Clustal method of alignment when compared
to a polypeptide selected from the group consisting of even SEQ ID
NOs: from 2 to 364, and SEQ ID NOs:365-429 and 528-532, and all odd
SEQ ID NOs: from 477 to 527;
[0193] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0194] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0195] It is understood by one skilled in the art that other
percent identity ranges may be useful in the above mentioned
method. Useful percent identities would include, but not be limited
to, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and all
integer percentages from 45 to 100%.
[0196] In another aspect, this invention also concerns a method of
mapping genetic variations related to altered oil phenotypes in a
plant comprising: [0197] (a) crossing two plant varieties; and
[0198] (b) evaluating genetic variations with respect to nucleic
acid sequences set forth in the odd SEQ ID NOs: from 1 to 363, and
in even SEQ ID NOs: from 476 to 526, in progeny plants resulting
from the cross of step (a) wherein the evaluation is made using a
method selected from the group consisting of: RFLP analysis, SNP
analysis, and PCR-based analysis.
[0199] In another embodiment, this invention concerns a method of
molecular breeding to obtain altered oil phenotypes in a plant
comprising: [0200] (a) crossing two plant varieties; and [0201] (b)
evaluating genetic variations with respect to nucleic acid
sequences set forth in the odd SEQ ID NOs: from 1 to 363, and in
even SEQ ID NOs: from 476 to 526, in progeny plants resulting from
the cross of step (a) wherein the evaluation is made using a method
selected from the group consisting of: RFLP analysis, SNP analysis,
and PCR-based analysis.
[0202] The genetic variability at a particular locus (gene) due to
even minor base changes can alter the pattern of restriction enzyme
digestion fragments that can be generated. Pathogenic alterations
to the genotype can be due to deletions or insertions within the
gene being analyzed or even single nucleotide substitutions that
can create or delete a restriction enzyme recognition site. RFLP
analysis takes advantage of this and utilizes Southern blotting
with a probe corresponding to the gene of interest.
[0203] Thus, if a polymorphism (i.e., a commonly occurring
variation in a gene or segment of DNA; also, the existence of
several forms of a gene (alleles) in the same species) creates or
destroys a restriction endonuclease cleavage site, or if it results
in the loss or insertion of DNA (e.g., a variable nucleotide tandem
repeat (VNTR) polymorphism), it will alter the size or profile of
the DNA fragments that are generated by digestion with that
restriction endonuclease. As such, individuals that possess a
variant sequence can be distinguished from those having the
original sequence by restriction fragment analysis. Polymorphisms
that can be identified in this manner are termed "restriction
fragment length polymorphisms: ("RFLPs"). RFLPs have been widely
used in human and plant genetic analyses (Glassberg, UK Patent
Application 2135774; Skolnick et al, Cytogen. Cell Genet. 32:58-67
(1982); Botstein et al, Ann. J. Hum. Genet. 32:314-331 (1980);
Fischer et al (PCT Application WO 90/13668; Uhlen, PCT Application
WO 90/11369).
[0204] A central attribute of "single nucleotide polymorphisms" or
"SNPs" is that the site of the polymorphism is at a single
nucleotide. SNPs have certain reported advantages over RFLPs or
VNTRs. First, SNPs are more stable than other classes of
polymorphisms. Their spontaneous mutation rate is approximately
10.sup.-9 (Kornberg, DNA Replication, W.H. Freeman & Co., San
Francisco, 1980), approximately, 1,000 times less frequent than
VNTRs (U.S. Pat. No. 5,679,524). Second, SNPs occur at greater
frequency, and with greater uniformity than RFLPs and VNTRs. As
SNPs result from sequence variation, new polymorphisms can be
identified by sequencing random genomic or cDNA molecules. SNPs can
also result from deletions, point mutations and insertions. Any
single base alteration, whatever the cause, can be a SNP. The
greater frequency of SNPs means that they can be more readily
identified than the other classes of polymorphisms.
[0205] SNPs can be characterized using any of a variety of methods.
Such methods include the direct or indirect sequencing of the site,
the use of restriction enzymes where the respective alleles of the
site create or destroy a restriction site, the use of
allele-specific hybridization probes, the use of antibodies that
are specific for the proteins encoded by the different alleles of
the polymorphism or by other biochemical interpretation. SNPs can
be sequenced by a number of methods. Two basic methods may be sued
for DNA sequencing, the chain termination method of Sanger et al,
Proc. Natl. Acad. Sci. (U.S.A.) 74:5463-5467 (1977), and the
chemical degradation method of Maxam and Gilbert, Proc. Natl. Acad.
Sci. (U.S.A.) 74: 560-564 (1977).
[0206] Polymerase chain reaction ("PCR") is a powerful technique
used to amplify DNA millions of fold, by repeated replication of a
template, in a short period of time. (Mullis et al, Cold Spring
Harbor Symp. Quant. Biol. 51:263-273 (1986); Erlich et al, European
Patent Application 50,424; European Patent Application 84,796;
European Patent Application 258,017, European Patent Application
237,362; Mullis, European Patent Application 201,184, Mullis et al
U.S. Pat. No. 4,683,202; Erlich, U.S. Pat. No. 4,582,788; and Saiki
et al, U.S. Pat. No. 4,683,194). The process utilizes sets of
specific in vitro synthesized oligonucleotides to prime DNA
synthesis. The design of the primers is dependent upon the
sequences of DNA that are desired to be analyzed. The technique is
carried out through many cycles (usually 20-50) of melting the
template at high temperature, allowing the primers to anneal to
complementary sequences within the template and then replicating
the template with DNA polymerase.
[0207] The products of PCR reactions are analyzed by separation in
agarose gels followed by ethidium bromide staining and
visualization with UV transillumination. Alternatively, radioactive
dNTPs can be added to the PCR in order to incorporate label into
the products. In this case the products of PCR are visualized by
exposure of the gel to x-ray film. The added advantage of
radiolabeling PCR products is that the levels of individual
amplification products can be quantitated.
[0208] Furthermore, single point mutations can be detected by
modified PCR techniques such as the ligase chain reaction ("LCR")
and PCR-single strand conformational polymorphisms ("PCR-SSCP")
analysis. The PCR technique can also be sued to identify the level
of expression of genes in extremely small samples of material,
e.g., tissues or cells from a body. The technique is termed reverse
transcription-PCR ("RT-PCR").
[0209] In another embodiment, this invention concerns a method for
altering oil phenotype in a plant which comprises:
[0210] (a) transforming a plant with a chimeric construct
comprising isolated nucleotide fragment comprising a nucleic acid
sequence selected from the group consisting of: [0211] (i) a
nucleic acid sequence encoding a plant Hap3/Lec1 transcription
factor having at least 70% identity based on the Clustal method of
alignment when compared to a second polypeptide selected from the
group consisting of SEQ ID NOs:260, 262, 264, 268, 270, 272, 274,
276, 278, 411, 412. or 459; [0212] (ii) the complement of the
nucleic acid sequence of (iv); [0213] (iii) the sequence of (iv) or
(v) or a part thereof which is useful in antisense inhibition or
co-suppression in a transformed plant;
[0214] (b) growing the transformed plant under conditions suitable
for expression of the chimeric gene; and
[0215] (c) selecting those transformed plants whose oil phenotype
has been altered compared to the oil phenotype of an untransformed
plant.
[0216] It is understood by one skilled in the art that other
percent identity ranges may be useful in the above mentioned
method. Useful percent identities would include, but not be limited
to, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% and all
integer percentages from 45 to 100%.
[0217] In another aspect this invention concerns a method to
isolate nucleic acid fragments associated with altering oil
phenotype in a plant which comprises:
[0218] (a) comparing SEQ ID NOs:260, 262, 264, 268, 270, 272, 274,
276, 278, 411, 412. or 459 with other polypeptide sequences for the
purpose of identifying polypeptides associated with altering oil
phenotype in a plant;
[0219] (b) identifying the conserved sequences(s) or 4 or more
amino acids obtained in step (a);
[0220] (c) making region-specific nucleotide probe(s) or
oligomer(s) based on the conserved sequences identified in step
(b); and
[0221] (d) using the nucleotide probe(s) or oligomer(s) of step (c)
to isolate sequences associated with altering oil phenotype by
sequence dependent protocols.
EXAMPLES
[0222] The present invention is further defined in the following
Examples, in which parts and percentages are by weight and degrees
are Celsius, unless otherwise stated. The disclosure of each
reference set forth herein is incorporated herein by reference in
its entirety.
Example 1
Composition of cDNA Libraries
Isolation and Sequencing of cDNA Clones
[0223] cDNA libraries representing mRNAs from various plant tissues
were prepared. The characteristics of the libraries are described
below.
TABLE-US-00003 TABLE 2 cDNA Libraries from Various Plants Library
Tissue Clone cbn10 Corn Developing Kernel (Embryo and
cbn10.pk0005.e6:fis Endosperm); 10 Days After Pollination
cbn10.pk0064.e6 cc71se-a Corn Callus Type II Tissue, Somatic Embryo
cc71se-a.pk0002.e11:fis Formed cc71se-b Corn Callus Type II Tissue,
Somatic Embryo cc71se-b.pk0018.e4:fis Formed cca Corn Callus Type
II Tissue, Undifferentiated, cca.pk0026.d6 Highly Transformable
ccase-b Corn Callus Type II Tissue, Somatic Embryo
ccase-b.pk0003.b9:fis Formed, Highly Transformable cco1n Corn Cob
of 67 Day Old Plants Grown in cco1n.pk062.j7 Green House*
cco1n.pk086.d20:fis cco1n.pk0014.d4:fis cco1n.pk055.o18
cco1n.pk089.g17 cco1n.pk068.f18:fis cde1c Corn (Zea Mays, B73)
developing embryo cde1c.pk003.o22:fis 20 dap cde1n Corn (Zea mays,
B73) developing embryo cde1n.pk003.a5 20 DAP normalized
cde1n.pk001.n24:fis cdo1c Corn (Zea mays L.) ovary, 5 days after
silking cdo1c.pk001.c1:fis (includes pedicel and glumes) ceb3 Corn
Embryo 20 Days After Pollination ceb3.pk0012.a7 ceb5 Corn Embryo 30
Days After Pollination ceb5.pk0081.b4 cen3n Corn Endosperm 20 Days
After Pollination* cen3n.pk0164.a10 cen3n.pk0044.b8:fis
cen3n.pk0112.e10:fis cho1c Corn (Zea mays L., Alexho Synthetic High
Oil) cho1c.pk003.p17:fis embryo 20 DAP cho1c.pk003.n23
cho1c.pk004.b19:fis cho1c.pk007.l21:fis cho1c.pk001.l23:fis
cho1c.pk009.g10 clm1f Corn (Zea mays, B73) leaf at V6-VT (full
clm1f.pk001.k17 length) clm1f.pk002.o13:fis cpd1c Corn (Zea mays
L.) pooled BMS treated with cpd1c.pk011.i5:fis chemicals related to
protein kinases cpd1c.pk008.e21 cpf1c Corn (Zea mays L.) pooled BMS
treated with cpf1c.pk006.e3:fis chemicals related to protein
synthesis cpj1c Corn (Zea mays L.) pooled BMS treated with
cpj1c.pk005.m20:fis chemicals related to membrane ionic force cr1n
Corn Root From 7 Day Old Seedlings* cr1n.pk0080.g6 cse1c Corn (Zea
mays L.) seedling at V2 stage cse1c.pk001.h6 treated with Ethylene
collected at 6 hr, 23 hr, 72 hr cta1n Corn Tassel*
cta1n.pk0070.f3:fis cta1n.pk0074.h11 ctn1c Corn (Zea mays L., B73)
night harvested ctn1c.pk002.o4 tassel (v12 stage). ece1c castor
bean developing endosperm to ece1c.pk003.g23:fis compare/contrast
triacylglycerol biosynthesis ect1c Canna edulis Tubers
ect1c.pk001.k17:fis ect1c.pk007.p18:fis eef1c Eucalyptus
tereticornis flower buds from eef1c.pk004.c8:fis adult tree egh1c
Upland Cotton (Gossypium hirsutum) egh1c.pk005.k20 germinating
seeds, to identify cDNAs associated with N-acyl-
phosphatidylethanolamine synthesis etr1c Cattail (Typha latifolia)
root etr1c.pk006.f9 fds Momordica charantia Developing Seed
fds.pk0003.h5:fis fds1n.pk015.l15 hss1c Sclerotinia infected
sunflower plants hss1c.pk011.h10:fis ncs Catalpa speciosa
Developing Seed ncs.pk0013.c4 p0006 Young shoot p0006.cbysa51r:fis
p0015 13 DAP embryo p0015.cdpgu90r:fis p0015.cdpfm55r:fis p0016
Tassel shoTassel shoots, pooled, 0.1-1.4 cm p0016.ctsbf56rb p0018
Seedling after 10 day drought (T001), heat p0018.chssh26r shocked
for 24 hrs (T002), recovery at normal growth condition for 8 hrs,
16 hrs, 24 hrs p0026 Regenerating callus 5 days after auxin
p0026.ccrab39r removal Hi-II callus 223a, 1129e p0027 GS3 shoot
cultures that were transformed with p0027.cgsag51r PHP5869 and were
maintained on 273T shoot multiplication medium since Mar. 17, 1994
(sample received on May 29, 1996 for RNA prep). The original
transformation was done on Nov. 6, 1993 p0031 CM45 shoot culture.
It was initiated on Feb. 28, 1996 p0031.ccmau15r:fis from seed
derived meristems. The culture was p0031.ccmbc81r maintained on
273N medium. p0032 Regenerating callus, 10 and 14 days after
p0032.crcav77r:fis auxin removal. Hi-II callus 223a, 1129e 10 days.
