Use of a Rock Inhibitor to Sustain Primary Human Keratinocytes in a Proliferative State

Abstract

Disclosed herein is the finding that treatment with a ROCK inhibitor increases proliferation and induces immortalization of primary keratinocytes. Accordingly, provided is a method of immortalizing primary keratinocytes by exposure to a ROCK inhibitor. Also provided are immortalized primary keratinocytes produced by the described method, as well as organotypic tissue equivalents and cell cultures comprising the immortalized primary keratinocytes. Furthermore, ROCK inhibitor-treated cells show a greatly increased ability to support viral DNA replication of both "low risk" and "high risk" HPV genomes, indicating that ROCK inhibitors will be useful for studying the life cycles of a wide range of HPVs.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 61/120,272, filed Dec. 5, 2008, which is herein incorporated by reference in its entirety.

SEQUENCE LISTING SUBMISSION VIA EFS-WEB

[0002] A computer readable text file, entitled "036681-5028-01-SequenceListing.txt" created on or about Feb. 7, 2013 with a file size of about 71 kb contains the sequence listing for this application and is hereby incorporated by reference in its entirety.

FIELD

[0003] This disclosure relates to the use of Rho-associated kinase (ROCK) inhibitors to increase the proliferative capacity and induce immortalization of primary keratinocytes.

BACKGROUND

[0004] Somatic cells have a limited lifespan and gradually slow in growth and stop dividing, a process known as cellular senescence. This process is thought to limit the vulnerability of aging cells to disease. Human keratinocytes are invaluable for the study of skin biology and the pathogenesis of skin-related diseases, but their short lifespan in culture is a limitation.

[0005] The life cycle of human papillomavirus (HPV) is best studied in primary human keratinocytes, the natural host cells of HPV. Papillomaviruses infect the mitotically active cells of the basal layer of the epithelium, but viral progeny are only produced when these infected precursor cells differentiate. Papillomavirus infections are persistent and the viral genome is maintained in the continuously dividing basal cells for long time periods. The HPV genome can be transfected into isolated keratinocytes where it becomes established as an extrachromosomally replicating element. These infected cells can be induced to differentiate and stratify and support the productive cycle of HPVs (Frattini et al., Proc. Natl. Acad. Sci, USA 93:3062-3067, 1996; Meyers et al., Science 257:971-973, 1992).

[0006] A subset of about 15 papillomaviruses from the alpha genera is associated with cancer, primarily of the uterine cervix (Smith et al., Int. J. Cancer 121:621-632, 2007). Almost 100% of cervical carcinomas contain a "high-risk" HPV. These "high-risk" viruses are also associated with a subset of head and neck cancers (Gillison and Shah, Curr. Opin. Oncol. 13:183-188, 2001). These cancer-associated HPVs are also able to immortalize primary human keratinocytes in culture (Hawley-Nelson et al., EMBO J. 8:3905-3910, 1989; Munger et al., J. Virol. 63:4417-4421, 1989). Under the appropriate culture conditions, the viral genome is maintained as an extrachromosomal element and the functions of the viral E6 and E7 oncoproteins provide a selective growth advantage for these cells (Goodwin et al., Proc. Natl. Acad. Sci. USA 97: 10978-10983, 2000). These cells can be further cultured as an organotypic raft where progeny virus can be produced (Frattini et al., Proc. Natl. Acad. Sci, USA 93:3062-3067, 1996).

[0007] Much less is known about the "low-risk" HPVs that are not associated with malignant carcinomas. The genomes of these viruses can be introduced into primary cells, but the E6 and E7 proteins do not provide a growth advantage to the cells which will often senesce before extensive studies can be carried out or before they can be cultured in an organotypic raft. These "low-risk" viruses are, however, the causative agents of a wide range of benign, proliferative lesions that can cause intractable disease. These viruses can be studied in immortalized keratinocyte cell lines, but these lines have been shown to have genetic abnormalities that could interfere with functional analyses of the virus (Lehman et al., Carcinogenesis 14:833-839, 1993). Thus, a need exists to increase the proliferative capacity of human primary keratinocytes and to develop an efficient means to induce immortalization of these cells. Such methods are desirable not only for studies of HPV replication, but for a variety of therapeutic purposes.

SUMMARY

[0008] It is disclosed herein that treatment of primary keratinocytes with a ROCK inhibitor increases proliferation and leads to immortalization of these cells. The immortalized keratinocytes have a normal karyotype, an intact DNA damage response and are able to differentiate into stratified epithelium. In addition, primary keratinocytes treated with a ROCK inhibitor support viral replication of both low-risk and high risk human papillomaviruses (HPVs).

[0009] Thus, provided herein is a method of immortalizing primary keratinocytes by culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes. In some embodiments, the method further includes continuing to culture the immortalized keratinocytes in the absence of the ROCK inhibitor. The immortalized keratinocytes retain the capacity to differentiate when cultured in the absence of the ROCK inhibitor. Isolated immortalized primary keratinocytes produced by the disclosed methods, organotypic tissue equivalents comprising the immortalized primary keratinocytes, and cell cultures comprising the immortalized primary keratinocytes, are also provided herein.

[0010] Also provided herein is a method of increasing proliferation of primary keratinocytes by culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor. In some embodiments, the method comprises culturing the primary keratinocytes in the presence of the ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes.

[0011] Further provided are organotypic tissue equivalents comprised of immortalized primary keratinocytes. The primary keratinocytes are immortalized by culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes. In some embodiments, the immortalized keratinocytes are further cultured in the absence of the ROCK inhibitor, allowing the keratinocytes to differentiate and form the organotypic tissue equivalent.

[0012] Also provided are compositions including an isolated immortalized primary keratinocyte. The primary keratinocyte is immortalized by culturing in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocyte.

[0013] A method of promoting HPV replication in primary keratinocytes is also provided. The method includes infecting the primary keratinocytes with HPV or transfecting the primary keratinocytes with an HPV genome, and culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor.

[0014] Further provided is a method of preparing an organotypic tissue equivalent including obtaining isolated primary keratinocytes, culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow for proliferation of the primary keratinocytes, and continuing to culture the primary keratinocytes in the absence of the ROCK inhibitor, thereby allowing the primary keratinocytes to differentiate and form an organotypic tissue equivalent. A method of treating a wound or skin disease in a subject by treating the subject with an organotypic tissue equivalent prepared according to the disclosed method is also provided.

[0015] Any molecule that inhibits expression or activity of ROCK is contemplated for use with the provided compositions and methods. For example, the ROCK inhibitor can be a small molecule, an antibody, a negative regulator or an antisense compound. In particular examples, the inhibitor is a small molecule ROCK inhibitor, such as Y-27632.

[0016] The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES

[0017] FIG. 1: The kinase activity of ROCK is auto-inhibited by an intramolecular interaction in which the C-terminal PH (Plekstrin homology) domain and the rho binding region of the CC (coiled coil) domain interact with and inhibits the kinase domain. Binding of GTP-bound rho disrupts this interaction and activates the ROCK kinase.

[0018] FIG. 2: A schematic of the chemical structure of Y-27632.

[0019] FIG. 3: Morphology of untreated human foreskin keratinocytes at p13 and Y-27632-treated cells at p81.

[0020] FIG. 4: Growth curves of primary human keratinocytes cultured in the presence or absence of 10 .mu.M Y-27632. After 48 passages, Y-27632 was removed from the culture of treated cells and the resulting growth is indicated.

[0021] FIG. 5: Replication of HPV18 and HPV31 viral genomes in the presence of 10 .mu.m Y-27632 at two days and five days post-transfection.

[0022] FIG. 6: Long-term replication assay of "low-risk" HPV6 and "high-risk" HPV18 in the presence or absence of 10 .mu.M Y-27632. The pass number of the cells post-electroporation at which DNA was isolated is shown along the bottom of the figure and the corresponding number of days at the top of each image.

[0023] FIG. 7: Growth curves of the immortalized CIN1 patient derived cell lines, W12 and CIN612 9E, containing extrachromosomally replicating HPV DNA in the presence or absence of 10 .mu.M Y-27632.

[0024] FIG. 8: Effect of 10 .mu.M Y-27632 treatment on the genome copy number of HPV16 in the CIN1-derived line W12, and of HPV31 in the CIN1-derived line CIN612 9E.

[0025] FIG. 9: Y-27632 stabilizes the growth rate of primary keratinocytes. Shown is the growth rate of human keratinocytes from foreskin (HFK strain c), ectocervix (HCK) and vaginal tissue (HVK) cultured in the presence (solid squares) or absence (open diamonds) of 10 .mu.M Y-27634. The arrows indicate that these cells lines continued to divide indefinitely. Growth rate is measured as population doubling time.

[0026] FIG. 10: Morphology of Y-27632-immortalized cells resembles early pass primary keratinocytes. The left column shows images of human foreskin keratinocytes (HFK), ectocervical keratinocytes (HCK), and vaginal keratinocytes (HVK) at pass P1. The middle column shows keratinocytes near senescence (HFK P15, HCK P9 and HVK P5). The right column shows keratinocytes immortalized by 10 .mu.M Y-27632 (HFK P100, HCK P29 and HVK P26). Scale bar, 10 .mu.m.

[0027] FIG. 11A is a graph showing the relative levels of hTERT mRNA from HFK strain a, cultured in the absence or presence of 10 .mu.M Y-27632, at the pass indicated, as quantitated by real-time PCR. FIG. 11B is a graph showing the relative length of telomeres in HFK strain a cultured in the absence or presence of 10 .mu.M Y-27632, at the pass indicated, as quantitated by real-time PCR.

[0028] FIG. 12A shows an immunoblot analysis of Myc and p16 proteins in cells cultured in HFK strain c, HVK, and HCK cells in the absence or presence of 10 .mu.M Y-27632, collected at the pass indicated. Cells containing oncogenic HPV31 and HPV 18 viruses are included as controls. .alpha.-tubulin is included as a loading control. FIG. 12B is an immunoblot showing that DNA damage was induced by treatment of cells with 0.5 nM actinomycin D. The response was measured by immunoblot analysis of p53 protein levels and its downstream target p21. HFKs grown in the absence of Y-27632 were used at P4, and the Y-27632-treated HFKs were used at P122.

[0029] FIGS. 13A-13D: Keratinocytes are still able to differentiate in organotypic raft culture after long term culture with Y-27632. Shown are H&E stained histological sections of primary keratinocytes grown in the absence of drug at P1 (A) or Y-27632-immortalized cells at P18 (B) in Y-27632, cultured in organotypic raft culture for 17 days, and P1 primary keratinocytes grown in organotypic raft culture for 14 days in raft media without (C) or with 10 .mu.M Y-27632 (D).

[0030] FIG. 14: Treatment with Y-27632 immortalizes primary keratinocytes. Human foreskin keratinocytes (HFK strain a) were cultured in the presence (solid squares) or absence (open diamonds) of 10 .mu.M Y-27632. Cells were passed when confluent and split at a ratio 1:10, with a few exceptions when cells were split 1:20.

[0031] FIG. 15: Telomerase expression in Y-27632-treated cells increases with passage. Relative levels of hTERT mRNA in HFK strain c, HCK and HVK cells cultured in the absence or presence of Y-27632, as quantitated by real-time PCR.

[0032] FIG. 16: Expression level of Myc is upregulated in Y-27632 immortalized cells at a late passage. Shown is an immunoblot analysis of Myc protein in HFK strain a P2 or after 107 passages in 10 .mu.M Y-27632. Cells containing the oncogenic HPV31 are included as a comparison. .alpha.-tubulin is included as a loading control.

SEQUENCE LISTING

[0033] The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:

[0034] SEQ ID NO: 1 is the nucleotide sequence of human ROCK1 (GenBank Accession No. NM.sub.--005406).

[0035] SEQ ID NO: 2 is the amino acid sequence of human ROCK1 (GenBank Accession No. NM.sub.--005406).

[0036] SEQ ID NO: 3 is the nucleotide sequence of human ROCK2 (Genbank Accession No. NM.sub.--004850).

[0037] SEQ ID NO: 4 is the amino acid sequence of human ROCK2 (Genbank Accession No. NM.sub.--004850).

[0038] SEQ ID NOs: 5-8 are the nucleotide sequences of primers used in the telomere length assay.

DETAILED DESCRIPTION

I. Introduction

[0039] It is disclosed herein that inhibition of Rho-associated kinase (ROCK) significantly increases the proliferation of primary keratinocytes and enables these cells to bypass senescence. This disclosure provides the first description of a defined chemical compound that mediates efficient cell immortalization.

[0040] Mammalian cells encode two Rho kinases, ROCK1 and ROCK2. These kinases are activated by binding to an active, GTP-bound Rho GTPase (see FIG. 1). ROCK phosphorylates a number of substrates on serine or threonine residues. These substrates are involved in a wide range of cell behavior. For example, myosin light chain phosphatase, involved in stress fiber formation and contractility; LIM kinase, involved in actin stabilization; NHE1 involved in focal adhesions and actin; and PTEN and Ezrin, involved in apoptosis (Mueller et al., Nat. Rev. Drug Discov. 4:387-398, 2005; Riento et al., Nat. Rev. Mol. Cell Biol. 4:446-456, 2003). ROCK inhibitors such as Y-27632 (see FIG. 2) and fasudil bind to the catalytic site in the kinase domain and displace ATP (Jacobs et al., J. Biol. Chem. 281:260-268, 2006). These inhibitors have been found to have diverse and profound effects on cell behavior and have great therapeutic promise in many areas of disease.

[0041] The results described herein show that primary keratinocytes treated with a ROCK inhibitor have greatly increased proliferation, become immortalized, retain the ability to differentiate, and can very efficiently support HPV DNA replication. As disclosed herein, treatment with a ROCK inhibitor resulted in bypass of senescence and immortalization of different types of keratinocytes from human foreskin, and vaginal and cervical epithelium. Efficient immortalization occurred in the presence of fibroblast feeder cells. As demonstrated herein, keratinocytes immortalized using a ROCK inhibitor are functionally equivalent to normal cells; they have a normal karyotype, an intact DNA damage response and are able to form a stratified epithelium in organotypic culture. The immortalized keratinocytes exhibit upregulated telomerase mRNA levels and have telomeres that are shortened, but remain at a stable length. Myc mRNA levels also are increased in ROCK inhibitor immortalized keratinocytes.

[0042] Thus, these cells are very useful for a variety of therapeutic and research purposes. For example, immortalized keratinocytes are useful for studying the pathogenesis of many different skin-related diseases. Furthermore, since these cells can form organotypic skin equivalents in culture, they can be used as epidermal autographs for wound repair of burns or chronic ulcers. The immortalized keratinocytes disclosed herein are also useful for studying various aspects of the HPV life cycle. They provide the ideal host cell for the long term study of `low-risk` HPVs that are unable to immortalize keratinocytes. Furthermore, inhibition of the ROCK pathway also increases the replication efficiency of `high risk` HPVs, most likely because of the increase in cell proliferation and plating efficiency.

[0043] The greatly extended proliferative capacity of primary human keratinocytes treated with Rho kinase inhibitors is also invaluable for research of many aspects of keratinocyte biology or keratinocyte associated therapeutics.

II. Abbreviations

[0044] EGF Epidermal growth factor

[0045] FBS Fetal bovine serum

[0046] H&E Hematoxylin & Eosin

[0047] HCK Human cervical keratinocytes

[0048] HFK Human foreskin keratinocytes

[0049] HPV Human papilloma virus

[0050] hTERT Human telomerase reverse transcriptase

[0051] HVK Human vaginal keratinocytes

[0052] PCR Polymerase chain reaction

[0053] PH Plekstrin homology

[0054] QRT-PCR Quantitative reverse transcription-PCR

[0055] ROCK Rho-associated kinase

[0056] SDS Sodium dodecyl sulfate

III. Terms and Methods

[0057] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

[0058] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

[0059] Antibody: A protein (or protein complex) that includes one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. As used herein, the term antibody includes intact immunoglobulins as well as a number of well-characterized fragments produced by digestion with various peptidases, or genetically engineered artificial antibodies. Antibodies for use in the methods and compositions of this disclosure can be monoclonal or polyclonal. Merely by way of example, monoclonal antibodies can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495-497, 1975) or derivative methods thereof. Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988).

[0060] Also specifically contemplated are human antibodies (arising from human genes) and humanized antibodies, either of which is suitable for administration to humans without engendering an adverse immune response by the human against the administered immunoglobulin. Humanized forms of antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab).sub.2 or other antigen-binding subsequences of antibodies) that are principally comprised of the sequence of a human immunoglobulin, and contain minimal sequence derived from a non-human immunoglobulin. Humanization can be performed following methods known in the art, such as by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see, for instance, U.S. Pat. No. 5,225,539; Jones et al., Nature 321(6069):522-525, 1986; Riechmann et al., J Mol Biol. 203(3):825-828, 1988; Verhoeyen et al., Science 239(4847):1534-1536, 1988; Riechmann et al., Nature 332(6162):323-327 1988; or Verhoeyen et al., Bioessays 8(2):74-78, 1988). Antibodies specific for IaI are known in the art (see, for example, U.S. Pat. No. 6,660,482; U.S. Patent Application Publication No. 2007/0297982; and Lim et al., J. Infect. Dis. 188:919-926, 2003).

[0061] Antisense compound: Refers to an oligomeric compound that is at least partially complementary to the region of a target nucleic acid molecule to which it hybridizes. As used herein, an antisense compound that is "specific for" a target nucleic acid molecule is one which specifically hybridizes with and modulates expression of the target nucleic acid molecule. As used herein, a "target" nucleic acid is a nucleic acid molecule to which an antisense compound is designed to specifically hybridize and modulate expression. In one embodiment, the target nucleic acid molecule is ROCK1. In another embodiment, the target nucleic acid molecule is ROCK2. Nonlimiting examples of antisense compounds include primers, probes, antisense oligonucleotides, siRNAs, miRNAs, shRNAs and ribozymes. As such, these compounds can be introduced as single-stranded, double-stranded, circular, branched or hairpin compounds and can contain structural elements such as internal or terminal bulges or loops. Double-stranded antisense compounds can be two strands hybridized to form double-stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.

[0062] Antisense oligonucleotide: As used herein, an "antisense oligonucleotide" is a single-stranded antisense compound that is a nucleic acid-based oligomer. An antisense oligonucleotide can include one or more chemical modifications to the sugar, base, and/or internucleoside linkages. Generally, antisense oligonucleotides are "DNA-like" such that when the antisense oligonucleotide hybridizes to a target mRNA, the duplex is recognized by RNase H (an enzyme that recognizes DNA:RNA duplexes), resulting in cleavage of the mRNA.

[0063] Differentiate or differentiation: Refers to the process by which a pluripotent cell becomes distinct in form and function (i.e., develops into a specialized cell, such as a skin cell). For example, an embryonic stem cell can differentiate into an epithelial cell, such as a keratinocyte. Differentiate can also refer to the process a specific cell type undergoes to become more specialized. For example, a keratinocyte can differentiate from a basal keratinocyte to more specialized keratinocytes in a stratified squamous epithelium.

[0064] Effective amount: As used herein, an "effective amount of a ROCK inhibitor" is the amount of inhibitor required to inhibit expression of ROCK or inhibit activity of ROCK. For example, when the ROCK inhibitor is a small molecule, antibody or negative regulator of ROCK, an effective amount is the concentration required to partially or completely eliminate ROCK activity, such as its kinase activity. In some examples, the ROCK inhibitor is Y-27632. In one embodiment, an effective amount of Y-27632 is at least 1 .mu.M. In another embodiment, an effective amount of Y-27632 is at least 5 .mu.M. In another embodiment, an effective amount of Y-27632 is at least 10 .mu.M. In some embodiments, the effective amount of ROCK inhibitor is about 1 to about 100 .mu.M, about 5 to about 25 .mu.M, or about 10 .mu.M. In another example, the ROCK inhibitor is an antisense compound. An effective amount of an antisense compound specific for ROCK is an amount required to inhibit ROCK mRNA level by at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50%. An effective amount of a ROCK inhibitor can also refer to the amount required to achieve a particular effect, such as immortalization of a primary keratinocyte.

[0065] Epithelial cells: Cells that line the exterior of a organism (e.g., skin, cornea), body lumens (e.g., gastrointestinal tract, urinary tract, reproductive tract, lungs) and mucous membranes (e.g., oesophagus, mouth and rectum). Epithelial cells also make up exocrine and endocrine glands.

