U.S. patent application number 14/356522 was filed with the patent office on 2014-10-30 for glypican-3-specific antibody and uses thereof.
This patent application is currently assigned to The Trustees of the University of Pennsylvania. The applicant listed for this patent is GOVERNMENT OF THE UNITED STATES OF AMERICA, The Trustees of the University of Pennsylvania. Invention is credited to David Kaplan.
Application Number | 20140322216 14/356522 |
Document ID | / |
Family ID | 48290459 |
Filed Date | 2014-10-30 |
United States Patent
Application |
20140322216 |
Kind Code |
A1 |
Kaplan; David |
October 30, 2014 |
GLYPICAN-3-SPECIFIC ANTIBODY AND USES THEREOF
Abstract
The present invention relates to compositions and methods for
diagnosing and treating diseases, disorders or conditions
associated with dysregulated expression of GPC3. The invention
provides novel antibodies that specifically bind to glypican-3
(GPC3). The invention also relates to a fully human chimeric
antigen receptor (CAR) wherein the CAR is able to target GPC3.
Inventors: |
Kaplan; David; (Media,
PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Trustees of the University of Pennsylvania
GOVERNMENT OF THE UNITED STATES OF AMERICA |
Philadephia
Washington |
PA
DC |
US
US |
|
|
Assignee: |
The Trustees of the University of
Pennsylvania
Philadelphia
PA
GOVERNMENT OF THE UNITED STATES OF AMERICA
Washington
DC
|
Family ID: |
48290459 |
Appl. No.: |
14/356522 |
Filed: |
October 31, 2012 |
PCT Filed: |
October 31, 2012 |
PCT NO: |
PCT/US2012/062765 |
371 Date: |
May 6, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61557174 |
Nov 8, 2011 |
|
|
|
Current U.S.
Class: |
424/134.1 ;
530/387.3 |
Current CPC
Class: |
C07K 2317/92 20130101;
C07K 14/70521 20130101; C07K 16/18 20130101; C07K 2317/622
20130101; C07K 16/2809 20130101; G01N 33/57438 20130101; C07K 16/30
20130101; C07K 16/303 20130101 |
Class at
Publication: |
424/134.1 ;
530/387.3 |
International
Class: |
C07K 16/18 20060101
C07K016/18; C07K 14/705 20060101 C07K014/705; C07K 16/28 20060101
C07K016/28 |
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. (canceled)
13. (canceled)
14. An isolated chimeric antigen receptor (CAR) comprising a human
GPC3 binding domain and a CD3 zeta signaling domain.
15. The isolated CAR of claim 14, further comprising the sequence
of a co-stimulatory signaling domain.
16. The isolated CAR of claim 15, wherein the co-stimulatory
signaling domain is selected from the group consisting of the CD28
signaling domain, the 4-1BB signaling domain, and any combination
thereof.
17. The isolated CAR of claim 14, wherein the human GPC3 binding
domain is a human antibody or a fragment thereof is selected from
the group consisting of an Fab fragment, an F(ab').sub.2 fragment,
an Fv fragment, and a single chain Fv (scFv).
18. The isolated CAR of claim 15, wherein the antibody or a
fragment thereof comprises a heavy chain and light chain, wherein
the amino acid sequence of the heavy chain is selected from the
group consisting of SEQ ID NOs: 12-16 and the amino acid sequence
of the light chain is selected from the group consisting of SEQ ID
NOs: 17-21.
19. A method of providing an anti-tumor immunity in a mammal, the
method comprising administering to the mammal an effective amount
of a genetically modified cell comprising an isolated nucleic acid
sequence encoding a chimeric antigen receptor (CAR), wherein the
isolated nucleic acid sequence comprises the sequence of a human
GPC3 binding domain and the nucleic acid sequence of a CD3 zeta
signaling domain.
20. The method of claim 19, wherein the cell is an autologous T
cell.
21. The method of claim 19, wherein the mammal is a human.
22. A method of treating a mammal having a disease, disorder or
condition associated with dysregulated expression of mesothelin,
the method comprising administering to the mammal an effective
amount of a genetically modified cell comprising an isolated
nucleic acid sequence encoding a chimeric antigen receptor (CAR),
wherein the isolated nucleic acid sequence comprises the sequence
of a human GPC3 binding domain and the nucleic acid sequence of a
CD3 zeta signaling domain.
23. The method of claim 22, wherein the disease, disorder or
condition associated with dysregulated expression of GPC3 is
selected from the group consisting of liver cancer, pancreatic
cancer, ovarian cancer, stomach cancer, lung cancer, endometrial
cancer, hepatocellular carcinoma, and any combination thereof.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional
Application Ser. No. 61/557,174, filed Nov. 8, 2011, the contents
of which are incorporated by reference herein in their
entirety.
BACKGROUND OF THE INVENTION
[0002] Hepatocellular carcinoma (HCC) is the fifth most common
cancer and the third most common cause of cancer-related death
worldwide (EI-Serag, 2002, J Clin Gastroenterology 35:S72-78).
During transformation from dysplastic regenerating hepatocytes to
malignant hepatoma cells, several tumor-associated proteins are
expressed that potentially could allow immune discrimination of
malignant hepatocytes from surrounding non-tumor cells. Glypican-3
(GPC3), an oncofetal antigen re-expressed in a high frequency of
neoplastic hepatocytes (Vidali, et al., 2008, J hepatol 48:399-406;
Verbeeck, et al., 2008. J Clin Microbiol 46:1901-1906; Levrero, et
al., 2009, J hepatol 51:581-592; Shaker, et al., 2009, Br J
Dermatol 160:980-983) has emerged as a useful immunohistochemical
diagnostic test (Anatelli, et al., 2008, Am J Clin Path
130:219-223; Baumhoer, et al., 2008, Am J Clin Path 129:899-906;
Coston, et al., 2008, Am J Surg Pathol 32:433-444) and potential
biomarker (Aburatani, 2005, J Gastroenterol 40. S16:1-6; Capurro,
et al., 2005, Cancer Res 65:372; Capurro, et al., 2003.
Gastroenterology 125:89-97; Hippo, et al., 2004, Cancer Res
64:2418-2423) for hepatocellular carcinoma. Glypican-3 appears
critical for the association of growth factors such as IGF-2. BMP-7
and FGF-2 with growth factor receptors (Thapa, et al., 2009, J
Paediatr Child Health 45:71-72; Zittermann, et al., 2010, Int J
Cancer 126:1291-1301) but also may play an immunomodulatory role
(Takai, et al., 2009, Cancer Biol Ther 8:2329-2338). Inhibition of
glypican-3 function via knockdown (Ruan, et al., 2011, Int J Mol
Med 28:497-503; Sun, et al., 2011, Neoplasia 13:735-747) or
competition (Zittermann, et al., 2010, Int J Cancer 126:1291-1301;
Feng, et al., 2011, Int J Cancer 128:2246-2247) has a profound
negative effect on HCC cell line proliferation. Unlike any other
tumor antigen associated with hepatocellular carcinoma to date,
GPC3 is a glycophosphatidylinositiol-linked membrane-associated
protein with a large extracellular domain attractive for
antibody-directed therapy. An anti-glypican-3 antibody that induces
antibody-dependent cytotoxicity has been shown to have anti-tumor
effect in a xenograft animal model of hepatocellular carcinoma
(Takai, et al., 2009, Cancer Biol Ther 8: 2329-38); this antibody
has subsequently been humanized (Nakano, et al. 2010, Anticancer
Drugs 21:907-916) and is entering human clinical trials. Thus the
relative specific expressions of GPC3 on cell surface of malignant
HCC tissues make it an attractive target for HCC tumor
immunotherapy. However, the GPC3-specific T bodies, particularly
the GPC3-specific scFv as targeting moieties, remain under
development. The present invention addresses this need.
SUMMARY OF THE INVENTION
[0003] The invention provides an isolated polynucleotide encoding a
human anti-GPC3 antibody or a fragment thereof comprising a heavy
chain and light chain, wherein the amino acid sequence of the heavy
chain is selected from the group consisting of SEQ ID NOs: 12-16
and the amino acid sequence of the light chain is selected from the
group consisting of SEQ ID NOs: 17-21.
[0004] In one embodiment, the isolated polynucleotide encoding a
human anti-GPC3 antibody or a fragment comprises nucleic acid
sequences for a heavy chain and light chain, wherein the nucleic
acid sequence of the heavy chain is selected from the group
consisting of SEQ ID NOs: 52-56 and the nucleic acid sequence of
the light chain is selected from the group consisting of SEQ ID
NOs: 57-61.
[0005] The invention also provides an isolated polypeptide encoding
a human anti-GPC3 antibody or fragment thereof comprising a heavy
chain and light chain, wherein the amino acid sequence of the heavy
chain is selected from the group consisting of SEQ ID NOs: 12-16
and the amino acid sequence of the light chain is selected from the
group consisting of SEQ ID NOs: 17-21.
[0006] In one embodiment, the antibody fragment comprises a
fragment selected from the group consisting of an Fab fragment, an
F(ab').sub.2 fragment, an Fv fragment, and a single chain Fv
(scFv).
[0007] The invention also provides a method for diagnosing a
condition associated with the expression of GPC3 in a cell, the
method comprising a) contacting the cell with a human anti-GPC3
antibody fragment comprising a heavy chain and light chain, wherein
the amino acid sequence of the heavy chain is selected from the
group consisting of SEQ ID NOs: 12-16 and the amino acid sequence
of the light chain is selected from the group consisting of SEQ ID
NOs: 17-21; and b) detecting the presence of GPC3 wherein the
presence of GPC3 diagnoses for a condition associated with the
expression of GPC3.
[0008] The invention also provides a method of diagnosing,
prognosing, or determining risk of liver cancer in a mammal, the
method comprising detecting the expression of GPC3 in a sample
derived from the mammal, the method comprising: a) contacting the
sample with a human anti-GPC3 antibody fragment comprising a heavy
chain and light chain, wherein the amino acid sequence of the heavy
chain is selected from the group consisting of SEQ ID NOs: 12-16
and the amino acid sequence of the light chain is selected from the
group consisting of SEQ ID NOs: 17-21; and b) detecting the
presence of GPC3 wherein the presence of GPC3 diagnoses for cancer
in the mammal.
[0009] The invention also includes a method of inhibiting growth of
a GPC3-expressing tumor cell, the method comprising contacting the
tumor cell with a human anti-GPC3 antibody or a fragment thereof
comprising a heavy chain and light chain, wherein the amino acid
sequence of the heavy chain is selected from the group consisting
of SEQ ID NOs: 12-16 and the amino acid sequence of the light chain
is selected from the group consisting of SEQ ID NOs: 17-21.
[0010] The invention also provides an isolated nucleic acid
sequence encoding a chimeric antigen receptor (CAR), wherein the
isolated nucleic acid sequence comprises the sequence of a human
GPC3 binding domain and the sequence of a CD3 zeta signaling
domain.
[0011] In one embodiment, the isolated nucleic acid sequence
encoding a CAR comprises the sequence of a co-stimulatory signaling
domain.
[0012] In one embodiment, the co-stimulatory signaling domain is
selected from the group consisting of the CD2S signaling domain,
the 4-1BB signaling domain, and any combination thereof.
[0013] In one embodiment, the human GPC3 binding domain is a human
antibody or a fragment thereof selected from the group consisting
of an Fab fragment, an F(ab').sub.2 fragment, an Fv fragment, and a
single chain Fv (scFv).
[0014] In one embodiment, the antibody or a fragment thereof
comprises a heavy chain and light chain, wherein the amino acid
sequence of the heavy chain is selected from the group consisting
of SEQ ID NOs: 12-16 and the amino acid sequence of the light chain
is selected from the group consisting of SEQ ID NOs: 17-21.
[0015] In one embodiment, the antibody or a fragment thereof
comprises nucleic acid sequences for a heavy chain and light chain,
wherein the nucleic acid sequence of the heavy chain is selected
from the group consisting of SEQ ID NOs: 52-56 and the nucleic acid
sequence of the light chain is selected from the group consisting
of SEQ ID NOs: 57-61.
[0016] The invention provides an isolated chimeric antigen receptor
(CAR) comprising a human GPC3 binding domain and a CD3 zeta
signaling domain.
[0017] In one embodiment, the CAR further comprises the sequence of
a co-stimulatory signaling domain.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The following detailed description of preferred embodiments
of the invention will be better understood when read in conjunction
with the appended drawings. For the purpose of illustrating the
invention, there are shown in the drawings embodiments which are
presently preferred. It should be understood, however, that the
invention is not limited to the precise arrangements and
instrumentalities of the embodiments shown in the drawings.
[0019] FIG. 1, comprising FIG. 1A through FIG. 1C, is a series of
images demonstrating target antigens applied to screen yeast
display library. FIG. 1A is a schematic diagram of the primary
structure of two antigen approaches selected from hGPC3 protein.
The 29mer hGPC3.sub.530-558 peptide and truncated hGPC3 fused with
GST are represented by gray regions. Two glycosaminoglycan binding
site (Gag) and putative glycosylphosphatidyl-inositol (GPI) anchor
regions within the C-terminal hydrophobic region of hGPC3 are
shown. FIG. 1B depicts an image of SDS-PAGE gel stained with
Coomassie brilliant blue showing the expressed GST-fusion protein.
BL21 bacteria transformed with the plasmid pGEX-4T/GPC3, encoding a
GST-human/mouse GPC3 fusion protein, were induced to express the
recombinant protein in presence of IPTG. Recombinant proteins were
purified by glutathione agarose beads. The purified proteins (10
ul/each) were electrophoresed on a 10% SDS-PAGE gel for analysis.
FIG. 1C is an image confirming of the purified recombinant protein
by western blot. The purified recombinant protein were subjected to
10% SDS-PAGE and transferred to a nitrocellulose filter. The filter
was probed with a commercial monoclonal anti-human GPC3 antibody
(clone 1G12). Note the cross-reactivity of murine GPC3 with 1G12
control antibody.
[0020] FIG. 2, comprising FIG. 2A and FIG. 2B, is a series of
images demonstrating enrichment of hGPC3-reactive scFvs. FIG. 2A
depicts surface co-localization of hGPC3-reactive yeast cells after
two rounds of MACS-sorting. Yeast display library were incubated
with target antigens and MACS sorting were performed.
hGPC3-reactive yeast are double-labeled with mouse anti-c-myc
detected with anti-mouse Alexa Fluor 488 secondary and biotinylated
hGPC3-GST detected by streptavidin-phycoerythrin. FIG. 2B is an
image demonstrating successful enrichment of hGPC3-reactive yeast
cells by three rounds of FACS sorting. Representative FACS sorting
using 29mer peptide hGPC3.sub.530-558 antigen was shown. Gradually
decreasing concentration of antigen was utilized in each round.
Yeast cells without antigen incubation were used as control. In
third FACS sorting, the PE-conjugated neutravidin was used in order
to minimize enrichment of streptavidin-specific scFv also present
in the library.
[0021] FIG. 3, comprising FIG. 3A through FIG. 3C, is a series of
images demonstrating validation of scFv specificity by ELISA. FIG.
3A depicts preparation of soluble scFvs. scFv cDNA amplified from
the enriched yeast population was co-transformed into YVH10 yeast
using p416-BCCR vector. Yeast was induced to secrete scFvs with 2%
galactose. Culture supernatant (5 .mu.l) was loaded into SDS-PAGE
gel for detection by anti-V5 mAb in Western Blot. Approximately 80%
of yeast transformants produced soluble scFv. FIG. 3B depicts the
results of ELISA screening of 576 scFv for binding to hGPC3-GST.
Maxsorb plates were coated with hGPC3-GST and GST protein. scFvs
were incubated in plates then washed extensively. HRP-conjugated
anti-V5 mAb was used for quantification of binding. Each scFv was
tested in parallel for binding to hGPC3-GST and GST. FIG. 3C
depicts that scFvs with highest hGPC3-GST/GST binding ratio were
screened for binding to full length hGPC3 protein expressed by
mammalian cells.
[0022] FIG. 4, comprising FIG. 4A through FIG. 4C, is a series of
images demonstrating affinity assessment of scFvs. FIG. 4A depicts
the results of immunoblot analysis of binding of scFv to rhGPC3.
The antigens including rhGPC3 and GST protein were spotted onto
cellulose membrane (10 ng/each). After the blocking step the
membrane were incubated with the scFvs antibody in room temperature
for 1 h. The binding of scFv to antigen was detected by incubation
with mouse anti-V5 mAb following by infrared dye IR680-labeled
anti-mouse antibodies. PBS was used as negative control. FIG. 4B
depicts results of direct ELISA for affinity determination of scFv
3E11. Two different concentrations of rhGPC3 protein (0.5 and 1.0
ug/ml) were coated and incubated with serial diluted scFv 3E11. For
detection, mouse-sourced anti-V5 mAb following HRP-conjugated
anti-mouse antibody and SureBlue substrate (measured at 450 nm) was
used. FIG. 4C depicts EC50 values for 5 candidate scFvs determined
by direct ELISA, Assays were performed twice separately for each
scFv.
[0023] FIG. 5, comprising FIG. 5A through 5D, is a series of images
demonstrating that scFvs specifically bind glypican-3-expressing
cell lines. FIG. 5A is an image of a Western blot confirming the
expression of glypican-3 in HepG2 and 293T.GPC3, knockdown in
HepG2.sh57, and absence of expression in parental 293T and Hs578t.
1G12 antibody was used for detection. FIG. 5B is an image depicting
the detection of hGPC3 expression on HepG2 and Hs578T cells by
immunofluorescent microscopy using commercial 1G12 anti-GPC3 mAb
followed by anti-mouse Alexa Fluor 488. FIG. 5C is an image
depicting binding of scFvs to HepG2 and Hs578T cells by flow
cytometry using indicated scFv or 1G12 mAb followed by either
APC-conjugated anti-V5 mAb or anti-mouse IR680 (for 1G12 only).
Cells incubated with isotype antibody were used as negative control
(grey area). FIG. 5D is an image of immunofluorescence of scFvs
(detected with anti-V5 Alexa Fluor 488) detected on
HepG2.tdTomato.
[0024] FIG. 6, comprising FIG. 6A through FIG. 6E, is a series of
images demonstrating scFv validation by HepG2 and HepG2-shRNA cell
lines. FIG. 6A depicts screening results of shRNAs for hGPC3
silencing. HEK 293 cells were transfected with shRNA-harboring
pSIREN-ZsGreen vector and hGPC3.sub.368-551 expressing plasmid.
Expression of myc-tagged hGPC3.sub.368-551 was assessed by Western
blot using anti-myc antibody. GAPDH was used as control. FIG. 6B
and FIG. 6C depict lower expression of hGPC3 in HepG2-sh57
expressing cells. Stable sh57 expression was established in HepG2
cell line via retroviral transduction. hGPC3 expression in these
cells was detected by FACS using anti-GPC3 antibody (1012) followed
by anti-mouse APC. Unstained HepG2 cells (grey area), mouse isotype
control-stained HepG2 (black line), HepG2 cells, and HepG2-sh57 are
shown. The mean fluorescent intensity of 3E11 scFv binding in HepG2
and HepG2-sh57 cells were calculated in FIG. 6C. FIG. 6D depicts
scFv binding to surface of HepG2 (black line) and HepG2-sh57 (grey
area) cells demonstrated by FACS. Cells were incubated with the
indicated scFvs and detected by APC-conjugated anti-V5 mAb. FIG.
6E, is a series of images of differential confocal
immunofluororescence staining of scFv with HepG2 (GFP-negative) and
HepG2.sh57 (GFP-positive) cells. The cellular mixture of HepG2 and
HepG2.sh57 (1:1) was cultured in slice chamber. Cells were stained
with the indicated scFv and detected by anti-V5 mAb followed by
anti-mouse Alexa Fluor 546 secondary antibody.
[0025] FIG. 7, comprising FIGS. 7A and 7B, is a series of images
demonstrating the lack of impact that scFvs have on the
proliferation of HepG2 cells. FIG. 7A is an image demonstrating
validation of an MTT assay as a measurement of growth of HepG2.
HepG2 and HepG2.sh57 cell lines that were grown for 4 days in
culture. Manual counting with hematocytonmeter of trypsinized cells
correlated strongly with MTT OD450 (R.sup.2=0.99). FIG. 7B is an
image demonstrating the effect of scFv on cell line proliferation.
MT OD450 for HepG2 cultured for 2 or 4 days in the presence or
absence of 2E10, 3E11, 3D8, 4G5, and 2G9 at 1 .mu.g/ml showed no
evidence of growth inhibition.
[0026] FIG. 8, comprising FIG. 8A through 8D, is a series of images
demonstrating generation of anti-hGPC3 chimeric antigen receptor
engineered T cells. FIG. 8A is a diagram of lentiviral vectors
encoding hGPC3-specific scFv-based CAR constructs. CARs with
hGPC3-specific scFv fused with CD3.lamda. in combination with CD137
and/or CD28 costimulatory module or truncated CD3; (negative
control) were constructed. FIG. 8B depicts western blotting of CAR
CD3C expression in plasmid-transformed 293T cells. Lane 1:
non-transduced cells as negative control: Lane 2: 3E11-dZ Lane 3:
3E11-BBZ; Lane 4: 3E11-28BBZ. FIG. 8C depicts transduction
efficiency of lentiviral particles in peripheral blood-isolated T
cells. Lentivirus encoding GFP, prepared with the same conditions
as the other lentivius, were transduced into peripheral
blood-isolated T cells from healthy donor. GFP expression in T
cells was analyzed after two and ten days infection. FIG. 8D
depicts flag expression on the surface of transduced T cells. One
protein tag FLAG was inserted at the N-terminal of the lentiviral
plasmid 3E11-28BBZ, and its expression on the 3E11-28BBZ
lentivirus-transduced T cells were detected by FACS using anti-Flag
mAb following Alex-546-labelled secondary antibody.
[0027] FIG. 9 is an image depicting results of 3E11-CAR expression
on human T cells after transductimon with lentivirus compared with
parallel untransduced T cells. CD3+ T cells isolated from
peripheral blood of healthy donor were placed in culture with
anti-CD3/CD28 beads. The cells were transduced 1 day later with
lentivirus encoding 3E11-dZ, and 3E11-BBZ and 3E 1-28BZ. The third
day after culture initiation, the cells were analyzed for CAR
expression by staining with anti-human Fab antibodies or isotype
control antibodies. The activated but untransduced cells were used
as control. Percent transduction is indicated.
[0028] FIG. 10, comprising FIGS. 10A and 10B, is a series of images
depicting surface expression of GPC3 expression and
antigen-specific lysis of GPC3-positive tumor cells. FIG. 10A
depicts surface GPC3 expression as shown by solid black line in
several human cancer cell lines by flow cytometry; isotype antibody
as shown by grey area was used as negative control. FIG. 10B
depicts antigen-specific lysis of GPC3-positive tumor cells by
human T lymphocytes transduced with 3E11-CARs in Cr51-release assay
at the indicated E/T ratio. 3E11-dZ transduced or GFP-transduced
human T lymphocytes served as controls.