Hi-II callus 223a, 1129e 14 days p0037 corn Root Worm infested V5
roots p0037.crwbs90r:fis p0083 7 DAP whole kernels
p0083.cldct11r:fis p0083.cldeu68r:fis p0083.clder12r p0086 P0067
screened 1; 11 DAP pericarp p0086.cbsaa24r p0118 Night harvested,
pooled stem tissue from the p0118.chsbc77r 4-5 internodes
subtending the tassel; V8-V12 p0118.chsbh89r stages, Screened 1
p0125 Anther: Prophase I sceened 1 p0125.czaab60rb:fis p0126 Night
harvested leaf tissue; V8-V10 p0126.cnlau71r:fis p0134 Hi-II callus
223a, 1129e, 10days hi-II callus p0134.carah47r 233a, 1129e, 14days
pps1c Prickly poppy developing seeds pps1c.pk001.h3:fis
pps1c.pk007.j21:fis rbm5c Rice (Oryza sativa, Cypress) bran 10 days
rbm5c.pk001.a19 after milling rca1c Rice Nipponbare Callus.
rca1c.pk007.b22:fis rca1n Rice (Oryza sativa L., Nipponbare) callus
rca1n.pk029.n22 normalized. rca1n.pk002.j3 rca1n.pk021.b20:fis
rca1n.pk004.j14:fis rca1n.pk026.m9 rca1n.pk008.o5:fis rl0n Rice 15
Day Old Leaf* r10n.pk096.h23 rl0n.pk0061.c8:fis rl0n.pk131.j17
r10n.pk0015.a4:fis rlm3n Rice (Oryza Sativa, YM) leaf mixture
(rsr9) rlm3n.pk005.d20:fis normalized at 45 C for 24 hrs using 20
fold excess of driver rlr2 Rice (Oryza sativa L.) leaf (15 DAG) 2
hrs after rlr2.pk0012.d2 infection of strain 4360-R-62 (AVR2-YAMO);
Resistant rlr24 Rice Leaf 15 Days After Germination, 24 Hours
rlr24.pk0032.e10 After Infection of Strain Magnaporthe grisea
4360-R-62 (AVR2-YAMO); Resistant rls6 Rice Leaf 15 Days After
Germination, 6 Hours rls6.pk0033.a9:fis After Infection of Strain
Magnaporthe grisea 4360-R-67 (AVR2-YAMO); Susceptible rls72 Rice
Leaf 15 Days After Germination, 72 Hours rls72.pk0023.c8:fis After
Infection of Strain Magnaporthe grisea 4360-R-67 (AVR2-YAMO);
Susceptible rr1 Rice Root of Two Week Old Developing
rr1.pk0039.d4:fis Seedling rr1.pk0003.a3:fis rr1.pk097.f22:fis
rr1.pk0047.g12:fis rsl1n Rice (Oryza sativa, YM) 15 day old
seedling rsl1n.pk002.g10:fis normalized rsl1n.pk002.j2:fis
rsl1n.pk006.n24:fis rsl1n.pk013.g2 scb1c Soybean (Glycine max L.,
2872) Embryogenic scb1c.pk004.n19:fis suspension culture subjected
to 4 bombardments and collected 12 hrs later. sde4c Soybean
Developing Embryo (9-11 mm) sde4c.pk0001.a2:fis sdp2c Soybean
(Glycine max L.) developing pods sdp2c.pk003.o5:fis 6-7 mm
sdp2c.pk023.n6:fis sdp2c.pk029.k17:fis sdp2c.pk044.e5:fis sdp3c
Soybean Developing Pods (8-9 mm) sdp3c.pk018.b9:fis
sdp3c.pk019.n1:fis sdp4c Soybean (Glycine max L.) developing pods
10-12 mm sdp4c.pk009.e3 sdp4c.pk016.e10 sdr1f Soybean (Glycine max,
Wye) 10 day old root sdr1f.pk001.p7 sds1f Soybean (Glycine max,
Wye) 11 day old sds1f.pk001.f7:fis seedling full length library
using trehalose se1 Soybean Embryo, 6 to 10 Days After Flowering
se1.pk0042.d8:fis se2 Soybean Embryo, 13 Days After Flowering
se2.11d12:fis se3 Soybean (Glycine max L.) embryo, 17 DAF
se3.pk0034.a3 ses2w Soybean Embryogenic Suspension 2 Weeks
ses2w.pk0015.a4:fis After Subculture ses2w.pk0035.a9:fis
ses2w.pk0012.d10:fis ses4d Soybean Embryogenic Suspension 4 Days
ses4d.pk0037.e3:fis After Subculture ses4d.pk0044.c12
ses4d.pk0006.a12 ses4d.pk0006.a12:fis ses4d.pk0043.d10:fis sfl1
Soybean Immature Flower sfl1.pk0102.h8 sfl1.pk131.j19 sfl1.pk135.g3
sfl1.pk0029.h10:fis sgc5c Soybean (Glycine max L., Wye) germanating
sgc5c.pk001.h16 cotyledon (3/4 yellow; 15-24 DAG) sgs1c Soybean
Seeds 4 Hours After Germination sgs1c.pk004.f19:fis sgs4c Soybean
(Glycine max L.) seeds 2 days after sgs4c.pk004.j2 germination.
sgs4c.pk006.g6 sgs4c.pk006.n21 sic1c Soybean (Glycine max) pooled
tissue of root, sic1c.pk003.o13:fis stem, and leaf with iron
chlorosis conditions sic1c.pk003.o18:fis sif1c Soybean (Glycine
max) pooled tissue of sif1c.pk001.m16:fis basal stem and root
infected with fusarium sls1c Soybean (Glycine max L., S1990)
infected sls1c.pk010.l1:fis with Sclerotinia sclerotiorum mycelium.
sls1c.pk032.j4 sls1c Soybean (Glycine max L., S1990) infected with
sls1c.pk010.l1:fis Sclerotinia sclerotiorum mycelium.
sls1c.pk020.h24 sls2c Soybean (Glycine max L., Manta) infected with
sls2c.pk007.c23:fis Sclerotinia sclerotiorum mycelium. sr1 Soybean
Root sr1.pk0041.a11:fis sr1.pk0049.c2 srb Scarlett runner bean (R.
Goldberg) srb.08g04 src1c Soybean 8 Day Old Root Infected With Cyst
src1c.pk003.o16:fis Nematode src2c Soybean (Glycine max L., 437654)
8 day old src2c.pk025.b3:fis root inoculated with eggs of cyst
Nematode src2c.pk011.m12:fis (Race 1) for 4 days.
src2c.pk009.g9:fis src2c.pk003.i13:fis src3c Soybean 8 Day Old Root
Infected With Cyst src3c.pk018.d10:fis Nematode sr3c.pk011.g22
src3c.pk012.m6:fis src3c.pk019.d4:fis src3c.pk009.b15
src3c.pk028.j21:fis sre Soybean (Glycine max L.) root elongation
sre.pk0037.c1 srr1c Soybean 8-Day-Old Root srr1c.pk001.i24:fis
srr3c Soybean 8-Day-Old Root srr3c.pk001.l10:fis Tobacco (Nicotiana
benthamiana) Leaves tlw1c Wounded by Abrasion and Harvested After
tlw1c.pk006.o16 1.5 Hour. vdb1c Grape (Vitis sp.) developing bud
vdb1c.pk001.m5:fis vmb1na Grape (Vitis sp.) midstage berries
normalized vmb1na.pk015.d18:fis vpl1c Grape (Vitis sp.) In vitro
plantlets vpl1c.pk008.o5:fis vrr1c Grape (Vitis sp.)resistant roots
vrr1c.pk004.o20:fis vs1n Vernonia Seed* vs1n.pk013.m13:fis wde1f
Wheat (Triticum aestivum, Hi Line) wde1f.pk003.h2:fis developing
endosperm 2-7 DPA wdk2c Wheat Developing Kernel, 7 Days After
wdk2c.pk009.e4 Anthesis. wdk2c Wheat Developing Kernel, 7 Days
After wdk2c.pk018.c16:fis Anthesis. wdk3c Wheat Developing Kernel,
14 Days After wdk3c.pk023.h15:fis Anthesis. wdk5c Wheat Developing
Kernel, 30 Days After wdk5c.pk006.m13 Anthesis wdk9n Wheat
(Triticum aestivu, Spring Wheat) wdk9n.pk001.k5 kernels 3, 7, 14
and 21 days after anthesis wdr1f Wheat (Triticum aestivum)
developing root wdr1f.pk003.b21:fis (full length) wds1f Wheat
developing seedling full length wds1f.pk002.p21:fis wia1c Wheat
(Triticum aestivum, Hi Line) immature wia1c.pk001.d20:fis anthers
wkm1c Wheat Kernel malted 55 Hours at 22 Degrees
wkm1c.pk0002.d7:fis Celsius wl1n Wheat Leaf From 7 Day Old
Seedling* wl1n.pk0114.f9 wle1n Wheat Leaf From 7 Day Old Etiolated
wle1n.pk0076.h7:fis Seedling* wlk8 Wheat Seedlings 8 Hours After
Treatment With wlk8.pk0001.e10:fis Fungicide** wlm96 Wheat
Seedlings 96 Hours After Inoculation With wlm96.pk060.d5 Erysiphe
graminis f. sp tritici wlm96.pk037.k9:fis wlm96.pk035.j11:fis
wlm96.pk0007.e4:fis wr1 Wheat Root From 7 Day Old Seedling
wr1.pk0094.f2:fis wr1.pk0153.c7:fis wr1.pk148.f7:fis wre1n Wheat
Root From 7 Day Old Etiolated wre1n.pk0066.e4:fis Seedling*
wre1n.pk0143.h2:fis *These libraries were normalized essentially as
described in U.S. Pat. No. 5,482,845, incorporated herein by
reference.
**Application of 6-iodo-3-propyl-2-propyloxy-4(3H)-quinazolinone;
synthesis and methods of using this compound are described in U.S.
Pat. No. 5,747,497.
[0224] cDNA libraries may be prepared by any one of many methods
available. For example, the cDNAs may be introduced into plasmid
vectors by first preparing the cDNA libraries in Uni-ZAP.TM. XR
vectors according to the manufacturer's protocol (Stratagene
Cloning Systems, La Jolla, Calif.). The Uni-ZAP.TM. XR libraries
are converted into plasmid libraries according to the protocol
provided by Stratagene. Upon conversion, cDNA inserts will be
contained in the plasmid vector pBluescript. In addition, the cDNAs
may be introduced directly into precut Bluescript II SK(+) vectors
(Stratagene) using T4 DNA ligase (New England Biolabs), followed by
transfection into DH10B cells according to the manufacturer's
protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid
vectors, plasmid DNAs are prepared from randomly picked bacterial
colonies containing recombinant pBluescript plasmids, or the insert
cDNA sequences are amplified via polymerase chain reaction using
primers specific for vector sequences flanking the inserted cDNA
sequences. Amplified insert DNAs or plasmid DNAs are sequenced in
dye-primer sequencing reactions to generate partial cDNA sequences
(expressed sequence tags or "ESTs"; see Adams et al, (1991) Science
252:1651-1656). The resulting ESTs are analyzed using a Perkin
Elmer Model 377 fluorescent sequencer.
[0225] Full-insert sequence (FIS) data is generated utilizing a
modified transposition protocol. Clones identified for FIS are
recovered from archived glycerol stocks as single colonies, and
plasmid DNAs are isolated via alkaline lysis. Isolated DNA
templates are reacted with vector primed M13 forward and reverse
oligonucleotides in a PCR-based sequencing reaction and loaded onto
automated sequencers. Confirmation of clone identification is
performed by sequence alignment to the original EST sequence from
which the FIS request is made.
[0226] Confirmed templates are transposed via the Primer Island
transposition kit (PE Applied Biosystems, Foster City, Calif.)
which is based upon the Saccharomyces cerevisiae Ty1 transposable
element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772).
The in vitro transposition system places unique binding sites
randomly throughout a population of large DNA molecules. The
transposed DNA is then used to transform DH10B electro-competent
cells (Gibco BRL/Life Technologies, Rockville, Md.) via
electroporation. The transposable element contains an additional
selectable marker (named DHFR; Fling and Richards (1983) Nucleic
Acids Res. 11:5147-5158), allowing for dual selection on agar
plates of only those subclones containing the integrated
transposon. Multiple subclones are randomly selected from each
transposition reaction, plasmid DNAs are prepared via alkaline
lysis, and templates are sequenced (ABI Prism dye-terminator
ReadyReaction mix) outward from the transposition event site,
utilizing unique primers specific to the binding sites within the
transposon.
[0227] Sequence data is collected (ABI Prism Collections) and
assembled using Phred/Phrap (P. Green, University of Washington,
Seattle). Phrep/Phrap is a public domain software program which
re-reads the ABI sequence data, re-calls the bases, assigns quality
values, and writes the base calls and quality values into editable
output files. The Phrap sequence assembly program uses these
quality values to increase the accuracy of the assembled sequence
contigs. Assemblies are viewed by the Consed sequence editor (D.
Gordon, University of Washington, Seattle).
[0228] In some of the clones the cDNA fragment corresponds to a
portion of the 3'-terminus of the gene and does not cover the
entire open reading frame. In order to obtain the upstream
information one of two different protocols are used. The first of
these methods results in the production of a fragment of DNA
containing a portion of the desired gene sequence while the second
method results in the production of a fragment containing the
entire open reading frame. Both of these methods use two rounds of
PCR amplification to obtain fragments from one or more libraries.
The libraries some times are chosen based on previous knowledge
that the specific gene should be found in a certain tissue and some
times are randomly-chosen. Reactions to obtain the same gene may be
performed on several libraries in parallel or on a pool of
libraries. Library pools are normally prepared using from 3 to 5
different libraries and normalized to a uniform dilution. In the
first round of amplification both methods use a vector-specific
(forward) primer corresponding to a portion of the vector located
at the 5'-terminus of the clone coupled with a gene-specific
(reverse) primer. The first method uses a sequence that is
complementary to a portion of the already known gene sequence while
the second method uses a gene-specific primer complementary to a
portion of the 3'-untranslated region (also referred to as UTR). In
the second round of amplification a nested set of primers is used
for both methods. The resulting DNA fragment is ligated into a
pBluescript vector using a commercial kit and following the
manufacturer's protocol. This kit is selected from many available
from several vendors including Invitrogen (Carlsbad, Calif.),
Promega Biotech (Madison, Wis.), and Gibco-BRL (Gaithersburg, Md.).
The plasmid DNA is isolated by alkaline lysis method and submitted
for sequencing and assembly using Phred/Phrap, as above.