[0066] Expand: A process by which the number or amount of cells in a cell culture is increased due to cell division. Similarly, the terms "expansion" or "expanded" refers to this process. The terms "proliferate," "proliferation," "proliferated" or "outgrowth" may be used interchangeably with the words "expand," "expansion," or "expanded."

[0067] Expose: To bring into contact with. As used herein, exposing cells to an inhibitor generally refers to culturing or incubating the cells in the presence of the inhibitor.

[0068] Feeder cells: Cells that are used in culture with other types of cells to assist in their growth. Feeder cells are growth arrested (such as by irradiation), but viable and form a substratum on which other cells can growth. Feeder cell layers provide an intact and functional extracellular matrix and typically secrete factors into the medium, such as matrix-associated factors and cytokines, which can assist in the growth of other cells. In some embodiments, feeder cells are fibroblast cells, such as a fibroblast cell line. In particular examples, the feeder cells are irradiated 3T3 J2 cells. In other examples, the feeder cells are murine embryonic fibroblasts.

[0069] Fibroblast: A type of cell that synthesizes the extracellular matrix and collagen, the structural framework (stroma) for animal tissues, and plays a critical role in wound healing. Fibroblasts are the most common cells of connective tissue in animals.

[0070] Human papillomavirus (HPV): A type of virus that infects the skin and mucous membranes of humans. HPVs are phylogenetically categorized into five genera: alpha, beta, gamma, mu and nu. Approximately 130 HPV types have been identified, some of which have been shown to cause warts (verrucae) or cancer (such as cervical cancer). Papillomaviruses are DNA viruses with a non-enveloped viron having icosahedral symmetry. The double-stranded, circular HPV DNA genome contains one coding region for late genes, one coding region for early genes, and a non-coding upstream regulatory region with binding sites for the various transcription factors controlling expression of early and late genes. Two separate open reading frames in the late gene coding region encode viral capsid proteins L1 and L2. Capsid protein L1 is the major capsid protein that is highly conserved among different HPV types. Eight open reading frames in the early gene coding region encode eight viral early proteins, designated E1, E2, E3, E4, E5, E6, E7, and E8. Early proteins E6 and E7 are oncoproteins critical for host cell immortalization and transformation, as well as for long term viral replication and survival.

[0071] "High-risk" HPV includes HPV types that are associated with malignant cancers, such as cervical carcinoma and head and neck cancers. High-risk HPVs are capable of immortalizing primary keratinocytes in culture. Examples of high-risk HPVs include, but are not limited to, HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and 68.

[0072] "Low-risk" HPV includes HPV types that are not associated with malignant cancers, but are known to cause a wide range of benign, hyperproliferative conditions such as genital warts, cutaneous warts and respiratory papillomatosis. The E6 and E7 proteins of low-risk HPVs are not capable (in the absence of other factors) of immortalizing primary cells in culture. Examples of low-risk HPVs include, but are not limited to, HPV types 1, 2, 3, 4, 6, 7, 11, 42, 43, 44 and 55.

[0073] Immortalized cell: A cell that has bypassed senescence and is capable of continuous growth in culture.

[0074] Inhibitor of ROCK: As used herein, a ROCK inhibitor is a protein, nucleic acid, small molecule, antibody or other agent that prevents expression of ROCK or down-regulates ROCK activity, such as its kinase activity. Examples of ROCK inhibitors are disclosed herein. ROCK inhibitors include, but are not limited to, small molecules, antibodies, antisense compounds and negative regulators of ROCK. ROCK inhibitors include inhibitors of ROCK-1, ROCK-2 or both. In some examples, the ROCK inhibitor is Y-27632.

[0075] Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein or cell) has been substantially separated or purified away from other biological components in the cell or tissue from which the component naturally occurs. As used herein, an "isolated" cell is a cell that has been substantially separated from the tissue from which it is derived.

[0076] Keratinocyte: A cell found in the epidermis that produces keratin. Keratinocytes make up about 90% of epidermal cells. Keratinocytes are produced by keratinocyte stem cells in the basal layer of the epidermis. As used herein, "primary keratinocytes" are keratinocytes isolated from tissue and grown in culture, but are not immortalized. In the context of the present disclosure, an "immortalized primary keratinocyte" is a primary keratinocyte that has become immortalized, such as by culturing the cell in the presence of a ROCK inhibitor. In some embodiments, the primary keratinocyte is a foreskin keratinocyte, a vaginal keratinocyte, a cervical keratinocyte, an oral keratinocyte or a cutaneous keratinocyte.

[0077] MicroRNA (miRNA): Single-stranded RNA molecules that regulate gene expression. miRNAs are generally 21-23 nucleotides in length. miRNAs are processed from primary transcripts known as pri-miRNA to short stem-loop structures called pre-miRNA and finally to functional miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA molecules, and their primary function is to down-regulate gene expression. MicroRNAs regulate gene expression through the RNAi pathway.

[0078] Organotypic tissue equivalent: A cell culture characterized by the organized growth of the cells in a form resembling a tissue (also referred to herein as an "organotypic cell culture"). In some embodiments, the organotypic tissue equivalent is an organotypic skin equivalent.

[0079] Percent identity: The similarity between amino acid or nucleic acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids Res. 16:10881-10890, 1988; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; and Altschul et al., Nature Genet. 6:119-129, 1994. The NCBI Basic Local Alignment Search Tool (BLAST.TM.) (Altschul et al., J. Mol. Biol. 215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, Md.) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx.

[0080] Pharmaceutically acceptable carrier: The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds or molecules, such as one or more nucleic acid molecules, proteins, antibodies, cells or small molecules, and additional pharmaceutical agents.

[0081] In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

[0082] Preventing, treating or ameliorating a disease: "Preventing" a disease refers to inhibiting the full development of a disease. "Treating" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. "Ameliorating" refers to the reduction in the number or severity of signs or symptoms of a disease.

[0083] Primary cell: A non-immortalized cell taken from a living organism or tissue source.

[0084] Prolonging viability: As used herein, "prolonging viability" of a cell, such as a primary cell, refers to extending the duration of time the cell is capable of normal growth and/or survival.

[0085] Rho-associated kinase (ROCK): Also known as Rho-associated coiled-coil kinase and Rho kinase. The ROCK family includes ROCK1 (also called ROK.beta. or p160ROCK) and ROCK2 (also called ROK.alpha.). ROCK proteins are serine-threonine kinases that interact with Rho GTPases. Nucleotide and amino acid sequence of exemplary human ROCK1 and ROCK2 are set forth herein as SEQ ID NOs: 1-4.

[0086] Ribozyme: A catalytic RNA molecule. In some cases, ribozymes can bind to specific sites on other RNA molecules and catalyze the hydrolysis of phosphodiester bonds in the RNA molecules.

[0087] Senescence: Refers to the point at which a cell is no longer capable of undergoing mitosis (cell division).

[0088] Short hairpin RNA (shRNA): A sequence of RNA that makes a tight hairpin turn and can be used to silence gene expression via the RNAi pathway. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA.

[0089] Small interfering RNA (siRNA): A double-stranded nucleic acid molecule that modulates gene expression through the RNAi pathway. siRNA molecules are generally 20-25 nucleotides in length with 2-nucleotide overhangs on each 3' end. However, siRNAs can also be blunt ended. Generally, one strand of a siRNA molecule is at least partially complementary to a target nucleic acid, such as a target mRNA. siRNAs are also referred to as "small inhibitory RNAs."

[0090] Small molecule inhibitor: A molecule, typically with a molecular weight less than about 1000 Daltons, or in some embodiments, less than about 500 Daltons, wherein the molecule is capable of modulating, to some measurable extent, an activity of a target molecule.

[0091] Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.

[0092] Therapeutically effective amount: A quantity of a specified agent sufficient to achieve a desired effect in a subject, cell or culture being treated with that agent.

[0093] Y-27632: A small molecule inhibitor that selectively inhibits activity of Rho-associated kinase. Also known as (+)-trans-N-(4-Pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide. Y-27632 is disclosed in U.S. Pat. No. 4,997,834 and PCT Publication No. WO 98/06433.

[0094] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Hence "comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, GenBank accession numbers and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

IV. Overview of Several Embodiments

[0095] Described herein is the finding that treatment of primary keratinocytes with a ROCK inhibitor increases their proliferative capacity and induces immortalization of these cells. The immortalized keratinocytes exhibit characteristics typical of normal primary keratinocytes, including having a normal karyotype and an intact DNA damage response. In addition, primary keratinocytes immortalized by exposure to a ROCK inhibitor retain the capacity to differentiate into stratified epithelium upon removal of the ROCK inhibitor. Further disclosed herein is the finding that primary keratinocytes treated with a ROCK inhibitor support viral replication of both low-risk and high-risk human papillomaviruses.

[0096] Thus, disclosed herein is a method of immortalizing primary keratinocytes, comprising culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes. In some embodiments, the method further comprises continuing to culture the immortalized keratinocytes in the absence of the ROCK inhibitor. As disclosed herein, the immortalized keratinocytes retain the capacity to differentiate when cultured in the absence of the ROCK inhibitor.

[0097] As used herein, culturing in the absence of a ROCK inhibitor does not require the complete absence of a ROCK inhibitor. For example, low or trace levels of a ROCK inhibitor may be present in the culture medium such that the level is below the threshold required to enhance proliferation, induce differentiation and/or inhibit differentiation of a primary keratinocyte. In some embodiments, culturing primary keratinocytes in the absence of a ROCK inhibitor comprises culturing the primary keratinocytes in the presence of less than about 1 .mu.M, less than about 0.1 .mu.M, less than about 0.01 .mu.M, or less than about 0.001 .mu.M ROCK inhibitor. In some embodiments, the primary keratinocytes are cultured in the complete absence of a ROCK inhibitor. Culturing in the absence of a ROCK inhibitor refers both to the original ROCK inhibitor present in the culture, as well as other types of ROCK inhibitor.

[0098] Culturing primary keratinocytes in the absence of ROCK inhibitor can be achieved by any one of a number of suitable means, such as by replacing ROCK inhibitor-containing media with fresh media lacking ROCK inhibitor. Alternatively, ROCK inhibitor can be removed from the existing media, such as by dialyzing the media.

[0099] In some embodiments of the method, continuing to culture the immortalized keratinocytes comprises culturing the immortalized keratinocytes until they form an organotypic tissue equivalent. In some embodiments, culturing the primary keratinocytes comprises culturing the primary keratinocytes in the presence of fibroblast feeder cells.

[0100] Also provided herein is a method of increasing proliferation of primary keratinocytes by culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor. In some embodiments, the method comprises culturing the primary keratinocytes in the presence of the ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes.

[0101] The primary keratinocytes can be any type of primary keratinocyte. In some examples, the primary keratinocyte is a foreskin keratinocyte, vaginal keratinocyte or cervical keratinocyte.

[0102] The ROCK inhibitor can be any type of molecule that inhibits expression or activity of ROCK, such as a small molecule inhibitor, antibody, antisense compound or negative regulator. Suitable ROCK inhibitors are discussed in greater detail below. In some embodiments, the ROCK inhibitor is a small molecule inhibitor. In particular examples, the ROCK inhibitor is Y-27632.

[0103] In some embodiments, when the ROCK inhibitor is Y-27632, the effective amount of the ROCK inhibitor is about 1 to about 100 .mu.M, or about 5 to about 25 .mu.M, or about 10 .mu.M.

[0104] The ROCK inhibitor can also be a negative regulator of ROCK, such as, but not limited to small GTP-binding proteins such as Gem, RhoE and Rad. In other examples, the ROCK inhibitor is an antibody that specifically binds ROCK1 or ROCK2 or both isoforms. In one example, the antibody specifically binds ROCK1 (SEQ ID NO: 2). In another example, the antibody specifically binds ROCK2 (SEQ ID NO: 4).

[0105] In other examples, the ROCK inhibitor is an antisense compound. Antisense compounds include, but are not limited to, antisense oligonucleotides, siRNA, miRNA, shRNA and ribozymes. Antisense compounds specifically target ROCK nucleic acids. In one example, a ROCK antisense compound specifically hybridizes with ROCK1 (SEQ ID NO: 1). In another example, a ROCK antisense compound specifically hybridizes with ROCK2 (SEQ ID NO: 3).

[0106] As described herein, the primary keratinocytes are cultured in the presence of the ROCK inhibitor for a period of time sufficient to allow immortalization. In some embodiments, the primary keratinocytes are cultured in the presence of the ROCK inhibitor for at least 15 days, at least 20 days, at least 40 days, at least 60 days, at least 100 days, at least 150 days, at least 200 days, at least 250 days, at least 300 days, at least 350 days, at least 400 days, at least 450 days, or at least 500 days.

[0107] Also provided herein are isolated immortalized primary keratinocytes produced by the disclosed method.

[0108] Further provided are cell cultures comprising isolated immortalized primary keratinocytes produced by the disclosed method.

[0109] Organotypic tissue equivalents comprising immortalized primary keratinocytes produced by the disclosed method are also provided.

[0110] Further provided are organotypic tissue equivalents comprising immortalized primary keratinocytes. The primary keratinocytes are immortalized by culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes and are further cultured in the absence of the ROCK inhibitor. When cultured in the absence of the ROCK inhibitor, the immortalized keratinocytes differentiate to form the organotypic tissue equivalent.

[0111] In some examples, the organotypic tissue equivalents described herein comprise primary keratinocytes that have been cultured in the presence of a ROCK inhibitor to increase proliferation of these cells, but the cells are not yet immortalized. Thus, also provided are organotypic tissue equivalents comprising primary keratinocytes that have been cultured in the presence of a ROCK inhibitor for a period of time sufficient to increase proliferation of the primary keratinocytes.

[0112] In some embodiments, culturing the primary keratinocytes comprises culturing the primary keratinocytes in the presence of fibroblast feeder cells.

[0113] The organotypic tissue equivalent can be comprised of any type of primary keratinocyte. In some embodiments, the primary keratinocytes are foreskin keratinocytes, vaginal keratinocytes, cervical keratinocytes, oral keratinocytes or cutaneous keratinocytes.

[0114] Also provided are compositions comprising an isolated immortalized primary keratinocyte. The compositions include a primary keratinocyte immortalized by culturing the primary keratinocyte in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocyte. In some embodiments, the immortalized keratinocyte is further cultured in the absence of the ROCK inhibitor. The immortalized keratinocyte retains the capacity to differentiate when cultured in the absence of the ROCK inhibitor. In some embodiments, culturing the primary keratinocytes comprises culturing the primary keratinocytes in the presence of fibroblast feeder cells.

[0115] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the immortalized primary keratinocyte is part of an organotypic tissue equivalent. In some embodiments, the composition is suitable for application to human skin. For example, the composition can include an ointment or viscous material suitable for application to and retention on the skin. Such pharmaceutically acceptable carriers are known in the art.

[0116] Further provided is a method of promoting human papilloma virus (HPV) replication in primary keratinocytes. In some embodiments, the method comprises infecting the primary keratinocytes with HPV or transfecting the primary keratinocytes with an HPV genome, and culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor, thereby promoting HPV replication in primary keratinocytes.

[0117] In some embodiments, the method further comprises culturing the primary keratinocytes in the presence of the ROCK inhibitor prior to infection with HPV or transfection with the HPV genome. In some embodiments, the primary keratinocytes are cultured in the presence of fibroblast feeder cells.

[0118] The primary keratinocytes can be any type of keratinocyte suitable for propagation of HPV. In particular examples, the primary keratinocytes are foreskin keratinocytes, vaginal keratinocytes or cervical keratinocytes.

[0119] The ROCK inhibitor can be any type of ROCK inhibitor (discussed in greater detail below). In some embodiments, the ROCK inhibitor is a small molecule inhibitor. In particular examples, the ROCK inhibitor is Y-27632.

[0120] In some embodiments, when the ROCK inhibitor is Y-27632, the effective amount of the ROCK inhibitor is about 1 to about 100 .mu.M, about 5 to about 25 .mu.M, or about 10 .mu.M. The primary keratinocytes are cultured in the presence of the ROCK inhibitor for any suitable period of time to allow for an enhancement in HPV replication. In some embodiments, the primary keratinocytes are cultured in the presence of the ROCK inhibitor for at least 15 days, at least 20 days, at least 40 days, at least 60 days, or at least 100 days. The primary keratinocytes can be cultured in the presence of the ROCK inhibitor before or during, or both before and during infection with HPV.

[0121] The HPV can be from any genus (alpha, beta, gamma, mu or nu). In some embodiments, the HPV is an alpha, beta or gamma HPV. The HPV can be a low-risk HPV or a high-risk HPV. In some embodiments, the HPV is a low-risk HPV, such as HPV type 1, 2, 3, 4, 6, 7, 11, 42, 43, 44 and 55. In particular examples, the low-risk HPV is HPV6. In some embodiments, the HPV is high-risk, such as HPV type 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 or 68. In particular examples, the high-risk HPV is HPV18.

[0122] Also provided is a method of preparing an organotypic tissue equivalent. The method includes obtaining isolated primary keratinocytes; culturing the primary keratinocytes in the presence of an effective amount of a ROCK inhibitor for a period of time sufficient to allow for proliferation of the primary keratinocytes; and continuing to culture the primary keratinocytes in the absence of the ROCK inhibitor, thereby allowing the primary keratinocytes to differentiate and form an organotypic tissue equivalent.

[0123] In some embodiments, the primary keratinocytes are obtained by a tissue biopsy. In some examples, the tissue biopsy is taken from the skin (e.g., the cutaneous and/or mucosal squamous epithelium).

[0124] Further provided is a method of treating a wound or skin disease in a subject, comprising treating the subject with an organotypic tissue equivalent prepared according to the method disclosed herein. In some embodiments, the wound is a burn or ulcer. In some embodiments, the primary keratinocytes are obtained by a tissue biopsy of the subject to be treated with the organotypic tissue equivalent (thus, the organotypic tissue equivalent is an autograft). In particular examples, the tissue is skin.

V. Keratinocyte Proliferation, Immortalization and Differentiation

[0125] Somatic cells have a limited lifespan and gradually slow in growth and stop dividing, a process known as cellular senescence. This process is thought to limit the vulnerability of aging cells to disease. Human keratinocytes are invaluable for the study of skin biology and the pathogenesis of skin-related diseases, but their short lifespan in culture is a limitation. Different conditions have been developed to optimize the culture of keratinocytes; the presence of fibroblast feeder cells increases the proliferative capacity of primary keratinocytes from approximately 20 to 40-60 population doublings (Ramirez et al. Genes Dev. 15: 398-403, 2001).

[0126] Spontaneous immortalization of human cells is rare. Primary keratinocytes can only proliferate for a limited number of cell divisions before they undergo replicative senescence (Ben-Porath and Weinberg, Cell Biol. 37:961-976, 2005; Liu et al., J. Virol. 82: 11568-11576, 2008). Several viral oncogenes can efficiently immortalize cells in culture, such as the E6 and E7 proteins from oncogenic types of HPV, T-antigen from SV40, and E1A and E1B from adenovirus. Retinal pigment epithelial cells and foreskin fibroblasts can be efficiently immortalized by exogenous expression of the catalytic subunit of human telomerase (Bodnar et al., Science 279: 349-352, 1998). However, most studies find that expression of hTERT is not sufficient for keratinocyte immortalization and additional changes, such as disruption of p16.sup.INK4a function, are also required (Kiyono et al., Nature 396: 84-88, 1998; Dickson et al., Mol. Cell Biol. 20: 1436-1447, 2000) Immortalization of human keratinocytes is very rare and only a few immortalized cell lines exist. These cell lines have genetic abnormalities such as p53 mutations in HaCaT cells (Lehman et al., Carcinogenesis 14:833-839, 1993) or an extra isochromosome of the long arm of chromosome 8 in the NIKs cell line (Allen-Hoffmann et al., J. Invest Dermatol. 114:444-455, 2000).

[0127] The events leading to senescence of human keratinocytes are well known. Cells in culture demonstrate increasing levels of the p16.sup.ink4 cyclin dependent kinase inhibitor until the cells reach senescence and cease to proliferate. This is concomitant with a gradual erosion of telomeres which also results in a growth crisis. The high risk HPVs are able to abrogate this process. The E7 protein inactivates and degrades the pRb retinoblastoma protein and induces G1/S phase progression of the cell cycle (Wise-Draper and Wells, Front Biosci. 13:1003-1017, 2008). This process increases the levels of p16.sup.ink4 but the inactivation of the pRb pathway renders it functionless (Kiyono et al., Nature 396:84-88, 1998). The E6 protein inactivates the p53 protein that is induced in response to the usurpation of the pRb pathway and activates telomerase which abrogates the erosion of the telomeres and allows the cells to proliferate beyond senescence.

