U.S. patent application number 13/845468 was filed with the patent office on 2014-10-09 for triple acting antimicrobials that are refractory to resistance development.
This patent application is currently assigned to The United Sates of America, as represented by the Secretary of Agriculture. The applicant listed for this patent is The United Sates of America, as represented by the Secretary of Agriculture. Invention is credited to Stephen C. Becker, David M. Donovan.
Application Number | 20140302004 13/845468 |
Document ID | / |
Family ID | 41570891 |
Filed Date | 2014-10-09 |
United States Patent
Application |
20140302004 |
Kind Code |
A1 |
Donovan; David M. ; et
al. |
October 9, 2014 |
Triple Acting Antimicrobials That Are Refractory To Resistance
Development
Abstract
Multi-drug resistant superbugs are a persistent problem in
modern health care. This invention provides an antimicrobial
endolysin-Lysostaphin triple fusion protein, comprising (1) an
endolysin CHAP endopeptidase domain, (2) an endolysin amidase
domain, and (3) a Lysostaphin glycyl-glycine endopeptidase domain.
The domains are derived from two proteins that show antimicrobial
synergy when used in combination. The protein has specificity and
exolytic activity for the peptidoglycan cell wall of untreated,
live Staphylococcus aureus from many growth phases i.e. stationary,
logarithmic and biofilm growth. The recombinant triple fusion
protein comprising the three functional antimicrobial domains is
designed to be refractory to resistance development.
Inventors: |
Donovan; David M.;
(Baltimore, MD) ; Becker; Stephen C.; (Baltimore,
MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
as represented by the Secretary of Agriculture; The United Sates of
America, |
|
|
US |
|
|
Assignee: |
The United Sates of America, as
represented by the Secretary of Agriculture
Washington
DC
|
Family ID: |
41570891 |
Appl. No.: |
13/845468 |
Filed: |
March 18, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12460812 |
Jul 24, 2009 |
8481289 |
|
|
13845468 |
|
|
|
|
61135810 |
Jul 24, 2008 |
|
|
|
Current U.S.
Class: |
424/94.63 ;
435/220 |
Current CPC
Class: |
C12N 9/52 20130101; A61K
38/48 20130101; C12N 9/80 20130101; A61K 38/50 20130101; C07K
2319/00 20130101; C12N 9/503 20130101; A61K 38/00 20130101 |
Class at
Publication: |
424/94.63 ;
435/220 |
International
Class: |
C12N 9/50 20060101
C12N009/50; A61K 38/50 20060101 A61K038/50; C12N 9/80 20060101
C12N009/80; A61K 38/48 20060101 A61K038/48; C12N 9/52 20060101
C12N009/52 |
Claims
1-17. (canceled)
18. A recombinant antimicrobial Staphylococcus-specific
endolysin-Lysostaphin triple fusion protein, comprising (1) an
endolysin CHAP endopeptidase domain, (2) an endolysin amidase
domain, and (3) a Lysostaphin glycyl-glycine endopeptidase domain,
said protein having specificity and exolytic activity for the
peptidoglycan cell wall of untreated, live Staphylococcus
aureus.
19. The recombinant triple fusion protein of claim 18 wherein each
domain of said protein cuts the peptidoglycan at a different,
unique covalent bond of the peptidoglycan, and each is lytic in the
presence of lysis by the others.
20. The recombinant triple fusion protein of claim 18 wherein the
parental lysin of each domain of the triple fusion protein is
synergistic in antimicrobial activity when the parental lysins of
said domains are used in combination.
21. The protein of claim 18, wherein the endolysin is a LysK
endolysin-derived peptidoglycan hydrolase.
22. The protein of claim 18, wherein the endolysin is a phi11
endolysin-derived peptidoglycan hydrolase.
23. The protein of claim 21 wherein said triple fusion protein
comprises a polypeptide identified by SEQ ID NO:6.
24. The protein of claim 22 wherein said triple fusion protein
comprises a polypeptide identified by SEQ ID NO:14.
25. A recombinant antimicrobial Staphylococcus-specific
endolysin-Lysostaphin triple fusion protein, comprising (1) an
endolysin-derived CHAP endopeptidase domain and (2) an
endolysin-derived amidase domain, and (3) a Lysostaphin
glycyl-glycine endopeptidase domain, said protein having
specificity and exolytic activity for the peptidoglycan cell wall
of untreated, live S. aureus, wherein an endolysin-derived domain
is truncated.
26. The protein of claim 25, wherein the fusion protein has
endopeptidase and amidase activity and does not require a SH3b
binding domain.
27. The protein of claim 25, wherein the fusion protein has
endopeptidase activity and does not require a SH3b binding
domain.
28. The recombinant antimicrobial Staphylococcus-specific
endolysin-Lysostaphin triple fusion protein of claim 25 wherein
said protein comprises a polypeptide identified by SEQ ID NO: 8,
SEQ ID NO:10, or SEQ ID NO:12.
29. A composition useful for the treatment of a disease caused by
multidrug-resistant staphylococci, wherein said composition
comprises the protein of claim 18 and a pharmaceutically acceptable
carrier.
30. A composition useful for the treatment of a disease caused by
staphylococci, wherein said composition comprises the protein of
claim 25 and a pharmaceutically acceptable carrier.
31. A method of treating infection and disease caused by
multidrug-resistant staphylococci in an individual comprising:
administering to said individual an effective dosage of a
composition of claim 18 or claim 25, wherein said composition
comprises a recombinant antimicrobial Staphylococcus-specific
endolysin-Lysostaphin triple fusion protein, comprising (1) an
endolysin CHAP endopeptidase domain, (2) an endolysin amidase
domain, and (3) a Lysostaphin glycyl-glycine endopeptidase domain,
said protein having specificity and exolytic activity for the
peptidoglycan cell wall of untreated, live Staphylococcus aureus,
wherein said administration is effective for the treatment of said
multidrug-resistant staphylococci.
32. A method of treating mastitis in an animal comprising:
administer to said animal an effective dosage of a composition of
claim 18 or claim 25, wherein said composition comprises a
recombinant antimicrobial Staphylococcus-specific
endolysin-Lysostaphin triple fusion protein, comprising (1) an
endolysin CHAP endopeptidase domain, (2) an endolysin amidase
domain, and (3) a Lysostaphin glycyl-glycine endopeptidase domain,
said protein having specificity and exolytic activity for the
peptidoglycan cell wall of untreated, live Staphylococcus aureus,
wherein said administration is effective for reducing the severity
of said mastitis.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/135,810, filed Jul. 24, 2008, which is
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to constructs comprising three
antimicrobial domains each harboring a unique lytic activity: a
CHAP endopeptidase, an amidase, and a glycyl-glycine endopeptidase.
In one embodiment, the CHAP endopeptidase and the amidase are
provided by the peptidoglycan hydrolase, LysK endolysin, and the
glycyl-glycine endopeptidase is provided by another peptidoglycan
hydrolase, Lysostaphin generating a pathogen-specific triple fusion
construct. The LysK endolysin specifically attacks the
peptidoglycan cell wall of untreated, live staphylococci including
S. aureus and methicillin-resistant Staphylococcus aureus (MRSA);
Lysostaphin is a potent anti-staphylococcal bacteriocin. The
constructs comprising the three functional antimicrobial domains
are designed to be refractory to resistance development and can be
used to treat staphylococcal pathogens including multi-drug
resistant strains MRSA and USA300.
[0004] 2. Description of the Relevant Art
[0005] S. aureus is an opportunistic bacterial pathogen responsible
for a diverse spectrum of human and animal diseases. Although S.
aureus may colonize mucosal surfaces of healthy humans, it is also
a major cause of wound infections and has the invasive potential to
induce severe infections, including osteomyelitis, endocarditis,
and bacteremia with metastatic complications (Lowy, F. D. 1998. New
England J. Med. 339: 520-532). Coagulase-negative staphylococci
(CoNS) and S. aureus are the most common pathogens in nosocomial
bacteremias and infections of implanted devices (Gordon et al.
2001. Ann. Thorac. Surg. 72: 725-730; Malani et al. 2002. Clin.
Infect. Dis. 34: 1295-1300. Although methicillin-resistant S.
aureus (MRSA) has classically been regarded as a nosocomial
pathogen, it has emerged as a cause of community-acquired
infections in hosts without predisposing risk factors. Superficial
skin and soft tissue infections caused by MRSA are increasingly
seen in clinical practice. There are limited treatment options
available in terms of topical antimicrobial agents, and some
strains of MRSA have developed resistance to topically applied
antimicrobial agents. MRSA account for 40%-60% of nosocomial S.
aureus infections in the U.S., and many of these strains are
multi-drug resistant. Recent data indicate that more patients in
U.S. hospitals die from MRSA (>18,000 per year) than AIDS
(Klevens et al., 2007. JAMA 298: 1763-1771). MRSA strains with
reduced susceptibility or resistance to vancomycin have also been
reported (Zhu et al. 2008. Antimicrob. Agents Chemother. 52:
452-457). Because S. aureus cannot always be controlled by
antibiotics and because MRSA isolates are becoming increasingly
prevalent in the community, additional control strategies are
sorely needed.
[0006] Peptidoglycan is the major structural component of the
bacterial cell wall and can be up to 40 layers thick, Bacteria have
autolytic peptidoglycan hydrolases that allow the cell to grow and
divide. Another well-studied group of peptidoglycan hydrolase
enzymes are the bacteriophage (viruses that infect bacteria)
endolysins. Endolysins allow the phage to escape from the bacterial
cell during the phage lytic cycle. Some Gram-positive bacteria
exposed to purified phage lysins externally undergo exolysis or
"lysis from without." Use of phage endolysins as antimicrobials has
not been reported for treatment of Gram-negative bacteria,
presumably due to the presence of an outer membrane that prevents
access to the peptidoglycan (Loessner, M. J. 2005. Curr. Opin.
Microbiol. 8: 480-487). Peptidoglycan is unique to bacteria and has
a complex structure (Loessner, supra) with a sugar backbone of
alternating units of N-acetyl glucosamine (GN) and N-acetylmuramic
acid (MN). Each MN residue is amide linked to a short pentapeptide
chain. Characteristic of S. aureus is the pentaglycine bridge that
connects the L-Lys of the stem peptide to the D-Ala at position 4
of a neighboring subunit (FIG. 1). Peptidoglycan hydrolases have
evolved a modular design to deal with this complexity. Although
single domain endolysins can lyse the target pathogen (Sanz et al.
1996. Eur. J. Biochem. 235: 601-605), endolysins can also harbor
two short domains (.about.100-200 amino acids), each encoding a
different peptidoglycan hydrolase activity.
[0007] Three classes of peptidoglycan hydrolase domains have been
identified: endopeptidases, amidases, and glycosidases (includes
glucosaminidase and lysozyme-like muramidases) (Lopez and Garcia.
2004. FEMS Microbiol. Rev. 28: 553-580; FIG. 1). Alignment of
conserved domain sequences from multiple peptidoglycan hydrolase
proteins has identified non-variant amino acid positions that, when
mutated, can destroy the hydrolytic activity of the domain
(Pritchard et al., 2004. Microbiology 150: 2079-2087; Huard et al.
2003. Microbiology 149: 695-705; Bateman and Rawlings. 2003. Trends
Biochem. Sci. 28: 234-237; Rigden at al. 2003. Trends Biochem. Sci.
28: 230-234). Chimeric peptidoglycan hydrolases have been created
by the exchange of cell wall binding domains of two lysins (Croux
et al. 1993. Mol. Microbiol. 9: 1019-1025). Enzymatic activity was
retained and regulatory properties exchanged when the cell wall
binding domains of choline-binding pneumococcal and clostridial
lysins were swapped. Intra-generic chimeric fusion lysins are also
functional (Diaz at al. 1990. Proc. Natl. Acad. Sci. USA 87:
8125-8129).
[0008] Lysostaphin is a bacteriocin secreted by S. simulans, that
lyses S. aureus (Browder et al. 1965. Biochem. Biophys. Res.
Commun. 19: 389). The endopeptidase activity is specific to the
glycyl-glycyl bonds of the staphylococcal peptidoglycan
inter-peptide bridge (FIG. 1). It is known that Lysostaphin can
kill planktonic S. aureus (Walencka et al. 2005. Pol. J. Microbiol.
54: 191-200; Wu at al. 2003. Antimicrob. Agents Chemother. 47:
3407-3414), as well as MRSA (Dajcs et al. 2000. Am. J. Ophthalmol.
130: 544), vancomycin-intermediate S. aureus (Patron et al. 1999.
Antimicrob. Agents Chemother. 43:1754-1755), and other
antibiotic-resistant strains of S. aureus (Peterson et al. 1978. J.
Clin. Invest. 61: 597-609). Lysostaphin can also kill S. aureus
growing in a biofilm (Walencka, supra; Wu, supra), and it exhibits
limited activity against CoNS (Cisani et al. 1982. Antimicrob.
Agents Chemother. 21: 531-535); McCormick at al. 2006. Curr. Eye
Res. 31: 225-230).
[0009] S. simulans produces Lysostaphin and avoids its lytic action
by the product of the Lysostaphin immunity factor (lit) gene [same
as endopeptidase resistance gene (epr) (DeHart et al. 1995. Appl.
Environ. Microbiol. 61: 1475-1479) that resides on a native plasmid
(pACK1) (Thumm and Gotz. 1997. Mol. Microbiol. 23: 1251-1265). The
lif gene product functions by inserting serine residues into the
peptidoglycan cross bridge, thus interfering with the ability of
the glycyl-glycyl endopeptidase to recognize and cleave this
structure. Similarly, mutations in the S. aureus femA gene (factor
essential for methicillin resistance) (Sugai at al. 1997. J.
Bacteriol. 179: 4311-4318) result in a reduction in the
peptidoglycan interpeptide cross bridge from pentaglycine to a
single glycine, rendering S. aureus resistant to the lytic action
of Lysostaphin. MRSA have been shown to mutate femA when exposed in
vitro or in vivo to sub-inhibitory doses of Lysostaphin (Climo et
al. 2001. Antimicrob. Agents Chemother. 45: 1431-1437).
[0010] Grundling et al. identified lyrA (Lysostaphin resistance A)
that, when mutated by a transposon insertion, reduced S. aureus
susceptibility to Lysostaphin (Grundling et al. 2006. J. Bacteriol.
188: 6286-6297). Although some structural changes were noted in
peptidoglycan purified from the mutant, the purified peptidoglycan
was susceptible to Lysostaphin and the phi11 endolysin, suggesting
that changes in accessibility of the enzyme to its substrate may
have rendered the strain Lysostaphin resistant.
[0011] Bacterial resistance to antibiotics usually involves the
acquisition of enzymes that 1) inactivate the antibiotic; 2) reduce
membrane permeability; 3) facilitate active efflux of the
antimicrobial from the cell; 4) modify the target protein to a
resistant form; or 5) produce higher quantities of the target
protein. Alternatively, the original target protein can be 6)
altered via a mutational or recombination event at the endogenous
gene to an antibiotic-resistant form; or 7) the organism can be
protected through the multi-faceted changes that accompany growth
in a biofilm (Spratt, B. G. 1994. Science 264: 388-393).
[0012] The Gram-positive peptidoglycan is on the cell surface,
outside of the cell membrane. Many mechanisms of resistance
development take advantage of the ability to inactivate the
antimicrobial inside the cell. Targets outside the cytoplasmic
membrane reduce the possible mechanisms by which resistance can
emerge (Spratt, supra). Although there have been no reports of
extracellular inactivation of peptidoglycan hydrolase enzymes, S.
aureus does secrete proteases that might degrade peptidoglycan
hydrolases. A regulatory mutation that increases the activity,
synthesis, regulation, or secretion of staphylococcal proteases
(such as sarA (Karisson et al. 2001. Infect. Immun. 69: 4742-4748)
might confer some level of resistance. Similarly, although phi11
and Lysostaphin could digest purified lyrA peptidoglycan, this
mutant is slightly resistant to Lysostaphin, suggesting that
resistance mechanisms could exist due to changes in surface
structures that limit accessibility to the target peptidoglycan
(Grundling, supra). O-acetylation of peptidoglycan N-acetyl muramic
acid residues by an O-acetyltransferase (OatA) results in
resistance to human lysozyme and correlates with heightened
virulence of some S. aureus strains (Bera et al. 2006. Infect.
Immun. 74: 4598-4604).
[0013] Bacteriophage endolysins are relatively new antimicrobials
compared to Lysostaphin, which was described in the 1960's
(Browder, supra). Despite repeated attempts, no strains of bacteria
that can resist lysis by bacteriophage endolysins have been
reported (Loeffler et al. 2001. Science 294: 2170-2172: Schuch et
al. 2002. Nature 418: 884-889; Fischetti, V. A. 2005. Trends.
Microbiol. 13: 491-496). Bacteriophages and bacteria may have
evolved such that phages have selected immutable target
peptidoglycan bonds for cleavage with the endolysin to guarantee
escape from the bacterium.
[0014] The near-species specificity of phage lysins avoids many
pitfalls associated with broad range antimicrobial treatments.
Broad range antimicrobials lead to selection for resistant strains,
not just in the target pathogen, but also in co-resident commensal
bacteria exposed to the drug. The acquisition of antibiotic
resistance is often accomplished by transfer of DNA sequences from
a resistant strain to a susceptible strain. This transfer is not
necessarily species or genus limited, and can lead to commensal
bacteria that are both antibiotic resistant and that can serve as
carriers of these DNA elements for propagation to neighboring
bacteria. Those neighboring strains (potential pathogens) with
newly acquired resistance elements can emerge as antibiotic
resistant strains during future treatment episodes. Thus, in order
to reduce the spread of antibiotic resistance, it is recommended to
avoid subjecting commensal bacterial communities to broad range
antibiotics. Toward this end, FDA, USDA, and CDC promote the
development of antimicrobials that reduce the risk of resistance
development (CDC Action Plan: Retrieved from the Internet: <URL:
www.cdc.gov/drug resistance/actionplan/html/product.htm).
[0015] Endolysins with two active domains are expected to be more
refractory to resistance development since the cell will need to
mutate or modify multiple target bonds to resist the lytic action
of two activities (Fischetti, supra). The use of two bacteriophage
endolysins has been reported to have a synergistic effect in the
killing of streptococcal pathogens both in vitro (Loeffler et al.
2003. Antimicrob. Agents Chemother. 47: 375-377) and in vivo in a
mouse sepsis model (Jado et al. 2003. J. Antimicrob. Chemother. 52:
967-973). This is consistent with synergy and better cure rates
observed in models of S. aureus infections in which animals are
treated with either antibiotics or Lysostaphin plus an antibiotic
(Climo at al. 1998. Antimicrob. Agents Chemother. 42: 1355-1360;
Climo at al. 2001, supra). Synergistic bactericidal activity has
also been demonstrated with an endolysin and an antibiotic against
S. pneumoniae (Djurkovic et al. 2005. Antimicrob. Agents Chemother.
49: 1225-1228).). A recent patent application (Kokai-Kun, J. F.
2003. US 20030211995) indicates there is synergy with Lysostaphin
and the phi11 endolysin or the antibiotic bacitracin against S.
aureus.
[0016] Lysostaphin or endolysin injections can cure bacterial
infections and do not raise an adverse immune response. It has been
reported that Lysostaphin was efficacious in treating S. aureus
animal infections, but the preparation was likely contaminated with
other bacterial antigens, and actual doses were probably less than
those described in the 1960s (reviewed in (Climo at al. 1998,
supra). Lysostaphin has also been used to treat bovine mastitis
(Oldham and Daly. 1991. J. Dairy Sci. 74: 4175-4182). The treatment
effectively cleared the milk of S. aureus, and no deleterious
effects to the animals were reported. Nonetheless, the majority of
Lysostaphin-treated quarters relapsed after treatment ceased.
[0017] Peptidoglycan hydrolases have been proposed for human
antimicrobial applications (Fischetti, V. A. 2003. Ann. N.Y. Acad.
Sci. 987: 207-214; Fischetti 2005, supra; Schuch et al., supra),
and they have demonstrated efficacy in animal models for
eliminating Group B streptococcal colonization (Cheng et al. 2005.
