U.S. patent application number 14/168927 was filed with the patent office on 2014-09-25 for humanized antibodies that bind to cd19 and their uses.
This patent application is currently assigned to GLENMARK PHARMACEUTICALS S.A.. The applicant listed for this patent is GLENMARK PHARMACEUTICALS S.A.. Invention is credited to Martin Bertschinger, Stanislas BLEIN, Christophe Debonneville, Darko Skegro.
Application Number | 20140286934 14/168927 |
Document ID | / |
Family ID | 42115917 |
Filed Date | 2014-09-25 |
United States Patent
Application |
20140286934 |
Kind Code |
A1 |
BLEIN; Stanislas ; et
al. |
September 25, 2014 |
HUMANIZED ANTIBODIES THAT BIND TO CD19 AND THEIR USES
Abstract
The present invention relates to humanized antibodies or
fragments thereof that bind to human CD19. More specifically, the
present invention relates to a humanized antibody or fragment
thereof that binds to human CD19 comprising a heavy chain CDR1
comprising the amino acid sequence of SEQ ID NO: 27, and/or a heavy
chain CDR2 comprising the amino acid sequence of SEQ ID NO: 28,
and/or a heavy chain CDR3 comprising the amino acid sequence of SEQ
ID NO: 29; and/or comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32.
Inventors: |
BLEIN; Stanislas; (La
Chaux-de-Fonds, CH) ; Skegro; Darko; (La
Chaux-de-Fonds, CH) ; Debonneville; Christophe; (La
Chaux-de-Fonds, CH) ; Bertschinger; Martin; (La
Chaux-de-Fonds, CH) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GLENMARK PHARMACEUTICALS S.A. |
La Chaux-de-Fonds |
|
CH |
|
|
Assignee: |
GLENMARK PHARMACEUTICALS
S.A.
La Chaux-de-Fonds
CH
|
Family ID: |
42115917 |
Appl. No.: |
14/168927 |
Filed: |
January 30, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12710442 |
Feb 23, 2010 |
8679492 |
|
|
14168927 |
|
|
|
|
61154524 |
Feb 23, 2009 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
435/252.3; 435/252.31; 435/252.33; 435/252.34; 435/254.11;
435/254.2; 435/254.22; 435/254.23; 435/254.3; 435/254.4; 435/254.5;
435/254.6; 435/320.1; 435/328; 435/372.2; 435/375; 435/69.6;
536/23.53 |
Current CPC
Class: |
A61P 37/02 20180101;
C07K 16/3061 20130101; C07K 2317/77 20130101; A61P 29/00 20180101;
C07K 2317/92 20130101; C07K 16/2803 20130101; C07K 2317/73
20130101; C07K 2317/24 20130101; A61P 7/00 20180101; A61P 19/02
20180101; A61K 2039/505 20130101; A61P 35/00 20180101; A61P 35/02
20180101; C07K 2317/56 20130101; C07K 2317/732 20130101; C07K
2317/72 20130101; A61P 43/00 20180101; C07K 2317/41 20130101; C07K
2317/565 20130101; C07K 2317/734 20130101 |
Class at
Publication: |
424/133.1 ;
536/23.53; 435/320.1; 435/69.6; 435/375; 435/372.2; 435/254.2;
435/252.33; 435/252.34; 435/252.3; 435/252.31; 435/254.11;
435/254.23; 435/254.22; 435/254.6; 435/254.4; 435/254.5; 435/254.3;
435/328 |
International
Class: |
C07K 16/30 20060101
C07K016/30 |
Claims
1-87. (canceled)
88. An isolated nucleic acid encoding a humanized antibody or
fragment thereof that binds to human CD19 comprising a heavy chain
CDR1 comprising the amino acid sequence of SEQ ID NO: 27, and/or a
heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:
28, and/or a heavy chain CDR3 comprising the amino acid sequence of
SEQ ID NO: 29; and/or comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32.
89. An isolated nucleic acid comprising the heavy chain encoding
nucleic acid sequence of a humanized FMC63 variant that binds to
human CD19 as deposited in a microorganism with DSMZ having
accession No. DSM 23302.
90. An isolated nucleic acid comprising the light chain encoding
nucleic acid sequence of a humanized FMC63 variant that binds to
human CD19 as deposited in a microorganism with DSMZ having
accession No. DSM 23303.
91. A vector comprising the isolated nucleic acid of claim 88.
92. A host cell comprising the isolated nucleic acid of claim
88.
93. A method of producing a humanized antibody or fragment thereof
that binds to human CD19, said method comprising culturing the host
cell of claim 92 so that the nucleic acid is expressed and the
antibody produced.
94-97. (canceled)
98. A method of inhibiting growth of tumor cells expressing CD19,
comprising contacting the cells with a humanized antibody or
fragment thereof that binds to human CD19 comprising a heavy chain
CDR1 comprising the amino acid sequence of SEQ ID NO: 27, and/or a
heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:
28, and/or a heavy chain CDR3 comprising the amino acid sequence of
SEQ ID NO: 29; and/or comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32 in
an amount effective to inhibit growth of the tumor cells.
99. The method of claim 98, wherein said tumor cells are selected
from the group consisting of human Burkitt lymphoma cells, human B
cell precursor leukemia cells, human B cell leukemia cells or human
B-cell lymphoma cells.
100. A method of depleting B cells in a subject comprising
administering to the subject a humanized antibody or fragment
thereof that binds to human CD19 comprising a heavy chain CDR1
comprising the amino acid sequence of SEQ ID NO: 27, and/or a heavy
chain CDR2 comprising the amino acid sequence of SEQ ID NO: 28,
and/or a heavy chain CDR3 comprising the amino acid sequence of SEQ
ID NO: 29; and/or comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32 in
an amount effective to deplete B cells from the subject.
101. A method for treating a CD19 mediated disorder in a subject,
the method comprising administering to the subject a
therapeutically effective amount of a humanized antibody or
fragment thereof that binds to human CD19 comprising a heavy chain
CDR1 comprising the amino acid sequence of SEQ ID NO: 27, and/or a
heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:
28, and/or a heavy chain CDR3 comprising the amino acid sequence of
SEQ NO: 29; and/or comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32.
102. The method of claim 101, wherein the CD19 mediated disorder is
selected from the group consisting of autoimmune disorders
including rheumatoid arthritis, cancer, non-Hodgkin's lymphoma,
acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia
(CLL), hairy cell leukemia, Burkitt's lymphoma, anaplastic
large-cell lymphomas (ALCL), cutaneous T-cell lymphomas, nodular
small cleaved-cell lymphomas, peripheral T-cell lymphomas,
Lennert's lymphomas, immunoblastic lymphomas, T-cell
leukemia/lymphomas (ATLL), adult T-cell leukemia (T-ALL),
entroblastic/centrocytic (cb/cc) follicular lymphomas cancers,
diffuse large cell lymphomas of B lineage, angioimmunoblastic
lymphadenopathy (AILD)-like T cell lymphoma, HIV associated body
cavity based lymphomas, Embryonal Carcinomas, undifferentiated
carcinomas of the rhino-pharynx (e.g., Schmincke's tumor),
Castleman's disease, Kaposi's Sarcoma, Multiple Myeloma,
Waldenstrom's macroglobulinemia, anti-CD20 antibody resistant
B-cell cancers and other B-cell lymphomas and leukemias.
103. The method of claim 101, wherein the CD19 mediated disorder is
selected from the group consisting of non-Hodgkin's lymphoma, acute
lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL),
hairy cell leukemia, rheumatoid arthritis, systemic lupus
erythematosus (SLE), and anti-CD20 antibody resistant B-cell
cancers.
104. The method of claim 101, wherein the CD19 mediated disorder is
a tumorigenic disorder.
105-108. (canceled)
109. A vector comprising the isolated nucleic acid of claim 89 or
90.
110. A host cell comprising the isolated nucleic acid of claim 89
or 90.
111. A host cell comprising the vector of claim 91.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 12/710,442, filed Feb. 23, 2010, which claims
the benefit of U.S. Provisional Application No. 61/154,524, filed
Feb. 23, 2009, each of which is incorporated by reference herein in
their entirety.
REFERENCE TO A SEQUENCE LISTING SUBMITTED ELECTRONICALLY VIA
EFS-WEB
[0002] The content of the electronically submitted sequence listing
(Name: 3305.sub.--0010002_SequenceListing_ascii.txt; Size: 143,187
bytes; and Date of Creation: Jan. 24, 2014) is herein incorporated
by reference in its entirety.
THE FIELD OF THE INVENTION
[0003] The present invention relates to humanized antibodies or
fragments thereof that bind to human CD19. More specifically, the
present invention relates to a humanized antibody or fragment
thereof that binds to human CD19 comprising a heavy chain CDR1
comprising the amino acid sequence of SEQ ID NO: 27, and/or a heavy
chain CDR2 comprising the amino acid sequence of SEQ ID NO: 28,
and/or a heavy chain CDR3 comprising the amino acid sequence of SEQ
ID NO: 29; and/or comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32.
BACKGROUND OF THE INVENTION
[0004] B cell surface markers have been generally suggested as
targets for the treatment of B cell disorders or diseases,
autoimmune disease, and transplantation rejection. Examples of B
cell surface markers include CD10, CD19, CD20, CD21, CD22, CD23,
CD24, CD37, CD53, CD72, CD74, CD75, CD77, CD79a, CD79b, CD80, CD81,
CD82, CD83, CD84, CD85, and CD86 leukocyte surface markers.
Antibodies that specifically bind certain of these markers have
been developed, and some have been tested for the treatment of
diseases and disorders.
[0005] For example, chimeric or radiolabeled monoclonal antibody
(mAb)-based therapies directed against the CD20 cell surface
molecule specific for mature B cells and their malignant
counterparts have been shown to be an effective in vivo treatment
for non-Hodgkin's lymphoma (Tedder et al, Immunol. Today 15:450-454
(1994); Press et al, Hematology, 221-240 (2001); Kaminski et al, N.
Engl. J. Med., 329:459-465 (1993); Weiner, Semin. Oncol, 26:43-51
(1999); Onrust et al, Drugs, 58:79-88 (1999); McLaughlin et al,
Oncology, 12:1763-1769 (1998); Reff et al, Blood, 83:435-445
(1994); Maloney et al, Blood, 90:2188-2195 (1997); Maloney et al,
J. Clin. Oncol, 15:3266-3274 (1997); Anderson et al, Biochem. Soc.
Transac, 25:705-708 (1997)). Anti-CD20 monoclonal antibody therapy
has also been found to ameliorate the manifestations of rheumatoid
arthritis, systemic lupus erythematosus, idiopathic
thrombocytopenic purpura and hemolytic anemia, as well as other
immune-mediated diseases (Silverman et al, Arthritis Rheum.,
48:1484-1492 (2002); Edwards et al, Rheumatology, 40:1-7 (2001); De
Vita et al, Arthritis Rheumatism, 46:2029-2033 (2002); Leandro et
al, Ann. Rheum. Dis., 61:883-888 (2002); Leandro et al, Arthritis
Rheum., 46:2673-2677 (2001)). The anti-CD22 monoclonal antibody
LL-2 was shown to be effective in treating aggressive and relapsed
lymphoma patients undergoing chemotherapeutic treatment (Goldenberg
U.S. Pat. Nos. 6,134,982 and 6,306,393). The anti-CD20 (IgG1)
antibody, RITUXAN.TM., has successfully been used in the treatment
of certain diseases such as adult immune thrombocytopenic purpura,
rheumatoid arthritis, and autoimmune hemolytic anemia (Cured et al,
WO 00/67796). Despite the effectiveness of this therapy, most acute
lymphoblastic leukemias (ALL) and many other B cell malignancies
either do not express CD20, express CD20 at low levels, or have
lost CD20 expression following CD20 immunotherapy (Smith et al,
Oncogene, 22:7359-7368 (2003)). Moreover, the expression of CD20 is
not predictive of response to anti-CD20 therapy as only half of
non-Hodgkin's lymphoma patients respond to CD20-directed
immunotherapy.
[0006] The human CD 19 molecule is a structurally distinct cell
surface receptor expressed on the surface of human B cells,
including, but not limited to, pre-B cells, B cells in early
development {i.e., immature B cells), mature B cells through
terminal differentiation into plasma cells, and malignant B cells.
CD19 is expressed by most pre-B acute lymphoblastic leukemias
(ALL), non-Hodgkin's lymphomas, B cell chronic lymphocytic
leukemias (CLL), pro-lymphocytic leukemias, hairy cell leukemias,
common acute lymphocytic leukemias, and some Null-acute
lymphoblastic leukemias (Nadler et al, J. Immunol., 131:244-250
(1983), Loken et al, Blood, 70:1316-1324 (1987), Uckun et al,
Blood, 71:13-29 (1988), Anderson et al, 1984. Blood, 63:1424-1433
(1984), Scheuermann, Leuk. Lymphoma, 18:385-397 (1995)). The
expression of CD19 on plasma cells further suggests it may be
expressed on differentiated B cell tumors such as multiple myeloma,
plasmacytomas, Waldenstrom's tumors (Grossbard et al., Br. J.
Haematol, 102:509-15 (1998); Treon et al, Semin. Oncol, 30:248-52
(2003)).
[0007] The CD 19 antigen has also been one of the many proposed
targets for immunotherapy. The CLB-CD 19 antibody (anti-CD 19
murine IgG2a mAb) was shown to inhibit growth of human tumors
implanted in athymic mice (Hooijberg et al, Cancer Research,
55:840-846 (1995)). In another study, the monoclonal murine
antibody FMC63 (IgG2a) was chimerized using a human IgG1 Fc region
(Zola et al, Immunol Cell Biol 69:411-22 (1991)). This antibody did
not induce complement-mediated cytotoxicity or ADCC in vitro and
administration to SCID mice bearing a human B cell lymphoma
(xenotransplantation model) resulted in moderate but unspecified
killing of the transplanted tumor cells (Pietersz et al, Cancer
Immunol. Immunother., 41:53-60 (1995)).
[0008] The results obtained using xenotransplantation mouse models
of tumor implantation led to studies using murine anti-CD 19
antibodies in human patients. The murine CLB-CD 19 antibody was
administered to six patients diagnosed with a progressive
non-Hodgkin's lymphoma who had failed previous conventional therapy
(chemotherapy or radiotherapy). These patients were given total
antibody doses ranging from 225 to 1,000 mg (Hekman et al, Cancer
Immunol. Immunotherapy, 32:364-372 (1991)). Although circulating
tumor cells were temporarily reduced in two patients after antibody
infusion, only one patient achieved partial remission after two
periods of antibody treatment. No conclusions regarding therapeutic
efficacy could be drawn from this small group of refractory
patients.
[0009] Subsequently, these investigators showed that the anti-tumor
effects of unconjugated CD20 mAbs are far superior to those of CD
19 mAbs in transplantation models (Hooijberg et al, Cancer Res.,
55:840-846 (1995); and Hooijberg et al, Cancer Res., 55:2627-2634
(1995)). Moreover, they did not observe additive or synergistic
effects on tumor incidence when using CD 19 and CD20 mAbs in
combination (Hooijberg et al, Cancer Res., 55:840-846 (1995)).
Although the xenotransplantation animal models were recognized to
be poor prognostic indicators for efficacy in human subjects, the
negative results achieved in these animal studies discouraged
interest in therapy with naked anti-CD 19 antibodies.
[0010] The use of anti-CD 19 antibody-based immunotoxins produced
equally discouraging results. In early clinical trials, the B4
anti-CD 19 antibody (murine IgG1 mAb) was conjugated to the plant
toxin ricin and administered to human patients having multiple
myeloma who had failed previous conventional therapy (Grossbard et
al., British Journal of Haematology, 102:509-515 (1998)), advanced
non-Hodgkin's lymphoma (Grossbard et al, Clinical Cancer Research,
5:2392-2398 (1999)), and refractory B cell malignancies (Grossbard
et al, Blood, 79:576-585 (1992)). These trials generally
demonstrated the safety of administering the B4-ricin conjugate to
humans; however, results were mixed and response rates were
discouraging in comparison to clinical trials with RITUXAN.TM.
(Grossbard et al, Clinical Cancer Research, 5:2392-2398 (1999)). In
addition, a significant portion of the patients developed a human
anti-mouse antibody (HAMA) response or a human anti-ricin antibody
(HARA) response.
[0011] Given the fact that current therapies using naked anti-CD 19
antibodies or anti-CD 19 antibody-based immunotoxins produce
equally discouraging results, there exists a need to develop
anti-CD 19 antibodies that are more effective to treat CD19
mediated disorders, e.g. anti-CD 19 antibodies that are able to
efficiently induce tumor cell death, by triggering apoptosis and
blockade of B cell proliferation, and by mediating killing through
ADCC.
SUMMARY OF THE INVENTION
[0012] The present disclosure relates generally to humanized
antibodies or fragments thereof that bind to human CD19, methods
for their preparation and use, including methods for treating CD19
mediated disorders. The humanized antibodies or fragments thereof
that bind to human CD19 of the present invention exhibit numerous
desirable properties including e.g. ADCC activity, induction of
apoptosis and inhibition of B cell proliferation.
[0013] In one aspect, the present disclosure provides a humanized
antibody or fragment thereof that binds to human CD19 comprising a
heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO:
27, and/or a heavy chain CDR2 comprising the amino acid sequence of
SEQ ID NO: 28, and/or a heavy chain CDR3 comprising the amino acid
sequence of SEQ ID NO: 29. In another aspect, the present
disclosure provides a humanized antibody or fragment thereof that
binds to human CD19 comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32.
[0014] In another aspect, the present disclosure provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain CDR1 comprising the amino acid sequence of
SEQ ID NO: 27, and/or a heavy chain CDR2 comprising the amino acid
sequence of SEQ ID NO: 28, and/or a heavy chain CDR3 comprising the
amino acid sequence of SEQ ID NO: 29; and/or comprising a light
chain CDR1 comprising the amino acid sequence of SEQ ID NO: 30,
and/or a light chain CDR2 comprising the amino acid sequence of SEQ
ID NO: 31 and/or a light chain CDR3 comprising the amino acid
sequence of SEQ ID NO: 32.
[0015] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain variable region sequence selected from the
group consisting of SEQ ID NOS: 19, 20, 21, 22, and 42.
[0016] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain variable framework region that is the
product of or derived from a human gene selected from the group
consisting of V3-33*01 (SEQ ID NO: 11), V3-11*01 (SEQ ID NO: 12),
V3-30*-18 (SEQ ID NO: 13) and V3-48*01 (SEQ ID NO: 14).
[0017] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a light chain variable region sequence selected from the
group consisting of SEQ ID NOS: 23, 24, 25, 26 and 41.
[0018] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a light chain variable framework region that is the
product of or derived from a human gene selected from the group
consisting of V1-5*03 (SEQ ID NO: 3), V1-27*01 (SEQ ID NO:4),
V1-39*-01 (SEQ ID NO: 5) and V1-12*01 (SEQ ID NO: 6).
[0019] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain variable region selected from the group
consisting of SEQ ID NOS: 33, 34, 35, 36, 37, 43, 44, 45, 46, 47,
54 and 55.
[0020] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a light chain variable region selected from the group
consisting of SEQ ID NOS: 25, 38, 39, 40, 48, 49, 50, 51, 52, 53,
56, 57, 58, 59, 60, 61, 62 and 63.
