U.S. patent application number 14/097384 was filed with the patent office on 2014-10-30 for method and composition for altering a b cell mediated pathology.
This patent application is currently assigned to MMRGLOBAL, INC.. The applicant listed for this patent is MMRGLOBAL, INC.. Invention is credited to Daniel P. Gold, Robert J. Shopes.
Application Number | 20140322160 14/097384 |
Document ID | / |
Family ID | 27499375 |
Filed Date | 2014-10-30 |
United States Patent
Application |
20140322160 |
Kind Code |
A1 |
Gold; Daniel P. ; et
al. |
October 30, 2014 |
METHOD AND COMPOSITION FOR ALTERING A B CELL MEDIATED PATHOLOGY
Abstract
The present invention provides compositions for altering a B
cell mediated pathology in a patient. The compositions may comprise
at least one and/or two chimeric proteins. Each chimeric protein
comprises at least a portion of either the VH or VL region of an
immunoglobulin module from particular B cells from a patient having
a B cell mediated pathology, and an immunoglobulin constant region.
The genes encoding VH and/or VL regions and the genes encoding
immunoglobulin constant regions are isolated and inserted in an
expression vector. The chimeric proteins may be produced by
introducing the expression vectors into insect cell lines. Proteins
may be further purified and conjugated to a compound such as a
immunogenic carrier.
Inventors: |
Gold; Daniel P.; (Del Mar,
CA) ; Shopes; Robert J.; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MMRGLOBAL, INC. |
Los Angeles |
CA |
US |
|
|
Assignee: |
MMRGLOBAL, INC.
Los Angeles
CA
|
Family ID: |
27499375 |
Appl. No.: |
14/097384 |
Filed: |
December 5, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13293495 |
Nov 10, 2011 |
8637638 |
|
|
14097384 |
|
|
|
|
10843703 |
May 10, 2004 |
8114404 |
|
|
13293495 |
|
|
|
|
09927121 |
Aug 10, 2001 |
6911204 |
|
|
10843703 |
|
|
|
|
60224723 |
Aug 11, 2000 |
|
|
|
60224722 |
Aug 11, 2000 |
|
|
|
60279079 |
Mar 23, 2001 |
|
|
|
Current U.S.
Class: |
424/85.1 ;
424/134.1; 424/178.1 |
Current CPC
Class: |
C07K 16/18 20130101;
A61K 47/643 20170801; C07K 2319/00 20130101; A61K 38/195 20130101;
A61K 38/193 20130101; A61K 38/1774 20130101; A61K 39/39541
20130101; C07K 2319/30 20130101; A61K 2039/505 20130101; A61K
47/646 20170801; A61K 38/195 20130101; A61P 35/00 20180101; A61K
38/193 20130101; A61K 2300/00 20130101; A61K 2300/00 20130101; A61K
38/1774 20130101; A61K 2300/00 20130101; Y10S 514/885 20130101 |
Class at
Publication: |
424/85.1 ;
424/134.1; 424/178.1 |
International
Class: |
C07K 16/18 20060101
C07K016/18; A61K 47/48 20060101 A61K047/48; A61K 39/395 20060101
A61K039/395; A61K 38/19 20060101 A61K038/19 |
Claims
1. A composition comprising two different proteins produced by a
process comprising the steps of: (a) isolating a gene encoding a
full length sequence of a human V.sub.H region isolated from a B
cell clone of a human patient having a B cell mediated pathology;
(b) linking said gene encoding said entire V.sub.H region and a
gene encoding at least a portion of an immunoglobulin constant
region in an expression vector to form a gene encoding the first of
said different proteins; (c) isolating a gene encoding a full
length sequence of a human V.sub.L region isolated from a B cell
clone of said patient having said B cell mediated pathology; (d)
linking said gene encoding said entire V.sub.L region and a gene
encoding at least a portion of an immunoglobulin constant region
into said expression vector to form a gene encoding the second of
said different proteins; (e) introducing said expression vector
into insect cells, wherein said expression vector contains two
separate expression cassettes each having a baculovirus promoter
and a heterologous secretory signal sequence; and (f) allowing the
expression of said two different proteins having the same V.sub.H
and V.sub.L amino acid sequences in said patient, wherein said
composition further comprises a cytokine or chemokine, and wherein
said composition elicits an active immune response.
2. The composition of claim 1 wherein said carrier protein is a
keyhole-limpet hemocyanin (KLH).
3. The composition of claim 1, wherein said composition is
administered to said patient with a granulocyte-macrophage-colony
stimulating factor (GM-CSF) cytokine.
4. The composition of claim 1, wherein said first protein and/or
said second protein is further conjugated to a carrier protein
5. The composition of claim 1, wherein said gene encoding said
first of said proteins comprising said entire V.sub.H region and a
first immunoglobulin constant region is controlled by a p10
promoter in an expression vector, and said gene encoding said
second of said proteins comprising said entire V.sub.L region and a
second first immunoglobulin constant region is controlled by a
polyhedrin promoter in an expression vector.
6. The composition of claim 1, wherein one of said genes encoding
said immunoglobulin constant regions is a gene encoding at least a
portion of a human .kappa. or .lamda. constant region.
7. The composition of claim 1, wherein said gene encoding one of
said immunoglobulin constant regions is a gene encoding at least a
portion of an immunoglobulin constant region selected from the
group consisting of a human IgG.gamma.1 constant region, a human
IgG.gamma.2 constant region, a human IgG.gamma.3 constant region, a
human IgG.gamma.4 constant region, a human IgA1 constant region, a
human IgA2 constant region, a human IgM constant region, a human
IgD constant region, a human IgE constant region, a human .kappa.,
chain constant region, and a human .lamda. chain constant
region.
8. The composition of claim 1, wherein said proteins are used to
treat refractory low grade lymphoma or follicular B cell
lymphoma.
9. The composition of claim 1, wherein said proteins are produced
in insect cells selected from the group consisting of the
Trichoplusia ni cell line and the Spodoptera frugiperda cell line,
and wherein said expression vector is a baculovirus expression
vector that comprises a honey bee melittin secretory signal
sequence and a human placental alkaline phosphatase secretory
signal sequence.
10. The composition of claim 1, wherein said expression vector is a
baculovirus expression vector that comprises a baculovirus p10
promoter and polyhedrin promoter, wherein said p10 promoter
controls a honey bee melittin secretory signal sequence, and
wherein said polyhedrin promoter controls a human placental
alkaline phosphatase secretory signal sequence.
11. A composition comprising two separate and distinct proteins
produced by a process comprising the steps of: (a) isolating a gene
encoding a full length sequence of a human V.sub.H region isolated
from a B cell clone of a human patient having a B cell mediated
pathology; (b) linking said gene encoding said entire V.sub.H
region and a gene encoding at least a portion of an immunoglobulin
constant region in an expression vector to form a gene encoding the
first of said separate and distinct proteins; (c) isolating a gene
encoding a full length sequence of a human V.sub.L region isolated
from a B cell clone of said patient having said B cell mediated
pathology; (d) linking said gene encoding said entire V.sub.L
region and a gene encoding at least a portion of an immunoglobulin
constant region into an expression vector to form a gene encoding
the second of said separate and distinct proteins; (e) introducing
said expression vectors into insect cells, wherein said expression
vectors contain two separate expression cassettes each having a
baculovirus promoter and a heterologous secretory signal sequence,
wherein (i) said promoters are selected from the group consisting
of p10 promoter and polyhedrin promoter, and (ii) said secretory
signal sequences are selected from the group consisting of human
placental alkaline phosphatase secretory signal sequence, honey bee
melittin secretory signal sequence, and the endogenous secretory
signal sequence associated with the immunoglobulin genes isolated
from said patient; and (f) allowing the expression of said two
separate and distinct proteins having the same V.sub.H and V.sub.L
amino acid sequences in said patient.
12. The composition of claim 11, wherein said expression vectors
are baculovirus expression vectors.
13. The composition of claim 11, wherein said expression vector is
a baculovirus expression vector that comprises a baculovirus p10
promoter and polyhedrin promoter, wherein said p10 promoter
controls a honey bee melittin secretory signal sequence, and
wherein said polyhedrin promoter controls a human placental
alkaline phosphatase secretory signal sequence.
14. The composition of claim 11, wherein said first protein and/or
said second protein is further conjugated to a carrier protein and
is administered to said patient together with a cytokine or
chemokine, and wherein said composition elicits an active immune
response.
15. The composition of claim 11, wherein said proteins are
conjugated to a keyhole-limpet hemocyanin (KLH).
16. The composition of claim 11, wherein said composition is
administered to said patient.
17. The composition of claim 16, wherein said composition is
administered to said patient with a monocyte chemotactic protein 3
(MCR 3) chemokine.
18. The composition of claim 17, wherein said composition is
administered to said patient with a granulocyte-macrophage-colony
stimulating factor (GM-CSF) cytokine.
19. The composition of claim 11, wherein said gene encoding said
first of the proteins comprising a full length V.sub.H region and a
first immunoglobulin constant region is controlled by a p10
promoter, and said gene encoding said second of the proteins
comprising a full length V.sub.L region and a second first
immunoglobulin constant region is controlled by a polyhedrin
promoter.
20. The composition of claim 11, wherein one of said genes encoding
at least a portion of said immunoglobulin constant regions is a
gene encoding at least a portion of a human .kappa. or .lamda.
constant region, and wherein said gene encoding at least a portion
of said immunoglobulin constant regions is a gene encoding at least
a portion of an immunoglobulin constant region selected from the
group consisting of a human IgG.gamma.1 constant region, a human
IgG.gamma.2 constant region, a human IgG.gamma.3 constant region, a
human IgG.gamma.4 constant region, a human IgA1 constant region, a
human IgA2 constant region, a human IgM constant region, a human
IgD constant region, a human IgE constant region, a human k chain
constant region, and a human 1 chain constant region.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. Ser. No.
13/293,495 filed Nov. 10, 2011, which is a Continuation of U.S.
Ser. No. 10/843,703 filed May 10, 2004 now U.S. Pat. No. 8,114,404
issued Feb. 14, 2012, which is a Continuation of U.S. Ser. No.
09/927,121 filed on Aug. 10, 2001, now U.S. Pat. No. 6,911,204
issued Jun. 28, 2005, which claims priority to the U.S. Provisional
Application No. 60/224,723 filed Aug. 11, 2000, U.S. Provisional
Application No. 60/224,722 filed on Aug. 11, 2000 and U.S.
Provisional Application No. 60/279,079 filed on Mar. 23, 2001, all
of which are herein incorporated by reference in their
entirety.
FIELD OF THE INVENTION
[0002] This invention relates generally to the field of immunology
and immunotherapy. More specifically, this invention relates to
methods and compositions for altering B cell mediated pathologies,
such as B cell malignancies and/or autoimmune diseases.
BACKGROUND OF THE INVENTION
[0003] The immune system produces both antibody-mediated and
cell-mediated responses. Each type of immune response is regulated
by a type of lymphocyte, B cells (for antibody-mediated response)
and T cells (for cell-mediated response). B cells initially
recognize an antigen when the antigen binds to the IgM and IgD
molecules on the B cell's surface. Each B cell clone recognizes
only specific antigens due to the unique idiotype of that clone.
Upon recognition of the antigen, B cells internalize and process
the antigen for presentation via MHC class II molecules. B cells
can thereby function as an antigen presenting cell ("APC") for T
cells. T cells bind to portions of foreign proteins (antigens) when
portions of the protein associate with a major histocompatibility
complex molecule ("MHC"), typically on an APC, in which the antigen
is digested into fragments and presented on the surface of the APC
bound to its MHC.
[0004] Several types of cancers have their origin in the
circulatory system. Among the major types are: leukemias, a
neoplasm of the bone marrow and blood; myelomas, a cancer of B
cells; and lymphomas, a group of cancers that originate in the
lymphatic system. Lymphomas can be further classified into several
groups; one of these groups is the non-Hodgkin's lymphomas which,
in turn, forms a diverse group of cancers. Three broad categories
of these lymphomas are defined according to the International
Working Formulation for tumor classification, low grade,
intermediate grade and high grade, which differ in their curability
and aggressiveness (Cheson, et al., "Report of an International
Workshop to Standardize Response Criteria for Non-Hodgkin's
Lymphomas," J. Clin Oncol. 17(4):1244, 1999). Overall, these
lymphomas collectively rank fifth in the United States in terms of
cancer incidence and mortality, and approximately 50,000 new cases
are diagnosed each year.
[0005] In a recent study which examined fifty-one case isolates of
high-grade non-Hodgkins's lymphoma (NHL), forty-three were shown to
be derived from B cells while eight were shown to be derived from T
cells (Brown et al., Histopathology 14:621-27, 1989). Therefore,
treatments directed specifically towards pathological B cells would
be valuable in the treatment of non-Hodgkin's lymphomas and
myelomas.
[0006] Initial attempts in the field to develop an immunology-based
treatment directed at antigens uniquely produced by malignant B
cells involved laboriously isolating and purifying idiotypic (Id)
proteins directly from the pathological B cells. This purified
protein was first used in model systems to treat the associated
lymphoma. It was demonstrated that this active immunization against
idiotypic determinants on isolated proteins could produce
resistance to tumor growth in a mouse model system (Daley et al.,
J. Immunol. 120(5):1620-24, 1978; Sakato et al., Microbiol Immunol.
23(9):927-31, 1979). This phenomenon of resistance to tumor growth
has been subsequently reproduced in a number of additional
experimental tumor models (Stevenson et al., J. Immunol.
130(2):970-03, 1983; George et al., J. Immunol. 141(6):2168-74,
1988; Kwak, et al., Blood 76(11):2411-17, 1990).
[0007] Among the first attempts at bringing this idea and
technology into the clinic was very labor intensive and utilized
mouse monoclonal antibodies generated against proteins isolated
from the patients' individual lymphomas following biopsy. Meeker
and coworkers generated mouse monoclonal anti-idiotype antibodies
for treatment of eleven patients after most had already undergone
conventional lymphoma therapy (Meeker et al., Blood 65:1349-63,
1985). Positive results were obtained in roughly half the patients,
with one case of apparent remission. In some of the patients,
however, the lymphoma cells developed a resistance to the antibody
via switching the class of cell surface-expressed antibodies
(Meeker et al., N. Engl J. Med. 312:1658-65, 1985).
[0008] Another way a B cell lymphoma clone developed resistance to
anti-idiotypic antibodies is via a somatic mutation in the CDR2
region (Cleary et al., Cell 44:97-106, 1986), thereby evading
recognition. While this passive immunity approach for treatment has
the advantage that it only requires isolation and purification of a
relatively minor amount of idiotypic protein from a patient for
raising an immune response in a mouse, the usefulness for treating
lymphomas with monoclonal antibodies directed at idiotypes is
limited. In the absence of a robust and convenient way to produce
large quantities of idiotypic protein, however, this could prove to
be the only practical way to exploit the abilities of the immune
system to directly attack the idiotype of a B cell lymphoma.
[0009] Kwak et al. pursued a different approach and attempted the
active immunization of patients using proteins purified from their
own unique lymphomas in spite of the logistical requirement for
isolating large quantities of idiotypic proteins (Kwak et al., N.
Engl, J. Med. 327:1209-15, 1992). Patients who had minimal or no
disease following chemotherapy were treated by vaccination with
autologous idiotype proteins. In order to obtain sufficient
quantities of idiotypic proteins for vaccination, lymphoma cells
obtained by biopsy were fused with an established cell line to
facilitate their growth in tissue culture, and the secreted
idiotype proteins were purified via chromatography. Large scale
application of this method of immunization is precluded due to the
extreme labor requirements, technical barriers, and prohibitive
costs. Additionally, concerns have recently been raised concerning
the viral loads associated with protein production in mammalian
cells.
[0010] In a following paper, Hsu et al. reported on the phase I/II
of the above clinical trial utilizing vaccination of the idiotype
conjugated to keyhole limpet hemocyanin (KLH) in the treatment of
B-cell lymphoma (Hsu et al., Blood 89:3129-35, 1997). After
standard chemotherapy, 41 patients with refractory non-Hodgkin's
B-cell lymphoma were vaccinated with a tumor-specific idiotype. As
per Kwak et al (1992), supra, the tumor-specific idiotype antigens
were obtained by chromatographic purification of proteins produced
by the patients' hybridomas. These proteins were therefore composed
of the entire variable and constant regions of the patient's own
immunoglobulin from the patients' lymphomas. The results showed
that the generation of an anti-idiotype response correlated with
improved clinical outcome. The duration of freedom from disease
progression and overall survival of all patients mounting an
anti-idiotype cellular immune response were significantly prolonged
compared to those patients who did not mount an immune response.
This study confirms that patients with B-cell lymphomas can be
induced to make a specific immune response against tumor idiotype
(Id) protein. Furthermore, the ability to generate an anti-idiotype
immune response correlates with a more favorable clinical outcome.
However, to treat each individual patient, lymphoma cells obtained
by biopsy must be fused to established cell lines in order to allow
the production of sufficient protein to vaccinate a typical
patient. This process would-be difficult or impractical to use on a
commercial scale.
[0011] More recently, Bendandi et al. demonstrated idiotypic,
patient-specific vaccination-induced remissions in patients with
follicular lymphoma (Bendandi et al., Nat. Med. 5:1171-77, 1999).
Following standard chemotherapy, twenty patients demonstrating
complete clinical remission were vaccinated using patient-specific
idiotypic proteins accompanied by granulocyte-monocyte
colony-stimulating factor (GM-CSF; see infra.). Molecular analysis
of the translocations characteristic of this lymphoma was conducted
prior to chemotherapy, at clinical remission and following,
vaccination therapy. Eight of eleven patients with detectable,
translocations after chemotherapy-induced remission were found to
undergo complete molecular remission following this vaccination.
Tumor-specific cytotoxic CD8+ and CD4+ T cells were found in 19 of
20 patients. Tumor-specific antibodies were also detected but were
not found to be required for remission. Again, this study used
idiotypic proteins made up of the entire variable and constant
region of the immunoglobulin found associated with the patient's
lymphoma and produced by heterohybridoma fusion.
[0012] Therefore, directing an immune response to the idiotype of
cells is a promising approach, but the above techniques are limited
by the requirement of producing sufficient quantities of idiotypic
proteins from each patient's lymphoma cells.
[0013] The concept of anti-idiotypic immunity against B cell tumors
has also been used in the case of multiple myeloma. Results have
been reported by Kwak and coworkers regarding its use in enhancing
the specific efficacy of allogeneic marrow grafts by pre-immunizing
the donor with myeloma IgG isolated from the patient (Kwak et al.,
Lancet 345 (8956):1016-20, 1995). Also, Massaia and coworkers
vaccinated patients in remission following high-dose chemotherapy,
followed by peripheral blood stem cell transplantation (Massaia et
al., Blood 94:673-83, 1999).
[0014] Granulocyte-monocyte colony-stimulating factor (GM-CSF),
used above in Bendandi et al.'s study, is a hematopoietic growth
factor which stimulates proliferation and differentiation of
hematopoietic progenitor cells. This cytokine also plays a role in
shaping cellular immunity by augmenting T-cell proliferation
(Santoli et al., J. Immunol. 141(2):519-26, 1988). increasing
expression of adhesion molecules on granulocytes and monocytes
(Young et al., J. Immunol 145(2):607-15, 1990; Grabstein et al.,
Science 232(4749):506-08, 1986), and augmenting antigen
presentation (Morrissey et al., J. Immunol. 139(4):1113-9, 1987;
Heufler et al., J. Exp. Med. 167(2):700-05, 1988; Smith et al., J.
Immunol. 144(5):1777-82, 1990).
[0015] Cell-based vaccines genetically engineered to produce GM-CSF
have been shown to induce cellular immune responses capable of
eliminating systemic lymphomas in preclinical models. This effect
is mediated exclusively through activation of the cellular arm of
the immune system (Levitsky et al., J. Immuno. 156(10): 3858-65,
1996). Similarly, low doses of free GM-CSF have been shown to
enhance the protective anti-tumor immunity induced by idiotype
protein-KLH immunization because of its ability to enhance immunity
through an effect on the CD8 cells (Kwak et al., Proc. Natl. Acad.
Sci. USA 93(20):10972-77, 1996. In one study, GM-CSF was shown to
be the best immunomodulator to generate anti-tumor immunity among
those tested in a model system (Dranoff, G., Proc. Natl. Acad. Sci.
USA 90(8):3539-43, 1993.)
[0016] GM-CSF has also been used as a portion of a chimeric protein
used to generate an immune response in model systems. Chen and Levy
(Chen and Levy, J. Immunol. 154(7):3105-17, 1995; U.S. Pat. No.
6,099,846) studied the production of mouse monoclonal antibodies
using a chimeric protein containing a portion of GM-CSF plus a
portion of an antigen of interest, namely an idiotypic region
obtained from a murine B-cell tumor, 38C13, both fused to portions
of human immunoglobulin chains. Chen and coworkers have also
studied fusion proteins where the GM-CSF moiety has been replaced
by portions of IL-2 or IL-4 (Chen et al., J. Immunol.
153(10):4775-87, 1994). One explanation for the requirement of
including the GM-CSF moiety (or interleukin moiety) was to augment
the effect-of low levels of chimeric protein produced by the
mammalian cell expression system. However, the use of purified
GM-CSF co-administered with a chimeric protein to enhance the
immune response of a vaccination has not been demonstrated.
[0017] With the advent of recombinant DNA technology, heavy and
light chain cDNA molecules can now be cloned from hybridomas or
from combinatorial libraries employing the polymerase chain
reaction (PCR). This recombinant DNA technology allows researchers
to manipulate the effector function or the binding function of a
selected monoclonal antibody. In addition, combinatorial libraries
of immunoglobulins can be generated by cloning a large number of
V.sub.L and V.sub.H genes, randomly assorting them to create a
library of different binding specificities, expressing them in E.
coli, then screening the stochastic library for clones with the
desired binding affinities (Huse et al., Science 246(4935):1275-81,
1989). Using this recombinant approach, human antibodies were
cloned with high affinity and specificity for tetanus toxoid from a
randomized combinatorial library expressed in E. coli (Mullinax et
al., Proc. Natl. Acad. Sci. 87(20):8095-99, 1990). The
immunoglobulin genes were cloned from activated B-cells into
bacteriophage vectors using the polymerase chain reaction (PCR)
with specific primers. The H and L chains were randomly combined
and co-expressed in E. coli to comprise a library of 1 members.
This combinatorial library was screened with .sup.125I-tetanus
toxoid and 0.2% of the clones displayed binding activity (Mullinax
et al., supra). In addition, murine monoclonal antibodies have also
been identified using a similar approach (Huse et al., supra; Caton
et al., Proc. Natl. Acad. Sci. 87(16):6450-54, 1990). Winter and
co-workers used a plasmid vector to clone immunoglobulin domains by
the polymerase chain reaction for expression in bacteria (Orlandi
et al., Proc. Natl. Acad. Sci. 86(10):3833-37, 1989).
[0018] Newly developed E. coli antibody cloning systems are very
useful for the identification of genes encoding desired binding
specificities. However, antibodies produced in E. coli are not
generally useful for therapeutic applications. Typically, only the
antibody antigen binding fragments, Fab or Fv, can be produced as
secreted products in bacteria. In the rare instance when a whole
chain tetrameric IgG has been produced in E. coli, the CH2 domains
are not glycosylated. Nonglycosylated antibodies lack the cytolytic
activities antibody-directed cellular cytotoxicity (ADCC) and
complement activation that make passive immunotherapy so powerful.
Mammalian expression systems produce glycosolated antibody and thus
circumvent this limitation of the bacterial system. However, recent
modifications in the CBER division of the FDA's "Points to
Consider" clearly signal their concerns about viral loads
associated with monoclonal antibodies produced in mammalian cells.
Moreover, it is expected that any engineered antibody produced in a
mammalian expression system will be quite expensive ($1500-$5000
per dose). Alternative expression systems that circumvent the
difficulties encountered with current mammalian and bacterial
systems are therefore highly desirable.
[0019] The baculovirus expression system is an attractive
alternative to antibody production in E. coli and mammalian cells.
The expression of recombinant proteins using the baculovirus system
has been demonstrated in the past several years and has emerged as
an excellent choice for high yield production (1-100 mg/L) of
biologically active proteins in eukaryotic cells. The
baculovirus/insect cell system also circumvents the solubility
problems often encountered when recombinant proteins are
overexpressed in prokaryotes. In addition, insect cells contain the
eukaryotic post-translational modification machinery responsible
for correct folding, disulfide formation, glycosylation,
.beta.-hydroxylation, fatty acid acylation, prenylation,
phosphorylation and amidation not present in prokaryotes. The
production of a functional, glycosylated monoclonal antibody
recognizing human colorectal carcinoma cells from a baculovirus
expression system has been recently demonstrated (Nesbit, J.
Immunol. Methods 151:201-208, 1992). Additionally, expression of
recombinant IgA has also been demonstrated in baculovirus cells,
and this IgA was correctly assembled into heavy chain/light chain
heterodimers, N-glycosylated, and secreted (Carayannopoulos et al.,
Proc. Natl. Acad. Sci. 91:8348-52, 1994, PCT Publication No. WO
98/30577, U.S. Pat. No. 6,063,905). However, the use of baculovirus
to express a chimeric idiotypic protein for use as an
immunotherapeutic agent to modify a B cell pathology such as B cell
malignancies and autoimmune diseases has not been demonstrated.
SUMMARY OF THE INVENTION
[0020] The present invention provides a method for altering a B
cell mediated pathology in a patient. This method includes
administering a composition that contains at least one chimeric
protein having at least a portion of a V.sub.L and V.sub.H region
of an immunoglobulin variable region and at least a portion of an
immunoglobulin constant region. The V.sub.L and V.sub.H region used
in this composition is associated with a particular immunoglobulin
produced by a B cell from a patient having a B cell mediated
pathology. After administering such a composition into a patient,
the B cell mediated pathology in the patient is altered.
[0021] The present invention also provides a method for altering a
B cell mediated pathology in a patient by administering a
composition containing two different chimeric proteins. Each
chimeric protein has at least a portion of a V.sub.L and/or V.sub.H
region of an immunoglobulin chain linked to at least a portion of
an immunoglobulin constant region. The V.sub.L and/or V.sub.H
regions that are part of the chimeric protein are associated with
particular immunoglobulin chains from a B cell of the patient
having a B cell mediated pathology.
[0022] Specific immunoglobulin chains containing patient-derived
unique V.sub.L and/or V.sub.H chains can be developed as
therapeutic compositions. They will have therapeutic value for
patients suffering from a variety of B cell malignancies or
autoimmune diseases. Among the major types of cancers that can be
treated are leukemias, myelomas, and lymphomas; among the lymphomas
is non-Hodgkin's lymphoma. As an example of the therapeutic value
of the instant invention, antigens derived from B cell lymphomas
have been used to treat patients.
[0023] Suspected self-antigens can be used to affinity purify B
cells involved in autoimmune diseases, such as multiple sclerosis
(MS) (Warren and Catz, Mult. Scler. 6(5):300-11, 2000), systemic
lupus erythematosus (SLE) (Zhang, J. et al., J. Immunol.
166(1):6-10, 2001; Odendahl, M. et al., J. Immunol.
165(10):5970-79, 2000), anti-Hu associated paraneoplastic
neurological syndromes (Rauer, S. and Kaiser, R., J. Neuroimmunol.
111(1-2):241-44, 2000); and autoimmune hepatitis (AIH) (Ogawa, S.
et al., J. Gastroenterol. Hepatol (1):69-75, 2000). Other
autoimmune diseases which may have B cell involvement include
rheumatoid arthritis (RA), myasthenia gravis (MG), autoimmune
thyroiditis (Hashimoto's thyroiditis), autoimmune uveoretinitis,
polymyositis, scleroderma, and certain types of diabetes. Following
the purification of a small number of pathogenic B cells, the
variable portion of the immunoglobulins expressed by these cells
may be cloned via PCR using the methods described in the invention.
Once cloned, the V.sub.L and/or V.sub.H portions of the
immunoglobulin chains specifically involved in the B cell pathology
can be used to make chimeric proteins which can be expressed in a
baculovirus system as described herein.
[0024] The immunoglobulin constant regions used in the above
compositions and chimeric protein can be from IgG.sub.1, IgG.sub.2,
IgG.sub.3, IgG.sub.4 IgA.sub.1, IgA.sub.2, IgM, IgD, IgE heavy
chains, and K or .lamda. light chains or portions thereof. In some
of the embodiments, the chimeric protein only contains either the
V.sub.L and/or V.sub.H region of an immunoglobulin region with an
immunoglobulin constant region. Examples of chimeric proteins
include V.sub.H-IgG.sub.65 1, V.sub.L-K, and V.sub.L-.lamda.. In
another embodiment, the composition contains two chimeric proteins
that each respectively contains a V.sub.L and V.sub.H region with
an immunoglobulin constant region. Examples include
V.sub.H-IgG.sub..gamma.1 and V.sub.L-K, and
V.sub.H-IgG.sub..gamma.1 and V.sub.L-.lamda..
[0025] The present invention also provides a method for producing
chimeric proteins using recombinant DNA technology and an
expression system. This method includes the following steps: (a)
isolating genes encoding the V.sub.L or V.sub.H region of an
immunoglobulin chain from B cells of a patient having a B cell
mediated pathology, (b) inserting the isolated gene encoding the
V.sub.L or V.sub.H region of an immunoglobulin chain and the gene
encoding an immunoglobulin constant region into an expression
vector to allow the expression of a chimeric protein, (c) producing
the chimeric protein by introducing the expression vector into
insect cell lines and allowing its expression, and (d) isolating
the chimeric protein. The method for producing chimeric proteins
further includes a step of inserting a gene encoding either the
V.sub.L and/or V.sub.H region of an immunoglobulin chain and a gene
encoding a second immunoglobulin constant region into the
expression vector to allow the expression of the second chimeric
protein.
[0026] The present invention further provides a composition for
altering a B cell mediated pathology in a patient. This composition
contains at least one chimeric protein having at least a portion of
a V.sub.L and/or V.sub.H region of an immunoglobulin chain and at
least a portion of an immunoglobulin constant region. In preferred
embodiments, the chimeric proteins may comprise at least a portion
of a V.sub.H region of an immunoglobulin chain and at least a
portion of an immunoglobulin constant region. The V.sub.L or
V.sub.H region that is part of the chimeric protein are associated
with a particular immunoglobulin chain from a B cell of a patient
having a B cell mediated pathology. The composition further
contains a second chimeric protein having at least a portion of a
V.sub.L and/or V.sub.H region of an immunoglobulin chain and at
least a portion of a second immunoglobulin constant region. In
other preferred embodiments, the second chimeric protein may
comprise at least a portion of a V.sub.L or V.sub.H region of an
immunoglobulin chain and at least a portion of an immunoglobulin
constant region. The V.sub.L or V.sub.H region that is part of the
chimeric protein is associated with a particular immunoglobulin
chain from a B cell of a patient having a B cell mediated
pathology.