Antimicrob. Agents Chemother. 49: 111-117; Nelson et al., 2001.
Proc. Natl. Acad. Sci. USA 98: 4107-4112), pneumococcal sepsis
(Jado et al., supra), and S. aureus infection of mammary glands in
transgenic mice (Kerr et al. 2001. Nat. Biotechnol. 19: 66-70) and
cows (Wall at al. 2005. Nat. Biotechnol. 23: 445-451). Lysostaphin
significantly increased survival of neonatal rat pups when given
intravenously (IV) at either 30 or 60 min post S. aureus challenge
(Oluola et al. 2007. Antimicrob. Agents Chemother. 51: 2198-2200).
In a recent catheter-induced S. aureus endocarditis model,
Lysostaphin was tolerated by the systemic route with minimal
adverse effects (Climo et al. 1998, supra). Rabbits injected weekly
with Lysostaphin (15 mg/kg) for 9 wks by the IV route produced
serum antibodies that resulted in an eight-fold reduction in its
lytic activity, consistent with earlier work (Schaffner at al.
1967. Yale J. Biol. Med. 39: 230-244), but no adverse immune
response. It is believed that high purity and the absence of
Gram-negative lipopolysaccharide are essential for guaranteeing a
minimal host immune response.
[0018] Serum antibodies raised to phage endolysins specific to
Bacillus anthracis, Streptococcus pyogenes, or Streptococcus
pneumoniae slowed but did not block in vitro killing of the
organism in vivo (Fischetti 2005, supra; Loeffler at al. 2003,
supra). Cpl-1, a S. pneumoniae-specific phage lysin, was injected
IV 3 times per week into mice for 4 wks, and 5 of 6 mice tested
positive for IgG antibodies to Cpl-1. Vaccinated and naive mice
were then challenged IV with pneumococci, and the mice were treated
IV with 200 .mu.g Cpl-1 after 10 h. Bacteremia was reduced within 1
min to the same level in both mouse groups, indicating that the
antibody did not neutralize the enzyme in vivo (Loeffler at al,
2003, supra). Western blot analysis revealed that Cpl-1 and Pal
elicited antibodies 10 d after a 200-.mu.g injection in mice, but
the second injection (at 20 d) also reduced the bacteremia profile
2-3 log units, indicating that the antibodies were not neutralizing
in vivo. All mice recovered fully with no apparent adverse side
effects or anaphylaxis (Jado et al. 2003, supra). A bacteriophage
lysin also cleared streptococci from the blood of rats in an
experimental endocarditis model, although antibody production was
not monitored in this study (Entenza at al. 2005. Infect. Immun.
73: 990-998). Similarly, aqueous preparations of phage lysins have
been proposed for the control of pathogenic bacteria on human
mucous membranes (Fischetti 2003, supra) and mucosal clearing has
been obtained with phage lytic enzymes applied to the murine
vagina, oropharynx (Cheng at al. 2005, supra), and oral cavity
(Nelson at al., supra). The mucosal immune response to these
enzymes was not monitored in any of these studies.
[0019] Thus, S. aureus is a significant pathogen in both
agricultural and human disease. Multi-drug resistant strains have
become more prevalent, especially nosocomial and community acquired
strains, and current antibiotic treatments are often less than 50%
effective. This increased incidence of bacterial antibiotic
resistance has led to a renewed search for novel antimicrobials
that are refractory to resistance development.
SUMMARY OF THE INVENTION
[0020] We have discovered that a triple fusion antimicrobial
protein comprising three different peptidoglycan hydrolase domains
each of which specifically attacks the peptidoglycan cell wall of
live, untreated S. aureus from without, each of which cuts the
peptidoglycan at a different, unique covalent bond of the
peptidoglycan, and each of which is lytic in the presence of lysis
by the others, is a novel antimicrobial polypeptide for the
treatment of infections and disease caused by S. aureus.
[0021] In accordance with this discovery, it is an object of the
invention to provide a triple fusion antimicrobial protein
comprising three different peptidoglycan hydrolase domains each of
which specifically attacks the peptidoglycan cell wall of live,
untreated S. aureus from without, each of which cuts the
peptidoglycan at a different, unique covalent bond of the
peptidoglycan, and each of which is lytic in the presence of lysis
by the others.
[0022] It is also an object of the invention to provide a
recombinant nucleic acid encoding a triple fusion antimicrobial
protein comprising three different peptidoglycan hydrolase domains
each of which specifically attacks the peptidoglycan cell wall of
live, untreated S. aureus from without, each of which cuts the
peptidoglycan at a different, unique covalent bond of the
peptidoglycan, and each of which is lytic in the presence of lysis
by the others.
[0023] It is another object of the invention to provide a triple
fusion antimicrobial protein comprising three different
peptidoglycan hydrolase domains, the parental lysins of each having
been shown to be synergistic in their antimicrobial activity, and
the nucleic acid encoding the triple fusion protein.
[0024] It is a further object of the invention to provide an
antimicrobial LysK endolysin-Lysostaphin triple fusion protein,
comprising (1) a LysK CHAP endopeptidase, (2) a LysK amidase, and
(3) a Lysostaphin glycyl-glycine endopeptidase domain, in which all
three lytic domains are functional, i.e., degrades the
peptidoglycan cell wall of untreated, live Staphylococcus aureus;
and the nucleic acid encoding the protein.
[0025] It is another object of the invention to provide an
antimicrobial phi11 endolysin-Lyso triple fusion protein,
comprising a (1) phi11 CHAP endopeptidase, (2) a phi11 amidase, and
(3) a Lysostaphin glycyl-glycine endopeptidase domain, in which all
three lytic domains are functional, i.e., degrades the
peptidoglycan cell wall of untreated, live Staphylococcus aureus;
and the nucleic acid encoding the protein.
[0026] An added object of the invention is to provide a
pharmaceutical composition comprising the triple fusion
polypeptides according to the invention, each which allows
Staphylococcus-induced disease and infection to be treated.
[0027] An added object of the invention is to provide compositions
useful for the treatment of diseases and infections caused by the
bacteria for which the LysK endolysin and Lysostaphin are specific
where the composition comprises a triple fusion polypeptide having
three peptidoglycan hydrolase domains each of which retains its
property of effectively lysing said bacteria.
[0028] An added object of the invention is method of treating
diseases and infections with the triple fusion polypeptide of the
invention, wherein said diseases and infections are caused by the
bacteria for which the three peptidoglycan hydrolases of the triple
fusion protein are specific.
[0029] A further object of the invention is method of using the
triple fusion polypeptide of the invention to kill S. aureus in
biofilms.
[0030] Also part of this invention is a kit, comprising a
composition for treatment of disease caused by the bacteria for
which the LysK endolysin and Lysostaphin are specific.
[0031] Other objects and advantages of this invention will become
readily apparent from the ensuing description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawing(s) will be provided by the U.S.
Patent and Trademark Office upon request and payment of the
necessary fee.
[0033] FIG. 1 shows the peptidoglycan structure and sites of
hydrolase cleavage. Phi11 hydrolase and Lysostaphin contain domains
encoding peptidoglycan endopeptidases. The Phi11 hydrolase also has
an amidase activity cleaving between the sugar backbone and the
first alanine. LysK cleaves in the exact same locations as the
phi11 endolysin (data described below FIG. 5). Glucosaminidase and
muramidase are examples of glycosidases that cleave between
N-acetyl glucosamine (GN) and N-acetyl muramic acid (MN). Amidases
cleave between the MN and the first amino acid of the peptide. Gram
positive cell walls can have up to 40 layers of this sugar-protein
structure [adapted from (Navarre et al, 1999. J. Biol. Chem. 274:
15847-15856)].
[0034] FIG. 2 is a schematic of five fusion construct preparations
and the two parental peptidoglycan hydrolase enzymes from which
some of the fusions were derived. Each protein is purified via
nickel column chromatography that takes advantage of an engineered
C-terminal 6.times.His tag (white stripes). A pair of amino acids
(LE) are introduced into each construct at the XhoI Restriction
enzyme site immediately prior to the addition of the 6.times.His
tag. His-tagged wild type Lysostaphin (Lyso-His; SEQ ID NO:2) has
just one (glycyl-glycine) endopeptidase domain (blue) and a SH3b
cell wall binding domain (black). His-tagged wild type LysK (Wt
LysK-His; SEQ ID NO:4) has a C-terminal SH3b cell wall binding
domain (grey) and two lytic domains, a CHAP endopeptidase (red) and
an amidase domain (green). Various fusions between LysK and
Lysostaphin have been created, wherein the domain order is shuffled
or deleted, and small restriction site sequences are inserted at
some fusion junctions. LysK-Lyso (SEQ ID NO:6) is a fusion of both
full length proteins with a C-terminal His-tag. 390LysK-Lyso (SEQ
ID NO:8) is derived from the LysK-Lyso fusion but lacks the LysK
SH3b domain. 221LysK-Lyso (SEQ ID NO:10) is lacking both the LysK
SH3b domain and 122 amino acids of the LysK amidase domain.
Lyso-390LysK (SEQ ID NO:12) is the reverse orientation as
390LysK-Lyso and is also lacking the LysK Sh3b domain.
155Lyso-390LysK-LysoSH3b is derived from an insertion of 390-LysK
(less the initial methionine) into Lysostaphin at amino acid 156.
SDS PAGE depicts 5 .mu.g of the nickel purified fusion proteins in
each lane and 32 .mu.g of Kaleidoscope prestained protein ladder
sizing markers (Biorad).
[0035] FIG. 3 depicts the SDS PAGE and zymogram of selected
purified peptidoglycan hydrolases and fusion constructs. All
samples were isolated from plasmid bearing E. coli cultures and
purified via nickel chromatography. Zymogram analysis with S.
aureus (ATCC 29740) cells embedded in the gel. SDS PAGE gel lanes
are presented with corresponding zymogram lanes (indicated as
prime). Each well contains 5 .mu.g of purified protein. Lanes A and
A', Lysostaphin; Lanes B and B', LysK endolysin; Lanes C and C',
.phi.11; Lanes D and D', LysK-Lyso fusion; Lanes E and E',
390LysK-Lyso fusion; Lanes F and F', 221 LysK-Lyso fusion; Lanes G
and G', Lyso-390LysK fusion; Lanes H and H',
155Lyso-390LysK-LysoSh3b fusion; Lanes I and I', .phi.11-Lyso
fusion. The size of the proteins is: Lysostaphin, 66 amino acids,
MW=28.1 kD; LysK, 503 amino acids, MW=55.8 kD; phi11 endolysin, 489
amino acids, MW=55.1 kD; LysK-Lyso fusion, 751 amino acids, MW=83.0
kD; 390LysK-Lyso, 673 amino acids, MW=71.4 kD; 221 LysK-Lyso, 477
amino acids, MW=52.9 kD; Lyso-390LysK, 646 amino acids, MW=71.6 kD;
155Lyso-390LysK-LysoSH3b (SEQ ID NO:30), 646 amino acids, MW+71.6
kD; phi11-Lyso fusion, 677 amino acids, MW=75.4 kD.
[0036] FIG. 4 depicts results of turbidity reduction assays with
four of the fusion proteins and two of the parental lysins. S.
aureus Newman was grown to log phase (0.4-0.6 OD.sub.600 nm),
pelleted, and suspended in 150 mM NaCl, 20 mM Tris pH 7.5 30%
glycerol and frozen at -80 degrees Celsius until time of assay. At
the time of assay, cells were thawed, washed twice with assay
buffer, then resuspended in assay buffer. The assay buffers were
either 150 mM NaCl, 20 mM Tris pH 7.5 (grey bars) or 300 mM NaCl,
20 mM Tris pH 7.5 (black bars). 100 .mu.l of the bacterial
suspension was added to 5 .mu.g of enzyme in 100 .mu.l buffer in a
96 well plate for an initial OD.sub.600 nm of 1.0. The ODs were
measured at 20 sec intervals over 5 min. The maximal activity in
each assay for a 40 second interval is reported with error bars
representing SEM across 3 experiments, each with 3 replicates. To
make comparisons between molecules with different molecular
weights, the specific activities of each enzyme (OD.sub.600
nm/min/.mu.g protein) were corrected for the molarity of the enzyme
solution (.DELTA.OD.sub.600 nm/min/microMolarity).
[0037] FIGS. 5A and B depict electrospray ionization mass spectra
of S. aureus peptidoglycan fragments resulting from digestion with
(A) LysK or (B) LysK-Lyso.
[0038] FIG. 6 depicts the effect of salt and pH on lytic activity
of endolysins, Lysostaphin and fusion constructs in the turbidity
reduction assay. 10 .mu.g of each protein were added to freshly
grown, untreated S. aureus Newman strain resuspended in buffers
containing various salt concentrations at pH7.5 or various pH
buffers containing 150 mM NaCl. Black squares (.box-solid.)
represent Lysostaphin, black triangles (.tangle-solidup.) represent
LysK, grey triangles (.tangle-solidup.) represent the LysK-Lyso
fusion, open triangles (.DELTA.) represent the 390K-Lyso fusion,
black diamonds (.diamond-solid.) represent the Phi11 endolysin, and
open diamonds (.diamond.) represent the Phi11 endolysin-Lyso
fusion. 100 .mu.l of cell resuspension was added to 100 .mu.l of
enzyme and buffer in a 96 well plate to reach an initial OD.sub.600
nm of 1.0. Each sample is repeated in triplicate and the OD is
measured in 20 second intervals for 5 minutes. The maximal activity
in each assay, for a 40 second interval, is reported as
.DELTA.OD.sub.600 nm/min/.mu.g, with error bars representing
standard deviation across experiments.
[0039] FIG. 7 depicts the results of the fusion proteins in plate
lysis assays with S. aureus strain Newman.
[0040] FIG. 8 depicts the Minimum Inhibitory Concentration (MIC) of
fusion proteins with S. aureus Newman.
[0041] FIG. 9 shows bactericidal activity of fusion proteins in rat
blood. CFUs were determined by serial dilution plating of rat blood
following various incubation times with buffer alone (control), or
various concentrations of each of six lytic enzyme constructs. Data
is presented as percent buffer alone control CFUs at the zero
minute time point. Note that the amount of enzyme is variable
between samples. Blue squares (.box-solid.) represent Lysostaphin;
red squares (.box-solid.) represent LysK; purple triangles
(.tangle-solidup.) represent LysK-Lyso fusion; yellow triangles
(.tangle-solidup.) represent 390LysK-Lyso fusion; green triangles
(.tangle-solidup.) represent 221LysK-Lyso fusion; and blue
triangles (.tangle-solidup.) represent Lyso-390LysK fusion; empty
circles (.smallcircle.) represent the buffer only control. (see
FIG. 4 for construct schematics). Error bars represent the standard
deviation of three replicate experiments.
DETAILED DESCRIPTION OF THE INVENTION
[0042] Cell wall peptidoglycan is the major structural component of
bacterial cell walls. Bacterial peptidoglycan has a complex
structure; namely, a sugar backbone of alternating units of
N-acetyl glucosamine (GN) and N-acetyl muramic acid (MN) residues,
cross-linked by oligopeptide attachments at the MNs. Bacteriophage
endolysins are peptidoglycan hydrolase enzymes synthesized by
bacteriophage to help nascent phage escape the host at the end of
the lytic cycle. Through digestion of the peptidoglycan, endolysins
can lyse host bacterial cells with near species specificity, a
characteristic that makes them an excellent source of new
antimicrobial agents. It is believed that the phage and host have
co-evolved, such that there has been no host identified that can
develop resistance to their phage endolysin. Thus, these hydrolases
are a novel source of new antimicrobials with an evolutionary
proven track record in avoiding host resistance mechanisms. They
function from outside the cell thus also reducing the potential
resistance mechanisms that most bacterial cells employ. The
endolysins digest the host cell walls with near-species
specificity. A minimal pathogen target range is a preferred trait
in new antimicrobials as a mechanism to reduce the risk of
resistance development in non-pathogenic commensal strains as often
occurs during broad range antibiotic treatment.
[0043] There are several advantages to the use of enzyme
antimicrobials compared to conventional antibiotics. Phage
endolysins have evolved a modular design to deal with the complex
structure of the bacterial cell wall. One protein can harbor
multiple domains, including both lytic and cell wall binding
domains. Three classes of endolysin domains have been identified
thus far: endopeptidase, glycosidase, and amidase. Any one of these
domains is sufficient to lyse the bacterial target cell. Each has
been localized to short protein domains (.about.100-200 amino
acids). Here, we demonstrate that fusion constructs consisting of
three lytic domains, with specificity to just one genus,
Staphylococcus, maintain all three peptidoglycan digestion
activities in the expressed triple fusion polypeptide. We show that
bacteria cannot evade the effects of three unique peptidoglycan
hydrolase lytic activities simultaneously. Thus, the triple fusion
construct and the resulting triple fusion polypeptide of the
invention represent the first class of Gram positive antimicrobials
that are refractory to resistance development.
[0044] Phi11 hydrolase, LysK and Lysostaphin harbor endopeptidase
domains that are examples of peptidoglycan hydrolase endopeptidases
that cleave peptide bonds. Glucosaminidase and muramidase are
examples of glycosidase that cleave between N-acetyl glucoseamine
(GN) and N-acetyl muramice acid (MN). The phi11 and LysK endolysins
harbor amidase domains that cleave between the MN and the first
amino acid of the peptide region of the peptidoglycan.
[0045] We have taken advantage of the modular nature of
peptidoglycan hydrolase enzymes to create fusion proteins that
harbor three lytic domains and at least one SH3b cell wall binding
domain, each targeting the peptidoglycan bonds of a Gram positive
pathogen (S. aureus). We have chosen three peptidoglycan hydrolase
domains that are known to cleave the peptidoglycan at unique
chemical bonds. The first triple fusion was created by the fusion
of LysK (endolysin from the phage K) and Lysostaphin (a bacteriocin
secreted by Staphylococcus simulans to kill S. aureus). The triple
fusion protein, LysK-Lyso (SEQ ID NO: 6) harbors a CHAP
endopeptidase, amidase and glycyl-glycine endopeptidase activity.
It is generally accepted that no bacteria can avoid the effects of
three antimicrobial domains simultaneously, thus we predict and
demonstrate (data not shown) that our fusions will be refractory to
resistance development. We have also created a second fusion
protein, phi11 endolysin-Lysostaphin (phi11-Lyso; SEQ ID NO:14) and
find a nearly identical set of results with all three lytic domains
active in the final fusion (data not shown).
[0046] Peptidoglycan hydrolases are also important new
antimicrobials because they have been shown to degrade
staphylococcal biofilms. Biofilms are sessile forms of bacterial
colonies that attach to a mechanical or prosthetic device or a
layer of mammalian cells. NIH estimates that 80% of bacterial
infections occur as biofilms
(http://grants.nih.gov/grants/guide/pa-files/PA-06-537.html).
Bacteria in biofilms can be orders of magnitude more resistant to
antibiotic treatment than their planktonic (liquid culture)
counterparts.
[0047] Several mechanisms are thought to contribute to the
antimicrobial resistance associated with biofilms: 1) delayed or
restricted penetration of antimicrobial agents through the biofilm
exopolysaccharide matrix, which might serve as a barrier, an
adsorbent, or a reactant; 2) decreased metabolism and growth rate
of biofilm organisms which resist killing by compounds that only
attack actively growing cells; 3) increased accumulation of
antimicrobial-degrading enzymes; 4) enhanced exchange rates of
genes encoding for resistance; 5) physiological changes due to the
biofilm mode of growth, including "persister" cells which appear to
have altered their physiology in such a way as to disable
programmed cell death; and 6) increased antibiotic tolerance (as
opposed to resistance) through expression of stress response genes,
phase variation, and biofilm specific phenotype development. Most
of these mechanisms are avoided by our peptidoglycan hydrolases
that lyse the cell from outside the cell.
[0048] Biofilms also show heightened resistance to host defense
mechanisms. Cells grown in biofilms express a polymer of
beta-1,6-linked N-acetylglucosamine (PNAG) in large amounts.
