U.S. patent application number 14/263158 was filed with the patent office on 2014-10-30 for transgenic non-human assay vertebrates, assays and kits.
This patent application is currently assigned to Kymab Limited. The applicant listed for this patent is Kymab Limited. Invention is credited to Allan Bradley, E-Chiang Lee, Qi Liang.
Application Number | 20140325690 14/263158 |
Document ID | / |
Family ID | 45373578 |
Filed Date | 2014-10-30 |
United States Patent
Application |
20140325690 |
Kind Code |
A1 |
Bradley; Allan ; et
al. |
October 30, 2014 |
Transgenic Non-Human Assay Vertebrates, Assays and Kits
Abstract
The invention provides Assay Vertebrates comprising a human
antigen or epitope knock-in for testing antibodies comprising human
variable regions and generated in a related Antibody-Generating
Vertebrate. The invention also provides kits and methods involving
these vertebrates and antibodies. The invention provides for
superior assay models and assay methods of chimaeric and other test
antibodies comprising human variable regions.
Inventors: |
Bradley; Allan; (Cambridge,
GB) ; Lee; E-Chiang; (Cambridge, GB) ; Liang;
Qi; (Cambridge, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kymab Limited |
Cambridge |
|
GB |
|
|
Assignee: |
Kymab Limited
Cambridge
GB
|
Family ID: |
45373578 |
Appl. No.: |
14/263158 |
Filed: |
April 28, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/GB2012/052670 |
Oct 26, 2012 |
|
|
|
14263158 |
|
|
|
|
Current U.S.
Class: |
800/3 ; 800/14;
800/18; 800/21; 800/6 |
Current CPC
Class: |
G01N 33/5088 20130101;
A01K 67/0276 20130101; G01N 33/53 20130101; A61K 49/00
20130101 |
Class at
Publication: |
800/3 ; 800/18;
800/14; 800/6; 800/21 |
International
Class: |
A01K 67/027 20060101
A01K067/027; A61K 49/00 20060101 A61K049/00 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 28, 2011 |
GB |
1118647.5 |
Claims
1. A method of assaying a test antibody comprising human variable
regions that bind to a human epitope, wherein the antibody is
isolated from a first transgenic non-human vertebrate wherein said
vertebrate is designated an Antibody-Generating Vertebrate,
optionally a mouse or a rat, following immunisation with an antigen
bearing said human epitope, and optionally subsequent
derivatisation or maturation of said antibody, the vertebrate
comprising one or more transgenic antibody loci encoding said
variable regions, and the transgenic vertebrate having an immune
system comprising proteins encoded by an immune gene repertoire,
said immune gene repertoire comprising said transgenic antibody
loci, the method comprising (a) providing a second transgenic
non-human wherein said vertebrate is designated as an Assay
Vertebrate, optionally a mouse or a rat, that is a modified version
of said first transgenic non-human vertebrate, wherein the Assay
Vertebrate comprises (i) an immune system comprising proteins
encoded by substantially the same immune gene repertoire as the
Antibody-Generating Vertebrate; (ii) a genome comprising a knock-in
of said human epitope, so that the Assay Vertebrate is capable of
expressing an antigen bearing said human epitope; and (iii)
optionally wherein said genome has a knock-out of an endogenous
non-human vertebrate epitope that is an orthologue or homologue of
said human epitope, wherein said Assay Vertebrate cannot express an
antigen bearing said endogenous epitope; (b) introducing said
antibody into the Assay Vertebrate; and (c) assaying the effect or
behaviour of said antibody in said Assay Vertebrate.
2. The method of claim 1, wherein the Antibody-Generating
Vertebrate and Assay Vertebrate have substantially identical
genomes with the exception that the Assay Vertebrate genome
comprises said knock-in.
3. The method of claim 1, wherein the Antibody-Generating
Vertebrate and Assay Vertebrate genomes comprise said
knock-out.
4. The method of claim 1, wherein in step (c) said assaying is
assay of one or more selected from the group consisting of:
pharmacodynamics of said antibody, pharmacokinetics of said
antibody, activity of said antibody, clearance of said antibody,
distribution of said antibody, toxicology of said antibody, a
physico-chemical characteristic or effect of said antibody, a
binding characteristic of said antibody, a biological
characteristic or effect of said antibody, a physiological
characteristic or effect of said antibody, a pharmaceutical
characteristic or effect of said antibody, and interaction of said
antibody with another protein or substance inside the Assay
Vertebrate; and immunogenicity of the antibody.
5. The method of claim 1, wherein the Antibody-Generating
Vertebrate is a genetic parent or grandparent of the Assay
Vertebrate.
6. The method of claim 1, wherein the Assay Vertebrate is derived
from a somatic cell of said Antibody-Generating Vertebrate;
optionally wherein the Assay Vertebrate is derived from an IPS cell
that is derived from said Antibody-Generating Vertebrate.
7. An assay kit comprising an Antibody-Generating Vertebrate and
Assay Vertebrate as defined in claim 1, and optionally a test
antibody.
8. A non-human, optionally a mouse or a rat, Assay Vertebrate
comprising (i) one or more transgenic antibody loci encoding human
variable regions; (ii) an immune system comprising proteins encoded
by an immune gene repertoire, said immune gene repertoire
comprising said transgenic antibody loci; (iii) a genome comprising
a knock-in of a human epitope, so that the Assay Vertebrate is
capable of expressing an antigen bearing said human epitope; and
(iv) a genome knock-out of the endogenous non-human vertebrate
epitope that is an orthologue or homologue of said human epitope,
wherein said Assay Vertebrate cannot express an antigen bearing
said endogenous epitope; and (v) optionally a test antibody inside
said Assay Vertebrate, wherein the antibody comprises human
variable regions that can bind said human epitope, said antibody
having been generated in an Antibody-Generating Vertebrate as
defined in claim 1, and optionally having undergone subsequent
derivatisation or maturation of said antibody,
9. A method of generating a non-human Assay Vertebrate, optionally
a mouse or a rat, for assaying the effect or behaviour of a test
antibody comprising human variable regions and which binds a human
epitope, the method comprising (a) obtaining a non-human vertebrate
child ES cell whose genome is a genetic cross between: (i) the
genome of a first genetic parent that is a non-human
Antibody-Generating Vertebrate whose genome encodes said test
antibody, the Antibody-Generating Vertebrate comprising one or more
transgenic antibody loci encoding antibodies comprising human
variable regions, and the Antibody-Generating Vertebrate having an
immune system comprising proteins encoded by an immune gene
repertoire, said immune gene repertoire comprising said transgenic
antibody loci; and (ii) the genome of a second genetic parent that
is a non-human vertebrate of the same species, optionally the same
strain, as said Antibody-Generating Vertebrate, the second parent
having an immune system encoded by substantially the same immune
gene repertoire as the first parent; (b) producing in vitro a
modified child ES cell with a knock-in of the human epitope by
introducing into the genome of the child ES cell a nucleotide
sequence encoding said human epitope and optionally knocking-out of
the genome an endogenous non-human vertebrate epitope that is an
orthologue of said human epitope; and (c) developing a non-human
child vertebrate from said modified child ES cell, wherein an Assay
Vertebrate is obtained that expresses said human epitope; and (d)
optionally producing a progeny of said Assay Vertebrate by genetic
crossing, wherein said progeny comprises substantially the same
immune gene repertoire as said Assay Vertebrate in addition to the
human epitope knock-in, and optionally the knock-out.
10. The method of claim 9, wherein the first and second genetic
parents (a) (i) and (ii) are of the same non-human vertebrate,
optionally a mouse or a rat, strain.
11. The method of claim 10, wherein the first and second genetic
parents are related as (a) siblings, (b) parent and child, (c)
parent and grandchild, (d) cousins or (e) uncle/aunt and
nephew/niece.
12. A method of generating a non-human Assay Vertebrate, optionally
a mouse or a rat, for assaying the effect or behaviour of a test
antibody comprising human variable regions and which binds a human
epitope, the method comprising: (a) obtaining a non-human
vertebrate child ES cell from a somatic cell, wherein optionally
said cell is an IPS cell, of a non-human Antibody-Generating
Vertebrate whose genome encodes said test antibody, the
Antibody-Generating Vertebrate comprising one or more transgenic
antibody loci encoding antibodies comprising human variable
regions, and the Antibody-Generating Vertebrate having an immune
system comprising proteins encoded by an immune gene repertoire,
said immune gene repertoire comprising said transgenic antibody
loci; (b) producing a modified child ES cell with a knock-in of the
human epitope by introducing into the genome of the child ES cell a
nucleotide sequence encoding said human epitope and optionally
knocking-out of the genome an endogenous non-human vertebrate
epitope that is an orthologue of said human epitope; and (c)
developing a non-human child vertebrate from said modified child ES
cell, wherein an Assay Vertebrate is obtained that expresses said
human epitope; and (d) optionally producing a progeny of said Assay
Vertebrate by genetic crossing, wherein said progeny comprises
substantially the same immune gene repertoire as said Assay
Vertebrate in addition to the human epitope knock-in, and
optionally the knock-out.
13. The method of claim 12, wherein the IPS cell is a mouse
embryonic fibroblast cell.
14. A method of generating a non-human Assay Vertebrate, optionally
a mouse or rat, for assaying the effect or behaviour of a test
antibody comprising human variable regions and which binds a human
epitope, the method comprising (a) providing an ES cell derived
from an Antibody-Generating Vertebrate whose genome encodes said
test antibody, the Antibody-Generating Vertebrate comprising one or
more transgenic antibody loci encoding antibodies comprising human
variable regions, and the Antibody-Generating Vertebrate having an
immune system comprising proteins encoded by an immune gene
repertoire, said immune gene repertoire comprising said transgenic
antibody loci; (b) introducing into the genome of the ES cell a
nucleotide sequence encoding said human epitope and optionally
knocking-out of the genome an endogenous non-human vertebrate
epitope that is an orthologue of said human epitope; and (c)
developing a non-human child vertebrate from said modified ES cell,
wherein an Assay Vertebrate is obtained that expresses said human
epitope; and (d) optionally producing a progeny of said Assay
Vertebrate that is homozygous for said knock-in, wherein said
progeny comprises substantially the same immune gene repertoire as
said Assay Vertebrate in addition to the human epitope knock-in,
and optionally the knock-out.
15. A method of assaying a test antibody comprising human variable
regions that bind to a human epitope, wherein the antibody is
isolated from a first transgenic non-human vertebrate, optionally a
mouse or rat, designated as an Antibody-Generating Vertebrate
following immunisation with an antigen bearing said human epitope,
and optionally subsequent subsequent derivatisation or maturation
of said antibody, the vertebrate comprising one or more transgenic
antibody loci encoding said variable regions, the method
comprising: (a) providing a second transgenic non-human vertebrate,
optionally a mouse or rat, designated as an Assay Vertebrate, that
is a modified version of said first transgenic non-human
vertebrate, wherein the Assay Vertebrate has substantially the same
genome as the Antibody-Generating Vertebrate, with the exception
that: (i) the Assay Vertebrate genome comprises a knock-in of said
human epitope, so that the Assay Vertebrate is capable of
expressing an antigen bearing said human epitope; and (ii)
optionally, wherein said genome has a knock-out of an endogenous
non-human vertebrate epitope that is an orthologue or homologue of
said human epitope, wherein said Assay Vertebrate cannot express an
antigen bearing said endogenous epitope; (b) introducing said
antibody into the Assay Vertebrate; and (c) assaying the effect or
behaviour of said antibody in said Assay Vertebrate.
16. The method of claim 15, wherein the Antibody-Generating
Vertebrate and Assay Vertebrate genomes comprise said
knock-out.
17. An assay kit comprising an Antibody-Generating Vertebrate and
Assay Vertebrate as defined in claim 15, and optionally a test
antibody.
18. A non-human, optionally a mouse or rat, Assay Vertebrate
comprising: (i) one or more transgenic antibody loci encoding human
variable regions; (ii) a genome comprising a knock-in of a human
epitope, so that the Assay Vertebrate is capable of expressing an
antigen bearing said human epitope; and (iii) a genome knock-out of
the endogenous non-human vertebrate epitope that is an orthologue
or homologue of said human epitope, wherein said Assay Vertebrate
cannot express an antigen bearing said endogenous epitope; and (iv)
optionally a test antibody inside said Assay Vertebrate, wherein
the antibody comprises human variable regions that can bind said
human epitope, said antibody having been generated in an
Antibody-Generating Vertebrate as defined in claim 1, optionally
with subsequent derivatisation or maturation to produce said
antibody.
19. The method of claim 1, wherein the human epitope is a human
CD40 ligand or human CD40 epitope; optionally wherein the knock-in
is a knock-in of human CD40 ligand or human CD40.
20. The vertebrate of claim 18, wherein the human epitope is a
human CD40 ligand or human CD40 epitope; optionally wherein the
knock-in is a knock-in of human CD40 ligand or human CD40.
21. The kit of claim 17, wherein the human epitope is a human CD40
ligand or human CD40 epitope; optionally wherein the knock-in is a
knock-in of human CD40 ligand or human CD40.
Description
[0001] This application is a continuation of PCT/GB2012/052670,
filed Oct. 26, 2012, which claims the benefit of GB 1118647.5,
filed Oct. 28, 2011; the entirety of each of these applications is
hereby incorporated by reference.
[0002] The present invention relates inter alia to non-human
vertebrates useful as assay models, as well as kits and methods of
making and using such vertebrates for testing chimaeric
antibodies.