[0029] FIG. 11, comprising FIGS. 11A through 11C, is a series of
images depicting schematics of a working model. FIG. 11A depicts
that region against which scFvs for glypican-3 were developed and
validated. FIG. 11B depicts structure of chimeric antigen receptor
(CAR) and signaling domains. FIG. 11C depicts overall schema of
redirecting T-cells based on CAR recognition of surface antigen to
activate T-cells independent of T-cell receptor: HLA
interactions.
[0030] FIG. 12, comprising FIG. 12A through 12D, is a series of
images demonstrating scFv candidates generated against recombinant
GPC3-GST fusion protein bind specifically glypican-3-expressing
human cell lines. FIG. 12A depicts binding of candidate scFV by
FACS to HepG2 (GPC3+) and 293T (GPC3-) cell lines. Either no scFv
and no anti-V5 APC (gray shaded unstained control), no scFv plus
anti-V5 APC (fluorochrome control), or 20 ul scFv-containing yeast
culture supernatant plus anti-V5 APC as shown by black line were
incubated .times.30 min, washed, then acquired on BD FACSCanto.
FIG. 12B depicts binding of scFv to HepG2.tdTomato (red) detected
by anti-myc Alexa488. 1G12 is commercial positive control antibody.
FIG. 12C depicts knockdown of GPC3 expression (90% by sh57) and
reduction of scFv binding in shRNA57-transduced HepG2 cells.
shRNA57 was constructed in bicistronic retroviral vector encoding
GFP (left and right). scFv binding to cell membrane (center and
right) is significantly reduced in GFP+knocked-down HepG2 cells.
FIG. 121) depicts binding affinity curves determined by ELISA.
rhGPC3 at 1 ug/ml was precoated in 96 well plates and scFv added at
0.5-1 log dilutions over possible binding affinity range. EC50 were
determined using antigen-antibody reaction equation.
[0031] FIG. 13, comprising FIG. 13A through FIG. 13C, is a series
of images demonstrating generation of anti-hGPC3 chimeric antigen
receptor engineered T cells. FIG. 13A depicts .sup.51Cr assay
incubating GPC3 CAR with HepG2.GFP2ALuc hGPC3+ cells. Transduction
efficiency was approximately 50% for all constructs. FIG. 13B
depicts knockdown abrogates killing by CAR T-cells against
HepG2.sh57. FIG. 3C depicts the result of .sup.51Cr assays of CAR
transduced T-cells against HCE4 (hGPC3+), Hepa1-6 which expresses
murine GPC3 homologue for which no cross-reactivity seen, hs578t
(GPC3-) and K562 (GPC3-).
DETAILED DESCRIPTION
[0032] The present invention is based partly on the identification
of human-derived antibodies that specifically bind to glypican-3
(GPC3). The antibodies of the invention can be used for diagnostic
and in vivo therapeutic applications. In embodiment, a peptide
containing amino acids 530-558 or 368-548 of human GPC3 was used to
screen a paired display/secretory yeast library to isolate
human-derived scFv against GPC3.
[0033] In one embodiment, the scFv antibodies of the invention can
be used for diagnosing the presence of GPC3 in a biological sample.
In one embodiment, the scFv antibodies of the invention can be used
for diagnosing the presence of GPC3 in a tumor cell.
[0034] In one embodiment, the scFv antibodies of the invention can
be used for therapy against a disease, disorder or condition
associated with dysregulation of GPC3 expression. In one
embodiment, the scFv antibodies of the invention can be used for
cancer therapy against cancers associated with dysregulated
expression of GPC3.
[0035] The present invention relates generally to the treatment of
a patient having a cancer associated with dysregulated expression
of Glypican-3 (GPC3), or at risk of having a cancer associated with
dysregulated expression of GPC3, using cellular infusion. In one
embodiment, lymphocyte in fusion, preferably autologous lymphocyte
infusion is used in the treatment.
[0036] In one embodiment, PBMCs are collected from a patient in
need of treatment and T cells therefrom are engineered and expanded
using the methods described herein and then infused back into the
patient. In another embodiment, autologous or heterologous NK cells
or NK cell lines are engineered and expanded using the methods
described herein and then infused back into the patient. The
invention should not be limited to a particular cell or cell type.
Rather, any cell or cell type can be engineered and expanded using
the methods described herein and then infused back into the
patient.
[0037] The present invention also relates generally to the use of T
cells engineered to express a Chimeric Antigen Receptor (CAR). CARs
combine an antigen recognition domain of a specific antibody with
an intracellular signaling molecule. For example, the intracellular
signaling molecule can include but is not limited to CD3-zeta
chain, 4-1BB and CD28 signaling nodules and combinations thereof.
Preferably, the antigen recognition domain binds to GPC3. More
preferably, the antigen recognition domain comprises a fully human
anti-GPC3. Accordingly, the invention provides a fully human
anti-GPC3-CAR engineered into a T cell and methods of their use for
adoptive therapy.
[0038] In one embodiment, the invention includes autologous cells
that are transfected with a vector comprising a fully-human
anti-GPC3 CAR transgene. Preferably, the vector is a retroviral
vector. More preferably, the vector is a self-inactivating
lentiviral vector as described elsewhere herein.
[0039] In one embodiment, the anti-GPC3-CAR T cells of the
invention can be generated by introducing a lentiviral vector
comprising a GCPC3 binding domain. CD8.alpha. hinge and
transmembrane domain, and a CD3zeta signaling domain into the
cells. In some instances, the vector further comprises the
signaling domain of 4-1 BB. CD28, or a combination of both. In one
embodiment, the CAR-modified T cells of the invention are able to
replicate in vivo resulting in long-term persistence that can lead
to sustained tumor control.
[0040] In one embodiment, the scFv antibodies of the invention can
be cloned into vectors that allow expression in cis with cellular
cytotoxins. The combination of the scFv antibodies with cellular
cytotoxins can be used for transarterial infusion into patients in
need thereof.
DEFINITIONS
[0041] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the present
invention, the preferred materials and methods are described
herein. In describing and claiming the present invention, the
following terminology will be used.
[0042] It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting.
[0043] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the granunatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0044] "About" as used herein when referring to a measurable value
such as an amount, a temporal duration, and the like, is meant to
encompass variations of .+-.20% or .+-.10%, more preferably .+-.5%,
even more preferably .+-.1%, and still more preferably .+-.0.1%
from the specified value, as such variations are appropriate to
perform the disclosed methods.
[0045] The term "antibody," as used herein, refers to an
immunoglobulin molecule which specifically binds with an antigen.
Antibodies can be intact immunoglobulins derived from natural
sources or from recombinant sources and can be immunoreactive
portions of intact immunoglobulins. Antibodies are typically
tetramers of immunoglobulin molecules. The antibodies in the
present invention may exist in a variety of forms including, for
example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and
F(ab).sub.2, as well as single chain antibodies (scFv) and
humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow
et al., 1989, In: Antibodies: A Laboratory Manual. Cold Spring
Harbor, N.Y.; Houston et al., 1988. Proc. Natl. Acad. Sci. USA
85:5879-5883; Bird et al., 1988. Science 242:423-426).
[0046] The term "antibody fragment" refers to a portion of an
intact antibody and refers to the antigenic determining variable
regions of an intact antibody. Examples of antibody fragments
include, but are not limited to, Fab, Fab', F(ab')2, and Fv
fragments, linear antibodies, scFv antibodies, and multispecific
antibodies formed from antibody fragments.
[0047] An "antibody heavy chain," as used herein, refers to the
larger of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
[0048] An "antibody light chain," as used herein, refers to the
smaller of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
.kappa. and .lamda. light chains refer to the two major antibody
light chain isotypes.
[0049] By the term "synthetic antibody" as used herein, is meant an
antibody which is generated using recombinant DNA technology, such
as, for example, an antibody expressed by a bacteriophage as
described herein. The term should also be construed to mean an
antibody which has been generated by the synthesis of a DNA
molecule encoding the antibody and which DNA molecule expresses an
antibody protein, or an amino acid sequence specifying the
antibody, wherein the DNA or amino acid sequence has been obtained
using synthetic DNA or amino acid sequence technology which is
available and well known in the art.
[0050] The term "antigen" or "Ag" as used herein is defined as a
molecule that provokes an immune response. This immune response may
involve either antibody production, or the activation of specific
immunologically-competent cells, or both. The skilled artisan will
understand that any macromolecule, including virtually all proteins
or peptides, can serve as an antigen. Furthermore, antigens can be
derived from recombinant or genomic DNA. A skilled artisan will
understand that any DNA, which comprises a nucleotide sequences or
a partial nucleotide sequence encoding a protein that elicits an
immune response therefore encodes an "antigen" as that term is used
herein. Furthermore, one skilled in the art will understand that an
antigen need not be encoded solely by a full length nucleotide
sequence of a gene. It is readily apparent that the present
invention includes, but is not limited to, the use of partial
nucleotide sequences of more than one gene and that these
nucleotide sequences are arranged in various combinations to elicit
the desired immune response. Moreover, a skilled artisan will
understand that an antigen need not be encoded by a "gene" at all.
It is readily apparent that an antigen can be generated synthesized
or can be derived from a biological sample. Such a biological
sample can include, but is not limited to a tissue sample, a tumor
sample, a cell or a biological fluid.
[0051] The term "anti-tumor effect" as used herein, refers to a
biological effect which can be manifested by a decrease in tumor
volume, a decrease in the number of tumor cells, a decrease in the
number of metastases, an increase in life expectancy, or
amelioration of various physiological symptoms associated with the
cancerous condition. An "anti-tumor effect" can also be manifested
by the ability of the peptides, polynucleotides, cells and
antibodies of the invention in prevention of the occurrence of
tumor in the first place.
[0052] The term "autoimmune disease" as used herein is defined as a
disorder that results from an autoimmune response. An autoimmune
disease is the result of an inappropriate and excessive response to
a self-antigen. Examples of autoimmune diseases include but are not
limited to, Addision's disease, alopecia greata, ankylosing
spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's
disease, diabetes (Type I), dystrophic epidermolysis bullosa,
epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr
syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus
erythematosus, multiple sclerosis, myasthenia gravis, pemphigus
vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis,
sarcoidosis, scleroderma, Sjogren's syndrome,
spondyloorthropathies, thyroiditis, vasculitis, vitiligo, myxedema,
pernicious anemia, ulcerntive colitis, among others.
[0053] As used herein, the term "autologous" is meant to refer to
any material derived from the same individual to which it is later
to be re-introduced into the individual.
[0054] "Allogeneic" refers to a graft derived from a different
animal of the same species.
[0055] "Xenogeneic" refers to a graft derived from an animal of a
different species.
[0056] The term "cancer" as used herein is defined as disease
characterized by the rapid and uncontrolled growth of aberrant
cells. Cancer cells can spread locally or through the bloodstream
and lymphatic system to other parts of the body. Examples of
various cancers include but are not limited to, breast cancer,
prostate cancer, ovarian cancer, cervical cancer, skin cancer,
pancreatic cancer, colorectal cancer, renal cancer, liver cancer,
brain cancer, lymphoma, leukemia, lung cancer and the like.
[0057] As used herein, the term "conservative sequence
modifications" is intended to refer to amino acid modifications
that do not significantly affect or alter the binding
characteristics of the antibody containing the amino acid sequence.
Such conservative modifications include amino acid substitutions,
additions and deletions. Modifications can be introduced into an
antibody of the invention by standard techniques known in the art,
such as site-directed mutagenesis and PCR-mediated mutagenesis.
Conservative amino acid substitutions are ones in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g. lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine, tryptophan),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine,
proline, phenylalanine, methionine), beta-branched side chains
(e.g. threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one
or more amino acid residues within the CDR regions of an antibody
of the invention can be replaced with other amino acid residues
from the same side chain family and the altered antibody can be
tested for the ability to bind glypican-3 using the functional
assays described herein.
[0058] "Co-stimulatory ligand," as the term is used herein,
includes a molecule on an antigen presenting cell (e.g., an aAPC,
dendritic cell, B cell, and the like) that specifically binds a
cognate co-stimulatory molecule on a T cell, thereby providing a
signal which, in addition to the primary signal provided by, for
instance, binding of a TCR/CD3 complex with an MHC molecule loaded
with peptide, mediates a T cell response, including, but not
limited to, proliferation, activation, differentiation, and the
like. A co-stimulatory ligand can include, but is not limited to.
CD7, B7-1 (CD80), B7-2 (CD86), PD-L, PD-L2, 4-1BBL. OX40L,
inducible costimulatory ligand (ICOS-L), intercellular adhesion
molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM,
lymphotoxin beta receptor. 3/TR6, ILT3, ILT4, HVEM, an agonist or
antibody that binds Toll ligand receptor and a ligand that
specifically binds with B7-H3. A co-stimulatory ligand also
encompasses, inter alia, an antibody that specifically binds with a
co-stimulatory molecule present on a T cell, such as, but not
limited to, CD27, CD28, 4-1 BB, OX40, CD30, CD40. PD-1, ICOS,
lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7. LIGHT,
NKG2C. B7-H3, and a ligand that specifically binds with CD83.
[0059] A "co-stimulatory molecule" refers to the cognate binding
partner on a T cell that specifically binds with a co-stimulatory
ligand, thereby mediating a co-stimulatory response by the T cell,
such as, but not limited to, proliferation. Co-stimulatory
molecules include, but are not limited to an MHC class I molecule,
BTLA and a Toll ligand receptor.
[0060] The term "dysregulated" when used in the context of the
level of expression or activity of GPC3 refers to the level of
expression or activity that is different from the expression level
or activity of GPC3 in an otherwise identical healthy animal,
organism, tissue, cell or component thereof. The term
"dysregulated" also refers to the altered regulation of the level
of expression and activity of GPC3 compared to the regulation in an
otherwise identical healthy animal, organism, tissue, cell or
component thereof
[0061] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRN A) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0062] Unless otherwise specified, a "nucleotide sequence encoding
an amino acid sequence" includes all nucleotide sequences that are
degenerate versions of each other and that encode the same amino
acid sequence. Nucleotide sequences that encode proteins and RNA
may include introns.
[0063] "Effective amount" or "therapeutically effective amounC" are
used interchangeably herein, and refer to an amount of a compound,
formulation, material, or composition, as described herein
effective to achieve a particular biological result. Such results
may include, but are not limited to, the inhibition of virus
infection as determined by any means suitable in the art.
[0064] As used herein "endogenous" refers to any material from or
produced inside an organism, cell, tissue or system.
[0065] As used herein, the term "exogenous" refers to any material
introduced from or produced outside an organism, cell, tissue or
system.
[0066] The term "expression" as used herein is defined as the
transcription and/or translation of a particular nucleotide
sequence driven by its promoter.
[0067] "Expression vector" refers to a vector comprising a
recombinant polynucleotide comprising expression control sequences
operatively linked to a nucleotide sequence to be expressed. An
expression vector comprises sufficient cis-acting elements for
expression; other elements for expression can be supplied by the
host cell or in an in vitro expression system. Expression vectors
include all those known in the art, such as cosmids, plamnids
(e.g., naked or contained in liposomes) and viruses (e.g.,
lentiviruses, retroviruses, adenoviruses, and adeno-associated
viruses) that incorporate the recombinant polynucleotide.
[0068] "Homologous" as used herein, refers to the subunit sequence
identity between two polymeric molecules, e.g., between two nucleic
acid molecules, such as, two DNA molecules or two RNA molecules, or
between two polypeptide molecules. When a subunit position in both
of the two molecules is occupied by the same monomeric subunit;
e.g. if a position in each of two DNA molecules is occupied by
adenine, then they are homologous at that position. The homology
between two sequences is a direct function of the number of
matching or homologous positions; e.g., if half (e.g. five
positions in a polymer ten subunits in length) of the positions in
two sequences are homologous, the two sequences are 50% homologous;
if 90% of the positions (e.g., 9 of 10), are matched or homologous,
the two sequences are 90% homologous.
[0069] "Humanized" forms of non-human (e.g. murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding
subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. For the most part, humanized
antibodies are human immunoglobulins (recipient antibody) in which
residues from a complementary-determining region (CDR) of the
recipient are replaced by residues from a CDR of a non-human
species (donor antibodly) such as mouse, rat or rabbit having the
desired specificity, affinity, and capacity. In some instances, Fv
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies can comprise residues which are found neither
in the recipient antibody nor in the imported CDR or framework
sequences. These modifications are made to further refine and
optimize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin sequence. The humanized antibody optimally also will
comprise at least a portion of an immunoglobulin constant region
(Fc), typically that of a human immunoglobulin. For further
details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et
al., Nature, 332: 323-329, 1988; Presta. Curr. Op. Struct. Biol.,
2: 593-596, 1992.
[0070] "Fully human" refers to an immunoglobulin, such as an
antibody, where the whole molecule is of human origin or consists
of an amino acid sequence identical to a human form of the
antibody.
[0071] As used herein, an "instructional material" includes a
publication, a recording, a diagram, or any other medium of
expression which can be used to communicate the usefulness of the
compositions and methods of the invention. The instructional
material of the kit of the invention may, for example, be affixed
to a container which contains the nucleic acid, peptide, and/or
composition of the invention or be shipped together with a
container which contains the nucleic acid, peptide, and/or
composition. Alternatively, the instructional material may be
shipped separately from the container with the intention that the
instructional material and the compound be used cooperatively by
the recipient.
[0072] "Isolated" means altered or removed from the natural state.
For example, a nucleic acid or a peptide naturally present in a
living animal is not "isolated," but the same nucleic acid or
peptide partially or completely separated from the coexisting
materials of its natural state is "isolated." An isolated nucleic
acid or protein can exist in substantially purified form, or can
exist in a non-native environment such as, for example, a host
cell.
[0073] In the context of the present invention, the following
abbreviations for the commonly occurring nucleic acid bases are
used. "A" refers to adenosine, "C" refers to cytosine, "G" refers
to guanosine, "T" refers to thymidine, and "U" refers to
uridine.
[0074] Unless otherwise specified, a "nucleotide sequence encoding
an amino acid sequence" includes all nucleotide sequences that are
degenerate versions of each other and that encode the same amino
acid sequence. The phrase nucleotide sequence that encodes a
protein or an RNA may also include introns to the extent that the
nucleotide sequence encoding the protein may in some version
contain an intron(s).
[0075] A "lentivirus" as used herein refers to a genus of the
Retroviridae family. Lentiviruses are unique among the retroviruses
in being able to infect non-dividing cells; they can deliver a
significant amount of genetic infommtion into the DNA of the host
cell, so they are one of the most efficient methods of a gene
delivery vector. HIV, SIV, and FIV are all examples of
lentiviruses. Vectors derived from lentiviruses offer the means to
achieve significant levels of gene transfer in vivo.
[0076] As used herein, the terms "glypican-3," "glypican
proteoglycan 3," "GPC3," are used interchangeably, and include
variants, isoforms and species homologs of human Glypican-3.
Accordingly, human antibodies of this disclosure may, in certain
cases, cross-react with Glypican-3 from species other than human.
In certain embodiments, the antibodiea may be completely specific
for one or more human Glypican-3 proteins and may not exhibit
species or other types of non-human cross-reactivity. The complete
amino acid sequence of an exemplary human Glypican-3 has
Genbank/NCBI accession number NM004484.
[0077] The term "operably linked" refers to functional linkage
between a regulatory sequence and a heterologous nucleic acid
sequence resulting in expression of the latter. For example, a
first nucleic acid sequence is operably linked with a second
nucleic acid sequence when the first nucleic acid sequence is
placed in a functional relationship with the second nucleic acid
sequence. For instance, a promoter is operably linked to a coding
sequence if the promoter affects the transcription or expression of
the coding sequence. Generally, operably linked DNA sequences are
contiguous and, where necessary to join two protein coding regions,
in the same reading frame.
[0078] "Parenteral" administration of an immunogenic composition
includes, e.g., subcutaneous (s.c.), intravenous (i.v.),
intramuscular (i.m.), or intrasternal injection, or infusion
techniques.
[0079] The term "polynucleotide" as used herein is defined as a
chain of nucleotides. Funhermore, nucleic acids are polymers of
nucleotides. Thus, nucleic acids and polynucleotides as used herein
are interchangeable. One skilled in the art has the general
knowledge that nucleic acids are polynucleotides, which can be
hydrolyzed into the monomeric "nucleotides." The monomeric
nucleotides can be hydrolyzed into nucleosides. As used herein
polynucleotides include, but are not limited to, all nucleic acid
sequences which are obtained by any means available in the art,
including, without limitation, recombinant means, i.e. the cloning
of nucleic acid sequences from a recombinant library or a cell
genome, using ordinary cloning technology and PCR.TM., and the
like, and by synthetic means.
[0080] As used herein, the terms "peptide," "polypeptide," and
"protein" are used interchangeably, and refer to a compound
comprised of amino acid residues covalently linked by peptide
bonds. A protein or peptide must contain at least two amino acids,
and no limitation is placed on the maximum number of amino acids
that can comprise a protein's or peptide's sequence. Polypeptides
include any peptide or protein comprising two or more amino acids
joined to each other by peptide bonds. As used herein, the term
refers to both short chains, which also commonly are referred to in
the art as peptides, oligopeptides and oligomers, for example, and
to longer chains, which generally are referred to in the art as
proteins, of which there are many types. "Polypeptides" include,
for example, biologically active fragments, substantially
homologous polypeptides, oligopeptides, homodimers, heterodimers,
variants of polypeptides, modified polypeptides, derivatives,
analogs, fusion proteins, among others. The polypeptides include
natural peptides, recombinant peptides, synthetic peptides, or a
combination thereof.
[0081] The term "promoter" as used herein is defined as a DNA
sequence recognized by the synthetic machinery of the cell, or
introduced synthetic machinery, required to initiate the specific
transcription of a polynucleotide sequence.
[0082] As used herein, the term "promoter/regulatory sequence"
means a nucleic acid sequence which is required for expression of a
gene product operably linked to the promoter/regulatory sequence.
In some instances, this sequence may be the core promoter sequence
and in other instances, this sequence may also include an enhancer
sequence and other regulatory elements which are required for
expression of the gene product. The promoter/regulatory sequence
may, for example, be one which expresses the gene product in a
tissue specific manner.
[0083] A "constitutive" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide which encodes or
specifies a gene product, causes the gene product to be produced in
a cell under most or all physiological conditions of the cell.
[0084] An "inducible" promoter is a nucleotide sequence which, when
operably linked with a polynucleotide which encodes or specifies a
gene product, causes the gene product to be produced in a cell
substantially only when an inducer which corresponds to the
promoter is present in the cell.
[0085] A "tissue-specific" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide encodes or specified by
a gene, causes the gene product to be produced in a cell
substantially only if the cell is a cell of the tissue type
corresponding to the promoter.