Biofilm cultures are believed to exhibit reduced activation of
complement (compared to planktonic cultures), and the aggregation
of bacteria makes them less susceptible to phagocytosis. Altered
gene expression of binding factors, cell surface peptidoglycan,
glycoprotein synthesizing enzymes, and stress related proteins
involved in the detoxification of formate, urea and reactive oxygen
species, are likely factors involved in persistence and resistance
of cells in a biofilm. Treatment with antibiotics, especially
subinhibitory concentrations, can actually foster the formation of
biofilms. There is clearly a current need for enzymes to break down
biofilms for more efficient treatment of biofilm-associated
staphylococcal infections.
[0049] It is known that Lysostaphin can kill cells in biofilms.
Phi11 endolysin was also recently reported to kill staphylococcal
cells in biofilms (Sass and Bierbaum. 2007. Appl. Environ.
Microbial. 73 (1):347-52). We have also shown that LysK can kill
cells in biofilms (data not shown). We anticipate that if all of
the components of our triple fusions are known to kill cells in
biofilms our triple fusion antimicrobials will be similarly
effective.
[0050] According to the present invention, the terms "nucleic acid
molecule", "nucleic acid sequence", "polynucleotide",
"polynucleotide sequence", "nucleic acid fragment", "isolated
nucleic acid fragment" are used interchangeably herein. These terms
encompass nucleotide sequences and the like. A polynucleotide may
be a polymer of RNA or DNA that is single- or double-stranded and
that optionally contains synthetic, non-natural or altered
nucleotide bases. A polynucleotide in the form of a polymer of DNA
may be comprised of one or more segments of cDNA, genomic DNA,
synthetic DNA, or mixtures thereof. This will also include a DNA
sequence for which the codons encoding, for example, the LysK-Lyso
fusion protein according to the invention will have been optimized
according to the host organism in which it will be expressed, these
optimization methods being well known to those skilled in the
art.
[0051] The term "isolated" polynucleotide refers to a
polynucleotide that is substantially free from other nucleic acid
sequences, such as other chromosomal and extrachromosomal DNA and
RNA, that normally accompany or interact with it as found in its
naturally occurring environment. However, isolated polynucleotides
may contain polynucleotide sequences which may have originally
existed as extrachromosomal DNA but exist as a nucleotide insertion
within the isolated polynucleotide. Isolated polynucleotides may be
purified from a host cell in which they naturally occur.
Conventional nucleic acid purification methods known to skilled
artisans may be used to obtain isolated polynucleotides. The term
also embraces recombinant polynucleotides and chemically
synthesized polynucleotides.
[0052] The term "construct" refers to a recombinant nucleic acid,
generally recombinant DNA, that has been generated for the purpose
of the expression of a specific nucleotide sequence(s), or is to be
used in the construction of other recombinant nucleotide sequences.
A "construct" or "chimeric gene construct" refers to a nucleic acid
sequence encoding a protein, operably linked to a promoter and/or
other regulatory sequences.
[0053] The term "operably linked" refers to the association of two
or more nucleic acid fragments on a single nucleic acid fragment so
that the function of one is affected by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of affecting the expression of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of
the promoter) or a DNA sequence and a regulatory sequence(s) are
connected in such a way as to permit gene expression when the
appropriate molecules (e.g., transcriptional activator proteins)
are bound to the regulatory sequence(s).
[0054] "Regulatory sequences" refer to nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence.
[0055] "Promoter" refers to a nucleotide sequence capable of
controlling the expression of a coding sequence or functional RNA.
In general, a coding sequence is located 3' to a promoter sequence.
The promoter sequence consists of proximal and more distal upstream
elements, the latter elements often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence that can
stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter.
[0056] The term "cDNA" refers to all nucleic acids that share the
arrangement of sequence elements found in native mature mRNA
species, where sequence elements are exons and 3' and 5' non-coding
regions. Normally mRNA species have contiguous exons, with the
intervening introns removed by nuclear RNA splicing, to create a
continuous open reading frame encoding the protein. "cDNA" refers
to a DNA that is complementary to and derived from an mRNA
template.
[0057] As used herein, "recombinant" refers to a nucleic acid
molecule which has been obtained by manipulation of genetic
material using restriction enzymes, ligases, and similar genetic
engineering techniques as described by, for example, Sambrook at
al. 1989. Molecular Cloning: A Laboratory Manual, Second Edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. or
DNA Cloning: A Practical Approach, Vol. I and II (Ed. D. N.
Glover), IRL Press, Oxford, 1985. "Recombinant," as used herein,
does not refer to naturally occurring genetic recombinations.
[0058] As used herein, the terms "encoding", "coding", or "encoded"
when used in the context of a specified nucleic acid mean that the
nucleic acid comprises the requisite information to guide
translation of the nucleotide sequence into a specified protein.
The information by which a protein is encoded is specified by the
use of codons. A nucleic acid encoding a protein may comprise
non-translated sequences (e.g., introns) within translated regions
of the nucleic acid or may lack such intervening non-translated
sequences (e.g., as in cDNA).
[0059] A "protein" or "polypeptide" is a chain of amino acids
arranged in a specific order determined by the coding sequence in a
polynucleotide encoding the polypeptide. Each protein or
polypeptide has a unique function.
[0060] The invention includes functional LysK-Lyso fusion protein,
390LysK-Lyso fusion protein, 221 LysK-Lyso fusion protein, Lyso-390
LysK fusion protein, 155Lyso-390 LysK-LysoSH3b fusion protein,
phi11-Lyso fusion protein, and functional fragments thereof, as
well as mutants and variants having the same biological function or
activity. As used herein, the terms "functional fragment", "mutant"
and "variant" refers to a polypeptide which possesses biological
function or activity identified through a defined functional assay
and associated with a particular biologic, morphologic, or
phenotypic alteration in the cell. The term "functional fragments"
refers to all fragments of the lytic domains of the triple fusion
polypeptide of the invention that retain lytic activity and
function to lyse staphylococcal bacteria.
[0061] Modifications of the primary amino acid sequence of the
lytic domains of the invention may result in further mutant or
variant proteins having substantially equivalent activity to the
fusion polypeptides described herein. Such modifications may be
deliberate, as by site-directed mutagenesis, or may occur by
spontaneous changes in amino acid sequences where these changes
produce modified polypeptides having substantially equivalent
activity to the endolysin polypeptides of the triple fusion
polypeptide. Any polypeptides produced by minor modifications of
the endolysin primary amino acid sequence are included herein as
long as the biological activity endolysin is present; e.g., having
a role in pathways leading to lysis of staphylococcal bacteria.
[0062] As used herein, "substantially similar" refers to nucleic
acid fragments wherein changes in one or more nucleotide bases
results in substitution of one or more amino acids, but do not
affect the functional properties of the polypeptide encoded by the
nucleotide sequence. "Substantially similar" also refers to
modifications of the nucleic acid fragments of the instant
invention such as deletion or insertion of nucleotides that do not
substantially affect the functional properties of the resulting
transcript. It is therefore understood that the invention
encompasses more than the specific exemplary nucleotide or amino
acid sequences and includes functional equivalents thereof.
Alterations in a nucleic acid fragment that result in the
production of a chemically equivalent amino acid at a given site,
but do not affect the functional properties of the encoded
polypeptide, are well known in the art. Thus, a codon for the amino
acid alanine, a hydrophobic amino acid, may be substituted by a
codon encoding another less hydrophobic residue, such as glycine,
or a more hydrophobic residue, such as valine, leucine, or
isoleucine. Similarly, changes which result in substitution of one
negatively charged residue for another, such as aspartic acid for
glutamic acid, or one positively charged residue for another, such
as lysine for arginine, can also be expected to produce a
functionally equivalent product. Nucleotide changes which result in
alteration of the N-terminal and C-terminal portions of the
polypeptide molecule would also not be expected to alter the
activity of the polypeptide. Each of the proposed modifications is
well within the routine skill in the art, as is determination of
retention of biological activity of the encoded products.
[0063] Moreover, substantially similar nucleic acid fragments may
also be characterized by their ability to hybridize. Estimates of
such homology are provided by either DNA-DNA or DNA-RNA
hybridization under conditions of stringency as is well understood
by those skilled in the art (1985. Nucleic Acid Hybridization,
Hames and Higgins, Eds., IRL Press, Oxford, U.K.). Stringency
conditions can be adjusted to screen for moderately similar
fragments, such as homologous sequences from distantly related
organisms, to highly similar fragments, such as genes that
duplicate functional enzymes from closely related organisms. An
indication that nucleotide sequences are substantially identical is
if two molecules hybridize to each other under stringent
conditions. Generally, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point (Tm) for
the specific sequence at a defined ionic strength and pH. However,
stringent conditions encompass temperatures in the range of about
1.degree. C. to about 20.degree. C., depending upon the desired
degree of stringency as otherwise qualified herein. Thus, isolated
sequences that encode a LysK-Lyso fusion polypeptide, 390 LysK-Lyso
fusion polypeptide, 221 LysK-Lyso fusion polypeptide, Lyso-390 LysK
fusion polypeptide, 155Lyso-390LysK-LysoSH3b fusion polypeptide,
phi11-Lyso fusion polypeptide and which hybridize under stringent
conditions to the LysK-Lyso fusion polypeptide, 390 LysK-Lyso
fusion polypeptide, 221 LysK-Lyso fusion polypeptide, Lyso-390 LysK
fusion polypeptide, 155Lyso-390LysK-LysoSH3b fusion polypeptide,
phi11-Lyso fusion polypeptide sequences disclosed herein, or to
fragments thereof, are encompassed by the present invention.
[0064] Substantially similar nucleic acid fragments of the instant
invention may also be characterized by the percent identity of the
amino acid sequences that they encode to the amino acid sequences
disclosed herein, as determined by algorithms commonly employed by
those skilled in this art. Methods of alignment of sequences for
comparison are well known in the art. Thus, the determination of
percent identity between any two sequences can be accomplished
using a mathematical algorithm. Non-limiting examples of such
mathematical algorithms are the algorithm of Myers and Miller
(1988. CABIOS 4:11-17), the local homology algorithm of Smith at
al. (1981. Adv. Appl. Math. 2:482); the homology alignment
algorithm of Needleman and Wunsch (1970. J. Mol. Biol. 48:443-453);
the search-for-similarity-method of Pearson and Lipman (1988. Proc.
Natl. Acad. Sol 85:2444-2448; the algorithm of Karlin and Altschul
(1990. Proc. Natl. Acad. Sci. USA 87:2264), modified as in Karlin
and Altschul (1993. Proc. Natl. Acad. Sci. USA 90:5873-5877).
[0065] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Version 8 (available from Genetics Computer Group
(GCG), 575 Science Drive, Madison, Wis., USA). Alignments using
these programs can be performed using the default parameters.
[0066] As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins, it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule.
[0067] As used herein, "percentage of sequence identity" means the
value determined by comparing two optimally aligned sequences over
a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0068] As used herein, "reference sequence" is a defined sequence
used as a basis for sequence comparison. A reference sequence may
be a subset or the entirety of a specified sequence; for example,
as a segment of a full-length cDNA or gene sequence, or the
complete cDNA or gene sequence.
[0069] The term "substantial identity" of polynucleotide sequences
means that a polynucleotide comprises a sequence that has at least
80% sequence identity, preferably at least 85%, more preferably at
least 90%, most preferably at least 95% sequence identity compared
to a reference sequence using one of the alignment programs
described using standard parameters. One of skill in the art will
recognize that these values can be appropriately adjusted to
determine corresponding identity of proteins encoded by two
nucleotide sequences by taking into account codon degeneracy, amino
acid similarity, reading frame positioning, and the like.
Substantial identity of amino acid sequences for these purposes
normally means sequence identity of at least 80%, preferably at
least 85%, more preferably at least 90%, and most preferably at
least 95%. Preferably, optimal alignment is conducted using the
homology alignment algorithm of Needleman et al. (1970. J. Mol.
Biol. 48:443).
[0070] A "substantial portion" of an amino acid or nucleotide
sequence comprises an amino acid or a nucleotide sequence that is
sufficient to afford putative identification of the protein or gene
that the amino acid or nucleotide sequence comprises. Amino acid
and nucleotide sequences can be evaluated either manually by one
skilled in the art, or by using computer-based sequence comparison
and identification tools that employ algorithms such as BLAST. In
general, a sequence of ten or more contiguous amino acids or thirty
or more contiguous nucleotides is necessary in order to putatively
identify a polypeptide or nucleic acid sequence as homologous to a
known protein or gene. Moreover, with respect to nucleotide
sequences, gene-specific oligonucleotide probes comprising 30 or
more contiguous nucleotides may be used in sequence-dependent
methods of gene identification and isolation. In addition, short
oligonucleotides of 12 or more nucleotides may be use as
amplification primers in PCR in order to obtain a particular
nucleic acid fragment comprising the primers. Accordingly, a
"substantial portion" of a nucleotide sequence comprises a
nucleotide sequence that will afford specific identification and/or
isolation of a nucleic acid fragment comprising the sequence. The
instant specification teaches amino acid and nucleotide sequences
encoding polypeptides that comprise a particular plant protein. The
skilled artisan, having the benefit of the sequences as reported
herein, may now use all or a substantial portion of the disclosed
sequences for purposes known to those skilled in this art. Thus,
such a portion represents a "substantial portion" and can be used
to establish "substantial identity", i.e., sequence identity of at
least 80%, compared to the reference sequence. Accordingly, the
instant invention comprises the complete sequences as reported in
the accompanying Sequence Listing, as well as substantial portions
at those sequences as defined above.
[0071] Fragments and variants of the disclosed nucleotide sequences
and proteins encoded thereby are also encompassed by the present
invention. By "fragment" a portion of the nucleotide sequence or a
portion of the amino acid sequence and hence protein encoded
thereby is intended. Fragments of a nucleotide sequence may encode
protein fragments that retain the biological activity of the native
protein and hence have LysK-Lyso fusion polypeptide-, 390 LysK-Lyso
fusion polypeptide-, 221 LysK-Lyso fusion polypeptide-, Lyso-390
LysK fusion polypeptide-, 155Lyso-390LysK-LysoSH3b fusion
polypeptide-, and phi11-Lyso fusion polypeptide-like activity.
Alternatively, fragments of a nucleotide sequence that are useful
as hybridization probes may not encode fragment proteins retaining
biological activity.
[0072] By "variants" substantially similar sequences are intended.
For nucleotide sequences, conservative variants include those
sequences that, because of the degeneracy of the genetic code,
encode the amino acid sequence of one of the LysK-Lyso fusion
polypeptides, 390 LysK-Lyso fusion polypeptides, 221 LysK-Lyso
fusion polypeptides, Lyso-390LysK fusion polypeptides,
155Lyso-390LysK-LysoSH3b fusion polypeptide or phi11-Lyso fusion
polypeptides of the invention. Naturally occurring allelic variants
such as these can be identified with the use of well-known
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR), a technique used for the amplification of
specific DNA segments. Generally, variants of a particular
nucleotide sequence of the invention will have generally at least
about 90%, preferably at least about 95% and more preferably at
least about 98% sequence identity to that particular nucleotide
sequence as determined by sequence alignment programs described
elsewhere herein.
[0073] By "variant protein" a protein derived from the native
protein by deletion (so-called truncation) or addition of one or
more amino acids to the N-terminal and/or C-terminal end of the
native protein; deletion or addition of one or more amino acids at
one or more sites in the native protein; or substitution of one or
more amino acids at one or more sites in the native protein is
intended. Variant proteins encompassed by the present invention are
biologically active, that is they possess the desired biological
activity, that is, LysK-Lyso fusion protein, 390 LysK-Lyso fusion
protein, 221 LysK-Lyso fusion protein, Lyso-390LysK fusion protein,
155Lyso-390LysK-LysoSH3b fusion polypeptide, phi11-Lyso fusion
protein activity as described herein. Such variants may result
from, for example, genetic polymorphism or from human manipulation.
Biologically active variants of a LysK-Lyso fusion polypeptide,
390LysK-Lyso fusion polypeptide, 221 LysK-Lyso fusion polypeptide,
Lyso-390LysK fusion polypeptide, 155Lyso-390LysK-LysoSH3b fusion
polypeptide or phi11-Lyso fusion polypeptide of the invention will
have at least about 90%, preferably at least about 95%, and more
preferably at least about 98% sequence identity to the amino acid
sequence for the protein of the invention as determined by sequence
alignment programs described elsewhere herein. A biologically
active variant of a protein of the invention may differ from that
protein by as few as 1-15 amino acid residues, or even 1 amino acid
residue.
[0074] The polypeptides of the invention may be altered in various
ways including amino acid substitutions, deletions, truncations,
and insertions. Novel proteins having properties of interest may be
created by combining elements and fragments of proteins of the
present invention, as well as with other proteins. Methods for such
manipulations are generally known in the art. Thus, the genes and
nucleotide sequences of the invention include both the naturally
occurring sequences as well as mutant forms. Likewise, the proteins
of the invention encompass naturally occurring proteins as well as
variations and modified forms thereof. Such variants will continue
to possess the desired LysK-Lyso fusion protein, 390LysK-Lyso
fusion protein, 221 LysK-Lyso fusion protein, Lyso-390LysK fusion
protein, 155Lyso-390LysK-LysoSH3b fusion polypeptide, and/or
phi11-Lyso fusion protein activity. Obviously, the mutations that
will be made in the DNA encoding the variant must not place the
sequence out of reading frame and preferably will not create
complementary regions that could produce secondary mRNA
structure.
[0075] The deletions, insertions, and substitutions of the protein
sequences encompassed herein are not expected to produce radical
changes in the characteristics of the protein. However, when it is
difficult to predict the exact effect of the substitution,
deletion, or insertion in advance of doing so, one skilled in the
art will appreciate that the effect will be evaluated by routine
screening assays where the effects of LysK-Lyso fusion protein,
390LysK-Lyso fusion protein, 221LysK-Lyso fusion protein,
Lyso-390LysK fusion protein, 155Lyso-390LysK-LysoSH3b fusion
polypeptide, and/or phi11-Lyso fusion protein can be observed.
[0076] "Codon degeneracy" refers to divergence in the genetic code
permitting variation of the nucleotide sequence without affecting
the amino acid sequence of an encoded polypeptide. Accordingly, the
instant invention relates to any nucleic acid fragment comprising a
nucleotide sequence that encodes all or a substantial portion of
the amino acid sequences set forth herein.
[0077] The staphylococcal control compositions of the invention
comprise the antimicrobial composition of the invention dissolved
or suspended in an aqueous carrier or medium. The composition may
further generally comprise an acidulant or admixture, a rheology
modifier or admixture, a film-forming agent or admixture, a buffer
system, a hydrotrope or admixture, an emollient or admixture, a
surfactant or surfactant admixture, a chromophore or colorant, and
optional adjuvants. The preferred compositions of this invention
comprise ingredients which are generally regarded as safe, and are
not of themselves or in admixture incompatible with milk or milk
by-products or human and veterinary applications. Likewise,
ingredients may be selected for any given composition which are
cooperative in their combined effects whether incorporated for
antimicrobial efficacy, physical integrity of the formulation or to
facilitate healing and health in medical and veterinary
applications, including for example in the case of mastitis,
healing and health of the teat or other human or animal body part.
Generally, the composition comprises a carrier which functions to
dilute the active ingredients and facilitates stability and
application to the intended surface. The carrier is generally an
aqueous medium such as water, or an organic liquid such as an oil,
a surfactant, an alcohol, an ester, an ether, or an organic or
aqueous mixture of any of these, or attached to a solid stratum
such as colloidal gold. Water is preferred as a carrier or diluent
in compositions of this invention because of its universal
availability and unquestionable economic advantages over other
liquid diluents.
[0078] Avoiding the generalized use of broad range antimicrobials
and using highly specific antimicrobials for just the target
organisms involved, should help reduce the ever-increasing
incidence of antibiotic resistance.
EXAMPLES
[0079] Having now generally described this invention, the same will
be better understood by reference to certain specific examples,
which are included herein only to further illustrate the invention
and are not intended to limit the scope of the invention as defined
by the claims.