BACKGROUND
[0003] Animal models are widely used in research, giving many
advantages such as providing for versatile experimentation in a way
that is accessible to the research community and in a way that is
more ethically acceptable than research on humans. Such models are
routinely used to assess the toxicology, pharmacokinetics, efficacy
and other characteristics of drugs in vivo prior to administration
to humans in clinical trials.
[0004] Knock-in and knock-out animal models have been produced in
which the effect of removing or adding a single gene can be
assessed in vivo.
[0005] Additionally, using embryonic stem cell (ES cell)
technology, the art has provided non-human vertebrates, such as
mice, bearing transgenic chimaeric antibody loci from which human
or chimaeric antibodies can be generated in vivo following
challenge with human antigen. Such antibodies usefully bear human
variable regions.
[0006] It is desirable to provide improved non-human vertebrates as
models for assaying such human and chimaeric antibodies in vivo in
the presence of the human antigen.
SUMMARY OF THE INVENTION
[0007] To this end, the present invention provides:--
[0008] A method of assaying a test antibody comprising human
variable regions that bind to a human epitope, wherein the antibody
is isolated from a first transgenic non-human vertebrate (eg, a
mouse or rat) (Antibody-Generating Vertebrate) following
immunisation with an antigen bearing said human epitope (with
optional subsequent derivatisation or maturation of said antibody),
the vertebrate comprising one or more transgenic antibody loci
encoding said variable regions, and the transgenic vertebrate
having an immune system comprising proteins encoded by an immune
gene repertoire, said immune gene repertoire comprising said
transgenic antibody loci, the method comprising
[0009] (a) Providing a second transgenic non-human vertebrate (eg,
mouse or rat) (Assay Vertebrate) that is a modified version of said
first transgenic non-human vertebrate, wherein the Assay Vertebrate
comprises
[0010] (i) An immune system comprising proteins encoded by
substantially the same immune gene repertoire as the
Antibody-Generating Vertebrate;
[0011] (ii) A genome comprising a knock-in of said human epitope,
so that the Assay Vertebrate is capable of expressing an antigen
bearing said human epitope; and
[0012] (iii) Optionally wherein said genome has a knock-out of an
endogenous non-human vertebrate epitope that is an orthologue or
homologue of said human epitope, wherein said Assay Vertebrate
cannot express an antigen bearing said endogenous epitope;
[0013] (b) Introducing said antibody into the Assay Vertebrate;
and
[0014] (c) Assaying the effect or behaviour of said antibody in
said Assay Vertebrate.
[0015] The invention also provides:--
[0016] A non-human (eg, mouse or rat) Assay Vertebrate
comprising
[0017] (i) One or more transgenic antibody loci encoding human
variable regions;
[0018] (ii) An immune system comprising proteins encoded by an
immune gene repertoire, said immune gene repertoire comprising said
transgenic antibody loci;
[0019] (iii) A genome comprising a knock-in of a human epitope, so
that the Assay Vertebrate is capable of expressing an antigen
bearing said human epitope; and
[0020] (iv) A genome knock-out of the endogenous non-human
vertebrate epitope that is an orthologue or homologue of said human
epitope, wherein said Assay Vertebrate cannot express an antigen
bearing said endogenous epitope; and
[0021] (v) Optionally a test antibody inside said Assay Vertebrate,
wherein the antibody comprises human variable regions that can bind
said human epitope, said antibody having been generated in an
Antibody-Generating Vertebrate as defined above (with optional
subsequent derivatisation or maturation to produce said
antibody).
[0022] The invention also provides:--
[0023] A method of assaying a test antibody comprising human
variable regions that bind to a human epitope, wherein the antibody
is isolated from a first transgenic non-human vertebrate (eg, a
mouse or rat) (Antibody-Generating Vertebrate) following
immunisation with an antigen bearing said human epitope (with
optional subsequent derivatisation or maturation of said antibody),
the vertebrate comprising one or more transgenic antibody loci
encoding said variable regions, the method comprising
[0024] (a) Providing a second transgenic non-human vertebrate (eg,
mouse or rat) (Assay Vertebrate) that is a modified version of said
first transgenic non-human vertebrate, wherein the Assay Vertebrate
has substantially the same genome as the Antibody-Generating
Vertebrate, with the exception that [0025] (i) the Assay Vertebrate
genome comprises a knock-in of said human epitope, so that the
Assay Vertebrate is capable of expressing an antigen bearing said
human epitope; and [0026] (ii) Optionally wherein said genome has a
knock-out of an endogenous non-human vertebrate epitope that is an
orthologue or homologue of said human epitope, wherein said Assay
Vertebrate cannot express an antigen bearing said endogenous
epitope;
[0027] (b) Introducing said antibody into the Assay Vertebrate;
and
[0028] (c) Assaying the effect or behaviour of said antibody in
said Assay Vertebrate.
[0029] The invention also provides:--
[0030] A non-human (eg, mouse or rat) Assay Vertebrate
comprising
[0031] (i) One or more transgenic antibody loci encoding human
variable regions;
[0032] (iii) A genome comprising a knock-in of a human epitope, so
that the Assay Vertebrate is capable of expressing an antigen
bearing said human epitope; and
[0033] (iv) A genome knock-out of the endogenous non-human
vertebrate epitope that is an orthologue or homologue of said human
epitope, wherein said Assay Vertebrate cannot express an antigen
bearing said endogenous epitope; and
[0034] (v) Optionally a test antibody inside said Assay Vertebrate,
wherein the antibody comprises human variable regions that can bind
said human epitope, said antibody having been generated in an
Antibody-Generating Vertebrate as defined in any one of claims 1 to
6, 15 and 16 (with optional subsequent derivatisation or maturation
to produce said antibody).
[0035] The invention also provides methods of making non-human
Assay Vertebrates.
[0036] The non-human vertebrates and methods of the invention
enable the generation and testing of human antibody variable
regions against human epitopes in a way that eliminates or
minimises background variability between the antibody and the
immune setting of the system used to test the antibody. By
generating and testing antibodies in substantially the same immune
background, complicating issues of immune reaction against the test
antibody are eliminated or minimised in the assay vertebrate.
Furthermore, testing and antibody generation can be matched for
human epitopes of interest and improved assays can be performed by
harnessing Assay Vertebrate in vivo tolerisation against human
antigen of interest.
BRIEF DESCRIPTION OF THE FIGURES
[0037] FIG. 1: The progressive changes in morphology of cultured
blastocysts (taken from "Manipulating the Mouse Embryo", 3.sup.rd
Edition, A Nagy et al, Cold Spring Harbor Laboratory Press, 2003;
FIG. 8.2 of that text).
[0038] FIG. 2A: Characteristic and illustrative ES cell morphology
(taken from "Manipulating the Mouse Embryo", 3.sup.rd Edition, A
Nagy et al, Cold Spring Harbor Laboratory Press, 2003; FIG. 8.4 of
that text).
[0039] FIG. 2B: Photograph showing ES cells generated according to
the example below (KX01.3 cells shown).
[0040] FIG. 3: A schematic representation of a precise gene
knock-out method.
[0041] FIGS. 4A and 4B: Schematic representations of a precise gene
knock-out method.
DETAILED DESCRIPTION OF THE INVENTION
[0042] The invention provides an assay vertebrate and a method of
assaying a test antibody comprising human variable regions that
specifically bind to a human epitope, which in one embodiment is an
epitope on a human target. For example, an entire human target is
used or alternatively a portion of such a human target is used
optionally fused to a heterologous protein moiety, wherein said
portion comprises the human epitope of interest. In one example,
the heterologous protein moiety is a transmembrane domain
optionally with an associated intracellular domain. The
heterologous protein moiety can be a mouse protein moiety (eg, a
mouse protein domain, eg, a mouse transmembrane domain optionally
with an associated mouse intracellular domain) or an antibody Fc
region (eg, a mouse or human Fc). In one embodiment, the human
epitope is provided on an extracellular domain of a human target.
The human target is, for example, selected from the group
consisting of growth factors, cytokines, cytokine receptors,
enzymes, co-factors for enzymes and DNA binding proteins. In one
example, the human epitope is provided on a multi-subunit protein
(eg, an oligomer) such as a receptor (eg, a dimeric or trimeric
receptor) or multimeric ligand. The multisubunit protein can, for
example, comprise a first subunit bearing the human epitope and one
or more second subunits (eg, mouse or human subunits). It is
advantageous to harbour the human epitope in the context of protein
domains of the non-human vertebrate species (eg, mouse or rat),
such as a non-human vertebrate (eg, mouse or rat) transmembrane
domain and/or intracellular signalling domain of a protein target
in which the human epitope is present on an extracellular domain of
the protein target. This allows for proper anchoring and signalling
in the non-human vertebrate (Assay Vertebrate) when the human
epitope is bound by the test antigen. Thus, this embodiment
accommodates the knocked-in human epitope in a context useful for
efficient and representative assaying within the Assay
Vertebrate.
[0043] The antibodies described herein can be of any format
provided that they comprise human variable regions. For example,
the present invention is applicable to of 4-chain antibodies, where
the antibodies each contain 2 heavy chains and 2 light chains.
Alternatively, the invention can be applied to H2 antibodies (heavy
chain antibodies) bearing human V regions and which are devoid of
CH1 and light chains (equivalent in respects to Camelid H2
antibodies: see, eg, Nature. 1993 Jun. 3; 363(6428):446-8;
Naturally occurring antibodies devoid of light chains;
Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers
C, Songa E B, Bendahman N, Hamers R). These antibodies function to
specifically bind antigen, such antibodies being akin to those
found in the blood of Camelidae (eg, llamas, camels, alpacas). Such
antibodies with human VH pairs can be synthetically produced to
provide therapeutic and prophylactic medicaments (eg, see
WO1994004678, WO2004041862, WO2004041863). Transgenic mice also can
produce such heavy chain antibodies and the in vivo production of
the antibodies allows the mouse's immune system to select for human
VH-VH pairings, sometimes selecting for such pairings in which
mutations have been introduced in vivo by the mouse to accommodate
the pairing (WO2010109165A2). Thus, in an embodiment of the present
invention, the heavy chain transgene is devoid of a CH1 gene
segment and the genome comprises no functional antibody light chain
locus. Alternatively, the test antibody is an antibody fragment,
eg, Fab or Fab.sub.2, which comprises a constant region and human
variable regions.
[0044] Throughout this text, and with application to any
configuration, aspect, embodiment or example of the invention, the
term "endogenous" (eg, endogenous constant region) in relation to a
non-human vertebrate or cell indicates that the constant region a
type of constant region that is normally found in the vertebrate or
cell (as opposed to an exogenous constant region whose sequence is
not normally found in such a vertebrate or cell).
[0045] The test antibody is isolated from a first transgenic
non-human vertebrate (eg, a mouse or rat) (Antibody-Generating
Vertebrate) following immunisation with an antigen bearing said
human epitope. The skilled person will be familiar with routine
methods and protocols for immunising with antigen, eg, using prime
and boost immunisation protocols. A suitable protocol is RIMMS (see
Hybridoma 1997 August; 16(4):381-9; "Rapid development of affinity
matured monoclonal antibodies using RIMMS"; Kilpatrick et al). The
Antibody-Generating Vertebrate comprises one or more transgenic
antibody loci encoding said variable regions. Suitable non-human
vertebrates (eg, mice or rats) are known in the art, and by way of
example reference is made to WO2011004192, U.S. Pat. No. 7,501,552,
U.S. Pat. No. 6,673,986, U.S. Pat. No. 6,130,364, WO2009/076464 and
U.S. Pat. No. 6,586,251, the disclosures of which are incorporated
herein by reference in their entirety. In one example, the
Antibody-Generating Vertebrate is a mouse having a 129 mouse
genetic background. In one example, the Assay Vertebrate is a mouse
having a 129 mouse genetic background, for example the same genetic
background as the Antibody-Generating Vertebrate but with the human
target knock-in. In one example, the Antibody-Generating Vertebrate
is a mouse having an AB2.1 mouse genetic background. In another
example, the Antibody-Generating Vertebrate is a mouse having a
genetic background of a mouse strain selected from a 129 strain,
C57BL/6N, C57BL/6J, 129S5, 129S7 or 129Sv or the genetic background
of a cell selected from a JM8, AB2.1 or AB2.2 cell. In one example,
the background is a mouse 129 strain.times.C57BL/6 strain cross,
eg, 129S7.times.C57BL/6 or 129S5.times.C57BL/6. In an example, the
background is a mouse B6 background or a B6-derived background.