[0086] A "signal transduction pathway" refers to the biochemical
relationship between a variety of signal transduction molecules
that play a role in the transmission of a signal from one portion
of a cell to another portion of a cell. The phrase "cell surface
receptor" includes molecules and complexes of molecules capable of
receiving a signal and transmitting signal across the plasma
membrane of a cell. An example of a "cell surface receptor" is
human GPC3.
[0087] "Single chain antibodies" refer to antibodies formed by
recombinant DNA techniques in which immunoglobulin heavy and light
chain fragments are linked to the Fv region via an engineered span
of amino acids. Various methods of generating single chain
antibodies are known, including those described in U.S. Pat. No.
4,694,778; Bird (1988) Science 242:423-442; Huston et al. (1988)
Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et. al. (1989) Nature
334:54454; Skerra et al. (1988) Science 242:1038-1041.
[0088] The term "subject" is intended to include living organisms
in which an immune response can be elicited (e.g., mammals).
[0089] As used herein, a "substantially purified" cell is a cell
that is essentially free of other cell types. A substantially
purified cell also refers to a cell which has been separated from
other cell types with which it is normally associated in its
naturally occurring state. In some instances, a population of
substantially purified cells refers to a homogenous population of
cells. In other instances, this term refers simply to cell that
have been separated from the cells with which they are naturally
associated in their natural state. In some embodiments, the cells
are cultured in vitro. In other embodiments, the cells are not
cultured in vitro.
[0090] The term "therapeutic" as used herein means a treatment
and/or prophylaxis. A therapeutic effect is obtained by
suppression, remission, or eradication of a disease state.
[0091] The term "transfected" or "transformed" or "transduced" as
used herein refers to a process by which exogenous nucleic acid is
transferred or introduced into the host cell. A "transfected" or
"transformed" or "transduced" cell is one which has been
transfected, transformed or transduced with exogenous nucleic acid.
The cell includes the primary subject cell and its progeny.
[0092] The phrase "under transcriptional control" or "operatively
linked" as used herein means that the promoter is in the correct
location and orientation in relation to a polynucleotide to control
the initiation of transcription by RNA polymerase and expression of
the polynucleotide.
[0093] A "vector" is a composition of matter which comprises an
isolated nucleic acid and which can be used to deliver the isolated
nucleic acid to the interior of a cell. Numerous vectors are known
in the art including, but not limited to, linear polynucleotides,
polynucleotides associated with ionic or amphiphilic compounds,
plasmids, and viruses. Thus, the term "vector" includes an
autonomously replicating plasmid or a virus. The term should also
be construed to include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into cells, such as, for
example, polylysine compounds, liposomes, and the like. Examples of
viral vectors include, but are not limited to, adenoviral vectors,
adeno-associated virus vectors, retroviral vectors, lentiviral
vectors, and the like.
[0094] By the term "specifically binds," as used herein, is meant
an antibody, or a ligand, which recognizes and binds with a cognate
binding partner (e.g., a stimulatory and/or costimulatory molecule
present on a T cell) protein present in a sample, but which
antibody or ligand does not substantially recognize or bind other
molecules in the sample.
[0095] By the term "stimulation," is meant a primary response
induced by binding of a stimulatory molecule (e.g., a TCRICD3
complex) with its cognate ligand thereby mediating a signal
transduction event, such as, but not limited to, signal
transduction via the TCR/CD3 complex. Stimulation can mediate
altered expression of certain molecules, such as downregulation of
TGF-.beta., and/or reorganization of cytoskeletal structures, and
the like.
[0096] A "stimulatory molecule," as the term is used herein, means
a molecule on a T cell that specifically binds with a cognate
stimulatory ligand present on an antigen presenting cell.
[0097] A "stimulatory ligand," as used herein, means a ligand that
when present on an antigen presenting cell (e.g., an aAPC, a
dendritic cell, a B-cell, and the like) can specifically bind with
a cognate binding partner (referred to herein as a "stimulatory
molecule") on a T cell, thereby mediating a primary response by the
T cell, including, but not limited to, activation, initiation of an
immune response, proliferation, and the like. Stimulatory ligands
are well-known in the art and encompass, inter alia, an MHC Class I
molecule loaded with a peptide, an anti-CD3 antibody, a
superagonist anti-CD28 antibody, and a superagonist anti-CD2
antibody.
[0098] Ranges: throughout this disclosure, various aspects of the
invention can be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc. as
well as individual numbers within that range, for example, 1, 2,
2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of
the range.
DESCRIPTION
[0099] The present invention provides isolated antibodies,
particularly human antibodies that bind specifically to GPC3. In
certain embodiments, the antibodies of the invention comprise
particular structural features such as CDR regions comprising
particular amino acid sequences. The invention also provides
methods of making such antibodies. The antibodies of the invention
can be incorporated into an immunoconjugate, a chimeric antigen
receptor (CAR), a pharmaceutical composition, and the like. In one
embodiment, the immunoconjugates of the invention may be
therapeutic agents, for example, cytotoxins or radioactive
isotopes. Accordingly, the present invention provides compositions
and methods for treating, among other diseases, cancer or any
malignancy or autoimmune disease in which expression of GPC3 is
dysregulated.
[0100] In one embodiment, the invention provides a cell (e.g., T
cell) engineered to express a chimeric antigen receptor (CAR)
wherein the CAR T cell exhibits an antitumor property. A preferred
antigen is GPC3. In one embodiment, the antigen recognition domain
of the CAR comprises a fully human anti-GPC3. Accordingly, the
invention provides a fully human anti-GPC3-CAR engineered into a T
cell and methods of their use for adoptive therapy.
[0101] In one embodiment, the anti-GPC3-CAR comprises one or more
intracellular domain selected from the group of a CD137 (4-1BB)
signaling domain, a CD28 signaling domain, a CD3zeta signal domain,
and any combination thereof. This is because the present invention
is partly based on the discovery that CAR-mediated T-cell responses
can be further enhanced with the addition of costimulatory domains.
For example, inclusion of the CD28 signaling domain significantly
increased anti-tumor activity and in vivo persistence of CAR T
cells compared to an otherwise identical CAR T cell not engineered
to express CD28.
Anti-Glypican-3 (anti-GPC3) Antibodies
[0102] The antibodies of the invention are characterized by
particular functional features or properties of the antibodies. For
example, the antibodies hind specifically to human Glypican-3.
Preferably, the antibodies of the invention bind to Glypican-3 with
high affinity, for example with an affinity EC50 ranging from about
5.0-110.9 nM. Preferably, the antibodies of the invention
specifically recognize naturally expressed hGPC3 protein on a cell
and do not cross-react to other surface proteoglycans.
[0103] In one embodiment, the antibodies of the invention are the
human antibodies designated as 3E11, 2G9, 4G5, 3D8, and 2E10. The
V.sub.H amino acid sequences of 3E11, 2G9, 4G5, 3D8, and 2E10 are
shown in SEQ ID NOs: 12, 13, 14, 15, and 16, respectively (Table
2). The V.sub.L amino acid sequences of 3E11, 2G9, 4G5, 3D8, and
2E10 are shown in SEQ ID NOs: 17, 18, 19, 20, and 21, respectively
(Table 2).
[0104] In one embodiment, the antibody contains heavy chain
variable regions (Table 1) having CDRs 1, 2 and 3 consisting of the
amino acid sequences set forth in SEQ ID NOs: in any of the
following (a) to (e):
[0105] (a) SEQ ID NOs: 22, 23, and 24 (3E11),
[0106] (b) SEQ ID NOs: 25, 26, and 27 (2G9),
[0107] (c) SEQ ID NOs: 28, 29, and 30 (405),
[0108] (d) SEQ ID NOs: 31, 32, and 33 (3D8),
[0109] (e) SEQ ID NOs: 34, 35, and 36 (2E 10).
[0110] In one embodiment, the antibody contains light chain
variable regions (Table 1) having CDRs 1, 2 and 3 consisting of the
amino acid sequences set forth in SEQ ID NOs: in any of the
following (f) to (j):
[0111] (f) SEQ ID NOs: 37, 38, and 39 (3E11).
[0112] (g) SEQ ID NOs: 40, 41, and 42 (2G9),
[0113] (h) SEQ ID NOs: 43, 44, and 45 (4G5).
[0114] (i) SEQ ID NOs: 46, 47, and 48 (3D8),
[0115] (j) SEQ ID NOs: 49, 50, and 51 (2E10).
[0116] Given that each of these antibodies can bind to Glypican-3,
the V.sub.H and V.sub.L sequences can be "mixed and matched" to
create other anti-Glypican-3 binding molecules of the invention.
Glypican-3 binding of such "mixed and matched" antibodies can be
tested using the binding assays described above and in the Examples
(e.g., ELISAs). Preferably, when VH and VL chains are mixed and
matched, a VH sequence from a particular VH/VL pairing is replaced
with a structurally similar VH sequence. Likewise, preferably a VL
sequence from a particular VH/VL pairing is replaced with a
structurally similar VL sequence. It will be readily apparent to
the ordinarily skilled artisan that novel VH and VL sequences can
be created by substituting one or more VH and/or VL CDR region
sequences with structurally similar sequences from the CDR
sequences disclosed herein.
[0117] In one embodiment, the invention provides antibodies that
comprise the heavy chain and light chain CDR1s, CDR2s and CDR3s of
3E11, 2G9, 4G5, 3D8, and 2E10, or combinations thereof.
[0118] In one embodiment, an antibody of the invention comprises
heavy and light chain variable regions comprising amino acid
sequences that are honmologous to the amino acid sequences of the
preferred antibodies described herein, and wherein the antibodies
retain the desired functional properties of the anti-Glypican-3
antibodies of the invention.
[0119] For example, the invention provides an isolated antibody, or
antigen binding portion thereof, comprising a heavy chain variable
region and a light chain variable region, wherein: (a) the heavy
chain variable region comprises an amino acid sequence that is at
least 80% homologous to an amino acid sequence selected from the
group consisting of SEQ ID NOs: 12, 13, 14, 15, and 16: (b) the
light chain variable region comprises an amino acid sequence that
is at least 80% homologous to an amino acid sequence selected from
the group consisting of 17, 18, 19, 20, and 21. Preferably, the
antibody binds to human Glypican-3 with an affinity of affinity
EC50 ranging from 5.0-110.9 nM.
[0120] In certain embodiments, an antibody of the invention
comprises a heavy chain variable region comprising CDR1, CDR2 and
CDR3 sequences and a light chain variable region comprising CDR1,
CDR2 and CDR3 sequences, wherein one or more of these CDR sequences
comprise specified amino acid sequences based on the preferred
antibodies described herein (e.g. 3E11, 2G9, 4G5, 3D8, and 2E10),
or conservative modifications thereof, and wherein the antibodies
retain the desired functional properties of the anti-Glypican-3
antibodies of the invention. Accordingly, the invention provides an
isolated antibody (e.g. scFv), or antigen binding portion thereof,
comprising a heavy chain variable region comprising CDR1, CDR2, and
CDR3 sequences and a light chain variable region comprising CDR1,
CDR2, and CDR3 sequences, wherein: (a) the heavy chain variable
region CDR3 sequence comprises an amino acid sequence selected from
the group consisting of amino acid sequences of SEQ ID NOs: 12, 13,
14, 15, and 16, and conservative modifications thereof; (b) the
light chain variable region CDR3 sequence comprises an amino acid
sequence selected from the group consisting of amino acid sequence
of SEQ ID NOs: 17, 18, 19, 20, and 21, and conservative
modifications thereof. Preferably, the antibody binds to human
Glypican-3 with an affinity of affinity EC50 ranging from 5.0-110.9
nM.
[0121] In another embodiment, the invention provides antibodies
that bind to the same epitope on human Glypican-3 as any of the
Glypican-3 antibodies of the invention (i.e., antibodies that have
the ability to cross-compete for binding to Glypican-3 with any of
the antibodies of the invention). In preferred embodiments, the
reference antibody for cross-competition studies can be one of the
antibodies described herein (e.g., 3E11, 2G9, 4G5, 3D8, and 2E10).
Such cross-competing antibodies can be identified based on their
ability to cross-compete with 4A6, 11E7, or 16D10 in standard
Glypican-3 binding assays. For example, Biacore analysis. ELISA
assays or flow cytometry may be used to demonstrate
cross-competition with the antibodies of the current invention. The
ability of a test antibody to inhibit the binding of, for example,
3E11, 2G9, 4G5, 3D8, or 2E10, to human Glypican-3 demonstrates that
the test antibody can compete with 3E11, 2G9, 4G5, 3D8, or 2E10 for
binding to human Glypican-3 and thus binds to the same epitope on
human Glypican-3 as 3E11, 2G9, 45C, 3D8, or 2E10.
[0122] An antibody of the invention further can be prepared using
an antibody having one or more of the VH and/or VL sequences
disclosed herein can be used as starting material to engineer a
modified antibody, which modified antibody may have altered
properties as compared to the starting antibody. An antibody can be
engineered by modifying one or more amino acids within one or both
variable regions (i.e., VH and/or VL), for example within one or
more CDR regions and/or within one or more framework regions.
Additionally or alternatively, an antibody can be engineered by
modifying residues within the constant region(s), for example to
alter the effector function(s) of the antibody.
CAR Composition
[0123] The present invention encompasses a recombinant DNA
construct comprising sequences of an antibody of the invention that
binds specifically to human glypican-3, wherein the sequence of the
antibody or a fragment thereof is operably linked to the nucleic
acid sequence of an intracellular domain. The intracellular domain
or otherwise the cytoplasmic domain comprises, a costimulatory
signaling region and/or a zeta chain portion. The costimulatory
signaling region refers to a portion of the CAR comprising the
intracellular domain of a costimulatory molecule. Costimulatory
molecules are cell surface molecules other than antigens receptors
or their ligands that are required for an efficient response of
lymphocytes to antigen.
[0124] The present invention encompasses a recombinant DNA
construct comprising sequences of a fully human CAR, wherein the
sequence comprises the nucleic acid sequence of a GPC3 binding
domain operably linked to the nucleic acid sequence of an
intracellular domain. An exemplary intracellular domain that can be
used in the CAR includes but is not limited to the intracellular
domain of CD3-zeta, CD28, 4-1BB, and the like. In some instances,
the CAR can comprise any combination of CD3-zeta, CD28, 4-1 BB, and
the like.
[0125] Between the extracellular domain and the transmembrane
domain of the CAR, or between the cytoplasmic domain and the
transmembrane domain of the CAR, there may be incorporated a spacer
domain. As used herein, the term "spacer domain" generally means
any oligo- or polypeptide that functions to link the transmembrane
domain to, either the extracellular domain or, the cytoplasmic
domain in the polypeptide chain. A spacer domain may comprise up to
3K) amino acids, preferably 10 to 100 amino acids and most
preferably 25 to 50 amino acids.
[0126] The nucleic acid sequences coding for the desired molecules
can be obtained using recombinant methods known in the art, such
as, for example by screening libraries from cells expressing the
gene, by deriving the gene from a vector known to include the same,
or by isolating directly from cells and tissues containing the
same, using standard techniques. Alternatively, the gene of
interest can be produced synthetically, rather than cloned.
[0127] Antigen Binding Moiety
[0128] In one embodiment, the CAR of the invention comprises a
target-specific binding element otherwise referred to as an antigen
binding moiety. The choice of moiety depends upon the type and
number of ligands that define the surface of a target cell. For
example, the antigen binding domain may be chosen to recognize a
ligand that acts as a cell surface marker on target cells
associated with a particular disease state. Thus examples of cell
surface markers that may act as ligands for the antigen moiety
domain in the CAR of the invention include those associated with
viral, bacterial and parasitic infections, autoimmune disease and
cancer cells.
[0129] In one embodiment, the CAR-mediated T-cell response can be
directed to an antigen of interest by way of engineering a desired
antigen into the CAR. In the context of the present invention,
"tumor antigen" or "hyperproliferative disorder antigen" or
"antigen associated with a hyperproliferative disorer" refers to
antigens that are common to specific hyperproliferative disorders.
In certain aspects, the hyperproliferative disorder antigens of the
present invention are derived from, cancers including but not
limited to primary or metastatic melanoma, thymoma, lymphoma,
sarcoma, lung cancer, liver cancer, non-Hodgkin's lymphoma,
Hodgkins lymphoma, leukemias, uterine cancer, cervical cancer,
bladder cancer, kidney cancer and adenocarcinomas such as breast
cancer, prostate cancer, ovarian cancer, pancreatic cancer, and the
like. Preferably, the cancer is hepatocellular carcinoma (HCC).
[0130] In one embodiment, the tumor antigen of the present
invention comprises one or more antigenic cancer epitopes
immunologically recognized by tumor infiltrating lymphocytes (TIL)
derived from a cancer tumor of a mammal.
[0131] In a preferred embodiment, the antigen binding moiety
portion of the CAR targets glypican-3, preferably human
glypican-3.
[0132] The antigen binding domain can be any domain that binds to
the antigen including but not limited to monoclonal antibodies,
polyclonal antibodies, synthetic antibodies, human antibodies,
humanized antibodies, and fragments thereof. In some instances, it
is beneficial for the antigen binding domain to be derived from the
same species in which the CAR will ultimately be used in. For
example, for use in humans, it may be beneficial for the antigen
binding domain of the CAR to comprise a human antibody or a
fragment thereof. Thus, in one embodiment, the antigen biding
domain portion comprises a human antibody or a fragment
thereof.
[0133] For in vivo use of antibodies in humans, it may be
preferable to use human antibodies. Completely human antibodies are
particularly desirable for therapeutic treatment of human subjects.
Human antibodies can be made by a variety of methods known in the
art including phage display methods using antibody libraries
derived from human immunoglobulin sequences, including improvements
to these techniques. See, also. U.S. Pat. No. 4,444,887 and U.S.
Pat. No. 4,716,111; and PCT publications WO 98/46645. WO 98/50433,
WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741:
each of which is incorporated herein by reference in its entirety.
A human antibody can also be an antibody wherein the heavy and
light chains are encoded by a nucleotide sequence derived from one
or more sources of human DNA.
[0134] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. For example, it has been described that the
homozygous deletion of the antibody heavy chain joining region (JH)
gene in chimeric and genn-line mutant mice results in complete
inhibition of endogenous antibody production. The modified
embryonic stem cells are expanded and microinjected into
blastocysts to produce chimeric mice. The chimeric mice are then
bred to produce homozygous offspring which express human
antibodies. The transgenic mice are immunized in the normal fashion
with a selected antigen, e.g., all or a portion of a polypeptide of
the invention. Anti-glypican-3 antibodies directed against the
human glypican-3 antigen can be obtained from the immunized,
transgenic mice using conventional hybridoma technology. The human
immunoglobulin transgenes harbored by the transgenic mice rearrange
during B cell differentiation, and subsequently uxndergo class
switching and somatic mutation. Thus, using such a technique, it is
possible to produce therapeutically useful IgG, IgA, IgM and IgE
antibodies, including, but not limited to. IgG1 (gamma 1) and IgG3.
For an overview of this, technology for producing human antibodies,
see. Lonberg and Huszar (Int. Rev. Immunol., 13:65-93 (1995)). For
a detailed discussion of this technology for producing human
antibodies and human nmonoclonal antibodies and protocols for
producing such antibodies, see, e.g., PCT Publication Nos. WO
98/24893, WO 96/34096, and WO 96/33735; and U.S. Pat. Nos.
5,413,923; 5,625.126; 5,633,425: 5.569,825; 5,661,016; 5,545,806;
5,814,318; and 5,939,598, each of which is incorporated by
reference herein in their entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.)
can be engaged to provide human antibodies directed against a
selected antigen using technology similar to that described above.
For a specific discussion of transfer of a human germ-line
immunoglobulin gene array in germ-line mutant mice that will result
in the production of human antibodies upon antigen challenge see,
e.g., Jakobovits et al. Proc. Natl. Acad. Sci. USA, 90:2551 (1993);
Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al.,
Year in Immunol., 7:33 (1993); and Duchosal et al., Nature, 355:258
(1992).
[0135] Human antibodies can also be derived from phage-display
libraries (Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks
et al., J. Mol. Biol., 222:581-597 (1991); Vaughan et al., Nature
Biotech., 14:309 (1996)). Phage display technology (McCafferty et
al., Nature, 348:552-553 (1990)) can be used to produce human
antibodies and antibody fragment in vitro, from immunoglobulin
variable (V) domain gene repertoires from unimmunized donors.
According to this technique, antibody V domain genes are cloned
in-frame into either a major or minor coat protein gene of a
filamentous bacteriophage, such as M13 or fd, and displayed as
functional antibody fragments on the surface of the phage particle.
Because the filamentous particle contains a single-stranded DNA
copy of the phage genome, selections based on the functional
properties of the antibody also result in selection of the gene
encoding the antibody exhibiting those properties. Thus, the phage
mimics some of the properties of the B cell. Phage display can be
performed in a variety of formats; for their review see, e.g.,
Johnson, Kevin S, and Chiswell. David J., Current Opinion in
Structural Biology 3:564-571 (1993). Several sources of V-gene
segments can be used for phage display. Clackson et al., Nature,
352:624-628 (1991) isolated a diverse array of anti-oxazolone
antibodies from a small random combinatorial library of V genes
derived from the spleens of unimmunized mice. A repertoire of V
genes from unimmunized human donors can be constructed and
antibodies to a diverse array of antigens (including self-antigens)
can be isolated essentially following the techniques described by
Marks et al., J. Mol. Biol., 222:581-597 (1991), or Griffith et
al., EMBO J., 12:725-734 (1993). See, also, U.S. Pat. Nos.
5,565,332 and 5,573,905, each of which is incorporated herein by
reference in its entirety.
[0136] Human antibodies may also be generated by in vitro activated
B cells (see, U.S. Pat. Nos. 5,567,610 and 5,229,275, each of which
is incorpoated herein by reference in its entirety). Human
antibodies may also be generated in vitro using hybridoma
techniques such as, but not limited to, that described by Roder et
al. (Methods Enzymol., 121:140-167 (1986)).
[0137] Alternatively, in some embodiments, a non-human antibody is
humanized, where specific sequences or regions of the antibody are
modified to increase similarity to an antibody naturally produced
in a human. In one embodiment, the antigen binding domain portion
is humanized.
[0138] A humanized antibody can be produced using a variety of
techniques known in the art, including but not limited to,
CDR-grafting (see, e.g., European Patent No. EP 239,400;
International Publication No. WO 91/09967; and U.S. Pat. Nos.
5,225,539, 5,530, 101, and 5,585,089, each of which is incorporated
herein in its entirety by reference), veneering or resurfacing
(see, e.g., European Patent Nos. EP 592,106 and EP 519,596: Padlan,
1991, Molecular Immunology, 28(4/5):489-498; Studnicka et al.,
1994, Protein Engineering, 7(6):805-814: and Roguska et al., 1994,
PNAS, 91:969-973, each of which is incorporated herein by its
entirety by reference), chain shuffling (see, e.g. U.S. Pat. No.
5,565,332, which is incorporated herein in its entirety by
reference), and techniques disclosed in, e.g., U.S. Patent
Application Publication No. US2005/10042664. U.S. Patent
Application Publication No. US2005/0048617, U.S. Pat. No.