Example 1
Plasmids, Constructs and Strains
[0080] The LysK cDNA was kindly provided by Paul Ross (O'Flaherty
et al. 2005. J. Bacteriol. 187: 7161-7164). Phage K genomic
sequence has been published (AY176327) and the LysK protein
sequence is also available (AA047477.2) through Genbank. Inducible
vector constructs were created in pET21a (EMD Biosciences, San
Diego, Calif.) for introduction of a C-terminal His-tag. For
cloning into pET21a, the LysK sequences were amplified with primers
LysK Nde F (5'-GAGAAATTACATATGGCTAAG ACTC-3'; SEQ ID NO:17) and
LysK Xho R (5'-ATGGTGATGCTCGAGTTTGAATACTC C-3'; SEQ ID NO:18, Table
1) (engineered restriction enzyme sites are underlined). [All
primers utilized in construct preparation are described in Table
I.] PCR subcloning is performed when PCR products are gel purified
and digested appropriately with Restriction Enzymes (RE) that
recognize and cleave at the engineered sites. The resultant gene
fragments are purified over a Micro Bio Spin P30 desalting column
(BioRAD, Inc.) and introduced into similarly digested,
dephosphorylated and gel purified vector pET21a, via conventional
means. At the C-terminus of the C-tagged LysK, there are an
additional 2 amino acids corresponding to the XhoI site (Leu-Glu)
followed by 6 His residues. The resulting plasmid was termed p3514
(listed in Table 2).
[0081] A plasmid harboring the Mature Lysostaphin
(gi|153046|gb|M15686.1| STALYS) cDNA was a gift from David Kerr,
Univ. Vermont. The entire mature protein coding sequence was
amplified using the primers Lyso AA1 NdeI F
(5'-ACGTACGTCATATGGCTGCAACACATGAAC ATTCAGCAC; SEQ ID NO:19) and
RlysoXhoI (5'-GCGCTACTCGAGACCACCTGCT TTTCCATATC; SEQ ID NO:20) and
introduced into pET21a via PCR cloning similar to that described
for LysK. The resulting plasmid was termed p5301 with the NdeI site
contributing the new ATG translational start site for the protein
coding sequences.
[0082] LysK-Lyso was generated by amplification of Lysostaphin gene
sequences, using plasmid p5301 as template and the primers FlysoSal
I (5'-ATCATC GTCGACGCTGCAACACATGAACATTCAGCAC; SEQ ID NO: 21) and
RlysoXhoI (5'-GC GCTACTCGAGACCACCTGCTTTTCCATATC; SEQ ID NO: 20).
The Lysostaphin fragment was PCR subcloned into the XhoI linearized
LysK expression plasmid p3514. The ligation of XhoI to SalI
destroys both RE sites and adds two amino acids to the fusion
joint, LD (Leu-Asp) which is present in all fusion constructs. The
resulting plasmid was termed p5031.
[0083] 390LysK-Lyso was created by amplification of the LysK
fragment with the primers R lysKCA 390
(5'-GTGGTGCTCGAGACTTGCGCTACTTGTTTTACC; SEQ ID NO: 22) (Xho I site)
and pET21a XbaI F (5'-GGATAACAATTCCCCTCTAG; SEQ ID NO: 23), using
plasmid p3514 as template. The amplified fragment was RE digested
and PCR subcloned into XbaI and XhoI cut pET21a similar to the
methods described previously, generating plasmid p5404. The
Lysostaphin fragment was amplified with primers FlysoSalI and
RlysoXhoI and the amplified fragment was RE digested and then
introduced into plasmid p5404 that had been linearized with XhoI
generating plasmid pSB1101.
[0084] 221lysK-Lyso was created by first PCR subcloning the lysK
fragment encoding amino acids 1-221 into pET21a. The fragment was
generated with the template plasmid p3514 and the primers lysK Chap
221S R (5'-GTATTGCTCGAGTGA AGAACGACCTGC; SEQ ID NO:24) and pET21a
XbaI F (5'-GGATAACAATTCCCCTCT AG-3'; SEQ ID NO:23). The resultant
fragment was RE digested with XhoI and Xba land PCR subcloned into
pET21a to create plasmid pSB0201. The Lysostaphin fragment was then
PCR amplified, with FlysoSalI and RlysoXhoI and the amplified
fragment was then PCR subcloned into the XhoI linearized plasmid
SB0201, generating plasmid pSB0408.
[0085] Lyso-390lysK was generated by introducing the PCR product
generated by amplification of the template p3514 with the primers
LysK aa1 Sal F (5'-GATATA GTCGACGCTAAGACTC; SEQ ID NO: 25) pET21a
Sty I-R (5'-CGTTTAGAGGCCCC AAGGGGTTATG; SEQ ID NO:26) into the XhoI
StyI digested p5301. The resulting plasmid was termed pSB1501
[0086] The phi11-Lyso fusion was created first by amplifying the
phi11 endolysin gene from the template plasmid pTZ18R (a gift from
R. Jayaswal containing the phi11 endolysin on a 3 kb EcoRI
fragment) with the primers LytA NdeF (5'-GTGGCGCAT
ATGCAAGCAAAATTAAC; SEQ ID NO:27) and LytA XhoI 481 R (5'-TGACTATGTC
CTCGAGACTGATTTC; SEQ ID NO:28). The resultant PCR product was PCR
subcloned into NdeI and XhoI digested pET21a to generate the
plasmid pLytA481. (Donovan et al. 2006. FEMS Microbiol Lett.
265(1):133-239). The Lysostaphin gene was then PCR amplified with
the primers FlysoSalI and RlysoXhoI and was PCR subcloned into
plasmid pLytA481 via the Xho1 site to generate the plasmid p5809.
This fusion is a direct fusion of the phi11 endolysin (481 amino
acids) and mature Lysostaphin (246 amino acids) open reading
frames, in a head to tail, head to tail fusion.
[0087] The 155Lyso-390LysK-LysoSH3b fusion was created by first
PCR-amplifying the Lysostaphin gene from the template 5301 with the
primers LysoAD 155.times.HO R (5'GTTTGTCTCGAGACCTGTATTCGG-3'SEQ ID:
31) and Lyso AA1 NdeI F
(5'-ACGTACGTCATATGGCTGCAACACATGAACATTCAGCAC-3', SEQ ID NO: 19) and
introducing this fragment into NdeI XhoI digested pET21a generating
pSB1701. A second intermediate was produced by introducing the
Lysostaphin SH3b domain to the construct p5404 by amplification of
the template 5301 with the primers LysoSH3b SalI F
GCGCATCTCGAGACAGTAACTCCAACGCCG, SEQ ID NO: 32) pET21a Sty I-R
(5'-CGTTTAGAGGCCCC AAGGGGTTATG; SEQ ID NO: 26) and introducing the
fragment into XhoI StyI linearized p5404 generating plasmid
pSB1001. The final construct 155Lyso-390LysK-LysoSH3b was generated
by introducing the PCR product generated by amplification of the
template pSB1001 with the primers LysK aa1 Sal F (5'-GATATA
GTCGACGCTAAGACTC; SEQ ID NO: 25) pET21a Sty I-R (5'-CGTTTAGAGGCCCC
AAGGGGTTATG; SEQ ID NO: 26) into the XhoI StyI digested pSB1701
generating pSB1801.
[0088] All subcloning was performed in E. coli DH5.alpha.
(Invitrogen, Carlsbad, Calif.) for plasmid DNA isolation. All
constructs were sequence verified. All constructs were DNA sequence
verified. pET21a constructs were induced in E. coli BL21 (DE3) (EMD
Biosciences, San Diego, Calif.).
TABLE-US-00001 TABLE 1 PCR primers utilized to create the fusion
constructs. SEQ ID Name Sequence NO: Lyso AA1
ACGTACGTCATATGGCTGCAACACATGAACATTCAGCAC 19 Ndel F RlysoXhol
GCGCTACTCGAGACCACCTGCTTTTCCATATC 20 Lyso Sal l-F
ATCATCGTCGACGCTGCAACACATGAACATTCAGCAC 21 LysK Nde F
GAGAAATTACATATGGCTAAGACTC 17 LysK Xho R ATGGTGATGCTCGAGTTTGAATACTCC
18 lysK Chap GTATTGCTCGAGTGAAGAACGACCTGC 24 221SR R lysKCA 390
GTGGTGCTCGAGACTTGCGCTACTTGTTTTACC 22 pET21a xbal
GGATAACAATTCCCCTCTAG 23 F LysK aa1 Sal GATATAGTCGACGCTAAGACTC 25 F
pET21a Sty CGTTTAGAGGCCCCAAGGGGTTATG 26 l-R LytA NdeF
GTGGCGCATATGCAAGCAAAATTAAC 27 LytA Xhol TGACTATGTCCTCGAGACTGATTTC
28 481 R LysoSH3b GCGCATCTCGAGACAGTAACTCCAACGCCG 32 Sall F Bolded
sequences represent Restriction Enzyme sequences utilized in the
cloning protocol.
TABLE-US-00002 TABLE 2 Inducible plasmids used during construction
of, and expression of, fusion constructs. Plasmid Construct p3514
LysK p5301 Lysostaphin p5031 LysK-Lyso p5404 390LysK pSB1101
390LysK-Lyso pSB0201 221LysK pSB0408 221LysK-Lyso pSB1501
Lyso-390LysK pSB1801 155Lyso-390LysK-LysoSH3b pLytA481 Phi11 p5809
Phi11-Lyso
[0089] Staphylococcus aureus Newbolt 305 capsular polysaccharide
serotype 5 (ATCC 29740) and Staphylococcus Newman (gift from Jean
Lee, Harvard Univ.) were grown at 37.degree. C. in Brain Heart
Infusion broth (BD, Sparks, Md.) or Tryptic Soy Broth (BD, Sparks,
Md.).
Example 2
Protein Purification
[0090] E. coli cultures harboring pET21a derived Lysostaphin
expression vectors were grown under ampicillin selection to mid log
phase (OD.sub.600 nm of 0.4-0.6), chilled on ice for 30 min,
induced with 1 mM IPTG (isopropyl-beta-D-thiogalactopyranoside),
and incubated at 19.degree. C. with shaking for 18 h. E. coli
harvested from 100 ml cultures were suspended in 2 ml lysis buffer
(50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8),
sonicated on ice for 15.times.5 sec pulses separated by 15 sec.
rests, and centrifuged at 11,000.times.g for 20 minutes at
4.degree. C. The cleared lysate was transferred to microfuge tubes
and centrifuged at 16,000.times.g for 30 min at 4.degree. C. The
cleared supernatant was applied to 1 ml Ni-NTA (nickel matrix) in a
slurry and mixed gently for 1 hour at 4.degree. C. (Qiagen). The
slurry was loaded into a polypropylene column (Qiagen #34964) where
wash and elution buffer profiles were empirically determined for
the LysK constructs to be 10 ml of 10 mM imidazole, 20 ml of 20 mM
imidazole and elution with 1.2 ml of 250 mM imidazole in the same
phosphate buffered saline (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH
8.0). Immediately after purification from the nickel column, all
samples were brought to 1% glycerol to prevent precipitation of the
purified protein. Addition of 1% glycerol has become a routine
practice in this lab when isolating His-tagged proteins in order to
help resolve solubility issues faced with other His-tagged
proteins. All samples were then converted to LysK storage buffer
(400 mM NaCl, 20 mM Tris HCl, 1% glycerol, pH 7.5) via Micro Bio
Spin P30 desalting column (BioRAD, Inc.) or Zeba desalting column
(Pierce) that had been converted to LysK Storage buffer. All
samples were then 0.22 micron filter sterilized for use in the MIC
assays. After filtration, protein concentration determinations were
made via BCA Protein kit (Pierce) and DTT was added to 10 mM after
protein concentration determination. Sterilized protein
preparations were stored at -80.degree. C. or 4.degree. C. until
the time of the assay. Purity of each preparation was determined
via SDS-PAGE (FIG. 2). Non-tagged Lysostaphin was purchased
(recombinant, Sigma-Aldrich, L0761).
Example 3
SDS PAGE and Zymogram
[0091] The purified fusion proteins and Kaleidoscope protein
standards (Invitrogen, Carlsbad, Calif.) were analyzed with 15%
SDS-PAGE, with or without 300 ml equivalent of mid log phase S.
aureus 305 cells (OD.sub.600 nm of 0.4-0.6). Gels were prepared and
electrophoresed in Tris-Glycine buffer at 100 volts for 1.5 hours
in the BioRad Mini-PROTEAN 3 gel apparatus, according to
manufacturer's instructions. SDS gels were stained in BioSafe
Coomassie stain (BioRad, Hercules, Calif.) for one hour and then
rinsed in distilled water overnight. Zymograms were washed in
excess water for 1 hour to remove the SDS and incubated at room
temperature in water, resulting in areas of clearing in the turbid
gel wherever a lytic protein was localized.
[0092] Zymogram analysis was performed with a 50.times.
concentrated suspension of log phase S. aureus cells added to the
SDS PAGE gel mixture prior to polymerization. The SDS PAGE and
zymogram gels were made identically, loaded with identical samples,
and electrophoresed for the same period of time. The gel results
indicate that the protein preparations are >95% pure.
[0093] As shown in FIG. 3, 5 .mu.g of the phi11 endolysin, LysK
endolysins, LysK-Lysostaphin fusions and the phi11 endolysin-Lyso
fusion or 5 .mu.g Lysostaphin produced cleared regions in the
zymogram (representing lysis of the S. aureus cells embedded in the
gel). The position of these cleared zones corresponds to the
observed (and predicted) position of the peptidoglycan hydrolase
proteins seen in the Coomassie blue-stained SDS-PAGE gel.
Example 4
Catalytic Activity of the Three Domains of the Triple, Fusion
Lysins
[0094] We assessed the relative lytic contributions of the three
different domains of the triple fusion constructs to determine the
activity of all the domains and also to determine that the products
resulting from a given domain's activity were suitable substrates
for the catalytic activities of the other two domains. Our approach
to identifying active lytic domains in the lysin constructs is to
analyze the cell wall digestion products. An increase in reducing
activity of the reaction products during digestion indicates
glycosidase activity. Analysis of the sodium borohydride reduction
products of the digests allows us to determine if the glycosidase
is an N-acetylglucosaminidase or an N-acetylmuramidase. Using such
a procedure previously, indicated that the B30 lysin possesses
N-acetylmuramidase activity (Baker et al. 2006. Appl. Environ.
Microbiol. 72: 6825-6828; Pritchard et al. 2004, supra) and the
LambdaSa2 lysin has N-acetyl-glucosaminidase activity (Pritchard et
al. 2007. Appl. Environ. Microbiol. 73: 7150-7154). We analyzed the
LysK, the LysK-Lyso, and 390Lysk-Lyso enzyme digestion products
with electrospray ionization mass spectrometry (ESI-MS) (sometimes
coupled to HPLC) to detect amidase and endopeptidase activities. In
addition, we used synthetic peptide substrates that mimic the stem
peptide and cross bridges of peptidoglycan to confirm the
endopeptidase cleavage sites. For example, using synthetic
peptides, we were able to show that the endopeptidase of the B30
lysin cleaves between the D-Ala of the stem peptide and the L-Ala
of the cross bridge (Baker of al., supra; Pritchard of al. 2004,
supra). Similar methods were used to demonstrate
gamma-D-glutaminyl-L-lysine activity in the LambdaSa2 lysin
(Pritchard of al. 2007, supra). We have also determined the
peptidoglycan cut sites for LysK, which are identical to the phi11
endolysin (FIG. 1).
[0095] When the full length phi11-Lyso (data not shown), LysK-Lyso
(FIG. 5B), and 390Lysk-Lyso (data not shown) triple fusions were
tested using ESI-MS for cut site determination, all 3 domains were
active in all three constructs. Characterization of the peptide
products in cell wall digests of LysK resulted in the
identification of the two enzymatically active peptidoglycan lytic
domains. One is an amidase that cleaves between N-acetylmuramic
acid residues and L-alanine of the stem peptide, and the other is
an endopeptidase that cleaves between a D-alanine in the stem
peptide and a glycine in the cross-bridge peptide. Similar
activities have been reported for the phi11 lysin (Navarre of al,
1999. J. Biol. Chem. 274: 15847-15856). The primary product of LysK
digestion was A.sub.2QKG.sub.5, which in positive-ion ESI-MS gives
a peak with a m/z=702 (FIG. 5A). Lysostaphin cleaves staphylococcal
peptidoglycan between the second and third, and third and fourth,
glycine residues of the cross-bridges. ESI-MS analysis of the
peptide digestion products of a LysK-Lyso fusion protein shows that
all three lytic domains are active. In FIG. 5B the presence of the
m/z 702 peak shows that both LysK domains are active. However, the
peaks at m/z 645 (A.sub.2QKG.sub.4), 588 (A.sub.2QKG.sub.3), and
531 (A.sub.2QKG.sub.2) are the result of Gly-Gly cleavages by the
Lysostaphin component of the fusion. Digestion with 390LysK-Lyso
gives similar spectrums of peaks, with a less predominant peak at
m/z 702. The peak at m/z 702 indicates that the predominant enzyme
activity in LysK-Lyso construct is due to the LysK domains; the
more evenly distributed peaks in the 390LysK-Lyso construct
suggests the Lysostaphin endopeptidase domain is more active in
this fusion.
Example 5
Turbidity Reduction Assay
[0096] The turbidity assay measures the drop in optical density
(OD.sub.600 nm) resulting from lysis of the target bacteria with
the phage endolysin-derived protein. The assay is performed in a
Molecular Devices, Spectra Max 340 plate reader. The assay was
modified from the cuvette method reported previously (Donovan et
al. 2006b. FEMS Microbiol. Lett. 265: 133-139). S. aureus is grown
to logarithmic phase (OD.sub.600 nm=0.4-0.6) at 37.degree. C. in
growth media (Tryptic Soy Broth, Brain Heart Infusion broth (BHI),
or Meuller Hinton Broth) with shaking, harvested at 4.degree. C. by
centrifugation, and stored on ice until just before the assay when
the cells are resuspended to OD.sub.600 nm=1.0 in 150 mM NaCl, 10
mM Tris HCl, pH 7.5 unless otherwise stated. Enzyme samples are
added to three wells of a 96 well dish in 100 .mu.l of buffer. All
conditions are performed in triplicate wells. The assay is started
by the addition, via multi channel pipettor, of 100 .mu.l of cells
resuspended in buffer. The cell suspensions are at sufficient
concentration to reach an OD.sub.600 nm.about.1.0 when combined
with the 100 .mu.l of buffer/enzyme in the well. The "no enzyme
control" contains buffer and cells, but no enzyme is included.
OD.sub.600 nm readings are taken automatically every 20 seconds.
The readings for each well are transferred electronically to an
Excel spreadsheet where they are analyzed in a sliding 40 second
window over each group of 3 consecutive time points during the five
minute period, to identify the highest instantaneous change in
OD.sub.600 nm for each well. The absolute values of
.DELTA.OD.sub.600 nm for each group of 3 time points is ranked for
the entire 5 minute period. A plot of these values vs. time is
examined for consistency (bubbles in the well cause high
variability) and the highest consistent value is chosen. The
highest value representing changes in the OD.sub.600 nm in the
control sample (cells alone) obtained the same way is then
subtracted from the highest ranked .DELTA.OD.sub.600 nm value for
each experimental sample, and the 40 second values for the
triplicate samples (wells) are averaged and multiplied by 1.5 to
give a .DELTA.OD.sub.600 nm/minute. This value is then divided by
the .mu.g of enzyme protein in the sample to yield a specific
activity .DELTA.OD.sub.600 nm/.mu.g/min. pH Buffers: pH buffers
were as follows: 10 mM sodium acetate buffer pH 5, 10 mM sodium
acetate buffer pH 6, 10 mM Tris HCl buffer pH 7, 10 mM Tris HCl
buffer pH 8, mM Tris HCl buffer pH 9, and 10 mM Carbonate buffer pH
10. Salt Buffers: Salt buffers were composed of 1% glycerol, 20 mM
Tris pH 7.5 with varying NaCl from 0-500 mM. Storage Buffers:
Storage buffers were composed of 400 mM NaCl, 1% glycerol, 20 mm
Iris HCl pH 7.5 or with the addition of 1M trehalose, 2M proline,
or 25% (final concentration) Glycerol.