[0021] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising
(a) a heavy chain sequence comprising the amino acid sequence of
SEQ ID NO: 64; and (b) a light chain sequence comprising the amino
acid sequence of SEQ ID NO: 65.
[0022] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising
(a) a heavy chain sequence comprising the amino acid sequence of
SEQ ID NO: 66; and (b) a light chain sequence comprising the amino
acid sequence of SEQ ID NO: 67.
[0023] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising
(a) a heavy chain sequence comprising the amino acid sequence of
SEQ ID NO: 66; and (b) a light chain sequence comprising the amino
acid sequence of SEQ ID NO: 65.
[0024] In a further aspect the present invention provides humanized
antibodies or fragments thereof that bind to human CD19 comprising
human heavy and/or light constant regions, wherein the human heavy
constant region comprises an isotypic variant comprising the CH1
from human IgG1, the hinge from human IgG1 and the Fc region from
human IgG3.
[0025] In a further aspect the present invention provides humanized
antibodies or fragments thereof that bind to human CD19 comprising
a variant human IgG Fc region which comprises at least one amino
acid modification relative to the human IgG Fc region of the parent
antibody, whereas the antibody comprising the variant human IgG Fc
region exhibits altered effector function compared to the parent
antibody.
[0026] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19,
wherein the antibody comprises a variant human IgG Fc region which
comprises amino acid substitution S324N replacing serine at amino
acid position 324 of the parent antibody with asparagine, whereas
the antibody comprising the variant human IgG Fc region exhibits
improved complement dependent cytotoxicity (CDC) compared to the
parent antibody.
[0027] In a further aspect the present invention provides humanized
antibodies or fragment thereof that bind to human CD19 which have
various desirable properties such as binding to Raji tumor cells,
binding to human CD19 with an affinity (Kd) of 50 nM or less,
retaining at least 20% of the CD19 binding affinity (K.sub.d) of
the corresponding chimeric antibody, competing for binding to Raji
tumor cells with an affinity (Ki) of 50 nM or less, induction of
apoptosis in Raji tumor cells, ADCC activity in Raji tumor cells,
inhibition of proliferation of malignant B-cells, inhibition of
clonogenicity of Raji tumor cells, causing B-cell depletion in
blood, internalization in Raji tumor cells and a FAB fragment
thermostability temperature greater than 65.degree. C.
[0028] The present disclosure also provides isolated nucleic acids
encoding humanized antibodies and fragments thereof that bind to
human CD19, vectors and host cells comprising the nucleic acid or
the vector. Compositions comprising the humanized antibody or
fragment thereof and a pharmaceutically acceptable carrier and
immunoconjugates comprising the humanized antibody or fragment
thereof linked to a therapeutic agent are also provided.
[0029] The present disclosure also provides methods for treating of
CD19 mediated disorders, methods of inhibiting growth of tumor
cells expressing CD 19 and methods of depleting B cells in a
subject in need of such treatment.
[0030] The present disclosure also provides kits and articles of
manufacturing comprising the humanized antibody or fragment
thereof, the composition or the immunoconjugate for the treatment
of a CD 19 mediated disorder.
BRIEF DESCRIPTION OF THE FIGURES
[0031] FIGS. 1A and 1B show flow cytometry analysis to determine
binding activity of FMC63-CDRs grafted to human acceptor antibody
frameworks on Raji tumor cells.
[0032] FIGS. 2A and 2B show alignment of the light chain (A) or
heavy chain (B) variable region of FMC63 with selected germline
frameworks from VBASE2 and CDR-grafted donor-amplified frameworks.
The Kabat numbering is used and shown below the numbering row.
[0033] FIG. 3 shows binding activity of humanized antibodies on
SU-DHL-6 human B cell lymphoma cells as determined by flow
cytometry.
[0034] FIGS. 4A and 4B show Scatchard analysis curves of humanized
anti-CD19 antibodies. Analysis was performed on Raji tumor cells
using europium-labeled antibodies.
[0035] FIGS. 5A and 5B show ADCC activity of humanized anti-CD19
antibodies on Raji tumor cells.
[0036] FIG. 6 shows induction of apoptosis by humanized anti-CD19
antibodies on Raji tumor cells.
[0037] FIG. 7A shows inhibition of SU-DHL-6 human B cell lymphoma
cell proliferation by humanized anti-CD19 antibodies. FIG. 7B shows
clonogenicicity of Raji tumor cells after treatment with humanized
anti-CD19 antibodies.
[0038] FIG. 8 shows internalization of anti-CD19 antibodies in Raji
tumor cells. The internalization is monitored by the cytotoxicity
of a saporin-conjugated secondary antibody (Hum-ZAP).
[0039] FIG. 9 shows complement dependent cytotoxicity (CDC) of
anti-CD19 antibody mutants at position S324, compared to wild type
VH16 R94K-VL43 V3Q/T7S/P44I/N92A: (1) IgG1 control antibody; (2)
VH16 R94K-VL43 V3Q/T7S/P44I/N92A; (3) VH16 R94K/S324N-VL43
V3Q/T7S/P44I/N92A; (4) VH16 R94K/S324G-VL43 V3Q/T7S/P44I/N92A; (5)
VH16 R94K/S324A-VL43 V3Q/T7S/P44I/N92A; (6) VH16 R94K/S324V-VL43
3Q/T7S/P44I/N92A; (7) VH16 R94K/S324L-VL43 V3Q/T7S/P44I/N92A; (8)
VH16 R94K/S324I-VL43 V3Q/T7S/P44I/N92A; (9) VH16 R94K/S324P-VL43
V3Q/T7S/P44I/N92A; (10) VH16 R94K/S324T-VL43 V3Q/T7S/P44I/N92A;
(11) VH16 R94K/S324C-VL43 V3Q/T7S/P44I/N92A; (12) VH16
R94K/S324M-VL43 V3Q/T7S/P44I/N92A; (13) VH16 R94K/S324Q-VL43
V3Q/T7S/P44I/N92A; (14) VH16 R94K/S324F-VL43 V3Q/T7S/P44I/N92A;
(15) VH16 R94K/S324Y-VL43 V3Q/T7S/P44I/N92A; (16) VH16
R94K/S324W-VL43 V3Q/T7S/P44I/N92A; (17) VH16 R94K/S324R-VL43
V3Q/T7S/P44I/N92A; (18) VH16 R94K/S324D-VL43 V3Q/T7S/P44I/N92A;
(19) serum only.
[0040] FIG. 10 shows CDC assay of anti-CD19 antibody variants with
substitution at positions E269, S298 and S324: (1) negative
control--no antibody; (2) IgG1 control antibody; (3) VH16 R94K-VL43
V3Q/T7S/P44I/N92A; (4) VH16 R94K/S324N-VL43 V3Q/T7S/P44I/N92A; (5)
VH16 R94K/S298A/S324N-VL43 V3Q/T7S/P44I/N92A; (6) VH16
R94K/E269D/S298A/S324N-VL43 V3Q/T7S/P44I/N92A.
[0041] FIG. 11 shows cell-based ADCC assay of selected anti-CD19
antibody variants: (1) negative control--no antibody; (2) IgG1
control antibody; (3) VH16 R94K-VL43 V3Q/T7S/P44I/N92A; (4) VH16
R94K/S298A-VL43 V3Q/T7S/P44I/N92A; (5) VH16 R94K/E269D/S298A-VL43
V3Q/T7S/P44I/N92A.
[0042] FIG. 12 shows cell-based CDC assay of selected anti-CD19
antibody variants: (1) IgG1 control antibody: (2) VH16 R94K-VL43
V3Q/T7S/P44I/N92A; (3) VH16 R94K (1133)-VL43 V3Q/T7S/P44I/N92A; (4)
VH16 R94K/K274Q-VL43 V3Q/T7S/P44I/N92A; (5) VH16 R94K/N276K-VL43
V3Q/T7S/P44I/N92A; (6) VH16 R94K/K334R-VL43 V3Q/T7S/P44I/N92A; (7)
VH16 R94K/S324N-VL43 V3Q/T7S/P44I/N92A; (8) VH16
R94K/K274Q/N276K-VL43 V3Q/T7S/P44I/N92A; (9) VH16
R94K/K274Q/N276K/K334R-VL43 V3Q/T7S/P44I/N92A; (10) negative
control--no antibody--no serum; (11) negative control--serum
only.
[0043] FIG. 13 shows cell-based ADCC assay of defucosylated
anti-CD19 antibody variants: (1) negative control--no antibody; (2)
IgG1 control antibody; (3) VH16 R94K-VL43 V3Q/T7S/P44I/N92A; (4)
VH16 R94K (shRNA)-VL43 V3Q/T7S/P44I/N92A; (5) VH16 R94K
(GNTIII)-VL43 V3Q/T7S/P44I/N92A; (6) VH16 R94K/E269D/S298A
(shRNA)-VL43 V3Q/T7S/P44I/N92A; (7) VH16 R94K/E269D/S298A
(GNTIII)-VL43 V3Q/T7S/P44I/N92A.
[0044] FIG. 14 shows B cell depletion (ACN of total B cells) by
anti-CD19 antibody variants detected in the spleens of SCID mice:
(1) negative control--no human PBMC; (2) human
PBMC--Herceptin.RTM.; (3) human PBMC--Mabthera.RTM.; (4) human
PBMC-VH16 R94K-VL43 V3Q/T7S/P44I/N92A; (5) human PBMC-VH16
R94K/S324N-VL43 V3Q/T7S/P44I/N92A.
[0045] FIG. 15 shows B cell depletion (percentage of total B cells)
by anti-CD19 antibody variants detected in the spleens of SCID
mice: (1) negative control--no human PBMC; (2) human
PBMC--Herceptin.RTM.; (3) human PBMC--Mabthera.RTM.; (4) human
PBMC-VH16 R94K-VL43 V3Q/T7S/P44I/N92A; (5) human PBMC-VH16
R94K/S324N-VL43 V3Q/T7S/P44I/N92A.
DETAILED DESCRIPTION OF THE INVENTION
[0046] Co-assigned PCT application entitled "Humanized antibodies
that bind to CD19 and their uses," filed on Feb. 23, 2010, is
incorporated herein by reference in its entirety.
[0047] The present disclosure relates to humanized antibodies and
fragments thereof that bind human CD 19.
[0048] The term "human CD19" as used herein includes variants,
isoforms, and species homologs of human CD19. Accordingly,
humanized antibodies of this disclosure may, in certain cases,
cross-react with CD19 from species other than human. In certain
embodiments, the antibodies may be completely specific for one or
more human CD19 proteins and may not exhibit species or other types
of non-human cross-reactivity. The complete amino acid sequence of
an exemplary human CD19 has SwissProt accession number P 15391 (SEQ
ID NO: 125). CD19 is also known as B-cell surface antigen B4,
B-cell antigen CD19, CD19 antigen, and Leu-12. Human CD19 is
designated GeneID: 930 by Entrez Gene, and HGNC: 1633 by HGNC. CD19
can be encoded by the gene designated CD19. The use of "human CD19"
herein encompasses all known or as yet undiscovered alleles and
polymorphic forms of human CD19. The term "CD19" as used herein
refers to "human CD19" if not otherwise specifically indicated.
[0049] The term "antibody that bind to human CD19" as used herein
includes antibodies, preferably IgG antibodies, that bind to human
CD19 e.g. human CD19 as expressed on the surface of Raji tumor
cells like Raji tumor cells DSMZ ACC319 with an affinity (Kd) of
500 nM or less, preferably 100 nM or less, more preferably 50 nM or
less.
[0050] By "B cell" or "B lymphocyte" as used herein is meant a type
of lymphocyte developed in bone marrow that circulates in the blood
and lymph, and provides humoral immunity. B cells recognize free
antigen molecules and differentiate or mature into plasma cells
that secrete immunoglobulin (antibodies) that inactivate the
antigens. Memory cells are also generated that make the specific
Immunoglobulin (antibody) on subsequent encounters with such
antigen. B cells are also known as "Beta cells" in the islet of
Langerhans.
[0051] The term "antibody" as referred to herein includes whole
antibodies and any antigen binding fragment or single chains
thereof. An "antibody" refers to a glycoprotein comprising at least
two heavy (H) chains and two light (L) chains inter-connected by
disulfide bonds, or an antigen binding fragment thereof. Each heavy
chain is comprised of a heavy chain variable region (abbreviated
herein as VH) and a heavy chain constant region. The heavy chain
constant region is comprised of three domains, CH1, CH2 and CH3.
Each light chain is comprised of a light chain variable region
(abbreviated herein as VL) and a light chain constant region. The
light chain constant region is comprised of one domain, CL. The VH
and VL regions can be further subdivided into regions of
hypervariability, termed complementarity determining regions (CDR),
interspersed with regions that are more conserved, termed framework
regions (FR or FW). Each VH and VL is composed of three CDRs and
four FRs, arranged from amino-terminus to carboxy-terminus in the
following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable
regions of the heavy and light chains contain a binding domain that
interacts with an antigen. The constant regions of the antibodies
may mediate the binding of the immunoglobulin to host tissues or
factors, including various cells of the immune system (e.g.,
effector cells) and the First component (CIq) of the classical
complement system.
[0052] The term "chimeric antibody" as used herein includes
antibodies in which the variable region sequences are derived from
one species and the constant region sequences are derived from
another species, such as an antibody in which the variable region
sequences are derived from a mouse antibody and the constant region
sequences are derived from a human antibody.
[0053] The term "humanized antibody" as used herein includes
antibodies in which CDR sequences derived from the germline of
another mammalian species, such as a mouse, have been grafted onto
human framework sequences. Additional framework region
modifications may be made within the human framework sequences as
well as within the CDR sequences derived from the germline of
another mammalian species.
[0054] The term "human antibody" as used herein includes antibodies
having variable regions in which both the framework and CDR regions
are derived from human germline immunoglobulin sequences.
Furthermore, if the antibody contains a constant region, the
constant region also is derived from human germline immunoglobulin
sequences. The human antibodies of the invention may include amino
acid residues not encoded by human germline immunoglobulin
sequences (e.g. mutations introduced by random or site-specific
mutagenesis in vitro or by somatic mutation in vivo). However, the
term "human antibody", as used herein, is not intended to include
antibodies in which CDR sequences derived from the germline of
another mammalian species, such as a mouse, have been grafted onto
human framework sequences.
[0055] As used herein, a humanized antibody comprises heavy or
light chain variable framework regions that are "the product of" or
"derived from" a particular human germline sequence (human gene) if
the variable framework regions of the antibody are obtained from a
system that uses human germline immunoglobulin genes. Such systems
include immunizing a transgenic mouse carrying human immunoglobulin
genes with the antigen of interest or screening a human
immunoglobulin gene library displayed on phage with the antigen of
interest. A humanized antibody which comprises a heavy or light
chain variable framework region that is "the product of" or
"derived from" a human germline immunoglobulin sequence can be
identified as such by comparing the amino acid sequence of the
heavy or light chain variable framework region of the humanized
antibody to the amino acid sequences of the heavy or light chain
variable framework region of human germline immunoglobulins. A
humanized antibody that comprises a heavy or light chain variable
framework region that is "the product of" a particular human
germline immunoglobulin sequence has a heavy or light chain
variable framework region which is 100% identical in amino acid
sequence to the heavy or light chain variable framework region of
the particular human germline immunoglobulin sequence. A humanized
antibody that comprises a heavy or light chain variable framework
region that is "derived from" a particular human germline
immunoglobulin sequence may contain amino acid differences as
compared to the heavy or light chain variable framework region of
the particular germline sequence, due to, for example,
naturally-occurring somatic mutations or intentional introduction
of site-directed mutation. However, a selected humanized antibody
typically is at least 90% identical in amino acid sequence of the
heavy or light chain variable framework region to an amino acid
sequence encoded by the heavy or light chain variable framework
region of a human germline immunoglobulin gene and contains amino
acid residues that identify the humanized antibody as being derived
from human when compared to the germline immunoglobulin amino acid
sequences of other species (e.g., murine germline sequences). In
certain cases, a humanized antibody may be preferably at least 95%,
more preferably at least 96%, most preferably at least 97%, in
particular at least 98%, most particular at least 99%, identical in
amino acid sequence of the heavy or light chain variable framework
region to the amino acid sequence of the heavy or light chain
variable framework region encoded by the germline immunoglobulin
gene. Typically, the heavy or light chain variable framework region
of a humanized antibody derived from a particular human germline
sequence will display no more than 10 amino acid, preferably no
more than 5, or even more preferably no more than 4, 3, 2, or 1
differences from the amino acid sequence of the heavy or light
chain variable framework region encoded by the human germline
immunoglobulin gene.
[0056] The term "Fab" or "Fab region" as used herein includes the
polypeptides that comprise the VH, CH1, VL, and CL immunoglobulin
domains. Fab may refer to this region in isolation, or this region
in the context of a full length antibody or antibody fragment.
[0057] The term "Fc" or "Fc region", as used herein includes the
polypeptide comprising the constant region of an antibody excluding
the first constant region immunoglobulin domain. Thus Fc refers to
the last two constant region immunoglobulin domains of IgA, IgD,
and IgG, and the last three constant region immunoglobulin domains
of IgE and IgM, and the flexible hinge N-terminal to these domains.
For IgA and IgM, Fc may include the J chain. For IgG, Fc comprises
immunoglobulin domains Cgamma2 and Cgamma3 (C[gamma]2 and
C[gamma]3) and the hinge between Cgamma1 (C[gamma]1) and Cgamma2
(C[gamma]2). Although the boundaries of the Fc region may vary, the
human IgG heavy chain Fc region is usually defined to comprise
residues C226 or P230 to its carboxyl-terminus, wherein the
numbering is according to the EU index as in Kabat. For human IgG1
the Fc region is herein defined to comprise residue P232 to its
carboxyl-terminus, wherein the numbering is according to the EU
index as in Kabat. Fc may refer to this region in isolation, or
this region in the context of an Fc polypeptide, for example an
antibody.
[0058] The term "hinge" or "hinge region" or "antibody hinge
region" herein includes the flexible polypeptide comprising the
amino acids between the first and second constant domains of an
antibody. Structurally, the IgG CH1 domain ends at EU position 220,
and the IgG CH2 domain begins at residue EU position 237. Thus for
IgG the antibody hinge is herein defined to include positions 221
(D221 in IgGI) to 231 (A231 in IgGI), wherein the numbering is
according to the EU index as in Kabat.
[0059] The term "parent antibody" or "parent immunoglobulin" as
used herein includes an unmodified antibody that is subsequently
modified to generate a variant. Said parent antibody may be a
naturally occurring antibody, or a variant or engineered version of
a naturally occurring antibody. Parent antibody may refer to the
antibody itself, compositions that comprise the parent antibody, or
the amino acid sequence that encodes it. By "parent anti-CD 19
antibody" as used herein is meant an antibody or immunoglobulin
that binds human CD 19 and is modified to generate a variant.
[0060] The term "parental antibody" or "parental immunoglobulin" as
used herein includes a murine or chimeric antibody that is
subsequently modified to generate a humanized antibody.
[0061] The term "variant antibody" or "antibody variant" as used
herein includes an antibody sequence that differs from that of a
parent antibody sequence by virtue of at least one amino acid
modification compared to the parent. The variant antibody sequence
herein will preferably possess at least about 80%, most preferably
at least about 90%, more preferably at least about 95% amino acid
sequence identity with a parent antibody sequence. Antibody variant
may refer to the antibody itself, compositions comprising the
antibody variant, or the amino acid sequence that encodes it.