6,407,213, U.S. Pat. No. 5,766,886. International Publication No.
WO 9317105, Tan et al., J. Immunol., 169:1119-25 (2002). Caldas et
al., Protein Eng., 13(5):353-60 (2000). Morea et al., Methods,
20(3):267-79 (200)). Baca et al., J. Biol. Chem., 272(16):10678-84
(1997). Roguska et al., Protein Eng., 9(10):895-904 (1996), Couto
et al., Cancer Res., 55 (23 Supp):5973s-5977s (1995), Couto et al.,
Cancer Res., 55(8):1717-22 (1995), Sandhu J S, Gene, 150(2):409-10
(1994), and Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994),
each of which is incorporated herein in its entirety by reference.
Often, framework residues in the framework regions will be
substituted with the corresponding residue from the CDR donor
antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well-known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; and Riechmann et al. 1988, Nature, 332:323,
which are incorporated herein by reference in their
entireties.)
[0139] A humanized antibody has one or more amino acid residues
intnxroduced into it from a source which is nonhuman. These
nonhuman amino acid residues are often referred to as "import"
residues, which are typically taken from an "import" variable
domain. Thus, humanized antibodies comprise one or more CDRs from
nonhuman immunoglobulin molecules and framework regions from human.
Humanization of antibodies is well-known in the art and can
essentially be performed following the method of Winter and
co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et
al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences
for the corresponding sequences of a human antibody, i.e.,
CDR-grafting (EP 239,400; PCT Publication No. WO 91/09967; and U.S.
Pat. Nos. 4,816,567; 6,331,415; 5,225,539; 5,530,101; 5,585,089;
6,548,640, the contents of which are incorporated herein by
reference herein in their entirety). In such humanized chimeric
antibodies, substantially less than an intact human variable domain
has been substituted by the corresponding sequence from a nonhuman
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some framework
(FR) residues are substituted by residues from analogous sites in
rodent antibodies. Humanization of antibodies can also be achieved
by veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991,
Molecular Immunology, 28(4/5):489-498; Studnicka et al., Protein
Engineering, 7(6):805-814 (1994); and Roguska et al., PNAS,
91:969-973 (1994)) or chain shuffling (U.S. Pat. No. 5,565,332),
the contents of which are incorporated herein by reference herein
in their entirety.
[0140] In some instances, a human scFv may also be derived from a
yeast display library.
[0141] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is to reduce
antigenicity. According to the so-called "best-fit" method, the
sequence of the variable domain of a rodent antibody is screened
against the entire library of known human variable-domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human framework (FR) for the
humanized antibody (Sims et al., J. Immunol., 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of
which are incorporated herein by reference herein in their
entirety). Another method uses a particular framework derived from
the consensus sequence of all human antibodies of a particular
subgroup of light or heavy chains. The same framework may be used
for several different humanized antibodies (Carter et al., Proc.
Natl. Acad. Sci. USA, 89:4285 (1992): Presta et al., J. Immunol.,
151:2623 (1993), the contents of which are incorporated herein by
reference herein in their entirety).
[0142] Antibodies can be humanized with retention of high affinity
for the target antigen and other favorable biological properties.
According to one aspect of the invention, humanized antibodies are
prepared by a process of analysis of the parental sequences and
various conceptual humanized products using three-dimensional
models of the parental and humanized sequences. Three-dimensional
immunoglobulin models are commonly available and are familiar to
those skilled in the art. Computer programs are available which
illustrate and display probable three-dimensional conformational
structures of selected candidate immunoglobulin sequences.
Inspection of these displays permits analysis of the likely role of
the residues in the functioning of the candidate immunoglobulin
sequence. i.e., the analysis of residues that influence the ability
of the candidate immunoglobulin to bind the target antigen. In this
way, FR residues can be selected and combined from the recipient
and import sequences so that the desired antibody characteristic,
such as increased affinity for the target antigen, is achieved. In
general, the CDR residues are directly and most substantially
involved in influencing antigen binding.
[0143] A humanized antibody retains a similar antigenic specificity
as the original antibody, i.e., in the present invention, the
ability to bind human glypican-3. However, using certain methods of
humanization, the affinity and/or specificity of binding of the
antibody for human glypican-3 may be increased using methods of
"directed evolution," as described by Wu et al., J. Mol. Biol.,
294:151 (1999), the contents of which are incorporated herein by
reference herein in their entirety.
[0144] Transmembrane Domain
[0145] With respect to the transmembrane domain, the CAR can be
designed to comprise a transmembrane domain that is fused to the
extracellular domain of the CAR. In one embodiment, the
transmembrane domain that naturally is associated with one of the
domains in the CAR is used. In some instances, the transmembrane
domain can be selected or modified by amino acid substitution to
avoid binding of such domains to the transmembrane domains of the
same or different surface membrane proteins to minimize
interactions with other members of the receptor complex.
[0146] The transmembrane domain may be derived either from a
natural or from a synthetic source. Where the source is natural,
the domain may be derived from any membrane-bound or transmembrane
protein. Transmembrane regions of particular use in this invention
may be derived from (i.e. comprise at least the transmembrane
region(s) of) the alpha, beta or zeta chain of the T-cell receptor.
CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33,
CD37, CD64. CD80, CD86, CD134, CD137, CD154. In some instances, a
variety of human hinges can be employed as well including the human
Ig (immunoglobulin) hinge.
[0147] In one embodiment, the transmembrane domain may be
synthetic, in which case it will comprise predominantly hydrophobic
residues such as leucine and valine. Preferably a triplet of
phenylalanine, tryptophan and valine will be found at each end of a
synthetic transmembrane domain. Optionally, a short oligo- or
polypeptide linker, preferably between 2 and 10 amino acids in
length may form the linkage between the transmembrane domain and
the cytoplasmic signaling domain of the CAR. A glycine-serine
doublet provides a particularly suitable linker.
[0148] Cytoplasmic Domain
[0149] The cytoplasmic domain or otherwise the intracellular
signaling domain of the CAR of the invention is responsible for
activation of at least one of the normal effector functions of the
immune cell in which the CAR has been placed in. The term "effector
function" refers to a specialized function of a cell. Effector
function of a T cell, for example, may be cytolytic activity or
helper activity including the secretion of cytokines. Thus the term
"intracellular signaling domain" refers to the portion of a protein
which transduces the effector function signal and directs the cell
to perform a specialized function. While usually the entire
intracellular signaling domain can be employed, in many cases it is
not necessary to use the entire chain. To the extent that a
truncated portion of the intracellular signaling domain is used,
such truncated portion may be used in place of the intact chain as
long as it transduces the effector function signal. The term
intracellular signaling domain is thus meant to include any
truncated portion of the intracellular signaling domain sufficient
to transduce the effector function signal.
[0150] Preferred examples of intracellular signaling domains for
use in the CAR of the invention include the cytoplasmic sequences
of the T cell receptor (TCR) and co-receptors that act in concert
to initiate signal transduction following antigen receptor
engagement, as well as any derivative or variant of these sequences
and any synthetic sequence that has the same functional
capability.
[0151] It is known that signals generated through the TCR alone are
insufficient for full activation of the T cell and that a secondary
or co-stimulatory signal is also required. Thus, T cell activation
can be said to be mediated by two distinct classes of cytoplasmic
signaling sequence: those that initiate antigen-dependent primary
activation through the TCR (primary cytoplasmic signaling
sequences) and those that act in an antigen-independent manner to
provide a secondary or co-stimulatory signal (secondary cytoplasmic
signaling sequences).
[0152] Primary cytoplasmic signaling sequences regulate primary
activation of the TCR complex either in a stimulatory way, or in an
inhibitory way. Primary cytoplasmic signaling sequences that act in
a stimulatory manner may contain signaling motifs which are known
as immunoreceptor tyrosine-based activation motifs or ITAMs.
[0153] Examples of ITAM containing primary cytoplasmic signaling
sequences that are of particular use in the invention include those
derived from TCR zeta. FcR gamma, FcR beta, CD3 gamma, CD3 delta,
CD3 epsilon, CD5, CD22, CD79a. CD79b, and CD66d. It is particularly
preferred that cytoplasmic signaling molecule in the CAR of the
invention comprises a cytoplasmic signaling sequence derived from
CD3-zeta.
[0154] In a preferred embodiment, the cytoplasmic domain of the CAR
can be designed to comprise the CD3-zeta signaling domain by itself
or combined with any other desired cytoplasmic domain(s) useful in
the context of the CAR of the invention. For example, the
cytoplasmic domain of the CAR can comprise a CD3 zeta chain portion
and a costimulatory signaling region. The costimulatory signaling
region refers to a portion of the CAR comprising the intracellular
domain of a costimulatory molecule. A costimulatory molecule is a
cell surface molecule other than an antigen receptor or its ligands
that is required for an efficient response of lymphocytes to an
antigen. Examples of such molecules include CD27, CD28, 4-1BB
(CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte
function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C,
B7-H3, and a ligand that specifically binds with CD83, and the
like. Thus, while the invention in exemplified primarily with CD28
and 4-1BB as the co-stimulatory signaling element, other
costimulatory elements are within the scope of the invention.
[0155] The cytoplasmic signaling sequences within the cytoplasmic
signaling portion of the CAR of the invention may be linked to each
other in a random or specified order. Optionally, a short oligo- or
polypeptide linker, preferably between 2 and 10 amino acids in
length may form the linkage. A glycine-serine doublet provides a
particularly suitable linker.
[0156] In one embodiment, the cytoplasmic domain is designed to
comprise the signaling domain of CD3-zeta and the signaling domain
of CD28. In another embodiment, the cytoplasmic domain is designed
to comprise the signaling domain of CD3-zeta and the signaling
domain of 4-1BB.
Vectors
[0157] The present invention also provides vectors in which a DNA
of the present invention is inserted. Vectors derived from
retroviruses such as the lentivirus are suitable tools to achieve
long-term gene transfer since they allow long-term, stable
integration of a transgene and its propagation in daughter cells.
Lentiviral vectors have the added advantage over vectors derived
from onco-retroviruses such as murine leukemia viruses in that they
can transduce non-proliferating cells, such as hepatocytes. They
also have the added advantage of low immunogenicity.
[0158] In brief summary, the expression of natural or synthetic
nucleic acids encoding CARs is typically achieved by operably
linking a nucleic acid encoding the CAR polypeptide or portions
thereof to a promoter, and incorporating the construct into an
expression vector. The vectors can be suitable for replication and
integration eukaryotes. Typical cloning vectors contain
transcription and translation terminators, initiation sequences,
and promoters useful for regulation of the expression of the
desired nucleic acid sequence.
[0159] The nucleic acid can be cloned into a number of types of
vectors. For example, the nucleic acid can be cloned into a vector
including, but not limited to a plasmid, a phagemid, a phage
derivative, an animal virus, and a cosmid. Vectors of particular
interest include expression vectors, replication vectors, probe
generation vectors, and sequencing vectors.
[0160] Further, the expression vector may be provided to a cell in
the form of a viral vector. Viral vector technology is well known
in the art and is described, for example, in Sambrook et al.,
MOLECULAR CLONING: A LABORATORY MANUAL, volumes 1-3 (3.sup.rd ed.,
Cold Spring Harbor Press, NY 2001), and in other virology and
molecular biology manuals. Viruses, which are useful as vectors
include, but are not limited to, retroviruses, adenoviruses,
adeno-associated viruses, herpes viruses, and tentiviruses. In
general, a suitable vector contains an origin of replication
functional in at least one organism, a promoter sequence,
convenient restriction endonuclease sites, and one or more
selectable markers, (e.g., WO 01/96584; WO 01/29058; and U.S. Pat.
No. 6,326,193).
[0161] Additional promoter elements, e.g. enhancers, regulate the
frequency of transcriptional initiation. Typically, these are
located in the region 30-110 bp upstream of the start site,
although a number of promoters have recently been shown to contain
functional elements downstream of the start site as well. The
spacing between promoter elements frequently is flexible, so that
promoter function is preserved when elements are inverted or moved
relative to one another. In the thymidine kinase (tk) promoter, the
spacing between promoter elements can be increased to 50 bp apart
before activity begins to decline. Depending on the promoter, it
appears that individual elements can function either cooperatively
or independently to activate transcription.
[0162] An example of a promoter is the immediate early
cytomegalovirus (CMV) promoter sequence. This promoter sequence is
a strong constitutive promoter sequence capable of driving high
levels of expression of any polynucleotide sequence operatively
linked thereto. However, other constitutive promoter sequences may
also be used, including, but not limited to the simian virus 40
(SV40) early promoter, mouse mammary tumor virus (MMTV), human
immunodeficiency virus (HIV) long terminal repeat (LTR) promoter,
MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr
virus immediate early promoter, a Rous sarcoma virus promoter, as
well as human gene promoters such as, but not limited to, the actin
promoter, the myosin promoter, the hemoglobin promoter, and the
creatine kinase promoter. Further, the invention should not be
limited to the use of constitutive promoters. Inducible promoters
are also contemplated as part of the invention. The use of an
inducible promoter provides a molecular switch capable of turning
on expression of the polynucleotide sequence which it is
operatively linked when such expression is desired, or turning off
the expression when expression is not desired. Examples of
inducible promoters include, but are not limited to a
metallothionine promoter, a glucocorticoid promoter, a progesterone
promoter, and a tetracycline promoter.
[0163] In order to assess the expression of a CAR polypeptide or
portions thereof, the expression vector to be introduced into a
cell can also contain either a selectable marker gene or a reporter
gene or both to facilitate identification and selection of
expressing cells from the population of cells sought to be
transfected or infected through viral vectors. In other aspects,
the selectable marker may be carried on a separate piece of DNA and
used in a co-transfection procedure. Both selectable markers and
reporter genes may be flanked with appropriate regulatory sequences
to enable expression in the host cells. Useful selectable markers
include, for example, antibiotic-resistance genes, such as neo and
the like.
[0164] Reporter genes are used for identifying potentially
transfected cells and for evaluating the functionality of
regulatory sequences. In general, a reporter gene is a gene that is
not present in or expressed by the recipient organism or tissue and
that encodes a polypeptide whose expression is manifested by some
easily detectable property, e.g., enzymatic activity. Expression of
the reporter gene is assayed at a suitable time after the DNA has
been introduced into the recipient cells. Suitable reporter genes
may include genes encoding luciferase, beta-galactosidase,
chloramphenicol acetyl transferase, secreted alkaline phosphatase,
or the green fluorescent protein gene (e.g. Ui-Tei et al., 2000
FEBS Letters 479: 79-82). Suitable expression systems are well
known and may be prepared using known techniques or obtained
commercially. In general, the construct with the minimal 5'
flanking region showing the highest level of expression of reporter
gene is identified as the promoter. Such promoter regions may be
linked to a reporter gene and used to evaluate agents for the
ability to modulate promoter-driven transcription.
[0165] Methods of introducing and expressing genes into a cell are
known in the art. In the context of an expression vector, the
vector can be readily introduced into a host cell, e.g., mammalian,
bacterial, yeast, or insect cell by any method in the art. For
example, the expression vector can be transferred into a host cell
by physical, chemical, or biological means.
[0166] Physical methods for introducing a polynucleotide into a
host cell include calcium phosphate precipitation, lipofection,
particle bombardment, micrinjection, electroporation, and the like.
Methods for producing cells comprising vectors and/or exogenous
nucleic acids are well-known in the art. See, for example. Sambrook
et al., MOLECULAR CLONING: A LABORATORY MANUAL volumes 1-3
(3.sup.rd ed., Cold Spring Harbor Press, NY 2001).
[0167] Biological methods for introducing a polynucleotide of
interest into a host cell include the use of DNA and RNA vectors.
Viral vectors, and especially retroviral vectors, have become the
most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from lentivirus,
poxviruses, herpes simplex virus I, adenoviruses and
adeno-associated viruses, and the like. See, for example, U.S. Pat.
Nos. 5,350,674 and 5,585,362.
[0168] Chemical means for introducing a polynucleotide into a host
cell include colloidal dispersion systems, such as macromolecule
complexes, nanocapsules, microspheres, beads, and lipid-based
systems including oil-in-water emulsions, micelles, mixed micelles,
and liposomes. An exemplary colloidal system for use as a delivery
vehicle in vitro and in vivo is a liposome (e.g., an artificial
membrane vesicle).
[0169] In the case where a non-viral delivery system is utilized,
an exemplary delivery vehicle is a liposome. The use of lipid
formulations is contemplated for the introduction of the nucleic
acids into a host cell (in vitro, ex vivo or in vivo). In another
aspect, the nucleic acid may be associated with a lipid. The
nucleic acid associated with a lipid may be encapsulated in the
aqueous interior of a liposome, interspersed within the lipid
bilayer of a liposome, attached to a liposome via a linking
molecule that is associated with both the liposome and the
oligonucleotide, entrapped in a liposome, complexed with a
liposome, dispersed in a solution containing a lipid, mixed with a
lipid, combined with a lipid, contained as a suspension in a lipid,
contained or complexed with a micelle, or otherwise associated with
a lipid. Lipid, lipid/DNA or lipid/expression vector associated
compositions are not limited to any particular structure in
solution. For example, they may be present in a bilayer structure,
as micelles, or with a "collapsed" structure. They may also simply
be interspersed in a solution, possibly forming aggregates that are
not uniform in size or shape. Lipids are fatty substances which may
be naturally occurring or synthetic lipids. For example, lipids
include the fatty droplets that naturally occur in the cytoplasm as
well as the class of compounds which contain long-chain aliphatic
hydrocarbons and their derivatives, such as fatty acids, alcohols,
amines, amino alcohols, and aldehydes.
[0170] Lipids suitable for use can be obtained from commercial
sources. For example, dimyristyl phosphatidylcholine ("DMPC") can
be obtained from Sigma. St. Louis, Mo.; dicetyl phosphate ("DCP")
can be obtained from K & K Laboratories (Plainview, N.Y.);
cholesterol ("Choi") can be obtained from Calbiochem-Behring;
dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be
obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock
solutions of lipids in chloroform or chloroform/methanol can be
stored at about -20.degree. C. Chloroform is used as the only
solvent since it is more readily evaporated than methanol.
"Liposome" is a generic term encompassing a variety of single and
multilamellar lipid vehicles formed by the generation of enclosed
lipid bilayers or aggregates. Liposomes can be characterized as
having vesicular structures with a phospholipid bilayer membrane
and an inner aqueous medium. Multilamellar liposomes have multiple
lipid layers separated by aqueous medium. They form spontaneously
when phospholipids are suspended in an excess of aqueous solution.
The lipid components undergo self-rearrangement before the
formation of closed structures and entrap water and dissolved
solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology
5: 505-10). However, compositions that have different structures in
solution than the normal vesicular structure are also encompassed.
For example, the lipids may assume a micellar structure or merely
exist as nonuniform aggregates of lipid molecules. Also
contemplated are lipofectamine-nucleic acid complexes.
Sources of T Cells
[0171] Prior to expansion and genetic modification, a source of T
cells is obtained from a subject. The term "subject" is intended to
include living organisms in which an immune response can be
elicited (e.g., mammals). Examples of subjects include humans,
dogs, cats, mice, rats, and transgenic species thereof. T cells can
be obtained from a number of sources, including peripheral blood
mononuclear cells, bone marrow, lymph node tissue, cord blood,
thymus tissue, tissue from a site of infection, ascites, pleural
effusion, spleen tissue, and tumors. In certain embodiments of the
present invention, any number of T cell lines available in the art,
may be used. In certain embodiments of the present invention, T
cells can be obtained from a unit of blood collected from a subject
using any number of techniques known to the skilled artisan, such
as Ficoll.TM. separation. In one preferred embodiment, cells from
the circulating blood of an individual are obtained by apheresis.
The apheresis product typically contains lymphocytes, including T
cells, monocytes, granulocytes, B cells, other nucleated white
blood cells, red blood cells, and platelets. In one embodiment, the
cells collected by apheresis may be washed to remove the plasma
fraction and to place the cells in an appropriate buffer or media
for subsequent processing steps. In one embodiment of the
invention, the cells are washed with phosphate buffered saline
(PBS). In an alternative embodiment, the wash solution lacks
calcium and may lack magnesium or may lack many if not all divalent
cations. Again, surprisingly, initial activation steps in the
absence of calcium lead to magnified activation. As those of
ordinary skill in the art would readily appreciate a washing step
may be accomplished by methods known to those in the art, such as
by using a semi-automated "flow-through" centrifuge (for example,
the Cobe 2991 cell processor, the Baxter CytoMate, or the
Haemonetics Cell Saver 5) according to the manufacturer's
instructions. After washing, the cells may be resuspended in a
variety of biocompatible buffers, such as, for example, Ca-free,
Mg-free PBS, PlasmaLyte A, or other saline solution with or without
buffer. Alternatively, the undesirable components of the apheresis
sample may be removed and the cells directly resuspended in culture
media.
[0172] In another embodiment T cells are isolated from peripheral
blood lymphocytes by lysing the red blood cells and depleting the
monocytes, for example, by centrifugation through a PERCOLL.TM.
gradient or by counterflow centrifugal elutriation. A specific
subpopulation of T cells, such as CD3.sup.+, CD28.sup.+, CD4.sup.+,
CD8.sup.+, CD45RA.sup.+, and CD45RO.sup.+ T cells, can be further
isolated by positive or negative selection techniques. For example,
in one embodiment, T cells are isolated by incubation with
anti-CD3/anti-CD28 (i.e., 3.times.28)-conjugated beads, such as
DYNABEADS.RTM. M-450 CD3/CD28 T, for a time period sufficient for
positive selection of the desired T cells. In one embodiment, the
time period is about 30 minutes. In a further embodiment, the time
period ranges from 30 minutes to 36 hours or longer and all integer
values there between. In a further embodiment, the time period is
at least 1, 2, 3, 4, 5, or 6 hours. In yet another preferred
embodiment, the time period is 10 to 24 hours. In one preferred
embodiment, the incubation time period is 24 hours. For isolation
of T cells from patients with leukemia, use of longer incubation
times, such as 24 hours, can increase cell yield. Longer incubation
times may be used to isolate T cells in any situation where there
are few T cells as compared to other cell types, such in isolating
tumor infiltrating lymphocytes (TIL) from tumor tissue or from
immunocompromised individuals. Further, use of longer incubation
times can increase the efficiency of capture of CD8+ T cells. Thus,
by simply shortening or lengthening the time T cells are allowed to
bind to the CD3/CD28 beads and/or by increasing or decreasing the
ratio of beads to T cells (as described further herein),
subpopulations of T cells can be preferentially selected for or
against at culture initiation or at other time points during the
process. Additionally, by increasing or decreasing the ratio of
anti-CD3 and/or anti-CD28 antibodies on the beads or other surface,
subpopulations of T cells can be preferentially selected for or
against at culture initiation or at other desired time points. The
skilled artisan would recognize that multiple rounds of selection
can also be used in the context of this invention. In certain
embodiments, it may be desirable to perform the selection procedure
and use the "unselected" cells in the activation and expansion
process. "Unselected" cells can also be subjected to further rounds
of selection.