[0128] This disclosure describes the effect of a ROCK inhibitor, Y-27632, on keratinocyte proliferation and immortalization and subsequent effects on HPV DNA replication. These observations could have far-reaching implications for the study and treatment of HPV disease. The greatly improved culture and extended lifespan of keratinocytes is also invaluable for both research and therapeutic purposes.

[0129] It is also important to determine whether ROCK inhibition changes the ability of the keratinocytes to differentiate. Studies of the complete viral life cycle require that cells containing the replicating viral genome can differentiate to switch the life cycle into the late stage necessary for the production of progeny virions. Studies on the effect of Y-27632 on keratinocyte differentiation have been controversial. Y-27632 enhances the survival rate of human embryonic stem cells following cryopreservation and the resulting treated cells are able to fully differentiate into all three germ layers after long term culture (Li et al., Stem Cells Dev 6:1079-1085, 2008). However, ROCK inhibition has also been reported to abrogate suspension-induced differentiation in keratinocytes (McMullan et al., Current Biology 13:2185-21 89, 2003), but another study showed that differentiation is negatively regulated by Rho signaling (Grossi et al., Proc. Natl. Acad. Sci. USA 102:11313-11318, 2005). It is disclosed herein that ROCK inhibitor immortalized keratinocytes retain the ability to differentiate and express appropriate differentiation markers.

VI. Use of ROCK Inhibitor Immortalized Keratinocytes

[0130] A. HPV-Related Studies

[0131] ROCK-inhibited keratinocytes are useful for studying all modes of HPV replication. It is shown herein that the efficiency of initial replication and maintenance replication is greatly increased in the presence of a ROCK inhibitor. An increase in virion production will be of great research benefit and can provide useful reagents for serological studies, for testing vaccines and for identifying receptors using authentic viral particles.

[0132] Efficient replication of "low-risk" HPV genomes will allow a much greater understanding of the life cycle of these less well understood viruses. Although not associated with cancer, these viruses are responsible for a great burden of recalcitrant disease such as genital warts, respiratory papillomatosis and cutaneous warts. These lesions can be especially problematic in individuals who are immunocompromised by HIV infection or organ transplant. Efficient means of studying the viral life cycle will allow testing of anti-viral therapies in a system that closely reflects the in vivo situation.

[0133] Most HPV studies use keratinocytes derived from neonatal foreskins because of the availability of this tissue from routine circumcision. However, these keratinocytes might not be the best host for papillomavirus studies as HPV infection of the foreskin is mostly clinically unapparent. A more appropriate cell type for the study of the cancer associated HPVs is that of the uterine cervix and in particular cells from the transformation zone between the ectocervix and the endocervix. Because of the difficulties in obtaining such tissue, only a few HPV studies have used cervical tissue. Different HPVs have a very specific tropism for different regions of epithelia. ROCK inhibitor treatment and expansion of small numbers of keratinocytes derived from different types of epithelia could greatly increase the understanding of HPV biology.

[0134] Remarkably, cervical carcinoma cell lines that have been in culture for decades still rely on the function of the E6 and E7 oncoproteins for continued proliferation and survival. Down-regulation of E6 and E7 expression results in immediate senescence of these cell lines (Goodwin et al., Proc. Natl. Acad. Sci. USA 97: 10978-10983, 2000). Disclosed herein is the finding that treatment of cells with Y-27632 removes the growth advantage conferred by the E6 and E7 oncoproteins (FIG. 6). In the absence of this selection, there is no need to maintain the viral genomes and they are gradually lost. This observation could be the basis of a therapy for persistent HPV infections. A combination of ROCK inhibitor treatment and a therapy to interfere with extrachromosomal viral DNA replication could clear infection from persistently infected cells.

[0135] The studies described herein have focused on replication of papillomaviruses in ROCK inhibitor-treated keratinocytes but the same approach can be used for other epitheliotropic viruses. For example, a range of herpesviruses and poxviruses have been shown to infect and replicate in keratinocyte organotypic raft cultures and these are used to test anti-viral therapies in a system that closely resembles natural infection (Jeon et al., J. Virol. 69:2989-2997, 1995).

[0136] B. Therapeutic Uses

[0137] The Rho/ROCK pathway has been shown to function in the cardiovascular system, central nervous system, cancers, and embryonic development (Shi et al., Arch. Immunol. Ther. Exp. (Warsz.) 55:61-75, 2007). This pathway is an important therapeutic target and one ROCK inhibitor (fasudil) is already marketed for cerebral vasospasm after surgery (Shihuya et al., Acta Neurochir. Suppl 77:201-204, 2001) and is currently being tested for the treatment of angina pectoris, acute cerebral thrombosis and other vascular diseases. Studies in animal models suggest widespread therapeutic benefits in the treatment of inflammation, fibrosis and neurological disorders (Kubo et al., Ther. Clin. Risk Manag. 4:605-615, 2008; Olson, Curr. Opin, Cell Biol. 20:242-248, 2008).

[0138] Large scale production of keratinocytes from a small number of cells, especially from individual hosts, is very valuable therapeutically. A small number of keratinocytes from a biopsy can be isolated, expanded in monolayer culture and developed into organotypic skin equivalents (Phillips, Arch. Dermatol. 135:977-978, 1999). These tissue sheets are very useful for epidermal replacement of regions of ulcers and burns.

[0139] Increased cell proliferation due to ROCK inhibition would greatly increase the amount of tissue generated and decrease the time required. It could also allow the use of donor graft tissue from more appropriate regions of the epithelium to be expanded.

[0140] Keratinocyte-mediated gene therapy is an intensively studied topic of research (Therrien et al., Toxicol. Pathol. 36:104-111, 2008). Autologous keratinocytes can be isolated and transfected or transduced with a vehicle expressing a therapeutic gene. Increased cellular proliferation and immortalization due to ROCK inhibition could greatly enhance the efficiency of this process. Notably, it has already been observed that Y-27632 can greatly increase the survival of embryonic stem cells (Watanabe et al., Nature Biotechnology 25:681-686, 2007).

[0141] In the dawn of the era of personalized medicine, it is becoming more and more important to test therapies directly on cells derived from the patient for which the therapy is eventually intended. Isolation of host keratinocytes and expansion in culture under conditions of ROCK inhibition could greatly increase the efficiency and time frame of this process. Patient-derived keratinocytes or tissue engineered skin equivalents could be used to test specific therapies to determine the outcome on the host. Large quantities of keratinocytes could be expanded from a small tissue biopsy of patients with specific diseases for research purposes. The ability to greatly expand these keratinocytes and derive tissue engineered skin from them will be of great research and therapeutic benefit.

[0142] Transplantation of apparently immortalized human keratinocytes onto human hosts raises concerns of uncontrolled growth and tumorogenicity. However, the experiment shown in FIG. 4 demonstrated that keratinocyte growth rate slows after withdrawal of Y-27632. In addition, it is also disclosed herein that ROCK inhibited keratinocytes have a normal karyotype and a normal DNA damage response. Thus, primary keratinocytes immortalized by exposure to a ROCK inhibitor would not be tumorigenic.

[0143] C. Organotypic Cultures and Tissue Equivalents

[0144] Preparation and use of organotypic cell cultures and tissue equivalents, including organotypic skin equivalents, have been described (see, for example, U.S. Patent Application Publication Nos. 2009/0280095, 2009/04228, 2006/0292126 and 2005/0079578; Stark et al., Biological Procedures Online 6: 55-60, 2004). An "organotypic culture" refers to a culture of cells that associate in a way that as closely as possible replicates the biochemical and physiological properties of the organ from which the cells are derived.

[0145] An organotypic cell culture is a cell culture characterized by the organized growth of the cells in a form resembling a tissue (also referred to herein as an "organotypic tissue equivalent"). As an example of an organotypic tissue equivalent, human primary keratinocytes are seeded onto a fibroblast-embedded (murine or human fibroblasts) collagen matrix and grown exposed to air. Within about 10 days keratinocytes resemble a stratified epithelia with the characteristic epidermal structure of human skin. These skin-equivalents have already been evaluated in clinical trials (Bell et al., Science 211:1052-1054, 1981; Greenberg et al., Methods Mol. Biol. 289:425-430, 2005).

[0146] Example 2 below describes a method for generating stratified epithelium using primary keratinocytes immortalized by exposure to a ROCK inhibitor. Similar methods can be employed to prepare an organotypic tissue equivalent for therapeutic purposes. As described herein, organotypic tissue equivalents are useful for the treatment of a variety or skin diseases or wounds.

[0147] Chronic wounds disrupt the integrity of the skin by tearing, cutting, piercing or breaking the tissue. The causes may be structural, such as injury, or physiological, such as an underlying disease. The most frequently occurring skin wounds are venous ulcers, pressure ulcers and diabetic foot ulcers.

[0148] Chronic wounds occur in individuals with underlying diseases of various types whose medical conditions compromise the body's ability to repair injured tissue on its own. Despite the use of a variety of medical and surgical treatments, chronic wounds can take months or even years to heal and frequently recur. These wounds are often large and unsightly and may be painful in some patients.

[0149] Chronic wounds are of three major types: venous stasis ulcers, diabetic ulcers and pressure ulcers. A venous ulcer is an ulceration that develops on the ankle or lower leg in patients with chronic vascular disease. In these patients, blood flow in the lower extremities is impaired, leading to edema (swelling) and mild redness and scaling of the skin that gradually progress to ulceration. Venous ulcers are a condition affecting 500,000-700,000 patients in the U.S. and 1.3 million people in the industrialized world.

[0150] A diabetic ulcer is a chronic wound that occurs in patients with diabetes. While the actual cause of the ulcer in these patients is an injury such as a callus, blister or foreign body such as a pebble or splinter, it is the patient's underlying disease that places him or her at high risk for developing an ulcer. Important risk factors include: inadequate local blood supply, which impairs their ability to repair injured tissue and ward off infection, and reduced sensation in the extremities, which causes the initial injury to go unrecognized until it becomes a serious, chronic wound. Diabetic ulcers are a condition affecting just under 500,000 patients in the US and 1.2 million people in the industrialized world.

[0151] A pressure ulcer is defined as any lesion caused by unrelieved pressure on tissues that are located over a bony prominence on the body. Pressure ulcers were formerly referred to as bedsores or decubitus ulcers. Pressure ulcers develop in immobile patients whose tissues are subjected to continuous pressure from bones on the interior and hard surfaces such as beds or chairs on the exterior. In addition to their immobility, patients at risk for the development of pressure ulcers typically have poor nutritional status, inadequate hydration, and other underlying medical conditions that compromise their ability to heal injuries. Pressure ulcers affect over 1.6 million people in the US and 4.1 million people in the industrialized world.

[0152] Organotypic tissue equivalents comprising primary keratinocytes immortalized by exposure to a ROCK inhibitor can be prepared using any technique known in the art. An exemplary procedure is described below (see U.S. Patent Application Publication No. 2006/0292126).

[0153] Organotypic tissue cultivation is generally performed in inserts with microporous membranes, which contain homologous or autologous human dermal fibroblasts (HDF), especially postmitotic HDF at their undersurface. HDF secrete factors that condition the medium in order to get a better growth of the epidermal equivalents. The HDF layer can be formed from between about 5.times.10.sup.3 to 1.times.10.sup.5 cells/cm.sup.2, and in some cases approximately 1.times.10.sup.4 to 5.times.10.sup.4 cells/cm.sup.2. The HDF are preferably postmitotic, but earlier passage cells can be used if they are irradiated, treated with mitomycin-C, or otherwise treated to inhibit their proliferation but maintain their metabolism (for example, by reduction of serum concentration).

[0154] Microporous membranes are suitable as a culture substrate because they allow substances to diffuse from one side to the other, but work as a barrier for cells. The pore size of the membrane should be adequate so as to allow diffusion of proteins of up to 100,000 Daltons molecular weight, and preferably of up to 70,000 Daltons molecular weight. The membrane should at least allow diffusion of small hormones such as insulin, and allow passage of proteins of up to 15,000 Daltons molecular weight. Other means than a microporous membrane for performing the function of allowing diffusion of soluble factors to the primary keratinocytes, while preventing mixing of the keratinocytes with the HDF can also be used.

[0155] Microporous membranes typical in the art can be used. However, membranes fabricated from a biodegradable material (e.g., polyhyaluronic acid or polylactic acid) can also be used. When a biodegradable microporous membrane is employed, the entire culture, including the differentiated keratinocytes, the microporous membrane and the HDF, can be transplanted into the skin defect. Thus, in this alternative embodiment, the HDF grown on the underside of the membrane need not be post-mitotic or treated to preclude proliferation. While HDF tend to be less immunogenic than keratinocytes, it is preferable that when this embodiment is employed, the HDF be allogeneic cells, preferably autologous cells.

[0156] In some cases, the thickness of mesh graft can range from 30-300 microns. In some examples, the mesh graft thickness ranges from 0.5-0.75 mm. A graft of tissue (for example, dermal collagen plus fibroblasts overlaid with keratinocytes tissue) that is too thick can result in a too rapid ischemic cell death, especially for the keratinocyte layer residing above the dermal fibroblast collagen layer. By contrast, this mesh graft tissue can take in wound sites.

[0157] To improve the stability of the organotypic tissue equivalents, a carrier membrane can be placed on top. As an adhesive, fibrin glue is can be used, or alternatives include extracellular matrix components such as collagen, fibronectin, proteoglycans (e.g., hyaluronic acid, chondroitin sulfate, and the like), or basement membrane zone components (e.g., laminin, Matrigel.TM., or L-polylysine), or similar tissue glues, may also be utilized.

[0158] The carriers used with the organotypic tissue equivalents can consist of a synthetic membrane, made from one or more of polyester, PTFE or polyurethane; from one or more biodegradable polymers (e.g., hyaluronic acid, polylactic acid or collagen); or a silicone or vaseline gauze dressing, or any other material suitable for wound dressing. These materials that are suitable for wound dressing allow the carrier to remain in place to immobilize the implanted tissue equivalents for several days, rather than requiring the carrier to be removed immediately after the tissue equivalents are transplanted. Thus, the carrier not only enhances stability and improves handling, but it also serves as a protective coat against physical damage as well as the proteolytic milieu and bacteria in the wound. Moreover, it serves for orientation of the graft.

[0159] The organotypic tissue equivalents can transplanted by simply placing them in the bed of the wound or other skin defect. The tissue equivalents are then immobilized. In some cases, the method for immobilization is by use of a biodegradable material, such as by using a tissue glue or adequate bandage.

VII. Rho Family Members and their Role in Cell Fate

[0160] Rho GTPase family proteins, which include Rho, Rac1 and Cdc42, control a wide variety of cellular processes, such as cell adhesion, motility, proliferation, differentiation and apoptosis (Etienne-Manneville and Hall, Nature 420:629-635, 2002; Hagerty et al., J. Biol. Chem. 282:4884-4893, 2007; Van Aelst and D'Souza-Schorey, Genes Dev. 11:2295-2322, 1997). One of the best characterized effectors of Rho is Rho-associated coiled-coil protein kinase (ROCK).

[0161] ROCK proteins are serine/threonine kinases that bind Rho. The catalytic kinase domain of ROCK, which comprises conserved motifs characteristic of serine/threonine kinases, is found at the N-terminus ROCK proteins also have a central coiled-coil domain, which includes a Rho-binding domain (RBD). The C-terminus is made up of a pleckstrin-homology (PH) domain with an internal cysteine-rich domain. The coiled-coil domain is thought to interact with other .alpha.-helical proteins. The RBD, located within the coiled-coil domain, interacts only with activated Rho GTPases, including RhoA, RhoB, and RhoC. The PH domain is thought to interact with lipid mediators such as arachidonic acid and sphingosylphosphorylcholine, and may play a role in protein localization. Interaction of the PH domain and RBD with the kinase domain results in an auto-inhibitory loop. In addition, the kinase domain is involved in binding to RhoE, which is a negative regulator of ROCK activity (Shi and Wei, Arch. Immunol. Ther. Exp. 55:61-75, 2007).

[0162] The ROCK family consists of two members, ROCK1 (also known as ROK.beta. or p160ROCK) and ROCK2 (also known as ROK.alpha.). ROCK1 (1354 amino acids; SEQ ID NO: 2) and ROCK2 (1388 amino acids; SEQ ID NO: 4) share 65% overall identity and 92% identity in the kinase domain.

[0163] Although both ROCK isoforms are ubiquitously expressed in tissues, they exhibit differing intensities in some tissues. For example, ROCK2 is more prevalent in brain and skeletal muscle, while ROCK1 is more abundant in liver, testes and kidney. Both isoforms are expressed in vascular smooth muscle and heart. In the resting state, both ROCK1 and ROCK2 are primarily cytosolic, but are translocated to the membrane upon Rho activation (Shi and Wei, Arch. Immunol. Ther. Exp. 55:61-75, 2007).

[0164] ROCK activity is regulated by several different mechanisms. As a result, Rho-dependent ROCK activation is highly cell-type dependent, ranging from changes in contractility, cell permeability, migration and proliferation to apoptosis. At least 20 ROCK substrates have been identified (Hu and Lee, Expert Opin. Ther. Targets 9:715-736, 2005; Loirand et al., Cir. Res. 98:322-334, 2006; Riento and Ridley, Nat. Rev. Mol. Cell Biol. 4:446-456, 2003), several of which are involved in apoptosis.

[0165] The role of ROCK in regulating apoptotic signaling is highly cell-type dependent and stimulus dependent. For example, several studies have demonstrated that Rho/ROCK activation is required for endothelial cell death elicited by cytokine or drug treatment. ROCK also appears to play a pro-apoptotic role in a number of other cell types, including primary thymocytes, embryonic fibroblasts and HeLa cells. In vivo, inhibition of ROCK results in protective effects in a variety of animal models. The protective effects of ROCK inhibition are often accompanied by a reduced inflammatory response (Shi and Wei, Arch. Immunol. Ther. Exp. 55:61-75, 2007).

[0166] In contrast, ROCK has also been associated with mediating cell-survival signals in vitro and in vivo. A ROCK-mediated pro-survival effect has been reported in epithelial cells, cancer cells and endothelial cells, as well as in other cell types. In airway epithelial cells, inhibition with Y-27632 or HA 1077 (also known as fasudil) induces membrane ruffling, loss of actin stress fibers and apoptosis (Moore et al., Am. J. Respir. Cell Mol. Biol. 30:379-387, 2004). Rho/ROCK activation also plays a pro-survival role during oxidative stress-induced intestinal epithelial cell injury (Song et al., Am. J. Physiol. Cell Physiol. 290:C1469-1476, 2006). ROCK has also been associated with pro-survival events in thyroid cancer cells (Zhong et al., Endocrinology 144:3852-3859, 2003), glioma cells (Rattan et al., J. Neurosci. Res. 83:243-255, 2006), human umbilical vein endothelial cells (Li et al., J. Biol. Chem. 277:15309-15316, 2002), hepatic stelate cells (Ikeda et al., Am. J. Physiol. Gastrointest. Liver Physiol. 285:G880-886, 2003) and human neuroblastoma cells (De Sarno et al., Brain Res. 1041:112-115, 2005). Evidence of ROCK playing a pro-survival role has also been reported in vivo, for example in vascular smooth muscle cells (Shibata et al., Circulation 103:284-289, 2001) and spinal motor neurons (Kobayashi et al., J. Neurosci. 24:3480-3488, 2004).

VIII. Rho-Associated Kinase (ROCK) Inhibitors

[0167] In one embodiment, the ROCK inhibitor is a small molecule. Exemplary small molecule ROCK inhibitors include Y-27632 (U.S. Pat. No. 4,997,834) and fasudil (also known as HA 1077; Asano et al., J. Pharmacol. Exp. Ther. 241:1033-1040, 1987). These inhibitors bind to the kinase domain to inhibit ROCK enzymatic activity. Other small molecules reported to specifically inhibit ROCK include H-1152 ((S)-(+)-2-Methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]homopiperazine, Ikenoya et al., J. Neurochem. 81:9, 2002; Sasaki et al., Pharmacol. Ther. 93:225, 2002); N-(4-Pyridyl)-N'-(2,4,6-trichlorophenyl)urea (Takami et al., Bioorg. Med. Chem. 12:2115, 2004); and 3-(4-Pyridyl)-1H-indole (Yarrow et al., Chem. Biol. 12:385, 2005).

[0168] Additional small molecule Rho kinase inhibitors include those described in PCT Publication Nos. WO 03/059913, WO 03/064397, WO 05/003101, WO 04/112719, WO 03/062225 and WO 03/062227; U.S. Pat. Nos. 7,217,722 and 7,199,147; and U.S. Patent Application Publication Nos. 2003/0220357, 2006/0241127, 2005/0182040 and 2005/0197328.