[0027] In one of the embodiments of the invention, the composition
comprises two chimeric proteins. The first of the chimeric protein
comprises the entire V.sub.H region and a human constant region of
an immunoglobulin IgG.sub..gamma.1 (V.sub.H-IgG.sub..gamma.1), and
the second chimeric protein comprises the entire V.sub.L and a
human K or .lamda. constant region (V.sub.L-C.sub.K or
V.sub.L-C.sub..lamda.). In other preferred embodiments, either or
both of the chimeric proteins may comprise at least a portion of a
V.sub.L and/or V.sub.H region of an immunoglobulin chain, plus a
linker region, and at least a portion of an immunoglobulin constant
region.
[0028] In another embodiment of the invention, the composition
contains a single chimeric protein containing either a V.sub.L
and/or V.sub.H region from a particular immunoglobulin chain from a
B cell of a patient and an immunoglobulin constant region. Examples
include chimeric proteins V.sub.H-IgG.sub..gamma.1, V.sub.L-K,
V.sub.L-.lamda., V.sub.L-IgG.sub..gamma.1, V.sub.H-K, and
V.sub.H-.lamda..
[0029] In one of the embodiments of the invention, the expression
vector used to express the chimeric proteins is a baculovirus
vector. The vector preferably contains two expression cassettes
each having a promoter, a secretory signal sequence and a chimeric
protein. One expression cassette contains the baculovirus AcNPV p10
promotor linked to the honey bee melittin secretory signal
sequence. The other expression cassette has the polyhedrin promotor
linked to a human placental alkaline phosphatase secretory-signal
sequence. In addition to the listed promoters and signal sequences,
other promoters and signal sequences known to those skilled in the
art could be used. In some preferred embodiments, the signal
sequences are endogenous signal sequences associated with the
V.sub.L and V.sub.H genes isolated from patients, or other signal
sequences involved in antibody production. The genes encoding the
V.sub.L or V.sub.H portions of the immunoglobulin chains, and the
genes encoding immunoglobulin constant region are inserted,
separately and/or together, into the above expression cassette of
the baculovirus vector allowing expression of one or two chimeric
proteins. In a preferred embodiment, the constant region of the
immunoglobulin heavy chain, such as IgG.sub..gamma.1, with either
the V.sub.L or V.sub.H region, is controlled by the polyhedrin
promotor.
[0030] Chimeric proteins produced are purified using affinity
columns with anti-immunoglobulin antibodies or Ig-binding proteins,
such as protein A for the constant, region of an immunoglobulin
heavy chain, and protein L for kappa light chains, and/or any other
proteins that bind to an immunoglobulin binding domain.
[0031] The present invention also contemplates covalently coupling
the chimeric proteins to a carrier protein such as keyhole limpet
hemocyanin (KLH). The composition of the present invention may also
be administered into a patient together with a cytokine such as
granulocyte-macrophage-CS-F (GM-CSF), or a chemokine such as a
monocyte chemotactic protein 3 (MCP 3). Because the present
composition of the present invention containing chimeric protein(s)
is specifically related to a particular immunoglobulin from B cells
of a patient having B cell mediated pathology, administration of
this composition induces an immune response against the disease
specific idiotype in which particular V.sub.L or V.sub.H segments
are involved. Similarly, responses against B cells associated with
autoimmune diseases involving B cells that use a restricted
repertoire of immunoglobulin V-region segments, such as V.sub.L or
V.sub.H segments may induce a therapeutic result. Thus, the
administration of the composition of the present invention alters a
B cell mediated pathology and/or autoimmune diseases in a patient.
The administration routes for the invented composition include but
are not limited to oral delivery, inhalation delivery, injection
delivery, transdermal delivery, and the like.
[0032] All U.S. patents and applications; foreign patents and
applications; scientific articles; books; and publications
mentioned herein are hereby incorporated by reference in their
entirety, including any drawings, figures and tables, as though set
forth in full.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] FIG. 1: A general scheme for producing a composition
comprising chimeric proteins for V.sub.L or V.sub.H regions of a
particular immunoglobulin from B cells from a patient having B cell
mediated pathology.
[0034] FIG. 2: Plasmid map of a baculovirus expression vector p2Bac
with multiple cloning sites.
[0035] FIGS. 3A, 3B and 3C: DNA sequence of baculovirus expression
vector p2Bac (SEQ ID NO:5). The sequence is depicted from 5' to 3'.
The p2Bac vector contains the AcNPV polyhedrin gene promoter
(nucleotides 1 to 120 of the GenBank accession number X06637 (SEQ
ID NO:92)) and the AcMNPV p10 promoter (nucleotides 8 to 237 of
GenBank accession number A28889 (SEQ ID NO:93)).
[0036] FIG. 4: DNA sequence of the plasmid pTRABac/9F12. This
plasmid contains the genes for the heavy and light (K) chains
expressed by the stable human cell-line 9F12. This cell line
produces a human IgG1/K, antibody specific for tetanus toxoid (SEQ
ID NO:89). The underlined regions represent sequences encoding
mature 9F12 IgG.sub.1 (TTTACCC . . . ) and kappa (ATCGACA . . . )
chains, respectively. The sequence is depicted from 5' to 3'.
[0037] FIG. 5A: Plasmid map of recombinant baculovirus expression
vector pTRABacHuLC.sub.K HC.sub..gamma.1 with IgG.sub..gamma.1
constant regions.
[0038] FIG. 5B: Plasmid map of recombinant baculovirus expression
vector pTRABacHuLC.sub..lamda. HC.sub..gamma.1 with
IgG.sub..gamma.1 constant regions.
[0039] FIG. 6A: DNA sequence of pTRABacHuLC.sub.KHC.sub..gamma.1
(SEQ ID NO:6). The sequence is depicted from 5' to 3'.
[0040] FIG. 6B: DNA sequence of pTRABacHuLC.sub..lamda.
HC.sub..gamma.1 (SEQ ID NO:7). The sequence is depicted from 5' to
3'.
[0041] FIG. 6C: DNA sequence of pTRABacHuLC.sub.K HC.sub..gamma.1
following modification utilizing the kappa stuff primers (SEQ ID
NO:90). The sequence is depicted from 5' to 3'.
[0042] FIG. 6D: DNA sequence of pTRABacHuLC.sub..lamda.
HC.sub..gamma.1 following modification utilizing the lambda stuff
primers (SEQ ID NO:91). The sequence is depicted from 5' to 3'.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0043] The possibility of evoking an immune response that would
recognize and eliminate neoplastic cells while sparing normal
tissue represents an exciting approach to the treatment of cancer.
Inducing such an immune response is assisted-by identifying a
unique tumor antigen. B-cell malignancies express a unique antigen,
the immunoglobulin idiotype (Id), on their surface. This antigen
contains protein sequences from both the variable immunoglobulin
heavy and light regions (V.sub.L and V.sub.H). Each B-cell harbors
a unique genetic sequence used in the production of the
immunoglobulin idiotype. Consequently, as most B cell malignancies
arise from the clonal expansion of a single B cell, all cells
comprising a B-cell malignancy expresses a unique Id protein.
Hence, idiotypic protein should serve as an ideal target for
immune-based therapy of any B cell malignancy, such as lymphoma or
leukemia.
[0044] Passive Immunotherapy
[0045] Early immunotherapy strategies focused on the use of
monoclonal antibodies against tumor-specific idiotype (anti-Id
MoAb). This approach resulted in tumor regression and long-lasting
remissions in several patients with non-Hodgkin's lymphoma. However
many patients experienced eventual relapse (Miller et al., N. Engl.
J. Med. 306(9):517-22, 1982; Maloney et al., Blood 80(6):1502-10,
1992; Brown et al., Blood 73(3):651-61, 1989; Brown et al., Semin.
Oncol 16(3):199-210, 1989; Meeker et al., Blood 65(6):1349-63,
1985.
[0046] One difficulty that arose in the studies described above was
that cells of a malignant B or T cell lymphoma could alter their
expression of their idiotypic immunoglobulins or T cell receptors.
Two examples of this were described in some of the articles listed
above (Cleary et al., 1986, and Meeker et al., 1985). It was also
shown that T cell leukemia cells could escape anti-idiotypic
antibodies by reducing their expression of surface T cell receptor
(Maecker et al., J. Immunol. 141:2994-3002, 1985), and this was
confirmed for B cell leukemias in an animal model (Stevenson et
al., J. Immunol. 130(2):970-3, 1983). Other studies demonstrated
that that there is idiotypic variation even within a given human B
cell lymphoma (Berinstein et al., J. Immunol. 144(2):752-8, 1990;
Levy S, et al., J. Exp. Med. 168(2):475-89, 1988;). Such mutations
appeared responsible for the decreased effectiveness of the anti-Id
MoAb over time (Berinstein et al., supra; Tao et al., Nature
362(6422):755-8, 1993; Chen et al., J. Immunol. 153(10):4775-87,
1994).
[0047] One way to avoid this problem is via the generation and use
of a polyclonal antisera against the idiotypic protein. Caspar and
co-workers studied the potential of a polyclonal antibody-based
therapy in a mouse model system (Caspar et al., Blood 90:3699-706,
1997). These authors vaccinated a mouse using idiotypic proteins
from a non-Hodgkin's leukemia patient who had relapsed following
successful monoclonal antibody therapy. The resultant polyclonal
antibodies recognized idiotypic proteins from both the original
tumor and all variants. Therefore, generation of polyclonal
antibody response specific to the idiotype of a B cell lymphoma or
leukemia would represent an improvement over monoclonal antibody
therapy. Producing sufficient quantities of protein to for a
vaccination to produce polyclonal antibodies is a significant
burden of this approach.
[0048] Active Immunotherapy
[0049] Active immunotherapy may avoid the phenomenon of mutational
escape seen with passive immune strategies. Such therapy has the
potential to generate a broader immune response and thereby
recognize the heterogeneous tumor cell population that can arise
over time. The difficulty with active immunotherapy lies in
convincing the patient's immune system to react against a perceived
"self antigen" expressed by the tumor. As with idiotypic protein,
many of the antigens expressed by tumors are weak immunogens.
[0050] In the instant invention, the unique specificity of the
immune system has been adapted to treat B cell malignancies. In the
instant invention, the DNA sequence encoding the variable region of
the idiotypic immunoglobulins was cloned using primers derived from
the 5' end of each unique subfamily of light and heavy
immunoglobulin chains together with a constant region primer.
Typically, this process uses one of several suitable cloning
techniques such as PCR. These constant region primers, in
combination with one for the V.sub.H region and one for the V.sub.L
region, maybe used to clone the variable regions as a first step in
producing a chimeric protein comprising a variable region and a
constant region. Alternatively, techniques such as 5' RACE may be
used. In the case of one patient described infra, 5' RACE was used
to clone the variable regions of the heavy and light immunoglobulin
chains in order to produce a chimeric protein. Examples of chimeric
proteins include: V.sub.L/C.sub.K, V.sub.L/C.sub..lamda.,
V.sub.L/IgG.sub..gamma.1, V.sub.H/IgG.sub..gamma.1,
V.sub.H/C.sub.K, and V.sub.H/C.sub..lamda.. These chimeric proteins
are produced in insect cells using a baculovirus vector. The
chimeric protein thus comprises a portion of a variable region from
an immunoglobulin molecule from a patient and also comprises a
portion of a constant region from a source other than the patient.
In preferred embodiments, the heavy and light chain constant
regions are derived from 9F12 cells. However, other sources for
immunoglobulin constant region genes may be used. These chimeric
proteins are predicted to be more efficiently produced than using
existing systems for producing idiotypic proteins and will be
excellent immunogens for use in vaccination protocols.
[0051] The present invention fills the great demand for an
effective treatment for B cell mediated pathologies and autoimmune
diseases. The inventions take advantage of the unique cell surface
antigens present on the surface of B cells involved in B cell
pathologies, and are prepared in a patient-specific manner. Such
vaccines provide exquisite selectivity by being tailored to the
markers unique to the pathogenic B cells found in a given
patient.
[0052] The novel baculovirus/insect cell expression system has
proven effective for the efficient production of functional
antibodies for immunotherapy from any given patient. This
baculovirus expression vector was designed such that only two
custom gene-specific primers were needed to amplify any pair of
antibody variable regions for easy subcloning and expression as
human kappa light chain and IgG.sub..gamma.1 heavy chain. The
incorporation of heterologous secretary signal sequences, which
directed the heavy and light chains to the secretary pathway, were
incorporated for the expression of large amounts of active
immunoglobulin from insect cells. This vector should be useful for
the expression of any kappa light chain variable region (V.sub.L)
in frame with human kappa constant region and secreted via the
human placental alkaline phosphatase secretary signal sequence; and
any heavy chain variable region (V.sub.H) in frame with the human
IgG.sub..gamma.1 constant domain led by the honey bee melittin
secretary signal sequence. In other systems, the lambda light chain
constant region replaces the kappa constant region. The chimeric
protein is then expressed with the V.sub.L region in frame with
human lambda constant region and secreted via the human placental
alkaline phosphatase secretary signal sequence, along with any
heavy chain variable region (V.sub.H) in frame with the human
IgG.sub..gamma.1 constant domain led by the honey bee melittin
secretary signal sequence. Any monoclonal antibody, mouse or human,
either from a monoclonal cell line or identified by phage display
cloning, could be easily expressed as whole human
IgG.sub..gamma.1/K or IgG.sub..gamma.1/.lamda. in this vector after
two simple subcloning steps. Additionally, different immunoglobulin
types, including IgG.sub..gamma.2, IgG.sub..gamma.3,
IgG.sub..gamma.4, IgA, IgA, IgA.sub.1, IgA.sub.2, IgM, IgD, IgE
heavy chains, or segments thereof, could be used in place of
IgG.sub..gamma.1. Furthermore, besides those signal sequences
described supra, the instant invention may use other secretory
signal sequences such as the endogenous secretory sequences
associated with the immunoglobulin genes derived from a given
patient. Additionally, one of skill in the art would be able to
select several different primers that could be used equivalently in
this system to produce equivalent results to amplify any pair of
antibody variable regions for easy subcloning.
[0053] In some instances, utilization of the baculovirus system for
the expression of biologically active proteins has been hampered by
the inability to efficiently solubilize recombinant proteins
without excessive proteolytic degradation. In order to circumvent
solubility and proteolysis problems encountered with the expression
of recombinant proteins in insect cells, baculovirus transfer
vectors were developed for the efficient secretion of biologically
active proteins. These vectors that facilitate the secretion of
recombinant proteins from host insect cells are constructed by
inserting functional secretory leader sequences downstream of the
polyhedrin promoter. In-frame insertion of cDNA sequences resulted
in the synthesis of proteins containing a heterologous signal
sequence which directed the recombinant protein to the secretory
pathway. Human and insect leader sequences were both tested to
maximize secretion of heterologous proteins from insect cells. The
human placental alkaline phosphatase signal sequence (SEQ ID NO: 1:
MLGPCMLLLLLLLGLRLQLSLG; DNA sequence is SEQ ID NO:2: ATG GTG GGA
CCC TGC ATG CTG CTG CTG CTG CTG CTG CTA GGC CTG AGG CTA CAG CTC TCC
CTG GGC) and the honeybee melittin signal sequence (SEQ ID NO:3:
MKFLVNVALVFMVVYISYIYA; DNA sequence is SEQ ID NO:4: ATG AAA TTC TTA
GTC AAC GTT GCA CTA GTT TTT ATG GTC GTG TAC ATT TCT TAC ATC TAT
GCG) have both proved useful for the secretion of numerous
bacterial and human proteins (Mroczkowski et al., J. Biol. Chem.
269:13522-28, 1994 and Tessier et al., Gene 98:177-83, 1991).
[0054] To tailor the present invention to a particular patient
first requires identification and isolation of the genes encoding
the unique antigens, and then the means of producing those
antigens. This may be accomplished in a number of different ways
available to one of skill in the art. For example, a recently
developed method that is adapted to the needs of the instant
invention uses a novel baculovirus/insect cell expression system
and was recently developed for the efficient production of
functional antibodies for immunotherapy (see U.S. Provisional
Application Ser. No. 60/244,722, entitled "Expression Vectors for
Production of Recombinant Immunoglobulin").
[0055] Expression of recombinant proteins using the baculovirus
system allows the production of large quantities of biologically
active proteins without many of the drawbacks associated with
proteins made in bacteria, and also avoids the complications of
using mammalian cells. For example the immunoglobulin genes from
the stable human cell-line 9F12 (ATCC#HB8177), which produces a
human IgG1/K antibody specific for tetanus toxoid, were cloned into
a baculovirus dual promoter expression transfer vector. Intact
IgG1/K immunoglobulin was produced in insect cells that behaved
similarly to the mammalian antibody in SDS-PAGE analysis and
Western blots. The antibody produced by insect cells was
glycosylated. The binding affinities of purified Mab9F12 and
purified baculovirus expressed antibody were determined to be
identical and production levels were determined to be approximately
5-10 .mu.g/ml.
[0056] Soluble human immunoglobulin fragments containing specific
epitopes of the particular variable regions can be produced in
insect host cells via genetic engineering. These soluble
recombinant immunoglobulin proteins containing patient-derived
particular V.sub.L and/or V.sub.H regions can be used as a
therapeutic composition. When administered into the patient, it
would specifically induce, in vivo, a cell mediated immune response
for altering the B cell mediated pathology.
[0057] This technology has also been applied towards the rapid
identification and cloning of patient-specific V.sub..alpha. and
V.sub..beta. genes expressed by a T cell lymphoma, then expressing
these as recombinant K/V.sub..alpha. or
IgG.sub..gamma.1/V.sub..beta. molecules in insect cells (see U.S.
Provisional Application Ser. No. 60/266,133 entitled "Method and
Composition for Altering a T Cell Mediated Pathology"). Molecules
produced by this method were formulated and used to induce
anti-idiotypic cell-mediated immunity against lymphomas in a
patient-specific fashion.
[0058] The term "altering" or "alters" refers to the ability of a
compound or composition of the invention to modulate a B cell
mediated pathology. A compound which alters a B cell pathology may
do so by a number of potential mechanisms, including raising
antibodies directed at the compound which in turn destroys cells of
the B cell pathology, inducing apoptosis in the B cells involved in
the pathology, inhibiting further growth and division of cells of
the B cell pathology, inducing cell-mediated immunity directed at
the cells of the B cell pathology, or otherwise inhibiting the
activity of the pathological B cells. The exact mechanism that
causes the alteration need not be determined, but only that an
alteration in the B cell mediated pathology occurs by some
mechanism as a consequence of adding the inventive molecules or
compositions.
[0059] The term "B cell mediated pathology" or "B cell pathology"
refers to those diseases and conditions that arise from
inappropriate replication or activity of B cells. In preferred
embodiments, the B cell mediated pathology is a B cell lymphoma
that results from inappropriate replication of B cells. B cell
lymphomas are difficult to treat effectively with the currently
available medical methods. Other types of B cell pathologies which
involve inappropriate replication of B cells include chronic and
acute B cell leukemias, multiple myelomas, and some non-Hodgkin's
lymphomas. Other preferred embodiments include a growing number of
human diseases that have been classified as autoimmune disease,
where the host's own immune system attacks the host's own tissue,
such as multiple sclerosis (MS) (Warren and Catz, Mult. Scler.
6(5):300-11, 2000), systemic lupus erythematosus (SLE) (Zhang, J.
et al., J. Immunol. 166(1):6-10, 2001; Odendahl, M. et al., J.
Immunol. 165(10):5970-79, 2000), anti-Hu associated paraneoplastic
neurological syndromes (Rauer, S. and Kaiser, R., J. Neuroimmunol.
111(1-2):241-44, 2000); autoimmune hepatitis (AIH) (Ogawa, S. et
al., J. Gastroenterol. Hepatol (1):69-75, 2000). Other candidate
autoimmune diseases for treatment by the present invention include
rheumatoid arthritis (RA), myasthenia gravis (MG), autoimmune
thyroiditis (Hashimoto's thyroiditis), Graves' disease,
inflammatory bowel disease, autoimmune uveoretinitis, polymyositis,
scleroderma, and certain types of diabetes. The present treatments
for these autoimmune diseases do not cure the disease, but instead
only ameliorate the symptoms.
[0060] The term "B cell" refers to a cell of the immune system of
an organism which is involved in the humoral immunity in normal
functioning of a organism (i.e., one that is not experiencing a B
cell mediated pathology). B cells are white blood cells that
develop from bone marrow and produce antibodies; they are also
known as B lymphocytes. In general, B cells are cells involved in
antibody production in an organism.
[0061] The term "pathology" refers to a state in an organism (e.g.,
a human) which is recognized as abnormal by members of the medical
community. The pathology to be treated in the present invention is
characterized by an abnormality in the function of B cells.
[0062] The term "patient" refers to an organism in need of
treatment for a pathology, or more specifically, a B cell
pathology. The term refers to a living subject who has presented at
a clinical setting with a particular symptom or symptoms suggesting
the need for treatment with a therapeutic agent. The treatment may
either be generally accepted in the medical community or it may be
experimental. In preferred embodiments, the patient is a mammal,
including animals such as dogs, cats, pigs, cows, sheep, goats,
horses, rats, and mice. In further preferred embodiments, the
patient is a human. A patient's diagnosis can alter during the
course of disease progression, either spontaneously or during the
course of a therapeutic regimen or treatment.
[0063] An "organism" can be a single cell or multi-cellular. The
term includes mammals, and, most preferably, humans. Preferred
organisms include mice, as the ability to treat or diagnose mice is
often predictive of the ability to function in other organisms such
as humans. Other preferred organisms include primates, as the
ability to treat or diagnose primates is often predictive of the
ability to function in other organisms such as humans.
[0064] The term "chimeric protein" refers to a protein which
comprises a single polypeptide chain comprising segments derived
from at least two different proteins. The segments of the chimeric
protein must be derived from heterologous proteins, that is, all
segments of the chimeric polypeptide do not arise from the same
protein. The chimeric proteins of the present invention include
proteins containing portions of the V.sub.L or V.sub.H region of an
immunoglobulin chain, but do not comprise the entire C region of
those chains as found in the B cell clone from which the V.sub.L or
V.sub.H regions is derived. Furthermore, the V.sub.L or V.sub.H
region may not include the entire variable region, but does include
enough to generate an immune response. Chimeric proteins of the
present invention may also include proteins in which a segment of
the naturally occurring protein has been replaced with an
equivalent naturally or non-naturally occurring segment. This
includes replacing the IgG.sub.1 constant region derived from a
patient with the IgG.sub.1 constant region from a different source
and would also include immunoglobulin constant regions in which a
segment of the protein has been replaced with a linker, segment or
domain that is partially or entirely manmade. In all cases,
however, the gene for the chimeric protein of the instant invention
will not be the same as the gene for the immunoglobulins which
occur naturally in the patient. The gene for the chimeric protein
will be distinguishable from naturally occurring protein for one of
the following reasons: (1) it will not be the full length
immunoglobulin gene or cDNA from the patient, (2) it will be a
different subtype than isolated from the patient, or (3) the
nucleic acid sequence encoding the patient's IgG.sub.1 constant
region will differ from the IgG.sub.1 gene used in the expression
vector.
[0065] The terms "protein," "polypeptide," and "peptide" are used
herein interchangeably.
[0066] The term "naturally" or "native" refers to a protein as it
is isolated from nature. Thus, a naturally occurring protein may
refer to a protein as it is found in nature which is encoded by a
gene that has not been modified by the use of recombinant
techniques. A native protein may refer to a protein as it may be
found or synthesized in nature. These terms may also apply to
proteins which are produced by biological system such as the
bacculovirus virus system of the present invention or by the
culture of cells derived from patients. A native protein may
alternately refer to an isolated protein which has not been
denatured. The term "native" may also refer to the manner in which
polypeptide or protein is folded, either alone or in combination
with other polypeptides, so that it resembles similar proteins
found in nature, or how it is modified after translation
("post-translational modifications") so that it resembles similar
proteins found in nature. A naturally-occurring protein may be
found only in pathological B cells from a single patient,
nevertheless, this may be considered a naturally-occurring
protein.
[0067] The term "segment" or "portion" is used to indicate a
polypeptide derived from the amino acid sequence of the proteins
used for the chimeric proteins having a length less than the
full-length polypeptide from which it has been derived. It is
understood that such segments may retain one or more characterizing
portions of the native polypeptide. Examples of such retained
characteristics include: binding with an antibody specific for the
native polypeptide, or an epitope thereof.
[0068] The terms "V.sub.H" and "V.sub.L" refer to the variable
regions of the polypeptide chains of immunoglobulin molecules, or
nucleic acids encoding such polypeptide chains. One skilled in the
art realizes the meaning of these terms. The exact sequence of a
variable region cannot be predicted and must be determined by
isolating the sequence in question. The V.sub.L and V.sub.H regions
isolated from particular patients are used in the instant
invention. The exact sequence of a kappa (K) or lambda (.lamda.)
light chain is determined by clonal rearrangements of the V
regions, J regions and Constant region of the light chain locus.
(The kappa and lambda loci are separate and distinct.) The exact
sequence of a heavy chain is determined by clonal rearrangements of
the V regions, D regions, J regions and Constant region of the
heavy chain locus. Additional sequence variation in the variable
region arises from imprecision during the recombination process and
also is generated by somatic mutations'subsequent to the end of the
recombination process. The terms "V.sub.H" and "V.sub.L" also refer
to portions or segments of the VL and VH regions. A segment of the
V.sub.L and V.sub.H region may also include all or substantially
all of the V region. The term "substantially all" refers to
approximately 90% of the entire variable region, or approximately
80% of the entire variable region. The portion of the V.sub.L and
V.sub.H region present must be sufficient to allow the chimeric
molecule to operate in the present invention. The terms "V.sub.H"
and "V.sub.L" also refer to functional derivatives of such
polypeptide regions as described infra.
[0069] The term "immunoglobulin constant region" refers to all or
part of that portion of immunoglobulin molecules which are not
encoded by the variable regions of immunoglobulins. The term
"immunoglobulin constant region" may also refer to the DNA sequence
encoding the immunoglobulin constant region. The immunoglobulin
constant region includes the segments C.sub.L, C.sub.H1, C.sub.H2,
C.sub.H3, and the Hinge region. Immunoglobulin types include
IgG.gamma.1, IgG.sub..gamma.2, IgG.sub..gamma.3, IgG.sub..gamma.1,
IgA.sub.1, IgA.sub.2, IgM, IgD, IgE heavy chains, and K or .lamda.
light chains or segments thereof. Any immunoglobulin constant
region segments may be used in the instant invention, provided that
the segment allows the immunoglobulin constant region to operate
for the purposes of the present invention, for example, or the
affinity purification of the chimeric molecule, via binding to
Protein G, Protein A, Protein L, or appropriate antibody.
Functional derivatives of the immunoglobulin constant region
segments, as described infra, may also be used.
[0070] The term "immunoglobulin fold" or "immunoglobulin domain"
refers to a structural element of the immunoglobulin super family.
The immunoglobulin domain is a conserved, repeating structural
domain of approximately 110 amino acids each.
[0071] Immunoglobulin domains are found in many protein molecules,
including antibodies, the T cell antigen receptor, cytokine
receptors (e.g., the platelet-derived growth factor receptor with 5
Ig domains), cell adhesion molecules (e.g., ICAM-1/CD54), and many
others. Two immunoglobulin domains are found in each TCR; one in
the variable region and one in the constant region. Two
immunoglobulin domains are found in antibody light chains and four
are found in IgG heavy chains. The present invention contemplates
the replacement of one or two domains of the constant region with
domains from a different molecule, such as an immunoglobulin
molecule, to produce a modified (chimeric) constant region which
may have different properties such as binding to other
molecules.
[0072] The terms "IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4, IgA,
IgA.sub.1, IgA.sub.2, IgM, IgD, IgE" refer to classes and
subclasses of human immunoglobulins. The terms may refer to either
the DNA sequences or the amino acid sequences of the proteins. The
class and subclass of an immunoglobulin molecule is determined by
its heavy chain. IgG and IgD are different classes of
immunoglobulins; IgG.sub.1 and IgG.sub.2 are different subclasses
of immunoglobulin molecules. The term "IgA" may refer to any
subclass of IgA molecules. In preferred embodiments, it refers to
an IgA.sub.1 molecule. In other preferred embodiments, it refers to
an IgA.sub.2 molecule. In some embodiments, the immunoglobulin
heavy chain used may be a chimeric protein that contains amino
acids from a second protein.
[0073] The term "IgG.sub..gamma.1" refers to the heavy chain
associated with the IgG.sub.1 class of immunoglobulins. IgG.sub.1
represents approximately 66% of human IgG immunoglobulins Roitt et
al., Immunology, Mosby, St. Louis, pg. 4.2, 1993).
[0074] The terms "kappa constant region," "lambda constant region,"
"K constant region," and ".lamda. constant region" refer to the
constant regions of kappa (K) and lambda (.lamda.) light chains
that remain constant during the development of the immune system.
The terms may refer to either the DNA sequences or the amino acid
sequences of the proteins. In some embodiments, portions of the
immunoglobulin light chain may be comprised in a chimeric protein
that contains amino acids from one or more other proteins.
[0075] The term "administering" relates to a method of contacting a
compound with or into cells or tissues of an organism. The B cell
mediated pathology can be prevented or treated when the cells or
tissues of the organism exist within the organism or outside of the
organism. Cells existing outside the organism can be maintained or
grown in cell culture dishes. For cells harbored within the
organism, many techniques exist in the art to administer compounds,
including (but not limited to) oral, parenteral delivery, decimal
application, injection, and aerosol applications.
[0076] The B cell mediated pathology can also be prevented or
treated by administering a compound of the invention, or an
antibody raised to a compound of the invention, to B cells
displaying the characteristics of a pathology. The effect of
administering a compound on organism function can then be
monitored. The organism is preferably a mouse, rat, rabbit, guinea
pig, or goat, more preferably a monkey or ape, and most preferably
a human.
[0077] The term "composition" refers to a mixture that contains the
protein of interest. In preferred embodiments, the composition may
contain additional components, such as adjuvants, stabilizers,
excipients, and the like.