Example 2
Identification of cDNA Clones
[0229] cDNA clones encoding proteins involved in altering plant oil
traits were identified by gene profiling (see Examples 6 and 8) and
by conducting BLAST (Basic Local Alignment Search Tool; Altschul et
al (1993) J. Mol. Biol. 215:403-410; see also
www.ncbi.nlm.nih.gov/BLAST/) searches for similarity to sequences
contained in the BLAST "nr" database (comprising all non-redundant
GenBank CDS translations, sequences derived from the 3-dimensional
structure Brookhaven Protein Data Bank, the last major release of
the SWISS-PROT protein sequence database, EMBL, and DDBJ
databases). The cDNA sequences obtained in Example 1 were analyzed
for similarity to all publicly available DNA sequences contained in
the "nr" database using the BLASTN algorithm provided by the
National Center for Biotechnology Information (NCBI). The DNA
sequences were translated in all reading frames and compared for
similarity to all publicly available protein sequences contained in
the "nr" database using the BLASTX algorithm (Gish and States
(1993) Nat. Genet. 3:266-272) provided by the NCBI. For
convenience, the P-value (probability) of observing a match of a
cDNA sequence to a sequence contained in the searched databases
merely by chance as calculated by BLAST are reported herein as
"pLog" values, which represent the negative of the logarithm of the
reported P-value. Accordingly, the greater the pLog value, the
greater the likelihood that the cDNA sequence and the BLAST "hit"
represent homologous proteins.
[0230] ESTs submitted for analysis are compared to the genebank
database as described above. ESTs that contain sequences more 5- or
3-prime can be found by using the BLASTn algorithm (Altschul et al
(1997) Nucleic Acids Res. 25:3389-3402.) against the DuPont
proprietary database comparing nucleotide sequences that share
common or overlapping regions of sequence homology. Where common or
overlapping sequences exist between two or more nucleic acid
fragments, the sequences can be assembled into a single contiguous
nucleotide sequence, thus extending the original fragment in either
the 5 or 3 prime direction. Once the most 5-prime EST is
identified, its complete sequence can be determined by Full Insert
Sequencing as described in Example 1. Homologous genes belonging to
different species can be found by comparing the amino acid sequence
of a known gene (from either a proprietary source or a public
database) against an EST database using the tBLASTn algorithm. The
tBLASTn algorithm searches an amino acid query against a nucleotide
database that is translated in all 6 reading frames. This search
allows for differences in nucleotide codon usage between different
species, and for codon degeneracy.
Example 3
Characterization of cDNA Clones Encoding Proteins Involved in
Altering Oil Phenotypes
[0231] The BLASTX search using the EST sequences from clones listed
in Table 3 revealed similarity of the polypeptides encoded by the
cDNAs to receptor protein kinases, MEK3 homologs, Hap2 homologs,
LIP 15 homologs, calcium EF-hand proteins, ATP citrate lyase,
glucose metabolism proteins such as SNF1 homologs, Lec1
transcription factors, and seed developmentally regulated
transcription factors such as CKC (Aintegumenta-like) homologs from
various species including Arabidopsis thaliana, rice (Oryza
sativa), corn (Zea mays), soybean (Glycine max), cucmber (Cucumis
sativus), Sordaria (Sordaria macrospora), sesame (Sesamum indicum),
grape (Vitis sp.), Brassica (Brassica napus), and tobacco
(Nicotiana tabacum). Shown in Table 3 are the BLAST results for
individual ESTs ("EST"), the sequences of the entire cDNA inserts
comprising the indicated cDNA clones ("FIS"), the sequences of
contigs assembled from two or more ESTs ("Contig"), sequences of
contigs assembled from an FIS and one or more ESTs ("Contig*", or
sequences encoding an entire protein derived from an FIS, a contig,
or an FIS and PCR ("CGS"):
TABLE-US-00004 TABLE 3 BLAST Results for Sequences Encoding
Polypeptides Homologous to Proteins Involved in Altering Oil
Phenotypes SEQ ID NO. Gene Name Clone Homolog Genbank # pLOG 2
Receptor PK cho1c.pk003.p17:fis Arabidopsis 3063445 14.0 4 Receptor
PK ceb3.pk0012.a7 Arabidopsis 7488207 74.2 6 MEK3 cho1c.pk003.n23
Tobacco 1362112 16.5 8 MEK3 p0125.czaab60rb:fis Tobacco 1362112
180.0 10 MEK3 rlr24.pk0032.e10 Arabidopsis 7487975 13.5 12 MEK3
r10n.pk096.h23 Arabidopsis 7487976 30.5 14 MEK3 src3c.pk018.d10:fis
Arabidopsis 4006878 92.5 16 MEK3 sr3c.pk011.g22 Arabidopsis 4006878
23.7 18 Hap2a ncs.pk0013.c4 No hits -- 20 Hap2c etr1c.pk006.f9 No
hits -- 22 Hap2a vmb1na.pk015.d18 Arabidopsis 11282597 8.1 24 Hap2a
vpl1c.pk008.o5:fis Grape 7141243 91.2 26 Hap2c vdb1c.pk001.m5:fis
Rice 7489565 38.0 28 Hap2c cho1c.pk004.b19:fis Rice 7489565 94.3 30
Hap2c p0015.cdpgu90r:fis Rice 7489565 96.2 32 Hap2a
cta1n.pk0070.f3:fis Rice 7489565 38.1 34 Hap2a cco1n.pk0014.d4:fis
Arabidopsis 6634774 37.2 36 Hap2a cco1n.pk086.d20:fis Arabidopsis
6634774 36.3 38 Hap2b p0126.cnlau71r:fis Rice 7489565 23.7 40 Hap2b
p0104.cabav52r Rice 7489565 16.7 42 Hap2b cho1c.pk007.l21:fis Rice
7489565 35.0 44 Hap2c contig of: Rice 7489565 43.5 cca.pk0026.d6
cen3n.pk0061.e10:fis cen3n.pk0135.c2 cho1c.pk001.n24 p0092.chwae40r
46 Hap2c cpf1c.pk006.e3:fis Rice 7489565 44.0 48 Hap2c contig of:
Rice 7489565 35.0 cr1n.pk0080.g6 p0003.cgpge51r 50 Hap2c
p0015.cdpfm55r:fis Arabidopsis 4587559 26.4 52 Hap2
p0083.cldct11r:fis Rice 7489565 91.4 54 Hap2 p0083.cldeu68r:fis
Rice 7489565 14.2 56 Hap2a pps1c.pk001.h3:fis Arabidopsis 9293997
45.5 58 Hap2c pps1c.pk007.j21:fis Arabidopsis 5903072 53.7 60 Hap2
rr1.pk0030.f7:fis Rice 7489565 identical 62 Hap2a
rls72.pk0023.c8:fis Arabidopsis 9293997 36.5 64 Hap2a
rca1n.pk002.c15 Grape 7141243 7.7 66 Hap2a rds3c.pk001.g9 Rice
7489565 18.2 68 Hap2b rca1n.pk002.j3:fis Rice 7489565 26.0 70 Hap2c
rca1n.pk029.n22:fis Arabidopsis 8778470 29.2 72 Hap2b
r10n.pk131.j17 Rice 7489565 10.5 74 Hap2a sdp3c.pk018.b9:fis
Arabidopsis 2398521 74.5 76 Hap2a sfl1.pk0102.h8 Grape 7141243 36.7
78 Hap2a srr3c.pk001.l10:fis Brassica 1586551 48.7 80 Hap2a
sdp2c.pk003.o5:fis Arabidopsis 6634774 53.0 82 Hap2b
sif1c.pk001.m16:fis Arabidopsis 6714441 180.0 84 Hap2c
src1c.pk003.o16:fis Rice 7489565 33.5 86 Hap2c src3c.pk012.m6:fis
Rice 7489565 31.5 88 Hap2a hss1c.pk011.h10:fis Arabidopsis 9293997
48.7 90 Hap2c wr1.pk0094.f2:fis Rice 7489565 92.7 92 Hap2a
wre1n.pk0143.h2:fis Arabidopsis 6634774 35.0 94 Hap2b
wds1f.pk002.p21:fis Arabidopsis 6714441 26.5 96 Hap2b contig of:
Rice 7489565 38.5 wdi1c.pk002.b10 wr1.pk0153.c7:fis 98 Hap2c
wre1n.pk0066.e4:fis Rice 7489565 42.7 100 Hap5c ect1c.pk001.k17:fis
Rice 5257260 57.0 102 Hap5a vrr1c.pk004.o20:fis Arabidopsis 6523090
93.0 104 Hap5a clm1f.pk001.k17:fis Arabidopsis 6523090 66.7 106
Hap5b cde1n.pk003.a5:fis Arabidopsis 3776575 57.0 108 Hap5b
cen3n.pk0164.a10:fis Arabidopsis 3776575 57.0 110 Hap5b
p0118.chsbc77r Arabidopsis 3776575 58.5 112 Hap5c cco1n.pk055.o18
Rice 5257260 41.0 114 Hap5c cho1c.pk001.l23:fis Rice 5257260 82.0
116 Hap5c cse1c.pk001.h6:fis Rice 5257260 86.4 118 Hap5a
rlm3n.pk005.d20:fis Arabidopsis 6523090 66.7 120 Hap5b
rr1.pk0003.a3:fis Arabidopsis 6289057 58.5 122 Hap5b
rr1.pk0039.d4:fis Arabidopsis 3776575 57.2 124 Hap5c
rca1n.pk021.b20:fis Rice 5257260 74.0 126 Hap5a sdp2c.pk029.k17:fis
Arabidopsis 6523090 90.5 128 Hap5a sdp2c.pk044.e5:fis Arabidopsis
6523090 92.4 130 Hap5b sgs4c.pk004.j2 Arabidopsis 3776575 18.5 132
Hap5b src3c.pk002.h4:fis Arabidopsis 6289057 61.1 134 Hap5b
src3c.pk009.b15:fis Arabidopsis 6289057 61.5 136 Hap5b
src3c.pk019.d4:fis Arabidopsis 6056368 51.5 138 Hap5c
sls1c.pk032.j4:fis Arabidopsis 6289057 74.5 140 Hap5
wdk2c.pk009.e4:fis Rice 5257260 20.0 142 Hap5a Contig of:
Arabidopsis 9758288 19.7 wlm96.pk036.j11 wlm96.pk060.d5:fis 144
Hap5c wle1n.pk0076.h7:fis Rice 5257260 82.0 146 LIP 15
cco1n.pk068.f18:fis Corn 2130123 69.4 148 LIP 15 cco1n.pk089.g17
Corn 2130123 54.0 150 LIP 15 rls6.pk0066.c9:fis Rice 479696 77.3
152 LIP 15 sdp4c.pk009.e3:fis Arabidopsis 7340713 36.1 154 LIP 15
sdp3c.pk019.n1:fis pepper 4457221 45.7 156 LIP 15
wl1n.pk0114.f9:fis Corn 2130123 69.1 158 Ca2+ EF HP
ccase-b.pk0003.b9:fis Sesame 6478218 82.7 160 Ca2+ EF HP
ceb5.pk0081.b4 Sesame 6478218 91.0 162 Ca2+ EF HP cbn10.pk0064.e6
Sesame 6478218 35.4 164 Ca2+ EF HP cml1c.pk001.e2 Sesame 6478218
30.3 166 Ca2+ EF HP cpd1c.pk008.e21 Sesame 6478218 64.2 168 Ca2+ EF
HP cta1n.pk0074.h11 Sesame 6478218 24.1 170 Ca2+ EF HP
p0031.ccmbc81r Sesame 6478218 26.4 172 Ca2+ EF HP p0134.carah47r
Sesame 6478218 34.2 174 Ca2+ EF HP rca1n.pk021.l20 Sesame 6478218
50.2 176 Ca2+ EF HP rca1n.pk004.j14:fis Rice 7459612 69.0 178 Ca2+
EF HP rca1n.pk026.m9 Sesame 6478218 29.7 180 Ca2+ EF HP
rsl1n.pk013.g2 Sesame 6478218 27.7 182 Ca2+ EF HP sfl1.pk131.j19
Sesame 6478218 29.2 184 Ca2+ EF HP sfl1.pk135.g3 Sesame 6478218
29.5 186 Ca2+ EF HP sgc5c.pk001.h16 Sesame 6478218 25.5 188 Ca2+ EF
HP sls1c.pk020.h24 Sesame 6478218 16.5 190 Ca2+ EF HP
sr1.pk0041.a11:fis Sesame 6478218 47.0 192 Ca2+ EF HP sr1.pk0049.c2
Sesame 6478218 17.4 194 Ca2+ EF HP wdk5c.pk006.m13 Sesame 6478218
41.4 196 Ca2+ EF HP wdk9n.pk001.k5 Sesame 6478218 40.7 198 Ca2+ EF
HP wdr1f.pk003.b21:fis Arabidopsis 2459421 65.0 200 ATP Cit Ly1
cdo1c.pk001.c1:fis Arabidopsis 3482918 180.0 202 ATP Cit Ly2
ctn1c.pk002.o4 Arabidopsis 9759429 180.0 204 ATP Cit Ly2
p0032.crcav77r:fis Arabidopsis 9759429 180.0 206 ATP Cit Ly1
p0037.crwbs90r:fis Arabidopsis 3482918 180.0 208 ATP Cit Ly1
r10n.pk0015.a4:fis Arabidopsis 3482918 180.0 210 ATP Cit Ly1
rlr2.pk0012.d2 Arabidopsis 3482918 23.5 212 ATP Cit Ly1
rr1.pk097.f22:fis Arabidopsis 3482918 180.0 214 ATP Cit Ly2
rls6.pk0033.a9:fis Arabidopsis 9759429 180.0 216 ATP Cit Ly2
sdp2c.pk023.n6:fis Arabidopsis 9759429 180.0 218 ATP Cit Ly1
sfl1.pk0029.h10:fis Arabidopsis 2462746 180.0 220 ATP Cit Ly2
sic1c.pk003.o13:fis Arabidopsis 9759429 180.0 222 ATP Cit Ly1
sls1c.pk010.l1:fis Arabidopsis 3482918 180.0 224 ATP Cit Ly2
sls2c.pk007.c23:fis Sordaria 4107343 180.0 226 ATP Cit Ly1
src2c.pk009.g9:fis Arabidopsis 2462746 180.0 228 ATP Cit Ly2
wde1f.pk003.h2:fis Arabidopsis 9759429 180.0 230 ATP Cit Ly1
wia1c.pk001.d20:fis Arabidopsis 3482918 180.0 232 ATP Cit Ly2
wlm96.pk035.j11:fis Sordaria 4107343 180.0 234 SNF1
cen3n.pk0044.b8:fis Arabidopsis 5051782 180.0 236 SNF1
p0016.ctsbf56rb Oryza sativa 4107001 180.0 238 SNF1 p0118.chsbh89r