[0173] Enrichment of a T cell population by negative selection can
be accomplished with a combination of antibodies directed to
surface markers unique to the negatively selected cells. One method
is cell sorting and/or selection via negative magnetic
immunoadherence or flow cytometry that uses a cocktail of
monoclonal antibodies directed to cell surface markers present on
the cells negatively selected. For example, to enrich for CD4.sup.+
cells by negative selection, a monoclonal antibody cocktail
typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR,
and CD8. In certain embodiments, it may be desirable to enrich for
or positively select for regulatory T cells which typically express
CD4.sup.+, CD25.sup.+, CD62L.sup.hi, GITR.sup.+, and FoxP3.sup.+.
Alternatively, in certain embodiments. T regulatory cells are
depleted by anti-C25 conjugated beads or other similar method of
selection.
[0174] For isolation of a desired population of cells by positive
or negative selection, the concentration of cells and surface
(e.g., particles such as beads) can be varied. In certain
embodiments, it may be desirable to significantly decrease the
volume in which beads and cells are mixed together (i.e., increase
the concentration of cells), to ensure maximum contact of cells and
beads. For example, in one embodiment, a concentration of 2 billion
cells/ml is used. In one embodiment, a concentration of 1 billion
cells/ml is used. In a further embodiment, greater than 100 million
cells/mil is used. In a further embodiment, a concentration of
cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is
used. In yet another embodiment, a concentration of cells from 75,
80, 85, 90, 95, or 100 million cells/ml is used. In further
embodiments, concentrations of 125 or 150 million cells/ml can be
used. Using high concentrations can result in increased cell yield,
cell activation, and cell expansion. Further, use of high cell
concentrations allows more efficient capture of cells that may
weakly express target antigens of interest, such as CD28-negative T
cells, or from samples where there are many tumor cells present
(i.e., leukemic blood, tumor tissue, etc.). Such populations of
cells may have therapeutic value and would be desirable to obtain.
For example, using high concentration of cells allows more
efficient selection of CD8.sup.+ T cells that normally have weaker
CD28 expression.
[0175] In a related embodiment, it may be desirable to use lower
concentrations of cells. By significantly diluting the mixture of T
cells and surface (e.g., particles such as beads), interactions
between the particles and cells is minimized. This selects for
cells that express high amounts of desired antigens to be bound to
the particles. For example, CD4.sup.+ T cells express higher levels
of CD28 and are more efficiently captured than CD8.sup.+ T cells in
dilute concentrations. In one embodiment, the concentration of
cells used is 5.times.10.sup.6/ml. In other embodiments, the
concentration used can be from about 1.times.10.sup.5/ml to
1.times.10.sup.6/ml, and any integer value in between.
[0176] In other embodiments, the cells may be incubated on a
rotator for varying lengths of time at varying speeds at either
2-10.degree. C. or at mom temperature.
[0177] T cells for stimulation can also be frozen after a washing
step. Wishing not to be bound by theory, the freeze and subsequent
thaw step provides a more uniform product by removing granulocytes
and to some extent monocytes in the cell population. After the
washing step that removes plasma and platelets, the cells may be
suspended in a freezing solution. While many freezing solutions and
parameters are known in the art and will be useful in this context,
one method involves using PBS containing 20% DMSO and 8% human
serum albumin, or culture media containing 10% Dextran 40 and 5%
Dextrose, 20% Human Serum Albumin and 7.5% DMSO, or 31.25%
Plasmalyte-A, 31.25% Dextrose 5%, 0.45% NaCl, 10% Dextran 40 and 5%
Dextrose, 20% Human Serum Albumin, and 7.5% DMSO or other suitable
cell freezing media containing for example, Hespan and PlasmaLyte
A, the cells then are frozen to -80.degree. C. at a rate of
1.degree. per minute and stored in the vapor phase of a liquid
nitrogen storage tank. Other methods of controlled freezing may be
used as well as uncontrolled freezing immediately at -20.degree. C.
or in liquid nitrogen.
[0178] In certain embodiments, cryopreserved cells are thawed and
washed as described herein and allowed to rest for one hour at mom
temperature prior to activation using the methods of the present
invention.
[0179] Also contemplated in the context of the invention is the
collection of blood samples or apheresis product from a subject at
a time period prior to when the expanded cells as described herein
might be needed. As such, the source of the cells to be expanded
can be collected at any time point necessary, and desired cells,
such as T cells, isolated and frozen for later use in T cell
therapy for any number of diseases or conditions that would benefit
from T cell therapy, such as those described herein. In one
embodiment a blood sample or an apheresis is taken from a generally
healthy subject. In certain embodiments, a blood sample or an
apheresis is taken from a generally healthy subject who is at risk
of developing a disease, but who has not yet developed a disease,
and the cells of interest are isolated and frozen for later use. In
certain embodiments, the T cells may be expanded, frozen, and used
at a later time. In certain embodiments, samples are collected from
a patient shortly after diagnosis of a particular disease as
described herein but prior to any treatments. In a further
embodiment, the cells are isolated from a blood sample or an
apheresis from a subject prior to any number of relevant treatment
modalities, including but not limited to treatment with agents such
as natalizumab, efalizumab, antiviral agents, chemotherapy,
radiation, immunosuppressive agents, such as cyclosporin,
azathioprine, methotrexate, mycophenolate, and FKS06, antibodies,
or other immunoablative agents such as CAMPATH, anti-CD3
antibodies, cytoxan, fludarabine, cyclosporin, FK506, rapamycin,
mycophenolic acid, steroids, FR901228, and irradiation. These drugs
inhibit either the calcium dependent phosphatase calcineurin
(cyclosporine and FK506) or inhibit the p70S6 kinase that is
important for growth factor induced signaling (rapamycin). (Liu et
al., Cell 66:807-815, 1991; Henderson et al., Immun. 73:316-321,
1991: Bierer et al., Curr. Opin. Immun. 5:763-773, 1993). In a
further embodiment, the cells are isolated for a patient and frozen
for later use in conjunction with (e.g., before, simultaneously or
following) bone marrow or stem cell transplantation, T cell
ablative therapy using either chemotherapy agents such as,
fludarabine, external-beam radiation therapy (XRT),
cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another
embodiment, the cells are isolated prior to and can be frozen for
later use for treatment following B-cell ablative therapy such as
agents that react with CD20, e.g., Rituxan.
[0180] In a further embodiment of the present invention, T cells
are obtained from a patient directly following treatment. In this
regard, it has been observed that following certain cancer
treatments, in particular treatments with drugs that damage the
immune system, shortly after treatment during the period when
patients would normally be recovering from the treatment, the
quality of T cells obtained may be optimal or improved for their
ability to expand ex vivo. Likewise, following ex vivo manipulation
using the methods described herein, these cells may be in a
preferred state for enhanced engraftment and in vivo expansion.
Thus, it is contemplated within the context of the present
invention to collect blood cells, including T cells, dendritic
cells, or other cells of the hematopoietic lineage, during this
recovery phase. Further, in certain embodiments, mobilization (for
example, mobilization with GM-CSF) and conditioning regimens can be
used to create a condition in a subject wherein repopulation,
recirculation, regeneration, and/or expansion of particular cell
types is favored, especially during a defined window of time
following therapy. Illustrative cell types include T cells, B
cells, dendritic cells, and other cells of the immune system.
Activation and Expansion of T Cells
[0181] T cells are activated and expanded generally using methods
as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055;
6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575;
7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874;
6,797,514; 6,867,041; and U.S. Patent Application Publication No.
20060121005.
[0182] Generally, the T cells of the invention are expanded by
contact with a surface having attached thereto an agent that
stimulates a CD3/TCR complex associated signal and a ligand that
stimulates a co-stimulatory molecule on the surface of the T cells.
In particular, T cell populations may be stimulated as described
herein, such as by contact with an anti-CD3 antibody, or
antigen-binding fragment thereof, or an anti-CD2 antibody
immobilized on a surface, or by contact with a protein kinase C
activator (e.g., bryostatin) in conjunction with a calcium
ionophore. For co-stimulation of an accessory molecule on the
surface of the T cells, a ligand that binds the accessory molecule
is used. For example, a population of T cells can be contacted with
an anti-CD3 antibody and an anti-CD28 antibody, under conditions
appropriate for stimulating proliferation of the T cells. To
stimulate proliferation of either CD4.sup.+ T cells or CD8.sup.+ T
cells, an anti-CD3 antibody and an anti-CD28 antibody. Examples of
an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone,
Besancon, France) can be used as can other methods commonly known
in the art (Berg et al., Transplant Proc. 30(8):3975-3977, 1998;
Haanen et al. J. Exp. Med. 190(9):13191328, 1999; Garland et al.,
J. Immunol Meth. 227(1-2):53-63, 1999).
[0183] In certain embodiments, the primary stimulatory signal and
the co-stimulatory signal for the T cell may be provided by
different protocols. For example, the agents providing each signal
may be in solution or coupled to a surface. When coupled to a
surface, the agents may be coupled to the same surface (i.e., in
"cis" formation) or to separate surfaces (i.e., in "trans"
formation). Alternatively, one agent may be coupled to a surface
and the other agent in solution. In one embodiment, the agent
providing the co-stimulatory signal is bound to a cell surface and
the agent providing the primary activation signal is in solution or
coupled to a surface. In certain embodiments, both agents can be in
solution. In another embodiment, the agents may be in soluble form,
and then cross-linked to a surface, such as a cell expressing Fc
receptors or an antibody or other binding agent which will bind to
the agents. In this regard, see for example. U.S. Patent
Application Publication Nos. 20040101519 and 20060034810 for
artificial antigen presenting cells (aAPCs) that are contemplated
for use in activating and expanding T cells in the present
invention.
[0184] In one embodiment, the two agents are immobilized on beads,
either on the same bead, i.e., "cis," or to separate heads, i.e.
"trans." By way of example, the agent providing the primary
activation signal is an anti-CD3 antibody or an antigen-binding
fragment thereof and the agent providing the co-stimulatory signal
is an anti-CD28 antibxody or antigen-binding fragment thereof; and
both agents are co-immobilized to the same bead in equivalent
molecular amounts. In one embodiment, a 1:1 ratio of each antibody
bound to the beads for CD4.sup.+ T cell expansion and T cell growth
is used. In certain aspects of the present invention, a ratio of
anti CD3:CD28 antibodies bound to the beads is used such that an
increase in T cell expansion is observed as compared to the
expansion observed using a ratio of 1:1. In one particular
embodiment an increase of from about 1 to about 3 fold is observed
as compared to the expansion observed using a ratio of 1:1. In one
embodiment, the ratio of CD3:CD28 antibody bound to the heads
ranges from 100:1 to 1:100 and all integer values there between. In
one aspect of the present invention, more anti-CD28 antibody is
bound to the particles than anti-CD3 antibody, i.e., the ratio of
CD3:CD28 is less than one. In certain embodiments of the invention,
the ratio of anti CD28 antibody to anti CD3 antibody bound to the
beads is greater than 2:1. In one particular embodiment, a 1:100
CD3:CD28 ratio of antibody bound to beads is used. In another
embodiment, a 1:75 CD3:CD28 ratio of antibody bound to beads is
used. In a further embodiment, a 1:50 CD3:CD28 ratio of antibody
bound to beads is used. In another embodiment, a 1:30 CD3:CD28
ratio of antibody bound to beads is used. In one preferred
embodiment, a 1:10 CD3:CD28 ratio of antibody bound to beads is
used. In another embodiment, a 1:3 CD3:CD28 ratio of antibody bound
to the beads is used. In yet another embodiment, a 3:1 CD3:CD28
ratio of antibody bound to the heads is used.
[0185] Ratios of particles to cells from 1:500 to 500:1 and any
integer values in between may be used to stimulate T cells or other
target cells. As those of ordinary skill in the art can readily
appreciate, the ratio of particles to cells may depend on particle
size relative to the target cell. For example, small sized beads
could only bind a few cells, while larger beads could bind many. In
certain embodiments the ratio of cells to particles ranges from
1:100 to 100:1 and any integer values in-between and in further
embodiments the ratio comprises 1:9 to 9:1 and any integer values
in between, can also be used to stimulate T cells. The ratio of
anti-CD3- and anti-CD28-coupled particles to T cells that result in
T cell stimulation can vary as noted above, however certain
preferred values include 1:100, 1:50, 1:40, 1:30, 1:20, 1:10, 1:9,
1:8, 1:7, 1:6. 1:5, 1:4, 1:3, 1:2, 1:1, 2:1.3:1, 4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1, and 15:1 with one preferred ratio being at
least 1:1 particles per T cell. In one embodiment, a ratio of
particles to cells of 1:1 or less is used. In one particular
embodiment, a preferred particle:cell ratio is 1:5. In further
embodiments, the ratio of particles to cells can be varied
depending on the day of stimulation. For example, in one
embodiment, the ratio of particles to cells is from 1:1 to 10:1 on
the first day and additional particles are added to the cells every
day or every other day thereafter for up to 10 days, at final
ratios of from 1:1 to 1:10 (based on cell counts on the day of
addition). In one particular embodiment, the ratio of particles to
cells is 1:1 on the first day of stimulation and adjusted to 1:5 on
the third and fifth days of stimulation. In another embodiment,
particles are added on a daily or every other day basis to a final
ratio of 1:1 on the first day, and 1:5 on the third and fifth days
of stimulation. In another embodiment, the ratio of particles to
cells is 2:1 on the first day of stimulation and adjusted to 1:10
on the third and fifth days of stimulation. In another embodiment,
particles are added on a daily or every other day basis to a final
ratio of 1:1 on the first day, and 1:10 on the third and fifth days
of stimulation. One of skill in the art will appreciate that a
variety of other ratios may be suitable for use in the present
invention. In particular, ratios will vary depending on particle
size and on cell size and type.
[0186] In further embodiments of the present invention, the cells,
such as T cells, are combined with agent-coated beads, the beads
and the cells are subsequently separated, and then the cells are
cultured. In an alternative embodiment, prior to culture, the
agent-coated beads and cells are mnot separated but are cultured
together. In a further embodiment, the beads and cells are first
concentrated by application of a force, such as a magnetic force,
resulting in increased ligation of cell surface markers, thereby
inducing cell stimulation.
[0187] By way of example, cell surface proteins may be ligated by
allowing paramagnetic beads to which anti-CD3 and anti-CD2S are
attached (3.times.28 beads) to contact the T cells. In one
embodiment the cells (for example, 10.sup.4 to 10.sup.9 T cells)
and beads (for example, DYNABEADS.RTM. M-450 CD3/CD28 T
paramagnetic beads at a ratio of 1:1) are combined in a buffer,
preferably PBS (without divalent cations such as, calcium and
magnesium). Again, those of ordinary skill in the art can readily
appreciate any cell concentration may be used. For example, the
target cell may be very rare in the sample and comprise only 0.01%
of the sample or the entire sample (i.e., 100%) may comprise the
target cell of interest. Accordingly, any cell number is within the
context of the present invention. In certain embodiments, it may be
desirable to significantly decrease the volume in which particles
and cells are mixed together (i.e., increase the concentration of
cells), to ensure maximum contact of cells and particles. For
example, in one embodiment, a concentration of about 2 billion
cells/ml is used. In another embodiment, greater than 100 million
cells/ml is used. In a further embodiment, a concentration of cells
of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used.
In yet another embodiment, a concentration of cells from 75, 80,
85, 90, 95, or 100 million cells/ml is used. In further
embodiments, concentrations of 125 or 150 million cells/ml can be
used. Using high concentrations can result in increased cell yield,
cell activation, and cell expansion. Further, use of high cell
concentrations allows more efficient capture of cells that may
weakly express target antigens of interest, such as CD28-negative T
cells. Such populations of cells may have therapeutic value and
would be desirable to obtain in certain embodiments. For example,
using high concentration of cells allows more efficient selection
of CD8+ T cells that normally have weaker CD28 expression.
[0188] In one embodiment of the present invention, the mixture may
be cultured for several hours (about 3 hours) to about 14 days or
any hourly integer value in between. In another embodiment, the
mixture may be cultured for 21 days. In one embodiment of the
invention the beads and the T cells are cultured together for about
eight days. In another embodiment, the beads and T cells are
cultured together for 2-3 days. Several cycles of stimulation may
also be desired such that culture time of T cells can be 60 days or
more. Conditions appropriate for T cell culture include an
appropriate media (e.g., Minimal Essential Media or RPMI Media 1640
or, X-vivo 15, (Lonza)) that may contain factors necessary for
proliferation and viability, including serum (e.g., fetal bovine or
human serum), interleukin-2 (IL-2), insulin, IFN-.gamma., IL-4,
IL-7, CM-CSF, IL-10, IL-12, IL-15, TGF.beta., and TNF-.alpha., or
any other additives for the growth of cells known to the skilled
artisan. Other additives for the growth of cells include, but are
not limited to, surfactant, plasmanate, and reducing agents such as
N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI
1640, AIM-V, DMEM, MEM, .alpha.-MEM, F-12, X-Vivo 15, and X-Vivo
20, Optimizer, with added amino acids, sodium pyruvate, and
vitamins. either serum-free or supplemented with an appropriate
amount of serum (or plasma) or a defined set of hormones, and/or an
amount of cytokine(s) sufficient for the growth and expansion of T
cells. Antibiotics, e.g., penicillin and streptomycin, are included
only in experimental cultures, not in cultures of cells that are to
be infused into a subject. The target cells are maintained under
conditions necessary to support growth, for example, an appropriate
temperature (e.g., 37.degree. C.) and atmosphere (e.g., air plus 5%
CO.sub.2).
[0189] T cells that have been exposed to varied stimulation times
may exhibit different characteristics. For example, typical blood
or apheresed peripheral blood mononuclear cell products have a
helper T cell population (T.sub.H, CD4.sup.+) that is greater than
the cytotoxic or suppressor T cell population (T.sub.C, CD8.sup.+).
Ex vivo expansion of T cells by stimulating CD3 and CD28 receptors
produces a population of T cells that prior to about days 8-9
consists predominately of T.sub.H cells, while after about days
8-9, the population of T cells comprises an increasingly greater
population of T.sub.C cells. Accordingly, depending on the purpose
of treatment, infusing a subject with a T cell population
comprising predominately of T.sub.H cells may be advantageous.
Similarly, if an antigen-specific subset of T.sub.C cells has been
isolated it may be beneficial to expand this subset to a greater
degree.
[0190] Further, in addition to CD4 and CD8 markers, other
phenotypic markers vary significantly, but in large part,
reproducibly during the course of the cell expansion process. Thus,
such reproducibility enables the ability to tailor an activated T
cell product for specific purposes.
Therapeutic Application
[0191] In one embodiment, the invention pertains to a method of
inhibiting growth of a GPC3-expressing tumor cell, comprising
contacting the tumor cell with at least one antibody or a fragment
thereof of the invention such that growth of the tumor cell is
inhibited.
[0192] In one embodiment, the invention pertains to a method of
inhibiting growth of a GPC3-expressing tumor cell, comprising
contacting the tumor cell with an anti-GPC3 CAR T cell of the
present invention such that growth of the tumor cell is
inhibited.
[0193] In another aspect, the invention pertains to a method of
treating cancer in a subject. The method comprises administering to
the subject an antibody or a fragment of the invention or an
anti-GPC3 CAR T cell of the present invention such that the cancer
is treated in the subject. Particularly preferred cancers for
treatment are hepatocellular carcinomas, pancreatic cancers,
ovarian cancers, stomach cancers, lung cancers and endometrial
cancers. In still other embodiments, the cancer to be treated is
selected from the group consisting of hepatocellular carcinomas,
papillary serous ovarian adenocarcinomas, clear cell ovarian
carcinomas, mixed Mullerian ovarian carcinomas, endometroid
mucinous ovarian carcinomas, pancreatic adenocarcinomas, ductal
pancreatic adenocarcinomas, uterine serous carcinomas, lung
adenocarcinomas, extrahepatic bile duct carcinomas, gastric
adenocarcinomas, esophageal adenocarcinomas colorectal
adenocarcinomas and breast adenocarcinomas.
[0194] The present invention includes a type of cellular therapy
where T cells are genetically modified to express a chimeric
antigen receptor (CAR) and the CAR T cell is infused to a recipient
in need thereof. The infused cell is able to kill tumor cells in
the recipient. Unlike antibody therapies, CAR-modified T cells are
able to replicate in vivo resulting in long-term persistence that
can lead to sustained tumor control. In various embodiments, the T
cells administered to the patient, or their progeny, persist in the
patient for at least four months, five months, six months, seven
months, eight months, nine months, ten months, eleven months,
twelve months, thirteen months, fourteen month, fifteen months,
sixteen months, seventeen months, eighteen months, nineteen months,
twenty months, twenty-one months, twenty-two months, twenty-three
months, two years, three years, four years, or five years after
administration of the T cell to the patient.
[0195] Without wishing to be bound by any particular theory, the
anti-tumor immunity response elicited by the CAR-modified T cells
may be an active or a passive immune response. In another
embodiment, the fully-human CAR transduced T cells exhibit specific
proinflammatory cytokine secretion and potent cytolytic activity in
response to human cancer cells expressing the GPC3, resist soluble
GPC3 inhibition, mediate bystander killing and nmediate regression
of an established human tumor. For example, antigen-less tumor
cells within a heterogeneous field of GPC3-expressing tumor may be
susceptible to indirect destruction by GPC3-redirected T cells that
has previously reacted against adjacent antigen-positive cancer
cells.
[0196] The fully-human CAR-modified T cells of the invention may be
a type of vaccine for ex vivo immunization and/or in vivo therapy
in a mammal. Preferably, the mammal is a human.
[0197] With respect to ex vivo immunization, at least one of the
following occurs in vitro prior to administering the cell into a
mammal: i) expansion of the cells, ii) introducing a nucleic acid
encoding a CAR to the cells or iii) cryopreservation of the
cells.
[0198] Ex vivo procedures are well known in the art and are
discussed more fully below. Briefly, cells are isolated from a
mammal (preferably a human) and genetically modified (i.e.,
transduced or transfected in vitro) with a vector expressing a CAR
disclosed herein. The CAR-modified cell can be administered to a
mammalian recipient to provide a therapeutic benefit. The
mannnalian recipient may be a human and the CAR-modified cell can
be autologous with respect to the recipient. Alternatively, the
cells can be allogeneic, syngeneic or xenogeneic with respect to
the recipient.
[0199] The procedure for ex vivo expansion of hematopoietic stem
and progenitor cells is described in U.S. Pat. No. 5,199,942,
incorporated herein by reference, can be applied to the cells of
the present invention. Other suitable methods are known in the art,
therefore the present invention is not limited to any particular
method of ex vivo expansion of the cells. Briefly, ex vivo culture
and expansion of T cells comprises: (1) collecting CD34+
hematopoietic stem and progenitor cells from a mammal from
peripheral blood harvest or bone marrow explants; and (2) expanding
such cells ex vivo. In addition to the cellular growth factors
described in U.S. Pat. No. 5,199,942, other factors such as flt3-L,
IL-1, IL-3 and c-kit ligand, can be used for culturing and
expansion of the cells.