[0078] The term "associated with" in reference to the relation of a
variable region to a B cell clone refers to the variable region
that is found on the immunoglobulins produced by a particular B
cell clone.
[0079] The term "B cell clone" refers to the clonal descendants of
a single B cell. Clonal descendants of B cells express the same
idiotype in the produced antibodies as the parental cell. One
skilled in the art realizes that clonal descendants of a B cell may
have undergone somatic mutation within the variable region of the
immunoglobulin gene but still remain part of the B cell clone.
[0080] The term "isolating" refers to removing a naturally
occurring nucleic acid sequence from its normal cellular
environment. Thus, the sequence may be in a cell-free solution or
placed in a different cellular environment. The term does not imply
that the sequence is the only nucleotide chain present, but that it
is essentially free (about 90-95% pure at least) of non-nucleotide
material naturally associated with it, and thus is distinguished
from isolated chromosomes. Also, by the use of the term "isolating"
in reference to nucleic acid is meant that the specific DNA or RNA
sequence is increased to a significantly higher fraction (2- to
5-fold) of the total DNA or RNA present in the solution of interest
than in the cells from which the sequence was taken. This could be
caused by a person by preferential reduction in the amount of other
DNA or RNA present, or by a preferential increase in the amount of
the specific DNA or RNA sequence, or by a combination of the two.
However, it should be noted that enriched does not imply that there
are no other DNA or RNA sequences present, just that the relative
amount of the sequence of interest has been significantly
increased. The term "significant" is used to indicate that the
level of increase is useful to the person making such an increase,
and generally means an increase relative to other nucleic acids of
about at least 2-fold, more preferably at least 5- to 10-fold or
even more. The term also does not imply that there is no DNA or RNA
from other sources. The DNA from other sources may, for example,
comprise DNA from a yeast or bacterial genome, or a cloning vector
such as pUC19. This term distinguishes from naturally occurring
events, such as viral infection, or tumor-type growths, in which
the level of one mRNA may be naturally increased relative to other
species of mRNA. That is, the term is meant to cover only those
situations in which a person has intervened to elevate the
proportion of the desired nucleic acid.
[0081] Isolated DNA sequences are relatively more pure than in the
natural environment (compared to the natural level this level
should be at least 2- to 5-fold greater, e.g., in terms of mg/mL).
Individual sequences obtained from PCR may be purified to
electrophoretic homogeneity. The DNA molecules obtained from this
PCR reaction could be obtained from total DNA or from total RNA.
These DNA sequences are not naturally occurring, but rather are
preferably obtained via manipulation of a partially purified
naturally occurring substance (e.g., messenger RNA (mRNA)). For
example, the construction of a cDNA library from mRNA involves the
creation of a synthetic substance (cDNA) and pure individual cDNA
clones can be isolated from the synthetic library by clonal
selection from the cells carrying the cDNA library. The process
which includes the construction of a cDNA library from mRNA and
isolation of distinct cDNA clones yields an approximately
10.sup.6-fold purification of the native message. Thus,
purification of at least one order of magnitude, preferably two or
three orders, and more preferably four or five orders of magnitude
is expressly contemplated.
[0082] The term "gene encoding" refers to a sequence of nucleic
acids which codes for a protein or polypeptide of interest. The
nucleic acid sequence may be either a molecule of DNA or RNA. In
preferred embodiments, the molecule is a DNA molecule. In other
preferred embodiments, the molecule is a RNA molecule. When present
as a RNA molecule, it will comprise sequences which direct the
ribosomes of the host cell to start translation (e.g., a start
codon, ATG) and direct the ribosomes to end translation (e.g., a
stop codon). Between the start codon and stop codon is an open
reading frame (ORF). One skilled in the art is very familiar with
the meaning of these terms.
[0083] The term "insect cell lines" refers to cell lines derived
from insects and susceptible to infection by the bacculovirus. One
skilled in the art is familiar with such cell lines and the
techniques needed to utilize them. Representative examples of
insect cell lines include Spodoptera frugiperda (sf9) and
Trichoplusia ni (Hi-5) cell lines.
[0084] The terms "Trichoplusia ni (High-5) cells" and "Spodoptera
frugiperda (sf9) cells" refers to insect cell lines used in
combination with baculovirus expression vectors. One skilled in the
art is familiar with these cell lines and how to obtain them.
[0085] The term "inserting" refers to a manipulation of a DNA
sequence via the use of restriction enzymes and ligases whereby the
DNA sequence of interest, usually encoding the gene of interest,
can be incorporated into another nucleic acid molecule by digesting
both molecules with appropriate restriction enzymes in order to
create compatible overlaps and then using a ligase to join the
molecules together. One skilled in the art is very familiar with
such manipulations and examples may be found in Sambrook et al.
(Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A
Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989),
which is hereby incorporated by reference in its entirety including
any drawings, figures and tables.
[0086] The term "adjuvant" refers to a substance which is provided
with the antigen or immunogen of choice, e.g., the protein or
polypeptide to which an immune response is desired, to enhance the
immune response when one attempts to raise an immune response in an
animal against the antigen or immunogen of choice. One skilled in
the art is familiar with appropriate adjuvants to select and use.
Adjuvants approved for human use include aluminum salts and MF59
(Singh and O'Hagan, Nature Biotech 17:1075-81, 1999). Other
adjuvants are being developed (Id.) and may be used in conjunction
with the present invention.
[0087] The term "keyhole-limpet hemocyanin" or "KLH" refers to a
protein which is isolated from keyhole limpets which is commonly
used as a carrier protein in the immunization process. One skilled
in the art is familiar with the meaning of the term keyhole limpet
hemocyanin.
[0088] The term "cytokine" refers to a family of growth factors,
soluble (glyco)proteins, secreted primarily from leukocytes.
Cytokines stimulate both the humoral and cellular immune responses,
as well as the activation of phagocytic cells. Cytokines are
synthesized, stored and transported by various cell types not only
inside of the immune system (lymphokines, interleukins, monokines,
tumor necrosis factors, interferons) but also by other cells which
are associated with the study of hematology (colony-stimulating
factors), oncology (transforming growth factors), and cell biology
(peptide growth factors, heat shock and other stress proteins).
[0089] Cytokines secreted from lymphocytes are termed lymphokines,
while those secreted by monocytes or macrophages are referred to as
monokines. Many of the lymphokines are also referred to as
interleukins (ILs), since they are not only secreted by leukocytes
but they are also able to affect the cellular responses of
leukocytes. Specifically, interleukins are growth factors targeted
to cells of hematopoietic origin.
[0090] The term "growth factor" refers to a protein that binds
receptors on the surface of a cell and subsequently activates
cellular proliferation and/or differentiation. Many growth factors
are quite versatile and can act to stimulate cellular division in a
wide variety of cell types, while others are specific to a
particular cell-type.
[0091] The term "chemokine" refers to a group of small
proinflammatory cytokines which function as chemoattractants and
activators for leukocytes and represent a superfamily of over 30
chemotactic cytokines. They orchestrate the activation and
migration of immune system cells from the blood or bone marrow to
the site of infection and damaged tissue. Chemokines also play an
essential role in the growth and proliferation of primitive stem
cells found in bone marrow which in turn develop into mature immune
cells. Chemokines are involved in a wide range of acute and
inflammatory diseases and exert their action by binding to
receptors of the seven-transmembrane-helix class.
[0092] Chemokines frequently range from 8 to 11 kDa in molecular
weights, are active over a concentration range of 1 to 100 ng/ml,
and are produced by a wide variety of cell types. The production of
chemokines typically is induced by exogenous irritants and
endogenous mediators such as IL-1, TNF-alpha, and PDGF. The
chemokines bind to specific cell surface receptors and can be
considered second-order cytokines that appear to be less
pleiotropic than first-order proinflammatory cytokines because they
are not potent inducers of other cytokines and exhibit more
specialized functions in inflammation and repair.
[0093] The term "granulocyte-macrophage colony-stimulating factor"
or "GM-CSF" refers to a small (less than 20 kDa) secreted protein.
It binds to specific cell surface receptors and functions as
species-specific stimulator of bone marrow cells. It stimulates the
growth and differentiation of several hematopoietic cell lineages
including dendritic cells, granulocytes, macrophages, eosinophils,
and erythrocytes. In particular, this cytokine also plays a role in
shaping cellular immunity by augmenting T-cell proliferation
(Santoli et al., J. Immunol. 141(2):519-26, 1988), increasing
expression of adhesion molecules on granulocytes and monocytes
(Young et al., J. Immunol. 145(2):607-15, 1990; Grabstein et al.,
Science 232(4749):506-08, 1986), and by augmenting antigen
presentation (Morrissey et al., J. Immunol 139(4):I.1.13-9, 1986;
Heufler et al., J. Exp. Med. 167(2):700-05, 1988; Smith et al., J.
Immunol. 144(5):1777-82, 1990).
[0094] The term "monocyte chemotactic protein-3" or "MCP-3" refers
a chemokine primarily produced by monocytes. MCP-3 has a wide
spectrum of chemotactic activity and attracts monocytes, dendritic
cells, lymphocytes, natural killer cells, eosinophils, basophils,
and neutrophils. The cDNA was cloned in 1993 by Minty et al., Eur
Cytokine Netw 4(2):99-110, 1993, and Opdenakker et al., Biochem
Biophys Res Commun., 191(2):535-42, 1993. Its properties have been
recently reviewed by Proost et al., J. Leukoc Biol. 59(1):67-74,
1996.
[0095] The term "expression vector" refers to a recombinant DNA
construct which is designed to express a selected gene of interest,
usually a protein, when properly inserted into the expression
vector. One skilled in the art understands the term. Expression
vectors commonly include a promotor at the 5' end of the site where
the gene of interest is inserted and a terminator region at 3' end
of the site. Frequently the gene of interest is inserted into the
appropriate site by means of selected restriction enzyme cleavage
sites. The term "expression vector" also refers to a DNA construct
such as described above into which the gene of interest encoding
the product of interest has already been inserted.
[0096] The term "baculovirus expression vector" refers to a DNA
construct which is designed to express a selected gene when used in
the baculovirus system. Any of the potential baculoviruses or
expression vectors designed to function in the baculovirus system
may be used in the instant invention. In a similar fashion, the
term "expression vector" is a genus which encompasses the
particular embodiment of baculovirus expression vectors, but
"expression vectors" may function in cells and cell lines aside
from, or in addition to, insect cell lines.
[0097] The term "allow the expression of" refers to placing an
expression vector into an environment in which the gene of interest
will be expressed. This commonly means inserting the expression
vector into an appropriate cell type where the promotor and other
regions necessary for gene expression will be recognized by the
host cell's components and will cause the expression of the gene of
interest. The expression normally consists of two steps:
transcription and translation. Expression can also be conducted in
vitro using components derived from cells. One skilled in the art
is familiar with these techniques, and such techniques are set
forth in Sambrook et al. (Sambrook, Fritsch, & Maniatis,
"Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring
Harbor Laboratory, 1989). In, the preferred embodiment, the
expressed product is a protein or polypeptide. In other, preferred
embodiments, the expressed product is V.sub.H/IgG.sub..gamma.1,
V.sub.L/C.sub.K, V.sub.L/C.sub..lamda., or
V.sub.L/IgG.sub..gamma.1.
[0098] The term "secretory signal sequence" refers to a peptide
sequence. When this sequence is translated in frame as a peptide
attached to the amino-terminal end of a polypeptide of choice, the
secretory signal sequence will cause the secretion of the
polypeptide of choice by interacting with the machinery of the host
cell. As part of the secretory process, this secretory signal
sequence will be cleaved off, leaving only the polypeptide of
interest after it has been exported. In preferred embodiments, the
honey bee melittin secretory signal sequence is employed. In other
preferred embodiments, the human placental alkaline phosphatase
secretory signal sequence is employed. The present invention is not
limited by these secretory signal sequences and others well known
to those skilled in the art may be substituted in place of, and in
addition to, these. The term "secretory signal sequence" also
refers to a nucleic acid sequence encoding the secretory
peptide.
[0099] The term "ELISA" refers to "Enzyme-Linked ImmunoSorbent
Assay" in which the presence or concentration of a protein is
determined by its binding to the plastic well of an ELISA plate
followed by its subsequent detection by antibodies specific for the
protein to be quantified or detected.
[0100] The term "promoter controls" refers to an arrangement of DNA
in an expression vector in which a promoter is placed 5' to a gene
of interest and causes the transcription of the DNA sequence into
an mRNA molecule. This mRNA molecule is then translated by the host
cell's machinery. One skilled in the art is very familiar with the
meaning of this term.
[0101] The terms "protein A," "protein G," and "protein L" refer to
specific bacterial proteins which are capable of specifically
binding immunoglobulin molecules without interacting with an
antigen binding site. Protein A is a polypeptide isolated from
Staphylococcus aureus that binds the Fc region of immunoglobulin
molecules. Protein G is a bacterial cell wall protein with affinity
for immunoglobulin G (IgG), which has been isolated from a human
group G streptococcal strain (G148). Protein L is an immunoglobulin
light chain-binding protein expressed by some strains of the
anaerobic bacterial species Peptostreptococcus magnus.
[0102] The term "B cell lymphoma" refers to a cancer that arises in
cells of the lymphatic system from B cells. B cells are white blood
cells that develop from bone marrow and produce antibodies. They
are also known as B lymphocytes.
[0103] The term "refractory low grade B cell lymphoma" refers to a
low grade B cell alymphoma that has not responded to treatment. The
term "low grade B cell lymphoma" refers to a lymphoma that tends to
grow and spread slowly, including follicular small cleaved cell
lymphoma. Also called indolent lymphomas due to their slow
growth.
[0104] The term "follicular B cell lymphoma" refers to a type of
non-Hodgkin's lymphoma. It is an indolent (slow-growing) type of
lymphoma.
[0105] Further definitions and characterizations of low-grade
lymphomas can be found on the Internet at
http://rituxan.com/professional/clinical_-information/class/index.html.
[0106] The term "isolating" as refers to a protein or polypeptide,
refers to removing a naturally occurring polypeptide or protein
from its normal cellular environment or refers to removing a
polypeptide or protein synthesized in an expression system (such as
the baculovirus system described herein) from the other components
of the expression system. Thus, the polypeptide sequence may be in
a cell-free solution or placed in a different cellular environment.
The term does not imply that the polypeptide sequence is the only
amino acid chain present, but that it is essentially free (about
90-95% pure at least) of non-amino acid-based material naturally
associated with it.
[0107] By the use of the term "enriched" in reference to a
polypeptide is meant that the specific amino acid sequence
constitutes a significantly higher fraction (2- to 5-fold) of the
total amino acid sequences present in the cells or solution of
interest than in normal or diseased cells or in the cells from
which, the sequence was taken. This could be caused by a person by
preferential reduction in the amount of other amino acid sequences
present, or by a preferential increase in the amount of the
specific amino acid sequence of interest, or by a combination of
the two. However, it should be noted that enriched does not imply
that there are no other amino acid sequences present, just that the
relative amount of the sequence of interest has been significantly
increased. The term significant here is used to indicate that the
level of increase is useful to the person making such an increase,
and generally means an increase relative to other amino acid
sequences of about at least 2-fold, more preferably at least 5- to
10-fold or even more. The term also does not imply that there is no
amino acid sequence from other sources. The other source of amino
acid sequences may, for example, comprise amino acid sequence
encoded by a yeast or bacterial genome, or a cloning vector such as
pUC19. In preferred embodiments, the amino acid sequence is a
chimeric protein as described above. The term is meant to cover
only those situations in which man has intervened to increase the
proportion of the desired amino acid sequence.
[0108] It is also advantageous for some purposes that an amino acid
sequence be in purified form. The term "purified" in reference to a
polypeptide does not require absolute purity (such as a homogeneous
preparation); instead, it represents an indication that the
sequence is relatively purer than in the natural environment.
Compared to the natural level this level should be at least 2- to
5-fold greater (e.g., in terms of mg/mL). Purification of at least
one order of magnitude, preferably two or three orders, and more
preferably four or five orders of magnitude is expressly
contemplated. The substance is preferably free of contamination at
a functionally significant level, for example 90%, 95%, or 99%
pure.
[0109] The term "operatively linked" refers to an arrangement of
DNA in which a controlling region, such as a promoter- or enhancer,
is attached to a connected DNA gene of interest so as to bring
about its transcription, and hence allowing its translation. The
term "operatively linked" may also refer to a DNA sequence encoding
a processing signal, such as a secretory signal sequence, connected
to a gene encoding a polypeptide to form a single open reading
frame. Following transcription and translation, the secretory
signal sequence has the potential to bring about the export of the
translated polypeptide. One skilled in the art is familiar with-the
meaning of this term.
[0110] Functional Derivatives of Useful Chimeric Proteins
[0111] Also provided herein are functional derivatives of a
polypeptide or nucleic acid of the invention. By "functional
derivative" is meant a "chemical derivative," "fragment," or
"variant," of the polypeptide or nucleic acid of the invention, as
these terms are defined below. A functional derivative retains at
least a portion of the function of the protein, for example,
reactivity with an antibody specific for the protein or binding
activity mediated through noncatalytic domains, which permits its
utility in accordance with the present invention. It is well known
in the art that due to the degeneracy of the genetic code numerous
different nucleic acid sequences can code for the same amino acid
sequence. Equally, it is also well known in the art that
conservative changes in amino acid can be made to arrive at a
protein or polypeptide that retains the functionality of the
original. In both cases, all permutations are intended to be
covered by this disclosure.
[0112] Included within the scope of this invention are the
functional equivalents of the herein-described isolated nucleic
acid molecules. The degeneracy of the genetic code permits
substitution of certain codons by other codons that specify the
same amino acid and hence would give rise to the same protein. The
nucleic acid sequence can vary substantially since, with the
exception of methionine and tryptophan, the known amino acids can
be coded for by more than one codon. Thus, portions or all of the
genes of the invention could be synthesized to give a nucleic acid
sequence significantly different from a sequence that is found in
nature. The encoded amino acid sequence thereof would, however, be
preserved.
[0113] A "chemical derivative" of the complex contains additional
chemical moieties not normally a part of the protein. Covalent
modifications of the protein or peptides are included within the
scope of this invention. Such modifications may be introduced into
the molecule by reacting targeted amino acid residues of the
peptide with an organic derivatizing agent that is capable of
reacting with selected side chains or terminal residues, as
described below. It may also consist of attaching carbohydrates to
the protein in addition to the normal carbohydrates attached by the
bacculovirus expression system of the invention.
[0114] Cysteinyl residues most commonly are reacted with
.alpha.-haloacetates (and corresponding amines), such as
chloroacetic acid or chloroacetamide, to give carboxymethyl or
carboxyamidomethyl derivatives. Cysteinyl residues also are
derivatized by reaction with bromotrifluoroacetone, chloroacetyl
phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl
2-pyridyl disulfide, p-chloromercuribenzoate,
2-chloromercuri-4-nitrophenol, or
chloro-7-nitrobenzo-2-oxa-1,3-diazole.
[0115] Histidyl residues are derivatized by reaction with
diethylprocarbonate at pH 5.5-7.0 because this agent is relatively
specific for the histidyl side chain. Para-bromophenacyl bromide
also is useful; the reaction is preferably performed in 0.1 M
sodium cacodylate at pH 6.0.
[0116] Lysinyl and amino terminal residues are reacted with
succinic or other carboxylic acid anhydrides. Derivatization with
these agents has the effect or reversing the charge of the lysinyl
residues. Other suitable reagents for derivatizing primary amine
containing residues include imidoesters such as methyl
picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride;
trinitrobenzenesulfonic acid; O-methylisourea; 2,4 pentanedione;
and transaminase-catalyzed reaction with glyoxylate.
[0117] Arginyl residues are modified by reaction with one or
several conventional reagents, among them phenylglyoxal,
2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin.
Derivatization of arginine residues requires that the reaction be
performed in alkaline conditions because of the high pK.sub.a of
the guanidine functional group. Furthermore, these reagents may
react with the groups of lysine as well as the arginine
.alpha.-amino group.
[0118] Tyrosyl residues are well-known targets of modification for
introduction of spectral labels by reaction with aromatic diazonium
compounds or tetranitromethane. Most commonly, N-acetylimidizol and
tetranitromethane are used to form 0-acetyl tyrosyl species and
3-nitro derivatives, respectively.
[0119] Carboxyl side groups (aspartyl or glutamyl) are selectively
modified by reaction with carbodiimide (R'--N--C--N--R') such as
1-cyclohexyl-3-(2-morpholinyl(4-ethyl) carbodiimide or
1-ethyl-3-(4-azonia-4,4-dimethyipentyl) carbodiimide. Furthermore,
aspartyl and glutamyl residues are converted to asparaginyl and
glutaminyl residues by reaction with ammonium ions.
[0120] Glutaminyl and asparaginyl residues are frequently
deamidated to the corresponding glutarnyl and aspartyl residues.
Alternatively, these residues are deamidated under mildly acidic
conditions; Either form of these residues falls within the scope of
this invention.
[0121] Other modifications include the in vitro glycosylation of
polypeptides or proteins.
[0122] Derivatization with bifunctional agents is useful, for
example, for cross-linking the component peptides of the protein to
each other or to other proteins in a complex to a water-insoluble
support matrix or to other macromolecular carriers. Commonly used
cross-linking agents include, for example,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), and bifunctional maleimides
such as bis-N-maleimido-1,8-octane. Derivatizing agents such as
methyl-3-[p-azidophenyl]dithiolpropioimidate yield photoactivatable
intermediates that are capable of forming crosslinks in the
presence of light. Alternatively, reactive water-insoluble matrices
such as cyanogen bromide-activated carbohydrates and the reactive
substrates described in U.S. Pat. Nos. 3,969,287; 3,691,016;
4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for
protein immobilization.
[0123] Other modifications include hydroxylation of proline and
lysine, phosphorylation of hydroxyl groups of seryl or threonyl
residues, methylation of the .alpha.-amino groups of lysine,
arginine, and histidine side chains (Creighton, T. E., Proteins:
Structure and Molecular Properties, W.H. Freeman & Co., San
Francisco, pp. 79-86, 1983), acetylation of the N-terminal amine,
and, in some instances, amidation of the C-terminal carboxyl
groups.
[0124] Such derivatized moieties may improve the stability,
solubility, absorption, biological half life, and the like. The
moieties may alternatively eliminate or attenuate any undesirable
side effect of the protein complex and the like. Moieties capable
of mediating such effects are disclosed, for example, in
Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co.,
Easton, Pa. (1990).
[0125] A functional derivative of a protein with deleted, inserted
and/or substituted amino acid residues may be prepared using
standard techniques well-known to those of ordinary skill in the
art. For example, the modified components of the functional
derivatives may be produced using site-directed mutagenesis
techniques (as exemplified by Adelman et al., DNA 2:183, 1983)
wherein nucleotides in the DNA coding the sequence are modified
such that a modified coding sequence is modified, and thereafter
expressing this recombinant DNA in a prokaryotic or eukaryotic host
cell, using techniques such as those described above.
Alternatively, proteins with amino acid deletions, insertions
and/or substitutions may be conveniently prepared by direct
chemical synthesis, using methods well-known in the art. The
functional derivatives of the proteins typically exhibit the same
qualitative biological activity as the native proteins.
Uses of the Chimeric Proteins of the Invention
[0126] Other aspects of the invention relate to uses for the
instant chimeric proteins. Preferred uses include pharmaceutical
and veterinary applications, wherein an effective amount of
chimeric protein according to the invention (preferably in a
composition according hereto) is administered to a patient. In this
way, the chimeric protein contacts cells of the patient, which
contacting thereafter elicits the desired biological response.
Methods for using the instant chimeric proteins include methods of
eliciting an immune response in an organism, methods of raising
antibodies (B cell immune response) in an organism, methods of
inducing a T cell immune response by an organism, and methods for
treating B cell pathologies. The invention also includes methods
for treatment of subjects in order to increase the immune response
capable of altering a B cell pathology by administering a chimeric
protein of the invention.
[0127] Typically, such methods are accomplished by delivering to
the organism an effective amount of a chimeric protein according to
the invention. "Effective amount" refers to an amount that results
in the desired biological response being elicited. What constitutes
such an amount will vary, and depends on a variety of factors,
including the particular chimeric protein, the desired biological
response to be elicited, the formulation of the chimeric protein,
the age, weight, gender, and health of the organism to be treated,
the dosage regimen, the condition or disease to be treated or
prevented, etc. Organisms to which the instant chimeric proteins
and compositions may be administered include mammals, preferably a
mammal selected from the group consisting of a bovine, canine,
equine, feline, ovine, porcine, and primate animal. Particularly
preferred organisms are humans.
[0128] The compounds described herein can be administered to a
human patient per se, or in pharmaceutical compositions where it is
mixed with other active ingredients, as in combination therapy, or
suitable carriers or excipient(s). Techniques for formulation and
administration of the compounds of the instant application may be
found in "Remington's Pharmaceutical Sciences," Mack Publishing
Co., Easton, Pa., latest edition.
[0129] 1. Routes of Administration.
[0130] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, or intestinal administration;
parenteral delivery, including intramuscular, subcutaneous,
intravenous, intramedullary injections, as well as intrathecal,
direct intraventricular, intraperitoneal, intranasal, or
intraocular injections. One of skill in the art will understand the
various modifications that would be made to adapt the composition
to a particular route of administration.
[0131] Alternately, one may administer the compound in a local
rather than systemic manner, for example, via injection of the
compound directly-into a solid tumor, often in a depot or sustained
release formulation.
[0132] 2. Composition/Formulation.
[0133] The pharmaceutical compositions of the present invention may
be manufactured in a manner that is itself known, e.g., by means of
conventional mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or lyophilizing
processes.
[0134] Pharmaceutical compositions for use in accordance with the
present invention thus may be formulated in conventional manner
using one or more physiologically acceptable carriers comprising
excipients and auxiliaries which facilitate processing of the
active compounds into preparations which can be used
pharmaceutically. Proper formulation is dependent upon the route of
administration chosen.
[0135] For injection, the agents of the invention may be formulated
in aqueous solutions, preferably in physiologically compatible
buffers such as Hanks' solution, Ringer's solution, or
physiological saline buffer. For transmucosal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the
art.
[0136] For oral administration, the compounds can be formulated
readily by combining the active compounds with pharmaceutically
acceptable carriers well known in the art. Such carriers enable the
compounds of the invention to be formulated as tablets, pills,
dragees, capsules, liquids, gels, syrups, slurries, suspensions and
the like, for oral ingestion by a patient to be treated. Suitable
carriers include excipients such as, fillers such as sugars,
including lactose, sucrose, mannitol, or sorbitol; cellulose
preparations such as, for example, maize starch, wheat starch, rice
starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate.
[0137] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0138] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. All formulations for oral administration
should be in dosages suitable for such administration.
[0139] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0140] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0141] The compounds may be formulated for parenteral
administration by injection, e.g., by bolus injection or continuous
infusion. Formulations for injection may be presented in unit
dosage form, e.g., in ampoules or in multi-dose containers, with an
added preservative. The compositions may take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain formulatory agents such as suspending, stabilizing
and/or dispersing agents.
[0142] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0143] Alternatively, the active ingredient may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0144] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compounds may be formulated with
suitable polymeric or hydrophobic materials (for example, as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt.
[0145] A pharmaceutical carrier for the hydrophobic compounds of
the invention is a cosolvent system comprising benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. The cosolvent system may be the VPD co-solvent
system. VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant polysorbate 80, and 65% w/v polyethylene glycol
300, made up to volume in absolute ethanol. The VPD co-solvent
system (VPD:D5W) consists of VPD diluted 1:1 with a 5% dextrose in
water solution. This co-solvent system dissolves hydrophobic
compounds well, and itself produces low toxicity upon systemic
administration. Naturally, the proportions of a co-solvent system
may be varied considerably without destroying its solubility and
toxicity characteristics. Furthermore, the identity of the
co-solvent components may be varied: for example, other
low-toxicity nonpolar surfactants may be used instead of
polysorbate 80; the fraction size of polyethylene glycol may be
varied; other biocompatible polymers may replace polyethylene
glycol, e.g., polyvinyl pyrrolidone; and other sugars or
polysaccharides may substitute for dextrose.
[0146] Alternatively, other delivery systems for compositions may
be employed. Liposomes and emulsions are well known examples of
delivery vehicles or carriers for hydrophobic drugs. Certain
organic solvents such as dimethylsulfoxide also may be employed,
although usually at the cost of greater toxicity. Additionally, the
compounds may be delivered using a sustained-release system, such
as semipermeable matrices of solid hydrophobic polymers containing
the therapeutic agent. Various sustained-release materials have
been established and are well known by those skilled in the art.
Sustained-release capsules may, depending on their chemical nature,
release the compounds for a few weeks up to over 100 days.
Depending on the chemical nature and the biological stability of
the therapeutic reagent, additional strategies for protein
stabilization may be employed.
[0147] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0148] Many of the compounds of the invention may be provided as
salts with pharmaceutically compatible counterions.
Pharmaceutically compatible salts may be formed with many acids,
including but not limited to hydrochloric, sulfuric, acetic,
lactic, tartaric, malic, succinic, etc. Salts tend to be more
soluble in aqueous or other protonic solvents that are the
corresponding free base forms.
[0149] 3. Effective Dosage.
[0150] Pharmaceutical compositions suitable for use in the present
invention include compositions where the active ingredients are
contained in an amount effective to achieve its intended purpose.
More specifically, a therapeutically effective amount means an
amount of compound effective to prevent, alleviate or ameliorate
symptoms of disease or prolong the survival of the subject being
treated. Determination of a therapeutically effective amount is
well within the capability of those skilled in the art, especially
in light of the detailed disclosure provided herein.
[0151] Toxicity and therapeutic efficacy of the compounds described
herein can be determined by standard pharmaceutical procedures in
cell cultures or experimental animals, e.g., for determining the
LD.sub.50 (the dose lethal to 50% of the population) and the
ED.sub.50 (the dose therapeutically effective in 50% of the
population). The dose ratio between toxic and therapeutic effects
is the therapeutic index and it can be expressed as the ratio
between LD.sub.50 and ED.sub.50. Compounds which exhibit high
therapeutic indices are preferred. The data obtained from these
cell culture assays and animal studies can be used in formulating a
range of dosage for use in human. The dosage of such compounds lies
preferably within a range of circulating concentrations that
include the ED.sub.50 with little or no toxicity. The dosage may
vary within this range depending upon the dosage form employed and
the route of administration utilized. The exact formulation, route
of administration and dosage can be chosen by the individual
physician in view of the patient's condition. (See e.g., Fingl et
al., "The Pharmacological Basis of Therapeutics," Ch. 1 p. 1,
1975).
