U.S. patent application number 14/106438 was filed with the patent office on 2014-09-25 for compounds and methods for modulating protein expression.
This patent application is currently assigned to ISIS PHARMACEUTICALS, INC.. The applicant listed for this patent is ISIS PHARMACEUTICALS, INC.. Invention is credited to C. Frank Bennett.
Application Number | 20140288291 14/106438 |
Document ID | / |
Family ID | 40561905 |
Filed Date | 2014-09-25 |
United States Patent
Application |
20140288291 |
Kind Code |
A1 |
Bennett; C. Frank |
September 25, 2014 |
COMPOUNDS AND METHODS FOR MODULATING PROTEIN EXPRESSION
Abstract
The present invention provides compounds and methods for
modulating expression of a protein, including, but not limited to,
modulating splicing of a pre-mRNA to modulate the amount of one or
more variants of a protein.
Inventors: |
Bennett; C. Frank;
(Carlsbad, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ISIS PHARMACEUTICALS, INC. |
CARLSBAD |
CA |
US |
|
|
Assignee: |
ISIS PHARMACEUTICALS, INC.
CARLSBAD
CA
|
Family ID: |
40561905 |
Appl. No.: |
14/106438 |
Filed: |
December 13, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12742652 |
Oct 8, 2010 |
8637478 |
|
|
PCT/US2008/083448 |
Nov 13, 2008 |
|
|
|
14106438 |
|
|
|
|
60987759 |
Nov 13, 2007 |
|
|
|
Current U.S.
Class: |
536/24.5 |
Current CPC
Class: |
C12N 2320/51 20130101;
A61K 31/7115 20130101; C12N 15/111 20130101; C12N 15/113
20130101 |
Class at
Publication: |
536/24.5 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1.-89. (canceled)
90. An oligomeric compound comprising a contiguous sequence of
nucleosides having the formula I:
T.sub.1-(Nu.sub.1).sub.n1-(Nu.sub.2).sub.n2-(Nu.sub.3).sub.n3-(Nu.sub.4).-
sub.n4-(Nu.sub.5).sub.n5-T.sub.2, wherein: Nu.sub.1 and Nu.sub.5
are, independently, 2' stabilizing nucleosides; Nu.sub.2 and
Nu.sub.4 are .beta.-D-2'-deoxy-2'-fluororibofuranosyl nucleosides;
Nu.sub.3 is a 2'-modified nucleoside; each of n1 and n5 is,
independently, from 0 to 3; the sum of n2 plus n4 is between 10 and
25; n3 is from 0 and 5; and each T.sub.1 and T.sub.2 is,
independently, H, a hydroxyl protecting group, an optionally linked
conjugate group or a capping group, wherein the sequence is either
the same as or complementary to a portion of any of: SEQ ID NOs.:
1-114 of WO 2007/002390; SEQ ID NOs.: 1-3 of WO 2007/028065; SEQ ID
NOs.: 1-7 of U.S. Pat. No. 5,627,274; SEQ ID NOs.: 1-161 of WO
2007/047913; SEQ ID NOs.: 1-116 of 2007/0105807.
91. The oligomeric compound of claim 90, wherein: the sum of n2 and
n4 is 16 or 17; n1 is 2; n3 is 2 or 3; and n5 is 2.
92. The oligomeric compound of claim 90, wherein the formula I is
selected from: a) formula I: n1=2, n2=19, n3=0, n4=0, n5=2; b)
formula I: n1=2, n2=2, n3=3, n4=14, n5=2; c) formula I: n1=2, n2=5,
n3=3, n4=11, n5=2; d) formula I: n1=2, n2=8, n3=3, n4=8, n5=2; e)
formula I: n1=2, n2=11, n3=3, n4=5, n5=2; f) formula I: n1=2,
n2=14, n3=3, n4=2, n5=2; g) formula I: n1=2, n2=9, n3=3, n4=7,
n5=2; h) formula I: n1=2, n2=10, n3=3, n4=6, n5=2; i) formula I:
n1=2, n2=12, n3=3, n4=4, n5=2; j) formula I: n1=2, n2=3, n3=3,
n4=13, n5=2; k) formula I: n1=2, n2=4, n3=3, n4=12, n5=2; l)
formula I: n1=2, n2=6, n3=3, n4=10, n5=2; m) formula I: n1=2, n2=7,
n3=3, n4-9, n5-2; n) formula I: n1=2, n2=13, n3=3, n4=3, n5=2; o)
formula I: n1=2, n2=8, n3=6, n4-5, n5=2; p) formula I: n1=2, n2=2,
n3=2, n4=15, n5=2; q) formula I: n1=2, n2=3, n3=2, n4=14, n5=2; r)
formula I: n1=2, n2=4, n3=2, n4=13, n5=2; s) formula I: n1=2, n2=5,
n3=2, n4=12, n5=2; t) formula I: n1=2, n2=6, n3=2, n4=11, n5=2; u)
formula I: n1=2, n2=7, n3=2, n4=10, n5=2; v) formula I: n1=2, n2=8,
n3=2, n4=9, n5=2; w) formula I: n1=2, n2=9, n3=2, n4=8, n5=2; x)
formula I: n1=2, n2=10, n3=2, n4=7, n5=2; y) formula I: n1=2,
n2=11, n3=2, n4=6, n5=2; z) formula I: n1=2, n2=12, n3=2, n4=5,
n5=2; aa) formula I: n1=2, n2=13, n3=2, n4=4, n5=2; bb) formula I:
n5=2, n2=14, n3=2, n4=3, n5=2; cc) formula I: n1=2, n2=15, n3=2,
n4=2, n5=2; and dd) formula I: n1=2, n2=9, n3=3, n4=4, n5=2.
93. The oligomeric compound of claim 92, wherein Nu.sub.1 and
Nu.sub.s are, independently, 2'-modified nucleosides.
94. The oligomeric compound of claim 93 wherein each of the
2'-modified nucleosides independently comprises a 2'-substituent
group selected from O--C.sub.1-C.sub.12 alkyl, substituted
O--C.sub.1-C.sub.12 alkyl, O--C.sub.2-C.sub.12 alkenyl, substituted
O--C.sub.2-C.sub.12 alkenyl, O--C.sub.2-C.sub.12 alkynyl,
substituted O--C.sub.2-C.sub.12 alkynyl, amino, substituted amino,
amide, substituted amide, aralkyl, substituted aralkyl, O-aralkyl,
substituted O-aralkyl, N.sub.3, SH, CN, OCN, CF.sub.3, OCF.sub.3,
SOCH.sub.3, --SO.sub.2CH.sub.3, heterocyclo-alkyl,
heterocycloalkaryl, aminoalkylamino and polyalkylamino; and wherein
each substituent group is, independently, halogen, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, O--C.sub.1-C.sub.12
alkyl, substituted O--C.sub.1-C.sub.12 alkyl, S--C.sub.1-C.sub.12
alkyl, substituted S--C.sub.1-C.sub.12 alkyl, acyl (C(.dbd.O)--H),
substituted acyl, amino, substituted amino, amide, substituted
amide, C.sub.1-C.sub.12 alkylamino, substituted C.sub.1-C.sub.12
alkylamino, C.sub.1-C.sub.12 aminoalkoxy, substituted
C.sub.1-C.sub.12 aminoalkoxy, C.sub.1-C.sub.12 alkylaminooxy,
substituted C.sub.1-C.sub.12 alkylaminooxy, guanidinyl, substituted
guanidinyl or a protecting group.
95. The oligomeric compound of claim 94 wherein each 2'-substituent
group is independently selected from O--C.sub.1-C.sub.12 alkyl,
O--CH.sub.2--CH.sub.2--CH.sub.2--NH.sub.2,
O--(CH.sub.2).sub.2--O--N(R.sub.6).sub.2,
O--CH.sub.2C(.dbd.O)--N(R.sub.6).sub.2,
O--(CH.sub.2).sub.2--O--(CH.sub.2).sub.2--N(R.sub.6).sub.2,
O--CH.sub.2--CH.sub.2--CH.sub.2--NHR.sub.6, N.sub.3,
O--CH.sub.2--CH.dbd.CH.sub.2, NHCOR.sub.6 or
O--CH.sub.2--N(H)--C(.dbd.NR.sub.6)[N(R.sub.6).sub.2]; wherein each
R.sub.6 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl or a protecting group wherein the
substituent groups are halogen, hydroxyl, amino, azido, cyano,
haloalkyl, alkenyl, alkoxy, thioalkoxy, haloalkoxy or aryl.
96. The oligomeric compound of claim 94 wherein each 2'-substituent
group is, independently, O(CH.sub.2).sub.0-2CH.sub.3,
O(CH.sub.2).sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
OCH.sub.2C(H)CH.sub.2, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 or
OCH.sub.2C(.dbd.O)N(H)CH.sub.3.
97. The oligomeric compound of claim 96 wherein each 2'-substituent
group is, independently, OCH.sub.3 or
O--(CH.sub.2).sub.2--OCH.sub.3.
98. The oligomeric compound of claim 97 wherein each 2'-substituent
group is O--(CH.sub.2).sub.2--OCH.sub.3.
99. The oligomeric compound of claim 93, wherein the 2'-modified
nucleoside is a bicyclic sugar modified nucleoside.
100. The oligomeric compound of claim 99, wherein each bicyclic
sugar modified nucleoside independently comprises a D or L sugar in
the alpha or beta configuration.
101. The oligomeric compound of claim 99 wherein each of the
bicyclic sugar modified nucleosides independently comprises a
bridge group between the 2' and the 4'-carbon atoms comprising from
1 to 8 linked biradical groups independently selected from --O--,
--S--, --N(Ri)--, --C(Ri)(R.sub.2)--,
--C(R.sub.1).dbd.C(R.sub.1)--, --C(R.sub.1).dbd.N--,
--C(.dbd.NR.sub.1)--, --Si(Ri)(R.sub.2)--, --S(.dbd.O).sub.2--,
--S(.dbd.O)--, --C(.dbd.O)-- and --C(.dbd.S)--; each R.sub.1 and
R.sub.2 is, independently, H, hydroxyl, C.sub.1-C.sub.12 alkyl,
substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl,
substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl,
substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl,
substituted C.sub.5-C.sub.20 aryl, a heterocycle radical, a
substituted heterocycle radical, heteroaryl, substituted
heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted
C.sub.5-C.sub.7 alicyclic radical, halogen, substituted oxy
(--O--), amino, substituted amino, azido, carboxyl, substituted
carboxyl, acyl, substituted acyl, CN, thiol, substituted thiol,
sulfonyl (S(.dbd.O).sub.2--H), substituted sulfonyl, sulfoxyl
(S(.dbd.O)--H) or substituted sulfoxyl; and wherein each
substituent group is, independently, halogen, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, amino, substituted
amino, acyl, substituted acyl, C.sub.1-C.sub.12 aminoalkyl,
C.sub.1-C.sub.12 aminoalkoxy, substituted C.sub.1-C.sub.12
aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkoxy or a
protecting group.
102. The oligomeric compound of claim 99 wherein each bicyclic
sugar modified nucleoside independently comprises from 1 to 4 of
the linked biradical groups.
103. The oligomeric compound of claim 99 wherein each bicyclic
sugar modified nucleoside independently comprises 2 or 3 of the
linked biradical groups.
104. The oligomeric compound of claim 99 wherein each bicyclic
sugar modified nucleoside comprises 2 of the linked biradical
groups.
105. The oligomeric compound of claim 101 wherein each bridge group
is, independently, --CH.sub.2--, --(CH.sub.2).sub.2--,
--CH.sub.2--O--, --(CH.sub.2).sub.2--O-- or
--CH.sub.2--N(R.sub.3)--O-- wherein R.sub.3 is H or
C.sub.1-C.sub.12 alkyl.
106. The oligomeric compound of claim 101 wherein each bridge group
is, independently, --CH.sub.2--O-- or --(CH.sub.2).sub.2--O--.