[0200] In addition to using a cell-based vaccine in terms of ex
vivo immunization, the present invention also provides compositions
and methods for in vivo immunization to elicit an immune response
directed against an antigen in a patient.
[0201] Generally, the cells activated and expanded as described
herein may be utilized in the treatment and prevention of diseases
that arise in individuals who are immunocompromised. In particular,
the CAR-modified T cells of the invention are used in the treatment
of diseases, disorders and conditions associated with dysregulated
expression of GPC3. In certain embodiments, the cells of the
invention are used in the treatment of patients at risk for
developing diseases, disorders and conditions associated with
dysregulated expression of GPC3. Thus, the present invention
provides methods for the treatment or prevention of diseases,
disorders and conditions associated with dysregulated expression of
GPC3 comprising administering to a subject in need thereof, a
therapeutically effective amount of the fully human CAR-modified T
cells of the invention.
[0202] The CAR-modified T cells of the present invention may be
administered either alone, or as a pharmaceutical composition in
combination with diluents and/or with other components such as IL-2
or other cytokines or cell populations. Briefly, pharmaceutical
compositions of the present invention may comprise a target cell
population as described herein, in combination with one or more
pharmaceutically or physiologically acceptable carriers, diluents
or excipients. Such compositions may comprise buffers such as
neutral buffered saline, phosphate buffered saline and the like:
carbohydrates such as glucose, mannose, sucrose or dextrans,
mannitol; proteins; polypeptides or amino acids such as glycine;
antioxidants; chelating agents such as EDTA or glutathione;
adjuvants (e.g., aluminum hydroxide); and preservatives.
Compositions of the present invention are preferably formulated for
intravenous administration.
[0203] Pharmaceutical compositions of the present, invention may be
administered in a manner appropriate to the disease to be treated
(or prevented). The quantity and frequency of administration will
be determined by such factors as the condition of the patient, and
the type and severity of the patient's disease, although
appropriate dosages may be determined by clinical trials.
[0204] When "an immunologically effective amount", "an anti-tumor
effective amount", "an tumor-inhibiting effective amount", or
"therapeutic amount" is indicated, the precise amount of the
compositions of the present invention to be administered can be
determined by a physician with consideration of individual
differences in age, weight, tumor size, extent of infection or
metastasis, and condition of the patient (subject). It can
generally be stated that a pharmaceutical composition comprising
the T cells described herein may be administered at a dosage of
10.sup.4 to 10.sup.9 cells/kg body weight, preferably 10.sup.5 to
10.sup.6 cells/kg body weight, including all integer values within
those ranges. T cell compositions may also be administered multiple
times at these dosages. The cells can be administered by using
infusion techniques that are connnonly known in immunotherapy (see,
e.g. Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The
optimal dosage and treatnent regime for a particular patient can
readily be determined by one skilled in the art of medicine by
monitoring the patient for signs of disease and adjusting the
treatment accordingly.
[0205] In certain embodiments, it may be desired to administer
activated T cells to a subject and then subsequently redraw blood
(or have an apheresis performed), activate T cells therefrom
according to the present invention, and reinfuse the patient with
these activated and expanded T cells. This process can be carried
out multiple times every few weeks. In certain embodiments, T cells
can be activated from blood draws of from 10 cc to 400 cc. In
certain embodiments, T cells are activated from blood draws of 20
cc, 30 cc, 40 cc, 50 cc, 60 cc, 70 cc, 80 cc, 90 cc, or 100 cc. Not
to be bound by theory, using this multiple blood draw/multiple
reinfusion protocol, may select out certain populations of T
cells.
[0206] The administration of the subject compositions may be
carried out in any convenient manner, including by aerosol
inhalation, injection, ingestion, transfusion, implantation or
transplantation. The compositions described herein may be
administered to a patient transarterially, subcutaneously,
intradermally, intratumorally, intranodally, intramedullary,
intramuscularly, by intravenous (i.v.) injection, or
intraperitoneally. In one embodiment, the T cell compositions of
the present invention are administered to a patient by intradermal
or subcutaneous injection. In another embodiment, the T cell
compositions of the present invention are preferably administered
by i.v. injection. The compositions of T cells may be injected
directly into a tumor, lymph node, or site of infection.
[0207] In certain embodiments of the present invention, cells
activated and expanded using the methods described herein, or other
methods known in the art where T cells are expanded to therapeutic
levels, are administered to a patient in conjunction with (e.g.,
before, simultaneously or following) any number of relevant
treatment modalities, including but not limited to treatment with
agents such as antiviral therapy, cidofovir and interleukin-2,
Cytarabine (also known as ARA-C) or natalizumab treatment for MS
patients or efalizumab treatment for psoriasis patients or other
treatments for PML patients. In further embodiments, the T cells of
the invention may be used in combination with chemotherapy,
radiation, immunosuppressive agents, such as cyclosporin,
azathioprine, methotrexate, mycophenolate, and FK506, antibodies,
or other immunoablative agents such as CAM PATH, anti-CD3
antibodies or other antibody therapies, cytoxin, fludaribine,
cyclosporin. FK506, rapamycin, mycophenolic acid, steroids.
FR901228, cytokines, and irradiation. These drugs inhibit either
the calcium dependent phosphatase calcineurin (cyclosporine and
FK506) or inhibit the p7QS6 kinase that is important for growth
factor induced signaling (rapamycin). (Liu et al., Cell 66:807-815,
1991: Henderson et al., Immun. 73:316-321, 1991; Bierer et al.,
Curr. Opin. Immun. 5:763-773, 1993). In a further embodiment, the
cell compositions of the present invention are administered to a
patient in conjunction with (e.g., before, simultaneously or
following) bone marrow transplantation, T cell ablative therapy
using either chemotherapy agents such as, fludarabine,
external-beam radiation therapy (XRT), cyclophosphamide, or
antibodies such as OKT3 or CAMPATH. In another embodiment, the cell
compositions of the present invention are administered following
B-cell ablative therapy such as agents that react with CD20, e.g.,
Rituxan. For example, in one embodiment, subjects may undergo
standard treatment with high dose chemotherapy followed by
peripheral blood stein cell transplantation. In certain
embodiments, following the transplant, subjects receive an infusion
of the expanded immune cells of the present invention. In an
additional embodiment, expanded cells are administered before or
following surgery.
[0208] The dosage of the above treatments to be administered to a
patient will vary with the precise nature of the condition being
treated and the recipient of the treatment. The scaling of dosages
for human administration can be performed according to art-accepted
practices. The dose for CAMPATH, for example, will generally be in
the range I to about 100 mg for an adult patient, usually
administered daily for a period between 1 and 30 days. The
preferred daily dose is 1 to 10 mg per day although in some
instances larger doses of up to 40 mg per day may be used
(described in U.S. Pat. No. 6,120,766).
Diagnostic Method
[0209] In another aspect, the present invention provides a method
of diagnosing a disease such as cancer by detecting GPC3 protein in
a test sample with the use of the antibody of the present
invention.
[0210] The detection used herein includes quantitative detection
and non-quantitative detection. The non-quantitative detection
include, for example, determination of merely whether or not GPC3
protein is present, determination of whether or not a specific
amount or more of GPC3 protein is present, determination for
comparison of the amount of GPC3 protein with that of another
sample (e.g., a control sample). The quantitative detection
includes determination of the concentration of GPC3 protein,
determination of the amount of GPC3 protein.
[0211] The test sample is not particularly limited as long as it is
a sample that may contain GPC3 protein, however, preferred is a
sample collected from the body of a living organism such as a
mammal, and more preferred is a sample collected from human.
Specific examples of the test sample may include, for example,
blood, interstitial fluid, plasma, extravascular fluid, cerebral
fluid, joint fluid, pleural fluid, serum, lymph fluid, saliva,
preferably blood, serum and plasma. In addition, a sample obtained
from the test sample such as culture solution of cells collected
from the body of the living organism is also included in the test
sample of the present invention.
[0212] The cancer to be diagnosed is not particularly limited, and
specific examples may include liver cancer, pancreatic cancer, lung
cancer, colon cancer, mammary cancer, prostate cancer, leukemia and
lymphoma, preferably liver cancer. GPC3 to be detected is not
particularly limited, and may be either full-length GPC3 or a
fragment thereof. In the case where a fragment of GPC3 is detected,
it may be either the N-terminal fragment or the C-terminal
fragment.
[0213] The method of detecting GPC3 protein contained in a test
sample is not particularly limited, however, detection is
preferably performed by an immunological method with the use of an
anti-GPC3 antibody. Examples of the immunological method include,
for example, a radioimmunoassay, an enzynme immunoassay, a
fluorescence immunoassay, a luminescence immunoassay,
immunoprecipitation, a turbidimetric immunoassay. Preferred is an
enzyme immunoassay, and particularly preferred is an enzyme-linked
immunosorbent assay (ELISA) (e.g., a sandwich ELISA). The
above-mentioned immunological method such as an ELISA can be
carried out by a method known to those skilled in the art.
[0214] A general detection method with the use of an anti-GPC3
antibody comprises immobilizing an anti-GPC3 antibody on a support,
adding a test sample thereto, incubating the support to allow the
anti-GPC3 antibody and GPC3 protein to bind to each other, washing
the support, and detecting the GPC3 protein binding to the support
via the anti-GPC3 antibody to detect GPC3 protein in a test
sample.
[0215] The binding between the anti-GPC3 antibody and the GPC3
protein is generally carried out in a buffer. Buffers used in the
invention include, for example, a phosphate buffer, a Tris buffer.
Incubation is carried out under the conditions generally employed,
for example, at 4.degree. C. to room temperature for 1 hour to 24
hours. The washing after incubation can be carried out by any
method as long as it does not inhibit the binding between the GPC3
protein and the anti-GPC3 antibody, using for example a buffer
containing a surfactant such as Tween 20.
[0216] In the method of detecting GPC3 protein of the present
invention, a control sample may be provided in addition to a test
sample to be tested for GPC3 protein. The control samples include a
negative control sample that does not contain GPC3 protein and a
positive control sample that contains GPC3 protein. In this case,
it is possible to detect GPC3 protein in the test sample by
comparing the result obtained with the negative control sample that
does not contain GPC3 protein with the result obtained with the
positive control sample that contains GPC3 protein. It is also
possible to quantitatively detect GPC3 protein contained in the
test sample by obtaining the detection results of the control
samples and the test sample as numerical values, and comparing
these numerical values.
[0217] One preferred embodiment of detecting GPC3 protein binding
to the support via an anti-GPC3 antibody is a method using an
anti-GPC3 antibody labeled with a detectable label. For example.
GPC3 protein may be detected by contacting the test sample with an
anti-GPC3 antibody immobilized on the support, washing the support,
and then detecting GPC3 with the use of the labeled antibody that
specifically binds to GPC3 protein.
[0218] The labeling of an anti-GPC3 antibody can be carried out by
a generally known method. Examples of the detectable label known to
those skilled in the art include a fluorescent dye, an enzyme, a
coenzyme, a chemiluminescent substance or a radioactive substance.
Specific examples may include radioisotopes (.sup.32P, .sup.14C,
.sup.125I, .sup.3H, .sup.131I and the like), fluorescein,
rhodamine, dansyl chloride, umbelliferone, luciferase, peroxidase,
alkaline phosphatase, beta-galactosidase, beta-glucosidase,
horseradish peroxidase, glucoamylase, lysozyme, saccharide oxidase,
microperoxidase., biotin and the like. In the case where biotin is
used as a detectable label, it is preferred that a biotin-labeled
antibody is added, and then avidin conjugated to an enzyme such as
alkaline phosphatase is further added.
[0219] Specifically, a solution containing an anti-GPC3 antibody is
added to a support such as a plate to allow the anti-GPC3 antibody
to be immobilized. After washing, the plate is blocked with, for
example. BSA in order to prevent the nonspecific binding of a
protein. The plate is washed again, and then the test sample is
added to the plate. After being incubated, the plate is washed, and
then the labeled anti-GPC3 antibody is added. After being incubated
appropriately, the plate is washed, and then the labeled anti-GPC3
antibody remaining on the plate is detected. The detection of the
protein can be carried out by a method known to those skilled in
the art. For example, in the case where the antibody is labeled
with a radioactive substance, the protein may be detected by liquid
scintillation or the RIA method. In the case where the antibody is
labeled with an enzyme, the protein may be detected by adding a
substrate and detecting an enzymatic change of the substrate such
as color development with an absorbance reader. In the case where
the antibody is labeled with a fluorescent substance, the protein
may be detected with the use of a fluorometer.
[0220] A particularly preferred embodiment of the method of
detecting GPC3 protein of the present invention is a method using
an anti-GPC3 antibody labeled with biotin and avidin. Specifically,
a solution containing an anti-GPC3 antibody is added to a support
such as a plate to allow the anti-GPC3 antibody to be immobilized
thereon. After washing, the plate is blocked with for example, BSA
in order to prevent the nonspecific binding of a protein. The plate
is washed again, and then the test sample is added to the plate.
After being incubated, the plate is washed, and then the
biotin-labeled anti-GPC3 antibody is added. After being incubated
appropriately, the plate is washed, and then avidin conjugated to
an enzyme such as alkaline phosphatase or peroxidase is added.
After being incubated, the plate is washed, and then a substrate of
the enzyme conjugated to avidin is added. Then, GPC3 protein is
detected by means of the enzymatic change of the substrate as an
indicator.
[0221] Another embodiment of the method of detecting GPC3 protein
of the present invention is a method using a primary antibody that
specifically binds to GPC3 protein and a secondary antibody that
specifically binds to the primary antibody. For example, the test
sample is brought into contact with an anti-GPC3 antibody
immobilized on the support, the support is incubated and washed,
and the bound GPC3 protein after washing is detected with a primary
anti-GPC3 antibody and a secondary antibody that specifically binds
to the primary antibody. In this case, the secondary antibody is
preferably labeled with a detectable label.
[0222] Specifically, a solution containing an anti-GPC3 antibody is
added to a support such as a plate to allow the anti-GPC3 antibody
to be immobilized thereon. After washing, the plate is blocked
with, for example. BSA in order to prevent the nonspecific binding
of a protein. The plate is washed again, and then the test sample
is added to the plate. After being incubated, the plate is washed,
and then a primary anti-GPC3 antibody is added. After being
incubated appropriately, the plate is washed, and then a secondary
antibody that specifically binds to the primary antibody is added.
After being incubated appropriately, the plate is washed, and then
the secondary antibody remaining on the plate is detected. The
detection of the secondary antibody can be carried out by the
above-mentioned method.
EXPERIMENTAL EXAMPLES
[0223] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0224] Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the compounds
of the present invention and practice the claimed methods. The
following working examples therefore, specifically point out the
preferred embodiments of the present invention, and are not to be
construed as limiting in any way the remainder of the
disclosure.
Example 1
Glypican-3-Specific scFv Isolation and Validation for Use in
Hepatocellular Carcinoma
[0225] The following experiments were designed to develop and
validate GPC3-specific T bodies. The high throughput methodology
used in these experiments identified human-derived scFvs with
EC.sub.50 ranging from 5.0-110.9 nM that bound specifically to
glypican-3-expressing cell lines and whose binding was
significantly reduced by shRNA knockdown of glypican-3. These scFvs
are optimal for development for diagnostic and in vivo therapeutic
applications.
[0226] Briefly, two different biotinylated antigen targets, a
synthesized 29mer fragment GPC3.sub.550-558 and a truncated
GPC3.sub.368-548 fused with GST, was used to screen a yeast display
library which was enriched to greater than 30% target-specific
yeast with both positive selection and depletion of streptavidin-
and GST-specific clones. After cloning identified scFv cDNA from
the enriched sublibrary, scFv specificity was validated by ELLSA
for binding to recombinant protein from prokaryotic and eurkaryotic
sources and ultimately naturally-presented human protein on the
cell membrane of human hepatocellular cell lines. Specificity was
confirmed using nonexpressing cell lines and shRNA knockdown.
Ultimately, five unique scFv with affinity EC.sub.50 ranging from
5.0-110.9 nM were identified. These results demonstrate
characterization of five novel and unique scFvs for potential
humoral or chimeric therapeutic development in human hepatocellular
carcinoma.
[0227] The materials and methods employed in these experiments are
now described.
Materials and Methods
[0228] Cell Lines and Media
[0229] Cell lines of 293T (ATCC, Manassas Va.). HepG2 (ATCC), Hep3B
(obtained from the Penn Center for Molecular Studies in Digestive
and Liver Disease) and GP2-293 cells (Clontech, Mountain View,
Calif.) were maintained in Dulbecco's modified essential medium
DMEM (Invitrogen. Carlsbad. CA) with 10% fetal bovine serum (FBS.
Sigma. St. Louis Mo.). HepG2.tdTomato were generated via stable
transfection of parental HepG2 with lentivirus-harboring tdTomato
Red and purified by flow cytometry. 293T.GPC3 were generated by
cloning full-length human GPC3 cDNA (NM.sub.--004484) into pDisplay
(Invitrogen) XmaI and SacII sites using the following forward (5'
CCCGGGGCCACCTGTCACCAAGTCCG 3' SEQ ID NO: 62) and reverse primer (5'
CCGCGGGGCTGCACCAGGAAGAAGAAGCAC 3' SEQ ID NO: 63).
[0230] Inducible Expression and Purification of Truncated hGPC3
Protein
[0231] The full-length cDNA of human glypican-3 (NM.sub.--0004484)
was amplified from a human cDNA library using the following forward
primers (5' ATGGCCGGGAC CGTGCGCACC 3') (SEQ ID NO: 1) and revere
primer (5' TCAGTGCACCAGGAA GAAGAAGCA 3') (SEQ ID NO: 2). A 594 bp
DNA fragment corresponding to the region of nt1277-1871, which
translates a truncated fragment of hGPC3 (aa 368-548) between the
CRD cleavage site and putative transmembrane domain, was cloned
into the prokaryotic expression vector pGEX-4T using Sail and EcoRI
restriction sites (forward primer: 5'CCG GAA TIC GAC AAG AAA GTA
TTA AAA GTT GCT CA 3' (SEQ ID NO: 3) and reverse primer: 5' ACG CGT
CGA CGG TGC TTA TCT CGT TGT CCT TC-3') (SEQ ID NO: 4) to generate a
plasmid encoding a truncated hGPC3-GST recombinant fusion protein
under the control of an IPTG-inducible tac promoter. The plasmid
was transformed into E. coli BL21-CodonPlus (DE3)-RIPL (Stratagene,
Santa Clara Calif.), grown in fresh 2YT medium, and induced by 1 mM
IPTG at 25.degree. C. for 6 hours. Bacterial cells were collected
by centrifugation and lysed by sonication in presence of 1%
sarkosyl and 2% Triton X-100. The lysate was incubated with
Glutathione Sepharose 4B heads (GE healthcare. Piscataway N.J.) at
4.degree. C. for 4 hours, washed, and then eluted 50 mM Tris-HCl
buffer (pH 7.4) containing 20 mM reduced glutathione. The recovery
of the GST and GPC3-GST fusion protein was monitored by Coomassie
Blue staining. The trhGPC3-GST, GST, and a commercially custom
synthesized 29mer GPC3 peptide (aa 530-558, Proimmune Oxford UK)
were biotinylated using NHS Biotinylation kit (Pierce, Rockford
Ill.).
[0232] Selection of hGPC3-Reactive scFvs by Screening Paired
Yeast-Display/Secretory scFv Library
[0233] The paired yeast-display/secretory scFv library has
previously been described (Zhao, et al., 2011, J Immunol Methods
363:221-232; Scholler, et al., 2006, J Immunol Methods 317,
132-143), and was screened using existing methodology with minor
modifications. Briefly the yeast display library was grown in
SD-CAA (2% raffinose, 0.67% yeast nitrogen base, and 0.5% casamino
acids) at 30.degree. C. to an .ANG.600 of .about.5. Surface scFv
expression was induced by re-inoculating yeast at an .ANG.600 of
0.5 in SGRD-CAA (SD-CAA+2% galactose) and grown at 20.degree. C.
for 16-36 h. scFv expression by yeast was confirmed by flow
cytometry using anti-c-myc mouse mAb (9E10, Santa Cruz
biotechnology) and goat anti-mouse Fab Alexa Fluor 488 (AF488,
Invitrogen, Carlsbad Calif.). Two rounds of magnetic bead-based
selection were performed as follows: 1.times.10.sup.9 induced yeast
cells in 500 ul PBE buffer (PBS+0.5% EDTA) were incubated with
biotinylated 29mer GPC3 peptide (100 nM) or biotinylated rhGPC3-GST
(100 ng/ml) at 25.degree. C. for 30 min then on ice for 10 min. The
rhGPC3-reactive scFv were enriched by magnetically sorting over an
LS column (Miltenyi Biotec, Auburn, Calif.). When screening with
rhGPC3-GST protein, GST-reactive yeast were depleted over an LS
column after incubation of induced yeast with biotinylated GST and
streptavidin microbeads. Three rounds of flow cytometry-based
sorting were performed with gradually decreasing concentration of
target antigen as follows: yeast cells were stained with mouse
anti-c-myc mAb (1:200), anti-mouse IgG1 AF488, biotinylated antigen
(rhGPC3 protein at 40 ng/ml in 1.sup.st round, 20 ng/ml in 2.sup.rd
round, and 10 ng/ml in 3.sup.rd round), and either streptavidin-PE
(1.sup.st and 2.sup.nd round. Invitrogen) or neutravidin-PE
(3.sup.rd round, Invitrogen). AF488+ and PE+ double positive yeast
were selected and recovered in 96 well plates containing
SD-CAA.
[0234] High Throughout Purification of Secreted scFvs
[0235] scFv cDNA were extracted from the enriched yeast population
after the 3.sup.rd round of flow sorting, amplified by PCR (forward
primer 5'-GGTTCTGGTGGTGGAG GTTCTGGTGGTGGTGGATCTG-3(SEQ ID NO: 5);
reverse 5'-GAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGT
CGACCAAGTCTTCTTCAGAATAAGCTT-3' (SEQ ID NO: 6)), purified using
MiniElute kit (Qiagen. Valencia Calif.), and then cotransformed
with 100 ng of linearized p416-BCCR vector into YVH 10 cells.
Transformed yeast were plated on Trp+SD-CAA dishes, from which
approximately six hundred colonies were transferred to growth
medium in deep 96-well plates (Fisher Scientific) and induced by 2%
galactose to secrete scFv for up to 72 h. For high throughput
purification of scFv, yeast culture supernatant (720 ul) with 80 ul
10.times. equilibration buffer (0.05M sodium phosphate and 0.3M
sodium chloride, pH 8.0) was transferred into a new clean deep
96-well plate and incubated with HIS-Select-Nickle Affinity Gel (10
ul) for 1 h at 4.degree. C. All supernatant were then transferred
to pre-wet Multi-screen-HV filter plates (Millipore, Billerica
Mass.) and drained with a vacuum manifold. After washing, scFv were
eluted using 50 mM sodium phosphate pH 8.0, 0.3M sodium chlorate
and 250 mM imidazole and vacuum transferred into polypropylene 96
well plates.