[0097] Turbidity reduction assays were also performed with frozen
cells. Live cells were grown to mid logarithmic phase (OD.sub.600
nm=0.4-0.6) at 37.degree. C. in BHI with shaking, harvested at
4.degree. C. by centrifugation, and stored on ice for 30 min to
arrest growth. Cells were resuspended in 5 ml of buffer (150 mM
NaCl, 10 mM Tris HCl, pH 7.5) per 250 ml of liquid culture.
Glycerol was added to 20% (1.25 ml of 100% glycerol per 5 ml). The
suspension was then separated into 1 ml aliquots and stored at
-80.degree. C. until needed. For turbidity assays, aliquots of
cells were rapidly thawed by agitation in a room temperature water
bath, pelleted by 16,000 g centrifugation, washed twice to remove
residual glycerol, then resuspended in 150 mM NaCl, 10 mM Tris HCl,
pH 7.5 or 300 mM NaCl, 10 mM Tris HCl, pH 7.5. Cell suspensions
were then adjusted to concentration and used as in a standard
turbidity reduction assay.
[0098] In the turbidity reduction assay (FIG. 4), the LysK-Lyso
fusion is less active than Lysostaphin or LysK alone. However,
removal of the LysK SH3b domain improves activity of the triple
fusion lysin .about.4 fold. This finding suggests that a phage
endolysin's binding domain might inhibit antimicrobial activity,
whereas the binding domain from a bacteriocin might make a better
antimicrobial. Lysostaphin is a S. simulans bacteriocin; by
definition, it is designed to kill all neighboring S. aureus. In
contrast, LysK is predicted to have a strong binding constant in
order to achieve lysis of just the host bacterial cell. Reversing
the orientation of the LysK and Lysostaphin components of this
triple domain fusion or inserting the 390LysK peptide into
Lysostaphin does not appear to enhance the lytic activity in the
turbidity reduction assay (390K-Lyso or 155Lyso-390LysK-LysoSH3b
vs. Lyso-390K). Similarly, creating a hybrid dual domain lysine by
removing the functional amidase domain (221K-Lyso) does not improve
the level of lytic activity in this assay, over the 390K-Lyso
fusion. Regardless of the levels of activity, it is important to
note that all are functional fusions and are lytic for live
cells.
[0099] All of the turbidity reduction assays were performed under
optimal salt and pH conditions. To determine the optimal conditions
for high antimicrobial activity, LysK-Lysostaphin had been tested
in the turbidity reduction assay against live cells for pH optimum
and NaCl concentrations. S. aureus 305 cells were resuspended in 20
mM Tris pH 7.5 containing 1% glycerol and NaCl concentrations
ranging from 0-500 mM. The cells were treated with 10 .mu.g of
either C-His-LysK or Lysostaphin for 5 minutes in the turbidity
reduction assay (FIG. 6). Lysostaphin activity is relatively
unaffected by salt concentrations between 200 mM to 500 mM whereas
LysK shows increasing activity from 150 mM with maximal activity at
concentrations approaching 400 mM. LysK has a higher specific
activity than Lysostaphin at NaCl concentrations greater than 150
mM. To determine the optimal pH, S. aureus 305 cells were
resuspended in buffers ranging from pH 5 to pH 10 and treated with
C-His-LysK or Lysostaphin for 5 minutes (FIG. 6). LysK and
Lysostaphin show strong activity over a broad pH range from pH 6 to
pH 9 (similar to previous reports for Lysostaphin (Schindler and
Schuhardt. 1965. Biochim. Biophys. Acta 97: 242-250).
[0100] Each peptidoglycan hydrolase has unique salt and pH optima.
When combined these optima are sometimes shifted with respect to
their components. Removing the LysK SH3b cell wall binding domain
from the LysK-Lyso fusion increases the activity of the fusion
protein.
Example 6
Plate Lysis Assay
[0101] Due to the fact that antimicrobial assays for peptidoglycan
hydrolases do not yield the same quantitative results between
assays (Kusuma and Kokai-Kun. 2005. Antimicrob. Agents Chemother.
49(8): 3256-63), it was decided to test a second assay, namely, the
plate lysis assay, with the fusion and parental proteins. Purified
fusion enzymes were serially diluted into 150 mM NaCl, 10 mM tris,
pH 7.5 buffer to yield concentrations of 10, 1, 0.1, and 0.01
.mu.g/10 .mu.l. 10 .mu.l of each dilution was spotted onto TSB agar
plates which were previously irrigated with 2 mL of mid-log
(0.4-0.6 OD.sub.600 nm) S. aureus strain Newman, excess culture
removed, and plates allowed to air dry at room temperature for
.about.30 minutes in a laminar flow hood. Enzyme spots are allowed
to air dry and incubated overnight at 37.degree. C.
[0102] The results of the plate lysis assay are shown in FIG. 7. As
shown above in the turbidity reduction assay, all of the fusion
constructs are able to kill live S. aureus in the plate lysis
assay. As expected from the work of Kusuma and Kokai-Kun (supra),
the relative activity levels differ from those observed in the
turbidity reduction assay. The bacteriocin, Lysostaphin, shows the
highest activity in the plate lysis assay, lysing cells at 0.01
.mu.g. All other enzymes analyzed show a weaker but similar
activity, requiring 0.1 .mu.g to lyse the S. aureus. It should be
noted that Lysostaphin is much smaller than the other proteins so
in molar equivalents, there are .about.3.times. as many Lysostaphin
molecules as some of the other fusions e.g. LysK-Lyso (see FIGS. 2
and 3 for SDS gels and molecular weight comparisons). This might be
contributing to the lack of quantitative identity between
assays.
Example 7
Minimum Inhibitory Concentration
[0103] The Minimal Inhibitory Concentration (MIC) of fusion
proteins with S. aureus Newman was determined. Enzymes are first
serially diluted two fold across a 96 well plate from the first
well containing 100 .mu.l of buffer (150 mM NaCl, 10 mM tris, pH
7.5)+enzyme and 100 .mu.l of 2.times. sterile Tryptic Soy Broth
(TSB). 100 .mu.l of these dilutions are then transferred to
duplicate 96 well plates to which 100 .mu.l of S. aureus Newman in
TSB is added to each well. The CFU of the inoculating culture is
.about.5.times.10.sup.5 cells/ml. Plates are incubated 20 hours at
37.degree. C., at which time plates are read with a 96 well plate
reader and photographed. Plate reader OD.sub.600 nm values are used
to determine the MIC. Wells that have less than 50% OD.sub.600 nm
of the full growth (bright wells) are considered growth inhibited
(red lines). Lysostaphin is serially diluted from 25 .mu.g/ml, all
other proteins are serially diluted from 125 .mu.g/ml in the first
well. Each well in the final assay contains 200 .mu.l of
1.times.TSB with the buffer contributing 37.5 mM NaCl and 2.5 mM
Tris.
[0104] MIC determinations for the fusion and parental lysins were
performed in a 96 well microtiter plate (FIG. 8). Again, all of the
fusion and parental lysins demonstrate the ability to inhibit S.
aureus growth. Lysostaphin is again more active than the fusion
proteins. Among the fusion proteins, the 221K-lyso construct is
most active in the MIC assay, inhibiting culture growth at 5
.mu.g/ml concentration.
Example 8
Bactericidal Blood Assays
[0105] Blood was taken from euthanized rats aseptically and
immediately added to conical tubes containing heparin (5 U/ml).
Heparinized rat blood was then stored rocking at room temperature
until used. S. aureus mastitis strain 305 was grown to mid-log
phase (OD.sub.600 nm=0.4-0.6) in Tryptic Soy Broth to .about.100
cfu/.mu.l. 1 .mu.l of the diluted bacterial culture was added per
90 .mu.ls of heparinized rat blood en masse at a total volume
sufficient to include for all samples. 455 .mu.l of inoculated
blood was then added to tubes containing 45 .mu.l of each enzyme or
buffer only (400 mM NaCl, 20 mM Tris HCl, 1% glycerol, pH 7.5). The
final volume of enzyme and TSB inoculum were 9% and 1% of the final
reaction volume, respectively. Reactions were incubated in a shaker
at 37.degree. C. between time points. Upon addition of blood, and
at 90 and 180 minutes, aliquots were removed, diluted, and
immediately plated onto TSB agar in triplicate. Plates were
incubated at 37.degree. C. overnight; colonies were then counted to
determine the number of colony forming units per ml.
[0106] The results in FIG. 9 are presented as the % CFUs of the
buffer alone control (no lysin added) and indicate that all of the
LysK-Lyso fusions kill S. aureus in heparinized whole rat blood;
therefore, the fusions should be active when applied systemically
to cure septicemia and other tissue infections.
Example 9
Plate Lysis Assay for Testing Resistance Development
[0107] Cells were repeatedly exposed to peptidoglycan hydrolases
over night on a tryptic soy agar (TSA) plate over a period of up to
20 days, similar to Loeffler et al., (2001, supra) with the
following modifications. Lawns were prepared by diluting a mid log
phase culture (OD.sub.600 nm 0.4-0.6) of S. aureus Newman cells
1/20 in TSB, flooding a TSA plate with 2 mL of the culture
dilution, incubating at room temperature for 1 minute, and removing
the excess culture. The plates (with lids removed) were allowed to
air dry in a laminar flow hood (.about.30 minutes). Serial 10 fold
dilutions of each enzyme in 150 mM NaCl, 10 mM Tris, pH 7.5 were
prepared yielding five solutions ranging between 10 .mu.g to 0.1 ng
in 10 .mu.l of each enzyme to be tested. Dilutions were spotted
onto the lawn, allowed to air dry for 30 minutes, and incubated
overnight at 37.degree. C. Cells were scraped from the spot with
the lowest concentration of enzyme where there was only partial
clearing (some obvious lysis had occurred as indicated by partial
clearing of the spot on the plate). These `exposed` cells were used
to inoculate 5 mL of TSB and grown for several hours to generate a
new culture and subsequent lawn. Cells were exposed consecutively
for up to 20 days, at which time cells were prepared and tested in
turbidity reduction assays, as described previously. Each strain
that resulted from repeated exposure to the peptidoglycan hydrolase
construct was then tested against the hydrolase used in the
selection procedure (and if a fusion, the parental hydrolases used
to make the construct) to ascertain if any resistance to either the
test construct or the hydrolases of origin had occurred as a result
of repeated exposure.
[0108] The S. aureus strain Newman isolates resulting from the 10
day "resistant strain selection protocol" demonstrated nearly
identical susceptibility, in the turbidity reduction assay, to both
the parental lysins and the fusion constructs as the S. aureus
strain Newman used to initiate the selection protocol. We conclude
that there was no resistance development following repeated
exposure to the lytic proteins.
[0109] All publications and patents mentioned in this specification
are herein incorporated by reference to the same extent as if each
individual publication or patent was specifically and individually
indicated to be incorporated by reference.
[0110] The foregoing description and certain representative
embodiments and details of the invention have been presented for
purposes of illustration and description of the invention. It is
not intended to be exhaustive or to limit the invention to the
precise forms disclosed. It will be apparent to practitioners
skilled in this art that modifications and variations may be made
therein without departing from the scope of the invention.
Sequence CWU 1
1
351768DNAStaphylococcus simulans 1atggctgcaa cacatgaaca ttcagcacaa
tggttgaata attacaaaaa aggatatggt 60tacggccctt atccattagg tataaatggc
ggtatgcact acggagttga tttttttatg 120aatattggaa caccagtaaa
agctatttca agcggaaaaa tagttgaagc tggttggagt 180aattacggag
gaggtaatca aataggtctt attgaaaatg atggagtgca tagacaatgg
240tatatgcatc taagtaaata taatgttaaa gtaggagatt atgtcaaagc
tggtcaaata 300atcggttggt ctggaagcac tggttattct acagcaccac
atttacactt ccaaagaatg 360gttaactcat tttcacagtc aactgcccaa
gatccaatgc ctttcttaaa gagcgcagga 420tatggaaaag caggtggtac
agtaactcca acgccgaata caggttggaa aacaaacaaa 480tatggcacac
tatataaatc agagtcagct agcttcacac ctaatacaga tataataaca
540agaacgactg gtccatttag aagcatgccg cagtcaggag tcttaaaagc
aggtcaaaca 600attcattatg atgaagtgat gaaacaagac ggtcatgttt
gggtaggtta tacaggtaac 660agtggccaac gtatttactt gcctgtgaga
acatggcaga agtctactaa tactctgggt 720gttctgtggg gaactataaa
gctcgagcac caccaccacc accactga 7682255PRTStaphylococcus simulans
2Met Ala Ala Thr His Glu His Ser Ala Gln Trp Leu Asn Asn Tyr Lys 1
5 10 15 Lys Gly Tyr Gly Tyr Gly Pro Tyr Pro Leu Gly Ile Asn Gly Gly
Met 20 25 30 His Tyr Gly Val Asp Phe Phe Met Asn Ile Gly Thr Pro
Val Lys Ala 35 40 45 Ile Ser Ser Gly Lys Ile Val Glu Ala Gly Trp
Ser Asn Tyr Gly Gly 50 55 60 Gly Asn Gln Ile Gly Leu Ile Glu Asn
Asp Gly Val His Arg Gln Trp 65 70 75 80 Tyr Met His Leu Ser Lys Tyr
Asn Val Lys Val Gly Asp Tyr Val Lys 85 90 95 Ala Gly Gln Ile Ile
Gly Trp Ser Gly Ser Thr Gly Tyr Ser Thr Ala 100 105 110 Pro His Leu
His Phe Gln Arg Met Val Asn Ser Phe Ser Gln Ser Thr 115 120 125 Ala
Gln Asp Pro Met Pro Phe Leu Lys Ser Ala Gly Tyr Gly Lys Ala 130 135
140 Gly Gly Thr Val Thr Pro Thr Pro Asn Thr Gly Trp Lys Thr Asn Lys
145 150 155 160 Tyr Gly Thr Leu Tyr Lys Ser Glu Ser Ala Ser Phe Thr
Pro Asn Thr 165 170 175 Asp Ile Ile Thr Arg Thr Thr Gly Pro Phe Arg
Ser Met Pro Gln Ser 180 185 190 Gly Val Leu Lys Ala Gly Gln Thr Ile
His Tyr Asp Glu Val Met Lys 195 200 205 Gln Asp Gly His Val Trp Val
Gly Tyr Thr Gly Asn Ser Gly Gln Arg 210 215 220 Ile Tyr Leu Pro Val
Arg Thr Trp Gln Lys Ser Thr Asn Thr Leu Gly 225 230 235 240 Val Leu
Trp Gly Thr Ile Lys Leu Glu His His His His His His 245 250 255
31512DNAartificial sequencePhage K 3atggctaaga ctcaagcaga
aataaataaa cgtttagatg cttatgcaaa aggaacagta 60gatagccctt acagagttaa
aaaagctaca agttatgacc catcatttgg tgtaatggaa 120gcaggagcca
ttgatgcaga tggttactat cacgctcagt gtcaagacct tattacagac
180tatgttttat ggttaacaga taataaagtt agaacttggg gtaatgctaa
agaccaaatt 240aaacagagtt atggtactgg atttaaaata catgaaaata
aaccttctac tgtacctaaa 300aaaggttgga ttgcggtatt tacatccggt
agttatgaac agtggggtca cataggtatt 360gtatatgatg gaggtaatac
ttctacattt actattttag agcaaaactg gaatggttat 420gctaataaaa
aacctacaaa acgtgtagat aattattacg gattaactca cttcattgaa
480atacctgtaa aagcaggaac tactgttaaa aaagaaacag ctaagaaaag
