High-Performance Ketol-Acid Reductoisomerases

Abstract

The present invention relates to recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI) or a modified NADH-dependent variant thereof, wherein said KARI is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. The present invention also relates to recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI) or a modified NADH-dependent variant thereof, wherein said KARI is at least about 99% identical to SEQ ID NO: 64. In various aspects of the invention, the recombinant microorganisms may comprise an isobutanol producing metabolic pathway and can be used in methods of making isobutanol.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application Ser. No. 61/506,562, filed Jul. 11, 2011, U.S. Provisional Application Ser. No. 61/506,564, filed Jul. 11, 2011, U.S. Provisional Application Ser. No. 61/510,618, filed Jul. 22, 2011, and is a continuation-in-part of U.S. Non-Provisional application Ser. No. 13/303,884, filed Nov. 23, 2011, each of which is herein incorporated by reference in its entirety for all purposes.

TECHNICAL FIELD

[0003] Recombinant microorganisms and methods of producing such microorganisms are provided. Also provided are methods of producing beneficial metabolites including fuels and chemicals by contacting a suitable substrate with the recombinant microorganisms of the invention and enzymatic preparations therefrom.

DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

[0004] The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: GEVO.sub.--064.sub.--01WO_SeqList_ST25.txt, date recorded: Jul. 10, 2012, file size: 185 kilobytes).

BACKGROUND

[0005] The ability of microorganisms to convert sugars to beneficial metabolites including fuels, chemicals, and amino acids has been widely described in the literature in recent years. See, e.g., Alper et al., 2009, Nature Microbiol. Rev. 7: 715-723 and McCourt et al., 2006, Amino Acids 31: 173-210. Recombinant engineering techniques have enabled the creation of microorganisms that express biosynthetic pathways capable of producing a number of useful products, including the commodity chemical, isobutanol.

[0006] Isobutanol, also a promising biofuel candidate, has been produced in recombinant microorganisms expressing a heterologous, five-step metabolic pathway (See, e.g., WO/2007/050671 to Donaldson et al., WO/2008/098227 to Liao et al., and WO/2009/103533 to Festel et al.). However, the microorganisms produced to date have fallen short of commercial relevance due to their low performance characteristics, including, for example low productivities, low titers, and low yields.

[0007] The second step of the isobutanol producing metabolic pathway is catalyzed by ketol-acid reductoisomerase (KARI), which converts acetolactate to 2,3-dihydroxyisovalerate. Because KARI is an essential enzyme in the isobutanol production pathway, it is desirable that recombinant microorganisms engineered to produce isobutanol exhibit optimal KARI activity. The present application addresses this need by identifying several KARI enzymes that give high performance with an isobutanol production pathway expressed in yeast. Accordingly, this application describes methods of increasing isobutanol production through the use of recombinant microorganisms comprising KARI enzymes with improved properties for the production of isobutanol.

[0008] Another important feature of a KARI enzyme is the ability to use NADH as a cofactor for the conversion of acetolactate to 2,3-dihydroxyisovalerate. The present inventors have found that when an NADH-dependent KARI is used in conjunction with an NADH-dependent alcohol dehydrogenase (ADH), isobutanol can be produced at theoretical yield and/or under anaerobic conditions. See, e.g., commonly owned and co-pending US Publication No. US 2010/0143997. Because NADH-dependence is an important feature of a KARI enzyme, the present inventors have identified several beneficial mutations which can be made to the KARI enzymes identified herein to switch the cofactor specificity of the enzymes from NADPH to NADH.

SUMMARY OF THE INVENTION

[0009] The present inventors have discovered a group of KARI enzymes with high level activity in the isobutanol pathway. The use of one or more of these KARI enzymes, or NADH-dependent variants thereof, can improve production of the isobutanol.

[0010] In a first aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 2. In one embodiment, the KARI is derived from the genus Shewanella. In a specific embodiment, the KARI is derived from Shewanella sp. strain MR-4. In another specific embodiment, the KARI is encoded by SEQ ID NO: 1.

[0011] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 4. In one embodiment, the KARI is derived from the genus Vibrio. In a specific embodiment, the KARI is derived from Vibrio fischeri. In another specific embodiment, the KARI is encoded by SEQ ID NO: 3.

[0012] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 6. In one embodiment, the KARI is derived from the genus Gramella. In a specific embodiment, the KARI is derived from Gramella forsetii. In another specific embodiment, the KARI is encoded by SEQ ID NO: 5.

[0013] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 8. In one embodiment, the KARI is derived from the genus Cytophaga. In a specific embodiment, the KARI is derived from Cytophaga hutchinsonii. In another specific embodiment, the KARI is encoded by SEQ ID NO: 7.

[0014] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 10. In one embodiment, the KARI is derived from a genus selected from Lactococcus and Streptococcus. In a specific embodiment, the KARI is derived from Lactococcus lactis, Streptococcus equinus, or Streptococcus infantarius. In another specific embodiment, the KARI is encoded by SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25.

[0015] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 28. In one embodiment, the KARI is derived from the genus Methanococcus. In a specific embodiment, the KARI is derived from Methanococcus maripaludis, Methanococcus vannielii, or Methanococcus voltae. In another specific embodiment, the KARI is encoded by SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, or SEQ ID NO: 37.

[0016] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 40. In one embodiment, the KARI is derived from a genus selected from Zymomonas, Erythrobacter, Sphingomonas, Sphingobium, and Novosphingobium. In a specific embodiment, the KARI is derived from Zymomonas mobilis, Erythrobacter litoralis, Sphingomonas wittichii, Sphingobium japonicum, Sphingobium chlorophenolicum, or Novosphingobium nitrogenifigens. In another specific embodiment, the KARI is encoded by SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53.

[0017] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 56. In one embodiment, the KARI is derived from the genus Bacteroides. In a specific embodiment, the KARI is derived from Bacteroides thetaiotaomicron. In another specific embodiment, the KARI is encoded by SEQ ID NO: 55.

[0018] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 58. In one embodiment, the KARI is derived from the genus Schizosaccharomyces. In a specific embodiment, the KARI is derived from Schizosaccharomyces pombe or Schizosaccharomyces japonicus. In another specific embodiment, the KARI is encoded by SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61.

[0019] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 99% identical to SEQ ID NO: 64. In one embodiment, the KARI is derived from the genus Salmonella. In a specific embodiment, the KARI is derived from Salmonella enterica. In another specific embodiment, the KARI is encoded by SEQ ID NO: 63.

[0020] In some embodiments, the KARI may be modified to be NADH-dependent. Accordingly, the present application further relates to NADH-dependent ketol-acid reductoisomerases (NKRs) derived from a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. Thus, in one embodiment, the present application relates to a recombinant microorganism comprising a NKR derived from a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58.

[0021] In other embodiments, the present application further relates to NADH-dependent ketol-acid reductoisomerases (NKRs) derived from a KARI that is at least about 99% identical to SEQ ID NO: 64. Thus, in one embodiment, the present application relates to a recombinant microorganism comprising a NKR derived from a KARI that is at least about 99% identical to SEQ ID NO: 64.

[0022] Therefore, the present application also relates to mutated ketol-acid reductoisomerase (KARI) enzymes that utilize NADH rather than NADPH.

[0023] Examples of such KARIs include enzymes having one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2).

[0024] In one embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 71 of the Shewanella sp. KARI (SEQ ID NO: 2). In another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 76 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 78 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In one embodiment, the KARI enzyme contains two or more modifications or mutations at the amino acids corresponding to the positions described above. In another embodiment, the KARI enzyme contains three or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains four modifications or mutations at the amino acids corresponding to the positions described above. Further included within the scope of the application are KARI enzymes, other than the Shewanella sp. KARI (SEQ ID NO: 2), which contain modifications or mutations corresponding to those set out above. In an exemplary embodiment, the modified KARI is derived from a KARI that is at least about 80% identical to SEQ ID NO: 2.

[0025] Additional mutated ketol-acid reductoisomerase (KARI) enzymes that utilize NADH rather than NADPH include enzymes having one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

[0026] In one embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 48 of the L. lactis KARI (SEQ ID NO: 10). In another embodiment the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 49 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 52 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 53 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 59 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 85 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 89 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 118 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 182 of the L. lactis KARI (SEQ ID NO: 10). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 320 of the L. lactis KARI (SEQ ID NO: 10). In one embodiment, the KARI enzyme contains two or more modifications or mutations at the amino acids corresponding to the positions described above. In another embodiment, the KARI enzyme contains three or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains four or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains five or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains six or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains seven or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains eight or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains nine or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains ten modifications or mutations at the amino acids corresponding to the positions described above. Further included within the scope of the application are KARI enzymes, other than the L. lactis KARI (SEQ ID NO: 10), which contain modifications or mutations corresponding to those set out above. In an exemplary embodiment, the modified KARI is derived from a KARI that is at least about 80% identical to SEQ ID NO: 10.

[0027] Additional mutated ketol-acid reductoisomerase (KARI) enzymes that utilize NADH rather than NADPH include enzymes having one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0028] In one embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 71 of the S. enterica KARI (SEQ ID NO: 64). In another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 76 of the S. enterica KARI (SEQ ID NO: 64). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 78 of the S. enterica KARI (SEQ ID NO: 64). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 110 of the S. enterica KARI (SEQ ID NO: 64). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 146 of the S. enterica KARI (SEQ ID NO: 64). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 185 of the S. enterica KARI (SEQ ID NO: 64). In yet another embodiment, the KARI enzyme contains a modification or mutation at the amino acid corresponding to position 433 of the S. enterica KARI (SEQ ID NO: 64). In one embodiment, the KARI enzyme contains two or more modifications or mutations at the amino acids corresponding to the positions described above. In another embodiment, the KARI enzyme contains three or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains four or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains five or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains six or more modifications or mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the KARI enzyme contains seven modifications or mutations at the amino acids corresponding to the positions described above. Further included within the scope of the application are KARI enzymes, other than the S. enterica KARI (SEQ ID NO: 64), which contain modifications or mutations corresponding to those set out above. In an exemplary embodiment, the modified KARI is derived from a KARI that is at least about 99% identical to SEQ ID NO: 64.

[0029] In various embodiments described herein, the modified or mutated KARI may exhibit an increased catalytic efficiency with NADH as compared to the wild-type KARI. In one embodiment, the KARI has at least about a 5% increased catalytic efficiency with NADH as compared to the wild-type KARI. In another embodiment, the KARI has at least about a 25%, at least about a 50%, at least about a 75%, at least about a 100%, at least about a 500%, at least about 1000%, or at least about a 10000% increased catalytic efficiency with NADH as compared to the wild-type KARI.

[0030] In various embodiments described herein, the modified or mutated KARI may exhibit a decreased Michaelis Menten constant (K.sub.M) for NADH as compared to the wild-type KARI. In one embodiment, the KARI has at least about a 5% decreased K.sub.M for NADH as compared to the wild-type KARI. In another embodiment, the KARI has at least about a 25%, at least about a 50%, at least about a 75%, at least about a 90%, at least about a 95%, or at least about a 97.5% decreased K.sub.M for NADH as compared to the wild-type KARI.

[0031] In various embodiments described herein, the modified or mutated KARI may exhibit an increased catalytic constant (k.sub.cat) with NADH as compared to the wild-type KARI. In one embodiment, the KARI has at least about a 5% increased k.sub.cat with NADH as compared to the wild-type KARI. In another embodiment, the KARI has at least about a 25%, at least about a 50%, at least about a 75%, at least about 100%, at least about 200%, or at least about a 500% increased k.sub.cat with NADH as compared to the wild-type KARI.

[0032] In various embodiments described herein, the modified or mutated KARI may exhibit an increased Michaelis Menten constant (K.sub.M) for NADPH as compared to the wild-type KARI. In one embodiment, the KARI has at least about a 5% increased K.sub.M for NADPH as compared to the wild-type KARI. In another embodiment, the KARI has at least about a 25%, at least about a 50%, at least about a 100%, at least about a 500%, at least about a 1000%, or at least about a 5000% increased K.sub.M for NADPH as compared to the wild-type KARI.

[0033] In various embodiments described herein, the modified or mutated KARI may exhibit a decreased catalytic constant (k.sub.cat) with NADPH as compared to the wild-type KARI. In one embodiment, the KARI has at least about a 5% decreased k.sub.cat with NADPH as compared to the wild-type KARI. In another embodiment, the KARI has at least about a 25%, at least about a 50%, or at least about a 75%, at least about 90% decreased k.sub.cat with NADPH as compared to the wild-type KARI.

[0034] In some embodiments described herein, the catalytic efficiency of the modified or mutated KARI with NADH is increased with respect to the catalytic efficiency with NADPH of the wild-type KARI. In one embodiment, the catalytic efficiency of said KARI with NADH is at least about 10% of the catalytic efficiency with NADPH of the wild-type KARI. In another embodiment, the catalytic efficiency of said KARI with NADH is at least about 25%, at least about 50%, or at least about 75% of the catalytic efficiency with NADPH of the wild-type KARI. In some embodiments, the modified or mutated KARI preferentially utilizes NADH rather than NADPH.

[0035] In one embodiment, the application is directed to NADH-dependent KARI enzymes having a catalytic efficiency with NADH that is greater than the catalytic efficiency with NADPH. In one embodiment, the catalytic efficiency of the NADH-dependent KARI is at least about 2-fold greater with NADH than with NADPH. In another embodiment, the catalytic efficiency of the NADH-dependent KARI is at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 25-fold, at least about 50-fold, at least about 100-fold, or at least about 500-fold greater with NADH than with NADPH.

[0036] In one embodiment, the application is directed to modified or mutated KARI enzymes that demonstrate a switch in cofactor specificity from NADPH to NADH. In one embodiment, the modified or mutated KARI has at least about a 2:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over k.sub.cat with NADPH. In an exemplary embodiment, the modified or mutated KARI has at least about a 10:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency (k.sub.cat/K.sub.M) with NADPH.

[0037] In one embodiment, the KARI exhibits at least about a 1:10 ratio of K.sub.M for NADH over K.sub.M for NADPH.

[0038] In additional embodiments, the application is directed to modified or mutated KARI enzymes that have been codon optimized for expression in certain desirable host organisms, such as yeast and E. coli.

[0039] In another aspect, the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a KARI enzyme. In one embodiment, the nucleic acid molecule encodes a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In another embodiment, the nucleic acid molecule encodes a KARI this is at least about 99% identical to SEQ ID NO: 64. In yet another embodiment, the nucleic acid molecule encodes an NADH-dependent ketol-acid reductoisomerase (NKR) derived from a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In one embodiment, the nucleic acid molecule encodes an NADH-dependent ketol-acid reductoisomerase (NKR) derived from a KARI that is at least about 80% identical to SEQ ID NO: 2, wherein said NKR has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2): (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In another embodiment, the nucleic acid molecule encodes an NADH-dependent ketol-acid reductoisomerase (NKR) derived from a KARI that is at least about 80% identical to SEQ ID NO: 10, wherein said NKR has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10). In one embodiment, the nucleic acid molecule encodes an NADH-dependent ketol-acid reductoisomerase (NKR) derived from a KARI that is at least about 99% identical to SEQ ID NO: 64. In a further embodiment, the nucleic acid molecule encodes an NADH-dependent ketol-acid reductoisomerase (NKR) derived from a KARI that is at least about 99% identical to SEQ ID NO: 64, wherein said NKR has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0040] In various embodiments described in the application, the recombinant microorganism comprises an isobutanol producing metabolic pathway. In one embodiment, the isobutanol producing metabolic pathway comprises at least one exogenous gene encoding a polypeptide that catalyzes a step in the conversion of pyruvate to isobutanol. In another embodiment, the isobutanol producing metabolic pathway comprises at least two exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least three exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least four exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least five exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, all of the isobutanol producing metabolic pathway steps in the conversion of pyruvate to isobutanol are converted by exogenously encoded enzymes. In an exemplary embodiment, at least one of the exogenously encoded enzymes is a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In another exemplary embodiment, at least one of the exogenously encoded enzymes is a KARI that is at least about 99% identical to SEQ ID NO: 64. In yet another exemplary embodiment, at least one of the exogenously encoded enzymes is a KARI enzyme has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another exemplary embodiment, at least one of the exogenously encoded enzymes is a KARI enzyme has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10). In yet another exemplary embodiment, at least one of the exogenously encoded enzymes is a KARI enzyme has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64): (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0041] In one embodiment, one or more of the isobutanol pathway genes encodes an enzyme that is localized to the cytosol. In one embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least one isobutanol pathway enzyme localized in the cytosol. In another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least two isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least three isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least four isobutanol pathway enzymes localized in the cytosol. In an exemplary embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with five isobutanol pathway enzymes localized in the cytosol. In yet another exemplary embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with all isobutanol pathway enzymes localized in the cytosol.

[0042] In various embodiments described herein, the isobutanol pathway genes may encode enzyme(s) selected from the group consisting of acetolactate synthase (ALS), ketol-acid reductoisomerase (KARI), dihydroxyacid dehydratase (DHAD), 2-keto-acid decarboxylase, e.g., keto-isovalerate decarboxylase (KIVD), and alcohol dehydrogenase (ADH). In one embodiment, the KARI is an NADH-dependent KARI (NKR). In another embodiment, the ADH is an NADH-dependent ADH. In yet another embodiment, the KARI is an NADH-dependent KARI (NKR) and the ADH is an NADH-dependent ADH. In an exemplary embodiment, the KARI is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In another exemplary embodiment, the KARI is at least about 99% identical to SEQ ID NO: 64. In yet another exemplary embodiment, the KARI comprises one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another exemplary embodiment, the KARI comprises one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10). In yet another exemplary embodiment, the KARI comprises one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64): (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0043] In various embodiments described herein, the recombinant microorganisms of the invention that comprise an isobutanol producing metabolic pathway may be further engineered to reduce or eliminate the expression or activity of one or more enzymes selected from a pyruvate decarboxylase (PDC), a glycerol-3-phosphate dehydrogenase (GPD), a 3-keto acid reductase (3-KAR), or an aldehyde dehydrogenase (ALDH).

[0044] In various embodiments described herein, the recombinant microorganisms may be recombinant yeast microorganisms. In some embodiments, the recombinant yeast microorganisms may be members of the Saccharomyces clade, Saccharomyces sensu stricto microorganisms, Crabtree-negative yeast microorganisms, Crabtree-positive yeast microorganisms, post-WGD (whole genome duplication) yeast microorganisms, pre-WGD (whole genome duplication) yeast microorganisms, and non-fermenting yeast microorganisms.

[0045] In some embodiments, the recombinant microorganisms may be yeast recombinant microorganisms of the Saccharomyces clade.

[0046] In some embodiments, the recombinant microorganisms may be Saccharomyces sensu stricto microorganisms. In one embodiment, the Saccharomyces sensu stricto is selected from the group consisting of S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids thereof.

[0047] In some embodiments, the recombinant microorganisms may be Crabtree-negative recombinant yeast microorganisms. In one embodiment, the Crabtree-negative yeast microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Pichia, Issatchenkia, Hansenula, or Candida. In additional embodiments, the Crabtree-negative yeast microorganism is selected from Saccharomyces kluyveri, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia anomala, Pichia stipitis, Hansenula anomala, Candida utilis and Kluyveromyces waltii.

[0048] In some embodiments, the recombinant microorganisms may be Crabtree-positive recombinant yeast microorganisms. In one embodiment, the Crabtree-positive yeast microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces, Candida, Pichia and Schizosaccharomyces. In additional embodiments, the Crabtree-positive yeast microorganism is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, Kluyveromyces thermotolerans, Candida glabrata, Z. bailli, Z. rouxii, Debaryomyces hansenii, Pichia pastorius, Schizosaccharomyces pombe, and Saccharomyces uvarum.

[0049] In some embodiments, the recombinant microorganisms may be post-WGD (whole genome duplication) yeast recombinant microorganisms. In one embodiment, the post-WGD yeast recombinant microorganism is classified into a genera selected from the group consisting of Saccharomyces or Candida. In additional embodiments, the post-WGD yeast is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, and Candida glabrata.

[0050] In some embodiments, the recombinant microorganisms may be pre-WGD (whole genome duplication) yeast recombinant microorganisms. In one embodiment, the pre-WGD yeast recombinant microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomyces, Hansenula, Pachysolen, Yarrowia and Schizosaccharomyces. In additional embodiments, the pre-WGD yeast is selected from the group consisting of Saccharomyces kluyveri, Kluyveromyces thermotolerans, Kluyveromyces marxianus, Kluyveromyces waltii, Kluyveromyces lactis, Candida tropicalis, Pichia pastoris, Pichia anomala, Pichia stipitis, Issatchenkia orientalis, Issatchenkia occidentalis, Debaryomyces hansenii, Hansenula anomala, Pachysolen tannophilis, Yarrowia lipolytica, and Schizosaccharomyces pombe.

[0051] In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but not limited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, Myxozyma, or Candida. In a specific embodiment, the non-fermenting yeast is C. xestobii.

[0052] In another aspect, the present invention provides methods of producing isobutanol using a recombinant microorganism as described herein. In one embodiment, the method includes cultivating the recombinant microorganism in a culture medium containing a feedstock providing the carbon source until a recoverable quantity of isobutanol is produced and optionally, recovering the isobutanol. In one embodiment, the microorganism produces isobutanol from a carbon source at a yield of at least about 5 percent theoretical. In another embodiment, the microorganism produces isobutanol at a yield of at least about 10 percent, at least about 15 percent, about least about 20 percent, at least about 25 percent, at least about 30 percent, at least about 35 percent, at least about 40 percent, at least about 45 percent, at least about 50 percent, at least about 55 percent, at least about 60 percent, at least about 65 percent, at least about 70 percent, at least about 75 percent, at least about 80 percent, at least about 85 percent, at least about 90 percent, at least about 95 percent, or at least about 97.5 percent theoretical.

[0053] In one embodiment, the recombinant microorganism converts the carbon source to isobutanol under aerobic conditions. In another embodiment, the recombinant microorganism converts the carbon source to isobutanol under microaerobic conditions. In yet another embodiment, the recombinant microorganism converts the carbon source to isobutanol under anaerobic conditions.

BRIEF DESCRIPTION OF DRAWINGS

[0054] Illustrative embodiments of the invention are illustrated in the drawings, in which:

[0055] FIG. 1 illustrates an exemplary embodiment of an isobutanol pathway.

[0056] FIG. 2 illustrates an exemplary embodiment of an NADH-dependent isobutanol pathway.

DETAILED DESCRIPTION

[0057] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the microorganism" includes reference to one or more microorganisms, and so forth.

[0058] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.

[0059] Any publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.

[0060] The term "microorganism" includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.

[0061] The term "prokaryotes" is art recognized and refers to cells which contain no nucleus or other cell organelles. The prokaryotes are generally classified in one of two domains, the Bacteria and the Archaea. The definitive difference between organisms of the Archaea and Bacteria domains is based on fundamental differences in the nucleotide base sequence in the 16S ribosomal RNA.

[0062] The term "Archaea" refers to a categorization of organisms of the division Mendosicutes, typically found in unusual environments and distinguished from the rest of the prokaryotes by several criteria, including the number of ribosomal proteins and the lack of muramic acid in cell walls. On the basis of ssrRNA analysis, the Archaea consist of two phylogenetically-distinct groups: Crenarchaeota and Euryarchaeota. On the basis of their physiology, the Archaea can be organized into three types: methanogens (prokaryotes that produce methane); extreme halophiles (prokaryotes that live at very high concentrations of salt (NaCl); and extreme (hyper) thermophiles (prokaryotes that live at very high temperatures). Besides the unifying archaeal features that distinguish them from Bacteria (i.e., no murein in cell wall, ester-linked membrane lipids, etc.), these prokaryotes exhibit unique structural or biochemical attributes which adapt them to their particular habitats. The Crenarchaeota consist mainly of hyperthermophilic sulfur-dependent prokaryotes and the Euryarchaeota contain the methanogens and extreme halophiles.

[0063] "Bacteria", or "eubacteria", refers to a domain of prokaryotic organisms. Bacteria include at least eleven distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (Actinomycetes, Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic+non-photosynthetic Gram-negative bacteria (includes most "common" Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant micrococci and relatives; (11) Thermotoga and Thermosipho thermophiles.

[0064] "Gram-negative bacteria" include cocci, nonenteric rods, and enteric rods. The genera of Gram-negative bacteria include, for example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia, Francisella, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides, Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirilla, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and Fusobacterium.

[0065] "Gram positive bacteria" include cocci, nonsporulating rods, and sporulating rods. The genera of gram positive bacteria include, for example, Actinomyces, Bacillus, Clostridium, Corynebacterium, Erysipelothrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus, and Streptomyces.

[0066] The term "genus" is defined as a taxonomic group of related species according to the Taxonomic Outline of Bacteria and Archaea (Garrity, G. M., Lilbum, T. G., Cole, J. R., Harrison, S. H., Euzeby, J., and Tindall, B. J. (2007) The Taxonomic Outline of Bacteria and Archaea. TOBA Release 7.7, March 2007. Michigan State University Board of Trustees.

[0067] The term "species" is defined as a collection of closely related organisms with greater than 97% 16S ribosomal RNA sequence homology and greater than 70% genomic hybridization and sufficiently different from all other organisms so as to be recognized as a distinct unit.

[0068] The terms "recombinant microorganism," "modified microorganism," and "recombinant host cell" are used interchangeably herein and refer to microorganisms that have been genetically modified to express or to overexpress endogenous polynucleotides, to express heterologous polynucleotides, such as those included in a vector, in an integration construct, or which have an alteration in expression of an endogenous gene. By "alteration" it is meant that the expression of the gene, or level of a RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or activity of one or more polypeptides or polypeptide subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the alteration. For example, the term "alter" can mean "inhibit," but the use of the word "alter" is not limited to this definition. It is understood that the terms "recombinant microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0069] The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein results from transcription and translation of the open reading frame sequence. The level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired product encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantitated by qRT-PCR or by Northern hybridization (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). Protein encoded by a selected sequence can be quantitated by various methods, e.g., by ELISA, by assaying for the biological activity of the protein, or by employing assays that are independent of such activity, such as western blotting or radioimmunoassay, using antibodies that recognize and bind the protein. See Sambrook et al., 1989, supra.

[0070] The term "overexpression" refers to an elevated level (e.g., aberrant level) of mRNAs encoding for a protein(s), and/or to elevated levels of protein(s) in cells as compared to similar corresponding unmodified cells expressing basal levels of mRNAs or having basal levels of proteins. In particular embodiments, mRNA(s) or protein(s) may be overexpressed by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, 15-fold or more in microorganisms engineered to exhibit increased gene mRNA, protein, and/or activity.

[0071] As used herein and as would be understood by one of ordinary skill in the art, "reduced activity and/or expression" of a protein such as an enzyme can mean either a reduced specific catalytic activity of the protein (e.g. reduced activity) and/or decreased concentrations of the protein in the cell (e.g. reduced expression). As would be understood by one or ordinary skill in the art, the reduced activity of a protein in a cell may result from decreased concentrations of the protein in the cell.

[0072] The term "wild-type microorganism" describes a cell that occurs in nature, i.e. a cell that has not been genetically modified. A wild-type microorganism can be genetically modified to express or overexpress a first target enzyme. This microorganism can act as a parental microorganism in the generation of a microorganism modified to express or overexpress a second target enzyme. In turn, the microorganism modified to express or overexpress a first and a second target enzyme can be modified to express or overexpress a third target enzyme.

[0073] Accordingly, a "parental microorganism" functions as a reference cell for successive genetic modification events. Each modification event can be accomplished by introducing a nucleic acid molecule in to the reference cell. The introduction facilitates the expression or overexpression of a target enzyme. It is understood that the term "facilitates" encompasses the activation of endogenous polynucleotides encoding a target enzyme through genetic modification of e.g., a promoter sequence in a parental microorganism. It is further understood that the term "facilitates" encompasses the introduction of heterologous polynucleotides encoding a target enzyme in to a parental microorganism

[0074] The term "engineer" refers to any manipulation of a microorganism that results in a detectable change in the microorganism, wherein the manipulation includes but is not limited to inserting a polynucleotide and/or polypeptide heterologous to the microorganism and mutating a polynucleotide and/or polypeptide native to the microorganism.

[0075] The term "mutation" as used herein indicates any modification of a nucleic acid and/or polypeptide which results in an altered nucleic acid or polypeptide. Mutations include, for example, point mutations, deletions, or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genetic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, a nonsense mutation, an insertion, or a deletion of part or all of a gene. In addition, in some embodiments of the modified microorganism, a portion of the microorganism genome has been replaced with a heterologous polynucleotide. In some embodiments, the mutations are naturally-occurring. In other embodiments, the mutations are identified and/or enriched through artificial selection pressure. In still other embodiments, the mutations in the microorganism genome are the result of genetic engineering.

[0076] The term "biosynthetic pathway", also referred to as "metabolic pathway", refers to a set of anabolic or catabolic biochemical reactions for converting one chemical species into another. Gene products belong to the same "metabolic pathway" if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate (i.e., metabolite) between the same substrate and metabolite end product.

[0077] As used herein, the term "isobutanol producing metabolic pathway" refers to an enzyme pathway which produces isobutanol from pyruvate.

[0078] The term "NADH-dependent" as used herein with reference to an enzyme, e.g., KARI and/or ADH, refers to an enzyme that catalyzes the reduction of a substrate coupled to the oxidation of NADH with a catalytic efficiency that is greater than the reduction of the same substrate coupled to the oxidation of NADPH at equal substrate and cofactor concentrations.

[0079] The term "exogenous" as used herein with reference to various molecules, e.g., polynucleotides, polypeptides, enzymes, etc., refers to molecules that are not normally or naturally found in and/or produced by a given yeast, bacterium, organism, microorganism, or cell in nature.

[0080] On the other hand, the term "endogenous" or "native" as used herein with reference to various molecules, e.g., polynucleotides, polypeptides, enzymes, etc., refers to molecules that are normally or naturally found in and/or produced by a given yeast, bacterium, organism, microorganism, or cell in nature.

[0081] The term "heterologous" as used herein in the context of a modified host cell refers to various molecules, e.g., polynucleotides, polypeptides, enzymes, etc., wherein at least one of the following is true: (a) the molecule(s) is/are foreign ("exogenous") to (i.e., not naturally found in) the host cell; (b) the molecule(s) is/are naturally found in (e.g., is "endogenous to") a given host microorganism or host cell but is either produced in an unnatural location or in an unnatural amount in the cell; and/or (c) the molecule(s) differ(s) in nucleotide or amino acid sequence from the endogenous nucleotide or amino acid sequence(s) such that the molecule differing in nucleotide or amino acid sequence from the endogenous nucleotide or amino acid as found endogenously is produced in an unnatural (e.g., greater than naturally found) amount in the cell.

[0082] The term "feedstock" is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. For example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a biofuel in a fermentation process. However, a feedstock may contain nutrients other than a carbon source.

[0083] The term "substrate" or "suitable substrate" refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term "substrate" encompasses not only compounds that provide a carbon source suitable for use as a starting material, such as any biomass derived sugar, but also intermediate and end product metabolites used in a pathway associated with a recombinant microorganism as described herein.

[0084] The term "fermentation" or "fermentation process" is defined as a process in which a microorganism is cultivated in a culture medium containing raw materials, such as feedstock and nutrients, wherein the microorganism converts raw materials, such as a feedstock, into products.

[0085] The term "volumetric productivity" or "production rate" is defined as the amount of product formed per volume of medium per unit of time. Volumetric productivity is reported in gram per liter per hour (g/L/h).

[0086] The term "specific productivity" or "specific production rate" is defined as the amount of product formed per volume of medium per unit of time per amount of cells. Specific productivity is reported in gram (or milligram) per gram cell dry weight per hour (g/g h).

[0087] The term "yield" is defined as the amount of product obtained per unit weight of raw material and may be expressed as g product per g substrate (g/g). Yield may be expressed as a percentage of the theoretical yield. "Theoretical yield" is defined as the maximum amount of product that can be generated per a given amount of substrate as dictated by the stoichiometry of the metabolic pathway used to make the product. For example, the theoretical yield for one typical conversion of glucose to isobutanol is 0.41 g/g. As such, a yield of isobutanol from glucose of 0.39 gig would be expressed as 95% of theoretical or 95% theoretical yield.

[0088] The term "titer" is defined as the strength of a solution or the concentration of a substance in solution. For example, the titer of a biofuel in a fermentation broth is described as g of biofuel in solution per liter of fermentation broth (g/L).

[0089] "Aerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is sufficiently high for an aerobic or facultative anaerobic microorganism to use as a terminal electron acceptor.

[0090] In contrast, "anaerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is too low for the microorganism to use as a terminal electron acceptor. Anaerobic conditions may be achieved by sparging a fermentation medium with an inert gas such as nitrogen until oxygen is no longer available to the microorganism as a terminal electron acceptor. Alternatively, anaerobic conditions may be achieved by the microorganism consuming the available oxygen of the fermentation until oxygen is unavailable to the microorganism as a terminal electron acceptor. Methods for the production of isobutanol under anaerobic conditions are described in commonly owned and co-pending publication, US 2010/0143997, the disclosures of which are herein incorporated by reference in its entirety for all purposes.

[0091] "Aerobic metabolism" refers to a biochemical process in which oxygen is used as a terminal electron acceptor to make energy, typically in the form of ATP, from carbohydrates. Aerobic metabolism occurs, e.g., via glycolysis and the TCA cycle, wherein a single glucose molecule is metabolized completely into carbon dioxide in the presence of oxygen.

[0092] In contrast, "anaerobic metabolism" refers to a biochemical process in which oxygen is not the final acceptor of electrons contained in NADH. Anaerobic metabolism can be divided into anaerobic respiration, in which compounds other than oxygen serve as the terminal electron acceptor, and substrate level phosphorylation, in which the electrons from NADH are utilized to generate a reduced product via a "fermentative pathway."

[0093] In "fermentative pathways", NAD(P)H donates its electrons to a molecule produced by the same metabolic pathway that produced the electrons carried in NAD(P)H. For example, in one of the fermentative pathways of certain yeast strains, NAD(P)H generated through glycolysis transfers its electrons to pyruvate, yielding ethanol. Fermentative pathways are usually active under anaerobic conditions but may also occur under aerobic conditions, under conditions where NADH is not fully oxidized via the respiratory chain. For example, above certain glucose concentrations, Crabtree positive yeasts produce large amounts of ethanol under aerobic conditions.

[0094] The term "byproduct" or "by-product" means an undesired product related to the production of an amino acid, amino acid precursor, chemical, chemical precursor, biofuel, biofuel precursor, higher alcohol, or higher alcohol precursor.

[0095] The term "substantially free" when used in reference to the presence or absence of a protein activity (3-KAR enzymatic activity, ALDH enzymatic activity, PDC enzymatic activity. GPD enzymatic activity, etc.) means the level of the protein is substantially less than that of the same protein in the wild-type host, wherein less than about 50% of the wild-type level is preferred and less than about 30% is more preferred. The activity may be less than about 20%, less than about 10%, less than about 5%, or less than about 1% of wild-type activity. Microorganisms which are "substantially free" of a particular protein activity (3-KAR enzymatic activity, ALDH enzymatic activity, PDC enzymatic activity, GPD enzymatic activity, etc.) may be created through recombinant means or identified in nature.

[0096] The term "non-fermenting yeast" is a yeast species that fails to demonstrate an anaerobic metabolism in which the electrons from NADH are utilized to generate a reduced product via a fermentative pathway such as the production of ethanol and CO.sub.2 from glucose. Non-fermentative yeast can be identified by the "Durham Tube Test" (J. A. Bamett, R. W. Payne, and D. Yarrow. 2000. Yeasts Characteristics and Identification. 3.sup.rd edition. p. 28-29. Cambridge University Press, Cambridge, UK) or by monitoring the production of fermentation productions such as ethanol and CO.sub.2.

[0097] The term "polynucleotide" is used herein interchangeably with the term "nucleic acid" and refers to an organic polymer composed of two or more monomers including nucleotides, nucleosides or analogs thereof, including but not limited to single stranded or double stranded, sense or antisense deoxyribonucleic acid (DNA) of any length and, where appropriate, single stranded or double stranded, sense or antisense ribonucleic acid (RNA) of any length, including siRNA. The term "nucleotide" refers to any of several compounds that consist of a ribose or deoxyribose sugar joined to a purine or a pyrimidine base and to a phosphate group, and that are the basic structural units of nucleic acids. The term "nucleoside" refers to a compound (as guanosine or adenosine) that consists of a purine or pyrimidine base combined with deoxyribose or ribose and is found especially in nucleic acids. The term "nucleotide analog" or "nucleoside analog" refers, respectively, to a nucleotide or nucleoside in which one or more individual atoms have been replaced with a different atom or with a different functional group. Accordingly, the term polynucleotide includes nucleic acids of any length, DNA, RNA, analogs and fragments thereof. A polynucleotide of three or more nucleotides is also called nucleotidic oligomer or oligonucleotide.

[0098] It is understood that the polynucleotides described herein include "genes" and that the nucleic acid molecules described herein include "vectors" or "plasmids." Accordingly, the term "gene", also called a "structural gene" refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise all or part of one or more proteins or enzymes, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. The transcribed region of the gene may include untranslated regions, including introns, 5'-untranslated region (UTR), and 3'-UTR, as well as the coding sequence.

[0099] The term "operon" refers to two or more genes which are transcribed as a single transcriptional unit from a common promoter. In some embodiments, the genes comprising the operon are contiguous genes. It is understood that transcription of an entire operon can be modified (i.e., increased, decreased, or eliminated) by modifying the common promoter. Alternatively, any gene or combination of genes in an operon can be modified to alter the function or activity of the encoded polypeptide. The modification can result in an increase in the activity of the encoded polypeptide. Further, the modification can impart new activities on the encoded polypeptide. Exemplary new activities include the use of alternative substrates and/or the ability to function in alternative environmental conditions.

[0100] A "vector" is any means by which a nucleic acid can be propagated and/or transferred between organisms, cells, or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), and the like, that are "episomes," that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as an agrobacterium or a bacterium.

[0101] "Transformation" refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a number of means including chemical transformation (e.g. lithium acetate transformation), electroporation, microinjection, biolistics (or particle bombardment-mediated delivery), or agrobacterium mediated transformation.

[0102] The term "enzyme" as used herein refers to any substance that catalyzes or promotes one or more chemical or biochemical reactions, which usually includes enzymes totally or partially composed of a polypeptide or polypeptides, but can include enzymes composed of a different molecule including polynucleotides.

[0103] The term "protein," "peptide," or "polypeptide" as used herein indicates an organic polymer composed of two or more amino acidic monomers and/or analogs thereof. As used herein, the term "amino acid" or "amino acidic monomer" refers to any natural and/or synthetic amino acids including glycine and both D or L optical isomers. The term "amino acid analog" refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, or with a different functional group. Accordingly, the term polypeptide includes amino acidic polymer of any length including full length proteins, and peptides as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called a protein oligomer or oligopeptide

[0104] The term "homolog," used with respect to an original polynucleotide or polypeptide of a first family or species, refers to distinct polynucleotides or polypeptides of a second family or species which are determined by functional, structural or genomic analyses to be a polynucleotide or polypeptide of the second family or species which corresponds to the original polynucleotide or polypeptide of the first family or species. Most often, homologs will have functional, structural or genomic similarities. Techniques are known by which homologs of a polynucleotide or polypeptide can readily be cloned using genetic probes and PCR. Identity of cloned sequences as homolog can be confirmed using functional assays and/or by genomic mapping of the genes.

[0105] A polypeptide has "homology" or is "homologous" to a second polypeptide if the amino acid sequence encoded by a gene has a similar amino acid sequence to that of the second gene. Alternatively, a polypeptide has homology to a second polypeptide if the two polypeptides have "similar" amino acid sequences. (Thus, the terms "homologous polypeptides" or "homologous proteins" are defined to mean that the two polypeptides have similar amino acid sequences).

[0106] The term "analog" or "analogous" refers to polynucleotide or polypeptide sequences that are related to one another in function only and are not from common descent or do not share a common ancestral sequence. Analogs may differ in sequence but may share a similar structure, due to convergent evolution. For example, two enzymes are analogs or analogous if the enzymes catalyze the same reaction of conversion of a substrate to a product, are unrelated in sequence, and irrespective of whether the two enzymes are related in structure.

Isobutanol Producing Recombinant Microorganisms

[0107] A variety of microorganisms convert sugars to produce pyruvate, which is then utilized in a number of pathways of cellular metabolism. In recent years, microorganisms, including yeast, have been engineered to produce a number of desirable products via pyruvate-driven biosynthetic pathways, including isobutanol, an important commodity chemical and biofuel candidate (See, e.g., commonly owned and co-pending patent publications, US 2009/0226991, US 2010/0143997, US 2011/0020889, US 2011/0076733, and WO 2010/075504).

[0108] As described herein, the present invention relates to recombinant microorganisms for producing isobutanol, wherein said recombinant microorganisms comprise an isobutanol producing metabolic pathway. In one embodiment, the isobutanol producing metabolic pathway to convert pyruvate to isobutanol can be comprised of the following reactions:

[0109] 1. 2 pyruvate.fwdarw.acetolactate+CO.sub.2

[0110] 2. acetolactate+NAD(P)H.fwdarw.2,3-dihydroxyisovalerate+NAD(P).sup.- +

[0111] 3. 2,3-dihydroxyisovalerate.fwdarw.alpha-ketoisovalerate

[0112] 4. alpha-ketoisovalerate.fwdarw.isobutyraldehyde+CO.sub.2

[0113] 5. isobutyraldehyde+NAD(P)H.fwdarw.isobutanol+NADP

[0114] In one embodiment, these reactions are carried out by the enzymes 1) Acetolactate synthase (ALS), 2) Ketol-acid reductoisomerase (KARI), 3) Dihydroxy-acid dehydratase (DHAD), 4) 2-keto-acid decarboxylase, e.g., Keto-isovalerate decarboxylase (KIVD), and 5) an Alcohol dehydrogenase (ADH) (FIG. 1). In some embodiments, the recombinant microorganism may be engineered to overexpress one or more of these enzymes. In an exemplary embodiment, the recombinant microorganism is engineered to overexpress all of these enzymes.