[0236] ELISA and Measurement scFv Affinity by ELISA
[0237] For measurement of scFv affinity, Nunc Maxisorb plates were
pre-coated with hGPC3-GST protein at the indicated concentration in
carbonate-bicarbonate buffer overnight at 4.degree. C. After three
washing steps with PBS/0.1% Tween-20 (PBST), 300 ul per well of
blocking solution (2% milk in PBS pH 7) was added for 2 h at room
temperature then washed three tinmes with PBST. Candidate scFv
starting at 100 ug/ml were added with serial dilutions, incubated
for Ih at room temperature followed by three washing steps with
PBST, scFv binding was detected by adding anti-V5 HRP (Invitrmgen),
washing .times.4 with PBST, washing .times.1 with PBS, then adding
50 ul/well of TMB peroxidase substrate (KPL, Gaithersburg Md.) plus
peroxidase substrate solution B at 1:1 ratio, then the reaction was
stopped using 50 ul of 0.5M H.sub.2SO.sub.4. OD450 was measured
using a BioRad 680 microplate reader. For determination of
functional affinity, half maximal binding concentration (EC50) was
calculated with non-linear regression curve fit algorithm using the
software program PRISM (GraphPad Software, San Diego, Calif.).
rhGPC3 expressed in a murine myeloma cell line which was
commercially obtained from R&D Systems (Minneapolis Minn.).
[0238] Flow Cytometrv
[0239] Detection of scPv binding to cell lines was detected with
anti-V5 mAb (AbD Senrec, Raleigh. NC). Anti-hGPC3 mAb (1G12,
Biomosaics Inc., Burlington. VT) was used as a positive control.
scFvs were premixed with anti-V5 APC mAb (AbD Serotec) at a molar
ratio of 1:1 for 30 min at RT. scFv-anti-V5 complexes were then
incubated with target cell lines for 30 min at 37.degree. C. Cells
were then acquired on a FACSCanto (Becton Dickinson, San Jose
Calif.) and analyzed using FlowJo (Treestar. Ashland, Oreg.).
[0240] Confocal Immunofluorescence
[0241] Target cell lines cultured on 0.2 .mu.m coverslips (Nunc,
Rochester, N.Y.) were fixed and stained with the indicated scFv-V5
APC complex. Image acquisition was performed on a Fluoview 10
confocal laser microscope (Olympus).
[0242] Western and Dot Blot
[0243] Cell lysates were separated by SDS-PAGE gel and transferred
to polyvinylidene difluoride membrances (PVDF). In a dot blot
procedure, purified protein (10 ng) was spotted on PVDF membrane.
Membranes were blotted with primary Abs followed by incubation with
infrared dye IR680-labeled secondary antibodies and quantified
using LI-COR Odyssey software.
[0244] Glypican-3 Knockdown
[0245] hGPC3-specific short hairpin RNAs (shRNAs) were prepared in
the pSIREN-retroQ-zsGreen retroviral vector using BD knockout RNAi
systems according to the manufacturer's instruction (Clontech).
Three pairs of 21 nt oligonucleotides, named sh56, sh57, and sh58
as well as a LacZ (negative control), were predicted according to
Ambion Silencer Select software, annealed and subcloned into
pSIREN-retroQ-z Green at the BamHI and EcoRI sites. The RNA
targeting sequence of these three shRNAs am (sh56:
5'-GCCAAATTATTCTCC TATGTT-3' (SEQ ID NO: 7); sh57: 5'-GCCAATATAGA
TCTGCTTATT-3' (SEQ ID NO: 8); sh58: 5'-GCTCAAGAA AGATGGAAGAAA-3'
(SEQ ID NO: 9)). For testing hairpin silencing, myc-tagged
hGPC3.sub.(AA 368-551) was cloned into the Display plasmid.
Plasmids expressing shRNA and hGPC3.myc plasmids were
co-transfected into HEK 293 cells (3:1 ratio, hairpin to target),
and cells were lysed after 48 h. hGPC3.myc levels were quantified
by Western blot using anti-c-myc mAb. Pseudotyped retrovirus
encoding shRNA were then produced. Briefly, GP2-293 cells were
seeded in 10 cm cell culture dishes 12 h prior to transfection. At
50% density, cells were transfected with 10 ug pSIREN-shRNA plasmid
and 5 ug pVSV-G (Clontech) for pseudotyping using the calcium
phosphate transfection method. On day 2 and day 3 after
transfection, media containing retroviral particles were collected.
Particles were concentrated 100-fold by ultracentrifugation. To
infect cells, 10 ul of concentrated virus stock were added into
1.times.10.sup.6 HepG2 cells in presence of polybrene (4 ug/ml).
Transduced cells were isolated by FACS sorting of eGFP+ cells and
maintained as stable cell lines.
[0246] MTT (3-4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide) assay
[0247] A standard MTT assay using the CellTiter 96.RTM.
Non-Radioactive Cell Proliferation Assay (Promega Corporation,
Madison Wis.) according to manufacturer's instructions was
performed. HepG2 and HepG2.sh57 cells were plated at a density of
5.times.10.sup.3 cells/well in triplicate in a 96-well plate and
incubated for 2-4 days as indicated. Optical density was measured
at 570 nm. Trypisinized cells were manually counted by
hematocytorneter in validation experiments.
[0248] The results of the experiments are now described.
Preparation of Target Antigen for Screening of hGPC3-Specific
scFv
[0249] Two target antigens were developed for scFv isolation.
First, a 29mer peptide hGPC3.sub.530-558 was chosen and
commercially synthesized in biotinylated and non-biotinylated
formats to develop scFvs specific for the region between two
C-terminal GAG modification sites and the hydrophobic putative
GPI-linkage domain predicted by an online algorithm
(http://tools.immuneepitope.org) as depicted in FIG. 1. Second, a
truncated hGPC3.sub.368-548-GST fusion protein spanning a larger
region of the C-terminus of the protein was expressed and purified
as depicted in FIG. 1. Purity of the expressed fusion protein was
further confirmed by Western blot with the 1G12 mAb as depicted in
FIG. 1C. Both the 29mer hGPC3.sub.530-558 and hGPC3.sub.368-548-GST
were biotinylated for yeast library screening.
[0250] Isolation of hGPC3-Reactive scFV-Displaying Yeast
[0251] The yeast library was subjected to two rounds of
magnetic-sorting using biotinylated hGPC3.sub.530-558 or three
rounds of magnetic-sorting using biotinylated hGPC3.sub.368-548-GST
to enrich hGPC3-specific scFv-expressing yeast. The third magnetic
son of hGPC3.sub.368-548-GST was a depletion sort to eliminate
GST-specific scFv-expressing yeast using biotinylated GST. The
enriched sub-library was then further enriched for hGPC3-specific
scFv-expressing yeast with three rounds of flow sorting selecting
for yeast expressing scFv-c-myc and biotinylated antigen at
progressively decreasing concentration as depicted in FIG. 2A.
Streptavidin-PE was used to identify scFv specific for biotinylated
target in the first two rounds. Neutravidin-PE was utilized in the
third round to eliminate selection of streptavidin-specific
scFv-expressing yeast (.about.9% of yeast after MACS and two rounds
of FACS sorting). This strategy yielded a marked enrichment of
hGPC3-reactive yeast to approximately 30% of the population as
depicted in FIG. 2B.
[0252] Selection of hGPC3-Specific scFv by ELISA
[0253] The majority of yeast clones obtained after transduction of
scFv cDN A cloned into a secretory plasmid produced scFv at
detectable quantities in supernatant (FIG. 3A). Approximately 3K)
transformed yeast colonies were subcultured for high-throughput
Ni-purification of supernatant. The 300 scFv candidates were then
assessed for binding to rhGPC3 by ELISA as depicted in FIG. 3B. In
order to eliminate GST-reactive scFv, each scFv candidate was
tested in parallel for binding to both GST and rhGPC3-GST.
Thirty-six scFv candidates with ODhGPC3-GST/ODGST ratios greater
than 1.5 were selected for further screening as depicted in FIG.
3B. Binding to full-length glycosylated recombinant hGPC3 protein
expressed in a murine myeloma cell line was assessed by ELSA as
depicted in FIG. 3C. Thirteen candidates with
OD.sub.GPC3/OD.sub.media ratio greater than 2 were identified.
Biological Characterization of the scFv Candidates
[0254] Among these thirteen scFv candidates, eight yeast colonies
with varying ELISA affinity were chosen for further validation.
Soluble scFv were purified from the supernatant by anti-HIS
chromatography resulting in 0.1-0.5 mg soluble antibody/liter
culture. Using a dot blot analysis, all scFv recognized rhGPC3
protein with no cross-reactivity with GST protein as depicted in
FIG. 4A, confirming ELISA findings. Nucleotide sequencing of these
thirteen scFv yeast colonies revealed five unique sequences, for
which 2E10, 3E11, 3D8, 4G5, and 2G9 represented one of each clone
(Table 2). The analysis of the predicted amino acid sequence by
aligmnent of scFv heavy and light chain variable region sequence to
a database of human immunoglobulin germline sequences (V base
directory of human V gene sequences) using IgBLAST
(http://www.ncbi.nim,nih.gov/igblast/) was applied to establish VH
and VL gene utilization and heavy-chain CDR composition of the scFv
antibodies as shown in Table 1. The VH domains in scFv 2G9, 4G5 and
2E10 are VH IV, while 3E11 and 3D8 are VHIII. For VL domain, 3E11
is LVIkvII, 4G5 is KV3; and the remaining are KV2. The binding
affinity for rhGPC3 was established by ELISA at two concentrations
of rhGPC3 protein and repeated, with affinity determined by
calculation of half maximal binding concentration (EC50) using a
non-linear regression curve-fit algorithm. The EC50 value of scFv
ranged from 3 nM to 105 nM. For scFv 3E11, the comparable
affinities were measured to be 14 nM at the concentration of 1
ug/ml and 11 nM at the concentration of 0.5 ug/ml rhGPC3 protein as
shown in FIGS. 48 and 4C.
TABLE-US-00001 TABLE 1 Sequence analysis of anti-GPC3 scFv Sub-
Number type of scFvs heavy CDR1 CDR2 CDR3 nucleotide clone chain
(SEQ ID NO:) (SEQ ID NO:) (SEQ ID NO:) difference VH: 3E11 HV3
SYGLH AISYDGSKKYYAD GWFVEPLS 13 (22) SVKG (23) (24) 2G9 HV4 SSSYYWA
NIYYSGSTYYNPSL FPLIRGYRYR 6 (25) KS (26) YDEY (27) 4G5 HV4 SGYYWG
RIYYGGSTHYNPS DRNYQSLSGY 16 (28) LQS (29) CLDY (30) 3D8 HV3 SYAMS
AISGSGTSTYYADS HKSFGVQWL 26 (31) VKG (32) (33) 2E10 HV4 SSSYYWG
SIYYSGSTYYNPSL HDGHRYGTY 15 (34) KS (35) YGLDV (36) VL: 3E11 LV1
SGSSSNIGSNTVN SNNQRPS GWFVEPLS 4 (37) (38) (39) 2G9 KV2
RSSQSLLHRDGYHYLN LGSNRAS MQAPQTPR 9 (40) (41) T (42) 4G5 KV3
RASQSVSSHIA GASTRAT QQYNKWP 11 (43) (44) P (45) 3D8 KV2
WSSQSLVYGDGNTYLN KVSNRDS MQGTHWP 4 (46) (47) PG (48) 2E10 KV2
SSQSLVYSDGNTYLN KVSNRDS MQGTHWP 10 (49) (50) P (51)
[0255] Amino acid sequences of the VH and VL antigen binding
regions of the scFv were analyzed by alignment of a database of
immunoglobulin germline sequence. The complementary determining
regions (CDRs) are provided. The number of nucleotide differences
from germline database is also tabulated.
TABLE-US-00002 TABLE 2 Sequence identifiers for anti-GPC3 scFV SEQ
ID NO: # IDENTITY SEQ ID NO: 12 3E11; heavy chain (amino acid) SEQ
ID NO: 13 2G9; heavy chain (amino acid) SEQ ID NO: 14 4G5; heavy
chain (amino acid) SEQ ID NO: 15 3D8; heavy chain (amino acid) SEQ
ID NO: 16 2E10; heavy chain (amino acid) SEQ ID NO: 17 3E11; light
chain (amino acid) SEQ ID NO: 18 2G9; light chain (amino acid) SEQ
ID NO: 19 4G5; light chain (amino acid) SEQ ID NO: 20 3D8; light
chain (amino acid) SEQ ID NO: 21 2E10; light chain (amino acid) SEQ
ID NO: 22-51 CDR1, CDR2, CDR3 of anti-GPC3 scFv SEQ ID NO: 52 3E11;
heavy chain (nucleotide) SEQ ID NO: 53 2G9; heavy chain
(nucleotide) SEQ ID NO: 54 4G5; heavy chain (nucleotide) SEQ ID NO:
55 3D8; heavy chain (nucleotide) SEQ ID NO: 56 2E10; heavy chain
(nucleotide) SEQ ID NO: 57 3E11; light chain (nucleotide) SEQ ID
NO: 58 2G9; light chain (nucleotide) SEQ ID NO: 59 4G5; light chain
(nucleotide) SEQ ID NO: 60 3D8; light chain (nucleotide) SEQ ID NO:
61 2E10; light chain (nucleotide)
scFv Binding to Native hGPC3 Protein Specifically on Human Cell
Surface on Glypican-3-Expressing Cell Lines
[0256] The next experiments were performed to test scFv binding to
naturally-expressed surface hGPC3. scFvs including 3E11, 2G9 and
3D8 were complexed with anti-V5 APC and incubated with HepG2
(glypican-3+). 293T (glypican-3-negative) or Hs578T
(glypican-3-negative) cell lines, which were then washed and
assessed by flow cytometry. As shown in FIG. 51, all three scFvs
exhibited a range of binding affinity to endogenous
surface-expressed hGPC3 on HepG2, while no binding was found on
293T or Hs578T cells. Binding was also confirmed by
immunofluorescence microscopy as depicted in FIG. 5C using
HepG2.tdTomato and Hs578LtdTomato cells. The transduction of
tdTomato protein did not alter GPC3 expression in HepG2 cells.
scFv-3E11, 2G9 and 3D8 showed intense membrane immunofluorescence
staining with a significant fraction of viable HepG2.tdTomato
cells. All these data suggests that these three scFvs can
specifically recognize naturally expressed hGPC3 protein and
absence of cross-reactivity to other surface proteoglycans.
Validation of scFvs' Specificities in RNAi-Based Cell Binding
[0257] To further confirm the specificity for scFv binding to
hGPC3, GPC3-shRNA transduced HepG2 cells were used. Silencing was
confirmed by co-expressing a plasmid encoding myc-tagged hGPC3(AA
368-551) with three shRNA candidate vectors in 293T cells. sh57
showed the best silencing efficiency, reducing hGPC3 protein levels
up to 80% compared to the scrambled control as depicted in FIG. 6A.
sh57 was then retrovirally transduced into HepG2 cells in a
GFP-expressing vector to generate HepG2.sh57 stable cell line.
HepG2.sh57 markedly reduced surface glypican-3 expression by
approximately 75% reduction of MF1 when detected with 1G12 as
depicted in FIG. 6B and FIG. 6C. scFvs including 3E 11, 2G9, 3D8,
2E10 and 4G5 were incubated with HepG2 and HepG2.sh57 cells,
respectively, and detected by APC-labeled anti-V5 mAb. As shown in
FIG. 6D, significant reduction of binding between HepG2 and
HepG2.sh57 cells was observed with scFv-3E11, 2G9 and 3D8, while
the staining with scFv-2E10 and 4G5 had no detectable differences.
These findings were confirmed by immunofluororescence staining in
which a 1:1 mixture of HepG2 and HepG2.sh57 cells were stained with
scFv as depicted in FIG. 6E. Cell membrane staining by scFvs was
profoundly reduced in HepG2.sh57 relative to wild-type HepG2
cells.
Glypican-3-Specific scFv are not Cytostatic
[0258] To determine if scFv binding to membrane-associated
glypican-3 alters cellular proliferation, a standard MTT assay was
performed after validation of the accuracy of MTT to measure
proliferation of HepG2 cells. It was observed that no positive or
negative impact on proliferation of the glypican-3-expressing HepG2
cell line was detected with any scFv at high concentration (1
ug/ml) (FIG. 7).
Validation of Glypican-3-Specific scFv Isolated from Paired
Display/Secretory Yeast Display Library
[0259] Therapeutic options for hepatocellular carcinoma (HCC)
remain limited particularly in advanced stages. Immunotherapy with
NK- or T-cell augmenting therapies to date has yielded some early
promising results (Korangy et al., 2010 Expert Rev Gastroenterol
Hepatol 4(3): 345-353; Greten et al. 2010 BMC Cancer 10: 209;
Palmer et al., 2009 Hepatology 49(1): 124-132; Barkholt et al.,
2009 Immunotherapy 1(5): 753-764) but the low affinity of
endogenous tumor specific T-cell receptors and the
immunosuppressive milieu of the tumor microenvironment represent
barriers to effectively harnessing the power of the endogenous
immune system to control cancer. Yeast-derived scFv offer many
advantageous properties for the development of anti-tumor
biologics. scFv are inexpensive to produce, easily modifiable e.g.
biotinylation (Scholler et al. 2.times.06 J Immunol Methods
317(1-2): 132-143), and facile for subsequent cloning in cis with
diagnostic or effector domains.
[0260] Identification of an appropriate tumor-associated antigen is
an obviously essential requirement for scFv development. Glypican-3
(GPC3), a heparan-sulfate proteoglycan, has recently been
identified as a highly specific, membrane-associated tumor antigen
found in 49-100% of HCC (Zhu et al., 2001 Gut 48(4): 558-564;
Capurro et al., 2003 Gastroenterology 125(1): 89-97; Sung et al.,
2003 Cancer Sci 94(3): 259-262; Nakatsura et al., 2003 Biochem
Biophys Res Commun 306(1): 16-25). GPC3 is not expressed (or is
expressed very focally (Abdul-Al et al., 2008 Hum Pathol 39(2):
209-212)) in nontumonxmus cirrhotic liver tissue (Baumboer et al.,
2008 Am J Clin Pathol 129(6): 899-906: Filmus et al., 2004 Mol
Diagn 8(4): 207-212) and expression of GPC3 in other normal tissues
appears limited (Baumhoer et al., 2008 Am J Clin Pathol 129(6):
899-906). GPC3 modulates the effect of growth factors such as
IGF-2, BMP-7 and FGF-2 on hepatoma cells (Midorikawa et al., 2003
Int J Cancer 103(4): 45, 5-465; Ziuermann et al., 2010 int J cancer
J int du cancer 126(6): 1291-1301) and may recruit M2
tumor-promoting macrophages to the HCC microenvironment (Takai et
al., 2009 Cancer Biol Ther 8(24): 2329-2338t. Emerging evidence
also suggests that inhibition of glypican-3 function via knockdown
Rouan et al., 2011 Int J Mol Med 28(4): 497-503; Sun et al., 2011
Neoplasia 13(8): 735-747) or competition (Zittermann et al., 2010
Int J cancer J int du cancer 126(6): 1291-1301; Feng et al. 2011
Int J cancer J int du cancer 128(9): 2246-2247) has a profound
negative effect on HCC pmliferation. Expression on the cell surface
makes GPC3 an attractive target for antibody-directed therapy.
Another group has shown that a murine anti-hGPC3 antibody induces
antibody-dependent cytotoxicity that manifests an anti-tumor effect
in a xenograft animal model of hepatocellular carcinoma (Takai et
al., 2009 Cancer Biol Ther 8(10): 930-938); this antibody has
subsequently been humanized (Nakano et al., 2010 Anti-cancer drugs
21(10): 907-916) and is entering human clinical trials. Thus,
available evidence suggests that glypican-3 is a rational target
for humoral and potentially chimeric immunotherapy for HCC.
[0261] In this study, the paired display/secretion yeast system was
used to isolate five candidate scFv with affinity in the range from
5.0-110.9 nM that each demonstrates specificity for binding the
surface of glypican-3-expressing cell lines. scFv binding was
significantly reduced after specific knockdown of glypican-3. The
paired yeast display/secretion system minimizes post-translational
and conformational changes in the conversion from displayed to
soluble scFvs, a property that allows for consistency during the
high throughput screening and validation process (Zhao et al. 2011
J Immunol Methods 363(2): 221-232). scFv specificity to the
naturally processed glypican-3 protein at physiological conditions
was critical given complex post-translational modifications of
glypican-3. Experiments were performed to utilized increasingly
physiological screening criteria to select scFv candidates for
further evaluation. Dramatic differences of scFv binding between
wild-type and glypican-3-knockdown HepG2 in cell culture conditions
confirmed not only the specificity of scFv binding but also the
capacity to bind to naturally-processed cell surface glypican-3 in
situ. Without wishing to be bound by any particular theory,
experiments can be performed to validate a chimeric antigen
receptor to redirect T-cells against glypican-3-expressing targets
using the 3E11 scFv.
[0262] Not surprisingly, scFv had no direct positive or negative
impact on cellular proliferation unlike that demonstrated by
soluble glypican-3 (Zittermann et al., 2010 int J cancer 126(6):
1291-1301). The relatively small size of scFv (27 kD) makes
competitive inhibition of growth factor binding unlikely.
[0263] Glypican-3 is a rational target in hepatocellular carcinoma
for antibody-based therapy. The results presented herein
demonstrate that five unique scFv with affinity ranging from
3.0-110.9 nM were identified. Each scFv demonstrated strong surface
binding to glypican-3-expressing cell lines that was attenuated by
shRNA knockdown, and did not bind glypican-3-nonexpressing cell
lines.
Example 2
GPC3-Specific CAR Generation and Lentivirally-Transduced Human T
Lymphocytes
[0264] The following experiments were performed to validate a
chimeric antigen receptor to redirect T-cells against
glypican-3-expressing targets using the 3E11 scFv.
[0265] The materials and methods employed in these experiments are
now described.
Materials and Methods
[0266] GPC3-Specific CAR Generation and Lentivirally-Transduced
Human T Lymphocytes
[0267] The cDNA of 3E II scFv was amplified from yeast colonies
using the primers (forward primer: 5' ggatccGTCCAGTCTGTCTGTTTGACG
CAGC 3' (SEQ ID NO: 10) and reverse primer 5'
gctagcTGAGGAGACGGTGACCAG TGTTC 3' (SEQ ID NO: 11)), and was
inserted into the lentiviral vector pELNs/CARs by BamHI and NheI to
generate lentiviral vector pELNs/3E 11-CARs. See FIG. 8.