[0046] Examples of suitable 129 strains are as follows (see also
http://www.informatics.jax.org/mgihome/nomen/strain.sub.--129.shtml)
129 Strain Designation
129P1
129P2
129P3
129X1
129S1
129S1
129S2
129S4
129S5
129S6
129S7
129S8
129T1
129T2
129T2
[0047] The transgenic vertebrate has an immune system comprising
proteins encoded by an immune gene repertoire (eg, an endogenous
immune gene repertoire), said immune gene repertoire comprising
said transgenic antibody loci and genes for immune system function
(eg, providing an immune response to immunisation of the
Antibody-Generating Vertebrate to the human target epitope). In one
embodiment, the immune gene repertoire is an endogenous immune gene
repertoire (ie, endogenous to the strain of non-human vertebrate
used). For example, when the Antibody-Generating Vertebrate is a
mouse having a genetic background of a mouse strain or cell
selected from 129, C57BL/6N, C57BL/6J, JM8, AB2.1, AB2.2, 129S5,
129S7 or 129Sv, the mouse has an immune gene repertoire provided by
said genetic background and said transgenic antibody loci. Thus,
the skilled person can choose the appropriate starting strain, cell
or species (eg, the same cell line or cells separated by no more
than 5, 4, 3, 2 or 1 generation) for generating both the
Antibody-Generating Vertebrate and Assay Vertebrate, and in doing
so the desired immune gene repertoire is provided for both
Vertebrates. In one embodiment, the immune gene repertoire is that
of a wild-type 129, C57BL/6, B6 or other mouse strain or mouse cell
disclosed herein, with the exception that the mouse genome
comprises a transgenic IgH locus (optionally in homozygous state)
comprising a human variable region (with human VH, D and JH gene
segments) operatively connected upstream of (5' of) a mouse
constant region and optionally endogenous mouse heavy chain
expression is inactive. In an example, the genome also comprises a
transgenic Ig.kappa. locus (optionally in homozygous state)
comprising a human variable region (with human V.kappa. and
J.kappa. gene segments) operatively connected upstream of (5' of) a
mouse constant region and optionally endogenous mouse kappa chain
expression is inactive. In an example, the genome also comprises a
transgenic Ig.lamda. locus (optionally in homozygous state)
comprising a human variable region (with human V.lamda. and
J.lamda. gene segments) operatively connected upstream of (5' of) a
mouse constant region and optionally endogenous mouse lambda chain
expression is inactive. Thus, in one embodiment, the vertebrate of
the invention comprises a wild-type 129, C57BL, B6 or other mouse
strain genome with the exception that mouse heavy chain (and kappa
and/or lambda chain) expression has been inactivated, the genome
comprises said transgenic Ig loci and an endogenous target
knock-out (and optionally also a human target knock-in) as per the
invention. Thus, endogenous regulatory and control mechanisms and
proteins functional to produce and regulate immune responses in the
vertebrate are retained for production of chimaeric antibody chains
having human variable regions in response to immunisation.
[0048] In one embodiment the Antibody-Generating Vertebrate is a
genetic parent or grandparent of the Assay Vertebrate. In one
embodiment, the Vertebrates are related as (a) siblings, (b) parent
and child, (c) parent and grandchild, (d) cousins or (e) uncle/aunt
and nephew/niece. This is achieved by breeding (crossing)
vertebrates in a method using the genome of the Antibody-Generating
Vertebrate. To this end, the invention also provides methods for
making the Assay Vertebrate, and this is explained in further
detail below.
[0049] In one embodiment, the Assay Vertebrate is derived from a
somatic cell of said Antibody-Generating Vertebrate; optionally
wherein the Assay Vertebrate is derived from an IPS cell (induced
pluripotent stem cell) that is derived from said
Antibody-Generating Vertebrate. Reference is made to WO2007069666,
WO2008118820, WO2008124133, WO2008151058, WO2009006997 and
WO2011027180, which provide guidance on IPS technology and suitable
methods, the disclosures of which are incorporated herein in their
entirety. The IPS cells can also be directly generated (ie, without
need for breeding) from other somatic cells from non-human
vertebrates (eg, mice) carrying the antibody transgenes using
standard methods. A worked example of ES cell derivation is
provided in the Examples below.
[0050] The method of the invention comprises the step of providing
a second transgenic non-human vertebrate (eg, mouse or rat) (Assay
Vertebrate) that is a modified version of said first transgenic
non-human vertebrate (ie, Antibody-Generating Vertebrate), wherein
the Assay Vertebrate comprises [0051] (i) An immune system
comprising substantially the same (or the same) immune gene
repertoire as the Antibody-Generating Vertebrate; [0052] (ii) A
genome comprising a knock-in of said human epitope, so that the
Assay Vertebrate is capable of expressing an antigen bearing said
human epitope; and [0053] (iii) Optionally wherein said genome has
a knock-out of an endogenous non-human vertebrate epitope that is
an orthologue or homologue of said human epitope, wherein said
Assay Vertebrate cannot express an antigen bearing said endogenous
epitope.
[0054] In one aspect, the Antibody-Generating Vertebrate and Assay
Vertebrate have identical or substantially identical genomes with
the exception that the Assay Vertebrate genome comprises said
knock-in.
[0055] Thus, when the Antibody-Generating Vertebrate is a mouse,
the Assay Vertebrate is also a mouse, eg, a mouse of the same
genetic background as the Antibody-Generating Vertebrate (except of
the knock-in and optional knock-out). Thus, in one embodiment, the
Antibody-Generating Vertebrate and Assay Vertebrates have a 129
genetic background. In another embodiment, the Vertebrates have an
AB2.1 genetic background. In yet another embodiment, the
Vertebrates have a C57BL background. In a further embodiment, the
Vertebrates have a JM8 background.
[0056] Thus, when the Antibody-Generating Vertebrate is a rat, the
Assay Vertebrate is also a rat, eg, a rat of the same genetic
background as the Antibody-Generating Vertebrate (except of the
knock-in and optional knock-out).
[0057] In one aspect, the Antibody-Generating Vertebrate and Assay
Vertebrate genomes comprise said knock-out. This is useful, for
example, when the endogenous orthologue/homologue epitope or target
protein is structurally or epitopically similar to the human target
or epitope. By knocking-out the orthologue/homologue expression,
test antibodies of interest are generated only to the human
epitope/target that is injected into the Antibody-Generating
Vertebrate, and isolation of antibodies that are raised against the
orthologue/homologue (ie, wrong target) is avoided. Advantageously,
this target expression profile is reproduced in the Assay
Vertebrate when the orthologue/homologue is knocked-out in that
model too.
[0058] Thus, in an embodiment, the Antibody-Generating Vertebrate
has a knock-out of the epitope that is an orthologue or homologue
of said human epitope. Additionally or alternatively, in an
embodiment, the Assay Vertebrate has a knock-out of the epitope
that is an orthologue or homologue of said human epitope.
[0059] Additionally, in the present invention, both the
Antibody-Generating and Assay Vertebrates produce antibodies with
human variable regions and constant regions of the same type (eg,
both Vertebrates are mice and the transgenic loci encode chimaeric
antibodies having human variable regions and mouse constant
regions, eg, constant regions endogenous to the strain of mouse
used to generate the Vertebrates). Thus, the test antibody that is
injected into the Assay Vertebrate is not seen as foreign to that
Vertebrate and is not substantially immunologically rejected or
attacked by the Assay Vertebrate's immune system. Moreover, the
Assay Vertebrate expresses the human epitope or target as a "self"
antigen, and thus the mouse's immune system has been tolerised to
this antigen during development of the Assay Mouse immune system.
This minimises interference in vivo of the assay by any anti-human
epitope/target antibodies produced by the Assay Vertebrate itself,
thereby enabling more effective and accurate assessment of the
effect and/or behaviour of the test antibody following introduction
into the Assay Vertebrate. Thus, the invention matches the immune
characteristics of the Vertebrates and test antibodies and
harnesses the Assay Vertebrate's ability to tolerise in the
presence of the knocked-in human epitope or target antigen of
interest. This provides for superior in vivo pre-clinical and
clinical assessment of test antibodies than has been possible
previously.
[0060] In one embodiment, the transgenic antibody loci of the Assay
Vertebrate are human antibody loci comprising human variable and
constant region gene segments. Optionally, the test antibody is a
human antibody comprising human variable and constant regions and
this is administered to the Assay Vertebrate of this embodiment.
Optionally, the test antibody is generated in an
Antibody-Generating Vertebrate in which the transgenic antibody
loci are human antibody loci comprising human variable and constant
region gene segments. Thus, the model animals and test antibodies
are matched, as per the present invention.
[0061] The skilled person will be familiar with conventional
techniques for manipulating non-human vertebrate (eg, mouse or rat)
genomes in embryonic stem cells (ES cells), as well as application
to knock-in genes (ie, insert a desired gene into the genome of the
ES cell) and knock-out genes (ie, delete a gene from the genome of
an ES cell). Tools such as site-specific recombination (eg, using
Cre/Lox, Frt/Flp, Dre/Rox and others) and homolgous recombination
are standard. By way of example and background, reference is made
to New England Journal of Medicine 2007 Dec. 13; 357(24):2426-9;
"Knock out, knock in, knock down-genetically manipulated mice and
the Nobel Prize"; Manis J P, which explains that: for the
construction of knock-out mice, a gene-targeting vector can be
constructed to delete a specific exon of a gene in embryonic stem
cells. Several kilobases of DNA on either side of the target gene
are cloned around a drug-selection marker. After the cloned DNA
(targeting vector) is introduced into the stem cells, positive and
negative drug selection occurs in culture. For example, a targeting
vector is constructed with IoxP sequences flanking the positive
drug-selection gene. Cre recombinase can delete the DNA sequence
between the IoxP sites, thereby deleting a specific gene in the
embryonic stem cells. Knock-in mice can be generated insertion of
DNA (eg, human target DNA) of interest with or without concomitant
deletion of an endogenous DNA (eg, the endogenous target
orthologue/homologue). For the latter, the gene-targeting strategy
is similar to that used for knock-out mice, except that a
replacement DNA is exchanged with the endogenous DNA. Cre-IoxP
strategies can delete most traces of the targeting vector. Once the
desired stem-cell clone is selected, it is injected into a
blastocyst (eg, of a mouse C57BL, JM8 or 129 strain), which is
implanted into the uterus of a foster mother (eg, a mouse mother).
If the gene-targeted stem cells contribute to germ cells in the
chimaeric mice, subsequent offspring will harbour the gene-targeted
mutation (germ-line transmission has been achieved). Optional
subsequent breeding can be carried out between the offspring to
breed the knock-in and knock-out to homozygosity, as is
standard.
[0062] In an Assay Vertebrate of the invention according to any
aspect, the Vertebrate comprises a second human knock-in nucleotide
sequence, the second sequence encoding a second human protein.
Optionally, the second human protein is part of a cascade
comprising the first human epitope/target. Optionally the first and
second human epitope/targets are related as human ligand and
receptor, eg, human CD40 ligand and human CD40. Immunisation of the
Assay-Generating Vertebrate can be with human CD40 ligand or CD40
and a resultant isolated antibody (or derivative thereof) can be
tested in the Assay Vertebrate bearing a knock in of both human
CD40 ligand and human CD40. Thus, in one embodiment of the Assay
Vertebrate, the first epitope is human CD40 ligand or human
CD40.
[0063] The test antibody isolated from the Antibody-Generating
Vertebrate can be introduced (eg, injected) into the Assay
Vertebrate in unmodified form. Alternatively, the test antibody can
be derivatised, eg, by the addition (such as by chemical
conjugation) of a label or toxin, PEG or other moiety, prior to
introduction into the Assay Vertebrate. Derivatisation is useful,
for example, when it is desirable to add an additional
functionality to the drug to be developed from the test antibody.
For example, for cancer indications it may be desirable to add
additional moieties that assist in cell-killing. In another
embodiment, the variable regions of the antibody isolated from the
Antibody-Generating Vertebrate are affinity matured in vivo or in
vitro (eg, by phage display, ribosome display, yeast display, etc)
and a matured test antibody is introduced into the Assay
Vertebrate. In another embodiment, the constant regions of the
antibody isolated from the Antibody-Generating Vertebrate are
mutated in vivo or in vitro (eg, by random or directed, specific
mutation and optional selection by phage display, ribosome display,
yeast display, etc) and a matured test antibody is introduced into
the Assay Vertebrate. The constant region may be mutated to ablate
or enhance Fc function (eg, ADCC). Thus, derivatised and/or mutated
antibodies are considered "test antibodies" in this context. The
constant region may be humanised (ie, where a chimaeric antibody is
isolated from the Assay-Generating Vertebrate having human variable
regions and non-human constant regions, the latter may be exchanged
for human constant regions and the resultant human antibody
introduced into the Assay Vertebrate).
[0064] The method of the invention entails assaying the effect or
behaviour of said antibody in said Assay Vertebrate. For example,
said assaying is assay of one or more selected from the group
consisting of: pharmacodynamics of said antibody (or a metabolite
or derivative thereof produced by the Assay Vertebrate),
pharmacokinetics of said antibody (or a metabolite or derivative
thereof produced by the Assay Vertebrate), activity of said
antibody (or a metabolite or derivative thereof produced by the
Assay Vertebrate), clearance of said antibody (or a metabolite or
derivative thereof produced by the Assay Vertebrate), distribution
of said antibody (or a metabolite or derivative thereof produced by
the Assay Vertebrate), toxicology of said antibody (or a metabolite
or derivative thereof produced by the Assay Vertebrate), a
physico-chemical characteristic or effect of said antibody (or a
metabolite or derivative thereof produced by the Assay Vertebrate),
a binding characteristic of said antibody (or a metabolite or
derivative thereof produced by the Assay Vertebrate), a biological
characteristic or effect of said antibody (or a metabolite or
derivative thereof produced by the Assay Vertebrate), a
physiological characteristic or effect of said antibody (or a
metabolite or derivative thereof produced by the Assay Vertebrate),
a pharmaceutical characteristic or effect of said antibody (or a
metabolite or derivative thereof produced by the Assay Vertebrate),
and interaction of said antibody (or a metabolite or derivative
thereof produced by the Assay Vertebrate) with another protein or
substance inside the Assay Vertebrate. Such assays are well known
to the skilled person. For example, said assaying is assay of
immunogenicity of the test antibody.