[0152] Dosage amount and interval may be adjusted individually to
provide plasma levels of the active moiety which are sufficient to
maintain the required effect, or minimal effective concentration
(MEC). The MEC will vary for each compound. Dosages necessary to
achieve the MEC will depend on individual characteristics and route
of administration. However, HPLC assays or bioassays can be used to
determine plasma concentrations.
[0153] Dosage intervals can also be determined using MEC value.
Compounds should be administered using a regimen which maintains
plasma levels above the MEC for 10-90% of the time, preferably
between 30-90% and most preferably between 50-90%.
[0154] In cases of local administration or selective uptake, the
effective local concentration of the drug may not be related to
plasma concentration.
[0155] The amount of composition administered will, of course, be
dependent on the subject being treated, on the subject's weight,
the severity of the affliction, the manner of administration and
the judgment of the prescribing physician.
[0156] 4. Packaging.
[0157] The compositions may, if desired, be presented in a pack or
dispenser device which may contain one or more unit dosage forms
containing the active ingredient. The pack may for example comprise
metal or plastic foil, such as a blister pack. The pack or
dispenser device may be accompanied by instructions for
administration. The pack or dispenser may also be accompanied with
a notice associated with the container in form prescribed by a
governmental agency regulating the manufacture, use, or sale of
pharmaceuticals, which notice is reflective of approval by the
agency of the form of the polynucleotide for human or veterinary
administration. Such notice, for example, may be the labeling
approved by the U.S. Food and Drug Administration for prescription
drugs, or the approved product insert. Compositions comprising a
compound of the invention formulated in a compatible pharmaceutical
carrier may also be prepared, placed in an appropriate container,
and labeled for treatment of an indicated condition. Suitable
conditions indicated on the label may include treatment of a tumor,
treatment of rheumatoid arthritis, treatment of diabetes, and the
like.
EXAMPLES
[0158] In the following description, reference will be made to
various methodologies known to those skilled in the art of
immunology, cell biology, and molecular biology. Publications and
other materials setting forth such known methodologies to which
reference is made are incorporated herein by reference in their
entireties as though set forth in full.
[0159] 1. Tissue Processing for Non-Hodgkin's Lymphoma Idiotype
[0160] (ID) Identification and Cloning:
[0161] Tumor samples from a peripheral lymph node were biopsied as
clinically indicated under sterile conditions and used to generate
patient idiotype-specific recombinant chimeric immunoglobulin
proteins. Remaining lymph node biopsy material was stored in liquid
nitrogen in tissue cell bank for future use.
[0162] a. Cell Isolation: Single cell suspensions of patient lymph
node biopsies were obtained by forcing the biopsied lymphoma tissue
through a disposable 0.38 mm steel mesh screen while submerged in
sterile PBS. The dispersed cells were washed twice in PBS, then
resuspended and counted. A 10% fraction of the cells were processed
for total RNA extraction and the remaining cells were archived in
liquid nitrogen following resuspension in RPMI 1640 tissue culture
media containing 30% (v/v) fetal bovine serum and 10% (v/v) DMSO.
All processing of clinical samples was performed in a biological
safety cabinet.
[0163] b. Total RNA Preparation: Total RNA from homogenized lymph
node cells was isolated using RNeasy Kit (Qiagen) as per
manufacturer's instruction. Total RNA was quantitated by
spectrophotometry.
[0164] c. cDNA Synthesis: Approximately 2.0 .mu.g total RNA was
used as template for first strand cDNA synthesis using the
SuperScript Preamplification System (GIBCO-BRL) according to
manufacturer's recommendation. Oligo (dT) provided with the kit was
used to prime the cDNA.
[0165] d. PCR Amplification of Genes Encoding Lymphoma Heavy and
Light Chains: Both heavy and light chains from the
lymphoma-specific immunoglobulins were identified as follows.
Aliquots of the single stranded lymphoma cDNA were combined with a
series of V.sub.H and V.sub.L leader sequence-specific
oligonucleotide sense primers representing all known V.sub.H,
V.sub.K, and V.sub.2, subfamilies as listed in Table 1, paired with
IgM, IgG, IgA, or Ig.sub.K and Ig.sub..lamda. constant region
specific antisense primers. These samples were then amplified by
PCR and analyzed by agarose gel electrophoresis.
[0166] Parallel reactions were conducted using cDNA prepared from
the patient's peripheral blood lymphocytes. A comparison of PCR
products generated by each pair of primers derived from samples
containing normal PBL or lymph node biopsy cDNA would lead to the
identification of the candidate tumor specific V.sub.H and V.sub.K
or V.sub..lamda. subfamily over-represented in the lymphoma, and
the isotype of the heavy and light chains. Candidate tumor V region
gene products were then excised, and their nucleic acid sequence
was determined to assess clonality. For each patient, two
independent analyses were performed from starting cellular
fractions.
[0167] One microliter of the cDNA reaction (representing 5% of the
total cDNA reaction volume) was amplified for 35 cycles in 50 .mu.l
volume using the HotStarTaq Master Mix Kit (Qiagen). Cycling
conditions: 95.degree. C. 15 min, 65.degree. C. 4 min, 72.degree.
C. 1 min, followed by 94.degree. C. 1 min, 61.degree. C. 30 sec,
72.degree. C. 1 min for 34 cycles; and a final extension step at
72.degree. C. for 7 min. A 10 .mu.l aliquot of each reaction is
analyzed by electrophoresis on a 1% agarose gel with ethidium
bromide.
TABLE-US-00001 TABLE 1 Primer Sequences Used for Amplification of
Lymphoma Heavy and Light Chains '(GA)' means either a G or an A,
'(TC)' means either a T or a C. PRIMER NAME PRIMER SEQUENCE (5' 3')
491 V.sub.H1 L TCACCATGGACTGGACCTGGAG SEQ ID NO: 38 492 V.sub.H2L.1
ACCATGGACATACTTTGTTCCACGC SEQ ID NO: 39 493 V.sub.H2L.2
ACCATGGACACACTTTGCTCCACGC SEQ ID NO: 40 494 V.sub.H3L.1
ACCATGGAGTTTGGGCTGAGCTG SEQ ID NO: 41 495 V.sub.H3L.2
ACCATGGAACTGGGGCTCCGCTG SEQ ID NO: 42 496 V.sub.H4L
AAGAACATGAAACACCTGTGGTTCTTC SEQ ID NO: 43 497 V.sub.H5L
ATCATGGGGTCAACCGCCATCCT SEQ ID NO: 44 498 V.sub.H6L
ACAATGTCTGTCTCCTTCCTCATC SEQ ID NO: 45 516 V.sub.K1L
ACATGAGGGTCCCCGCTCAGC SEQ ID NO: 46 517 V.sub.K2L
TCAGCTCCTGGGGCTGCTAATG SEQ ID NO: 47 515 V.sub.K3L
CTTCCTCCTGCTACTCTGGCTC SEQ ID NO: 48 518 V.sub.K4L
GCAGACCCAGGTCTTCATTTCTC SEQ ID NO: 49 519 V.sub.K5L
CCAGGTTCACCTCCTCAGCTTC SEQ ID NO: 50 520 V.sub.K6L
GGTTTCTGCTGCTCTGGGTTCC SEQ ID NO: 51 522 V.sub..lamda.1L
TCACTG(TC)(GA)CAGGGTCCTGGGC SEQ ID NO: 52 523 V.sub..lamda.2L
ACTCAGG(GA)CACAGG(GA)TCCTGG SEQ ID NO: 53 524 V.sub..lamda.3.1
TTGCTTACTGCACAGGATCCGTG SEQ ID NO: 54 525 V.sub..lamda.3L.2
CTTGCTCACTTTACAGGTTCTGTG SEQ ID NO: 55 526 V.sub..lamda.3L.3
CTCACTCTTTGCATAGGTTCTGTG SEQ ID NO: 56 527 V.sub..lamda.3L.4
TCAACCTCTACACAGGCTCTATTG SEQ ID NO: 57 528 V.sub..lamda.3L.5
CTCACTCTCTGCACAG(GT)CTCTG(AT)G SEQ ID NO: 58 529 V.sub..lamda.4.L1
CATTTTCTCCACAGGTCTCTGTGC SEQ ID NO: 59 530 V.sub..lamda.4L.2
CCTCCACTG(GC)ACAGGGTCTCTC SEQ ID NO: 60 531 V.sub..lamda.5L
CTCTCACTGCACAGGTTCCCTC SEQ ID NO: 61 532 V.sub..lamda.6L
CGCTCACTGCACAGGTTCTTGG SEQ ID NO: 62 533 V.sub..lamda.7L
CTTGCTGCCCAGGGTCCAATTC SEQ ID NO: 63 534 V.sub..lamda.8L
TGCTTATGGATCAGGAGTGGATTC SEQ ID NO: 64 535 V.sub..lamda.9L
CAGTCTCCTCACAGGGTCCCTC SEQ ID NO: 65 536 V.sub..lamda.10L
TCACTCACTCTGCAGTGTCAGTG SEQ ID NO: 66 IgG Constant-E
CTGAGTTCCACGACACCGTCAC SEQ ID NO: 69 IgM Constant-E
GGGAATTCTCACAGGAGACGAGG SEQ ID NO: 70 C.sub.K-E
TTGGAGGGCGTTATCCACCTTC SEQ ID NO: 71 C.sub..lamda.-E
GAAGTCACTTATGAGACACACCAG SEQ ID NO: 72 IgG Constant-I
GGAAGTAGTCCTTGACCAGGCAG SEQ ID NO: 73 IgM Constant-I
GGGAAAAGGGTTGGGCCCGATGCAC SEQ ID NO: 74 C.sub.K-I
GGGAAAAGGGTTGGGCCCGATGCAC SEQ ID NO: 75 C.sub..lamda.-I
GGAACAGAGTGACACTGGGTGCAGCCTTGGGCTG SEQ ID NO: 76 C.lamda.
Downstream TGCCGTCGGCAGGAGGTATTTCATTATGACTG
TCTCCTTGCTATTATGAACATTCTGTAGGGG-C CA SEQ ID NO: 77 C.lamda.-5'
GTCAGCCCAAGGCTGCACCCAGTGTCACTCTGTTCC SEQ ID NO: 78 C.lamda.-3'
CGTATCAAGCTTTTACTATGAACATTCTGTAGGGGCCAC SEQ ID NO: 79 .lamda.-stuff
1 CCTTTGATAACACCCA SEQ ID NO: 80 .lamda.-stuff 1' GTGTTATCAAAGG SEQ
ID NO: 81 .gamma.1-stuff 1 5'CTAGTTTGATAAGGGCC3' SEQ ID NO: 82
.gamma.1-stuff 1' 5'CTTATCAAA3' SEQ ID NO: 83 K-Stuff 1
5'-CCTTTGATAACACCAA3' SEQ ID NO: 84 K-Stuff 1' 5'--3' SEQ ID NO:
85
[0168] e. Cloning and Sequencing of PCR Products: PCR products from
reactions determined-to contain the tumor specific variable
sequences for heavy and light chains were cloned directly into
plasmid pCR2.1-tOPO as per manufacturer's recommendations, and
introduced into Top 10 competent E. coli cells (Invitrogen). Twenty
four miniprep DNA plasmids were prepared from carbenicillin
resistant bacterial colonies using the QIAprep Spin Miniprep Kit
(Qiagen), and quantitated by spectrophotometry. Two hundred ng of
each plasmid was sequenced using the Cy5/Cy5.5 Dye Primer Cycle
Sequencing Kit (Visible Genetics). Following the completion of the
sequencing reactions, samples were electrophoresed on the OpenGene
Automated DNA Sequencing System and the data was processed with
GeneObjects software package (Visible Genetics). Additional
analysis including sequence alignments were performed using the
SEQUENCHER Version 4.1.2 DNA analysis software. (GENE Codes Corp.).
A V-region derived sequence could be considered tumor specific if
it was present in 75% of the samples, for example, if 18 or greater
of the 24 form a consensus group when analyzed using the above
software utilizing the default parameters. Two independent biopsy
samples would be compared when available.
[0169] f. cDNA Synthesis and Generation of 5' RACE Products: Due to
the occurrence of mutations in the V.sub.H and V.sub.L sequences,
it is not possible at times to identify tumor-specific
immunoglobulin rearrangements. As an alternative to the
sequence-specific PCR strategy supra, one can employ a 5' RACE PCR
strategy to identify tumor specific immunoglobulin (Ig)
rearrangements. All steps for first strand cDNA synthesis to the
generation of Ig specific PCR products are performed according to
manufacturer's directions (5' RACE system for Rapid Amplification
of cDNA Ends, version 2.0, Gibco BRL), with slight modification.
Approximately 2.5 .mu.g of total RNA is used as template for each
first strand cDNA synthesis in the presence of specific antisense
primers complimentary to the immunoglobulin heavy and the light
chains' constant region utilized by the B cell population of
interest (SEQ ID NO:69 for IgG, SEQ ID NO:70 for IgM, SEQ ID NO:71
for C.sub.K, and SEQ ID NO:72 for C.sub..lamda.). The cDNA
reactions are purified over GlassMAX spin cartridges, generating a
final volume of 50 .mu.l each. A 10 .mu.l aliquot of each purified
cDNA is oligo(dC) tailed with terminal deoxynucleotidyl transferase
in a 25 .mu.l volume, generating the templates to be used for
subsequent PCR reactions. The PCR set up utilizes an upstream
primer containing a poly(G) track provided by the manufacturer and
an Ig specific antisense primer interior to that used for cDNA
first strand synthesis (SEQ ID NO:73 for IgG, SEQ ID NO:74 for IgM,
SEQ ID NO:75 for C.sub.K, and SEQ ID NO:76 for C.sub..lamda.). Five
.mu.l of template is amplified in a 50 ..mu.l volume as follows:
95.degree. C. for 15 min, 55.degree. C. for 4 min, 72.degree. C.
for 1 min, followed by 94.degree. C. for 1 min, 55.degree. C. for
30 sec, 72.degree. C. for 1 min for 34 cycles, and a final
extension step at 72.degree. C. for 7 min. The final PCR products
are separated by electrophoresis on a 1% agarose gel with ethidium
bromide and the band of the appropriate size (.about.500-600 bp) is
isolated are cloned into the pCR2.1-TOPO plasmid as described in
1e, supra.
[0170] 2. Construction of Baculovirus Expression Vectors
pTRABacHuLC.sub.KHC.sub..gamma.1 and
pTRABacHuLC.sub..lamda.HC.sub-.gamma.1.
[0171] a. Cloning of Secretory Signal Sequences into p2Bac: The
base vector for the pTRABacHuLC.sub.KHC.sub..gamma.1 and
pTRABacHuLC.sub..lamda.HC.sub..gamma.1 constructs was p2Bac (FIG.
2, SEQ ID NO:5, Invitrogen, Carlsbad, Calif.). Two secretory signal
sequences were cloned into this base vector, and the first
intermediate baculovirus expression vector p2BacM was created. In
general, the vector p2Bac was first modified utilizing
complimentary oligonucleotides encoding the amino terminal domain
of the honey bee melittin secretory signal sequence positioned to
be under transcriptional control of the baculoviral AcNPV P10
promoter. For melittin sequence cloning, 2 .mu.g p2Bac was digested
with Not I and Spe I for 4 hours at 37.degree. C. The linear vector
was purified following electrophoresis through a 1% agarose gel
using Qiaex II resin (Qiagen, Chatsworth, Calif.). The purified DNA
was then eluted with 50 .mu.l water and the DNA concentration was
determined. One fig each of primers Me1S/N (SEQ ID NO:15) and
Me1N/S (SEQ ID NO: 16) were mixed in 10 .mu.l digestion buffer M
(Roche Molecular Biochemicals, Indianapolis, Ind.), and heated to
70.degree. C. for 5 min, then cooled to room temperature to anneal
complimentary primers. Ten percent of the annealed primers was
digested in 20 .mu.l reaction with Not I and Spe I for 4 hours at
37.degree. C., and the digested primers were purified following
electrophoresis through a 15% polyacrylamide gel with Qiaex H
resin, and the concentration of the DNA for annealed primers was
determined. The DNAs of p2Bac vector and annealed melittin fragment
were ligated at 1:10 vector to insert ratio. The ligation product
was transformed using competent XL1-Blue E. coli (Stratagene, San
Diego, Calif.) and plated on a LB-carbenicillin agar plate for
overnight growing at 37.degree. C. Miniprep colonies were prepared
by standard protocols, and the plasmids were sequenced to check the
construction. The resulting vector p2BacM contained the melittin
secretory signal sequence.
[0172] The p2BacM vector was further modified similarly to encode
for the amino terminal domain of the human placental alkaline
phosphatase secretory signal sequence under transcriptional control
of the AcNPV polyhedron promoter, creating a second intermediate
baculovirus expression vector p2BacMA. The procedure used to
introduce the alkaline phosphatase sequence was generally cloned as
follows: 2 .mu.g p2BacM plasmid was digested with Bam HI and Eco
RI, the linear vector was gel purified from agarose gel with Qiaex
II resin and eluted in 50 H1 water. The DNA concentration of the
vector was determined. One jig each of primers APB/E (SEQ ID NO:
17) and APE/B (SEQ ID NO: 18) were mixed in 10 .mu.l digestion
buffer M, and heated to 70.degree. C. for 5 min and then cooled
down to room temperature to anneal complimentary primers. Ten
percent of the annealed primers was digested in a 20 .mu.l reaction
with Bam HI and Eco RI for 4 hours at 37.degree. C. The digested
primers were then purified from 15% polyacrylamide gel with Qiaex
II resin. The DNA concentration of the digested primers was also
determined. The linear p2BacM vector and alkaline phosphatase
fragment were then ligated at 1:10 vector to insert ratio, and the
ligation product was transformed using competent XL1-Blue E. coli
and plated on a LB-carbenicillin agar plate for overnight growing
at 37.degree. C. Miniprep colonies were prepared and the plasmids
were sequenced to check the construction. The resulting
intermediate vector p2BacMA would contain a secretory signal
sequence for a human placental alkaline phosphatase. The p2BacMA
plasmid was further transformed into SCS-110 E. coli strain
(Stratagene) lacking dcm methylase activity for subsequent cloning
of the K constant region into methyl-sensitive Stu I site.
[0173] b. Amplification and Cloning of Constant Regions of
IFG.sub..gamma.1 and Light Chains: The human kappa (K) constant and
the human IgG.sub..gamma.1 constant domains of human monoclonal
antibody 9F12 were PCR amplified from RNA extracted from the human
cell line 9F12 (ATCC#HB8177). The K constant region was cloned
behind the alkaline phosphatase signal sequence. The
IgG.sub..gamma.1 constant region was inserted downstream from the
melittin secretory signal sequence thus creating the vector
(pTRABacHuLC.sub.KHC.sub..gamma.1, FIG. 5a). A vector containing
the human lambda (.lamda.) light chain constant region
(pTRABacHuLC.sub..lamda.HC.sub..gamma.1, FIG. 5b) was produced by
replacing the K light chain constant region with a .lamda. light
chain constant region. The light chains were isolated by RT-PCR
from a chronic lymphocytic leukemia cellular RNA preparation. The
detailed description of the cloning procedures are as follows.
[0174] c. Amplification of 9F12 K and IgG.gamma.1 constant region
fragments: Total RNA from 9F12 cells (ATCC#HB8177) was extracted
using the RNeasy Kit (Qiagen) as per the manufacturer's
instruction. A single stranded cDNA was synthesized using
SuperScript reverse transcriptase (GIBCO BRL, Rockville, Md.) with
oligo(dT) primers. One twentieth of the synthesized single strand
cDNA was amplified in 100 .mu.l PCR reactions with Expand High
Fidelity Taq (Roche) using K and IgG.sub..gamma.1 specific
oligonucleotides (SEQ ID NO:21 plus SEQ ID NO:22 and SEQ ID NO:19
plus SEQ ID NO:20, respectively). The fragments from amplified 9F12
immunoglobulin were purified from 1.5% SeaKem agarose with Qiaex II
resin and eluted with 50 .mu.l water. The DNA concentrations for
the fragments were determined. The purified 9F12 immunoglobulin
fragments were ligated separately into the TA-II (Invitrogen) PCR
cloning vector. The ligation products were transformed using
competent XL1-Blue E. coli and plated on a LB-carbenicillin agar
plate for overnight growing at 37.degree. C. Miniprep colonies were
prepared and the plasmid DNA was sequenced.
[0175] d. Insertion of the 9F12 K Constant Region into the
Expression Vector: For K constant domain, 5 .mu.g plasmid DNA
containing a K constant region and 2 .mu.g of DNA for the vector
p2BacMA purified from SCS 110 E. coli were digested with Stu I and
Hind III. A 320 bp fragment containing K constant region and a 7.1
kb fragment containing p2BacMA vector were gel purified with Quiex
II and eluted in 50 .mu.l water. The DNA concentrations for both
fragments were determined. The purified fragments were then ligated
with Rapid Ligation Kit (Roche). The ligation products were
transformed using competent XL1-Blue E. coli and plated on a
LB-carbenicillin agar plate for overnight growing at 37.degree. C.
Miniprep bacterial colonies were prepared and the recombinant DNA
was sequenced to verify proper K constant region insertion. The
resulting plasmid vector was pTRABacLC.sub.K.
[0176] e. Addition of the IgG.sub..gamma.1 Constant Domain to the
Vector: The IgG.sub..gamma.1 constant domain was added to the
vector by first digesting 5 .mu.g of plasmid DNA containing
IgG.sub..gamma.1 constant region and 2 .mu.g plasmid DNA for the
vector pTRABacLC.sub.K with Spe I and Xba I. A 1 kb fragment of
IgG.sub..gamma.1 constant region and a 7.4 kb fragment of
pTkAacLC.sub.K vector were gel purified from agarose plugs with
Quiex II and eluted in 50 .mu.l water. The DNA concentrations for
both fragments were determined. The purified fragments were then
ligated with Rapid Ligation Kit (Roche). The ligation products were
transformed using competent XL1-Blue E. coli and plated on a
LB-carbenicillin agar plate for overnight growing at 37.degree. C.
Miniprep colonies were prepared and the ligation and orientation of
the IgG.sub..gamma.1 insertion were determined by restriction
analysis and sequencing of the restriction sites. The resulting
recombinant vector was pTRABacHuLC.sub.KHC.sub..gamma.1.
[0177] This plasmid, pTRABacHuLC.sub.KHC.sub..gamma.1 was further
refined to add translational stop codons between the melittin
secretory sequence, and the C.sub..gamma.1 region sequence and the
alkaline phosphatase secretory sequence and the C.sub.K region
sequence, respectively. To accomplish these modifications, the
pTRABacHuLC.sub.KHC.sub..gamma.1 vector was linearized following
digestion with Spe I.+Apa I. The linearized vector was then ligated
with annealed complimentary primers .gamma.1-stuff 1 (SEQ ID NO:82)
and .gamma.1-stuff 1' (SEQ ID NO:83) to introduce the in-frame stop
codons. The vector resulting from this modification was
subsequently linearized following digestion with Stu I (AGGCCT)+Dra
III (CACnnnGTG) and then ligated with annealed complimentary
primers K-stuff 1 (SEQ ID No. 84) and K-stuff 1' (SEQ ID NO:81) to
introduce the in-frame stop codons. The net effect of these
modifications are indicated in the sequences shown in FIGS. 6C
& 6D, respectively. (The added sequences are highlighted by a
double underline and bold.) f. Addition of the .lamda. Constant
Region to the Vectors: Total RNA from purified peripheral blood
lymphocytes (PBL) obtained from a chronic lymphocytic leukemia
(CLL) patient displaying a .lamda. light chain idiotype was
extracted using the RNeasy kit (Qiagen). Approximately 2.0 .mu.g
total RNA was used as template for first strand cDNA synthesis
using the SuperScript Preamplification System (Gibco BRL) according
to manufacturer's recommendation. Oligo(dT) was used for priming.
One twentieth of the synthesized single stranded cDNA was amplified
in a PCR reaction using an upstream primer identical to a portion
of the V.lamda. signal sequence (SEQ ID NO:54) and a downstream
primer (SEQ ID NO:77) complimentary to the last several codons of
the constant region as well as a portion of the 3' untranslated
region. The PCR products were cloned into the pCRII vector
(Invitrogen) and sequenced to confirm identity. A plasmid
containing the correct .lamda. constant region sequence was chosen
as a template for a second PCR. In this reaction a sense
oligonucleotide, C.lamda.-5' (SEQ ID NO:78), containing an
engineered Dra III restriction site, corresponding the sequence in
the A constant region immediately downstream of J.lamda. and a Hind
III containing antisense oligonucleotide primer, C.lamda.-3' (SEQ
ID NO:79) spanning the STOP codon immediately following the .lamda.
constant region were utilized. The resulting PCR product was cloned
into the pCR2.1-TOPO vector and sequenced. A fragment containing
the .lamda. constant region sequence was released upon Hind III
restriction from some of the plasmids, depending on orientation of
the insert. This restriction fragment was gel isolated and cloned
into pTRABacHuLCKHC.gamma.1 (FIG. 5A), following linearization
following Hind III digestion, generating an intermediate plasmid
containing both the .lamda. and K constant regions. Restriction of
this plasmid with Stu I and Dra III resulted in the removal of the
K sequences. This linearized plasmid was then ligated with annealed
complimentary primers .lamda.-stuff 1 (SEQ ID NO:80) and
.lamda.-stuff 1' to generate the final version of
pTRABacHuLC.lamda.HC.gamma.1 (FIG. 5B).
[0178] 3. Insertion of Genes for Patient-Derived Idiotype V.sub.H
ND/or V.sub.L Regions into an Expression Vector
[0179] Using either pTRABacHuLC.sub.KHC.sub..gamma.1 or
pTRABacHuLC.sub..lamda.HC.sub..gamma.1, it was possible to insert
genes for any V.sub.L region containing the unique cloning
sequences Stu I and Dra III between the alkaline phosphatase signal
sequence and the K or .lamda. constant region, and genes for any
V.sub.H region containing the unique cloning sequences Spe I and
Apa I between the melittin secretory signal sequence and the
IgG.sub..gamma.1 constant region (See FIGS. 5A and 5B). The
resulting expression vector could then be utilized for transduction
into Spodoptera frugiperda (Sf-9) insect cells to produce
recombinant budded baculovirus. The recombinant baculovirus was
then serially amplified in Sf-9 cells to produce a high titer
recombinant baculovirus stock. This high titer recombinant
baculovirus stock was then used to infect Trichoplusia ni (High-5)
cells for subsequent chimeric IgG protein production. A list of all
oligonucleotide primers used in the construction of
pTRABacHuLC.sub.KHC.sub..gamma.1 or
pTRABacHuLC.sub..lamda.HC.sub..lamda.1 can be found in Table 2.
[0180] After the tumor derived sequences for V.sub.H and/or V.sub.L
regions are isolated as described above, oligonucleotide primers
including the terminal 40 nucleotides of the melittin leader
peptide (for Ig heavy chain cloning) (SEQ ID NO:8--CAGATCACTA
GTTTTTATGG TCGTGTACAT TTCTTACATC TATGCG], the terminal 28
nucleotides of the alkaline phosphatase leader peptide (for Ig
light chain cloning) (SEQ ID NO:9--CTGAGTAGGC CTGAGGCTAC AGCTCTCCCT
GGGC), and the first 21 to 24 nucleotides of the respective V.sub.H
or V.sub.L region proteins are prepared. Reverse oligonucleotide
primers from the heavy or light chain constant region are used
(IgG: SEQ ID NO:10--GGAAGTAGTC CTTGACCAGG CAG; IgM: SEQ ID
NO:11--GGGAAAAGGG TTGGGCCCGA TGCAC; IgK: SEQ ID NO:12--GATGAAGACA
CTTGGTGCAG CCACAG; Ig.lamda.: SEQ ID NO:13: GGAACAGAGT GACACTGGGT
GCAGCCTTGG GCTG). Recombinant plasmids identified previously as
having the clonal V.sub.H or V.sub.L sequences are used as
templates for a second round of PCR. Cycling conditions were as
described supra.
[0181] Plasmid templates were combined with an IgG.sub..gamma.1,
IgM, Ig.lamda., or IgK constant region primer complementary to
codon encoding amino acids 141-149, 115-123, 108-119, and 109-117
respectively and the appropriate leader/V region fusion primer. For
example, for one patient, the primers used were SEQ ID NO:67 for
V.sub.H3 and SEQ ID NO:68 for V.sub.K3(SEQ ID NO:67: CAGATCACTA
GTTTTTATGG TCGTGTACAT TTCTTACATC TATGCGGAGA TGAAATTGGT GGAGTCTGGG;
SEQ ID NO:68: CTGAGTAGGC CTGAGGCTAC AGCTCTCCCT GGGCGAAGTT
GTGTTGACTC AGTCTCC). Cycling conditions were as described
above.
[0182] a. Light Chain Variable Region Insertion into Expression
Vector: A PCR derived V.sub.L product and 2 .mu.g of the
corresponding pTRABacHuLC.sub.KHC.sub..gamma.1 or
pTRABacHuLC.sub..lamda.HC.sub..gamma.1 cassette vector digested
with Stu I and Dra Ill. The 350 bp DNA fragment from the patient
derived V.sub.L region and the 8.4 kb fragment for the linear
pTRABacHuLC.sub.KHC.sub..gamma.1 or
pTRABacHuLC.sub..lamda.HC.sub..gamma.1 vector were purified from
agarose gel plugs with Qiaex II resin and eluted in 50 .mu.l water.
The DNA concentrations for both fragments were determined and then
the fragments ligated using Rapid Ligation kit (Roche). The
ligation products were used to transform competent XL1-Blue E. coli
which were subsequently plated on a LB-carbenicillin agar plate for
overnight growing at 37.degree. C. Miniprep colonies were prepared
and the recombinant DNA plasmids were verified by restriction
analysis and sequencing. The resulting vector designated
pTRABac(NHL-V.sub.L)LC.sub.KHC.sub..gamma.1 or
pTRABac(NHL-V.sub.L)LC.sub..lamda.HC.sub..gamma.1.