107. The oligomeric compound of claim 91, wherein Nu.sub.1 is
O--(CH.sub.2).sub.2--OCH.sub.3, Nu.sub.3 is
O--(CH.sub.2).sub.2--OCH.sub.3, Nu.sub.s
O--(CH.sub.2).sub.2--OCH.sub.3, T.sub.1 is H and T.sub.2 is H, and
wherein formula I is selected from: a. formula I: n1=2, n2=19,
n3=0, n4=0, n5=2; b. formula I: n1=2, n2=2, n3=3, n4=14, n5=2; c.
formula I: n1=2, n2=5, n3=3, n4=11, n5=2; d. formula I: n1=2, n2=8,
n3=3, n4=8, n5=2; e. formula I: n1=2, n2=11, n3=3, n4=5, n5=2; f.
formula I: n1=2, n2=14, n3=3, n4=2, n5=2; g. formula I: n1=2, n2=9,
n3=3, n4=7, n5=2; h. formula I: n1=2, n2=10, n3=3, n4=6, n5=2; i.
formula I: n1=2, n2=12, n3=3, n4=4, n5=2; j. formula I: n1=2, n2=3,
n3=3, n4=13, n5=2; k. formula I: n1=2, n2=4, n3=3, n4=12, n5=2; l.
formula I: n1=2, n2=6, n3=3, n4=10, n5=2; m. formula I: n1=2, n2=7,
n3=3, n4=9, n5=2; n. formula I: n1=2, n2=13, n3=3, n4=3, n5=2; o.
formula I: n1=2, n2=8, n3=6, n4=5, n5=2; p. formula I: n1=2, n2=2,
n3=2, n4=15, n5=2; q. formula I: n1=2, n2=3, n3=2, n4=14, n5=2; r.
formula I: n1=2, n2=4, n3=2, n4=13, n5=2; s. formula I: n1=2, n2=5,
n3=2, n4=12, n5=2; t. formula I: n1=2, n2=6, n3=2, n4=11, n5=2; u.
formula I: n1=2, n2=7, n3=2, n4=10, n5=2; v. formula I: n1=2, n2=8,
n3=2, n4=9, n5=2; w. formula I: n1=2, n2=9, n3=2, n4=8, n5=2; x.
formula I: n1=2, n2=10, n3=2, n4=7, n5=2; y. formula I: n1=2,
n2=11, n3=2, n4=6, n5=2; z. formula I: n1=2, n2=12, n3=2, n4=5,
n5=2; aa. formula I: n1=2, n2=13, n3=2, n4=4, n5=2; bb. formula I:
n5=2, n2=14, n3=2, n4=3, n5=2; cc. formula I: n1=2, n2=15, n3=2,
n4=2, n5=2; and dd. formula I: n1=2, n2=9, n3=3, n4=4, n5=2.
108. The oligomeric compound of claim 107 wherein the oligomeric
compound comprises at least one phosphorothioate internucleoside
linkage.
109. The oligomeric compound of claim 107 wherein each
internucleoside linkage comprises a phosphorothioate
internucleoside linkage.
Description
CROSS REFERENCED TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/742,652, filed Oct. 8, 2010, which is a
U.S. National Phase filing under 35 U.S.C. .sctn.371 claiming
priority to International Serial No. PCT/US2008/083448 filed Nov.
13, 2008, which claims priority to U.S. Provisional Application
60/987,759, filed Nov. 13, 2007 and U.S. Provisional Application
61/496,462, filed Jun. 13, 2011, each of which is incorporated
herein by reference in its entirety.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0077USC1SEQ.txt, created Dec. 13, 2013, which is
4.0 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The present invention provides methods and compositions for
modulating protein expression.
BACKGROUND OF THE INVENTION
[0004] Antisense compounds have been used to modulate target
nucleic acids. Antisense compounds comprising a variety of
modifications and motifs have been reported. In certain instances,
such compounds are useful as research tools and as therapeutic
agents. In certain instances antisense compounds have been shown to
modulate protein expression by altering splicing of a pre-mRNA, by
arresting translation and/or by interrupting poly-adenylation of a
pre-mRNA.
SUMMARY OF THE INVENTION
[0005] In certain embodiments, provided herein are compounds and
methods that modulate protein expression, including, but not
limited to, modulation of splicing.
DETAILED DESCRIPTION OF THE INVENTION
[0006] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0007] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose.
DEFINITIONS
[0008] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th
edition, 1990; and "Antisense Drug Technology, Principles,
Strategies, and Applications" Edited by Stanley T. Crooke, CRC
Press, Boca Raton, Fla.; and Sambrook et al., "Molecular Cloning, A
laboratory Manual," 2.sup.nd Edition, Cold Spring Harbor Laboratory
Press, 1989, which are hereby incorporated by reference for any
purpose. Where permitted, all patents, applications, published
applications and other publications and other data referred to
throughout in the disclosure herein are incorporated by reference
in their entirety.
[0009] Unless otherwise indicated, the following terms have the
following meanings:
[0010] As used herein, the term "nucleoside" means a glycosylamine
comprising a nucleobase and a sugar. Nucleosides include, but are
not limited to, naturally occurring nucleosides, abasic
nucleosides, modified nucleosides, and nucleosides having mimetic
bases and/or sugar groups.
[0011] As used herein, the term "nucleotide" refers to a
glycosomine comprising a nucleobase and a sugar having a phosphate
group covalently linked to the sugar. Nucleotides may be modified
with any of a variety of substituents.
[0012] As used herein, the term "nucleobase" refers to the base
portion of a nucleoside or nucleotide. A nucleobase may comprise
any atom or group of atoms capable of hydrogen bonding to a base of
another nucleic acid.
[0013] As used herein, the term "heterocyclic base moiety" refers
to a nucleobase comprising a heterocycle.
[0014] As used herein, the term "oligomeric compound" refers to a
polymeric structure comprising two or more sub-structures and
capable of hybridizing to a region of a nucleic acid molecule. In
certain embodiments, oligomeric compounds are oligonucleosides. In
certain embodiments, oligomeric compounds are oligonucleotides. In
certain embodiments, oligomeric compounds are antisense compounds.
In certain embodiments, oligomeric compounds are antidote
compounds. In certain embodiments, oligomeric compounds comprise
conjugate groups.
[0015] As used herein "oligonucleoside" refers to an
oligonucleotide in which the internucleoside linkages do not
contain a phosphorus atom.
[0016] As used herein, the term "oligonucleotide" refers to an
oligomeric compound comprising a plurality of linked nucleosides.
In certain embodiments, one or more nucleotides of an
oligonucleotide is modified. In certain embodiments, an
oligonucleotide comprises ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA). In certain embodiments,
oligonucleotides are composed of naturally- and/or
non-naturally-occurring nucleobases, sugars and covalent
internucleoside linkages, and may further include non-nucleic acid
conjugates.
[0017] As used herein "internucleoside linkage" refers to a
covalent linkage between adjacent nucleosides.
[0018] As used herein "naturally occurring internucleoside linkage"
refers to a 3' to 5' phosphodiester linkage.
[0019] As used herein, the term "antisense compound" refers to an
oligomeric compound that is at least partially complementary to a
target nucleic acid molecule to which it hybridizes. In certain
embodiments, an antisense compound modulates (increases or
decreases) expression or amount of a target nucleic acid. In
certain embodiments, an antisense compound alters splicing of a
target pre-mRNA resulting in a different splice variant. Antisense
compounds include, but are not limited to, compounds that are
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, and chimeric combinations of these.
Consequently, while all antisense compounds are oligomeric
compounds, not all oligomeric compounds are antisense
compounds.
[0020] As used herein, the term "antisense oligonucleotide" refers
to an antisense compound that is an oligonucleotide.
[0021] As used herein, the term "antisense activity" refers to any
detectable and/or measurable activity attributable to the
hybridization of an antisense compound to its target nucleic acid.
In certain embodiments, such activity may be an increase or
decrease in an amount of a nucleic acid or protein. In certain
embodiments, such activity may be a change in the ratio of splice
variants of a nucleic acid or protein. Detection and/or measuring
of antisense activity may be direct or indirect. For example, in
certain embodiments, antisense activity is assessed by detecting
and or measuring the amount of target protein or the relative
amounts of splice variants of a target protein. In certain
embodiments, antisense activity is assessed by detecting and/or
measuring the amount of target nucleic acids and/or cleaved target
nucleic acids and/or alternatively spliced target nucleic
acids.
[0022] As used herein the term "detecting antisense activity" or
"measuring antisense activity" means that a test for detecting or
measuring antisense activity is performed on a particular sample
and compared to that of a control sample. Such detection and/or
measuring may include values of zero. Thus, if a test for detection
of antisense activity results in a finding of no antisense activity
(antisense activity of zero), the step of "detecting antisense
activity" has nevertheless been performed.
[0023] As used herein, the term "splice altering activity" refers
to a change in the ratio of one splice variant nucleic acid or
splice variant protein product to another splice variant nucleic
acid or splice variant protein product attributable to antisense
activity.
[0024] As used herein, the term "detecting splice altering
activity" or "measuring splice altering activity" means that a test
for detecting or measuring splice altering activity is performed on
a sample and compared to a control sample. Such detection and/or
measuring may include values of zero. Thus, if a test for detection
of antisense activity results in a finding of no splice altering
activity (splice altering activity of zero), the step of "detecting
splice altering activity" has nevertheless been performed.
[0025] As used herein the term "control sample" refers to a sample
that has not been contacted with an antisense compound.
[0026] As used herein, the term "motif" refers to the pattern of
unmodified and modified nucleotides in an oligomeric compound.
[0027] As used herein, the term "chimeric antisense oligomeric
compound" refers to an antisense oligomeric compound, having at
least one sugar, nucleobase or internucleoside linkage that is
differentially modified as compared to at least on other sugar,
nucleobase or internucleoside linkage within the same antisense
oligomeric compound. The remainder of the sugars, nucleobases and
internucleoside linkages can be independently modified or
unmodified, the same or different.
[0028] As used herein, the term "chimeric antisense
oligonucleotide" refers to an antisense oligonucleotide, having at
least one sugar, nucleobase or internucleoside linkage that is
differentially modified as compared to at least on other sugar,
nucleobase or internucleoside linkage within the same antisense
oligonucleotide. The remainder of the sugars, nucleobases and
internucleoside linkages can be independently modified or
unmodified, the same or different.
[0029] As used herein, the term "mixed-backbone oligomeric
compound" refers to an oligomeric compound wherein at least one
internucleoside linkage of the oligomeric compound is different
from at least one other internucleoside linkage of the oligomeric
compound.
[0030] As used herein, the term "target protein" refers to a
protein, the modulation of which is desired.
[0031] As used herein, the term "target gene" refers to a gene
encoding a target protein.
[0032] As used herein, the term "target nucleic acid" refers to any
nucleic acid molecule the expression or activity of which is
capable of being modulated by an antisense compound. Target nucleic
acids include, but are not limited to, RNA (including, but not
limited to pre-mRNA and mRNA or portions thereof) transcribed from
DNA encoding a target protein, and also cDNA derived from such RNA,
and miRNA.
[0033] For example, the target nucleic acid can be a cellular gene
(or mRNA transcribed from the gene) whose expression is associated
with a particular disorder or disease state, or a nucleic acid
molecule from an infectious agent.
[0034] As used herein, the term "targeting" or "targeted to" refers
to the association of an antisense compound to a particular target
nucleic acid molecule or a particular region of nucleotides within
a target nucleic acid molecule.
[0035] As used herein, the term "nucleobase complementarity" refers
to a nucleobase that is capable of base pairing with another
nucleobase. For example, in DNA, adenine (A) is complementary to
thymine (T). For example, in RNA, adenine (A) is complementary to
uracil (U). In certain embodiments, complementary nucleobase refers
to a nucleobase of an antisense compound that is capable of base
pairing with a nucleobase of its target nucleic acid. For example,
if a nucleobase at a certain position of an antisense compound is
capable of hydrogen bonding with a nucleobase at a certain position
of a target nucleic acid, then the position of hydrogen bonding
between the oligonucleotide and the target nucleic acid is
considered to be complementary at that nucleobase pair.
[0036] As used herein, the term "non-complementary nucleobase"
refers to a pair of nucleobases that do not form hydrogen bonds
with one another or otherwise support hybridization.
[0037] As used herein, the term "complementary" refers to the
capacity of an oligomeric compound to hybridize to another
oligomeric compound or nucleic acid through nucleobase
complementarity. In certain embodiments, an antisense compound and
its target are complementary to each other when a sufficient number
of corresponding positions in each molecule are occupied by
nucleobases that can bond with each other to allow stable
association between the antisense compound and the target. One
skilled in the art recognizes that the inclusion of mismatches is
possible without eliminating the ability of the oligomeric
compounds to remain in association. Therefore, described herein are
antisense compounds that may comprise up to about 20% nucleotides
that are mismatched (i.e., are not nucleobase complementary to the
corresponding nucleotides of the target). Preferably the antisense
compounds contain no more than about 15%, more preferably not more
than about 10%, most preferably not more than 5% or no mismatches.
The remaining nucleotides are nucleobase complementary or otherwise
do not disrupt hybridization (e.g., universal bases). One of
ordinary skill in the art would recognize the compounds provided
herein are at least 80%, at least 85%, at least 90%, at least 95%,
at least 96%, at least 97%, at least 98%, at least 99% or 100%
complementary to a target nucleic acid.
[0038] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid or an antidote to its antisense compound).
While not limited to a particular mechanism, the most common
mechanism of pairing involves hydrogen bonding, which may be
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding,
between complementary nucleoside or nucleotide bases (nucleobases).
For example, the natural base adenine is nucleobase complementary
to the natural nucleobases thymidine and uracil which pair through
the formation of hydrogen bonds. The natural base guanine is
nucleobase complementary to the natural bases cytosine and 5-methyl
cytosine. Hybridization can occur under varying circumstances.
[0039] As used herein, the term "specifically hybridizes" refers to
the ability of an oligomeric compound to hybridize to one nucleic
acid site with greater affinity than it hybridizes to another
nucleic acid site. In certain embodiments, an antisense
oligonucleotide specifically hybridizes to more than one target
site.
[0040] As used herein, "designing" or "designed to" refer to the
process of designing an oligomeric compound that specifically
hybridizes with a selected nucleic acid molecule.