[0065] The invention provides a non-human (eg, mouse or rat) Assay
Vertebrate comprising
[0066] (i) One or more transgenic antibody loci encoding human
variable regions;
[0067] (ii) An immune system comprising proteins encoded by an
immune gene repertoire, said immune gene repertoire comprising said
transgenic antibody loci;
[0068] (iii) A genome comprising a knock-in of a human epitope, so
that the Assay Vertebrate is capable of expressing an antigen
bearing said human epitope; and
[0069] (iv) A genome knock-out of the endogenous non-human
vertebrate epitope that is an orthologue or homologue of said human
epitope, wherein said Assay Vertebrate cannot express an antigen
bearing said endogenous epitope; and
[0070] (v) Optionally a test antibody inside said Assay Vertebrate,
wherein the antibody comprises human variable regions that can bind
said human epitope, said antibody having been generated in an
Antibody-Generating Vertebrate as defined above (with optional
subsequent derivatisation or maturation to produce said
antibody).
[0071] The various aspects of the Vertebrates, epitopes, targets,
knock-in, knock-out, test antibodies, immune gene repertoire and
all other aspects described herein apply to this configuration of
the invention that provides the Assay Vertebrate per se.
[0072] In one embodiment, the transgenic antibody loci of any
aspect of the invention are according to the loci described in any
of WO2011004192, U.S. Pat. No. 7,501,552, U.S. Pat. No. 6,673,986,
U.S. Pat. No. 6,130,364, WO2009076464 and U.S. Pat. No. 6,586,251,
the disclosures of which are incorporated herein by reference in
their entirety. In one example, the Antibody-Generating Vertebrate
comprises [0073] (a) A heavy chain locus comprising one or more
human heavy chain V gene segments, one or more human heavy chain D
gene segments and one or more human heavy chain JH gene segments
upstream of an endogenous non-human vertebrate (eg, endogenous
mouse or rat) constant region (eg, Cmu and/or Cgamma); [0074] (b) A
kappa light chain locus comprising one or more human kappa chain V
gene segments, and one or more human kappa chain Jk gene segments
upstream of an endogenous non-human vertebrate (eg, endogenous
mouse or rat) kappa constant region; and optionally [0075] (c) A
lambda light chain locus comprising one or more human lambda chain
V gene segments, and one or more human lambda chain J.lamda. gene
segments upstream of a lambda constant region; and [0076] (d)
Wherein the Vertebrate is capable of producing chimaeric test
antibodies following rearrangement of said loci and immunisation
with the human epitope or target.
[0077] Optionally endogenous heavy and kappa chain expression is
inactive. In an embodiment, endogenous lambda chain expression is
also inactive.
[0078] Alternatively or additionally, the Assay Vertebrate
comprises [0079] (a) A heavy chain locus comprising one or more
human heavy chain V gene segments, one or more human heavy chain D
gene segments and one or more human heavy chain JH gene segments
upstream of an endogenous non-human vertebrate (eg, endogenous
mouse or rat) constant region (eg, Cmu and/or Cgamma); [0080] (b) A
kappa light chain locus comprising one or more human kappa chain V
gene segments, and one or more human kappa chain Jk gene segments
upstream of an endogenous non-human vertebrate (eg, endogenous
mouse or rat) kappa constant region; and optionally [0081] (c) A
lambda light chain locus comprising one or more human lambda chain
V gene segments, and one or more human lambda chain JX gene
segments upstream of a lambda constant region; and [0082] (d)
Wherein the Assay Vertebrate is capable of producing chimaeric
antibodies; [0083] (e) Optionally wherein said Assay Vertebrate
loci comprise substantially the same repertoire of human antibody
gene segments as said Antibody-Generating Vertebrate loci
(optionally with rearrangement of the loci in one or both of said
Vertebrates). [0084] (f) Optionally endogenous heavy and kappa
chain expression is inactive. In an embodiment, endogenous lambda
chain expression is also inactive.
[0085] The invention provides an Antibody-Generating Vertebrate as
herein described, optionally as part of a kit also comprising a
test antibody as herein described.
[0086] The invention provides an assay kit comprising an
Antibody-Generating Vertebrate and Assay Vertebrate as defined
herein and optionally a test antibody (or derivative thereof). In
one example, the test antibody has been isolated from said
Antibody-Generating Vertebrate or a relative thereof that is no
more than 5, 4, 3, 2 or 1 generations way from the Assay Vertebrate
and comprises substantially the same immune gene repertoire.
[0087] A kit of the invention, in an aspect, comprises instructions
instructing administration of a test antibody with an Assay
Vertebrate as herein described.
[0088] The invention provides a method of generating a non-human
Assay Vertebrate (eg, a mouse or rat) for assaying the effect or
behaviour of a test antibody comprising human variable regions and
which binds a human epitope, the method comprising [0089] (a)
Providing an ES cell derived from an Antibody-Generating Vertebrate
whose genome encodes said test antibody, the Antibody-Generating
Vertebrate comprising one or more transgenic antibody loci encoding
antibodies comprising human variable regions, and the
Antibody-Generating Vertebrate having an immune system comprising
proteins encoded by an immune gene repertoire, said immune gene
repertoire comprising said transgenic antibody loci; [0090] (b)
Introducing into the genome of the ES cell a nucleotide sequence
encoding said human epitope and optionally knocking-out of the
genome an endogenous non-human vertebrate epitope that is an
orthologue or homologue of said human epitope; and [0091] (c)
Developing a non-human child vertebrate from said modified ES cell,
wherein an Assay Vertebrate is obtained that expresses said human
epitope; and [0092] (d) Optionally producing a progeny of said
Assay Vertebrate, wherein said progeny comprises substantially the
same immune gene repertoire as said Assay Vertebrate in addition to
the human epitope knock-in (and optional knock-out) and optionally
the progeny is homozygous for said nucleotide sequence encoding the
knocked-in human epitope (and optionally also homozygous for the
knocked-out orthologous or homologous epitope).
[0093] The Examples illustrate a method of obtaining an ES cell
derived from an Antibody-Generating Vertebrate.
[0094] The invention provides a method of generating a non-human
Assay Vertebrate (eg, a mouse or rat) for assaying the effect or
behaviour of a test antibody comprising human variable regions and
which binds a human epitope, the method comprising [0095] (a)
Obtaining a non-human vertebrate child ES cell whose genome is a
genetic cross between (i) the genome of a first genetic parent that
is a non-human Antibody-Generating Vertebrate whose genome encodes
said test antibody, the Antibody-Generating Vertebrate comprising
one or more transgenic antibody loci encoding antibodies comprising
human variable regions, and the Antibody-Generating Vertebrate
having an immune system comprising proteins encoded by an immune
gene repertoire, said immune gene repertoire comprising said
transgenic antibody loci and (ii) the genome of a second genetic
parent that is a non-human vertebrate of the same species
(optionally the same strain or cell background, eg, of mouse strain
129, C57BL/6N, C57BL/6J, JM8, AB2.1, AB2.2, 129S5, 129S7 or 129Sv)
as said Antibody-Generating Vertebrate, the second parent having an
immune system encoded by substantially the same immune gene
repertoire as the first parent; [0096] (b) Producing in vitro a
modified child ES cell with a knock-in of the human epitope by
introducing into the genome of the child ES cell a nucleotide
sequence encoding said human epitope and optionally knocking-out of
the genome an endogenous non-human vertebrate epitope that is an
orthologue or homologue of said human epitope; and [0097] (c)
Developing a non-human child vertebrate from said modified child ES
cell, wherein an Assay Vertebrate is obtained that expresses said
human epitope; and [0098] (d) Optionally producing a progeny of
said Assay Vertebrate by genetic crossing, wherein said progeny
comprises substantially the same immune gene repertoire as said
Assay Vertebrate in addition to the human epitope knock-in (and
optional knock-out).
[0099] The first (and optionally also the second) parent is, in one
aspect, any Antibody-Generating Vertebrate described herein. Step
(a) can be performed, for example, using breeding between parents
to achieve the genetic cross in a resulting embryo. The non-human
child ES cell can be generated from the embryo (eg, blastocyst
stage) using any standard technique for ES cell generation. For
example, reference is made to Proc Natl Acad Sci 1997 May 27;
94(11):5709-12; "The origin and efficient derivation of embryonic
stem cells in the mouse"; Brook F A & Gardner R L, the
disclosure of which is incorporated herein by reference. Other
standard ES cell-generating techniques can be used. See also the
illustrative, non-limiting Example below.
[0100] Knock-in and knock-out technology has been discussed above,
and any of these methods can be used to effect step (b).
[0101] The skilled person conversant with ES cell technology will
readily know how to develop a child from a transgenic ES cell that
has been manipulated in vitro. For example, a non-human ES cell
obtained in step (b) is implanted into a donor blastocyst (eg, a
blastocyst of the same strain of vertebrate as the ES cell). The
blastocyst is then implanted into a foster mother where it develops
into a child (an Assay Vertebrate). In this way, a plurality of
children can be developed, each from a respective modified child ES
cell. Siblings can be bred together to achieve crosses providing
one or more resultant Assay Vertebrates that are homozygous for the
human knock-in (and optional knock-out). Alternatively, an Assay
Vertebrate that is heterozygous for the knock-in (and also for the
optional knock-out) can be provided. Homozygous or heterozygous
Assay Vertebrates can be used to assay a test antibody in the
method of the invention.
[0102] In one example, the first and second genetic parents (a) (i)
and (ii) are of the same non-human vertebrate (eg, mouse or rat)
strain or cell background.
[0103] In one example, the first and second genetic parents are
related as (a) siblings, (b) parent and child, (c) parent and
grandchild, (d) cousins or (e) uncle/aunt and nephew/niece.
[0104] The invention also provides a method of generating a
non-human Assay Vertebrate (eg, a mouse or rat) for assaying the
effect or behaviour of a test antibody comprising human variable
regions and which binds a human epitope, the method comprising
[0105] (a) Obtaining a non-human vertebrate child ES cell from a
somatic cell (optionally wherein the ES cell is an IPS cell) of a
non-human Antibody-Generating Vertebrate whose genome encodes said
test antibody, the Antibody-Generating Vertebrate comprising one or
more transgenic antibody loci encoding antibodies comprising human
variable regions, and the Antibody-Generating Vertebrate having an
immune system comprising proteins encoded by an immune gene
repertoire (eg, an endogenous immune gene repertoire), said immune
gene repertoire comprising said transgenic antibody loci;
[0106] (b) Producing a modified child ES cell with a knock-in of
the human epitope by introducing into the genome of the child ES
cell a nucleotide sequence encoding said human epitope and
optionally knocking-out of the genome an endogenous non-human
vertebrate epitope that is an orthologue or homologue of said human
epitope; and
[0107] (c) Developing a non-human child vertebrate from said
modified child ES cell, wherein an Assay Vertebrate is obtained
that expresses said human epitope; and
[0108] (d) Optionally producing a progeny of said Assay Vertebrate
by genetic crossing, wherein said progeny comprises substantially
the same immune gene repertoire as said Assay Vertebrate in
addition to the human epitope knock-in (and optional
knock-out).
[0109] The Antibody-Generating Vertebrate used in this method is,
in one embodiment, any Antibody-Generating Vertebrate described
herein. Step (a) can be performed, for example, using breeding
between an Antibody-Generating Vertebrate and a second vertebrate
of the same species (eg, another Antibody-Generating Vertebrate
with substantially the same immune repertoire and/or substantially
the same genetic background) to produce a resulting embryo. Mouse
embryo fibroblasts can be generated from the embryo and then IPS
cells generated using any standard technique. For example,
reference is made to Proc Natl Acad Sci; 2011 Oct. 11; "Rapid and
efficient reprogramming of somatic cells to induced pluripotent
stem cells by retinoic acid receptor gamma and liver receptor
homolog 1"; Wang et al, the disclosure of which is incorporated
herein by reference. Other standard IPS-generating techniques can
be used.
[0110] Knock-in and knock-out technology has been discussed above,
and any of these methods can be used to effect step (b).
[0111] In one embodiment, the IPS cell is a mouse embryonic
fibroblast cell.
Human Target & Epitope DNA
[0112] The DNA encoding the human target or epitope can be from any
suitable source, eg, obtained by cloning the DNA from a blood or
tissue sample of a human donor. In one embodiment, a cDNA is used
that is encodes the human epitope or target. In another embodiment,
genomic DNA is used, eg, the gene for the human target. In one
example, the coding sequence for the human target is used, together
with the endogenous human signal sequence (if present) and promoter
(and optionally any enhancer of the gene).
[0113] Human DNA is readily obtainable from commercial and academic
libraries, eg, Bacterial Artificial Chromosome (BAC) libraries
containing human DNA. Examples are the Human RPCI-11 and -13
libraries (Osoegawa et al, 2001--see below;
http://bacpac.med.buffalo.edu/11framehmale.htm) and also the
"CalTech" Human BAC libraries (CalTech Libraries A, B, C and/or D,
http://www.tree.caltech.edu/lib_status.html).
CalTech Human BAC Library D:
[0114] See:
http://www.ncbi.nlm.nih.gov/clone/library/genomic/16/
[0115] The Hiroaki Shizuya laboratory at the California Institute
of Technology has developed three distinct human BAC libraries
(obtainable from Open Biosystems). The Cal Tech B (CTB) and Cal
Tech C (CTC) libraries together represent a genomic coverage of
15.times.. The Cal Tech D (CTD) library represents a 17.times.
coverage of the human genome. Whole collections as well as
individual clones are available. Detailed information on the
construction of the libraries can be found at
http://informa.bio.caltech.edu/idx_www_tree.html.