[0169] In another embodiment, the ROCK inhibitor is a negative regulator of ROCK activity. Negative regulators of ROCK activation include small GTP-binding proteins such as Gem, RhoE, and Rad, which can attenuate ROCK activity. Auto-inhibitory activity of ROCK has also been demonstrated upon interaction of the carboxyl terminus with the kinase domain to reduce kinase activity.

[0170] In another embodiment, the ROCK inhibitor can be an antibody that specifically binds ROCK1 or ROCK2 or both isoforms. In one example, the antibody specifically binds ROCK1 (SEQ ID NO: 2). In another example, the antibody specifically binds ROCK2 (SEQ ID NO: 4). By way of example and not limitation, an antibody specific for a ROCK protein can interfere with binding of ROCK to Rho or other binding partners, or the antibody can directly disrupt kinase activity of ROCK.

[0171] In another embodiment, the ROCK inhibitor is an antisense compound. Generally, the principle behind antisense technology is that an antisense compound hybridizes to a target nucleic acid and effects the modulation of gene expression activity, or function, such as transcription, translation or splicing. The modulation of gene expression can be achieved by, for example, target RNA degradation or occupancy-based inhibition. An example of modulation of target RNA function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound, such as an antisense oligonucleotide. Antisense oligonucleotides can also be used to modulate gene expression, such as splicing, by occupancy-based inhibition, such as by blocking access to splice sites.

[0172] Another example of modulation of gene expression by target degradation is RNA interference (RNAi) using small interfering RNAs (siRNAs). RNAi is a form of antisense-mediated gene silencing involving the introduction of double stranded (ds)RNA-like oligonucleotides leading to the sequence-specific reduction of targeted endogenous mRNA levels. Another type of antisense compound that utilizes the RNAi pathway is a microRNA. MicroRNAs are naturally occurring RNAs involved in the regulation of gene expression. However, these compounds can be synthesized to regulate gene expression via the RNAi pathway. Similarly, shRNAs are RNA molecules that form a tight hairpin turn and can be used to silence gene expression via the RNAi pathway. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA.

[0173] Other compounds that are often classified as antisense compounds are ribozymes. Ribozymes are catalytic RNA molecules that can bind to specific sites on other RNA molecules and catalyze the hydrolysis of phosphodiester bonds in the RNA molecules. Ribozymes modulate gene expression by direct cleavage of a target nucleic acid, such as a messenger RNA.

[0174] Each of the above-described antisense compounds provides sequence-specific target gene regulation. This sequence-specificity makes antisense compounds effective tools for the selective modulation of a target nucleic acid of interest. In one embodiment, the target nucleic acid is ROCK1 (SEQ ID NO: 1; Genbank Accession No. NM.sub.--005406). In another embodiment, the target nucleic acid is ROCK2 (SEQ ID NO: 3; Genbank Accession No. NM.sub.--004850). However, other known ROCK sequences can be used to design antisense compounds.

[0175] Methods of designing, preparing and using antisense compounds that specifically target ROCK are within the abilities of one of skill in the art. Examples of ROCK antisense oligonucleotides are described in U.S. Patent Application No. 2004/0115641.

[0176] Antisense compounds specifically targeting ROCK1 or ROCK2 can be prepared by designing compounds that are complementary to a ROCK1 or ROCK2 nucleotide sequence. Antisense compounds targeting ROCK1 or ROCK2 need not be 100% complementary to ROCK1 or ROCK2 to specifically hybridize and regulate expression of the target gene. For example, the antisense compound, or antisense strand of the compound if a double-stranded compound, can be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% complementary to the selected ROCK1 or ROCK2 nucleic acid sequence. Methods of screening antisense compounds for specificity are well known in the art (see, for example, U.S. Patent Application No. 2003-0228689). Antisense compounds can contain one or more modifications to enhance nuclease resistance and/or increase activity of the compound. Modified antisense compounds include those comprising modified internucleoside linkages, modified sugar moieties and/or modified nucleosides.

[0177] The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.

EXAMPLES

Example 1

A ROCK Inhibitor Promotes Keratinocyte Proliferation and Differentiation Experimental Procedures

Plasmids

[0178] The HPV6 genome was cloned into the BamHI site of pBR322 (Schwarz et al., EMBO J. 2:2341-2348, 1983); the HPV11 genome was cloned into the pML2d plasmid (derivative of pBR322) (Dartmann et al., Virology 151: J 24-130, 1986); the HPV18 genome was cloned into the EcoRI site of pBR322 (Boshart et al., EMBO J. 3:1151-1157, 1984); and the HPV31 genome was cloned into the EcoRI site of pT713.

Cell Lines and Culture

[0179] Primary human foreskin keratinocytes (HFKs) were isolated and pooled from neonatal human foreskins from seven donors and grown in F medium (3:1(v/v) F-12 Nutrient Mixture: DMEM, 5% FBS, 0.4 .mu.g/ml hydrocortisone, 5 .mu.g/ml insulin, 8.4 ng/ml cholera toxin, 10 ng/ml EGF, and 24 .mu.g/ml adenine) (Jeon et al., Proc. Natl. Acad. Sci. USA 92:1654-1658, 1995) in the presence of irradiated J2 feeder cells. HFKs were divided into 10 cm plates, containing F-media with or without the addition of 10 .mu.M Y-27632 (Alexis Biochemicals, San Diego, Calif.).

[0180] The 9E and W12 (20863 clone) cell lines were cultured in F-media on irradiated J2 feeder cells. For the Y-27632 experiments they were cultured in F-medium with or without 10 .mu.M Y-27632 and continually passed for the times indicated.

Replication Assay

[0181] Cloned viral genomes were cleaved with restriction enzymes to separate viral and vector sequences. The genomes were religated at a concentration of 5 .mu.g/ml to favor intramolecular circularization. Prior to electroporation, J2 feeder cells were removed from the keratinocytes by versene treatment and the HFKs were collected by trypsinization. HFKs (1.times.10.sup.6) were electroporated with 2 .mu.g of re-circularized viral genomic DNA using the Amaxa Nucleofector II electroporator and the Human Keratinocyte Nucleofector Kit. The Amaxa program optimized for cell survival was used according to the manufacturer's specifications. Cells were removed from the cuvettes immediately following electroporation, and seeded onto 10 cm plates containing irradiated feeder cells and F-medium, in the presence or absence of 10 .mu.M Y-27632, as indicated. At various times post-transfection, low molecular weight DNA was isolated by a modified Hirt extraction procedure (Ustav et al., EMBO J. 10:449-457, 1991). For Southern blot analysis, the isolated DNA was linearized with EcoRI or BamHI, depending on cloning site for each viral genome, and DpnI, to digest any unreplicated input DNA. DNA fragments were separated by agarose gel electrophoresis followed by Southern blot hybridization. A .sup.32P-labeled probe was synthesized from the isolated viral genomic DNA (purified from the vector sequence) by the random prime method and used in Southern hybridizations.

Results

[0182] Inhibition of the Rho associated kinase ROCK by the inhibitor Y-27632 has been shown to increase survival of human embryonic stem cells (Watanabe et al., Nature Biotechnology 25:681-686, 2007) and to increase the colony forming ability of primary human foreskin keratinocytes. To determine whether inhibition of this pathway would increase the ability of keratinocytes to support HPV replication and the viral life-cycle, primary human foreskin keratinocytes were cultured in the presence or absence of 10 .mu.M Y-27632. The treated cells proliferated at a rate that exceeded the untreated cells almost immediately. After about 15 passages (120 days in culture), the untreated cells ceased dividing and formed only abortive colonies containing flat cells that appeared senescent. The Y-27632-treated cells continued to divide without any decrease in growth rate. The treated cells were small and cuboidal and grew in closely packed colonies characteristic of basal cells (see FIG. 3). The cells were passed at least 82 times and were in continuous culture for over 10 months. Thus, they can be considered immortal. The growth curves of these cells are shown in FIG. 4. To determine whether the continuous presence of Y-27632 was required for this immortalized state, Y-27632 treatment was withdrawn at passage 48 (p48), after 196 days in culture. These cells continued to grow unchecked with only a gradual slowing in the rate of population doubling.

[0183] To determine whether the greatly improved culture conditions of the primary human keratinocytes would benefit HPV DNA replication, viral genomes from the "high-risk" viruses HPV 18 and HPV31 were transfected into early passage primary foreskin keratinocytes using nucleofection. Transfected cultures were maintained in the presence or absence of Y-276328 and low molecular weight extrachromosomal DNA was isolated at two days and five days post-electroporation. The isolated DNA was cleaved with a restriction enzyme that linearized the viral genome and with DpnI which will only cleave unreplicated input DNA that harbors methylation from propagation in bacteria. The levels of replicated DNA were further analyzed by Southern blot analysis. As shown in FIG. 5, treatment with Y-27632 greatly increased the efficiency of HPV replication up to five days.

[0184] The great increase in efficiency of "high-risk" HPV DNA replication in the presence of Y-27632 prompted examination of the replication of "low-risk" HPV6. Replication assays are much more difficult with the low risk viruses because the E6 and E7 viral proteins do not provide the cells with a selective growth advantage. FIG. 6 shows a replication experiment with the "low risk" HPV6 and the "high-risk" HPV 18 viral genomes. Both genomes were electroporated into primary human keratinocytes and were passed in the presence or absence of Y-27632 for up to 12 passages. In the absence of Y-27632, the keratinocytes containing HPV6 DNA had only reached passage 4 by day 49 after electroporation. The viral DNA was detectable at days five and ten but by the next pass, at day 32, was undetectable. Treatment with Y-27632 greatly increased the efficiency of replication and robust levels of viral DNA were present after three passes. After this, however, the levels of viral DNA declined. This is likely because there is no selective advantage to having the viral genome present. Co-transfection of "low risk" HPV DNA with a drug selectable marker in addition to Y-27632 treatment should enable maintenance of the viral genome for much greater time periods. At early times, replication of the "high risk" HPV18 was greater in the presence of Y-27632 (FIGS. 5 and 6). However, after day 10 there appeared to be greater levels of replication in the absence of Y-27632. HPV18 expresses oncogenic E6 and E7 proteins that give the cells a selective growth advantage. It is most likely that inhibition of the Rho kinase pathway by Y-27632 has negated the selective growth advantage conferred by the "high-risk" E6 and E7 oncoproteins. Again, co-transfection with a drug-selectable marker should increase apparent replication levels by selecting for the transfected cells. It has been reported that HPV replication of "high risk" HPVs requires E6 and E7 functions (Park et al., J. Virol. 76: 11359-11364, 2002; Thomas et al., Proc. Natl. Acad, Sci. USA 96:8449-8454, 1999). It will be of interest to determine whether these functions are required in the presence of Y-27632.

[0185] Only two cell lines that harbor extrachromosomally replicating HPV DNA have been successfully cultured from patients with early dysplastic cervical lesions. W12 cells (Stanley et al., Int. J. Cancer 43:672-676, 1989) and CIN612 9E cells (Rader et al., Oncogene 5:571-576, 1990) were isolated from CIN1 lesions containing HPV16 and HPV31, respectively. Both CIN612 9E cells and the 20863 clone (Jeon et al., J. Virol. 69:2989-2997, 1995) of W12 cells were cultured in the presence or absence of Y-27632 for 44 days (approximately 35 population doublings) to determine any effects on cell growth and HPV replication levels. As shown in FIG. 7, no differences in growth rate were observed in either cell line in the presence of Y-27632. Low molecular weight DNA was isolated and analyzed for HPV DNA at various time points. As shown in FIG. 8, Y-27632 had somewhat different effects on each cell line. The HPV31 copy number remained constant in the 9E cells, showing that Y-27632 had no direct effect on HPV replication. The copy number of HPV16 declined gradually in the W12 cells, both in the presence and absence of Y-27632. This is likely explained by the previous observation that extrachromosomal maintenance of the viral genome in W12 cells is somewhat unstable and the genomes have the propensity to integrate upon prolonged culture, giving the cells with integrated genomes a selected growth advantage (Jeon et al., J. Virol. 69:2989-2997, 1995). Y-27632 partially rescued the decline in copy number and this is likely due to removing the selective advantage provided by integration of the viral genome.

Example 2

Immortalization of Human Keratinocytes Using a Rock Inhibitor

Materials and Methods

Cell Culture

[0186] Human foreskin keratinocytes (HFKs) were isolated from pools of at least seven neonatal foreskins and grown in 154 medium supplemented with Human Keratinocyte Growth Supplement and Gentamicin/Amphotericin (Invitrogen, Carlsbad, Calif.) or in F medium [3:1 (v/v) F-12 (Ham)-DMEM, 5% FBS, 0.4 .mu.g/ml hydrocortisone, 5 .mu.g/ml insulin, 8.4 ng/ml cholera toxin, 10 ng/ml EGF, 24 .mu.g/ml adenine, 100 U penicillin, 100 .mu.g/ml streptomycin (Invitrogen, cat no. 15140-148)] in the presence of irradiated 3T3 J2 feeder cells (Jeon et al., J. Virol. 69: 2989-2997, 1995).

[0187] The HPV 18 cell line was established by introducing the HPV 18 genome into primary HFKs using the Amaxa human keratinocyte nucleofection system. Primary human cervical keratinocytes (HCKs), human vaginal keratinocytes (HVKs), the HPV18 cell lines and the HPV31 positive cell line (CIN-612 9E) were grown in the presence or absence of 10 .mu.M Y-27632 (Alexis Biochemicals), as indicated. Cells were subcultured by removing the fibroblast feeder cells with versene and keratinocytes were collected by trypsinization. At each pass, 2.times.10.sup.5 cells were plated on a 10 cm plate of J2 feeder cells. Population doubling was calculated as: PD=3.32(log(# cells harvested/# cells seeded)).

Immunodetection

[0188] Proteins were extracted in 2% sodium dodecyl sulfate (SDS), 50 mM Tris-HCl (pH 6.8), 10% glycerol supplemented with inhibitors Complete and PhosphoSTOP (Roche, Indianapolis, Ind.). Protein samples were resolved on NuPage gels, electrotransferred to Immobilon-P membrane (Millipore, Billerica, Mass.), and probed with the relevant antibodies before detection by chemiluminescence. Monoclonal antibody against p53 (DO-1) was obtained from Santa Cruz Biotechnology (Santa Cruz, Calif.). Monoclonal antibody against .alpha.-tubulin (B-5-1-2) was obtained from Sigma-Aldrich. Polyclonal antibodies against Myc (N-262), p21 (C-19), and p16 (C-20) were obtained from Santa Cruz Biotechnology.

Real Time QRT-PCR

[0189] Total cellular RNA was isolated with TRIZol.TM. reagent (Invitrogen, Carlsbad, Calif.) and treated with DNA-free kit (Ambion, Austin, Tex.). First-strand cDNA was synthesized from 8 .mu.g of total cellular RNA using the Superscript III First-Strand Synthesis System (Invitrogen, Carlsbad, Calif.). RNase H-treated cDNA from 20 ng RNA was amplified by quantitative real time PCR using the Taqman Gene Expression Assay for hTERT (Assay ID: Hs00972646 ml, Applied Biosystems) spanning exons 14 and 15 and human RPLPO (large ribosomal protein) endogenous control, VIC/MGB Probe, primer limited (Applied Biosystems). All samples were run in triplicate using the ABI 7900HT system and the amount of product was calculated with reference to standard curves generated by 4-fold serial dilutions of a mixed set of cDNAs with high telomerase expression. Values were adjusted relative to the level of RPO transcripts.

Telomere Length Assay

[0190] Genomic DNA was extracted from cells and the average telomere length was assessed by a modified method of the real-time PCR-based telomere assay described previously (Cawthon et al., Nucleic Acids Res. 30: e47, 2002; Cawthon, Nucleic Acids Res. 37: e21, 2009). Briefly, the telomere repeat copy number to single gene copy number (T/S) ratio was determined using a Bio-Rad IQ5 thermocycler. Genomic DNA (5 ng) was subjected to PCR reactions and detected with SYBR Green Super Mix (Bio-Rad). The primers for telomere length and HBG1 (a single copy gene) were as follows.

TABLE-US-00001 Tel-1: (SEQ ID NO: 5) CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT Tel-2: (SEQ ID NO: 6) GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT HBG1: (SEQ ID NO: 7) TGTGCTGGCCCATCACTTTG HBG2: (SEQ ID NO: 8) ACCAGCCACCACTTTCTGATAGG

[0191] Reaction conditions were: 1 cycle, 95.degree. C., 5 minutes; 41 cycles, 95.degree. C., 15 seconds; 1 cycle, 60.degree. C. for 45 seconds. All reactions were carried out in triplicate and compared to a standard curve of 0, 0.2, 1, 5, 25 and 125 ng genomic DNA (telomere length 10.4 kb) from Roche Telo-kit. The T/S ratio (dCt) for each sample was calculated by normalizing the average HBG Ct value to the average telomere Ct value.

Karyotype Analysis

[0192] This was conducted by Molecular Diagnostic Services, Inc. San Diego, Calif. Metaphase spreads were prepared and stained to observe chromosomal G bands.

[0193] Twenty metaphase spreads of each cell line was analyzed and five complete karyotypes were prepared from each.

DNA Genotype Analysis

[0194] Cellular DNAs were analyzed using the PowerPlex 1.2 STR genotyping kit (Promega) by Molecular Diagnostic Services, Inc., San Diego, Calif.

Organotypic Raft Culture

[0195] Organotypic cultures were generated as described previously with modifications. (Banerjee et al., Methods Mol. Med. 119: 187-202, 2005). Briefly, 1.times.10.sup.5 keratinocytes were seeded onto a rat tail type 1 collagen dermal equivalent containing 1-2.times.10.sup.6 J2 3T3 feeder cells. The rafts were lifted onto stainless steel grids and were fed by diffusion from below with raft medium [3:1 (v/v) DMEM-F-12 (Ham), 10% FBS, 0.4 .mu.g/ml hydrocortisone, 0.1 nM cholera toxin, and 5 .mu.g/ml transferring]. Raft cultures were allowed to stratify and differentiate for 11-17 days. The collagen-epithelial rafts were fixed in formalin for 4 hours, paraffin embedded, sectioned and stained with hematoxylin and eosin (H&E) or by immunofluorescence as described in Pei et al. (Methods Mol. Med. 119: 49-59, 2005). Monoclonal antibody against anti-keratin 14 (K14) (Ab-1) was from Thermo Fisher Scientific, Fremont, Calif. Goat polyclonal antiserum against Filaggrin (N-20) and rabbit polyclonal antiserum against involucrin (H-120) were from Santa Cruz Biotechnology.

Growth Arrest Assay

[0196] Keratinocytes (1-2.times.10.sup.6) were seeded on a 10 cm plate. Forty-eight hours later they were treated with 0.5 nM actinomycin D for 24 hours. Protein extracts were prepared, as described above, and analyzed for p53 and p21 protein levels.

Results

Y-27632 Immortalizes Primary Human Keratinocytes

[0197] Rho kinase inhibition has been reported to affect keratinocyte proliferation and differentiation (Terunuma et al., Tissue Eng Part A, Nov. 15, 2009 [Epub]; McMullan et al., Current Biology 13: 2185-2189, 2003). To further explore the effect of Rho kinase inhibition on the long term growth of keratinocytes, human neonatal foreskin keratinocytes and adult vaginal and ectocervical keratinocytes were cultured in the presence or absence of 10 .mu.M Y-27632, a well-characterized inhibitor of the Rho-associated kinase, ROCK. As shown in FIG. 9, the growth rate of all three keratinocyte types slowed with time and senescence was observed at approximately population doubling 20-40, depending on the specific cell type. In the presence of Y-27632, a dramatic increase in cellular proliferation of all three types of keratinocytes was observed within days and continued indefinitely. Y-27632-treated cells had a constant and steady growth rate, as indicated by the constant slope of population doublings against time. All three types of keratinocytes efficiently bypassed senescence with no observed decline in growth rate. As shown in Table 1, efficient keratinocyte immortalization was observed at least eight times with three different donor pools of foreskin keratinocytes (strains a, b, and c) and twice each with ectocervical and vaginal keratinocytes. Foreskin keratinocytes have been cultured for up to 150 passages for a period of 500 days and can be considered immortal (see FIG. 14). Occasionally, spontaneously immortalized cells grew out from quiescent cells that were close to senescence in the absence of Y-27632, but this only occurred after a long lag period suggesting that individual cells had picked up rare mutations allowing them to escape senescence. In contrast, Y-27632-treated cells grew steadily at all times.