[0115] Alternative pathways for the production of isobutanol in yeast have been described in WO/2007/050671 and in Dickinson et al., 1998, J Biol Chem 273:25751-6. These and other isobutanol producing metabolic pathways are within the scope of the present application. In one embodiment, the isobutanol producing metabolic pathway comprises five substrate to product reactions. In another embodiment, the isobutanol producing metabolic pathway comprises six substrate to product reactions. In yet another embodiment, the isobutanol producing metabolic pathway comprises seven substrate to product reactions.

[0116] In various embodiments described herein, the recombinant microorganism comprises an isobutanol producing metabolic pathway. In one embodiment, the isobutanol producing metabolic pathway comprises at least one exogenous gene encoding a polypeptide that catalyzes a step in the conversion of pyruvate to isobutanol. In another embodiment, the isobutanol producing metabolic pathway comprises at least two exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least three exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least four exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least five exogenous genes encoding polypeptides that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, all of the isobutanol producing metabolic pathway steps in the conversion of pyruvate to isobutanol are converted by exogenously encoded enzymes.

[0117] In one embodiment, one or more of the isobutanol pathway genes encodes an enzyme that is localized to the cytosol. In one embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least one isobutanol pathway enzyme localized in the cytosol. In another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least two isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least three isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least four isobutanol pathway enzymes localized in the cytosol. In an exemplary embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with five isobutanol pathway enzymes localized in the cytosol. In yet another exemplary embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with all isobutanol pathway enzymes localized in the cytosol. Isobutanol producing metabolic pathways in which one or more genes are localized to the cytosol are described in commonly owned and co-pending U.S. application Ser. No. 12/855,276, which is herein incorporated by reference in its entirety for all purposes.

[0118] As is understood in the art, a variety of organisms can serve as sources for the isobutanol pathway enzymes, including, but not limited to, Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis, and K. marxianus, Pichia spp., Hansenula spp., including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. spp. stipitis, Torulaspora pretoriensis, Issatchenkia orientalis, Schizosaccharomyces spp., including S. pombe, Cryptococcus spp., Aspergillus spp., Neurospora spp., or Ustilago spp. Sources of genes from anaerobic fungi include, but not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Sources of prokaryotic enzymes that are useful include, but not limited to, Escherichia spp., Zymomonas spp., Staphylococcus spp., Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp., Streptococcus spp., Salmonella spp., Slackia spp., Cryptobacterium spp., and Eggerthella spp.

[0119] In some embodiments, one or more of these enzymes can be encoded by native genes. Alternatively, one or more of these enzymes can be encoded by heterologous genes.

[0120] For example, acetolactate synthases capable of converting pyruvate to acetolactate may be derived from a variety of sources (e.g., bacterial, yeast, Archaea, etc.), including B. subtilis (GenBank Accession No. Q04789.3), L. lactis (GenBank Accession No. NP.sub.--267340.1), S. mutans (GenBank Accession No. NP.sub.--721805.1), K. pneumoniae (GenBank Accession No. ZP.sub.--06014957.1), C. glutamicum (GenBank Accession No. P42463.1), E. cloacae (GenBank Accession No. YP.sub.--003613611.1), M. maripaludis (GenBank Accession No. ABX01060.1), M. grisea (GenBank Accession No. AAB81248.1), T. stipitatus (GenBank Accession No. XP.sub.--002485976.1), or S. cerevisiae ILV2 (GenBank Accession No. NP.sub.--013826.1). Additional acetolactate synthases capable of converting pyruvate to acetolactate are described in commonly owned and co-pending US Publication No. 2011/0076733, which is herein incorporated by reference in its entirety. A review article characterizing the biosynthesis of acetolactate from pyruvate via the activity of acetolactate synthases is provided by Chipman et al., 1998, Biochimica et Biophysica Acta 1385: 401-19, which is herein incorporated by reference in its entirety. Chipman et al. provide an alignment and consensus for the sequences of a representative number of acetolactate synthases. Motifs shared in common between the majority of acetolactate synthases include:

TABLE-US-00001 (SEQ ID NO: 65) SGPG(A/C/V)(T/S)N, (SEQ ID NO: 66) GX(P/A)GX(V/A/T), (SEQ ID NO: 67) GX(Q/G)(T/A)(L/M)G(Y/F/W)(A/G)X(P/G) (W/A)AX(G/T)(A/V), and (SEQ ID NO: 68) GD(G/A)(G/S/C)F

motifs at amino acid positions corresponding to the 163-169, 240-245, 521-535, and 549-553 residues, respectively, of the S. cerevisiae ILV2. Thus, a protein harboring one or more of these amino acid motifs can generally be expected to exhibit acetolactate synthase activity.

[0121] Dihydroxy acid dehydratases capable of converting 2,3-dihydroxyisovalerate to .alpha.-ketoisovalerate may be derived from a variety of sources (e.g., bacterial, yeast, Archaea, etc.), including E. coli (GenBank Accession No. YP.sub.--026248.1), L. lactis (GenBank Accession No. NP.sub.--267379.1), S. mutans (GenBank Accession No. NP.sub.--722414.1), M. stadtmanae (GenBank Accession No. YP.sub.--448586.1), M. tractuosa (GenBank Accession No. YP.sub.--004053736.1), Eubacterium SCB49 (GenBank Accession No. ZP.sub.--01890126.1), G. forsetti (GenBank Accession No. YP.sub.--862145.1), Y. lipolytica (GenBank Accession No. XP.sub.--502180.2), N. crassa (GenBank Accession No. XP.sub.--963045.1), or S. cerevisiae ILV3 (GenBank Accession No. NP.sub.--012550.1). Additional dihydroxy acid dehydratases capable of 2,3-dihydroxyisovalerate to .alpha.-ketoisovalerate are described in commonly owned and co-pending US Publication No. 2011/0076733. Motifs shared in common between the majority of dihydroxy acid dehydratases include:

TABLE-US-00002 (SEQ ID NO: 69) SLXSRXXIA, (SEQ ID NO: 70) CDKXXPG, (SEQ ID NO: 71) GXCXGXXTAN, (SEQ ID NO: 72) GGSTN, (SEQ ID NO: 73) GPXGXPGMRXE, (SEQ ID NO: 74) ALXTDGRXSG, and (SEQ ID NO: 75) GHXXPEA

motifs at amino acid positions corresponding to the 93-101, 122-128, 193-202, 276-280, 482-491, 509-518, and 526-532 residues, respectively, of the E. coli dihydroxy acid dehydratase encoded by ilvD. Thus, a protein harboring one or more of these amino acid motifs can generally be expected to exhibit dihydroxy acid dehydratase activity.

[0122] 2-keto-acid decarboxylases capable of converting .alpha.-ketoisovalerate to isobutyraldehyde may be derived from a variety of sources (e.g., bacterial, yeast, Archaea, etc.), including L. lactis kivD (GenBank Accession No. YP.sub.--003353820.1), E. cloacae (GenBank Accession No. P23234.1), M. smegmatis (GenBank Accession No. A0R480.1), M. tuberculosis (GenBank Accession No. 053865.1), M. avium (GenBank Accession No. Q742Q2.1, A. brasilense (GenBank Accession No. P51852.1), L. lactis kdcA (GenBank Accession No. AAS49166.1), S. epidermidis (GenBank Accession No. NP.sub.--765765.1), M. caseolyticus (GenBank Accession No. YP.sub.--002560734.1), B. megaterium (GenBank Accession No. YP.sub.--003561644.1), S. cerevisiae ARO10 (GenBank Accession No. NP.sub.--010668.1), or S. cerevisiae THI3 (GenBank Accession No. CAA98646.1). Additional 2-keto-acid decarboxylases capable of converting .alpha.-ketoisovalerate to isobutyraldehyde are described in commonly owned and co-pending US Publication No. 2011/0076733. Motifs shared in common between the majority of 2-keto-acid decarboxylases include:

TABLE-US-00003 (SEQ ID NO: 76) FG(V/I)(P/S)G(D/E)(Y/F), (SEQ ID NO: 77) (T/V)T(F/Y)G(V/A)G(E/A)(L/F)(S/N), (SEQ ID NO: 78) N(G/A)(L/I/V)AG(S/A)(Y/F)AE, (SEQ ID NO: 79) (V/I)(L/I/V)XI(V/T/S)G, and (SEQ ID NO: 80) GDG(S/A)(L/F/A)Q(L/M)T

motifs at amino acid positions corresponding to the 21-27, 70-78, 81-89, 93-98, and 428-435 residues, respectively, of the L. lactis 2-keto-acid decarboxylase encoded by kivD. Thus, a protein harboring one or more of these amino acid motifs can generally be expected to exhibit 2-keto-acid decarboxylase activity.

[0123] Alcohol dehydrogenases capable of converting isobutyraldehyde to isobutanol may be derived from a variety of sources (e.g., bacterial, yeast, Archaea, etc.), including L. lactis (GenBank Accession No. YP.sub.--003354381), B. cereus (GenBank Accession No. YP.sub.--001374103.1), N. meningitidis (GenBank Accession No. CBA03965.1), S. sanguinis (GenBank Accession No. YP.sub.--001035842.1), L. brevis (GenBank Accession No. YP.sub.--794451.1), B. thuringiensis (GenBank Accession No. ZP.sub.--04101989.1), P. acidilactici (GenBank Accession No. ZP.sub.--06197454.1), B. subtilis (GenBank Accession No. EHA31115.1), N. crassa (GenBank Accession No. CAB91241.1) or S. cerevisiae ADH6 (GenBank Accession No. NP.sub.--014051.1). Additional alcohol dehydrogenases capable of converting isobutyraldehyde to isobutanol are described in commonly owned and co-pending US Publication Nos. 2011/0076733 and 2011/0201072. Motifs shared in common between the majority of alcohol dehydrogenases include:

TABLE-US-00004 (SEQ ID NO: 81) C(H/G)(T/S)D(L/I)H, (SEQ ID NO: 82) GHEXXGXV, (SEQ ID NO: 83) (L/V)(Q/K/E)(V/I/K)G(D/Q)(R/H)(V/A), (SEQ ID NO: 84) CXXCXXC, (SEQ ID NO: 85) (C/A)(A/G/D)(G/A)XT(T/V), and (SEQ ID NO: 86) G(L/A/C)G(G/P)(L/I/V)G

motifs at amino acid positions corresponding to the 39-44, 59-66, 76-82, 91-97, 147-152, and 171-176 residues, respectively, of the L. lactis alcohol dehydrogenase encoded by adhA. Thus, a protein harboring one or more of these amino acid motifs can generally be expected to exhibit alcohol dehydrogenase activity.

[0124] In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to isobutanol. In one embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to isobutyraldehyde. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to keto-isovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to 2,3-dihydroxyisovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to acetolactate.

[0125] Furthermore, any of the genes encoding the foregoing enzymes (or any others mentioned herein (or any of the regulatory elements that control or modulate expression thereof)) may be optimized by genetic/protein engineering techniques, such as directed evolution or rational mutagenesis, which are known to those of ordinary skill in the art. Such action allows those of ordinary skill in the art to optimize the enzymes for expression and activity in yeast.

Isobutanol-Producing Metabolic Pathways with Improved KARI Properties

[0126] As described herein, the present application provides several KARI enzymes that give high performance when expressed in yeast in the context of isobutanol production. Accordingly, this application describes methods of increasing isobutanol production through the use of recombinant microorganisms comprising KARI enzymes with improved properties for the production of isobutanol.

[0127] One aspect of the application is directed to an isolated nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO; 28, SEQ ID NO: 40, or SEQ ID NO: 56. Further within the scope of present application are KARIs which are at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6. SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO; 28, SEQ ID NO: 40, or SEQ ID NO: 56.

[0128] In one embodiment, the KARI is derived from the genus Shewanella. In a specific embodiment, the KARI is derived from Shewanella sp. strain MR-4. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 1. In another embodiment, the KARI is derived from the genus Vibrio. In a specific embodiment, the KARI is derived from Vibrio fischeri. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 3. In yet another embodiment, the KARI is derived from the genus Gramella. In a specific embodiment, the KARI is derived from Gramella forsetii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 5. In yet another embodiment, the KARI is derived from the genus Cytophaga. In a specific embodiment, the KARI is derived from Cytophaga hutchinsonii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 7. In yet another embodiment, the KARI is derived from a genus selected from Lactococcus and Streptococcus. In a specific embodiment, the KARI is derived from Lactococcus lactis, Streptococcus equinus, or Streptococcus infantarius. In another specific embodiment, the KARI is encoded by SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25. In yet another embodiment, the KARI is derived from the genus Methanococcus. In a specific embodiment, the KARI is derived from Methanococcus maripaludis, Methanococcus vannielii, or Methanococcus voltae. In another specific embodiment, the KARI is encoded by SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, or SEQ ID NO: 37. In yet another embodiment, the KARI is derived from a genus selected from Zymomonas, Erythrobacter, Sphingomonas, Sphingobium, and Novosphingobium. In a specific embodiment, the KARI is derived from Zymomonas mobilis, Erythrobacter litoralis, Sphingomonas wittichii, Sphingobium japonicum, Sphingobium chlorophenolicum, or Novosphingobium nitrogenifigens. In another specific embodiment, the KARI is encoded by SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53. In yet another embodiment, the KARI is derived from the genus Bacteroides. In a specific embodiment, the KARI is derived from Bacteroides thetaiotaomicron. In another specific embodiment, the KARI is encoded by SEQ ID NO: 55. In yet another embodiment, the KARI is derived from the genus Schizosaccharomyces. In a specific embodiment, the KARI is derived from Schizosaccharomyces pombe or Schizosaccharomyces japonicus. In another specific embodiment, the KARI is encoded by SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61.

[0129] Also included within the scope of this application are isolated KARI enzymes that have been modified to be NADH-dependent. Accordingly, the present application further relates to NADH-dependent ketol-acid reductoisomerases (NKRs) derived from a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58.

[0130] Another aspect of the application is directed to an isolated nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 99% identical to SEQ ID NO: 64. In one embodiment, the KARI is derived from the genus Salmonella. In a specific embodiment, the KARI is derived from Salmonella enterica. In another specific embodiment, the KARI is encoded by SEQ ID NO: 63. The present application further relates to NADH-dependent ketol-acid reductoisomerases (NKRs) derived from a KARI that is at least about 99% identical to SEQ ID NO: 64.

[0131] The invention also includes fragments of the disclosed KARI enzymes which comprise at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acid residues and retain one or more activities associated with KARI enzymes. Such fragments may be obtained by deletion mutation, by recombinant techniques that are routine and well-known in the art, or by enzymatic digestion of the KARI enzyme(s) of interest using any of a number of well-known proteolytic enzymes. The invention further includes nucleic acid molecules which encode the above described KARI enzymes and KARI enzyme fragments.

[0132] Another aspect of the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO; 28, SEQ ID NO: 40, or SEQ ID NO: 56. Further within the scope of present application are recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO; 28, SEQ ID NO: 40, or SEQ ID NO: 56.

[0133] In one embodiment, the KARI is derived from the genus Shewanella. In a specific embodiment, the KARI is derived from Shewanella sp. strain MR-4. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 1. In another embodiment, the KARI is derived from the genus Vibrio. In a specific embodiment, the KARI is derived from Vibrio fischeri. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 3. In yet another embodiment, the KARI is derived from the genus Gramella. In a specific embodiment, the KARI is derived from Gramella forsetii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 5. In yet another embodiment, the KARI is derived from the genus Cytophaga. In a specific embodiment, the KARI is derived from Cytophaga hutchinsonii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 7. In yet another embodiment, the KARI is derived from a genus selected from Lactococcus and Streptococcus. In a specific embodiment, the KARI is derived from Lactococcus lactis, Streptococcus equinus, or Streptococcus infantarius. In another specific embodiment, the KARI is encoded by SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25. In yet another embodiment, the KARI is derived from the genus Methanococcus. In a specific embodiment, the KARI is derived from Methanococcus maripaludis, Methanococcus vannielii, or Methanococcus voltae. In another specific embodiment, the KARI is encoded by SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, or SEQ ID NO: 37. In yet another embodiment, the KARI is derived from a genus selected from Zymomonas, Erythrobacter, Sphingomonas, Sphingobium, and Novosphingobium. In a specific embodiment, the KARI is derived from Zymomonas mobilis, Erythrobacter litoralis, Sphingomonas wittichii, Sphingobium japonicum, Sphingobium chlorophenolicum, or Novosphingobium nitrogenifigens. In another specific embodiment, the KARI is encoded by SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53. In yet another embodiment, the KARI is derived from the genus Bacteroides. In a specific embodiment, the KARI is derived from Bacteroides thetaiotaomicron. In another specific embodiment, the KARI is encoded by SEQ ID NO: 55. In yet another embodiment, the KARI is derived from the genus Schizosaccharomyces. In a specific embodiment, the KARI is derived from Schizosaccharomyces pombe or Schizosaccharomyces japonicus. In another specific embodiment, the KARI is encoded by SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61.

[0134] Another aspect of the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 99% identical to SEQ ID NO: 64. In one embodiment, the KARI is derived from the genus Salmonella. In a specific embodiment, the KARI is derived from Salmonella enterica. In another specific embodiment, the KARI is encoded by SEQ ID NO: 63.

[0135] In an exemplary embodiment, pathway steps 2 and 5 of the isobutanol pathway may be carried out by KARI and ADH enzymes that utilize NADH (rather than NADPH) as a cofactor. It has been found previously that utilization of NADH-dependent KARI (NKR) and ADH enzymes to catalyze pathway steps 2 and 5, respectively, surprisingly enables production of isobutanol at theoretical yield and/or under anaerobic conditions. See, e.g., commonly owned and co-pending patent publication US 2010/0143997. An example of an NADH-dependent isobutanol pathway is illustrated in FIG. 2. Thus, in one embodiment, the recombinant microorganisms of the present invention may use an NKR to catalyze the conversion of acetolactate to produce 2,3-dihydroxyisovalerate. In another embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde to produce isobutanol. In yet another embodiment, the recombinant microorganisms of the present invention may use both an NKR to catalyze the conversion of acetolactate to produce 2,3-dihydroxyisovalerate, and an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde to produce isobutanol.

[0136] In an exemplary embodiment, the NKR is derived from a KARI that is at least about 80% identical to SEQ ID NO: 2. In another exemplary embodiment, the NKR is a KARI enzyme that has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2).

[0137] In one specific embodiment, the application is directed to KARI enzymes wherein the alanine corresponding to position 71 of the Shewanella sp. KARI (SEQ ID NO: 2) is replaced with an amino acid selected from serine, threonine, asparagine, or glutamine. In another specific embodiment, the application is directed to KARI enzymes wherein the arginine corresponding to position 76 of the Shewanella sp. KARI (SEQ ID NO: 2) is replaced with aspartic acid or glutamic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the serine corresponding to position 78 of the Shewanella sp. KARI (SEQ ID NO: 2) is replaced with aspartic acid or glutamic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the glutamine corresponding to position 110 of the Shewanella sp. KARI (SEQ ID NO: 2) is replaced with valine, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, or tyrosine.

[0138] In another specific embodiment, the application relates to a KARI enzyme having four modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2).

[0139] In another exemplary embodiment, the NKR is derived from a KARI that is at least about 80% identical to SEQ ID NO: 10. In another exemplary embodiment, the NKR is a KARI enzyme that has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

[0140] In one specific embodiment, the application is directed to KARI enzymes wherein the valine corresponding to position 48 of the L. lactis KARI (SEQ ID NO: 2) is replaced with leucine or proline. In another specific embodiment, the application is directed to KARI enzymes wherein the arginine corresponding to position 49 of the L. lactis KARI (SEQ ID NO: 2) is replaced with valine, leucine, serine, or proline. In yet another specific embodiment, the application is directed to KARI enzymes wherein the lysine corresponding to position 52 of the L. lactis KARI (SEQ ID NO: 2) is replaced with leucine, alanine, isoleucine, methionine, phenylalanine, tryptophan, tyrosine, valine, aspartic acid, or glutamic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the serine corresponding to position 53 of the L. lactis KARI (SEQ ID NO: 2) is replaced with aspartic acid or glutamic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the glutamic acid corresponding to position 59 of the L. lactis KARI (SEQ ID NO: 2) is replaced with lysine, arginine, or histidine. In yet another specific embodiment, the application is directed to KARI enzymes wherein the leucine corresponding to position 85 of the L. lactis KARI (SEQ ID NO: 2) is replaced with threonine or alanine. In yet another specific embodiment, the application is directed to KARI enzymes wherein the isoleucine corresponding to position 89 of the L. lactis KARI (SEQ ID NO: 2) is replaced with alanine. In yet another specific embodiment, the application is directed to KARI enzymes wherein the lysine corresponding to position 118 of the L. lactis KARI (SEQ ID NO: 2) is replaced with glutamic acid or aspartic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the threonine corresponding to position 182 of the L. lactis KARI (SEQ ID NO: 2) is replaced with serine, asparagine, or glutamine. In yet another specific embodiment, the application is directed to KARI enzymes wherein the glutamic acid corresponding to position 320 of the L. lactis KARI (SEQ ID NO: 2) is replaced with lysine, arginine, or histidine.

[0141] In another specific embodiment, the application relates to a KARI enzyme having seven modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10): (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (g) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

[0142] In yet another exemplary embodiment, the NKR is derived from a KARI that is at least about 99% identical to SEQ ID NO: 64. In another exemplary embodiment, the NKR is a KARI enzyme that has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64): (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0143] In one specific embodiment, the application is directed to KARI enzymes wherein the alanine corresponding to position 71 of the S. enterica KARI (SEQ ID NO: 64) is replaced with an amino acid selected from serine, threonine, asparagine, or glutamine. In another specific embodiment, the application is directed to KARI enzymes wherein the arginine corresponding to position 76 of the S. enterica KARI (SEQ ID NO: 64) is replaced with aspartic acid or glutamic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the serine corresponding to position 78 of the S. enterica KARI (SEQ ID NO: 64) is replaced with aspartic acid or glutamic acid. In yet another specific embodiment, the application is directed to KARI enzymes wherein the glutamine corresponding to position 110 of the S. enterica KARI (SEQ ID NO: 64) is replaced with valine, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, or tyrosine. In yet another specific embodiment, the application is directed to KARI enzymes wherein the aspartic acid corresponding to position 146 of the S. enterica KARI (SEQ ID NO: 64) is replaced with glycine, cysteine, or proline. In yet another specific embodiment, the application is directed to KARI enzymes wherein the glycine corresponding to position 185 of the S. enterica KARI (SEQ ID NO: 64) is replaced with arginine, histidine, or lysine. In yet another specific embodiment, the application is directed to KARI enzymes wherein the lysine corresponding to position 433 of the S. enterica KARI (SEQ ID NO: 64) is replaced with glutamic acid or aspartic acid.

[0144] In another specific embodiment, the application relates to a KARI enzyme having seven modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0145] Further included within the scope of the application are KARI enzymes, other than the Shewanella sp. KARI (SEQ ID NO: 2), the L. lactis KARI (SEQ ID NO: 10), or the S. enterica KARI (SEQ ID NO: 64) which contain modifications or mutations corresponding to those set out above. The nucleotide sequences for several KARI enzymes are known. A representative listing of KARI enzymes capable of being modified are disclosed in commonly owned and co-pending US Publication No. US 2010/0143997.

[0146] The corresponding positions of the KARI enzyme identified herein (e.g., the Shewanella sp. KARI, the L. lactis KARI, or the S. enterica KARI) may be readily identified for other KARI enzymes by one of skill in the art. Thus, given the defined region and the assays described in the present application, one with skill in the art can make one or a number of modifications which would result in an increased ability to utilize NADH, particularly for the conversion of acetolactate to 2,3-dihydroxyisovalerate, in any KARI enzyme of interest. Residues to be modified in accordance with the present application may include those described in Examples 4-5.

[0147] The application also includes fragments of the modified KARI enzymes which comprise at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acid residues and retain one or more activities associated with KARI enzymes. Such fragments may be obtained by deletion mutation, by recombinant techniques that are routine and well-known in the art, or by enzymatic digestion of the KARI enzyme(s) of interest using any of a number of well-known proteolytic enzymes. The invention further includes nucleic acid molecules which encode the above described mutant KARI enzymes and KARI enzyme fragments.

[0148] Another aspect of the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). Further included within the scope of the application are recombinant microorganisms comprising a KARI enzyme, other than the Shewanella sp. KARI (SEQ ID NO: 2), which contains modifications or mutations at positions corresponding to those set out above.

[0149] Yet another aspect of the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10). Further included within the scope of the application are recombinant microorganisms comprising a KARI enzyme, other than the L. lactis KARI (SEQ ID NO: 10), which contains modifications or mutations at positions corresponding to those set out above.

[0150] Another aspect of the application relates to a recombinant microorganism comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64). Further included within the scope of the application are recombinant microorganisms comprising a KARI enzyme, other than the S. enterica KARI (SEQ ID NO: 64), which contains modifications or mutations at positions corresponding to those set out above.

[0151] Further within the scope of present application are recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO; 28, SEQ ID NO: 40, or SEQ ID NO: 56. Also within the scope of present application are recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a KARI having one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). Also within the scope of present application are recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a KARI having one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

[0152] Further within the scope of present application are recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 99% identical to SEQ ID NO: 64. Also within the scope of present application are recombinant microorganisms comprising at least one nucleic acid molecule encoding a ketol-acid reductoisomerase (KARI), wherein said KARI is at least about 99% identical to a KARI having one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0153] In accordance with the invention, any number of mutations can be made to the KARI enzymes, and in a preferred aspect, multiple mutations can be made to result in an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. Such mutations include point mutations, frame shift mutations, deletions, and insertions, with one or more (e.g., one, two, three, four, five or more, etc.) point mutations preferred.

[0154] Mutations may be introduced into the KARI enzymes of the present application to create NKRs using any methodology known to those skilled in the art. Mutations may be introduced randomly by, for example, conducting a PCR reaction in the presence of manganese as a divalent metal ion cofactor. Alternatively, oligonucleotide directed mutagenesis may be used to create the NKRs which allows for all possible classes of base pair changes at any determined site along the encoding DNA molecule. In general, this technique involves annealing an oligonucleotide complementary (except for one or more mismatches) to a single stranded nucleotide sequence coding for the KARI enzyme of interest. The mismatched oligonucleotide is then extended by DNA polymerase, generating a double-stranded DNA molecule which contains the desired change in sequence in one strand. The changes in sequence can, for example, result in the deletion, substitution, or insertion of an amino acid. The double-stranded polynucleotide can then be inserted into an appropriate expression vector, and a mutant or modified polypeptide can thus be produced. The above-described oligonucleotide directed mutagenesis can, for example, be carried out via PCR.

[0155] In one aspect, the NADH-dependent activity of the modified or mutated KARI enzyme is increased.

[0156] In an exemplary embodiment, the catalytic efficiency of the modified or mutated KARI enzyme is improved for the cofactor NADH. Preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 5% as compared to the wild-type or parental KARI for NADH. More preferably the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 15% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 25% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 50% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 75% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 100% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 300% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 500% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 1000% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 5000% as compared to the wild-type or parental KARI for NADH.

[0157] In another exemplary embodiment, the catalytic efficiency of the modified or mutated KARI enzyme with NADH is increased with respect to the catalytic efficiency of the wild-type or parental enzyme with NADPH. Preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 10% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 25% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 50% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 75%, 85%, 95% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH.

[0158] In another exemplary embodiment, the K.sub.M of the KARI enzyme for NADH is decreased relative to the wild-type or parental enzyme. A change in K.sub.M is evidenced by at least a 5% or greater increase or decrease in K.sub.M compared to the wild-type KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 10 times decreased K.sub.M for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 30 times decreased K.sub.M for NADH compared to the wild-type or parental KARI enzyme.

[0159] In another exemplary embodiment, the k.sub.cat of the KARI enzyme with NADH is increased relative to the wild-type or parental enzyme. A change in k.sub.cat is evidenced by at least a 5% or greater increase or decrease in K.sub.M compared to the wild-type KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 50% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 100% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 200% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme.

Recombinant Microorganisms Comprising KARI with Improved Properties

[0160] In addition to isobutanol producing metabolic pathways, a number of biosynthetic pathways use KARI enzymes to catalyze a reaction step, including pathways for the production of isoleucine, leucine, valine, pantothenate, coenzyme A, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. A representative list of the engineered biosynthetic pathways utilizing KARI enzymes is provided in Table 1.

TABLE-US-00005 TABLE 1 Biosynthetic Pathways Utilizing KARI to Catalyze a Reaction Step. Biosynthetic Pathway Reference.sup.a Isobutanol US 2009/0226991 (Feldman et al.), US 2011/0020889 (Feldman et al.), and US 2010/0143997 (Buelter et al.) Leucine WO/2001/021772 (Yocum et al.) and McCourt et al., 2006, Amino Acids 31: 173-210 Valine WO/2001/021772 (Yocum et al.) and McCourt et al., 2006, Amino Acids 31: 173-210 Pantothenic Acid WO/2001/021772 (Yocum et al.) Coenzyme A WO/2001/021772 (Yocum et al.) 1-Butanol WO/2010/017230 (Lynch), WO/2010/031772 (Wu at al.), and KR2011002130 (Lee et al.) 2-Methyl-1- WO/2008/098227 (Liao et al.), WO/2009/076480 Butanol (Picataggio et al.), and Atsumi et al., 2008, Nature 451: 86-89 3-Methyl-1- WO/2008/098227 (Liao et al.), Atsumi et al., 2008, Butanol Nature 451: 86-89, and Connor et al., 2008, Appl. Environ. Microbiol. 74: 5769-5775 3-Methyl-1- WO/2010/045629 (Liao et al.), Zhang at al., 2008, Pentanol Proc Natl Acad Sci USA 105: 20653-20658 4-Methyl-1- WO/2010/045629 (Liao et al.), Zhang et al., 2008, Pentanol Proc Natl Acad Sci USA 105: 20653-20658 4-Methyl-1- WO/2010/045629 (Liao et al.), Zhang et al., 2008, Hexanol Proc Natl Acad Sci USA 105:20653-20658 5-Methyl-1- WO/2010/045629 (Liao et al.), Zhang et al., 2008, Heptanol Proc Natl Acad Sci USA 105: 20653-20658 .sup.aThe contents of each of the references in this table are herein incorporated by reference in their entireties for all purposes.

[0161] As described above, each of these biosynthetic pathways uses a KARI enzyme to catalyze a reaction step. Therefore, the product yield from these biosynthetic pathways will in part depend upon the activity of KARI.

[0162] As will be understood by one skilled in the art equipped with the present disclosure, the KARI enzymes described herein would have utility in any of the above-described pathways. Thus, in an additional aspect, the present application relates to a recombinant microorganism comprising a KARI-requiring biosynthetic pathway, wherein said recombinant microorganism comprises at least one nucleic acid molecule encoding a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In one embodiment, the KARI is derived from the genus Shewanella. In a specific embodiment, the KARI is derived from Shewanella sp. strain MR-4. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 1. In another embodiment, the KARI is derived from the genus Vibrio. In a specific embodiment, the KARI is derived from Vibrio fischei. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 3. In yet another embodiment, the KARI is derived from the genus Gramella. In a specific embodiment, the KARI is derived from Gramella forsetii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 5. In yet another embodiment, the KARI is derived from the genus Cytophaga. In a specific embodiment, the KARI is derived from Cytophaga hutchinsonii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 7. In yet another embodiment, the KARI is derived from a genus selected from Lactococcus and Streptococcus. In a specific embodiment, the KARI is derived from Lactococcus lactis, Streptococcus equinus, or Streptococcus infantarius. In another specific embodiment, the KARI is encoded by SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25. In yet another embodiment, the KARI is derived from the genus Methanococcus. In a specific embodiment, the KARI is derived from Methanococcus maripaludis, Methanococcus vannielii, or Methanococcus voltae. In another specific embodiment, the KARI is encoded by SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, or SEQ ID NO: 37. In yet another embodiment, the KARI is derived from a genus selected from Zymomonas, Erythrobacter, Sphingomonas, Sphingobium, and Novosphingobium. In a specific embodiment, the KARI is derived from Zymomonas mobilis, Erythrobacter litoralis, Sphingomonas wittichii, Sphingobium japonicum, Sphingobium chlorophenolicum, or Novosphingobium nitrogenifigens. In another specific embodiment, the KARI is encoded by SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53. In yet another embodiment, the KARI is derived from the genus Bacteroides. In a specific embodiment, the KARI is derived from Bacteroides thetaiotaomicron. In another specific embodiment, the KARI is encoded by SEQ ID NO: 55. In yet another embodiment, the KARI is derived from the genus Schizosaccharomyces. In a specific embodiment, the KARI is derived from Schizosaccharomyces pombe or Schizosaccharomyces japonicus. In another specific embodiment, the KARI is encoded by SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61. In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10): (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

[0163] In an additional aspect, the present application relates to a recombinant microorganism comprising a KARI-requiring biosynthetic pathway, wherein said recombinant microorganism comprises at least one nucleic acid molecule encoding a KARI that is at least about 99% identical to SEQ ID NO: 64. In one embodiment, the KARI is derived from the genus Salmonella. In a specific embodiment, the KARI is derived from Salmonella enterica. In another specific embodiment, the KARI is encoded by SEQ ID NO: 63. In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0164] As used herein, a "KARI-requiring biosynthetic pathway" refers to any metabolic pathway which utilizes KARI to convert acetolactate to 2,3-dihydroxyisovalerate or 2-aceto-2-hydroxy-butanoate to 2,3-dihydroxy-3-methylvalerate. Examples of KARI-requiring biosynthetic pathways include, but are not limited to, isobutanol, isoleucine, leucine, valine, pantothenate, coenzyme A, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol metabolic pathways. The metabolic pathway may naturally occur in a microorganism (e.g., a natural pathway for the production of valine) or arise from the introduction of one or more heterologous polynucleotides through genetic engineering. In an exemplary embodiment, the recombinant microorganisms expressing the KARI-requiring biosynthetic pathway are yeast cells.

The Microorganism in General

[0165] As described herein, the recombinant microorganisms of the present invention can express a plurality of heterologous and/or native enzymes involved in pathways for the production of a beneficial metabolite such as isobutanol.

[0166] As described herein, "engineered" or "modified" microorganisms are produced via the introduction of genetic material into a host or parental microorganism of choice and/or by modification of the expression of native genes, thereby modifying or altering the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material and/or the modification of the expression of native genes the parental microorganism acquires new properties, e.g., the ability to produce a new, or greater quantities of, an intracellular and/or extracellular metabolite. As described herein, the introduction of genetic material into and/or the modification of the expression of native genes in a parental microorganism results in a new or modified ability to produce beneficial metabolites such as isobutanol from a suitable carbon source. The genetic material introduced into and/or the genes modified for expression in the parental microorganism contains gene(s), or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of isobutanol and may also include additional elements for the expression and/or regulation of expression of these genes, e.g., promoter sequences.

[0167] In addition to the introduction of a genetic material into a host or parental microorganism, an engineered or modified microorganism can also include the alteration, disruption, deletion or knocking-out of a gene or polynucleotide to alter the cellular physiology and biochemistry of the microorganism. Through the alteration, disruption, deletion or knocking-out of a gene or polynucleotide, the microorganism acquires new or improved properties (e.g., the ability to produce a new metabolite or greater quantities of an intracellular metabolite, to improve the flux of a metabolite down a desired pathway, and/or to reduce the production of by-products).

[0168] Recombinant microorganisms provided herein may also produce metabolites in quantities not available in the parental microorganism. A "metabolite" refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g., isobutanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.

[0169] The disclosure identifies specific genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutations and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme using methods known in the art.

[0170] Due to the inherent degeneracy of the genetic code, other polynucleotides which encode substantially the same or functionally equivalent polypeptides can also be used to clone and express the polynucleotides encoding such enzymes.

[0171] As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Codons can be substituted to reflect the preferred codon usage of the host, in a process sometimes called "codon optimization" or "controlling for species codon bias."

[0172] Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host (Murray et al., 1989, Nucl Acids Res. 17: 477-508) can be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. coli commonly use UAA as the stop codon (Dalphin et al., 1996, Nucl Acids Res. 24: 216-8). Methodology for optimizing a nucleotide sequence for expression in a plant is provided, for example, in U.S. Pat. No. 6,015,891, and the references cited therein.

[0173] Those of skill in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA compounds differing in their nucleotide sequences can be used to encode a given enzyme of the disclosure. The native DNA sequence encoding the biosynthetic enzymes described above are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes utilized in the methods of the disclosure. In similar fashion, a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity. The disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as the modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein merely illustrate embodiments of the disclosure.

[0174] In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein.

[0175] As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences have at least about 30%, 40%, 50% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In one embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, typically at least 40%, more typically at least 50%, even more typically at least 60%, and even more typically at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[0176] When "homologous" is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art (See, e.g., Pearson W. R., 1994, Methods in Mol Biol 25: 365-89).

[0177] The following six groups each contain amino acids that are conservative substitutions for one another: 1) Serine (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[0178] Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See commonly owned and co-pending application US 2009/0226991. A typical algorithm used comparing a molecule sequence to a database containing a large number of sequences from different organisms is the computer program BLAST. When searching a database containing sequences from a large number of different organisms, it is typical to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms described in commonly owned U.S. Pat. No. 8,017,375.

[0179] It is understood that a range of microorganisms can be modified to include an isobutanol producing metabolic pathway suitable for the production of isobutanol. In various embodiments, the microorganisms may be selected from yeast microorganisms. Yeast microorganisms for the production of isobutanol may be selected based on certain characteristics:

[0180] One characteristic may include the property that the microorganism is selected to convert various carbon sources into isobutanol. The term "carbon source" generally refers to a substance suitable to be used as a source of carbon for prokaryotic or eukaryotic cell growth. Examples of suitable carbon sources are described in commonly owned U.S. Pat. No. 8,017,375. Accordingly, in one embodiment, the recombinant microorganism herein disclosed can convert a variety of carbon sources to products, including but not limited to glucose, galactose, mannose, xylose, arabinose, lactose, sucrose, CO.sub.2, and mixtures thereof.

[0181] The recombinant microorganism may thus further include a pathway for the production of isobutanol from five-carbon (pentose) sugars including xylose. Most yeast species metabolize xylose via a complex route, in which xylose is first reduced to xylitol via a xylose reductase (XR) enzyme. The xylitol is then oxidized to xylulose via a xylitol dehydrogenase (XDH) enzyme. The xylulose is then phosphorylated via a xylulokinase (XK) enzyme. This pathway operates inefficiently in yeast species because it introduces a redox imbalance in the cell. The xylose-to-xylitol step uses primarily NADPH as a cofactor (generating NADP+), whereas the xylitol-to-xylulose step uses NAD+ as a cofactor (generating NADH). Other processes must operate to restore the redox imbalance within the cell. This often means that the organism cannot grow anaerobically on xylose or other pentose sugars. Accordingly, a yeast species that can efficiently ferment xylose and other pentose sugars into a desired fermentation product is therefore very desirable.

[0182] Thus, in one aspect, the recombinant microorganism is engineered to express a functional exogenous xylose isomerase. Exogenous xylose isomerases (XI) functional in yeast are known in the art. See, e.g., Rajgarhia et al., U.S. Pat. No. 7,943,366, which is herein incorporated by reference in its entirety. In an embodiment according to this aspect, the exogenous XI gene is operatively linked to promoter and terminator sequences that are functional in the yeast cell. In a preferred embodiment, the recombinant microorganism further has a deletion or disruption of a native gene that encodes for an enzyme (e.g., XR and/or XDH) that catalyzes the conversion of xylose to xylitol. In a further preferred embodiment, the recombinant microorganism also contains a functional, exogenous xylulokinase (XK) gene operatively linked to promoter and terminator sequences that are functional in the yeast cell. In one embodiment, the xylulokinase (XK) gene is overexpressed.

[0183] In one embodiment, the yeast microorganism has reduced or no pyruvate decarboxylase (PDC) activity. PDC catalyzes the decarboxylation of pyruvate to acetaldehyde, which is then reduced to ethanol by ADH via an oxidation of NADH to NAD+. Ethanol production is the main pathway to oxidize the NADH from glycolysis. Deletion, disruption, or mutation of this pathway increases the pyruvate and the reducing equivalents (NADH) available for a biosynthetic pathway which uses pyruvate as the starting material and/or as an intermediate. Accordingly, deletion, disruption, or mutation of one or more genes encoding for pyruvate decarboxylase and/or a positive transcriptional regulator thereof can further increase the yield of the desired pyruvate-derived metabolite (e.g., isobutanol). In one embodiment, said pyruvate decarboxylase gene targeted for disruption, deletion, or mutation is selected from the group consisting of PDC1, PDC5, and PDC6, or homologs or variants thereof. In another embodiment, all three of PDC1, PDC5, and PDC6 are targeted for disruption, deletion, or mutation. In yet another embodiment, a positive transcriptional regulator of the PDC1, PDC5, and/or PDC6 is targeted for disruption, deletion or mutation. In one embodiment, said positive transcriptional regulator is PDC2, or homologs or variants thereof.

[0184] As is understood by those skilled in the art, there are several additional mechanisms available for reducing or disrupting the activity of a protein encoded by PDC1, PDC5, PDC6, and/or PDC2, including, but not limited to, the use of a regulated promoter, use of a weak constitutive promoter, disruption of one of the two copies of the gene in a diploid yeast, disruption of both copies of the gene in a diploid yeast, expression of an anti-sense nucleic acid, expression of an siRNA, over expression of a negative regulator of the endogenous promoter, alteration of the activity of an endogenous or heterologous gene, use of a heterologous gene with lower specific activity, the like or combinations thereof. Yeast strains with reduced PDC activity are described in commonly owned U.S. Pat. No. 8,017,375, as well as commonly owned and co-pending US Patent Publication No. 2011/0183392.