cgcaagtaaa 540acgcctgcac ctaaaaagaa agcaacacta aaagtttcta
agaatcacat taactataca 600atggataaac gtggtaaaaa acctgaagga
atggtaatac acaacgatgc aggtcgttct 660tcaggacaac aatacgagaa
ttcattagct aatgcaggtt atgctagata cgctaatggt 720attgctcatt
actacggctc tgaaggttat gtatgggaag caatagatgc taagaatcaa
780attgcttggc acacgggtga tggaacagga gcaaactcag gtaactttag
atttgcaggt 840attgaagtct gtcaatcaat gagtgctagt gatgctcaat
tccttaaaaa tgaacaagca 900gtattccaat ttacagcaga gaaatttaaa
gaatggggtc ttactcctaa ccgtaaaact 960gtaagattgc atatggaatt
tgtaccaact gcctgtcctc accgttctat ggttcttcat 1020acaggattta
atccagtaac acaaggaaga ccatcacaag caataatgaa taaattaaaa
1080gattatttca ttaaacaaat taaaaactac atggataaag gaacttcaag
ttctacagta 1140gttaaagatg gtaaaacaag tagcgcaagt acaccggcaa
ctagaccagt tacaggttct 1200tggaaaaaga accagtacgg aacttggtat
aaaccggaaa atgcaacatt tgtcaatggt 1260aaccaaccta tagtaactag
aataggttct ccattcttaa atgctccagt aggcggtaac 1320ttaccggcag
gggctacaat tgtatatgac gaagtttgta tccaagcagg tcacatttgg
1380ataggttata atgcttacaa cggtaacaga gtatattgcc ctgttagaac
ttgtcaaggt 1440gttccaccta atcaaatacc tggcgttgcc tggggagtat
tcaaactcga gcaccaccac 1500caccaccact ga 15124503PRTartificial
sequencePhage K 4Met Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu
Asp Ala Tyr Ala 1 5 10 15 Lys Gly Thr Val Asp Ser Pro Tyr Arg Val
Lys Lys Ala Thr Ser Tyr 20 25 30 Asp Pro Ser Phe Gly Val Met Glu
Ala Gly Ala Ile Asp Ala Asp Gly 35 40 45 Tyr Tyr His Ala Gln Cys
Gln Asp Leu Ile Thr Asp Tyr Val Leu Trp 50 55 60 Leu Thr Asp Asn
Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln Ile 65 70 75 80 Lys Gln
Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro Ser 85 90 95
Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser Tyr 100
105 110 Glu Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr
Ser 115 120 125 Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala
Asn Lys Lys 130 135 140 Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu
Thr His Phe Ile Glu 145 150 155 160 Ile Pro Val Lys Ala Gly Thr Thr
Val Lys Lys Glu Thr Ala Lys Lys 165 170 175 Ser Ala Ser Lys Thr Pro
Ala Pro Lys Lys Lys Ala Thr Leu Lys Val 180 185 190 Ser Lys Asn His
Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys Lys Pro 195 200 205 Glu Gly
Met Val Ile His Asn Asp Ala Gly Arg Ser Ser Gly Gln Gln 210 215 220
Tyr Glu Asn Ser Leu Ala Asn Ala Gly Tyr Ala Arg Tyr Ala Asn Gly 225
230 235 240 Ile Ala His Tyr Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala
Ile Asp 245 250 255 Ala Lys Asn Gln Ile Ala Trp His Thr Gly Asp Gly
Thr Gly Ala Asn 260 265 270 Ser Gly Asn Phe Arg Phe Ala Gly Ile Glu
Val Cys Gln Ser Met Ser 275 280 285 Ala Ser Asp Ala Gln Phe Leu Lys
Asn Glu Gln Ala Val Phe Gln Phe 290 295 300 Thr Ala Glu Lys Phe Lys
Glu Trp Gly Leu Thr Pro Asn Arg Lys Thr 305 310 315 320 Val Arg Leu
His Met Glu Phe Val Pro Thr Ala Cys Pro His Arg Ser 325 330 335 Met
Val Leu His Thr Gly Phe Asn Pro Val Thr Gln Gly Arg Pro Ser 340 345
350 Gln Ala Ile Met Asn Lys Leu Lys Asp Tyr Phe Ile Lys Gln Ile Lys
355 360 365 Asn Tyr Met Asp Lys Gly Thr Ser Ser Ser Thr Val Val Lys
Asp Gly 370 375 380 Lys Thr Ser Ser Ala Ser Thr Pro Ala Thr Arg Pro
Val Thr Gly Ser 385 390 395 400 Trp Lys Lys Asn Gln Tyr Gly Thr Trp
Tyr Lys Pro Glu Asn Ala Thr 405 410 415 Phe Val Asn Gly Asn Gln Pro
Ile Val Thr Arg Ile Gly Ser Pro Phe 420 425 430 Leu Asn Ala Pro Val
Gly Gly Asn Leu Pro Ala Gly Ala Thr Ile Val 435 440 445 Tyr Asp Glu
Val Cys Ile Gln Ala Gly His Ile Trp Ile Gly Tyr Asn 450 455 460 Ala
Tyr Asn Gly Asn Arg Val Tyr Cys Pro Val Arg Thr Cys Gln Gly 465 470
475 480 Val Pro Pro Asn Gln Ile Pro Gly Val Ala Trp Gly Val Phe Lys
Leu 485 490 495 Glu His His His His His His 500 52256DNAartificial
sequencePhage K & Staphylococcus simulans 5atggctaaga
ctcaagcaga aataaataaa cgtttagatg cttatgcaaa aggaacagta 60gatagccctt
acagagttaa aaaagctaca agttatgacc catcatttgg tgtaatggaa
120gcaggagcca ttgatgcaga tggttactat cacgctcagt gtcaagacct
tattacagac 180tatgttttat ggttaacaga taataaagtt agaacttggg
gtaatgctaa agaccaaatt 240aaacagagtt atggtactgg atttaaaata
catgaaaata aaccttctac tgtacctaaa 300aaaggttgga ttgcggtatt
tacatccggt agttatgaac agtggggtca cataggtatt 360gtatatgatg
gaggtaatac ttctacattt actattttag agcaaaactg gaatggttat
420gctaataaaa aacctacaaa acgtgtagat aattattacg gattaactca
cttcattgaa 480atacctgtaa aagcaggaac tactgttaaa aaagaaacag
ctaagaaaag cgcaagtaaa 540acgcctgcac ctaaaaagaa agcaacacta
aaagtttcta agaatcacat taactataca 600atggataaac gtggtaaaaa
acctgaagga atggtaatac acaacgatgc aggtcgttct 660tcaggacaac
aatacgagaa ttcattagct aatgcaggtt atgctagata cgctaatggt
720attgctcatt actacggctc tgaaggttat gtatgggaag caatagatgc
taagaatcaa 780attgcttggc acacgggtga tggaacagga gcaaactcag
gtaactttag atttgcaggt 840attgaagtct gtcaatcaat gagtgctagt
gatgctcaat tccttaaaaa tgaacaagca 900gtattccaat ttacagcaga
gaaatttaaa gaatggggtc ttactcctaa ccgtaaaact 960gtaagattgc
atatggaatt tgtaccaact gcctgtcctc accgttctat ggttcttcat
1020acaggattta atccagtaac acaaggaaga ccatcacaag caataatgaa
taaattaaaa 1080gattatttca ttaaacaaat taaaaactac atggataaag
gaacttcaag ttctacagta 1140gttaaagatg gtaaaacaag tagcgcaagt
acaccggcaa ctagaccagt tacaggttct 1200tggaaaaaga accagtacgg
aacttggtat aaaccggaaa atgcaacatt tgtcaatggt 1260aaccaaccta
tagtaactag aataggttct ccattcttaa atgctccagt aggcggtaac
1320ttaccggcag gggctacaat tgtatatgac gaagtttgta tccaagcagg
tcacatttgg 1380ataggttata atgcttacaa cggtaacaga gtatattgcc
ctgttagaac ttgtcaaggt 1440gttccaccta atcaaatacc tggcgttgcc
tggggagtat tcaaactcga cgctgcaaca 1500catgaacatt cagcacaatg
gttgaataat tacaaaaaag gatatggtta cggcccttat 1560ccattaggta
taaatggcgg tatgcactac ggagttgatt tttttatgaa tattggaaca
1620ccagtaaaag ctatttcaag cggaaaaata gttgaagctg gttggagtaa
ttacggagga 1680ggtaatcaaa taggtcttat tgaaaatgat ggagtgcata
gacaatggta tatgcatcta 1740agtaaatata atgttaaagt aggagattat
gtcaaagctg gtcaaataat cggttggtct 1800ggaagcactg gttattctac
agcaccacat ttacacttcc aaagaatggt taactcattt 1860tcacagtcaa
ctgcccaaga tccaatgcct ttcttaaaga gcgcaggata tggaaaagca
1920ggtggtacag taactccaac gccgaataca ggttggaaaa caaacaaata
tggcacacta 1980tataaatcag agtcagctag cttcacacct aatacagata
taataacaag aacgactggt 2040ccatttagaa gcatgccgca gtcaggagtc
ttaaaagcag gtcaaacaat tcattatgat 2100gaagtgatga aacaagacgg
tcatgtttgg gtaggttata caggtaacag tggccaacgt 2160atttacttgc
ctgtgagaac atggcagaag tctactaata ctctgggtgt tctgtgggga
2220actataaagc tcgagcacca ccaccaccac cactga 22566751PRTartificial
sequencePhage K & Staphylococcus simulans 6Met Ala Lys Thr Gln
Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr Ala 1 5 10 15 Lys Gly Thr
Val Asp Ser Pro Tyr Arg Val Lys Lys Ala Thr Ser Tyr 20 25 30 Asp
Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp Gly 35 40
45 Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu Trp
50 55 60 Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp
Gln Ile 65 70 75 80 Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu
Asn Lys Pro Ser 85 90 95 Thr Val Pro Lys Lys Gly Trp Ile Ala Val
Phe Thr Ser Gly Ser Tyr 100 105 110 Glu Gln Trp Gly His Ile Gly Ile
Val Tyr Asp Gly Gly Asn Thr Ser 115 120 125 Thr Phe Thr Ile Leu Glu
Gln Asn Trp Asn Gly Tyr Ala Asn Lys Lys 130 135 140 Pro Thr Lys Arg
Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile Glu 145 150 155 160 Ile
Pro Val Lys Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys Lys 165 170
175 Ser Ala Ser Lys Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys Val
180 185 190 Ser Lys Asn His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys
Lys Pro 195 200 205 Glu Gly Met Val Ile His Asn Asp Ala Gly Arg Ser
Ser Gly Gln Gln 210 215 220 Tyr Glu Asn Ser Leu Ala Asn Ala Gly Tyr
Ala Arg Tyr Ala Asn Gly 225 230 235 240 Ile Ala His Tyr Tyr Gly Ser
Glu Gly Tyr Val Trp Glu Ala Ile Asp 245 250 255 Ala Lys Asn Gln Ile
Ala Trp His Thr Gly Asp Gly Thr Gly Ala Asn 260 265 270 Ser Gly Asn
Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met Ser 275 280 285 Ala
Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln Phe 290 295
300 Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys Thr
305 310 315 320 Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro
His Arg Ser 325 330 335 Met Val Leu His Thr Gly Phe Asn Pro Val Thr
Gln Gly Arg Pro Ser 340 345 350 Gln Ala Ile Met Asn Lys Leu Lys Asp
Tyr Phe Ile Lys Gln Ile Lys 355 360 365 Asn Tyr Met Asp Lys Gly Thr
Ser Ser Ser Thr Val Val Lys Asp Gly 370 375 380 Lys Thr Ser Ser Ala
Ser Thr Pro Ala Thr Arg Pro Val Thr Gly Ser 385 390 395 400 Trp Lys
Lys Asn Gln Tyr Gly Thr Trp Tyr Lys Pro Glu Asn Ala Thr 405 410 415
Phe Val Asn Gly Asn Gln Pro Ile Val Thr Arg Ile Gly Ser Pro Phe 420
425 430 Leu Asn Ala Pro Val Gly Gly Asn Leu Pro Ala Gly Ala Thr Ile
Val 435 440 445 Tyr Asp Glu Val Cys Ile Gln Ala Gly His Ile Trp Ile
Gly Tyr Asn 450 455 460 Ala Tyr Asn Gly Asn Arg Val Tyr Cys Pro Val
Arg Thr Cys Gln Gly 465 470 475 480 Val Pro Pro Asn Gln Ile Pro Gly
Val Ala Trp Gly Val Phe Lys Leu 485 490 495 Asp Ala Ala Thr His Glu
His Ser Ala Gln Trp Leu Asn Asn Tyr Lys 500 505 510 Lys Gly Tyr Gly
Tyr Gly Pro Tyr Pro Leu Gly Ile Asn Gly Gly Met 515 520 525 His Tyr
Gly Val Asp Phe Phe Met Asn Ile Gly Thr Pro Val Lys Ala 530 535 540
Ile Ser Ser Gly Lys Ile Val Glu Ala Gly Trp Ser Asn Tyr Gly Gly 545
550 555 560 Gly Asn Gln Ile Gly Leu Ile Glu Asn Asp Gly Val His Arg
Gln Trp 565 570 575 Tyr Met His Leu Ser Lys Tyr Asn Val Lys Val Gly
Asp Tyr Val Lys 580 585 590 Ala Gly Gln Ile Ile Gly Trp Ser Gly Ser
Thr Gly Tyr Ser Thr Ala 595 600 605 Pro His Leu His Phe Gln Arg Met
Val Asn Ser Phe Ser Gln Ser Thr 610 615 620 Ala Gln Asp Pro Met Pro
Phe Leu Lys Ser Ala Gly Tyr Gly Lys Ala 625 630 635 640 Gly Gly Thr
Val Thr Pro Thr Pro Asn Thr Gly Trp Lys Thr Asn Lys 645 650 655 Tyr
Gly Thr Leu Tyr Lys Ser Glu Ser Ala Ser Phe Thr Pro Asn Thr 660 665
670 Asp Ile Ile Thr Arg Thr Thr Gly Pro Phe Arg Ser Met Pro Gln Ser
675 680 685 Gly Val Leu Lys Ala Gly Gln Thr Ile His Tyr Asp Glu Val
Met Lys 690 695 700 Gln Asp Gly His Val Trp Val Gly Tyr Thr Gly Asn
Ser Gly Gln Arg 705 710 715 720 Ile Tyr Leu Pro Val Arg Thr Trp Gln
Lys Ser Thr Asn Thr Leu Gly 725 730 735 Val Leu Trp Gly Thr Ile Lys
Leu Glu His His His His His His 740 745 750 71941DNAartificial
sequencePhage K & Staphylococcus simulans 7atggctaaga
ctcaagcaga aataaataaa cgtttagatg cttatgcaaa aggaacagta 60gatagccctt
acagagttaa aaaagctaca agttatgacc catcatttgg tgtaatggaa
120gcaggagcca ttgatgcaga tggttactat cacgctcagt gtcaagacct
tattacagac 180tatgttttat ggttaacaga taataaagtt agaacttggg
gtaatgctaa agaccaaatt 240aaacagagtt atggtactgg atttaaaata
catgaaaata aaccttctac tgtacctaaa 300aaaggttgga
ttgcggtatt tacatccggt agttatgaac agtggggtca cataggtatt
360gtatatgatg gaggtaatac ttctacattt actattttag agcaaaactg
gaatggttat 420gctaataaaa aacctacaaa acgtgtagat aattattacg
gattaactca cttcattgaa 480atacctgtaa aagcaggaac tactgttaaa
aaagaaacag ctaagaaaag cgcaagtaaa 540acgcctgcac ctaaaaagaa
agcaacacta aaagtttcta agaatcacat taactataca 600atggataaac
gtggtaaaaa acctgaagga atggtaatac acaacgatgc aggtcgttct
660tcaggacaac aatacgagaa ttcattagct aatgcaggtt atgctagata
cgctaatggt 720attgctcatt actacggctc tgaaggttat gtatgggaag
caatagatgc taagaatcaa 780attgcttggc acacgggtga tggaacagga
gcaaactcag gtaactttag atttgcaggt 840attgaagtct gtcaatcaat
gagtgctagt gatgctcaat tccttaaaaa tgaacaagca 900gtattccaat
ttacagcaga gaaatttaaa gaatggggtc ttactcctaa ccgtaaaact
960gtaagattgc atatggaatt tgtaccaact gcctgtcctc accgttctat
ggttcttcat 1020acaggattta atccagtaac acaaggaaga ccatcacaag
caataatgaa taaattaaaa 1080gattatttca ttaaacaaat taaaaactac
atggataaag gaacttcaag ttctacagta 1140gttaaagatg gtaaaacaag
tagcgcaagt ctcgacgctg caacacatga acattcagca 1200caatggttga
ataattacaa aaaaggatat ggttacggcc cttatccatt aggtataaat
1260ggcggtatgc actacggagt tgattttttt atgaatattg gaacaccagt
aaaagctatt 1320tcaagcggaa aaatagttga agctggttgg agtaattacg
gaggaggtaa tcaaataggt 1380cttattgaaa atgatggagt gcatagacaa
tggtatatgc atctaagtaa atataatgtt 1440aaagtaggag attatgtcaa
agctggtcaa ataatcggtt ggtctggaag cactggttat 1500tctacagcac
cacatttaca cttccaaaga atggttaact cattttcaca gtcaactgcc
1560caagatccaa tgcctttctt aaagagcgca ggatatggaa aagcaggtgg
tacagtaact 1620ccaacgccga atacaggttg gaaaacaaac aaatatggca
cactatataa atcagagtca 1680gctagcttca cacctaatac agatataata
acaagaacga ctggtccatt tagaagcatg 1740ccgcagtcag gagtcttaaa
agcaggtcaa acaattcatt atgatgaagt gatgaaacaa 1800gacggtcatg
tttgggtagg ttatacaggt aacagtggcc aacgtattta cttgcctgtg
1860agaacatggc agaagtctac taatactctg ggtgttctgt ggggaactat
aaagctcgag 1920caccaccacc accaccactg a 19418646PRTartificial
sequencePhage K & Staphylococcus simulans 8Met Ala Lys Thr Gln
Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr Ala 1 5 10 15 Lys Gly Thr
Val Asp Ser Pro Tyr Arg Val Lys Lys Ala Thr Ser Tyr 20 25 30 Asp
Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp Gly 35 40
45 Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu Trp
50 55 60 Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp
Gln Ile 65 70 75 80 Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu
Asn Lys Pro Ser 85 90 95 Thr Val Pro Lys Lys Gly Trp Ile Ala Val
Phe Thr Ser Gly Ser Tyr 100 105 110 Glu Gln Trp Gly His Ile Gly Ile
Val Tyr Asp Gly Gly Asn Thr Ser 115 120 125 Thr Phe Thr Ile Leu Glu
Gln Asn Trp Asn Gly Tyr Ala Asn Lys Lys 130 135 140 Pro Thr Lys Arg
Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile Glu 145 150 155 160 Ile
Pro Val Lys Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys Lys 165 170
175 Ser Ala Ser Lys Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys Val
180 185 190 Ser Lys Asn His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys
Lys Pro 195 200 205 Glu Gly Met Val Ile His Asn Asp Ala Gly Arg Ser
Ser Gly Gln Gln 210 215 220 Tyr Glu Asn Ser Leu Ala Asn Ala Gly Tyr
Ala Arg Tyr Ala Asn Gly 225 230 235 240 Ile Ala His Tyr Tyr Gly Ser
Glu Gly Tyr Val Trp Glu Ala Ile Asp 245 250 255 Ala Lys Asn Gln Ile
Ala Trp His Thr Gly Asp Gly Thr Gly Ala Asn 260 265 270 Ser Gly Asn
Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met Ser 275 280 285 Ala
Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln Phe 290 295
300 Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys Thr
305 310 315 320 Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro
His Arg Ser 325 330 335 Met Val Leu His Thr Gly Phe Asn Pro Val Thr
Gln Gly Arg Pro Ser 340 345 350 Gln Ala Ile Met Asn Lys Leu Lys Asp