[0062] The term "amino acid modification" herein includes an amino
acid substitution, insertion, and/or deletion in a polypeptide
sequence. By "amino acid substitution" or "substitution" herein is
meant the replacement of an amino acid at a particular position in
a parent polypeptide sequence with another amino acid. For example,
the substitution R94K refers to a variant polypeptide, in this case
a heavy chain variable framework region variant, in which the
arginine at position 94 is replaced with a lysine. For the
preceding example, 94K indicates the substitution of position 94
with a lysine. For the purposes herein, multiple substitutions are
typically separated by a slash. For example, R94K/L78V refers to a
double variant comprising the substitutions R94K and L78V. By
"amino acid insertion" or "insertion" as used herein is meant the
addition of an amino acid at a particular position in a parent
polypeptide sequence. For example, insert -94 designates an
insertion at position 94. By "amino acid deletion" or "deletion" as
used herein is meant the removal of an amino acid at a particular
position in a parent polypeptide sequence. For example, R94-
designates the deletion of arginine at position 94.
[0063] As used herein, the term "conservative modifications" or
"conservative sequence modifications" is intended to refer to amino
acid modifications that do not significantly affect or alter the
binding characteristics of the antibody containing the amino acid
sequence. Such conservative modifications include amino acid
substitutions, insertions and deletions. Modifications can be
introduced into an antibody of the invention by standard techniques
known in the art, such as site-directed mutagenesis and
PCR-mediated mutagenesis. Conservative amino acid substitutions are
ones in which the amino acid residue is replaced with an amino acid
residue having a similar side chain. Families of amino acid
residues having similar side chains have been defined in the art.
These families include amino acids with basic side chains (e.g.,
lysine, arginine, histidine), acidic side chains (e.g., aspartic
acid, glutamic acid), uncharged polar side chains (e.g., glycine,
asparagine, glutamine, serine, threonine, tyrosine, cysteine,
tryptophan), nonpolar side chains (e.g., alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine), beta-branched side
chains (e.g., threonine, valine, isoleucine) and aromatic side
chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
Thus, one or more amino acid residues within the CDR regions or
within the framework regions of an antibody of the invention can be
replaced with other amino acid residues from the same side chain
family and the altered antibody (variant antibody) can be tested
for retained function.
[0064] For all immunoglobulin heavy chain constant region positions
discussed in the present invention, numbering is according to the
EU index as in Kabat (Kabat et al., 1991, Sequences of Proteins of
Immunological Interest, 5th Ed., United States Public Health
Service, National Institutes of Health, Bethesda, incorporated
entirely by reference). The "EU index as in Kabat" refers to the
residue numbering of the human IgG1 EU antibody, as described in
Edelman et al., 1969, Biochemistry 63:78-85.
[0065] The term "full length antibody" as used herein includes the
structure that constitutes the natural biological form of an
antibody, including variable and constant regions. For example, in
most mammals, including humans and mice, the full length antibody
of the IgG class is a tetramer and consists of two identical pairs
of two immunoglobulin chains, each pair having one light and one
heavy chain, each light chain comprising immunoglobulin domains VL
and CL, and each heavy chain comprising immunoglobulin domains VH,
CH1 (C[gamma]1), CH2 (C[gamma]2), and CH3 (C[gamma]3). In some
mammals, for example in camels and llamas, IgG antibodies may
consist of only two heavy chains, each heavy chain comprising a
variable domain attached to the Fc region.
[0066] Antibody fragments include, but are not limited to, (i) the
Fab fragment consisting of VL, VH, CL and CH1 domains, including
Fab' and Fab'-SH, (ii) the Fd fragment consisting of the VH and CH1
domains, (iii) the Fv fragment consisting of the VL and VH domains
of a single antibody; (iv) the dAb fragment (Ward et al., 1989,
Nature 341:544-546) which consists of a single variable, (v)
F(ab')2 fragments, a bivalent fragment comprising two linked Fab
fragments (vi) single chain Fv molecules (scFv), wherein a VH
domain and a VL domain are linked by a peptide linker which allows
the two domains to associate to form an antigen binding site (Bird
et al., 1988, Science 242:423-426, Huston et al., 1988, Proc. Natl.
Acad. Sci. U.S.A. 85:5879-5883), (vii) bispecific single chain Fv
dimers (PCT/US92/09965), (viii) "diabodies" or "triabodies",
multivalent or multispecific fragments constructed by gene fusion
(Tomlinson et. al., 2000, Methods Enzymol. 326:461-479; WO94/13804;
Holliger et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90:6444-6448)
and (ix) scFv genetically fused to the same or a different antibody
(Coloma & Morrison, 1997, Nature Biotechnology 15,
159-163).
[0067] Antibodies are grouped into classes, also referred to as
isotypes, as determined genetically by the constant region. Human
constant light chains are classified as kappa (CK) and lambda
(C[lambda]) light chains. Heavy chains are classified as mu, delta,
gamma, alpha, or epsilon, and define the antibody's isotype as IgM,
IgD, IgG, IgA, and IgE, respectively. The IgG class is the most
commonly used for therapeutic purposes. In humans this class
comprises subclasses IgG1, IgG2, IgG3, and IgG4. In mice this class
comprises subclasses IgG1, IgG2a, IgG2b, IgG3. IgM has subclasses,
including, but not limited to, IgM1 and IgM2. IgA has several
subclasses, including but not limited to IgA1 and IgA2. Thus,
"isotype" as used herein is meant any of the classes or subclasses
of immunoglobulins defined by the chemical and antigenic
characteristics of their constant regions. The known human
immunoglobulin isotypes are IgG1, IgG2, IgG3, IgG4, IgA1, IgA2,
IgM1, IgM2, IgD, and IgE.
[0068] The term "ADCC" or "antibody dependent cell-mediated
cytotoxicity" as used herein includes the cell-mediated reaction
wherein nonspecific cytotoxic cells that express Fc[gamma]Rs
recognize bound antibody on a target cell and subsequently cause
lysis of the target cell. In various aspects, the enhanced ADCC
effector function can mean enhanced potency or enhanced efficacy.
By "potency" as used in the experimental context is meant the
concentration of antibody when a particular therapeutic effect is
observed EC50 (half maximal effective concentration). By "efficacy"
as used in the experimental context is meant the maximal possible
effector function at saturating levels of antibody.
[0069] The term "ADCP" or antibody dependent cell-mediated
phagocytosis as used herein includes the cell-mediated reaction
wherein nonspecific cytotoxic cells that express Fc[gamma]Rs
recognize bound antibody on a target cell and subsequently cause
phagocytosis of the target cell.
[0070] The term "CDC" or "complement dependent cytotoxicity" as
used herein includes the reaction wherein one or more complement
protein components recognize bound antibody on a target cell and
subsequently cause lysis of the target cell.
[0071] The term "effector function" as used herein includes a
biochemical event that results from the interaction of an antibody
Fc region with an Fc receptor or ligand. Effector functions include
Fc[gamma]R-mediated effector functions such as ADCC and ADCP, and
complement-mediated effector functions such as CDC.
[0072] As used herein, the term "subject" includes any human or
nonhuman animal. The term "nonhuman animal" includes all
vertebrates, e.g., mammals and non-mammals, such as nonhuman
primates, sheep, dogs, cats, horses, cows, chickens, amphibians,
reptiles, etc. Preferably the subject is human.
[0073] The term "isotypic variant" as used herein includes an amino
acid modification that converts at least one amino acid of one
isotype, preferably at least one amino acid of the heavy chain
constant region of one isotype, to the corresponding amino acid in
a different, aligned isotype. The amino acid modification may
comprise conversion of a whole constant region immunoglobulin
domain or, preferably, of an Fc region of one isotype in a
different isotype, e.g. the conversion of the Fc region of the
human IgG1 heavy constant region to an Fc region from human IgG3
resulting in an isotypic variant comprising the CH1 from human
IgG1, the hinge from human IgG1 and the Fc region from human
IgG3.
[0074] The term "isotypic modification" as used herein includes an
amino acid modification that converts one amino acid of one isotype
to the corresponding amino amino acid in a different, aligned
isotype. For example, because IgG1 has a tyrosine and IgG2 a
phenylalanine at Kabat position 296, a F296Y substitution in IgG2
is considered an isotypic modification.
[0075] The term "mature core carbohydrate structure" as used herein
includes a processed core carbohydrate structure attached to an Fc
region which generally consists of the carbohydrate structure
GlcNAc (Fucose)-GlcNAc-Man-(Man-GlcNAc).sub.2 typical of
biantennary oligosaccharides represented schematically below:
##STR00001##
[0076] This term specifically includes G-1 forms of the core mature
carbohydrate structure lacking a .beta.1,2 GlcNAc residue.
Preferably, however, the core carbohydrate structure includes both
.beta.1,2 GlcNAc residues. The mature core carbohydrate structure
herein generally is not hypermannosylated. The mature core
carbohydrate structure is attached to the Fc region of the
glycoprotein, generally via N-linkage to Asn297 of a CH2 domain of
the Fc region.
Anti-CD19 Antibodies
[0077] In a first aspect the present invention provides a humanized
antibody or fragment thereof that binds to human CD19 comprising a
heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO:
27, and/or a heavy chain CDR2 comprising the amino acid sequence of
SEQ ID NO: 28, and/or a heavy chain CDR3 comprising the amino acid
sequence of SEQ ID NO: 29. In another aspect, the present
disclosure provides a humanized antibody or fragment thereof that
binds to human CD19 comprising a light chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 30, and/or a light chain CDR2
comprising the amino acid sequence of SEQ ID NO: 31 and/or a light
chain CDR3 comprising the amino acid sequence of SEQ ID NO: 32.
[0078] In another aspect, the present disclosure provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain CDR1 comprising the amino acid sequence of
SEQ ID NO: 27, and/or a heavy chain CDR2 comprising the amino acid
sequence of SEQ ID NO: 28, and/or a heavy chain CDR3 comprising the
amino acid sequence of SEQ ID NO: 29; and/or comprising a light
chain CDR1 comprising the amino acid sequence of SEQ ID NO: 30,
and/or a light chain CDR2 comprising the amino acid sequence of SEQ
ID NO: 31 and/or a light chain CDR3 comprising the amino acid
sequence of SEQ ID NO: 32.
[0079] Preferably the humanized antibody or fragment thereof that
binds to human CD19 comprises a heavy chain CDR1 comprising the
amino acid sequence of SEQ ID NO: 27, a heavy chain CDR2 comprising
the amino acid sequence of SEQ ID NO: 28, and a heavy chain CDR3
comprising the amino acid sequence of SEQ ID NO: 29 and/or a light
chain CDR1 comprising the amino acid sequence of SEQ ID NO: 30, a
light chain CDR2 comprising the amino acid sequence of SEQ ID NO:
31 and a light chain CDR3 comprising the amino acid sequence of SEQ
ID NO: 32. More preferably the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain CDR1
comprising the amino acid sequence of SEQ ID NO: 27, a heavy chain
CDR2 comprising the amino acid sequence of SEQ ID NO: 28, and a
heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO:
29; and a light chain CDR1 comprising the amino acid sequence of
SEQ ID NO: 30, a light chain CDR2 comprising the amino acid
sequence of SEQ ID NO: 31 and a light chain CDR3 comprising the
amino acid sequence of SEQ ID NO: 32.
[0080] It is well known in the art that the CDR3 domain,
independently from the CDR1 and/or CDR2 domain(s), alone can
determine the binding specificity of an antibody for a cognate
antigen and that multiple antibodies can predictably be generated
having the same binding specificity based on a common CDR3
sequence. See, for example, Klimka et al, British J. of Cancer
83[pound]2):252-260 (2000) (describing the production of a
humanized anti-CD30 antibody using only the heavy chain variable
domain CDR3 of murine anti-CD30 antibody Ki-4); Beiboer et al, J.
MoI. Biol. 296:833-849 (2000) (describing recombinant epithelial
glycoprotein-2 (EGP-2) antibodies using only the heavy chain CDR3
sequence of the parental murine MOC-31 anti-EGP-2 antibody); Rader
et al, Proc. Natl. Acad. ScL U.S.A. 95:8910-8915 (1998) (describing
a panel of humanized anti-integrin [alpha]v[beta]3 antibodies using
a heavy and light chain variable CDR3 domain of a murine
anti-integrin [alpha]v[beta]3 antibody LM609 wherein each member
antibody comprises a distinct sequence outside the CDR3 domain and
capable of binding the same epitope as the parental murine antibody
with affinities as high or higher than the parental murine
antibody); Barbas et al, J. Am. Chem. Soc. 116:2161-2162 (1994)
(disclosing that the CDR3 domain provides the most significant
contribution to antigen binding).
[0081] Accordingly, the present invention provides humanized
antibodies and fragments thereof that bind to human CD19 comprising
one or more heavy and/or light chain CDR3 domains from an antibody
of a non-human animal e.g from a murine antibody like FMC63, in
particular comprising heavy chain CDR3 comprising the amino acid
sequence of SEQ ID NO: 29 and/or light chain CDR3 comprising the
amino acid sequence of SEQ ID NO: 32, wherein the antibody is
capable of binding to CD 19. Within some embodiments, such
inventive antibodies comprising one or more heavy and/or light
chain CDR3 domain from a non-human antibody (a) are capable of
competing for binding with; (b) retain the functional
characteristics; (c) bind to the same epitope; and/or (d) have a
similar binding affinity as the corresponding parental non-human
e.g. murine antibody.
[0082] In a further aspect the present invention provides a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain variable region sequence selected from the
group consisting of SEQ ID NOS: 19, 20, 21, 22 and 42, preferably a
heavy chain variable region sequence selected from the group
consisting of SEQ ID NOS: 21, 22 and 42, more preferably a heavy
chain variable region sequence comprising SEQ ID NO: 21.
[0083] In another aspect the present invention provides a humanized
antibody or fragment thereof that binds to human CD19 comprising a
light chain variable region sequence selected from the group
consisting of SEQ ID NOS: 23, 24, 25, 26 and 41, preferably a light
chain variable region sequence selected from the group consisting
of SEQ ID NOS: 25 and 41, more preferably a light chain variable
region sequence comprising SEQ ID NO: 41.
[0084] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain variable
region sequence selected from the group consisting of SEQ ID NOS:
19, 20, 21, 22, and 42 and a light chain variable region sequence
selected from the group consisting of SEQ ID NOS: 23, 24, 25, 26
and 41, preferably a heavy chain variable region sequence selected
from the group consisting of SEQ ID NOS: 21, 22 and 42 and a light
chain variable region sequence selected from the group consisting
of SEQ ID NOS: 23, 24, 25, 26 and 41, more preferably a heavy chain
variable region sequence selected from the group consisting of SEQ
ID NOS: 21, 22 and 42 and a light chain variable region sequence
selected from the group consisting of SEQ ID NOs: 25 and 41, most
preferably a heavy chain variable region sequence comprising SEQ ID
NO: 21 and a light chain variable region sequence comprising SEQ ID
NO: 41.
[0085] Given that each of these heavy and light chain variable
region sequences can bind to human CD19, the heavy and light chain
variable region sequences can be "mixed and matched" to create
anti-CD19 binding molecules of the invention. CD 19 binding of such
"mixed and matched" antibodies can be tested using the binding
assays described e.g. in the Examples.
[0086] In another aspect the present invention provides variants of
a humanized antibody or fragment thereof that binds to human CD19.
Thus the present invention provides humanized antibodies or
fragments thereof that have an amino acid sequence of the heavy
and/or light chain variable framework region which is at least 80%
identical (having at least 80% amino acid sequence identity) to the
amino acid sequence of the heavy and/or light chain variable
framework region of the parent humanized antibody of either the
heavy or the light chain e.g. of either the heavy and light
variable region sequences as in SEQ ID NO: 21 or SEQ ID NO: 41,
respectively. Preferably the amino acid sequence identity of the
heavy and/or light chain variable framework region is at least 85%,
more preferably at least 90%, and most preferably at least 95%, in
particular 96%, more particular 97%, even more particular 98%, most
particular 99%, including for example, 80%, 81%, 82%, 83%, 84%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99%, and 100%. Identity or homology with respect to an amino
acid sequence is defined herein as the percentage of amino acid
residues in the candidate sequence that are identical with the
humanized antibody or fragment thereof that binds to human CD19,
after aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity. Thus sequence
identity can be determined by standard methods that are commonly
used to compare the similarity in position of the amino acids of
two polypeptides. Using a computer program such as BLAST or FASTA,
two polypeptides are aligned for optimal matching of their
respective amino acids (either along the full length of one or both
sequences, or along a pre-determined portion of one or both
sequences). The programs provide a default opening penalty and a
default gap penalty, and a scoring matrix such as PAM250 (a
standard scoring matrix; see Dayhoff et al., in Atlas of Protein
Sequence and Structure, vol 5, supp. 3 (1978)) can be used in
conjunction with the computer program. For example, the percent
identity can be calculated as: the total number of identical
matches multiplied by 100 and then divided by the sum of the length
of the longer sequence within the matched span and the number of
gaps introduced into the longer sequences in order to align the two
sequences.
[0087] In some embodiments the present disclosure thus provides a
humanized antibody or fragment thereof that binds to human CD19,
wherein the humanized antibody or fragment thereof comprises a
heavy chain variable framework region sequence which is at least
80% identical to the framework region sequence of SEQ ID NOS: 19,
20, 21, 22 or 42 and/or a light chain variable framework region
sequence which is at least 80% identical to the framework region
sequence of SEQ ID NOS: 23, 24, 25, 26 and 41.
[0088] In some embodiments the present disclosure provides a
humanized antibody or fragment thereof that binds to human CD19,
wherein the humanized antibody or fragment thereof comprises a
heavy chain variable framework region sequence which is at least
80% identical to the framework region sequence of SEQ ID NO: 21, 22
or 42 and/or a light chain variable framework region sequence which
is at least 80% identical to the framework region sequence of SEQ
ID NO: 25 or 41. In some embodiments the present disclosure
provides a humanized antibody or fragment thereof that binds to
human CD19, wherein the humanized antibody or fragment thereof
comprises a heavy chain variable framework region sequence which is
at least 80% identical to the framework region sequence of SEQ ID
NO: 21 and/or a light chain variable framework region sequence
which is at least 80% identical to the framework region sequence of
SEQ ID NO: 41.
[0089] In another aspect the present invention provides a humanized
antibody or fragment thereof that binds to human CD19 comprising
the heavy and or light chain CDRs as described supra and further
comprising a heavy chain variable framework region that is the
product of or derived from a human gene selected from the group
consisting of V3-33*01 (SEQ ID NO: 11), V3-11*01 (SEQ ID NO: 12),
V3-30*-18 (SEQ ID NO: 13) and V3-48*01 (SEQ ID NO: 14), preferably
a heavy chain variable framework region that is the product of or
derived from human gene V3-30*-18 (SEQ ID NO: 13) or V3-48*01 (SEQ
ID NO: 14), more preferably a heavy chain variable framework region
that is the product of or derived from human gene V3-30*-18 (SEQ ID
NO: 13). The heavy chain variable framework region may comprise one
or more (e.g., one, two, three and/or four) heavy chain framework
region sequences (e.g., framework 1 (FW1), framework 2 (FW2),
framework 3 (FW3) and/or framework 4 (FW4)) present in the product
of or derived from those human genes. Preferably the heavy chain
variable region framework comprises FW1, FW2 and/or FW3, more
preferably FW1, FW2 and FW3 present in the product of or derived
from a human gene selected from the group consisting of V3-33*01
(SEQ ID NO: 11), V3-11*01 (SEQ ID NO: 12), V3-30*-18 (SEQ ID NO:
13) and V3-48*01 (SEQ ID NO: 14). Heavy chain framework region
sequences as used herein include FW1 (position 1 to position 25),
FW2 (position 36 to position 49), FW3 (position 66 to position 94)
and FW4 (position 103 to position 113), wherein the amino acid
position is indicated utilizing the numbering system set forth in
Kabat.