[0185] In another embodiment, the microorganism has reduced glycerol-3-phosphate dehydrogenase (GPD) activity. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) via the oxidation of NADH to NAD+. Glycerol is then produced from G3P by Glycerol-3-phosphatase (GPP). Glycerol production is a secondary pathway to oxidize excess NADH from glycolysis. Reduction or elimination of this pathway would increase the pyruvate and reducing equivalents (NADH) available for the production of a pyruvate-derived metabolite (e.g., isobutanol). Thus, disruption, deletion, or mutation of the genes encoding for glycerol-3-phosphate dehydrogenases can further increase the yield of the desired metabolite (e.g., isobutanol). Yeast strains with reduced GPD activity are described in commonly owned and co-pending US Patent Publication Nos. 2011/0020889 and 2011/0183392.

[0186] In yet another embodiment, the microorganism has reduced 3-keto acid reductase (3-KAR) activity. 3-KARs catalyze the conversion of 3-keto acids (e.g., acetolactate) to 3-hydroxyacids (e.g., DH2 MB). Yeast strains with reduced 3-KAR activity are described in commonly owned U.S. Pat. Nos. 8,133,715, 8,153,415, and 8,158,404, which are herein incorporated by reference in their entireties.

[0187] In yet another embodiment, the microorganism has reduced aldehyde dehydrogenase (ALDH) activity. Aldehyde dehydrogenases catalyze the conversion of aldehydes (e.g., isobutyraldehyde) to acid by-products (e.g., isobutyrate). Yeast strains with reduced ALDH activity are described in commonly owned U.S. Pat. Nos. 8,133,715, 8,153,415, and 8,158,404, which are herein incorporated by reference in their entireties.

[0188] In one embodiment, the yeast microorganisms may be selected from the "Saccharomyces Yeast Clade", as described in commonly owned U.S. Pat. No. 8,017,375.

[0189] The term "Saccharomyces sensu stricto" taxonomy group is a cluster of yeast species that are highly related to S. cerevisiae (Rainieri et al., 2003, J. Biosci Bioengin 96: 1-9). Saccharomyces sensu stricto yeast species include but are not limited to S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids derived from these species (Masneuf et al., 1998, Yeast 7: 61-72).

[0190] An ancient whole genome duplication (WGD) event occurred during the evolution of the hemiascomycete yeast and was discovered using comparative genomic tools (Kellis et al., 2004, Nature 428: 617-24; Dujon et al., 2004, Nature 430:35-44; Langkjaer et al., 2003, Nature 428: 848-52; Wolfe et al., 1997, Nature 387: 708-13). Using this major evolutionary event, yeast can be divided into species that diverged from a common ancestor following the WGD event (termed "post-WGD yeast" herein) and species that diverged from the yeast lineage prior to the WGD event (termed "pre-WGD yeast" herein).

[0191] Accordingly, in one embodiment, the yeast microorganism may be selected from a post-WGD yeast genus, including but not limited to Saccharomyces and Candida. The favored post-WGD yeast species include: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, and C. glabrata.

[0192] In another embodiment, the yeast microorganism may be selected from a pre-whole genome duplication (pre-WGD) yeast genus including but not limited to Saccharomyces, Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomyces, Hansenula, Yarrowia and, Schizosaccharomyces. Representative pre-WGD yeast species include: S. kluyveri, K. thermotolerans, K. marxianus, K. waltii, K. lactis, C. tropicalis, P. pastoris, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, D. hansenii, H. anomala, Y. lipolytica, and S. pombe.

[0193] A yeast microorganism may be either Crabtree-negative or Crabtree-positive as described in described in commonly owned U.S. Pat. No. 8,017,375. In one embodiment the yeast microorganism may be selected from yeast with a Crabtree-negative phenotype including but not limited to the following genera: Saccharomyces, Kluyveromyces, Pichia, Issatchenkia, Hansenula, and Candida. Crabtree-negative species include but are not limited to: S. kluyvenri, K. lactis, K. marxianus, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, H. anomala, and C. utilis. In another embodiment, the yeast microorganism may be selected from yeast with a Crabtree-positive phenotype, including but not limited to Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces, Pichia and Schizosaccharomyces. Crabtree-positive yeast species include but are not limited to: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, K. thermotolerans, C. glabrata, Z. bailli, Z. rouxii, D. hansenii, P. pastorius, and S. pombe.

[0194] Another characteristic may include the property that the microorganism is that it is non-fermenting. In other words, it cannot metabolize a carbon source anaerobically while the yeast is able to metabolize a carbon source in the presence of oxygen. Nonfermenting yeast refers to both naturally occurring yeasts as well as genetically modified yeast. During anaerobic fermentation with fermentative yeast, the main pathway to oxidize the NADH from glycolysis is through the production of ethanol. Ethanol is produced by alcohol dehydrogenase (ADH) via the reduction of acetaldehyde, which is generated from pyruvate by pyruvate decarboxylase (PDC). In one embodiment, a fermentative yeast can be engineered to be non-fermentative by the reduction or elimination of the native PDC activity. Thus, most of the pyruvate produced by glycolysis is not consumed by PDC and is available for the isobutanol pathway. Deletion of this pathway increases the pyruvate and the reducing equivalents available for the biosynthetic pathway. Fermentative pathways contribute to low yield and low productivity of pyruvate-derived metabolites such as isobutanol. Accordingly, deletion of one or more PDC genes may increase yield and productivity of a desired metabolite (e.g., isobutanol).

[0195] In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but not limited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, Myxozyma, or Candida. In a specific embodiment, the non-fermenting yeast is C. xestobii.

Methods in General

Identification of KARI Homologs

[0196] Any method can be used to identify genes that encode for enzymes that are homologous to the genes described herein (e.g., KARI homologs). Generally, genes that are homologous or similar to the KARIs described herein may be identified by functional, structural, and/or genetic analysis. In most cases, homologous or similar genes and/or homologous or similar enzymes will have functional, structural, or genetic similarities.

[0197] Techniques known to those skilled in the art may be suitable to identify additional homologous genes and homologous enzymes. Generally, analogous genes and/or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a gene by PCR using primers based on a published sequence of a gene/enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among ketol-acid reductoisomerase genes. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic activity of an enzyme through in vitro enzyme assays for said activity (e.g. as described herein or in Kiritani, K. Branched-Chain Amino Acids Methods Enzymology, 1970), then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or similar genes and/or homologous or similar enzymes, analogous genes and/or analogous enzymes or proteins, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein.

Genetic Insertions and Deletions

[0198] Any method can be used to introduce a nucleic acid molecule into yeast and many such methods are well known. For example, transformation and electroporation are common methods for introducing nucleic acid into yeast cells. See, e.g., Gietz et al., 1992, Nuc Acids Res. 27: 69-74; Ito et al., 1983, J. Bacteriol. 153: 163-8; and Becker et al., 1991, Methods in Enzymology 194: 182-7.

[0199] In an embodiment, the integration of a gene of interest into a DNA fragment or target gene of a yeast microorganism occurs according to the principle of homologous recombination. According to this embodiment, an integration cassette containing a module comprising at least one yeast marker gene and/or the gene to be integrated (internal module) is flanked on either side by DNA fragments homologous to those of the ends of the targeted integration site (recombinogenic sequences). After transforming the yeast with the cassette by appropriate methods, a homologous recombination between the recombinogenic sequences may result in the internal module replacing the chromosomal region in between the two sites of the genome corresponding to the recombinogenic sequences of the integration cassette. (Orr-Weaver et al., 1981, PNAS USA 78: 6354-58).

[0200] In an embodiment, the integration cassette for integration of a gene of interest into a yeast microorganism includes the heterologous gene under the control of an appropriate promoter and terminator together with the selectable marker flanked by recombinogenic sequences for integration of a heterologous gene into the yeast chromosome. In an embodiment, the heterologous gene includes an appropriate native gene desired to increase the copy number of a native gene(s). The selectable marker gene can be any marker gene used in yeast, including but not limited to, HIS3, TRP1, LEU2, URA3, bar, ble, hph, and kan. The recombinogenic sequences can be chosen at will, depending on the desired integration site suitable for the desired application.

[0201] In another embodiment, integration of a gene into the chromosome of the yeast microorganism may occur via random integration (Kooistra et al., 2004, Yeast 21: 781-792).

[0202] Additionally, in an embodiment, certain introduced marker genes are removed from the genome using techniques well known to those skilled in the art. For example, URA3 marker loss can be obtained by plating URA3 containing cells in FOA (5-fluoro-orotic acid) containing medium and selecting for FOA resistant colonies (Boeke et al., 1984, Mol. Gen. Genet 197: 345-47).

[0203] The exogenous nucleic acid molecule contained within a yeast cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the cell or maintained in an episomal state that can stably be passed on ("inherited") to daughter cells. Such extra-chromosomal genetic elements (such as plasmids, mitochondrial genome, etc.) can additionally contain selection markers that ensure the presence of such genetic elements in daughter cells. Moreover, the yeast cells can be stably or transiently transformed. In addition, the yeast cells described herein can contain a single copy, or multiple copies of a particular exogenous nucleic acid molecule as described above.

Reduction of Enzymatic Activity

[0204] Yeast microorganisms within the scope of the invention may have reduced enzymatic activity such as reduced PDC, GPD, ALDH, or 3-KAR activity. The term "reduced" as used herein with respect to a particular polypeptide activity refers to a lower level of polypeptide activity than that measured in a comparable yeast cell of the same species. The term reduced also refers to the elimination of polypeptide activity as compared to a comparable yeast cell of the same species. Thus, yeast cells lacking activity for an endogenous PDC, GPD, ALDH, or 3-KAR are considered to have reduced activity for PDC, GPD. ALDH, or 3-KAR since most, if not all, comparable yeast strains have at least some activity for PDC, GPD, ALDH, or 3-KAR. Such reduced PDC, GPD, ALDH, or 3-KAR activities can be the result of lower PDC, GPD, ALDH, or 3-KAR concentration (e.g., via reduced expression), lower specific activity of the PDC. GPD, ALDH, or 3-KAR, or a combination thereof. Many different methods can be used to make yeast having reduced PDC, GPD, ALDH, or 3-KAR activity. For example, a yeast cell can be engineered to have a disrupted PDC-, GPD-, ALDH-, or 3-KAR-encoding locus using common mutagenesis or knock-out technology. See, e.g., Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Stems, Cold Spring Harbor Press (1998). In addition, a yeast cell can be engineered to partially or completely remove the coding sequence for a particular PDC, GPD, ALDH, or 3-KAR. Furthermore, the promoter sequence and/or associated regulatory elements can be mutated, disrupted, or deleted to reduce the expression of a PDC, GPD, ALDH, or 3-KAR. Moreover, certain point-mutation(s) can be introduced which results in a PDC, GPD, ALDH, or 3-KAR with reduced activity. Also included within the scope of this invention are yeast strains which when found in nature, are substantially free of one or more PDC, GPD, ALDH, or 3-KAR activities.

[0205] Alternatively, antisense technology can be used to reduce PDC, GPD, ALDH, or 3-KAR activity. For example, yeasts can be engineered to contain a cDNA that encodes an antisense molecule that prevents a PDC, GPD, ALDH, or 3-KAR from being made. The term "antisense molecule" as used herein encompasses any nucleic acid molecule that contains sequences that correspond to the coding strand of an endogenous polypeptide. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA.

Overexpression of Heterologous Genes

[0206] Methods for overexpressing a polypeptide from a native or heterologous nucleic acid molecule are well known. Such methods include, without limitation, constructing a nucleic acid sequence such that a regulatory element promotes the expression of a nucleic acid sequence that encodes the desired polypeptide. Typically, regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Thus, regulatory elements include, without limitation, promoters, enhancers, and the like. For example, the exogenous genes can be under the control of an inducible promoter or a constitutive promoter. Moreover, methods for expressing a polypeptide from an exogenous nucleic acid molecule in yeast are well known. For example, nucleic acid constructs that are used for the expression of exogenous polypeptides within Kluyveromyces and Saccharomyces are well known (see, e.g., U.S. Pat. Nos. 4,859,596 and 4,943,529, for Kluyveromyces and, e.g., Gellissen et al., Gene 190(1):87-97 (1997) for Saccharomyces). Yeast plasmids have a selectable marker and an origin of replication. In addition certain plasmids may also contain a centromeric sequence. These centromeric plasmids are generally a single or low copy plasmid. Plasmids without a centromeric sequence and utilizing either a 2 micron (S. cerevisiae) or 1.6 micron (K. lactis) replication origin are high copy plasmids. The selectable marker can be either prototrophic, such as HIS3. TRP1, LEU2, URA3 or ADE2, or antibiotic resistance, such as, bar, ble, hph, or kan.

[0207] In another embodiment, heterologous control elements can be used to activate or repress expression of endogenous genes. Additionally, when expression is to be repressed or eliminated, the gene for the relevant enzyme, protein or RNA can be eliminated by known deletion techniques.

[0208] As described herein, any yeast within the scope of the disclosure can be identified by selection techniques specific to the particular polypeptide (e.g. an isobutanol pathway enzyme) being expressed, over-expressed or repressed. Methods of identifying the strains with the desired phenotype are well known to those skilled in the art. Such methods include, without limitation, PCR, RT-PCR, and nucleic acid hybridization techniques such as Northern and Southern analysis, altered growth capabilities on a particular substrate or in the presence of a particular substrate, a chemical compound, a selection agent and the like. In some cases, immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid by detecting the expression of the encoded polypeptide. For example, an antibody having specificity for an encoded enzyme can be used to determine whether or not a particular yeast cell contains that encoded enzyme. Further, biochemical techniques can be used to determine if a cell contains a particular nucleic acid molecule encoding an enzymatic polypeptide by detecting a product produced as a result of the expression of the enzymatic polypeptide. For example, transforming a cell with a vector encoding acetolactate synthase and detecting increased acetolactate concentrations compared to a cell without the vector indicates that the vector is both present and that the gene product is active. Methods for detecting specific enzymatic activities or the presence of particular products are well known to those skilled in the art. For example, the presence of acetolactate can be determined as described by Hugenholtz and Starrenburg, 1992, Appl. Micro. Biot. 38:17-22.

Increase of Enzymatic Activity

[0209] Yeast microorganisms of the invention may be further engineered to have increased activity of enzymes (e.g., increased activity of enzymes involved in an isobutanol producing metabolic pathway). The term "increased" as used herein with respect to a particular enzymatic activity refers to a higher level of enzymatic activity than that measured in a comparable yeast cell of the same species. For example, overexpression of a specific enzyme can lead to an increased level of activity in the cells for that enzyme. Increased activities for enzymes involved in glycolysis or the isobutanol pathway would result in increased productivity and yield of isobutanol.

[0210] Methods to increase enzymatic activity are known to those skilled in the art. Such techniques may include increasing the expression of the enzyme by increased copy number and/or use of a strong promoter, introduction of mutations to relieve negative regulation of the enzyme, introduction of specific mutations to increase specific activity and/or decrease the K.sub.M for the substrate, or by directed evolution. See, e.g., Methods in Molecular Biology (vol. 231), ed. Arnold and Georgiou, Humana Press (2003).

Methods of Using Recombinant Microorganisms for Metabolite Production

[0211] For a biocatalyst to produce a beneficial metabolite most economically, it is desirable to produce said metabolite at a high yield. Preferably, the only product produced is the desired metabolite, as extra products (i.e. by-products) lead to a reduction in the yield of the desired metabolite and an increase in capital and operating costs, particularly if the extra products have little or no value. These extra products also require additional capital and operating costs to separate these products from the desired metabolite.

[0212] In one aspect, the present application provides methods of producing a desired metabolite using a recombinant described herein. In one embodiment, the recombinant microorganism comprises a KARI-requiring biosynthetic pathway, wherein said recombinant microorganism comprises at least one nucleic acid molecule encoding a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In one embodiment, the KARI is derived from the genus Shewanella. In a specific embodiment, the KARI is derived from Shewanella sp. strain MR-4. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 1. In another embodiment, the KARI is derived from the genus Vibrio. In a specific embodiment, the KARI is derived from Vibrio fischeri. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 3. In yet another embodiment, the KARI is derived from the genus Gramella. In a specific embodiment, the KARI is derived from Gramella forsetii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 5. In yet another embodiment, the KARI is derived from the genus Cytophaga. In a specific embodiment, the KARI is derived from Cytophaga hutchinsonii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 7. In yet another embodiment, the KARI is derived from a genus selected from Lactococcus and Streptococcus. In a specific embodiment, the KARI is derived from Lactococcus lactis, Streptococcus equinus, or Streptococcus infantarius. In another specific embodiment, the KARI is encoded by SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25. In yet another embodiment, the KARI is derived from the genus Methanococcus. In a specific embodiment, the KARI is derived from Methanococcus maripaludis, Methanococcus vannielii, or Methanococcus voltae. In another specific embodiment, the KARI is encoded by SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, or SEQ ID NO: 37. In yet another embodiment, the KARI is derived from a genus selected from Zymomonas, Erythrobacter, Sphingomonas, Sphingobium, and Novosphingobium. In a specific embodiment, the KARI is derived from Zymomonas mobilis, Erythrobacter litoralis, Sphingomonas wittichii, Sphingobium japonicum, Sphingobium chlorophenolicum, or Novosphingobium nitrogenifigens. In another specific embodiment, the KARI is encoded by SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53. In yet another embodiment, the KARI is derived from the genus Bacteroides. In a specific embodiment, the KARI is derived from Bacteroides thetaiotaomicron. In another specific embodiment, the KARI is encoded by SEQ ID NO: 55. In yet another embodiment, the KARI is derived from the genus Schizosaccharomyces. In a specific embodiment, the KARI is derived from Schizosaccharomyces pombe or Schizosaccharomyces japonicus. In another specific embodiment, the KARI is encoded by SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61. In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2): (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

[0213] In another embodiment, the recombinant microorganism comprises a KARI-requiring biosynthetic pathway, wherein said recombinant microorganism comprises at least one nucleic acid molecule encoding a KARI that is at least about 99% identical to SEQ ID NO: 64. In one embodiment, the KARI is derived from the genus Salmonella. In a specific embodiment, the KARI is derived from Salmonella enterica. In another specific embodiment, the KARI is encoded by SEQ ID NO: 63. In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0214] In an exemplary embodiment, the KARI-requiring biosynthetic pathway is a pathway for the production of a metabolite selected from isobutanol, isoleucine, leucine, valine, pantothenate, coenzyme A, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. In a further exemplary embodiment, the beneficial metabolite is isobutanol.

[0215] In a method to produce a beneficial metabolite (e.g., isobutanol) from a carbon source, the recombinant microorganism is cultured in an appropriate culture medium containing a carbon source. In certain embodiments, the method further includes isolating the beneficial metabolite (e.g., isobutanol) from the culture medium. For example, a beneficial metabolite (e.g., isobutanol) may be isolated from the culture medium by any method known to those skilled in the art, such as distillation, pervaporation, or liquid-liquid extraction. In certain exemplary embodiments, the beneficial metabolite is selected from isobutanol, isoleucine, leucine, valine, pantothenate, coenzyme A, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. In a further exemplary embodiment, the beneficial metabolite is isobutanol.

[0216] In one embodiment, the recombinant microorganism may produce the beneficial metabolite (e.g., isobutanol) from a carbon source at a yield of at least 5 percent theoretical. In another embodiment, the microorganism may produce the beneficial metabolite (e.g., isobutanol) from a carbon source at a yield of at least about 10 percent, at least about 15 percent, about least about 20 percent, at least about 25 percent, at least about 30 percent, at least about 35 percent, at least about 40 percent, at least about 45 percent, at least about 50 percent, at least about 55 percent, at least about 60 percent, at least about 65 percent, at least about 70 percent, at least about 75 percent, at least about 80 percent, at least about 85 percent, at least about 90 percent, at least about 95 percent, or at least about 97.5% theoretical. In a specific embodiment, the beneficial metabolite is isobutanol.

Distillers Dried Grains Comprising Spent Yeast Biocatalysts

[0217] In an economic fermentation process, as many of the products of the fermentation as possible, including the co-products that contain biocatalyst cell material, should have value. Insoluble material produced during fermentations using grain feedstocks, like corn, is frequently sold as protein and vitamin rich animal feed called distillers dried grains (DDG). See, e.g., commonly owned and co-pending U.S. Publication No. 2009/0215137, which is herein incorporated by reference in its entirety for all purposes. As used herein, the term "DDG" generally refers to the solids remaining after a fermentation, usually consisting of unconsumed feedstock solids, remaining nutrients, protein, fiber, and oil, as well as spent yeast biocatalysts or cell debris therefrom that are recovered by further processing from the fermentation, usually by a solids separation step such as centrifugation.

[0218] Distillers dried grains may also include soluble residual material from the fermentation, or syrup, and are then referred to as "distillers dried grains and solubles" (DDGS). Use of DDG or DDGS as animal feed is an economical use of the spent biocatalyst following an industrial scale fermentation process.

[0219] Accordingly, in one aspect, the present invention provides an animal feed product comprised of DDG derived from a fermentation process for the production of a beneficial metabolite (e.g., isobutanol), wherein said DDG comprise a spent yeast biocatalyst of the present invention. In an exemplary embodiment, said spent yeast biocatalyst has been engineered to comprise at least one nucleic acid molecule encoding a KARI that is at least about 80% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 28, SEQ ID NO: 40, or SEQ ID NO: 58. In one embodiment, the KARI is derived from the genus Shewanella. In a specific embodiment, the KARI is derived from Shewanella sp. strain MR-4. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 1. In another embodiment, the KARI is derived from the genus Vibrio. In a specific embodiment, the KARI is derived from Vibrio fischeri. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 3. In yet another embodiment, the KARI is derived from the genus Gramella. In a specific embodiment, the KARI is derived from Gramella forsetii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 5. In yet another embodiment, the KARI is derived from the genus Cytophaga. In a specific embodiment, the KARI is derived from Cytophaga hutchinsonii. In another specific embodiment, the isolated nucleic acid molecule is comprised of SEQ ID NO: 7. In yet another embodiment, the KARI is derived from a genus selected from Lactococcus and Streptococcus. In a specific embodiment, the KARI is derived from Lactococcus lactis, Streptococcus equinus, or Streptococcus infantarius. In another specific embodiment, the KARI is encoded by SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25. In yet another embodiment, the KARI is derived from the genus Methanococcus. In a specific embodiment, the KARI is derived from Methanococcus maripaludis, Methanococcus vannielii, or Methanococcus voltae. In another specific embodiment, the KARI is encoded by SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, or SEQ ID NO: 37. In yet another embodiment, the KARI is derived from a genus selected from Zymomonas, Erythrobacter, Sphingomonas, Sphingobium, and Novosphingobium. In a specific embodiment, the KARI is derived from Zymomonas mobilis, Erythrobacter litoralis, Sphingomonas wittichii, Sphingobium japonicum, Sphingobium chlorophenolicum, or Novosphingobium nitrogenifigens. In another specific embodiment, the KARI is encoded by SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53. In yet another embodiment, the KARI is derived from the genus Bacteroides. In a specific embodiment, the KARI is derived from Bacteroides thetaiotaomicron. In another specific embodiment, the KARI is encoded by SEQ ID NO: 55. In yet another embodiment, the KARI is derived from the genus Schizosaccharomyces. In a specific embodiment, the KARI is derived from Schizosaccharomyces pombe or Schizosaccharomyces japonicus. In another specific embodiment, the KARI is encoded by SEQ ID NO: 57, SEQ ID NO: 59, or SEQ ID NO: 61. In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the Shewanella sp. KARI (SEQ ID NO: 2); (b) arginine 76 of the Shewanella sp. KARI (SEQ ID NO: 2); (c) serine 78 of the Shewanella sp. KARI; and (d) glutamine 110 of the Shewanella sp. KARI (SEQ ID NO: 2). In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10). In another exemplary embodiment, said spent yeast biocatalyst has been engineered to comprise at least one nucleic acid molecule encoding a KARI that is at least about 99% identical to SEQ ID NO: 64. In one embodiment, the KARI is derived from the genus Salmonella. In a specific embodiment, the KARI is derived from Salmonella enterica. In another specific embodiment, the KARI is encoded by SEQ ID NO: 63. In yet another embodiment, the KARI has one or more modifications or mutations at positions corresponding to amino acids selected from: (a) alanine 71 of the S. enterica KARI (SEQ ID NO: 64); (b) arginine 76 of the S. enterica KARI (SEQ ID NO: 64); (c) serine 78 of the S. enterica KARI (SEQ ID NO: 64); (d) glutamine 110 of the S. enterica KARI (SEQ ID NO: 64); (e) aspartic acid 146 of the S. enterica KARI (SEQ ID NO: 64); (f) glycine 185 of the S. enterica KARI (SEQ ID NO: 64); and (g) lysine 433 of the S. enterica KARI (SEQ ID NO: 64).

[0220] In certain additional embodiments, the DDG comprising a spent yeast biocatalyst of the present invention comprise at least one additional product selected from the group consisting of unconsumed feedstock solids, nutrients, proteins, fibers, and oils.

[0221] In another aspect, the present invention provides a method for producing DDG derived from a fermentation process using a yeast biocatalyst (e.g., a recombinant yeast microorganism of the present invention), said method comprising: (a) cultivating said yeast biocatalyst in a fermentation medium comprising at least one carbon source; (b) harvesting insoluble material derived from the fermentation process, said insoluble material comprising said yeast biocatalyst; and (c) drying said insoluble material comprising said yeast biocatalyst to produce the DDG.

[0222] In certain additional embodiments, the method further comprises step (d) of adding soluble residual material from the fermentation process to said DDG to produce DDGS. In some embodiments, said DDGS comprise at least one additional product selected from the group consisting of unconsumed feedstock solids, nutrients, proteins, fibers, and oils.

[0223] This invention is further illustrated by the following examples that should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the Figures and the Sequence Listing, are incorporated herein by reference for all purposes.

Example 1

Reduction of KARI Inhibition by 2,3-Dihydroxyisovalerate (DHIV)

[0224] The purpose of this example is to show how high-performance KARIs were identified.

Materials and Methods for Example 1

TABLE-US-00006 [0225] TABLE 2 Strain Used in Examples 1-2. GEVO3956 MATa ura3 leu2 his3 trp1 ald6::P.sub.ENO2- LI_adhA.sup.RE1 -P.sub.FBA1-Sc_TRP1 gpd1::T.sub.KI_URA3 gpd2::T.sub.KI_URA3 tma29::T.sub.KI_URA3 pdc1::P.sub.PDC1-LI_kivD2_coSc5-P.sub.FBA1- LEU2-T.sub.LEU2-P.sub.ADH1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1- LI_kivD2_coEc-P.sub.ENO2-Sp_HIS5 pdc5::T.sub.KI_URA3 pdc6::P.sub.TDH3-Sc_AFT1-P.sub.ENO2-LI_adhA.sup.RE1- T-.sub.KI_URA3_short-P.sub.FBA1-KI_URA3-T.sub.KI_URA3

TABLE-US-00007 TABLE 3 Plasmid Used in Example 1-2. pGV3009 P.sub.Sc_TEF1:LI_ilvD_coSc:T.sub.Sc_ADH1, P.sub.Sc_PDC1-350:EC_ilvC_coSc.sup.P2D1_A1_his6, P.sub.Sc_TPI1:G418.sup.R,P.sub.Sc_ENO2:LI_adhA.sup.RE1, CEN/ARS origin of replication, Ap.sup.R, pMB1 origin of replication

[0226] In this example, a series of KARI genes were individually expressed from a yeast promoter in conjunction with other components of an isobutanol production pathway in yeast such that KARI was the limiting enzyme in the pathway and the amount of isobutanol produced during a fermentation was dependent on the KARI activity level. In this system, the S. cerevisiae host strain GEV03956, which expresses ALS and KIVD enzymes, was used to produce isobutanol when supplied with a low copy number plasmid expressing KARI, DHAD, and ADH enzymes.

[0227] KARIs were identified and grouped by bioinformatic and phylogenetic methods based on the amino acid sequence. Individual KARIs were chosen for the above analysis to provide a representative sample of broadly diverse clades. KARI genes were designed and synthesized based on the primary amino acid sequence of the chosen KARI, with codon optimization of the genes for expression in S. cerevisiae. These genes were cloned downstream of the Sc_PDC1.sup.-350 promoter in pGV3009 to replace the Ec_IlvC_coSc.sup.P2D1-A1.sup.--.sup.his6 gene present in the plasmid.

[0228] Shake Flask Fermentations:

[0229] Shake flask fermentations using GEV03956 carrying these individual plasmids were performed together in experiments with GEV03956 carrying pGV3022 (derived from pGV3009 but containing the E. coli ilvC_coSc gene expressed from the Sc_PDC1.sup.-350 promoter) and GEV03956 carrying pGV3012 (equivalent to pGV3009 lacking the Sc_PDC1.sup.-350 promoter and KARI gene) for comparison of isobutanol production. The shake flask fermentations were performed as follows. The strains were grown overnight in 3 mL of YPD medium containing 1% v/v ethanol and 0.1 g/L G418 at 30.degree. C. and 250 rpm. The OD.sub.600 of these cultures was determined after overnight growth and the appropriate amount of culture was added to 50 mL of YP medium containing 5% w/v glucose, 1% v/v ethanol, 200 mM MES, pH 6.5, and 0.1 g/L G418 to obtain an OD.sub.600 of 0.1 in 250 mL baffled flasks with sleeve caps. Cultures were incubated at 30.degree. C. and 250 rpm overnight. The OD.sub.600 of these cultures was determined after overnight growth and the appropriate amount of culture to total 250 ODs was added to 50 mL Falcon tubes and centrifuged at 2700.times.g for 5 minutes. The supernatant was removed and cells were resuspended in 50 mL of YP medium containing 8% w/v glucose, 1% v/v ethanol, 200 mM MES, pH 6.5, and 0.1 g/L G418 to obtain a final OD.sub.600 of 5 OD per ml. At t=0 the OD.sub.600 of each flask was determined. The fermentation cultures were incubated at 30.degree. C. and 250 rpm in non-baffled 250 mL flasks with vented screw cap tops. After 24, 48 and 72 hours of incubation, 1.5 mL of culture was removed into 1.5 mL microcentrifuge tubes from each culture. OD.sub.600 values were determined from the samples and the remainder of each sample was centrifuged for 10 min at 14,000 rpm in a microcentrifuge and 1 mL of the supernatant was removed to be submitted for gas chromatographic analysis. Analysis of volatile organic compounds, including ethanol and isobutanol, was performed on an Agilent 6890 gas chromatograph (GC) fitted with a 7683B liquid autosampler, a split/splitless injector port, a ZB-FFAP column (Phenomenex 30 m length, 0.32 mm ID, 0.25 .mu.M film thickness) connected to a flame ionization detector (FID). The temperature program is as follows: 230.degree. C. for the injector, 300.degree. C. for the detector, 100.degree. C. oven for 1 minute, 35.degree. C./minute gradient to 230.degree. C., and then hold for 2.5 min. Analysis is performed using authentic standards (>98%, obtained from Sigma-Aldrich), and a 6-point calibration curve with 1-pentanol as the internal standard. Injection size is 0.5 .mu.L with a 50:1 split and run time is 7.4 min.

[0230] Results:

[0231] KARI gene clones resulting in isobutanol production equivalent to or higher than fermentations with pGV3022 or within two standard deviations below that of fermentations with pGV3022, averaged from multiple experiments, were chosen as encoding high-performing KARIs. These fermentations identified the following as high-performance KARIs: Shewanella sp. strain MR-4 (SEQ ID NO: 2), Vibrio fischeri strain ES114 (SEQ ID NO: 4), Gramella forsetii strain KT0803 (SEQ ID NO: 6), and Cytophaga hutchinsonii strain ATCC33406 (SEQ ID NO: 8). Table 4 shows the results of 48 hr and 72 hr isobutanol fermentation timepoints.

TABLE-US-00008 TABLE 4 Isobutanol Titers from Fermentations with High-Performance KARIs as compared to E. coli KARI. KARI Gene 48 h isobutanol 72 h isobutanol Expressed Titer (g/L) Titer (g/L) Shewanella sp. MR-4 4.01 .+-. 0.61 4.60 .+-. 0.53 Vibrio fischeri 4.27 .+-. 0.27 4.52 .+-. 0.30 Gramella forsetii 4.38 .+-. 0.69 4.45 .+-. 0.50 Cytophaga hutchinsonii 3.49 .+-. 0.20 4.26 .+-. 0.31 E. coli 3.93 .+-. 1.16 4.72 .+-. 0.90 (Mean of 3 experiments .+-. 2 standard deviations)

[0232] Each of these identified KARIs share the property of being long-form KARIs. Long-form KARIs are found in plants, algae, and some bacteria, while short-form KARIs are found in fungi and bacteria. The amino acid sequences of these high-performing bacterial long form KARIs were aligned with the sequences of 103 other KARIs representing broad biological diversity of KARIs chosen from the bioinformatic and phylogenetic analysis above and were used to generate a phylogenetic tree in Clone Manager using the "Align Multiple Sequences" feature to perform a Multi-Way alignment of the amino acid sequences using the BLOSUM62 scoring matrix and otherwise default parameters. This analysis identified the Shewanella sp., Vibrio fischeri, Gramella forsetii, Cytophaga hutchinsonii, and E. coli KARIs as all belonging to a distinct clade of closely related bacterial long-form KARIs (see FIG. 2 of U.S. Provisional Application No. 506,562, which is herein incorporated by reference). A separate clade of bacterial long form KARIs contained KARIs from the symbiotic bacteria Buchnera aphidicola and Candidatus blochmannia species.

[0233] The Shewanella sp. KARI sequence amino acid sequence (SEQ ID NO: 2) was used to identify the 500 closest protein sequences in the GenBank database using the blastp algorithm on the non-redundant protein sequence database using the default parameters. The COBALT Multiple Alignment link from the BLAST results page was used to perform a multiple alignment of the 500 closest protein sequences plus the Shewanella sp. KARI sequence (SEQ ID NO: 2) using the default parameters. This alignment was downloaded as a "Fasta plus gaps" file and opened with the Clone Manager "Align Multiple Sequences" feature to perform a Multi-Way alignment of the amino acid sequences using the BLOSUM62 scoring matrix and otherwise default parameters to generate a phylogenetic tree of the sequences.

[0234] KARI sequences representing the major clades of this tree were chosen and used to generate a representative subset phylogenetic tree. The resulting subset phylogenetic tree showed a clade of proteins sequences containing the Shewanella sp., Vibrio fischeri, Gramella forsetii, Cytophaga hutchinsonii, and E. coli KARIs and KARIs that were closely related to those sequences (see FIG. 3 of U.S. Provisional Application No. 506,562, which is herein incorporated by reference). Each of the Shewanella sp., Vibrio fischeri, Gramella forsetii, Cytophaga hutchinsonii, and E. coli KARIs were in a separate subclade in this tree, indicating that high-performing KARIs for isobutanol production in yeast can be found throughout this overall clade of long-form bacterial KARIs.

Example 2

[0235] The purpose of this example is to show how additional high-performance KARIs were identified.

[0236] In this example, a series of KARI genes were individually expressed from a yeast promoter in conjunction with other components of an isobutanol production pathway in yeast such that KARI was the limiting enzyme in the pathway and the amount of isobutanol produced during a fermentation was dependent on the KARI activity level. In this system, the S. cerevisiae host strain GEV03956, which expresses ALS and KIVD enzymes, was used to produce isobutanol when supplied with a low copy number plasmid expressing KARI, DHAD, and ADH enzymes.

[0237] KARIs were identified and grouped by bioinformatic and phylogenetic methods based on the amino acid sequence. Individual KARIs were chosen for the above analysis to provide a representative sample of broadly diverse clades. KARI genes were designed and synthesized based on the primary amino acid sequence of the chosen KARI, with codon optimization of the genes for expression in S. cerevisiae. These genes were cloned downstream of the Sc_PDC1.sup.-350 promoter in pGV3009 to replace the Ec_IlvC_coSc.sup.P2D-A1.sup.--.sup.his6 gene present in the plasmid.

[0238] Shake Flask Fermentations:

[0239] Shake flask fermentations using GEV03956 carrying these individual plasmids were performed together in experiments with GEV03956 carrying pGV3022 (derived from pGV3009 but containing the E. coli ilvC_coSc gene expressed from the Sc_PDC1.sup.-350 promoter) and GEV03956 carrying pGV3012 (equivalent to pGV3009 lacking the Sc_PDC1.sup.-350 promoter and KARI gene) for comparison of isobutanol production. The shake flask fermentations were performed as follows. The strains were grown overnight in 3 mL of YPD medium containing 1% v/v ethanol and 0.1 g/L G418 at 30.degree. C. and 250 rpm. The OD.sub.600 of these cultures was determined after overnight growth and the appropriate amount of culture was added to 50 mL of YP medium containing 5% w/v glucose, 1% v/v ethanol, 200 mM MES, pH 6.5, and 0.1 g/L G418 to obtain an OD.sub.600 of 0.1 in 250 mL baffled flasks with sleeve caps. Cultures were incubated at 30.degree. C. and 250 rpm overnight. The OD.sub.600 of these cultures was determined after overnight growth and the appropriate amount of culture to total 250 ODs was added to 50 mL Falcon tubes and centrifuged at 2700.times.g for 5 minutes. The supernatant was removed and cells were resuspended in 50 mL of YP medium containing 8% w/v glucose, 1% v/v ethanol, 200 mM MES, pH 6.5, and 0.1 g/L G418 to obtain a final OD.sub.600 of 5 OD per ml. At t=0 the OD.sub.600 of each flask was determined. The fermentation cultures were incubated at 30.degree. C. and 250 rpm in non-baffled 250 mL flasks with vented screw cap tops. After 24, 48 and 72 hours of incubation, 1.5 mL of culture was removed into 1.5 mL microcentrifuge tubes from each culture. OD.sub.600 values were determined from the samples and the remainder of each sample was centrifuged for 10 min at 14,000 rpm in a microcentrifuge and 1 mL of the supernatant was removed to be submitted for gas chromatographic analysis. Analysis of volatile organic compounds, including ethanol and isobutanol, was performed on an Agilent 6890 gas chromatograph (GC) fitted with a 7683B liquid autosampler, a split/splitless injector port, a ZB-FFAP column (Phenomenex 30 m length, 0.32 mm ID, 0.25 .mu.M film thickness) connected to a flame ionization detector (FID). The temperature program is as follows: 230.degree. C. for the injector, 300.degree. C. for the detector, 100.degree. C. oven for 1 minute, 35.degree. C./minute gradient to 230.degree. C., and then hold for 2.5 min. Analysis is performed using authentic standards (>98%, obtained from Sigma-Aldrich), and a 6-point calibration curve with 1-pentanol as the internal standard. Injection size is 0.5 .mu.L with a 50:1 split and run time is 7.4 min.

[0240] Results:

[0241] KARI gene clones resulting in isobutanol production equivalent to or higher than fermentations with pGV3022 or within two standard deviations below that of fermentations with pGV3022, averaged from multiple experiments, were chosen as encoding high-performing KARIs. These fermentations identified the following as high-performance KARIs: Lactococcus lactis strain KF147 (SEQ ID NO: 10), Methanococcus maripaludis strain C5 (SEQ ID NO: 28), Zymomonas mobilis strains ZM4, ATCC10988, and NCIMB 11163 (SEQ ID NO: 40), Bacteroides thetaiotaomicron strain VPI-5482 (SEQ ID NO: 56), and Schizosaccharomyces pombe strain ATCC33406 (SEQ ID NO: 58). Table 5 shows the results of 48 hr and 72 hr isobutanol fermentation timepoints.

TABLE-US-00009 TABLE 5 Isobutanol Titers from Fermentations with High-Performance KARIs as compared to E. coli KARI. KARI Gene 48 h Isobutanol 72 h Isobutanol Expressed Titer (g/L) Titer (g/L) Lactococcus lactis 5.68 .+-. 0.90 6.21 .+-. 0.62 Methanococcus maripaludis 4.03 .+-. 0.18 4.70 .+-. 0.18 Zymomonas mobilis 4.00 .+-. 0.32 4.67 .+-. 0.24 Bacteroides thetaotaomicron 3.21 .+-. 0.03 4.07 .+-. 0.01 Schizosaccharomyces pombe 3.33 .+-. 0.30 3.89 .+-. 0.23 (.DELTA.54tr)* E. coli 3.93 .+-. 1.16 4.72 .+-. 0.90 (Mean of 3 experiments .+-. 2 standard deviations) *Truncated by removal of first 54 AA encoding MTS (SEQ ID NO: 90).

[0242] Each of these identified KARIs share the property of being short-form KARIs. Short-form KARIs are found in fungi and bacteria, while long-form KARIs are found in plants, algae, and some bacteria. An additional 21 short-form KARIs tested did not meet the yeast isobutanol fermentation criteria in the above experiments.

[0243] The Lactococcus lactis, Methanococcus maripaludis, and Zymomonas mobilis KARIs were also identified as performing as well or better than the E. coli KARI in shake flask fermentations when expressed from a high copy number plasmid. Genes encoding these KARIs were cloned downstream of a Sc_TDH3 promoter to replace the Ec_ilvC_coSc.sup.P2D1-A1.sup.--.sup.his6 gene present in that plasmid.