[0041] As used herein, the term "modulation" refers to a
perturbation of amount or quality of a function or activity when
compared to the function or activity prior to modulation. For
example, modulation includes the change, either an increase
(stimulation or induction) or a decrease (inhibition or reduction)
in gene expression. As further example, modulation of expression
can include perturbing splice site selection of pre-mRNA
processing, resulting in a change in the amount of a particular
splice-variant present compared to conditions that were not
perturbed.
[0042] As used herein, the term "expression" refers to all the
functions and steps by which a gene's coded information is
converted into structures present and operating in a cell. Such
structures include, but are not limited to the products of
transcription and translation.
[0043] As used herein, "variant" refers to an alternative RNA
transcript that can be produced from the same genomic region of
DNA. Variants include, but are not limited to "pre-mRNA variants"
which are transcripts produced from the same genomic DNA that
differ from other transcripts produced from the same genomic DNA in
either their start or stop position and contain both intronic and
exonic sequence. Variants also include, but are not limited to,
those with alternate splice junctions, or alternate initiation and
termination codons.
[0044] As used herein, "high-affinity modified monomer" refers to a
monomer having at least one modified nucleobase, internucleoside
linkage or sugar moiety, when compared to naturally occurring
monomers, such that the modification increases the affinity of an
antisense compound comprising the high-affinity modified monomer to
its target nucleic acid. High-affinity modifications include, but
are not limited to, monomers (e.g., nucleosides and nucleotides)
comprising 2'-modified sugars.
[0045] As used herein, the term "2'-modified" or "2'-substituted"
means a sugar comprising substituent at the 2' position other than
H or OH. 2'-modified monomers, include, but are not limited to,
BNA's and monomers (e.g., nucleosides and nucleotides) with
2'-substituents, such as allyl, amino, azido, thio, O-allyl,
O--C1-C10 alkyl, --OCF3, O--(CH2)2-O--CH3, 2'--O(CH2)2SCH3,
O--(CH2)2-O--N(Rm)(Rn), or O--CH2-C(.dbd.O)--N(Rm)(Rn), where each
Rm and Rn is, independently, H or substituted or unsubstituted
C1-C10 alkyl. In certain embodiments, oligomeric compounds comprise
a 2' modified monomer that does not have the formula 2'-O(CH2)nH,
wherein n is one to six. In certain embodiments, oligomeric
compounds comprise a 2' modified monomer that does not have the
formula 2'-OCH3. In certain embodiments, oligomeric compounds
comprise a 2' modified monomer that does not have the formula or,
in the alternative, 2'-O(CH2)2OCH3.
[0046] As used herein, the term "bicyclic nucleic acid" or "BNA" or
"bicyclic nucleoside" or "bicyclic nucleotide" refers to a
nucleoside or nucleotide wherein the furanose portion of the
nucleoside includes a bridge connecting two carbon atoms on the
furanose ring, thereby forming a bicyclic ring system.
[0047] As used herein, unless otherwise indicated, the term
"methyleneoxy BNA" alone refers to .beta.-D-methyleneoxy BNA.
[0048] As used herein, the term "MOE" refers to a 2'-O-methoxyethyl
substituent.
[0049] As used herein, the term "gapmer" refers to a chimeric
oligomeric compound comprising a central region (a "gap") and a
region on either side of the central region (the "wings"), wherein
the gap comprises at least one modification that is different from
that of each wing. Such modifications include nucleobase, monomeric
linkage, and sugar modifications as well as the absence of
modification (unmodified). Thus, in certain embodiments, the
nucleotide linkages in each of the wings are different than the
nucleotide linkages in the gap. In certain embodiments, each wing
comprises nucleotides with high affinity modifications and the gap
comprises nucleotides that do not comprise that modification. In
certain embodiments the nucleotides in the gap and the nucleotides
in the wings all comprise high affinity modifications, but the high
affinity modifications in the gap are different than the high
affinity modifications in the wings. In certain embodiments, the
modifications in the wings are the same as one another. In certain
embodiments, the modifications in the wings are different from each
other. In certain embodiments, nucleotides in the gap are
unmodified and nucleotides in the wings are modified. In certain
embodiments, the modification(s) in each wing are the same. In
certain embodiments, the modification(s) in one wing are different
from the modification(s) in the other wing. In certain embodiments,
oligomeric compounds are gapmers having 2'-deoxynucleotides in the
gap and nucleotides with high-affinity modifications in the
wing.
[0050] As used herein, "different modifications" or "differently
modified" refer to nucleosides or internucleoside linkages that
have different nucleoside modifications or internucleoside linkages
than one another, including absence of modifications. Thus, for
example, a MOE nucleoside and an unmodified DNA nucleoside are
"differently modified," even though the DNA nucleoside is
unmodified. Likewise, DNA and RNA are "differently modified," even
though both are naturally-occurring unmodified nucleosides.
[0051] As used herein, the term "prodrug" refers to a therapeutic
agent that is prepared in an inactive form that is converted to an
active form (i.e., drug) within the body or cells thereof by the
action of endogenous enzymes or other chemicals and/or
conditions.
[0052] As used herein, the term "pharmaceutically acceptable salts"
refers to salts of active compounds that retain the desired
biological activity of the active compound and do not impart
undesired toxicological effects thereto.
[0053] As used herein, the term "cap structure" or "terminal cap
moiety" refers to chemical modifications, which have been
incorporated at either terminus of an antisense compound.
[0054] As used herein, the term "prevention" refers to delaying or
forestalling the onset or development of a condition or disease for
a period of time from hours to days, preferably weeks to
months.
[0055] As used herein, the term "amelioration" refers to a
lessening of at least one activity or one indicator of the severity
of a condition or disease. The severity of indicators may be
determined by subjective or objective measures which are known to
those skilled in the art.
[0056] As used herein, the term "treatment" refers to administering
a composition of the invention to effect an alteration or
improvement of the disease or condition. Prevention, amelioration,
and/or treatment may require administration of multiple doses at
regular intervals, or prior to onset of the disease or condition to
alter the course of the disease or condition. Moreover, a single
agent may be used in a single individual for each prevention,
amelioration, and treatment of a condition or disease sequentially,
or concurrently.
[0057] As used herein, the term "pharmaceutical agent" refers to a
substance provides a therapeutic benefit when administered to a
subject.
[0058] As used herein, the term "therapeutically effective amount"
refers to an amount of a pharmaceutical agent that provides a
therapeutic benefit to an animal.
[0059] As used herein, "administering" means providing a
pharmaceutical agent to an animal, and includes, but is not limited
to administering by a medical professional and
self-administering.
[0060] As used herein, the term "pharmaceutical composition" refers
to a mixture of substances suitable for administering to an
individual. For example, a pharmaceutical composition may comprise
an antisense oligonucleotide and a sterile aqueous solution.
[0061] As used herein, the term "animal" refers to a human or
non-human animal, including, but not limited to, mice, rats,
rabbits, dogs, cats, pigs, and non-human primates, including, but
not limited to, monkeys and chimpanzees.
[0062] As used herein, the term "parenteral administration," refers
to administration through injection or infusion. Parenteral
administration includes, but is not limited to, subcutaneous
administration, intravenous administration, or intramuscular
administration.
[0063] As used herein, the term "subcutaneous administration"
refers to administration just below the skin. "Intravenous
administration" means administration into a vein.
[0064] As used herein, the term "dose" refers to a specified
quantity of a pharmaceutical agent provided in a single
administration. In certain embodiments, a dose may be administered
in two or more boluses, tablets, or injections. For example, in
certain embodiments, where subcutaneous administration is desired,
the desired dose requires a volume not easily accommodated by a
single injection. In such embodiments, two or more injections may
be used to achieve the desired dose. In certain embodiments, a dose
may be administered in two or more injections to minimize injection
site reaction in an individual.
[0065] As used herein, the term "dosage unit" refers to a form in
which a pharmaceutical agent is provided. In certain embodiments, a
dosage unit is a vial comprising lyophilized antisense
oligonucleotide. In certain embodiments, a dosage unit is a vial
comprising reconstituted antisense oligonucleotide.
[0066] As used herein, the term "active pharmaceutical ingredient"
refers to the substance in a pharmaceutical composition that
provides a desired effect.
[0067] As used herein, the term "alkyl," as used herein, refers to
a saturated straight or branched hydrocarbon radical containing up
to twenty four carbon atoms. Examples of alkyl groups include, but
are not limited to, methyl, ethyl, propyl, butyl, isopropyl,
n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically
include from 1 to about 24 carbon atoms, more typically from 1 to
about 12 carbon atoms (C1-C12 alkyl) with from 1 to about 6 carbon
atoms being more preferred. The term "lower alkyl" as used herein
includes from 1 to about 6 carbon atoms. Alkyl groups as used
herein may optionally include one or more further substituent
groups.
[0068] As used herein, the term "alkenyl," as used herein, refers
to a straight or branched hydrocarbon chain radical containing up
to twenty four carbon atoms and having at least one carbon-carbon
double bond. Examples of alkenyl groups include, but are not
limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl,
dienes such as 1,3-butadiene and the like. Alkenyl groups typically
include from 2 to about 24 carbon atoms, more typically from 2 to
about 12 carbon atoms with from 2 to about 6 carbon atoms being
more preferred. Alkenyl groups as used herein may optionally
include one or more further substituent groups.
[0069] As used herein, the term "alkynyl," as used herein, refers
to a straight or branched hydrocarbon radical containing up to
twenty four carbon atoms and having at least one carbon-carbon
triple bond. Examples of alkynyl groups include, but are not
limited to, ethynyl, 1-propynyl, 1-butyryl, and the like. Alkynyl
groups typically include from 2 to about 24 carbon atoms, more
typically from 2 to about 12 carbon atoms with from 2 to about 6
carbon atoms being more preferred. Alkynyl groups as used herein
may optionally include one or more further substitutent groups.
[0070] As used herein, the term "aminoalkyl" as used herein, refers
to an amino substituted alkyl radical. This term is meant to
include C1-C12 alkyl groups having an amino substituent at any
position and wherein the alkyl group attaches the aminoalkyl group
to the parent molecule. The alkyl and/or amino portions of the
aminoalkyl group can be further substituted with substituent
groups.
[0071] As used herein, the term "aliphatic," as used herein, refers
to a straight or branched hydrocarbon radical containing up to
twenty four carbon atoms wherein the saturation between any two
carbon atoms is a single, double or triple bond. An aliphatic group
preferably contains from 1 to about 24 carbon atoms, more typically
from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms
being more preferred. The straight or branched chain of an
aliphatic group may be interrupted with one or more heteroatoms
that include nitrogen, oxygen, sulfur and phosphorus. Such
aliphatic groups interrupted by heteroatoms include without
limitation polyalkoxys, such as polyalkylene glycols, polyamines,
and polyimines. Aliphatic groups as used herein may optionally
include further substitutent groups.
[0072] As used herein, the term "alicyclic" or "alicyclyl" refers
to a cyclic ring system wherein the ring is aliphatic. The ring
system can comprise one or more rings wherein at least one ring is
aliphatic. Preferred alicyclics include rings having from about 5
to about 9 carbon atoms in the ring. Alicyclic as used herein may
optionally include further substitutent groups. As used herein, the
term "alkoxy," as used herein, refers to a radical formed between
an alkyl group and an oxygen atom wherein the oxygen atom is used
to attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include, but are not limited to, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substitutent groups.
[0073] As used herein, the terms "halo" and "halogen," as used
herein, refer to an atom selected from fluorine, chlorine, bromine
and iodine.
[0074] As used herein, the terms "aryl" and "aromatic," as used
herein, refer to a mono- or polycyclic carbocyclic ring system
radicals having one or more aromatic rings. Examples of aryl groups
include, but are not limited to, phenyl, naphthyl,
tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl
ring systems have from about 5 to about 20 carbon atoms in one or
more rings. Aryl groups as used herein may optionally include
further substitutent groups.
[0075] As used herein, the terms "aralkyl" and "arylalkyl," as used
herein, refer to a radical formed between an alkyl group and an
aryl group wherein the alkyl group is used to attach the aralkyl
group to a parent molecule. Examples include, but are not limited
to, benzyl, phenethyl and the like. Aralkyl groups as used herein
may optionally include further substitutent groups attached to the
alkyl, the aryl or both groups that form the radical group.
[0076] As used herein, the term "heterocyclic radical" as used
herein, refers to a radical mono-, or poly-cyclic ring system that
includes at least one heteroatom and is unsaturated, partially
saturated or fully saturated, thereby including heteroaryl groups.
Heterocyclic is also meant to include fused ring systems wherein
one or more of the fused rings contain at least one heteroatom and
the other rings can contain one or more heteroatoms or optionally
contain no heteroatoms. A heterocyclic group typically includes at
least one atom selected from sulfur, nitrogen or oxygen. Examples
of heterocyclic groups include, [1,3]dioxolane, pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl,
morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl,
pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as
used herein may optionally include further substitutent groups.