[0183] b. Heave Chain Variable Regon Insertion into Expression
Vector: A PCR derived V.sub.H product and 2 .mu.g of the
pTRABac(NHL-V.sub.L)LC.sub.K HC.sub..gamma.1 or
pTRABac(NHL-V.sub.L)LC.sub..lamda.HC.sub..gamma.1 cassette vector
were digested with Spe I and Apa I. The 350 bp DNA fragment from
the patient derived V.sub.H region and the 8.8 kb fragment for the
linear pTRABac(NHL-V.sub.L)LC.sub.K HC.sub..gamma.1 or
pTRABac(NHL-V.sub.L)LC.sub..lamda.HC.sub..gamma.1 vector were
purified from agarose gel plugs with Qiaex II resin and eluted in
50 .mu.l water. The DNA concentrations for both fragments were
determined and then the fragments ligated using Rapid Ligation kit
(Roche). The ligation products were used to transform competent
XL1-Blue E. coli which were subsequently plated on a
LB-carbenicillin agar plate for overnight growing at 37.degree. C.
Miniprep colonies were prepared and the recombinant DNA plasmids
were verified by restriction analysis and sequencing. The resulting
vector is designated
pTRABac(NHL-V.sub.L)LC.sub.K(NHL-V.sub.H)HC.sub.7i,
pTRABac(NHL-V.sub.L)LC.sub..lamda. (NHL-V.sub.H)HC.sub..gamma.1 and
is assigned a reference number corresponding to a patient, e.g.,
FV8786-001.
TABLE-US-00002 TABLE 2 Primer Sequences Used for Construction of
pTRABacHuLC.sub.KHC.sub..gamma.1 and
pTRABacHuLC.sub..lamda.HC.sub..gamma.1 Baculovirus Transfer
Vectors. PRIMER NAME PRIMER SEQUENCE (5' 3') 1. Melittin N-terminus
ACTAGTGCAACGTTGACTAAGAATTTCAT (MelS/N and MelN/S) GCGGCCGC (SEQ ID
NO: 15) GCGGCCGCATGAAATTCTTAGTCAA-CGTT GCACTAGT (SEQ ID NO: 16) 2.
Human Placental GCGGATCCATGGTGGGACCCTGCATGCTG Alkaline Phosphatase
CTGCTGCTGCTGCTGCTAGGCCTggaatt N- terminus (APB/E and CC APE/B) (SEQ
ID NO: 17) GGAATTCCAGGCCTAGCAGCAGCAGCAGC
AGCAGCATGCAGGGTCCCACCATGGATCC GC (SEQ ID NO: 18) 3. IgG.sub..gamma.
Heavy Chain TGTGACTAGTATGTATCGGCCCATCGGTC Constant: Upstream
TTCCCCCT Downstream (SEQ ID NO: 19) TTTCTAGACTATTATTTACCCGGAGACAG
GGAGAG (SEQ ID NO: 20) 4. Kappa Light Chain
CTAGGCCTATGTATCACCAAGTGTCTTCA Constant: Upstream TCTTCCCGCCATCT
Downstream (SEQ ID NO: 21) CCCAAGCTTCTATTAACACTCTCCCCTGT TTGAAGCT
(SEQ ID NO: 22)
[0184] 4. Transfection of Insect Cell Lines with Variable
Region-Containing Expression Vectors and Production of Recombinant
Chimeric Proteins:
[0185] a. Insect Cell Growth: Two established insect cell lines
(Sf9 and High-5) were transfected with modified baculoviral vectors
to produce recombinant chimeric V.sub.H/immunoglobulin and/or
V.sub.L/immunoglobulin proteins. All insect cells were grown at
28.degree. C. in ESF-921 Serum Free Insect Media (Expression
Systems LLP) containing 50 .mu.g/L gentamycin in disposable sterile
vented shaker flasks (Coming), at 140-150 rpm, with no more than
50% liquid volume. Cells were passaged every 2 to 3 days. Frozen
cells were thawed (Cryo-preservation media: 10% DMSO, 40% ESF-921
medium, 50% High-5 conditioned media) from a working cell bank for
each lot of product or every six weeks to assure a continuous stock
of exponentially growing cells that was not retractile to infection
by baculovirus.
[0186] b. Sf9 Cell Transfection and Recombination Assay: The
modified baculovirus expression vectors containing genes for
V.sub.H and/or V.sub.L regions and genes encoding immunoglobulin
heavy and/or light chain constant regions were co-transfected into
Sf9 cells using the BacVector-3000 transfection kit (Invitrogen).
Ten individual plaques are picked from agarose overlays. Virus from
isolated plaques are used to infect T-25 flasks seeded with Sf-9
cells at 50% confluency in 5 ml ESF-921 media. Clonal viral
isolates amplified in T-25 flasks are tested by PCR, using two
primers (SEQ ID NO:36--TTTACTGTTT TCGTAACAGT TTTG) and (SEQ ID
NO:37--GGTCGTTAAC AATGGGGAAG CTG) to assure clonality of the
isolated plaques and that there was no wild type virus
contamination. In general, 200 ng recombinant transfer vector
plasmid was co-transfected with triple-cut Bac-Vector-3000 as
described in the Bac Vector manual (Novagen) using the Eufectin
lipid reagent supplied. This transfection mixture was subjected to
serially 5-fold dilutions. One hundred microliter aliquots were
plated in 60 mm tissue culture dishes containing 2.5.times.10.sup.6
adherent Sf9 cells. After 1 hour, cells were overlaid with 4 ml of
a 1% agarose solution in ESF-921 culture medium. Ten individual
clones were picked from the transfected cells grown in agarose
overlays after staining for live cells using Neutral Red (Sigma,
St. Louis, Mo.) at t=144 hours post transfection. Virus was eluted
from plaque plugs overnight in 1 ml ESF-921 media. T-25 flasks were
seeded with Sf-9 cells at 50% confluency in 5 ml ESF-921 media, and
infected with 0.5 ml of eluted clonal A virus. Ninety-six hours
post infection, 0.5 ml media was removed from T-25 flasks; the
cells were removed by centrifugation and the supernatant was
assayed for immunoglobulin activity by dot blotting on
nitrocellulose. The absence of wild type virus was also tested by
PCR as follows.
[0187] Infectious supernatant (10 .mu.l) containing recombinant
baculovirus was added to 90 .mu.l of lysis buffer containing 10 mM
Tris pH 8.3, 50 mM KCl, 0.1 mg/ml gelatin, 0.45% Nonidet P-40, and
0.45% Tween-20, containing 6 .mu.g Proteinase-K. The mixture was
heated for 1 hour at 60.degree. C. and the Proteinase-K was
denatured by incubation at 95.degree. C. for 10 min. Twenty five
ill of the heated mixture was removed to a fresh PCR tube after
cooling, and another 25 .mu.l of the mixture containing 10 mM Tris
pH 8.3, 50 mM KCl, 0.1 mg/ml gelatin, 0.45% NP-40, 0.45% Tween-20,
400 .mu.M each dNTP, 5 mM MgCl.sub.2, 50 pM each PCR primher
(final), and 2.5 U Taq polymerase (Roche) was added. The viral DNA
was amplified for 40 cycles at: 92.degree. C. for 1 min., followed
by 58.degree. C. for 1 min. and 72.degree. C. for 1 min. The
recombinant baculovirus primers PH forward (SEQ ID NO:36) and PH
reverse (SEQ ID NO:37) were used to amplify the polyhedron locus
expressing the light chain gene. PCR products were analyzed
following electrophoresis through an agarose gel. Recombinant
baculovirus would amplify a 1300 bp fragment, while wild type
baculovirus would produce a .about.800 bp fragment with these
primer sets. Recombinant virus contaminated with wild type virus
would amplify both fragment sizes.
[0188] C. Preparation of High Titer Viral Stocks in Sf9 Insect
Cells: Two ml from a T-25 primary culture was transferred to a T-75
flask containing SUP cells at 50% confluency in 10 ml ESF-921
media, and cells were grown for 120 hours at 28.degree. C. Five ml
of secondary T-75 cultures was transferred to a 150 ml shaker flask
containing 50 ml of Sf9 cells at 2.times.10.sup.6 cells/ml, and
cells were grown for 120 hours at 28.degree. C. 25 ml was
transferred from the 150 ml shaker flask into 500-ml of Sf-9 cells
at 2.times.10.sup.6 cells/ml in a one liter shaker flask, and was
grown at 28.degree. C. When the cultures reached 20%, viable cells
as determined by trypan blue staining (approximately 120 to 144
hours post infection), the viral culture was harvested by
centrifugation at 3000.times.g, distributed into 50 ml sterile
tubes, and half of the tubes were stored at 4.degree. C. with the
rest at -80.degree. C. This harvested 500 ml high titer
(>1.times.10.sup.8 pfu/ml) viral stock was then used to infect
High-5 insect cells for immunoglobulin production. Viral titers
(pfu/ml) were determined using a Baculovirus Rapid Titer Kit
(Clontech, Palo Alto, Calif.).
[0189] d. Production of Id in High-5 Insect Cells: High-5 insect
celis (BTI-TN-5B1-4) secreted higher levels (2-20.times.) of
recombinant immunoglobulin compared to Sip cells, and were chosen
for chimeric protein production. Early log phase High-5 cells
(1.0-2.0.times.10.sup.6 cells/ml) were seeded in 1 liter disposable
culture flasks with vented closures at 5.times.10.sup.5 cells/ml in
ESF921 Media (Expression Systems LLP). The flasks were shaken at
140-150 rpm at 28.degree. C., and the volume of media in the flasks
was adjusted over time to no greater than 500 ml. When the cell
densities reached 1.5-2.5 cell/ml in 500 ml media, the flasks were
infected with high titer recombinant baculovirus stock at a
multiplicity of infection (MOI) approximating 0.5:1 (pfi:cells).
The flasks were then shaken at 140-150 rpm at 28.degree. C.; the
culture was harvested 96 hours post-infection.
[0190] 5. Purification of the Chimeric Protein Comprising a
V.sub.H, Immunoglobulin and a V.sub.L-Immunoglobulin:
[0191] Cells and debris were removed by centrifugation for 60 min.
at approximately 5,000.times.g, followed by filtration through a
0.2.mu. PES sterile filter unit. Chimeric proteins were purified
from cleared tissue culture media by affinity chromatography with a
Protein-A High-Trap cartridge (Amersham Pharmacia, Piscataway,
N.J.), followed by ion-exchange chromatography utilizing FPLC
technology (Amersham Pharmacia). The purified chimeric proteins
were size separated and buffer exchanged into PBS by FPLC
chromatography. All reagents used for protein purification were of
USP biotechnology grade (GenAr, Mallinckrot Baker, Parris, Ky.) and
endotoxin tested by the manufacturer. Sterile USP grade water was
used to make all buffers and other solutions. Buffers and other
solutions were prepared in a biological safety cabinet, and filter
sterilized through 0.2 .mu.m PES filter units.
[0192] a. Protein A Sepharose Affinity Purification of the Chimeric
Proteins:
[0193] Tissue culture medium was removed from growing culture
flasks and spun for 60 min. at 5,000.times.g to sediment cells and
debris. The supernatant was sterilized by filtration using a
0.2.mu. PES filter unit. Tris buffer (1M, pH 7.4) was added to the
filtered medium containing V.sub.H and/or V.sub.L-immunoglobulin
chimeric proteins to a final concentration of 20 mM. The buffered
tissue culture supernatant was loaded onto a 5 ml HighTrap
recombinant Protein A Sepharose affinity cartridge at a flow rate
of 1 to 5 ml/min with a P1 peristaltic pump (Amersham Pharmacia)
collecting the flow-through in a clean flask. The column was washed
with 25 ml PBS (pH 7.4) at 5 ml/min. The direction of the flow was
reversed and the column was washed with an additional 25 ml PBS.
The column was eluted in reverse at 1 ml/min with 0.05 M citric
acid (pH 3.5) collecting 1 ml fractions. Other protein columns
including but not limited to protein G, protein L, or any proteins
that are-able to bind to an immunoglobulin binding domain could be
used in the same manner.
[0194] b. Ion Exchange Chromatography: A 5 ml High Trap SP
Sepharose cation exchange cartridge was equilibrated with 50 ml of
25 mM citric acid (pH 3.5) and 20 mM NaCl. The Protein A eluted
V.sub.H and/or V.sub.L-IgG chimeric proteins were loaded directly
onto the equilibrated High Trap SP Sepharose column using a
peristaltic pump at a flow rate of 1 ml/min. The column was washed
with 25 ml 50 mM citric acid (pH 3.5) and 20 mM NaCl (Buffer A) at
2 ml/min. The column was eluted with a linear gradient (0% Buffer B
to 100% Buffer B) to collect 1 ml fractions at 1 ml/min. (Buffer
B=100 mM Na carbonate (pH 10.0) and 1M NaCl). The ion exchange
eluted fractions containing V.sub.H and/or V.sub.L-IgG chimeric
proteins were analyzed spectrophotometrically by their OD.sub.280.
The peak fractions were pooled.
[0195] C. Size Exclusion Chromatography: The pooled Ig fraction
from SP ion-exchange was then loaded onto a Hi Prep Sephacryl 26/60
S200 Hi Resolution column (Pharmacia) that had been equilibrated in
5 column volumes of PBS (pH7.2) following a pre-wash in 100 ml
sterile water. The chimeric Ig proteins were eluted in PBS at a
flow rate of 0.5 ml/min and collected in 1 ml fractions. The major
Ig peak was apooled a sterile filtered through a 0.2.mu.
filter.
[0196] 6. Idiotypic Protein and Keyhole Limpet Hemocyanin (KLH)
Conjugation.
[0197] Once purified, the idiotypic protein was conjugated to GMP
grade KLH (VACMUNE, Biosyn Corporation) via glutaraldehyde
crosslinking. At least 5 mg of purified, sterile idiotypic protein
as described, supra, was combined with an equal weight of KLH in a
sterile 15 ml conical tube and the final volume was adjusted to 9
ml in PBS. One ml of 1% glutaraldehyde (25% Grade 1 aqueous
solution, Sigma) was added dropwise to a final concentration of
0.1%. The tube was then slowly rocked for 4 hours at room
temperature. The conjugate was dialyzed in sterile DispoDialyzers
(Spectrum Labs) against 2 liters sterile PBS, with three buffer
changes over at least 24 hours in a biological safety hood. The
final IgG/KLH conjugate in PBS is aseptically removed from the
dialysis chambers and transferred into a sterile tube, mixed, then
aliquoted in vials. Each vial of final product was labeled with the
lot number, patient identifier, vial number and date vialed. Ten
percent of the final vialed lot was tested for sterility and a vial
was tested for the presence of endotoxin. One vial was retained for
archival purposes.
[0198] 7. Product Tests
[0199] a. DNA Sequence of Baculovirus Containing Production Lot
[0200] Supernantant: A 1 ml aliquot of sample of infected insect
cell production culture supernatant was harvested and cleared of
cellular debris by spinning at 3000 rpm for 5 min in a desktop
centrifuge. At least 0.1 ml of this cleared supernatant containing
baculovirus particles was combined at a volume ratio of 1 to 9 with
lysis buffer (10 mM Tris pH 8.3, 50 mM KCl, 0.1 mg/ml gelatin,
0.45% Nonidet P-40, and 0.45% Tween-20), subjected to proteolysis
with proteinase K (final concentration 60 .mu.g/ml) for 1 h at
60.degree. C., followed by denaturation for 15 min at 95.degree. C.
Twenty-five .mu.l of this lysate was then combined with an
additional 25 .mu.l of the above lysis buffer containing 400 .mu.M
each dNTP, 5 MM MgCl.sub.2, 25 pmol forward and reverse
oligonucleotide primers (see Table 3; SEQ ID NO:34 and SEQ ID NO:31
for V.sub.H Identification and SEQ ID NO:35 and SEQ ID NO:36 for
V.sub.L identification, respectively), and 2.5 U Taq polymerase
(Roche). Cycling conditions for the PCR of V.sub.L are: initial
denaturation for 2 min at 92.degree. C., followed by 40 cycles of 1
min each at 92.degree. C., 58.degree. C., and 72.degree. C., with a
final extension of 7 min at 72.degree. C. For the PCR of V.sub.H,
cycling conditions are the same except that the annealing
temperature is 64.degree. C. PCR products were assessed for
expected size and quantity by agarose gel electrophoresis.
Subsequently, two or more nested primers were used to directly
sequence the PCR products. (See Table 3; SEQ ID NO:30 and SEQ ID
NO:34 for V.sub.H identification, SEQ ID NO:28 and SEQ ID NO:35 for
VK identification, and SEQ ID NO:88 and SEQ ID NO:35 for V.lamda.
identification, respectively.) The complete V.sub.H and V.sub.L
nucleotide sequences was determined using the OpenGene Automated
DNA Sequencing System (Visible Genetics) and sequencing analysis
software, as described above and compared with the V-gene sequences
of the pTRABac(NHL-FV-8786-XXX) vector corresponding to that
patient's idiotype.
[0201] b. Superose 6 Gel Filtration Chromatography: Gel filtration
chromatography of the purified Id was performed to assess protein
purity. Gel filtration chromatography was performed using a
Superose 6 HR 10/30 FPLC column (Amersham Pharmacia) with PBS as
the liquid phase. Peak integration was performed on the largest 20
peaks by the FPLC software using the following criteria to reject a
peak from being included in area evaluation: height less than 0.01
Au; width less than 0.05 ml; area less than 0.01 Au/ml. Fractions
of each column run were collected and assayed for human
immunoglobulin specific activity by capture ELISA, and compared to
the OD.sub.280 chromatogram.
[0202] c. Immunoglobulin Assay; Anti Human IgG ELISA: Microtiter
plate wells were coated with 100 .mu.l of a 3 .mu.g/ml dilution of
Goat anti-Human IgG heavy chain specific antibody (Roche) in
carbonate buffer overnight at 4.degree. C., and washed 2 times with
100 .mu.l TBS (50 mM Tris, 150 mM NaCl, pH 7.5). Wells were blocked
with of 200 .mu.l TBSB (TBS+1% BSA) for 1 hour at 22.degree. C.
[0203] Each chromatogram fraction corresponding to human peak in
TBSB was tested. One hundred .mu.l of diluted sample was added in
2-fold serial dilutions to wells in replicates, and incubated 1
hour at 22.degree. C. The assay was repeated with purified Human
IgG1/K or IgG1.lamda. standards (Sigma, St. Louis, Mo.). The wells
were washed 4 times with 200 TBST (TBS+0.1% Tween 20). The
detection antibody was diluted (Goat-anti-Human K or .lamda.-HRP
(Fischer, Pittsburgh, Pa.) 1:2000 in TBSB, 100 .mu.l was added to
wells, and incubated for 1 hour at 22.degree. C. The wells were
washed 6 times with 200 .mu.l TBST. One hundred .mu.l of substrate
(TMB 1 component, KPL Inc., Gaithersburg, Md.) was added to wells,
developed 30 min. and assayed at OD.sub.620.
[0204] d. Idiotypic Protein Release Criteria: (1) The DNA sequence
of idiotype-variable genes in baculovirus from production
supernantant must be identical to the DNA sequence in the
production vector. (2) The idiotypic protein concentration was
greater than 0.5 mg/ml based on OD.sub.280. (3) The major peak area
was greater than 90% of area in evaluated peaks on Superose 6
analytical chromatography. (4) The major chromatographic peak
corresponds to the human IgGK (or .lamda.) ELISA activity peak.
[0205] The final vaccine product, Id-KLH, was tested for endotoxin
levels by a kinetic turbidity microplate assay or a Limulus
Amoebocyte Lysate (LAL) assay and had a level below 350 endotoxin
units (EU) per ml. Ten percent of the lot was tested for sterility
on a 14-day test and tests negative or was discarded.
[0206] Table 3 shows a summary of primer sequences used for
establishing final product identity.
TABLE-US-00003 TABLE 3 Primer Sequences Used for Establishing Final
Product Identity PRIMER NAME PRIMER SEQUENCE (5' 3') 1. Human
Placental Alkaline AAATGATAACCATCTCGC Phosphatase Internal (SEQ ID
NO: 25) 2. Human Placental Alkaline TTTACTGTTTTCGTAACAGTTTTG
Phosphatase External (SEQ ID NO: 26) 3. Kappa Light Chain Constant
TTGGAGGGCGTTATCCACCTTC Antisense (SEQ ID NO: 27) 4. Kappa Light
Chain Constant CTGTAAATCAACAACGCACAG Downstream Internal (SEQ ID
NO: 28) 5. Kappa Light Chain Constant CAACAACGCACAGAATCTAG
Downstream External (SEQ ID NO: 29) 6. Melittin Internal
GGGACCTTTAATTCAACCCAACAC (SEQ ID NO: 30) 7. Melittin External
AAACGCGTTGGAGTCTTGTGTGC (SEQ ID NO: 31) 8. IgG.sub..gamma.1 Heavy
Chain Constant GGAAGTAGTCCTTGACCAGGCAG Downstream Internal (SEQ ID
NO: 32) 9. IgG.sub..gamma.1 Heavy Chain Constant
CTGAGTTCCACGACACCGTCAC Downstream Middle (SEQ ID NO: 33) 10.
IgG.sub..gamma.1 Heavy Chain Constant TAGAGTCCTGAGGACTGTAGGAC
Downstream External (SEQ ID NO: 34) 11. Kappa & Lambda
Downstream: 5'-GGTCGTTAACAATGGGGAAGCTG-3' (SEQ ID NO: 35) 12. PH
forward 5'-TTTACTGTTTTCGTAACAGTTTTG-3' (SEQ ID NO: 36) 13. PH
reverse 5'-GGTCGTTAACAATGGGGAAGCTG-3' (SEQ ID NO: 37) 14. Lambda
Constant Internal 5'-GAAGTCACTTATGAGACACACCAG-3' (SEQ ID NO:
38)
[0207] 8. Use of Chimeric Protein of the Invention for Treatment of
Non-Hodgkin's B-Cell Lymphoma.
[0208] V.sub.H and V.sub.L regions were obtained from a patient
with Non-Hodgkin's B-Cell Lymphoma. Using the 5' RACE method
described supra, genes encoding these regions were cloned and
inserted into the expression vector and expressed by the methods of
the instant invention. Table 5 contains the DNA sequences of the Vh
and Vl regions used for the expression vector. The Apa I and Dra
III sites used for cloning are indicated by underlining.
TABLE-US-00004 TABLE 5 Variable region sequences obtained from a
patient. VH A/07 SEQ ID NO: 86
GACATGTTGTTGGTGGAATCGGGGGG-AGGCCTGGTCCA
GCCGGGGGAGTCCCTGAGACTCTCCTGTGTGGCCTCTAGA
TTCACCTTTAGAAC-GTTTTGGATGACCTGGGTCCGCCA
ACTTCCAGGGAAGGGGCTGGAGTGGGTGGCCAATATAAAT
CAAGATGGCAGTCAGACGTATCATGCGGACTCTGTAAAGG
GCCGATTTACCATCTCCAGAGACAACGGCAGGAACTCCCT
ATTTTTACAAATGACAAGTCTGAGAGTCGCGGACACGGCT
ATATATTACTGTGCGACTAATGAAACGTCCAGTGGCCTGG
ACTGCTGGGGCCAAGGAACCCTGGTCACTGTCTCCTCAGC TTCCACCAAGGGCCC VK A/L6
SEQ ID NO: 87 GAAATCGTGTTGACACAGTCTCCAGCCACCCTGTCTTCGT
CTCCAGGAGACAGAGTCGCCCTCTCCTGCAGGGCCAGTCA
GAGTGTAAGAAGTTACTTAAGTTGGTATCAACAGAAGGCT
GGCCAGGCTCCCAGGCTCCTCATCCATAATGCATCCAGTA
GGGCCACTGGCATCCCGCCCAGATTCAGTGGCAGTGGGTC
TGGGACAGACTTCACTCTCACCATCAGTCGCCTAGAGACT
GAAGATGCTGCAGTTTATTACTGTCAGCAACTTTATTTCT
GGCCTCCGATATTATTTTTCGGCCCTGGGACCAAAGTGAA
TATCACACGAACTGTGGCTGCACCAAGTG
[0209] The isolated recombinant chimeric immunoglobulin protein
produced for this patient from the genetic information detailed
above was conjugated to KLH and administered with GM-CSF five times
over a six-month period as described supra. A CT scan was performed
on the neck and pelvis areas of the patient prior to administration
of the therapy and 9 months later. A comparison of the sum of the
diameters of 6 tumor masses revealed a 60% reduction nine months
following therapy initiation. (Note that these figures are not
adjusted to accommodate the size of the lymph node prior to
diagnosis of the disease (See, Cheson et al., J. Clin. Oncol.,
17(4):1244, 1999.)