TABLE-US-00002 TABLE 1 Keratinocyte immortalization in the presence and absence of Y-27632 Keratinocyte strain +Y-27632.sup.1 -Y-27632.sup.2 HFK a PD195 PD62 PD193 PD51 PD177 PD42 PD183 PD29 PD145 PD29 b PD199 PD34 c PD150 PD69 PD105 PD41 HCK PD93 PD28 PD67 PD22 HVK PD80 PD17 PD66 PD15 .sup.1Cells were cultured to the population doubling (PD) shown and were considered to be immortal. .sup.2Cells were determined to be senescent at the population doubling shown. Senescence was defined as growth rate (population doubling/day) less than or equal to 0.2 within the time period of one month. HFK: human foreskin keratinocyte; HCK: human cervical keratinocytes; HVK: human vaginal keratinocyte

[0198] Genetic analysis was carried out on two of the immortalized foreskin keratinocyte strains (a and b) to ensure that they were identical to the original donor cells. Short tandem repeat analysis, a method used to distinguish individuals based on the highly polymorphic nature of certain regions of chromosomes, showed that the immortalized cells were genetically indistinguishable from the original keratinocytes, eliminating the possibility of contamination by an immortalized cell line.

Immortalization by Y-27632 is Dependent on Co-Culture with Fibroblasts

[0199] Culturing keratinocytes in the presence of fibroblast feeder cells increases the lifespan of keratinocytes (Fu et al., Cancer Res. 63: 7815-7824, 2003; Rheinwald et al., Mol. Cell Biol. 22: 5157-5172, 2002) and might contribute to the observed immortalization by Y-27632. Therefore, the effect of Y-27632 on foreskin keratinocytes grown in the absence of fibroblast feeder cells, cultured on plastic and in serum-free medium was analyzed. Y-27632 treatment resulted in somewhat increased proliferation but this was not as pronounced as in the presence of feeders. Furthermore, in repeated experiments, these cells did not bypass senescence. Therefore, co-culture with feeder fibroblasts is required in concert with ROCK inhibition to immortalize keratinocytes.

Morphology of Y-27632 Immortalized Keratinocytes Resembles Early Passage, Basal-Like Keratinocytes

[0200] At early passages, primary keratinocytes are actively dividing and are small, cuboidal and homogeneous in shape (FIG. 10). When cultured with fibroblast feeder cells, they grow in tightly packed colonies and resemble basal keratinocytes. As they approach senescence, their morphology changes and they becomes flat, and heterogeneous with enlarged cytoplasmic volume. The morphology of the Y-27632 immortalized cells was similar to early passage keratinocytes and is typical of actively dividing cells.

The Karyotype of Y-27632 Immortalized Cells is Normal

[0201] Immortalization of primary human keratinocytes is rare and the resulting cell lines have genetic changes and abnormal karyotypes. The karyotype was analyzed for one of the foreskin keratinocyte lines (strain a) that had been cultured in the presence of Y-27632 for 95 passages. The karyotype of the immortalized cells was identical to that of the donor cells with the correct number of chromosomes with no apparent abnormalities.

Telomerase is Upregulated in Y-27632-Immortalized Cells

[0202] Human telomerase verse transcriptase (hTERT) is a subunit of telomerase, which maintains the telomere caps throughout the multiple cell divisions of development. hTERT expression is turned off in most somatic cells and so the telomere ends become progressively shorter over multiple cell divisions. Replicative senescence is triggered when these protective ends become critically short (Harley et al, Nature 345: 458-460, 1990). To overcome this constraint, most tumor-derived or immortal cell lines have reactivated hTERT expression to maintain the telomere ends. Quantitative RT-PCR analysis showed that the level of hTERT mRNA increased with passage of foreskin keratinocytes in the presence of Y-27632 (FIG. 11A). As a comparison, hTERT mRNA levels were also determined in keratinocytes immortalized with HPV 18. The "high risk" HPV E6 protein directly upregulates hTERT transcription as part of the immortalization process (Klingelhutz et al., Nature 380: 79-82, 1996). By passage 34 in Y-27632, hTERT mRNA levels were comparable to those in HPV 18-immortalized keratinocytes. A similar induction of hTERT mRNA was observed in vaginal and cervical keratinocytes immortalized by Y-27632, as well as in another strain of foreskin keratinocytes (FIG. 15).

The Lengths of Telomeres Shorten, but are Stabilized, in Keratinocytes Immortalized by Y-27632

[0203] In HPV immortalized cells, telomere ends erode despite telomerase induction, but the shortened length becomes stable (Stoppler et al., J. Biol. Chem. 272: 13332-13337, 1997). A similar phenomenon was observed in Y-27632 immortalized cells. The relative length of telomeres was measured using a quantitative PCR assay. Despite increased levels of telomerase expression, the length of the telomeres in cells cultured with Y-27632 became progressively shorter with passage (FIG. 11B). However, the length became stable from passage 50 to 120 and was similar to the length of telomeres in HPV18 immortalized cells.

P16.sup.INK4a is Expressed in Y-27632-Immortalized Cells

[0204] Unlike the situation for fibroblasts, telomerase expression is not sufficient for immortalization of human keratinocytes and the pRB/p16.sup.INK4a pathway must also be inactivated (Dickson et al., Mol. Cell Biol. 20: 1436-1447, 2000). p16.sup.INK4a mRNA and protein levels were examined in keratinocytes during long term culture with Y-27632. P16.sup.INK4a mRNA and protein expression were still observed, albeit at a low level, after long-term culture with Y-27632 (see FIG. 12A). However, at this point it is unknown whether the observed p16.sup.INK4a is functional. In contrast, the level of p16.sup.INK4a in HPV immortalized cells is very high, but non-functional because of inactivation of the pRb pathway. Y-27632 treatment had no effect on the p16.sup.INK4a levels in these cells.

c-Myc is Upregulated in Y-27632-Immortalized Cells

[0205] The Myc protein binds to the E-boxes of the hTERT promoter to induce transcription (Wang et al., Genes Dev. 12: 1769-1774, 1998) and HPV E6 requires Myc for cellular immortalization (Liu, et al., J. Virol. 82: 11568-11576, 2008). As shown in FIG. 12A, Y-27632 has both short term and long term effects on Myc expression in all three keratinocyte types. Myc protein levels are induced transiently immediately after culture with Y-27632 (compare p4 for HFK and P2s for HCK and HVK). After this initial induction there is a decrease in Myc expression but then a general increase over time in all three cell types. At very late passages (p107), the level of Myc is equivalent to that of an HPV31-containing cell line (FIG. 16A). The long term increase in Myc levels is similar to the increase in hTERT expression implying that increased telomerase expression might be due to Myc induction.

[0206] The Tumor Suppressor Gene p.53 is Expressed in Y-27632 Immortalized Cells and can Mediate a Normal DNA Damage Response

[0207] The tumor suppressor gene, p53, prevents aberrant proliferation and arrests the growth of cells that have sustained genetic damage. In most cancer-derived or immortalized cell lines the p53 pathway is either mutated or suppressed to allow cells to proliferate in conditions of aberrant growth regulation. p53 protein levels gradually increase in keratinocytes cultured with Y-27632, but this does not appear to be inhibitory to cell growth and p21 is not induced. To test whether the p53 pathway was functional in the Y-27632 immortalized cells, the response of the cells to p53-induced growth arrest mediated by DNA damage was analyzed. Normal cells exhibit growth arrest when exposed to a mutagen but this arrest is abrogated in cells immortalized by the human papillomavirus E6 and E7 oncoproteins (Foster et al., J Virol 68: 5698-5705, 1994). Keratinocytes were treated with 0.5 nM actinomycin D, which induces DNA strand breaks and induces a p53-mediated growth arrest (Abrams et al., Cell Immunol. 182: 137-151, 1997). Early passage keratinocytes and Y-27632-treated keratinocytes exhibited a normal DNA damage response; both p53 and the p53-responsive protein, p21, were upregulated (see FIG. 12B). In contrast, the HPV31 immortalized cell line CIN612, as well as HPV18 immortalized cells, did not induce p53 levels or the p53 pathway in response to the DNA damage. Therefore, Y27632 immortalized keratinocytes retain a normal DNA damage response.

[0208] Y-27632-Treated Cells Retain the Ability to Differentiate

[0209] McMullan et al. (Current Biology 13: 2185-2189, 2003) have shown that blocking ROCK function inhibits suspension induced differentiation of human keratinocytes. To determine whether keratinocytes grown in the presence of Y-27632 retain their differentiation potential, their ability to form a stratified epithelium in organotypic raft culture was assayed. Early passage HFKs and Y-27632-treated keratinocytes were seeded onto a fibroblast-collagen matrix, and cultured as a "raft" at the liquid-air interphase for 17 days in the absence of Y-27632 in the raft media. As shown in FIG. 13 (panel a), this induces primary keratinocytes to produce a stratified epithelial tissue. Similarly, keratinocytes cultured in the presence of Y-27632 for 18 passages (FIG. 13 panel b) and late pass Y-27632 immortalized cells could also produce a stratified epithelium in organotypic culture. However, when 10 .mu.M Y-27632 was added to the organotypic raft culture medium, no differentiation or stratification were observed (compare FIG. 13 panel c and panel d), confirming the findings of McMullan et al. in a different differentiation system.

[0210] To further demonstrate that the stratified epithelial tissue grown from Y-27632 immortalized cells expressed appropriate differentiation markers, the expression of keratin 14 (expressed in the basal layer), involucrin (upper spinous layer) and filaggrin (granular/cornified layer) was analyzed by immunofluorescence on fixed tissue sections. The results demonstrated that raft tissue grown from either untreated or Y-27632-treated cells expressed these differentiation markers in the appropriate layer (Pommerencke et al., BMC Bioinformatics. 9: 473, 2008). Thus, epithelial tissue generated from Y-27632 treated keratinocytes retains the ability to differentiate normally.

Example 3

Treatment of a Chronic Wound with an Organotypic Tissue Equivalent

[0211] Organotypic tissue equivalents comprised of primary keratinocytes that have been exposed to a ROCK inhibitor to increase their proliferation (and induce immortalization if cultured for a sufficient period of time) can be used to treat a subject with a chronic wound, such as a venous statis ulcer, diabetic ulcer or pressure ulcer. As described herein, primary keratinocytes are obtained from a donor. In some cases, the donor is the subject to be treated. The primary keratinocytes are obtained by skin biopsy and expanded in a monolayer culture containing an effective amount of a ROCK inhibitor, such as 10 .mu.M Y-27632, to allow for expansion of the primary keratinocytes. The expanded primary keratinocytes are developed into an organotypic tissue equivalent by seeding onto a suitable matrix, such as a fibroblast-embedded collagen matrix and growing the cells exposed to air. After culturing for approximately, 7-14 days, the keratinocytes resemble a stratified epithelium with the characteristic epidermal structure of the human skin. The organotypic tissue equivalent is transplanted directly onto the ulcer and immobilized using a suitable bandage.