[0077] As used herein, the terms "heteroaryl," and
"heteroaromatic," as used herein, refer to a radical comprising a
mono- or poly-cyclic aromatic ring, ring system or fused ring
system wherein at least one of the rings is aromatic and includes
one or more heteroatom. Heteroaryl is also meant to include fused
ring systems including systems where one or more of the fused rings
contain no heteroatoms. Heteroaryl groups typically include one
ring atom selected from sulfur, nitrogen or oxygen. Examples of
heteroaryl groups include, but are not limited to, pyridinyl,
pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl,
oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl,
furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl,
quinoxalinyl, and the like. Heteroaryl radicals can be attached to
a parent molecule directly or through a linking moiety such as an
aliphatic group or hetero atom. Heteroaryl groups as used herein
may optionally include further substitutent groups.
[0078] As used herein, the term "heteroarylalkyl," as used herein,
refers to a heteroaryl group as previously defined having an alky
radical that can attach the heteroarylalkyl group to a parent
molecule. Examples include, but are not limited to,
pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the
like. Heteroarylalkyl groups as used herein may optionally include
further substitutent groups on one or both of the heteroaryl or
alkyl portions.
[0079] As used herein, the term "mono or poly cyclic structure" as
used in the present invention includes all ring systems that are
single or polycyclic having rings that are fused or linked and is
meant to be inclusive of single and mixed ring systems individually
selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl,
arylalkyl, heterocyclic, heteroaryl, heteroaromatic,
heteroarylalkyl. Such mono and poly cyclic structures can contain
rings that are uniform or have varying degrees of saturation
including fully saturated, partially saturated or fully
unsaturated. Each ring can comprise ring atoms selected from C, N,
O and S to give rise to heterocyclic rings as well as rings
comprising only C ring atoms which can be present in a mixed motif
such as for example benzimidazole wherein one ring has only carbon
ring atoms and the fused ring has two nitrogen atoms. The mono or
poly cyclic structures can be further substituted with substituent
groups such as for example phthalimide which has two .dbd.O groups
attached to one of the rings. In another aspect, mono or poly
cyclic structures can be attached to a parent molecule directly
through a ring atom, through a substituent group or a bifunctional
linking moiety.
[0080] As used herein, the term "acyl," as used herein, refers to a
radical formed by removal of a hydroxyl group from an organic acid
and has the general formula --C(O)--X where X is typically
aliphatic, alicyclic or aromatic. Examples include aliphatic
carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic
sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic
phosphates and the like. Acyl groups as used herein may optionally
include further substitutent groups.
[0081] As used herein, the term "hydrocarbyl" includes groups
comprising C, O and H. Included are straight, branched and cyclic
groups having any degree of saturation. Such hydrocarbyl groups can
include one or more heteroatoms selected from N, O and S and can be
further mono or poly substituted with one or more substituent
groups.
[0082] As used herein, the terms "substituent" and "substituent
group," include groups that are typically added to other groups or
parent compounds to enhance desired properties or give desired
effects. Substituent groups can be protected or unprotected and can
be added to one available site or to many available sites in a
parent compound. Substituent groups may also be further substituted
with other substituent groups and may be attached directly or via a
linking group such as an alkyl or hydrocarbyl group to a parent
compound. Such groups include without limitation, halogen,
hydroxyl, alkyl, alkenyl, alkynyl, acyl (--C(O)Raa), carboxyl
(--C(O)O-Raa), aliphatic groups, alicyclic groups, alkoxy,
substituted oxo (--O-Raa), aryl, aralkyl, heterocyclic, heteroaryl,
heteroarylalkyl, amino (--NRbbRcc), imino(.dbd.NRbb), amido
(--C(O)NRbbRccor --N(Rbb)C(O)Raa), azido (--N3), nitro (--NO2),
cyano (--CN), carbamido (--OC(O)NRbbRcc or --N(Rbb)C(O)ORaa),
ureido (--N(Rbb)C(O)NRbbRcc), thioureido (--N(Rbb)C-(S)NRbbRcc),
guanidinyl (--N(Rbb)C(.dbd.NRbb)NRbbRcc), amidinyl
(--C(.dbd.NRbb)NRbbRcc or --N(Rbb)C(NRbb)Raa), thiol (--SRbb),
sulfinyl (--S(O)Rbb), sulfonyl (--S(O)2Rbb), sulfonamidyl
(--S(O)2NRbbRcc or --N(Rbb)S(O)2Rbb) and conjugate groups. Wherein
each Rau, Rbb and Rcc is, independently, H, an optionally linked
chemical functional group or a further substituent group with a
preferred list including without limitation H, alkyl, alkenyl,
alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl,
alicyclic, heterocyclic and heteroarylalkyl.
[0083] A "stabilizing modification" means providing enhanced
stability, in the presence of nucleases, relative to that provided
by 2'-deoxynucleosides linked by phosphodiester internucleoside
linkages. Thus, such modifications provide "enhanced nuclease
stability" to oligomeric compounds. Stabilizing modifications
include at least stabilizing nucleosides and stabilizing
internucleoside linkage groups.
[0084] The term "stability enhancing nucleoside" or "stabilizing
nucleoside" is meant to include all manner of nucleosides known to
those skilled in the art to provide enhanced nuclease stability of
oligomeric compounds. In one embodiment, stabilizing nucleosides
can be 2'-modified nucleosides. Examples of such stability
enhancing 2'-modified nucleosides include, but are not limited to,
2'-OCH3, 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, Martin
et al., Hely. Chim. Acta, 1995, 78, 486-504), a bicyclic sugar
modified nucleoside, 2'-dimethylaminooxyethoxy (O(CH2)2ON(CH3)2,
2'-dimethylaminoethoxyethoxy (2'-O--CH2-O--CH2-N(CH3)2), methoxy
(--O--CH3), aminopropoxy (--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2),
allyl (--CH.sub.2--CH.dbd.CH.sub.2), --O-allyl
(--O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-acetamido
(2'-O--CH.sub.2C(.dbd.O)NR1R1 wherein each R1 is independently, H
or C1-C1 alkyl.
[0085] Representative U.S. patents that teach the preparation of
such 2'-modified nucleosides include, but are not limited to, U.S.
Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;
5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427;
5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265;
5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which
are commonly owned with this application, and each of which is
herein incorporated by reference.
[0086] In one aspect the present invention provides oligomeric
compounds having at least one stability enhancing internucleoside
linkage. The term "stability enhancing internucleoside linkage" or
"stabilizing internucleoside linking group" is meant to include all
manner of internucleoside linkages that provide enhanced nuclease
stability to oligomeric compounds relative to that provided by
phosphodiester internucleoside linkages. Thus, stability enhancing
internucleoside linkages are linkages other than phosphodiester
internucleoside linkages. An example of such stability enhancing
internucleoside linkages includes, but is not limited to,
phosphorothioates internucleoside linkages.
[0087] Representative U.S. patents that teach the preparation of
stability enhancing internucleoside linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 5,286,717; 5,587,361;
5,672,697; 5,489,677; 5,663,312; 5,646,269 and 5,677,439, each of
which is herein incorporated by reference.
Oligomeric Compounds
[0088] In certain embodiments, the present invention provides
oligomeric compounds. In certain such embodiments, oligomeric
compounds have antisense activity. In certain such embodiments,
oligomeric compounds have splice altering activity. In certain
embodiments, oligomeric compounds alter poly-adenylation. In
certain embodiments, oligomeric compounds interfere with
translation. In certain embodiments, oligomeric compounds have
RNase H independent antisense activity.
[0089] In certain embodiments, the present invention provides
oligomeric compounds comprising modifications. In certain
embodiments the present invention provides oligomeric compounds
comprising motifs of modifications. In certain embodiments,
modifications and motifs suitable for the present invention may be
found in WO 2007/090073, which is hereby incorporated by reference
in its entirety for any purpose.
Oligomeric Compound Modifications
[0090] As is known in the art, a nucleoside is a base-sugar
combination. The base (or nucleobase) portion of the nucleoside is
normally a heterocyclic base moiety. The two most common classes of
such heterocyclic bases are purines and pyrimidines. Nucleotides
are nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to the 2',3' or 5' hydroxyl moiety of the
sugar. In forming oligonucleotides, the phosphate groups covalently
link adjacent nucleosides to one another to form a linear polymeric
compound. The respective ends of this linear polymeric structure
can be joined to form a circular structure by hybridization or by
formation of a covalent bond. In addition, linear compounds may
have internal nucleobase complementarity and may therefore fold in
a manner as to produce a fully or partially double-stranded
structure. Within the unmodified oligonucleotide structure, the
phosphate groups are commonly referred to as forming the
internucleoside linkages of the oligonucleotide. The unmodified
internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester
linkage.
Modified Internucleoside Linking Groups
[0091] Specific examples of oligomeric compounds include
oligonucleotides containing modified, i.e. non-naturally occurring
internucleoside linkages. Such non-naturally internucleoside
linkages are often selected over naturally occurring forms because
of desirable properties such as, for example, enhanced cellular
uptake, enhanced affinity for other oligonucleotides or nucleic
acid targets and increased stability in the presence of
nucleases.
[0092] Oligomeric compounds of the invention can have one or more
modified internucleoside linkages. As defined in this
specification, oligonucleotides having modified internucleoside
linkages include internucleoside linkages that retain a phosphorus
atom and internucleoside linkages that do not have a phosphorus
atom. For the purposes of this specification, and as sometimes
referenced in the art, modified oligonucleotides that do not have a
phosphorus atom in their internucleoside backbone can also be
considered to be oligonucleosides.
[0093] One suitable phosphorus-containing modified internucleoside
linkage is the phosphorothioate internucleoside linkage. A number
of other modified oligonucleotide backbones (internucleoside
linkages) are known in the art and may be useful in the context of
this invention.
[0094] Representative U.S. patents that teach the preparation of
phosphorus-containing internucleoside linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899;
5,721,218; 5,672,697 5,625,050, 5,489,677, and 5,602,240 each of
which is herein incorporated by reference.
[0095] Modified oligonucleoside backbones (internucleoside
linkages) that do not include a phosphorus atom therein have
internucleoside linkages that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having amide backbones; and others, including those
having mixed N, O, S and CH2 component parts.
[0096] Representative U.S. patents that teach the preparation of
the above non-phosphorous-containing oligonucleosides include, but
are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, each of which is herein incorporated by
reference.
[0097] Oligomeric compounds can also include oligonucleotide
mimetics. The term mimetic as it is applied to oligonucleotides is
intended to include oligomeric compounds wherein only the furanose
ring or both the furanose ring and the internucleotide linkage are
replaced with novel groups, replacement of only the furanose ring
with for example a morpholino ring, is also referred to in the art
as being a sugar surrogate. The heterocyclic base moiety or a
modified heterocyclic base moiety is maintained for hybridization
with an appropriate target nucleic acid. Oligonucleotide mimetics
can include oligomeric compounds such as peptide nucleic acids
(PNA) and cyclohexenyl nucleic acids (known as CeNA, see Wang et
al., J. Am. Chem. Soc., 2000, 122, 8595-8602) Representative U.S.
patents that teach the preparation of oligonucleotide mimetics
include, but are not limited to, U.S. Pat. Nos. 5,539,082;
5,714,331; and 5,719,262, each of which is herein incorporated by
reference. Another class of oligonucleotide mimetic is referred to
as phosphonomonoester nucleic acid and incorporates a phosphorus
group in the backbone. This class of olignucleotide mimetic is
reported to have useful physical and biological and pharmacological
properties in the areas of inhibiting gene expression (antisense
oligonucleotides, ribozymes, sense oligonucleotides and
triplex-forming oligonucleotides), as probes for the detection of
nucleic acids and as auxiliaries for use in molecular biology.
Another oligonucleotide mimetic has been reported wherein the
furanosyl ring has been replaced by a cyclobutyl moiety.
Modified Sugar Moieties
[0098] Oligomeric compounds of the invention can also contain one
or more modified or substituted sugar moieties. The base moieties
are maintained for hybridization with an appropriate nucleic acid
target compound. Sugar modifications can impart nuclease stability,
binding affinity or some other beneficial biological property to
the oligomeric compounds. Representative modified sugars include
carbocyclic or acyclic sugars, sugars having substituent groups at
one or more of their 2',3' or 4' positions, sugars having
substituents in place of one or more hydrogen atoms of the sugar,
and sugars having a linkage between any two other atoms in the
sugar. A large number of sugar modifications are known in the art,
sugars modified at the 2' position and those which have a bridge
between any 2 atoms of the sugar (such that the sugar is bicyclic)
are particularly useful in this invention. Examples of sugar
modifications useful in this invention include, but are not limited
to compounds comprising a sugar substituent group selected from:
OH; F; O--, S--, or N-alkyl; or O-alkyl-O-alkyl, wherein the alkyl,
alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to
C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl.
Particularly suitable are: 2-methoxyethoxy (also known as
2'-O-methoxyethyl, 2'-MOE, or 2'-OCH.sub.2CH.sub.2OCH.sub.3),
2'-O-methyl (2'-.beta.-CH.sub.3), 2'-fluoro (2'-F); or bicyclic
sugar modified nucleosides having a bridging group connecting the
4' carbon atom to the 2' carbon atom wherein example bridge groups
include --CH.sub.2--O--, --(CH.sub.2).sub.2--O-- or
--CH.sub.2--N(R.sub.3)--O-- wherein R.sub.3 is H or
C.sub.1-C.sub.12 alkyl.