Oryza sativa 4107009 180.0 240 SNF1 Contig of: Oryza sativa 4107009
180.0 cen3n.pk0123.g6 cho1lc.pk021.k16 cmm.pk007.c3.f
p0019.clwab75rb p0119.cmtmj75r p0123.cammb73r p0126.cnlds35r 242
SNF1 Contig of: Arabidopsis 4895200 58.3 rda.pk007.g3
rr1.pk0008.e12 rr1.pk0047.g12 244 SNF1 rr1.pk0047.g12:fis
Arabidopsis 7630013 143.0 246 SNF1 sdp4c.pk016.e10 Arabidopsis
2980770 180.0 248 SNF1 sdr1f.pk001.p7 Cucumis 1743009 180.0 250
SNF1 sgs4c.pk006.g6 Arabidopsis 2980770 180.0 252 SNF1
sgs4c.pk006.n21 Glycine max 4567091 180.0 254 SNF1
srr1c.pk001.i24:fis Arabidopsis 3885328 180.0 256 SNF1
wdk2c.pk018.c16:fis Oryza sativa 4107001 180.0 258 SNF1
wlm96.pk0007.e4:fis Oryza sativa 4107009 180.0 260 Lec1
eas1c.pk003.e16 Arabidopsis 9758795 49.2 262 Lec1 fds1n.pk008.m14
Arabidopsis 9758795 46.1 264 Lec1 p0015.cdpg75rb:fis Arabidopsis
9758795 45.4 266 Lec1 p0083.clder12r:fis Arabidopsis 6552738 35.2
268 Lec1 pps1c.pk002.l19 Arabidopsis 9758795 45.2 270 Lec1 Contig
of: Arabidopsis 9758795 47.4 scb1c.pk004.j10 se1.pk0042.d8:fis 272
Lec1 se2.11d12:fis Arabidopsis 9758795 52.2 274 Lec1
ses2w.pk0015.a4:fis Arabidopsis 9758795 43.7 276 Lec1
vs1n.pk013.m13:fis Arabidopsis 9758795 53.1 278 Lec1
wdk3c.pk023.h15:fis Arabidopsis 9758795 36.7 280 Lec1-CCAAT
ect1c.pk007.p18:fis Zea mays 22380 44.7 282 Lec1-CCAAT
fds.pk0003.h5:fis Arabidopsis 6729485 57.7 284 Lec1-CCAAT
eef1c.pk004.c8:fis Zea mays 22380 61.7 286 Lec1-CCAAT
cbn10.pk0005.e6:fis Zea mays 22380 72.2 288 Lec1-CCAAT
p0006.cbysa51r:fis Arabidopsis 2244810 55.5 290 Lec1-CCAAT
rl0n.pk0061.c8:fis Zea mays 22380 46.5 292 Lec1-CCAAT
rsl1n.pk002.g10:fis Zea mays 22380 68.7 294 Lec1-CCAAT
ses4d.pk0037.e3:fis Arabidopsis 2398529 49.0 296 Lec1-CCAAT
src2c.pk003.i13:fis Arabidopsis 3738293 41.1 298 Lec1-CCAAT
src2c.pk011.m12:fis Arabidopsis 6729485 62.0 300 Lec1-CCAAT
src2c.pk025.b3:fis Zea mays 22380 45.5 302 Lec1-CCAAT
src3c.pk028.j21:fis Zea mays 22380 54.3 304 Lec1-CCAAT
wkm1c.pk0002.d7:fis Zea mays 22380 79.5 306 Lec1-CCAAT
wlk8.pk0001.e10:fis Arabidopsis 2398529 52.7 308 Lec1-CCAAT
wlm96.pk037.k9:fis Zea mays 22380 73.5 310 CKC 6 fds1n.pk015.l15
Arabidopsis 2887500 28.3 312 CKC 2 contig of: Arabidopsis 11357162
77.4 ece1c.pk003.g23 ece1c.pk005.j13 314 CKC 8 ids.pk0022.b6 Zea
mays 7489754 40.0 316 CKC 1 contig of: Arabidopsis 2129537 56.2
cpd1c.pk011.i5 p0086.cbsaa24r:fis 318 CKC 1 cpd1c.pk011.i5:fis
Arabidopsis 2129537 320 CKC 2 cde1c.pk003.o22:fis Arabidopsis
6587812 73.1 322 CKC2 cho1c.pk003.f17:fis Arabidopsis 1171429 61.2
324 CKC 5 contig of: Arabidopsis 6587812 75.2 cds1f.pk003.b12
clm1f.pk002.o13:fis 326 CKC2 p0015.cdpfn03r No hit -- -- 328 CKC 3
contig of: Arabidopsis 6648171 66.2 cc71se-a.pk0002.e11
p0027.cgsag51r:fis 330 CKC 6 p0031.ccmau15r:fis Arabidopsis 2887500
99.0 332 CKC 8 cc71se- Zea mays 7489754 180.0 b.pk0018.e4:fis 334
CKC 7 cpj1c.pk005.m20:fis Zea mays 2652938 180.0 336 CKC 8
cen7f.pk002.m15 Zea mays 7489754 34.0 338 CKC 8 rsl1n.pk006.n24:fis
Zea mays 7489754 180.0 340 CKC 8 Contig of: Arabidopsis 6648171
62.1 rca1n.pk019.p10 rsl1n.pk002.j2:fis 342 CKC 1 rdi2c.pk009.a15
Arabidopsis 2129537 87.7 344 CKC 2 sds1f.pk001.f7:fis Arabidopsis
6587812 108.0 346 CKC 2 se3.pk0034.a3 Arabidopsis 7715603 30.0 348
CKC 6 ses2w.pk0035.a9:fis Arabidopsis 2652938 162.0 350 CKC 4
ses4d.pk0043.d10:fis Arabidopsis 4836931 58.0 352 CKC 5
scb1c.pk004.n19:fis Arabidopsis 4836931 109.0 354 CKC 5
ses4d.pk0006.a12:fis Arabidopsis 4836931 109.0 356 CKC 5
sgs1c.pk004.f19:fis 358 CKC 8 sic1c.pk003.o18:fis Zea mays 2652938
107.0 360 CKC 8 sde4c.pk0001.a2:fis Arabidopsis 1171429 98.0 362
CKC 3 ses2w.pk0012.d10:fis Arabidopsis 9294411 177.0 364 CKC 1
Contig of: Arabidopsis 6648171 54.7 wde1f.pk001.h1 wr1.pk148.f7:fis
459 Lec1 rice genome seq Oryza sativa 7378310 180 461 Hap2
ncs.pk0013.c4:fis Arabidopsis 9293997 46.7 463 Hap2
p0117.chcln94r:fis Oryza sativa 1489565 26.0 465 Hap2
rdi2c.pk011.f19:fis Oryza sativa 1489565 45.0 467 Hap2
sfl1.pk0101.g7:fis Vitis sp. 7141243 38.4 469 Hap2
wdi1c.pk002.b10:fis Oryza sativa 1489565 40.3 474 Hap5
sgs4c.pk004.j2:fis Arabidopsis 15223482 69.0 477 CKC 2
fds1n.pk015.l15:fis Arabidopsis 18394319 77.3 479 CKC 2
ece1c.pk003.g23:fis Arabidopsis 18394319 77.3 481 CKC 2
se3.pk0034.a3:fis Arabidopsis 18394319 77.3 483 CKC 4
sre.pk0037.c1:fis Arabidopsis 15238174 157.0 485 CKC 7
ncs.pk0013.a9:fis Oryza sativa 20161013 96.7 487 CKC 8
egh1c.pk005.k20 Oryza sativa 20161013 98.5 489 CKC 8
cde1c.pk003.n23:fis Zea mays 7489754 110.0 491 CKC 1
sde4c.pk0001.a2:fis Arabidopsis 1171429 98.0 493 MEK3
sr3.pk011.g22:fis Arabidopsis 4006878 91.3 495 MEK3
r10n.pk096.h23:fis Arabidopsis 7487975 63.4 497 MEK3
rlr24.pk0032.e10:fis Arabidopsis 7487975 63.5 499 Ca2+ EF HP
cml1c.pk001.e2:fis Sesame 6478218 41.5 501 Ca2+ EF HP
cdp1c.pk008.e21:fis Sesame 6478218 65.0 503 Ca2+ EF HP
cta1n.pk0074.h11:fis Sesame 6478218 37.0 505 Ca2+ EF HP
p0031.ccmbc81r:fis Sesame 6478218 65.7 507 Ca2+ EF HP
p0134.carah47r:fis Sesame 6478218 34.7 509 Ca2+ EF HP
rca1n.pk004.j14:fis Oryza sativa 1177320 69.0 511 Ca2+ EF HP
rsl1n.pk013.g2:fis Sesame 6478218 41.5
513 Ca2+ EF HP sfl1.pk131.j19:fis Sesame 6478218 47.7 515 Ca2+ EF
HP sfl1.pk135.g3:fis Sesame 6478218 47.7 517 Ca2+ EF HP
sls1c.pk020.h24:fis Sesame 6478218 47.4 519 Ca2+ EF HP
sr1.pk0041.a11:fis Sesame 6478218 47.0 521 Ca2+ EF HP
sr1.pk0049.c2:fis Sesame 6478218 48.0 523 Ca2+ EF HP
wdk5c.pk006.m13:fis Sesame 6478218 80.0 525 Ca2+ EF HP
wdk9n.pk001.k5:fis Sesame 6478218 83.0 527 Ca2+ EF HP
wdk1f.pk003.b21:fis Arabidopsis 2459421 65.0
[0232] The sequence of the entire cDNA insert in the clones listed
in Table 3 was determined. Further sequencing and searching of the
DuPont proprietary database allowed the identification of other
corn, rice, soybean and/or wheat clones encoding polypeptides
involved in altering oil phenotypes. The BLASTX search using the
sequences from clones listed in Table 4 revealed similarity of the
polypeptides encoded by the various cDNAs from plant and fungal
species (noted by their NCBI General Identifier No. in Tables 3 and
4). Shown in Table 4 are the BLAST results for individual ESTs
("EST"), the sequences of the entire cDNA inserts comprising the
indicated cDNA clones ("FIS"), sequences of contigs assembled from
two or more ESTs ("Contig"), sequences of contigs assembled from an
FIS and one or more ESTs ("Contig*"), or sequences encoding the
entire protein derived from an FIS, a contig, or an FIS and PCR
("CGS"):
TABLE-US-00005 TABLE 4 Percent Identity of Amino Acid Sequences
Deduced From the Nucleotide Sequences of cDNA Clones Encoding
Polypeptides Homologous to Polypeptides Involved in Altering Plant
Oil Phenotypes SEQ ID NO. Accession No. Percent Identity 2 3063445
33.3% 4 7488207 83.9% 6 1362112 51.2% 8 1362112 66.8% 10 7487975
27.5% 12 7487976 39.7% 14 4006878 45.6% 16 4006878 42.7% 18 1586551
23.4% 20 7489565 27.4% 22 11282597 22.1% 26 7489565 36.1% 28
7489565 67.2% 30 7489565 70.6% 32 7489565 33.2% 34 6634774 40.1% 36
6634774 39.1% 38 7489565 28.2% 40 7489565 53.2% 42 7489565 34.0% 44
7489565 39.5% 46 7489565 39.5% 48 7489565 35.5% 50 4587559 54.1% 52
7489565 67.2% 54 7489565 29.0% 56 9293997 31.5% 58 5903072 35.3% 62
5903072 33.7% 64 7141243 34.5% 66 7489565 35.7% 68 7489565 27.2% 70
8778470 40.5% 72 7489565 22.1% 74 2398521 49.1% 76 7141243 40.9% 78
1586551 37.8% 80 6634774 49.2% 82 6714441 32.5% 84 7489565 32.4% 86
7489565 31.1% 88 9293997 40.6% 90 7489565 68.5% 92 6634774 36.5% 94
6714441 23.7% 96 7489565 34.5% 98 7489565 37.4% 100 5257260 62.9%
102 6523090 77.7% 104 6523090 53.8% 106 3776575 50.7% 108 3776575
51.6% 110 3776575 60.0% 112 5257260 62.7% 114 5257260 75.0% 116
5257260 77.5% 118 6523090 53.8% 120 6289057 50.6% 122 3776575 52.1%
124 5257260 77.9% 126 6523090 70.3% 128 6523090 70.7% 130 3776575
35.7% 132 6289057 53.2% 134 6289057 52.8% 136 6056368 73.0% 138
6289057 57.1% 140 5257260 27.3% 142 9758288 46.3% 144 5257260 74.9%
148 2130123 83.0% 152 7340713 50.7% 154 4457221 56.9% 158 6478218
57.0% 160 6478218 61.9% 162 6478218 33.6% 164 6478218 41.3% 166
6478218 46.9% 168 6478218 46.6% 170 6478218 48.4% 172 6478218 31.8%
174 6478218 64.4% 176 7459612 49.8% 178 6478218 62.1% 180 6478218
36.7% 182 6478218 46.5% 184 6478218 45.3% 186 6478218 53.8% 188
6478218 47.5% 190 6478218 41.3% 192 6478218 52.5% 194 6478218 57.2%
196 6478218 58.4% 198 2459421 42.4% 200 3482918 85.4% 202 9759429
92.1% 204 9759429 92.3% 206 3482918 87.4% 208 3482918 87.0% 210
3482918 63.3% 212 3482918 87.5% 214 9759429 92.8% 216 9759429 89.6%
218 2462746 84.4% 220 9759429 93.3% 222 3482918 87.5% 224 4107343
89.8% 226 2462746 88.9% 228 9759429 91.8% 230 3482918 87.9% 232
4107343 90.1% 244 7630013 63.0% 256 4107001 89.2% 258 4107009 81.2%
260 9758795 49.0% 262 9758795 49.7% 264 9758795 49.8% 266 6552738
38.9% 310 2887500 45.3% 312 11357162 68.8% 316 2129537 37.2% 318
2129537 37.2% 320 6587812 43.1% 328 6648171 36.2% 330 2887500 41.6%
332 7489754 87.0% 338 7489754 66.1% 342 2129537 83.1% 344 6587812
60.9% 348 2652938 41.6% 352 4836931 40.5% 354 4836931 39.3% 358
2652938 42.3% 362 9294411 49.8% 477 18394319 44.1% 479 18394319
44.3% 481 18394319 42.3% 483 15238174 50.4% 485 20161013 42.1% 487
20161013 40.7% 489 7489754 44.1% 491 1171429 36.4% 493 4006878
46.3% 495 7487975 31.2% 497 7487975 30.0% 499 6478218 37.5% 501
6478218 48.5% 503 6478218 44.3% 505 6478218 48.4% 507 6478218 35.0%
509 1177320 54.2% 511 6478218 40.0% 513 6478218 46.5% 515 6478218
47.5% 517 6478218 47.5% 519 6478218 45.8% 521 6478218 47.0% 523
6478218 57.2% 525 6478218 58.6% 527 2459421 49.1%
[0233] Sequence alignments and percent identity calculations were
performed using the Megalign program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
Multiple alignment of the sequences was performed using the Clustal
method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153)
with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments using the
Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5. Sequence alignments and BLAST scores and probabilities
indicate that the nucleic acid fragments comprising the instant
cDNA clones encode a substantial portion of cDNAs to receptor
protein kinases, MEK3 homologs, Hap2 homologs, LIP 15 homologs,
calcium EF-hand proteins, ATP citrate lyase, glucose metabolism
proteins such as SNF1 homologs, Lec1 transcription factors, and
seed developmentally regulated transcription factors such as CKC
(Aintegumenta-like) homologs.