TABLE-US-00005 TABLE 6 Reduction in size of lymph nodes following
treatment. PRIOR TO TXT. (Product of 9 MONTHS POST TXT. diameters;
cm.sup.2) (Product of diameters; cm.sup.2) LYMPH NODE 1 6.16 2.8
LYMPH NODE 2 5.0 1.6 LYMPH NODE 3 3.3 1.17 LYMPH NODE 4 3.78 1.44
LYMPH NODE 5 1.92 1.0 LYMPH NODE 6 1.08 0.80 SUM OF DIAMETERS 21.24
8.81
Sequence CWU 1
1
93122PRTHomo sapiens 1Met Leu Gly Pro Cys Met Leu Leu Leu Leu Leu
Leu Leu Gly Leu Arg1 5 10 15Leu Gln Leu Ser Leu Gly 20266DNAHomo
sapiens 2atggtgggac cctgcatgct gctgctgctg ctgctgctag gcctgaggct
acagctctcc 60ctgggc 66321PRTApis mellifera 3Met Lys Phe Leu Val Asn
Val Ala Leu Val Phe Met Val Val Tyr Ile1 5 10 15Ser Tyr Ile Tyr Ala
20463DNAApis mellifera 4atgaaattct tagtcaacgt tgcactagtt tttatggtcg
tgtacatttc ttacatctat 60gcg 6357125DNAAutographa californica
nucleopolyhedrovirusExpression vector 5gcagttcgtt gacgccttcc
tccgtgtggc cgaacacgtc gagcgggtgg tcgatgacca 60gcggcgtgcc gcacgcgacg
cacaagtatc tgtacaccga atgatcgtcg ggcgaaggca 120cgtcggcctc
caagtggcaa tattggcaaa ttcgaaaata tatacagttg ggttgtttgc
180gcatatctat cgtggcgttg ggcatgtacg tccgaacgtt gatttgcatg
caagccgaaa 240ttaaatcatt gcgattagtg cgattaaaac gttgtacatc
ctcgctttta atcatgccgt 300cgattaaatc gcgcaatcga gtcaagtgat
caaagtgtgg aataatgttt tctttgtatt 360cccgagtcaa gcgcagcgcg
tattttaaca aactagccat cttgtaagtt agtttcattt 420aatgcaactt
tatccaataa tatattatgt atcgcacgtc aagaattaac aatgcgcccg
480ttgtcgcatc tcaacacgac tatgatagag atcaaataaa gcgcgaatta
aatagcttgc 540gacgcaacgt gcacgatctg tgcacgcgtt ccggcacgag
ctttgattgt aataagtttt 600tacgaagcga tgacatgacc cccgtagtga
caacgatcac gcccaaaaga actgccgact 660acaaaattac cgagtatgtc
ggtgacgtta aaactattaa gccatccaat cgaccgttag 720tcgaatcagg
accgctggtg cgagaagccg cgaagtatgg cgaatgcatc gtataacgtg
780tggagtccgc tcattagagc gtcatgttta gacaagaaag ctacatattt
aattgatccc 840gatgatttta ttgataaatt gaccctaact ccatacacgg
tattctacaa tggcggggtt 900ttggtcaaaa tttccggact gcgattgtac
atgctgttaa cggctccgcc cactattaat 960gaaattaaaa attccaattt
taaaaaacgc agcaagagaa acatttgtat gaaagaatgc 1020gtagaaggaa
agaaaaatgt cgtcgacatg ctgaacaaca agattaatat gcctccgtgt
1080ataaaaaaaa tattgaacga tttgaaagaa aacaatgtac cgcgcggcgg
tatgtacagg 1140aagaggttta tactaaactg ttacattgca aacgtggttt
cgtgtgccaa gtgtgaaaac 1200cgatgtttaa tcaaggctct gacgcatttc
tacaaccacg actccaagtg tgtgggtgaa 1260gtcatgcatc ttttaatcaa
atcccaagat gtgtataaac caccaaactg ccaaaaaatg 1320aaaactgtcg
acaagctctg tccgtttgct ggcaactgca agggtctcaa tcctatttgt
1380aattattgaa taataaaaca attataaatg ctaaatttgt tttttattaa
cgatacaaac 1440caaacgcaac aagaacattt gtagtattat ctataattga
aaacgcgtag ttataatcgc 1500tgaggtaata tttaaaatca ttttcaaatg
attcacagtt aatttgcgac aatataattt 1560tattttcaca taaactagac
gccttgtcgt cttcttcttc gtattccttc tctttttcat 1620ttttctcctc
ataaaaatta acatagttat tatcgtatcc atatatgtat ctatcgtata
1680gagtaaattt tttgttgtca taaatatata tgtctttttt aatggggtgt
atagtaccgc 1740tgcgcatagt ttttctgtaa tttacaacag tgctattttc
tggtagttct tcggagtgtg 1800ttgctttaat tattaaattt atataatcaa
tgaatttggg atcgtcggtt ttgtacaata 1860tgttgccggc atagtacgca
gcttcttcta gttcaattac accatttttt agcagcaccg 1920gattaacata
actttccaaa atgttgtacg aaccgttaaa caaaaacagt tcacctccct
1980tttctatact attgtctgcg agcagttgtt tgttgttaaa aataacagcc
attgtaatga 2040gacgcacaaa ctaatatcac aaactggaaa tgtctatcaa
tatatagttg ctgatatctc 2100cccagcatgc ctgctattgt cttcccaatc
ctcccccttg ctgtcctgcc ccaccccacc 2160ccccagaata gaatgacacc
tactcagaca atgcgatgca atttcctcat tttattagga 2220aaggacagtg
ggagtggcac cttccagggt caaggaaggc acgggggagg ggcaaacaac
2280agatggctgg caactagaag gcacagtcga ggctgatcag cgagctctag
tctagactag 2340tataccgcgg gccctgcagg ccttaaggcg cgcccgggcg
gccgcgtacg attgtaaata 2400aaatgtaatt tacagtatag tattttaatt
aatatacaaa tgatttgata ataattctta 2460tttaactata atatattgtg
ttgggttgaa ttaaaggtcc cggcatcctc aaatgcataa 2520tttcatagtc
ccccttgttg taagtgatgc gtatttctga atctttgtaa aatagcacac
2580aagactccaa cgcgtttggc gttttatttt cttgctcgag gatatcatgg
agataattaa 2640aatgataacc atctcgcaaa taaataagta ttttactgtt
ttcgtaacag ttttgtaata 2700aaaaaaccta taaatattcc ggattattca
taccgtccca ccatcgggcg tgctagcgga 2760tccgagctcg agatctgcag
ctggtaccat ggaattcgaa gcttgtcgtt ggatggaaag 2820gaaaagagtt
ctacagggaa acttggaccc gcttcatgga agacagcttc cccattgtta
2880acgaccaaga agtgatggat gttttccttg ttgtcaacat gcgtcccact
agacccaacc 2940gttgttacaa attcctggcc caacacgctc tgcgttgcga
ccccgactat gtacctcatg 3000acgtgattag gatcgtcgag ccttcatggg
tgggcagcaa caacgagtac cgcatcagcc 3060tggctaagaa gggcggcggc
tgcccaataa tgaaccttca ctctgagtac accaactcgt 3120tcgaacagtt
catcgatcgt gtcatctggg agaacttcta caagcccatc gtttacatcg
3180gtaccgactc tgctgaagag gaggaaattc tccttgaagt ttccctggtg
ttcaaagtaa 3240aggagtttgc accagacgca cctctgttca ctggtccggc
gtattaaaac acgatacatt 3300gttattagta catttattaa gcgctagatt
ctgtgcgttg ttgatttaca gacaattgtt 3360gtacgtattt taataattca
ttaaatttat aatctttagg gtggtatgtt agagcgaaaa 3420tcaaatgatt
ttcagcgtct ttatatctga atttaaatat taaatcctca atagatttgt
3480aaaataggtt tcgattagtt tcaaacaagg gttgtttttc cgaaccgatg
gctggactat 3540ctaatggatt ttcgctcaac gccacaaaac ttgccaaatc
ttgtagcagc aatctagctt 3600tgtcgatatt cgtttgtgtt ttgttttgta
ataaaggttc gacgtcgttc aaaatattat 3660gcgcttttgt atttctttca
tcactgtcgt tagtgtacaa ttgactcgac gtaaacacgt 3720taaataaagc
tagcttggac atatttaaca tcgggcgtgt tagctttatt aggccgatta
3780tcgtcgtcgt cccaaccctc gtcgttagaa gttgcttccg aagacgattt
tgccatagcc 3840acacgacgcc tattaattgt gtcggctaac acgtccgcga
tcaaatttgt agttgagctt 3900tttggaatta tttctgattg cgggcgtttt
tgggcgggtt tcaatctaac tgtgcccgat 3960tttaattcag acaacacgtt
agaaagcgat ggtgcaggcg gtggtaacat ttcagacggc 4020aaatctacta
atggcggcgg tggtggagct gatgataaat ctaccatcgg tggaggcgca
4080ggcggggctg gcggcggagg cggaggcgga ggtggtggcg gtgatgcaga
cggcggttta 4140ggctcaaatg tctctttagg caacacagtc ggcacctcaa
ctattgtact ggtttcgggc 4200gccgtttttg gtttgaccgg tctgagacga
gtgcgatttt tttcgtttct aatagcttcc 4260aacaattgtt gtctgtcgtc
taaaggtgca gcgggttgag gttccgtcgg cattggtgga 4320gcgggcggca
attcagacat cgatggtggt ggtggtggtg gaggcgctgg aatgttaggc
4380acgggagaag gtggtggcgg cggtgccgcc ggtataattt gttctggttt
agtttgttcg 4440cgcacgattg tgggcaccgg cgcaggcgcc gctggctgca
caacggaagg tcgtctgctt 4500cgaggcagcg cttggggtgg tggcaattca
atattataat tggaatacaa atcgtaaaaa 4560tctgctataa gcattgtaat
ttcgctatcg tttaccgtgc cgatatttaa caaccgctca 4620atgtaagcaa
ttgtattgta aagagattgt ctcaagctcc gcacgccgat aacaagcctt
4680ttcattttta ctacagcatt gtagtggcga gacacttcgc tgtcgtcgac
tcgagttcta 4740tagtgtcacc taaatcgtat gtgtatgata cataaggtta
tgtattaatt gtagccgcgt 4800tctaacgaca atatgtccat atggtgcact
ctcagtacaa tctgctctga tgccgcatag 4860ttaagccagc cccgacaccc
gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc 4920ccggcatccg
cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt
4980tcaccgtcat caccgaaacg cgcgagacga aagggcctcg tgatacgcct
atttttatag 5040gttaatgtca tgataataat ggtttcttag acgtcaggtg
gcacttttcg gggaaatgtg 5100cgcggaaccc ctatttgttt atttttctaa
atacattcaa atatgtatcc gctcatgaga 5160caataaccct gataaatgct
tcaataatat tgaaaaagga agagtatgag tattcaacat 5220ttccgtgtcg
cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca
5280gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt
gggttacatc 5340gaactggatc tcaacagcgg taagatcctt gagagttttc
gccccgaaga acgttttcca 5400atgatgagca cttttaaagt tctgctatgt
ggcgcggtat tatcccgtat tgacgccggg 5460caagagcaac tcggtcgccg
catacactat tctcagaatg acttggttga gtactcacca 5520gtcacagaaa
agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata
5580accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg
accgaaggag 5640ctaaccgctt ttttgcacaa catgggggat catgtaactc
gccttgatcg ttgggaaccg 5700gagctgaatg aagccatacc aaacgacgag
cgtgacacca cgatgcctgt agcaatggca 5760acaacgttgc gcaaactatt
aactggcgaa ctacttactc tagcttcccg gcaacaatta 5820atagactgga
tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct
5880ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg
tatcattgca 5940gcactggggc cagatggtaa gccctcccgt atcgtagtta
tctacacgac ggggagtcag 6000gcaactatgg atgaacgaaa tagacagatc
gctgagatag gtgcctcact gattaagcat 6060tggtaactgt cagaccaagt
ttactcatat atactttaga ttgatttaaa acttcatttt 6120taatttaaaa
ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa
6180cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg
atcttcttga 6240gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa
aaaaaccacc gctaccagcg 6300gtggtttgtt tgccggatca agagctacca
actctttttc cgaaggtaac tggcttcagc 6360agagcgcaga taccaaatac
tgtccttcta gtgtagccgt agttaggcca ccacttcaag 6420aactctgtag
caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc
6480agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc
ggataaggcg 6540cagcggtcgg gctgaacggg gggttcgtgc acacagccca
gcttggagcg aacgacctac 6600accgaactga gatacctaca gcgtgagcat
tgagaaagcg ccacgcttcc cgaagggaga 6660aaggcggaca ggtatccggt
aagcggcagg gtcggaacag gagagcgcac gagggagctt 6720ccagggggaa
acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag
6780cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc
cagcaacgcg 6840gcctttttac ggttcctggc cttttgctgg ccttttgctc
acatgttctt tcctgcgtta 6900tcccctgatt ctgtggataa ccgtattacc
gcctttgagt gagctgatac cgctcgccgc 6960agccgaacga ccgagcgcag
cgagtcagtg agcgaggaag cggaagagcg cccaatacgc 7020aaaccgcctc
tccccgcgcg ttggccgatt cattaatgca ggttaacctg gcttatcgaa
7080attaatacga ctcactatag ggagaccggc agatcgatct gtcga
712568420DNAUnknown OrganismDescription of Unknown Organism
pTRABacHuLCHC1 DNA sequence 6gcagttcgtt gacgccttcc tccgtgtggc
cgaacacgtc gagcgggtgg tcgatgacca 60gcggcgtgcc gcacgcgacg cacaagtatc
tgtacaccga atgatcgtcg ggcgaaggca 120cgtcggcctc caagtggcaa
tattggcaaa ttcgaaaata tatacagttg ggttgtttgc 180gcatatctat
cgtggcgttg ggcatgtacg tccgaacgtt gatttgcatg caagccgaaa
240ttaaatcatt gcgattagtg cgattaaaac gttgtacatc ctcgctttta
atcatgccgt 300cgattaaatc gcgcaatcga gtcaagtgat caaagtgtgg
aataatgttt tctttgtatt 360cccgagtcaa gcgcagcgcg tattttaaca
aactagccat cttgtaagtt agtttcattt 420aatgcaactt tatccaataa
tatattatgt atcgcacgtc aagaattaac aatgcgcccg 480ttgtcgcatc
tcaacacgac tatgatagag atcaaataaa gcgcgaatta aatagcttgc
540gacgcaacgt gcacgatctg tgcacgcgtt ccggcacgag ctttgattgt
aataagtttt 600tacgaagcga tgacatgacc cccgtagtga caacgatcac
gcccaaaaga actgccgact 660acaaaattac cgagtatgtc ggtgacgtta
aaactattaa gccatccaat cgaccgttag 720tcgaatcagg accgctggtg
cgagaagccg cgaagtatgg cgaatgcatc gtataacgtg 780tggagtccgc
tcattagagc gtcatgttta gacaagaaag ctacatattt aattgatccc
840gatgatttta ttgataaatt gaccctaact ccatacacgg tattctacaa
tggcggggtt 900ttggtcaaaa tttccggact gcgattgtac atgctgttaa
cggctccgcc cactattaat 960gaaattaaaa attccaattt taaaaaacgc
agcaagagaa acatttgtat gaaagaatgc 1020gtagaaggaa agaaaaatgt
cgtcgacatg ctgaacaaca agattaatat gcctccgtgt 1080ataaaaaaaa
tattgaacga tttgaaagaa aacaatgtac cgcgcggcgg tatgtacagg
1140aagaggttta tactaaactg ttacattgca aacgtggttt cgtgtgccaa
gtgtgaaaac 1200cgatgtttaa tcaaggctct gacgcatttc tacaaccacg
actccaagtg tgtgggtgaa 1260gtcatgcatc ttttaatcaa atcccaagat
gtgtataaac caccaaactg ccaaaaaatg 1320aaaactgtcg acaagctctg
tccgtttgct ggcaactgca agggtctcaa tcctatttgt 1380aattattgaa
taataaaaca attataaatg ctaaatttgt tttttattaa cgatacaaac
1440caaacgcaac aagaacattt gtagtattat ctataattga aaacgcgtag
ttataatcgc 1500tgaggtaata tttaaaatca ttttcaaatg attcacagtt
aatttgcgac aatataattt 1560tattttcaca taaactagac gccttgtcgt
cttcttcttc gtattccttc tctttttcat 1620ttttctcctc ataaaaatta
acatagttat tatcgtatcc atatatgtat ctatcgtata 1680gagtaaattt
tttgttgtca taaatatata tgtctttttt aatggggtgt atagtaccgc
1740tgcgcatagt ttttctgtaa tttacaacag tgctattttc tggtagttct
tcggagtgtg 1800ttgctttaat tattaaattt atataatcaa tgaatttggg
atcgtcggtt ttgtacaata 1860tgttgccggc atagtacgca gcttcttcta
gttcaattac accatttttt agcagcaccg 1920gattaacata actttccaaa
atgttgtacg aaccgttaaa caaaaacagt tcacctccct 1980tttctatact
attgtctgcg agcagttgtt tgttgttaaa aataacagcc attgtaatga
2040gacgcacaaa ctaatatcac aaactggaaa tgtctatcaa tatatagttg
ctgatatctc 2100cccagcatgc ctgctattgt cttcccaatc ctcccccttg
ctgtcctgcc ccaccccacc 2160ccccagaata gaatgacacc tactcagaca
atgcgatgca atttcctcat tttattagga 2220aaggacagtg ggagtggcac
cttccagggt caaggaaggc acgggggagg ggcaaacaac 2280agatggctgg
caactagaag gcacagtcga ggctgatcag cgagctctag tctagactat
2340tatttacccg gagacaggga gaggctcttc tgcgtgtagt ggttgtgcag
agcctcatgc 2400atcacggagc atgagaagac gttcccctgc tgccacctgc
tcttgtccac ggtgagcttg 2460ctgtagagga agaaggagcc gtcggagtcc
agcacgggag gcgtggtctt gtagttgttc 2520tccggctgcc cattgctctc
ccactccacg gcgatgtcgc tgggatagaa gcctttgacc 2580aggcaggtca
ggctgacctg gttcttggtc agctcatccc gggatggggg cagggtgtac
2640acctgtggtt ctcggggctg ccctttggct ttggagatgg ttttctcgat
gggggctggg 2700agggctttgt tggagacctt gcacttgtac tccttgccat
tcagccagtc ctggtgcagg 2760acggtgagga cgctgaccac acggtacgtg
ctgttgtact gctcctcccg cggctttgtc 2820ttggcattat gcacctccac
gccgtccacg taccagttga acttgacctc agggtcttcg 2880tggctcacgt
ccaccaccac gcatgtgacc tcaggggtcc gggagatcat gagggtgtcc
2940ttgggttttg gggggaagag gaagactgac ggtcccccca ggagttcagg
tgctgggcac 3000ggtgggcatg tgtgagtttt gtcacaagat ttgggctcaa
ctttcttgtc caccttggtg 3060ttgctgggct tgtgattcac gttgcagatg
taggtctggg tgcccaagct gctggagggc 3120acggtcacca cgctgctgag
ggagtagagt cctgaggact gtaggacagc cgggaaggtg 3180tgcacgccgc
tggtcagggc gcctgagttc cacgacaccg tcaccggttc ggggaagtag
3240tccttgacca ggcagcccag ggccgctgtg cccccagagg tgctcttgga
ggagggtgcc 3300agggggaaga ccgatgggcc cactagtgca acgttgacta
agaatttcat gcggccgcgt 3360acgattgtaa ataaaatgta atttacagta
tagtatttta attaatatac aaatgatttg 3420ataataattc ttatttaact
ataatatatt gtgttgggtt gaattaaagg tcccggcatc 3480ctcaaatgca
taatatcata gtcccccttg ttgtaagtga tgcgtatttc tgaatctttg
3540taaaatagca cacaggactc caacgcgttt ggcgttttat tttcttgctc
gaggatatca 3600tggagataat taaaatgata accatctcgc aaataaataa
gtattttact gttttcgtaa 3660cagttttgta ataaaaaaac ctataaatat
tccggattat tcataccgtc ccaccatcgg 3720gcgtgctagc ggatccatgg
tgggaccctg catgctgctg ctgctgctgc tgctaggcct 3780caccaagtgt
cttcatcttc ccgccatctg atgagcagtt gaaatctgga actgcctctg
3840ttgtgtgcct gctgaataac ttctatccca gagaggccaa agtacagtgg
aaggtggata 3900acgccctcca atcgggtaac tcccaggaga gtgtcacaga
gcaggacagc aaggacagca 3960cctacagcct cagcagcacc ctgacgctga
gcaaagcaga ctacgagaaa cacaaagtct 4020acgcctgcga agtcacccat
cagggcctga gctcgcccgt cacaaagagc ttcaacaggg 4080gagagtgtta
atagaagctt gtcgttggat ggaaaggaaa agagttctac agggaaactt
4140ggacccgctt catggaagac agcttcccca ttgttaacga ccaagaagtg
atggatgttt 4200tccttgttgt caacatgcgt cccactagac ccaaccgttg
ttacaaattc ctggcccaac 4260acgctctgcg ttgcgacccc gactatgtac
ctcatgacgt gattaggatc gtcgagcctt 4320catgggtggg cagcaacaac
gagtaccgca tcagcctggc taagaagggc ggcggctgcc 4380caataatgaa
ccttcactct gagtacacca actcgttcga acagttcatc gatcgtgtca
4440tctgggagaa cttctacaag cccatcgttt acatcggtac cgactctgct
gaagaggagg 4500aaattctcct tgaagtttcc ctggtgttca aagtaaagga
gtttgcacca gacgcacctc 4560tgttcactgg tccggcgtat taaaacacga
tacattgtta ttagtacatt tattaagcgc 4620tagattctgt gcgttgttga
tttacagaca attgttgtac gtattttaat aattcattaa 4680atttataatc
tttagggtgg tatgttagag cgaaaatcaa atgattttca gcgtctttat
4740atctgaattt aaatattaaa tcctcaatag atttgtaaaa taggtttcga
ttagtttcaa 4800acaagggttg tttttccgaa ccgatggctg gactatctaa
tggattttcg ctcaacgcca 4860caaaacttgc caaatcttgt agcagcaatc
tagctttgtc gatattcgtt tgtgttttgt 4920tttgtaataa aggttcgacg
tcgttcaaaa tattatgcgc ttttgtattt ctttcatcac 4980tgtcgttagt
gtacaattga ctcgacgtaa acacgttaaa taaagctagc ttggacatat
5040ttaacatcgg gcgtgttagc tttattaggc cgattatcgt cgtcgtccca
accctcgtcg 5100ttagaagttg cttccgaaga cgattttgcc atagccacac
gacgcctatt aattgtgtcg 5160gctaacacgt ccgcgatcaa atttgtagtt
gagctttttg gaattatttc tgattgcggg 5220cgtttttggg cgggtttcaa
tctaactgtg cccgatttta attcagacaa cacgttagaa 5280agcgatggtg
caggcggtgg taacatttca gacggcaaat ctactaatgg cggcggtggt
5340ggagctgatg ataaatctac catcggtgga ggcgcaggcg gggctggcgg
cggaggcgga 5400ggcggaggtg gtggcggtga tgcagacggc ggtttaggct
caaatgtctc tttaggcaac 5460acagtcggca cctcaactat tgtactggtt
tcgggcgccg tttttggttt gaccggtctg 5520agacgagtgc gatttttttc
gtttctaata gcttccaaca attgttgtct gtcgtctaaa 5580ggtgcagcgg
gttgaggttc cgtcggcatt ggtggagcgg gcggcaattc agacatcgat
5640ggtggtggtg gtggtggagg cgctggaatg ttaggcacgg gagaaggtgg
tggcggcggt 5700gccgccggta taatttgttc tggtttagtt tgttcgcgca
cgattgtggg caccggcgca 5760ggcgccgctg gctgcacaac ggaaggtcgt
ctgcttcgag gcagcgcttg gggtggtggc 5820aattcaatat tataattgga
atacaaatcg taaaaatctg ctataagcat tgtaatttcg 5880ctatcgttta
ccgtgccgat atttaacaac cgctcaatgt aagcaattgt attgtaaaga
5940gattgtctca agctccgcac gccgataaca agccttttca tttttactac
agcattgtag 6000tggcgagaca cttcgctgtc gtcgactcga gttctatagt
gtcacctaaa tcgtatgtgt 6060atgatacata aggttatgta ttaattgtag
ccgcgttcta acgacaatat gtccatatgg 6120tgcactctca gtacaatctg
ctctgatgcc gcatagttaa gccagccccg acacccgcca 6180acacccgctg
acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct
6240gtgaccgtct ccgggagctg catgtgtcag aggttttcac cgtcatcacc
gaaacgcgcg 6300agaggaaagg gcctcgtgat acgcctattt ttataggtta
atgtcatgat aataatggtt 6360tcttagacgt caggtggcac ttttcgggga
aatgtgcgcg gaacccctat ttgtttattt 6420ttctaaatac attcaaatat
gtatccgctc atgagacaat aaccctgata aatgcttcaa 6480taatattgaa
aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt
6540tttgcggcat tttgccttcc tgtttttgct cacccagaaa cgctggtgaa
agtaaaagat 6600gctgaagatc agttgggtgc acgagtgggt tacatcgaac
tggatctcaa cagcggtaag 6660atccttgaga gttttcgccc cgaagaacgt
tttccaatga tgagcacttt taaagttctg 6720ctatgtggcg cggtattatc
ccgtattgac gccgggcaag agcaactcgg tcgccgcata 6780cactattctc
agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat
6840ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa
cactgcggcc 6900aacttacttc tgacaacgat cggaggaccg aaggagctaa
ccgctttttt gcacaacatg 6960ggggatcatg taactcgcct tgatcgttgg
gaaccggagc tgaatgaagc cataccaaac 7020gacgagcgtg acaccacgat
gcctgtagca atggcaacaa cgttgcgcaa actattaact 7080ggcgaactac
ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa
7140gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc
tgataaatct
7200ggagccggtg agcgtgggtc tcgcggtatc attgcagcac tggggccaga
tggtaagccc 7260tcccgtatcg tagttatcta cacgacgggg agtcaggcaa
ctatggatga acgaaataga 7320cagatcgctg agataggtgc ctcactgatt
aagcattggt aactgtcaga ccaagtttac 7380tcatatatac tttagatgat
ttaaaacttc atttttaatt taaaaggatc taggtgaaga 7440tcctttttga
taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
7500cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg
cgcgtaatct 7560gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt
ttgtttgccg gatcaagagc 7620taccaactct ttttccgaag gtaactggct
tcagcagagc gcagatacca aatactgtcc 7680ttctagtgta gccgtagtta
ggccaccact tcaagaactc tgtagcaccg cctacatacc 7740tcgctctgct
aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
7800ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga
acggggggtt 7860cgtgcacaca gcccagcttg gagcgaacga cctacaccga
actgagatac ctacagcgtg 7920agcattgaga aagcgccacg cttcccgaag
ggagaaaggc ggacaggtat ccggtaagcg 7980gcagggtcgg aacaggagag
cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 8040atagtcctgt
cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
8100gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc
ctggcctttt 8160gctggccttt tgctcacatg ttctttcctg cgttatcccc
tgattctgtg gataaccgta 8220ttaccgcctt tgagtgagct gataccgctc
gccgcagccg aacgaccgag cgcagcgagt 8280cagtgagcga ggaagcggaa
gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 8340cgattcatta
atgcaggtta acctggctta tcgaaattaa tacgactcac tatagggaga
8400ccggcagatc gatctgtcga 842078415DNAUnknown OrganismDescription
of Unknown Organism pTRABacHuLCHC1 DNA sequence 7gcagttcgtt
gacgccttcc tccgtgtggc cgaacacgtc gagcgggtgg tcgatgacca 60gcggcgtgcc
gcacgcgacg cacaagtatc tgtacaccga atgatcgtcg ggcgaaggca
120cgtcggcctc caagtggcaa tattggcaaa ttcgaaaata tatacagttg
ggttgtttgc 180gcatatctat cgtggcgttg ggcatgtacg tccgaacgtt
gatttgcatg caagccgaaa 240ttaaatcatt gcgattagtg cgattaaaac
gttgtacatc ctcgctttta atcatgccgt 300cgattaaatc gcgcaatcga
gtcaagtgat caaagtgtgg aataatgttt tctttgtatt 360cccgagtcaa
gcgcagcgcg tattttaaca aactagccat cttgtaagtt agtttcattt
420aatgcaactt tatccaataa tatattatgt atcgcacgtc aagaattaac
aatgcgcccg 480ttgtcgcatc tcaacacgac tatgatagag atcaaataaa
gcgcgaatta aatagcttgc 540gacgcaacgt gcacgatctg tgcacgcgtt
ccggcacgag ctttgattgt aataagtttt 600tacgaagcga tgacatgacc
cccgtagtga caacgatcac gcccaaaaga actgccgact 660acaaaattac
cgagtatgtc ggtgacgtta aaactattaa gccatccaat cgaccgttag
720tcgaatcagg accgctggtg cgagaagccg cgaagtatgg cgaatgcatc
gtataacgtg 780tggagtccgc tcattagagc gtcatgttta gacaagaaag
ctacatattt aattgatccc 840gatgatttta ttgataaatt gaccctaact
ccatacacgg tattctacaa tggcggggtt 900ttggtcaaaa tttccggact
gcgattgtac atgctgttaa cggctccgcc cactattaat 960gaaattaaaa
attccaattt taaaaaacgc agcaagagaa acatttgtat gaaagaatgc
1020gtagaaggaa agaaaaatgt cgtcgacatg ctgaacaaca agattaatat
gcctccgtgt 1080ataaaaaaaa tattgaacga tttgaaagaa aacaatgtac
cgcgcggcgg tatgtacagg 1140aagaggttta tactaaactg ttacattgca
aacgtggttt cgtgtgccaa gtgtgaaaac 1200cgatgtttaa tcaaggctct
gacgcatttc tacaaccacg actccaagtg tgtgggtgaa 1260gtcatgcatc
ttttaatcaa atcccaagat gtgtataaac caccaaactg ccaaaaaatg
1320aaaactgtcg acaagctctg tccgtttgct ggcaactgca agggtctcaa
tcctatttgt 1380aattattgaa taataaaaca attataaatg ctaaatttgt
tttttattaa cgatacaaac 1440caaacgcaac aagaacattt gtagtattat
ctataattga aaacgcgtag ttataatcgc 1500tgaggtaata tttaaaatca
ttttcaaatg attcacagtt aatttgcgac aatataattt 1560tattttcaca
taaactagac gccttgtcgt cttcttcttc gtattccttc tctttttcat
1620ttttctcctc ataaaaatta acatagttat tatcgtatcc atatatgtat
ctatcgtata 1680gagtaaattt tttgttgtca taaatatata tgtctttttt
aatggggtgt atagtaccgc 1740tgcgcatagt ttttctgtaa tttacaacag
tgctattttc tggtagttct tcggagtgtg 1800ttgctttaat tattaaattt
atataatcaa tgaatttggg atcgtcggtt ttgtacaata 1860tgttgccggc
atagtacgca gcttcttcta gttcaattac accatttttt agcagcaccg
1920gattaacata actttccaaa atgttgtacg aaccgttaaa caaaaacagt
tcacctccct 1980tttctatact attgtctgcg agcagttgtt tgttgttaaa
aataacagcc attgtaatga 2040gacgcacaaa ctaatatcac aaactggaaa
tgtctatcaa tatatagttg ctgatatctc 2100cccagcatgc ctgctattgt
cttcccaatc ctcccccttg ctgtcctgcc ccaccccacc 2160ccccagaata
gaatgacacc tactcagaca atgcgatgca atttcctcat tttattagga
2220aaggacagtg ggagtggcac cttccagggt caaggaaggc acgggggagg
ggcaaacaac 2280agatggctgg caactagaag gcacagtcga ggctgatcag
cgagctctag tctagactat 2340tatttacccg gagacaggga gaggctcttc
tgcgtgtagt ggttgtgcag agcctcatgc 2400atcacggagc atgagaagac
gttcccctgc tgccacctgc tcttgtccac ggtgagcttg 2460ctgtagagga
agaaggagcc gtcggagtcc agcacgggag gcgtggtctt gtagttgttc
2520tccggctgcc cattgctctc ccactccacg gcgatgtcgc tgggatagaa
gcctttgacc 2580aggcaggtca ggctgacctg gttcttggtc agctcatccc
gggatggggg cagggtgtac 2640acctgtggtt ctcggggctg ccctttggct
ttggagatgg ttttctcgat gggggctggg 2700agggctttgt tggagacctt
gcacttgtac tccttgccat tcagccagtc ctggtgcagg 2760acggtgagga
cgctgaccac acggtacgtg ctgttgtact gctcctcccg cggctttgtc
2820ttggcattat gcacctccac gccgtccacg taccagttga acttgacctc
agggtcttcg 2880tggctcacgt ccaccaccac gcatgtgacc tcaggggtcc
gggagatcat gagggtgtcc 2940ttgggttttg gggggaagag gaagactgac
ggtcccccca ggagttcagg tgctgggcac 3000ggtgggcatg tgtgagtttt
gtcacaagat ttgggctcaa ctttcttgtc caccttggtg 3060ttgctgggct
tgtgattcac gttgcagatg taggtctggg tgcccaagct gctggagggc
3120acggtcacca cgctgctgag ggagtagagt cctgaggact gtaggacagc
cgggaaggtg 3180tgcacgccgc tggtcagggc gcctgagttc cacgacaccg
tcaccggttc ggggaagtag 3240tccttgacca ggcagcccag ggccgctgtg