[0099] In one embodiment, oligomeric compounds include one or more
nucleosides having a substituent group at the 2'-position. Examples
of 2'-sugar substituent groups useful in this invention include,
but are not limited to: OH; F; O--, S--, or N-alkyl; O--, S--, or
N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the
alkyl, alkenyl and alkynyl may be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and
alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2,
OCH.sub.2C(.dbd.O)N(H)CH.sub.3 and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m
are from 1 to about 10. Other 2'-sugar substituent groups include:
C.sub.1 to C.sub.10 alkyl, substituted alkyl, alkenyl, alkynyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving pharmacokinetic properties, or a group for
improving the pharmacodynamic properties of an oligomeric compound,
and other substituents having similar properties.
[0100] One modification that imparts increased nuclease resitance
and a very high binding affinity to nucleotides is the 2'-MOE side
chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One
of the immediate advantages of the 2'-MOE substitution is the
improvement in binding affinity, which is greater than many similar
2' modifications such as O-methyl, O-propyl, and O-aminopropyl.
Oligonucleotides having the 2'-MOE substituent also have been shown
to be antisense inhibitors of gene expression with promising
features for in vivo use (Martin, P., Helv. Chim. Acta, 1995, 78,
486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al.,
Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al.,
Nucleosides Nucleotides, 1997, 16, 917-926).
[0101] 2'-Sugar substituent groups may be in the arabino (up)
position or ribo (down) position. One 2'-arabino modification is
2'-F. Similar modifications can also be made at other positions on
the oligomeric compound, particularly the 3' position of the sugar
on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides
and the 5' position of 5' terminal nucleotide. Oligomeric compounds
may also have sugar mimetics such as cyclobutyl moieties in place
of the pentofuranosyl sugar. Representative U.S. patents that teach
the preparation of such modified sugar structures include, but are
not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and
5,700,920, each of which is herein incorporated by reference in its
entirety.
[0102] Representative sugar substituents groups are disclosed in
U.S. Pat. No. 6,172,209 entitled "Capped 2'-Oxyethoxy
Oligonucleotides," hereby incorporated by reference in its
entirety.
[0103] Representative cyclic sugar substituent groups are disclosed
in U.S. Pat. No. 6,271,358 entitled "RNA Targeted 2'-Oligomeric
compounds that are Conformationally Preorganized," hereby
incorporated by reference in its entirety.
[0104] Representative guanidino substituent groups are disclosed in
U.S. Pat. No. 6,593,466 entitled "Functionalized Oligomers," hereby
incorporated by reference in its entirety.
[0105] Representative acetamido substituent groups are disclosed in
U.S. Pat. No. 6,147,200 which is hereby incorporated by reference
in its entirety.
[0106] Another group of modifications includes nucleosides having
sugar moieties that are bicyclic thereby locking the sugar
conformational geometry. Such modifications may impart nuclease
stability, binding affinity or some other beneficial biological
property to the oligomeric compounds. The most studied of these
nucleosides is a bicyclic sugar modified nucleoside having a
4'-CH.sub.2--O-2' bridge. This bridge attaches under the sugar as
shown forcing the sugar ring into a locked 3'-endo conformation
geometry. The alpha-L nucleoside has also been reported wherein the
linkage is above the ring and the heterocyclic base is in the alpha
rather than the beta-conformation (see U.S. Patent Application
Publication No.: Application 2003/0087230). The xylo analog has
also been prepared (see U.S. Patent Application Publication No.:
2003/0082807). Another bicyclic sugar modified nucleoside having
similar properties to the 4'-CH.sub.2--O-2' bridged nucleoside has
one added methylene group in the bridge 4'--(CH.sub.2).sub.2--O-2'
(Kaneko et al., U.S. Patent Application Publication No.: US
2002/0147332, Singh et al., Chem. Commun., 1998, 4, 455-456, also
see U.S. Pat. Nos. 6,268,490 and 6,670,461 and U.S. Patent
Application Publication No.: US 2003/0207841). Oligomeric compounds
incorporating these bicyclic sugar modified nucleosides
(4'-(CH.sub.2).sub.1(or)-O-2') display very high duplex thermal
stabilities with complementary DNA and RNA (Tm=+3 to +10 C),
stability towards 3'-exonucleolytic degradation and good solubility
properties.
[0107] The synthesis and preparation of the bicyclic sugar modified
monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and
uracil, along with their oligomerization, and nucleic acid
recognition properties have been described (Koshkin et al.,
Tetrahedron, 1998, 54, 3607-3630; WO 98/39352 and WO 99/14226).
[0108] Other bicyclic sugar modified nucleoside analogs such as the
4'-CH.sub.2--S-2' analog have also been prepared (Kumar et al.,
Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of other
bicyclic sugar analogs containing oligodeoxyribonucleotide duplexes
as substrates for nucleic acid polymerases has also been described
(Wengel et al., PCT International Application WO 98-DK393
19980914).
Nucleobase Modifications
[0109] Oligomeric compounds of the invention can also contain one
or more nucleobase (often referred to in the art simply as "base")
modifications or substitutions which are structurally
distinguishable from, yet functionally interchangeable with,
naturally occurring or synthetic unmodified nucleobases. Such
nucleobase modifications can impart nuclease stability, binding
affinity or some other beneficial biological property to the
oligomeric compounds. As used herein, "unmodified" or "natural"
nucleobases include the purine bases adenine (A) and guanine (G),
and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
Modified nucleobases also referred to herein as heterocyclic base
moieties include other synthetic and natural nucleobases, many
examples of which such as 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, 7-deazaguanine and 7-deazaadenine among
others.
[0110] Heterocyclic base moieties can also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Some nucleobases include those disclosed in U.S. Pat.
No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I.,
ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research
and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed.,
CRC Press, 1993. Certain of these nucleobases are particularly
useful for increasing the binding affinity of the oligomeric
compounds of the invention. These include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2 aminopropyladenine, 5-propynyluracil and
5-propynylcytosine.
[0111] In one aspect of the present invention oligomeric compounds
are prepared having polycyclic heterocyclic compounds in place of
one or more heterocyclic base moieties. A number of tricyclic
heterocyclic compounds have been previously reported. These
compounds are routinely used in antisense applications to increase
the binding properties of the modified strand to a target strand.
The most studied modifications are targeted to guanosines hence
they have been termed G-clamps or cytidine analogs.
[0112] Representative cytosine analogs that make 3 hydrogen bonds
with a guanosine in a second strand include
1,3-diazaphenoxazine-2-one (R.sub.10.dbd.O,
R.sub.11-R.sub.14.dbd.H) (Kurchavov, et al., Nucleosides and
Nucleotides, 1997, 16, 1837-1846), 1,3-diazaphenothiazine-2-one
(R.sub.10.dbd.S, R.sub.11-R.sub.14.dbd.H), (Lin, K.-Y.; Jones, R.
J.; Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873-3874) and
6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (R.sub.10.dbd.O,
R.sub.11-R.sub.14.dbd.F) (Wang, J.; Lin, K.-Y., Matteucci, M.
Tetrahedron Lett. 1998, 39, 8385-8388). When incorporated into
oligonucleotides, these base modifications were shown to hybridize
with complementary guanine and the latter was also shown to
hybridize with adenine and to enhance helical thermal stability by
extended stacking interactions (also see U.S. Patent Application
Publication 20030207804 and U.S. Patent Application Publication
20030175906, both of which are incorporated herein by reference in
their entirety).
[0113] Helix-stabilizing properties have been observed when a
cytosine analog/substitute has an aminoethoxy moiety attached to
the rigid 1,3-diazaphenoxazine-2-one scaffold (R.sub.10.dbd.O,
R.sub.11=--O--(CH.sub.2).sub.2--NH.sub.2, R.sub.12-14.dbd.H) (Lin,
K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532).
Binding studies demonstrated that a single incorporation could
enhance the binding affinity of a model oligonucleotide to its
complementary target DNA or RNA with a .DELTA.T.sub.m of up to
18.degree. relative to 5-methyl cytosine (dC5.sup.me), which is the
highest known affinity enhancement for a single modification. On
the other hand, the gain in helical stability does not compromise
the specificity of the oligonucleotides. The T.sub.m data indicate
an even greater discrimination between the perfect match and
mismatched sequences compared to dC5.sup.me. It was suggested that
the tethered amino group serves as an additional hydrogen bond
donor to interact with the Hoogsteen face, namely the O6, of a
complementary guanine thereby forming 4 hydrogen bonds. This means
that the increased affinity of G-clamp is mediated by the
combination of extended base stacking and additional specific
hydrogen bonding.
[0114] Tricyclic heterocyclic compounds and methods of using them
that are amenable to the present invention are disclosed in U.S.
Pat. No. 6,028,183, and U.S. Pat. No. 6,007,992, the contents of
both are incorporated herein in their entirety.
[0115] The enhanced binding affinity of the phenoxazine derivatives
together with their sequence specificity makes them valuable
nucleobase analogs for the development of more potent
antisense-based drugs. The activity enhancement was even more
pronounced in case of G-clamp, as a single substitution was shown
to significantly improve the in vitro potency of a 20 mer
2'-deoxyphosphorothioate oligonucleotides (Flanagan, W. M.; Wolf,
J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci,
M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518).
[0116] Modified polycyclic heterocyclic compounds useful as
heterocyclic bases are disclosed in but not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269;
5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S.
Patent Application Publication 20030158403, each of which is
incorporated herein by reference in its entirety.
[0117] Certain nucleobase substitutions, including
5-methylcytosinse substitutions, are particularly useful for
increasing the binding affinity of the oligonucleotides of the
invention. For example, 5-methylcytosine substitutions have been
shown to increase nucleic acid duplex stability by 0.6-1.2.degree.
C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
Conjugated Oligomeric Compounds
[0118] One substitution that can be appended to the oligomeric
compounds of the invention involves the linkage of one or more
moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting oligomeric
compounds. In one embodiment such modified oligomeric compounds are
prepared by covalently attaching conjugate groups to functional
groups such as hydroxyl or amino groups. Conjugate groups of the
invention include intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, polyethers, groups that enhance
the pharmacodynamic properties of oligomers, and groups that
enhance the pharmacokinetic properties of oligomers. Typical
conjugates groups include cholesterols, carbohydrates, lipids,
phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve oligomeric
compound uptake, enhance oligomeric compound resistance to
degradation, and/or strengthen hybridization with RNA. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve oligomeric compound uptake,
distribution, metabolism or excretion. Representative conjugate
groups are disclosed in International Patent Application
PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which
is incorporated herein by reference. Conjugate moieties include but
are not limited to lipid moieties such as a cholesterol moiety and
a variety of others known in the art.
[0119] Furthermore, the oligomeric compounds of the invention can
have one or more moieties bound or conjugated, which facilitates
the active or passive transport, localization, or
compartmentalization of the oligomeric compound. Cellular
localization includes, but is not limited to, localization to
within the nucleus, the nucleolus, or the cytoplasm.
Compartmentalization includes, but is not limited to, any directed
movement of the oligonucleotides of the invention to a cellular
compartment including the nucleus, nucleolus, mitochondrion, or
imbedding into a cellular membrane. Furthermore, the oligomeric
compounds of the invention comprise one or more conjugate moieties
which facilitate posttranscriptional modification.
[0120] Certain conjugate groups amenable to the present invention
include lipid moieties such as a cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid
(Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); a
thioether, e.g., hexyl-5-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem.
Let., 1993, 3, 2765); a thiocholesterol (Oberhauser et al., Nucl.
Acids Res., 1992, 20, 533); an aliphatic chain, e.g., dodecandiol
or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
111; Kabanov et al., FEB S Lett., 1990, 259, 327; Svinarchuk et
al., Biochimie, 1993, 75, 49); a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or
triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al.,
Nucl. Acids Res., 1990, 18, 3777); a polyamine or a polyethylene
glycol chain (Manoharan et al., Nucleosides & Nucleotides,
1995, 14, 969); adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651); a palmityl moiety (Mishra et
al., Biochim. Biophys. Acta, 1995, 1264, 229); or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923).
[0121] Conjugate groups can be attached to various positions of an
oligomeric compound directly or via an optional linking group. The
term linking group is intended to include all groups amenable to
attachment of a conjugate group to an oligomeric compound. Linking
groups are bivalent groups useful for attachment of chemical
functional groups, conjugate groups, reporter groups and other
groups to selective sites in a parent compound such as for example
an oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the linker comprises a chain structure
or an oligomeric compound of repeating units such as ethylene glyol
or amino acid units. Examples of functional groups that are
routinely used in bifunctional linking moieties include, but are
not limited to, electrophiles for reacting with nucleophilic groups
and nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like. Some nonlimiting examples of bifunctional
linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C1-C10 alkyl,
substituted or unsubstituted C2-C10 alkenyl or substituted or
unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list
of preferred substituent groups includes hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl and alkynyl. Further representative linking groups
are disclosed for example in WO 94/01550 and WO 94/01550.