[0244] Shake flask fermentations of GEVO3956 carrying these individual plasmids were performed together with GEVO3956 carrying pGV2911 (derived from pGV2901 but containing the E. coli ilvC_coSc gene expressed from the Sc_TDH3 promoter) for comparison of isobutanol production. The shake flask fermentations were performed as follows. The strains were grown overnight in 3 mL of YPD medium containing 1% v/v ethanol and 0.1 g/L G418 at 30.degree. C. and 250 rpm. The OD.sub.600 of these cultures was determined after overnight growth and the appropriate amount of culture was added to 50 mL of YP medium containing 5% w/v glucose, 1% v/v ethanol, 200 mM MES, pH 6.5, and 0.1 g/L G418 to obtain an OD.sub.600 of 0.1 in 250 mL baffled flasks with sleeve caps. Cultures were incubated at 30.degree. C. and 250 rpm overnight. The OD.sub.600 of these cultures was determined after overnight growth and the appropriate amount of culture to total 250 ODs was added to 50 mL Falcon tubes and centrifuged at 2700.times.g for 5 minutes. The supernatant was removed and cells were resuspended in 50 mL of YP medium containing 8% w/v glucose, 1% v/v of a stock of 3 g/L ergosterol and 132 g/L Tween 80 dissolved in ethanol, 200 mM MES, pH 6.5, and 0.2 g/L G418 to obtain a final OD.sub.600 of 5 OD per ml. At t=0 the OD.sub.600 of each flask was determined. The fermentation cultures were incubated at 30.degree. C. and 250 rpm in non-baffled 250 mL flasks with vented screw cap tops. After 24, 46-48 and 72 hours of incubation, 1.5 mL of culture was removed into 1.5 mL microcentrifuge tubes from each culture. OD.sub.600 values were determined from the samples and the remainder of each sample was centrifuged for 10 min at 14,000 rpm in a microcentrifuge and 1 mL of the supernatant was removed to be submitted for gas chromatographic analysis. Analysis of volatile organic compounds, including ethanol and isobutanol, was performed on an Agilent 6890 gas chromatograph (GC) fitted with a 7683B liquid autosampler, a split/splitless injector port, a ZB-FFAP column (Phenomenex 30 m length, 0.32 mm ID, 0.25 .mu.M film thickness) connected to a flame ionization detector (FID). The temperature program is as follows: 230.degree. C. for the injector, 300.degree. C. for the detector, 100.degree. C. oven for 1 minute, 35.degree. C./minute gradient to 230.degree. C., and then hold for 2.5 min. Analysis is performed using authentic standards (>98%, obtained from Sigma-Aldrich), and a 6-point calibration curve with 1-pentanol as the internal standard. Injection size is 0.5 .mu.L with a 50:1 split and run time is 7.4 min.

[0245] The M. maripaludis, Z. mobilis, and L. lactis KARIs, expressed from plasmids in GEV03956, resulted in isobutanol titers within two standard deviations of that produced from pGV2911 in GEV03956 at both the 48 hour and 72 hour fermentation time points (Tables 6 and 7).

TABLE-US-00010 TABLE 6 Isobutanol titers from isobutanol fermentations with the M. maripaludis and Z. mobilis KARIs versus the E. coli KARI expressed from high copy number plasmids. KARI Gene 48 h Isobutanol 72 h Isobutanol Expressed Titer (g/L) Titer (g/L) M. maripaludis 11.26 .+-. 0.84 12.60 .+-. 1.08 Z. mobilis 11.47 .+-. 0.07 13.13 .+-. 0.02 E. coli 12.34 .+-. 1.06 13.61 .+-. 1.06 (Mean of 3 experiments .+-. 2 standard deviations)

TABLE-US-00011 TABLE 7 Isobutanol titers from isobutanol fermentations with the L. lactis KARI versus the E. coli KARI expressed from high copy number plasmids. KARI Gene 48 h Isobutanol 72 h Isobutanol Expressed Titer (g/L) Titer (g/L) L. lactis 7.25 .+-. 0.88 14.51 .+-. 2.16 E. coli 7.39 .+-. 2.64 13.54 .+-. 4.54 (Mean of 3 experiments .+-. 2 standard deviations)

[0246] The L. lactis, M. maripaludis, Z. mobilis, B. thetaiotaomicron, and S. pombe KARI amino acid sequences were used to identify the closest protein sequences in the GenBank database using the blastp algorithm on the non-redundant protein sequence database using the default parameters. Table 8 discloses KARI sequences that have .gtoreq.80% amino acid identity with the L. lactis, M. maripaludis, Z. mobilis, or S. pombe KARIs.

TABLE-US-00012 TABLE 8 KARI sequences having .gtoreq. 80% amino acid identity with the L. lactis, M. maripaludis, Z. mobilis, or S. pombe KARIs. Reference Sequence Origin SEQ ID NO: L. lactis subsp. lactis L. lactis subsp. lactis II1430 12 KF147 L. lactis subsp. lactis CV56 14 (SEQ ID NO: 10) L. lactis subsp. cremoris MG1363 16 L. lactis subsp. cremoris NZ9000 18 L. lactis subsp. cremoris SK11 20 L. lactis subsp. lactis NCDO2118 22 S. equinus ATCC 9812 24 S. infantarius subsp. infantarius 26 ATCC BAA-102 M. maripaludis M. maripaludis C7 30 strain C5 M. maripaludis C6 32 (SEQ ID NO: 28) M. maripaludis S2 34 M. vannielii SB 36 M. voltae A3 38 Z. mobilis strain Erythrobacter sp. NAP1 42 ZM4 Sphingomonas wittichii RW1 44 (SEQ ID NO: 40) Sphingobium japonicum UT26S 46 Erythrobacter litoralis HTCC2594 48 Sphingobium chlorophenolicum L-1 50 Sphingomonas sp. S17 52 Novosphingobium nitrogenifigens 54 DSM 19370 S. pombe strain S. pombe PR745 60 972 h-* (Fuii Length: S. japonicus yFS275 62 SEQ ID NO: 58)

[0247] A phylogenetic tree that discloses the database identification numbers of 50 KARI sequences that have 278% amino acid identity with the B. thetaiotaomicron KARI and their phylogenetic relationship with the B. thetaiotaomicron KARI was generated (see FIG. 2 of U.S. Provisional Application No. 506,564, which is herein incorporated by reference).

[0248] The alignments of the B. thetaiotaomicron KARI protein with 42 closely related KARIs (85-97% amino acid sequence identity in aligned regions) from other Bacteroides strains and species indicates that the N-terminal 12 amino acids of the B. thetaiotaomicron KARI are not conserved and are missing from these related proteins. There is no clearly identifiable ribosome binding site with appropriate spacing upstream of either the annotated start codon of the B. thetaiotaomicron KARI gene sequence annotated from the B. thetaiotaomicron genome sequence project (NCBI reference sequence NC.sub.--004663) or the methionine codon for amino acid position 13 of the annotated protein (nucleotide positions 2600124-2600122 from NCBI reference sequence NC.sub.--004663). As such it is difficult to determine whether the start codon in B. thetaiotaomicron is at the annotated position (nucleotides 2600160-2600158 from NCBI reference sequence NC.sub.--004663) or at the methionine codon for amino acid position 13 of the annotated protein (nucleotide positions 2600124-2600122 from NCBI reference sequence NC.sub.--004663). Based on these analyses, a version of the B. thetaiotaomicron KARI lacking the N-terminal 12 amino acids of the annotated protein may function as well or better for isobutanol production in yeast compared with performance of the B. thetaiotaomicron KARI. Such a protein would have the sequence of SEQ ID NO: 88.

Example 3

Cofactor Switch of the L. lactis KARI

[0249] The purpose of this example is to demonstrate how the cofactor specificity of the L. lactis KARI can be switched from NADPH to NADH.

[0250] Similar to all known native KARI enzymes, the L. lactis KARI is NADPH-dependent. To enable the enzyme's use in the production of isobutanol at theoretical yield and/or under anaerobic conditions, the enzyme's cofactor usage was switched from NADPH to NADH.

Materials and Methods for Example 3

TABLE-US-00013 [0251] TABLE 9 Strains Used in Example 3. Strain Genotype/Source E. coli F.sup.- ompT gal dcm lon hsdS.sub.B(r.sub.B.sup.-m.sub.B.sup.-) .lamda. (DE3 BL21 (DE3) [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]

TABLE-US-00014 TABLE 10 Plasmids Used in Example 3. Plasmid Genotype pET22b(+) PT7, bla, ori pBR322, lacI, C-term 6xHis pET[ilvC] PT7::Ec_ilvC_coEc.sup.his6, bla, oripBR322, lacI pGV3281 PT7::LI_KARI_coSc.sup.his6, bla, oripBR322, lacI pETLI1A9 PT7::LI_KARI.sup.1A9_coSc.sup.his6, bla, opripBR322, lacI pETLI1G2 PT7::LI_KARI.sup.1G2_coSc.sup.his6, bla, oripBR322, lacI pETLI1C2 PT7::LI_KARI.sup.1C2_coSc.sup.his6, bla, oripBR322, lacI pETLI1G5 PT7::LI_KARI.sup.1G5_coSc.sup.his6, bla, oripBR322, lacI pETLI4H8 PT7::LI_KARI.sup.4H8_coSc.sup.his6, bla, oripBR322, lacI pETLI3C7 PT7::LI_KARI.sup.3C7_coSc.sup.his6, bla, oripBR322, lacI pETLINKRGen6a PT7::LI_NKR.sup.Gen6a_coSc.sup.his6, bla, oripBR322, lacI pETLINKRGen6b PT7::LI_NKR.sup.Gen6b_coSc.sup.his6, bla, oripBR322, lacI

TABLE-US-00015 TABLE 11 Primers Used in Example 3. # Primer name Sequence 1 T7_for TAATACGACTCACTATAGGG (SEQ ID NO: 91) 2 T7_rev GCTAGTTATTGCTCAGCGG (SEQ ID NO: 92) 3 LIKARI_Y26NNK_for ATCGCCGTTATTGGANNKGG TTCACAAGGACATGCCCATG (SEQ ID NO: 93) 4 LIKARI_Y26NNK_rev CATGGGCATGTCCTTGTGAA CCMNNTCCAATAACGGCGAT (SEQ ID NO: 94) 5 LIKARI_V48NNK_for CAATGTTATCATTGGTNNKA GGCACGGAAAATCTTTTGAT (SEQ ID NO: 95) 6 LIKARI_V48NNK_rev ATCAAAAGATTTTCCGTGCC TMNNACCAATGATAACATTG (SEQ ID NO: 96) 7 LIKARI_R49NNK_for GTTATCATTGGTGTANNKCA CGGAAAATCTTTTG (SEQ ID NO: 97) 8 LIKARI_R49NNK_rev CAAAAGATTTTCCGTGMNNT ACACCAATGATAAC (SEQ ID NO: 98) 9 LIKARI_G51NNK_for ATTGGTGTAAGGCACNNKAA ATCTTTTGATAAAGCTAAG (SEQ ID NO: 99) 10 LIKARI_G51NNK_rev CTTAGCTTTATCAAAAGATTT MNNGTGCCTTACACCAAT (SEQ ID NO: 100) 11 LIKARI_K52NNK_for GGTGTAAGGCACGGANNKTC TTTTGATAAAGCTAAGGAA (SEQ ID NO: 101) 12 LIKARI_K52NNK_rev TTCCTTAGCTTTATCAAAAG AMNNTCCGTGCCTTACACC (SEQ ID NO: 102) 13 LIKARI_S53NNK_for GTGTAAGGCACGGAAAANNK TTTGATAAAGCTAAGGA (SEQ ID NO: 103) 14 LIKARI_S53NNK_rev TCCTTAGCTTTATCAAAMNN TTTTCCGTGCCTTACAC (SEQ ID NO: 104) 15 LIKARI_L85NNK_for TTTGGCACCAGATGAGNNKC AACAATCCATATACGAG (SEQ ID NO: 105) 16 LIKARI_L85NNK_rev CTCGTATATGGATTGTTGMN NCTCATCTGGTGCCAM (SEQ ID NO: 106) 17 LIKARI_I89NNK_for GAGTTGCAACAATCCNNKTA CGAGGAGGATATCAAGCCT (SEQ ID NO: 107) 18 LIKARI_I89NNK_rev AGGCTTGATATCCTCCTCGT AMNNGGATTGTTGCAACTC (SEQ ID NO: 108) 19 LI_recomb_1a_for GGGCACAATGTTATCATTGG TSYACBACACGGAMWATCTT TTGATAAAGCTAAGGAAG (SEQ ID NO: 109) 20 LI_recomb_1b_for GGGCACAATGTTATCATTGG TSYAGTGCACGGAMWATCTT TTGATAAAGCTAAGGAAG (SEQ ID NO: 110) 21 LI_recomb_1c_for GGGCACAATGTTATCATTGG TSYATCGCACGGAMWATCTT TTGATAAAGCTAAGGAAG (SEQ ID NO: 111) 22 LI_recomb_1a_rev CTTCCTTAGCTTTATCAAAA GATWKTCCGTGTVGTRSAC CAATGATAACATTGTGCCC (SEQ ID NO: 112) 23 LI_recomb_1b_rev CTTCCTTAGCTTTATCAAAA GATWKTCCGTGCACTRSACC AATGATAACATTGTGCCC (SEQ ID NO: 113) 24 LI_recomb_1c_rev CTTCCTTAGCTTTATCAAAA GATWKTCCGTGCGATRSACC AATGATAACATTGTGCCC (SEQ ID NO: 114) 25 LI_recomb_2a_for GGCACCAGATGAGRCACAAC AATCCATATACGAGGAGGAT ATCAAGCC (SEQ ID NO: 115) 26 LI_recomb_2b_for GGCACCAGATGAGRCACAAC AATCCGCATACGAGGAGGAT ATCAAGCC (SEQ ID NO: 116) 27 LI_recomb_2c_for GGCACCAGATGAGTTGCAAC AATCCATATACGAGGAGGAT ATCAAGCC (SEQ ID NO: 117) 28 LI_recomb_2d_for GGCACCAGATGAGTTGCAAC AATCCGCATACGAGGAGGAT ATCAAGCC (SEQ ID NO: 118) 29 LI_recornb_2a_rev GGCTTGATATCCTCCTCGTA TATGGATTGTTGTGYCTCAT CTGGTGCC (SEQ ID NO: 119) 30 LI_recomb_2b_rev GGCTTGATATCCTCCTCGTA TGCGGATTGTTGTGYCTCAT CTGGTGCC (SEQ ID NO: 120) 31 LI_recomb_2c_rev GGCTTGATATCCTCCTCGTA TATGGATTGTTGCAACTCAT CTGGTGCC (SEQ ID NO: 121) 32 LI_recomb_2d_rev GGCTTGATATCCTCCTCGTA TGCGGATTGTTGCAACTCAT CTGGTGCC (SEQ ID NO: 122) 33 LI_recomb_3KS_for CACGGAAAATCTTTTGATAA AGCTAAGGAA (SEQ ID NO: 123) 34 LI_recomb_3LS_for CACGGACTATCTTTTGATAA AGCTAAGGAA (SEQ ID NO: 124) 35 LI_recomb_3KD_for CACGGAAAAGATTTTGATAA AGCTAAGGAA (SEQ ID NO: 125) 36 LI_recomb_3LD_for CACGGACTAGATTTTGATAA AGCTAAGGAA (SEQ ID NO: 126) 37 LI_recomb_3KS_rev TTCCTTAGCTTTATCAAAAG ATTTTCCGTG (SEQ ID NO: 127) 38 LI_recomb_3LS_rev TTCCTTAGCTTTATCAAAAG ATAGTCCGTG (SEQ ID NO: 128) 39 LI_recomb_3KD_rev TTCCTTAGCTTTATCAAAAT CTTTTCCGTG (SEQ ID NO: 129) 40 LI_recomb_3LD_rev TTCCTTAGCTTTATCAAAAT CTAGTCCGTG (SEQ ID NO: 130) 41 LI_K52NNkS53NNK_for GGTCTACCACACGGANNKNN KTTTGATAAAGCTAAG (SEQ ID NO: 131) 42 LI_K52NNkS53NNK_rev CTTAGCTTTATCAAAMNNMN NTCCGTGTGGTAGACC (SEQ ID NO: 132) 43 E59K_recomb_rev AAAAGTTTCGAATCCATCTT YCTTAGCTTTATC (SEQ ID NO: 133) 44 E59K_recomb_for GATAAAGCTAAGRAAGATGG ATTCGAAACTTTT (SEQ ID NO: 134) 45 A70V_recomb_rev ATCTGCCTTAGCTACTRCTT CACCTACTTCAAA (SEQ ID NO: 135) 46 A70V_recomb_for TTTGAAGTAGGTGAAGYAGT AGCTAAGGCAGAT (SEQ ID NO: 136) 47 K118E/D122G_recomb_for GGATACATCRAAGTCCCAGA GGRCGTGGACGTGTTTATG (SEQ ID NO: 137) 48 K118E/D122G_recomb_rev CATAAACACGTCCACGYCCT CTGGGACTTYGATGTATCC (SEQ ID NO: 138) 49 H135L_recomb_rev GGTCCTTCTAACAAGGWGGC CTGGTGCTTTTGG (SEQ ID NO: 139) 50 H135L_recomb_for CCAAAAGCACCAGGCCWCCT TGTTAGAAGGACC (SEQ ID NO: 140) 51 T182S_recomb_rev CTCTTCCTTGAAAGTGSTTT CAATGATGCCGAC (SEQ ID NO: 141) 52 T182S_recomb_for GTCGGCATCATTGAAASCAC TTTCAAGGAAGAG (SEQ ID NO: 142) 53 E320K_recomb_rev CATAGCTTGTCTAAGTTYTG CCCCTATCTTTTC (SEQ ID NO: 143) 54 E320K_recomb_for GAAAAGATAGGGGCARAACT TAGACAAGCTATG (SEQ ID NO: 144) * A (Adenine), G (Guanine), C (Cytosine), T (Thymine), R (Purine - A or G), Y (Pyrimidine - C or T), N (Any nucleotide), S (Strong - G or C), M (Amino - A or C), K (Keto - G or T), B (Not A - C, G, or T), W (Weak - A or T), V (Not T - A, C, or G)

[0252] Heterologous Expression of Wild-Type L. lactis KARI in E. coli:

[0253] Expression of wild-type L. lactis KARI was conducted in a 2-L baffled Erlenmeyer flask filled with 1 L LB.sub.amp (Luria Bertani Broth, Research Products International Corp, supplemented with 100 .mu.g/mL ampicillin) inoculated with overnight culture to an initial OD.sub.600 of 0.1. After growing the expression culture at 37.degree. C. with shaking at 250 rpm for 4 h, the cultivation temperature was dropped to 25.degree. C., and KARI expression was induced with IPTG to a final concentration of 0.5 mM. After 24 h at 25.degree. C. and shaking at 250 rpm, the cells were pelleted at 5,300 g for 10 min and then frozen at -20.degree. C. until further use.

[0254] Heterologous Expression of L. lactis KARI Variants in E. coli:

[0255] The expression of L. lactis KARI variants was conducted in 0.25-L Erlenmeyer flasks filled with 50 mL LB.sub.amp (Luria Bertani Broth, Research Products International Corp, supplemented with 100 .mu.g/mL ampicillin) inoculated with overnight culture to an initial OD.sub.600 of 0.1. After growing the expression cultures at 37.degree. C. with shaking at 250 rpm for 4 h, the cultivation temperature was dropped to 25.degree. C., and KARI expression was induced with IPTG to a final concentration of 0.5 mM. After 24 h at 25.degree. C. and shaking at 250 rpm, the cells were pelleted at 5,300 g for 10 min and then frozen at -20.degree. C. until further use.

[0256] Histrap Purification of L. lactis KARI: L. lactis KARI was purified over a 5-mL histrap column.

[0257] Histrap Purification of L. lactis KARI Variants:

[0258] L. lactis KARI variants were purified over 1-mL histrap columns.

[0259] Preparation of Enantiopure (S)-2-Acetolactate:

[0260] Enzymatic synthesis of (S)-2-acetolactate was performed in an anaerobic flask. The reaction was carried out in a total volume of 55 mL containing 20 mM potassium phosphate buffer, pH 7.0, 1 mM MgCl.sub.2, 0.05 mM thiamine pyrophosphate (TPP), and 200 mM sodium pyruvate. The synthesis was initiated by the addition of 65 units of purified B. subtilis acetolactate synthase (Bs_AlsS), and the reaction was incubated at 30.degree. C. (in a static incubator) for 7.5 hours. A buffer exchange was performed on the purified Bs_AlsS before the synthesis to remove as much glycerol as possible. This was done using a microcon filter with a 50 kDa nominal molecular weight cutoff membrane to filter 0.5 mL of the purified enzyme until only 50 .mu.L were left on top of the membrane. 450 .mu.L of 20 mM KPO.sub.4 pH 7.0, 1 mM MgCl.sub.2, and 0.05 mM TPP were then added to the membrane and filtered again; this process was repeated three times. The final acetolactate concentration was determined by liquid chromatography and was .about.200 mM.

[0261] KARI Assay in 1-mL Scale to Measure NADPH and NADH K.sub.M Values:

[0262] L. lactis KARI activity or activities of its variants were assayed kinetically by monitoring the decrease in NADPH or NADH concentration by measuring the change in absorbance at 340 nm. An assay buffer was prepared containing 100 mM potassium phosphate pH 7.0, 1 mM DTT. 2.5 mM (S)-2-acetolactate, and 10 mM MgCl.sub.2 (final concentrations in the 1-mL assay, accounting for dilution with enzyme and cofactor). Fifty .mu.L purified enzyme and 930 .mu.L of the assay buffer were placed into a 1-mL cuvette. The reaction was initiated by addition of 20 .mu.L NADPH or NADH (200 .mu.M final concentration) for a general activity assay. Michaelis-Menten constants of the cofactors were determined with varying concentrations of NADPH (500--12 .mu.M final) or NADH (200--6 .mu.M final).

[0263] Construction of Site-Saturation Libraries (Generation 1):

[0264] One-site site-saturation libraries (with NNK codons) were constructed using standard SOE PCR with Phusion polymerase, pGV3281 as template, and respective primer pairs #1-18. The fragments were DpnI digested for 1 h, separated on an agarose gel, freeze'n'squeeze (BIORAD) treated, and finally precipitated with pellet paint (Novagen). The clean fragments served as templates for the assembly PCRs using commercial T7 forward and reverse primers (primers #1 and 2) as flanking primers. After successful assembly, the insert was restriction digested with NdeI and XhoI, ligated into pET22b(+), and electro-competent BL21(D3) cells (Lucigen) were transformed.

[0265] Construction of Recombination Library (Generation 2):

[0266] The recombination library was constructed using SOE PCR introducing mutations found at eight target sites while allowing for the respective wild-type residues as well. We generated four fragments using pGV3281 as template and primers #1, 2, and 19-32. Primers 19 through 21, 22-24, 25-28, and 29-32 were mixed manually to give equimolar distributions of the codons they contained. The fragments were DpnI digested for 1 h at 37.degree. C., separated on an agarose gel, freeze'n'squeezed (BIORAD) and finally pellet painted (Novagen). The fragments served as templates in the assembly PCR using commercial T7 forward and reverse primers as flanking primers. The purified assembly product (Zymo clean up) was restriction digested with NdeI and XhoI, ligated into pET22b(+), and electro-competent BL21(D3) cells (Lucigen) were transformed. Although the S53D mutation had not been identified as beneficial in our NNK libraries, it was included in the recombination library (=library 2). An assembly product of the recombination library described above was used to introduce S53D via SOE PCR using primer pairs 33-40 (Table 11). The forward and reverse primers were mixed manually as described above. The resulting fragments were gel purified and used as templates for the assembly PCR with flanking T7 primers. The resulting assembly PCR product was treated as described above.

[0267] Construction of Double NNK Library (K52NNKS53NNK) (Generation 3):

[0268] The double NNK library was constructed via SOE PCR using construct pETLI1G2 as template and primers #1 and 2, and 41 and 42. The construction of the library was as described above (site-saturation library). 2,800 colonies were picked for screening.

[0269] High-Throughput Expression of L. lactis KARI Variants in E. coli:

[0270] For growth and expression of KARI variants in deep well plates, sterile toothpicks were used to pick single colonies into shallow 96-well plates filled with 300 .mu.L LB.sub.amp. Fifty .mu.L of these overnight cultures were used to inoculate deep well plates filled with 600 .mu.L of LB.sub.amp per well. The plates were grown at 37.degree. C. with shaking at 250 rpm for 3 h. One hour before induction with IPTG (final concentration 0.5 mM), the temperature of the incubator was reduced to 25.degree. C. After induction, growth and expression continued for 20 h at 25.degree. C. and 250 rpm. Cells were harvested at 5.300 g and 4.degree. C. and then stored at -20.degree. C. The plates always contained four wild-type or parent L. lactis KARI colonies, three BL21(DE3) colonies carrying pET22b(+) to control for background reactions in cell lysates, and one well that contained only media to make sure the plates were free of contaminations.

[0271] High-Throughput Screening:

[0272] Frozen cell pellets were thawed at room temperature for 20 min and then 200 .mu.L of lysis buffer (100 mM Kpi, 750 mg/L lysozyme, 10 mg/L DNaseI, pH 7) were added. Plates were vortexed to resuspend the cell pellets. After a 60 min incubation phase at 37.degree. C. and shaking at 130 rpm, plates were centrifuged at 5,300 g and 4.degree. C. for 10 min. Forty .mu.L of the resulting crude extracts were transferred into assay plates (flat bottom, Rainin) using a liquid handling robot. Twenty mL assay buffer per plate were prepared (100 mM Kpi, pH 7, 2.5 mM (S)-2-acetolactate, 1 mM DTT, 200 .mu.M NADPH or NADH, and 10 mM MgCl.sub.2) and 160 .mu.L thereof were added to each well to start the reaction resulting in a 20% dilution of the ingredients. The depletion of NAD(P)H was monitored at 340 nm in a plate reader (TECAN) over 200 s.

[0273] Results:

[0274] The residues chosen to test by site-saturation mutagenesis were Y25, V48, R49, G51, S53, L85, and 189 of the L. lactis KARI (SEQ ID NO: 2). Site-saturation libraries were constructed as described in the materials and method section. After successful transformation of BL21(DE3) cells, 88 individual clones per library were chosen. The libraries were screened with NADH (not NADPH) as cofactor. Screening results are summarized in Table 12.

TABLE-US-00016 TABLE 12 Exemplary Variants of Generation 1 NNK Libraries. L. lactic Beneficial % improvement KARI Sites Mutations over parent Y25 none n/a V48 P 73% V 44% L 80% R49 S 67% P 60% G51 none n/a K52 L 24% S53 none n/a L85 T 61% A 61% I89 A 43%

[0275] No improved variants were found in libraries harboring Y25, G51, and S53 mutations.

[0276] Recombination Libraries:

[0277] Generation 2: A recombination library introducing all mutations found at each site (Table 12) was constructed and also allowing for the wild-type residues as well using pGV3281 as template and primers #19-40. In addition, the S53D mutation was tested in the context of the recombination library. However, given previous experiences with this mutation (low expression levels, no switch in cofactor specificity, and loss of activity) the recombination library was constructed first, which only contained the mutations found in Generation 1. This was deemed library 1. Next, another round of SOE PCR was used to introduce S or D at position 53 (library 2). Both libraries were separately ligated and transformed. 1.100 of library 1 and 1,700 of library 2 were screened for improved NADH consumption. Having no NADPH screening data for the 2,800 clones and assuming that a switch in cofactor specificity comes with the likely cost of losing activity on NADH, selected variants with improved activity or activity equal to the parent, as well variants that had lost up to 20% of their activity on NADH were rescreened. In total, 88 variants were rescreened on both cofactors narrowing the number down to 14 shown in Table 13. Five double mutants 1A9, 1C2, 1G2, 2A9, and 1G5 were found. The rest were single mutants. None of the 14 showed a switch in cofactor specificity

TABLE-US-00017 TABLE 13 Exemplary Hits in Rescreen of Generation 2 Recombination Library. NADH/ Improve- NADPH ment in activity NADH ratio activity Variant in screen [%] V48 R49 K52 S53 L85 I89 Parent 0.34 -- -- -- -- -- -- -- 1A9 0.52 71 -- L -- -- A -- 1C2 0.73 64 A -- -- -- A -- 1E1 0.66 70 -- P -- -- -- -- 1E3 0.83 103 -- -- -- -- A -- 1G2 0.87 77 L P -- -- -- -- 1G5 0.7 70 -- -- -- -- A A 1G10 0.68 82 -- -- -- -- A -- 1H1 0.9 86 -- -- -- -- A -- 2A5 0.73 72.5 -- V -- -- -- -- 2A8 0.51 55 -- P -- -- -- -- 2A9 0.5 52.5 L P -- -- -- -- 2A10 0.52 59 -- V -- -- -- -- 2E5 0.71 34.5 L -- -- -- -- -- 2G8 0.72 80 -- V -- -- -- --

[0278] Variants 1A9, 1C2, 1G2, and 1G5 were expressed, purified, and characterized (Table 14). Mutation L85A is noteworthy. In all three cases (1A9, 1C2, and 1G5), the NADPH K.sub.M value was either cut in half (1A9) or below 1 .mu.M (1C2 and 1G5) and thus beneath the measurable threshold. These variants also showed the lowest NADH K.sub.M values with 99, 115, and 112 .mu.M. Mutation L85A could be conceived as being generally activating.

TABLE-US-00018 TABLE 14 Comparison of L. lactis KARI and Variants Thereof mutations U/mg K.sub.m [M] for cofactor Gen Variant (gene) V48 R49 K52 S53 L85 I89 NADH NADPH ratio NADH NADPH 0 LI_KARI-.sup.his6 (wt) V R K S L I 0.05 0.34 .+-. 0.05 0.15 285 .+-. 30 13 .+-. 1.3 2 LI_KARI.sup.1A9-his6 L A 0.2 0.33 0.6 99 8 LI_KARI.sup.1G2-his6 A A 0.17 0.33 0.5 115 <1 LI_KARI.sup.1G2-his6 L P 0.21 0.34 0.6 150 13 LI_KARI.sup.1G5-his6 A A 0.21 0.4 0.5 112 <1 Gen Variant (gene) k.sub.cat.sup.[s-1] k.sub.cat/K.sub.m [M.sup.-1*s.sup.-1] 0 LI_KARI-.sup.his6 (wt) NADH NADPH NADH NADPH ratio 2 LI_KARI.sup.1A9-his6 0.1 0.8 530 65,000 0.008 LI_KARI.sup.1G2-his6 0.5 0.8 5,000 102,000 0.049 LI_KARI.sup.1G2-his6 0.4 0.8 3,700 >800,000 <0.005 LI_KARI.sup.1G5-his6 0.5 0.8 3,300 65,000 0.051 0.5 1.0 4,700 >990,000 <0.005

[0279] None of the variants had mutations at residues K52 and S53, positions that bind the NADPH phosphate with high probability. Based on the results of Generation 1, it was hypothesized that the strong NADPH binding is not due to one residue only, but rather due to a concerted binding via R49, K52, and S53. Disrupting the binding of R49 with a mutation such as R49P would give the opportunity to explore different combinations at the two important sites 52 and 53. Thus, a double NNK library at these two positions was generated using a variant with a mutation at residue R49 as template.

[0280] Generation 3: Double NNK Library at Positions K52 and S53:

[0281] Given the data presented in Table 14, the choice of the parent for the next round was between 1A9 and 1G2. Both had a mutation at position R49 (L and P); in addition, 1A9 carried the L85A mutation described above; 1G2 had a mutation at position 48 (V48L). Even though the NADH K.sub.M value and catalytic efficiency of 1G2 were not as favorable as 1A9's, 1G2 was chosen as parent because, due to the lack of L85A, its NADPH activities were parent-like. Thus, its improvements stem from increased NADH activity only.

[0282] A library with 1G2 as parent was generated using primers #41 and 42 and the commercial T7 primers (#1 and 2). Approximately 2,800 individual colonies were screened for both NADH and NADPH consumption. The introduction of two negative charges, K52E and S53D, gives the highest NADH/NADPH ratio in the screen (variant 4H8). However, when the order of the residues is reversed, K52D and S53E (variant 3H5), the protein has potential folding issues. The introduction of one negative charge in combination with L, P, S, or K results in at least four-fold ratio improvements compared to parent 1G2. However, when K52 is mutated to P and S53 is still able to bind phosphate, no beneficial effects on the ratio were observed (variant 2G6).

TABLE-US-00019 TABLE 15 NADH/NADPH activity ratio measured in screen of double NNK library. The variants in this table are the top hits (except 2G6) of 1/6.sup.th of this library. NADH/ NADPH Variant in screen K52 S53 LI_KARI.sup.1G-his6 0.5 K S 4H8 >10 E D 3C7 8.2 L D 3H5 8.2 D E 3E9 6.1 P E 2A4 3.7 K E 3F9 2.2 S D 2G6 0.5 P S

[0283] Four out of eight variants are shown in Table 15 (4H8, 3C7, 3H5, and 3E9). In Table 16, characterization data of the cofactor switched variants is presented. Each is compared to the wild-type L. lactis KARI and variants found in Generation 2. The NADPH K.sub.M value of LI_KARI.sup.3C7-his6 is estimated to be greater than 1000 .mu.M. An NADPH concentration of 500 .mu.M in the cuvette in the spectrometer was capable of being measured. At this concentration, the variant had not reached saturation yet. The other two variants, 3H5 and 3E9, had double peaks in the purification chromatogram, low expression levels, and also very low activity after purification.

TABLE-US-00020 TABLE 16 Comparison of properties of LI_KARI.sup.his6 and Generation 2 and Generation 3 enzyme variants. mutations U/mg K.sub.m [.mu.M] for cofactor Gen Variant (gene) V48 R49 K52 S53 L85 I89 NADH NADPH ratio NADH NADPH 0 LI_KARI-.sup.his6 (wt) V R K S L I 0.05 0.34 .+-. 0.05 0.15 285 .+-. 30 13 .+-. 1.3 2 LI_KARI.sup.1A9-his6 L A 0.2 0.33 0.6 99 8 LI_KARI.sup.1C2-his6 A A 0.17 0.33 0.5 115 <1 LI_KARI.sup.1G2-his6 L P 0.21 0.34 0.6 150 13 LI_KARI.sup.1G5-his6 A A 0.21 0.4 0.5 112 <1 3 LI_KARI.sup.4H8-his6 L P E D 0.14 0.024 5.8 128 .+-. 9 1180 .+-. 280 LI_KARI.sup.3C1-his6 L P L D 0.16 0.003 53.3 108 .+-. 9 >1000 k.sub.cat [.sup.s-1] k.sub.cat/K.sub.m [M.sup.-1*s.sup.-1] Gen Variant (gene) NADH NADPH NADH NADPH ratio 0 LI_KARI-.sup.his6 (wt) 0.1 0.8 530 65,000 0.008 2 LI_KARI.sup.1A9-his6 0.5 0.8 5,000 102,000 0.049 LI_KARI.sup.1C2-his6 0.4 0.8 3,700 >800.000 <0.005 LI_KARI.sup.1G2-his6 0.5 0.8 3,300 65,000 0.051 3 LI_KARI.sup.1G5-his6 0.5 1.0 4,700 >990,000 <0.005 LI_KARI.sup.4H8-his6 0.35 0.06 2,700 <50 54 LI_KARI.sup.3C1-his6 0.4 0.01 3,700 <7 529

[0284] Generation 3 variants LI_KARI.sup.4H8-his6 and LI_KARI.sup.3C7-his6 exhibit switches in cofactor specificities for NADH over NADPH in terms of catalytic efficiency. Both variants carry four mutations and only differ at position K52 (K52E or K52L, respectively). Residues K52 and S53D appear to be important determinants of cofactor specificity. Both variants have .about.2.5 fold reduced NADH K.sub.M values relative to the wild-type L. lactis KARI. Both variants have lost almost all activity (U/mg) on NADPH: 14-fold decrease of activity for 4H8 and 113-fold decrease of activity for 3C7.

[0285] In addition to the above-described modifications, further generations of mutants were constructed. Briefly, a recombination library was constructed using standard overlap extension polymerase chain reaction and primer pairs 1, 2, and 43-54. In these additional generations, two variants exhibited beneficial properties: LI_NKR.sup.Gen6a-his6 and LI_NKR.sup.Gen6b-his6. LI_NKR.sup.Gen6a-his contained mutations K118E, T182S, and E320K and showed a 3.7-fold increase in catalytic efficiency in the presence of NADH and a 15-fold decrease in 2S-AL K.sub.M value. LI_NKR.sup.Gen6b-his retained mutations E59K, T182S, and E320K and had an almost 40-fold improved K.sub.M value for 2S-AL. The catalytic efficiency of this enzyme in the presence of NADH was 14.8-fold increased compared to its parent, LI_NKR.sup.Gen3-his6. LI_NKR.sup.Gen6b-his showed a complete switch of cofactor preference. The characterization data is summarized in Table 17.

TABLE-US-00021 TABLE 17 Characterization of recombination variants LI_NKR.sup.Gen6a-his and LI_NKR.sup.Gen6b-his in comparison to their lineage. K.sub.m [.mu.M] for Mutations U/mg cofactor Gen Variant (gene) V48 R49 K52 S53 E59 K118 T182 E320 NADH NADPH ratio NADH NADPH 0 LI_KARI.sup.his6 (wt) 0.5 0.34 .+-. 0.05 0.15 285 .+-. 30 13 .+-. 1.3 3 LI_NKR.sup.3C7-his6 L P L D 0.16 .+-. 0.03 .+-. 5 .+-. 108 .+-. 1000 .+-. 0.002 0.004 0.7 9 100 6 LI_NKR.sup.Gen6a-his6 L P L D E S K 0.25 .+-. 0.16 .+-. 1.56 .+-. 45 .+-. 1059 .+-. 0.003 0.007 0.1 19 306 6 LI_NKR.sup.Gen6b-his6 L P L D K S K 0.43 .+-. 0.14 .+-. 3 .+-. 15 .+-. 749 .+-. 0.01 0.031 0.7 4 95 K.sub.m K.sub.i [mM] [mM] for for R- IC.sub.50 Gen Variant (gene) k.sub.cat[s.sup.-1] k.sub.cat/K.sub.m[ M.sup.-1*s.sup.-1] substrate DHIV K.sub.i/K.sub.M (mM) for 0 LI_KARI.sup.his6 (wt) NADH NADPH NADH NADPH ratio NADH NADH NADH R-DHIV 3 LI_NKR.sup.3C7-his6 0.1 0.8 .+-. 430 .+-. 65,000 .+-. 0.007 .+-. 5.6 .+-. 1.7 0.3 N.D 0.12 45 11559 0.0 1.6 6 LI_NKR.sup.Gen6a-his6 0.4 .+-. 0.08 .+-. 3,704 .+-. 80 .+-. 46 .+-. 8.2 .+-. N.D N.D N.D 0.005 0.01 312 13 9 1.0 6 LI_NKR.sup.Gen6b-his6 0.62 .+-. 0.4 .+-. 13,808 .+-. 375 .+-. 37 .+-. 0.53 .+-. 0.05 .+-. 0.1 1.05 .+-. 0.01 0.02 5,834 110 19 0.11 0.011 0.26 1.07 .+-. 0.35 .+-. 71,248 .+-. 465 .+-. 153 .+-. 0.21 .+-. 0.01 .+-. 0.05 0.26 .+-. 0.03 0.08 19,102 122 57 0.03 0.001 0.06

Example 4

NADH-Dependent KARI Derived from Shewanella and Salmonella

[0286] The following example illustrates exemplary long-form KARI enzymes from Shewanella sp. and Salmonella enterica and corresponding NADH-dependent ketol-acid reductoisomerases (NKR) derived therefrom.

[0287] Plasmids and primers disclosed in this example are shown in Tables 18-19 below.

TABLE-US-00022 TABLE 18 Plasmids Disclosed in Example 4. Plasmids Genotype pET22b(+) PT7, bla, ori pBR322, lacI, C-term 6xHis pGV3195 PT7::Se1_KARI.sup.his6, bla, oripBR322, lacI pGV3627 PT7::Sh_sp_KARI_coSc.sup.his6, bla, oripBR322, lacI pGV3628 PT7::Sh_sp_NKR_coSc.sup.DDhis6, bla, oripBR322, lacI pGVSh_sp_S78D PT7::Sh_sp_KARI_coSc.sup.S78Dhis6, bla, oripBR322, lacI pGV3629 PT7::Sh_sp_NKR_coSc.sup.6E6his6, bla, oripBR322, lacI pGV3630 PT7::Se2_KARI_coSc.sup.his6, bla, oripBR322, lacI pGVSe2_S78D PT7::Se2_KARI_coSc.sup.S78Dhis6, bla, oripBR322, lacI pGV3631 PT7::Se2_NKR_coSc.sup.DDhis6, bla, oripBR322, lacI pGV3632 PT7::Se2_NKR_coSc.sup.6E6his6, bla, oripBR322, lacI

TABLE-US-00023 TABLE 19 Oligonucleotide Primers Disclosed in Example 4. Primer name Sequence Sh_S78D_for GCACAAAAGAGAGCCGATTGGCAAAAAGCGAC (SEQ ID NO: 145) Sh_S78D_rev GTCGCTTTTTGCCAATCGGCTCTCTTTTGTGC (SEQ ID NO: 146) Se2_S78D_for GCAGAAAAGAGAGCCGATTGGCGTAAAGCGACGGA (SEQ ID NO: 147) Se2_S78D_rev TCCGTCGCTTTACGCCAATCGGCTCTCTTTTCTGC (SEQ ID NO: 148)

[0288] Mutations relative to wild-type Salmonella enterica KARI (Se2_KARI) and Shewanella sp. KARI (Sh_sp_KARI) are listed in Table 20 below.

TABLE-US-00024 TABLE 20 Mutations Relative to Se2_KARI and Sh_KARI. Source Variant (enzyme) Mutations Salmenella Se2_KARI n/a enterica Se2_KARI.sup.S78D S78D Se2_NKR.sup.DD R76D, S78D Se2_NKR.sup.6E6 A71S, R76D, S78D, Q110V Shewanella sp. Sh_sp_KARI n/a Sh_sp_NKR.sup.S78D S78D Sh_sp_NKR.sup.DD R76D, S78D Sh_sp_NKR.sup.6E6 A71S, R76D, S78D, Q110V

[0289] Genes encoding Se2_KARI, Se2_NKR.sup.DD, Se2_NKR.sup.6E6, Sh_sp_KARI, Sh_sp_NKR.sup.DD, and Sh_sp_NKR.sup.6E6 were synthesized by GenScript USA Inc. (Piscataway, N.J. 08854 USA) with flanking NdeI and XhoI sites. The genes were isolated by restriction enzyme digestion with NdeI and XhoI for 1 hour at 37.degree. C. The expression vector, pGV3195, was also digested with NdeI and XhoI for 1 hour at 37.degree. C. The fragments were ligated using T4 DNA ligase from New England Biolabs (Ipswich, Mass. USA). The ligated DNAs were transformed into chemically competent E. coli DH5.alpha. cells, incubated for 1 h at 37.degree. C. in SOC medium, and plated to LB.sub.amp agar plates (Luria Bertani Broth, Research Products International Corp, supplemented with 100 .mu.g/mL ampicillin) to yield single colonies. After confirming the correct sequence, E. coli BL21(DE3) cells were transformed with the correct plasmids for expression.