[0212] In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Sequence CWU 1

1

816650DNAHomo sapiensCDS(942)..(5006) 1gctggttccc cttccgagcg tccgcgcccc gcatgcgcag tctgccccgg cggtctccgt 60ttgtttgaac aggaaggcgg acatattagt ccctctcagc ccccctcgcc ccacccccca 120ggcattcgcc gccgcgactc gccctttccc cggctgggac cgcagcccct cccagaagct 180cccccatcag cagccgccgg gacccaacta tcgtcttcct cttcgcccgc tctccagcct 240ttcctctgct aagtctccat cgggcatcga cctcgccctg ccccaccgga caccgtagca 300gcagccccag cagcgacggg acaaaatggg agagtgaggc tgtcctgcgt ggaccagctc 360gtggccgaga ctgatcggtg cgtcgggccg ggccgagtag agccggggac gcggggctag 420accgtctaca gcgcctctga gcggagcggg cccggcccgt ggcccgagcg gcggccgcag 480ctggcacagc tcctcacccg ccctttgctt tcgcctttcc tcttctccct cccttgttgc 540ccggagggag tctccaccct gcttctcttt ctctacccgc tcctgcccat ctcgggacgg 600ggacccctcc atggcgacgg cggccggggc ccgctagact gaagcacctc gccggagcga 660cgaggctggt ggcgacggcg ctgtcggctg tcgtgagggg ctgccgggtg ggatgcgact 720ttgggcgtcc gagcggctgt gggtcgctgt tgcccccggc ccggggtctg gagagcggag 780gtcccctcag tgaggggaag acgggggaac cgggcgcacc tggtgaccct gaggttccgg 840ctcctccgcc ccgcggctgc gaacccaccg cggaggaagt tggttgaaat tgctttccgc 900tgctggtgct ggtaagaggg cattgtcaca gcagcagcaa c atg tcg act ggg gac 956 Met Ser Thr Gly Asp 1 5 agt ttt gag act cga ttt gaa aaa atg gac aac ctg ctg cgg gat ccc 1004Ser Phe Glu Thr Arg Phe Glu Lys Met Asp Asn Leu Leu Arg Asp Pro 10 15 20 aaa tcg gaa gtg aat tcg gat tgt ttg ctg gat gga ttg gat gct ttg 1052Lys Ser Glu Val Asn Ser Asp Cys Leu Leu Asp Gly Leu Asp Ala Leu 25 30 35 gta tat gat ttg gat ttt cct gcc tta aga aaa aac aaa aat att gac 1100Val Tyr Asp Leu Asp Phe Pro Ala Leu Arg Lys Asn Lys Asn Ile Asp 40 45 50 aac ttt tta agc aga tat aaa gac aca ata aat aaa atc aga gat tta 1148Asn Phe Leu Ser Arg Tyr Lys Asp Thr Ile Asn Lys Ile Arg Asp Leu 55 60 65 cga atg aaa gct gaa gat tat gaa gta gtg aag gtg att ggt aga ggt 1196Arg Met Lys Ala Glu Asp Tyr Glu Val Val Lys Val Ile Gly Arg Gly 70 75 80 85 gca ttt gga gaa gtt caa ttg gta agg cat aaa tcc acc agg aag gta 1244Ala Phe Gly Glu Val Gln Leu Val Arg His Lys Ser Thr Arg Lys Val 90 95 100 tat gct atg aag ctt ctc agc aaa ttt gaa atg ata aag aga tct gat 1292Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met Ile Lys Arg Ser Asp 105 110 115 tct gct ttt ttc tgg gaa gaa agg gac atc atg gct ttt gcc aac agt 1340Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met Ala Phe Ala Asn Ser 120 125 130 cct tgg gtt gtt cag ctt ttt tat gca ttc caa gat gat cgt tat ctc 1388Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln Asp Asp Arg Tyr Leu 135 140 145 tac atg gtg atg gaa tac atg cct ggt gga gat ctt gta aac tta atg 1436Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp Leu Val Asn Leu Met 150 155 160 165 agc aac tat gat gtg cct gaa aaa tgg gca cga ttc tat act gca gaa 1484Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Arg Phe Tyr Thr Ala Glu 170 175 180 gta gtt ctt gca ttg gat gca atc cat tcc atg ggt ttt att cac aga 1532Val Val Leu Ala Leu Asp Ala Ile His Ser Met Gly Phe Ile His Arg 185 190 195 gat gtg aag cct gat aac atg ctg ctg gat aaa tct gga cat ttg aag 1580Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys Ser Gly His Leu Lys 200 205 210 tta gca gat ttt ggt act tgt atg aag atg aat aag gaa ggc atg gta 1628Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asn Lys Glu Gly Met Val 215 220 225 cga tgt gat aca gcg gtt gga aca cct gat tat att tcc cct gaa gta 1676Arg Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr Ile Ser Pro Glu Val 230 235 240 245 tta aaa tcc caa ggt ggt gat ggt tat tat gga aga gaa tgt gac tgg 1724Leu Lys Ser Gln Gly Gly Asp Gly Tyr Tyr Gly Arg Glu Cys Asp Trp 250 255 260 tgg tcg gtt ggg gta ttt tta tac gaa atg ctt gta ggt gat aca cct 1772Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu Val Gly Asp Thr Pro 265 270 275 ttt tat gca gat tct ttg gtt gga act tac agt aaa att atg aac cat 1820Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser Lys Ile Met Asn His 280 285 290 aaa aat tca ctt acc ttt cct gat gat aat gac ata tca aaa gaa gca 1868Lys Asn Ser Leu Thr Phe Pro Asp Asp Asn Asp Ile Ser Lys Glu Ala 295 300 305 aaa aac ctt att tgt gcc ttc ctt act gac agg gaa gtg agg tta ggg 1916Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg Glu Val Arg Leu Gly 310 315 320 325 cga aat ggt gta gaa gaa atc aaa cga cat ctc ttc ttc aaa aat gac 1964Arg Asn Gly Val Glu Glu Ile Lys Arg His Leu Phe Phe Lys Asn Asp 330 335 340 cag tgg gct tgg gaa acg ctc cga gac act gta gca cca gtt gta ccc 2012Gln Trp Ala Trp Glu Thr Leu Arg Asp Thr Val Ala Pro Val Val Pro 345 350 355 gat tta agt agt gac att gat act agt aat ttt gat gac ttg gaa gaa 2060Asp Leu Ser Ser Asp Ile Asp Thr Ser Asn Phe Asp Asp Leu Glu Glu 360 365 370 gat aaa gga gag gaa gaa aca ttc cct att cct aaa gct ttc gtt ggc 2108Asp Lys Gly Glu Glu Glu Thr Phe Pro Ile Pro Lys Ala Phe Val Gly 375 380 385 aat caa cta cct ttt gta gga ttt aca tat tat agc aat cgt aga tac 2156Asn Gln Leu Pro Phe Val Gly Phe Thr Tyr Tyr Ser Asn Arg Arg Tyr 390 395 400 405 tta tct tca gca aat cct aat gat aac aga act agc tcc aat gca gat 2204Leu Ser Ser Ala Asn Pro Asn Asp Asn Arg Thr Ser Ser Asn Ala Asp 410 415 420 aaa agc ttg cag gaa agt ttg caa aaa aca atc tat aag ctg gaa gaa 2252Lys Ser Leu Gln Glu Ser Leu Gln Lys Thr Ile Tyr Lys Leu Glu Glu 425 430 435 cag ctg cat aat gaa atg cag tta aaa gat gaa atg gag cag aag tgc 2300Gln Leu His Asn Glu Met Gln Leu Lys Asp Glu Met Glu Gln Lys Cys 440 445 450 aga acc tca aac ata aaa cta gac aag ata atg aaa gaa ttg gat gaa 2348Arg Thr Ser Asn Ile Lys Leu Asp Lys Ile Met Lys Glu Leu Asp Glu 455 460 465 gag gga aat caa aga aga aat cta gaa tct aca gtg tct cag att gag 2396Glu Gly Asn Gln Arg Arg Asn Leu Glu Ser Thr Val Ser Gln Ile Glu 470 475 480 485 aag gag aaa atg ttg cta cag cat aga att aat gag tac caa aga aaa 2444Lys Glu Lys Met Leu Leu Gln His Arg Ile Asn Glu Tyr Gln Arg Lys 490 495 500 gct gaa cag gaa aat gag aag aga aga aat gta gaa aat gaa gtt tct 2492Ala Glu Gln Glu Asn Glu Lys Arg Arg Asn Val Glu Asn Glu Val Ser 505 510 515 aca tta aag gat cag ttg gaa gac tta aag aaa gtc agt cag aat tca 2540Thr Leu Lys Asp Gln Leu Glu Asp Leu Lys Lys Val Ser Gln Asn Ser 520 525 530 cag ctt gct aat gag aag ctg tcc cag tta caa aag cag cta gaa gaa 2588Gln Leu Ala Asn Glu Lys Leu Ser Gln Leu Gln Lys Gln Leu Glu Glu 535 540 545 gcc aat gac tta ctt agg aca gaa tcg gac aca gct gta aga ttg agg 2636Ala Asn Asp Leu Leu Arg Thr Glu Ser Asp Thr Ala Val Arg Leu Arg 550 555 560 565 aag agt cac aca gag atg agc aag tca att agt cag tta gag tcc ctg 2684Lys Ser His Thr Glu Met Ser Lys Ser Ile Ser Gln Leu Glu Ser Leu 570 575 580 aac aga gag ttg caa gag aga aat cga att tta gag aat tct aag tca 2732Asn Arg Glu Leu Gln Glu Arg Asn Arg Ile Leu Glu Asn Ser Lys Ser 585 590 595 caa aca gac aaa gat tat tac cag ctg caa gct ata tta gaa gct gaa 2780Gln Thr Asp Lys Asp Tyr Tyr Gln Leu Gln Ala Ile Leu Glu Ala Glu 600 605 610 cga aga gac aga ggt cat gat tct gag atg att gga gac ctt caa gct 2828Arg Arg Asp Arg Gly His Asp Ser Glu Met Ile Gly Asp Leu Gln Ala 615 620 625 cga att aca tct tta caa gag gag gtg aag cat ctc aaa cat aat ctc 2876Arg Ile Thr Ser Leu Gln Glu Glu Val Lys His Leu Lys His Asn Leu 630 635 640 645 gaa aaa gtg gaa gga gaa aga aaa gag gct caa gac atg ctt aat cac 2924Glu Lys Val Glu Gly Glu Arg Lys Glu Ala Gln Asp Met Leu Asn His 650 655 660 tca gaa aag gaa aag aat aat tta gag ata gat tta aac tac aaa ctt 2972Ser Glu Lys Glu Lys Asn Asn Leu Glu Ile Asp Leu Asn Tyr Lys Leu 665 670 675 aaa tca tta caa caa cgg tta gaa caa gag gta aat gaa cac aaa gta 3020Lys Ser Leu Gln Gln Arg Leu Glu Gln Glu Val Asn Glu His Lys Val 680 685 690 acc aaa gct cgt tta act gac aaa cat caa tct att gaa gag gca aag 3068Thr Lys Ala Arg Leu Thr Asp Lys His Gln Ser Ile Glu Glu Ala Lys 695 700 705 tct gtg gca atg tgt gag atg gaa aaa aag ctg aaa gaa gaa aga gaa 3116Ser Val Ala Met Cys Glu Met Glu Lys Lys Leu Lys Glu Glu Arg Glu 710 715 720 725 gct cga gag aag gct gaa aat cgg gtt gtt cag att gag aaa cag tgt 3164Ala Arg Glu Lys Ala Glu Asn Arg Val Val Gln Ile Glu Lys Gln Cys 730 735 740 tcc atg cta gac gtt gat ctg aag caa tct cag cag aaa cta gaa cat 3212Ser Met Leu Asp Val Asp Leu Lys Gln Ser Gln Gln Lys Leu Glu His 745 750 755 ttg act gga aat aaa gaa agg atg gag gat gaa gtt aag aat cta acc 3260Leu Thr Gly Asn Lys Glu Arg Met Glu Asp Glu Val Lys Asn Leu Thr 760 765 770 ctg caa ctg gag cag gaa tca aat aag cgg ctg ttg tta caa aat gaa 3308Leu Gln Leu Glu Gln Glu Ser Asn Lys Arg Leu Leu Leu Gln Asn Glu 775 780 785 ttg aag act caa gca ttt gag gca gac aat tta aaa ggt tta gaa aag 3356Leu Lys Thr Gln Ala Phe Glu Ala Asp Asn Leu Lys Gly Leu Glu Lys 790 795 800 805 cag atg aaa cag gaa ata aat act tta ttg gaa gca aag aga tta tta 3404Gln Met Lys Gln Glu Ile Asn Thr Leu Leu Glu Ala Lys Arg Leu Leu 810 815 820 gaa ttt gag tta gct cag ctt acg aaa cag tat aga gga aat gaa gga 3452Glu Phe Glu Leu Ala Gln Leu Thr Lys Gln Tyr Arg Gly Asn Glu Gly 825 830 835 cag atg cgg gag cta caa gat cag ctt gaa gct gag caa tat ttc tcg 3500Gln Met Arg Glu Leu Gln Asp Gln Leu Glu Ala Glu Gln Tyr Phe Ser 840 845 850 aca ctt tat aaa acc cag gta aag gaa ctt aaa gaa gaa att gaa gaa 3548Thr Leu Tyr Lys Thr Gln Val Lys Glu Leu Lys Glu Glu Ile Glu Glu 855 860 865 aaa aac aga gaa aat tta aag aaa ata cag gaa cta caa aat gaa aaa 3596Lys Asn Arg Glu Asn Leu Lys Lys Ile Gln Glu Leu Gln Asn Glu Lys 870 875 880 885 gaa act ctt gct act cag ttg gat cta gca gaa aca aaa gct gag tct 3644Glu Thr Leu Ala Thr Gln Leu Asp Leu Ala Glu Thr Lys Ala Glu Ser 890 895 900 gag cag ttg gcg cga ggc ctt ctg gaa gaa cag tat ttt gaa ttg acg 3692Glu Gln Leu Ala Arg Gly Leu Leu Glu Glu Gln Tyr Phe Glu Leu Thr 905 910 915 caa gaa agc aag aaa gct gct tca aga aat aga caa gag att aca gat 3740Gln Glu Ser Lys Lys Ala Ala Ser Arg Asn Arg Gln Glu Ile Thr Asp 920 925 930 aaa gat cac act gtt agt cgg ctt gaa gaa gca aac agc atg cta acc 3788Lys Asp His Thr Val Ser Arg Leu Glu Glu Ala Asn Ser Met Leu Thr 935 940 945 aaa gat att gaa ata tta aga aga gag aat gaa gag cta aca gag aaa 3836Lys Asp Ile Glu Ile Leu Arg Arg Glu Asn Glu Glu Leu Thr Glu Lys 950 955 960 965 atg aag aag gca gag gaa gaa tat aaa ctg gag aag gag gag gag atc 3884Met Lys Lys Ala Glu Glu Glu Tyr Lys Leu Glu Lys Glu Glu Glu Ile 970 975 980 agt aat ctt aag gct gcc ttt gaa aag aat atc aac act gaa cga acc 3932Ser Asn Leu Lys Ala Ala Phe Glu Lys Asn Ile Asn Thr Glu Arg Thr 985 990 995 ctt aaa aca cag gct gtt aac aaa ttg gca gaa ata atg aat cga 3977Leu Lys Thr Gln Ala Val Asn Lys Leu Ala Glu Ile Met Asn Arg 1000 1005 1010 aaa gat ttt aaa att gat aga aag aaa gct aat aca caa gat ttg 4022Lys Asp Phe Lys Ile Asp Arg Lys Lys Ala Asn Thr Gln Asp Leu 1015 1020 1025 aga aag aaa gaa aag gaa aat cga aag ctg caa ctg gaa ctc aac 4067Arg Lys Lys Glu Lys Glu Asn Arg Lys Leu Gln Leu Glu Leu Asn 1030 1035 1040 caa gaa aga gag aaa ttc aac cag atg gta gtg aaa cat cag aag 4112Gln Glu Arg Glu Lys Phe Asn Gln Met Val Val Lys His Gln Lys 1045 1050 1055 gaa ctg aat gac atg caa gcg caa ttg gta gaa gaa tgt gca cat 4157Glu Leu Asn Asp Met Gln Ala Gln Leu Val Glu Glu Cys Ala His 1060 1065 1070 agg aat gag ctt cag atg cag ttg gcc agc aaa gag agt gat att 4202Arg Asn Glu Leu Gln Met Gln Leu Ala Ser Lys Glu Ser Asp Ile 1075 1080 1085 gag caa ttg cgt gct aaa ctt ttg gac ctc tcg gat tct aca agt 4247Glu Gln Leu Arg Ala Lys Leu Leu Asp Leu Ser Asp Ser Thr Ser 1090 1095 1100 gtt gct agt ttt cct agt gct gat gaa act gat ggt aac ctc cca 4292Val Ala Ser Phe Pro Ser Ala Asp Glu Thr Asp Gly Asn Leu Pro 1105 1110 1115 gag tca aga att gaa ggt tgg ctt tca gta cca aat aga gga aat 4337Glu Ser Arg Ile Glu Gly Trp Leu Ser Val Pro Asn Arg Gly Asn 1120 1125 1130 atc aaa cga tat ggc tgg aag aaa cag tat gtt gtg gta agc agc 4382Ile Lys Arg Tyr Gly Trp Lys Lys Gln Tyr Val Val Val Ser Ser 1135 1140 1145 aaa aaa att ttg ttc tat aat gac gaa caa gat aag gag caa tcc 4427Lys Lys Ile Leu Phe Tyr Asn Asp Glu Gln Asp Lys Glu Gln Ser 1150 1155 1160 aat cca tct atg gta ttg gac ata gat aaa ctg ttt cac gtt aga 4472Asn Pro Ser Met Val Leu Asp Ile Asp Lys Leu Phe His Val Arg 1165 1170 1175 cct gta acc caa gga gat gtg tat aga gct gaa act gaa gaa att 4517Pro Val Thr Gln Gly Asp Val Tyr Arg Ala Glu Thr Glu Glu Ile 1180 1185 1190 cct aaa ata ttc cag ata cta tat gca aat gaa ggt gaa tgt aga 4562Pro Lys Ile Phe Gln Ile Leu Tyr Ala Asn Glu Gly Glu Cys Arg 1195 1200 1205 aaa gat gta gag atg gaa cca gta caa caa gct gaa aaa act aat 4607Lys Asp Val Glu Met Glu Pro Val Gln Gln Ala Glu Lys Thr Asn 1210 1215 1220 ttc caa aat cac aaa ggc cat gag ttt att cct aca ctc tac cac 4652Phe Gln Asn His Lys Gly His Glu Phe Ile Pro Thr Leu Tyr His 1225 1230 1235 ttt cct gcc aat tgt gat gcc tgt gcc aaa cct ctc tgg cat gtt 4697Phe Pro Ala Asn Cys Asp Ala Cys Ala Lys Pro Leu Trp His Val 1240 1245 1250 ttt aag cca ccc cct gcc cta gag tgt cga aga tgc cat gtt aag 4742Phe Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg Cys His Val Lys 1255 1260 1265 tgc cac aga gat cac tta gat aag aaa gag gac tta att tgt cca 4787Cys His Arg Asp His Leu Asp Lys Lys Glu Asp Leu Ile Cys Pro 1270 1275 1280 tgt aaa gta agt tat gat gta aca tca gca

aga gat atg ctg ctg 4832Cys Lys Val Ser Tyr Asp Val Thr Ser Ala Arg Asp Met Leu Leu 1285 1290 1295 tta gca tgt tct cag gat gaa caa aaa aaa tgg gta act cat tta 4877Leu Ala Cys Ser Gln Asp Glu Gln Lys Lys Trp Val Thr His Leu 1300 1305 1310 gta aag aaa atc cct aag aat cca cca tct ggt ttt gtt cgt gct 4922Val Lys Lys Ile Pro Lys Asn Pro Pro Ser Gly Phe Val Arg Ala 1315 1320 1325 tcc cct cga acg ctt tct aca aga tcc act gca aat cag tct ttc 4967Ser Pro Arg Thr Leu Ser Thr Arg Ser Thr Ala Asn Gln Ser Phe 1330 1335 1340 cgg aaa gtg gtc aaa aat aca tct gga aaa act agt taa ccatgtgact 5016Arg Lys Val Val Lys Asn Thr Ser Gly Lys Thr Ser 1345 1350 gagtgccctg tggaatcgtg tgggatgcta cctgataaac caggcttctt taaccatgca 5076gagcagacag gctgtttctt tgacacaaat atcacaggct tcagggttaa gattgctgtt 5136tttctgtcct tgctttggca caacacactg agggtttttt ttattgcggg tttgcctaca 5196ggtagattag attaattatt actatgtaat gcaagtacag ttgggggaaa gcttaggtag 5256atatattttt tttaaaaggt gctgcctttt tggatttata agaaaatgcc tgtcagtcgt 5316gatagaacag agttttcctc atatgagtaa gaggaaggga ctttcacttt caagtggaac 5376agccatcact atcaagatca gctcatggaa ggagtaaaga aaatatctca aaatgagaca 5436aactgaagtt ttgttttttt tttaatgact taagtttttg tgctcttgca agactataca 5496aaactatttt aagaaagcag tgatatcact tgaacttcag tgccctcact gtagaattta 5556aaagccttac tgttgattgc ccatgttgga cttgatggag aaattaaata tctttcatta 5616tgctttacaa aatactgtat atgtttcagc aagtttgggg aatgggagag gacaaaaaaa 5676agttacattt aatctatgca tttttgccaa gccatattga gttattttac tactagagac 5736attaggaaac taactgtaca aaagaaccaa gtttaaaagc attttgtggg gtacatcatt 5796tctataattg tataatgtat ttctttgtgg ttttaaatga taaagacatt aagttaacaa 5856acatataaga aatgtatgca ctgtttgaaa tgtaaattat tcttagaaca ctttcaatgg 5916gggttgcatt gtccttttag tgccttaatt tgagataatt attttactgc catgagtaag 5976tatagaaatt tcaaaaaatg tattttcaaa aaattatgtg tgtcagtgag tttttcattg 6036ataattggtt taatttaaaa tatttagagg tttgttggac tttcataaat tgagtacaat 6096ctttgcatca aactacctgc tacaataatg actttataaa actgcaaaaa atgtagaagg 6156ttgcaccaac ataaaaagga aatatggcaa tacatccatg atgttttcca gttaacatag 6216gaattaccag ataaatactg ttaaactctt gtccagtaac aagagttgat tcatatggac 6276agtatgattt attgtttatt tttttaacca aatacctcct cagtaattta taatggcttt 6336gcagtaatgt gtatcagata agaagcactg gaaaaccgat cgtctctagg atgatatgca 6396tgtttcaagt ggtattgaaa gccgcactga tggatatgta ataataaaca tatctgttat 6456taatatacta atgactctgt gctcatttaa tgagaaataa aagtaattta tggatgggta 6516tctttaattt ttactgcaat gtgttttctc atggctgaaa tgaatggaaa acatacttca 6576aattagtctc tgattgtata taaatgtttg tgaaattcca tggttagatt aaagtgtatt 6636tttaaaagat aaaa 665021354PRTHomo sapiens 2Met Ser Thr Gly Asp Ser Phe Glu Thr Arg Phe Glu Lys Met Asp Asn 1 5 10 15 Leu Leu Arg Asp Pro Lys Ser Glu Val Asn Ser Asp Cys Leu Leu Asp 20 25 30 Gly Leu Asp Ala Leu Val Tyr Asp Leu Asp Phe Pro Ala Leu Arg Lys 35 40 45 Asn Lys Asn Ile Asp Asn Phe Leu Ser Arg Tyr Lys Asp Thr Ile Asn 50 55 60 Lys Ile Arg Asp Leu Arg Met Lys Ala Glu Asp Tyr Glu Val Val Lys 65 70 75 80 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Gln Leu Val Arg His Lys 85 90 95 Ser Thr Arg Lys Val Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met 100 105 110 Ile Lys Arg Ser Asp Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met 115 120 125 Ala Phe Ala Asn Ser Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln 130 135 140 Asp Asp Arg Tyr Leu Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp 145 150 155 160 Leu Val Asn Leu Met Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Arg 165 170 175 Phe Tyr Thr Ala Glu Val Val Leu Ala Leu Asp Ala Ile His Ser Met 180 185 190 Gly Phe Ile His Arg Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys 195 200 205 Ser Gly His Leu Lys Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asn 210 215 220 Lys Glu Gly Met Val Arg Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr 225 230 235 240 Ile Ser Pro Glu Val Leu Lys Ser Gln Gly Gly Asp Gly Tyr Tyr Gly 245 250 255 Arg Glu Cys Asp Trp Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu 260 265 270 Val Gly Asp Thr Pro Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser 275 280 285 Lys Ile Met Asn His Lys Asn Ser Leu Thr Phe Pro Asp Asp Asn Asp 290 295 300 Ile Ser Lys Glu Ala Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg 305 310 315 320 Glu Val Arg Leu Gly Arg Asn Gly Val Glu Glu Ile Lys Arg His Leu 325 330 335 Phe Phe Lys Asn Asp Gln Trp Ala Trp Glu Thr Leu Arg Asp Thr Val 340 345 350 Ala Pro Val Val Pro Asp Leu Ser Ser Asp Ile Asp Thr Ser Asn Phe 355 360 365 Asp Asp Leu Glu Glu Asp Lys Gly Glu Glu Glu Thr Phe Pro Ile Pro 370 375 380 Lys Ala Phe Val Gly Asn Gln Leu Pro Phe Val Gly Phe Thr Tyr Tyr 385 390 395 400 Ser Asn Arg Arg Tyr Leu Ser Ser Ala Asn Pro Asn Asp Asn Arg Thr 405 410 415 Ser Ser Asn Ala Asp Lys Ser Leu Gln Glu Ser Leu Gln Lys Thr Ile 420 425 430 Tyr Lys Leu Glu Glu Gln Leu His Asn Glu Met Gln Leu Lys Asp Glu 435 440 445 Met Glu Gln Lys Cys Arg Thr Ser Asn Ile Lys Leu Asp Lys Ile Met 450 455 460 Lys Glu Leu Asp Glu Glu Gly Asn Gln Arg Arg Asn Leu Glu Ser Thr 465 470 475 480 Val Ser Gln Ile Glu Lys Glu Lys Met Leu Leu Gln His Arg Ile Asn 485 490 495 Glu Tyr Gln Arg Lys Ala Glu Gln Glu Asn Glu Lys Arg Arg Asn Val 500 505 510 Glu Asn Glu Val Ser Thr Leu Lys Asp Gln Leu Glu Asp Leu Lys Lys 515 520 525 Val Ser Gln Asn Ser Gln Leu Ala Asn Glu Lys Leu Ser Gln Leu Gln 530 535 540 Lys Gln Leu Glu Glu Ala Asn Asp Leu Leu Arg Thr Glu Ser Asp Thr 545 550 555 560 Ala Val Arg Leu Arg Lys Ser His Thr Glu Met Ser Lys Ser Ile Ser 565 570 575 Gln Leu Glu Ser Leu Asn Arg Glu Leu Gln Glu Arg Asn Arg Ile Leu 580 585 590 Glu Asn Ser Lys Ser Gln Thr Asp Lys Asp Tyr Tyr Gln Leu Gln Ala 595 600 605 Ile Leu Glu Ala Glu Arg Arg Asp Arg Gly His Asp Ser Glu Met Ile 610 615 620 Gly Asp Leu Gln Ala Arg Ile Thr Ser Leu Gln Glu Glu Val Lys His 625 630 635 640 Leu Lys His Asn Leu Glu Lys Val Glu Gly Glu Arg Lys Glu Ala Gln 645 650 655 Asp Met Leu Asn His Ser Glu Lys Glu Lys Asn Asn Leu Glu Ile Asp 660 665 670 Leu Asn Tyr Lys Leu Lys Ser Leu Gln Gln Arg Leu Glu Gln Glu Val 675 680 685 Asn Glu His Lys Val Thr Lys Ala Arg Leu Thr Asp Lys His Gln Ser 690 695 700 Ile Glu Glu Ala Lys Ser Val Ala Met Cys Glu Met Glu Lys Lys Leu 705 710 715 720 Lys Glu Glu Arg Glu Ala Arg Glu Lys Ala Glu Asn Arg Val Val Gln 725 730 735 Ile Glu Lys Gln Cys Ser Met Leu Asp Val Asp Leu Lys Gln Ser Gln 740 745 750 Gln Lys Leu Glu His Leu Thr Gly Asn Lys Glu Arg Met Glu Asp Glu 755 760 765 Val Lys Asn Leu Thr Leu Gln Leu Glu Gln Glu Ser Asn Lys Arg Leu 770 775 780 Leu Leu Gln Asn Glu Leu Lys Thr Gln Ala Phe Glu Ala Asp Asn Leu 785 790 795 800 Lys Gly Leu Glu Lys Gln Met Lys Gln Glu Ile Asn Thr Leu Leu Glu 805 810 815 Ala Lys Arg Leu Leu Glu Phe Glu Leu Ala Gln Leu Thr Lys Gln Tyr 820 825 830 Arg Gly Asn Glu Gly Gln Met Arg Glu Leu Gln Asp Gln Leu Glu Ala 835 840 845 Glu Gln Tyr Phe Ser Thr Leu Tyr Lys Thr Gln Val Lys Glu Leu Lys 850 855 860 Glu Glu Ile Glu Glu Lys Asn Arg Glu Asn Leu Lys Lys Ile Gln Glu 865 870 875 880 Leu Gln Asn Glu Lys Glu Thr Leu Ala Thr Gln Leu Asp Leu Ala Glu 885 890 895 Thr Lys Ala Glu Ser Glu Gln Leu Ala Arg Gly Leu Leu Glu Glu Gln 900 905 910 Tyr Phe Glu Leu Thr Gln Glu Ser Lys Lys Ala Ala Ser Arg Asn Arg 915 920 925 Gln Glu Ile Thr Asp Lys Asp His Thr Val Ser Arg Leu Glu Glu Ala 930 935 940 Asn Ser Met Leu Thr Lys Asp Ile Glu Ile Leu Arg Arg Glu Asn Glu 945 950 955 960 Glu Leu Thr Glu Lys Met Lys Lys Ala Glu Glu Glu Tyr Lys Leu Glu 965 970 975 Lys Glu Glu Glu Ile Ser Asn Leu Lys Ala Ala Phe Glu Lys Asn Ile 980 985 990 Asn Thr Glu Arg Thr Leu Lys Thr Gln Ala Val Asn Lys Leu Ala Glu 995 1000 1005 Ile Met Asn Arg Lys Asp Phe Lys Ile Asp Arg Lys Lys Ala Asn 1010 1015 1020 Thr Gln Asp Leu Arg Lys Lys Glu Lys Glu Asn Arg Lys Leu Gln 1025 1030 1035 Leu Glu Leu Asn Gln Glu Arg Glu Lys Phe Asn Gln Met Val Val 1040 1045 1050 Lys His Gln Lys Glu Leu Asn Asp Met Gln Ala Gln Leu Val Glu 1055 1060 1065 Glu Cys Ala His Arg Asn Glu Leu Gln Met Gln Leu Ala Ser Lys 1070 1075 1080 Glu Ser Asp Ile Glu Gln Leu Arg Ala Lys Leu Leu Asp Leu Ser 1085 1090 1095 Asp Ser Thr Ser Val Ala Ser Phe Pro Ser Ala Asp Glu Thr Asp 1100 1105 1110 Gly Asn Leu Pro Glu Ser Arg Ile Glu Gly Trp Leu Ser Val Pro 1115 1120 1125 Asn Arg Gly Asn Ile Lys Arg Tyr Gly Trp Lys Lys Gln Tyr Val 1130 1135 1140 Val Val Ser Ser Lys Lys Ile Leu Phe Tyr Asn Asp Glu Gln Asp 1145 1150 1155 Lys Glu Gln Ser Asn Pro Ser Met Val Leu Asp Ile Asp Lys Leu 1160 1165 1170 Phe His Val Arg Pro Val Thr Gln Gly Asp Val Tyr Arg Ala Glu 1175 1180 1185 Thr Glu Glu Ile Pro Lys Ile Phe Gln Ile Leu Tyr Ala Asn Glu 1190 1195 1200 Gly Glu Cys Arg Lys Asp Val Glu Met Glu Pro Val Gln Gln Ala 1205 1210 1215 Glu Lys Thr Asn Phe Gln Asn His Lys Gly His Glu Phe Ile Pro 1220 1225 1230 Thr Leu Tyr His Phe Pro Ala Asn Cys Asp Ala Cys Ala Lys Pro 1235 1240 1245 Leu Trp His Val Phe Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg 1250 1255 1260 Cys His Val Lys Cys His Arg Asp His Leu Asp Lys Lys Glu Asp 1265 1270 1275 Leu Ile Cys Pro Cys Lys Val Ser Tyr Asp Val Thr Ser Ala Arg 1280 1285 1290 Asp Met Leu Leu Leu Ala Cys Ser Gln Asp Glu Gln Lys Lys Trp 1295 1300 1305 Val Thr His Leu Val Lys Lys Ile Pro Lys Asn Pro Pro Ser Gly 1310 1315 1320 Phe Val Arg Ala Ser Pro Arg Thr Leu Ser Thr Arg Ser Thr Ala 1325 1330 1335 Asn Gln Ser Phe Arg Lys Val Val Lys Asn Thr Ser Gly Lys Thr 1340 1345 1350 Ser 36401DNAHomo sapiensCDS(450)..(4616) 3caaggcggcc ggcggcgacc atggcagcgg gccggcggcg gccgtagtgg cccaggcctg 60ggcttcagcc tcccggggcc ccagagggcg gggcggtccg ggccgcggcg gtggcggcgc 120cacttccctg ctcccgcccg aggactcctg cgggcactcg ctgaggacca gcggaccggc 180ggcgcgaatc tgactgaggg gcggggacgc cgtctgttcc ccgccgctcc cggcagggcc 240gggccgggct gggccgggct gggccgggcg ggcccctggg agcagccccc aggcggggga 300ccgccttgga gacccgaagc cggagctaga ggcaggcggt gggcccgggt ggagtcccgg 360ccggagctgg tggttcgggg gcggtgctag gccccgaggc tgcgggacct gagcgcgagg 420agcctgagtg cgggtccagc ggtggcggc atg agc cgg ccc ccg ccg acg ggg 473 Met Ser Arg Pro Pro Pro Thr Gly 1 5 aaa atg ccc ggc gcc ccc gag acc gcg ccg ggg gac ggg gca ggc gcg 521Lys Met Pro Gly Ala Pro Glu Thr Ala Pro Gly Asp Gly Ala Gly Ala 10 15 20 agc cgc cag agg aag ctg gag gcg ctg atc cga gac cct cgc tcc ccc 569Ser Arg Gln Arg Lys Leu Glu Ala Leu Ile Arg Asp Pro Arg Ser Pro 25 30 35 40 atc aac gtg gag agc ttg ctg gat ggc tta aat tcc ttg gtc ctt gat 617Ile Asn Val Glu Ser Leu Leu Asp Gly Leu Asn Ser Leu Val Leu Asp 45 50 55 tta gat ttt cct gct ttg agg aaa aac aag aac ata gat aat ttc tta 665Leu Asp Phe Pro Ala Leu Arg Lys Asn Lys Asn Ile Asp Asn Phe Leu 60 65 70 aat aga tat gag aaa att gtg aaa aaa atc aga ggt cta cag atg aag 713Asn Arg Tyr Glu Lys Ile Val Lys Lys Ile Arg Gly Leu Gln Met Lys 75 80 85 gca gaa gac tat gat gtt gta aaa gtt att gga aga ggt gct ttt ggt 761Ala Glu Asp Tyr Asp Val Val Lys Val Ile Gly Arg Gly Ala Phe Gly 90 95 100 gaa gtg cag ttg gtt cgt cac aag gca tcg cag aag gtt tat gct atg 809Glu Val Gln Leu Val Arg His Lys Ala Ser Gln Lys Val Tyr Ala Met 105 110 115 120 aag ctt ctt agt aag ttt gaa atg ata aaa aga tca gat tct gcc ttt 857Lys Leu Leu Ser Lys Phe Glu Met Ile Lys Arg Ser Asp Ser Ala Phe 125 130 135 ttt tgg gaa gaa aga gat att atg gcc ttt gcc aat agc ccc tgg gtg 905Phe Trp Glu Glu Arg Asp Ile Met Ala Phe Ala Asn Ser Pro Trp Val 140 145 150 gtt cag ctt ttt tat gcc ttt caa gat gat agg tat ctg tac atg gta 953Val Gln Leu Phe Tyr Ala Phe Gln Asp Asp Arg Tyr Leu Tyr Met Val 155 160 165 atg gag tac atg cct ggt gga gac ctt gta aac ctt atg agt aat tat 1001Met Glu Tyr Met Pro Gly Gly Asp Leu Val Asn Leu Met Ser Asn Tyr 170 175 180 gat gtg cct gaa aaa tgg gcc aaa ttt tac act gct gaa gtt gtt ctt 1049Asp Val Pro Glu Lys Trp Ala Lys Phe Tyr Thr Ala Glu Val Val Leu 185 190 195 200 gct ctg gat gca ata cac tcc atg ggt tta ata cac aga gat gtg aag 1097Ala Leu Asp Ala Ile His Ser Met Gly Leu Ile His Arg Asp Val Lys 205 210 215 cct gac aac atg ctc ttg gat aaa cat gga cat cta aaa tta gca gat 1145Pro Asp Asn Met Leu Leu Asp Lys His Gly His Leu Lys Leu Ala Asp 220 225 230 ttt ggc acg tgt atg aag atg gat gaa aca ggc atg gta cat tgt gat 1193Phe Gly Thr Cys Met Lys Met Asp Glu Thr Gly Met Val His Cys Asp 235 240 245 aca gca gtt gga aca ccg gat tat ata tca cct gag gtt ctg aaa tca 1241Thr Ala Val Gly Thr Pro Asp Tyr Ile Ser Pro Glu Val Leu Lys Ser 250 255 260 caa ggg ggt gat ggt ttc tat ggg cga gaa tgt gat tgg tgg tct gta 1289Gln Gly Gly Asp Gly Phe Tyr Gly Arg Glu Cys Asp Trp Trp Ser Val 265 270 275 280 ggt gtt ttc ctt tat gag atg cta gtg ggg gat act cca ttt tat gcg 1337Gly Val Phe Leu Tyr