[0122] Oligomeric compounds used in the compositions of the present
invention can also be modified to have one or more stabilizing
groups that are generally attached to one or both termini of
oligomeric compounds to enhance properties such as for example
nuclease stability. Included in stabilizing groups are cap
structures. By "cap structure or terminal cap moiety" is meant
chemical modifications, which have been incorporated at either
terminus of oligonucleotides (see for example Wincott et al., WO
97/26270, incorporated by reference herein). These terminal
modifications can protect the oligomeric compounds having terminal
nucleic acid molecules from exonuclease degradation, and can help
in delivery and/or localization within a cell. The cap can be
present at the 5'-terminus (5'-cap) or at the 3'-terminus (3'-cap)
or can be present on both termini. For double-stranded oligomeric
compounds, the cap may be present at either or both termini of
either strand. In non-limiting examples, the 5'-cap includes
inverted abasic residue (moiety), 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide,
carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl riucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety (see Wincott
et al., International PCT publication No. WO 97/26270, incorporated
by reference herein).
[0123] Particularly preferred 3'-cap structures of the present
invention include, for example 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide,
carbocyclic nucleotide; 5'-amino-alkyl phosphate;
1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5',-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925;
incorporated by reference herein).
[0124] Further 3' and 5'-stabilizing groups that can be used to cap
one or both ends of an oligomeric compound to impart nuclease
stability include those disclosed in WO 03/004602 published on Jan.
16, 2003.
Oligomeric Compound Chemical Motifs
[0125] Oligomeric compounds can have chemically modified subunits
arranged in specific orientations along their length. A "chemical
motif" is defined as the arrangement of chemical modifications
throughout an oligomeric compound
[0126] In certain embodiments, oligomeric compounds of the
invention are uniformly modified. As used herein, in a "uniformly
modified" oligomeric compound a chemical modification of a sugar,
base, internucleoside linkage, or combination thereof, is applied
to each subunit of the oligomeric compound. In one embodiment, each
sugar moiety of a uniformly modified oligomeric compound is
modified. In other embodiments, each internucleoside linkage of a
uniformly modified oligomeric compound is modified. In further
embodiments, each sugar and each internucleoside linkage of
uniformly modified oligomeric compounds bears a modification.
Examples of uniformly modified oligomeric compounds include, but
are not limited to, uniform 2'-MOE sugar moieties; uniform 2'-MOE
and uniform phosphorothioate backbone; uniform 2'-OMe; uniform
2'-OMe and uniform phosphorothioate backbone; uniform 2'-F; uniform
2'-F and uniform phosphorothioate backbone; uniform
phosphorothioate backbone; uniform deoxynucleotides; uniform
ribonucleotides; uniform phosphorothioate backbone; and
combinations thereof.
[0127] As used herein the term "positionally modified motif" is
meant to include a sequence of uniformly sugar modified nucleosides
wherein the sequence is interrupted by two or more regions
comprising from 1 to about 8 sugar modified nucleosides wherein
internal regions are generally from 1 to about 6 or from 1 to about
4. The positionally modified motif includes internal regions of
sugar modified nucleoside and can also include one or both termini.
Each particular sugar modification within a region of sugar
modified nucleosides essentially uniform. The nucleotides of
regions are distinguished by differing sugar modifications.
Positionally modified motifs are not determined by the nucleobase
sequence or the location or types of internucleoside linkages. The
term positionally modified oligomeric compound includes many
different specific substitution patterns. A number of these
substitution patterns have been prepared and tested in
compositions. In one embodiment the positionally modified
oligomeric compounds may comprise phosphodiester internucleotide
linkages, phosphorothioate internucleotide linkages, or a
combination of phosphodiester and phosphorothioate internucleotide
linkages.
[0128] In some embodiments, positionally modified oligomeric
compounds include oligomeric compounds having clusters of a first
modification interspersed with a second modification, as follows
5'-MMmmMmMMMmmmmMMMMmmmmm-3'; and 5'-MMmMMmMMmMMmMMmMMmMMmMM-3';
wherein "M" represent the first modification, and "m" represents
the second modification. In one embodiment, "M" is 2'-MOE and "m"
is a bicyclic sugar modified nucleoside having a
4'-(CH.sub.2).sub.n--O-2' where n is 1 or 2. In other embodiments,
"M" is 2'-MOE and "m" is 2'-F. In other embodiments, "M" is 2'-OMe
and "m" is 2'-F.
[0129] In some embodiments, oligomeric compounds are chimeric
oligomeric compounds.
[0130] In certain embodiments, chimeric oligomeric compounds are
gapmers. The types of sugar moieties that are used to differentiate
the regions of a gapmer oligomeric compound include
.beta.-D-ribonucleosides, .beta.-D-deoxyribonucleosides, or
2'-modified nucleosides disclosed herein, including, without
limitation, 2'-MOE, 2'-fluoro, 2'-O--CH.sub.3, and bicyclic sugar
modified nucleosides. In one embodiment, each region is uniformly
modified. In another embodiment, the nucleosides of the internal
region uniform sugar moieties that are different than the sugar
moieties in an external region. In one non-limiting example, the
gap is uniformly comprised of a first 2'-modified nucleoside and
each of the wings is uniformly comprised of a second 2'-modified
nucleoside.
[0131] Gapmer oligomeric compounds are further defined as being
either "symmetric" or "asymmetric". A gapmer having the same
uniform sugar modification in each of the wings is termed a
"symmetric gapmer oligomeric compound." A gapmer having different
uniform modifications in each wing is termed an "asymmetric gapmer
oligomeric compound." In one embodiment, gapmer oligomeric
compounds such as these can have, for example, both wings
comprising 2'-MOE modified nucleosides (symmetric gapmer) and a gap
comprising .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides. In another embodiment, a symmetric
gapmer can have both wings comprising 2'-MOE modified nucleosides
and a gap comprising 2'-modified nucleosides other than 2'-MOE
modified nucleosides. Asymmetric gapmer oligomeric compounds, for
example, can have one wing comprising 2'-OCH.sub.3 modified
nucleosides and the other wing comprising 2'-MOE modified
nucleosides with the internal region (gap) comprising
.beta.-D-ribonucleosides, .beta.-D-deoxyribonucleosides or
2'-modified nucleosides that are other than 2'-MOE or 2'-OCH3
modified nucleosides. These gapmer oligomeric compounds may
comprise phosphodiester internucleotide linkages, phosphorothioate
internucleotide linkages, or a combination of phosphodiester and
phosphorothioate internucleotide linkages.
[0132] In some embodiments, each wing of a gapmer oligomeric
compounds comprises the same number of subunits. In other
embodiments, one wing of a gapmer oligomeric compound comprises a
different number of subunits than the other wing of a gapmer
oligomeric compound. In one embodiment, the wings of gapmer
oligomeric compounds have, independently, from 1 to about 3
nucleosides. Suitable wings comprise from 2 to about 3 nucleosides.
In one embodiment, the wings can comprise 2 nucleosides. In another
embodiment, the 5'-wing can comprise 1 or 2 nucleosides and the
3'-wing can comprise 2 or 3 nucleosides. The present invention
therefore includes gapped oligomeric compounds wherein each wing
independently comprises 1, 2 or 3 sugar modified nucleosides. In
one embodiment, the internal or gap region comprises from 15 to 23
nucleosides, which is understood to include 15, 16, 17, 18, 19, 20,
21, 22 and 23 nucleotides. In a further embodiment, the internal or
gap region is understood to comprise from 17 to 21 nucleosides,
which is understood to include 17, 18, 19, 20, or 21 nucleosides.
In another embodiment, the internal or gap region is understood to
comprise from 18 to 20 nucleosides, which is understood to include
18, 19 or 20 nucleosides. In one preferred embodiment, the gap
region comprises 19 nucleosides. In one embodiment, the oligomeric
compound is a gapmer oligonucleotides with full length
complementarity to its target miRNA. In a further embodiment, the
wings are 2'-MOE modified nucleosides and the gap comprises
2'-fluoro modified nucleosides. In one embodiment one wing is 2
nucleosides in length and the other wing is 3 nucleosides in
length. In an additional embodiment, the wings are each 2
nucleosides in length and the gap region is 19 nucleotides in
length.
[0133] Examples of chimeric oligomeric compounds include, but are
not limited to, a 23 nucleobase oligomeric compound having a
central region comprised of a first modification and wing regions
comprised of a second modification (5'MMmmmmmmmmmmmmmmmmmmmMM3'); a
22 nucleobase compound having a central region comprised of a first
modification and wing regions comprised of a second modification
(5'MMmmmmmmmmmmmmmmmmmmMM3'); and a 21 nucleobase compound having a
central region comprised of a first modification and wing regions
comprised of a second modification (5'MMmmmmmmmmmmmmmmmmmMM3');
wherein "M" represents the first modification and "m" represents
the second modification. In one non-limiting example, "M" may be
2'-O-methoxyethyl and "m" may be 2'-fluoro.
[0134] In one embodiment, chimeric oligomeric compounds are
"hemimer oligomeric compounds" wherein chemical modifications to
sugar moieties and/or internucleoside linkage distinguish a region
of subunits at the 5' terminus from a region of subunits at the 3'
terminus of the oligomeric compound.
[0135] Chimeric oligomeric compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, and/or increased binding
affinity for the target nucleic acid. An additional region of the
oligomeric compound can, for example, contain a different
modification, and in some cases may serve as a substrate for
enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of
example, an oligomeric compound can be designed to comprise a
region that serves as a substrate for RNase H. RNase H is a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H by an oligomeric compound having a
cleavage region, therefore, results in cleavage of the RNA target,
thereby enhancing the efficiency of the oligomeric compound.
Alternatively, the binding affinity of the oligomeric compound for
its target nucleic acid can be varied along the length of the
oligomeric compound by including regions of chemically modified
nucleosides which have exhibit either increased or decreased
affinity as compared to the other regions. Consequently, comparable
results can often be obtained with shorter oligomeric compounds
having substrate regions when chimeras are used, compared to for
example phosphorothioate deoxyoligonucleotides hybridizing to the
same target region.
[0136] Chimeric oligomeric compounds of the invention can be formed
as composite structures of two or more oligonucleotides,
oligonucleotide mimics, oligonucleotide analogs, oligonucleosides
and/or oligonucleoside mimetics as described above. Such oligomeric
compounds have also been referred to in the art as hybrids,
hemimers, gapmers or inverted gapmers. Representative U.S. patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, each of which is herein
incorporated by reference in its entirety.
[0137] In another aspect of the chimeric oligomeric compound there
is a "gap-disabled" motif (also referred to as "gap-ablated
motif"). In the gap-disabled motif, the internal region is
interrupted by a chemical modification distinct from that of the
internal region. The wing regions can be uniformly sized or
differentially sized as also described above. Examples of
gap-disabled motifs are as follows: 5'MMMMMMmmmMMMmmmmMMMM3';
5'MMMMmmmmmmMmmmmmmmMM3'; 5'MMmmmmmmmmmmMMMmmmMM3'; wherein "m"
represents one sugar modification and "M" represents a different
sugar modification
[0138] As used in the present invention the term "alternating
motif" is meant to include a contiguous sequence of nucleosides
comprising two different nucleosides that alternate for essentially
the entire sequence of the oligomeric compound. The pattern of
alternation can be described by the formula:
5'-A(-L-B-L-A)n(-L-B)nn-3' where A and B are nucleosides
differentiated by having at least different sugar groups, each L is
an internucleoside linking group, nn is 0 or 1 and n is from about
7 to about 11. This permits alternating oligomeric compounds from
about 17 to about 24 nucleosides in length. This length range is
not meant to be limiting as longer and shorter oligomeric compounds
are also amenable to the present invention. This formula also
allows for even and odd lengths for alternating oligomeric
compounds wherein the 3' and 5'-terminal nucleosides are the same
(odd) or different (even). These alternating oligomeric compounds
may comprise phosphodiester internucleotide linkages,
phosphorothioate internucleotide linkages, or a combination of
phosphodiester and phosphorothioate internucleotide linkages.
[0139] The "A" and "B" nucleosides comprising alternating
oligomeric compounds of the present invention are differentiated
from each other by having at least different sugar moieties. Each
of the A and B nucleosides has a modified sugar moiety selected
from .beta.-D-ribonucleosides, .beta.-D-deoxyribonucleosides,
2'-modified nucleosides (such 2'-modified nucleosides may include
2'-MOE, 2'-fluoro, and 2'-O--CH.sub.3, among others), and bicyclic
sugar modified nucleosides. The alternating motif is independent
from the nucleobase sequence and the internucleoside linkages. The
internucleoside linkage can vary at each position or at particular
selected positions or can be uniform or alternating throughout the
oligomeric compound.
[0140] As used in the present invention the term "fully modified
motif" is meant to include a contiguous sequence of sugar modified
nucleosides wherein essentially each nucleoside is modified to have
the same modified sugar moiety. Suitable sugar modified nucleosides
for fully modified strands of the invention include, but are not
limited to, 2'-Fluoro (2'F), 2'--O(CH.sub.2).sub.2OCH.sub.3
(2'-MOE), 2'-OCH.sub.3 (2'-.beta.-methyl), and bicyclic sugar
modified nucleosides. In one aspect the 3' and 5'-terminal
nucleosides are left unmodified. In a preferred embodiment, the
modified nucleosides are either 2'-MOE, 2'-F, 2'-O-Me or a bicyclic
sugar modified nucleoside.