[0090] In another aspect the present invention provides a humanized
antibody or fragment thereof that binds to human CD19 comprising a
light chain variable framework region that is the product of or
derived from a human gene selected from the group consisting of
V1-5*03 (SEQ ID NO: 3), V1-27*01 (SEQ ID NO:4), V1-39*-01 (SEQ ID
NO: 5) and V1-12*01 (SEQ ID NO: 6), preferably a light chain
variable framework region that is the product of or derived from
human gene V1-39*-01 (SEQ ID NO: 5). The light chain variable
region framework region may comprise one or more (e.g., one, two,
three and/or four) light chain framework region sequences (e.g.,
framework 1 (FW1), framework 2 (FW2), framework 3 (FW3) and/or
framework 4 (FW4)) present in the product of or derived from those
human genes. Preferably the light chain variable region framework
comprises FW1, FW2 and/or FW3, more preferably FW1, FW2 and FW3
present in the product of or derived from a human gene selected
from the group consisting of V1-5*03 (SEQ ID NO: 3), V1-27*01 (SEQ
ID NO:4), V1-39*-01 (SEQ ID NO: 5) and V1-12*01 (SEQ ID NO: 6).
Light chain framework region sequences as used herein include FW1
(position 1 to position 23), FW2 (position 35 to position 49), FW3
(position 57 to position 88) and FW4 (position 98 to position 108),
wherein the amino acid position is indicated utilizing the
numbering system set forth in Kabat.
[0091] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain variable
framework region that is the product of or derived from a human
gene selected from the group consisting of V3-33*01 (SEQ ID NO:
11), V3-11*01 (SEQ ID NO: 12), V3-30*-18 (SEQ ID NO: 13) and
V3-48*01 (SEQ ID NO: 14) and a light chain variable framework
region that is the product of or derived from a human gene selected
from the group consisting of V1-5*03 (SEQ ID NO: 3), V1-27*01 (SEQ
ID NO:4), V1-39*-01 (SEQ ID NO: 5) and V1-12*01 (SEQ ID NO: 6),
preferably a heavy chain variable framework region that is the
product of or derived from human gene V3-30*-18 (SEQ ID NO: 13) or
V3-48*01 (SEQ ID NO: 14), and a light chain variable framework
region that is the product of or derived from human gene V1-39*-01
(SEQ ID NO: 5), more preferably a heavy chain variable framework
region that is the product of or derived from human gene V3-30*-18
(SEQ ID NO: 13) and a light chain variable framework region that is
the product of or derived from human gene V1-39*-01 (SEQ ID NO:
5).
[0092] As well combinations of heavy chain variable region
framework regions which are present in the product of or derived
from different human genes and/or of light chain variable region
framework regions which are present in the product of or derived
from different human genes are encompassed by the present
invention, e.g. FW1 and FW2 present in the product of or derived
from V3-30*-18 (SEQ ID NO: 13) combined with FW3 present in the
product of or derived from V3-48*01 (SEQ ID NO: 14) and/or FW1 and
FW2 present in the product of or derived from V1-39*-01 (SEQ ID NO:
5) combined with FW3 present in the product of or derived from
V1-12*01 (SEQ ID NO: 6).
[0093] Germline DNA sequences for human heavy and light chain
variable region genes can be found in Kabat, E. A., et al. (1991)
Sequences of Proteins of Immunological Interest, Fifth Edition,
U.S. Department of Health and Human Services, NIH Publication No.
91-3242; Tomlinson, I. M., et al. (1992) "The Repertoire of Human
Germline VH Sequences Reveals about Fifty Groups of VH Segments
with Different Hypervariable Loops" J. MoI. Biol. 227:776-798; and
Cox, J. P. L. et al. (1994) "A Directory of Human Germline VH
Segments Reveals a Strong Bias in their Usage" Eur. J. Immunol.
24:827-836. As another example, the germline DNA sequences for
human heavy and light chain variable region genes can be found in
the Genbank database.
[0094] In another aspect, the present disclosure also provides a
humanized antibody or fragment thereof that binds to human CD19,
wherein at least one of the heavy chain CDRs and/or at least one of
the light chain CDRs comprises at least one amino acid
modification. Site-directed mutagenesis or PCR-mediated mutagenesis
can be performed to introduce the modification(s) and the effect on
antibody binding, or other functional property of interest, can be
evaluated in in vitro or in vivo assays as described herein and
provided in the Examples. Preferably conservative modifications are
introduced. The modification(s) may be amino acid substitutions,
additions or deletions, but are preferably substitutions.
Typically, no more than five, preferably no more than four, more
preferably no more than three, even more preferably no more than
two, most preferably no more than one amino acid modifications are
performed within a CDR region.
[0095] Thus the present disclosure also provides a humanized
antibody or fragment thereof that binds to human CD19, comprising
an amino acid modification comprising amino acid substitution Y32F
within heavy chain CDR1, and/or comprising an amino acid
modification comprising amino acid substitution Y58F or Y59F within
heavy chain CDR2 and/or comprising an amino acid modification
comprising one or more amino acid substitutions selected from the
group consisting of Y96F, Y97F, Y98F and Y100.sub.BF within heavy
chain CDR3. Preferred amino acid modifications of the humanized
antibody or fragment thereof is amino acid substitution Y32F within
heavy chain CDR1 and amino acid substitutions selected from the
group consisting of Y96F, Y97F, Y98F and Y100.sub.BF within heavy
chain CDR3. More preferred amino acid modifications of the
humanized antibody or fragment thereof are amino acid substitution
Y32F within heavy chain CDR1 and/or amino acid substitution
Y100.sub.BF within heavy chain CDR3.
[0096] The present disclosure also provides a humanized antibody or
fragment thereof, comprising an amino acid modification comprising
amino acid substitution Y32F within light chain CDR1 and/or
comprising an amino acid modification comprising an amino acid
substitution selected from the group consisting of N92A, T93A and
T93V within light chain CDR3. Preferred amino acid modifications of
the humanized antibody or fragment thereof are amino acid
substitution Y32F within light chain CDR1 and/or amino acid
substitution N92A within light chain CDR3.
[0097] In some embodiments the present disclosure provides a
humanized antibody or fragment thereof that binds to human CD19,
comprising an amino acid modification comprising amino acid
substitution Y32F within heavy chain CDR1, and/or comprising an
amino acid modification comprising amino acid substitution Y58F or
Y59F within heavy chain CDR2 and/or comprising an amino acid
modification comprising one or more amino acid substitutions
selected from the group consisting of Y96F, Y97F, Y98F and
Y100.sub.BF within heavy chain CDR3 and comprising an amino acid
modification comprising amino acid substitution Y32F within light
chain CDR1 and/or comprising an amino acid modification comprising
an amino acid substitution selected from the group consisting of
N92A, T93A and T93V within light chain CDR3.
[0098] In certain embodiments, framework sequences can be used to
engineer variable regions to produce variant antibodies. Variant
antibodies of the invention include those in which modifications
have been made to framework residues within VH and/or VK, e.g. to
improve the properties of the antibody. Typically such framework
modifications are made to decrease the immunogenicity of the
antibody. For example, one approach is to "backmutate" one or more
framework residues to the corresponding murine sequence or to
"backmutate" one or more framework residues to a corresponding
germline sequence.
[0099] Thus in a further aspect the present disclosure provides a
humanized antibody or fragment thereof that binds to human CD19,
wherein at least one of the framework regions of the heavy chain
variable region of the humanized antibody or fragment thereof
comprises at least one amino acid modification from the
corresponding framework region of the heavy chain variable region
of the corresponding murine antibody. Preferably the amino acid
modification is an amino acid substitution. Typically, no more than
five, preferably no more than four, more preferably no more than
three, even more preferably no more than two, most preferably no
more than one amino acid modifications are performed within a
framework region.
[0100] In some embodiments the present disclosure provides a
humanized antibody or fragment thereof that binds to human CD19,
wherein the amino acid modification of the framework regions of the
heavy chain variable region comprise an amino acid substitution at
amino acid position selected from the group consisting of 37, 42,
48, 49, 67, 71, 78 and 94. Preferred amino acid substitution of the
framework regions of the heavy chain variable region are at amino
acid positions selected from the group consisting of 42, 67, 71, 78
and 94. More preferred amino acid substitutions of the framework
regions of the heavy chain variable region are selected from the
group consisting of G42R, F67L, R71K, L78V and R94K, with the
proviso that if the amino acid modification is R94K the heavy chain
variable region sequence is not SEQ ID NO: 19 or SEQ ID NO: 20,
whereas R94K is the most preferred amino acid substitution of the
framework regions of the heavy chain variable region.
[0101] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19, wherein at least one of
the framework regions of the light chain variable region of the
humanized antibody or fragment thereof comprises at least one amino
acid modification from the corresponding framework region of the
light chain variable region of the corresponding murine antibody.
Preferably the amino acid modification is an amino acid
substitution. Typically, no more than five, preferably no more than
four, more preferably no more than three, even more preferably no
more than two, most preferably no more than one amino acid
modifications are performed within a framework region. In some
embodiments the present disclosure provides a humanized antibody or
fragment thereof, wherein the amino acid modification of the
framework regions of the light chain variable region sequence
comprises an amino acid substitution at amino acid position
selected from the group consisting of 44, 71 and 87. More preferred
amino acid substitutions of the framework regions of the light
chain variable region sequence are selected from the group
consisting of P44V, P44I, P44L, F71Y, F71H, F71S, F71T and Y87F.
Most preferred amino acid substitutions of the framework regions of
the light chain variable region sequence are selected from the
group consisting of P44V, P44I, F71Y, and Y87F, whereas P44I is
particular preferred.
[0102] In some embodiments the humanized antibody or fragment
thereof of the present invention may comprise amino acid
modifications of the framework regions of the heavy chain variable
region sequence as set out supra and amino acid modifications of
the framework regions of the light chain variable region sequence
as set out supra.
[0103] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 that comprises a heavy
chain variable region selected from the group consisting of SEQ ID
NOS: 33, 34, 35, 36, 37, 43, 44, 45, 46, 47, 54 and 55, preferably
selected from the group consisting of SEQ ID NOS: 37, 43 and 47,
more preferably selected from the group consisting of SEQ ID NOS:
37 and 47.
[0104] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 that comprises a light
chain variable region selected from the group consisting of SEQ ID
NOS: 25, 38, 39, 40, 48, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60,
61, 62 and 63, preferably selected from the group consisting of SEQ
ID NOS: 25, 59 and 60, more preferably selected from the group
consisting of SEQ ID NOS: 59 and 60.
[0105] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain variable
region selected from the group consisting of SEQ ID NOS: 33, 34,
35, 36, 37, 43, 44, 45, 46, 47, 54 and 55, and a light chain
variable region selected from the group consisting of SEQ ID NOS:
25, 38, 39, 40, 48, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 61, 62
and 63.
[0106] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain variable
region selected from the group consisting of SEQ ID NOS: 37, 43 and
47, and a light chain variable region selected from the group
consisting of SEQ ID NOS: 25, 59 and 60. In more preferred
embodiments the humanized antibody or fragment thereof that binds
to human CD19 comprises a heavy chain variable region selected from
the group consisting of SEQ ID NOS: 37 and 47, and a light chain
variable region selected from the group consisting of SEQ ID NOS:
59 and 60. Most preferred is a humanized antibody or fragment
thereof that binds to human CD19 comprising a heavy chain variable
region comprising the amino acid sequence of SEQ ID NO: 37, and a
light chain variable region comprising the amino acid sequence of
SEQ ID NO: 59, a humanized antibody or fragment thereof that binds
to human CD19 comprising a heavy chain variable region comprising
the amino acid sequence of SEQ ID NO: 47, and a light chain
variable region comprising the amino acid sequence of SEQ ID NO:
60, a humanized antibody or fragment thereof that binds to human
CD19 comprising a heavy chain variable region comprising the amino
acid sequence of SEQ ID NO: 47, and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 59, a humanized
antibody or fragment thereof that binds to human CD19 comprising a
heavy chain variable region comprising the amino acid sequence of
SEQ ID NO: 37, and a light chain variable region comprising the
amino acid sequence of SEQ ID NO: 25, a humanized antibody or
fragment thereof that binds to human CD19 comprising a heavy chain
variable region comprising the amino acid sequence of SEQ ID NO:
37, and a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 49, a humanized antibody or fragment thereof
that binds to human CD19 comprising a heavy chain variable region
comprising the amino acid sequence of SEQ ID NO: 47, and a light
chain variable region comprising the amino acid sequence of SEQ ID
NO: 49 or a humanized antibody or fragment thereof that binds to
human CD19 comprising a heavy chain variable region comprising the
amino acid sequence of SEQ ID NO: 43, and a light chain variable
region comprising the amino acid sequence of SEQ ID NO: 59, in
particular a humanized antibody or fragment thereof that binds to
human CD19 comprising a heavy chain variable region comprising the
amino acid sequence of SEQ ID NO: 37, and a light chain variable
region comprising the amino acid sequence of SEQ ID NO: 59, a
humanized antibody or fragment thereof that binds to human CD19
comprising a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 47, and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 60, a humanized
antibody or fragment thereof that binds to human CD19 comprising a
heavy chain variable region comprising the amino acid sequence of
SEQ ID NO: 47, and a light chain variable region comprising the
amino acid sequence of SEQ ID NO: 59.
[0107] Given that each of these heavy and light chain variable
region sequences can bind to human CD19, the heavy and light chain
variable region sequences can be "mixed and matched" to create
anti-CD19 binding molecules of the invention. CD 19 binding of such
"mixed and matched" antibodies can be tested using the binding
assays described e.g. in the Examples.
[0108] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain sequence
comprising the amino acid sequence of SEQ ID NO: 64, and a light
chain sequence comprising the amino acid sequence of SEQ ID NO:
65.
[0109] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain sequence
comprising the amino acid sequence of SEQ ID NO: 66, and a light
chain sequence comprising the amino acid sequence of SEQ ID NO:
67.
[0110] In some embodiments the humanized antibody or fragment
thereof that binds to human CD19 comprises a heavy chain sequence
comprising the amino acid sequence of SEQ ID NO: 66, and a light
chain sequence comprising the amino acid sequence of SEQ ID NO:
65.
[0111] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 which further comprises a
human heavy and/or light constant domain. Human heavy constant
regions may be selected from the group of human immunoglobulins
consisting of IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgM1, IgM2, IgD,
and IgE, whereas the human heavy constant region IgG, in particular
IgG1 is preferred. Human light constant region may be selected from
the group of human immunoglobulins consisting of kappa or lambda
constant regions, whereas human kappa constant region is preferred.
In some preferred embodiments the humanized antibody or fragment
thereof comprises a human IgG1 heavy constant domain and a human
light kappa constant domain. The present disclosure also provides a
humanized antibody or fragment thereof that binds to human CD19
comprising human heavy and/or light constant regions, wherein the
human heavy constant region comprises an isotypic variant
comprising the CH1 from human IgG1, the hinge from human IgG1 and
the Fc region from human IgG3. Preferably the humanized antibody
comprising the isotypic variant is a full length antibody. A
particular preferred humanized antibody or fragment thereof that
binds to human CD19 comprising an isotypic variant comprising the
CH1 from human IgG1, the hinge from human IgG1 and the Fc region
from human IgG3 comprises a heavy chain sequence comprising the
amino acid sequence of SEQ ID NO: 124 and a light chain sequence
comprising the amino acid sequence of SEQ ID NO: 65. It has been
found that the isotypic variant exhibits improved complement
dependent cytotoxicity (CDC) as compared to a humanized antibody or
fragment thereof that binds to human CD19 which comprises a human
heavy constant region from human IgG1 (which is usually a native
human IgG1), i.e. as compared to a humanized antibody or fragment
thereof that binds to human CD19 that only differs from the
isotypic variant with regard to the modified heavy constant
region.
[0112] The present disclosure also provides a fragment of a
humanized antibody that binds to human CD19 selected from the group
consisting of Fab, Fab', Fab'-SH, Fd, Fv, dAb, F(ab')2, scFv,
bispecific single chain Fv dimers, diabodies, triabodies and scFv
genetically fused to the same or a different antibody. Preferred
fragments are scFv, bispecific single chain Fv dimers and
diabodies. The present disclosure also provides a full length
humanized antibody that binds to human CD19.
[0113] In addition or alternative to modifications made within the
framework regions or CDR regions, antibodies of the invention may
be engineered to include modifications within the Fc region,
typically to alter one or more functional properties of the
antibody, such as serum half-life, complement fixation, Fc receptor
binding, and/or antigen-dependent cellular cytotoxicity.
Furthermore, an antibody of the invention may be chemically
modified (e.g., one or more chemical moieties can be attached to
the antibody) or be modified to alter its glycosylation. Each of
these embodiments is described in further detail below.
Modifications within the Fc region as outlined below are according
to the numbering of residues in the Fc region of the EU index of
Kabat. In one embodiment, the hinge region of CH1 is modified such
that the number of cysteine residues in the hinge region is
altered, e.g., increased or decreased. This approach is described
further in U.S. Pat. No. 5,677,425 by Bodmer et al.
[0114] The number of cysteine residues in the hinge region of CH1
is altered to, for example, facilitate assembly of the light and
heavy chains or to increase or decrease the stability of the
antibody. In another embodiment, the Fc hinge region of an antibody
is mutated to decrease the biological half life of the antibody.
More specifically, one or more amino acid mutations are introduced
into the CH2-CH3 domain interface region of the Fc-hinge fragment
such that the antibody has impaired Staphylococcyl protein A (SpA)
binding relative to native Fc-hinge domain SpA binding. This
approach is described in further detail in U.S. Pat. No. 6,165,745
by Ward et al. In another embodiment, the antibody is modified to
increase its biological half life. Various approaches are possible.
For example, one or more of the following mutations can be
introduced: T252L, T254S, T256F, as described in U.S. Pat. No.
6,277,375 to Ward. Alternatively, to increase the biological half
life, the antibody can be altered within the CH1 or CL region to
contain a salvage receptor binding epitope taken from two loops of
a CH2 domain of an Fc region of an IgG, as described in U.S. Pat.
Nos. 5,869,046 and 6,121,022 by Presta et al. In a further
embodiment Fc region is altered by replacing at least one amino
acid residue with a different amino acid residue to alter the
effector function(s) of the antibody. For example, one or more
amino acids selected from amino acid residues 234, 235, 236, 237,
297, 318, 320 and 322 can be replaced with a different amino acid
residue such that the antibody has an altered affinity for an
effector ligand but retains the antigen-binding ability of the
parent antibody. The effector ligand to which affinity is altered
can be, for example, an Fc receptor or the C1 component of
complement. This approach is described in further detail in U.S.