cccccagagg tgctcttgga ggagggtgcc 3300agggggaaga ccgatgggcc
cactagtgca acgttgacta agaatttcat gcggccgcgt 3360acgattgtaa
ataaaatgta atttacagta tagtatttta attaatatac aaatgatttg
3420ataataattc ttatttaact ataatatatt gtgttgggtt gaattaaagg
tcccggcatc 3480ctcaaatgca taatatcata gtcccccttg ttgtaagtga
tgcgtatttc tgaatctttg 3540taaaatagca cacaggactc caacgcgttt
ggcgttttat tttcttgctc gaggatatca 3600tggagataat taaaatgata
accatctcgc aaataaataa gtattttact gttttcgtaa 3660cagttttgta
ataaaaaaac ctataaatat tccggattat tcataccgtc ccaccatcgg
3720gcgtgctagc ggatccatgg tgggaccctg catgctgctg ctgctgctgc
tgctaggcct 3780cacccagtgt cactctgttc ccgccctcct ctgaggagct
tcaagccaac aaggccacac 3840tggtgtgtct cataagtgac ttctacccgg
gagccgtgac agtggcctgg aaggcagata 3900gcagccccgt caaggcggga
gtggagacca ccacaccctc caaacaaagc aacaacaagt 3960acgcggccag
cagctacctg agcctgacgc ctgagcagtg gaagtcccac aaaagctaca
4020gctgccaggt cacgcatgaa gggagcaccg tggagaagac agtggcccct
acagaatgtt 4080catagtaaaa gcttgtcgtt ggatggaaag gaaaagagtt
ctacagggaa acttggaccc 4140gcttcatgga agacagcttc cccattgtta
acgaccaaga agtgatggat gttttccttg 4200ttgtcaacat gcgtcccact
agacccaacc gttgttacaa attcctggcc caacacgctc 4260tgcgttgcga
ccccgactat gtacctcatg acgtgattag gatcgtcgag ccttcatggg
4320tgggcagcaa caacgagtac cgcatcagcc tggctaagaa gggcggcggc
tgcccaataa 4380tgaaccttca ctctgagtac accaactcgt tcgaacagtt
catcgatcgt gtcatctggg 4440agaacttcta caagcccatc gtttacatcg
gtaccgactc tgctgaagag gaggaaattc 4500tccttgaagt ttccctggtg
ttcaaagtaa aggagtttgc accagacgca cctctgttca 4560ctggtccggc
gtattaaaac acgatacatt gttattagta catttattaa gcgctagatt
4620ctgtgcgttg ttgatttaca gacaattgtt gtacgtattt taataattca
ttaaatttat 4680aatctttagg gtggtatgtt agagcgaaaa tcaaatgatt
ttcagcgtct ttatatctga 4740atttaaatat taaatcctca atagatttgt
aaaataggtt tcgattagtt tcaaacaagg 4800gttgtttttc cgaaccgatg
gctggactat ctaatggatt ttcgctcaac gccacaaaac 4860ttgccaaatc
ttgtagcagc aatctagctt tgtcgatatt cgtttgtgtt ttgttttgta
4920ataaaggttc gacgtcgttc aaaatattat gcgcttttgt atttctttca
tcactgtcgt 4980tagtgtacaa ttgactcgac gtaaacacgt taaataaagc
tagcttggac atatttaaca 5040tcgggcgtgt tagctttatt aggccgatta
tcgtcgtcgt cccaaccctc gtcgttagaa 5100gttgcttccg aagacgattt
tgccatagcc acacgacgcc tattaattgt gtcggctaac 5160acgtccgcga
tcaaatttgt agttgagctt tttggaatta tttctgattg cgggcgtttt
5220tgggcgggtt tcaatctaac tgtgcccgat tttaattcag acaacacgtt
agaaagcgat 5280ggtgcaggcg gtggtaacat ttcagacggc aaatctacta
atggcggcgg tggtggagct 5340gatgataaat ctaccatcgg tggaggcgca
ggcggggctg gcggcggagg cggaggcgga 5400ggtggtggcg gtgatgcaga
cggcggttta ggctcaaatg tctctttagg caacacagtc 5460ggcacctcaa
ctattgtact ggtttcgggc gccgtttttg gtttgaccgg tctgagacga
5520gtgcgatttt tttcgtttct aatagcttcc aacaattgtt gtctgtcgtc
taaaggtgca 5580gcgggttgag gttccgtcgg cattggtgga gcgggcggca
attcagacat cgatggtggt 5640ggtggtggtg gaggcgctgg aatgttaggc
acgggagaag gtggtggcgg cggtgccgcc 5700ggtataattt gttctggttt
agtttgttcg cgcacgattg tgggcaccgg cgcaggcgcc 5760gctggctgca
caacggaagg tcgtctgctt cgaggcagcg cttggggtgg tggcaattca
5820atattataat tggaatacaa atcgtaaaaa tctgctataa gcattgtaat
ttcgctatcg 5880tttaccgtgc cgatatttaa caaccgctca atgtaagcaa
ttgtattgta aagagattgt 5940ctcaagctcc gcacgccgat aacaagcctt
ttcattttta ctacagcatt gtagtggcga 6000gacacttcgc tgtcgtcgac
tcgagttcta tagtgtcacc taaatcgtat gtgtatgata 6060cataaggtta
tgtattaatt gtagccgcgt tctaacgaca atatgtccat atggtgcact
6120ctcagtacaa tctgctctga tgccgcatag ttaagccagc cccgacaccc
gccaacaccc 6180gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg
cttacagaca agctgtgacc 6240gtctccggga gctgcatgtg tcagaggttt
tcaccgtcat caccgaaacg cgcgagagga 6300aagggcctcg tgatacgcct
atttttatag gttaatgtca tgataataat ggtttcttag 6360acgtcaggtg
gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa
6420atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct
tcaataatat 6480tgaaaaagga agagtatgag tattcaacat ttccgtgtcg
cccttattcc cttttttgcg 6540gcattttgcc ttcctgtttt tgctcaccca
gaaacgctgg tgaaagtaaa agatgctgaa 6600gatcagttgg gtgcacgagt
gggttacatc gaactggatc tcaacagcgg taagatcctt 6660gagagttttc
gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt
6720ggcgcggtat tatcccgtat tgacgccggg caagagcaac tcggtcgccg
catacactat 6780tctcagaatg acttggttga gtactcacca gtcacagaaa
agcatcttac ggatggcatg 6840acagtaagag aattatgcag tgctgccata
accatgagtg ataacactgc ggccaactta 6900cttctgacaa cgatcggagg
accgaaggag ctaaccgctt ttttgcacaa catgggggat 6960catgtaactc
gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag
7020cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt
aactggcgaa 7080ctacttactc tagcttcccg gcaacaatta atagactgga
tggaggcgga taaagttgca 7140ggaccacttc tgcgctcggc ccttccggct
ggctggttta ttgctgataa atctggagcc 7200ggtgagcgtg ggtctcgcgg
tatcattgca gcactggggc cagatggtaa gccctcccgt 7260atcgtagtta
tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc
7320gctgagatag gtgcctcact gattaagcat tggtaactgt cagaccaagt
ttactcatat 7380atactttaga ttgatttaaa acttcatttt taatttaaaa
ggatctaggt gaagatcctt 7440tttgataatc tcatgaccaa aatcccttaa
cgtgagtttt cgttccactg agcgtcagac 7500cccgtagaaa agatcaaagg
atcttcttga gatccttttt ttctgcgcgt aatctgctgc 7560ttgcaaacaa
aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca
7620actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac
tgtccttcta 7680gtgtagccgt agttaggcca ccacttcaag aactctgtag
caccgcctac atacctcgct 7740ctgctaatcc tgttaccagt ggctgctgcc
agtggcgata agtcgtgtct taccgggttg 7800gactcaagac gatagttacc
ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 7860acacagccca
gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcat
7920tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt
aagcggcagg 7980gtcggaacag gagagcgcac gagggagctt ccagggggaa
acgcctggta tctttatagt 8040cctgtcgggt ttcgccacct ctgacttgag
cgtcgatttt tgtgatgctc gtcagggggg 8100cggagcctat ggaaaaacgc
cagcaacgcg gcctttttac ggttcctggc cttttgctgg 8160ccttttgctc
acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc
8220gcctttgagt gagctgatac cgctcgccgc agccgaacga ccgagcgcag
cgagtcagtg 8280agcgaggaag cggaagagcg cccaatacgc aaaccgcctc
tccccgcgcg ttggccgatt 8340cattaatgca ggttaacctg gcttatcgaa
attaatacga ctcactatag ggagaccggc 8400agatcgatct gtcga
8415846DNAArtificial SequenceDescription of Artificial Sequence
Primer 8cagatcacta gtttttatgg tcgtgtacat ttcttacatc tatgcg
46934DNAArtificial SequenceDescription of Artificial Sequence
Primer 9ctgagtaggc ctgaggctac agctctccct gggc 341023DNAArtificial
SequenceDescription of Artificial Sequence Primer 10ggaagtagtc
cttgaccagg cag 231125DNAArtificial SequenceDescription of
Artificial Sequence Primer 11gggaaaaggg ttgggcccga tgcac
251226DNAArtificial SequenceDescription of Artificial Sequence
Primer 12gatgaagaca cttggtgcag ccacag 261334DNAArtificial
SequenceDescription of Artificial Sequence Primer 13ggaacagagt
gacactgggt gcagccttgg gctg 3414 140001537DNAArtificial
SequenceDescription of Artificial Sequence Primer 15actagtgcaa
cgttgactaa gaatttcatg cggccgc 371637DNAArtificial
SequenceDescription of Artificial Sequence Primer 16gcggccgcat
gaaattctta gtcaacgttg cactagt 371760DNAArtificial
SequenceDescription of Artificial Sequence Primer 17gcggatccat
ggtgggaccc tgcatgctgc tgctgctgct gctgctaggc ctggaattcc
601860DNAArtificial SequenceDescription of Artificial Sequence
Primer 18ggaattccag gcctagcagc agcagcagca gcagcatgca gggtcccacc
atggatccgc 601937DNAArtificial SequenceDescription of Artificial
Sequence Primer 19tgtgactagt atgtatcggc ccatcggtct tccccct
372035DNAArtificial SequenceDescription of Artificial Sequence
Primer 20tttctagact attatttacc cggagacagg gagag 352143DNAArtificial
SequenceDescription of Artificial Sequence Primer 21ctaggcctat
gtatcaccaa gtgtcttcat cttcccgcca tct 432236DNAArtificial
SequenceDescription of Artificial Sequence Primer 22cccaagcttc
tattaacact ctcccctgtt gaagct 3623 2300024 240002518DNAArtificial
SequenceDescription of Artificial Sequence Primer 25aaatgataac
catctcgc 182624DNAArtificial SequenceDescription of Artificial
Sequence Primer 26tttactgttt tcgtaacagt tttg 242722DNAArtificial
SequenceDescription of Artificial Sequence Primer 27ttggagggcg
ttatccacct tc 222821DNAArtificial SequenceDescription of Artificial
Sequence Primer 28ctgtaaatca acaacgcaca g 212920DNAArtificial
SequenceDescription of Artificial Sequence Primer 29caacaacgca
cagaatctag 203024DNAArtificial SequenceDescription of Artificial
Sequence Primer 30gggaccttta attcaaccca acac 243123DNAArtificial
SequenceDescription of Artificial Sequence Primer 31aaacgcgttg
gagtcttgtg tgc 233223DNAArtificial SequenceDescription of
Artificial Sequence Primer 32ggaagtagtc cttgaccagg cag
233322DNAArtificial SequenceDescription of Artificial Sequence
Primer 33ctgagttcca cgacaccgtc ac 223423DNAArtificial
SequenceDescription of Artificial Sequence Primer 34tagagtcctg
aggactgtag gac 233523DNAArtificial SequenceDescription of
Artificial Sequence Primer 35ggtcgttaac aatggggaag ctg
233624DNAArtificial SequenceDescription of Artificial Sequence
Primer 36tttactgttt tcgtaacagt tttg 243723DNAArtificial
SequenceDescription of Artificial Sequence Primer 37ggtcgttaac
aatggggaag ctg 233822DNAArtificial SequenceDescription of
Artificial Sequence Primer 38tcaccatgga ctggacctgg ag
223925DNAArtificial SequenceDescription of Artificial Sequence
Primer 39accatggaca tactttgttc cacgc 254025DNAArtificial
SequenceDescription of Artificial Sequence Primer 40accatggaca
cactttgctc cacgc 254123DNAArtificial SequenceDescription of
Artificial Sequence Primer 41accatggagt ttgggctgag ctg
234223DNAArtificial SequenceDescription of Artificial Sequence
Primer 42accatggaac tggggctccg ctg 234327DNAArtificial
SequenceDescription of Artificial Sequence Primer 43aagaacatga
aacacctgtg gttcttc 274423DNAArtificial SequenceDescription of
Artificial Sequence Primer 44atcatggggt caaccgccat cct
234524DNAArtificial SequenceDescription of Artificial Sequence
Primer 45acaatgtctg tctccttcct catc 244621DNAArtificial
SequenceDescription of Artificial Sequence Primer 46acatgagggt
ccccgctcag c 214722DNAArtificial SequenceDescription of Artificial
Sequence Primer 47tcagctcctg gggctgctaa tg 224822DNAArtificial
SequenceDescription of Artificial Sequence Primer 48cttcctcctg
ctactctggc tc 224923DNAArtificial SequenceDescription of Artificial
Sequence Primer 49gcagacccag gtcttcattt ctc 235022DNAArtificial
SequenceDescription of Artificial Sequence Primer 50ccaggttcac
ctcctcagct tc 225122DNAArtificial SequenceDescription of Artificial
Sequence Primer 51ggtttctgct gctctgggtt cc 225221DNAArtificial
SequenceDescription of Artificial Sequence Primer 52tcactgyrca
gggtcctggg c 215321DNAArtificial SequenceDescription of Artificial
Sequence Primer 53actcaggrca caggrtcctg g 215423DNAArtificial
SequenceDescription of Artificial
Sequence Primer 54ttgcttactg cacaggatcc gtg 235524DNAArtificial
SequenceDescription of Artificial Sequence Primer 55cttgctcact
ttacaggttc tgtg 245624DNAArtificial SequenceDescription of
Artificial Sequence Primer 56ctcactcttt gcataggttc tgtg
245724DNAArtificial SequenceDescription of Artificial Sequence
Primer 57tcaacctcta cacaggctct attg 245824DNAArtificial
SequenceDescription of Artificial Sequence Primer 58ctcactctct
gcacagkctc tgwg 245924DNAArtificial SequenceDescription of
Artificial Sequence Primer 59cattttctcc acaggtctct gtgc
246022DNAArtificial SequenceDescription of Artificial Sequence
Primer 60cctccactgs acagggtctc tc 226122DNAArtificial
SequenceDescription of Artificial Sequence Primer 61ctctcactgc
acaggttccc tc 226222DNAArtificial SequenceDescription of Artificial
Sequence Primer 62cgctcactgc acaggttctt gg 226322DNAArtificial
SequenceDescription of Artificial Sequence Primer 63cttgctgccc
agggtccaat tc 226424DNAArtificial SequenceDescription of Artificial
Sequence Primer 64tgcttatgga tcaggagtgg attc 246522DNAArtificial
SequenceDescription of Artificial Sequence Primer 65cagtctcctc
acagggtccc tc 226623DNAArtificial SequenceDescription of Artificial
Sequence Primer 66tcactcactc tgcagtgtca gtg 236770DNAArtificial
SequenceDescription of Artificial Sequence Primer 67cagatcacta
gtttttatgg tcgtgtacat ttcttacatc tatgcggaga tgaaattggt 60ggagtctggg
706857DNAArtificial SequenceDescription of Artificial Sequence
Primer 68ctgagtaggc ctgaggctac agctctccct gggcgaagtt gtgttgactc
agtctcc 576922DNAArtificial SequenceDescription of Artificial
Sequence Primer 69ctgagttcca cgacaccgtc ac 227023DNAArtificial
SequenceDescription of Artificial Sequence Primer 70gggaattctc
acaggagacg agg 237122DNAArtificial SequenceDescription of
Artificial Sequence Primer 71ttggagggcg ttatccacct tc
227224DNAArtificial SequenceDescription of Artificial Sequence
Primer 72gaagtcactt atgagacaca ccag 247323DNAArtificial
SequenceDescription of Artificial Sequence Primer 73ggaagtagtc
cttgaccagg cag 237425DNAArtificial SequenceDescription of
Artificial Sequence Primer 74gggaaaaggg ttgggcccga tgcac
257525DNAArtificial SequenceDescription of Artificial Sequence
Primer 75gggaaaaggg ttgggcccga tgcac 257634DNAArtificial
SequenceDescription of Artificial Sequence Primer 76ggaacagagt
gacactgggt gcagccttgg gctg 347766DNAArtificial SequenceDescription
of Artificial Sequence Primer 77tgccgtcggc aggaggtatt tcattatgac
tgtctccttg ctattatgaa cattctgtag 60gggcca 667836DNAArtificial
SequenceDescription of Artificial Sequence Primer 78gtcagcccaa
ggctgcaccc agtgtcactc tgttcc 367939DNAArtificial
SequenceDescription of Artificial Sequence Primer 79cgtatcaagc
ttttactatg aacattctgt aggggccac 398016DNAArtificial
SequenceDescription of Artificial Sequence Primer 80cctttgataa
caccca 168113DNAArtificial SequenceDescription of Artificial
Sequence Primer 81gtgttatcaa agg 138217DNAArtificial
SequenceDescription of Artificial Sequence Primer 82ctagtttgat
aagggcc 17839DNAArtificial SequenceDescription of Artificial
Sequence Primer 83cttatcaaa 98416DNAArtificial SequenceDescription
of Artificial Sequence Primer 84cctttgataa caccaa 1685
8500086371DNAHomo sapiens 86gacatgttgt tggtggaatc ggggggaggc
ctggtccagc cgggggagtc cctgagactc 60tcctgtgtgg cctctagatt cacctttaga
acgttttgga tgacctgggt ccgccaactt 120ccagggaagg ggctggagtg
ggtggccaat ataaatcaag atggcagtca gacgtatcat 180gcggactctg
taaagggccg atttaccatc tccagagaca acggcaggaa ctccctattt
240ttacaaatga caagtctgag agtcgcggac acggctatat attactgtgc
gactaatgaa 300acgtccagtg gcctggactg ctggggccaa ggaaccctgg
tcactgtctc ctcagcttcc 360accaagggcc c 37187349DNAHomo sapiens
87gaaatcgtgt tgacacagtc tccagccacc ctgtcttcgt ctccaggaga cagagtcgcc
60ctctcctgca gggccagtca gagtgtaaga agttacttaa gttggtatca acagaaggct
120ggccaggctc ccaggctcct catccataat gcatccagta gggccactgg
catcccgccc 180agattcagtg gcagtgggtc tgggacagac ttcactctca
ccatcagtcg cctagagact 240gaagatgctg cagtttatta ctgtcagcaa
ctttatttct ggcctccgat attatttttc 300ggccctggga ccaaagtgaa
tatcacacga actgtggctg caccaagtg 3498824DNAArtificial
SequenceDescription of Artificial Sequence Primer 88gaagtcactt
atgagacaca ccag 24899182DNAArtificial SequenceDescription of
Artificial Sequence Plasmid pTRABac/9F12 DNA sequence 89gcagttcgtt
gacgccttcc tccgtgtggc cgaacacgtc gagcgggtgg tcgatgacca 60gcggcgtgcc
gcacgcgacg cacaagtatc tgtacaccga atgatcgtcg ggcgaaggca
120cgtcggcctc caagtggcaa tattggcaaa ttcgaaaata tatacagttg
ggttgtttgc 180gcatatctat cgtggcgttg ggcatgtacg tccgaacgtt
gatttgcatg caagccgaaa 240ttaaatcatt gcgattagtg cgattaaaac
gttgtacatc ctcgctttta atcatgccgt 300cgattaaatc gcgcaatcga
gtcaagtgat caaagtgtgg aataatgttt tctttgtatt 360cccgagtcaa
gcgcagcgcg tattttaaca aactagccat cttgtaagtt agtttcattt
420aatgcaactt tatccaataa tatattatgt atcgcacgtc aagaattaac
aatgcgcccg 480ttgtcgcatc tcaacacgac tatgatagag atcaaataaa
gcgcgaatta aatagcttgc 540gacgcaacgt gcacgatctg tgcacgcgtt
ccggcacgag ctttgattgt aataagtttt 600tacgaagcga tgacatgacc
cccgtagtga caacgatcac gcccaaaaga actgccgact 660acaaaattac
cgagtatgtc ggtgacgtta aaactattaa gccatccaat cgaccgttag
720tcgaatcagg accgctggtg cgagaagccg cgaagtatgg cgaatgcatc
gtataacgtg 780tggagtccgc tcattagagc gtcatgttta gacaagaaag
ctacatattt aattgatccc 840gatgatttta ttgataaatt gaccctaact
ccatacacgg tattctacaa tggcggggtt 900ttggtcaaaa tttccggact
gcgattgtac atgctgttaa cggctccgcc cactattaat 960gaaattaaaa
attccaattt taaaaaacgc agcaagagaa acatttgtat gaaagaatgc
1020gtagaaggaa agaaaaatgt cgtcgacatg ctgaacaaca agattaatat
gcctccgtgt 1080ataaaaaaaa tattgaacga tttgaaagaa aacaatgtac
cgcgcggcgg tatgtacagg 1140aagaggttta tactaaactg ttacattgca
aacgtggttt cgtgtgccaa gtgtgaaaac 1200cgatgtttaa tcaaggctct
gacgcatttc tacaaccacg actccaagtg tgtgggtgaa 1260gtcatgcatc
ttttaatcaa atcccaagat gtgtataaac caccaaactg ccaaaaaatg
1320aaaactgtcg acaagctctg tccgtttgct ggcaactgca agggtctcaa
tcctatttgt 1380aattattgaa taataaaaca attataaatg ctaaatttgt
tttttattaa cgatacaaac 1440caaacgcaac aagaacattt gtagtattat
ctataattga aaacgcgtag ttataatcgc 1500tgaggtaata tttaaaatca
ttttcaaatg attcacagtt aatttgcgac aatataattt 1560tattttcaca
taaactagac gccttgtcgt cttcttcttc gtattccttc tctttttcat
1620ttttctcctc ataaaaatta acatagttat tatcgtatcc atatatgtat
ctatcgtata 1680gagtaaattt tttgttgtca taaatatata tgtctttttt
aatggggtgt atagtaccgc 1740tgcgcatagt ttttctgtaa tttacaacag
tgctattttc tggtagttct tcggagtgtg 1800ttgctttaat tattaaattt
atataatcaa tgaatttggg atcgtcggtt ttgtacaata 1860tgttgccggc
atagtacgca gcttcttcta gttcaattac accatttttt agcagcaccg
1920gattaacata actttccaaa atgttgtacg aaccgttaaa caaaaacagt
tcacctccct 1980tttctatact attgtctgcg agcagttgtt tgttgttaaa
aataacagcc attgtaatga 2040gacgcacaaa ctaatatcac aaactggaaa
tgtctatcaa tatatagttg ctgatatctc 2100cccagcatgc ctgctattgt
cttcccaatc ctcccccttg ctgtcctgcc ccaccccacc 2160ccccagaata
gaatgacacc tactcagaca atgcgatgca atttcctcat tttattagga
2220aaggacagtg ggagtggcac cttccagggt caaggaaggc acgggggagg
ggcaaacaac 2280agatggctgg caactagaag gcacagtcga ggctgatcag
cgagctctag tctagactat 2340tatttacccg gagacaggga gaggctcttc
tgcgtgtagt ggttgtgcag agcctcatgc 2400atcacggagc atgagaagac
gttcccctgc tgccacctgc tcttgtccac ggtgagcttg 2460ctgtagagga
agaaggagcc gtcggagtcc agcacgggag gcgtggtctt gtagttgttc
2520tccggctgcc cattgctctc ccactccacg gcgatgtcgc tgggatagaa
gcctttgacc 2580aggcaggtca ggctgacctg gttcttggtc agctcatccc
gggatggggg cagggtgtac 2640acctgtggtt ctcggggctg ccctttggct
ttggagatgg ttttctcgat gggggctggg 2700agggctttgt tggagacctt
gcacttgtac tccttgccat tcagccagtc ctggtgcagg 2760acggtgagga
cgctgaccac acggtacgtg ctgttgtact gctcctcccg cggctttgtc
2820ttggcattat gcacctccac gccgtccacg taccagttga acttgacctc
agggtcttcg 2880tggctcacgt ccaccaccac gcatgtgacc tcaggggtcc
gggagatcat gagggtgtcc 2940ttgggttttg gggggaagag gaagactgac
ggtcccccca ggagttcagg tgccggtggg 3000catgtgtgag ttttgtcaca
agatttgggc tcaactttct tgtccacctt ggtgttgctg 3060ggcttgtgat
tcacgttgca gatgtaggtc tgggtgccca agctgctgga gggcacggtc
3120accacgctgc tgagggagta gagtcctgag gactgtagga cagccgggaa
ggtgtgcacg 3180ccgctggtca gggcgcctga gttccacgac accgtcaccg
gttcggggaa gtagtccttg 3240accaggcagc ccagggccgc tgtgccccca
gaggtgctct tggaggaggg tgccaggggg 3300aagaccgatg ggcccttggt
ggaggctgag gagacggtga ccagggttcc ctggccccag 3360gagtcaaagt
agtagtgggc cagccactgt tttcccgctt tcgcacagta ataaacggcc
3420gtgtcctcgg ctctcaggct gttcaagtgc agatatagcg tgttcatgga
attgtctctg 3480gagatggtca atcggcccgt cacggagtct gcataatatg
tggtagttcc tctagcacta 3540atagccgcga cccactccag ccccatccct
ggagcctggc ggacccagct catggcatag 3600ctgctaaagc tgaatccaga
ggctgcacag gagagtctca cggacccccc aggctgtacc 3660aagcctcccc
cagactgcac cagctgcacc tcgtccgcat agatgtaaga aatgtacacg
3720accataaaaa ctagtgcaac gttgactaag aatttcatgc ggccgcgtac
gattgtaaat 3780aaaatgtaat ttacagtata gtattttaat taatatacaa
atgatttgat aataattctt 3840atttaactat aatatattgt gttgggttga
attaaaggtc ccggcatcct caaatgcata 3900atatcatagt cccccttgtt
gtaagtgatg cgtatttctg aatctttgta aaatagcaca 3960caggactcca
acgcgtttgg cgttttattt tcttgctcga ggatatcatg gagataatta
4020aaatgataac catctcgcaa ataaataagt attttactgt tttcgtaaca
gttttgtaat 4080aaaaaaacct ataaatattc cggattattc ataccgtccc
accatcgggc gtgctagcgg 4140atccatggtg ggaccctgca tgctgctgct
gctgctgctg ctaggcctga ggctacagct 4200ctccctgggc atcgacatcc
agatgaccca gtctccatcc tccctgtctg catctgtagg 4260agacagagtc
atcatcactt gccgggcaag tcagagtatt agcacctatt taaattggta
4320tcagcagaaa ccagggaaag cccctaaact cctgatctat tatgcaacca
atttgcaaag 4380tggggtccca tcaaggttca gtggcagtgg atctgggaca
gatttcactc tcaccatcag 4440cagtctgcaa cctgaagatt ttgcgactta
ttattgtcaa cagagttcca acaccgtcac 4500tttcggccct gggaccaaag
tggatatgaa gactgtggct gcaccaagtg tcttcatctt 4560cccgccatct
gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc tgctgaataa
4620cttctatccc agagaggcca aagtacagtg gaaggtggat aacgccctcc
aatcgggtaa 4680ctcccaggag agtgtcacag agcaggacag caaggacagc
acctacagcc tcagcagcac 4740cctgacgctg agcaaagcag actacgagaa
acacaaagtc tacgcctgcg aagtcaccca 4800tcagggcctg agctcgcccg
tcacaaagag cttcaacagg ggagagtgtt aatagaagct 4860tgtcgttgga
tggaaaggaa aagagttcta cagggaaact tggacccgct tcatggaaga
4920cagcttcccc attgttaacg accaagaagt gatggatgtt ttccttgttg
tcaacatgcg 4980tcccactaga cccaaccgtt gttacaaatt cctggcccaa
cacgctctgc gttgcgaccc 5040cgactatgta cctcatgacg tgattaggat
cgtcgagcct tcatgggtgg gcagcaacaa 5100cgagtaccgc atcagcctgg
ctaagaaggg cggcggctgc ccaataatga accttcactc 5160tgagtacacc
aactcgttcg aacagttcat cgatcgtgtc atctgggaga acttctacaa
5220gcccatcgtt tacatcggta ccgactctgc tgaagaggag gaaattctcc
ttgaagtttc 5280cctggtgttc aaagtaaagg agtttgcacc agacgcacct
ctgttcactg gtccggcgta 5340ttaaaacacg atacattgtt attagtacat
ttattaagcg ctagattctg tgcgttgttg 5400atttacagac aattgttgta
cgtattttaa taattcatta aatttataat ctttagggtg 5460gtatgttaga
gcgaaaatca aatgattttc agcgtcttta tatctgaatt taaatattaa
5520atcctcaata gatttgtaaa ataggtttcg attagtttca aacaagggtt
gtttttccga 5580accgatggct ggactatcta atggattttc gctcaacgcc
acaaaacttg ccaaatcttg 5640tagcagcaat ctagctttgt cgatattcgt
ttgtgttttg ttttgtaata aaggttcgac 5700gtcgttcaaa atattatgcg
cttttgtatt tctttcatca ctgtcgttag tgtacaattg 5760actcgacgta
aacacgttaa ataaagctag cttggacata tttaacatcg ggcgtgttag
5820ctttattagg ccgattatcg tcgtcgtccc aaccctcgtc gttagaagtt
gcttccgaag 5880acgattttgc catagccaca cgacgcctat taattgtgtc
ggctaacacg tccgcgatca 5940aatttgtagt tgagcttttt ggaattattt
ctgattgcgg gcgtttttgg gcgggtttca 6000atctaactgt gcccgatttt
aattcagaca acacgttaga aagcgatggt gcaggcggtg 6060gtaacatttc
agacggcaaa tctactaatg gcggcggtgg tggagctgat gataaatcta
6120ccatcggtgg aggcgcaggc ggggctggcg gcggaggcgg aggcggaggt
ggtggcggtg 6180atgcagacgg cggtttaggc tcaaatgtct ctttaggcaa
cacagtcggc acctcaacta 6240ttgtactggt ttcgggcgcc gtttttggtt
tgaccggtct gagacgagtg cgattttttt 6300cgtttctaat agcttccaac
aattgttgtc tgtcgtctaa aggtgcagcg ggttgaggtt 6360ccgtcggcat
tggtggagcg ggcggcaatt cagacatcga tggtggtggt ggtggtggag
6420gcgctggaat gttaggcacg ggagaaggtg gtggcggcgg tgccgccggt
ataatttgtt 6480ctggtttagt ttgttcgcgc acgattgtgg gcaccggcgc
aggcgccgct ggctgcacaa 6540cggaaggtcg tctgcttcga ggcagcgctt
ggggtggtgg caattcaata ttataattgg 6600aatacaaatc gtaaaaatct
gctataagca ttgtaatttc gctatcgttt accgtgccga 6660tatttaacaa
ccgctcaatg taagcaattg tattgtaaag agattgtctc aagctccgca
6720cgccgataac aagccttttc atttttacta cagcattgta gtggcgagac
acttcgctgt 6780cgtcgactcg agttctatag tgtcacctaa atcgtatgtg
tatgatacat aaggttatgt 6840attaattgta gccgcgttct aacgacaata
tgtccatatg gtgcactctc agtacaatct 6900gctctgatgc cgcatagtta
agccagcccc gacacccgcc aacacccgct gacgcgccct 6960gacgggcttg
tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct
7020gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gagaggaaag