Library Summary
[0116] Library Name: CalTech human BAC library D
[0117] Library Abbreviation: CTD
[0118] Organism: Homo sapiens
[0119] Distributors: Invitrogen, Open Biosystems
[0120] Vector type(s): BAC
[0121] # clones Clone DB: 226,848
[0122] # end sequences Clone DB: 403,688
[0123] # insert sequences Clone DB: 3,153
[0124] # clones with both ends sequenced: 153,035
Library Details
TABLE-US-00001 [0125] DNA Source: Sex Cell type male Sperm Library
Construction Vector Cloning Library segment Vector Name Site(s) 1
pBeloBACII HindIII 2-5 pBeloBACII EcoRI Library Statistics Library
segment Avg Insert (kb) Plate Range(s) 1 129 2001 to 2423 2 202
2501 to 2565 3 182 2566 to 2671 4 142 3000 to 3253 5 166 3254 to
4869
RPCI-11 BACs
REFERENCES
[0126] Osoegawa K, Mammoser A G, Wu C, Frengen E, Zeng C, Catanese
J J, de Jong P J; Genome Res. 2001 March; 11(3):483-96; "A
bacterial artificial chromosome library for sequencing the complete
human genome"; [0127] Osoegawa, K., Woon, P. Y., Zhao, B., Frengen,
E., Tateno, M., Catanese, J. J, and de Jong, P. J. (1998); "An
Improved Approach for Construction of Bacterial Artificial
Chromosome Libraries"; Genomics 52, 1-8; [0128]
http://bacpac.chori.org/hmale11.htm, which describes the BACs as
follows
RPCI-11 Human Male BAC Library
[0129] The RPCI-11 Human Male BAC Library (Osoegawa et al., 2001)
was constructed using improved cloning techniques (Osoegawa et al.,
1998) developed by Kazutoyo Osoegawa. The library was generated by
Kazutoyo Osoegawa. Construction was funded by a grant from the
National Human Genome Research Institute (NHGRI, NIH)
(#1R01RG01165-03). This library was generated according to the new
NHGRI/DOE "Guidance on Human Subjects in Large-Scale DNA
Sequencing".
[0130] Male blood was obtained via a double-blind selection
protocol. Male blood DNA was isolated from one randomly chosen
donor (out of 10 male donors) and partially digested with a
combination of EcoRI and EcoRI Methylase. Size selected DNA was
cloned into the pBACe3.6 vector between the EcoRI sites. For
Segment 5, the same male donor DNA was partially digested with
Mbol, size selected, and ligated into the pTARBAC1 cloning vector
at the BamHI sites. The ligation products were transformed into
DH10B electrocompetent cells (BRL Life Technologies). The library
has been arrayed into 384-well microtiter dishes and also gridded
onto 22.times.22 cm nylon high density filters for screening by
probe hybridization.
The RPCI Human Male BAC Library:
TABLE-US-00002 [0131] Plate Empty Wells Segment Cloning Vector DNA
Numbers Total Plates Total Clones (Total) 1 pBACe3.6.sup.(1) Male
1-288 288 108,499 2,093 2 pBACe3.6.sup.(1) Male 289-576 288 109,496
1,096 3 pBACe3.6.sup.(1) Male 577-864 288 109,657 935 4
pBACe3.6.sup.(1) Male 865-1152 288 109,382 1,210 5 pTARBAC1.sup.(2)
Male 1153-1440 288 106,763 3,289 Total Library 1-1440 1440 543,797
9,163 .sup.(1)donor DNA EcoRI partially digested .sup.(2)donor DNA
MboI partially digested
TABLE-US-00003 Non- Empty Recombinant Non- Wells Clones Recombinant
Insert Size Genomic Segment (%) (Total) Clones (%) (average)
Coverage 1 1.9 approx. 1800 1.7 164 Kbp 5.8X 2 1.0 approx. 550 0.5
168 Kbp 6.0X 3 0.8 approx. 1100 1.0 181 Kbp 6.7X 4 1.1 approx. 1100
1.0 183 Kbp 6.8X 5 3.5 approx. 530 0.5 196 Kbp 6.9X Total 1.7
approx. 5080 0.9 178 Kbp 32.2X Library The average insert size has
been determined by Pulsed Field Gel Electrophoresis analysis of
clones randomly chosen from plates from each segment.
BAC Availability
[0132] The RP11 BACs are available for purchase from Invitrogen
(see
http://tools.invitrogen.com/content/sfs/manuals/bac_clones_man.pdf).
[0133] Vectors, such as BACs or PACs, can be manipulated in vitro
by standard Molecular Biology techniques, for example
recombineering (see http://www.genebridges.com; EP129142 and
EP1204740). For example, recombineering can be used to create
vectors in which a nucleotide sequence coding for a human target or
epitope of interest is flanked by one or more sequences, such as
homology arms or site-specific recombination sites (eg, lox, frt or
rox). The homology arms are, in one embodiment, homologous to, or
identical to, stretches of DNA from the genome of the non-human
vertebrate to be used to generate the Assay Vertebrate. Vectors
created in this way are useful for performing homologous
recombination (see, eg, U.S. Pat. No. 6,638,768, the disclosure of
which is incorporated herein by reference) in a method of precisely
inserting the human DNA into the non-human vertebrate genome (eg,
to precisely replace the orthologous or homologous DNA in the
vertebrate genome).
[0134] Other useful DNA- and genome-manipulation techniques are
readily available to the skilled person, including technologies
described in U.S. Pat. No. 6,461,818 (Baylor College of Medicine),
U.S. Pat. No. 6,586,251 (Regeneron) and WO2011044050 (eg, see
Examples).
[0135] Techniques for constructing non-human vertebrates and
vertebrate cells whose genomes comprise a transgene, eg, a
transgenic antibody locus containing human V, J and optionally D
regions are well known in the art. For example, reference is made
to WO2011004192, U.S. Pat. No. 7,501,552, U.S. Pat. No. 6,673,986,
U.S. Pat. No. 6,130,364, WO2009/076464 and U.S. Pat. No. 6,586,251,
the disclosures of which are incorporated herein by reference in
their entirety.
[0136] All nucleotide coordinates for the mouse are from NCBI m37,
April 2007 ENSEMBL Release 55.37 h for the mouse C57BL/6J strain.
Human nucleotides are from GRCh37, February 2009 ENSEMBL Release
55.37 and rat from RGSC 3.4 Dec. 2004 ENSEMBL release 55.34w.
[0137] In one embodiment in any configuration of the invention, the
Antibody-Generating Vertebrate and/or the Assay Vertebrate is a
non-human mammal. In one embodiment in any configuration of the
invention, the Antibody-Generating Vertebrate and/or the Assay
Vertebrate is a mouse, rat, rabbit, Camelid (eg, a llama, alpaca or
camel) or shark.
[0138] In one aspect the transgenic antibody loci comprise human V,
D and/or J coding regions placed under control of the host
regulatory sequences or other (non-human, non-host) sequences. In
one aspect reference to human V, D and/or J coding regions includes
both human introns and exons, or in another aspect simply exons and
no introns, which may be in the form of cDNA.
[0139] Alternatively it is possible to use recombineering, or other
recombinant DNA technologies, to insert a non human-vertebrate
(e.g. mouse) promoter or other control region, such as a promoter
for a V region, into a BAC containing a human Ig region. The
recombineering step then places a portion of human DNA under
control of the mouse promoter or other control region.
[0140] The invention also relates to a cell line (eg, ES or IPS
cell line) which is grown from or otherwise derived from cells or a
Vertebrate as described herein, including an immortalised cell
line. The cell line may be immortalised by fusion to a tumour cell
to provide an antibody producing cell and cell line, or be made by
direct cellular immortalisation.
[0141] In one aspect the non-human vertebrate of any configuration
of the invention is able to generate a diversity of at least
1.times.10.sup.6 different functional chimaeric antibody sequence
combinations.
[0142] Optionally in any configuration of the invention the
constant region is endogenous to the Vertebrate and optionally
comprises an endogenous switch. In one embodiment, the constant
region comprises a Cgamma (C.gamma.) region and/or a Smu (S.mu.)
switch. Switch sequences are known in the art, for example, see
Nikaido et al, Nature 292: 845-848 (1981) and also WO2011004192,
U.S. Pat. No. 7,501,552, U.S. Pat. No. 6,673,986, U.S. Pat. No.
6,130,364, WO2009/076464 and U.S. Pat. No. 6,586,251, eg, SEQ ID
NOs: 9-24 disclosed in U.S. Pat. No. 7,501,552. Optionally the
constant region comprises an endogenous S gamma switch and/or an
endogenous Smu switch.
[0143] In one aspect the test antibodies have a part of a non-human
vertebrate host constant region sufficient to provide one or more
effector functions seen in antibodies occurring naturally in a host
vertebrate, for example that they are able interact with Fc
receptors, and/or bind to complement.
[0144] Reference to a chimaeric antibody or antibody chain having a
non-human vertebrate constant region herein therefore is not
limited to the complete constant region but also includes chimaeric
antibodies or chains which have all of the host constant region, or
a part thereof sufficient to provide one or more effector
functions. This also applies to non-human Vertebrates and cells and
methods of the invention in which human variable region DNA may be
inserted into the host genome such that it forms a chimaeric
antibody chain with all or part of a host (endogenous) constant
region. In one aspect the whole of a host non-human vertebrate
constant region is operably linked to human variable region
DNA.
[0145] The host non-human vertebrate constant region herein is
optionally the endogenous host wild-type constant region located at
the wild type locus, as appropriate for the heavy or light chain.
For example, the human heavy chain DNA is suitably inserted on
mouse chromosome 12, suitably adjacent the mouse heavy chain
constant region, where the vertebrate is a mouse.
[0146] In one optional aspect where the Vertebrate is a mouse, the
insertion of the human antibody gene DNA, such as the human VDJ
region is targeted to the region between the J4 exon and the C.mu.
locus in the mouse genome IgH locus, and in one aspect is inserted
between coordinates 114,667,090 and 114,665,190, suitably at
coordinate 114,667,091. In one aspect the insertion of the human
antibody DNA, such as the human light chain kappa VJ is targeted
into mouse chromosome 6 between coordinates 70,673,899 and
70,675,515, suitably at position 70,674,734, or an equivalent
position in the lambda mouse locus on chromosome 16.
[0147] In one aspect the host non-human vertebrate constant region
for forming the chimaeric antibody may be at a different (non
endogenous) chromosomal locus. In this case the inserted human
antibody DNA, such as the human variable VDJ or VJ region(s) may
then be inserted into the non-human genome at a site which is
distinct from that of the naturally occurring heavy or light
constant region. The native constant region may be inserted into
the genome, or duplicated within the genome, at a different
chromosomal locus to the native position, such that it is in a
functional arrangement with the human variable region such that
chimaeric antibodies of the invention can still be produced.
[0148] In one aspect the human antibody DNA is inserted at the
endogenous host wild-type constant region located at the wild type
locus between the host constant region and the host VDJ region.
[0149] Reference to location of the variable region upstream of the
non-human vertebrate constant region means that there is a suitable
relative location of the two antibody portions, variable and
constant, to allow the variable and constant regions to form a
chimaeric antibody or antibody chain in vivo in the vertebrate.
Thus, the inserted human antibody DNA and host constant region are
in operable connection with one another for antibody or antibody
chain production.
[0150] In one aspect the inserted human antibody DNA is capable of
being expressed with different host constant regions through
isotype switching. In one aspect isotype switching does not require
or involve trans switching. Insertion of the human variable region
DNA on the same chromosome as the relevant host constant region
means that there is no need for trans-switching to produce isotype
switching.
[0151] In the present invention, optionally host non-human
vertebrate constant regions are maintained and it is preferred that
at least one non-human vertebrate enhancer or other control
sequence, such as a switch region, is maintained in functional
arrangement with the non-human vertebrate constant region, such
that the effect of the enhancer or other control sequence, as seen
in the host vertebrate, is exerted in whole or in part in the
transgenic animal. This approach is designed to allow the full
diversity of the human locus to be sampled, to allow the same high
expression levels that would be achieved by non-human vertebrate
control sequences such as enhancers, and is such that signalling in
the B-cell, for example isotype switching using switch
recombination sites, would still use non-human vertebrate
sequences.
[0152] A non-human vertebrate having such a genome would produce
chimaeric antibodies with human variable and non-human vertebrate
constant regions, but these are readily humanized, for example in a
cloning step that replaces the mouse constant regions for
corresponding human constant regions (eg, after the chimaeric
antibody has been tested in the Assay Vertebrate).
[0153] In one aspect the inserted human IgH VDJ region comprises,
in germline configuration, all of the V, D and J regions and
intervening sequences from a human. Optionally, non-functional V
and/or D and/or J gene segments are omitted. For example, VH which
are inverted or are pseudogenes may be omitted.
[0154] In one aspect 800-1000 kb of the human IgH VDJ region is
inserted into the non-human vertebrate IgH locus, and in one aspect
a 940, 950 or 960 kb fragment is inserted. Suitably this includes
bases 105,400,051 to 106,368,585 from human chromosome 14 (all
coordinates refer to NCBI36 for the human genome, ENSEMBL Release
54 and NCBIM37 for the mouse genome, relating to mouse strain
C57BL/6J).
[0155] In one aspect the inserted IgH human fragment consists of
bases 105,400,051 to 106,368,585 from chromosome 14. In one aspect
the inserted human heavy chain DNA, such as DNA consisting of bases
105,400,051 to 106,368,585 from chromosome 14, is inserted into
mouse chromosome 12 between the end of the mouse J4 region and the
E.mu. region, suitably between coordinates 114,667,091 and
114,665,190, suitably at coordinate 114,667,091.