[0290] Genes encoding Se2_KARI.sup.S78D and Sh_sp_NKR.sup.S78D: Single aspartic acid substitutions were introduced using the QuikChange site-directed mutagenesis kit according to manufacturer's protocol (Stratagene). Plasmids pGV3627 and pGV3630 encoding Sh_sp_KARI and Se2_KARI, respectively, were used as templates. The respective primer pairs were primers Sh_S78D_for and Sh_S78D_rev and primers Se2_S78D_for and Se2_S78D_rev. Pfu turbo polymerase (Stratagene) was used as the polymerase in the following PCR program: 95.degree. C. for 2 min; 95.degree. C. for 30 s, 55.degree. C. for 30 s, 72.degree. C. for 8 min (repeat 15 times); 72.degree. C. for 10 min. After the PCR program was completed, the reaction mixtures were digested with DpnI for 1 h at 37.degree. C. Then, chemically competent E. coli XL1-Gold cells were transformed with 3 .mu.L of the un-cleaned PCR mixtures and the cells were allowed to recover in SOC medium at 37.degree. C. with shaking at 250 rpm for 1 h. The recovery allowed the cells to close the nick-containing DNA produced during the PCR and thus to generate circularized plasmids. We then plated varying volumes on LB.sub.amp agar plates (Luria Bertani Broth, Research Products International Corp, supplemented with 100 .mu.g/mL ampicillin) to yield single colonies. After confirming the correct sequence, E. coli BL21(DE3) cells were transformed with the correct plasmids for expression.

[0291] Heterologous expression of Se2_KARI and Sh_sp_KARI variants in E. coli: The expression of Se2_KARI, Sh_sp_KARI, and their corresponding NKR variants (Table 20) was conducted in 0.5 L Erlenmeyer flasks filled with 0.2 L LB.sub.amp (Luria Bertani Broth, Research Products International Corp, supplemented with 100 .mu.g/mL ampicillin) inoculated with overnight culture to an initial OD.sub.600 of 0.1. After growing the expression cultures at 37.degree. C. with shaking at 250 rpm for 4 h, the cultivation temperature was dropped to 25.degree. C., and KARI expression was induced with IPTG to a final concentration of 0.5 mM. After 24 h at 25.degree. C. and shaking at 250 rpm, the cells were pelleted at 5,300 g for 10 min and then frozen at -20.degree. C. until further use.

[0292] Sh_sp_KARI and its NKR variants were expressed in 200-mL cultures and purified over a 1-mL histrap HP column. The K.sub.M, k.sub.cat, and specific activity values were measured as described above, and the results are summarized in Table 21. In terms of the ratio of catalytic efficiency with NADH over NADPH, variants Sh_sp_NKR.sup.S78D, Sh_sp_NKR.sup.R76DS78D, and Sh_sp_NKR.sup.6E6 can be defined as being NADH-dependent KARIs (NKR) in terms of their catalytic efficiencies.

[0293] Se2_KARI and its NKR variants were expressed in 200-mL cultures and purified over a 1-mL histrap HP column. The K.sub.M, k.sub.cat, and specific activity values were measured as described above, and the results are summarized in Table 22. In terms of the ratio of catalytic efficiency with NADH over NADPH, variants Se2_NKR.sup.DD and Se2_NKR.sup.6E6 can be defined as being NADH-dependent KARIs (NKR). Additional mutations at positions D146, G185, and K433 are generally expected to further improve activity of the Se2_KARI (data not shown).

TABLE-US-00025 TABLE 21 Comparison of properties of wild-type Shewanella sp. KARI (Sh_sp_KARI), the single and double aspartic acid variants, and the "6E6" variant. Data is based on measurements using purified proteins. Sp. Activity [U/mg] K.sub.m [.mu.M] for cofactor k.sub.cat[.sup.s-1] NADH .+-. NADPH .+-. ratio .+-. NADH .+-. NADPH .+-. NADH .+-. NADPH .+-. Sh_sp_KARI 0.30 0.012 1.2 0.013 0.2 0.0 415 44 .ltoreq.1 1.1 0.05 4.5 0.05 Sh_sp_NKR.sup.S78D 0.36 0.024 0.5 0.042 0.7 0.1 130 15 267 26 1.3 0.09 2.0 0.16 Sh_sp_NKR.sup.DD 0.34 0.001 0.03 0.004 10.7 1.5 90 24 >1000 1.3 0.01 0.1 0.02 Sh_sp_NKR.sup.6E6 0.66 0.00 0.1 0.013 9.1 1.7 75 10 600 130 2.4 0.00 0.3 0.05 k.sub.cat/K.sub.m[M.sup.-1*s.sup.-1] NADH .+-. NADPH .+-. ratio .+-. Sh_sp_KARI 2,649 301 4,479,890 0.0006 Sh_sp_NKR.sup.S78D 10,269 1,360 7,373 924 1.4 0.3 Sh_sp_NKR.sup.DD 14,022 3,740 <117 119 Sh_sp_NKR.sup.6E6 32,410 4,322 446 127 73 22.9

TABLE-US-00026 TABLE 22 Comparison of properties of wild-type Salmonella enterica KARI (Se2_KARI), the single and double aspartic acid variants, and the "6E6" variant. Data is based on measurements using purified proteins. Sp. Activity [U/mg] K.sub.m [.mu.M] for cofactor k.sub.cat[.sup.s-1] NADH .+-. NADPH .+-. ratio .+-. NADH .+-. NADPH .+-. NADH .+-. NADPH .+-. Se2_KARI 0.14 0.009 1.1 0.062 0.1 0.0 157 4 8 2 0.51 0.03 3.96 0.23 Se2_NKR.sup.S78D 0.17 0.005 0.4 0.015 0.4 0.0 233 43 272 23 0.63 0.02 1.47 0.05 Se2_NKR.sup.DD 0.37 0.002 0.03 0.005 12.4 1.9 121 20 >1000 1.36 0.01 0.11 0.02 Se2_NKR.sup.6E6 0.64 0.10 0.1 0.045 6.6 3.2 24 4 630 291 2.33 0.35 0.36 0.01 k.sub.cat/K.sub.m[M.sup.-1*S.sup.-1] NADH .+-. NADPH .+-. ratio .+-. Se2_KARI 3,229 222 495,409 127,118 0.01 0.0 Se2_NKR.sup.S78D 2,696 503 5,402 498 0.5 0.1 Se2_NKR.sup.DD 11,222 1,856 <110 >102 Se2_NKR.sup.6E6 97,284 21.857 565 261 172 88.5

[0294] The foregoing detailed description has been given for clearness of understanding only and no unnecessary limitations should be understood there from as modifications will be obvious to those skilled in the art.

[0295] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.

[0296] The disclosures, including the claims, figures and/or drawings, of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entireties.

Sequence CWU 1

1

14811479DNAShewanella sp. 1atggctaact attttaactc tctgaattta cgtcaacaat tagaacagct tggccaatgc 60cgttttatgg atcgctccga gtttagcgat ggctgcaatt acatcaaaga ttggaatatt 120gttattttag gttgtggtgc tcagggtctt aaccaaggtc tgaacatgcg tgactctggg 180ctgaatattg cctacgccct gcgcccagaa gccattgccc agaaacgtgc ctcatggcaa 240aaagccacgg acaacggctt taaagtgggc acctttgaag agctgatccc aacggcggat 300ttggtactga acttaacgcc cgataagcag cactccaatg tggttagcgc tgtgatgcca 360ctgatgaaac aaggcgcaac gctgtcttat tcccacggtt ttaacatcgt tgaagaaggc 420atgcagatcc gccccgatat tacagttgtg atggtagcgc ctaagtgccc aggtactgaa 480gtgcgtgaag aatacaagcg tggttttggt gtaccgacac tgattgcagt gcacccagaa 540aacgacccta atggcgatgg tttagagatt gccaaagcct atgcgagtgc cacaggcggt 600gaccgcgctg gcgtgttgca atcttccttt attgccgaag taaaatcgga tctgatgggc 660gaacaaacca ttctgtgcgg tatgttgcag acgggcgcta tcctaggtta cgacaagatg 720gtggccgatg gtgttgaacc tggctatgcc gctaagttaa tccaacaagg ttgggaaacc 780gtgaccgagg cgcttaagca cggcggtatc accaacatga tggacagact gtctaatcct 840gccaagatta aagcgtttga aattgcagaa gatttaaaag aaattctgca acccttattc 900gaaaaacata tggatgacat catcagcggc gagttctcac gcactatgat gcaagactgg 960gcgaatgacg acgctaacct gctgcgttgg cgcgccgaaa ccgccgaaac gggcttcgaa 1020aatgcccctg tttcgagcga gcatatcgac gagcaaacct atttcgacaa ggggattttc 1080ctagttgcga tgatcaaagc cggtgtcgaa ttagccttcg atactatggt gtcggcgggt 1140attgttgaag agtcagccta ttacgaatca ctgcatgaaa cgccgctgat cgctaacacc 1200atcgcccgta aacgtcttta cgagatgaac gtggtgatct cggataccgc agaatacggt 1260tgttatctgt tcaaccatgc tgcagtacct atgctgcgtg actatgtaaa tgccatgtcg 1320ccagagtatt taggtgcggg tctgaaggac agttctaaca acgtcgataa cctgcagtta 1380atcgccatca atgatgcgat tcgccacact tcagttgagt atatcggtgc ggaacttcgt 1440ggttatatga ctgatatgaa aagtattgtt ggagcttaa 14792492PRTShewanella sp. 2Met Ala Asn Tyr Phe Asn Ser Leu Asn Leu Arg Gln Gln Leu Glu Gln 1 5 10 15 Leu Gly Gln Cys Arg Phe Met Asp Arg Ser Glu Phe Ser Asp Gly Cys 20 25 30 Asn Tyr Ile Lys Asp Trp Asn Ile Val Ile Leu Gly Cys Gly Ala Gln 35 40 45 Gly Leu Asn Gln Gly Leu Asn Met Arg Asp Ser Gly Leu Asn Ile Ala 50 55 60 Tyr Ala Leu Arg Pro Glu Ala Ile Ala Gln Lys Arg Ala Ser Trp Gln 65 70 75 80 Lys Ala Thr Asp Asn Gly Phe Lys Val Gly Thr Phe Glu Glu Leu Ile 85 90 95 Pro Thr Ala Asp Leu Val Leu Asn Leu Thr Pro Asp Lys Gln His Ser 100 105 110 Asn Val Val Ser Ala Val Met Pro Leu Met Lys Gln Gly Ala Thr Leu 115 120 125 Ser Tyr Ser His Gly Phe Asn Ile Val Glu Glu Gly Met Gln Ile Arg 130 135 140 Pro Asp Ile Thr Val Val Met Val Ala Pro Lys Cys Pro Gly Thr Glu 145 150 155 160 Val Arg Glu Glu Tyr Lys Arg Gly Phe Gly Val Pro Thr Leu Ile Ala 165 170 175 Val His Pro Glu Asn Asp Pro Asn Gly Asp Gly Leu Glu Ile Ala Lys 180 185 190 Ala Tyr Ala Ser Ala Thr Gly Gly Asp Arg Ala Gly Val Leu Gln Ser 195 200 205 Ser Phe Ile Ala Glu Val Lys Ser Asp Leu Met Gly Glu Gln Thr Ile 210 215 220 Leu Cys Gly Met Leu Gln Thr Gly Ala Ile Leu Gly Tyr Asp Lys Met 225 230 235 240 Val Ala Asp Gly Val Glu Pro Gly Tyr Ala Ala Lys Leu Ile Gln Gln 245 250 255 Gly Trp Glu Thr Val Thr Glu Ala Leu Lys His Gly Gly Ile Thr Asn 260 265 270 Met Met Asp Arg Leu Ser Asn Pro Ala Lys Ile Lys Ala Phe Glu Ile 275 280 285 Ala Glu Asp Leu Lys Glu Ile Leu Gln Pro Leu Phe Glu Lys His Met 290 295 300 Asp Asp Ile Ile Ser Gly Glu Phe Ser Arg Thr Met Met Gln Asp Trp 305 310 315 320 Ala Asn Asp Asp Ala Asn Leu Leu Arg Trp Arg Ala Glu Thr Ala Glu 325 330 335 Thr Gly Phe Glu Asn Ala Pro Val Ser Ser Glu His Ile Asp Glu Gln 340 345 350 Thr Tyr Phe Asp Lys Gly Ile Phe Leu Val Ala Met Ile Lys Ala Gly 355 360 365 Val Glu Leu Ala Phe Asp Thr Met Val Ser Ala Gly Ile Val Glu Glu 370 375 380 Ser Ala Tyr Tyr Glu Ser Leu His Glu Thr Pro Leu Ile Ala Asn Thr 385 390 395 400 Ile Ala Arg Lys Arg Leu Tyr Glu Met Asn Val Val Ile Ser Asp Thr 405 410 415 Ala Glu Tyr Gly Cys Tyr Leu Phe Asn His Ala Ala Val Pro Met Leu 420 425 430 Arg Asp Tyr Val Asn Ala Met Ser Pro Glu Tyr Leu Gly Ala Gly Leu 435 440 445 Lys Asp Ser Ser Asn Asn Val Asp Asn Leu Gln Leu Ile Ala Ile Asn 450 455 460 Asp Ala Ile Arg His Thr Ser Val Glu Tyr Ile Gly Ala Glu Leu Arg 465 470 475 480 Gly Tyr Met Thr Asp Met Lys Ser Ile Val Gly Ala 485 490 31485DNAVibrio fischeri 3atgtctaact actttaatac gctaaattta cgtgaacaat tagatcaact aggtcgttgt 60cgctttatgg atcgtgaaga atttgcaaca gaagctgatt accttaaagg taaaaaagtg 120gttattgttg gttgtggtgc tcaaggctta aaccaaggcc ttaatatgcg tgattcaggc 180ttagatgttg cttatgcact gcgtcaagcc gctattgatg agcaacgaca atcttataaa 240aatgcaaaag aaaatggttt tgaagtagct agctatgaaa ctctgatccc tcaagctgac 300ctagttatta atcttactcc tgataaacaa catactaatg tagttgaaac tgttatgcct 360ctaatgaaag agggggcagc tttaggctat tcacatggtt ttaatgttgt tgaagaaggg 420atgcaaatcc gtaaagattt gacggttgtt atggttgctc ctaagtgtcc aggaacagaa 480gttcgtgaag aatataaacg tggttttggg gttccaactc taattgctgt tcacccagaa 540aatgatccta aaggtgaagg ttgggatatt gctaaggctt gggctgctgg tacaggtggt 600caccgtgcgg gttgtctaga gtcttctttt gtcgctgaag ttaaatctga ccttatgggt 660gagcaaacga ttctttgtgg catgctacaa gctggttcta ttgtatctta cgagaagatg 720attgctgacg gtattgagcc tggttatgca ggtaaacttc tacagtacgg ttgggaaaca 780attactgaag ccctaaagtt tggcggtgtt acgcatatga tggatcgcct ttcaaaccca 840gctaaagtaa aagcttttga gctttcagaa gaacttaaag agctaatgcg tccactttat 900aataagcata tggacgatat tatttctggt gagttttctc gcacaatgat ggctgattgg 960gctaatgatg atgttaatct atttggctgg cgtgaagaaa caggtcaaac tgcgtttgaa 1020aactaccctg agtctgatgt agagatctct gaacaagaat actttgataa cggtatttta 1080ctcgttgcaa tggttcgtgc cggcgttgaa ttagcttttg aagctatgac tgcatcaggc 1140attatcgatg aatcagctta ctatgagtcg ctgcacgaat taccactgat tgctaacact 1200gtagcacgta agcgtttgta cgaaatgaac gtagttattt ctgatactgc tgaatatggt 1260aactacctat ttgcaaatgt agcaacgcca cttcttcgtg agaaattcat gccttctgtt 1320gaaacagatg ttattggccg aggattaggt gaggcatcaa atcaagtgga taatgcaacg 1380ctaatcgctg ttaatgatgc gattcgtaat catccagttg aatatattgg tgaagaatta 1440cgtagctaca tgagcgatat gaagcgaatt gcagttggtg gctaa 14854494PRTVibrio fischeri 4Met Ser Asn Tyr Phe Asn Thr Leu Asn Leu Arg Glu Gln Leu Asp Gln 1 5 10 15 Leu Gly Arg Cys Arg Phe Met Asp Arg Glu Glu Phe Ala Thr Glu Ala 20 25 30 Asp Tyr Leu Lys Gly Lys Lys Val Val Ile Val Gly Cys Gly Ala Gln 35 40 45 Gly Leu Asn Gln Gly Leu Asn Met Arg Asp Ser Gly Leu Asp Val Ala 50 55 60 Tyr Ala Leu Arg Gln Ala Ala Ile Asp Glu Gln Arg Gln Ser Tyr Lys 65 70 75 80 Asn Ala Lys Glu Asn Gly Phe Glu Val Ala Ser Tyr Glu Thr Leu Ile 85 90 95 Pro Gln Ala Asp Leu Val Ile Asn Leu Thr Pro Asp Lys Gln His Thr 100 105 110 Asn Val Val Glu Thr Val Met Pro Leu Met Lys Glu Gly Ala Ala Leu 115 120 125 Gly Tyr Ser His Gly Phe Asn Val Val Glu Glu Gly Met Gln Ile Arg 130 135 140 Lys Asp Leu Thr Val Val Met Val Ala Pro Lys Cys Pro Gly Thr Glu 145 150 155 160 Val Arg Glu Glu Tyr Lys Arg Gly Phe Gly Val Pro Thr Leu Ile Ala 165 170 175 Val His Pro Glu Asn Asp Pro Lys Gly Glu Gly Trp Asp Ile Ala Lys 180 185 190 Ala Trp Ala Ala Gly Thr Gly Gly His Arg Ala Gly Cys Leu Glu Ser 195 200 205 Ser Phe Val Ala Glu Val Lys Ser Asp Leu Met Gly Glu Gln Thr Ile 210 215 220 Leu Cys Gly Met Leu Gln Ala Gly Ser Ile Val Ser Tyr Glu Lys Met 225 230 235 240 Ile Ala Asp Gly Ile Glu Pro Gly Tyr Ala Gly Lys Leu Leu Gln Tyr 245 250 255 Gly Trp Glu Thr Ile Thr Glu Ala Leu Lys Phe Gly Gly Val Thr His 260 265 270 Met Met Asp Arg Leu Ser Asn Pro Ala Lys Val Lys Ala Phe Glu Leu 275 280 285 Ser Glu Glu Leu Lys Glu Leu Met Arg Pro Leu Tyr Asn Lys His Met 290 295 300 Asp Asp Ile Ile Ser Gly Glu Phe Ser Arg Thr Met Met Ala Asp Trp 305 310 315 320 Ala Asn Asp Asp Val Asn Leu Phe Gly Trp Arg Glu Glu Thr Gly Gln 325 330 335 Thr Ala Phe Glu Asn Tyr Pro Glu Ser Asp Val Glu Ile Ser Glu Gln 340 345 350 Glu Tyr Phe Asp Asn Gly Ile Leu Leu Val Ala Met Val Arg Ala Gly 355 360 365 Val Glu Leu Ala Phe Glu Ala Met Thr Ala Ser Gly Ile Ile Asp Glu 370 375 380 Ser Ala Tyr Tyr Glu Ser Leu His Glu Leu Pro Leu Ile Ala Asn Thr 385 390 395 400 Val Ala Arg Lys Arg Leu Tyr Glu Met Asn Val Val Ile Ser Asp Thr 405 410 415 Ala Glu Tyr Gly Asn Tyr Leu Phe Ala Asn Val Ala Thr Pro Leu Leu 420 425 430 Arg Glu Lys Phe Met Pro Ser Val Glu Thr Asp Val Ile Gly Arg Gly 435 440 445 Leu Gly Glu Ala Ser Asn Gln Val Asp Asn Ala Thr Leu Ile Ala Val 450 455 460 Asn Asp Ala Ile Arg Asn His Pro Val Glu Tyr Ile Gly Glu Glu Leu 465 470 475 480 Arg Ser Tyr Met Ser Asp Met Lys Arg Ile Ala Val Gly Gly 485 490 51476DNAGramella forsetii 5atgaccaact attttaacag cctttcttta cgtgatcaat tagctcagct tggaacctgc 60aggtttatgg agctggatga attcagcaac gaggtggctg tcctaaaaga taaaaaaatt 120gtgatcgtag gctgtggagc ccagggtctt aatcaggggc tcaatatgcg cgatagcgga 180ctcgatatct catatgcgtt aagggaagga gcgattaaag aaaagcgaca gtcctggaaa 240aatgctacgg aaaataattt taacgtagga acttatgagg agcttattcc aaaggctgat 300cttgttatca atcttacgcc agataaacaa catacttcgg tgatcaaggc gattcaacct 360catatcaaaa aagatgcggt actttcttac tctcatggtt tcaacattgt ggaagaagga 420acgaagatac gtgaagatat aacggtaatt atggtcgcgc caaaatgtcc cggaactgag 480gtgagggaag aatataaaag aggttttgga gtgccgactc ttatcgcggt tcatccggaa 540aatgatcctc atggaattgg cctggattgg gcaaaagctt atgcgtatgc tacaggtggt 600cacagggccg gagtactgga atcttctttt gttgctgaag taaaatctga cctaatgggg 660gaacaaacaa tgctttgtgg agttcttcaa acaggatcga tcttaacttt cgataaaatg 720gttgcagatg gtgtggagcc aaattatgct gcaaaactta tccagtatgg atgggaaaca 780attactgaag ccctgaaaca tggtggaata accaatatga tggacaggct ttcaaatcct 840gcaaagctta gagcgaatga aattgctgaa gaacttaaag agaaaatgcg tccgcttttt 900cagaaacata tggatgatat aatttcagga gaattcagca gtcgaatgat gcgtgactgg 960gcaaatgatg ataaagaatt actcacctgg cgtgccgaaa cagagaatac cgcttttgaa 1020aaaactgaag ccacttcaga agagatcaaa gagcaggaat attttgataa aggtgtgctg 1080atggtggcct ttgtaagggc aggtgtagag ctggcctttg aaacgatggt ggaagccggg 1140ataattgaag aatcggctta ttatgaatca cttcatgaaa ctccgcttat agccaatacc 1200attgccagaa agaaattata cgagatgaat cgtgtgattt cagatactgc tgaatacggt 1260tgttatttat ttgatcatgc tgcaaaacca ttggtgaaag attatgtaaa ctcacttgaa 1320ccggaagttg ccgggaagaa atttggaaca gattgtaatg gtgtggataa ccagaaattg 1380atacacgtga atgatgatct tagaagtcat ccggttgaaa aagttggagc gagattaaga 1440actgcaatga ccgcaatgaa gaaaatatac gcataa 14766491PRTGramella forsetii 6Met Thr Asn Tyr Phe Asn Ser Leu Ser Leu Arg Asp Gln Leu Ala Gln 1 5 10 15 Leu Gly Thr Cys Arg Phe Met Glu Leu Asp Glu Phe Ser Asn Glu Val 20 25 30 Ala Val Leu Lys Asp Lys Lys Ile Val Ile Val Gly Cys Gly Ala Gln 35 40 45 Gly Leu Asn Gln Gly Leu Asn Met Arg Asp Ser Gly Leu Asp Ile Ser 50 55 60 Tyr Ala Leu Arg Glu Gly Ala Ile Lys Glu Lys Arg Gln Ser Trp Lys 65 70 75 80 Asn Ala Thr Glu Asn Asn Phe Asn Val Gly Thr Tyr Glu Glu Leu Ile 85 90 95 Pro Lys Ala Asp Leu Val Ile Asn Leu Thr Pro Asp Lys Gln His Thr 100 105 110 Ser Val Ile Lys Ala Ile Gln Pro His Ile Lys Lys Asp Ala Val Leu 115 120 125 Ser Tyr Ser His Gly Phe Asn Ile Val Glu Glu Gly Thr Lys Ile Arg 130 135 140 Glu Asp Ile Thr Val Ile Met Val Ala Pro Lys Cys Pro Gly Thr Glu 145 150 155 160 Val Arg Glu Glu Tyr Lys Arg Gly Phe Gly Val Pro Thr Leu Ile Ala 165 170 175 Val His Pro Glu Asn Asp Pro His Gly Ile Gly Leu Asp Trp Ala Lys 180 185 190 Ala Tyr Ala Tyr Ala Thr Gly Gly His Arg Ala Gly Val Leu Glu Ser 195 200 205 Ser Phe Val Ala Glu Val Lys Ser Asp Leu Met Gly Glu Gln Thr Met 210 215 220 Leu Cys Gly Val Leu Gln Thr Gly Ser Ile Leu Thr Phe Asp Lys Met 225 230 235 240 Val Ala Asp Gly Val Glu Pro Asn Tyr Ala Ala Lys Leu Ile Gln Tyr 245 250 255 Gly Trp Glu Thr Ile Thr Glu Ala Leu Lys His Gly Gly Ile Thr Asn 260 265 270 Met Met Asp Arg Leu Ser Asn Pro Ala Lys Leu Arg Ala Asn Glu Ile 275 280 285 Ala Glu Glu Leu Lys Glu Lys Met Arg Pro Leu Phe Gln Lys His Met 290 295 300 Asp Asp Ile Ile Ser Gly Glu Phe Ser Ser Arg Met Met Arg Asp Trp 305 310 315 320 Ala Asn Asp Asp Lys Glu Leu Leu Thr Trp Arg Ala Glu Thr Glu Asn 325 330 335 Thr Ala Phe Glu Lys Thr Glu Ala Thr Ser Glu Glu Ile Lys Glu Gln 340 345 350 Glu Tyr Phe Asp Lys Gly Val Leu Met Val Ala Phe Val Arg Ala Gly 355 360 365 Val Glu Leu Ala Phe Glu Thr Met Val Glu Ala Gly Ile Ile Glu Glu 370 375 380 Ser Ala Tyr Tyr Glu Ser Leu His Glu Thr Pro Leu Ile Ala Asn Thr 385 390 395 400 Ile Ala Arg Lys Lys Leu Tyr Glu Met Asn Arg Val Ile Ser Asp Thr 405 410 415 Ala Glu Tyr Gly Cys Tyr Leu Phe Asp His Ala Ala Lys Pro Leu Val 420 425 430 Lys Asp Tyr Val Asn Ser Leu Glu Pro Glu Val Ala Gly Lys Lys Phe 435 440 445 Gly Thr Asp Cys Asn Gly Val Asp Asn Gln Lys Leu Ile His Val Asn 450 455 460 Asp Asp Leu Arg Ser His Pro Val Glu Lys Val Gly Ala Arg Leu Arg 465 470 475 480 Thr Ala Met Thr Ala Met Lys Lys Ile Tyr Ala 485 490 71479DNACytophaga hutchinsonii 7atggcaaatt atttcaatac tctttcatta agagaaaaat tagatcagtt aggcgtttgc 60gaattcatgg acagaagtga gttttctgac ggtgtagctg ctttgaaagg taaaaaaatt 120gtaatcgtag gttgtggtgc acaaggtttg aaccagggtt taaaccttcg tgattctggt 180ttagatgttt cttatacatt acgtaaagaa gccattgatt ctaaaagaca atcattttta 240aatgcttctg aaaatggttt caaagtgggc acgtacgaag aattaattcc tactgctgat 300ttagtaatta acttaacgcc ggataaacaa catactgctg ttgtgtctgc agttatgcca 360ttaatgaaaa aaggttctac cttatcttac tctcacggtt tcaacatcgt tgaagaaggt 420atgcagatcc gtaaggacat cacggtaatc atggttgctc ctaagtctcc gggttctgaa 480gttcgtgaag aatataaaag aggtttcggt gtccctacgt tgatcgccgt tcaccctgaa 540aacgatcctg aaggtaaagg ctgggattat gctaaggctt actgcgtagg tacaggtggt 600gacagagctg gtgtattgaa atcatctttc gttgctgaag taaaatctga tttaatgggt 660gagcaaacaa tcctttgtgg tttgttgcaa actggttcta tcctttgctt cgacaaaatg 720gttgaaaaag gcattgataa aggatatgct tctaaattga tccagtacgg

atgggaagtt 780atcacggaat cattgaaaca tggcggtatc agcggtatga tggatcgtct ttcaaaccct 840gctaaaatca aggcgttcca ggtatctgaa gaattgaaag atatcatgcg tccattattc 900cgtaagcatc aggatgatat catcagcgga gaattctccc gcatcatgat ggaagactgg 960gcgaatggcg ataaaaattt attgacatgg agagctgcaa caggtgaaac tgcatttgaa 1020aaaacgcctg caggtgacgt taaaattgct gagcaggaat attatgacaa tggtttgctg 1080atggttgcta tggttcgtgc gggtgttgaa ctggcattcg aaacaatgac tgaatcaggt 1140atcattgatg aatctgctta ctacgaatca ttacacgaaa caccgcttat cgcgaacaca 1200atcgcgcgta agaaattatt cgaaatgaac cgtgtaattt ctgatacagc tgaatacggc 1260tgctacttat tcgatcatgc ctgtaagcca ttattggcga acttcatgaa gacagtagat 1320acagacatca ttggtaaaaa cttcaacgcg ggtaaagata atggtgttga caaccagatg 1380ctgatcgctg taaatgaagt attacgttct cacccgatcg aaatcgttgg tgctgaatta 1440cgtgaagcaa tgactgaaat gaaagcaatc gtttcttaa 14798492PRTCytophaga hutchinsonii 8Met Ala Asn Tyr Phe Asn Thr Leu Ser Leu Arg Glu Lys Leu Asp Gln 1 5 10 15 Leu Gly Val Cys Glu Phe Met Asp Arg Ser Glu Phe Ser Asp Gly Val 20 25 30 Ala Ala Leu Lys Gly Lys Lys Ile Val Ile Val Gly Cys Gly Ala Gln 35 40 45 Gly Leu Asn Gln Gly Leu Asn Leu Arg Asp Ser Gly Leu Asp Val Ser 50 55 60 Tyr Thr Leu Arg Lys Glu Ala Ile Asp Ser Lys Arg Gln Ser Phe Leu 65 70 75 80 Asn Ala Ser Glu Asn Gly Phe Lys Val Gly Thr Tyr Glu Glu Leu Ile 85 90 95 Pro Thr Ala Asp Leu Val Ile Asn Leu Thr Pro Asp Lys Gln His Thr 100 105 110 Ala Val Val Ser Ala Val Met Pro Leu Met Lys Lys Gly Ser Thr Leu 115 120 125 Ser Tyr Ser His Gly Phe Asn Ile Val Glu Glu Gly Met Gln Ile Arg 130 135 140 Lys Asp Ile Thr Val Ile Met Val Ala Pro Lys Ser Pro Gly Ser Glu 145 150 155 160 Val Arg Glu Glu Tyr Lys Arg Gly Phe Gly Val Pro Thr Leu Ile Ala 165 170 175 Val His Pro Glu Asn Asp Pro Glu Gly Lys Gly Trp Asp Tyr Ala Lys 180 185 190 Ala Tyr Cys Val Gly Thr Gly Gly Asp Arg Ala Gly Val Leu Lys Ser 195 200 205 Ser Phe Val Ala Glu Val Lys Ser Asp Leu Met Gly Glu Gln Thr Ile 210 215 220 Leu Cys Gly Leu Leu Gln Thr Gly Ser Ile Leu Cys Phe Asp Lys Met 225 230 235 240 Val Glu Lys Gly Ile Asp Lys Gly Tyr Ala Ser Lys Leu Ile Gln Tyr 245 250 255 Gly Trp Glu Val Ile Thr Glu Ser Leu Lys His Gly Gly Ile Ser Gly 260 265 270 Met Met Asp Arg Leu Ser Asn Pro Ala Lys Ile Lys Ala Phe Gln Val 275 280 285 Ser Glu Glu Leu Lys Asp Ile Met Arg Pro Leu Phe Arg Lys His Gln 290 295 300 Asp Asp Ile Ile Ser Gly Glu Phe Ser Arg Ile Met Met Glu Asp Trp 305 310 315 320 Ala Asn Gly Asp Lys Asn Leu Leu Thr Trp Arg Ala Ala Thr Gly Glu 325 330 335 Thr Ala Phe Glu Lys Thr Pro Ala Gly Asp Val Lys Ile Ala Glu Gln 340 345 350 Glu Tyr Tyr Asp Asn Gly Leu Leu Met Val Ala Met Val Arg Ala Gly 355 360 365 Val Glu Leu Ala Phe Glu Thr Met Thr Glu Ser Gly Ile Ile Asp Glu 370 375 380 Ser Ala Tyr Tyr Glu Ser Leu His Glu Thr Pro Leu Ile Ala Asn Thr 385 390 395 400 Ile Ala Arg Lys Lys Leu Phe Glu Met Asn Arg Val Ile Ser Asp Thr 405 410 415 Ala Glu Tyr Gly Cys Tyr Leu Phe Asp His Ala Cys Lys Pro Leu Leu 420 425 430 Ala Asn Phe Met Lys Thr Val Asp Thr Asp Ile Ile Gly Lys Asn Phe 435 440 445 Asn Ala Gly Lys Asp Asn Gly Val Asp Asn Gln Met Leu Ile Ala Val 450 455 460 Asn Glu Val Leu Arg Ser His Pro Ile Glu Ile Val Gly Ala Glu Leu 465 470 475 480 Arg Glu Ala Met Thr Glu Met Lys Ala Ile Val Ser 485 490 91023DNALactococcus lactis 9atggcagtta caatgtatta tgaagatgat gtagaagtat cagcacttgc tggaaagcaa 60attgcagtaa tcggttatgg ttcacaagga catgctcacg cacagaattt gcgtgattct 120ggtcacaacg ttatcattgg tgtgcgccac ggaaaatctt ttgataaagc aaaagaagat 180ggctttgaaa catttgaagt aggagaagca gtagctaaag ctgatgttat tatggttttg 240gcaccagatg aacttcaaca atccatttat gaagaggaca tcaaaccaaa cttgaaagca 300ggttcagcac ttggttttgc tcacggattt aatatccatt ttggctatat taaagtacca 360gaagacgttg acgtctttat ggttgcgcct aaggctccag gtcaccttgt ccgtcggact 420tatactgaag gttttggtac accagctttg tttgtttcac accaaaatgc aagtggtcat 480gcgcgtgaaa tcgcaatgga ttgggccaaa ggaattggtt gtgctcgagt gggaattatt 540gaaacaactt ttaaagaaga aacagaagaa gatttgtttg gagaacaagc tgttctatgt 600ggaggtttga cagcacttgt tgaagccggt tttgaaacac tgacagaagc tggatacgct 660ggcgaattgg cttactttga agttttgcac gaaatgaaat tgattgttga cctcatgtat 720gaaggtggtt ttactaaaat gcgtcaatcc atctcaaata ctgctgagtt tggcgattat 780gtgactggtc cacggattat tactgacgaa gttaaaaaga atatgaagct tgttttggct 840gatattcaat ctggaaaatt tgctcaagat ttcgttgatg acttcaaagc ggggcgtcca 900aaattaatag cctatcgcga agctgcaaaa aatcttgaaa ttgaaaaaat tggggcagag 960ctacgtcaag caatgccatt cacacaatct ggtgatgacg atgcctttaa aatctatcag 1020taa 102310340PRTLactococcus lactis 10Met Ala Val Thr Met Tyr Tyr Glu Asp Asp Val Glu Val Ser Ala Leu 1 5 10 15 Ala Gly Lys Gln Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asn Val Ile Ile Gly Val 35 40 45 Arg His Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ala Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Lys Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Tyr Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Ser Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Glu Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Ile Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 Leu Arg Gln Ala Met Pro Phe Thr Gln Ser Gly Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Gln 340 111023DNALactococcus lactis 11atggcagtta caatgtatta tgaagatgat gtagaagtat cagcacttgc tggaaagcaa 60attgcagtaa tcggttatgg ttcacaagga catgctcacg cacagaattt gcgtgattct 120ggtcacaacg ttatcattgg tgtgcgccac ggaaaatctt ttgataaagc aaaagaagat 180ggctttgaaa catttgaagt aggagaagcg gtagctaaag ctgatgttat tatggttttg 240gcgccagatg aacttcaaca atccatttat gaagaggaca tcaaaccaaa cttgaaagca 300ggttcagcac ttggttttgc tcacggattt aatatccatt ttggctatat taaagtacca 360gaagacgttg acgtctttat ggttgcacct aaggctccag gtcaccttgt ccgtcggact 420tatactgaag gttttggtac accagctttg tttgtttcac accaaaatgc aagtggtcat 480gcgcgtgaaa tcgcaatgga ttgggccaaa ggaattggtt gtgctcgagt gggaattatt 540gaaacaacct ttaaagaaga aacagaagaa gatttgtttg gagaacaagc tgttctatgt 600ggaggtttga cagcacttgt tgaagccggt tttgaaacac tgacagaagc tggatacgct 660ggcgaattgg cttactttga agttttgcac gaaatgaaat tgattgttga cctcatgtat 720gaaggtggtt ttactaaaat gcgtcaatcc atctcaaata ctgctgagtt tggcgattat 780gtgactggtc caaggattat tactgacgca gttaaaaaga atatgaagct tgttttggct 840gatattcaat ctggaaaatt tgctcaagat ttcgttgatg acttcaaagc ggggcgtcca 900aaattaacag cctatcgcga agctgctaaa aatcttgaaa ttgaaaaaat tggggcagaa 960ttacgtaaag caatgccatt cacacaatct ggtgatgacg atgcctttaa aatctatcag 1020taa 102312340PRTLactococcus lactis 12Met Ala Val Thr Met Tyr Tyr Glu Asp Asp Val Glu Val Ser Ala Leu 1 5 10 15 Ala Gly Lys Gln Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asn Val Ile Ile Gly Val 35 40 45 Arg His Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ala Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Lys Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Tyr Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Ser Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Ala Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Thr Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Thr Gln Ser Gly Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Gln 340 131023DNALactococcus lactis 13atggcagtta caatgtatta tgaagatgat gtagaagtat cagcacttgc tggaaagcaa 60attgcagtaa tcggttatgg ttcacaagga catgctcacg cacagaattt gcatgattct 120ggtcacaacg ttatcattgg tgtgcgccac ggaaaatctt ttgataaagc aaaagaagat 180ggctttgaaa catttgaagt aggagaagcg gtagctaaag ctgatgttat tatggttttg 240gcgccagatg aacttcaaca atccatttat gaagaggaca tcaaaccaaa cttgaaagca 300ggttcagcac ttggttttgc tcacggattt aatatccatt ttggctatat taaagtacca 360gaagacgttg acgtctttat ggttgcacct aaggctccag gtcaccttgt ccgtcggact 420tatactgaag gttttggtac accagctttg tttgtttcac accaaaatgc aagtggtcat 480gcgcgtgaaa tcgcaatgga ttgggccaaa ggaattggtt gtgctcgagt gggaattatt 540gaaacaacct ttaaagaaga aacagaagaa gatttgtttg gagaacaagc tgttctatgt 600ggaggtttga cagcacttgt tgaagccggt tttgaaacac tgacagaagc tggatacgct 660ggcgaattgg cttactttga agttttgcac gaaatgaaat tgattgttga cctcatgtat 720gaaggtggtt ttactaaaat gcgtcaatcc atctcaaata ctgctgagtt tggcgattat 780gtgactggtc caaggattat tactgacgca gttaaaaaga atatgaagct tgttttggct 840gatattcaat ctggaaaatt tgctcaagat ttcgttgatg acttcaaagc ggggcgtcca 900aaattaacag cctatcgcga agctgctaaa aatcttgaaa ttgaaaaaat tggggcagaa 960ttacgtaaag caatgccatt cacacaatct ggtgatgacg atgcctttaa aatctatcag 1020taa 102314340PRTLactococcus lactis 14Met Ala Val Thr Met Tyr Tyr Glu Asp Asp Val Glu Val Ser Ala Leu 1 5 10 15 Ala Gly Lys Gln Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu His Asp Ser Gly His Asn Val Ile Ile Gly Val 35 40 45 Arg His Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ala Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Lys Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Tyr Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Ser Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Ala Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Thr Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Thr Gln Ser Gly Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Gln 340 151023DNALactococcus lactis 15atggcagtta caatgtatta tgaagaagat gtagaagtag ccgcactcgc gggtaagaaa 60atcgcagtga ttggatatgg ctcacaagga cacgctcatg cacaaaactt gcgtgattct 120ggtcatgatg tgattattgg tgtccgtcag gggaaatctt ttgataaagc aaaagaagat 180ggttttgaaa catttgaagt aggagaagca gtagctaaag ctgacgtcat tatggttctg 240gcacctgatg aacttcaaca atctatttat gaagaggaca taaaaccaaa tttgaaagca 300ggttcagcac ttggttttgc ccatggtttc aatattcatt ttggctatat tgaagttcca 360gaagatgttg atgtcttcat ggttgcgcca aaagcgccgg gacatctcgt tcggcggact 420tttaccgaag gtttcggaac gccagctttg ttcgtttcgc atcaaaatgc cactggtcat 480gcgcgtgaaa ttgccatgga ctgggccaaa ggaattggct gtgcccgtgt cggtatcatt 540gaaacaactt tcaaagaaga aacagaagaa gatttgtttg gcgaacaggc cgtgctttgt 600ggcggtttga cagcacttgt tgaagctggt tttgaaacac tgacagaagc tggatatgct 660ggcgaattgg cttactttga agtgctgcat gaaatgaaat tgattgttga ccttatgtac 720gaaggtggtt tcactaaaat gcgtcagtca atctcaaaca ctgccgaatt tggtgattat 780gtgactggac cacgcattat tactgacgaa gttaaaaaga atatgaaact cgtgttggct 840gacattcaat caggaaaatt tgcgcaagat ttcgttgatg atttcaaagc tggacgtcca 900aaattaactg cttatcgtga agcagctaaa aatctggaaa ttgaaaaaat cggtgcagaa 960ctacgtaaag caatgccatt tacacaatct ggtgatgacg acgcctttaa aatttatcaa