[0141] As used in the present invention the term "hemimer motif" is
meant to include a sequence of nucleosides that have uniform sugar
moieties (identical sugars, modified or unmodified) and wherein one
of the 5'-end or the 3'-end has a sequence of from 2 to 12
nucleosides that are sugar modified nucleosides that are different
from the other nucleosides in the hemimer modified oligomeric
compound. An example of a typical hemimer is an oligomeric compound
comprising .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides that have a sequence of sugar
modified nucleosides at one of the termini. One hemimer motif
includes a sequence of .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides having from 2-12 sugar modified
nucleosides located at one of the termini. Another hemimer motif
includes a sequence of .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides having from 2-6 sugar modified
nucleosides located at one of the termini with from 2-4 being
suitable. In a preferred embodiment of the invention, the
oligomeric compound comprises a region of 2'-MOE modified
nculeotides and a region of .beta.-D-deoxyribonucleosides. In one
embodiment, the .beta.-D-deoxyribonucleosides comprise less than 13
contiguous nucleotides within the oligomeric compound. These
hemimer oligomeric compounds may comprise phosphodiester
internucleotide linkages, phosphorothioate internucleotide
linkages, or a combination of phosphodiester and phosphorothioate
internucleotide linkages.
[0142] As used in the present invention the term "blockmer motif"
is meant to include a sequence of nucleosides that have uniform
sugars (identical sugars, modified or unmodified) that is
internally interrupted by a block of sugar modified nucleosides
that are uniformly modified and wherein the modification is
different from the other nucleosides. More generally, oligomeric
compounds having a blockmer motif comprise a sequence of
.beta.-D-ribonucleosides or .beta.-D-deoxyribonucleosides having
one internal block of from 2 to 6, or from 2 to 4 sugar modified
nucleosides. The internal block region can be at any position
within the oligomeric compound as long as it is not at one of the
termini which would then make it a hemimer. The base sequence and
internucleoside linkages can vary at any position within a blockmer
motif.
[0143] Nucleotides, both native and modified, have a certain
conformational geometry which affects their hybridization and
affinity properties. The terms used to describe the conformational
geometry of homoduplex nucleic acids are "A Form" for RNA and "B
Form" for DNA. The respective conformational geometry for RNA and
DNA duplexes was determined from X-ray diffraction analysis of
nucleic acid fibers (Arnott and Hukins, Biochem. Biophys. Res.
Comm., 1970, 47, 1504.) In general, RNA:RNA duplexes are more
stable and have higher melting temperatures (Tm's) than DNA:DNA
duplexes (Sanger et al., Principles of Nucleic Acid Structure,
1984, Springer-Verlag; New York, N.Y.; Lesnik et al., Biochemistry,
1995, 34, 10807-10815; Conte et al., Nucleic Acids Res., 1997, 25,
2627-2634). The increased stability of RNA has been attributed to
several structural features, most notably the improved base
stacking interactions that result from an A-form geometry (Searle
et al., Nucleic Acids Res., 1993, 21, 2051-2056). The presence of
the 2' hydroxyl in RNA biases the sugar toward a C3' endo pucker,
i.e., also designated as Northern pucker, which causes the duplex
to favor the A-form geometry. In addition, the 2' hydroxyl groups
of RNA can form a network of water mediated hydrogen bonds that
help stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35,
8489-8494). On the other hand, deoxy nucleic acids prefer a C2'
endo sugar pucker, i.e., also known as Southern pucker, which is
thought to impart a less stable B-form geometry (Sanger, W. (1984)
Principles of Nucleic Acid Structure, Springer-Verlag, New York,
N.Y.). As used herein, B-form geometry is inclusive of both
C2'-endo pucker and O4'-endo pucker. This is consistent with
Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who
pointed out that in considering the furanose conformations which
give rise to B-form duplexes consideration should also be given to
a O4'-endo pucker contribution.
[0144] DNA:RNA hybrid duplexes, however, are usually less stable
than pure RNA:RNA duplexes, and depending on their sequence may be
either more or less stable than DNA:DNA duplexes (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid
duplex is intermediate between A- and B-form geometries, which may
result in poor stacking interactions (Lane et al., Eur. J.
Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993,
233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982;
Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of
the duplex formed between a target RNA and a synthetic sequence is
central to therapies such as, but not limited to, antisense
mechanisms, including RNase H-mediated and RNA interference
mechanisms, as these mechanisms involved the hybridization of a
synthetic sequence strand to an RNA target strand. In the case of
RNase H, effective inhibition of the mRNA requires that the
antisense sequence achieve at least a threshold of
hybridization.
[0145] One routinely used method of modifying the sugar puckering
is the substitution of the sugar at the 2'-position with a
substituent group that influences the sugar geometry. The influence
on ring conformation is dependent on the nature of the substituent
at the 2'-position. A number of different substituents have been
studied to determine their sugar puckering effect. For example,
2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest population (65%) of the C3'-endo form, and the
2'-iodo exhibits the lowest population (7%). The populations of
adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%,
respectively. Furthermore, the effect of the 2'-fluoro group of
adenosine dimers
(2'-deoxy-2'-fluoroadenosine-2'-deoxy-2'-fluoro-adenosine) is also
correlated to the stabilization of the stacked conformation.
[0146] As expected, the relative duplex stability can be enhanced
by replacement of 2'-OH groups with 2'-F groups thereby increasing
the C3'-endo population. It is assumed that the highly polar nature
of the 2'-F bond and the extreme preference for C3'-endo puckering
may stabilize the stacked conformation in an A-form duplex. Data
from UV hypochromicity, circular dichroism, and .sup.1H NMR also
indicate that the degree of stacking decreases as the
electronegativity of the halo substituent decreases. Furthermore,
steric bulk at the 2'-position of the sugar moiety is better
accommodated in an A-form duplex than a B-form duplex. Thus, a
2'-substituent on the 3'-terminus of a dinucleoside monophosphate
is thought to exert a number of effects on the stacking
conformation: steric repulsion, furanose puckering preference,
electrostatic repulsion, hydrophobic attraction, and hydrogen
bonding capabilities. These substituent effects are thought to be
determined by the molecular size, electronegativity, and
hydrophobicity of the substituent. Melting temperatures of
complementary strands is also increased with the 2'-substituted
adenosine diphosphates. It is not clear whether the 3'-endo
preference of the conformation or the presence of the substituent
is responsible for the increased binding. However, greater overlap
of adjacent bases (stacking) can be achieved with the 3'-endo
conformation.
[0147] Nucleoside conformation is influenced by various factors
including substitution at the 2',3' or 4'-positions of the
pentofuranosyl sugar. Electronegative substituents generally prefer
the axial positions, while sterically demanding substituents
generally prefer the equatorial positions (Principles of Nucleic
Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.)
Modification of the 2' position to favor the 3'-endo conformation
can be achieved while maintaining the 2'-OH as a recognition
element (Gallo et al., Tetrahedron (2001), 57, 5707-5713.
Harry-Olcuru et al., J. Org. Chem., (1997), 62(6), 1754-1759 and
Tang et al., J. Org. Chem. (1999), 64, 747-754.) Alternatively,
preference for the 3'-endo conformation can be achieved by deletion
of the 2'-OH as exemplified by 2' deoxy-2'F-nucleosides (Kawasaki
et al., J. Med. Chem. (1993), 36, 831-841), which adopts the
3'-endo conformation positioning the electronegative fluorine atom
in the axial position. Other modifications of the ribose ring, for
example substitution at the 4'-position to give 4'-F modified
nucleosides (Guillerm et al., Bioorganic and Medicinal Chemistry
Letters (1995), 5, 1455-1460 and Owen et al., J. Org. Chem. (1976),
41, 3010-3017), or for example modification to yield methanocarba
nucleoside analogs (Jacobson et al., J. Med. Chem. Lett. (2000),
43, 2196-2203 and Lee et al., Bioorganic and Medicinal Chemistry
Letters (2001), 11, 1333-1337) also induce preference for the
3'-endo conformation.
[0148] In one aspect of the present invention oligomeric compounds
include nucleosides synthetically modified to induce a 3'-endo
sugar conformation. A nucleoside can incorporate synthetic
modifications of the heterocyclic base, the sugar moiety or both to
induce a desired 3'-endo sugar conformation. These modified
nucleosides are used to mimic RNA-like nucleosides so that
particular properties of an oligomeric compound can be enhanced
while maintaining the desirable 3'-endo conformational geometry.
Properties that are enhanced by using more stable 3'-endo
nucleosides include but are not limited to modulation of
pharmacokinetic properties through modification of protein binding,
protein off-rate, absorption and clearance; modulation of nuclease
stability as well as chemical stability; modulation of the binding
affinity and specificity of the oligomeric compound (affinity and
specificity for enzymes as well as for complementary sequences);
and increasing efficacy of RNA cleavage.
[0149] The conformation of modified nucleosides and their oligomers
can be estimated by various methods such as molecular dynamics
calculations, nuclear magnetic resonance spectroscopy and CD
measurements. Hence, modifications predicted to induce RNA-like
conformations (A-form duplex geometry in an oligomeric context),
are useful in the oligomeric compounds of the present invention.
The synthesis of modified nucleosides amenable to the present
invention are known in the art (see for example, Chemistry of
Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988,
Plenum Press.)
[0150] In one aspect, the present invention is directed to
oligomeric compounds that are designed to have enhanced properties
compared to native RNA or DNA. One method to design optimized or
enhanced oligomeric compounds involves each nucleoside of the
selected sequence being scrutinized for possible enhancing
modifications. One modification would be the replacement of one or
more RNA nucleosides with nucleosides that have the same 3'-endo
conformational geometry. Such modifications can enhance chemical
and nuclease stability relative to native RNA while at the same
time being much cheaper and easier to synthesize and/or incorporate
into an oligonucleotide. The sequence can be further divided into
regions and the nucleosides of each region evaluated for enhancing
modifications that can be the result of a chimeric configuration.
Consideration is also given to the 5' and 3'-termini as there are
often advantageous modifications that can be made to one or more of
the terminal nucleosides. The oligomeric compounds of the present
invention may include at least one 5'-modified phosphate group on a
single strand or on at least one 5'-position of a double-stranded
sequence or sequences. Other modifications considered are
internucleoside linkages, conjugate groups, substitute sugars or
bases, substitution of one or more nucleosides with nucleoside
mimetics and any other modification that can enhance the desired
property of the oligomeric compound.
[0151] In certain embodiments, the present invention provides
oligomeric compounds, including antisense oligomeric compounds and
antidote oligomeric compounds, of any of a variety of ranges of
lengths. In certain embodiments, the invention provides oligomeric
compounds consisting of X-Y linked oligonucleosides, where X and Y
are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
and 50; provided that X<Y. For example, in certain embodiments,
the invention provides oligomeric compounds comprising: 8-9, 8-10,
8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21,
8-22, 8-23, 8-24, 8-25, 8-26, 8-27, 8-28, 8-29, 8-30, 9-10, 9-11,
9-12, 9-13, 9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22,
9-23, 9-24, 9-25, 9-26, 9-27, 9-28, 9-29, 9-30, 10-11, 10-12,
10-13, 10-14, 10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21,
10-22, 10-23, 10-24, 10-25, 10-26, 10-27, 10-28, 10-29, 10-30,
11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20,
11-21, 11-22, 11-23, 11-24, 11-25, 11-26, 11-27, 11-28, 11-29,
11-30, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20,
12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29,
12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21,
13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30,
14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23,
14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17,
15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26,
15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21,
16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30,
17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26,
17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23,
18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21,
19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30,
20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29,
20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29,
21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30,
23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26,
24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30,
26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or
29-30 linked nucleosides.
[0152] In certain embodiments, the invention provides a method of
modulating expression of a target protein in a cell comprising
contacting the cell with an oligomeric compound comprising a
contiguous sequence of nucleosides having the formula I:
T.sub.1-(Nu.sub.1).sub.n1-(Nu.sub.2).sub.n2-(Nu.sub.3).sub.n3-(Nu.sub.4)-
.sub.n4-(Nu.sub.5).sub.n5-T.sub.2,
wherein:
[0153] Nu.sub.t and Nu.sub.5 are, independently, 2' stabilizing
nucleosides;
[0154] Nu.sub.2 and Nu.sub.4 are
.beta.-D-2'-deoxy-2'-fluororibofuranosyl nucleosides;
[0155] Nu.sub.3 is a 2'-modified nucleoside;
[0156] each of n1 and n5 is, independently, from 0 to 3;
[0157] the sum of n2 plus n4 is between 10 and 25;
[0158] n3 is from 0 and 5; and
[0159] each T.sub.1 and T.sub.2 is, independently, H, a
hydroxylprotecting group, an optionally linked conjugate group or a
capping group; and thereby modulating expression of the target
protein. In certain such embodiments, the sum of n2 and n4 is 13 or
14; n1 is 2; n3 is 2 or 3; and n5 is 2. In certain such
embodiments, formula I is selected from Table A.