Glu Met Leu Val Gly Asp Thr Pro Phe Tyr Ala 285 290 295 gat tca ctt gta gga aca tat agc aaa att atg gat cat aag aat tca 1385Asp Ser Leu Val Gly Thr Tyr Ser Lys Ile Met Asp His Lys Asn Ser 300 305 310 ctg tgt ttc cct gaa gat gca gaa att tcc aaa cat gca aag aat ctc 1433Leu Cys Phe Pro Glu Asp Ala Glu Ile Ser Lys His Ala Lys Asn Leu 315 320 325 atc tgt gct ttc tta aca gat agg gag gta cga ctt ggg aga aat ggg 1481Ile Cys Ala Phe Leu Thr Asp Arg Glu Val Arg Leu Gly Arg Asn Gly 330 335 340 gtg gaa gaa atc aga cag cat cct ttc ttt aag aat gat cag tgg cat 1529Val Glu Glu Ile Arg Gln His Pro Phe Phe Lys Asn Asp Gln Trp His 345 350 355 360 tgg gat aac ata aga gaa acg gca gct cct gta gta cct gaa ctc agc 1577Trp Asp Asn Ile Arg Glu Thr Ala Ala Pro Val Val Pro Glu Leu Ser 365 370 375 agt gac ata gac agc agc aat ttc gat gac att gaa gat gac aaa gga 1625Ser Asp Ile Asp Ser Ser Asn Phe Asp Asp Ile Glu Asp Asp Lys Gly 380 385 390 gat gta gaa acc ttc cca att cct aaa gct ttt gtt gga aat cag ctg 1673Asp Val Glu Thr Phe Pro Ile Pro Lys Ala Phe Val Gly Asn Gln Leu 395 400 405 cct ttc atc gga ttt acc tac tat aga gaa aat tta tta tta agt gac 1721Pro Phe Ile Gly Phe Thr Tyr Tyr Arg Glu Asn Leu Leu Leu Ser Asp 410 415 420 tct cca tct tgt aga gaa act gat tcc ata caa tca agg aaa aat gaa 1769Ser Pro Ser Cys Arg Glu Thr Asp Ser Ile Gln Ser Arg Lys Asn Glu 425 430 435 440 gaa agt caa gag att cag aaa aaa ctg tat aca tta gaa gaa cat ctt 1817Glu Ser Gln Glu Ile Gln Lys Lys Leu Tyr Thr Leu Glu Glu His Leu 445 450 455 agc aat gag atg caa gcc aaa gag gaa ctg gaa cag aag tgc aaa tct 1865Ser Asn Glu Met Gln Ala Lys Glu Glu Leu Glu Gln Lys Cys Lys Ser 460 465 470 gtt aat act cgc cta gaa aaa aca gca aag gag cta gaa gag gag att 1913Val Asn Thr Arg Leu Glu Lys Thr Ala Lys Glu Leu Glu Glu Glu Ile 475 480 485 acc tta cgg aaa agt gtg gaa tca gca tta aga cag tta gaa aga gaa 1961Thr Leu Arg Lys Ser Val Glu Ser Ala Leu Arg Gln Leu Glu Arg Glu 490 495 500 aag gcg ctt ctt cag cac aaa aat gca gaa tat cag agg aaa gct gat 2009Lys Ala Leu Leu Gln His Lys Asn Ala Glu Tyr Gln Arg Lys Ala Asp 505 510 515 520 cat gaa gca gac aaa aaa cga aat ttg gaa aat gat gtt aac agc tta 2057His Glu Ala Asp Lys Lys Arg Asn Leu Glu Asn Asp Val Asn Ser Leu 525 530 535 aaa gat caa ctt gaa gat ttg aaa aaa aga aat caa aac tct caa ata 2105Lys Asp Gln Leu Glu Asp Leu Lys Lys Arg Asn Gln Asn Ser Gln Ile 540 545 550 tcc act gag aaa gtg aat caa ctc cag aga caa ctg gat gaa acc aat 2153Ser Thr Glu Lys Val Asn Gln Leu Gln Arg Gln Leu Asp Glu Thr Asn 555 560 565 gct tta ctg cga aca gag tct gat act gca gcc cgg tta agg aaa acc 2201Ala Leu Leu Arg Thr Glu Ser Asp Thr Ala Ala Arg Leu Arg Lys Thr 570 575 580 cag gca gaa agt tca aaa cag att cag cag ctg gaa tct aac aat aga 2249Gln Ala Glu Ser Ser Lys Gln Ile Gln Gln Leu Glu Ser Asn Asn Arg 585 590 595 600 gat cta caa gat aaa aac tgc ctg ctg gag act gcc aag tta aaa ctt 2297Asp Leu Gln Asp Lys Asn Cys Leu Leu Glu Thr Ala Lys Leu Lys Leu 605 610 615 gaa aag gaa ttt atc aat ctt cag tca gct cta gaa tct gaa agg agg 2345Glu Lys Glu Phe Ile Asn Leu Gln Ser Ala Leu Glu Ser Glu Arg Arg 620 625 630 gat cga acc cat gga tca gag ata att aat gat tta caa ggt aga ata 2393Asp Arg Thr His Gly Ser Glu Ile Ile Asn Asp Leu Gln Gly Arg Ile 635 640 645 tgt ggc cta gaa gaa gat tta aag aac ggc aaa atc tta cta gcg aaa 2441Cys Gly Leu Glu Glu Asp Leu Lys Asn Gly Lys Ile Leu Leu Ala Lys 650 655 660 gta gaa ctg gag aag aga caa ctt cag gag aga ttt act gat ttg gaa 2489Val Glu Leu Glu Lys Arg Gln Leu Gln Glu Arg Phe Thr Asp Leu Glu 665 670 675 680 aag gaa aaa agc aac atg gaa ata gat atg aca tac caa cta aaa gtt 2537Lys Glu Lys Ser Asn Met Glu Ile Asp Met Thr Tyr Gln Leu Lys Val 685 690 695 ata cag cag agc cta gaa caa gaa gaa gct gaa cat aag gcc aca aag 2585Ile Gln Gln Ser Leu Glu Gln Glu Glu Ala Glu His Lys Ala Thr Lys 700 705 710 gca cga cta gca gat aaa aat aag atc tat gag tcc atc gaa gaa gcc 2633Ala Arg Leu Ala Asp Lys Asn Lys Ile Tyr Glu Ser Ile Glu Glu Ala 715 720 725 aaa tca gaa gcc atg aaa gaa atg gag aag aag ctc ttg gag gaa aga 2681Lys Ser Glu Ala Met Lys Glu Met Glu Lys Lys Leu Leu Glu Glu Arg 730 735 740 act tta aaa cag aaa gtg gag aac cta ttg cta gaa gct gag aaa aga 2729Thr Leu Lys Gln Lys Val Glu Asn Leu Leu Leu Glu Ala Glu Lys Arg 745 750 755 760 tgt tct cta tta gac tgt gac ctc aaa cag tca cag cag aaa ata aat 2777Cys Ser Leu Leu Asp Cys Asp Leu Lys Gln Ser Gln Gln Lys Ile Asn 765 770 775 gag ctc ctt aaa cag aaa gat gtg cta aat gag gat gtt aga aac ctg 2825Glu Leu Leu Lys Gln Lys Asp Val Leu Asn Glu Asp Val Arg Asn Leu 780 785 790 aca tta aaa ata gag caa gaa act cag aag cgc tgc ctt aca caa aat 2873Thr Leu Lys Ile Glu Gln Glu Thr Gln Lys Arg Cys Leu Thr Gln Asn 795 800 805 gac ctg aag atg caa aca caa cag gtt aac aca cta aaa atg tca gaa 2921Asp Leu Lys Met Gln Thr Gln Gln Val Asn Thr Leu Lys Met Ser Glu 810 815 820 aag cag tta aag caa gaa aat aac cat ctc atg gaa atg aaa atg aac 2969Lys Gln Leu Lys Gln Glu Asn Asn His Leu Met Glu Met Lys Met Asn 825 830 835 840 ttg gaa aaa caa aat gct gaa ctt cga aaa gaa cgt cag gat gca gat 3017Leu Glu Lys Gln Asn Ala Glu Leu Arg Lys Glu Arg Gln Asp Ala Asp 845 850 855 ggg caa atg aaa gag ctc cag gat cag ctc gaa gca gaa cag tat ttc 3065Gly Gln Met Lys Glu Leu Gln Asp Gln Leu Glu Ala Glu Gln Tyr Phe 860 865 870 tca acc ctt tat aaa aca caa gtt agg gag ctt aaa gaa gaa tgt gaa 3113Ser Thr Leu Tyr Lys Thr Gln Val Arg Glu Leu Lys Glu Glu Cys Glu 875 880 885 gaa aag acc aaa ctt ggt aaa gaa ttg cag cag aag aaa cag gaa tta 3161Glu Lys Thr Lys Leu Gly Lys Glu Leu Gln Gln Lys Lys Gln Glu Leu 890 895 900 cag gat gaa cgg gac tct ttg gct gcc caa ctg gag atc acc ttg acc 3209Gln Asp Glu Arg Asp Ser Leu Ala Ala Gln Leu Glu Ile Thr Leu Thr 905 910 915 920 aaa gca gat tct gag caa ctg gct cgt tca att gct gaa gaa caa tat 3257Lys Ala Asp Ser Glu Gln Leu Ala Arg Ser Ile Ala Glu Glu Gln Tyr 925 930 935 tct gat ttg gaa aaa gag aag atc atg aaa gag ctg gag atc aaa gag 3305Ser Asp Leu Glu Lys Glu Lys Ile Met Lys Glu Leu Glu Ile Lys Glu 940 945 950 atg atg gct aga cac aaa cag gaa ctt acg gaa aaa gat gct aca att 3353Met Met Ala Arg His Lys Gln Glu Leu Thr Glu Lys Asp Ala Thr Ile 955 960 965 gct tct ctt gag gaa act aat agg aca cta act agt gat gtt gcc aat 3401Ala Ser Leu Glu Glu Thr Asn Arg Thr Leu Thr Ser Asp Val Ala Asn 970 975 980 ctt gca aat gag aaa gaa gaa tta aat aac aaa ttg aaa gat gtt caa 3449Leu Ala Asn Glu Lys Glu Glu Leu Asn Asn Lys Leu Lys Asp Val Gln 985 990 995 1000 gag caa ctg tca aga ttg aaa gat gaa gaa ata agc gca gca gct 3494Glu Gln Leu Ser Arg Leu Lys Asp Glu Glu Ile Ser Ala Ala Ala 1005 1010 1015 att aaa gca cag ttt gag aag cag cta tta aca gaa aga aca ctc 3539Ile Lys Ala Gln Phe Glu Lys Gln Leu Leu Thr Glu Arg Thr Leu 1020 1025 1030 aaa act caa gct gtg aat aag ttg gct gag atc atg aat cga aaa 3584Lys Thr Gln Ala Val Asn Lys Leu Ala Glu Ile Met Asn Arg Lys 1035 1040 1045 gaa cct gtc aag cgt ggt aat gac aca gat gtg cgg aga aaa gag 3629Glu Pro Val Lys Arg Gly Asn Asp Thr Asp Val Arg Arg Lys Glu 1050 1055 1060 aag gag aat aga aag cta cat atg gag ctt aaa tct gaa cgt gag 3674Lys Glu Asn Arg Lys Leu His Met Glu Leu Lys Ser Glu Arg Glu 1065 1070 1075 aaa ttg acc cag cag atg atc aag tat cag aaa gaa ctg aat gaa 3719Lys Leu Thr Gln Gln Met Ile Lys Tyr Gln Lys Glu Leu Asn Glu 1080 1085 1090 atg cag gca caa ata gct gaa gag agc cag att cga att gaa ctg 3764Met Gln Ala Gln Ile Ala Glu Glu Ser Gln Ile Arg Ile Glu Leu 1095 1100 1105 cag atg aca ttg gac agt aaa gac agt gac att gag cag ctg cgg 3809Gln Met Thr Leu Asp Ser Lys Asp Ser Asp Ile Glu Gln Leu Arg 1110 1115 1120 tca caa ctc caa gcc ttg cat att ggt ctg gat agt tcc agt ata 3854Ser Gln Leu Gln Ala Leu His Ile Gly Leu Asp Ser Ser Ser Ile 1125 1130 1135 ggc agt gga cca ggg gat gct gag gca gat gat ggg ttt cca gaa 3899Gly Ser Gly Pro Gly Asp Ala Glu Ala Asp Asp Gly Phe Pro Glu 1140 1145 1150 tca aga tta gaa gga tgg ctt tca ttg cct gta cga aac aac act 3944Ser Arg Leu Glu Gly Trp Leu Ser Leu Pro Val Arg Asn Asn Thr 1155 1160 1165 aag aaa ttt gga tgg gtt aaa aag tat gtg att gta agc agt aag 3989Lys Lys Phe Gly Trp Val Lys Lys Tyr Val Ile Val Ser Ser Lys 1170 1175 1180 aag att ctt ttc tat gac agt gaa caa gat aaa gaa caa tcc aat 4034Lys Ile Leu Phe Tyr Asp Ser Glu Gln Asp Lys Glu Gln Ser Asn 1185 1190 1195 cct tac atg gtt tta gat ata gac aag tta ttt cat gtc cga cca 4079Pro Tyr Met Val Leu Asp Ile Asp Lys Leu Phe His Val Arg Pro 1200 1205 1210 gtt aca cag aca gat gtg tat aga gca gat gct aaa gaa att cca 4124Val Thr Gln Thr Asp Val Tyr Arg Ala Asp Ala Lys Glu Ile Pro 1215 1220 1225 agg ata ttc cag att ctg tat gcc aat gaa gga gaa agt aag aag 4169Arg Ile Phe Gln Ile Leu Tyr Ala Asn Glu Gly Glu Ser Lys Lys 1230 1235 1240 gaa caa gaa ttt cca gtg gag cca gtt gga gaa aaa tct aat tat 4214Glu Gln Glu Phe Pro Val Glu Pro Val Gly Glu Lys Ser Asn Tyr 1245 1250 1255 att tgc cac aag gga cat gag ttt att cct act ctt tat cat ttc 4259Ile Cys His Lys Gly His Glu Phe Ile Pro Thr Leu Tyr His Phe 1260 1265 1270 cca acc aac tgt gag gct tgt atg aag ccc ctg tgg cac atg ttt 4304Pro Thr Asn Cys Glu Ala Cys Met Lys Pro Leu Trp His Met Phe 1275 1280 1285 aag cct cct cct gct ttg gag tgc cgc cgt tgc cat att aag tgt 4349Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg Cys His Ile Lys Cys 1290 1295 1300 cat aaa gat cat atg gac aaa aag gag gag att ata gca cct tgc 4394His Lys Asp His Met Asp Lys Lys Glu Glu Ile Ile Ala Pro Cys 1305 1310 1315 aaa gta tat tat gat att tca acg gca aag aat ctg tta tta cta 4439Lys Val Tyr Tyr Asp Ile Ser Thr Ala Lys Asn Leu Leu Leu Leu 1320 1325 1330 gca aat tct aca gaa gag cag cag aag tgg gtt agt cgg ttg gtg 4484Ala Asn Ser Thr Glu Glu Gln Gln Lys Trp Val Ser Arg Leu Val 1335 1340 1345 aaa aag ata cct aaa aag ccc cca gct cca gac cct ttt gcc cga 4529Lys Lys Ile Pro Lys Lys Pro Pro Ala Pro Asp Pro Phe Ala Arg 1350 1355 1360 tca tct cct aga act tca atg aag ata cag caa aac cag tct att 4574Ser Ser Pro Arg Thr Ser Met Lys Ile Gln Gln Asn Gln Ser Ile 1365 1370 1375 aga cgg cca agt cga cag ctt gcc cca aac aaa cct agc taa 4616Arg Arg Pro Ser Arg Gln Leu Ala Pro Asn Lys Pro Ser 1380 1385 ctgccttcta tgaaagcagt cattattcaa ggtgatcgta ttcttccagt gaaaacaaga 4676ctgaaatatg atggcccaaa atttattaaa aagctatatt ttcctgagag actgatacat 4736acactcatac atatatgtgt tccccttttc cctgtaatat aaattacaaa tctgggctcc 4796tttgaagcaa caggttgaac caacaatgat tggttgatag actaaggata tatgcaactc 4856ttccagactt ttccataaag ctctctcggc agtcgctcac actacaatgc acacaaggat 4916tgagaagagt taaaggctaa agaaaacatc ttttctagct tcaacagaga ggtttcacca 4976gcacatttac cagaagaatc tgggaatgga ttccactaca gtgatattga ctgcatcttt 5036aagaagtgac cattatactg tgtatatata tataaacaca cacacatata tatatatata 5096tatagtactc taatactgca agaaggtttt ttaaacttcc cactttattt tttatacaca 5156ttaatcagat atcattactt gctgcagttg caactatgca cttgtataaa gccataatgt 5216tggagtttat atcactcatt cctgtgtacc tgatggaagt tgcatgttca tgtttaagca 5276gttactgtaa caagaagttt aaagttaatt atatcagttt cctaatgctt catgataggc 5336aactttaccc attttgaatg ccttaattta atttttttca aagtctcagc cctgtctgta 5396ttaaaaaaca aaaaaagcgt ttaccagctc ttaggatgta aactagcttt gtggaagata 5456aatcgtgcac tatttttaca cataaatagt tatatcaatg tcagcctatt ttgattaaca 5516aatgttttta aagtattatt ggttatagaa acaataatgg atggtgttgg aactaatata 5576tccttgatgt ctgtctatta ttcattcaac tctttttaca gacctcagta ttagtctgtg 5636actacaaaat attttatttg ctttaaattt gctggctacc ctagatgtgt ttttattcct 5696ggtaaagaca tttgtgatta cattttcaca cttaagattc aaaatttttc ccaaatataa 5756agaaaactaa gacagactgt agatgcattt taaatattta aatatgatcc tcagacatgc 5816agctgtgtgt ggcagtattt tagtaccggg ttaagaaaac tggcaactgg gaagaagtgg 5876cctcaaaggc acttaatttg atttttattt tttaaatgct gtcaaagtta cagtttacgc 5936aggacattct tgccgtattc tcatgatccc agataagtgt gtgttttata ctgcaacaat 5996atgcagcaat ggtaagcgta aagttttttt tttgtttttg ttttttttta tattatgaag 6056tcttttaaca gtctctcttt atataaatac acagagtttg gtatgatatt taaatacatc 6116atctggccag gcatggtggc ttacgcctgt aatcctagca ctttgggagg ccaagacggg 6176cggatcacct gaggtgagga gttcaagacc agcctgccca acatagtgaa actccgtctc 6236taccaatata caaaaattag ccgggcatga tggtggtggc ctgtaatccc agctacttgg 6296gaggctgaga caggagaatc gcttgaaccc aggagacggt ggttgcagtg agcgaagatc 6356gagccactgc actccagcct gggcagctga acaagactcc gtctc 640141388PRTHomo sapiens 4Met Ser Arg Pro Pro Pro Thr Gly Lys Met Pro Gly Ala Pro Glu Thr 1 5 10 15 Ala Pro Gly Asp Gly Ala Gly Ala Ser Arg Gln Arg Lys Leu Glu Ala 20 25 30 Leu Ile Arg Asp Pro Arg Ser Pro Ile Asn Val Glu Ser Leu Leu Asp 35 40 45 Gly Leu Asn Ser Leu Val Leu Asp Leu Asp Phe Pro Ala Leu Arg Lys 50 55 60 Asn Lys Asn Ile Asp Asn Phe Leu Asn Arg Tyr Glu Lys Ile Val Lys 65 70 75 80 Lys Ile Arg Gly Leu Gln Met Lys Ala Glu Asp Tyr Asp Val Val Lys 85 90 95 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Gln Leu Val Arg His Lys 100 105 110 Ala Ser Gln Lys Val Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met 115 120 125 Ile Lys Arg Ser Asp Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met 130 135 140 Ala Phe Ala Asn Ser Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln 145 150 155 160 Asp Asp Arg Tyr Leu Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp 165 170 175 Leu Val Asn Leu Met Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Lys 180 185 190 Phe Tyr Thr Ala Glu Val Val Leu