1020taa 102316340PRTLactococcus lactis 16Met Ala Val Thr Met Tyr Tyr Glu Glu Asp Val Glu Val Ala Ala Leu 1 5 10 15 Ala Gly Lys Lys Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asp Val Ile Ile Gly Val 35 40 45 Arg Gln Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ala Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Glu Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Phe Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Thr Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Glu Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Thr Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Thr Gln Ser Gly Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Gln 340 171023DNALactococcus lactis 17atggcagtta caatgtatta tgaagaagat gtagaagtag ccgcactcgc gggtaagaaa 60atcgcagtga ttggatatgg ctcacaagga cacgctcatg cacaaaactt gcgtgattct 120ggtcatgatg tgattattgg tgtccgtcag gggaaatctt ttgataaagc aaaagaagat 180ggttttgaaa catttgaagt aggagaagca gtagctaaag ctgacgtcat tatggttctg 240gcacctgatg aacttcaaca atctatttat gaagaggaca taaaaccaaa tttgaaagca 300ggttcagcac ttggttttgc ccatggtttc aatattcatt ttggctatat tgaagttcca 360gaagatgttg atgtcttcat ggttgcgcca aaagcgccgg gacatctcgt tcggcggact 420tttaccgaag gtttcggaac gccagctttg ttcgtttcgc atcaaaatgc cactggtcat 480gcgcgtgaaa ttgccatgga ctgggccaaa ggaattggct gtgcccgtgt cggtatcatt 540gaaacaactt tcaaagaaga aacagaagaa gatttgtttg gcgaacaggc cgtgctttgt 600ggcggtttga cagcacttgt tgaagctggt tttgaaacac tgacagaagc tggatatgct 660ggcgaattgg cttactttga agtgctgcat gaaatgaaat tgattgttga ccttatgtac 720gaaggtggtt tcactaaaat gcgtcagtca atctcaaaca ctgccgaatt tggtgattat 780gtgactggac cacgcattat tactgacgaa gttaaaaaga atatgaaact cgtgttggct 840gacattcaat caggaaaatt tgcgcaagat ttcgttgatg atttcaaagc tggacgtcca 900aaattaactg cttatcgtga agcagctaaa aatctggaaa ttgaaaaaat cggtgcagaa 960ctacgtaaag caatgccatt tacacaatct ggtgatgacg acgcctttaa aatttatcaa 1020taa 102318340PRTLactococcus lactis 18Met Ala Val Thr Met Tyr Tyr Glu Glu Asp Val Glu Val Ala Ala Leu 1 5 10 15 Ala Gly Lys Lys Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asp Val Ile Ile Gly Val 35 40 45 Arg Gln Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ala Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Glu Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Phe Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Thr Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Glu Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Thr Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Thr Gln Ser Gly Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Gln 340 191023DNALactococcus lactis 19atggcagtta caatgtatta tgaagaagat gtagaagtag ccgcactcgc gggtaagaaa 60atcgcagtga ttggatatgg ctcacaagga cacgctcatg cacaaaactt gcgtgattct 120ggtcatgatg tgattattgg cgttcgtcag gggaaatctt ttgatagagc aaaagaagat 180ggctttgaaa catttgaagt aggagaagca gtagctaaag ctgatgtcat tatggttctg 240gcacctgatg aacttcaaca atctatttat gaagaggaca taaaaccaaa tttgaaatca 300ggttcagcac ttggttttgc ccatggtttc aatattcatt ttggctatat tgaagttcca 360gaagatgttg atgtcttcat ggttgcgcca aaagcgccgg gacatctcgt tcggcggact 420tttaccgaag gtttcggaac gccagctttg ttcgtttcgc atcaaaatgc cactggtcat 480gcgcgtgaaa tcgctatgga ctgggcgaaa ggcattggtt gtgcccgtgt gggaattatc 540gaaacaactt tcaaagaaga aacagaagaa gatttgtttg gcgaacaagc tgtgctttgt 600ggtggtttga cagcacttgt tgaagctggt tttgaaacac tgacagaagc tagatatgct 660ggtgaattgg cttactttga agtgctgcat gaaatgaaat tgattgttga ccttatgtac 720gaaggtggtt tcactaaaat gcgtcagtca atctcaaata ctgccgaatt tggcgattat 780gtgactggac cacgcattat tactgacgaa gttaaaaaga atatgaaact cgtgttggct 840gacattcaat caggaaaatt tgcgcaagat ttcgttgatg atttcaaagc tggacgtcca 900aaattaactg cttatcgtga agcagctaaa aatctggaaa ttgaaaaaat cggtgcagaa 960ctacgtaaag caatgccatt tacacaatct ggtgatgacg acgcctttaa aatttatcaa 1020taa 102320340PRTLactococcus lactis 20Met Ala Val Thr Met Tyr Tyr Glu Glu Asp Val Glu Val Ala Ala Leu 1 5 10 15 Ala Gly Lys Lys Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asp Val Ile Ile Gly Val 35 40 45 Arg Gln Gly Lys Ser Phe Asp Arg Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ser Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Glu Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Phe Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Thr Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Arg Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Glu Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Thr Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Thr Gln Ser Gly Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Gln 340 211034DNALactococcus lactis 21atggcagtta caatgtatta tgaagatgat gtagaagtat cagcacttgc tggaaagcaa 60attgcagtaa tcggttatgg ttcacaagga catgctcacg cacagaattt gcgtgattct 120ggtcacaacg ttatcattgg tgtgcgccac ggaaaatctt ttgataaagc aaaagaagat 180ggctttgaaa catttgaagt aggagaagca gtagctaaag ctgatgttat tatggttttg 240gcaccagatg aacttcaaca atccatttat gaagaggaca tcaaaccaaa cttgaaagca 300ggttcagcac ttggttttgc tcacggattt aatatccatt ttggctatat taaagtacca 360gaagacgttg acgtctttat ggttgcgcct aaggctccag gtcaccttgt ccgtcggact 420tatactgaag gttttggtac accagctttg tttgtttcac accaaaatgc aagtggtcat 480gcgcgtgaaa tcgcaatgga ttgggccaaa ggaattggtt gtgctcgagt gggaattatt 540gaaacaactt ttaaagaaga aacagaagaa gatttgtttg gagaacaagc tgttctatgt 600ggaggtttga cagcacttgt tgaagccggt tttgaaacac tgacagaagc tggatacgct 660ggcgaattgg cttactttga agttttgcac gaaatgaaat tgattgttga cctcatgtat 720gaaggtggtt ttactaaaat gcgtcaatcc atctcaaata ctgctgagtt tggcgattat 780gtgactggtc cacggattat tactgacgaa gttaaaaaga atatgaagct tgttttggct 840gatattcaat ctggaaaatt tgctcaagat ttcgttgatg acttcaaagc ggggcgtcca 900aaattaatag cctatcgcga agctgcaaaa aatcttgaaa ttgaaaaaat tggggcagag 960cacgtcaagc aatgccattc acacaatctg gtgatgacga tgcctttaaa atctatcagt 1020aatttctctt attg 103422344PRTLactococcus lactis 22Met Ala Val Thr Met Tyr Tyr Glu Asp Asp Val Glu Val Ser Ala Leu 1 5 10 15 Ala Gly Lys Gln Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asn Val Ile Ile Gly Val 35 40 45 Arg His Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Phe Glu Val Gly Glu Ala Val Ala Lys Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Leu Gln Gln Ser Ile Tyr Glu Glu Asp Ile Lys Pro 85 90 95 Asn Leu Lys Ala Gly Ser Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 His Phe Gly Tyr Ile Lys Val Pro Glu Asp Val Asp Val Phe Met Val 115 120 125 Ala Pro Lys Ala Pro Gly His Leu Val Arg Arg Thr Tyr Thr Glu Gly 130 135 140 Phe Gly Thr Pro Ala Leu Phe Val Ser His Gln Asn Ala Ser Gly His 145 150 155 160 Ala Arg Glu Ile Ala Met Asp Trp Ala Lys Gly Ile Gly Cys Ala Arg 165 170 175 Val Gly Ile Ile Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Val Glu 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Gly Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Phe Thr Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Thr Gly Pro Arg Ile Ile Thr Asp Glu Val Lys 260 265 270 Lys Asn Met Lys Leu Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Gln Asp Phe Val Asp Asp Phe Lys Ala Gly Arg Pro Lys Leu Ile Ala 290 295 300 Tyr Arg Glu Ala Ala Lys Asn Leu Glu Ile Glu Lys Ile Gly Ala Glu 305 310 315 320 His Val Lys Gln Cys His Ser His Asn Leu Val Met Thr Met Pro Leu 325 330 335 Lys Ser Ile Ser Asn Phe Ser Tyr 340 231023DNAStreptococcus equinus 23atggcagtaa caatggaata cgaaaaagat gtaaaagtag cagctcttga tggtaaaaaa 60attgccgtta tcggttatgg atcacaaggt catgctcatg ctcaaaactt acgtgattca 120ggtcacgatg ttatcattgg ggttcgccat ggtaaatcat tcgacaaagc aaaagaagat 180ggtttcgaaa catatgaagt agctgaagca acaaaacttg ctgatgttat catggttttg 240gcaccagatg aaatccaagc aaaactttat gctgaagaaa ttgcaccaaa tcttgaagca 300ggtaatgcac ttggttttgc tcatggtttc aatatccgtt ttgaatatat taaagctcca 360gaaacagtag atgtctttat gtgtgcgcct aaaggtccag gtcaccttgt acgccgtact 420tacactgaag gatttggtgt gccagcactt tacgctgttt atcaagatgc tactggtcat 480gctaaagaca tcgcaatgga ctggtctaaa ggtatcggtg ctgcgcgtgt tggacttctt 540gaaactacat tcaaagaaga aactgaagaa gatttgttcg gtgaacaagc agttctttgt 600ggtggtttga ctgcccttat cgaagcaggt tttgaagttc ttactgaagc aggctatgct 660ccagaattgg cttacttcga agttcttcat gaaatgaaac ttatcgttga ccttatttac 720gaaggtggat tcaagaaaat gcgtcaatca atttcaaata cagctgaatt tggtgactat 780gtttcaggtc cacgtgtcat cactaaagat gttaaagaaa atatgaaagc cgttcttgct 840gatattcaat caggtaaatt tgctgaagaa tttgtaagcg actataaagc tggtcgtcca 900aaacttgaag cttatcgtaa agaagctgca gaacttgaaa ttgaaaaagt gggtgcagaa 960cttcgtaaag caatgccttt tgttaaccaa aatgatgacg atgcattcaa aatttataac 1020taa 102324340PRTStreptococcus equinus 24Met Ala Val Thr Met Glu Tyr Glu Lys Asp Val Lys Val Ala Ala Leu 1 5 10 15 Asp Gly Lys Lys Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asp Val Ile Ile Gly Val 35 40 45 Arg His Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Glu Thr 50 55 60 Tyr Glu Val Ala Glu Ala Thr Lys Leu Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Ile Gln Ala Lys Leu Tyr Ala Glu Glu Ile Ala Pro 85 90 95 Asn Leu Glu Ala Gly Asn Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 Arg Phe Glu Tyr Ile Lys Ala Pro Glu Thr Val Asp Val Phe Met Cys 115 120 125 Ala Pro Lys Gly Pro Gly His Leu Val Arg Arg Thr Tyr Thr Glu Gly 130 135 140 Phe Gly Val Pro Ala Leu Tyr Ala Val Tyr Gln Asp Ala Thr Gly His 145 150 155 160 Ala Lys Asp Ile Ala Met Asp Trp Ser Lys Gly Ile Gly Ala Ala Arg 165 170 175 Val Gly Leu Leu Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Ile Glu 195 200 205 Ala Gly Phe Glu Val Leu Thr Glu Ala Gly Tyr Ala Pro Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val

Asp Leu Ile Tyr 225 230 235 240 Glu Gly Gly Phe Lys Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Ser Gly Pro Arg Val Ile Thr Lys Asp Val Lys 260 265 270 Glu Asn Met Lys Ala Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Glu Glu Phe Val Ser Asp Tyr Lys Ala Gly Arg Pro Lys Leu Glu Ala 290 295 300 Tyr Arg Lys Glu Ala Ala Glu Leu Glu Ile Glu Lys Val Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Val Asn Gln Asn Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Asn 340 251023DNAStreptococcus infantarius 25atggcagtaa caatggaata cgaaaaagac gtaaaagtag cagctcttga tggtaaaaaa 60attgccgtta ttggttatgg atcacaaggt catgctcatg ctcaaaactt gcgtgactca 120ggtcacgatg ttatcattgg ggttcgccat ggtaaatcat tcgataaagc aaaagaagat 180ggatttgata cttatgaagt agcagaagca acaaaacttg ctgatgttat catggtattg 240gctcctgatg aaatccaagc taaactttat gctgaagaaa tcgctccaaa ccttgaagct 300ggtaacgctc ttggatttgc acatggtttt aatatccgtt ttggatacat taaagctcca 360gaaacagtag atgtcttcat gtgtgctcct aaaggaccag gtcaccttgt tcgtcgtact 420tacacagaag gatttggtgt accagcactt tacgctgttt accaagatgc tactggtaat 480gctaaagaca tcgcaatgga ttggtctaaa ggtatcggtg ctgcacgtgt tggacttctt 540gaaacaacat ttaaagaaga aactgaagaa gacctctttg gtgaacaagc agtactttgt 600ggtggtttaa ctgctcttat cgaagctggt tttgaagttc ttactgaagc tggctatgct 660ccagaattgg cttactttga agttcttcat gaaatgaaac ttatcgttga ccttatctac 720gaaggtggat tcaagaaaat gcgtcaatca atttcaaata cagctgaatt tggtgactac 780gtatctggac cacgtgttat cactaaagat gttaaagaaa atatgaaagc tgttcttgct 840gatatccaat caggtaaatt cgctgaagat tttgttaacg actaccaagc aggtcgtcca 900aaacttgaag cataccgtaa agaagctgca gctcttgaaa ttgaaaaagt gggtgctgaa 960cttcgtaaag caatgccttt tgttaaccaa aacgatgacg atgcattcaa aatttataac 1020taa 102326340PRTStreptococcus infantarius 26Met Ala Val Thr Met Glu Tyr Glu Lys Asp Val Lys Val Ala Ala Leu 1 5 10 15 Asp Gly Lys Lys Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly His Ala 20 25 30 His Ala Gln Asn Leu Arg Asp Ser Gly His Asp Val Ile Ile Gly Val 35 40 45 Arg His Gly Lys Ser Phe Asp Lys Ala Lys Glu Asp Gly Phe Asp Thr 50 55 60 Tyr Glu Val Ala Glu Ala Thr Lys Leu Ala Asp Val Ile Met Val Leu 65 70 75 80 Ala Pro Asp Glu Ile Gln Ala Lys Leu Tyr Ala Glu Glu Ile Ala Pro 85 90 95 Asn Leu Glu Ala Gly Asn Ala Leu Gly Phe Ala His Gly Phe Asn Ile 100 105 110 Arg Phe Gly Tyr Ile Lys Ala Pro Glu Thr Val Asp Val Phe Met Cys 115 120 125 Ala Pro Lys Gly Pro Gly His Leu Val Arg Arg Thr Tyr Thr Glu Gly 130 135 140 Phe Gly Val Pro Ala Leu Tyr Ala Val Tyr Gln Asp Ala Thr Gly Asn 145 150 155 160 Ala Lys Asp Ile Ala Met Asp Trp Ser Lys Gly Ile Gly Ala Ala Arg 165 170 175 Val Gly Leu Leu Glu Thr Thr Phe Lys Glu Glu Thr Glu Glu Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Ile Glu 195 200 205 Ala Gly Phe Glu Val Leu Thr Glu Ala Gly Tyr Ala Pro Glu Leu Ala 210 215 220 Tyr Phe Glu Val Leu His Glu Met Lys Leu Ile Val Asp Leu Ile Tyr 225 230 235 240 Glu Gly Gly Phe Lys Lys Met Arg Gln Ser Ile Ser Asn Thr Ala Glu 245 250 255 Phe Gly Asp Tyr Val Ser Gly Pro Arg Val Ile Thr Lys Asp Val Lys 260 265 270 Glu Asn Met Lys Ala Val Leu Ala Asp Ile Gln Ser Gly Lys Phe Ala 275 280 285 Glu Asp Phe Val Asn Asp Tyr Gln Ala Gly Arg Pro Lys Leu Glu Ala 290 295 300 Tyr Arg Lys Glu Ala Ala Ala Leu Glu Ile Glu Lys Val Gly Ala Glu 305 310 315 320 Leu Arg Lys Ala Met Pro Phe Val Asn Gln Asn Asp Asp Asp Ala Phe 325 330 335 Lys Ile Tyr Asn 340 27993DNAMethanococcus maripaludis 27atgaaggtat tctatgactc agattttaaa ttagatgctt taaaagaaaa aacaattgca 60gtaatcggtt atggaagtca aggtagggca cagtccttaa acatgaaaga cagcggatta 120aacgttgttg ttggtttaag aaaaaacggt gcttcatggg aaaacgctaa agcagacggt 180cacaacgtaa tgactatcga agaagctgct gaaaaagctg acatcatcca catcttaatt 240cctgacgaat tacaggcaga agtttatgaa agccagataa aaccatattt aaaggaagga 300aaaacactca gcttttcaca tggttttaac atccactatg gattcattgt tccaccaaag 360ggagttaacg tggttttagt tgctccaaaa tcacctggaa aaatggttag aagaacatac 420gaagaaggct tcggtgttcc aggtttaatc tgtatcgaaa tcgatgcaac aaacaacgca 480tttgacattg tttcagcaat ggcaaaagga atcggtttat caagggccgg agttatccag 540acaactttca aagaagaaac agaaactgac cttttcggtg aacaagctgt tttatgcggc 600ggagttaccg aattaatcaa agcaggattc gaaacacttg ttgaagcagg atacgcacca 660gaaatggcat actttgaaac atgccacgaa ttgaaattaa ttgttgactt aatctaccaa 720aaaggattca aaaacatgtg gaacgatgta agtaacactg cagaatacgg tggacttaca 780agaagaagca gaatcgttac agctgactca aaagctgcaa tgaaagaaat cttaaaagaa 840atccaagatg gaagattcac aaaagaattc gtgcttgaaa aacaagtaaa ccacgcgcac 900ttaaaagcaa tgagaagaat cgaaggagac ttacaaatcg aagaagtcgg tgcaaaatta 960agaaaaatgt gcggtcttga aaaagaagaa tga 99328330PRTMethanococcus maripaludis 28Met Lys Val Phe Tyr Asp Ser Asp Phe Lys Leu Asp Ala Leu Lys Glu 1 5 10 15 Lys Thr Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly Arg Ala Gln Ser 20 25 30 Leu Asn Met Lys Asp Ser Gly Leu Asn Val Val Val Gly Leu Arg Lys 35 40 45 Asn Gly Ala Ser Trp Glu Asn Ala Lys Ala Asp Gly His Asn Val Met 50 55 60 Thr Ile Glu Glu Ala Ala Glu Lys Ala Asp Ile Ile His Ile Leu Ile 65 70 75 80 Pro Asp Glu Leu Gln Ala Glu Val Tyr Glu Ser Gln Ile Lys Pro Tyr 85 90 95 Leu Lys Glu Gly Lys Thr Leu Ser Phe Ser His Gly Phe Asn Ile His 100 105 110 Tyr Gly Phe Ile Val Pro Pro Lys Gly Val Asn Val Val Leu Val Ala 115 120 125 Pro Lys Ser Pro Gly Lys Met Val Arg Arg Thr Tyr Glu Glu Gly Phe 130 135 140 Gly Val Pro Gly Leu Ile Cys Ile Glu Ile Asp Ala Thr Asn Asn Ala 145 150 155 160 Phe Asp Ile Val Ser Ala Met Ala Lys Gly Ile Gly Leu Ser Arg Ala 165 170 175 Gly Val Ile Gln Thr Thr Phe Lys Glu Glu Thr Glu Thr Asp Leu Phe 180 185 190 Gly Glu Gln Ala Val Leu Cys Gly Gly Val Thr Glu Leu Ile Lys Ala 195 200 205 Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala Tyr 210 215 220 Phe Glu Thr Cys His Glu Leu Lys Leu Ile Val Asp Leu Ile Tyr Gln 225 230 235 240 Lys Gly Phe Lys Asn Met Trp Asn Asp Val Ser Asn Thr Ala Glu Tyr 245 250 255 Gly Gly Leu Thr Arg Arg Ser Arg Ile Val Thr Ala Asp Ser Lys Ala 260 265 270 Ala Met Lys Glu Ile Leu Lys Glu Ile Gln Asp Gly Arg Phe Thr Lys 275 280 285 Glu Phe Val Leu Glu Lys Gln Val Asn His Ala His Leu Lys Ala Met 290 295 300 Arg Arg Ile Glu Gly Asp Leu Gln Ile Glu Glu Val Gly Ala Lys Leu 305 310 315 320 Arg Lys Met Cys Gly Leu Glu Lys Glu Glu 325 330 29993DNAMethanococcus maripaludis 29atgaaggtat tctatgactc agattttaaa ttagatgctt taaaagaaaa aacaattgca 60gtaatcggtt acggaagtca aggaagagca cagtccttaa acatgaaaga cagtggatta 120aacgttgttg ttggtttaag gaaaaatgga gcttcgtggg aaaacgctaa agcagacggt 180cacaatgtaa tgactatcga agaagctgct gaaaaagctg acatcatcca catcttaatc 240cctgacgaat tacaggcaga agtttacgat gctcaaataa aaccatacct caaagaagga 300aaaacactca gtttctcaca tggttttaac atccactatg gattcattgt tccaccaaaa 360ggagttaacg tggttttagt tgctccaaaa tcacctggaa aaatggttag aagaacatac 420gaagaaggtt tcggtgttcc aggtttaatc tgtatcgaaa tagatgcaac aaacaacgca 480tttgacattg tttcagcaat ggcaaaagga atcggtttat caagagctgg agttatccag 540acaacattta aagaagaaac agaaactgac cttttcggtg aacaagctgt tttatgcggt 600ggagttaccg aattaatcaa agcaggattt gaaacactcg tagaagcagg atacgcacca 660gaaatggcat actttgaaac atgccacgaa ttgaaattaa tcgttgactt aatctaccaa 720aaaggattca aaaacatgtg gaacgacgta agtaacactg cagaatacgg tggacttaca 780agaagaagca gaattgtaac tgctgattca aaagctgcaa tgaaagaaat cttaaaagaa 840atccaagacg gaagattcac aaaagaattc gttcttgaaa aacaagtaaa ccacgcacat 900ttaaaagcaa tgagaagact cgaaggagaa ttacaaatcg aagaagtcgg tgcaaaatta 960agaaaaatgt gcggtcttga aaaagaagaa taa 99330330PRTMethanococcus maripaludis 30Met Lys Val Phe Tyr Asp Ser Asp Phe Lys Leu Asp Ala Leu Lys Glu 1 5 10 15 Lys Thr Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly Arg Ala Gln Ser 20 25 30 Leu Asn Met Lys Asp Ser Gly Leu Asn Val Val Val Gly Leu Arg Lys 35 40 45 Asn Gly Ala Ser Trp Glu Asn Ala Lys Ala Asp Gly His Asn Val Met 50 55 60 Thr Ile Glu Glu Ala Ala Glu Lys Ala Asp Ile Ile His Ile Leu Ile 65 70 75 80 Pro Asp Glu Leu Gln Ala Glu Val Tyr Asp Ala Gln Ile Lys Pro Tyr 85 90 95 Leu Lys Glu Gly Lys Thr Leu Ser Phe Ser His Gly Phe Asn Ile His 100 105 110 Tyr Gly Phe Ile Val Pro Pro Lys Gly Val Asn Val Val Leu Val Ala 115 120 125 Pro Lys Ser Pro Gly Lys Met Val Arg Arg Thr Tyr Glu Glu Gly Phe 130 135 140 Gly Val Pro Gly Leu Ile Cys Ile Glu Ile Asp Ala Thr Asn Asn Ala 145 150 155 160 Phe Asp Ile Val Ser Ala Met Ala Lys Gly Ile Gly Leu Ser Arg Ala 165 170 175 Gly Val Ile Gln Thr Thr Phe Lys Glu Glu Thr Glu Thr Asp Leu Phe 180 185 190 Gly Glu Gln Ala Val Leu Cys Gly Gly Val Thr Glu Leu Ile Lys Ala 195 200 205 Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala Tyr 210 215 220 Phe Glu Thr Cys His Glu Leu Lys Leu Ile Val Asp Leu Ile Tyr Gln 225 230 235 240 Lys Gly Phe Lys Asn Met Trp Asn Asp Val Ser Asn Thr Ala Glu Tyr 245 250 255 Gly Gly Leu Thr Arg Arg Ser Arg Ile Val Thr Ala Asp Ser Lys Ala 260 265 270 Ala Met Lys Glu Ile Leu Lys Glu Ile Gln Asp Gly Arg Phe Thr Lys 275 280 285 Glu Phe Val Leu Glu Lys Gln Val Asn His Ala His Leu Lys Ala Met 290 295 300 Arg Arg Leu Glu Gly Glu Leu Gln Ile Glu Glu Val Gly Ala Lys Leu 305 310 315 320 Arg Lys Met Cys Gly Leu Glu Lys Glu Glu 325 330 31993DNAMethanococcus maripaludis 31atgaaggtat tctatgactc agattttaaa ttagatgctt taaaagaaaa aacaatcgca 60gtaatcggtt acggaagcca aggtcgggca cagtccttaa acatgaaaga cagcggatta 120aacgttgttg ttggtttaag aaaaaatggt gcttcatggg aaaacgctaa agcagacggt 180cacaatgtaa tgaccatcga agaagctgct gaaaaagctg acatcatcca catcttaatc 240cctgacgaat tacaggcaga agtttacgat gctcaaataa aaccatgcct caaagaagga 300aaaacactca gcttttcaca tggttttaac atccactatg gattcattgt tccaccaaaa 360ggagttaacg tggttttagt tgctccaaaa tcaccaggaa aaatggttag aagaacatac 420gaagaaggtt tcggtgttcc aggattaatc tgtatcgaaa ttgatgcaac aaacaatgca 480tttgacattg tttcagcaat ggcaaaagga atcggtttat caagagctgg agttatccag 540acaacattta aagaagaaac agaaaccgat cttttcggtg aacaagctgt tttatgcggt 600ggagttaccg aattaatcaa agcaggattt gaaacactcg ttgaagcagg atacgcacca 660gaaatggctt actttgaaac atgtcacgaa ttgaaattaa ttgttgactt aatctaccaa 720aaaggattca aaaacatgtg gaacgatgta agtaacactg ctgaatatgg tggacttaca 780agaagaagca gaattgttac tgctgactca aaagctgcaa tgaaagaaat tttaaaagaa 840atccaagacg gaagattcac aaaagaattc gtgcttgaaa aacaagtaaa ccacgcgcac 900ttaaaagcaa tgagaagaat cgaaggagaa ttacaaatcg aggaagtcgg cgcaaaatta 960agaaaaatgt gcggtcttga aaaagaagaa taa 99332330PRTMethanococcus maripaludis 32Met Lys Val Phe Tyr Asp Ser Asp Phe Lys Leu Asp Ala Leu Lys Glu 1 5 10 15 Lys Thr Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly Arg Ala Gln Ser 20 25 30 Leu Asn Met Lys Asp Ser Gly Leu Asn Val Val Val Gly Leu Arg Lys 35 40 45 Asn Gly Ala Ser Trp Glu Asn Ala Lys Ala Asp Gly His Asn Val Met 50 55 60 Thr Ile Glu Glu Ala Ala Glu Lys Ala Asp Ile Ile His Ile Leu Ile 65 70 75 80 Pro Asp Glu Leu Gln Ala Glu Val Tyr Asp Ala Gln Ile Lys Pro Cys 85 90 95 Leu Lys Glu Gly Lys Thr Leu Ser Phe Ser His Gly Phe Asn Ile His 100 105 110 Tyr Gly Phe Ile Val Pro Pro Lys Gly Val Asn Val Val Leu Val Ala 115 120 125 Pro Lys Ser Pro Gly Lys Met Val Arg Arg Thr Tyr Glu Glu Gly Phe 130 135 140 Gly Val Pro Gly Leu Ile Cys Ile Glu Ile Asp Ala Thr Asn Asn Ala 145 150 155 160 Phe Asp Ile Val Ser Ala Met Ala Lys Gly Ile Gly Leu Ser Arg Ala 165 170 175 Gly Val Ile Gln Thr Thr Phe Lys Glu Glu Thr Glu Thr Asp Leu Phe 180 185 190 Gly Glu Gln Ala Val Leu Cys Gly Gly Val Thr Glu Leu Ile Lys Ala 195 200 205 Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala Tyr 210 215 220 Phe Glu Thr Cys His Glu Leu Lys Leu Ile Val Asp Leu Ile Tyr Gln 225 230 235 240 Lys Gly Phe Lys Asn Met Trp Asn Asp Val Ser Asn Thr Ala Glu Tyr 245 250 255 Gly Gly Leu Thr Arg Arg Ser Arg Ile Val Thr Ala Asp Ser Lys Ala 260 265 270 Ala Met Lys Glu Ile Leu Lys Glu Ile Gln Asp Gly Arg Phe Thr Lys 275 280 285 Glu Phe Val Leu Glu Lys Gln Val Asn His Ala His Leu Lys Ala Met 290 295 300 Arg Arg Ile Glu Gly Glu Leu Gln Ile Glu Glu Val Gly Ala Lys Leu 305 310 315 320 Arg Lys Met Cys Gly Leu Glu Lys Glu Glu 325 330 33993DNAMethanococcus maripaludis 33atgaaggtat tctatgactc agattttaaa ttagatgctt taaaagaaaa aacaattgca 60gtaatcggtt atggaagtca aggtagggca cagtccttaa acatgaaaga cagcggatta 120aacgttgttg ttggtttaag aaaaaacggt gcttcatgga acaacgctaa agcagacggt 180cacaatgtaa tgaccattga agaagctgct gaaaaagcgg acatcatcca catcttaata 240cctgatgaat tacaggcaga agtttatgaa agccagataa aaccatacct aaaagaagga 300aaaacactaa gcttttcaca tggttttaac atccactatg gattcattgt tccaccaaaa 360ggagttaacg tggttttagt tgctccaaaa tcacctggaa aaatggttag aagaacatac 420gaagaaggtt tcggtgttcc aggtttaatc tgtattgaaa ttgatgcaac aaacaacgca 480tttgatattg tttcagcaat ggcaaaagga atcggtttat caagagctgg agttatccag 540acaactttca aagaagaaac agaaactgac cttttcggtg aacaagctgt tttatgcggt 600ggagttaccg aattaatcaa ggcaggattt gaaacactcg ttgaagcagg atacgcacca 660gaaatggcat actttgaaac ctgccacgaa ttgaaattaa tcgttgactt aatctaccaa 720aaaggattca aaaacatgtg gaacgatgta agtaacactg cagaatacgg cggacttaca 780agaagaagca gaatcgttac agctgattca aaagctgcaa tgaaagaaat cttaagagaa 840atccaagatg gaagattcac aaaagaattc cttctcgaaa aacaggtaag ctatgctcat 900ttaaaatcaa tgagaagact cgaaggagac ttacaaatcg aagaagtcgg cgcaaaatta 960agaaaaatgt gcggtcttga aaaagaagaa taa 99334330PRTMethanococcus maripaludis 34Met Lys Val Phe Tyr Asp Ser Asp Phe Lys Leu Asp Ala Leu Lys Glu 1 5 10 15 Lys Thr Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly Arg Ala Gln Ser 20

25 30 Leu Asn Met Lys Asp Ser Gly Leu Asn Val Val Val Gly Leu Arg Lys 35 40 45 Asn Gly Ala Ser Trp Asn Asn Ala Lys Ala Asp Gly His Asn Val Met 50 55 60 Thr Ile Glu Glu Ala Ala Glu Lys Ala Asp Ile Ile His Ile Leu Ile 65 70 75 80 Pro Asp Glu Leu Gln Ala Glu Val Tyr Glu Ser Gln Ile Lys Pro Tyr 85 90 95 Leu Lys Glu Gly Lys Thr Leu Ser Phe Ser His Gly Phe Asn Ile His 100 105 110 Tyr Gly Phe Ile Val Pro Pro Lys Gly Val Asn Val Val Leu Val Ala 115 120 125 Pro Lys Ser Pro Gly Lys Met Val Arg Arg Thr Tyr Glu Glu Gly Phe 130 135 140 Gly Val Pro Gly Leu Ile Cys Ile Glu Ile Asp Ala Thr Asn Asn Ala 145 150 155 160 Phe Asp Ile Val Ser Ala Met Ala Lys Gly Ile Gly Leu Ser Arg Ala 165 170 175 Gly Val Ile Gln Thr Thr Phe Lys Glu Glu Thr Glu Thr Asp Leu Phe 180 185 190 Gly Glu Gln Ala Val Leu Cys Gly Gly Val Thr Glu Leu Ile Lys Ala 195 200 205 Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala Tyr 210 215 220 Phe Glu Thr Cys His Glu Leu Lys Leu Ile Val Asp Leu Ile Tyr Gln 225 230 235 240 Lys Gly Phe Lys Asn Met Trp Asn Asp Val Ser Asn Thr Ala Glu Tyr 245 250 255 Gly Gly Leu Thr Arg Arg Ser Arg Ile Val Thr Ala Asp Ser Lys Ala 260 265 270 Ala Met Lys Glu Ile Leu Arg Glu Ile Gln Asp Gly Arg Phe Thr Lys 275 280 285 Glu Phe Leu Leu Glu Lys Gln Val Ser Tyr Ala His Leu Lys Ser Met 290 295 300 Arg Arg Leu Glu Gly Asp Leu Gln Ile Glu Glu Val Gly Ala Lys Leu 305 310 315 320 Arg Lys Met Cys Gly Leu Glu Lys Glu Glu 325 330 35993DNAMethanococcus vannielii 35atgaaggtat tctacgatgc agacataaaa ttagacgctt taaaaagtaa aacaattgca 60gttattggtt acggaagtca gggtagagcc cagtctttaa acatgaaaga cagcggttta 120aacgttgtag ttggtttaag gaaaaacggt gcttcatggg aaaacgctaa aaacgatggt 180catgaagtat taacgattga agaagcttca aaaaaagcag acataattca tatattaatc 240cctgatgaat tacaggctga agtttacgaa agccagataa aaccatacct tacagaagga 300aaaacattaa gcttctcaca cggctttaat atccattatg ggtttattat tccgccaaaa 360ggagttaacg tggttttagt tgcaccaaag tcacccggta aaatggttag aaaaacatac 420gaagaaggat ttggtgttcc gggattaatc tgtatagaag tagatgctac aaatactgca 480tttgagactg tttcagcaat ggcaaagggg atcggcctct caagagcagg cgttatccag 540acaacattta gggaggaaac tgaaaccgat ctttttggtg aacaggcagt attgtgcggc 600ggagttactg aattaattaa agcaggattt gaaacactcg ttgaagcagg atattcacct 660gaaatggcgt attttgaaac atgccacgag ttaaaattaa ttgttgactt aatttaccaa 720aaaggattca aaaacatgtg gcatgatgta agtaatactg cagaatatgg tggacttaca 780agaagaagca gaatcgttac tgctgactca aaagctgcga tgaaagaaat tttaaaagag 840attcaagatg gaagatttac aaaagaattt gttcttgaaa atcaagctaa aatggcacat 900ttaaaagcaa tgaggagact tgaaggcgaa ttgcaaattg aagaagtcgg ttcaaagtta 960agaaaaatgt gtggtcttga aaaagacgaa taa 99336330PRTMethanococcus vannielii 36Met Lys Val Phe Tyr Asp Ala Asp Ile Lys Leu Asp Ala Leu Lys Ser 1 5 10 15 Lys Thr Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly Arg Ala Gln Ser 20 25 30 Leu Asn Met Lys Asp Ser Gly Leu Asn Val Val Val Gly Leu Arg Lys 35 40 45 Asn Gly Ala Ser Trp Glu Asn Ala Lys Asn Asp Gly His Glu Val Leu 50 55 60 Thr Ile Glu Glu Ala Ser Lys Lys Ala Asp Ile Ile His Ile Leu Ile 65 70 75 80 Pro Asp Glu Leu Gln Ala Glu Val Tyr Glu Ser Gln Ile Lys Pro Tyr 85 90 95 Leu Thr Glu Gly Lys Thr Leu Ser Phe Ser His Gly Phe Asn Ile His 100 105 110 Tyr Gly Phe Ile Ile Pro Pro Lys Gly Val Asn Val Val Leu Val Ala 115 120 125 Pro Lys Ser Pro Gly Lys Met Val Arg Lys Thr Tyr Glu Glu Gly Phe 130 135 140 Gly Val Pro Gly Leu Ile Cys Ile Glu Val Asp Ala Thr Asn Thr Ala 145 150 155 160 Phe Glu Thr Val Ser Ala Met Ala Lys Gly Ile Gly Leu Ser Arg Ala 165 170 175 Gly Val Ile Gln Thr Thr Phe Arg Glu Glu Thr Glu Thr Asp Leu Phe 180 185 190 Gly Glu Gln Ala Val Leu Cys Gly Gly Val Thr Glu Leu Ile Lys Ala 195 200 205 Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ser Pro Glu Met Ala Tyr 210 215 220 Phe Glu Thr Cys His Glu Leu Lys Leu Ile Val Asp Leu Ile Tyr Gln 225 230 235 240 Lys Gly Phe Lys Asn Met Trp His Asp Val Ser Asn Thr Ala Glu Tyr 245 250 255 Gly Gly Leu Thr Arg Arg Ser Arg Ile Val Thr Ala Asp Ser Lys Ala 260 265 270 Ala Met Lys Glu Ile Leu Lys Glu Ile Gln Asp Gly Arg Phe Thr Lys 275 280 285 Glu Phe Val Leu Glu Asn Gln Ala Lys Met Ala His Leu Lys Ala Met 290 295 300 Arg Arg Leu Glu Gly Glu Leu Gln Ile Glu Glu Val Gly Ser Lys Leu 305 310 315 320 Arg Lys Met Cys Gly Leu Glu Lys Asp Glu 325 330 37990DNAMethanococcus voltae 37atgcaagtac tttacgaagc tgacgcaaac tatgataaat taaaaggcaa aacaatagca 60gttatcggat acggtagcca aggtagagct caatcattaa atatgaaaga gagcggttta 120aacgtaataa tgggtttaag agaaggcggt gcatcctggg aatctgctaa aaaagacggc 180cacgaagtat actcaatcga ggaagctgca aaaatggctg acgttataca tatattaata 240cctgacgaaa tccaaggtaa tgtatacaat agccaaataa aaccttattt ggaagaaggc 300aacacattaa gcttttcaca cggttataat atccatttta actacattgt agcaccaaaa 360ggtgttaata taacaatggt agctcctaaa tcacctggaa aaatggtaag aaaaacctac 420gaagaaggtt tcggtgtacc tggtttaatc tgcatcgaaa aagacgaaac tggcgaagct 480tacgatattg cattaggtat ggcaaaaggt atcggattaa caagagcggg agttattcaa 540acaacattca gggaagaaac agaaaccgat ttattcggtg agcaagctgt tctctgtggt 600ggcgttactg aattaatcaa agcaggattt gagacacttg ttgaagcagg atatgctcca 660gaaatggctt actttgaaac ttgccacgaa ttgaaattaa tcgttgattt aatctaccaa 720aaaggattta aaaatatgtg gcacgatgta agtaatactg cggaatatgg tggacttacc 780agaagagaaa gagtagttac aaaagaatca aaagaagcaa tgaaggaaat cttaaaagaa 840atccaagatg gaagatttac aaaagaattt gctctcgaaa accaagctgg aaaacctcac 900ttaaattcaa tgagaagatt agaaggagaa ttactcatcg aacaagtagg tgctgattta 960aggaaaaaat gcggtttaga aaaagaataa 99038329PRTMethanococcus voltae 38Met Gln Val Leu Tyr Glu Ala Asp Ala Asn Tyr Asp Lys Leu Lys Gly 1 5 10 15 Lys Thr Ile Ala Val Ile Gly Tyr Gly Ser Gln Gly Arg Ala Gln Ser 20 25 30 Leu Asn Met Lys Glu Ser Gly Leu Asn Val Ile Met Gly Leu Arg Glu 35 40 45 Gly Gly Ala Ser Trp Glu Ser Ala Lys Lys Asp Gly His Glu Val Tyr 50 55 60 Ser Ile Glu Glu Ala Ala Lys Met Ala Asp Val Ile His Ile Leu Ile 65 70 75 80 Pro Asp Glu Ile Gln Gly Asn Val Tyr Asn Ser Gln Ile Lys Pro Tyr 85 90 95 Leu Glu Glu Gly Asn Thr Leu Ser Phe Ser His Gly Tyr Asn Ile His 100 105 110 Phe Asn Tyr Ile Val Ala Pro Lys Gly Val Asn Ile Thr Met Val Ala 115 120 125 Pro Lys Ser Pro Gly Lys Met Val Arg Lys Thr Tyr Glu Glu Gly Phe 130 135 140 Gly Val Pro Gly Leu Ile Cys Ile Glu Lys Asp Glu Thr Gly Glu Ala 145 150 155 160 Tyr Asp Ile Ala Leu Gly Met Ala Lys Gly Ile Gly Leu Thr Arg Ala 165 170 175 Gly Val Ile Gln Thr Thr Phe Arg Glu Glu Thr Glu Thr Asp Leu Phe 180 185 190 Gly Glu Gln Ala Val Leu Cys Gly Gly Val Thr Glu Leu Ile Lys Ala 195 200 205 Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala Tyr 210 215 220 Phe Glu Thr Cys His Glu Leu Lys Leu Ile Val Asp Leu Ile Tyr Gln 225 230 235 240 Lys Gly Phe Lys Asn Met Trp His Asp Val Ser Asn Thr Ala Glu Tyr 245 250 255 Gly Gly Leu Thr Arg Arg Glu Arg Val Val Thr Lys Glu Ser Lys Glu 260 265 270 Ala Met Lys Glu Ile Leu Lys Glu Ile Gln Asp Gly Arg Phe Thr Lys 275 280 285 Glu Phe Ala Leu Glu Asn Gln Ala Gly Lys Pro His Leu Asn Ser Met 290 295 300 Arg Arg Leu Glu Gly Glu Leu Leu Ile Glu Gln Val Gly Ala Asp Leu 305 310 315 320 Arg Lys Lys Cys Gly Leu Glu Lys Glu 325 391020DNAZymomonas mobilis 39atgaaagttt attacgatag tgatgctgat cttgggctga tcaagtccaa gaaaatcgct 60attcttggct atggtagcca gggtcacgcc catgcacaga atttgcgcga ttccggtgtt 120gctgaagtag ctattgcgct tcgtcctgat tcggcttctg ttaaaaaagc acaggatgct 180ggtttcaagg ttttgaccaa tgctgaagcc gcaaaatggg ctgatatcct gatgatcttg 240gcacctgatg aacatcaggc tgctatctat gccgaagatt taaaagataa tttgcgccct 300ggtagtgcaa ttgcttttgc tcatggtttg aatatccatt tcggtctgat cgaaccccgc 360aaagatatcg atgttttcat gatcgcaccg aaaggcccag gtcacacggt tcgttctgaa 420tatgtccgtg gcggtggtgt gccttgcttg gtcgccgttg atcaggatgc cagcggtaac 480gctcatgaca tcgctcttgc ttatgcttct ggcatcggtg gcggtcgttc tggtgttatt 540gaaaccactt tccgtgaaga agtcgaaacc gatttgtttg gtgagcaggc tgttctctgc 600ggtggtttga ctgcgcttat cacggctggt tttgaaactt tgactgaagc cggttacgct 660cctgaaatgg cattcttcga atgtatgcat gaaatgaagc tgatcgtgga tctgatctac 720gaagcgggta ttgccaatat gcgttattcg atttctaaca ctgccgaata tggtgatatc 780gtatctggcc cgcgggtcat caatgaagaa tccaaaaagg caatgaaggc tattctggac 840gacatccaga gcggtcgttt tgtcagcaaa tttgttcttg ataaccgcgc tggtcagccg 900gaactcaaag ctgcccgtaa acgtatggct gctcacccga tcgaacaggt tggtgcacgt 960ctgcgtaaaa tgatgccgtg gatcgccagc aacaagctgg ttgataaggc tcgcaactag 102040339PRTZymomonas mobilis 40Met Lys Val Tyr Tyr Asp Ser Asp Ala Asp Leu Gly Leu Ile Lys Ser 1 5 10 15 Lys Lys Ile Ala Ile Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Val Ala Glu Val Ala Ile Ala Leu Arg 35 40 45 Pro Asp Ser Ala Ser Val Lys Lys Ala Gln Asp Ala Gly Phe Lys Val 50 55 60 Leu Thr Asn Ala Glu Ala Ala Lys Trp Ala Asp Ile Leu Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Tyr Ala Glu Asp Leu Lys Asp 85 90 95 Asn Leu Arg Pro Gly Ser Ala Ile Ala Phe Ala His Gly Leu Asn Ile 100 105 110 His Phe Gly Leu Ile Glu Pro Arg Lys Asp Ile Asp Val Phe Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Ser Glu Tyr Val Arg Gly 130 135 140 Gly Gly Val Pro Cys Leu Val Ala Val Asp Gln Asp Ala Ser Gly Asn 145 150 155 160 Ala His Asp Ile Ala Leu Ala Tyr Ala Ser Gly Ile Gly Gly Gly Arg 165 170 175 Ser Gly Val Ile Glu Thr Thr Phe Arg Glu Glu Val Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr Ala Leu Ile Thr 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Phe Phe Glu Cys Met His Glu Met Lys Leu Ile Val Asp Leu Ile Tyr 225 230 235 240 Glu Ala Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Val Ser Gly Pro Arg Val Ile Asn Glu Glu Ser Lys 260 265 270 Lys Ala Met Lys Ala Ile Leu Asp Asp Ile Gln Ser Gly Arg Phe Val 275 280 285 Ser Lys Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ala Arg Lys Arg Met Ala Ala His Pro Ile Glu Gln Val Gly Ala Arg 305 310 315 320 Leu Arg Lys Met Met Pro Trp Ile Ala Ser Asn Lys Leu Val Asp Lys 325 330 335 Ala Arg Asn 411020DNAErythrobacter sp. 41atgaaagtct actacgacgc cgatgccgat cttggcctca tcaaatccaa gaagatcgcc 60gtgctcggct atggctcgca gggccacgct cacgcccaga acctgcgcga cagcggtgtc 120gccgaagtgg caattgccct tcgcgaaggc tcggccacag caaagaaggc gcaagatgca 180ggcttcaagg tgctttccaa taccgaggct gccaagtggg ccgatatcgt gatgatcctc 240gcacccgatg agcatcaggc agcaatctgg gaaaatgatc tcgccggcca catgaagccg 300ggcagcgcga ttgcctttgc ccacggcctc aacattcact tcggccttat cgaagcaccg 360caggatatcg acgtcatcat gatcgcgccc aaaggtccgg ggcacactgt gcgtagcgaa 420taccagcgcg gcggcggcgt cccttgcctg attgctgttc atcaggacgc gagcggcagc 480gccaaggaaa tcgccctcgc ctacgcatca ggcgtcggag gcggccgctc gggcatcatc 540gagaccaact tccgcgagga atgcgagacc gatctgttcg gtgagcaggc cgtgctttgc 600ggcgggatca cgcacctgat tcaggccggt ttcgaaaccc tgaccgaagc cggttacgcg 660cccgaaatgg cctatttcga gtgcctccac gaaaccaagc tgatcgtcga tcttctctac 720gaaggcggca ttgcgaacat gcgctattcc atctcgaaca cggcggaata tggcgacatc 780accaccggcc cgcgcatcat caccgatgag acgaaggccg agatgaagcg cgtgctcgac 840gacatccaat cgggccgctt cgtgaagaac ttcgtgctcg acaatcgcgc aggccagccc 900gaactcaagg cagcccgcaa gcgcgccgaa gctcacccga ttgagaagac cggcgcagaa 960ctgcgcgcaa tgatgccatg gatcagtgcc aacaagctgg tcgacaagtc gaaaaactag 102042339PRTErythrobacter sp. 42Met Lys Val Tyr Tyr Asp Ala Asp Ala Asp Leu Gly Leu Ile Lys Ser 1 5 10 15 Lys Lys Ile Ala Val Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Val Ala Glu Val Ala Ile Ala Leu Arg 35 40 45 Glu Gly Ser Ala Thr Ala Lys Lys Ala Gln Asp Ala Gly Phe Lys Val 50 55 60 Leu Ser Asn Thr Glu Ala Ala Lys Trp Ala Asp Ile Val Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Trp Glu Asn Asp Leu Ala Gly 85 90 95 His Met Lys Pro Gly Ser Ala Ile Ala Phe Ala His Gly Leu Asn Ile 100 105 110 His Phe Gly Leu Ile Glu Ala Pro Gln Asp Ile Asp Val Ile Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Ser Glu Tyr Gln Arg Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Val His Gln Asp Ala Ser Gly Ser 145 150 155 160 Ala Lys Glu Ile Ala Leu Ala Tyr Ala Ser Gly Val Gly Gly Gly Arg 165 170 175 Ser Gly Ile Ile Glu Thr Asn Phe Arg Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Ile Thr His Leu Ile Gln 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Thr Lys Leu Ile Val Asp Leu Leu Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Thr Thr Gly Pro Arg Ile Ile Thr Asp Glu Thr Lys 260 265 270 Ala Glu Met Lys Arg Val Leu Asp Asp Ile Gln Ser Gly Arg Phe Val 275 280 285 Lys Asn Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ala Arg Lys Arg Ala Glu Ala His Pro Ile Glu Lys Thr Gly Ala Glu 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Ser Ala Asn Lys Leu Val Asp Lys 325 330 335 Ser Lys Asn 431020DNASphingomonas wittichii 43atgcgcgtct