Tyr Phe Ile Lys Gln Ile Lys 355 360 365 Asn Tyr Met Asp Lys Gly Thr
Ser Ser Ser Thr Val Val Lys Asp Gly 370 375 380 Lys Thr Ser Ser Ala
Ser Leu Asp Ala Ala Thr His Glu His Ser Ala 385 390 395 400 Gln Trp
Leu Asn Asn Tyr Lys Lys Gly Tyr Gly Tyr Gly Pro Tyr Pro 405 410 415
Leu Gly Ile Asn Gly Gly Met His Tyr Gly Val Asp Phe Phe Met Asn 420
425 430 Ile Gly Thr Pro Val Lys Ala Ile Ser Ser Gly Lys Ile Val Glu
Ala 435 440 445 Gly Trp Ser Asn Tyr Gly Gly Gly Asn Gln Ile Gly Leu
Ile Glu Asn 450 455 460 Asp Gly Val His Arg Gln Trp Tyr Met His Leu
Ser Lys Tyr Asn Val 465 470 475 480 Lys Val Gly Asp Tyr Val Lys Ala
Gly Gln Ile Ile Gly Trp Ser Gly 485 490 495 Ser Thr Gly Tyr Ser Thr
Ala Pro His Leu His Phe Gln Arg Met Val 500 505 510 Asn Ser Phe Ser
Gln Ser Thr Ala Gln Asp Pro Met Pro Phe Leu Lys 515 520 525 Ser Ala
Gly Tyr Gly Lys Ala Gly Gly Thr Val Thr Pro Thr Pro Asn 530 535 540
Thr Gly Trp Lys Thr Asn Lys Tyr Gly Thr Leu Tyr Lys Ser Glu Ser 545
550 555 560 Ala Ser Phe Thr Pro Asn Thr Asp Ile Ile Thr Arg Thr Thr
Gly Pro 565 570 575 Phe Arg Ser Met Pro Gln Ser Gly Val Leu Lys Ala
Gly Gln Thr Ile 580 585 590 His Tyr Asp Glu Val Met Lys Gln Asp Gly
His Val Trp Val Gly Tyr 595 600 605 Thr Gly Asn Ser Gly Gln Arg Ile
Tyr Leu Pro Val Arg Thr Trp Gln 610 615 620 Lys Ser Thr Asn Thr Leu
Gly Val Leu Trp Gly Thr Ile Lys Leu Glu 625 630 635 640 His His His
His His His 645 91434DNAartificial sequencePhage K &
Staphylococcus simulans 9atggctaaga ctcaagcaga aataaataaa
cgtttagatg cttatgcaaa aggaacagta 60gatagccctt acagagttaa aaaagctaca
agttatgacc catcatttgg tgtaatggaa 120gcaggagcca ttgatgcaga
tggttactat cacgctcagt gtcaagacct tattacagac 180tatgttttat
ggttaacaga taataaagtt agaacttggg gtaatgctaa agaccaaatt
240aaacagagtt atggtactgg atttaaaata catgaaaata aaccttctac
tgtacctaaa 300aaaggttgga ttgcggtatt tacatccggt agttatgaac
agtggggtca cataggtatt 360gtatatgatg gaggtaatac ttctacattt
actattttag agcaaaactg gaatggttat 420gctaataaaa aacctacaaa
acgtgtagat aattattacg gattaactca cttcattgaa 480atacctgtaa
aagcaggaac tactgttaaa aaagaaacag ctaagaaaag cgcaagtaaa
540acgcctgcac ctaaaaagaa agcaacacta aaagtttcta agaatcacat
taactataca 600atggataaac gtggtaaaaa acctgaagga atggtaatac
acaacgatgc aggtcgttct 660tcactcgacg ctgcaacaca tgaacattca
gcacaatggt tgaataatta caaaaaagga 720tatggttacg gcccttatcc
attaggtata aatggcggta tgcactacgg agttgatttt 780tttatgaata
ttggaacacc agtaaaagct atttcaagcg gaaaaatagt tgaagctggt
840tggagtaatt acggaggagg taatcaaata ggtcttattg aaaatgatgg
agtgcataga 900caatggtata tgcatctaag taaatataat gttaaagtag
gagattatgt caaagctggt 960caaataatcg gttggtctgg aagcactggt
tattctacag caccacattt acacttccaa 1020agaatggtta actcattttc
acagtcaact gcccaagatc caatgccttt cttaaagagc 1080gcaggatatg
gaaaagcagg tggtacagta actccaacgc cgaatacagg ttggaaaaca
1140aacaaatatg gcacactata taaatcagag tcagctagct tcacacctaa
tacagatata 1200ataacaagaa cgactggtcc atttagaagc atgccgcagt
caggagtctt aaaagcaggt 1260caaacaattc attatgatga agtgatgaaa
caagacggtc atgtttgggt aggttataca 1320ggtaacagtg gccaacgtat
ttacttgcct gtgagaacat ggcagaagtc tactaatact 1380ctgggtgttc
tgtggggaac tataaagctc gagcaccacc accaccacca ctga
143410477PRTartificial sequencePhage K & Staphylococcus
simulans 10Met Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala
Tyr Ala 1 5 10 15 Lys Gly Thr Val Asp Ser Pro Tyr Arg Val Lys Lys
Ala Thr Ser Tyr 20 25 30 Asp Pro Ser Phe Gly Val Met Glu Ala Gly
Ala Ile Asp Ala Asp Gly 35 40 45 Tyr Tyr His Ala Gln Cys Gln Asp
Leu Ile Thr Asp Tyr Val Leu Trp 50 55 60 Leu Thr Asp Asn Lys Val
Arg Thr Trp Gly Asn Ala Lys Asp Gln Ile 65 70 75 80 Lys Gln Ser Tyr
Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro Ser 85 90 95 Thr Val
Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser Tyr 100 105 110
Glu Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr Ser 115
120 125 Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys
Lys 130 135 140 Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu Thr His
Phe Ile Glu 145 150 155 160 Ile Pro Val Lys Ala Gly Thr Thr Val Lys
Lys Glu Thr Ala Lys Lys 165 170 175 Ser Ala Ser Lys Thr Pro Ala Pro
Lys Lys Lys Ala Thr Leu Lys Val 180 185 190 Ser Lys Asn His Ile Asn
Tyr Thr Met Asp Lys Arg Gly Lys Lys Pro 195 200 205 Glu Gly Met Val
Ile His Asn Asp Ala Gly Arg Ser Ser Leu Asp Ala 210 215 220 Ala Thr
His Glu His Ser Ala Gln Trp Leu Asn Asn Tyr Lys Lys Gly 225 230 235
240 Tyr Gly Tyr Gly Pro Tyr Pro Leu Gly Ile Asn Gly Gly Met His Tyr
245 250 255 Gly Val Asp Phe Phe Met Asn Ile Gly Thr Pro Val Lys Ala
Ile Ser 260 265 270 Ser Gly Lys Ile Val Glu Ala Gly Trp Ser Asn Tyr
Gly Gly Gly Asn 275 280 285 Gln Ile Gly Leu Ile Glu Asn Asp Gly Val
His Arg Gln Trp Tyr Met 290 295 300 His Leu Ser Lys Tyr Asn Val Lys
Val Gly Asp Tyr Val Lys Ala Gly 305 310 315 320 Gln Ile Ile Gly Trp
Ser Gly Ser Thr Gly Tyr Ser Thr Ala Pro His 325 330 335 Leu His Phe
Gln Arg Met Val Asn Ser Phe Ser Gln Ser Thr Ala Gln 340 345 350 Asp
Pro Met Pro Phe Leu Lys Ser Ala Gly Tyr Gly Lys Ala Gly Gly 355 360
365 Thr Val Thr Pro Thr Pro Asn Thr Gly Trp Lys Thr Asn Lys Tyr Gly
370 375 380 Thr Leu Tyr Lys Ser Glu Ser Ala Ser Phe Thr Pro Asn Thr
Asp Ile 385 390 395 400 Ile Thr Arg Thr Thr Gly Pro Phe Arg Ser Met
Pro Gln Ser Gly Val 405 410 415 Leu Lys Ala Gly Gln Thr Ile His Tyr
Asp Glu Val Met Lys Gln Asp 420 425 430 Gly His Val Trp Val Gly Tyr
Thr Gly Asn Ser Gly Gln Arg Ile Tyr 435 440 445 Leu Pro Val Arg Thr
Trp Gln Lys Ser Thr Asn Thr Leu Gly Val Leu 450 455 460 Trp Gly Thr
Ile Lys Leu Glu His His His His His His 465 470 475
111941DNAartificial sequencePhage K & Staphylococcus simulans
11atggctgcaa cacatgaaca ttcagcacaa tggttgaata attacaaaaa aggatatggt
60tacggccctt atccattagg tataaatggc ggtatgcact acggagttga tttttttatg
120aatattggaa caccagtaaa agctatttca agcggaaaaa tagttgaagc
tggttggagt 180aattacggag gaggtaatca aataggtctt attgaaaatg
atggagtgca tagacaatgg 240tatatgcatc taagtaaata taatgttaaa
gtaggagatt atgtcaaagc tggtcaaata 300atcggttggt ctggaagcac
tggttattct acagcaccac atttacactt ccaaagaatg 360gttaactcat
tttcacagtc aactgcccaa gatccaatgc ctttcttaaa gagcgcagga
420tatggaaaag caggtggtac agtaactcca acgccgaata caggttggaa
aacaaacaaa 480tatggcacac tatataaatc agagtcagct agcttcacac
ctaatacaga tataataaca 540agaacgactg gtccatttag aagcatgccg
cagtcaggag tcttaaaagc aggtcaaaca 600attcattatg atgaagtgat
gaaacaagac ggtcatgttt gggtaggtta tacaggtaac 660agtggccaac
gtatttactt gcctgtgaga acatggcaga agtctactaa tactctgggt
720gttctgtggg gaactataaa gctcgacgct aagactcaag cagaaataaa
taaacgttta 780gatgcttatg caaaaggaac agtagatagc ccttacagag
ttaaaaaagc tacaagttat 840gacccatcat ttggtgtaat ggaagcagga
gccattgatg cagatggtta ctatcacgct 900cagtgtcaag accttattac
agactatgtt ttatggttaa cagataataa agttagaact 960tggggtaatg
ctaaagacca aattaaacag agttatggta ctggatttaa aatacatgaa
1020aataaacctt ctactgtacc taaaaaaggt tggattgcgg tatttacatc
cggtagttat 1080gaacagtggg gtcacatagg tattgtatat gatggaggta
atacttctac atttactatt 1140ttagagcaaa actggaatgg ttatgctaat
aaaaaaccta caaaacgtgt agataattat 1200tacggattaa ctcacttcat
tgaaatacct gtaaaagcag gaactactgt taaaaaagaa 1260acagctaaga
aaagcgcaag taaaacgcct gcacctaaaa agaaagcaac actaaaagtt
1320tctaagaatc acattaacta tacaatggat aaacgtggta aaaaacctga
aggaatggta 1380atacacaacg atgcaggtcg ttcttcagga caacaatacg
agaattcatt agctaatgca 1440ggttatgcta gatacgctaa tggtattgct
cattactacg gctctgaagg ttatgtatgg 1500gaagcaatag atgctaagaa
tcaaattgct tggcacacgg gtgatggaac aggagcaaac 1560tcaggtaact
ttagatttgc aggtattgaa gtctgtcaat caatgagtgc tagtgatgct
1620caattcctta aaaatgaaca agcagtattc caatttacag cagagaaatt
taaagaatgg 1680ggtcttactc ctaaccgtaa aactgtaaga ttgcatatgg
aatttgtacc aactgcctgt 1740cctcaccgtt ctatggttct tcatacagga
tttaatccag taacacaagg aagaccatca 1800caagcaataa tgaataaatt
aaaagattat ttcattaaac aaattaaaaa ctacatggat 1860aaaggaactt
caagttctac agtagttaaa gatggtaaaa caagtagcgc aagtctcgag
1920caccaccacc accaccactg a 194112646PRTartificial sequencePhage K
& Staphylococcus simulans 12Met Ala Ala Thr His Glu His Ser Ala
Gln Trp Leu Asn Asn Tyr Lys 1 5 10 15 Lys Gly Tyr Gly Tyr Gly Pro
Tyr Pro Leu Gly Ile Asn Gly Gly Met 20 25 30 His Tyr Gly Val Asp
Phe Phe Met Asn Ile Gly Thr Pro Val Lys Ala 35 40 45 Ile Ser Ser
Gly Lys Ile Val Glu Ala Gly Trp Ser Asn Tyr Gly Gly 50 55 60 Gly
Asn Gln Ile Gly Leu Ile Glu Asn Asp Gly Val His Arg Gln Trp 65 70
75 80 Tyr Met His Leu Ser Lys Tyr Asn Val Lys Val Gly Asp Tyr Val
Lys 85 90 95 Ala Gly Gln Ile Ile Gly Trp Ser Gly Ser Thr Gly Tyr
Ser Thr Ala 100 105 110 Pro His Leu His Phe Gln Arg Met Val Asn Ser
Phe Ser Gln Ser Thr 115 120 125 Ala Gln Asp Pro Met Pro Phe Leu Lys
Ser Ala Gly Tyr Gly Lys Ala 130 135 140 Gly Gly Thr Val Thr Pro Thr
Pro Asn Thr Gly Trp Lys Thr Asn Lys 145 150 155 160 Tyr Gly Thr Leu
Tyr Lys Ser Glu Ser Ala Ser Phe Thr Pro Asn Thr 165 170 175 Asp Ile
Ile Thr Arg Thr Thr Gly Pro Phe Arg Ser Met Pro Gln Ser 180 185 190
Gly Val Leu Lys Ala Gly Gln Thr Ile His Tyr Asp Glu Val Met Lys 195
200 205 Gln Asp Gly His Val Trp Val Gly Tyr Thr Gly Asn Ser Gly Gln
Arg 210 215 220 Ile Tyr Leu Pro Val Arg Thr Trp Gln Lys Ser Thr Asn
Thr Leu Gly 225 230 235 240 Val Leu Trp Gly Thr Ile Lys Leu Asp Ala
Lys Thr Gln Ala Glu Ile 245 250 255 Asn Lys Arg Leu Asp Ala Tyr Ala
Lys Gly Thr Val Asp Ser Pro Tyr 260 265 270 Arg Val Lys Lys Ala Thr
Ser Tyr Asp Pro Ser Phe Gly Val Met Glu 275 280 285 Ala Gly Ala Ile
Asp Ala Asp Gly Tyr Tyr His Ala Gln Cys Gln Asp 290 295 300 Leu Ile
Thr Asp Tyr Val Leu Trp Leu Thr Asp Asn Lys Val Arg Thr 305 310 315
320 Trp Gly Asn Ala Lys Asp Gln Ile Lys Gln Ser Tyr Gly Thr Gly Phe
325 330 335 Lys Ile His Glu Asn Lys Pro Ser Thr Val Pro Lys Lys Gly
Trp Ile 340 345 350 Ala Val Phe Thr Ser Gly Ser Tyr Glu Gln Trp Gly
His Ile
Gly Ile 355 360 365 Val Tyr Asp Gly Gly Asn Thr Ser Thr Phe Thr Ile
Leu Glu Gln Asn 370 375 380 Trp Asn Gly Tyr Ala Asn Lys Lys Pro Thr
Lys Arg Val Asp Asn Tyr 385 390 395 400 Tyr Gly Leu Thr His Phe Ile
Glu Ile Pro Val Lys Ala Gly Thr Thr 405 410 415 Val Lys Lys Glu Thr
Ala Lys Lys Ser Ala Ser Lys Thr Pro Ala Pro 420 425 430 Lys Lys Lys
Ala Thr Leu Lys Val Ser Lys Asn His Ile Asn Tyr Thr 435 440 445 Met
Asp Lys Arg Gly Lys Lys Pro Glu Gly Met Val Ile His Asn Asp 450 455
460 Ala Gly Arg Ser Ser Gly Gln Gln Tyr Glu Asn Ser Leu Ala Asn Ala
465 470 475 480 Gly Tyr Ala Arg Tyr Ala Asn Gly Ile Ala His Tyr Tyr
Gly Ser Glu 485 490 495 Gly Tyr Val Trp Glu Ala Ile Asp Ala Lys Asn
Gln Ile Ala Trp His 500 505 510 Thr Gly Asp Gly Thr Gly Ala Asn Ser
Gly Asn Phe Arg Phe Ala Gly 515 520 525 Ile Glu Val Cys Gln Ser Met
Ser Ala Ser Asp Ala Gln Phe Leu Lys 530 535 540 Asn Glu Gln Ala Val
Phe Gln Phe Thr Ala Glu Lys Phe Lys Glu Trp 545 550 555 560 Gly Leu
Thr Pro Asn Arg Lys Thr Val Arg Leu His Met Glu Phe Val 565 570 575
Pro Thr Ala Cys Pro His Arg Ser Met Val Leu His Thr Gly Phe Asn 580
585 590 Pro Val Thr Gln Gly Arg Pro Ser Gln Ala Ile Met Asn Lys Leu
Lys 595 600 605 Asp Tyr Phe Ile Lys Gln Ile Lys Asn Tyr Met Asp Lys
Gly Thr Ser 610 615 620 Ser Ser Thr Val Val Lys Asp Gly Lys Thr Ser
Ser Ala Ser Leu Glu 625 630 635 640 His His His His His His 645
132214DNAartificial sequencePhage Phi 11 & Staphylococcus
simulans 13atgcaagcaa aattaactaa aaatgagttt atagagtggt tgaaaacttc
tgagggaaaa 60caattcaatg tggacttatg gtatggattt caatgctttg attatgccaa
tgctggttgg 120aaagttttgt ttggattact tctaaaaggt ttaggtgcaa
aagatattcc gttcgctaac 180aacttcgacg gattagctac tgtataccaa
aatacaccgg acttcttagc acaacctggc 240gacatggtgg tattcggtag
caactacggt gctggatatg gtcacgttgc atgggtaatt 300gaagcaactt
tagattacat cattgtatat gagcagaatt ggctaggcgg tggctggact
360gacggaatcg aacaacccgg ctggggttgg gaaaaagtta caagacgaca
acatgcttat 420gatttcccta tgtggtttat ccgtccgaat tttaaaagtg
agacagcgcc acgatcagtt 480caatctccta cacaagcacc taaaaaagaa
acagctaagc cacaacctaa agcagtagaa 540cttaaaatca tcaaagatgt
ggttaaaggt tatgacctac ctaagcgtgg tagtaaccct 600aaaggtatag
ttatacacaa cgacgcaggg agcaaagggg cgactgctga agcatatcgt
660aacggattag taaatgcacc tttatcaaga ttagaagcgg gcattgcgca
tagttacgta 720tcaggcaaca cagtttggca agccttagat gaatcacaag
taggttggca taccgctaat 780caaataggta ataaatatta ttacggtatt
gaagtatgtc aatcaatggg cgcagataac 840gcgacattct taaaaaatga
acaggcaact ttccaagaat gcgctagatt gttgaaaaaa 900tggggattac
cagcaaacag aaatacaatc agattgcaca atgaatttac ttcaacatca
960tgccctcata gaagttcggt tttacacact ggttttgacc cagtaactcg
cggtctattg 1020ccagaagaca agcggttgca acttaaagac tactttatca
agcagattag ggcgtacatg 1080gatggtaaaa taccggttgc cactgtctct
aatgagtcaa gcgcttcaag taatacagtt 1140aaaccagttg caagtgcatg
gaaacgtaat aaatatggta cttactacat ggaagaaagt 1200gctagattca
caaacggcaa tcaaccaatc acagtaagaa aagtggggcc attcttatct
1260tgtccagtgg gttatcagtt ccaacctggt gggtattgtg attatacaga
agtgatgtta 1320caagatggtc atgtttgggt aggatataca tgggaggggc
aacgttatta cttgcctatt 1380agaacatgga atggttctgc cccacctaat
cagatattag gtgacttatg gggagaaatc 1440agtctcgacg ctgcaacaca
tgaacattca gcacaatggt tgaataatta caaaaaagga 1500tatggttacg
gcccttatcc attaggtata aatggcggta tgcactacgg agttgatttt
1560tttatgaata ttggaacacc agtaaaagct atttcaagcg gaaaaatagt
tgaagctggt 1620tggagtaatt acggaggagg taatcaaata ggtcttattg
aaaatgatgg agtgcataga 1680caatggtata tgcatctaag taaatataat
gttaaagtag gagattatgt caaagctggt 1740caaataatcg gttggtctgg
aagcactggt tattctacag caccacattt acacttccaa 1800agaatggtta
actcattttc acagtcaact gcccaagatc caatgccttt cttaaagagc
1860gcaggatatg gaaaagcagg tggtacagta actccaacgc cgaatacagg
ttggaaaaca 1920aacaaatatg gcacactata taaatcagag tcagctagct
tcacacctaa tacagatata 1980ataacaagaa cgactggtcc atttagaagc
atgccgcagt caggagtctt aaaagcaggt 2040caaacaattc attatgatga
agtgatgaaa caagacggtc atgtttgggt aggttataca 2100ggtaacagtg
gccaacgtat ttacttgcct gtgagaacat ggcagaagtc tactaatact
2160ctgggtgttc tgtggggaac tataaagctc gagcaccacc accaccacca ctga
221414737PRTartificial sequencePhage Phi 11 & Staphylococcus
simulans 14Met Gln Ala Lys Leu Thr Lys Asn Glu Phe Ile Glu Trp Leu
Lys Thr 1 5 10 15 Ser Glu Gly Lys Gln Phe Asn Val Asp Leu Trp Tyr
Gly Phe Gln Cys 20 25 30 Phe Asp Tyr Ala Asn Ala Gly Trp Lys Val
Leu Phe Gly Leu Leu Leu 35 40 45 Lys Gly Leu Gly Ala Lys Asp Ile
Pro Phe Ala Asn Asn Phe Asp Gly 50 55 60 Leu Ala Thr Val Tyr Gln
Asn Thr Pro Asp Phe Leu Ala Gln Pro Gly 65 70 75 80 Asp Met Val Val
Phe Gly Ser Asn Tyr Gly Ala Gly Tyr Gly His Val 85 90 95 Ala Trp
Val Ile Glu Ala Thr Leu Asp Tyr Ile Ile Val Tyr Glu Gln 100 105 110