ggcctcgtga 7080tacgcctatt tttataggtt aatgtcatga taataatggt
ttcttagacg tcaggtggca 7140cttttcgggg aaatgtgcgc ggaaccccta
tttgtttatt tttctaaata cattcaaata 7200tgtatccgct catgagacaa
taaccctgat aaatgcttca ataatattga aaaaggaaga 7260gtatgagtat
tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc
7320ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat
cagttgggtg 7380cacgagtggg ttacatcgaa ctggatctca acagcggtaa
gatccttgag agttttcgcc 7440ccgaagaacg ttttccaatg atgagcactt
ttaaagttct gctatgtggc gcggtattat 7500cccgtattga cgccgggcaa
gagcaactcg gtcgccgcat acactattct cagaatgact 7560tggttgagta
ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat
7620tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt
ctgacaacga 7680tcggaggacc gaaggagcta accgcttttt tgcacaacat
gggggatcat gtaactcgcc 7740ttgatcgttg ggaaccggag ctgaatgaag
ccataccaaa cgacgagcgt gacaccacga 7800tgcctgtagc aatggcaaca
acgttgcgca aactattaac tggcgaacta cttactctag 7860cttcccggca
acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc
7920gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt
gagcgtgggt 7980ctcgcggtat cattgcagca ctggggccag atggtaagcc
ctcccgtatc gtagttatct 8040acacgacggg gagtcaggca actatggatg
aacgaaatag acagatcgct gagataggtg 8100cctcactgat taagcattgg
taactgtcag accaagttta ctcatatata ctttagattg 8160atttaaaact
tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca
8220tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc
gtagaaaaga 8280tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat
ctgctgcttg caaacaaaaa 8340aaccaccgct accagcggtg gtttgtttgc
cggatcaaga gctaccaact ctttttccga 8400aggtaactgg cttcagcaga
gcgcagatac caaatactgt ccttctagtg tagccgtagt 8460taggccacca
cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt
8520taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac
tcaagacgat 8580agttaccgga taaggcgcag cggtcgggct gaacgggggg
ttcgtgcaca cagcccagct 8640tggagcgaac gacctacacc gaactgagat
acctacagcg tgagcattga gaaagcgcca 8700cgcttcccga agggagaaag
gcggacaggt atccggtaag cggcagggtc ggaacaggag 8760agcgcacgag
ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc
8820gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg
agcctatgga 8880aaaacgccag caacgcggcc tttttacggt tcctggcctt
ttgctggcct tttgctcaca 8940tgttctttcc tgcgttatcc cctgattctg
tggataaccg tattaccgcc tttgagtgag 9000ctgataccgc tcgccgcagc
cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg 9060aagagcgccc
aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcaggt
9120taacctggct tatcgaaatt aatacgactc actataggga gaccggcaga
tcgatctgtc 9180ga 9182908435DNAUnknown OrganismDescription of
Unknown Organism pTRABacHuLCHC1 DNA sequence 90gcagttcgtt
gacgccttcc tccgtgtggc cgaacacgtc gagcgggtgg tcgatgacca 60gcggcgtgcc
gcacgcgacg cacaagtatc tgtacaccga atgatcgtcg ggcgaaggca
120cgtcggcctc caagtggcaa tattggcaaa ttcgaaaata tatacagttg
ggttgtttgc 180gcatatctat cgtggcgttg ggcatgtacg tccgaacgtt
gatttgcatg caagccgaaa 240ttaaatcatt gcgattagtg cgattaaaac
gttgtacatc ctcgctttta atcatgccgt 300cgattaaatc gcgcaatcga
gtcaagtgat caaagtgtgg aataatgttt tctttgtatt 360cccgagtcaa
gcgcagcgcg tattttaaca aactagccat cttgtaagtt agtttcattt
420aatgcaactt tatccaataa tatattatgt atcgcacgtc aagaattaac
aatgcgcccg 480ttgtcgcatc tcaacacgac tatgatagag atcaaataaa
gcgcgaatta aatagcttgc 540gacgcaacgt gcacgatctg tgcacgcgtt
ccggcacgag ctttgattgt aataagtttt 600tacgaagcga tgacatgacc
cccgtagtga caacgatcac gcccaaaaga actgccgact 660acaaaattac
cgagtatgtc ggtgacgtta aaactattaa gccatccaat cgaccgttag
720tcgaatcagg accgctggtg cgagaagccg cgaagtatgg cgaatgcatc
gtataacgtg 780tggagtccgc tcattagagc gtcatgttta gacaagaaag
ctacatattt aattgatccc 840gatgatttta ttgataaatt gaccctaact
ccatacacgg tattctacaa tggcggggtt 900ttggtcaaaa
tttccggact gcgattgtac atgctgttaa cggctccgcc cactattaat
960gaaattaaaa attccaattt taaaaaacgc agcaagagaa acatttgtat
gaaagaatgc 1020gtagaaggaa agaaaaatgt cgtcgacatg ctgaacaaca
agattaatat gcctccgtgt 1080ataaaaaaaa tattgaacga tttgaaagaa
aacaatgtac cgcgcggcgg tatgtacagg 1140aagaggttta tactaaactg
ttacattgca aacgtggttt cgtgtgccaa gtgtgaaaac 1200cgatgtttaa
tcaaggctct gacgcatttc tacaaccacg actccaagtg tgtgggtgaa
1260gtcatgcatc ttttaatcaa atcccaagat gtgtataaac caccaaactg
ccaaaaaatg 1320aaaactgtcg acaagctctg tccgtttgct ggcaactgca
agggtctcaa tcctatttgt 1380aattattgaa taataaaaca attataaatg
ctaaatttgt tttttattaa cgatacaaac 1440caaacgcaac aagaacattt
gtagtattat ctataattga aaacgcgtag ttataatcgc 1500tgaggtaata
tttaaaatca ttttcaaatg attcacagtt aatttgcgac aatataattt
1560tattttcaca taaactagac gccttgtcgt cttcttcttc gtattccttc
tctttttcat 1620ttttctcctc ataaaaatta acatagttat tatcgtatcc
atatatgtat ctatcgtata 1680gagtaaattt tttgttgtca taaatatata
tgtctttttt aatggggtgt atagtaccgc 1740tgcgcatagt ttttctgtaa
tttacaacag tgctattttc tggtagttct tcggagtgtg 1800ttgctttaat
tattaaattt atataatcaa tgaatttggg atcgtcggtt ttgtacaata
1860tgttgccggc atagtacgca gcttcttcta gttcaattac accatttttt
agcagcaccg 1920gattaacata actttccaaa atgttgtacg aaccgttaaa
caaaaacagt tcacctccct 1980tttctatact attgtctgcg agcagttgtt
tgttgttaaa aataacagcc attgtaatga 2040gacgcacaaa ctaatatcac
aaactggaaa tgtctatcaa tatatagttg ctgatatctc 2100cccagcatgc
ctgctattgt cttcccaatc ctcccccttg ctgtcctgcc ccaccccacc
2160ccccagaata gaatgacacc tactcagaca atgcgatgca atttcctcat
tttattagga 2220aaggacagtg ggagtggcac cttccagggt caaggaaggc
acgggggagg ggcaaacaac 2280agatggctgg caactagaag gcacagtcga
ggctgatcag cgagctctag tctagactat 2340tatttacccg gagacaggga
gaggctcttc tgcgtgtagt ggttgtgcag agcctcatgc 2400atcacggagc
atgagaagac gttcccctgc tgccacctgc tcttgtccac ggtgagcttg
2460ctgtagagga agaaggagcc gtcggagtcc agcacgggag gcgtggtctt
gtagttgttc 2520tccggctgcc cattgctctc ccactccacg gcgatgtcgc
tgggatagaa gcctttgacc 2580aggcaggtca ggctgacctg gttcttggtc
agctcatccc gggatggggg cagggtgtac 2640acctgtggtt ctcggggctg
ccctttggct ttggagatgg ttttctcgat gggggctggg 2700agggctttgt
tggagacctt gcacttgtac tccttgccat tcagccagtc ctggtgcagg
2760acggtgagga cgctgaccac acggtacgtg ctgttgtact gctcctcccg
cggctttgtc 2820ttggcattat gcacctccac gccgtccacg taccagttga
acttgacctc agggtcttcg 2880tggctcacgt ccaccaccac gcatgtgacc
tcaggggtcc gggagatcat gagggtgtcc 2940ttgggttttg gggggaagag
gaagactgac ggtcccccca ggagttcagg tgctgggcac 3000ggtgggcatg
tgtgagtttt gtcacaagat ttgggctcaa ctttcttgtc caccttggtg
3060ttgctgggct tgtgattcac gttgcagatg taggtctggg tgcccaagct
gctggagggc 3120acggtcacca cgctgctgag ggagtagagt cctgaggact
gtaggacagc cgggaaggtg 3180tgcacgccgc tggtcagggc gcctgagttc
cacgacaccg tcaccggttc ggggaagtag 3240tccttgacca ggcagcccag
ggccgctgtg cccccagagg tgctcttgga ggagggtgcc 3300agggggaaga
ccgatgggcc cttatcaaac tagtgcaacg ttgactaaga atttcatgcg
3360gccgcgtacg attgtaaata aaatgtaatt tacagtatag tattttaatt
aatatacaaa 3420tgatttgata ataattctta tttaactata atatattgtg
ttgggttgaa ttaaaggtcc 3480cggcatcctc aaatgcataa tatcatagtc
ccccttgttg taagtgatgc gtatttctga 3540atctttgtaa aatagcacac
aggactccaa cgcgtttggc gttttatttt cttgctcgag 3600gatatcatgg
agataattaa aatgataacc atctcgcaaa taaataagta ttttactgtt
3660ttcgtaacag ttttgtaata aaaaaaccta taaatattcc ggattattca
taccgtccca 3720ccatcgggcg tgctagcgga tccatggtgg gaccctgcat
gctgctgctg ctgctgctgc 3780taggcctttg ataacaccaa gtgtcttcat
cttcccgcca tctgatgagc agttgaaatc 3840tggaactgcc tctgttgtgt
gcctgctgaa taacttctat cccagagagg ccaaagtaca 3900gtggaaggtg
gataacgccc tccaatcggg taactcccag gagagtgtca cagagcagga
3960cagcaaggac agcacctaca gcctcagcag caccctgacg ctgagcaaag
cagactacga 4020gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc
ctgagctcgc ccgtcacaaa 4080gagcttcaac aggggagagt gttaatagaa
gcttgtcgtt ggatggaaag gaaaagagtt 4140ctacagggaa acttggaccc
gcttcatgga agacagcttc cccattgtta acgaccaaga 4200agtgatggat
gttttccttg ttgtcaacat gcgtcccact agacccaacc gttgttacaa
4260attcctggcc caacacgctc tgcgttgcga ccccgactat gtacctcatg
acgtgattag 4320gatcgtcgag ccttcatggg tgggcagcaa caacgagtac
cgcatcagcc tggctaagaa 4380gggcggcggc tgcccaataa tgaaccttca
ctctgagtac accaactcgt tcgaacagtt 4440catcgatcgt gtcatctggg
agaacttcta caagcccatc gtttacatcg gtaccgactc 4500tgctgaagag
gaggaaattc tccttgaagt ttccctggtg ttcaaagtaa aggagtttgc
4560accagacgca cctctgttca ctggtccggc gtattaaaac acgatacatt
gttattagta 4620catttattaa gcgctagatt ctgtgcgttg ttgatttaca
gacaattgtt gtacgtattt 4680taataattca ttaaatttat aatctttagg
gtggtatgtt agagcgaaaa tcaaatgatt 4740ttcagcgtct ttatatctga
atttaaatat taaatcctca atagatttgt aaaataggtt 4800tcgattagtt
tcaaacaagg gttgtttttc cgaaccgatg gctggactat ctaatggatt
4860ttcgctcaac gccacaaaac ttgccaaatc ttgtagcagc aatctagctt
tgtcgatatt 4920cgtttgtgtt ttgttttgta ataaaggttc gacgtcgttc
aaaatattat gcgcttttgt 4980atttctttca tcactgtcgt tagtgtacaa
ttgactcgac gtaaacacgt taaataaagc 5040tagcttggac atatttaaca
tcgggcgtgt tagctttatt aggccgatta tcgtcgtcgt 5100cccaaccctc
gtcgttagaa gttgcttccg aagacgattt tgccatagcc acacgacgcc
5160tattaattgt gtcggctaac acgtccgcga tcaaatttgt agttgagctt
tttggaatta 5220tttctgattg cgggcgtttt tgggcgggtt tcaatctaac
tgtgcccgat tttaattcag 5280acaacacgtt agaaagcgat ggtgcaggcg
gtggtaacat ttcagacggc aaatctacta 5340atggcggcgg tggtggagct
gatgataaat ctaccatcgg tggaggcgca ggcggggctg 5400gcggcggagg
cggaggcgga ggtggtggcg gtgatgcaga cggcggttta ggctcaaatg
5460tctctttagg caacacagtc ggcacctcaa ctattgtact ggtttcgggc
gccgtttttg 5520gtttgaccgg tctgagacga gtgcgatttt tttcgtttct
aatagcttcc aacaattgtt 5580gtctgtcgtc taaaggtgca gcgggttgag
gttccgtcgg cattggtgga gcgggcggca 5640attcagacat cgatggtggt
ggtggtggtg gaggcgctgg aatgttaggc acgggagaag 5700gtggtggcgg
cggtgccgcc ggtataattt gttctggttt agtttgttcg cgcacgattg
5760tgggcaccgg cgcaggcgcc gctggctgca caacggaagg tcgtctgctt
cgaggcagcg 5820cttggggtgg tggcaattca atattataat tggaatacaa
atcgtaaaaa tctgctataa 5880gcattgtaat ttcgctatcg tttaccgtgc
cgatatttaa caaccgctca atgtaagcaa 5940ttgtattgta aagagattgt
ctcaagctcc gcacgccgat aacaagcctt ttcattttta 6000ctacagcatt
gtagtggcga gacacttcgc tgtcgtcgac tcgagttcta tagtgtcacc
6060taaatcgtat gtgtatgata cataaggtta tgtattaatt gtagccgcgt
tctaacgaca 6120atatgtccat atggtgcact ctcagtacaa tctgctctga
tgccgcatag ttaagccagc 6180cccgacaccc gccaacaccc gctgacgcgc
cctgacgggc ttgtctgctc ccggcatccg 6240cttacagaca agctgtgacc
gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 6300caccgaaacg
cgcgagagga aagggcctcg tgatacgcct atttttatag gttaatgtca
6360tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg
cgcggaaccc 6420ctatttgttt atttttctaa atacattcaa atatgtatcc
gctcatgaga caataaccct 6480gataaatgct tcaataatat tgaaaaagga
agagtatgag tattcaacat ttccgtgtcg 6540cccttattcc cttttttgcg
gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 6600tgaaagtaaa
agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc
6660tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca
atgatgagca 6720cttttaaagt tctgctatgt ggcgcggtat tatcccgtat
tgacgccggg caagagcaac 6780tcggtcgccg catacactat tctcagaatg
acttggttga gtactcacca gtcacagaaa 6840agcatcttac ggatggcatg
acagtaagag aattatgcag tgctgccata accatgagtg 6900ataacactgc
ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt
6960ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg
gagctgaatg 7020aagccatacc aaacgacgag cgtgacacca cgatgcctgt
agcaatggca acaacgttgc 7080gcaaactatt aactggcgaa ctacttactc
tagcttcccg gcaacaatta atagactgga 7140tggaggcgga taaagttgca
ggaccacttc tgcgctcggc ccttccggct ggctggttta 7200ttgctgataa
atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc
7260cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag
gcaactatgg 7320atgaacgaaa tagacagatc gctgagatag gtgcctcact
gattaagcat tggtaactgt 7380cagaccaagt ttactcatat atactttaga
ttgatttaaa acttcatttt taatttaaaa 7440ggatctaggt gaagatcctt
tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 7500cgttccactg
agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt
7560ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg
gtggtttgtt 7620tgccggatca agagctacca actctttttc cgaaggtaac
tggcttcagc agagcgcaga 7680taccaaatac tgtccttcta gtgtagccgt
agttaggcca ccacttcaag aactctgtag 7740caccgcctac atacctcgct
ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 7800agtcgtgtct
taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg
7860gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac
accgaactga 7920gatacctaca gcgtgagcat tgagaaagcg ccacgcttcc
cgaagggaga aaggcggaca 7980ggtatccggt aagcggcagg gtcggaacag
gagagcgcac gagggagctt ccagggggaa 8040acgcctggta tctttatagt
cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 8100tgtgatgctc
gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac
8160ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta
tcccctgatt 8220ctgtggataa ccgtattacc gcctttgagt gagctgatac
cgctcgccgc agccgaacga 8280ccgagcgcag cgagtcagtg agcgaggaag
cggaagagcg cccaatacgc aaaccgcctc 8340tccccgcgcg ttggccgatt
cattaatgca ggttaacctg gcttatcgaa attaatacga 8400ctcactatag
ggagaccggc agatcgatct gtcga 8435918429DNAUnknown
OrganismDescription of Unknown Organism pTRABacHuLCHC1 DNA sequence
91gcagttcgtt gacgccttcc tccgtgtggc cgaacacgtc gagcgggtgg tcgatgacca
60gcggcgtgcc gcacgcgacg cacaagtatc tgtacaccga atgatcgtcg ggcgaaggca
120cgtcggcctc caagtggcaa tattggcaaa ttcgaaaata tatacagttg
ggttgtttgc 180gcatatctat cgtggcgttg ggcatgtacg tccgaacgtt
gatttgcatg caagccgaaa 240ttaaatcatt gcgattagtg cgattaaaac
gttgtacatc ctcgctttta atcatgccgt 300cgattaaatc gcgcaatcga
gtcaagtgat caaagtgtgg aataatgttt tctttgtatt 360cccgagtcaa
gcgcagcgcg tattttaaca aactagccat cttgtaagtt agtttcattt
420aatgcaactt tatccaataa tatattatgt atcgcacgtc aagaattaac
aatgcgcccg 480ttgtcgcatc tcaacacgac tatgatagag atcaaataaa
gcgcgaatta aatagcttgc 540gacgcaacgt gcacgatctg tgcacgcgtt
ccggcacgag ctttgattgt aataagtttt 600tacgaagcga tgacatgacc
cccgtagtga caacgatcac gcccaaaaga actgccgact 660acaaaattac
cgagtatgtc ggtgacgtta aaactattaa gccatccaat cgaccgttag
720tcgaatcagg accgctggtg cgagaagccg cgaagtatgg cgaatgcatc
gtataacgtg 780tggagtccgc tcattagagc gtcatgttta gacaagaaag
ctacatattt aattgatccc 840gatgatttta ttgataaatt gaccctaact
ccatacacgg tattctacaa tggcggggtt 900ttggtcaaaa tttccggact
gcgattgtac atgctgttaa cggctccgcc cactattaat 960gaaattaaaa
attccaattt taaaaaacgc agcaagagaa acatttgtat gaaagaatgc
1020gtagaaggaa agaaaaatgt cgtcgacatg ctgaacaaca agattaatat
gcctccgtgt 1080ataaaaaaaa tattgaacga tttgaaagaa aacaatgtac
cgcgcggcgg tatgtacagg 1140aagaggttta tactaaactg ttacattgca
aacgtggttt cgtgtgccaa gtgtgaaaac 1200cgatgtttaa tcaaggctct
gacgcatttc tacaaccacg actccaagtg tgtgggtgaa 1260gtcatgcatc
ttttaatcaa atcccaagat gtgtataaac caccaaactg ccaaaaaatg
1320aaaactgtcg acaagctctg tccgtttgct ggcaactgca agggtctcaa
tcctatttgt 1380aattattgaa taataaaaca attataaatg ctaaatttgt
tttttattaa cgatacaaac 1440caaacgcaac aagaacattt gtagtattat
ctataattga aaacgcgtag ttataatcgc 1500tgaggtaata tttaaaatca
ttttcaaatg attcacagtt aatttgcgac aatataattt 1560tattttcaca
taaactagac gccttgtcgt cttcttcttc gtattccttc tctttttcat
1620ttttctcctc ataaaaatta acatagttat tatcgtatcc atatatgtat
ctatcgtata 1680gagtaaattt tttgttgtca taaatatata tgtctttttt
aatggggtgt atagtaccgc 1740tgcgcatagt ttttctgtaa tttacaacag
tgctattttc tggtagttct tcggagtgtg 1800ttgctttaat tattaaattt
atataatcaa tgaatttggg atcgtcggtt ttgtacaata 1860tgttgccggc
atagtacgca gcttcttcta gttcaattac accatttttt agcagcaccg
1920gattaacata actttccaaa atgttgtacg aaccgttaaa caaaaacagt
tcacctccct 1980tttctatact attgtctgcg agcagttgtt tgttgttaaa
aataacagcc attgtaatga 2040gacgcacaaa ctaatatcac aaactggaaa
tgtctatcaa tatatagttg ctgatatctc 2100cccagcatgc ctgctattgt
cttcccaatc ctcccccttg ctgtcctgcc ccaccccacc 2160ccccagaata
gaatgacacc tactcagaca atgcgatgca atttcctcat tttattagga
2220aaggacagtg ggagtggcac cttccagggt caaggaaggc acgggggagg
ggcaaacaac 2280agatggctgg caactagaag gcacagtcga ggctgatcag
cgagctctag tctagactat 2340tatttacccg gagacaggga gaggctcttc
tgcgtgtagt ggttgtgcag agcctcatgc 2400atcacggagc atgagaagac
gttcccctgc tgccacctgc tcttgtccac ggtgagcttg 2460ctgtagagga
agaaggagcc gtcggagtcc agcacgggag gcgtggtctt gtagttgttc
2520tccggctgcc cattgctctc ccactccacg gcgatgtcgc tgggatagaa
gcctttgacc 2580aggcaggtca ggctgacctg gttcttggtc agctcatccc
gggatggggg cagggtgtac 2640acctgtggtt ctcggggctg ccctttggct
ttggagatgg ttttctcgat gggggctggg 2700agggctttgt tggagacctt
gcacttgtac tccttgccat tcagccagtc ctggtgcagg 2760acggtgagga
cgctgaccac acggtacgtg ctgttgtact gctcctcccg cggctttgtc
2820ttggcattat gcacctccac gccgtccacg taccagttga acttgacctc
agggtcttcg 2880tggctcacgt ccaccaccac gcatgtgacc tcaggggtcc
gggagatcat gagggtgtcc 2940ttgggttttg gggggaagag gaagactgac
ggtcccccca ggagttcagg tgctgggcac 3000ggtgggcatg tgtgagtttt
gtcacaagat ttgggctcaa ctttcttgtc caccttggtg 3060ttgctgggct
tgtgattcac gttgcagatg taggtctggg tgcccaagct gctggagggc
3120acggtcacca cgctgctgag ggagtagagt cctgaggact gtaggacagc
cgggaaggtg 3180tgcacgccgc tggtcagggc gcctgagttc cacgacaccg
tcaccggttc ggggaagtag 3240tccttgacca ggcagcccag ggccgctgtg
cccccagagg tgctcttgga ggagggtgcc 3300agggggaaga ccgatgggcc
cttatcaaac tagtgcaacg ttgactaaga atttcatgcg 3360gccgcgtacg
attgtaaata aaatgtaatt tacagtatag tattttaatt aatatacaaa
3420tgatttgata ataattctta tttaactata atatattgtg ttgggttgaa
ttaaaggtcc 3480cggcatcctc aaatgcataa tatcatagtc ccccttgttg
taagtgatgc gtatttctga 3540atctttgtaa aatagcacac aggactccaa
cgcgtttggc gttttatttt cttgctcgag 3600gatatcatgg agataattaa
aatgataacc atctcgcaaa taaataagta ttttactgtt 3660ttcgtaacag
ttttgtaata aaaaaaccta taaatattcc ggattattca taccgtccca
3720ccatcgggcg tgctagcgga tccatggtgg gaccctgcat gctgctgctg
ctgctgctgc 3780taggcctttg ataacaccca gtgtcactct gttcccgccc
tcctctgagg agcttcaagc 3840caacaaggcc acactggtgt gtctcataag
tgacttctac ccgggagccg tgacagtggc 3900ctggaaggca gatagcagcc
ccgtcaaggc gggagtggag accaccacac cctccaaaca 3960aagcaacaac
aagtacgcgg ccagcagcta cctgagcctg acgcctgagc agtggaagtc
4020ccacaaaagc tacagctgcc aggtcacgca tgaagggagc accgtggaga
agacagtggc 4080ccctacagaa tgttcatagt aaaagcttgt cgttggatgg
aaaggaaaag agttctacag 4140ggaaacttgg acccgcttca tggaagacag
cttccccatt gttaacgacc aagaagtgat 4200ggatgttttc cttgttgtca
acatgcgtcc cactagaccc aaccgttgtt acaaattcct 4260ggcccaacac
gctctgcgtt gcgaccccga ctatgtacct catgacgtga ttaggatcgt
4320cgagccttca tgggtgggca gcaacaacga gtaccgcatc agcctggcta
agaagggcgg 4380cggctgccca ataatgaacc ttcactctga gtacaccaac
tcgttcgaac agttcatcga 4440tcgtgtcatc tgggagaact tctacaagcc
catcgtttac atcggtaccg actctgctga 4500agaggaggaa attctccttg
aagtttccct ggtgttcaaa gtaaaggagt ttgcaccaga 4560cgcacctctg
ttcactggtc cggcgtatta aaacacgata cattgttatt agtacattta
4620ttaagcgcta gattctgtgc gttgttgatt tacagacaat tgttgtacgt
attttaataa 4680ttcattaaat ttataatctt tagggtggta tgttagagcg
aaaatcaaat gattttcagc 4740gtctttatat ctgaatttaa atattaaatc
ctcaatagat ttgtaaaata ggtttcgatt 4800agtttcaaac aagggttgtt
tttccgaacc gatggctgga ctatctaatg gattttcgct 4860caacgccaca
aaacttgcca aatcttgtag cagcaatcta gctttgtcga tattcgtttg
4920tgttttgttt tgtaataaag gttcgacgtc gttcaaaata ttatgcgctt
ttgtatttct 4980ttcatcactg tcgttagtgt acaattgact cgacgtaaac
acgttaaata aagctagctt 5040ggacatattt aacatcgggc gtgttagctt
tattaggccg attatcgtcg tcgtcccaac 5100cctcgtcgtt agaagttgct
tccgaagacg attttgccat agccacacga cgcctattaa 5160ttgtgtcggc
taacacgtcc gcgatcaaat ttgtagttga gctttttgga attatttctg
5220attgcgggcg tttttgggcg ggtttcaatc taactgtgcc cgattttaat
tcagacaaca 5280cgttagaaag cgatggtgca ggcggtggta acatttcaga
cggcaaatct actaatggcg 5340gcggtggtgg agctgatgat aaatctacca
tcggtggagg cgcaggcggg gctggcggcg 5400gaggcggagg cggaggtggt
ggcggtgatg cagacggcgg tttaggctca aatgtctctt 5460taggcaacac
agtcggcacc tcaactattg tactggtttc gggcgccgtt tttggtttga
5520ccggtctgag acgagtgcga tttttttcgt ttctaatagc ttccaacaat
tgttgtctgt 5580cgtctaaagg tgcagcgggt tgaggttccg tcggcattgg
tggagcgggc ggcaattcag 5640acatcgatgg tggtggtggt ggtggaggcg
ctggaatgtt aggcacggga gaaggtggtg 5700gcggcggtgc cgccggtata
atttgttctg gtttagtttg ttcgcgcacg attgtgggca 5760ccggcgcagg
cgccgctggc tgcacaacgg aaggtcgtct gcttcgaggc agcgcttggg
5820gtggtggcaa ttcaatatta taattggaat acaaatcgta aaaatctgct
ataagcattg 5880taatttcgct atcgtttacc gtgccgatat ttaacaaccg
ctcaatgtaa gcaattgtat 5940tgtaaagaga ttgtctcaag ctccgcacgc
cgataacaag ccttttcatt tttactacag 6000cattgtagtg gcgagacact
tcgctgtcgt cgactcgagt tctatagtgt cacctaaatc 6060gtatgtgtat
gatacataag gttatgtatt aattgtagcc gcgttctaac gacaatatgt
6120ccatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc
cagccccgac 6180acccgccaac acccgctgac gcgccctgac gggcttgtct
gctcccggca tccgcttaca 6240gacaagctgt gaccgtctcc gggagctgca
tgtgtcagag gttttcaccg tcatcaccga 6300aacgcgcgag aggaaagggc
ctcgtgatac gcctattttt ataggttaat gtcatgataa 6360taatggtttc
ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt
6420gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa
ccctgataaa 6480tgcttcaata atattgaaaa aggaagagta tgagtattca
acatttccgt gtcgccctta 6540ttcccttttt tgcggcattt tgccttcctg
tttttgctca cccagaaacg ctggtgaaag 6600taaaagatgc tgaagatcag
ttgggtgcac gagtgggtta catcgaactg gatctcaaca 6660gcggtaagat
ccttgagagt tttcgccccg aagaacgttt tccaatgatg agcactttta
6720aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag
caactcggtc 6780gccgcataca ctattctcag aatgacttgg ttgagtactc
accagtcaca gaaaagcatc 6840ttacggatgg catgacagta agagaattat
gcagtgctgc cataaccatg agtgataaca 6900ctgcggccaa cttacttctg
acaacgatcg gaggaccgaa ggagctaacc gcttttttgc 6960acaacatggg
ggatcatgta actcgccttg atcgttggga accggagctg aatgaagcca
7020taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg
ttgcgcaaac 7080tattaactgg cgaactactt actctagctt cccggcaaca
attaatagac tggatggagg 7140cggataaagt tgcaggacca cttctgcgct
cggcccttcc ggctggctgg tttattgctg 7200ataaatctgg agccggtgag
cgtgggtctc gcggtatcat tgcagcactg gggccagatg 7260gtaagccctc
ccgtatcgta gttatctaca cgacggggag tcaggcaact atggatgaac
7320gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa
ctgtcagacc 7380aagtttactc atatatactt tagattgatt
taaaacttca tttttaattt aaaaggatct 7440aggtgaagat cctttttgat
aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc 7500actgagcgtc
agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc
7560gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt
tgtttgccgg 7620atcaagagct accaactctt tttccgaagg taactggctt
cagcagagcg cagataccaa 7680atactgtcct tctagtgtag ccgtagttag
gccaccactt caagaactct gtagcaccgc 7740ctacatacct cgctctgcta
atcctgttac cagtggctgc tgccagtggc gataagtcgt 7800gtcttaccgg
gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa
7860cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa
ctgagatacc 7920tacagcgtga gcattgagaa agcgccacgc ttcccgaagg
gagaaaggcg gacaggtatc 7980cggtaagcgg cagggtcgga acaggagagc
gcacgaggga gcttccaggg ggaaacgcct 8040ggtatcttta tagtcctgtc
gggtttcgcc acctctgact tgagcgtcga tttttgtgat 8100gctcgtcagg
ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc
8160tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct
gattctgtgg 8220ataaccgtat taccgccttt gagtgagctg ataccgctcg
ccgcagccga acgaccgagc 8280gcagcgagtc agtgagcgag gaagcggaag
agcgcccaat acgcaaaccg cctctccccg 8340cgcgttggcc gattcattaa
tgcaggttaa cctggcttat cgaaattaat acgactcact 8400atagggagac
cggcagatcg atctgtcga 842992120DNAAutographa californica
nucleopolyhedrovirus 92cttttctata ctattgtctg cgagcagttg tttgttgtta
aaaataacag ccattgtaat 60gagacgcaca aactaatatc acaaactgga aatgtctatc
aatatatagt tgctgatatc 12093230DNAAutographa californica
nucleopolyhedrovirus 93tcgagcaaga aaataaaacg ccaaacgcgt tggagtcttg
tgtgctattt tacaaagatt 60cagaaatacg catcacttac aacaaggggg actatgaaat
tatgcatttg aggatgccgg 120gacctttaat tcaacccaac acaatatatt
atagttaaat aagaattatt atcaaatcat 180ttgtatatta attaaaatac
tatactgtaa attacatttt atttacaatc 230
* * * * *
References