attatgatcg tgatgccgac atcggcctca tcaagaccaa gaaggtggcg 60atcgtcggct atggcagcca gggccacgcc catgcccaga acctgcagga ctcgggcgtc 120gccgacgtcg cgatcgcgct gcgccccggc tcggccaccg cgaagaaggc cgaaggcgcc 180ggcttcaagg tgctgtcgaa cgccgacgcg gccaagtggg ccgacatcgt catgatcctg 240gcgcccgacg agcaccaggc cgcgatctac aatgacgacc tgcgcgacaa tctgaagccg 300ggcgcggcgc tcgccttcgc ccatggcctc aacgtccatt tcggcctgat cgagccgcgc 360gccgacatcg acgtgttcat gatcgcgccg aagggccccg gccacaccgt ccgttccgaa 420tatcagcgcg gcggcggcgt gccctgcctg atcgcgatcg cccaggacgc cagcggcaac 480gcgcacgacg tcgccctgtc ctacgcctcg gcgatcggcg gcggccgttc gggcgtgatc 540gagacgacct tcaaggaaga gtgcgagacc gacctgttcg gcgagcaggc ggtgctgtgc 600ggcggcctca gccacctgat catggccggc ttcgagacgc tggtcgaggc gggctacgcc 660cccgagatgg cctatttcga atgcctccac gaagtgaagc tgatcgtcga cctgatgtat 720gagggcggca tcgccaacat gcgctactcg atctcgaaca ccgccgaata tggcgacatc 780cacaccggcc cgcgcgtcat cacctcggag accaaggccg agatgaagcg cgtgctcgac 840gacatccaga agggcaagtt cgtcaagcgc ttcgtcctcg acaaccgcgc cggccagccc 900gagctgaagg cgagccgcaa gctcgtcgcc gagcatccga tcgagaaggt cggcgccgaa 960ctgcgcgcga tgatgccctg gatcagcaag aaccagctgg tcgacaaggc caagaactga 102044339PRTSphingomonas wittichii 44Met Arg Val Tyr Tyr Asp Arg Asp Ala Asp Ile Gly Leu Ile Lys Thr 1 5 10 15 Lys Lys Val Ala Ile Val Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Gln Asp Ser Gly Val Ala Asp Val Ala Ile Ala Leu Arg 35 40 45 Pro Gly Ser Ala Thr Ala Lys Lys Ala Glu Gly Ala Gly Phe Lys Val 50 55 60 Leu Ser Asn Ala Asp Ala Ala Lys Trp Ala Asp Ile Val Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Tyr Asn Asp Asp Leu Arg Asp 85 90 95 Asn Leu Lys Pro Gly Ala Ala Leu Ala Phe Ala His Gly Leu Asn Val 100 105 110 His Phe Gly Leu Ile Glu Pro Arg Ala Asp Ile Asp Val Phe Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Ser Glu Tyr Gln Arg Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Ile Ala Gln Asp Ala Ser Gly Asn 145 150 155 160 Ala His Asp Val Ala Leu Ser Tyr Ala Ser Ala Ile Gly Gly Gly Arg 165 170 175 Ser Gly Val Ile Glu Thr Thr Phe Lys Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Ser His Leu Ile Met 195 200 205 Ala Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Val Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile His Thr Gly Pro Arg Val Ile Thr Ser Glu Thr Lys 260 265 270 Ala Glu Met Lys Arg Val Leu Asp Asp Ile Gln Lys Gly Lys Phe Val 275 280 285 Lys Arg Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ser Arg Lys Leu Val Ala Glu His Pro Ile Glu Lys Val Gly Ala Glu 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Ser Lys Asn Gln Leu Val Asp Lys 325 330 335 Ala Lys Asn 451020DNASphingobium japonicum 45atgaaggttt attacgaccg cgacgccgac atcggcctga tcaagggcaa gaaggtcgcc 60atcctcggtt acggttcgca gggtcacgcc catgcgcaga atctgcgcga cagcggcgtc 120gccgaagtcg ccatcgcgct gcgccccggc tcgcccagcg ccaagaaggc cgaaggcgcg 180ggcttcaagg tgctgccgaa cgcggaagcc gccgcatggg ccgacgtgct gatgatcctg 240gcgcccgacg agcatcaggc cgccatctac gccgccgaca tccacgccaa tctgcgcccc 300ggcgcggcgc tggccttcgc gcacggcctc aacgtccatt tcggcctgat cgagccgcgc 360aaggatgtcg acgtcatcat gatcgcgccc aagggtccgg gccacaccgt tcgcggcgaa 420tatgtgaagg gcggcggcgt gccctgcctg atcgccgttc atcaggacgc gaccggcaac 480gcgcatgaca tcgccctgtc ctacgcttcg ggcgtcggcg gcggccgcag cggcatcatc 540gaaaccaatt tccgcgagga atgcgaaacc gacctgttcg gcgagcaggc cgtgctgtgc 600ggcggcgcga ccgcgctggt ccaagcgggc ttcgaaacgc tggtcgaggc gggctacgcc 660cccgaaatgg cctatttcga atgcctgcac gaactgaagc tgatcgtcga cctgatgtat 720gaaggcggca tcgccaacat gcgctattcg atctcgaaca ccgccgaata tggcgatatc 780aagaccggcc cgcgcatcat caccgaagaa acgaagaagg aaatgaagcg cgttctggcc 840gacatccagt cgggccgctt cgtcaaggac ttcgtgctcg acaaccgcgc cggccagccg 900gaattgaagg ccagccgcat cgccgcccag cgccacccga tcgaggaaac cggcgccaag 960ctgcgcgcca tgatgccctg gatcggcgcg aacaagctgg tcgacaagga caggaactga 102046339PRTSphingobium japonicum 46Met Lys Val Tyr Tyr Asp Arg Asp Ala Asp Ile Gly Leu Ile Lys Gly 1 5 10 15 Lys Lys Val Ala Ile Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Val Ala Glu Val Ala Ile Ala Leu Arg 35 40 45 Pro Gly Ser Pro Ser Ala Lys Lys Ala Glu Gly Ala Gly Phe Lys Val 50 55 60 Leu Pro Asn Ala Glu Ala Ala Ala Trp Ala Asp Val Leu Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Tyr Ala Ala Asp Ile His Ala 85 90 95 Asn Leu Arg Pro Gly Ala Ala Leu Ala Phe Ala His Gly Leu Asn Val 100 105 110 His Phe Gly Leu Ile Glu Pro Arg Lys Asp Val Asp Val Ile Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Gly Glu Tyr Val Lys Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Val His Gln Asp Ala Thr Gly Asn 145 150 155 160 Ala His Asp Ile Ala Leu Ser Tyr Ala Ser Gly Val Gly Gly Gly Arg 165 170 175 Ser Gly Ile Ile Glu Thr Asn Phe Arg Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Ala Thr Ala Leu Val Gln 195 200 205 Ala Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Leu Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Lys Thr Gly Pro Arg Ile Ile Thr Glu Glu Thr Lys 260 265 270 Lys Glu Met Lys Arg Val Leu Ala Asp Ile Gln Ser Gly Arg Phe Val 275 280 285 Lys Asp Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ser Arg Ile Ala Ala Gln Arg His Pro Ile Glu Glu Thr Gly Ala Lys 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Gly Ala Asn Lys Leu Val Asp Lys 325 330 335 Asp Arg Asn 471020DNAErythrobacter litoralis 47gtgaaagttt attacgacgc cgatgccgat cttggactga tcacggacaa gaagatcgcc 60gtgctcggct atggcagcca ggggcacgcc catgcacaga atctgcgtga cagcgggatc 120aaagaggtag caatcgcgct gcgcgacggc tcttccagcg cgaagaaagc gcaggatgct 180ggcttcaagg tgctcagcaa ttccgacgct gccgagtggg ccgatatcct gatgatcctc 240gcccccgacg agcaccaggc ggcgatctgg gcggatgacc ttgcgggcaa catgaagccg 300ggcagcgccc tcgccttcgc ccacgggctc aacatccact tcggcctgat cgaaccaccc 360gccgagatcg acgtcatcat gatcgcgccg aagggtcctg gtcatactgt ccgcagcgag 420tatcagcgcg gcggcggcgt gccctgcctc atcgccgtcc accaggattc gagcggcaat 480gccaaggaca tcgccctcgc ctatgccagc ggtgtcggcg gcgggcgcag cggcattatc 540gagaccaact tccgcgagga atgcgagacc gacctgttcg gcgagcaggc cgtgctgtgc 600ggcgggatca cgcacctgat ccaagccggc ttcgagacgc tgaccgaggc cggatatgca 660ccggagatgg cctatttcga gtgcctgcac gagaccaagc tgatcgtcga cctgctctac 720gaaggcggca tcgccaatat gcgctactcg atcagcaaca ccgccgagta tggcgacatc 780accaccggcc cgcgcatcat caccgatgag accaaggccg aaatgaagcg cgttctcggc 840gatatccagt cgggccgctt cgtgaagaac ttcgtcctcg acaaccgcgc cggccagccc 900gaactcaagg ctgcccgcaa gcgcgccgaa gcgcatccga tcgaacagac cggtgccaag 960ctgcgcgcaa tgatgccgtg gatcggcaag aacaagctgg tcgacaagga caggaactag 102048339PRTErythrobacter litoralis 48Met Lys Val Tyr Tyr Asp Ala Asp Ala Asp Leu Gly Leu Ile Thr Asp 1 5 10 15 Lys Lys Ile Ala Val Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Ile Lys Glu Val Ala Ile Ala Leu Arg 35 40 45 Asp Gly Ser Ser Ser Ala Lys Lys Ala Gln Asp Ala Gly Phe Lys Val 50 55 60 Leu Ser Asn Ser Asp Ala Ala Glu Trp Ala Asp Ile Leu Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Trp Ala Asp Asp Leu Ala Gly 85 90 95 Asn Met Lys Pro Gly Ser Ala Leu Ala Phe Ala His Gly Leu Asn Ile 100 105 110 His Phe Gly Leu Ile Glu Pro Pro Ala Glu Ile Asp Val Ile Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Ser Glu Tyr Gln Arg Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Val His Gln Asp Ser Ser Gly Asn 145 150 155 160 Ala Lys Asp Ile Ala Leu Ala Tyr Ala Ser Gly Val Gly Gly Gly Arg 165 170 175 Ser Gly Ile Ile Glu Thr Asn Phe Arg Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Ile Thr His Leu Ile Gln 195 200 205 Ala Gly Phe Glu Thr Leu Thr Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Thr Lys Leu Ile Val Asp Leu Leu Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Thr Thr Gly Pro Arg Ile Ile Thr Asp Glu Thr Lys 260 265 270 Ala Glu Met Lys Arg Val Leu Gly Asp Ile Gln Ser Gly Arg Phe Val 275 280 285 Lys Asn Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ala Arg Lys Arg Ala Glu Ala His Pro Ile Glu Gln Thr Gly Ala Lys 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Gly Lys Asn Lys Leu Val Asp Lys 325 330 335 Asp Arg Asn 491020DNASphingobium chlorophenolicum 49atgaaggttt attacgaccg cgacgcagac atcggcctga tcaagggcaa gaaggtcgcc 60atcctgggtt acggttcgca gggtcacgcc catgcgcaga atctgcgcga ttccggcgtc 120gccgaagtcg ccatcgcgct gcgccccggc tcgccgagcg ccaagaaggc cgaaggcgcg 180ggcttcaagg tgctggcgaa cgccgacgcc gccgcatggg ccgatgtgct catgatcctg 240gcgcccgacg agcatcaggc cgccatctac gccgacgaca tccacgccaa tctgcgcccc 300ggcgccgcgc tcgccttcgc gcacggcctc aacgtgcatt tcggcctgat cgagccgcgc 360aaggacgtcg acgtcatcat gatcgcgccc aagggccccg gccacaccgt gcgcggcgaa 420tatgtgaagg gcggcggcgt gccctgcctg atcgccatcc atcaggacgc gaccggcaac 480gcccatgaca tcgccctgtc ctacgcttcg ggcgtcggcg gcggccgcag cggcatcatc 540gaaaccaact tccgcgagga atgcgaaacc gacctgttcg gcgagcaggc cgtgctgtgc 600ggcggcgcca ccgcgctggt gcaggcgggc ttcgaaacgc tggtcgaggc tggctacgcc 660ccggaaatgg cctatttcga atgcctgcac gaactgaagc tgatcgtcga cctgatgtat 720gaaggcggca tcgccaacat gcgctattcg atctcgaaca ccgccgaata tggcgatatc 780aagaccggcc cgcgcatcat caccgatgaa acgaagaagg aaatgaagcg cgttctggcc 840gacatccagt cgggccgctt cgtcaaggac ttcgtgctcg acaaccgcgc cggccagccg 900gaattgaagg ccagccgcat cgccgcccag cgccacccga tcgaggaaac cggcgccaag 960ctgcgcgcca tgatgccctg gatcggcgcg aacaagctgg tcgacaagga caagaactga 102050339PRTSphingobium chlorophenolicum 50Met Lys Val Tyr Tyr Asp Arg Asp Ala Asp Ile Gly Leu Ile Lys Gly 1 5 10 15 Lys Lys Val Ala Ile Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Val Ala Glu Val Ala Ile Ala Leu Arg 35 40 45 Pro Gly Ser Pro Ser Ala Lys Lys Ala Glu Gly Ala Gly Phe Lys Val 50 55 60 Leu Ala Asn Ala Asp Ala Ala Ala Trp Ala Asp Val Leu Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Tyr Ala Asp Asp Ile His Ala 85 90 95 Asn Leu Arg Pro Gly Ala Ala Leu Ala Phe Ala His Gly Leu Asn Val 100 105 110 His Phe Gly Leu Ile Glu Pro Arg Lys Asp Val Asp Val Ile Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Gly Glu Tyr Val Lys Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Ile His Gln Asp Ala Thr Gly Asn 145 150 155 160 Ala His Asp Ile Ala Leu Ser Tyr Ala Ser Gly Val Gly Gly Gly Arg 165 170 175 Ser Gly Ile Ile Glu Thr Asn Phe Arg Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Ala Thr Ala Leu Val Gln 195 200 205 Ala Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Leu Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Lys Thr Gly Pro Arg Ile Ile Thr Asp Glu Thr Lys 260 265 270 Lys Glu Met Lys Arg Val Leu Ala Asp Ile Gln Ser Gly Arg Phe Val 275 280 285 Lys Asp Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ser Arg Ile Ala Ala Gln Arg His Pro Ile Glu Glu Thr Gly Ala Lys 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Gly Ala Asn Lys Leu Val Asp Lys 325 330 335 Asp Lys Asn 511020DNASphingomonas sp. 51atgcgtgtct attatgatcg cgacgccgat ctgaacctga tctccgagaa gaacatcgcc 60atcctgggtt acggctcgca gggccatgcc catgcgcaga acctgcgcga ttcgggcgtc 120aagaatgtcg cgatcgcgct gcgccccggt tcggcctcgg ccgccaaggc ggaggctgcg 180ggcttcaagg tcctgtcgaa caaggaagcg gccggctggg ccgacatcct gatgatcctg 240gcccccgacg agcatcaggc cgcgatctat gacgccgacc tgaagggcaa tttgaagccg 300ggcgccgcgc tcgccttcgc gcacggcctg aacgtgcatt tcggcctgat cgagccgcct 360gcggacatcg acgttatcat gatcgcgccg aagggccccg gccacaccgt gcgcagcgaa 420tatgtgcgcg gcggcggcgt gccctgcctg atcgcgatcc atcaggacgc cagcggcaac 480gcgcatgacg tggcgctggc ctatgcgtcg ggcgtcggcg gcggtcgctc gggcatcatc 540gagacgaact tccgcgaaga gtgcgaaacc gatctgttcg gcgagcaggc cgtgctgtgt 600ggcggcgcga ccgcgctggt ccaggcgggc ttcgagacgc tggtcgaggc gggctatgcc 660cccgaaatgg cgtatttcga gtgcctccac gagctgaagc tgatcgtcga cctgatgtat 720gagggcggca tcgccaacat gcgctactcg atctcgaaca ccgccgagta cggcgacatc 780aagaccggcc cacgcatcat cactgaagag accaagaagg aaatgaagcg cgtgctcgcc 840gacatccagt cgggccgctt cgtgaaggac ttcgtgctcg acaaccgcgc cggccagccc 900gaactgaagg ccagccgcat cgccgccaag cgccatcaga tcgaacaggt cggcagcgaa 960ctgcgcgcga tgatgccgtg gatcggcgcg aacaagctgg tggacaaggc gaagaactga 102052339PRTSphingomonas sp. 52Met Arg Val Tyr Tyr Asp Arg Asp Ala Asp Leu Asn Leu Ile Ser Glu 1 5 10 15 Lys Asn Ile Ala Ile Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Val Lys Asn Val Ala Ile Ala Leu Arg 35 40 45 Pro Gly Ser Ala Ser Ala Ala Lys Ala Glu Ala Ala Gly Phe Lys Val 50 55 60 Leu Ser Asn Lys Glu Ala Ala Gly Trp Ala Asp Ile Leu Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Tyr Asp Ala Asp Leu Lys Gly 85 90 95 Asn Leu Lys Pro Gly Ala Ala Leu Ala Phe Ala His Gly Leu Asn Val 100 105 110 His Phe Gly Leu Ile Glu Pro Pro Ala Asp Ile Asp Val Ile Met Ile 115 120

125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Ser Glu Tyr Val Arg Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Ile His Gln Asp Ala Ser Gly Asn 145 150 155 160 Ala His Asp Val Ala Leu Ala Tyr Ala Ser Gly Val Gly Gly Gly Arg 165 170 175 Ser Gly Ile Ile Glu Thr Asn Phe Arg Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Ala Thr Ala Leu Val Gln 195 200 205 Ala Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Leu Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Lys Thr Gly Pro Arg Ile Ile Thr Glu Glu Thr Lys 260 265 270 Lys Glu Met Lys Arg Val Leu Ala Asp Ile Gln Ser Gly Arg Phe Val 275 280 285 Lys Asp Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ser Arg Ile Ala Ala Lys Arg His Gln Ile Glu Gln Val Gly Ser Glu 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Gly Ala Asn Lys Leu Val Asp Lys 325 330 335 Ala Lys Asn 531020DNANovosphingobium nitrogenifigens 53atgaaggttt actacgacgc cgacgccgat ctcaacctga tcaccgggaa gaaggtcgcc 60atcctgggct atggcagcca gggccacgcc cacgcgcaga acctgcgcga ttcgggcgtc 120aaggaagtgg cgatcgcgct gcgtcccggt tcggccagcg ccgccaaggc tgaaggcgcc 180ggtttcaagg tcatggcgaa cgccgaagcc gctgcctggg ccgacgttct catgattctc 240gcgcccgacg aacatcaggc cgcgatctat gccgacgaca tccacgccaa cctgcgcccc 300ggcgcggcgc tggccttcgc acacggcctc aacgttcact tcggcctgat cgaaccgcgc 360gccgacgtcg acgtgatcat gatcgcgccc aagggcccgg gccacaccgt tcgcggtgaa 420tacgtgaagg gcggcggggt gccctgcctc atcgccatcg cgcaggacgc gaccggcaat 480gcccacgaca tcgcccttgc ctatgcttcg ggtgtcggcg gcggccgttc gggtatcatc 540gaaaccaact tcaaggaaga gtgcgaaacc gacctgttcg gcgaacaagc cgttctttgc 600ggcggcctga cccacctcat ccaggctggt ttcgaaaccc tggtcgaagc cggttacgcg 660ccggaaatgg cctatttcga atgcctccac gaagtgaagc tgatcgtcga cctgatgtat 720gaaggcggca tcgccaacat gcgctactcg atctcgaaca cggccgaata cggtgacatc 780accactggtc cgcgcctgat caccgccgaa accaaggcgg aaatgaagcg cgtcctcgaa 840gacatccagg ccggtcgctt cgtcaagaac ttcgtgctcg acaaccgcgc tggccagccc 900gagctgaagg ctgcccgcaa ggctgccgct gcgcacccga tcgaacagac cggcgctcgc 960ctgcgtgcga tgatgccctg gatcggtgcg aaccagctgg tcgacaaggc caagaactga 102054339PRTNovosphingobium nitrogenifigens 54Met Lys Val Tyr Tyr Asp Ala Asp Ala Asp Leu Asn Leu Ile Thr Gly 1 5 10 15 Lys Lys Val Ala Ile Leu Gly Tyr Gly Ser Gln Gly His Ala His Ala 20 25 30 Gln Asn Leu Arg Asp Ser Gly Val Lys Glu Val Ala Ile Ala Leu Arg 35 40 45 Pro Gly Ser Ala Ser Ala Ala Lys Ala Glu Gly Ala Gly Phe Lys Val 50 55 60 Met Ala Asn Ala Glu Ala Ala Ala Trp Ala Asp Val Leu Met Ile Leu 65 70 75 80 Ala Pro Asp Glu His Gln Ala Ala Ile Tyr Ala Asp Asp Ile His Ala 85 90 95 Asn Leu Arg Pro Gly Ala Ala Leu Ala Phe Ala His Gly Leu Asn Val 100 105 110 His Phe Gly Leu Ile Glu Pro Arg Ala Asp Val Asp Val Ile Met Ile 115 120 125 Ala Pro Lys Gly Pro Gly His Thr Val Arg Gly Glu Tyr Val Lys Gly 130 135 140 Gly Gly Val Pro Cys Leu Ile Ala Ile Ala Gln Asp Ala Thr Gly Asn 145 150 155 160 Ala His Asp Ile Ala Leu Ala Tyr Ala Ser Gly Val Gly Gly Gly Arg 165 170 175 Ser Gly Ile Ile Glu Thr Asn Phe Lys Glu Glu Cys Glu Thr Asp Leu 180 185 190 Phe Gly Glu Gln Ala Val Leu Cys Gly Gly Leu Thr His Leu Ile Gln 195 200 205 Ala Gly Phe Glu Thr Leu Val Glu Ala Gly Tyr Ala Pro Glu Met Ala 210 215 220 Tyr Phe Glu Cys Leu His Glu Val Lys Leu Ile Val Asp Leu Met Tyr 225 230 235 240 Glu Gly Gly Ile Ala Asn Met Arg Tyr Ser Ile Ser Asn Thr Ala Glu 245 250 255 Tyr Gly Asp Ile Thr Thr Gly Pro Arg Leu Ile Thr Ala Glu Thr Lys 260 265 270 Ala Glu Met Lys Arg Val Leu Glu Asp Ile Gln Ala Gly Arg Phe Val 275 280 285 Lys Asn Phe Val Leu Asp Asn Arg Ala Gly Gln Pro Glu Leu Lys Ala 290 295 300 Ala Arg Lys Ala Ala Ala Ala His Pro Ile Glu Gln Thr Gly Ala Arg 305 310 315 320 Leu Arg Ala Met Met Pro Trp Ile Gly Ala Asn Gln Leu Val Asp Lys 325 330 335 Ala Lys Asn 551080DNABacteroides thetaiotaomicron 55atggcgcaag tcatcaaaac aaaaaaacaa aaaaaaatgg cacagttgaa ttttggcgga 60actgtagaaa atgtagttat ccgtgatgaa tttccattgg aaaaagctcg tgaagtattg 120aaaaatgaaa caatcgctgt aatcggttat ggcgtacaag gtcctggaca ggctctgaac 180cttcgtgata acggtttcaa tgtaatcgtt ggtcaacgcc agggaaagac atatgacaaa 240gcggtagctg acggatgggt tccgggtgaa actttgttcg gtattgaaga agcttgcgaa 300aaaggtacga tcattatgtg cctgttgtct gatgcagcgg taatgtctgt atggcctact 360atcaagcctt acctgactgc aggaaaagct ctttatttct ctcatggttt tgctattaca 420tggagtgatc gcacaggtgt agttcctcct gcagatatcg acgtaatcat ggttgctcct 480aaaggttcgg gtacatcctt gcgtactatg ttccttgaag gtcgcggctt gaactcttct 540tacgctatct atcaggatgc aacaggcaac gctatggaca gaacaatcgc attgggtatc 600ggtatcggtt caggttattt gttcgaaaca actttcatcc gcgaagctac ttccgacctg 660acaggcgaac gtggttcatt gatgggagct atccagggtc tgttgctggc acaatacgaa 720gtgttacgtg aaaacggtca cactccttcc gaagcattca acgaaactgt agaagagctg 780actcagtcat tgatgccgtt gtttgcaaag aacggtatgg actggatgta tgctaactgc 840tctactacag ctcaacgtgg tgctctcgac tggatgggcc ccttccacga tgctatcaaa 900ccggtagttg aaaagttgta tcacagtgtg aagactggta acgaagcaca gatttcaatc 960gactctaact ccaaaccgga ttatcgtgag aaactggaag aagaactgaa agcattgcgc 1020gaaagcgaaa tgtggcagac tgccgtgaca gttcgtaaac ttcgtccgga aaataattaa 108056359PRTBacteroides thetaiotaomicron 56Met Ala Gln Val Ile Lys Thr Lys Lys Gln Lys Lys Met Ala Gln Leu 1 5 10 15 Asn Phe Gly Gly Thr Val Glu Asn Val Val Ile Arg Asp Glu Phe Pro 20 25 30 Leu Glu Lys Ala Arg Glu Val Leu Lys Asn Glu Thr Ile Ala Val Ile 35 40 45 Gly Tyr Gly Val Gln Gly Pro Gly Gln Ala Leu Asn Leu Arg Asp Asn 50 55 60 Gly Phe Asn Val Ile Val Gly Gln Arg Gln Gly Lys Thr Tyr Asp Lys 65 70 75 80 Ala Val Ala Asp Gly Trp Val Pro Gly Glu Thr Leu Phe Gly Ile Glu 85 90 95 Glu Ala Cys Glu Lys Gly Thr Ile Ile Met Cys Leu Leu Ser Asp Ala 100 105 110 Ala Val Met Ser Val Trp Pro Thr Ile Lys Pro Tyr Leu Thr Ala Gly 115 120 125 Lys Ala Leu Tyr Phe Ser His Gly Phe Ala Ile Thr Trp Ser Asp Arg 130 135 140 Thr Gly Val Val Pro Pro Ala Asp Ile Asp Val Ile Met Val Ala Pro 145 150 155 160 Lys Gly Ser Gly Thr Ser Leu Arg Thr Met Phe Leu Glu Gly Arg Gly 165 170 175 Leu Asn Ser Ser Tyr Ala Ile Tyr Gln Asp Ala Thr Gly Asn Ala Met 180 185 190 Asp Arg Thr Ile Ala Leu Gly Ile Gly Ile Gly Ser Gly Tyr Leu Phe 195 200 205 Glu Thr Thr Phe Ile Arg Glu Ala Thr Ser Asp Leu Thr Gly Glu Arg 210 215 220 Gly Ser Leu Met Gly Ala Ile Gln Gly Leu Leu Leu Ala Gln Tyr Glu 225 230 235 240 Val Leu Arg Glu Asn Gly His Thr Pro Ser Glu Ala Phe Asn Glu Thr 245 250 255 Val Glu Glu Leu Thr Gln Ser Leu Met Pro Leu Phe Ala Lys Asn Gly 260 265 270 Met Asp Trp Met Tyr Ala Asn Cys Ser Thr Thr Ala Gln Arg Gly Ala 275 280 285 Leu Asp Trp Met Gly Pro Phe His Asp Ala Ile Lys Pro Val Val Glu 290 295 300 Lys Leu Tyr His Ser Val Lys Thr Gly Asn Glu Ala Gln Ile Ser Ile 305 310 315 320 Asp Ser Asn Ser Lys Pro Asp Tyr Arg Glu Lys Leu Glu Glu Glu Leu 325 330 335 Lys Ala Leu Arg Glu Ser Glu Met Trp Gln Thr Ala Val Thr Val Arg 340 345 350 Lys Leu Arg Pro Glu Asn Asn 355 571215DNASchizosaccharomyces pombe 57atgtctttcc gtaattcctc tagaatggcc atgaaggcct tgcgtactat gggtagccgt 60cgtttggcta ctcgtagcat gtctgttatg gctcgcacca ttgctgcccc cagcatgcgt 120tttgcgcctc gcatgaccgc ccctttgatg caaactcgcg gtatgcgtgt tatggacttt 180gccggtacca aggagaacgt ttgggagcgt tctgactggc ctcgtgaaaa gcttgttgac 240tacttcaaga acgacactct tgccatcatt ggatacggat ctcaaggaca tggtcaaggt 300ttgaacgctc gtgatcaagg tttgaacgtt attgtcggtg tccgtaagga tggtgcttcc 360tggaagcaag ctattgaaga cggttgggtc cctggtaaga ctttgttccc cgtcgaggag 420gccatcaaga agggttctat catcatgaac cttttgtccg atgccgctca aactgagact 480tggcccaaga ttgctcccct tattaccaag ggtaagactt tgtacttctc tcacggtttc 540tccgtcatct tcaaggatca aactaagatt caccccccta aggatgttga tgttatcctt 600gtcgctccca agggttctgg tcgtaccgtt cgtacccttt tcaaggaagg tcgtggtatt 660aactcttcct tcgctgttta ccaagacgtt actggtaagg ctcaagaaaa ggccattggt 720ttggctgttg ccgtcggttc cggtttcatc taccaaacca ctttcaagaa ggaggttatc 780tccgatttgg ttggtgagcg tggatgtctc atgggtggta tcaacggtct tttcttggct 840caataccaag ttttgcgtga acgtggtcac tcccctgctg aggctttcaa cgagactgtt 900gaagaggcca ctcaatccct ttaccccttg attggcaagt acggtcttga ctacatgttt 960gccgcttgct ctaccaccgc tcgtcgtggt gccattgact ggactcctcg tttccttgag 1020gctaacaaga aggtccttaa tgaattgtat gacaatgttg agaacggtaa cgaggctaag 1080cgttccttgg aatacaactc tgctcccaac taccgtgagc tttacgataa ggagttggag 1140gaaatccgca acttggaaat ctggaaggct ggtgaggttg ttcgttctct ccgtcctgaa 1200cacaacaagc actag 121558404PRTSchizosaccharomyces pombe 58Met Ser Phe Arg Asn Ser Ser Arg Met Ala Met Lys Ala Leu Arg Thr 1 5 10 15 Met Gly Ser Arg Arg Leu Ala Thr Arg Ser Met Ser Val Met Ala Arg 20 25 30 Thr Ile Ala Ala Pro Ser Met Arg Phe Ala Pro Arg Met Thr Ala Pro 35 40 45 Leu Met Gln Thr Arg Gly Met Arg Val Met Asp Phe Ala Gly Thr Lys 50 55 60 Glu Asn Val Trp Glu Arg Ser Asp Trp Pro Arg Glu Lys Leu Val Asp 65 70 75 80 Tyr Phe Lys Asn Asp Thr Leu Ala Ile Ile Gly Tyr Gly Ser Gln Gly 85 90 95 His Gly Gln Gly Leu Asn Ala Arg Asp Gln Gly Leu Asn Val Ile Val 100 105 110 Gly Val Arg Lys Asp Gly Ala Ser Trp Lys Gln Ala Ile Glu Asp Gly 115 120 125 Trp Val Pro Gly Lys Thr Leu Phe Pro Val Glu Glu Ala Ile Lys Lys 130 135 140 Gly Ser Ile Ile Met Asn Leu Leu Ser Asp Ala Ala Gln Thr Glu Thr 145 150 155 160 Trp Pro Lys Ile Ala Pro Leu Ile Thr Lys Gly Lys Thr Leu Tyr Phe 165 170 175 Ser His Gly Phe Ser Val Ile Phe Lys Asp Gln Thr Lys Ile His Pro 180 185 190 Pro Lys Asp Val Asp Val Ile Leu Val Ala Pro Lys Gly Ser Gly Arg 195 200 205 Thr Val Arg Thr Leu Phe Lys Glu Gly Arg Gly Ile Asn Ser Ser Phe 210 215 220 Ala Val Tyr Gln Asp Val Thr Gly Lys Ala Gln Glu Lys Ala Ile Gly 225 230 235 240 Leu Ala Val Ala Val Gly Ser Gly Phe Ile Tyr Gln Thr Thr Phe Lys 245 250 255 Lys Glu Val Ile Ser Asp Leu Val Gly Glu Arg Gly Cys Leu Met Gly 260 265 270 Gly Ile Asn Gly Leu Phe Leu Ala Gln Tyr Gln Val Leu Arg Glu Arg 275 280 285 Gly His Ser Pro Ala Glu Ala Phe Asn Glu Thr Val Glu Glu Ala Thr 290 295 300 Gln Ser Leu Tyr Pro Leu Ile Gly Lys Tyr Gly Leu Asp Tyr Met Phe 305 310 315 320 Ala Ala Cys Ser Thr Thr Ala Arg Arg Gly Ala Ile Asp Trp Thr Pro 325 330 335 Arg Phe Leu Glu Ala Asn Lys Lys Val Leu Asn Glu Leu Tyr Asp Asn 340 345 350 Val Glu Asn Gly Asn Glu Ala Lys Arg Ser Leu Glu Tyr Asn Ser Ala 355 360 365 Pro Asn Tyr Arg Glu Leu Tyr Asp Lys Glu Leu Glu Glu Ile Arg Asn 370 375 380 Leu Glu Ile Trp Lys Ala Gly Glu Val Val Arg Ser Leu Arg Pro Glu 385 390 395 400 His Asn Lys His 591215DNASchizosaccharomyces pombe 59atgtctttcc gtaattcctc tagaatggcc atgaaggcct tgcgtactat gggtagccga 60cgtttggcta ctcgtagcat gtctgttatg gctcgcacca ttgctgcccc cagaatgcgt 120tgggcgcctc gcatgaccgc ccctttgatg caaactcgcg gtatgcgtgt tatggacttt 180gccggtacca aggagaacgt ttgggagcgc tctgactggc ctcgtgaaaa gcttgttgac 240tacttcaaga acgacactct tgccatcatt ggatccggat ctcaaggaca tggtcaaggt 300ttgaacgctc gtgatcaagg tttgaacgtt attgtcggtg tccgtaagga tggtgcttcc 360tggaagcaag ctattgaaga cggttgggtc cctggtaaga ctttgttccc cgtcgaggag 420gccatcaaga agggttctat catcatgaac cttttgtccg atgccgctca aactgagact 480tggcccaaga ttgctcccct tattaccaag ggtaagactt tgtacttctc tcacggtttc 540tccgtcatct tcaaggatca aactaagatt caccccccta aggatgttga tgttatcctt 600gtcgctccca agggttctgg tcgtaccgtt cgtacccttt tcaaggaagg tcgtggtatt 660aactcttcct tcgctgttta ccaagacgtt actggtaagg ctcaagaaaa gaccattggt 720ttggctgttg ccgtcggttc cggtttcatc taccaaacca ctttcaagaa ggaggttatc 780tccgatttgg ttggtgagcg tggatgtctc atgggtggta tccccggtct tttcttggct 840caataccaag ttttgcgtga acgtggtcac tcccctgctg aggctttccc cgagactgtt 900gaagaggcca ctcaatccct ttaccccttg attggcaagt acggtcttga ctacatgttt 960gccgcttgct ctaccaccgc tcgtcgtggt gccattgact ggactcctcg tttccttgag 1020gctaacaaga aggtccttaa tgaattgtat gacaatgttg agaacggtaa cgaggctaag 1080cgttccttgg aatacaactc tgctcccaac taccgtgagc tttacgataa ggagttggag 1140gaaatccgca acttggaaat ctggaaggct ggtgaggttg gtcggtctct ccggcctgaa 1200cacaacaagc actag 121560404PRTSchizosaccharomyces pombe 60Met Ser Phe Arg Asn Ser Ser Arg Met Ala Met Lys Ala Leu Arg Thr 1 5 10 15 Met Gly Ser Arg Arg Leu Ala Thr Arg Ser Met Ser Val Met Ala Arg 20 25 30 Thr Ile Ala Ala Pro Arg Met Arg Trp Ala Pro Arg Met Thr Ala Pro 35 40 45 Leu Met Gln Thr Arg Gly Met Arg Val Met Asp Phe Ala Gly Thr Lys 50 55 60 Glu Asn Val Trp Glu Arg Ser Asp Trp Pro Arg Glu Lys Leu Val Asp 65 70 75 80 Tyr Phe Lys Asn Asp Thr Leu Ala Ile Ile Gly Ser Gly Ser Gln Gly 85 90 95 His Gly Gln Gly Leu Asn Ala Arg Asp Gln Gly Leu Asn Val Ile Val 100 105 110 Gly Val Arg Lys Asp Gly Ala Ser Trp Lys Gln Ala Ile Glu Asp Gly 115 120 125 Trp Val Pro Gly Lys Thr Leu Phe Pro Val Glu Glu Ala Ile Lys Lys 130 135 140 Gly Ser Ile Ile Met Asn Leu Leu Ser Asp Ala Ala Gln Thr Glu Thr 145 150 155 160 Trp Pro Lys Ile Ala Pro Leu Ile Thr Lys Gly Lys Thr Leu Tyr Phe 165 170 175 Ser His Gly Phe Ser Val Ile Phe Lys Asp Gln Thr Lys Ile His Pro 180 185 190 Pro Lys Asp Val Asp Val Ile Leu Val Ala Pro Lys Gly Ser Gly Arg 195 200 205 Thr Val Arg Thr Leu Phe Lys Glu Gly Arg Gly Ile Asn Ser Ser Phe 210 215 220 Ala Val Tyr Gln Asp Val Thr Gly Lys Ala Gln Glu Lys Thr Ile Gly 225 230 235