Pat. Nos. 5,624,821 and 5,648,260, both by Winter et al. In another
example, one or more amino acids selected from amino acid residues
329, 331 and 322 can be replaced with a different amino acid
residue such that the antibody has altered CIq binding and/or
reduced or abolished complement dependent cytotoxicity (CDC). This
approach is described in further detail in U.S. Pat. No. 6,194,551
by Idusogie et al. In another example, one or more amino acid
residues within amino acid positions 231 to 238 in the N-terminal
region of the CH2 domain are altered to thereby alter the ability
of the antibody to fix complement. This approach is described
further in PCT Publication WO 94/29351 by Bodmer et al. In yet
another example, the Fc region is modified to increase the ability
of the antibody to mediate antibody dependent cellular cytotoxicity
(ADCC) and/or to increase the affinity of the antibody for an
Fc[gamma] receptor by modifying one or more amino acids at the
following positions: 238, 239, 248, 249, 252, 254, 255, 256, 258,
265, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289,
290, 292, 293, 294, 295, 296, 298, 301, 303, 305, 307, 309, 312,
315, 320, 322, 324, 326, 327, 329, 330, 331, 333, 334, 335, 337,
338, 340, 360, 373, 376, 378, 382, 388, 389, 398, 414, 416, 419,
430, 434, 435, 437, 438 or 439. This approach is described further
in PCT Publication WO 00/42072 by Presta.
[0115] Thus in a preferred embodiment the present disclosure
provides a humanized antibody or fragment thereof that binds to
human CD19, which comprises a variant human IgG Fc region which
comprises at least one amino acid modification relative to the
human IgG Fc region of the parent antibody, whereas the antibody
comprising the variant human IgG Fc region exhibits altered
effector function compared to the parent antibody. Preferably the
antibody comprises a variant human IgG1 Fc region. More preferred
is a full length antibody comprising a variant human IgG1 Fc
region. The parent antibody is a humanized antibody or fragment
thereof that binds to human CD19 and is identical to the humanized
antibody that binds to human CD19 which comprises a variant human
IgG Fc region, except for the amino acid modification in the human
IgG Fc region and is usually an antibody with a native human IgG Fc
region. The amino acid modification is preferably not isotopic.
[0116] The effector function altered is usually complement
dependent cytotoxicity (CDC) and/or CIq binding and/or antibody
dependent cell mediated cytotoxicity (ADCC) and/or binding affinity
of the antibody for an Fc[gamma] receptor, preferably complement
dependent cytotoxicity (CDC) and/or antibody dependent cell
mediated cytotoxicity (ADCC). CDC, CIq binding, ADCC, and binding
affinity of the antibody for an Fc[gamma] receptor are measured by
standard in vitro assays, which are known in the art and
commercially available. Usually ADCC is measured by the lactate
dehydrogenase (LDH)-releasing assay as described e.g. in Example 4
of the present application and CDC is measure by the cell-based
assay described e.g. in Example 10 of the present application.
[0117] In one embodiment the amino acid modification which alters
the effector function compared to the parent antibody comprises an
amino acid substitution at amino acid position selected from the
group consisting of 269, 274, 276, 298, 324 and 334, preferably
selected from the group consisting of 269, 298 and 324, more
preferably 298 and/or 324, wherein the amino acid position of each
group member is indicated utilizing the numbering system set forth
in Kabat.
[0118] In a further embodiment the amino acid modification which
alters the effector function compared to the parent antibody
comprises an amino acid substitution selected from the group
consisting of E269D, K274Q, N276K, S298A, S324N, and K334R,
preferably selected from the group consisting of E269D, S298A and
S324N, more preferably S298A and/or S324N, wherein the amino acid
position of each group member is indicated utilizing the numbering
system set forth in Kabat.
[0119] In a further embodiment the amino acid modification which
alters the effector function compared to the parent antibody
comprises a combination of amino acid substitutions at amino acid
position selected from the group consisting of 269/274, 269/276,
269/298, 269/324, 269/334, 274/276, 274/298, 274/324, 274/334,
276/298, 276/324, 276/334, 298/324, 298/334, 324/334, 269/274/276,
269/274/298, 269/274/324, 269/274/334, 269/276/298, 269/276/324,
269/276/334, 269/298/324, 269/298/334, 274/276/298, 274/276/324,
274/276/334, 274/298/324, 274/298/334, 276/298/324, and
276/298/334, preferably selected from the group consisting of
274/276, 269/298, 298/324, 274/276/334, and 269/298/324, more
preferably selected from the group consisting of 298/324 and
269/298/324, wherein the amino acid position of each group member
is indicated utilizing the numbering system set forth in Kabat.
[0120] In a further embodiment the amino acid modification which
alters the effector function compared to the parent antibody
comprises a combination of amino acid substitutions selected from
the group consisting of E269D/K274Q, E269D/N276K, E269D/S298A,
E269D/S324N, E269D/K334R, K274Q/N276K, K274Q/S298A, K274Q/S324N,
K274Q/K334R, N276K/S298A, N276K/S324N, N276K/K334R, S298A/S324N,
S298A/K334R, S324N/K334R, E269D/K274Q/N276K, E269D/K274Q/S298A,
E269D/K274Q/S324N, E269D/K274Q/K334R, E269D/N276K/S298A,
E269D/N276K/S324N, E269D/N276K/K334R, E269D/S298A/S324N,
E269D/S298A/K334R, K274Q/N276K/S298A, K274Q/N276K/S324N,
K274Q/N276K/K334R, K274Q/S298A/S324N, K274Q/S298A/K334R,
N276K/S298A/S324N, and N276K/S298A/K334R, preferably selected from
the group consisting of K274Q/N276K, E269D/S298A, S298A/S324N,
K274Q/N276K/K334R, and E269D/S298A/S324N, more preferably selected
from the group consisting of S298A/S324N and E269D/S298A/S324N,
wherein the amino acid position of each group member is indicated
utilizing the numbering system set forth in Kabat.
[0121] Preferably the humanized anti-CD-19 antibody of the present
disclosure comprising the variant human IgG Fc region exhibits
improved CDC in an in vitro assay as described above compared to
the parent antibody. Exhibition of improved CDC as used herein
includes a) exhibition of enhanced CDC compared to the parent
antibody, i.e. the parent antibody already exhibits CDC which is
enhanced by the amino acid modification of the human IgG Fc region
and b) de novo exhibition of CDC compared to the parent antibody,
i.e. the parent antibody does not exhibit CDC, thus CDC has been
introduced de novo by the amino acid modification of the human IgG
Fc region.
[0122] In a further embodiment, variants of the human IgG Fc region
of the humanized anti-CD-19 antibody of the present invention which
exhibit improved CDC in an in vitro assay compared to the parent
antibody comprise an amino acid substitution or a combination of
amino acid substitutions at amino acid positions selected from the
group consisting of 324, 334, 274/276, 298/324, 274/276/334, and
269/298/324, preferably selected from the group consisting of 324,
334, 298/324, 274/276/334, and 269/298/324, more preferably
selected from the group consisting of 324, 298/324, and
269/298/324, wherein the amino acid position of each group member
is indicated utilizing the numbering system set forth in Kabat.
[0123] In a further embodiment, variants of the human IgG Fc region
of the humanized anti-CD-19 antibody of the present invention which
exhibit improved CDC in an in vitro assay compared to the parent
antibody comprise an amino acid substitution or a combination of
amino acid substitutions at amino acid positions selected from the
group consisting of S324N, K334R, K274Q/N276K, S298A/S324N,
K274Q/N276K/K334R, and E269D/S298A/S324N, preferably selected from
the group consisting of S324N, K334R, S298A/S324N,
K274Q/N276K/K334R, and E269D/S298A/S324N, more preferably selected
from the group consisting of S324N, S298A/S324N, and
E269D/S298A/S324N, wherein the amino acid position of each group
member is indicated utilizing the numbering system set forth in
Kabat.
[0124] In a further embodiment, variants of the human IgG Fc region
of the humanized anti-CD-19 antibody of the present invention which
exhibit improved ADCC in an in vitro assay compared to the parent
antibody comprise an amino acid substitution or a combination of
amino acid substitutions at amino acid position selected from the
group consisting of 269, 298, 269/298, 269/324, 298/324, and
269/298/324, preferably selected from the group consisting of 298,
269/298, 269/298/324, wherein the amino acid position of each group
member is indicated utilizing the numbering system set forth in
Kabat.
[0125] In a further embodiment, variants of the human IgG Fc region
of the humanized anti-CD-19 antibody of the present invention which
exhibit improved ADCC in an in vitro assay compared to the parent
antibody comprise an amino acid substitution or a combination of
amino acid substitutions at amino acid position selected from the
group consisting of E269D, S298A, E269D/S298A, E269D/S324N,
S298A/S324N, and E269D/S298A/S324N, preferably selected from the
group consisting of S298A, E269D/S298A, and E269D/S298A/S324N,
wherein the amino acid position of each group member is indicated
utilizing the numbering system set forth in Kabat.
[0126] Thus particular preferred humanized antibodies or fragments
thereof that binds to human CD19 and exhibit altered effector
function compared to the parent humanized antibody provided by the
present disclosure are humanized antibodies or fragments thereof
comprising a heavy chain sequence comprising the amino acid
sequence of SEQ ID NO: 114 (VH16 R94K/S298A) and a light chain
sequence comprising the amino acid sequence of SEQ ID NO: 65 (VL43
V3Q/T7S/P44I/N92A); a heavy chain sequence comprising the amino
acid sequence of SEQ ID NO: 115 (VH16 R94K/E269D/S298A) and a light
chain sequence comprising the amino acid sequence of SEQ ID NO: 65
(VL43 V3Q/T7S/P44I/N92A); a heavy chain sequence comprising the
amino acid sequence of SEQ ID NO: 116 (VH16 R94K/S298A/S324N) and a
light chain sequence comprising the amino acid sequence of SEQ ID
NO: 65 (VL43 V3Q/T7S/P44I/N92A); a heavy chain sequence comprising
the amino acid sequence of SEQ ID NO: 117 (VH16
R94K/E269D/S298A/S324N) and a light chain sequence comprising the
amino acid sequence of SEQ ID NO: 65 (VL43 V3Q/T7S/P44I/N92A); a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 118 (VH16 R94K/S324N) and a light chain sequence comprising the
amino acid sequence of SEQ ID NO: 65 (VL43 V3Q/T7S/P44I/N92A); a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 119 (VH16 R94K/K274Q) and a light chain sequence comprising the
amino acid sequence of SEQ ID NO: 65 (VL43 V3Q/T7S/P44I/N92A); a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 120 (VH16 R94K/N276K) and a light chain sequence comprising the
amino acid sequence of SEQ ID NO: 65 (VL43 V3Q/T7S/P44I/N92A); a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 121 (VH16 R94K/K334R) and a light chain sequence comprising the
amino acid sequence of SEQ ID NO: 65 (VL43 V3Q/T7S/P44I/N92A) a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 122 (VH16 R94K/K274Q/N276K) and a light chain sequence
comprising the amino acid sequence of SEQ ID NO: 65 (VL43
V3Q/T7S/P44I/N92A); or a heavy chain sequence comprising the amino
acid sequence of SEQ ID NO: 123 (VH16 R94K/K274Q/N276K/K334R) and a
light chain sequence comprising the amino acid sequence of SEQ ID
NO: 65 (VL43 V3Q/T7S/P44I/N92A).
[0127] The present disclosure further provides a humanized antibody
or fragment thereof that binds to human CD19, wherein the antibody
comprises a variant human IgG Fc region which comprises amino acid
substitution S324N replacing serine at amino acid position 324 of
the parent antibody with asparagine, whereas the antibody
comprising the variant human IgG Fc region exhibits improved
complement dependent cytotoxicity (CDC) compared to the parent
antibody. Preferably the antibody comprises a variant human IgG1 Fc
region. More preferred is a full length antibody comprising a
variant human IgG1 Fc region. It has surprisingly found that among
16 different amino acid substitutions at amino acid position 324
the substitution S324N significantly improves CDC compared to the
parent antibody whereas the other substitutions do not improve CDC
compared to the parent antibody as described in Example 10. Without
being bound by theory, this unexpected selective effect on CDC of
the S324N substitution seems to be due to an enhanced binding to
human complement component C1q.
[0128] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 which comprises a human
IgG Fc region, wherein the mature core carbohydrate structure
attached to the human IgG Fc region lacks fucose. Preferably the
antibody comprises a human IgG1 Fc region, wherein the mature core
carbohydrate structure attached to the human IgG1 Fc region lacks
fucose. More preferred is a full length antibody comprising a human
IgG1 Fc region, wherein the mature core carbohydrate structure
attached to the human IgG1 Fc region lacks fucose. It is known from
WO 2003/035835 that lack of fucose in the mature core carbohydrate
structure attached to the human IgG Fc region may enhance ADCC.
Thus in a further embodiment the humanized antibody or fragment
thereof of the present disclosure comprises a human IgG Fc region,
wherein the mature core carbohydrate structure attached to the
human IgG Fc region lacks fucose, whereas the antibody lacking
fucose exhibits enhanced ADCC compared to the parent humanized
antibody or fragment thereof not lacking fucose. A preferred
antibody or fragment thereof that binds to human CD19 comprising a
human IgG Fc region, wherein the mature core carbohydrate structure
attached to the human IgG Fc region lacks fucose, whereas the
antibody lacking fucose exhibits enhanced ADCC compared to the
parent humanized antibody or fragment thereof not lacking fucose is
the antibody comprising a heavy chain sequence comprising the amino
acid sequence of SEQ ID NO: 64, and a light chain sequence
comprising the amino acid sequence of SEQ ID NO: 65. Methods to
generate antibodies which lack fucose are, for example, (a) use of
an engineered or mutant host cell that is deficient in fucose
metabolism such that it has a reduced ability (or is unable to)
fucosylate proteins expressed therein; (b) culturing cells under
conditions which prevent or reduce fucosylation; (c)
post-translational removal of fucose (e.g. with a fucosidase
enzyme); (d) post-translational addition of the desired
carbohydrate, e.g. after recombinant expression of a
non-glycosylated glycoprotein; or (e) purification of the
glycoprotein so as to select for product which is not fucosylated.
Preferably used are methods described in Example 14, e,g. methods
described in Longmore et al. (1982), Carbohydr. Res. 365-92, or in
Imai-Nishiya et al. (2007), BMC Biotechnol. 7, 84.
Anti-CD19 Antibodies Properties
[0129] Standard assays to evaluate the binding ability of the
antibodies toward e.g. human CD19 are known in the art, including
for example, ELISAs, Western blots, R1As, and flow cytometry
analysis. Suitable assays are described in detail in the Examples.
The binding kinetics (e.g., binding affinity like K.sub.d) of the
antibodies also can be assessed by standard assays known in the
art, such as by Scatchard or Biacore.RTM. system analysis and can
be performed and calculated e.g. as described in Example 3. The
relative binding affinity K.sub.i can be assessed by standard
competion assay known in the art and can be performed and
calculated e.g. as described in Example 3. To assess binding, Raji
tumor cells (human Burkitt lymphoma, DSMZ ACC319), NALM-6 (human B
cell precursor leukemia, DSMZ AC128) or SU-DHL-6 (human B cell
lymphoma, DSMZ ACC572) can be used, preferably Raji tumor cells
such as human Burkitt lymphoma, DSMZ ACC319 or SU-DHL-6 (human B
cell lymphoma, DSMZ ACC572), more preferably Raji tumor cells such
as human Burkitt lymphoma, DSMZ ACC319 are used. Those cells can be
obtained from publicly available sources, such as the Deutsche
Sammlung von Mikroorganismen and Zellkulturen GmbH, Braunschweig,
Germany, and can be used in standard assays, such as flow
cytometric analysis. The corresponding chimeric antibody which can
be used in the assays of the present invention is usually a
chimeric version of murine antibody FMC63 which consists of the
FMC63 murine heavy variable domain fused to human IgG1 heavy
constant domains and the murine light variable domain fused to
kappa constant domain. The corresponding chimeric antibody which is
preferably used in the assays of the present invention is a
chimeric version of antibody FMC63 comprising a heavy chain
sequence comprising the amino acid sequence of SEQ ID NO: 68 and a
light chain sequence comprising the amino acid sequence of SEQ ID
NO: 69. The parental non-humanized antibody or corresponding
parental non-humanized antibody which can be used in the assays of
the present invention is usually a murine antibody, in particular
murine antibody FMC63.
[0130] The present disclosure also provides a humanized antibody or
fragment thereof that binds to Raji tumor cells with Mid-Point
Fluorescence (MPF) of at least 10% relative to the binding of the
corresponding chimeric antibody. Raji tumor cells do express CD19
on their surface to which the humanized antibody or fragment
thereof can bind. Values for Mid-Point Fluorescence can be obtained
from measurements of Mean Fluorescent Intensity (MFI) of cell
staining using flow cytometry versus antibody concentration.
Preferably the humanized antibody or fragment thereof binds to Raji
tumor cells with MPF of at least 30%, more preferably of at least
50%, most preferably of at least 70%, in particular of at least
80%, more particular of at least 90%, most particular of at least
95% relative to the binding of the corresponding chimeric antibody.
Raji tumor cells as described supra can be used for assessing
binding to CD19.
[0131] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 with an affinity
(K.sub.d) of 50 nM or less, in particular 40 nM or less, more
particular 30 nM or less, even more particular 20 nM or less, most
particular 15 nM or less. Raji tumor cells as described supra can
be used for assessing binding to human CD19.
[0132] The present disclosure also provides a humanized antibody or
fragment thereof that retains at least 20% of the CD19 binding
affinity (K.sub.d) of the corresponding chimeric antibody.
Preferably the humanized antibody or fragment thereof retains at
least 40%, more preferably at least 60%, most preferably at least
80%, in particular at least 90%, more particular at least 95% of
the CD19 binding affinity (K.sub.d) of the corresponding chimeric
antibody. Raji tumor cells or SU-DHL-6 cells as described supra can
be used for assessing binding to human CD19.
[0133] The present disclosure also provides a humanized antibody or
fragment that binds to human CD19 and competes for binding to Raji
tumor cells with an affinity (K.sub.i) of 50 nM or less, preferably
20 nM or less, more preferably 10 nM or less, most preferably 5 nM
or less, in particular 4 nM or less, more particular 3 nM or less,
most particular at least about 1.5 nM to about 5.0 nM (e.g. 1.9;
1.6 or 2.9 to about 2.6 or 4.9 nM). Binding competition is usually
measured against the corresponding chimeric antibody, whereas Raji
tumor cells as described supra can be used for assessing K.
[0134] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 and induces apoptosis in
Raji tumor cells. Induction of apoptosis in Raji tumor cells can be
measured by annexin-V and propidium iodine staining (Vermes et al.,
1995, J. Immunol. Methods. 184: 39-51). The induction of apoptosis
is a very surprising property displayed by the humanized antibodies
of the present invention in view of the fact that the corresponding
chimeric antibody has no effect on apoptosis. Raji tumor cells as
described supra can be used for assessing apoptosis. Thus the
present disclosure also provides a humanized antibody or fragment
thereof wherein apoptosis is induced in at least 10%, preferably in
at least 15%, more preferably in at least 20%, most preferably in
at least 25% of Raji tumor cells.
[0135] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 and induces ADCC activity
in Raji tumor cells. ADCC related specific lysis of target cells
such as Raji tumor cells as described supra can be assessed using
e.g. a lactate dehydrogenase release assay (CytoTox 96 Non
radioactive assay, Promega, Madison, USA). Surprisingly the
humanized antibody or fragment thereof that binds to human CD19
induces ADCC activity in Raji tumor cells equivalent or even
greater to induction of ADCC activity of the corresponding chimeric
antibody. Preferably the humanized antibody or binding fragment
thereof that binds CD19 has at least 80%, more preferably at least
100%, most preferably at least 120% of the ADCC activity of the
corresponding chimeric antibody.