Example 4
Expression of Chimeric Constructs in Monocot Cells
[0234] A chimeric construct comprising a cDNA encoding the instant
polypeptides in sense orientation with respect to the maize 27 kD
zein promoter that is located 5' to the cDNA fragment, and the 10
kD zein 3' end that is located 3' to the cDNA fragment, can be
constructed. The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites (NcoI or SmaI) can be
incorporated into the oligonucleotides to provide proper
orientation of the DNA fragment when inserted into the digested
vector pML103 as described below. Amplification is then performed
in a standard PCR. The amplified DNA is then digested with
restriction enzymes NcoI and SmaI and fractionated on an agarose
gel. The appropriate band can be isolated from the gel and combined
with a 4.9 kb NcoI-SmaI fragment of the plasmid pML103. Plasmid
pML103 has been deposited under the terms of the Budapest Treaty at
ATCC (American Type Culture Collection, 10801 University Blvd.,
Manassas, Va. 20110-2209), and bears accession number ATCC 97366.
The DNA segment from pML103 contains a 1.05 kb SalI-NcoI promoter
fragment of the maize 27 kD zein gene and a 0.96 kb SmaI-SalI
fragment from the 3' end of the maize 10 kD zein gene in the vector
pGem9Zf(+) (Promega). Vector and insert DNA can be ligated at
15.degree. C. overnight, essentially as described (Maniatis). The
ligated DNA may then be used to transform E. coli XL1-Blue
(Epicurian Coli XL-1 Blue.TM.; Stratagene). Bacterial transformants
can be screened by restriction enzyme digestion of plasmid DNA and
limited nucleotide sequence analysis using the dideoxy chain
termination method (Sequenase.TM. DNA Sequencing Kit; U.S.
Biochemical). The resulting plasmid construct would comprise a
chimeric gene encoding, in the 5' to 3' direction, the maize 27 kD
zein promoter, a cDNA fragment encoding the instant polypeptides,
and the 10 kD zein 3' region.
[0235] The chimeric construct described above can then be
introduced into corn cells by the following procedure. Immature
corn embryos can be dissected from developing caryopses derived
from crosses of the inbred corn lines H99 and LH132. The embryos
are isolated 10 to 11 days after pollination when they are 1.0 to
1.5 mm long. The embryos are then placed with the axis-side facing
down and in contact with agarose-solidified N6 medium (Chu et al
(1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the
dark at 27.degree. C. Friable embryogenic callus consisting of
undifferentiated masses of cells with somatic proembryoids and
embryoids borne on suspensor structures proliferates from the
scutellum of these immature embryos. The embryogenic callus
isolated from the primary explant can be cultured on N6 medium and
sub-cultured on this medium every 2 to 3 weeks.
[0236] The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst
Ag, Frankfurt, Germany) may be used in transformation experiments
in order to provide for a selectable marker. This plasmid contains
the Pat gene (see European Patent Publication 0 242 236) which
encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers resistance to herbicidal glutamine synthetase inhibitors
such as phosphinothricin. The pat gene in p35S/Ac is under the
control of the 35S promoter from Cauliflower Mosaic Virus (Odell et
al (1985) Nature 313:810-812) and the 3' region of the nopaline
synthase gene from the T-DNA of the Ti plasmid of Agrobacterium
tumefaciens.
[0237] The particle bombardment method (Klein et al (1987) Nature
327:70-73) may be used to transfer genes to the callus culture
cells. According to this method, gold particles (1 .mu.m in
diameter) are coated with DNA using the following technique. Ten
.mu.g of plasmid DNAs are added to 50 .mu.L of a suspension of gold
particles (60 mg per ml). Calcium chloride (50 .mu.L of a 2.5 M
solution) and spermidine free base (20 .mu.L of a 1.0 M solution)
are added to the particles. The suspension is vortexed during the
addition of these solutions. After 10 minutes, the tubes are
briefly centrifuged (5 sec at 15,000 rpm) and the supernatant
removed. The particles are resuspended in 200 .mu.L of absolute
ethanol, centrifuged again and the supernatant removed. The ethanol
rinse is performed again and the particles resuspended in a final
volume of 30 .mu.L of ethanol. An aliquot (5 .mu.L) of the
DNA-coated gold particles can be placed in the center of a
Kapton.TM. flying disc (Bio-Rad Labs). The particles are then
accelerated into the corn tissue with a Biolistic.TM. PDS-1000/He
(Bio-Rad Instruments, Hercules Calif.), using a helium pressure of
1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0
cm.
[0238] For bombardment, the embryogenic tissue is placed on filter
paper over agarose-solidified N6 medium. The tissue is arranged as
a thin lawn and covered a circular area of about 5 cm in diameter.
The petri dish containing the tissue can be placed in the chamber
of the PDS-1000/He approximately 8 cm from the stopping screen. The
air in the chamber is then evacuated to a vacuum of 28 inches of
Hg. The macrocarrier is accelerated with a helium shock wave using
a rupture membrane that bursts when the He pressure in the shock
tube reaches 1000 psi.
[0239] Seven days after bombardment the tissue can be transferred
to N6 medium that contains bialophos (5 mg per liter) and lacks
casein or proline. The tissue continues to grow slowly on this
medium. After an additional 2 weeks the tissue can be transferred
to fresh N6 medium containing bialophos. After 6 weeks, areas of
about 1 cm in diameter of actively growing callus can be identified
on some of the plates containing the bialophos-supplemented medium.
These calli may continue to grow when sub-cultured on the selective
medium.
[0240] Plants can be regenerated from the transgenic callus by
first transferring clusters of tissue to N6 medium supplemented
with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be
transferred to regeneration medium (Fromm et al (1990)
Bio/Technology 8:833-839).
Example 5
Expression of Chimeric Constructs in Dicot Cells
[0241] A seed-specific expression cassette composed of the promoter
and transcription terminator from the gene encoding the .beta.
subunit of the seed storage protein phaseolin from the bean
Phaseolus vulgaris (Doyle et al (1986) J. Biol. Chem.
261:9228-9238) can be used for expression of the instant
polypeptides in transformed soybean. The phaseolin cassette
includes about 500 nucleotides upstream (5') from the translation
initiation codon and about 1650 nucleotides downstream (3') from
the translation stop codon of phaseolin. Between the 5' and 3'
regions are the unique restriction endonuclease sites Nco I (which
includes the ATG translation initiation codon), Sma I, Kpn I and
Xba I. The entire cassette is flanked by Hind III sites.
[0242] The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites can be incorporated into the
oligonucleotides to provide proper orientation of the DNA fragment
when inserted into the expression vector. Amplification is then
performed as described above, and the isolated fragment is inserted
into a pUC18 vector carrying the seed expression cassette.
[0243] Soybean embryos may then be transformed with the expression
vector comprising sequences encoding the instant polypeptides. To
induce somatic embryos, cotyledons, 3-5 mm in length dissected from
surface sterilized, immature seeds of the soybean cultivar A2872,
can be cultured in the light or dark at 26.degree. C. on an
appropriate agar medium for 6-10 weeks. Somatic embryos which
produce secondary embryos are then excised and placed into a
suitable liquid medium. After repeated selection for clusters of
somatic embryos which multiplied as early, globular staged embryos,
the suspensions are maintained as described below.
[0244] Soybean embryogenic suspension cultures can be maintained in
35 mL liquid media on a rotary shaker, 150 rpm, at 26.degree. C.
with florescent lights on a 16:8 hour day/night schedule. Cultures
are subcultured every two weeks by inoculating approximately 35 mg
of tissue into 35 mL of liquid medium.
[0245] Soybean embryogenic suspension cultures may then be
transformed by the method of particle gun bombardment (Klein et al
(1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A
DuPont Biolistic.TM. PDS1000/HE instrument (helium retrofit) can be
used for these transformations.
[0246] A selectable marker gene which can be used to facilitate
soybean transformation is a chimeric gene composed of the 35S
promoter from Cauliflower Mosaic Virus (Odell et al (1985) Nature
313:810-812), the hygromycin phosphotransferase gene from plasmid
pJR225 (from E. coli; Gritz et al (1983) Gene 25:179-188) and the
3' region of the nopaline synthase gene from the T-DNA of the Ti
plasmid of Agrobacterium tumefaciens. The seed expression cassette
comprising the phaseolin 5' region, the fragment encoding the
instant polypeptides and the phaseolin 3' region can be isolated as
a restriction fragment. This fragment can then be inserted into a
unique restriction site of the vector carrying the marker gene.
[0247] To 50 .mu.L of a 60 mg/mL 1 .mu.m gold particle suspension
is added (in order): 5 .mu.L DNA (1 .mu.g/.mu.L), 20 .mu.L
spermidine (0.1 M), and 50 .mu.L CaCl.sub.2 (2.5 M). The particle
preparation is then agitated for three minutes, spun in a microfuge
for 10 seconds and the supernatant removed. The DNA-coated
particles are then washed once in 400 .mu.L 70% ethanol and
resuspended in 40 .mu.L of anhydrous ethanol. The DNA/particle
suspension can be sonicated three times for one second each. Five
.mu.L of the DNA-coated gold particles are then loaded on each
macro carrier disk.
[0248] Approximately 300-400 mg of a two-week-old suspension
culture is placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue are
normally bombarded. Membrane rupture pressure is set at 1100 psi
and the chamber is evacuated to a vacuum of 28 inches mercury. The
tissue is placed approximately 3.5 inches away from the retaining
screen and bombarded three times. Following bombardment, the tissue
can be divided in half and placed back into liquid and cultured as
described above.
[0249] Five to seven days post bombardment, the liquid media may be
exchanged with fresh media, and eleven to twelve days post
bombardment with fresh media containing 50 mg/mL hygromycin. This
selective media can be refreshed weekly. Seven to eight weeks post
bombardment, green, transformed tissue may be observed growing from
untransformed, necrotic embryogenic clusters. Isolated green tissue
is removed and inoculated into individual flasks to generate new,
clonally propagated, transformed embryogenic suspension cultures.
Each new line may be treated as an independent transformation
event. These suspensions can then be subcultured and maintained as
clusters of immature embryos or regenerated into whole plants by
maturation and germination of individual somatic embryos.
Example 6
Gene Profiling of Corn Lines Displaying High Oil Phenotype
Plant Material.
[0250] Seeds from the "maize lines" were germinated and grown in
the field. Typical "maize lines" used are as follows: [0251] 1)
Qx47, IHO, Ask c.28, Ryd c.7 (herein called "high oil lines");
[0252] 2) GS3, HG11, B73, Ask c.0, Ryd c.0 (herein called "normal
oil" or "control lines") and, [0253] 3) ILO (herein called "low oil
line").
[0254] The ears of all plants were self-pollinated, and embryo
tissues were collected at 10, 15, 20, 25, 30, 35, 40 and 45 DAP.
All tissue was frozen immediately and stored at -80.degree. C.
until used. Total RNA was extracted followed by isolation of poly
A+ RNA using standard molecular biology techniques (Sambrook et al
(1989) "Molecular Cloning", Cold Spring Harbor Laboratory Press,
CSH, NY).
[0255] The goal was to identify regulatory/structural genes that
control oil content and/or germ size in corn. Two different
transcript profiling techniques were used namely DNA microarray
(Schena et al (1995) Science 270:368-9, 371), Lynx comparator
(Brenner et al (2000) Proc Natl Acad Sci USA 97:1665-70) and Lynx
MPSS (Brenner et al (2000) Nat Biotechnol 18:630-4). These
experiments were aimed at comparing transcription profiles between
different high oil corn lines and their normal/low oil
counterparts.
[0256] Molecular Dynamics Microarray Technology:
[0257] The steps of fluorescent mRNA probe labeling, amplification
of target DNA, immobilization of target DNA on slide, hybridization
to different developmental stage embryos of different corn lines,
washings, signal detection, data acquisition and normalization of
data were as described (Lee et al, 2001). The target DNA collection
consisted of 900 corn EST's from DuPont Internal Database
corresponding to genes expected to play a role in corn seed fatty
acid, protein and carbohydrate metabolism and an additional 4000
random EST's from a corn embryo library also from DuPont Internal
Database were selected. Gene profiling experiments were performed
aimed at identifying genes differentially expressed in high oil
germ lines when compared to lines with either normal or low levels
of oil in the germ. Potential candidates were identified and
selected if the relative gene expression of the gene in question
showed a ratio of 2 or greater in at least one comparison involved
at least one high oil line and either a low oil line or a line with
normal levels of oil. Using this criteria to analyze these data we
have identified two candidate regulatory genes whose expression is
either altered when comparing the pattern of gene expression
between the high oil lines and their normal/low oil counterparts
(i.e. Ask cycle 28 to Ask cycle 0 ratio and/or IHO to ILO ratio):
Caleosin (DuPont/Pioneer Internal Database EST ID#
ccase-b.pk0003.b9, shown in SEQ ID NOs:157-158) or, showed a
similar expression pattern as several genes encoding enzymes of the
oil biosynthesis pathway: Aintegumenta (DuPont/Pioneer Internal
Database EST ID# adf1c.pk009.n6, which is identical to the
Arabidopsis thaliana clone found in GenBank Accession No. gi
1171429, shown in SEQ ID NO:424) and an additional corn clone,
cho1c.pk003.f17:fis (SEQ ID NO:322). We have also identified four
other potential regulatory candidate genes, which in addition to
show elevated gene expression when compared "internally" within the
high oil population lines are also elevated when high oil lines
were compared to the control line B73: receptor-like protein kinase
(DuPont/Pioneer Internal Database EST ID# cho1c.pk003.p17, SEQ ID
NOs:1-2), MAP kinase kinase 3 (DuPont/Pioneer Internal Database EST
ID# p0125.czaab60rb, SEQ ID NOs:7-8), HAP2 (DuPont/Pioneer Internal
Database EST ID# cho1c.pk006.b14 which is a shorter clone of
cho1c.pk004.b19:fis, shown in SEQ ID NOs:27-28), LIP15 (DuPont
Internal Database EST ID# ceb3.pk0011.g9 which was replaced by
clone cco1n.pk089.g17, shown in SEQ ID NOs:147-148).