[0156] In one aspect the inserted human kappa VJ region comprises,
in germline configuration, all of the V and J regions and
intervening sequences from a human. Optionally, non-functional V
and/or J gene segments are omitted.
[0157] Suitably this includes bases 88,940,356 to 89,857,000 from
human chromosome 2, suitably approximately 917 kb. In a further
aspect the light chain VJ insert may comprise only the proximal
clusters of V segments and J segments. Such an insert would be of
approximately 473 kb.
[0158] In one aspect the human light chain kappa DNA, such as the
human IgK fragment of bases 88,940,356 to 89,857,000 from human
chromosome 2, is suitably inserted into mouse chromosome 6 between
coordinates 70,673,899 and 70,675,515, suitably at position
70,674,734.
[0159] In one aspect the human lambda VJ region comprises, in
germline configuration, all of the V and J regions and intervening
sequences from a human. Suitably this includes analogous bases to
those selected for the kappa fragment, from human chromosome 2.
Optionally, non-functional V and/or J gene segments are
omitted.
[0160] All specific human antibody fragments described herein may
vary in length, and may for example be longer or shorter than
defined as above, such as 500 bases, 1 KB, 2K, 3K, 4K, 5 KB, 10 KB,
20 KB, 30 KB, 40 KB or 50 KB or more, which suitably comprise all
or part of the human V(D)J region, whilst preferably retaining the
requirement for the final insert to comprise human genetic material
encoding the complete heavy chain region and light chain region, as
appropriate, as described herein.
[0161] In one aspect the 3' end of the last inserted human antibody
sequence, generally the last human J sequence, is inserted less
than 2 kb, preferably less than 1 KB from the human/non-human
vertebrate (eg, human/mouse or human/rat) join region.
[0162] Optionally, the genome is homozygous at one, or both, or all
three antibody loci (IgH, IgX and IgK).
[0163] In another aspect the genome may be heterozygous at one or
more of the antibody loci, such as heterozygous for DNA encoding a
chimaeric antibody chain and native (host cell) antibody chain. In
one aspect the genome may be heterozygous for DNA capable of
encoding 2 different antibody chains encoded by immunoglobulin
transgenes of the invention, for example, comprising 2 different
chimaeric heavy chains or 2 different chimaeric light chains.
[0164] In one embodiment in any configuration of the invention, the
genome of the Vertebrate has been modified to prevent or reduce the
expression of fully-endogenous antibody. Examples of suitable
techniques for doing this can be found in WO2011004192, U.S. Pat.
No. 7,501,552, U.S. Pat. No. 6,673,986, U.S. Pat. No. 6,130,364,
WO2009/076464, EP1399559 and U.S. Pat. No. 6,586,251, the
disclosures of which are incorporated herein by reference. In one
embodiment, the non-human vertebrate VDJ region of the endogenous
heavy chain immunoglobulin locus, and optionally VJ region of the
endogenous light chain immunoglobulin loci (lambda and/or kappa
loci), have been inactivated. For example, all or part of the
non-human vertebrate VDJ region is inactivated by inversion in the
endogenous heavy chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus. For example, all or part of
the non-human vertebrate VJ region is inactivated by inversion in
the endogenous kappa chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus. For example, all or part of
the non-human vertebrate VJ region is inactivated by inversion in
the endogenous lambda chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus. In one embodiment the
endogenous heavy chain locus is inactivated in this way as is one
or both of the endogenous kappa and lambda loci.
[0165] Additionally or alternatively, the Vertebrate has been
generated in a genetic background which prevents the production of
mature host B and T lymphocytes, optionally a RAG-1-deficient
and/or RAG-2 deficient background. See U.S. Pat. No. 5,859,301 for
techniques of generating RAG-1 deficient animals.
[0166] In one embodiment in any configuration of the invention, the
human V, J and optional D regions are provided by all or part of
the human IgH locus; optionally wherein said all or part of the IgH
locus includes substantially the full human repertoire of IgH V, D
and J regions and intervening sequences. A suitable part of the
human IgH locus is disclosed in WO2011004192. In one embodiment,
the human IgH part includes (or optionally consists of) bases
105,400,051 to 106,368,585 from human chromosome 14 (coordinates
from NCBI36). Additionally or alternatively, optionally wherein the
vertebrate is a mouse or the cell is a mouse cell, the human V, J
and optional D regions are inserted into mouse chromosome 12 at a
position corresponding to a position between coordinates
114,667,091 and 114,665,190, optionally at coordinate 114,667,091
(coordinates from NCBIM37, relating to mouse strain C57BL/6J).
[0167] In one embodiment of any configuration of a Vertebrate or
cell (line) of the invention when the Vertebrate is a mouse, (i)
the mouse comprises a transgenic heavy chain locus whose constant
region comprises a mouse or rat S.mu. switch and optionally a mouse
C.mu. region. For example the constant region is provided by the
constant region endogenous to the mouse, eg, by inserting human
V(D)J region sequences into operable linkage with the endogenous
constant region of a mouse genome or mouse cell genome.
[0168] In one embodiment of any configuration of a Vertebrate or
cell (line) of the invention when the Vertebrate is a rat, (i) the
rat comprises a transgenic heavy chain locus whose constant region
comprises a mouse or rat S.mu. switch and optionally a rat C.mu.
region. For example the constant region is provided by the constant
region endogenous to the rat, eg, by inserting human V(D)J region
sequences into operable linkage with the endogenous constant region
of a rat genome or rat cell genome.
[0169] In one embodiment of any configuration of a Vertebrate or
cell (line) of the invention the lambda antibody transgene
comprises all or part of the human Ig.lamda. locus including at
least one human J.lamda. region and at least one human C.lamda.
region, optionally C.sub..lamda.6 and/or C.sub..lamda.7.
Optionally, the transgene comprises a plurality of human J.lamda.
regions, optionally two or more of J.sub..lamda.1, J.sub..lamda.2,
J.sub..lamda.6 and J.sub..lamda.7, optionally all of
J.sub..lamda.1, J.sub..lamda.2, J.sub..lamda.6 and J.sub..lamda.7.
The human lambda immunoglobulin locus comprises a unique gene
architecture composed of serial J-C clusters. In order to take
advantage of this feature, the invention in optional aspects
employs one or more such human J-C clusters inoperable linkage with
the constant region in the transgene, eg, where the constant region
is endogenous to the non-human vertebrate or non-human vertebrate
cell (line). Thus, optionally the transgene comprises at least one
human J.sub..lamda.-C.sub..lamda. cluster, optionally at least
J.sub..lamda.7-C.sub..lamda.7. The construction of such transgenes
is facilitated by being able to use all or part of the human lambda
locus such that the transgene comprises one or more J-C clusters in
germline configuration, advantageously also including intervening
sequences between clusters and/or between adjacent J and C regions
in the human locus. This preserves any regulatory elements within
the intervening sequences which may be involved in VJ and/or JC
recombination and which may be recognised by AID
(activation-induced deaminase) or AID homologues.
[0170] Where endogenous regulatory elements are involved in CSR
(class-switch recombination) in the non-human vertebrate, these can
be preserved by including in the transgene a constant region that
is endogenous to the non-human vertebrate. In the first
configuration of the invention, one can match this by using an AID
or AID homologue that is endogenous to the vertebrate or a
functional mutant thereof. Such design elements are advantageous
for maximising the enzymatic spectrum for SHM (somatic
hypermutation) and/or CSR and thus for maximising the potential for
antibody diversity.
[0171] Optionally, the lambda transgene comprises a human EX
enhancer. Optionally, the kappa transgene comprises a human EK
enhancer. Optionally, the heavy chain transgene comprises a heavy
chain human enhancer.
[0172] In one embodiment of any configuration of the invention the
constant region of the or each antibody transgene is endogenous to
the non-human vertebrate or derived from such a constant region.
For example, the vertebrate is a mouse or the cell is a mouse cell
and the constant region is endogenous to the mouse. For example,
the vertebrate is a rat or the cell is a rat cell and the constant
region is endogenous to the rat.
[0173] In one embodiment of any configuration of the invention the
heavy chain transgene comprises a plurality human IgH V regions, a
plurality of human D regions and a plurality of human J regions,
optionally substantially the full human repertoire of IgH V, D and
J regions.
[0174] In one embodiment of any configuration of the invention, the
vertebrate or cell comprises a heavy chain further transgene, the
further transgene comprising at least one human IgH V region, at
least one human D region and at least one human J region,
optionally substantially the full human repertoire of IgH V, D and
J regions.
[0175] In one embodiment of any configuration of the invention, for
the Antibody-Generating Vertebrate and/or Assay Vertebrate:--
[0176] (i) the heavy chain transgene comprises substantially the
full human repertoire of IgH V, D and J regions; and
[0177] (ii) the vertebrate comprises substantially the full human
repertoire of Ig.kappa. V and J regions and/or substantially the
full human repertoire of Ig.lamda. V and J regions.
[0178] An aspect provides a B-cell, hybridoma or a stem cell,
optionally an embryonic stem cell or haematopoietic stem cell,
derived from an Assay Vertebrate according to any configuration of
the invention. In one embodiment, the cell is a B6, BALB/c, JM8 or
AB2.1 or AB2.2 embryonic stem cell (see discussion of suitable
cells, and in particular JM8 and AB2.1 cells, in WO2011004192,
which disclosure is incorporated herein by reference).
[0179] In one aspect the ES cell is derived from the mouse BALB/c,
C57BL/6N, C57BL/6J, 129S5, 129S7 or 129Sv strain.
[0180] In one aspect the non-human vertebrate is a rodent, suitably
a mouse, and cells (cell lines) of the invention, are rodent cells
or ES cells, suitably mouse ES cells.
[0181] The ES cells of the present invention can be used to
generate animals using techniques well known in the art, which
comprise injection of the ES cell into a blastocyst followed by
implantation of chimaeric blastocysts into females to produce
offspring which can be bred and selected for homozygous
recombinants having the required insertion. In one aspect the
invention relates to a transgenic animal comprised of ES
cell-derived tissue and host embryo derived tissue. In one aspect
the invention relates to genetically-altered subsequent generation
animals, which include animals having a homozygous recombinants for
the VDJ and/or VJ regions.
[0182] An aspect provides a method of isolating an antibody or
nucleotide sequence encoding said antibody, the method
comprising
[0183] (a) immunising (see e.g. Harlow, E. & Lane, D. 1998,
5.sup.th edition, Antibodies: A Laboratory Manual, Cold Spring
Harbor Lab. Press, Plainview, N.Y.; and Pasqualini and Arap,
Proceedings of the National Academy of Sciences (2004) 101:257-259)
an Antibody-Generating Vertebrate according to any configuration or
aspect of the invention with a human target antigen such that the
vertebrate produces test antibodies; and
[0184] (b) isolating from the vertebrate a test antibody that
specifically binds to said antigen and/or a nucleotide sequence
encoding at least the heavy and/or the light chain variable regions
of said antibody;
[0185] optionally wherein the variable regions of said antibody are
subsequently joined to a human constant region (eg, after testing
of the antibody in an Assay Vertebrate of the invention). Such
joining can be effected by techniques readily available in the art,
such as using conventional recombinant DNA and RNA technology as
will be apparent to the skilled person. See e.g. Sambrook, J and
Russell, D. (2001, 3'd edition) Molecular Cloning: A Laboratory
Manual (Cold Spring Harbor Lab. Press, Plainview, N.Y.).
[0186] Suitably an immunogenic amount of the human epitope or
target antigen is delivered. The invention also relates to a method
for detecting a human epitope or target antigen comprising
detecting a test antibody produced as above with a secondary
detection agent which recognises a portion of that antibody.
[0187] Isolation of the antibody in step (b) can be carried out
using conventional antibody selection techniques, eg, panning for
antibodies against antigen that has been immobilised on a solid
support, optionally with iterative rounds at increasing stringency,
as will be readily apparent to the skilled person.
[0188] As a further optional step, after step (b) the amino acid
sequence of the heavy and/or the light chain variable regions of
the antibody are mutated to improve affinity for binding to said
antigen. Mutation can be generated by conventional techniques as
will be readily apparent to the skilled person, eg, by error-prone
PCR. Affinity can be determined by conventional techniques as will
be readily apparent to the skilled person, eg, by surface plasmon
resonance, eg, using Biacore.TM..
[0189] Additionally or alternatively, as a further optional step,
after step (b) the amino acid sequence of the heavy and/or the
light chain variable regions of a test antibody are mutated to
improve one or more biophysical characteristics of the antibody,
eg, one or more of melting temperature, solution state (monomer or
dimer), stability and expression (eg, in CHO or E. coli).
[0190] An aspect provides a test antibody of the invention,
optionally for use in medicine, eg, for treating and/or preventing
a medical condition or disease in a patient, eg, a human.
[0191] An aspect provides a nucleotide sequence encoding a test
antibody of the invention, optionally wherein the nucleotide
sequence is part of a vector. Suitable vectors will be readily
apparent to the skilled person, eg, a conventional antibody
expression vector comprising the nucleotide sequence together in
operable linkage with one or more expression control elements.
[0192] An aspect provides a pharmaceutical composition comprising a
test antibody of the invention and a diluent, excipient or carrier,
optionally wherein the composition is contained in an IV container
(eg, and IV bag) or a container connected to an IV syringe.
[0193] An aspect provides the use of a test antibody of the
invention in the manufacture of a medicament for the treatment
and/or prophylaxis of a disease or condition in a patient, eg a
human.