Ala Leu Asp Ala Ile His Ser Met 195 200 205 Gly Leu Ile His Arg Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys 210 215 220 His Gly His Leu Lys Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asp 225 230 235 240 Glu Thr Gly Met Val His Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr 245 250 255 Ile Ser Pro Glu Val Leu Lys Ser Gln Gly Gly Asp Gly Phe Tyr Gly 260 265 270 Arg Glu Cys Asp Trp Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu 275 280 285 Val Gly Asp Thr Pro Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser 290 295 300 Lys Ile Met Asp His Lys Asn Ser Leu Cys Phe Pro Glu Asp Ala Glu 305 310 315 320 Ile Ser Lys His Ala Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg 325 330 335 Glu Val Arg Leu Gly Arg Asn Gly Val Glu Glu Ile Arg Gln His Pro 340 345 350 Phe Phe Lys Asn Asp Gln Trp His Trp Asp Asn Ile Arg Glu Thr Ala 355 360 365 Ala Pro Val Val Pro Glu Leu Ser Ser Asp Ile Asp Ser Ser Asn Phe 370 375 380 Asp Asp Ile Glu Asp Asp Lys Gly Asp Val Glu Thr Phe Pro Ile Pro 385 390 395 400 Lys Ala Phe Val Gly Asn Gln Leu Pro Phe Ile Gly Phe Thr Tyr Tyr 405 410 415 Arg Glu Asn Leu Leu Leu Ser Asp Ser Pro Ser Cys Arg Glu Thr Asp 420 425 430 Ser Ile Gln Ser Arg Lys Asn Glu Glu Ser Gln Glu Ile Gln Lys Lys 435 440 445 Leu Tyr Thr Leu Glu Glu His Leu Ser Asn Glu Met Gln Ala Lys Glu 450 455 460 Glu Leu Glu Gln Lys Cys Lys Ser Val Asn Thr Arg Leu Glu Lys Thr 465 470 475 480 Ala Lys Glu Leu Glu Glu Glu Ile Thr Leu Arg Lys Ser Val Glu Ser 485 490 495 Ala Leu Arg Gln Leu Glu Arg Glu Lys Ala Leu Leu Gln His Lys Asn 500 505 510 Ala Glu Tyr Gln Arg Lys Ala Asp His Glu Ala Asp Lys Lys Arg Asn 515 520 525 Leu Glu Asn Asp Val Asn Ser Leu Lys Asp Gln Leu Glu Asp Leu Lys 530 535 540 Lys Arg Asn Gln Asn Ser Gln Ile Ser Thr Glu Lys Val Asn Gln Leu 545 550 555 560 Gln Arg Gln Leu Asp Glu Thr Asn Ala Leu Leu Arg Thr Glu Ser Asp 565 570 575 Thr Ala Ala Arg Leu Arg Lys Thr Gln Ala Glu Ser Ser Lys Gln Ile 580 585 590 Gln Gln Leu Glu Ser Asn Asn Arg Asp Leu Gln Asp Lys Asn Cys Leu 595 600 605 Leu Glu Thr Ala Lys Leu Lys Leu Glu Lys Glu Phe Ile Asn Leu Gln 610 615 620 Ser Ala Leu Glu Ser Glu Arg Arg Asp Arg Thr His Gly Ser Glu Ile 625 630 635 640 Ile Asn Asp Leu Gln Gly Arg Ile Cys Gly Leu Glu Glu Asp Leu Lys 645 650 655 Asn Gly Lys Ile Leu Leu Ala Lys Val Glu Leu Glu Lys Arg Gln Leu 660 665 670 Gln Glu Arg Phe Thr Asp Leu Glu Lys Glu Lys Ser Asn Met Glu Ile 675 680 685 Asp Met Thr Tyr Gln Leu Lys Val Ile Gln Gln Ser Leu Glu Gln Glu 690 695 700 Glu Ala Glu His Lys Ala Thr Lys Ala Arg Leu Ala Asp Lys Asn Lys 705 710 715 720 Ile Tyr Glu Ser Ile Glu Glu Ala Lys Ser Glu Ala Met Lys Glu Met 725 730 735 Glu Lys Lys Leu Leu Glu Glu Arg Thr Leu Lys Gln Lys Val Glu Asn 740 745 750 Leu Leu Leu Glu Ala Glu Lys Arg Cys Ser Leu Leu Asp Cys Asp Leu 755 760 765 Lys Gln Ser Gln Gln Lys Ile Asn Glu Leu Leu Lys Gln Lys Asp Val 770 775 780 Leu Asn Glu Asp Val Arg Asn Leu Thr Leu Lys Ile Glu Gln Glu Thr 785 790 795 800 Gln Lys Arg Cys Leu Thr Gln Asn Asp Leu Lys Met Gln Thr Gln Gln 805 810 815 Val Asn Thr Leu Lys Met Ser Glu Lys Gln Leu Lys Gln Glu Asn Asn 820 825 830 His Leu Met Glu Met Lys Met Asn Leu Glu Lys Gln Asn Ala Glu Leu 835 840 845 Arg Lys Glu Arg Gln Asp Ala Asp Gly Gln Met Lys Glu Leu Gln Asp 850 855 860 Gln Leu Glu Ala Glu Gln Tyr Phe Ser Thr Leu Tyr Lys Thr Gln Val 865 870 875 880 Arg Glu Leu Lys Glu Glu Cys Glu Glu Lys Thr Lys Leu Gly Lys Glu 885 890 895 Leu Gln Gln Lys Lys Gln Glu Leu Gln Asp Glu Arg Asp Ser Leu Ala 900 905 910 Ala Gln Leu Glu Ile Thr Leu Thr Lys Ala Asp Ser Glu Gln Leu Ala 915 920 925 Arg Ser Ile Ala Glu Glu Gln Tyr Ser Asp Leu Glu Lys Glu Lys Ile 930 935 940 Met Lys Glu Leu Glu Ile Lys Glu Met Met Ala Arg His Lys Gln Glu 945 950 955 960 Leu Thr Glu Lys Asp Ala Thr Ile Ala Ser Leu Glu Glu Thr Asn Arg 965 970 975 Thr Leu Thr Ser Asp Val Ala Asn Leu Ala Asn Glu Lys Glu Glu Leu 980 985 990 Asn Asn Lys Leu Lys Asp Val Gln Glu Gln Leu Ser Arg Leu Lys Asp 995 1000 1005 Glu Glu Ile Ser Ala Ala Ala Ile Lys Ala Gln Phe Glu Lys Gln 1010 1015 1020 Leu Leu Thr Glu Arg Thr Leu Lys Thr Gln Ala Val Asn Lys Leu 1025 1030 1035 Ala Glu Ile Met Asn Arg Lys Glu Pro Val Lys Arg Gly Asn Asp 1040 1045 1050 Thr Asp Val Arg Arg Lys Glu Lys Glu Asn Arg Lys Leu His Met 1055 1060 1065 Glu Leu Lys Ser Glu Arg Glu Lys Leu Thr Gln Gln Met Ile Lys 1070 1075 1080 Tyr Gln Lys Glu Leu Asn Glu Met Gln Ala Gln Ile Ala Glu Glu 1085 1090 1095 Ser Gln Ile Arg Ile Glu Leu Gln Met Thr Leu Asp Ser Lys Asp 1100 1105 1110 Ser Asp Ile Glu Gln Leu Arg Ser Gln Leu Gln Ala Leu His Ile 1115 1120 1125 Gly Leu Asp Ser Ser Ser Ile Gly Ser Gly Pro Gly Asp Ala Glu 1130 1135 1140 Ala Asp Asp Gly Phe Pro Glu Ser Arg Leu Glu Gly Trp Leu Ser 1145 1150 1155 Leu Pro Val Arg Asn Asn Thr Lys Lys Phe Gly Trp Val Lys Lys 1160 1165 1170 Tyr Val Ile Val Ser Ser Lys Lys Ile Leu Phe Tyr Asp Ser Glu 1175 1180 1185 Gln Asp Lys Glu Gln Ser Asn Pro Tyr Met Val Leu Asp Ile Asp 1190 1195 1200 Lys Leu Phe His Val Arg Pro Val Thr Gln Thr Asp Val Tyr Arg 1205 1210 1215 Ala Asp Ala Lys Glu Ile Pro Arg Ile Phe Gln Ile Leu Tyr Ala 1220 1225 1230 Asn Glu Gly Glu Ser Lys Lys Glu Gln Glu Phe Pro Val Glu Pro 1235 1240 1245 Val Gly Glu Lys Ser Asn Tyr Ile Cys His Lys Gly His Glu Phe 1250 1255 1260 Ile Pro Thr Leu Tyr His Phe Pro Thr Asn Cys Glu Ala Cys Met 1265 1270 1275 Lys Pro Leu Trp His Met Phe Lys Pro Pro Pro Ala Leu Glu Cys 1280 1285 1290 Arg Arg Cys His Ile Lys Cys His Lys Asp His Met Asp Lys Lys 1295 1300 1305 Glu Glu Ile Ile Ala Pro Cys Lys Val Tyr Tyr Asp Ile Ser Thr 1310 1315 1320 Ala Lys Asn Leu Leu Leu Leu Ala Asn Ser Thr Glu Glu Gln Gln 1325 1330 1335 Lys Trp Val Ser Arg Leu Val Lys Lys Ile Pro Lys Lys Pro Pro 1340 1345 1350 Ala Pro Asp Pro Phe Ala Arg Ser Ser Pro Arg Thr Ser Met Lys 1355 1360 1365 Ile Gln Gln Asn Gln Ser Ile Arg Arg Pro Ser Arg Gln Leu Ala 1370 1375 1380 Pro Asn Lys Pro Ser 1385 539DNAArtificial SequenceSynthetic oligonucleotide 5cggtttgttt gggtttgggt ttgggtttgg gtttgggtt 39639DNAArtificial SequenceSynthetic oligonucleotide 6ggcttgcctt acccttaccc ttacccttac ccttaccct 39720DNAArtificial SequenceSynthetic oligonucleotide 7tgtgctggcc catcactttg 20823DNAArtificial SequenceSynthetic oligonucleotide 8accagccacc actttctgat agg 23

Claims

1-26. (canceled)

27. A method of immortalizing primary keratinocytes, comprising (i) culturing the primary keratinocytes in the presence of fibroblast feeder cells and in media containing an effective amount of a ROCK inhibitor for a period of time sufficient to allow immortalization of the primary keratinocytes; and (ii) continuing to culture the immortalized keratinocytes in media lacking the ROCK inhibitor, wherein the immortalized keratinocytes retain the capacity to differentiate when cultured in media lacking the ROCK inhibitor.

28. The method of claim 27, wherein continuing to culture the immortalized keratinocytes comprises culturing the immortalized keratinocytes until they form an organotypic tissue equivalent.

29. The method of claim 27, wherein the primary keratinocytes are foreskin keratinocytes, vaginal keratinocytes or cervical keratinocytes.

30. The method of claim 27, wherein the ROCK inhibitor is Y-27632.

31. The method of claim 30, wherein the effective amount of Y-27632 is about 1 to about 100 .mu.M.

32. The method of claim 30, wherein the effective amount of Y-27632 is about 5 to 25 .mu.M.

33. The method of claim 27, wherein the primary keratinocytes are cultured in media containing the ROCK inhibitor for at least 15 days.

34. The method of claim 30, wherein the effective amount of Y-27632 is about 10 .mu.M.

35. The method of claim 27, wherein the ROCK inhibitor is a small molecule inhibitor.

36. The method of claim 35, wherein the effective amount of the ROCK inhibitor is about 1 to about 100 .mu.M.

37. The method of claim 35, wherein the effective amount of the ROCK inhibitor is about 5 to about 25 .mu.M.

38. The method of claim 35, wherein the effective amount of the ROCK inhibitor is about 10 .mu.M.

39. The method of claim 27, wherein the ROCK inhibitor is fasudil.

40. The method of claim 27, wherein the primary keratinocytes are cultured in media containing the ROCK inhibitor for at least 20 days.

41. The method of claim 27, wherein the primary keratinocytes are cultures in media containing the ROCK inhibitor for at least 40 days.

42. The method of claim 27, wherein the primary keratinocytes are cultured in media containing the ROCK inhibitor for at least 60 days.

43. The method of claim 27, wherein the primary keratinocytes are cultured in media containing the ROCK inhibitor for at least 100 days.