[0258] Lynx (Comparator and MPSS):
[0259] Gene profiling by Lynx was performed as described (Brenner
et al (2000) Proc Natl Acad Sci USA 97:1665-70). Using this
criteria to analyze these data we have identified two candidate
regulatory genes whose expression is either altered when comparing
the pattern of gene expression between the high oil lines and their
normal/low oil counterparts (i.e. Ask cycle 28 to Ask cycle 0 ratio
and/or IHO to ILO ratio): HAP5 (DuPont/Pioneer Internal Database
EST ID# cho1c.pk001.123, SEQ ID NOs:113-114) and SNF1/AMPK from
corn (DuPont/Pioneer Internal Database EST ID# cen3n.pk0150.c7
which is a shorter clone of p0019.clwab:fis, one of the sequences
used in the contig shown in SEQ ID NOs:239-240).
[0260] Unlike the candidates listed above, other genes were chosen
based on the knowledge of the role that the candidate gene they
encode play in the partition of carbohydrate flux in the embryo:
ATP-citrate lyase (DuPont Internal Database EST ID# cdo1c.pk001.c1,
shown in SEQ ID NOs:199-200), SNF1/AMPK from soybean
(DuPont/Pioneer Internal Database EST ID# sdp4c.pk016.e10, shown in
SEQ ID NOs:245-246) or, regulation of gene expression in early
embryo developmental phases: HAP3/Lec1 (DuPont/Pioneer Internal
Database EST ID# p0015.cdpgp75rb, shown in SEQ ID NOs:263-264).
Example 7
Expression Vector for Plant Transformation by Particle Gun
Bombardment
[0261] A seed specific gene expression cassette was used for making
chimeric constructs for expression of candidate genes in corn. The
expression cassette is composed of the 0.9 kb oleosin promoter, the
intron 1 of the maize shrunken 1 gene and adjacent exon (Vasil et
al, 1989, Plant Physiol 91: 1575-1579; Mascarenhas et al, 1990,
Plant Mol Biol 15:913-920) and 3' transcription termination region
from the nopaline synthase (Nos) gene. In between the exon adjacent
to the shrunken 1 gene and the nopaline synthase (Nos) gene are
unique restriction endonuclease sites MfeI and XmaI. This vector
has been designated pBN256 (REF. Jennie Shen's patent). pMUT256
refers to a pBN256 plasmid in which a EcoRI site has been removed
by site directed mutagenesis. A modified version of pMUT256,
designated pMUT256e was modified by addition of a synthetic
multiple cloning site. The synthetic polylinker was generated by
annealing of oligos (5'-acagtacagtacagtacagtacagt-3') and
(5'-actgtactgtactgtacgtgactg-3') [SEQ ID NOs:430 and 431,
respectively] and subsequent subcloning into the pMut256 open with
MfeI and XmaI. Additional expression cassettes/vectors will be
described in reference to specific examples where they have been
used (see below).
Example 8
Isolation and Cloning of Candidate Genes into Embryo-Specific Plant
Expression Vectors
HAP3/LEC1 (Heme-Activated Protein 3/Leafy Cotyledon 1):
[0262] A full length clone (p0015.cdpgp75rb, SEQ ID NOs:263) for
the corn homolog of the HAP3/Lec1 gene was obtained from
Dupont/Pioneer EST Database. The ORF of maize HAP3/Lec1 (a 1 kb
SalI/HpaI fragment, PCT Application No. WO 00/28058, published on
May 18, 2000) was moved into an expression cassette containing a
maize oleosin promoter (a 0.9 kb BamHI/XhoI fragment, PCT
Application No. WO 99/64579, published on Dec. 16, 1999) and a
polyadenylation sequence from the Agrobacterium nopaline synthase
gene. This expression cassette was then subcloned adjacent to a
35S::Bar expression cassette (Sidorenko et al (2000) Plant J
22:471-482). The resulting expression cassettes flanked by T-DNA
border sequences were then mobilized into the Agrobacterium
"super-binary" vector (Komari, 1990) using electroporation.
Additional constructs were made to confer expression patterns
different from those obtained with the oleosin promoter. A
ubiquitin promoter (UBI, Christensen et al (1992) Plant Mol Biol
18:675-680), a lipid transfer protein (LTP) promoter (U.S. Pat. No.
5,525,716), and a gamma zein promoter (GZP) (Boronat et al (1986)
Plant Science 47: 95-102) were each fused to Lec1 as described
above for the oleosin promoter. The two transcription units,
LTP-Lec1 and GZP-Lec1, were combined into one expression construct
next to the 35S:Bar expression construct and flanked by T-DNA
border sequences (as described above).
HAP2 (Heme-Activated Protein 2):
[0263] A full length clone (cho1c.pk006.b14, a 30 nucleotide
shorter cDNA than cho1c.pk004.b19:fis, shown in SEQ ID NO:27) for
the corn homolog of the HAP2 gene was obtained from Dupont/Pioneer
EST Database. The ApoI/ApaI 1.1 kb fragment of cho1c.pk006.b14 was
isolated and subcloned into pMUT256e opened by digestion with
EcoRI/ApaI. One clone was selected for corn transformation by
restriction digestion analysis for correct insert size. Subcloning
artifacts were excluded by 5' and 3' sequence of the vector-insert
boundaries.
HAP5 (Heme-Activated Protein 5):
[0264] A full length clone (cho1c.pk001.123, shown in SEQ ID
NO:113) for the corn homolog of HAP5 gene was obtained from
Dupont/Pioneer EST Database. The EcoRI/ApaI 1.1 kb fragment of
cho1c.pk001.123 was isolated and subcloned into pMUT256e opened by
digestion with EcoRI/ApaI. One clone was selected for corn
transformation after restriction digestion analysis for correct
insert size. Subcloning artifacts were excluded by 5' and 3'
sequence of the vector-insert boundaries.
Caleosin (Ca.sup.2+ EF-Hand Binding Protein):
[0265] A full length clone (ccase-b.pk0003.b9, shown in SEQ ID
NO:157) for a corn homolog of the Caleosin gene was obtained from
Dupont/Pioneer EST Database. Two open reading frames were amplified
from this sequence using PCR. One ORF contains nucleotides 253-987
and was amplified using primers
(CTCAATTGCCCGGGAACATGCACCACGGCCTGTCG and CCCGGGCTAGGACATCTTGGCGTGCT
[SEQ ID NOs:432 and 433, respectively]), which introduce a MfeI
restriction site just prior the translation start codon and a XmaI
site just past the translation stop codon respectively.
[0266] The other ORF contains nucleotides 46-987 and was amplified
using primers (AATTGATGCAGGGAGGGGCGACGGC and
CCCGGGCTAGGACATCTTGGCGTGCT [SEQ ID NOs:434 and 435, respectively]),
which introduce a MfeI restriction site just prior the translation
start codon and a XmaI site just past the translation stop codon
respectively.
[0267] The corresponding PCR fragments were cloned into the Topo-TA
cloning vector (Invitrogen) and Ampicillin resistant colonies
further analysed using restriction digest analysis. Three clones
confirmed of containing the insert were sequenced and one of each
subjected to MfeI-XmaI restriction digest and the corresponding 784
and 942 bp fragments were gel isolated and each cloned into the
MfeI-XmaI site of pMut256. This constructs were designated SICEF26
& SICEF32, respectively. Insertion of the insert into pMut256
was confirmed by 5' and 3'-end sequencing of the vector/insert
boundaries.
LIP15 (Low Temperature-Induced Protein 15):
[0268] A full length clone (cco1n.pk089.g17, shown in SEQ ID
NO:147) for a corn homolog of the HAP5 gene was obtained from
Dupont/Pioneer EST Database. The XmaI/ApaI 0.8 kb fragment of
cco1n.pk089.g17 was isolated and subcloned into pMUT256e opened by
digestion with XmaI/ApaI. One clone was selected for corn
transformation after restriction digestion analysis for correct
insert size. Subcloning artifacts were excluded by 5' and 3'
sequence of the vector-insert boundaries.
ANT (Aintegumenta):
[0269] A full length Arabidopsis thaliana clone (adf1c.pk009.n6,
same as gi 1171429, shown in SEQ ID NO:424) for the Aintegumenta
gene was obtained from Dupont's Expressed Sequence Tag's (EST's)
Database and cloned into pMut256. For this purpose the open reading
frame from clone adf1c.pk009.n6 was subjected to PCR using the
primers [(GGCGCCAATTGATGAAGTCTTTTTGTGATAATGATGA and
TCATACCCGGGTCAAGAATCAGCCCAAGCAG SEQ ID NOs:436 and 437,
respectively]. These primers introduce a MfeI restriction site just
prior to the translation initiation codon and a XmaI restriction
site just past the stop codon, respectively.
[0270] The PCR fragment was gel isolated and subcloned into the
Topo-TA sequencing vector (Invitrogen). Ampicillin resistant
colonies were further analysed using restriction digest analysis
diagnostic for the presence of the Aintegumenta gene. Three clones
that contained the insert were sequenced. Two out of three
sequences completely agreed with the sequence of clone
adf1c.pk009.n6. One of these clones was subjected to a MfeI-XmaI
digest and the corresponding 1668 bp fragment was gel isolated and
cloned into the MfeI-XmaI site of pMut256, which was named SIANT.
Insertion of the insert into pMut256 was confirmed by 5' and 3'-end
sequencing of the vector/insert boundaries.
[0271] Two additional gene expression cassettes were used for the
specific expression of the Arabidopsis Aintegumenta in soybean. One
of them is composed of the 35 S promoter of cauliflower mosaic
virus (Odell et al (1985) Nature 313:810-812; Hull et al (1987)
Virology 86:482-493) and 3' nos terminator. The other is composed
of the beta-conglycinin promoter and the Phaseolin 3'
terminator.
SNF1/AMPK (Sucrose Non-Fermenting 1/AMP-Dependent Protein Kinase,
Corn Genes)
[0272] Full length clones for corn homologs of SNF1 gene
(cen3n.pk0044.b8 [SEQ ID NO:233] and p0123.cammb73r, part of the
contig shown in SEQ ID NO:239) were obtained from Dupont/Pioneer
EST Database. The inserts were isolated and subcloned into pMUT256e
opened by digestion with XmaI/ApaI. One clone was selected for corn
transformation after restriction digestion analysis for correct
insert size. Subcloning artifacts were excluded by 5' and 3'
sequence of the vector-insert boundaries.
SNF1/AMPK (Sucrose Non-Fermenting 1/AMP-Dependent Protein Kinase,
Soybean Gene).
[0273] A full length clone for a soybean homolog of the SNF1 gene
obtained from clone sgs4c.pk006.n21 [SEQ ID NO:251] also known as
MRK6. The ORF of MRK6 was amplified by using the primers
(5':AATTTCTAGAATGGACAGATCAACTGGCCG and
3':GTGATCTAGACTAGAGAACACGTAGCTGTGAAAGGA [SEQ ID NOs:438 and 439,
respectively]) containing XbaI sites. After PCR amplification the
fragment containing the complete MRK6 ORF was subcloned into pCST2
plasmid. For subcloning of MRK6 into pMUT256e, the XbaI fragment of
MRK6 was digested from pCST2, gel purified and subsequently made
blunt-end by Klenow polimerase treatment. Thereafter, the
blunt-ended MRK6 fragment was ligated to pMUT256e digested with
SmaI. One clone showing the right insert size was selected for
transformation. Subcloning artifacts were excluded by 5' and 3'
sequence of the vector-insert boundaries.
ACL (ATP Citrate Lyase, Subunits 1 & 2):
[0274] Lipid biosynthesis is known to be localized in the plastids
and therefore an enzyme that should resume a catalytic role in the
biosynthesis of fatty acids, such as ATP Citrate lyase, has to be
targeted to the plastid. Since the cloned corn ATP Citrate lyase is
of cytosolic origin, it does not contain a signal peptide. A
chloroplast transit sequence was therefore fused to Subunits 1
& 2 of the corn ATP Citrate lyase. The cts used was based on
the small subunit of ribulose 1,5-bisphospate carboxylase from corn
(Lebrun et al (1987) Nucleic Acid Res. 15:4360) and is designated
mcts. For fusion between SU1 of ATP Citrate lyase and mcts, the
transit sequence was amplified with primers
(TCATACCCGGGTCAAGAATCAGCCCAAGCAG and
CCCGGGAATTCGCACCGGATTCTTCCGCCGT [SEQ ID NOs:440 and 441,
respectively]), which introduce a MfeI site at the 5' end and XmaI
and EcoRI site at the 3' end. For fusion of the SU2 of ATP Citrate
lyase to the mcts, the transit sequence was amplified with primers
(CAATTGATGGCGCCCACCGTGATGAT and CCCGGGCTAGCCATGCACCGGATTCTTCCG [SEQ
ID NOs:442 and 443, respectively]), which introduces a MfeI site at
the 5' end and NheI and XmaI site at the 3' end. Each of the
amplified Pcr products was subcloned into the Topo TA sequencing
vector (Invitrogen). Ampicillin resistant colonies were further
analyzed for presence of the inserts using restriction enzyme
digests and three clones for each insert were sequenced. One of
each of the clones, whose sequence agreed completely with the
published sequence of the transit peptide, was submitted to an
MfeI-XmaI digest and the corresponding 158 bp fragments were gel
extracted and cloned into the MfeI-XmaI site of pMut256, which then
were designated pMut257 and pMut258.