Asn Trp Leu Gly Gly Gly Trp Thr Asp Gly Ile Glu Gln Pro Gly Trp 115
120 125 Gly Trp Glu Lys Val Thr Arg Arg Gln His Ala Tyr Asp Phe Pro
Met 130 135 140 Trp Phe Ile Arg Pro Asn Phe Lys Ser Glu Thr Ala Pro
Arg Ser Val 145 150 155 160 Gln Ser Pro Thr Gln Ala Pro Lys Lys Glu
Thr Ala Lys Pro Gln Pro 165 170 175 Lys Ala Val Glu Leu Lys Ile Ile
Lys Asp Val Val Lys Gly Tyr Asp 180 185 190 Leu Pro Lys Arg Gly Ser
Asn Pro Lys Gly Ile Val Ile His Asn Asp 195 200 205 Ala Gly Ser Lys
Gly Ala Thr Ala Glu Ala Tyr Arg Asn Gly Leu Val 210 215 220 Asn Ala
Pro Leu Ser Arg Leu Glu Ala Gly Ile Ala His Ser Tyr Val 225 230 235
240 Ser Gly Asn Thr Val Trp Gln Ala Leu Asp Glu Ser Gln Val Gly Trp
245 250 255 His Thr Ala Asn Gln Ile Gly Asn Lys Tyr Tyr Tyr Gly Ile
Glu Val 260 265 270 Cys Gln Ser Met Gly Ala Asp Asn Ala Thr Phe Leu
Lys Asn Glu Gln 275 280 285 Ala Thr Phe Gln Glu Cys Ala Arg Leu Leu
Lys Lys Trp Gly Leu Pro 290 295 300 Ala Asn Arg Asn Thr Ile Arg Leu
His Asn Glu Phe Thr Ser Thr Ser 305 310 315 320 Cys Pro His Arg Ser
Ser Val Leu His Thr Gly Phe Asp Pro Val Thr 325 330 335 Arg Gly Leu
Leu Pro Glu Asp Lys Arg Leu Gln Leu Lys Asp Tyr Phe 340 345 350 Ile
Lys Gln Ile Arg Ala Tyr Met Asp Gly Lys Ile Pro Val Ala Thr 355 360
365 Val Ser Asn Glu Ser Ser Ala Ser Ser Asn Thr Val Lys Pro Val Ala
370 375 380 Ser Ala Trp Lys Arg Asn Lys Tyr Gly Thr Tyr Tyr Met Glu
Glu Ser 385 390 395 400 Ala Arg Phe Thr Asn Gly Asn Gln Pro Ile Thr
Val Arg Lys Val Gly 405 410 415 Pro Phe Leu Ser Cys Pro Val Gly Tyr
Gln Phe Gln Pro Gly Gly Tyr 420 425 430 Cys Asp Tyr Thr Glu Val Met
Leu Gln Asp Gly His Val Trp Val Gly 435 440 445 Tyr Thr Trp Glu Gly
Gln Arg Tyr Tyr Leu Pro Ile Arg Thr Trp Asn 450 455 460 Gly Ser Ala
Pro Pro Asn Gln Ile Leu Gly Asp Leu Trp Gly Glu Ile 465 470 475 480
Ser Leu Asp Ala Ala Thr His Glu His Ser Ala Gln Trp Leu Asn Asn 485
490 495 Tyr Lys Lys Gly Tyr Gly Tyr Gly Pro Tyr Pro Leu Gly Ile Asn
Gly 500 505 510 Gly Met His Tyr Gly Val Asp Phe Phe Met Asn Ile Gly
Thr Pro Val 515 520 525 Lys Ala Ile Ser Ser Gly Lys Ile Val Glu Ala
Gly Trp Ser Asn Tyr 530 535 540 Gly Gly Gly Asn Gln Ile Gly Leu Ile
Glu Asn Asp Gly Val His Arg 545 550 555 560 Gln Trp Tyr Met His Leu
Ser Lys Tyr Asn Val Lys Val Gly Asp Tyr 565 570 575 Val Lys Ala Gly
Gln Ile Ile Gly Trp Ser Gly Ser Thr Gly Tyr Ser 580 585 590 Thr Ala
Pro His Leu His Phe Gln Arg Met Val Asn Ser Phe Ser Gln 595 600 605
Ser Thr Ala Gln Asp Pro Met Pro Phe Leu Lys Ser Ala Gly Tyr Gly 610
615 620 Lys Ala Gly Gly Thr Val Thr Pro Thr Pro Asn Thr Gly Trp Lys
Thr 625 630 635 640 Asn Lys Tyr Gly Thr Leu Tyr Lys Ser Glu Ser Ala
Ser Phe Thr Pro 645 650 655 Asn Thr Asp Ile Ile Thr Arg Thr Thr Gly
Pro Phe Arg Ser Met Pro 660 665 670 Gln Ser Gly Val Leu Lys Ala Gly
Gln Thr Ile His Tyr Asp Glu Val 675 680 685 Met Lys Gln Asp Gly His
Val Trp Val Gly Tyr Thr Gly Asn Ser Gly 690 695 700 Gln Arg Ile Tyr
Leu Pro Val Arg Thr Trp Gln Lys Ser Thr Asn Thr 705 710 715 720 Leu
Gly Val Leu Trp Gly Thr Ile Lys Leu Glu His His His His His 725 730
735 His 151470DNAartificial sequencePhi 11 15atgcaagcaa aattaactaa
aaatgagttt atagagtggt tgaaaacttc tgagggaaaa 60caattcaatg tggacttatg
gtatggattt caatgctttg attatgccaa tgctggttgg 120aaagttttgt
ttggattact tctaaaaggt ttaggtgcaa aagatattcc gttcgctaac
180aacttcgacg gattagctac tgtataccaa aatacaccgg acttcttagc
acaacctggc 240gacatggtgg tattcggtag caactacggt gctggatatg
gtcacgttgc atgggtaatt 300gaagcaactt tagattacat cattgtatat
gagcagaatt ggctaggcgg tggctggact 360gacggaatcg aacaacccgg
ctggggttgg gaaaaagtta caagacgaca acatgcttat 420gatttcccta
tgtggtttat ccgtccgaat tttaaaagtg agacagcgcc acgatcagtt
480caatctccta cacaagcacc taaaaaagaa acagctaagc cacaacctaa
agcagtagaa 540cttaaaatca tcaaagatgt ggttaaaggt tatgacctac
ctaagcgtgg tagtaaccct 600aaaggtatag ttatacacaa cgacgcaggg
agcaaagggg cgactgctga agcatatcgt 660aacggattag taaatgcacc
tttatcaaga ttagaagcgg gcattgcgca tagttacgta 720tcaggcaaca
cagtttggca agccttagat gaatcacaag taggttggca taccgctaat
780caaataggta ataaatatta ttacggtatt gaagtatgtc aatcaatggg
cgcagataac 840gcgacattct taaaaaatga acaggcaact ttccaagaat
gcgctagatt gttgaaaaaa 900tggggattac cagcaaacag aaatacaatc
agattgcaca atgaatttac ttcaacatca 960tgccctcata gaagttcggt
tttacacact ggttttgacc cagtaactcg cggtctattg 1020ccagaagaca
agcggttgca acttaaagac tactttatca agcagattag ggcgtacatg
1080gatggtaaaa taccggttgc cactgtctct aatgagtcaa gcgcttcaag
taatacagtt 1140aaaccagttg caagtgcatg gaaacgtaat aaatatggta
cttactacat ggaagaaagt 1200gctagattca caaacggcaa tcaaccaatc
acagtaagaa aagtggggcc attcttatct 1260tgtccagtgg gttatcagtt
ccaacctggt gggtattgtg attatacaga agtgatgtta 1320caagatggtc
atgtttgggt aggatataca tgggaggggc aacgttatta cttgcctatt
1380agaacatgga atggttctgc cccacctaat cagatattag gtgacttatg
gggagaaatc 1440agtctcgagc accaccacca ccaccactga
147016489PRTartificial sequencePhi 11 16Met Gln Ala Lys Leu Thr Lys
Asn Glu Phe Ile Glu Trp Leu Lys Thr 1 5 10 15 Ser Glu Gly Lys Gln
Phe Asn Val Asp Leu Trp Tyr Gly Phe Gln Cys 20 25 30 Phe Asp Tyr
Ala Asn Ala Gly Trp Lys Val Leu Phe Gly Leu Leu Leu 35 40 45 Lys
Gly Leu Gly Ala Lys Asp Ile Pro Phe Ala Asn Asn Phe Asp Gly 50 55
60 Leu Ala Thr Val Tyr Gln Asn Thr Pro Asp Phe Leu Ala Gln Pro Gly
65 70 75 80 Asp Met Val Val Phe Gly Ser Asn Tyr Gly Ala Gly Tyr Gly
His Val 85 90 95 Ala Trp Val Ile Glu Ala Thr Leu Asp Tyr Ile Ile
Val Tyr Glu Gln 100 105 110 Asn Trp Leu Gly Gly Gly Trp Thr Asp Gly
Ile Glu Gln Pro Gly Trp 115 120 125 Gly Trp Glu Lys Val Thr Arg Arg
Gln His Ala Tyr Asp Phe Pro Met 130 135 140 Trp Phe Ile Arg Pro Asn
Phe Lys Ser Glu Thr Ala Pro Arg Ser Val 145 150 155 160 Gln Ser Pro
Thr Gln Ala Pro Lys Lys Glu Thr Ala Lys Pro Gln Pro 165 170 175 Lys
Ala Val Glu Leu Lys Ile Ile Lys Asp Val Val Lys Gly Tyr Asp 180 185
190 Leu Pro Lys Arg Gly Ser Asn Pro Lys Gly Ile Val Ile His Asn Asp
195 200 205 Ala Gly Ser Lys Gly Ala Thr Ala Glu Ala Tyr Arg Asn Gly
Leu Val 210 215 220 Asn Ala Pro Leu Ser Arg Leu Glu Ala Gly Ile Ala
His Ser Tyr Val 225 230 235 240 Ser Gly Asn Thr Val Trp Gln Ala Leu
Asp Glu Ser Gln Val Gly Trp 245 250 255 His Thr Ala Asn Gln Ile Gly
Asn Lys Tyr Tyr Tyr Gly Ile Glu Val 260 265 270 Cys Gln Ser Met Gly
Ala Asp Asn Ala Thr Phe Leu Lys Asn Glu Gln 275 280 285 Ala Thr Phe
Gln Glu Cys Ala Arg Leu Leu Lys Lys Trp Gly Leu Pro 290 295 300 Ala
Asn Arg Asn Thr Ile Arg Leu His Asn Glu Phe Thr Ser Thr Ser 305 310
315 320 Cys Pro His Arg Ser Ser Val Leu His Thr Gly Phe Asp Pro Val
Thr 325 330 335 Arg Gly Leu Leu Pro Glu Asp Lys Arg Leu Gln Leu Lys
Asp Tyr Phe 340 345 350 Ile Lys Gln Ile Arg Ala Tyr Met Asp Gly Lys
Ile Pro Val Ala Thr 355 360 365 Val Ser Asn Glu Ser Ser Ala Ser Ser
Asn Thr Val Lys Pro Val Ala 370 375 380 Ser Ala Trp Lys Arg Asn Lys
Tyr Gly Thr Tyr Tyr Met Glu Glu Ser 385 390 395 400 Ala Arg Phe Thr
Asn Gly Asn Gln Pro Ile Thr Val Arg Lys Val Gly 405 410 415 Pro Phe
Leu Ser Cys Pro Val Gly Tyr Gln Phe Gln Pro Gly Gly Tyr 420 425 430
Cys Asp Tyr Thr Glu Val Met Leu Gln Asp Gly His Val Trp Val Gly 435
440 445 Tyr Thr Trp Glu Gly Gln Arg Tyr Tyr Leu Pro Ile Arg Thr Trp
Asn 450 455 460 Gly Ser Ala Pro Pro Asn Gln Ile Leu Gly Asp Leu Trp
Gly Glu Ile 465 470 475 480 Ser Leu Glu His His His His His His 485
1725DNAartificial sequenceChemically Synthesized 17gagaaattac
atatggctaa gactc 251827DNAartificial sequenceChemically Synthesized
18atggtgatgc tcgagtttga atactcc 271939DNAartificial
sequenceChemically Synthesized 19acgtacgtca tatggctgca acacatgaac
attcagcac 392032DNAartificial sequenceChemically Synthesized
20gcgctactcg agaccacctg cttttccata tc 322137DNAartificial
sequenceChemically Synthesized 21atcatcgtcg acgctgcaac acatgaacat
tcagcac 372233DNAartificial sequenceChemically Synthesized
22gtggtgctcg agacttgcgc tacttgtttt acc 332320DNAartificial
sequenceChemically Synthesized 23ggataacaat tcccctctag
202427DNAartificial sequenceChemically Synthesized 24gtattgctcg
agtgaagaac gacctgc 272522DNAartificial sequenceChemically
Synthesized 25gatatagtcg acgctaagac tc 222625DNAartificial
sequenceChemically Synthesized 26cgtttagagg ccccaagggg ttatg
252726DNAartificial sequenceChemically Synthesized 27gtggcgcata
tgcaagcaaa attaac
262825DNAartificial sequenceChemically Synthesized 28tgactatgtc
ctcgagactg atttc 25291974DNAartificial sequenceStaphylococcus
simulans & Phage K 29atggctgcaa cacatgaaca ttcagcacaa
tggttgaata attacaaaaa aggatatggt 60tacggccctt atccattagg tataaatggc
ggtatgcact acggagttga tttttttatg 120aatattggaa caccagtaaa
agctatttca agcggaaaaa tagttgaagc tggttggagt 180aattacggag
gaggtaatca aataggtctt attgaaaatg atggagtgca tagacaatgg
240tatatgcatc taagtaaata taatgttaaa gtaggagatt atgtcaaagc
tggtcaaata 300atcggttggt ctggaagcac tggttattct acagcaccac
atttacactt ccaaagaatg 360gttaattcat tttcaaattc aactgcccaa
gatccaatgc ctttcttaaa gagcgcagga 420tatggaaaag caggtggtac
agtaactcca acgccgaata caggtctcga cgctaagact 480caagcagaaa
taaataaacg tttagatgct tatgcaaaag gaacagtaga tagcccttac
540agagttaaaa aagctacaag ttatgaccca tcatttggtg taatggaagc
aggagccatt 600gatgcagatg gttactatca cgctcagtgt caagacctta
ttacagacta tgttttatgg 660ttaacagata ataaagttag aacttggggt
aatgctaaag accaaattaa acagagttat 720ggtactggat ttaaaataca
tgaaaataaa ccttctactg tacctaaaaa aggttggatt 780gcggtattta
catccggtag ttatgaacag tggggtcaca taggtattgt atatgatgga
840ggtaatactt ctacatttac tattttagag caaaactgga atggttatgc
taataaaaaa 900cctacaaaac gtgtagataa ttattacgga ttaactcact
tcattgaaat acctgtaaaa 960gcaggaacta ctgttaaaaa agaaacagct
aagaaaagcg caagtaaaac gcctgcacct 1020aaaaagaaag caacactaaa
agtttctaag aatcacatta actatacaat ggataaacgt 1080ggtaaaaaac
ctgaaggaat ggtaatacac aacgatgcag gtcgttcttc aggacaacaa
1140tacgagaatt cattagctaa tgcaggttat gctagatacg ctaatggtat
tgctcattac 1200tacggctctg aaggttatgt atgggaagca atagatgcta
agaatcaaat tgcttggcac 1260acgggtgatg gaacaggagc aaactcgggt
aactttagat ttgcaggtat tgaagtctgt 1320caatcaatga gtgctagtga
tgctcaattc cttaaaaatg aacaagcagt attccaattt 1380acagcagaga
aatttaaaga atggggtctt actcctaacc gtaaaactgt aagattgcat
1440atggaatttg taccaactgc ctgtcctcac cgttctatgg ttcttcatac
aggatttaat 1500ccagtaacac aaggaagacc atcacaagca ataatgaata
aattaaaaga ttatttcatt 1560aaacaaatta aaaactacat ggataaagga
acttcgagtt ctacagtagt taaagatggt 1620aaaacaagta gcgcaagtct
cgacacagta actccaacgc cgaatacagg ttggaaaaca 1680aacaaatatg
gcacactata taaatcagag tcagctagct tcacacctaa tacagatata
1740ataacaagaa cgactggtcc atttagaagc atgccgcagt caggagtctt
aaaagcaggt 1800caaacaattc attatgatga agtgatgaaa caagacggtc
atgtttgggt aggttataca 1860ggtaacagtg gccaacgtat ttacttgcct
gtaagaacat ggaataagtc tactaatact 1920ctgggtgttc tgtggggaac
tataaagctc gagcaccacc accaccacca ctga 197430657PRTartificial
sequenceStaphylococcus simulans & Phage K 30Met Ala Ala Thr His
Glu His Ser Ala Gln Trp Leu Asn Asn Tyr Lys 1 5 10 15 Lys Gly Tyr
Gly Tyr Gly Pro Tyr Pro Leu Gly Ile Asn Gly Gly Met 20 25 30 His
Tyr Gly Val Asp Phe Phe Met Asn Ile Gly Thr Pro Val Lys Ala 35 40
45 Ile Ser Ser Gly Lys Ile Val Glu Ala Gly Trp Ser Asn Tyr Gly Gly
50 55 60 Gly Asn Gln Ile Gly Leu Ile Glu Asn Asp Gly Val His Arg
Gln Trp 65 70 75 80 Tyr Met His Leu Ser Lys Tyr Asn Val Lys Val Gly
Asp Tyr Val Lys 85 90 95 Ala Gly Gln Ile Ile Gly Trp Ser Gly Ser
Thr Gly Tyr Ser Thr Ala 100 105 110 Pro His Leu His Phe Gln Arg Met
Val Asn Ser Phe Ser Asn Ser Thr 115 120 125 Ala Gln Asp Pro Met Pro
Phe Leu Lys Ser Ala Gly Tyr Gly Lys Ala 130 135 140 Gly Gly Thr Val
Thr Pro Thr Pro Asn Thr Gly Leu Asp Ala Lys Thr 145 150 155 160 Gln
Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr Ala Lys Gly Thr Val 165 170
175 Asp Ser Pro Tyr Arg Val Lys Lys Ala Thr Ser Tyr Asp Pro Ser Phe
180 185 190 Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp Gly Tyr Tyr
His Ala 195 200 205 Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu Trp
Leu Thr Asp Asn 210 215 220 Lys Val Arg Thr Trp Gly Asn Ala Lys Asp
Gln Ile Lys Gln Ser Tyr 225 230 235 240 Gly Thr Gly Phe Lys Ile His
Glu Asn Lys Pro Ser Thr Val Pro Lys 245 250 255 Lys Gly Trp Ile Ala
Val Phe Thr Ser Gly Ser Tyr Glu Gln Trp Gly 260 265 270 His Ile Gly
Ile Val Tyr Asp Gly Gly Asn Thr Ser Thr Phe Thr Ile 275 280 285 Leu
Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys Lys Pro Thr Lys Arg 290 295
300 Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile Glu Ile Pro Val Lys
305 310 315 320 Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys Lys Ser
Ala Ser Lys 325 330 335 Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys
Val Ser Lys Asn His 340 345 350 Ile Asn Tyr Thr Met Asp Lys Arg Gly
Lys Lys Pro Glu Gly Met Val 355 360 365 Ile His Asn Asp Ala Gly Arg
Ser Ser Gly Gln Gln Tyr Glu Asn Ser 370 375 380 Leu Ala Asn Ala Gly
Tyr Ala Arg Tyr Ala Asn Gly Ile Ala His Tyr 385 390 395 400 Tyr Gly
Ser Glu Gly Tyr Val Trp Glu Ala Ile Asp Ala Lys Asn Gln 405 410 415
Ile Ala Trp His Thr Gly Asp Gly Thr Gly Ala Asn Ser Gly Asn Phe 420
425 430 Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met Ser Ala Ser Asp
Ala 435 440 445 Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln Phe Thr
Ala Glu Lys 450 455 460 Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys
Thr Val Arg Leu His 465 470 475 480 Met Glu Phe Val Pro Thr Ala Cys
Pro His Arg Ser Met Val Leu His 485 490 495 Thr Gly Phe Asn Pro Val
Thr Gln Gly Arg Pro Ser Gln Ala Ile Met 500 505 510 Asn Lys Leu Lys
Asp Tyr Phe Ile Lys Gln Ile Lys Asn Tyr Met Asp 515 520 525 Lys Gly
Thr Ser Ser Ser Thr Val Val Lys Asp Gly Lys Thr Ser Ser 530 535 540
Ala Ser Leu Asp Thr Val Thr Pro Thr Pro Asn Thr Gly Trp Lys Thr 545
550 555 560 Asn Lys Tyr Gly Thr Leu Tyr Lys Ser Glu Ser Ala Ser Phe
Thr Pro 565 570 575 Asn Thr Asp Ile Ile Thr Arg Thr Thr Gly Pro Phe
Arg Ser Met Pro 580 585 590 Gln Ser Gly Val Leu Lys Ala Gly Gln Thr
Ile His Tyr Asp Glu Val 595 600 605 Met Lys Gln Asp Gly His Val Trp
Val Gly Tyr Thr Gly Asn Ser Gly 610 615 620 Gln Arg Ile Tyr Leu Pro
Val Arg Thr Trp Asn Lys Ser Thr Asn Thr 625 630 635 640 Leu Gly Val
Leu Trp Gly Thr Ile Lys Leu Glu His His His His His 645 650 655 His
3124DNAartificial sequenceChemically Synthesized 31gtttgtctcg
agacctgtat tcgg 243230DNAartificial sequenceChemically Synthesized
32gcgcatctcg agacagtaac tccaacgccg 30334PRTStaphylococcus aureus
33Ala Gln Lys Ala 1 345PRTStaphylococcus aureus 34Gly Gly Gly Gly
Gly 1 5 355PRTStaphylococcus aureus 35Ala Gln Lys Ala Gly 1 5
* * * * *
References