240 Leu Ala Val Ala Val Gly Ser Gly Phe Ile Tyr Gln Thr Thr Phe Lys 245 250 255 Lys Glu Val Ile Ser Asp Leu Val Gly Glu Arg Gly Cys Leu Met Gly 260 265 270 Gly Ile Pro Gly Leu Phe Leu Ala Gln Tyr Gln Val Leu Arg Glu Arg 275 280 285 Gly His Ser Pro Ala Glu Ala Phe Pro Glu Thr Val Glu Glu Ala Thr 290 295 300 Gln Ser Leu Tyr Pro Leu Ile Gly Lys Tyr Gly Leu Asp Tyr Met Phe 305 310 315 320 Ala Ala Cys Ser Thr Thr Ala Arg Arg Gly Ala Ile Asp Trp Thr Pro 325 330 335 Arg Phe Leu Glu Ala Asn Lys Lys Val Leu Asn Glu Leu Tyr Asp Asn 340 345 350 Val Glu Asn Gly Asn Glu Ala Lys Arg Ser Leu Glu Tyr Asn Ser Ala 355 360 365 Pro Asn Tyr Arg Glu Leu Tyr Asp Lys Glu Leu Glu Glu Ile Arg Asn 370 375 380 Leu Glu Ile Trp Lys Ala Gly Glu Val Gly Arg Ser Leu Arg Pro Glu 385 390 395 400 His Asn Lys His 611212DNASchizosaccharomyces japonicus 61atgtctttcc gttccgcctc taagttggcc atgaaggcct tccgccaaaa tggtgcccgc 60cgcgttatcc ctgctacccg ctctatgtct gtcttggctc gcgccggcgt tatgagccgc 120tctgctgctc gtgttgcccc catggtccaa acccgtggtg tccgtactat ggactttggc 180ggtgttaagg agaccgtctg ggagcgtaac gactggcccc gtgagaagct tcttgactac 240ttcaagaacg acactcttgc cgttattggt tacggttccc aaggtcacgg acaaggtttg 300aacgctcgtg acaacggttt gaacgttatt gttggtgttc gtgagggtgg tgcctcctgg 360aaggctgcca tcgaggacgg ttgggtcccc ggcaagaact tgttccccat ggaggaggcc 420atcaagaagg gtaccatcat catggacctt ctttccgatg ccgctcaaac cgagacctgg 480cccactattg ctccccttct caccaagggt aagactctct acttctctca cggtttctcc 540gtcgtcttca aggaccaaac caaggttgtc ccccctaagg acatcgatgt catccttgct 600gcccccaagg gttccggccg taccgtccgt tccttgttca aggagggccg tggtatcaac 660tcctccgtcg ccgtcttcca aaacgtttcc ggcaaggctg acgagaaggc tgttgctatt 720gctgtcgcca ttggctccgg tttcatctac aagaccacct tcgagcgcga ggtcgtttct 780gacttggtcg gtgagcgtgg ttgccttatg ggtggtatca acggtctctt cttggcccaa 840taccaaactc tccgtgagca cggccacacc cccgccgagg ccttcaacga gactgttgag 900gaggccactc aatcccttta ccccttgatc ggtaagtacg gtttggacta catgttcgcc 960gcctgctcta ccactgctcg tcgtggtgcc attgactgga ctcaacgctt ctacgacgcc 1020aacaagaagg tccttgagga cttgtacgag aacgttgcca acggtaacga ggccaagcgc 1080tccttggagt acaactctaa gcccaactac cgtgagcttt acgagaagga gctcgctgag 1140atccgcgact tggagatctg gagagccggt gagactgtcc gttctctccg tcccgaggag 1200aacaagcact ag 121262403PRTSchizosaccharomyces japonicus 62Met Ser Phe Arg Ser Ala Ser Lys Leu Ala Met Lys Ala Phe Arg Gln 1 5 10 15 Asn Gly Ala Arg Arg Val Ile Pro Ala Thr Arg Ser Met Ser Val Leu 20 25 30 Ala Arg Ala Gly Val Met Ser Arg Ser Ala Ala Arg Val Ala Pro Met 35 40 45 Val Gln Thr Arg Gly Val Arg Thr Met Asp Phe Gly Gly Val Lys Glu 50 55 60 Thr Val Trp Glu Arg Asn Asp Trp Pro Arg Glu Lys Leu Leu Asp Tyr 65 70 75 80 Phe Lys Asn Asp Thr Leu Ala Val Ile Gly Tyr Gly Ser Gln Gly His 85 90 95 Gly Gln Gly Leu Asn Ala Arg Asp Asn Gly Leu Asn Val Ile Val Gly 100 105 110 Val Arg Glu Gly Gly Ala Ser Trp Lys Ala Ala Ile Glu Asp Gly Trp 115 120 125 Val Pro Gly Lys Asn Leu Phe Pro Met Glu Glu Ala Ile Lys Lys Gly 130 135 140 Thr Ile Ile Met Asp Leu Leu Ser Asp Ala Ala Gln Thr Glu Thr Trp 145 150 155 160 Pro Thr Ile Ala Pro Leu Leu Thr Lys Gly Lys Thr Leu Tyr Phe Ser 165 170 175 His Gly Phe Ser Val Val Phe Lys Asp Gln Thr Lys Val Val Pro Pro 180 185 190 Lys Asp Ile Asp Val Ile Leu Ala Ala Pro Lys Gly Ser Gly Arg Thr 195 200 205 Val Arg Ser Leu Phe Lys Glu Gly Arg Gly Ile Asn Ser Ser Val Ala 210 215 220 Val Phe Gln Asn Val Ser Gly Lys Ala Asp Glu Lys Ala Val Ala Ile 225 230 235 240 Ala Val Ala Ile Gly Ser Gly Phe Ile Tyr Lys Thr Thr Phe Glu Arg 245 250 255 Glu Val Val Ser Asp Leu Val Gly Glu Arg Gly Cys Leu Met Gly Gly 260 265 270 Ile Asn Gly Leu Phe Leu Ala Gln Tyr Gln Thr Leu Arg Glu His Gly 275 280 285 His Thr Pro Ala Glu Ala Phe Asn Glu Thr Val Glu Glu Ala Thr Gln 290 295 300 Ser Leu Tyr Pro Leu Ile Gly Lys Tyr Gly Leu Asp Tyr Met Phe Ala 305 310 315 320 Ala Cys Ser Thr Thr Ala Arg Arg Gly Ala Ile Asp Trp Thr Gln Arg 325 330 335 Phe Tyr Asp Ala Asn Lys Lys Val Leu Glu Asp Leu Tyr Glu Asn Val 340 345 350 Ala Asn Gly Asn Glu Ala Lys Arg Ser Leu Glu Tyr Asn Ser Lys Pro 355 360 365 Asn Tyr Arg Glu Leu Tyr Glu Lys Glu Leu Ala Glu Ile Arg Asp Leu 370 375 380 Glu Ile Trp Arg Ala Gly Glu Thr Val Arg Ser Leu Arg Pro Glu Glu 385 390 395 400 Asn Lys His 631476DNASalmonella enterica 63atggctaact actttaatac actgaatctg cgccagcagc tggcgcagct gggtaaatgc 60cgctttatgg gccgcgacga attcgccgac ggcgcgagct accttcaggg taaaaaagtg 120gtcatcgtcg gctgtggcgc tcaggggctg aaccagggcc tgaacatgcg tgactccggt 180ctggatattt cctatgccct gcgtaaagaa gccattgctg agaagcgtgc ctcctggcgt 240aaagcgaccg aaaacggctt caaagtgggt acctacgaag agctgattcc gcaggctgac 300ctggtggtta acctgacgcc ggacaaacag cactccgacg tggtgcgctc cgtacagccg 360ctgatgaaag acggcgcggc gctgggctac tcccacggct tcaatatcgt ggaggtgggc 420gagcagatcc gtaaagacat caccgtggtg atggtagcgc cgaagtgtcc gggcaccgaa 480gtgcgcgaag agtacaaacg tggtttcggc gtgccgacgc tgatcgccgt tcacccggaa 540aacgatccga aaggcgaagg catggcgatt gctaaagcct gggcagcagc aactggcggt 600caccgtgcgg gcgtactgga atcttctttc gtggcggaag tgaaatccga cctgatgggc 660gagcagacta tcctgtgcgg tatgctgcag gctggttctc tgctgtgctt cgacaagctg 720gtggcagaag gcaccgaccc ggcatacgcc gaaaaactga ttcagttcgg ctgggaaacc 780atcaccgaag cgctgaagca gggcggcatc accctgatga tggaccgtct gtctaacccg 840gcgaaactgc gtgcttacgc gctgtccgaa cagctgaaag agatcatggc gccgctgttc 900cagaaacaca tggatgacat catctccggc gagttctctt ccggcatgat ggctgactgg 960gctaacgacg ataagaaact gctgacctgg cgtgaagaga ccggtaaaac tgcgttcgaa 1020accgcgccgc agtttgaagg taagatcggc gagcaggagt acttcgataa aggcgtgctg 1080atgatcgcga tggtgaaagc gggcgttgag ctggcgttcg aaaccatggt cgattccggc 1140atcatcgaag aatccgctta ctacgaatca ctgcacgagc tgccgctgat cgcgaacacc 1200atcgcccgta agcgtctgta cgaaatgaac gtggttatct ccgataccgc agaatacggt 1260aactatctgt tctcttacgc ttgcgtaccg ctgctgaaac cgtttattgc ggaattgcaa 1320ccgggcgatc tgggtagtgc tatcccggaa ggcgcggtag acaacgcaca gcttcgcgac 1380gtgaacgacg cgattcgtag tcatgcgatt gagcaggtag gtaagaaact gcgcggctat 1440atgacggata tgaagcgtat tgcggtagcg ggttga 147664491PRTSalmonella enterica 64Met Ala Asn Tyr Phe Asn Thr Leu Asn Leu Arg Gln Gln Leu Ala Gln 1 5 10 15 Leu Gly Lys Cys Arg Phe Met Gly Arg Asp Glu Phe Ala Asp Gly Ala 20 25 30 Ser Tyr Leu Gln Gly Lys Lys Val Val Ile Val Gly Cys Gly Ala Gln 35 40 45 Gly Leu Asn Gln Gly Leu Asn Met Arg Asp Ser Gly Leu Asp Ile Ser 50 55 60 Tyr Ala Leu Arg Lys Glu Ala Ile Ala Glu Lys Arg Ala Ser Trp Arg 65 70 75 80 Lys Ala Thr Glu Asn Gly Phe Lys Val Gly Thr Tyr Glu Glu Leu Ile 85 90 95 Pro Gln Ala Asp Leu Val Val Asn Leu Thr Pro Asp Lys Gln His Ser 100 105 110 Asp Val Val Arg Ser Val Gln Pro Leu Met Lys Asp Gly Ala Ala Leu 115 120 125 Gly Tyr Ser His Gly Phe Asn Ile Val Glu Val Gly Glu Gln Ile Arg 130 135 140 Lys Asp Ile Thr Val Val Met Val Ala Pro Lys Cys Pro Gly Thr Glu 145 150 155 160 Val Arg Glu Glu Tyr Lys Arg Gly Phe Gly Val Pro Thr Leu Ile Ala 165 170 175 Val His Pro Glu Asn Asp Pro Lys Gly Glu Gly Met Ala Ile Ala Lys 180 185 190 Ala Trp Ala Ala Ala Thr Gly Gly His Arg Ala Gly Val Leu Glu Ser 195 200 205 Ser Phe Val Ala Glu Val Lys Ser Asp Leu Met Gly Glu Gln Thr Ile 210 215 220 Leu Cys Gly Met Leu Gln Ala Gly Ser Leu Leu Cys Phe Asp Lys Leu 225 230 235 240 Val Ala Glu Gly Thr Asp Pro Ala Tyr Ala Glu Lys Leu Ile Gln Phe 245 250 255 Gly Trp Glu Thr Ile Thr Glu Ala Leu Lys Gln Gly Gly Ile Thr Leu 260 265 270 Met Met Asp Arg Leu Ser Asn Pro Ala Lys Leu Arg Ala Tyr Ala Leu 275 280 285 Ser Glu Gln Leu Lys Glu Ile Met Ala Pro Leu Phe Gln Lys His Met 290 295 300 Asp Asp Ile Ile Ser Gly Glu Phe Ser Ser Gly Met Met Ala Asp Trp 305 310 315 320 Ala Asn Asp Asp Lys Lys Leu Leu Thr Trp Arg Glu Glu Thr Gly Lys 325 330 335 Thr Ala Phe Glu Thr Ala Pro Gln Phe Glu Gly Lys Ile Gly Glu Gln 340 345 350 Glu Tyr Phe Asp Lys Gly Val Leu Met Ile Ala Met Val Lys Ala Gly 355 360 365 Val Glu Leu Ala Phe Glu Thr Met Val Asp Ser Gly Ile Ile Glu Glu 370 375 380 Ser Ala Tyr Tyr Glu Ser Leu His Glu Leu Pro Leu Ile Ala Asn Thr 385 390 395 400 Ile Ala Arg Lys Arg Leu Tyr Glu Met Asn Val Val Ile Ser Asp Thr 405 410 415 Ala Glu Tyr Gly Asn Tyr Leu Phe Ser Tyr Ala Cys Val Pro Leu Leu 420 425 430 Lys Pro Phe Ile Ala Glu Leu Gln Pro Gly Asp Leu Gly Ser Ala Ile 435 440 445 Pro Glu Gly Ala Val Asp Asn Ala Gln Leu Arg Asp Val Asn Asp Ala 450 455 460 Ile Arg Ser His Ala Ile Glu Gln Val Gly Lys Lys Leu Arg Gly Tyr 465 470 475 480 Met Thr Asp Met Lys Arg Ile Ala Val Ala Gly 485 490 657PRTArtificial SequenceAcetolactate synthase motif 65Ser Gly Pro Gly Xaa Xaa Asn 1 5 666PRTArtificial SequenceAcetolactate synthase motif 66Gly Xaa Xaa Gly Xaa Xaa 1 5 6715PRTArtificial SequenceAcetolactate synthase motif 67Gly Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Xaa Xaa Ala Xaa Xaa Xaa 1 5 10 15 685PRTArtificial SequenceAcetolactate synthase motif 68Gly Asp Xaa Xaa Phe 1 5 699PRTArtificial SequenceDihydroxy acid dehydratase motif 69Ser Leu Xaa Ser Arg Xaa Xaa Ile Ala 1 5 707PRTArtificial SequenceDihydroxy acid dehydratase motif 70Cys Asp Lys Xaa Xaa Pro Gly 1 5 7110PRTArtificial SequenceDihydroxy acid dehydratase motif 71Gly Xaa Cys Xaa Gly Xaa Xaa Thr Ala Asn 1 5 10 725PRTArtificial SequenceDihydroxy acid dehydratase motif 72Gly Gly Ser Thr Asn 1 5 7311PRTArtificial SequenceDihydroxy acid dehydratase motif 73Gly Pro Xaa Gly Xaa Pro Gly Met Arg Xaa Glu 1 5 10 7410PRTArtificial SequenceDihydroxy acid dehydratase motif 74Ala Leu Xaa Thr Asp Gly Arg Xaa Ser Gly 1 5 10 757PRTArtificial SequenceDihydroxy acid dehydratase motif 75Gly His Xaa Xaa Pro Glu Ala 1 5 767PRTArtificial Sequence2-keto-acid decarboxylase motif 76Phe Gly Xaa Xaa Gly Xaa Xaa 1 5 779PRTArtificial Sequence2-keto-acid decarboxylase motif 77Xaa Thr Xaa Gly Xaa Gly Xaa Xaa Xaa 1 5 789PRTArtificial Sequence2-keto-acid decarboxylase motif 78Asn Xaa Xaa Ala Gly Xaa Xaa Ala Glu 1 5 796PRTArtificial Sequence2-keto-acid decarboxylase motif 79Xaa Xaa Xaa Ile Xaa Gly 1 5 808PRTArtificial Sequence2-keto-acid decarboxylase motif 80Gly Asp Gly Xaa Xaa Gln Xaa Thr 1 5 816PRTArtificial SequenceAlcohol dehydrogenase motif 81Cys Xaa Xaa Asp Xaa His 1 5 828PRTArtificial SequenceAlcohol dehydrogenase motif 82Gly His Glu Xaa Xaa Gly Xaa Val 1 5 837PRTArtificial SequenceAlcohol dehydrogenase motif 83Xaa Xaa Xaa Gly Xaa Xaa Xaa 1 5 847PRTArtificial SequenceAlcohol dehydrogenase motif 84Cys Xaa Xaa Cys Xaa Xaa Cys 1 5 856PRTArtificial SequenceAlcohol dehydrogenase motif 85Xaa Xaa Xaa Xaa Thr Xaa 1 5 866PRTArtificial SequenceAlcohol dehydrogenase motif 86Gly Xaa Gly Xaa Xaa Gly 1 5 871044DNABacteroides thetaiotaomicron 87atggcacagt tgaattttgg cggaactgta gaaaatgtag ttatccgtga tgaatttcca 60ttggaaaaag ctcgtgaagt attgaaaaat gaaacaatcg ctgtaatcgg ttatggcgta 120caaggtcctg gacaggctct gaaccttcgt gataacggtt tcaatgtaat cgttggtcaa 180cgccagggaa agacatatga caaagcggta gctgacggat gggttccggg tgaaactttg 240ttcggtattg aagaagcttg cgaaaaaggt acgatcatta tgtgcctgtt gtctgatgca 300gcggtaatgt ctgtatggcc tactatcaag ccttacctga ctgcaggaaa agctctttat 360ttctctcatg gttttgctat tacatggagt gatcgcacag gtgtagttcc tcctgcagat 420atcgacgtaa tcatggttgc tcctaaaggt tcgggtacat ccttgcgtac tatgttcctt 480gaaggtcgcg gcttgaactc ttcttacgct atctatcagg atgcaacagg caacgctatg 540gacagaacaa tcgcattggg tatcggtatc ggttcaggtt atttgttcga aacaactttc 600atccgcgaag ctacttccga cctgacaggc gaacgtggtt cattgatggg agctatccag 660ggtctgttgc tggcacaata cgaagtgtta cgtgaaaacg gtcacactcc ttccgaagca 720ttcaacgaaa ctgtagaaga gctgactcag tcattgatgc cgttgtttgc aaagaacggt 780atggactgga tgtatgctaa ctgctctact acagctcaac gtggtgctct cgactggatg 840ggccccttcc acgatgctat caaaccggta gttgaaaagt tgtatcacag tgtgaagact 900ggtaacgaag cacagatttc aatcgactct aactccaaac cggattatcg tgagaaactg 960gaagaagaac tgaaagcatt gcgcgaaagc gaaatgtggc agactgccgt gacagttcgt 1020aaacttcgtc cggaaaataa ttaa 104488347PRTBacteroides thetaiotaomicron 88Met Ala Gln Leu Asn Phe Gly Gly Thr Val Glu Asn Val Val Ile Arg 1 5 10 15 Asp Glu Phe Pro Leu Glu Lys Ala Arg Glu Val Leu Lys Asn Glu Thr 20 25 30 Ile Ala Val Ile Gly Tyr Gly Val Gln Gly Pro Gly Gln Ala Leu Asn 35 40 45 Leu Arg Asp Asn Gly Phe Asn Val Ile Val Gly Gln Arg Gln Gly Lys 50 55 60 Thr Tyr Asp Lys Ala Val Ala Asp Gly Trp Val Pro Gly Glu Thr Leu 65 70 75 80 Phe Gly Ile Glu Glu Ala Cys Glu Lys Gly Thr Ile Ile Met Cys Leu 85 90 95 Leu Ser Asp Ala Ala Val Met Ser Val Trp Pro Thr Ile Lys Pro Tyr 100 105 110 Leu Thr Ala Gly Lys Ala Leu Tyr Phe Ser His Gly Phe Ala Ile Thr 115 120 125 Trp Ser Asp Arg Thr Gly Val Val Pro Pro Ala Asp Ile Asp Val Ile 130 135 140 Met Val Ala Pro Lys Gly Ser Gly Thr Ser Leu Arg Thr Met Phe Leu 145 150 155 160 Glu Gly Arg Gly Leu Asn Ser Ser Tyr Ala Ile Tyr Gln Asp Ala Thr 165 170 175 Gly Asn Ala Met Asp Arg Thr Ile Ala Leu Gly Ile Gly Ile Gly Ser 180 185 190 Gly Tyr Leu Phe Glu Thr Thr Phe Ile Arg Glu Ala Thr Ser Asp Leu 195 200 205 Thr Gly Glu Arg Gly Ser Leu Met Gly Ala Ile Gln Gly Leu Leu Leu 210 215 220 Ala Gln Tyr Glu Val Leu Arg Glu Asn Gly His Thr Pro Ser Glu Ala 225 230 235 240 Phe Asn Glu Thr Val Glu Glu Leu Thr Gln Ser Leu Met Pro Leu Phe 245 250 255 Ala Lys Asn Gly Met Asp Trp Met Tyr Ala Asn Cys Ser Thr Thr Ala 260 265 270 Gln Arg Gly Ala Leu Asp Trp Met Gly Pro Phe His Asp Ala Ile Lys 275

280 285 Pro Val Val Glu Lys Leu Tyr His Ser Val Lys Thr Gly Asn Glu Ala 290 295 300 Gln Ile Ser Ile Asp Ser Asn Ser Lys Pro Asp Tyr Arg Glu Lys Leu 305 310 315 320 Glu Glu Glu Leu Lys Ala Leu Arg Glu Ser Glu Met Trp Gln Thr Ala 325 330 335 Val Thr Val Arg Lys Leu Arg Pro Glu Asn Asn 340 345 891053DNASchizosaccharomyces pombe 89atgcgtgtta tggactttgc cggtaccaag gagaacgttt gggagcgttc tgactggcct 60cgtgaaaagc ttgttgacta cttcaagaac gacactcttg ccatcattgg atacggatct 120caaggacatg gtcaaggttt gaacgctcgt gatcaaggtt tgaacgttat tgtcggtgtc 180cgtaaggatg gtgcttcctg gaagcaagct attgaagacg gttgggtccc tggtaagact 240ttgttccccg tcgaggaggc catcaagaag ggttctatca tcatgaacct tttgtccgat 300gccgctcaaa ctgagacttg gcccaagatt gctcccctta ttaccaaggg taagactttg 360tacttctctc acggtttctc cgtcatcttc aaggatcaaa ctaagattca cccccctaag 420gatgttgatg ttatccttgt cgctcccaag ggttctggtc gtaccgttcg tacccttttc 480aaggaaggtc gtggtattaa ctcttccttc gctgtttacc aagacgttac tggtaaggct 540caagaaaagg ccattggttt ggctgttgcc gtcggttccg gtttcatcta ccaaaccact 600ttcaagaagg aggttatctc cgatttggtt ggtgagcgtg gatgtctcat gggtggtatc 660aacggtcttt tcttggctca ataccaagtt ttgcgtgaac gtggtcactc ccctgctgag 720gctttcaacg agactgttga agaggccact caatcccttt accccttgat tggcaagtac 780ggtcttgact acatgtttgc cgcttgctct accaccgctc gtcgtggtgc cattgactgg 840actcctcgtt tccttgaggc taacaagaag gtccttaatg aattgtatga caatgttgag 900aacggtaacg aggctaagcg ttccttggaa tacaactctg ctcccaacta ccgtgagctt 960tacgataagg agttggagga aatccgcaac ttggaaatct ggaaggctgg tgaggttgtt 1020cgttctctcc gtcctgaaca caacaagcac tag 105390350PRTSchizosaccharomyces pombe 90Met Arg Val Met Asp Phe Ala Gly Thr Lys Glu Asn Val Trp Glu Arg 1 5 10 15 Ser Asp Trp Pro Arg Glu Lys Leu Val Asp Tyr Phe Lys Asn Asp Thr 20 25 30 Leu Ala Ile Ile Gly Tyr Gly Ser Gln Gly His Gly Gln Gly Leu Asn 35 40 45 Ala Arg Asp Gln Gly Leu Asn Val Ile Val Gly Val Arg Lys Asp Gly 50 55 60 Ala Ser Trp Lys Gln Ala Ile Glu Asp Gly Trp Val Pro Gly Lys Thr 65 70 75 80 Leu Phe Pro Val Glu Glu Ala Ile Lys Lys Gly Ser Ile Ile Met Asn 85 90 95 Leu Leu Ser Asp Ala Ala Gln Thr Glu Thr Trp Pro Lys Ile Ala Pro 100 105 110 Leu Ile Thr Lys Gly Lys Thr Leu Tyr Phe Ser His Gly Phe Ser Val 115 120 125 Ile Phe Lys Asp Gln Thr Lys Ile His Pro Pro Lys Asp Val Asp Val 130 135 140 Ile Leu Val Ala Pro Lys Gly Ser Gly Arg Thr Val Arg Thr Leu Phe 145 150 155 160 Lys Glu Gly Arg Gly Ile Asn Ser Ser Phe Ala Val Tyr Gln Asp Val 165 170 175 Thr Gly Lys Ala Gln Glu Lys Ala Ile Gly Leu Ala Val Ala Val Gly 180 185 190 Ser Gly Phe Ile Tyr Gln Thr Thr Phe Lys Lys Glu Val Ile Ser Asp 195 200 205 Leu Val Gly Glu Arg Gly Cys Leu Met Gly Gly Ile Asn Gly Leu Phe 210 215 220 Leu Ala Gln Tyr Gln Val Leu Arg Glu Arg Gly His Ser Pro Ala Glu 225 230 235 240 Ala Phe Asn Glu Thr Val Glu Glu Ala Thr Gln Ser Leu Tyr Pro Leu 245 250 255 Ile Gly Lys Tyr Gly Leu Asp Tyr Met Phe Ala Ala Cys Ser Thr Thr 260 265 270 Ala Arg Arg Gly Ala Ile Asp Trp Thr Pro Arg Phe Leu Glu Ala Asn 275 280 285 Lys Lys Val Leu Asn Glu Leu Tyr Asp Asn Val Glu Asn Gly Asn Glu 290 295 300 Ala Lys Arg Ser Leu Glu Tyr Asn Ser Ala Pro Asn Tyr Arg Glu Leu 305 310 315 320 Tyr Asp Lys Glu Leu Glu Glu Ile Arg Asn Leu Glu Ile Trp Lys Ala 325 330 335 Gly Glu Val Val Arg Ser Leu Arg Pro Glu His Asn Lys His 340 345 350 9120DNAArtificial SequenceT7_for primer 91taatacgact cactataggg 209219DNAArtificial SequenceT7_rev primer 92gctagttatt gctcagcgg 199340DNAArtificial SequenceLlKARI_Y26NNK_for primer 93atcgccgtta ttggannkgg ttcacaagga catgcccatg 409440DNAArtificial SequenceLlKARI_Y26NNK_rev primer 94catgggcatg tccttgtgaa ccmnntccaa taacggcgat 409540DNAArtificial SequenceLlKARI_V48NNK_for primer 95caatgttatc attggtnnka ggcacggaaa atcttttgat 409640DNAArtificial SequenceLlKARI_V48NNK_rev primer 96atcaaaagat tttccgtgcc tmnnaccaat gataacattg 409734DNAArtificial SequenceLlKARI_R49NNK_for primer 97gttatcattg gtgtannkca cggaaaatct tttg 349834DNAArtificial SequenceLlKARI_R49NNK_rev primer 98caaaagattt tccgtgmnnt acaccaatga taac 349939DNAArtificial SequenceLlKARI_G51NNK_for primer 99attggtgtaa ggcacnnkaa atcttttgat aaagctaag 3910039DNAArtificial SequenceLlKARI_G51NNK_rev primer 100cttagcttta tcaaaagatt tmnngtgcct tacaccaat 3910139DNAArtificial SequenceLlKARI_K52NNK_for 101ggtgtaaggc acggannktc ttttgataaa gctaaggaa 3910239DNAArtificial SequenceLlKARI_K52NNK_rev primer 102ttccttagct ttatcaaaag amnntccgtg ccttacacc 3910337DNAArtificial SequenceLlKARI_S53NNK_for primer 103gtgtaaggca cggaaaannk tttgataaag ctaagga 3710437DNAArtificial SequenceLlKARI_S53NNK_rev primer 104tccttagctt tatcaaamnn ttttccgtgc cttacac 3710537DNAArtificial SequenceLlKARI_L85NNK_for primer 105tttggcacca gatgagnnkc aacaatccat atacgag 3710637DNAArtificial SequenceLlKARI_L85NNK_rev primer 106ctcgtatatg gattgttgmn nctcatctgg tgccaaa 3710739DNAArtificial SequenceLlKARI_I89NNK_for primer 107gagttgcaac aatccnnkta cgaggaggat atcaagcct 3910839DNAArtificial SequenceLlKARI_I89NNK_rev primer 108aggcttgata tcctcctcgt amnnggattg ttgcaactc 3910958DNAArtificial SequenceLl_recomb_1a_for primer 109gggcacaatg ttatcattgg tsyacbacac ggamwatctt ttgataaagc taaggaag 5811058DNAArtificial SequenceLl_recomb_1b_for primer 110gggcacaatg ttatcattgg tsyagtgcac ggamwatctt ttgataaagc taaggaag 5811158DNAArtificial SequenceLl_recomb_1c_for primer 111gggcacaatg ttatcattgg tsyatcgcac ggamwatctt ttgataaagc taaggaag 5811258DNAArtificial SequenceLl_recomb_1a_rev primer 112cttccttagc tttatcaaaa gatwktccgt gtvgtrsacc aatgataaca ttgtgccc 5811358DNAArtificial SequenceLl_recomb_1b_rev primer 113cttccttagc tttatcaaaa gatwktccgt gcactrsacc aatgataaca ttgtgccc 5811458DNAArtificial SequenceLl_recomb_1c_rev primer 114cttccttagc tttatcaaaa gatwktccgt gcgatrsacc aatgataaca ttgtgccc 5811548DNAArtificial SequenceLl_recomb_2a_for primer 115ggcaccagat gagrcacaac aatccatata cgaggaggat atcaagcc 4811648DNAArtificial SequenceLl_recomb_2b_for primer 116ggcaccagat gagrcacaac aatccgcata cgaggaggat atcaagcc 4811748DNAArtificial SequenceLl_recomb_2c_for primer 117ggcaccagat gagttgcaac aatccatata cgaggaggat atcaagcc 4811848DNAArtificial SequenceLl_recomb_2d_for primer 118ggcaccagat gagttgcaac aatccgcata cgaggaggat atcaagcc 4811948DNAArtificial SequenceLl_recomb_2a_rev primer 119ggcttgatat cctcctcgta tatggattgt tgtgyctcat ctggtgcc 4812048DNAArtificial SequenceLl_recomb_2b_rev primer 120ggcttgatat cctcctcgta tgcggattgt tgtgyctcat ctggtgcc 4812148DNAArtificial SequenceLl_recomb_2c_rev primer 121ggcttgatat cctcctcgta tatggattgt tgcaactcat ctggtgcc 4812248DNAArtificial SequenceLl_recomb_2d_rev primer 122ggcttgatat cctcctcgta tgcggattgt tgcaactcat ctggtgcc 4812330DNAArtificial SequenceLl_recomb_3KS_for primer 123cacggaaaat cttttgataa agctaaggaa 3012430DNAArtificial SequenceLl_recomb_3LS_for primer 124cacggactat cttttgataa agctaaggaa 3012530DNAArtificial SequenceLl_recomb_3KD_for primer 125cacggaaaag attttgataa agctaaggaa 3012630DNAArtificial SequenceLl_recomb_3LD_for primer 126cacggactag attttgataa agctaaggaa 3012730DNAArtificial SequenceLl_recomb_3KS_rev primer 127ttccttagct ttatcaaaag attttccgtg 3012830DNAArtificial SequenceLl_recomb_3LS_rev primer 128ttccttagct ttatcaaaag atagtccgtg 3012930DNAArtificial SequenceLl_recomb_3KD_rev primer 129ttccttagct ttatcaaaat cttttccgtg 3013030DNAArtificial SequenceLl_recomb_3LD_rev primer 130ttccttagct ttatcaaaat ctagtccgtg 3013136DNAArtificial SequenceLl_K52NNkS53NNK_for primer 131ggtctaccac acggannknn ktttgataaa gctaag 3613236DNAArtificial SequenceLl_K52NNkS53NNK_rev primer 132cttagcttta tcaaamnnmn ntccgtgtgg tagacc 3613333DNAArtificial SequenceE59K_recomb_rev primer 133aaaagtttcg aatccatctt ycttagcttt atc 3313433DNAArtificial SequenceE59K_recomb_for primer 134gataaagcta agraagatgg attcgaaact ttt 3313533DNAArtificial SequenceA70V_recomb_rev primer 135atctgcctta gctactrctt cacctacttc aaa 3313633DNAArtificial SequenceA70V_recomb_for primer 136tttgaagtag gtgaagyagt agctaaggca gat 3313739DNAArtificial SequenceK118E/D122G_recomb_for primer 137ggatacatcr aagtcccaga ggrcgtggac gtgtttatg 3913839DNAArtificial SequenceK118E/D122G_recomb_rev primer 138cataaacacg tccacgycct ctgggactty gatgtatcc 3913933DNAArtificial SequenceH135L _recomb_rev primer 139ggtccttcta acaaggwggc ctggtgcttt tgg 3314033DNAArtificial SequenceH135L_recomb_for primer 140ccaaaagcac caggccwcct tgttagaagg acc 3314133DNAArtificial SequenceT182S_recomb_rev primer 141ctcttccttg aaagtgsttt caatgatgcc gac 3314233DNAArtificial SequenceT182S_recomb_for primer 142gtcggcatca ttgaaascac tttcaaggaa gag 3314333DNAArtificial SequenceE320K_recomb_rev primer 143catagcttgt ctaagttytg cccctatctt ttc 3314433DNAArtificial SequenceE320K _recomb_for primer 144gaaaagatag gggcaraact tagacaagct atg 3314532DNAArtificial SequenceSh_S78D_for primer 145gcacaaaaga gagccgattg gcaaaaagcg ac 3214632DNAArtificial SequenceSh_ S78D_rev primer 146gtcgcttttt gccaatcggc tctcttttgt gc 3214735DNAArtificial SequenceSe2_S78D_for primer 147gcagaaaaga gagccgattg gcgtaaagcg acgga 3514835DNAArtificial SequenceSe2_S78D_rev primer 148tccgtcgctt tacgccaatc ggctctcttt tctgc 35

Claims

1.-72. (canceled)

73. A mutant ketol-acid reductoisomerase (KARI) comprising one or more mutations or modifications at positions corresponding to amino acids selected from the group consisting of: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

74. The mutant KARI of claim 73, wherein said valine 48 is replaced with a residue selected from leucine or proline.

75. The mutant KARI of claim 73, wherein said arginine 49 is replaced with a residue selected from valine, leucine, serine, or proline.

76. The mutant KARI of claim 73, wherein said lysine 52 is replaced with a residue selected from leucine, alanine, isoleucine, methionine, phenylalanine, tryptophan, tyrosine, valine, aspartic acid, or glutamic acid.

77. The mutant KARI of claim 73, wherein said serine 53 is replaced with a residue selected from aspartic acid or glutamic acid.

78. The mutant KARI of claim 73, wherein said glutamic acid 59 is replaced with a residue selected from lysine, arginine, or histidine.

79. The mutant KARI of claim 73, wherein said leucine 85 is replaced with a residue selected from threonine or alanine.

80. The mutant KARI of claim 73, wherein said isoleucine 89 is replaced with alanine.

81. The mutant KARI of claim 73, wherein said lysine 118 is replaced with a residue selected from glutamic acid or aspartic acid.

82. The mutant KARI of claim 73, wherein said threonine 182 is replaced with a residue selected from serine, asparagine, or glutamine.

83. The mutant KARI of claim 73, wherein said glutamic acid 320 is replaced with a residue selected from lysine, arginine, or histidine.

84. The mutant KARI of claim 73, wherein said mutant KARI is a modified version of a wild-type KARI, and wherein said wild-type KARI is at least 80% identical to SEQ ID NO: 10.

85.-93. (canceled)

94. A recombinant microorganism comprising at least one nucleic acid molecule encoding a mutant KARI of claim 73.

95. (canceled)

96. An isolated nucleic acid molecule encoding a mutant KARI, wherein said mutant KARI comprises one or more mutations or modifications at positions corresponding to amino acids selected from the group consisting of: (a) valine 48 of the L. lactis KARI (SEQ ID NO: 10); (b) arginine 49 of the L. lactis KARI (SEQ ID NO: 10); (c) lysine 52 of the L. lactis KARI (SEQ ID NO: 10); (d) serine 53 of the L. lactis KARI (SEQ ID NO: 10); (e) glutamic acid 59 of the L. lactis KARI (SEQ ID NO: 10): (f); leucine 85 of the L. lactis KARI (SEQ ID NO: 10); (g) isoleucine 89 of the L. lactis KARI (SEQ ID NO: 10); (h) lysine 118 of the L. lactis KARI (SEQ ID NO: 10); (i) threonine 182 of the L. lactis KARI (SEQ ID NO: 10); and (j) glutamic acid 320 of the L. lactis KARI (SEQ ID NO: 10).

97.-98. (canceled)

99. The recombinant microorganism of claim 94, wherein said recombinant microorganism further expresses exogenous genes encoding an acetolactate synthase, a dihydroxy acid dehydratase, a keto-isovalerate decarboxylase, and an alcohol dehydrogenase, wherein said recombinant microorganism produces isobutanol.

100. (canceled)

101. The recombinant microorganism of claim 94, wherein said recombinant microorganism is a yeast microorganism.

102. A method of producing isobutanol, comprising: (a) providing a recombinant microorganism of claim 99; and (b) cultivating the recombinant microorganism in a culture medium containing a feedstock providing a carbon source, until the isobutanol is produced.

103. A method of producing isobutanol, comprising: (a) providing a recombinant microorganism of claim 101; and (b) cultivating the recombinant microorganism in a culture medium containing a feedstock providing a carbon source, until the isobutanol is produced.