[0275] A full length clone (cdo1c.pk001.c1, SEQ ID NO:199) for
Subunit 1 of the ATP citrate lyase gene was obtained from Dupont's
EST database. An open reading frame encomprising nucleotides
66-1337 was amplified using Primers (CCCGGGCTAGCCATGCACCGGATTCTTCCG
and CCCGGGTTACGCTGCAGCCATGATGC [SEQ ID NOs:444 and 445,
respectively]. The 1271 bp PCR fragment was gel isolated and cloned
into the Topo TA cloning vector. Ampicillin resistant colonies were
further analysed for the presence of the insert using restriction
enzyme analysis. 3 clones positive for the insert were sequenced.
One of the sequenced clones was digested with EcoRI and XmaI and
the corresponding fragment was gel extracted and cloned into the
EcoRI-XmaI site of pMut257. In order to put the mcts in frame with
the gene for ATP Citrate lyase subunit 1, a 184 bp KasI-Bsu361
fragment, which encomprises the EcoRI cloning site between the ATP
sitrate lyase subunit 1 and the transit peptide, was isolated and
substituted with a 178 pb KasI-Bsu361 fragment that has been
generated using PCR amplification with the primers
(GGATGGCGCCCACCGTGATGATGGC; CGCGCCATGCACCGGATTCTTCC;
CTTCTTGCGCGCCATGCACCGGATTCT; GTACTCCCGGATCTTCTTGCGCGCCAT;
CGCTTGGAGTCGTACTCCCGGATCTTCTTG; and
GCTTCCTGAGGAGGCGCTTGGAGTCGTACTCCCG [SEQ ID NOs:446-451,
respectively]). This fragment is void of the EcoRI site. Clones
containing the insert, which was verified by restriction enzyme
analysis were sequenced and the absence of the EcoRI site
verified.
[0276] A full length clone (ctn1c.pk002.o4, SEQ ID NO:201) for
subunit 2 of ATP Citrate lyase from corn was obtained from Dupont's
EST Database. An open reading frame encompassing 1827 bp was
amplified using primers ((ATGGCTAGCGGGCAACTTTTCTCA and
GTACCCCCGGGTCACTTGGTGTAAAGTACATCCT [SEQ ID NOs:452 and 453,
respectively]). Primer with Seq. ID NO: 452 introduces a NheI
restriction site, which changes the third nucleotide in the second
codon after the translation start from G to T, which does not
result in a change in the amino acid sequence of the protein. The
primer also changes the third codon from ACG to AGC which results
in a change from threonine to serine in the protein. Primer with
SEQ ID NO:453 introduces a XmaI site just past the stop codon of
the Subunit 2 of the ATP citrate lyase gene. The resulting PCR
fragment was subcloned into Topo TA sequencing vector (Invitrogen)
and Ampicillin resistant colonies were further analyzed by
restriction digest analysis and three clones positive for the
insert were sequenced. All of three sequences appear to agree with
the sequence of clone ctn1c.pk002.o4. One of the clones was
digested with NheI and XmaI and the corresponding 1824 bp fragment
was gel isolated and cloned into pMut 258. The resulting vector was
called SIACL2 and presence of the insert was verified by 5' and
3'-end sequencing of the vector/insert boundaries.
MAP Kinase Kinase 3 (MAPKK3/MEK3)
[0277] A full length clone for a corn homolog of then MEK3 gene
(p0125.czaab60rb:fis [SEQ ID NO:7]) was obtained from
Dupont/Pioneer EST Database. The missing 5' end of the corn MEK3
clone was amplified from a corn embryo cDNA library by PCR using a
forward primer in the vector and a reverse one internal to EST
clone p0125.czaab60rb:fis (GCCAAGCTCGGAATTAACCCTCA and
CGCAGACCAAGCAATACTTT respectively, [SEQ ID NOs:454 and 455,
respectively]). A full length corn MEK3 was constructed by joining
this PCR-amplified MEK3 5' end fragment into the
p0125.czaab60rb:fis clone. The full-length MEK3 was confirmed by
sequence. The coding region of the full-length MEK3 clone is PCR
amplified using the primers GTTGAATTCCAGGGTGCATT and
CGAAAGGAATTCTTCTAAATCCTC [SEQ ID NOs:456 and 457, respectively]
which leaves terminal SmaI sites. The PCR product is digested with
SmaI and subcloned into pMUT256e opened by digestion with SmaI. One
clone is selected for corn transformation after restriction
digestion analysis for correct insert size and orientation.
Subcloning artifacts are excluded by 5' and 3' sequence of the
vector-insert boundaries.
Example 9
Transformation of Immature Embryos by Particle Bombardment and
Regeneration of Corn Plants
[0278] Immature maize embryos from greenhouse donor plants are
bombarded with a plasmid containing the gene of the invention
operably linked to a weak promoter, such as the nos promoter, or an
inducible promoter, such as In2, plus a plasmid containing the
selectable marker gene PAT (Wohlleben et al (1988) Gene 70:25-37)
that confers resistance to the herbicide Bialaphos. Transformation
is performed as follows. The ears are surface sterilized in 30%
Chloral bleach plus 0.5% Micro detergent for 20 minutes, and rinsed
two times with sterile water. The immature embryos are excised and
placed embryo axis side down (scutellum side up), 25 embryos per
plate. These are cultured on 560 L medium 4 days prior to
bombardment in the dark. Medium 560 L is an N6-based medium
containing Eriksson's vitamins, thiamine, sucrose, 2,4-D, and
silver nitrate. The day of bombardment, the embryos are transferred
to 560 Y medium for 4 hours and are arranged within the 2.5-cm
target zone. Medium 560Y is a high osmoticum medium (560 L with
high sucrose concentration). A plasmid vector comprising the gene
of the invention operably linked to the selected promoter is
constructed. This plasmid DNA plus plasmid DNA containing a PAT
selectable marker is precipitated onto 1.1 .mu.m (average diameter)
tungsten pellets using a CaCl.sub.2 precipitation procedure as
follows: 100 .mu.l prepared tungsten particles in water, 10 .mu.l
(1 .mu.g) DNA in TrisEDTA buffer (1 .mu.g total), 100 .mu.l 2.5 M
CaCl.sub.2, 10 .mu.l 0.1 M spermidine. Each reagent is added
sequentially to the tungsten particle suspension, while maintained
on the multitube vortexer. The final mixture is sonicated briefly
and allowed to incubate under constant vortexing for 10 minutes.
After the precipitation period, the tubes are centrifuged briefly,
liquid removed, washed with 500 ml 100% ethanol, and centrifuged
for 30 seconds. Again the liquid is removed, and 105 .mu.l 100%
ethanol is added to the final tungsten particle pellet. For
particle gun bombardment, the tungsten/DNA particles are briefly
sonicated and 10 .mu.l spotted onto the center of each macrocarrier
and allowed to dry about 2 minutes before bombardment. The sample
plates are bombarded at level #4 in particle gun #HE34-1 or
#HE34-2. All samples receive a single shot at 650 PSI, with a total
of ten aliquots taken from each tube of prepared particles/DNA.
Following bombardment, the embryos are kept on 560Y medium, an N6
based medium, for 2 days, then transferred to 560R selection
medium, an N6 based medium containing 3 mg/liter Bialaphos, and
subcultured every 2 weeks. After approximately 10 weeks of
selection, selection-resistant callus clones are sampled for PCR
and activity of the gene of interest. Positive lines are
transferred to 288J medium, an N6 based medium with lower sucrose
and hormone levels, to initiate plant regeneration. Following
somatic embryo maturation (2-4 weeks), well-developed somatic
embryos are transferred to medium for germination and transferred
to the lighted culture room. Approximately 7-10 days later,
developing plantlets are transferred to medium in tubes for 7-10
days until plantlets are well established. Plants are then
transferred to inserts in flats (equivalent to 2.5'' pot)
containing potting soil and grown for 1 week in a growth chamber,
subsequently grown an additional 1-2 weeks in the greenhouse, then
transferred to classic 600 pots (1.6 gallon) and grown to maturity.
Plants are monitored for expression of the gene of interest.
Example 10
Transformation of Callus and Regeneration of Corn Plants
Particle Gun
Type II Callus Isolation and Maintenance
[0279] After 10-21 days, type II callus is initiated from the
scutellum and appears as a friable, embryogenic outgrowth of
rapidly dividing cells. Callus is subcultured every 5-10 days and
maintained on N6 medium supplemented with 1 mg/L 2,4-D (CM). These
cultures are used in transformation experiments from 5 to 12 weeks
after initiation.
Preparation of Callus for Transformation.
[0280] Proembryogenic type II callus is transferred to #4 Whatman
filter paper on CM media. The CM plates with callus is wrapped with
parafilm and incubated in the dark Conviron growth chamber (45%
humidity, 27-28.degree. C.) for two days before bombardment. Prior
to bombardment, the osmotic plates are left partially ajar for
thirty minutes in the laminar flow hood to allow moisture on the
tissue to dissipate.
Gold Particle Preparation
[0281] Sixty mg of 0.6 micron gold is weighed out in a siliconized
eppendorf tube (Axgen Microtubes-1.7 ml clear tube). The tube is
left stationary for 15 minutes and spun down. The pellet is rinsed
with sterile water three more times. Subsequently, one ml of
sterile water is added to the gold pellet and vortexed for 10
minutes. The gold particles are divided into 50 ul aliquots.
DNA/Gold Preparation
[0282] Fifty .mu.L of 0.6 micron gold in sterile dd H2O. A 2:1
molar ratio of trait gene:bar gene (usually .about.5-10 ug in total
DNA) is added and vortexed. Subsequently, fifty .mu.L of 2.5 M
CaCl.sub.2 is added quickly into the suspension and vortexed
followed by the addition of 20 .mu.L of 0.1 M spermidine and
vortexed and spun down. The pellet is rinsed 3.times. in 100%
ethanol. The pellet is gently resuspended by tapping the side of
the eppendorf tube several times. The DNA prep is stored in the
20.degree. C. freezer.
Loading of the Macrocarrier
[0283] The DNA/gold prep is thawed and sonicated (2 strokes) in the
Branson 200 Ultrasonic cleaner prior to the addition to
macrocarriers. The suspension is mixed well by pipetting in and
out. Immediately, 6 .mu.l of DNA/gold suspension is dispensed
quickly to the center of each macrocarrier. Once the DNA prep is
dried onto the macrocarrier, the PDS-100/He Gun is used to bombard
the maize callus cells with the DNA-coated gold particles.
Particle Gun Parameters.
[0284] Plates containing callus are the bombarded with the
PDS-1000/He Gun using the following parameters: 1) DNA precipitated
onto 0.6 .mu.M Gold particles; 2) 8 cm distance from stopping
screen; 3) 27-29 inches Hg vacuum; 4) 1050-1100 PSI He
pressure.
[0285] Selection of Transgenic Callus Lines.
[0286] After 3-4 days of incubation in the dark chamber the callus
is transferred (3-4 mm clumps) onto media containing 3-5 ppm
bialaphos (SM3 or SM5). The SM plates are incubated in the dark at
27.degree. C. for .about.7-14 days. Thereafter, all callus is
transferred onto SM (5 ppm bialaphos) keeping track of unique lines
as above. Each clump may be split into several pieces at this
transfer.
[0287] Regeneration of Transgenic Maize Plants.
[0288] Callus events are isolated onto fresh SM medium, sampled for
PCR (polymerase chain reaction) and placed on first-stage
regeneration media (RM31). After 10-14 days, the proembryogenic
callus are transferred onto fresh RM3 plates and placed in the
light chamber at 26.degree. C. Plantlets approximately 2-3 cm are
removed and transfer to RM4 media tubs. After 1-2 weeks plants from
RM4 are potted to a maximum of two plantlets per pot. The pots are
then placed in the Conviron growth chamber (photolight=20 hours,
humidity=65%, temperature=24.degree. C.) and watered with Roots2
solution. Plants (.about.20 cm tall) are tested for expression of
the bar gene by performing a 2% basta swipe test.
Example 11
Analysis of Fatty Acid Content and Composition by Gas
Chromatography (GC)
[0289] Fatty acid (FA) determination was done from a total of
300-400 mg of tissue lyophilized for 24 hours. The tissue was then
ground using a FastPrep mill (Bio101) at 4.5 speed and 20 seconds
in the presence of 0.5 ml of 2.5% Sulfuric Acid+97.5% Methanol and
Heptadecanoic acid (17:0, stock 10 mg/ml in Tuloene) as an external
standard. Thereafter, another 0.5 ml 2.5% Sulfuric Acid+97.5%
Methanol was used to wash each tube and incubate in 95.degree. C.
for 1 hour for transesterification. The tubes were removed from the
water bath and allowed to cool down to RT. FAs were extracted in
one volume of heptane:H.sub.2O (1:1) and cleared by centrifugation.
The supernatant (50 ul) containing the fatty acid methyl esters
were loaded into a Hewlett Packard 6890 gas chromatograph fitted
with a 30 m.times.0.32 mm Omegawax column and the separated peaks
were analyzed and characterized.
Example 12
Lec 1 Over-Expression Leads to Altered Fatty Acid Accumulation in
Maize Somatic Embryos
[0290] The ubiquitin promoter (Christensen et al (1992) Plant Mol
Biol 18:675-89) was used to drive Hap3/Lec1 expression (outlined in
Example 8) in maize embryogenic callus to test what phenotype would
arise from over-expression of Lec1 in somatic embryos.
Transformation of the construct into maize embryogenic callus and
generation of somatic embryos is outlined in Example 10.
[0291] More than ten different events were analysed by GC for fatty
acid content/composition and compared to controls transformed with
the selectable marker (BAR gene) plasmid alone. A pool of three
embryos each from XX different events showed that the somatic
embryos overexpressing Lec1 contain elevated fatty acid content
(average 119% increase over control) with no significant alteration
in fatty acid composition when compared to the control somatic
embryos.
Example 13
Nuclear Magnetic Resonance (NMR) Analysis
[0292] Seed are imbibed in distilled water for 12-24 hours at
4.degree. C. The embryo is dissected away and stored in a 48 well
plate. The samples are lyophilized overnight in a Virtis
24.times.48 lyophilizer. The NMR (Process Control Technologies--PCT
(Ft. Collins, Colo.) is set up as per the manufacturer's
instructions. The NMR is calibrated using a series of 5 mm NMR
tubes containing precisely measured amounts of corn oil (Mazola).