TABLE-US-00001 TABLE A n1 n2 n3 n4 n5 2 16 0 0 2 2 2 3 11 2 2 5 3 8
2 2 8 3 5 2 2 11 3 2 2 2 9 3 4 2 2 10 3 3 2 2 3 3 10 2 2 4 3 9 2 2
6 3 7 2 2 7 3 6 2 2 8 6 2 2 2 2 2 12 2 2 3 2 11 2 2 4 2 10 2 2 5 2
9 2 2 6 2 8 2 2 7 2 7 2 2 8 2 6 2 2 9 2 5 2 2 10 2 4 2 2 11 2 3 2 2
12 2 2 2
Table A is intended to illustrate, but not to limit the present
invention. The oligomeric compounds depicted in Table A each
comprise 20 nucleosides. Oligomeric compounds comprising more or
fewer nucleosides can easily by designed by selecting different
numbers of nucleosides for one or more of n1-n5.
Certain Targets and Mechanisms
[0160] In certain embodiments, oligomeric compounds provided herein
are targeted to a pre-mRNA. In certain embodiments, such oligomeric
compounds alter splicing of the pre-mRNA. In certain such
embodiments, the ratio of one variant of a target mRNA to another
variant of the target mRNA is altered. In certain such embodiments,
the ratio of one variant of a target protein to another variant of
the target protein is altered. Certain oligomeric compounds and
nucleobase sequences that may be used to alter splicing of a
pre-mRNA may be found for example in U.S. Pat. No. 6,210,892; U.S.
Pat. No. 5,627,274; U.S. Pat. No. 5,665,593; 5,916,808; U.S. Pat.
No. 5,976,879; US2006/0172962; US2007/002390; US2005/0074801;
US2007/0105807; US2005/0054836; WO 2007/090073; WO2007/047913, Hua
et al., PLoS Biol 5(4):e73; Vickers et al., J. Immunol 2006 Mar.
15; 176(6):3652-61, each of which is hereby incorporated by
reference in its entirety for any purpose. In certain embodiments
antisense sequences that alter splicing are modified according to
motifs of the present invention. In certain embodiments, oligomeric
compounds of the present invention redirect polyadenylation of
pre-mRNA. See, for example Vickers et al., Nucleic Acids Res.
29(6):1293-1299, which is hereby incorporated by reference in its
entirety for any purpose. In certain embodiments antisense
sequences that redirect polyadenylation are modified according to
motifs of the present invention.
[0161] In certain embodiments, the invention provides oligomeric
compounds complementary to a pre-mRNA encoding Bcl-x. In certain
such embodiments, the oligomeric compound alters splicing of Bcl-x.
Certain sequences and regions useful for altering splicing of Bcl-x
may be found in U.S. Pat. No. 6,172,216; U.S. Pat. No. 6,214,986;
U.S. Pat. No. 6,210,892; US2007/002390 and WO 2007/028065, each of
which is hereby incorporated by reference in its entirety for any
purpose.
[0162] In certain embodiments, the present invention provides
compounds complementary to a pre-mRNA encoding MyD88. In certain
such embodiments, the oligomeric compound alters splicing of MyD88.
Certain sequences and regions useful for altering splicing of MyD88
may be found in U.S. application Ser. No. 11/336,785, which is
hereby incorporated by reference in its entirety for any
purpose.
[0163] In certain embodiments, the present invention provides
compounds complementary to a pre-mRNA encoding Lamin A (LMN-A). In
certain such embodiments, the oligomeric compound alters splicing
of Lamin A Certain sequences and regions useful for altering
splicing of Lamin A may be found in PCT/US2006/041018, which is
hereby incorporated by reference in its entirety for any
purpose.
[0164] In certain embodiments, the present invention provides
compounds complementary to a pre-mRNA encoding SMN2. In certain
such embodiments, the oligomeric compound alters splicing of SMN2.
Certain sequences and regions useful for altering splicing of SMN2
may be found in PCT/US06/024469, which is hereby incorporated by
reference in its entirety for any purpose.
[0165] In certain embodiments, the present invention provides
compounds complementary to a pre-mRNA encoding TNF superfamily of
receptors. In certain such embodiments, the oligomeric compound
alters splicing of TF. Certain sequences and regions useful for
altering splicing of TNF may be found in US2007/0105807, which is
hereby incorporated by reference in its entirety for any
purpose.
Synthesis, Purification and Analysis
[0166] Oligomerization of modified and unmodified nucleosides and
nucleotides can be routinely performed according to literature
procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed.
Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001),
23, 206-217. Gait et al., Applications of Chemically synthesized
RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et
al., Tetrahedron (2001), 57, 5707-5713).
[0167] Oligomeric compounds provided herein can be conveniently and
routinely made through the well-known technique of solid phase
synthesis. Equipment for such synthesis is sold by several vendors
including, for example, Applied Biosystems (Foster City, Calif.).
Any other means for such synthesis known in the art may
additionally or alternatively be employed. It is well known to use
similar techniques to prepare oligonucleotides such as the
phosphorothioates and alkylated derivatives. The invention is not
limited by the method of antisense compound synthesis.
[0168] Methods of purification and analysis of oligomeric compounds
are known to those skilled in the art. Analysis methods include
capillary electrophoresis (CE) and electrospray-mass spectroscopy.
Such synthesis and analysis methods can be performed in multi-well
plates. The method of the invention is not limited by the method of
oligomeric compound purification.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0169] Oligomeric compounds may be admixed with pharmaceutically
acceptable active and/or inert substances for the preparation of
pharmaceutical compositions or formulations. Compositions and
methods for the formulation of pharmaceutical compositions are
dependent upon a number of criteria, including, but not limited to,
route of administration, extent of disease, or dose to be
administered.
[0170] Oligomeric compounds, including antisense compounds and/or
antidote compounds, can be utilized in pharmaceutical compositions
by combining such oligomeric compounds with a suitable
pharmaceutically acceptable diluent or carrier. A pharmaceutically
acceptable diluent includes phosphate-buffered saline (PBS). PBS is
a diluent suitable for use in compositions to be delivered
parenterally. Accordingly, in one embodiment, employed in the
methods described herein is a pharmaceutical composition comprising
an antisense compound and/or antidote compound and a
pharmaceutically acceptable diluent. In certain embodiments, the
pharmaceutically acceptable diluent is PBS.
[0171] Pharmaceutical compositions comprising oligomeric compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising oligomeric compounds comprise one or more
oligonucleotide which, upon administration to an animal, including
a human, is capable of providing (directly or indirectly) the
biologically active metabolite or residue thereof. Accordingly, for
example, the disclosure is also drawn to pharmaceutically
acceptable salts of antisense compounds, prodrugs, pharmaceutically
acceptable salts of such prodrugs, and other bioequivalents.
Suitable pharmaceutically acceptable salts include, but are not
limited to, sodium and potassium salts.
[0172] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligomeric compound which are
cleaved by endogenous nucleases within the body, to form the active
oligomeric compound.
Nonlimiting Disclosure and Incorporation by Reference
[0173] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety.
[0174] The nucleoside sequences set forth in the sequence listing
and Examples, are independent of any modification to a sugar
moiety, a monomeric linkage, or a nucleobase. As such, oligomeric
compounds defined by a SEQ ID NO may comprise, independently, one
or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase. Oligomeric compounds described by Isis
Number (Isis NO.) indicate a combination of nucleobase sequence and
one or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase, as indicated.
EXAMPLES
Example 1
EGFP-654 Transgenic Mouse Model
[0175] EGFP-654 transgenic mice transcribe the EGFP-654 transgene
throughout the body. In this mouse model, the transgene encoding
enhanced green fluorescent protein (EGFP) is interrupted by an
aberrantly spliced mutated intron 2 of the human .beta.-globin
gene. The mutation at nucleotide 654 of intron 2 of human
.beta.-globin activates aberrant splice sites and leads to
retention of the intron fragment in spliced mRNA, preventing proper
translation of EGFP. Aberrant splicing of this intron prevents
expression of EGFP-654 in all tissues. Blocking the aberrant splice
site restores normal pre-mRNA splicing and EGFP expression. Thus,
EGFP-654 transgenic mice can be used to evaluate oligomeric
compounds designed to modulate splicing. Generation of EGFP-654
transgenic mice and control EGFP-WT mice is described in Sazani et
al. (2002, Nature Biotechnol. 20:1228-1233). Briefly, plasmid
CX-EGFP-654 was constructed from plasmid CXEGFP (Okabe et al. 1997,
FEBS Lett. 407:313-319) as described by Sazani et al. (2001,
Nucleic Acids Res. 29:3965-3974). To generate the CX-EGFP-WT
plasmid, an EcoNI-Ppuml fragment of .beta.-globin intron 2 from the
CX-EGFG-654 plasmid was replaced by the same fragment from the
intron 2 of the wild-type .beta.-globin gene. Transgenic mice were
produced using standard procedures by microinjection of the 3.8 kb
PstI/SalI fragments of CX-EGFP-654 and CX-EGFP-WT into fertilized
FVB/N mouse embryos.
Example 2
Design of Oligomeric Compounds for Modulation of Splicing
[0176] A series of oligomeric compounds was designed to modulate
splicing of selected pre-mRNAs. The sequence and motif of each
compound is shown in Table 1. Compounds were designed to target the
5' splice site of nucleotide 654 of the human .beta.-globin intron
2 sequence of the EGFP-654 transgene. Underlined nucleosides are 2'
MOE modified. Nucleosides that are not underlined are 2'-fluoro
modified.
TABLE-US-00002 TABLE 1 Oligomeric compounds. ISIS # Sequence Length
SEQ ID 404029 ('029) TGCTATTACCTTAACCCAGA 20 1 404030 ('030)
TGCTATTACCTTAACCCAGA 20 1 404031 ('031) GCTATTACCTTAACCCAG 18 2
404032 ('032) GCTATTACCTTAACCCAG 18 2 Underlined nucleosides
comprise 2'MOE. Those not underlined comprise 2'-F.
Example 3
Modulation of EGFP-654 Pre-mRNA Splicing In Vivo
[0177] The EGFP-654 transgenic mouse system was used to evaluate
oligomeric compounds for modulation of splicing. As described in
Example 1, the EGFP-654 transgene contains the EGFP coding sequence
interrupted by a mutated intron 2 of the human .beta.-globin gene
which contains an aberrant splice site. Due to aberrant splicing,
EGFP is not expressed. Blockade of the aberrant splice site would
allow EGFP expression in all tissues.
[0178] Twenty four EGFP-654 mice were each injected either with one
of the oligomeric compounds form Table 1 at 25 mg/kg, with saline,
or with 25 mg/kg of a control oligomeric compound having one or the
other of the sequences of Table 1 and comprising LNA and DNA
nucleosides. All antisense oligomeric compounds were dissolved in
0.9% saline at 2.5 mg/ml. 200 .mu.L of oligonucleotide solution was
used per injection. Injections were given daily, at approximately
the same time each day. All mice were injected daily for 4 days and
were sacrificed 24 hours after the last injection.
[0179] Tissue samples were flash frozen in liquid nitrogen and then
homogenized in 800 .mu.L of TRI-Reagent and samples were
centrifuged for 1 min to remove cellular debris. The supernatant
was transferred to a new tube and total RNA was isolated following
the TRI-Reagent supplier's protocol. To test for a shift in the
splicing pattern of EGFP-654 pre-mRNA, the RNA was analyzed by
RT-PCR using primers that flank the alternatively spliced intron.
.sup.32P-ATP was included in the PCR reaction mixture. The PCR
products were separated by electrophoresis on a 10% polyacrylamide
gel and the gels were subjected to autoradiography. A correctly
spliced EGFP-654 mRNA is smaller than the aberrantly spliced
transcript and thus migrates faster in an electrophoretic gel.
Quantitation of percent shift in splicing was determined using a
TYPHOON phosphoimager and using IMAGEQUANT software. Results are
provided in Table 2, below.
TABLE-US-00003 TABLE 2 Percent shift in splicing in various tissues
of mice treated with oligomeric compounds targeting intron 2 of the
human .beta.-globin gene. LNA/DNA LNA/DNA Organ Saline Saline 20mer
18mer '029 '029 '030 '030 '031 '031 '032 '032 Liver 11 12 76 82 75
79 57 47 79 82 62 73 Kidney 2 1 21 23 9 10 10 8 13 15 13 13 Lung 1
2 9 7 6 9 6 5 10 11 13 12 Small 7 ND 72 ND 58 42 35 25 ND ND ND ND
Inest. Colon 3 ND 63 ND 55 51 27 34 ND ND ND ND Skel. 0 ND 1 ND 3 3
2 0 ND ND ND ND Muscle Spleen 0 ND 31 ND 13 15 4 3 ND ND ND ND
Diaphragm 0 ND 42 ND 44 44 45 17 ND ND ND ND Heart 1 ND 10 ND 6 5 6
4 ND ND ND ND Stomach 4 ND 17 ND 8 11 9 12 ND ND ND ND Skin 0 ND 19
ND 14 13 19 9 ND ND ND ND Thymus 3 ND 19 ND 15 13 12 9 ND ND ND ND
Sequence CWU 1
1
2120DNAArtificial SequenceSynthetic Oligonucleotide 1tgctattacc
ttaacccaga 20218DNAArtificial SequenceSynthetic Oligonucleotide
2gctattacct taacccag 18
* * * * *