[0194] In a further aspect the invention relates to humanised
antibodies and antibody chains produced o assayed according to the
present invention, both in chimaeric and fully humanised form, and
use of said antibodies in medicine. The invention also relates to a
pharmaceutical composition comprising such an antibody and a
pharmaceutically acceptable carrier or other excipient.
[0195] Antibody chains containing human sequences, such as
chimaeric human-non human antibody chains, are considered humanised
herein by virtue of the presence of the human protein coding
regions region. Fully human antibodies may be produced starting
from DNA encoding a chimaeric antibody chain of the invention using
standard techniques.
[0196] Methods for the generation of both monoclonal and polyclonal
antibodies are well known in the art, and the present invention
relates to both polyclonal and monoclonal antibodies of chimaeric
or fully humanised antibodies produced in response to antigen
challenge in non human-vertebrates of the present invention.
[0197] In a yet further aspect, chimaeric antibodies or antibody
chains generated in the present invention may be manipulated,
suitably at the DNA level, to generate molecules with antibody-like
properties or structure, such as a human variable region from a
heavy or light chain absent a constant region, for example a domain
antibody; or a human variable region with any constant region from
either heavy or light chain from the same or different species; or
a human variable region with a non-naturally occurring constant
region; or human variable region together with any other fusion
partner. The invention relates to all such chimaeric antibody
derivatives derived from chimaeric antibodies identified, isolated
or assayed according to the present invention.
[0198] In a further aspect, the invention relates to use of an
Assay Vertebrate of the present invention in the analysis of the
likely effects of a drug or vaccine in the context of a human
antibody variable region repertoire, the human epitope/target and
the test antibody. This is useful for simulating the environment in
vivo in human patients likely to receive the drug.
[0199] The invention also relates to a method for identification or
validation of a drug or vaccine, the method comprising delivering
the vaccine or drug to an Assay Vertebrate of the invention and
monitoring one or more of: the immune response, the safety profile;
the effect on disease. In one embodiment, the drug is a test
antibody as herein defined; in another embodiment it is not, but
the Assay Vertebrate contains both the drug and a test antibody.
This is useful for assessing interactions, effect, performance,
toxicity or PK (or any of the assay parameters mentioned above) of
useful drugs (and drug candidates) in the presence of a test
antibody; or conversely assessing this for a test antibody in the
context of a known drug. In the latter, the drug may be a drug
commonly found in patients of the type expected to receive the
antibody as a therapeutic and/or prophylactic--which is useful when
the antibody is intended to be a second-line (or subsequent)
treatment in patients receiving the drug as a first-line (or
earlier) treatment.
[0200] It will be understood that particular embodiments described
herein are shown by way of illustration and not as limitations of
the invention. The principal features of this invention can be
employed in various embodiments without departing from the scope of
the invention. Those skilled in the art will recognize, or be able
to ascertain using no more than routine study, numerous equivalents
to the specific procedures described herein. Such equivalents are
considered to be within the scope of this invention and are covered
by the claims. All publications and patent applications mentioned
in the specification are indicative of the level of skill of those
skilled in the art to which this invention pertains. All
publications and patent applications are herein incorporated by
reference to the same extent as if each individual publication or
patent application was specifically and individually indicated to
be incorporated by reference. The use of the word "a" or an when
used in conjunction with the term "comprising" in the claims and/or
the specification may mean "one," but it is also consistent with
the meaning of "one or more," "at least one," and "one or more than
one." The use of the term or in the claims is used to mean "and/or"
unless explicitly indicated to refer to alternatives only or the
alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the feature in the context with which it is referred. The term
"substantially" when referring to an amount, extent or feature (eg,
"substantially identical" or "substantially the same") includes a
disclosure of "identical" or "the same" respectively, and this
provides basis for insertion of these precise terms into claims
below.
[0201] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps
[0202] The term or combinations thereof' as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof is intended to
include at least one of: A, B, C, AB, AC, BC, or ABC, and if order
is important in a particular context, also BA, CA, CB, CBA, BCA,
ACB, BAC, or CAB. Continuing with this example, expressly included
are combinations that contain repeats of one or more item or term,
such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
The skilled artisan will understand that typically there is no
limit on the number of items or terms in any combination, unless
otherwise apparent from the context.
[0203] Any part of this disclosure may be read in combination with
any other part of the disclosure, unless otherwise apparent from
the context.
[0204] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. All such similar substitutes and modifications apparent
to those skilled in the art are deemed to be within the spirit,
scope and concept of the invention as defined by the appended
claims.
[0205] The present invention is described in more detail in the
following non limiting exemplification.
EXAMPLES
[0206] The following examples will be useful for demonstrating the
present invention. Example 3 is a fully-worked example and data
from this is provided below as a non-limiting illustration of how
to derive ES cells for use in the present invention.
Example 1
Generation of Transgenic Antibody-Generating Mouse
[0207] A transgenic mouse is generated using ES cell technology and
genetic manipulation to introduce human antibody heavy chain and
kappa chain V, D and J segments operatively connected directly 5'
of endogenous mouse heavy and kappa constant regions respectively.
Mouse mu switch and mu constant and gamma regions are provided in
the heavy chain transgenic locus thus produced. Endogenous, mouse
heavy chain and kappa chain expression are inactivated; mouse
lambda chain expression is typically 5% or less so inactivation is
optional. The human antibody gene segments are introduced into a
mouse ES cell using homologous recombination and/or recombinase
mediated cassette exchange (RMCE) as is known in the art. Human DNA
can be manipulated using BAC and recombineering technology as known
in the art. BACs containing human antibody gene DNA is obtainable
from Invitrogen. A suitable ES cell is a 129, AB2.1 or AB2.2 cell
(obtainable from Baylor College of Medicine).
[0208] The transgenic ES cells are then implanted into a blastocyst
from a foster mouse mother (eg, a 129 or C57BL/6N mouse strain).
Heavy chain and kappa chain lines can be produced and crossed to
provide an Antibody-Generating mouse bearing homozygous transgenic
heavy and kappa chains with human variable regions (HK mouse).
[0209] Using a similar protocol, a lambda chain line is produced
and by crossing a HKL mouse is generated bearing homozygous
transgenic heavy, lambda and kappa chains with human variable
regions
[0210] Further guidance is disclosed in WO2011004192, U.S. Pat. No.
7,501,552, U.S. Pat. No. 6,673,986, U.S. Pat. No. 6,130,364,
WO2009/076464 and U.S. Pat. No. 6,586,251, the disclosures of which
are incorporated herein by reference in their entirety.
Isolation of Test Antibody
[0211] Using a human target antigen in a suitable injection medium
(eg, including an adjuvant such as Freunds or Titermax.TM.), the HK
Antibody-Generating mouse is immunised. RIMMS is a suitable
immunisation protocol, or any other standard immunisation
protocol.
[0212] A test antibody is isolated that comprises human variable
regions and binds the human antigen with desired affinity. Affinity
is tested using surface plasmon resonance (eg, using
Biacore.TM.)
ES cell recovery & Production of Assay Mice:
[0213] The HK Antibody-Generating mouse is crossed with a mouse of
the same genetic background; in this example, the mice are of a 129
background and have essentially the same immune gene repertoire. ES
cells are isolated from an embryo resulting from the cross. Such ES
cells (H/H; K/K--ie, homozygous for the antibody transgenes) are
further used to knock-out an endogenous target gene that is
orthologous or homologous to the human target used previously for
immunisation; while the gene for the human target is knocked into
the ES cell genome. In one embodiment, using homologous
recombination and a vector harbouring the DNA for the human target,
the endogenous gene is replaced by the human gene so that the
genome comprises a knock-out for the endogenous gene and a knock-in
for the human gene. A suitable vector has the human DNA flanked by
homology arms which are mouse sequences immediately 5' and 3' of
the endogenous target DNA in the ES cell genome.
[0214] ES cell chimera are generated and used for production of
mice demonstrating germline transmission (F1 mice: H/HA; K/KA,
where H/HA=heterozygous-transgenic heavy chain locus+inactivated
endogenous heavy chain locus and K/KA=heterozygous-transgenic kappa
chain locus+inactivated endogenous kappa locus; KI or KO/+). F2
mice (H/HA or H; K/KA or K; KO/KO or KI/KI) are then generated by
crossing the F1 mice to produce [H/H+K/K+KI/KI] or
[H/H+K/K+KI/KI+KO/KO] Assay Mice.
Antibody Testing
[0215] The Test Antibody is injected into an Assay Mouse and one or
more of the following is determined:--
[0216] pharmacodynamics of said antibody (or a metabolite or
derivative thereof produced by the Assay Mouse), pharmacokinetics
of said antibody, activity of said antibody, clearance of said
antibody, distribution of said antibody, toxicology of said
antibody, a physico-chemical characteristic or effect of said
antibody, a binding characteristic of said antibody, a biological
characteristic or effect of said antibody, a physiological
characteristic or effect of said antibody, a pharmaceutical
characteristic or effect of said antibody, and interaction of said
antibody with another protein or substance inside the Assay Mouse.
The skilled person will be fully conversant with standard
techniques for carrying out such assays.
[0217] The test antibody bears constant regions that are
species-matched for the Assay Mouse and the antibody is seen as
"self" by the mouse and thus tolerated. Thus, issues of anti-test
antibody reaction are not encountered which would otherwise hamper
the assay. By matching the Antigen-Generating Vertebrate and Assay
Vertebrate (and thus matching the constant region of the test
antibody), the present invention provides for pre-clinical and
clinical assay testing with more accuracy and less risk of
anti-antibody interference of data sets. This allows for better
selection of lead candidates for progression into clinical
development and drug production.
Humanisation of Test Antibody
[0218] The method is conducted for a panel of test antibodies. A
lead candidate is chosen according to affinity for binding the
human target and one or more of the assay parameters discussed
above.
[0219] Using recombinant DNA technology, as is standard, the mouse
constant regions of the lead candidate are replaced with
corresponding human constant regions to produce a fully-human
antibody that binds the human target.
Example 2
[0220] Example 1 is carried out with the exception that IPS cell
(induced pluripotent cell) generation is carried out instead of ES
cell recovery.
IPS Cell Recovery:
[0221] Mouse embryonic fibroblasts (MEF) which are isolated from
embryos derived from crossing of parents carrying the antibody
transgenes (HK or HKL mice) are induced to IPS cells. The IPS cells
can also be directly generated from other somatic cells from mice
carrying the antibody transgenes. Such iPS cells (H/H; K/K) are
further used to knock-in the human target gene (and optionally
knock out the endogenous mouse orthologue or homologue). IPS
chimeras are generated and used for production of germline
transmission mice (F1 mice: H/HA; K/KA; KI or KO/+). F2 mice (H/HA
or H; K/KA or K; KO/KO or KI/KI) are then generated by crossing the
F1 mice.
Example 3
Derivation of ES Cells from Antibody-Generating Non-Human
Vertebrates
[0222] The aim of this experiment was to test our protocol for ES
Cell derivation, to see if we could produce ES cells from mice we
have created.
Parental Mice Cross
[0223] Mice were heterozygous for S3F (ie, S3F/+). S3F denotes a
transgenic IgH locus comprising a human gene segment repertoire
V.sub.H2-5, V.sub.H7-4-1, V.sub.H4-4, V.sub.H1-3, V.sub.H1-2,
V.sub.H6-1, D1-1, D2-2, D3-9, D3-10, D4-11, D5-12, D6-13, D1-14,
D2-15, D3-16, D4-17, D5-18, D6-19, D1-20, D2-21, D3-22, D4-23,
D5-24, D6-25, D1-26, D7-27, J.sub.H1, J.sub.H2, J.sub.H3, J.sub.H4,
J.sub.H5 and J.sub.H6 (in 5' to 3' order) upstream of a mouse heavy
chain constant region. The "+" indicates wild type mouse IgH
allele.
[0224] (Genetic back ground is: 12957/SvEvBrd,
C57BL/6Brd-Tyr.sup.c-Brd)
[0225] The parental cross was:
[0226] "KMSP95.1b" Male (S3F/+) X "KMSP95.2g" Female (S3F/+)
[0227] We used the protocol detailed below and obtained 8
Blastocysts.
ESC Derivation Media:
[0228] Knockout-DMEM (Gibco)
[0229] 15% Knockout serum replacement (Gibco)
[0230] 5% ESC-grade FCS (Gibco)
[0231] 1.times.NEAA (Gibco)
[0232] 2 mM Glutamine (Gibco)
[0233] 0.1 mM 2-Mercaptoethanol
3000 U/Ml LIF (ESGRO)
[0234] 1. Flush e3.5 embryos from uterus and plate onto a feeder
plate (6 Well plates can be convenient for picking colonies later)
with above mentioned medium. [0235] 2. Don't disturb for next 48
hours [0236] 3. Medium change every other day. Around day 5, look
for the Inner Cell Mass outgrowth, or ICM. [0237] 4. Pick colonies
around day 7-10, trypsinise into a single cell suspension in a
round bottom 96 well plate, and plate onto 6 well plates. Briefly
pick the outgrowths into a 96 well containing 25-30|10.25% trypsin
(Sigma) solution, incubate for 3-4 mins. Using a 10| pipette
disaggregate the ICM gently into smaller cellular aggregates of
three or four cells. Transfer the contents form the 96 well onto
freshly prepared 6 well plates, each well going to one 6 well.
[0238] 5. Inspect the plates daily. After about 2 days primary
colonies of cells will become visible and may have one of several
morphologies: trophoblast-like cells, epithelium-like cells,
endoderm-like cells, ES cell-like cells which are what we are
looking for. If the plate contains clumps with ES cell morphology
which are the majority of cells, passage the cells following normal
protocol for maintenance, trypsinise every other day. If there are
very few cells with ES cell morphology, these can be picked and
trypsinised as described in step 4. Once cells have been expanded
to 2.times.10 cm dishes they can be frozen for storage. [0239] 6.