[0268] Lentiviral Vectors
[0269] 293T cells (5.times.10.sup.6) were plated on 10-ckm dish
pre-coated with 0.002% poly-L-lysine (Sigma, St. Louis Mo.). The
lentiviral vector pELNS/3E11-CARs were co-transfected with the
plasmid pMD.G, pMDLg/pRRE, and pRSV-Rev. After 12 h, the medium was
changed. After a further 24 h, virus-containing supernatant was
collected and passed through a 0.45 .mu.m filter. Then, supernatant
was concentrated by ultracentrifugation at 25,000 rpm, tittered and
stored at -80.degree. C. until use.
[0270] Lentiviral Transduction of Human T Lymphocytes
[0271] Primary human T lymphocytes isolated from healthy donors
were acquired from the Human Immununology Core at University of
Pennsylvania. T cells were cultured in complete medium (RPMI 1640
supplemented with 10% inactivated FBS, 100 U/ml penicillin and
streptomycin sulfate), and stimulated with anti-CD3 and anti-CD28
mAb-coated beads (invitrogen). Twelve hours after activation. T
cells were transduced with lentiviral vectors in presence of 4
.mu.g/ml polybrene. Human T lymphocytes were expanded and
maintained by addition of interleukin-2 every other day at 100
IU/ml.
[0272] .sup.51Cr Release Assay
[0273] The ability of transduced T lymphocytes to lyse
GPC3-positive tumor cells was evaluated using a .sup.51Cr assay.
Briefly, 106 tumor cells were labeled for 1 h at 37.degree. C. with
100 .mu.Ci of 51Cr (Amersham Biosciences, Pittsburgh, Pa.). The
labeled target cells (1.times.10.sup.4) were co-cultured with
effector cells at the ratios indicated in the figures for 6 hours
at 37 C in 150 .mu.l of complete medium. Harvested supernatants
were counted using a MicroBeta TriLux instrument (Perkin Ehner,
Waltham, Mass.). Total and spontaneous 51Cr release was determined
by incubating 1.times.10-labeled target cells in either 1% Triton
X-100 or medium alone for the above conditions, respectively. Each
data point was determined as the mean results from triplicate
wells. Specific lysis was calculated by use of the following
formmula: % specific release=(cpm of exp-cpm of mean
spontaneous)/(cpm of mean total-cpm of mean spontaneous).
[0274] The results of the experiments are now described.
GPC3-Specific CAR Construction
[0275] The 3E11 scFv was selected to construct GPC3-specific CAR
for the reason of relative high antigen binding affinity among the
identified scFvs. The lentiviral CAR-expressed vector presently
used in the experiment has been optimized before (Carpenito, et
al., 2009, Proc Natl Acad Sci USA 106:3360-3365) and constitute a
CD8a hinge and transmembrance region, followed by a CD33 signaling
moiety and in tandem with the CD 137 (4-1BB) or CD28 intracellular
signaling motif. A signaling deficient containing a truncated
CD3.xi. intracellular domain (A4) was designed as negative control
to assess initiating signaling transduction as depicted in FIG. 8.
The cDNA of scFv 3E11 was sub-cloned into these lentiviral-CAR
vectors. Further, these vectors were transformed into 293T cells
and western blot probed to CD3.xi. confirmed successful expression
by these vectors.
[0276] For effective lentiviral transduction, human T lymphocytes
from peripheral blood were activated by CD3/CD28 beads. To test the
transduction efficiency. T cells were transduced with GFP-expressed
lentiviral vector, and the stable consistent GEP expression can be
observed after 10 days transduction as depicted in FIG. 8. To track
CAR expression on T cell membrane, one Flag-tag was artificially
inserted on N-terminal of CAR, and the expression of CAR on T cell
membrane was detected by FACS using anti-Flag mAb. The data as
depicted in FIG. 8 suggested around 50% T cells were transduced and
express CAR receptor on cell membranes.
3E11-CAR+ T Cells Showed GPC3-Specific Cytotoxicity in Vitro
[0277] Engineered T cells were cocultured with GPC3+ or GPC3- tumor
cells to determine the effects of antigen specific cytotoxicity. T
cells were transduced by lentiviral vector of 3E11-BBZ, 3E11-28BBZ,
and 3E11-dZ, and their transduction efficiency were assessed by
FACS, and further equilibrated to the similar cell numbers in the
following cytotoxicity assays as depicted in FIG. 9. Also, T cells
transduced with GFP lentiviral vector were included as control. For
target cells, several established tumor cell lines were selected
and GPC3 protein expression levels were determined by FACS. Two
tumor cell lines, hs578T (GPC3-) and HepG2.sh57 (less GPC3
expression), were also selected. As shown in FIG. 10, T cells
transduced with 3E11-BBZ or 3E11-28BBZ have significant cellular
lysis of HepG2 ranged from 44-60% at E:T ratio of 5-15:1, while no
lysis effects on 3E11-dZ and GFP transduced T cells. Similar lysis
effects were observed on other two GPC3+tumor cell lines of HCE4
and NC1-N87 cells. For Hs578T and HepG2.sh37 cells, no significant
lysis was detected with 3E11-BBZ and 3E11-28BBZ transduced T cells.
The present data suggested antigen-specific cytotoxicity by
3E11-CAR transduced T cells. The CAR transduced T cells can be used
to target GPC3 expressing tumors as a type of T cell-based
immunotherapy of HCC. The results presented herein provide a
specific and human-sourced scFv for CAR-transduced T cells-based
immunotherapy.
[0278] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirely. While this invention has
been disclosed with reference to specific embodiments, it is
apparent that other embodiments and variations of this invention
may be devised by others skilled in the art without departing from
the true spirit and scope of the invention. The appended claims are
intended to be construed to include all such embodiments and
equivalent variations.
Sequence CWU 1
1
63121DNAArtificialChemically synthesized 1atggccggga ccgtgcgcac c
21224DNAArtificialChemically synthesized 2tcagtgcacc aggaagaaga
agca 24335DNAArtificialChemically synthesized 3ccggaattcg
acaagaaagt attaaaagtt gctca 35432DNAArtificialChemically
synthesized 4acgcgtcgac ggtgcttatc tcgttgtcct tc
32537DNAArtificialChemically synthesized 5ggttctggtg gtggaggttc
tggtggtggt ggatctg 37662DNAArtificialChemically synthesized
6gagaccgagg agagggttag ggataggctt accgtcgacc aagtcttctt cagaataagc
60tt 62721DNAArtificialChemically synthesized 7gccaaattat
tctcctatgt t 21821DNAArtificialChemically synthesized 8gccaatatag
atctgcttat t 21921DNAArtificialChemically synthesized 9gctcaagaaa
gatggaagaa a 211028DNAArtificialChemically synthesized 10ggatccgtcc
agtctgtgtt gacgcagc 281129DNAArtificialChemically synthesized
11gctagctgag gagacggtga ccagtgttc 2912117PRTArtificialChemically
synthesized 12Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe Ser Ser Tyr 20 25 30 Gly Leu His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Ala Ile Ser Tyr Asp Gly
Ser Lys Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Leu Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met
Asn Ser Leu Ser Pro Glu Asp Thr Ala Leu Tyr Phe Cys 85 90 95 Ala
Arg Gly Trp Phe Val Glu Pro Leu Ser Trp Gly Gln Gly Thr Leu 100 105
110 Val Thr Val Ser Ser 115 13124PRTArtificialChemically
synthesized 13Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys
Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Ser Cys Thr Val Ser Gly Gly
Ser Ile Ser Ser Ser 20 25 30 Ser Tyr Tyr Trp Ala Trp Ile Arg Gln
Pro Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Asn Ile Tyr Tyr
Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val
Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys
Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys
Ala Arg Phe Pro Leu Ile Arg Gly Tyr Arg Tyr Arg Tyr Asp Glu 100 105
110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120
14123PRTArtificialChemically synthesized 14Gln Val Gln Leu Gln Glu
Ser Gly Leu Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu
Thr Cys Ala Val Ser Gly Tyr Ser Ile Thr Ser Gly 20 25 30 Tyr Tyr
Trp Gly Trp Ile Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp 35 40 45
Ile Gly Arg Ile Tyr Tyr Gly Gly Ser Thr His Tyr Asn Pro Ser Leu 50
55 60 Gln Ser Arg Val Thr Ile Ser Val Asp Thr Ala Lys Asn Gln Phe
Ser 65 70 75 80 Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val
Tyr Tyr Cys 85 90 95 Ala Arg Asp Arg Asn Tyr Gln Ser Leu Ser Gly
Tyr Cys Leu Asp Tyr 100 105 110 Trp Gly Gln Gly Lys Val Val Thr Val
Ser Ser 115 120 15118PRTArtificialChemically synthesized 15Gln Val
Gln Leu Val Gln Ser Gly Gly Gly Leu Ala Gln Pro Gly Gly 1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ser Phe Ser Thr Phe 20
25 30 Val Leu Ser Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Gln Trp
Val 35 40 45 Ser Thr Ile Ser Gly Ser Gly Thr Ser Thr Tyr Tyr Ala
Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala
Lys Asn Thr Gln Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ala Arg His Lys Ser Phe Gly
Val Gln Trp Leu Trp Gly Gln Gly Ala 100 105 110 Leu Val Val Arg Leu
Leu 115 16127PRTArtificialChemically synthesized 16Gln Val Gln Leu
Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu
Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30
Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35
40 45 Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro
Ser 50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys
Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp
Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg Val His Asp Gly His Arg
Tyr Gly Thr Tyr Tyr Tyr Tyr 100 105 110 Gly Leu Asp Val Trp Gly Gln
Gly Thr Ala Val Thr Val Ser Ser 115 120 125
17109PRTArtificialChemically synthesized 17Ser Val Leu Thr Gln Pro
Pro Ser Ala Ser Gly Thr Pro Gly Gln Arg 1 5 10 15 Val Thr Ile Ser
Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn Thr 20 25 30 Val Asn
Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile 35 40 45
Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly 50
55 60 Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln
Ser 65 70 75 80 Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp
Ser Leu Asn 85 90 95 Gly Tyr Val Phe Gly Thr Gly Thr Lys Leu Thr
Val Leu 100 105 18114PRTArtificialChemically synthesized 18Val Asp
Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro 1 5 10 15
Gly Glu Ala Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His 20
25 30 Arg Asp Gly Tyr His Tyr Leu Asn Trp Phe Leu Gln Lys Pro Gly
Gln 35 40 45 Ser Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala
Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Lys 65 70 75 80 Ile Ser Arg Val Glu Ala Glu Asp Val
Gly Val Tyr Tyr Cys Met Gln 85 90 95 Ala Pro Gln Thr Pro Arg Thr
Leu Leu Gly Gln Gly Thr Lys Leu Glu 100 105 110 Ile Lys
19110PRTArtificialChemically synthesized 19Val Glu Ile Val Leu Thr
Gln Ser Pro Gly Thr Leu Ser Val Ser Pro 1 5 10 15 Gly Glu Arg Ala
Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser 20 25 30 His Ile
Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45
Ile His Gly Ala Ser Thr Arg Ala Thr Gly Val Pro Ala Arg Phe Ser 50
55 60 Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu
Gln 65 70 75 80 Ser Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn
Lys Trp Pro 85 90 95 Pro Glu Tyr Thr Phe Gly Gln Gly Thr Lys Leu
Glu Ile Lys 100 105 110 20114PRTArtificialChemically synthesized
20Val His Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Leu 1
5 10 15 Gly Gln Pro Ala Ser Ile Ser Cys Trp Ser Ser Gln Ser Leu Val
Tyr 20 25 30 Gly Asp Gly Asn Thr Tyr Leu Asn Trp Phe Gln Gln Arg
Pro Gly Gln 35 40 45 Ser Pro Arg Arg Leu Ile Tyr Lys Val Ser Asn
Arg Asp Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys 65 70 75 80 Ile Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Met Gln 85 90 95 Gly Thr His Trp Pro
Pro Gly Thr Phe Gly Gly Gly Thr Lys Leu Glu 100 105 110 Ile Lys
21108PRTArtificialChemically synthesized 21Asp Ile Val Met Thr Gln
Ser Pro Leu Ser Leu Pro Val Thr Pro Xaa 1 5 10 15 Glu Ala Ala Ser
Ile Ser Cys Arg Ser Ser Gln Ser Leu Tyr Ser Ala 20 25 30 Trp Glu
Thr Leu Leu Glu Leu Leu Gln Gln Ile Lys Pro Ile Ser Lys 35 40 45
Gly Ala Thr Tyr Lys Val Ser Asn Arg Asp Ser Gly Val Gln Thr Asp 50
55 60 Gln Arg Gln Trp Val Arg His Trp Phe His Thr Glu Asn Gln Gln
Val 65 70 75 80 Glu Ala Glu Asp Val Gly Val Ile Thr Ala Cys Lys Val
His Thr Gly 85 90 95 Pro Pro Phe Ser Ala Pro Gly Pro Lys Trp Ile
Ser 100 105 225PRTArtificialChemically synthesized 22Ser Tyr Gly
Leu His 1 5 2317PRTArtificialChemically synthesized 23Ala Ile Ser
Tyr Asp Gly Ser Lys Lys Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly
248PRTArtificialChemically synthesized 24Gly Trp Phe Val Glu Pro
Leu Ser 1 5 257PRTArtificialChemically synthesized 25Ser Ser Ser
Tyr Tyr Trp Ala 1 5 2616PRTArtificialChemically synthesized 26Asn
Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser 1 5 10
15 2714PRTArtificialChemically synthesized 27Phe Pro Leu Ile Arg
Gly Tyr Arg Tyr Arg Tyr Asp Glu Tyr 1 5 10
286PRTArtificialChemically synthesized 28Ser Gly Tyr Tyr Trp Gly 1
5 2916PRTArtificialChemically synthesized 29Arg Ile Tyr Tyr Gly Gly
Ser Thr His Tyr Asn Pro Ser Leu Gln Ser 1 5 10 15
3014PRTArtificialChemically synthesized 30Asp Arg Asn Tyr Gln Ser
Leu Ser Gly Tyr Cys Leu Asp Tyr 1 5 10 315PRTArtificialChemically
synthesized 31Ser Tyr Ala Met Ser 1 5 3217PRTArtificialChemically
synthesized 32Ala Ile Ser Gly Ser Gly Thr Ser Thr Tyr Tyr Ala Asp
Ser Val Lys 1 5 10 15 Gly 339PRTArtificialChemically synthesized
33His Lys Ser Phe Gly Val Gln Trp Leu 1 5
347PRTArtificialChemically synthesized 34Ser Ser Ser Tyr Tyr Trp
Gly 1 5 3516PRTArtificialChemically synthesized 35Ser Ile Tyr Tyr
Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser 1 5 10 15
3614PRTArtificialChemically synthesized 36His Asp Gly His Arg Tyr
Gly Thr Tyr Tyr Gly Leu Asp Val 1 5 10 3713PRTArtificialChemically
synthesized 37Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn Thr Val Asn 1
5 10 387PRTArtificialChemically synthesized 38Ser Asn Asn Gln Arg
Pro Ser 1 5 398PRTArtificialChemically synthesized 39Gly Trp Phe
Val Glu Pro Leu Ser 1 5 4016PRTArtificialChemically synthesized
40Arg Ser Ser Gln Ser Leu Leu His Arg Asp Gly Tyr His Tyr Leu Asn 1
5 10 15 417PRTArtificialChemically synthesized 41Leu Gly Ser Asn
Arg Ala Ser 1 5 428PRTArtificialChemically synthesized 42Met Gln
Ala Pro Gln Thr Pro Arg 1 5 4311PRTArtificialChemically synthesized
43Arg Ala Ser Gln Ser Val Ser Ser His Ile Ala 1 5 10
447PRTArtificialChemically synthesized 44Gly Ala Ser Thr Arg Ala
Thr 1 5 457PRTArtificialChemically synthesized 45Gln Gln Tyr Asn
Lys Trp Pro 1 5 4616PRTArtificialChemically synthesized 46Trp Ser
Ser Gln Ser Leu Val Tyr Gly Asp Gly Asn Thr Tyr Leu Asn 1 5 10 15
477PRTArtificialChemically synthesized 47Lys Val Ser Asn Arg Asp
Ser 1 5 489PRTArtificialChemically synthesized 48Met Gln Gly Thr
His Trp Pro Pro Gly 1 5 4915PRTArtificialChemically synthesized
49Ser Ser Gln Ser Leu Val Tyr Ser Asp Gly Asn Thr Tyr Leu Asn 1 5
10 15 507PRTArtificialChemically synthesized 50Lys Val Ser Asn Arg
Asp Ser 1 5 518PRTArtificialChemically synthesized 51Met Gln Gly
Thr His Trp Pro Pro 1 5 52349DNAArtificialChemically synthesized
52caggtgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt agctatggct tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagct atatcatatg atggtagtaa
gaaatactat 180gcagactccg tgaagggccg actcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagtttgag acctgacgac
acggctctgt atttctgtgc gaggggatgg 300ttcgtggagc cactatcctg
gggccaggaa cactggtcac gtctcctca 34953373DNAArtificialChemically
synthesized 53caggtgcagc tgcaggagtc gggcccagga ctggtgaagc
cttcggagac cctgtccctc 60agctgcactg tctctggtgg ctccatcagc agtagtagtt
actactgggc ctggatccgc 120cagcccccag ggaaggggct ggagtggatt
ggcaatatct actatagtgg gagcacctac 180tacaacccgt ccctcaagag
tcgagtcacc atatcagtag acacgtccaa gaaccagttc 240tccctgaagc
tgagctctgt gaccgccgcg gacacggccg tgtattactg tgcgagattc
300cctttaatac gtggatacag atatcgttac gatgagtact ggggccaggg
aacgctggtc 360accgtctcct cag 37354369DNAArtificialChemically
synthesized 54caggtgcagc tgcaggagtc gggcctagga ctggtgaagc
cttcggagac cctgtccctc 60acatgcgctg tctctggtta ctccatcacc agtggttact
actggggctg gatccggcag 120acgccaggga agggactgga gtggattgga
cgtatctatt atggtgggag cacccactac 180aacccatccc tccagagtcg
agtcaccata tcagtagaca cggccaagaa tcagttctcc 240ctgaagctga
gctctgtgac cgccgcagac acggccgtct attactgtgc gagagaccgg
300aattaccaga gtttgagcgg ttattgctta gactactggg gccagggaaa
ggtggtcacc 360gtctcctca 36955356DNAArtificialChemically synthesized
55caggtgcagc tggtgcagtc tgggggaggc ttggcacagc ctggggggtc cctgagactc
60tcctgtgcag cctctggatc cagcttcagc accttcgtct taagttgggt ccgccagact
120ccagggaagg ggctgcaatg ggtctcaact attagtggta gtggtactag
cacatactac 180gcagactccg tgaagggccg attcaccgtc tccagagaca
atgccaagaa cacacagtat 240ttgcaaatga acagcttgag agccgaggac
acggccatat attactgtgc gagacacaaa 300tctttcgggg ttcagtggct
gtggggccag ggagcgctgg tcgtccgtct cctcag
35656382DNAArtificialChemically synthesized 56caggtgcagc tgcaggagtc
gggcccagga ctggtcaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg
ctccatcagc agtagtagtt actactgggg ctggatccgc 120cagcccccag
ggaaggggct ggagtggatt gggagtatct attatagtgg gagcacctac
180tacaacccgt ccctcaagag tcgagtcacc atatccgtag acacgtccaa
gaaccagttc 240tccctgaagc tgagctctgt gaccgccgca gacacggctg
tgtattactg tgcgagagtt 300catgacggac acaggtatgg tacctactac
tactacggtc tagacgtctg gggccaaggg 360accgcggtca ccgtctcctc ag
38257336DNAArtificialChemically synthesized 57gtccagtctg tgttgacgca
gccgccctca gcgtctggga cccccgggca gagggtcacc 60atctcttgtt ctggaagcag
ctccaacatc ggaagtaata ctgtaaactg gtaccagcag 120ctcccaggaa
cggcccccaa
actcctcatc tatagtaata atcagcggcc ctcaggggtc 180cctgaccgat
tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc
240cagtctgagg atgaggctga ttattactgt gcagcatggg atgacagcct
gaatgggtat 300gtcttcggaa ctggcaccaa gctgaccgtc ctaggc
33658342DNAArtificialChemically synthesized 58gtcgatattg tgatgactca
gtctccactc tccctgcccg tcacccctgg agaggcggcc 60tccatctcct gcaggtctag
tcagagcctc ctgcatagag atggatacca ctatttgaat 120tggttcctgc
agaagccagg gcagtctcca cagctcctga tctatttggg ttctaatcgg
180gcctccgggg tccctgacag gttcagtggc agtggatcag gcacagattt
tacactgaaa 240atcagcagag tggaggctga ggatgttggg gtgtattact
gcatgcaagc tccacagact 300cctaggacac ttttgggcca ggggaccaag
ctggagatca aa 34259330DNAArtificialChemically synthesized
59gtcgaaattg tgttgacgca gtctccaggc accctgtctg tgtctccagg ggaaagagcc
60accctctcct gcagggccag tcagagtgtt agcagccaca tagcctggta ccagcagaaa
120cctggccagg ctcctaggct cctcatccat ggtgcatcca ccagggccac
tggtgtccca 180gccaggttca gtggcagcgg gtctgggaca gagttcactc
tcaccatcag cagcttgcag 240tctgaagatt ttgcagttta ttactgtcag
cagtataata agtggcctcc agagtacact 300tttggccagg ggaccaagct
ggagatcaaa 33060342DNAArtificialChemically synthesized 60gtccatattg
tgatgaccca gtctccactc tccctgcccg tcacccttgg acagccggcc 60tccatctcct
gctggtctag tcaaagcctc gtatacggtg atggaaacac ctacttgaat
120tggtttcagc agaggccagg ccaatctcca aggcgcctaa tttataaggt
ttctaaccgg 180gactctgggg tcccagacag attcagcggc agtgggtcag
gcactgattt cacactgaaa 240atcagcaggg tggaggctga ggatgttggg
gtttattact gcatgcaagg tacacactgg 300cctccgggta ctttcggcgg
agggaccaag ctggagatca aa 34261380DNAArtificialChemically
synthesized 61gatattgtga tgactcagtc tccactctcc ctgcccgtca
cccctgrrga ggcggcctcc 60atctcctgca ggtctagtca gagcctctac agtgcatggg
aaacactact tgaattgctt 120cagcagatca agccaatctc caaaggcgct
acttataaag tttctaaccg cgactctggg 180gtccagacag atcagcggca
gtgggtcagg cactggtttc acactgaaaa tcagcaggtg 240gaggctgagg
atgttggggt tattactgca tgcaaggtac acactggccc cccgttttcg
300gccccgggac caaagtggat atcaaaggtg gttcctctag atcttcctcc
tctggtggcg 360gtggctcggg cggtggtggg 3806226DNAArtificialChemically
synthesized 62cccggggcca cctgtcacca agtccg
266328DNAArtificialChemically synthesized 63ccgcgggtgc accaggaaga
agaagcac 28
* * * * *
References