[0136] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 and that inhibits
proliferation of malignant B-cells. Preferably, the humanized
antibody or fragment thereof retains at least 60%, more preferably
at least 80%, most preferably at least 90%, in particular 95%, more
particular 100% of the inhibition of the proliferation of malignant
B-cells of the corresponding chimeric antibody. To measure
inhibition of cell proliferation by antibodies, Raji tumor cells or
SU-DHL-6 cells as described supra can be used for assessing
proliferation of malignant B-cells.
[0137] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 and that inhibits
clonogenicity of Raji tumor cells. The inhibition of clonogenicity
is measured by counting the number of clones after treatment with
the antibody and can be carried out according to e.g. Nahimana et
al., 2009, Blood. 0: blood-2008-08-173369v1" (Blood, 2009, Vol.
113, No. 14, pp. 3276-3286). Raji tumor cells as described supra
can be used for assessing clonogenicity. The number of clones
counted after treatment with the humanized antibodies of the
invention is at least 30%, preferably at least 40%, more preferably
at least 50%, most preferably at least 60% less than the number of
clones counted after treatment with the corresponding chimeric
antibody. The inhibition of clonogenicity of Raji tumor cells
confirms the strong inhibitory function of the humanized antibodies
of the invention on B cell proliferation.
[0138] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 and that causes B-cell
depletion in blood. Preferably, the B cell depletion caused is at
least identical, preferably at least 1.5 times, more preferably at
least 2 times greater than the B cell depletion caused by the
corresponding chimeric antibody. B cell depletion can be assessed
by determining the % positive B cells in whole blood after
incubation with antibody as described in the Examples.
[0139] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 and that internalizes in
Raji tumor cells. The humanized antibody or fragment of the present
invention internalizes at a degree comparable to the degree of
internalization of the corresponding chimeric antibody. Preferably,
the internalization degree of the humanized antibody of the
invention used at 0.01 .mu.g/ml is between 50% and 150%, more
preferably between 60% and 140%, most preferably between 70% and
130% of the internalization degree of the corresponding chimeric
antibody. Antibody internalization can be assessed on Raji tumor
cells as described supra using e.g. a secondary anti-human antibody
conjugated to the toxin saporin (Hum-Zap, Advanced Targeting
Systems, San Diego, Calif., USA).
[0140] The present disclosure also provides a humanized antibody or
fragment thereof that binds to human CD19 which has a FAB fragment
thermostability temperature greater than 65.degree. C., preferably
greater than 70.degree. C., more preferably greater than 75.degree.
C., most preferably greater than 80.degree. C. For analysis of FAB
fragment thermostability differential scanning calorimetry
measurements are used, whereas a mid-point melting temperature of
the FAB fragment in context of a full-length IgG is identified.
These kind of calorimetric measurements are known to the skilled
person and can be carried out according to e.g. Garber and Demarest
(2007), BBRC 355:751-7. Surprisingly, it has been found that the
humanized antibody of the present invention has a FAB fragment
thermostability temperature equivalent to the corresponding
chimeric antibody. Thus the present disclosure also provides a
humanized antibody or fragment thereof that binds to human CD19
which has a FAB fragment thermostability temperature equivalent to
the FAB fragment thermostability temperature of the corresponding
chimeric antibody.
[0141] Nucleic Acids, Vectors and Host Cells
[0142] The present disclosure also provides isolated nucleic acids
encoding the humanized antibodies and fragments thereof that bind
to human CD19, vectors and host cells comprising the nucleic acid
or the vector. The nucleic acids may be present in whole cells, in
a cell lysate, or in a partially purified or substantially pure
form. A nucleic acid is "isolated" or "rendered substantially pure"
when purified away from other cellular components or other
contaminants, e.g., other cellular nucleic acids or proteins, by
standard techniques, including alkaline/SDS treatment, CsCl
banding, column chromatography, agarose gel electrophoresis and
others well known in the art, see e.g. F. Ausubel, et al, ed.
(1987) Current Protocols in Molecular Biology, Greene Publishing
and Wiley Interscience, New York. A nucleic acid of the invention
can be, for example, DNA or RNA and may or may not contain intronic
sequences. In a preferred embodiment, the nucleic acid is a cDNA
molecule.
[0143] Nucleic acids of the invention can be obtained using
standard molecular biology techniques e.g. cDNAs encoding the light
and heavy chains of the antibody or encoding VH and VL segments can
be obtained by standard PCR amplification or cDNA cloning
techniques. For antibodies obtained from an immunoglobulin gene
library (e.g., using phage display techniques), one or more nucleic
acids encoding the antibody can be recovered from the library. The
methods of introducing exogenous nucleic acid into host cells are
well known in the art, and will vary with the host cell used.
Techniques include but are not limited to dextran-mediated
transfection, calcium phosphate precipitation, calcium chloride
treatment, polybrene mediated transfection, protoplast fusion,
electroporation, viral or phage infection, encapsulation of the
polynucleotide(s) in liposomes, and direct microinjection of the
DNA into nuclei. In the case of mammalian cells, transfection may
be either transient or stable.
[0144] Preferred nucleic acids molecules of the invention are those
encoding the light chain variable region selected from the group
consisting of SEQ ID NOS: 25, 38, 39, 40, 48, 49, 50, 51, 52, 53,
56, 57, 58, 59, 60, 61, 62 and 63 and/or the heavy chain variable
region selected from the group consisting of SEQ ID NOS: 33, 34,
35, 36, 37, 43, 44, 45, 46, 47, 54 and 55. More preferred are
nucleic acids molecules encoding a heavy chain sequence comprising
the amino acid sequence of SEQ ID NO: 64, and a light chain
sequence comprising the amino acid sequence of SEQ ID NO: 65;
encoding a heavy chain sequence comprising the amino acid sequence
of SEQ ID NO: 66, and a light chain sequence comprising the amino
acid sequence of SEQ ID NO: 67; or encoding a heavy chain sequence
comprising the amino acid sequence of SEQ ID NO: 66, and a light
chain sequence comprising the amino acid sequence of SEQ ID NO: 65;
or encoding a heavy chain sequence comprising the amino acid
sequence of SEQ ID NO: 114, and a light chain sequence comprising
the amino acid sequence of SEQ ID NO: 65; or encoding a heavy chain
sequence comprising the amino acid sequence of SEQ ID NO: 115, and
a light chain sequence comprising the amino acid sequence of SEQ ID
NO: 65; or encoding a heavy chain sequence comprising the amino
acid sequence of SEQ ID NO: 116, and a light chain sequence
comprising the amino acid sequence of SEQ ID NO: 65; or encoding a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 117, and a light chain sequence comprising the amino acid
sequence of SEQ ID NO: 65; or encoding a heavy chain sequence
comprising the amino acid sequence of SEQ ID NO: 118, and a light
chain sequence comprising the amino acid sequence of SEQ ID NO: 65;
or encoding a heavy chain sequence comprising the amino acid
sequence of SEQ ID NO: 119, and a light chain sequence comprising
the amino acid sequence of SEQ ID NO: 65; or encoding a heavy chain
sequence comprising the amino acid sequence of SEQ ID NO: 120, and
a light chain sequence comprising the amino acid sequence of SEQ ID
NO: 65; or encoding a heavy chain sequence comprising the amino
acid sequence of SEQ ID NO: 121, and a light chain sequence
comprising the amino acid sequence of SEQ ID NO: 65; or encoding a
heavy chain sequence comprising the amino acid sequence of SEQ ID
NO: 122, and a light chain sequence comprising the amino acid
sequence of SEQ ID NO: 65; or encoding a heavy chain sequence
comprising the amino acid sequence of SEQ ID NO: 123, and a light
chain sequence comprising the amino acid sequence of SEQ ID NO: 65;
or encoding a heavy chain sequence comprising the amino acid
sequence of SEQ ID NO: 124, and a light chain sequence comprising
the amino acid sequence of SEQ ID NO: 65.
[0145] The present disclosure also provides an isolated nucleic
acid comprising the heavy chain encoding nucleic acid sequence of a
humanized FMC63 variant that binds to human CD19 as deposited in a
microorganism with DSMZ on Feb. 5, 2010, having accession No. DSM
23302. The heavy chain encoded by the deposited nucleic acid
sequence of a humanized FMC63 variant that binds to human CD19
comprises a heavy chain CDR1 comprising the amino acid sequence of
SEQ ID NO: 27, a heavy chain CDR2 comprising the amino acid
sequence of SEQ ID NO: 28, and a heavy chain CDR3 comprising the
amino acid sequence of SEQ ID NO: 29.
[0146] The present disclosure also provides an isolated nucleic
acid comprising the light chain encoding nucleic acid sequence of a
humanized FMC63 variant that binds to human CD19 as deposited in a
microorganism with DSMZ on Feb. 5, 2010, having accession No. DSM
23303. The light chain encoded by the deposited nucleic acid
sequence of a humanized FMC63 variant that binds to human CD19
comprises a light chain CDR1 comprising the amino acid sequence of
SEQ ID NO: 30, a light chain CDR2 comprising the amino acid
sequence of SEQ ID NO: 31, and a light chain CDR3 comprising the
amino acid sequence of SEQ ID NO: 32.
[0147] Thus the present disclosure also provides a humanized
antibody or fragment thereof that binds to human CD19 encoded by
the isolated nucleic acid comprising the heavy chain encoding
nucleic acid sequence of a humanized FMC63 variant that binds to
human CD19 as deposited in a microorganism with DSMZ on Feb. 5,
2010, having accession No. DSM 23302 and the isolated nucleic acid
comprising the light chain encoding nucleic acid sequence of a
humanized FMC63 variant that binds to human CD19 as deposited in a
microorganism with DSMZ on Feb. 5, 2010, having accession No. DSM
23303.
[0148] In one embodiment the humanized antibody or fragment thereof
that binds to human CD19 encoded by the isolated nucleic acid
comprising the heavy chain encoding nucleic acid sequence of a
humanized FMC63 variant that binds to human CD19 as deposited in a
microorganism with DSMZ on Feb. 5, 2010, having accession No. DSM
23302 comprises a variant human IgG Fc region, preferably a variant
human IgG1 Fc region, which comprises an amino acid substitution at
amino acid position selected from the group consisting of 269, 274,
276, 298, 324 and 334, preferably selected from the group
consisting of 269, 298 and 324, more preferably 298 and/or 324,
wherein the amino acid position of each group member is indicated
utilizing the numbering system set forth in Kabat.
[0149] Once DNA fragments encoding VH and VL segments are obtained,
these DNA fragments can be further manipulated by standard
recombinant DNA techniques, for example to convert the variable
region genes to full-length antibody chain genes, or to fragments
genes corresponding to the fragments described supra like Fab
fragment genes or to a scFv gene. In these manipulations, a VL- or
VH-encoding DNA fragment is operatively linked to another DNA
fragment encoding another protein, such as an antibody constant
region or a flexible linker. The term "operatively linked", as used
in this context, is intended to mean that the two DNA fragments are
joined such that the amino acid sequences encoded by the two DNA
fragments remain in-frame. The isolated DNA encoding the VH region
can be converted to a full-length heavy chain gene by operatively
linking the VH-encoding DNA to another DNA molecule encoding heavy
chain constant regions (CH1, CH2 and CH3). The sequences of human
heavy chain constant region genes are known in the art (see e.g.,
Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological
Interest, Fifth Edition, U.S. Department of Health and Human
Services, NIH Publication No. 91-3242) and DNA fragments
encompassing these regions can be obtained by standard PCR
amplification. The heavy chain constant region can be an IgG1,
IgG2, IgG3, IgG4, IgA, IgE, IgM or IgD constant region, but most
preferably is an IgG1 constant region. For a Fab fragment heavy
chain gene, the V[pi]-encoding DNA can be operatively linked to
another DNA molecule encoding only the heavy chain CH1 constant
region. The isolated DNA encoding the VL region can be converted to
a full-length light chain gene (as well as a Fab light chain gene)
by operatively linking the VL-encoding DNA to another DNA molecule
encoding the light chain constant region, CL. The sequences of
human light chain constant region genes are known in the art (see
e.g., Kabat, E. A., et al. (1991) Sequences of Proteins of
Immunological Interest, Fifth Edition, U.S. Department of Health
and Human Services, NIH Publication No. 91-3242) and DNA fragments
encompassing these regions can be obtained by standard PCR
amplification. In preferred embodiments, the light chain constant
region can be a kappa or lambda constant region, preferably a kappa
constant region. To create a scFv gene, the VH- and VL-encoding DNA
fragments are operatively linked to another fragment encoding a
flexible linker, e.g., encoding the amino acid sequence
(GIy4-Ser).sub.3, such that the VH and VL sequences can be
expressed as a contiguous single-chain protein, with the VL and VH
regions joined by the flexible linker (see e.g., Bird et al. (1988)
Science 242:423-426; Huston et al. (1988) Proc. Natl. Acad. ScL USA
85:5879-5883; McCafferty et al, (1990) Nature 348:552-554). Various
techniques have been developed for the production of antibody
fragments of humanized antibodies. Traditionally, these fragments
were derived via proteolytic digestion of intact antibodies (see,
e.g., Morimoto et al., Journal of Biochemical and Biophysical
Methods, 24:107-117 (1992); and Brennan et al., Science, 229:81
(1985)). However, these fragments can now be produced directly by
recombinant host cells. For example, the antibody fragments can be
isolated from the antibody phage libraries discussed above.
Alternatively, Fab'-SH fragments can be directly recovered from E.
coli and chemically coupled to form F(ab').sub.2 fragments (Carter
et al., Bio/Technology, 10: 163-167 (1992)). According to another
approach, F(ab')2 fragments can be isolated directly from
recombinant host cell culture. Other techniques for the production
of antibody fragments will be apparent to the skilled practitioner.
In other embodiments, the antibody of choice is a single-chain Fv
fragment (scFv), see e.g. WO 1993/16185; U.S. Pat. No. 5,571,894;
and U.S. Pat. No. 5,587,458. The antibody fragment may also be a
"linear antibody", e.g., as described in U.S. Pat. No. 5,641,870,
for example.
[0150] The nucleic acids that encode the antibodies of the present
invention may be incorporated into an expression vector in order to
express the protein. A variety of expression vectors may be
utilized for protein expression. Expression vectors may comprise
self-replicating extra-chromosomal vectors or vectors which
integrate into a host genome. Expression vectors are constructed to
be compatible with the host cell type. Thus expression vectors
which find use in the present invention include but are not limited
to those which enable protein expression in mammalian cells,
bacteria, insect cells, yeast, and in in vitro systems. As is known
in the art, a variety of expression vectors are available,
commercially or otherwise, that may find use in the present
invention for expressing antibodies.
[0151] Expression vectors typically comprise a protein operably
linked with control or regulatory sequences, selectable markers,
any fusion partners, and/or additional elements. By "operably
linked" herein is meant that the nucleic acid is placed into a
functional relationship with another nucleic acid sequence. The
term "regulatory sequence" is intended to include promoters,
enhancers and other expression control elements (e.g.,
polyadenylation signals) that control the transcription or
translation of the antibody chain genes. Such regulatory sequences
are described, for example, in Goeddel (Gene Expression Technology,
Methods in Enzymology 185, Academic Press, San Diego, Calif.
(1990)). Generally, these expression vectors include
transcriptional and translational regulatory nucleic acid operably
linked to the nucleic acid encoding the antibody, and are typically
appropriate to the host cell used to express the protein. In
general, the transcriptional and translational regulatory sequences
may include promoter sequences, ribosomal binding sites,
transcriptional start and stop sequences, translational start and
stop sequences, and enhancer or activator sequences. As is also
known in the art, expression vectors typically contain a selection
gene or marker to allow the selection of transformed host cells
containing the expression vector. Selection genes are well known in
the art and will vary with the host cell used. For example,
typically the selectable marker gene confers resistance to drugs,
such as G418, hygromycin or methotrexate, on a host cell into which
the vector has been introduced. Preferred selectable marker genes
include the dihydrofolate reductase (DHFR) gene (for use in
dhfr-host cells with methotrexate selection/amplification) and the
neo gene (for G418 selection).
[0152] Suitable host cells for cloning or expressing the DNA in the
vectors herein are prokaryote, yeast, or higher eukaryote cells.
Suitable prokaryotes for this purpose include eubacteria, including
gram-negative or gram-positive organisms, for example,
Enterobacteriaceae such as Escherichia, e.g., E. coli,
Enterobacter, Klebsiella, Proteus, Salmonella, e.g., Salmonella
typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as
well as Bacilli such as B. subtilis and B. licheniformis,
Pseudomonas such as P. aeruginosa, and Streptomyces. Suitable E.
coli cloning hosts include E. coli 294 (ATCC 31,446), E. coli B, E.
coli X1776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325).
[0153] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression
hosts. Saccharomyces cerevisiae, or common baker's yeast, is the
most commonly used among lower eukaryotic host microorganisms.
However, a number of other genera, species, and strains are
commonly available and useful, such as Schizosaccharoriyces pombe;
Kluyveromyces hosts including K. lactis, K. fragilis (ATCC 12,424),
K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. WaItH
(AJCC 56,500), K. drosopmarum (ATCC 36,906), K. thermotolerans, or
K. marxianusyarrowia (EP 402226); Pichia pastoris (EP 183,070);
Candida; Trichoderma reesia (EP 244234); Neurospora crassa;
Schwanniomyces such as Schwanniomyces occidentalis; and filamentous
fungi including Neurospora, Penicillium, Tolypocladium, or
Aspergillus hosts such as A. nidulans or A. niger.
[0154] Suitable host cells for the expression of the humanized
antibodies of the invention are derived from multicellular
organisms. Examples of invertebrate cells include plaril and insect
cells. Numerous baculoviral strains and variants and corresponding
permissive insect host cells from hosts such as Spodoptera
frugiperda (caterpillar), Aedes augypti (mosquito), Aedes
albopictus (mosquito), Drosophila melanogaster (fruitfly), and
Bombyx mori have been identified. A variety of viral strains for
transfection are publicly available, for example, the L-1 variant
of Autographa californica NPV and the Bm-5 strain of Bombyx mori
NPV, and such viruses may be used, particularly for transfection of
Spodoptera frugiperda cells. Plant cell cultures of cotton, corn,
potato, soybean, petunia, tomato, and tobacco can also be utilized
as hosts.
[0155] Host cells for expressing the recombinant antibodies of the
invention are preferably mammalian host cells which include Chinese
Hamster Ovary (CHO cells) (including dhfr<-> CHO cells,
described in Urlaub and Chasin, (1980) Proc. Natl. Acad. ScL USA
77:4216-4220, used with a DHFR selectable marker, e.g., as
described in R. J. Kaufman and P. A. Sharp (1982) J. MoI. Biol
159:601-621), NSO myeloma cells, COS cells and SP2 cells. In
particular, for use with NSO myeloma cells, another preferred
expression system is the GS gene expression system disclosed in WO
87/04462 (to Wilson), WO 89/01036 (to Bebbington) and EP 338841 (to
Bebbington). When recombinant antibody genes are introduced into
mammalian host cells, the antibodies are produced by culturing the
host cells for a period of time sufficient to allow for expression
of the antibody in the host cells or, more preferably, for
secretion of the antibody into the culture medium in which the host
cells are grown. Host cells useful for producing antibodies that
bind to human CD19 may be cultured in a variety of media.