Freeze cells following a standard freezing protocol. [0240] 7. When
frozen cells are thawed, the can be placed into the usual ES cell
culture media KO-DMEM+15% Serum+1000 U/MI LIF
Identification of ES Cells
[0241] In step 3, ICM of the desired morphology can be seen by the
illustrative example in box D of FIG. 1. FIG. 1 shows the
progressive changes in morphology of cultured blastocysts (taken
from "Manipulating the Mouse Embryo", 3.sup.rd Edition, A Nagy et
al, Cold Spring Harbor Laboratory Press, 2003; FIG. 8.2 of that
text).
[0242] In step 5, ES cells have characteristic morphology, as will
be known by the skilled person. An illustration is shown in FIG. 2A
(taken from "Manipulating the Mouse Embryo", 3.sup.rd Edition, A
Nagy et al, Cold Spring Harbor Laboratory Press, 2003; FIG. 8.4 of
that text). Nagy et al provides a description as follows: box A
shows a colony of stem cells 2 days after disaggregation on the
ICM; box B shows the same colony 2 days later. The colony remains
composed of a homogeneous population of stem cells and no overt
cellular differentiation has occurred. Stem cells are comparatively
small, typically have a large clear nucleus containing one or more
prominent nucleoli and are tightly packed within the multilayered
primary colony. In box C, the colony was subcultured into fresh a
feeder well. Within 2 days numerous small nests of stem cells
appeared in culture.
[0243] Additionally or alternatively to the use of morphology to
look for ES cells, the skilled person will be aware of the use of
ES cell markers (eg, Nanog and Oct4) for this purpose. Oct4 and
Nanog are transcription factors required to maintain the
pluripotency and self-renewal of embryonic stem (ES) cells.) as
described in the following paper: Nature Genetics 38, 431-440
(2006); Published online: 5 Mar. 2006; |doi:10.1038/ng1760; "The
Oct4 and Nanog transcription network regulates pluripotency in
mouse embryonic stem cells".
[0244] In the present example we did not use these markers for our
work; we only look at the morphology. Following this method we
obtained 3 separate clones which when assessed under the microscope
showed the morphological characteristics of ES cells (see FIG. 2B).
Stem cells are comparatively small, typically have a large clear
nucleus containing one or more prominent nuclei and are tightly
packed within the multi-layered primary colony.
[0245] Once the clones were expanded onto 2.times.10 cm plates they
were frozen following a normal freezing protocol. Briefly the cells
are trypsinised as described above this time incubating for 20
mins, the trypsin is inactivated using an equal volume of ES cell
media, the cells are pipetted to separate colonies. The cell
suspension is collected and centrifuged, any supernatant is removed
and the cells re-suspended in ES cell media. An equal volume of
freeze media is added (60% DMEM, 20% FBS, 20% DMSO (Sigma), freshly
prepared), 1 ml is aliquoted into pre-labelled sterile freezing
vials, 6 vials per clone.
[0246] The clones were named KX01.1, KX01.2 and KX01.3.
Genotyping Analysis
[0247] A small volume of each clone was kept aside to be used for
genotyping analysis to ensure the ES cells obtained carried the
same gene as the parent animals used to produce the blastocysts.
Alongside genotyping we tested for the Y chromosome as our ES cells
should ideally be male. Male ES cells are preferred over female ES
cells because they offer much better rates of germ line
transmission:
[0248] (i) They are much more stable in culture. Female [XX] mouse
ES cells have two active X-chromosomes, meaning that the dose of
X-to-autosomal gene products is 1:1, while in all other cell types
it is 1:2 because of X-inactivation. This unusual 1:1 gene dosage
situation is not well tolerated and often one of X-chromosomes is
lost or deleted.
[0249] (ii) Most reported germ line transmission events come from
male chimaeras because the male XY ES cells will often convert
female embryos into phenotypic males. As a result the majority of
chimaeras born [75-80%] following the injection of male ES cells
into blastocysts are phenotypic males which transmit their male ES
cell-derived genomes. Even if the injected embryo is female, male
ES cells can convert the chimaera into a fully functional fertile
male.
[0250] (iii) Male chimaeras can be extensively and quickly bred,
producing 100s of progeny in a matter of months if required. So
even low levels of contribution to sperm can be rapidly
detected.
[0251] (iv) Although the injection of female ES cells can result in
germ line transmission, this is only possible through female
chimaeras. It is not possible to breed females extensively, because
litters are limited in size and frequency, thus low level germ-line
chimaerism will not be reliably detected.
Genotyping Protocols
[0252] ES cell genotyping was conducted using the following
protocol, this was to ensure that the ES cells obtained carried the
same gene as the parent animals used to obtain the blastocysts.
ES Cell Digestion
[0253] Remove media [0254] Wash with 500 .mu.l PBS [0255] Use the
ES cell lysis buffer (50 mM Tris, 50 mM EDTA, 1% SDS, 100 mM NaCl)
Add PK powder from freezer (Sigma P8044-5g) to create a 1 mg/ml
concentration [0256] Add 500 .mu.l of PK Lysis buffer to each well.
[0257] Seal plate with tape and put it in a plastic container that
also contains paper towel soaked with water.
[0258] This will keep the wells from drying out [0259] Incubate at
55.degree. C. overnight. [0260] Move samples into eppendorf tubes
and add equal volumes of isopropanol (in this case add 500 .mu.l)
[0261] Centrifuge for 10 mins at 13000 rpm to form a DNA pellet.
[0262] Pour off supernatant and added equal volumes (in this case 1
ml of 70% ethanol) to wash. [0263] Add 100 .mu.l of Water to
resuspend the DNA, .sup..about.1 .mu.l of DNA is used.
[0264] Appropriate primer sequences were used in the PCR reaction
using the appropriate PCR cycle for this preparation.
[0265] The same digested DNA was used for the Y chromosome PCR
which used the following primer sequences:
Sry3 (SEQ ID NO: 1)
[0266] ATGGAGGGCCATGTCAAGCGCCCCATGAA
Sry5 (SEQ ID NO: 2)
[0267] TTGCTGGTTTTTGGAGTACAGGTGTGCAGC
[0268] The protocol below was followed for the Y chromosome PCR:
[0269] 2. After lysis, 1:10 dilution, take 1 ul for PCR reaction;
[0270] 3, PCR system:
TABLE-US-00004 [0270] DNA 1 ul Primer Forward concentration 0.1 uM
Primer Reverse concentration 0.1 uM 2x Mongo Mix 10 ul Water 9
ul
[0271] PCR reaction
[0272] Close Lid 105.0.degree. C. Auto Tube Pressure
[0273] Hot Start Automatic 94.0.degree. C. 00:02.00
[0274] Start Cycle JUNCTION PCR 30 times
[0275] Denaturation 94.0.degree. C. 00:00.30
[0276] Annealing 56.0.degree. C. 00:00.30
[0277] Elongation 68.0.degree. C. 00:01.00
[0278] End Cycle `JUNCTION PCR`
[0279] Elongation 68.0.degree. C. 00:10.00
Results Obtained:
[0280] The genotyping indicated the following results
[0281] KX01.1: S3F/S3F
[0282] KX01.2: S3F/+
[0283] KX01.3: S3F/+
[0284] Y Chromosome PCR result:
[0285] All clones resulted in female ES cells.
Example 4
General KO and KI Strategies
[0286] Generating monoclonal antibodies in animal systems is well
documented and it has resulted in the successful development of
numerous therapeutic antibodies. The process leading to the
generation of a high-quality monoclonal antibody against a given
target involves importantly the immunogenicity of the given antigen
or target. For example, a target which is highly conserved between
humans and the animal host, mouse for example, will result in a
poor immune response due to self-tolerance and thus it will be
difficult to generate good antibody leads against the human target
using the conventional approach.
[0287] There are several ways to improve the immune response and
breaking the immune tolerance using adjuvants, various toll-like
receptor agonists, altering the immunisation regime and using
target-specific gene knock-out (KO) mice lines for immunisation.
The latter approach of generating specific knock-out mice is a
convenient approach for overcoming the limitation of immune
tolerance to human targets. Generating knock-out mice however could
be both time consuming and costly. To this end, establishment of a
streamlined methodology for generating specific KO mice is
essential. The methodology described herein for generating specific
KO mice allows exact deletion of the gene of interest and without
leaving behind DNA scar or any exogenous DNA material normally left
behind using traditional gene KO methodologies. The KO methodology
is depicted schematically in FIG. 3.
[0288] Once a therapeutic antibody lead has been generated, it is
important to test it on a relevant preclinical model and often such
a model may not exist. Where therapeutic antibodies have been
raised against human targets and which do not cross-react with the
murine counterpart, incorporating the human target into the murine
system using a knock-in (KI) approach can establish a murine
preclinical model. To supplement the preclinical model further and
depending on the therapeutic target, it could be beneficial to KI
the human target and any additional human interacting partners to
better reflect the natural cellular protein interactions in the
animal model. In the case of a receptor, CD40 for example, its
interacting ligand, CD40L, could also be knocked-in the murine
host. There are several strategies one could take to KI human
targets into a murine model. As described above for generating a KO
mice, the murine target could be initially KO in its entirety
depending on the size of the gene and the human target could be KI
(eg, prior to the excision of the landing pad in the method
described below). An alternative approach would be to humanise by
knocking-in only the relevant human gene segment known to be
involved in antibody binding or carry out an exon-specific
knock-in. Such an approach will maintain the cis-regulatory
elements, endogenous promoter and any signal peptides from the
mouse or other model organism required for cell signalling thus
maintaining the gene expression of the in-coming human gene segment
under the same control as the endogeneous wild-type allele. This in
turn will provide a platform for conducting preclinical studies.
Also, this will be a useful alternative to KO/KI where the target
gene is excessively large and thus where it may be difficult,
time-consuming or costly to carry out a complete gene KO or KI
using gene targeting in ES cells. Furthermore, knocking-in only
part of human genes is less likely to alter gene regulation and
in-turn the gene expression profile in the model organism.
[0289] The methodology described herein is designed to expedite the
process of creating precise gene KI, which is easily amenable to
alteration to suit the skilled person's requirement for KI. For
example the method could be used to KI a single human exon, several
exons or the entire human gene. Exemplary KI methodology is
depicted schematically in FIGS. 4A and 4B.
Example 5
Exemplary KO Method
[0290] FIG. 3 shows a schematic representation of a precise gene
knock-out strategy for use in the present invention. A targeting
vector (eg, a bacterial artificial chromosome) is designed against
a target gene of interest using homology arms flanking the region
destined for deletion. The features included in the targeting
vector include HPRT gene split with loxP site and a mutant loxP
site, lox5171, under the regulation of PGK promoter, which is
flanked by PBase 5' and 3' LTR forming a PiggyBac transposon.
Targeting is achieved by homologous recombination in ES cells
whereby targeted clones are positively selected on hypoxanthine
aminopterin thymidine (HAT) medium. The genomic region within the
homology arm will be knocked-out and replaced by the transposon.
The transposon could then be conveniently removed by transiently
expressing the transposase and negatively selecting for the
excision of the transposon using 6-thioguanine (6TG). This will
leave behind a precise deletion unmarked with any exogenous DNA
material. Note: The lox sites can instead be retained as part of a
"landing pad" for subsequent targeting of a human gene or gene
portion (eg, exon). Thus, the lox sites could be used as a base for
knocking-in gene of interest using recombinase-mediated cassette
exchange (RMCE) and acts as a landing pad for in-coming DNA (shown
further in the following KI example).
Example 6
Exemplary KI Method
[0291] FIGS. 4A-4B show schematic representations of a precise gene
knock-in strategy whereby exons 3-5 of a mouse gene (black boxes)
is replaced with the human equivalent (grey boxes). A PiggyBac
transposon is knocked-in a defined region within the gene of
interest using homologous recombination. Targeted clones are
positively selected on hypoxanthine aminopterin thymidine medium.
Targeting of the transposon will KO the region of the gene that is
required for knocking-in the human equivalent and it acts as a
landing pad for knocking-in any DNA material of interest. The
equivalent human exons 3-5 are knocked-in via the lox sites using
RMCE. This creates two independent functional transposon elements,
each flanked by 5' and 3' PB LTRs, and which are conveniently
excised simultaneously by transiently expressing PBase transposase
in ES cells correctly targeted with the initial landing pad.
Removal of the transposons and thus the generation of a precise
exon-specific gene KI in ES cell clones is negatively selected with
1-(2-deoxy-2-fluoro-D-arabinofuranosyl)-5 iodouracil (FIAU). The
inserted human exon(s) precisely replace the mouse (non-human
vertebrate) sequence and are conveniently placed under endogenous
mouse regulatory control.
[0292] As is known in the art, several non-human vertebrate ES
cells are available for use in these methods, wherein the
engineered (KO and/or KI) ES cell can be implanted into a
blastocyst and transferred to a donor mouse or other appropriate
non-human vertebrate surrogate. Non-human vertebrates bearing the
desired KO/KI are then developed from the implanted blastocyst and
progeny thereof.
[0293] All publications cited herein are hereby incorporated by
reference.
Sequence CWU 1
1
2129DNAArtificial SequenceSry3 1atggagggcc atgtcaagcg ccccatgaa
29230DNAArtificial SequenceSry5 2ttgctggttt ttggagtaca ggtgtgcagc
30
* * * * *
References