The calibration standards are 3, 6, 9, 12, 15, 18, 21, 27, 33, and
40 mg of oil.
Example 14
Lec 1 Over-Expression Leads to Altered Oil Accumulation in Maize
Kernels
[0293] The Hap3/Lec1 expression construct with the oleosin promoter
(outlined in Example 8) was introduced into maize to test what
phenotype would arise from seed specific over-expression.
Transformation of the construct into maize was accomplished using
Agrobacterium tumefaciens as follows.
[0294] Freshly isolated immature embryos of maize, about 10 days
after pollination (DAP), are incubated with the Agrobacterium. The
preferred genotype for transformation is the highly transformable
genotype Hi-II (Armstrong, C. L., 1991, Development and
Availability of Germplasm with High Type II Culture Formation
Response, Maize Genetics Cooperation Newsletter, 65:92-93). An
F.sub.1 hybrid created by crossing with an Hi-II with an elite
inbred may also be used. After Agrobacterium treatment of immature
embryos, the embryos are cultured on medium containing toxic levels
of herbicide. Only those cells which receive the
herbicide-resistance gene, and the linked gene(s), grow on
selective medium. Transgenic events so selected are propagated and
regenerated to whole plants, produce seed, and transmit transgenes
to progeny.
[0295] The engineered Agrobacterium tumefaciens LBA4404 is
constructed as per U.S. Pat. No. 5,591,616 to contain the linked
gene(s) and the selectable marker gene. Typically either BAR
(D'Halluin et al (1992) Methods Enzymol. 216:415-426) or PAT
(Wohlleben et al (1988) Gene 70:25-37) may be used.
[0296] To use the engineered vector in plant transformation, a
master plate of single bacterial colonies is first prepared by
inoculating the bacteria on minimal AB medium and then incubating
the bacteria plate inverted at 28.degree. C. in darkness for about
3 days. A working plate is then prepared by selecting a single
colony from the plate of minimal A medium and streaking it across a
plate of YP medium. The YP-medium bacterial plate is then incubated
inverted at 28.degree. C. in darkness for 1-2 days.
[0297] Agrobacterium for plant transfection and co-cultivation is
prepared 1 day prior to transformation. Into 30 ml of minimal A
medium in a flask is placed 50 .mu.g/ml spectinomycin (or
appropriate bacterial antibiotic depending on marker in
co-integrate),100 .mu.M acetosyringone, and about a 1/8 loopful of
Agrobacterium from a 1 to 2-day-old working plate. The
Agrobacterium is then grown at 28.degree. C. at 200 rpm in darkness
overnight (about 14 hours). In mid-log phase, the Agrobacterium is
harvested and resuspended at 3 to 5.times.10.sup.8 CFU/ml in 561Q
medium +100 .mu.M acetosyringone using standard microbial
techniques and standard curves.
Immature Embryo Preparation
[0298] Nine to ten days after controlled pollination of a corn
plant, developing immature embryos are opaque and 1-1.5 mm long and
are the appropriate size for Agro-infection. The husked ears are
sterilized in 50% commercial bleach and 1 drop Tween for 30
minutes, and then rinsed twice with sterile water. The immature
embryos are aseptically removed from the caryopsis and placed into
2 ml of sterile holding solution comprising of 561Q+100 .mu.M
acetosyringone.
Agrobacterium Infection and Co-Cultivation of Embryos
[0299] Holding solution is decanted from excised immature embryos
and replaced with prepared Agrobacterium. Following gentle mixing
and incubation for about 5 minutes, the Agrobacterium is decanted
from the immature embryos. Immature embryos are then moved to a
plate of 562P medium, scutellum surface upwards, and incubated at
20.degree. C. for 3 days in darkness followed by incubation at
28.degree. C. for 3 days in darkness on medium 562P+100 mg/ml
carbenecillin (see U.S. Pat. No. 5,981,840).
Selection of Transgenic Events
[0300] Following incubation, the immature embryos are transferred
to 563O medium for selection of events. The transforming DNA
possesses a herbicide-resistance gene, in this example the PAT
gene, which confers resistance to bialaphos. At 10- to 14-day
intervals, embryos are transferred to 5630 medium. Actively growing
putative transgenic embryogenic tissue is visible in 6-8 weeks.
Regeneration of T.sub.0 Plants
[0301] Transgenic embryogenic tissue is transferred to 288W medium
and incubated at 28.degree. C. in darkness until somatic embryos
matured, or about 10 to 18 days. Individual matured somatic embryos
with well-defined scutellum and coleoptile are transferred to 272
embryo germination medium and incubated at 28.degree. C. in the
light. After shoots and roots emerge, individual plants are potted
in soil and hardened-off using typical horticultural methods.
Confirmation of Transformation
[0302] Putative transgenic events are subjected to analysis to
confirm their transgenic nature. Events are tested for the presence
of Lec1 by PCR amplification. Additionally, T.sub.0 plants are
painted with bialaphos herbicide. The subsequent lack of a
herbicide-injury lesion indicates the presence and action of the
herbicide resistance gene. The plants are monitored and scored for
altered Lec1 expression and/or phenotype such as increased organic
sulfur compounds.
Media Recipes
[0303] Medium 561 Q contains the following ingredients: 950.000 ml
of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma
C-1416); 1.000 ml of Eriksson's Vitamin Mix (1000.times.
Sigma-1511); 1.250 ml of Thiamine.HCL.4 mg/ml; 3.000 ml of 2, 4-D
0.5 mg/ml (No. 2A); 0.690 g of L-proline; 68.500 g of Sucrose; and
36.000 g of Glucose. Directions are: dissolve ingredients in
polished deionized water in sequence; adjust pH to 5.2 w/KOH; Q.S.
to volume with polished deionized water after adjusting pH; and
filter sterilize (do not autoclave).
[0304] Medium 562 P contains the following ingredients: 950.000 ml
of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma
C-1416); 1.000 ml of Eriksson's Vitamin Mix (1000.times.
Sigma-1511); 1.250 ml of Thiamine.HCL.4 mg/ml; 4.000 ml of 2, 4-D
0.5 mg/ml; 0.690 g of L-proline; 30.000 g of Sucrose; 3.000 g of
Gelrite, which is added after Q.S. to volume; 0.425 ml of Silver
Nitrate 2 mg/ml #; and 1.000 ml of Aceto Syringone 100 mM #.
Directions are: dissolve ingredients in polished deionized water in
sequence; adjust pH to 5.8 w/KOH; Q.S. to volume with polished
deionized water after adjusting pH; and sterilize and cool to
60.degree. C. Ingredients designated with a # are added after
sterilizing and cooling to temperature.
[0305] Medium 563 O contains the following ingredients: 950.000 ml
of D-I Water, Filtered; 4.000 g of Chu (N6) Basal Salts (Sigma
C-1416); 1.000 ml of Eriksson's Vitamin Mix (1000.times.
Sigma-1511); 1.250 ml of Thiamine.HCL.4 mg/ml; 30.000 g of Sucrose;
3.000 ml of 2,4-D 0.5 mg/ml (No. 2A); 0.690 g of L-proline; 0.500 g
of Mes Buffer; 8.000 g of Agar (Sigma A-7049, Purified), which is
added after Q.S. to volume; 0.425 ml of Silver Nitrate 2 mg/ml #;
3.000 ml of Bialaphos 1 mg/ml #; and 2.000 ml of Agribio
Carbenicillin 50 mg/ml #. Directions are: dissolve ingredients in
polished deionized water in sequence; adjust to pH 5.8 w/koh; Q.S.
to volume with polished deionized water after adjusting pH;
sterilize and cool to 60.degree. C. Ingredients designated with a #
are added after sterilizing and cooling to temperature.
[0306] Medium 288 W contains the following ingredients: 950.000 ml
of D-I H.sub.2O; 4.300 g of MS Salts; 0.100 g of Myo-Inositol;
5.000 ml of MS Vitamins Stock Solution (No. 36J); 1.000 ml of
Zeatin.5 mg/ml; 60.000 g of Sucrose; 8.000 g of Agar (Sigma A-7049,
Purified), which is added after Q.S. to volume; 2.000 ml of IAA 0.5
mg/ml #; 1.000 ml of 0.1 Mm ABA #; 3.000 ml of Bialaphos 1 mg/ml #;
and 2.000 ml of Agribio Carbenicillin 50 mg/ml #. Directions are:
dissolve ingredients in polished deionized water in sequence;
adjust to pH 5.6; Q.S. to volume with polished deionized water
after adjusting pH; sterilize and cool to 60.degree. C. Add 3.5 g/L
of Gelrite for cell biology. Ingredients designated with a # are
added after sterilizing and cooling to temperature.
[0307] Medium 272 contains the following ingredients: 950.000 ml of
deionized water; 4.300 g of MS Salts; 0.100 g of Myo-Inositol;
5.000 of MS Vitamins Stock Solution; 40.000 g of Sucrose; and 1.500
g of Gelrite, which is added after Q.S. to volume. Directions are:
dissolve ingredients in polished deionized water in sequence;
adjust to pH 5.6; Q.S. to volume with polished deionized water
after adjusting pH; and sterilize and cool to 60.degree. C.
[0308] Medium minimal A contains the following ingredients: 950.000
ml of deionized water; 10.500 g of potassium phosphate dibasic
K2HPO4; 4.500 g of potassium phosphate monobasic KH2PO4; 1.000 g of
ammonium sulfate; 0.500 g of sodium citrate dihydrate; 10.000 ml of
sucrose 20% solution #; and 1.000 ml of 1M magnesium sulfate #.
Directions are: dissolve ingredients in polished deionized water in
sequence; Q.S. to volume with deionized water; sterilize and cool
to 60.degree. C. Ingredients designated with a # are added after
sterilizing and cooling to temperature.
[0309] Medium minimal AB contains the following ingredients:
850.000 ml of deionized water; 50.000 ml of stock solution 800A; 9
g of Phytagar which is added after Q.S. to volume; 50.000 ml of
stock solution 800B #; 5.000 g of glucose #; and 2.000 ml of
spectinomycin 50/mg/ml stock #. Directions are: dissolve
ingredients in polished deionized water in sequence; Q.S. to volume
with polished deionized water less 100 ml per liter; sterilize and
cool to 60.degree. C. Ingredients designated with a # are added
after sterilizing and cooling to temperature. Stock solution 800A
contains the following ingredients: 950.000 ml of deionized water;
60.000 g of potassium phosphate dibasic K2HPO4; and 20.000 g of
sodium phos. monobasic, hydrous. Directions are: dissolve
ingredients in polished deionized water in sequence; adjust pH to
7.0 with potassium hydroxide; Q.S. to volume with polished
deionized water after adjusting pH; and sterilize and cool to
60.degree. C. Stock solution 800B contains the following
ingredients: 950.000 ml of deionized water; 20.000 g of ammonium
chloride; 6.000 g of magnesium sulfate 7-H.sub.2O, MgSO.sub.4, 7
H.sub.2O; 3.000 g of potassium chloride; 0.200 g of calcium
chloride (anhydrate); and 0.050 g of ferrous sulfate 7-hydrate.
Directions are: dissolve ingredients in polished deionized water in
sequence; Q.S. to volume with polished deionized water; and
sterilize and cool to 60.degree. C.
[0310] Medium minimal YP contains the following ingredients:
950.000 ml of deionized water; 5.000 g of yeast extract (Difco);
10.000 g of peptone (Difco); 5.000 g of sodium chloride; 15.000 g
of bacto-agar, which is added after Q.S. to volume; and 1.000 ml of
spectinomycin 50 mg/ml stock #. Directions are: dissolve
ingredients in polished deionized water in sequence; adjust pH to
6.8 with potassium hydroxide; Q.S. to volume with polished
deionized water after adjusting pH; sterilize and cool to
60.degree. C. Ingredients designated with a # are added after
sterilizing and cooling to temperature.
[0311] More than twenty events producing segregating T1 seed were
analyzed by NMR for embryo oil content (see Example 13). Six to
twelve embryos analyzed for each of five different events showed
that some embryos within each event contained elevated oil content.
The same embryos from these five events were analyzed by PCR to
determine the presence or absence of the Lec1 construct. Embryos
with high oil are always found to contain the Lec1 construct
(darkly shaded bars), whereas embryos with normal levels of oil
were typically found not to contain the Lec1 construct
(cross-hatched bars). These data demonstrate the presence of the
Lec1 gene does lead to increased oil in the embryo. It is believed
that embryos containing sharply higher levels of oil were
homozygous for the Lec1 construct, as these events were segregating
1:2:1. For these events, the oil concentration in the embryos
containing the Lec1 construct greatly surpassed any increase
previously achieved through enzymatic modification of the fatty
acid biosynthetic pathway, with some embryos containing an average
increase of 56% in embryo oil content. Plants derived from seed
that contained high oil exhibit some phenotypic changes in growth
and development. There is an accumulation of additional leaves
during early growth and development phase, and strong leaf curling
throughout plant growth and development.
Example 15
Additional Promoters Coupled to Lec1 Also Result in Altered Maize
Kernel Oil Accumulation
[0312] Other types of seed-specific promoters, the lipid transfer
protein promoter and the gamma zein promoter, were also tested for
their ability to alter oil accumulation in maize kernels when
expressing Lec1. Transformation and analysis of these constructs
was essentially the same as protocols outlined in Example 14. More
than twenty events producing segregating T1 seed are analyzed by
NMR for embryo oil content (see Example 13). Six to twelve embryos
were analyzed for each event. Events containing embryos with high
oil content were analyzed further. The same embryos from these
events are analyzed by PCR to determine the presence or absence of
the Lec1 construct. As with the oleosin promoter containing
construct, all embryos with high oil contents are found to contain
the Lec1 construct, whereas embryos with lower or normal oil
contents are typically found not to contain the Lec1 construct.
Like the events containing Lec1 and the oleosin promoter, the oil
concentration in the embryo for these events also greatly surpass
any increase previously achieved through enzymatic modification,
with some embryos containing an average increase of more than 50%
in embryo oil content.
[0313] Surprisingly, plants derived from seed containing high oil
using this construct do not show the abnormal phenotype found for
plants expressing Lec1 under the control of the oleosin promoter.
It is believed that these data demonstrate that high oil can be
achieved in the embryo without negative agronomic effects when the
appropriate expression is employed.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140325704A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140325704A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References