Commercially available media such as Ham's F10 (Sigma), Minimal
Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma or Chemie
Brunschwig AG, PAA, Basel, Switzerland), and Dulbecco's Modified
Eagle's Medium ((DMEM), Sigma) are suitable for culturing the host
cells. Antibodies can be recovered from the culture medium using
standard protein purification methods.
[0156] Antibodies may be operably linked to a fusion partner to
enable targeting of the expressed protein, purification, screening,
display, and the like. Fusion partners may be linked to the
antibody sequence via a linker sequences. The linker sequence will
generally comprise a small number of amino acids, typically less
than ten, although longer linkers may also be used. Typically,
linker sequences are selected to be flexible and resistant to
degradation. As will be appreciated by those skilled in the art,
any of a wide variety of sequences may be used as linkers. For
example, a common linker sequence comprises the amino acid sequence
GGGGS (SEQ ID NO: 126).
[0157] A fusion partner may be a targeting or signal sequence that
directs antibody and any associated fusion partners to a desired
cellular location or to the extracellular media. As is known in the
art, certain signaling sequences may target a protein to be either
secreted into the growth media, or into the periplasmic space,
located between the inner and outer membrane of the cell. A fusion
partner may also be a sequence that encodes a peptide or protein
that enables purification and/or screening. Such fusion partners
include but are not limited to polyhistidine tags (His-tags) (for
example H6 and H10 or other tags for use with Immobilized Metal
Affinity Chromatography (IMAC) systems (e.g. Ni<+2> affinity
columns)), GST fusions, MBP fusions, Strep-tag, the BSP
biotinylation target sequence of the bacterial enzyme BirA, and
epitope tags which are targeted by antibodies (for example c-myc
tags, flag-tags, and the like). As will be appreciated by those
skilled in the art, such tags may be useful for purification, for
screening, or both.
Construction and Production of Antibodies
[0158] Antibodies can be produced by recombinant DNA techniques
known to the skilled person. In additional antibodies can be
produced by enzymatic or chemical cleavage of naturally occurring
antibodies. Humanized antibodies of the present invention may be
constructed by transferring one or more CDRs or portions thereof
from VH and/or VL regions from a non-human animal (e.g., mouse) to
one or more framework regions from human VH and/or VL regions.
Optionally, human framework residues thus present in the VH and/or
VL regions may be replaced by corresponding non-human (e.g., mouse)
residues when needed or desired for decreasing immunogenicity of
the antibody and/or maintaining binding affinity.
[0159] Optionally, non-human amino acid residues present in the
CDRs may be replaced with human residues. Chimeric or humanized
antibodies of the present invention can be prepared based on the
sequence of a non-human monoclonal antibody prepared as described
above. DNA encoding the heavy and light chain immunoglobulins can
be obtained from the non-human hybridoma of interest and engineered
to contain non-murine (e.g., human) immunoglobulin sequences using
standard molecular biology techniques. For example, to create a
chimeric antibody, murine variable regions can be linked to human
constant regions using methods known in the art (see e.g., U.S.
Pat. No. 4,816,567 to Cabilly et al). To create a humanized
antibody, murine CDR regions can be inserted into a human framework
using methods known in the art (see e.g., U.S. Pat. No. 5,225,539
to Winter, and U.S. Pat. Nos. 5,530,101; 5,585,089; 5,693,762 and
6,180,370 to Queen et al).
[0160] Humanized antibodies of the present invention may be
constructed wherein the human acceptor molecule for the heavy chain
variable region is selected based on homology considerations
between potential acceptor molecule variable regions and the heavy
chain variable region of the murine antibody. Germline candidate
human acceptor molecules are preferred to reduce potential
immunogenicity. Germline databases are made up of antibody
sequences that read through the end of the heavy chain FW3 region
and partially into the CDR3 sequence. For selection of a FW4
region, databases of mature antibody sequences which have been
derived from the selected germline molecule can be searched or
antibody sequences which have been derived from the selected
germline molecule from a human donor can be used. Human acceptor
molecules are preferably selected from the same heavy chain class
as the murine donor molecule, and of the same canonical structural
class of the variable region of the murine donor molecule.
Secondary considerations for selection of the human acceptor
molecule for the heavy chain variable region elude homology in CDR
length between the murine donor molecule and the human acceptor
molecule. Human acceptor antibody molecules are preferably selected
by homology search to the V-BASE database, although other databases
such as the Kabat and the public NCBI databases may be used as
well.
[0161] Humanized antibodies of the present invention may be
constructed wherein the human acceptor molecule for the light chain
variable region is selected based on homology considerations
between potential acceptor molecule variable regions and with the
light chain variable region of the murine antibody. Germline
candidate human acceptor molecules are preferred to reduce
potential immunogenicity. Germline databases are made up of
antibody sequences that read through the end of the heavy chain FW3
region and partially into the CDR3 sequence. For selection of a FW4
region, databases of mature antibody sequences which have been
derived from the selected germline molecule can be searched or
antibody sequences which have been derived from the selected
germline molecule from a human donor can be used. Human acceptor
molecules are preferably selected from the same light chain class
as the murine donor molecule, and of the same canonical structural
class of the variable region of the murine donor molecule.
Secondary considerations for selection of the human acceptor
molecule for the light chain variable region include homology in
CDR length between the murine donor molecule and the human acceptor
molecule. Human acceptor antibody molecules are preferably selected
by homology searches to the V-BASE database, and other databases
such as the Kabat and the public NCBI databases may be used as
well.
[0162] Methods for humanizing a nonhuman antibody are described
herein, including in the Examples below.
[0163] The present invention provides a method of producing a
humanized antibody or fragment thereof that binds to human CD19
comprising culturing a host cell comprising an isolated nucleic
acid encoding the humanized antibody or fragment thereof that binds
to human CD19 or a vector comprising an isolated nucleic acid
encoding the humanized antibody or fragment thereof that binds to
human CD19 so that the nucleic acid is expressed and the antibody
produced. Preferably the antibody is isolated.
[0164] As host cells, nucleic acids and vectors, the ones described
supra can be used. Expression of the nucleic acids can be obtained
by, for example, a combination of recombinant DNA techniques and
gene transfection methods as is well known in the art (e.g.,
Morrison, S. (1985) Science 229:1202) and as further outlined
supra. For example, to express the antibodies, or antibody
fragments thereof, DNAs encoding partial or full-length light and
heavy chains, can be obtained by standard molecular biology
techniques (e.g., PCR amplification or cDNA cloning using a
hybridoma that expresses the antibody of interest) and the DNAs can
be inserted into vectors such as expression vectors. The expression
vector and expression control sequences are chosen to be compatible
with the expression host cell used.
[0165] The antibody light chain gene and the antibody heavy chain
gene can be inserted into separate vector or, more typically, both
genes are inserted into the same expression vector. The antibody
genes are inserted into the expression vector by standard methods
(e.g., ligation of complementary restriction sites on the antibody
gene fragment and vector, or blunt end ligation if no restriction
sites are present). The light and heavy chain variable regions of
the antibodies described herein can be used to create full-length
antibody genes of any antibody isotype by inserting them into
expression vectors already encoding heavy chain constant and light
chain constant regions of the desired isotype such that the VH
segment is operatively linked to the CH segment(s) within the
vector and the VK segment is operatively linked to the CL segment
within the vector.
Characterization and Purification of Anti-CD19 Antibodies.
[0166] Antibodies of the invention can be tested for binding to
human CD19 by, for example, standard ELISA or by binding to Raji
tumor cells. Antibodies of the present invention may be isolated or
purified in a variety of ways known to those skilled in the art.
Standard purification methods include chromatographic techniques,
including ion exchange, hydrophobic interaction, affinity, sizing
or gel filtration, and reversed-phase, carried out at atmospheric
pressure or at high pressure using systems such as FPLC and HPLC.
Purification methods also include electrophoretic, immunological,
precipitation, dialysis, and chromatofocusing techniques.
Ultrafiltration and diafiltration techniques, in conjunction with
protein concentration, are also useful. To purify anti-CD19
antibodies, selected host cells can be grown in e.g spinner-flasks
for monoclonal antibody purification. Supernatants can be filtered
and concentrated before affinity chromatography with protein
A-sepharose (Pharmacia, Piscataway, N.J.). Eluted IgG can be
checked by gel electrophoresis and high performance liquid
chromatography to ensure purity.
Immunoconjugates
[0167] In another aspect, the present invention provides a
humanized anti-CD19 antibody or a fragment thereof that binds to
human CD19, linked to a therapeutic agent, such as a cytotoxin, a
drug (e.g., an immunosuppressant) or a radiotoxin. Such conjugates
are referred to herein as "immunoconjugates" Immunoconjugates that
include one or more cytotoxins are referred to as "immunotoxins." A
cytotoxin or cytotoxic agent includes any agent that is detrimental
to (e.g., kills) cells. Examples include taxol, cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, and puromycin and analogs or
homologs thereof. Therapeutic agents also include, for example,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine). Other examples of therapeutic
cytotoxins that can be linked to an antibody of the invention
include duocarmycins, calicheamicins, maytansines and auristatins,
and derivatives thereof. An example of a calicheamicin antibody
conjugate is commercially available (Mylotarg.RTM.; American Home
Products). Cytotoxins can be linked to antibodies of the invention
using linker technology available in the art. Examples of linker
types that have been used to conjugate a cytotoxin to an antibody
include, but are not limited to, hydrazones, thioethers, esters,
disulfides and peptide-containing linkers. A linker can be chosen
that is, for example, susceptible to cleavage by low pH within the
lysosomal compartment or susceptible to cleavage by proteases, such
as proteases preferentially expressed in tumor tissue such as
cathepsins (e.g., cathepsins B, C, D). For further discussion of
types of cytotoxins, linkers and methods for conjugating
therapeutic agents to antibodies, see also Saito, G. et al. (2003)
Adv. Drug Deliv. Rev. 55: 199-215; Trail, P. A. et al. (2003)
Cancer Immunol. Immunother. 52: 328-337; Payne, G. (2003) Cancer
Cell 3:207-212; Allen, T. M. (2002) Nat. Rev. Cancer 2:750-763;
Pastan, I. and Kreitman, R. J. (2002) Curr. Opin. Investig. Drugs
3: 1089-1091; Senter, P. D. and Springer, C J. (2001) Adv. Drug
Deliv. Rev. 53: 247-264. Antibodies of the present invention also
can be linked to a radioactive isotope to generate cytotoxic
radiopharmaceuticals, also referred to as radioimmunoconjugates.
Examples of radioactive isotopes that can be conjugated to
antibodies for use diagnostically or therapeutically include, but
are not limited to, iodine<131>, indium<111>,
yttrium<90> and lutetium<177>. Methods for preparing
radioimmunconjugates are established in the art. Examples of
radioimmunoconjugates are commercially available, including
Zevalin.RTM. (EDEC Pharmaceuticals) and Bexxar.RTM. (Corixa
Pharmaceuticals), and similar methods can be used to prepare
radioimmunoconjugates using the antibodies of the invention. The
antibody immunoconjugates of the invention can be used to modify a
given biological response, and the drug moiety is not to be
construed as limited to classical chemical therapeutic agents. For
example, the drug moiety may be a protein or polypeptide possessing
a desired biological activity. Such proteins may include, for
example, an enzymatically active toxin, or active fragment thereof,
such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin;
a protein such as tumor necrosis factor or interferon-[gamma]; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
[0168] Techniques for linking such therapeutic agents to antibodies
are well known, see, e.g., Arnon et al, "Monoclonal Antibodies For
Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal
Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56
(Alan R. Liss, Inc. 1985); Hellstrom et al, "Antibodies For Drug
Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al.
(eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody
Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in
Monoclonal Antibodies '84: Biological And Clinical Applications,
Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And
Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody
In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection
And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press
1985), and Thorpe et al, Immunol. Rev., 62: 119-58 (1982).
Pharmaceutical Compositions
[0169] In another aspect, the present invention provides a
composition, e.g., a pharmaceutical composition, comprising the
humanized antibody or fragment thereof, of the present invention,
and a pharmaceutically acceptable carrier. Such compositions may
include one or a combination of (e.g., two or more different)
antibodies or immunoconjugates of the invention. For example, a
pharmaceutical composition of the invention can comprise a
combination of antibodies (or immunoconjugates) that bind to
different epitopes on the target antigen or that have complementary
activities. Pharmaceutical compositions of the invention also can
be administered in combination therapy, i.e., combined with other
agents. For example, the combination therapy can include an
anti-CD19 antibody of the present invention combined with at least
one other anti-inflammatory or immunosuppressant agent.
[0170] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like that are physiologically compatible.
Preferably, the carrier is suitable for intravenous, intramuscular,
subcutaneous, parenteral, spinal or epidermal administration (e.g.,
by injection or infusion). Depending on the route of
administration, the active compound, i.e., antibody or
immunoconjugate, may be coated in a material to protect the
compound from the action of acids and other natural conditions that
may inactivate the compound. Pharmaceutically acceptable carriers
include sterile aqueous solutions or dispersions and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersion. The use of such media and agents for
pharmaceutically active substances is known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the pharmaceutical compositions of
the invention is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0171] In another aspect, the present invention provides a
composition comprising an immunoconjugate comprising the humanized
antibody or fragment thereof that binds to human CD19 linked to a
therapeutic agent and a pharmaceutically acceptable carrier.
Immunoconjugates and therapeutic agents which can be used are as
described supra.
[0172] A pharmaceutical composition of the invention may also
include a pharmaceutically acceptable antioxidant. Examples of
pharmaceutically acceptable antioxidants include: (1) water soluble
antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium
bisulfate, sodium metabisulfite, sodium sulfite and the like; (2)
oil-soluble antioxidants, such as ascorbyl palmitate, butylated
hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin,
propyl gallate, alpha-tocopherol, and the like; and (3) metal
chelating agents, such as citric acid, ethylenediamine
tetraacetic-acid (EDTA), sorbitol, tartaric acid, phosphoric acid,
and the like. Examples of suitable aqueous and nonaqueous carriers
that may be employed in the pharmaceutical compositions of the
invention include water, ethanol, polyols (such as glycerol,
propylene glycol, polyethylene glycol, and the like), and suitable
mixtures thereof, vegetable oils, such as olive oil, and injectable
organic esters, such as ethyl oleate. Proper fluidity can be
maintained, for example, by the use of coating materials, such as
lecithin, by the maintenance of the required particle size in the
case of dispersions, and by the use of surfactants. These
compositions may also contain adjuvants such as preservatives,
wetting agents, emulsifying agents and dispersing agents.
Prevention of presence of microorganisms may be ensured both by
sterilization procedures, supra, and by the inclusion of various
antibacterial and antifungal agents, for example, paraben,
chlorobutanol, phenol sorbic acid, and the like. It may also be
desirable to include isotonic agents, such as sugars, sodium
chloride, and the like into the compositions. In addition,
prolonged absorption of the injectable pharmaceutical form may be
brought about by the inclusion of agents which delay absorption
such as aluminum monostearate and gelatin.
Therapeutic and Other Uses
[0173] The humanized antibodies of the present invention have
numerous in vitro and in vivo diagnostic and therapeutic utilities
involving the diagnosis and treatment of CD19 mediated disorders.
For example, these molecules can be administered to cells in
culture, in vitro or ex vivo, or to human subjects, e.g., in vivo,
to treat, prevent and to diagnose a variety of CD19-mediated
disorders. Preferred subjects are human and include patients having
disorders mediated by CD19 activity (CD19 mediated disorders). The
methods are particularly suitable for treating human patients
having a CD19-mediated disorder associated with aberrant B cell
populations.
[0174] A "patient" for the purposes of the present invention
includes both humans and other animals, preferably mammals and most
preferably humans. Thus the antibodies of the present invention
have both human therapy and veterinary applications. The term
"treatment" or "treating" in the present invention is meant to
include therapeutic treatment, as well as prophylactic, or
suppressive measures for a disease or disorder. Thus, for example,
successful administration of an antibody prior to onset of the
disease results in treatment of the disease.
[0175] As another example, successful administration of an antibody
after clinical manifestation of the disease to combat the symptoms
of the disease comprises treatment of the disease. "Treatment" and
"treating" also encompasses administration of an antibody after the
appearance of the disease in order to eradicate the disease.
Successful administration of an antibody after onset and after
clinical symptoms have developed, with possible abatement of
clinical symptoms and perhaps amelioration of the disease,
comprises treatment of the disease.
[0176] Those "in need of treatment" include mammals already having
the disease or disorder, as well as those prone to having the
disease or disorder, including those in which the disease or
disorder is to be prevented.
[0177] In a particular embodiment, the humanized antibodies are
used in vivo to treat, prevent or diagnose a variety of
CD19-mediated diseases. Thus the invention provides a method for
treating a CD19 mediated disorder in a subject, the method
comprising administering to the subject a therapeutically effective
amount of the humanized antibody or fragment thereof. Exemplary
CD19 mediated disorders include autoimmune disorder including
rheumatoid arthritis, cancer, non-Hodgkin's lymphoma, acute
lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL),
hairy cell leukemia, Burkitt's lymphoma, anaplastic large-cell
lymphomas (ALCL), cutaneous T-cell lymphomas, nodular small
cleaved-cell lymphomas, peripheral T-cell lymphomas, Lennert's
lymphomas, immunoblastic lymphomas, T-cell leukemia/lymphomas
(ATLL), adult T-cell leukemia (T-ALL), entroblastic/centrocytic
(cb/cc) follicular lymphomas cancers, diffuse large cell lymphomas
of B lineage, angioimmunoblastic lymphadenopathy (AILD)-like T cell
lymphoma, HIV associated body cavity based lymphomas, Embryonal
Carcinomas, undifferentiated carcinomas of the rhino-pharynx (e.g.,
Schmincke's tumor), Castleman's disease, Kaposi's Sarcoma, Multiple
Myeloma, Waldenstrom's macroglobulinemia, anti-CD20 antibody
resistant B-cell cancers and other B-cell lymphomas and leukemias.
Anti-CD20 antibody resistant B-cell cancers are e.g. rituximab
(Rituxan.RTM.) resistant B-cell cancers, which is the preferred
anti-CD20 antibody resistant B-cell cancer. Preferred cancers are
hematologic cancers, especially cancers relating to lymphomas and
leukemias expressing CD19, in particular non-Hodgkin's lymphoma,
acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia
(CLL), and hairy cell leukemia. Preferred CD19 mediated disorders
to be treated with the antibody of the invention are selected from
the group consisting of non-Hodgkin's lymphoma, acute lymphocytic
leukemia (ALL), chronic lymphocytic leukemia (CLL), hairy cell
leukemia, rheumatoid arthritis, systemic lupus erythematosus (SLE),
and anti-CD20 antibody resistant B-cell cancers. More preferred
CD19 mediated disorders to be treated with the antibody of the
invention are rheumatoid arthritis, non-Hodgkin's lymphoma or
anti-CD20 antibody resistant B-cell cancers.
[0178] "Autoimmune disorders" include allogenic islet graft
rejection, alopecia areata, ankylosing spondylitis,
antiphospholipid syndrome, autoimmune Addison's disease,
antineutrophil cytoplasmic autoantibodies (ANCA), autoimmune
diseases of the adrenal gland, autoimmune hemolytic anemia,
autoimmune hepatitis, autoimmune myocarditis, autoimmune
neutropenia, autoimmune oophoritis and orchitis, autoimmune
thrombocytopenia, autoimmune urticaria, Behcet's disease, bullous
pemphigoid, cardiomyopathy, Castleman's syndrome, celiac
spruce-dermatitis, chronic fatigue immune disfunction syndrome,
chronic inflammatory demyelinating polyneuropathy, Churg-Strauss
syndrome, cicatrical pemphigoid, CREST syndrome, cold agglutinin
disease, Crohn's disease, dermatomyositis, discoid lupus, essential
mixed cryoglobulinemia, factor VIII deficiency,
fibromyalgia-fibromyositis, glomerulonephritis, Grave's disease,
Guillain-Barre, Goodpasture's syndrome, graft-versus-host disease
(GVHD), Hashimoto's thyroiditis, hemophilia A, idiopathic pulmonary
fibrosis, idiopathic thrombocytopenia purpura (ITP), IgA
neuropathy, IgM polyneuropathies, immune mediated thrombocytopenia,
juvenile arthritis, Kawasaki's disease, lichen planrus, lupus
erthematosis, Meniere's disease, mixed connective tissue disease,
multiple sclerosis (MS), type 1 diabetes mellitus, myasthenia
gravis, pemphigus vulgaris, pernicious anemia, polyarteritis
nodosa, polychondritis, polyglandular syndromes, polymyalgia
rheumatica, polymyositis and dermatomyositis, primary
agammaglobinulinemia, primary biliary cirrhosis, psoriasis,
psoriatic arthritis, Reynauld's phenomenon, Reiter's syndrome,
rheumatoid arthritis (RA), sarcoidosis, scleroderma, Sjogren's
syndrome, solid organ transplant rejection, stiff-man syndrome,
systemic lupus erythematosus (SLE), takayasu arteritis, temporal
arteristis/giant cell arteritis, thrombotic thrombocytopenia
purpura, ulcerative colitis, uveitis, vasculitides such as
dermatitis herpetiformis vasculitis, vitiligo, anti-neutrophil
cytoplasmic antibody associated vasculitis, graft vs. host disease,
cryoglobulinemia, IgM mediated neuropathy, neuromyelitis optica,
idiopathic membranous nephropathy, opsoclonus myoclonus, and
Wegner's granulomatosis.
[0179] Furthermore, given the expression of CD19 on various tumor
cells and given the fact that the humanized antibody or fragment
thereof of the present invention inhibits proliferation of
malignant B-cells expressing CD19 as mentioned supra, the CD19
mediated disease is preferably a tumorigenic disorder like cancer,
e.g., a disorder characterized by the presence of tumor cells
expressing CD19 including, for example, non-Hodgkin's lymphoma
(NHL), acute lymphocytic leukemia (ALL), chronic lymphocytic
leukemia (CLL), hairy cell leukemia Burkitt's lymphoma, anaplastic
large-cell lymphomas (ALCL), multiple myeloma, cutaneous T-cell
lymphomas, nodular small cleaved-cell lymphomas, lymphocytic
lymphomas, peripheral T-cell lymphomas, Lennert's lympho mas,
immunoblastic lymphomas, T-cell leukemia/lymphomas (ATLL), adult
T-cell leukemia (T-ALL), entroblastic/centrocytic (cb/cc)
follicular lymphomas cancers, diffuse large cell lymphomas of B
lineage, angioimmunoblastic lymphadenopathy (AILD)-like T cell
lymphoma, HIV associated body cavity based lymphomas, Embryonal
Carcinomas, undifferentiated carcinomas of the rhino-pharynx (e.g.,
Schmincke's tumor), Castleman's disease, Kaposi's Sarcoma, Multiple
Myeloma, Waldenstrom's macroglobulinemia, anti-CD20 antibody
resistant B-cell cancers and other B-cell lymphomas and
leukemias.
[0180] Thus in a further aspect the present invention provides a
method of inhibiting growth of tumor cells expressing CD19,
comprising contacting the cells with the humanized antibody or
fragment thereof of the invention, in an amount effective to
inhibit growth of tumor cells. Tumor cells are typically selected
from human Burkitt lymphoma cells, human B cell precursor leukemia
cells, human B cell leukemia cells or human B-cell lymphoma cells,
preferably human Burkitt lymphoma cells or human B-cell lymphoma
cells.
[0181] Given the fact that the humanized antibody or fragment
thereof of the present invention causes B-cell depletion in blood,
the present invention further provides a method of depleting B
cells in a subject comprising administering to the subject the
humanized antibody or fragment thereof of the invention in an
amount effective to deplete B cells from the subject.
[0182] In one embodiment, the antibodies of the invention can be
used to detect levels of CD19, or levels of cells which contain
CD19 on their membrane surface, which levels can then be linked to
certain disease symptoms. Alternatively, the antibodies can be used
to inhibit or block CD19 function which, in turn, can be linked to
the prevention or amelioration of certain disease symptoms, thereby
implicating CD19 as a mediator of the disease. This can be achieved
by contacting a sample and a control sample with the anti-CD19
antibody under conditions that allow for the formation of a complex
between the antibody and CD19. Any complexes formed between the
antibody and CD19 are detected and compared in the sample and the
control. In light of the specific binding of the antibodies of the
invention for CD19, the antibodies of the invention can be used to
specifically detect CD19 expression on the surface of cells and,
moreover, can be used to purify CD19 via immunoaffinity
purification.
[0183] In another embodiment, the antibodies of the invention can
be initially tested for binding activity associated with
therapeutic or diagnostic use in vitro. For example, compositions
of the invention can be tested using the flow cytometric assays
described in the Examples below.
[0184] The present disclosure further provides the use of a
humanized antibody or fragment thereof as a medicament and the use
of a humanized antibody or fragment thereof in the preparation of a
medicament for the treatment of a CD19 mediated disorder. In a
further embodiment the present disclosure provides the humanized
antibody or fragment thereof for use as a medicament. Also provided
by the present disclosure is the humanized antibody or fragment
thereof for use in a method for treating a CD19 mediated disorder.
CD19 mediated disorders are the ones as described supra.
[0185] As previously described, human anti-CD19 antibodies of the
invention can be co-administered with one or other more therapeutic
agents, e.g., a cytotoxic agent, a radiotoxic agent or an
immunosuppressive agent. The antibody can be linked to the agent
(as an immunocomplex) or can be administered separate from the
agent. In the latter case (separate administration), the antibody
can be administered before, after or concurrently with the agent or
can be co-administered with other known therapies, e.g., an
anti-cancer therapy, e.g., radiation.
[0186] For administration of the antibody, the dosage ranges from
about 0.0001 to 100 mg/kg, and more usually 0.01 to 10 mg/kg, of
the host body weight. An exemplary treatment regime entails
administration once per week, once every two weeks, once every
three weeks, once every four weeks, once a month, once every 3
months or once every three to 6 months.
[0187] The antibody is usually administered on multiple occasions.
Intervals between single dosages can be, for example, weekly,
monthly, every three months or yearly. Intervals can also be
irregular as indicated by measuring blood levels of antibody to the
target antigen in the patient. In some methods, dosage is adjusted
to achieve a plasma antibody concentration of about 1-1000 .mu.g/ml
and in some methods about 25-300 .mu.g/ml. Alternatively, antibody
can be administered as a sustained release formulation, in which
case less frequent administration is required. Dosage and frequency
vary depending on the half-life of the antibody in the patient. The
dosage and frequency of administration can vary depending on
whether the treatment is prophylactic or therapeutic. In
prophylactic applications, a relatively low dosage is administered
at relatively infrequent intervals over a long period of time. Some
patients continue to receive treatment for the rest of their lives.
In therapeutic applications, a relatively high dosage at relatively
short intervals is sometimes required until progression of the
disease is reduced or terminated.
[0188] Actual dosage levels of the active ingredients, i.e. the
antibody in the pharmaceutical compositions of the present
invention may be varied so as to obtain an amount of the active
ingredient which is effective to achieve the desired therapeutic
response for a particular patient, composition, and mode of
administration, without being toxic to the patient.
[0189] The selected dosage level will depend upon a variety of
pharmacokinetic factors including the activity of the particular
compositions of the present invention employed, the route of
administration, the time of administration, the rate of excretion
of the particular antibody being employed, the duration of the
treatment, other drugs, compounds and/or materials used in
combination with the particular compositions employed, the age,
sex, weight, condition, general health and prior medical history of
the patient being treated, and like factors well known in the
medical arts.
[0190] A "therapeutically effective amount" of an anti-CD19
antibody of the invention preferably results in a decrease in
severity of disease symptoms, an increase in frequency and duration
of disease symptom-free periods, and/or a prevention of impairment
or disability due to the disease affliction. For example, for the
treatment of a tumorogenic disorder (CD19<+> tumors), a
"therapeutically effective amount" preferably inhibits cell growth
or tumor growth by at least about 20%, more preferably by at least
about 40%, even more preferably by at least about 60%, and still
more preferably by at least about 80% relative to untreated
subjects. The ability of a compound to inhibit tumor growth can be
evaluated in an animal model system predictive of efficacy in human
tumors. Alternatively, this property of a composition can be
evaluated by examining the ability of the compound to inhibit cell
growth, such inhibition can be measured in vitro by assays known to
the skilled practitioner. A therapeutically effective amount of a
therapeutic compound can decrease tumor size, or otherwise
ameliorate symptoms in a subject. One of ordinary skill in the art
would be able to determine such amounts based on such factors as
the subject's size, the severity of the subject's symptoms, and the
particular composition or route of administration selected.
[0191] The antibody or the composition of the present invention can
be administered via one or more routes of administration using one
or more of a variety of methods known in the art. As will be
appreciated by the skilled artisan, the route and/or mode of
administration will vary depending upon the desired results.
Preferred routes of administration include intravenous,
intramuscular, intradermal, intraperitoneal, subcutaneous, spinal
or other parenteral routes of administration, for example by
injection or infusion. More preferred routes of administration are
intravenous or subcutaneous. The phrase "parenteral administration"
as used herein means modes of administration other than enteral and
topical administration, usually by injection, and includes, without
limitation, intravenous, intramuscular, intraarterial, intrathecal,
intracapsular, intraorbital, intracardiac, intradermal,
intraperitoneal, transtracheal, subcutaneous, subcuticular,
intraarticular, subcapsular, subarachnoid, intraspinal, epidural
and intrasternal injection and infusion. Alternatively, an antibody
of the invention can be administered via a non-parenteral route,
such as a topical, epidermal or mucosal route of administration,
for example, intranasally, orally, vaginally, rectally,
sublingually or topically.
Article of Manufacture and Kit
[0192] In another embodiment of the disclosure, an article of
manufacture comprising the humanized antibody or fragment thereof,
the composition or the immunoconjugate of the invention for the
treatment of a CD19 mediated disorder is provided. The article of
manufacture may comprise a container and a label or package insert
on or associated with the container. Suitable containers include,
for example, bottles, vials or syringes. The containers may be
formed from a variety of materials such as glass or plastic. The
container holds a composition that may be effective for treating
the condition and may have a sterile access port (e.g., the
container may be an intravenous solution bag or a vial having a
stopper pierceable by a hypodermic injection needle). At least one
active agent in the composition may be the humanized antibody
described herein. The label or package insert may indicate that the
composition may be used for treating the condition of choice, such
as cancer. In one embodiment, the label or package insert may
indicate that the composition comprising the humanized antibody may
be used to treat a CD19-mediated disorder.
[0193] Moreover, the article of manufacture may comprise (a) a
first container with a composition contained therein, wherein the
composition comprises the humanized antibody herein, and (b) a
second container with a composition contained therein, wherein the
composition comprises a therapeutic agent other than the humanized
antibody. The article of manufacture in this embodiment of the
disclosure may further comprise a package insert indicating that
the first and second compositions can be used in combination to
treat a CD19 mediated disease or disorder. Such therapeutic agent
may be any of the adjunct therapies described in the preceding
section (e.g., a thrombolytic agent, an anti-platelet agent, a
chemotherapeutic agent, an anti-angiogenic agent, an anti-hormonal
compound, a cardioprotectant, and/or a regulator of immune function
in a mammal, including a cytokine).
[0194] Alternatively, or additionally, the article of manufacture
may further comprise a second (or third) container comprising a
pharmaceutically acceptable buffer, such as bacteriostatic water
for injection (BWFI), phosphate-buffered saline, Ringer's solution
and dextrose solution. It may further include other materials
desirable from a commercial and user standpoint, including other
buffers, diluents, filters, needles, and syringes.
[0195] Also within the scope of the present invention are kits
comprising the antibody, the compositions or the immunoconjugates
of the invention and instructions for use. The kit can further
contain one ore more additional reagents, such as an
immunosuppressive reagent, a cytotoxic agent or a radiotoxic agent,
or one or more additional humanized antibodies of the invention
(e.g., a humanized antibody having a complementary activity which
binds to an epitope in the CD 19 antigen distinct from the first
humanized antibody).
Deposit of Material:
[0196] The following materials have been deposited with the
Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ),
Inhoffenstr. 7 B, 38124 Braunschweig, Germany:
[0197] Microorganism (E. coli) deposited with DSMZ on Feb. 5, 2010,
having accession No. DSM 23303, comprising isolated nucleic acid
comprising the light chain encoding nucleic acid sequence of
humanized FMC63 variant that binds to human CD19 as described in
Example 1. Microorganism (E. coli) deposited with DSMZ on Feb. 5,
2010, having accession No. DSM 23302, which comprises isolated
nucleic acid comprising the heavy chain encoding nucleic acid
sequence of humanized FMC63 variant that binds to human CD19 as
described in Example 1. These deposits were made under the
provisions of the Budapest Treaty on the International Recognition
of the Deposit of Microorganisms for the Purpose of Patent
Procedure and the Regulations thereunder (Budapest Treaty).
[0198] Without further description, it is believed that one of
ordinary skill in the art may, using the preceding description and
the following illustrative examples, make and utilize the agents of
the present disclosure and practice the claimed methods. The
following working examples are provided to facilitate the practice
of the present disclosure, and are not to be construed as limiting
in any way the remainder of the disclosure.
EXAMPLES
Example 1
Humanization of Mouse Monoclonal FMC63 Antibody Against Human
CD19
[0199] Humanizing the anti-human CD19 murine antibody FMC63
including selection of human acceptor frameworks, back mutations,
and mutations that substantially retain and/or improve the binding
properties of human CDR-grafted acceptor frameworks is described
herein.
[0200] FMC63 is a murine IgG2a, kappa antibody isolated from mice
immunized with the human prolymphocytic leukaemia cell line JVM3
(Zola H. et al (1991), Immunol Cell Biol., 69:411-22.), and for
which variable regions are known and publicly available (Heavy
chain NCBI accession number, CAA74659 (SEQ ID NO: 1); Light chain
NCBI accession number, CAA74660 (SEQ ID NO: 2)). Methods for
assaying antigen-binding affinity are well known in the art and
include half-maximal binding assays, competition assays, and
Scatchard plot analysis.
Design of the Reshaped Variable Regions
[0201] Selection of human acceptor frameworks: Homology matching
was used to choose human acceptor frameworks to graft FMC63 CDRs.
Databases (e.g. a database of germline variable genes from the
immunoglobulin loci of human and mouse, VBASE2 (Retter I. et al,
2005, Nucleic Acids Res., 33, Database issue D671-D674), or the
Kabat database (Johnson G. et al, 2000, Nucleic Acids Res., 28, p
214-218)) or publications (e.g., Kabat et al, Sequences of Proteins
of Immunological Interest, 1992) may be used to identify the human
subfamilies to which the murine heavy and light chain V regions
belong and determine the best-fit human germline framework to use
as the acceptor molecule. Selection of VH and VL sequences within
these subfamilies to be used as acceptor may be based upon sequence
homology and/or a match of structure of the CDR1 and CDR2 regions
to help preserve the appropriate relative presentation of the six
CDRs after grafting.
[0202] For example, use of the VBASE2 database indicates that the
kappa light chain of FMC63 is of the kappa one subfamily given that
good homology was identified between the FMC63 VL framework and the
members of the human kappa subfamily I. The highest homology and
identity of both CDRs and framework sequences is observed for four
germline sequences: IGKV1-5*03 (VBASE2 ID humIGKV087) (SEQ ID
NO:3), IGKV1-27*01 (VBASE2 ID humIGKV106) (SEQ ID NO:4),
IGKV1-39*01 (VBASE2 ID humIGKV115) (SEQ ID NO:5), and IGKV1-12*01
(VBASE2 ID humIGKV094) (SEQ ID NO:6); which have a sequence
identity of 70.4%, 75%, 76.1%, and 72.7% respectively for the whole
sequence up to CDR3 and a sequence identity of 74.3%, 78.6%, 78.6%,
and 77.1% respectively for frameworks regions. Since complete LCDR3
and framework 4 regions are not included in VBASE2, best matching
JK segment sequences to human acceptor framework were identified by
analysis of complementary DNA (cDNA) prepared from healthy donor
B-cell mRNA, which were subsequently amplified using a degenerate
primer and immunoglobulin light chain first constant domain from
kappa isotype as shown in Table 1. Using this approach, best
matching sequences from amplifications were: SEQ ID NO: 7, SEQ ID
NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 for IGKV1-5*03 (SEQ ID NO:
3), IGKV1-27*01 (SEQ ID NO: 4), IGKV1-39*01 (SEQ ID NO: 5), and
IGKV1-12*01 (SEQ ID NO: 6) respectively.
TABLE-US-00001 TABLE 1 Forward Primer Sequence Reverse Primer
Sequence (5'.fwdarw.3') (5'.fwdarw.3') GATCGGATCCACTGGTGATATTGTGAT
GATCGCGGCCGCACACTCTCCCCTGTT GACYCAGWCTCC GAAGCTCTT (SEQ ID NO: 70)
(SEQ ID NO: 71) Germline Amplified variable region Primers variable
region Hum IGHV 199 SEQ ID NO: 72 pAE18 VH-3a clone#2 (SEQ ID NO:
11) SEQ ID NO: 73 (SEQ ID NO: 15) Hum IGHV 175 SEQ ID NO: 72 pAE18
VH-3a clone#5 (SEQ ID NO: 12) SEQ ID NO: 73 (SEQ ID NO: 16) Hum
IGHV 195 SEQ ID NO: 113 pAE18 VH-1b clone#16 (SEQ ID NO: 13) SEQ ID
NO: 73 (SEQ ID NO: 17) Hum IGHV 031 SEQ ID NO: 113 pAE18 VH-1b
clone#20 (SEQ ID NO: 14) SEQ ID NO: 73 (SEQ ID NO: 18)
[0203] Similarly, use of VBASE2 indicates that the VH sequence of
FMC63 through to framework three falls in the human VH subfamily
III. Within the human VH subfamily III, FMC63 shows the highest
sequence homology with IGHV3-33*01 (VBASE2-ID: humIGHV199) (SEQ ID
NO: 11), IGHV3-11*01 (VBASE2-ID: humIGHV175) (SEQ ID NO: 12),
IGHV3-30*18 (VBASE2-ID: humIGHV195) (SEQ ID NO: 13), and
IGHV3-48*01 (VBASE2-ID: humIGHV031) (SEQ ID NO: 14), which exhibit
sequence homology above 70.4% for framework and CDR regions. As for
the light chain, a source to identify compatible JH segments is
cDNAs prepared from healthy donor B-cell mRNA amplified with
degenerate primers and IgM heavy chain first constant domain (Table
2). The following sequences: SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID
NO: 17, and SEQ ID NO: 18 were closest to IGHV3-33*01 (VBASE2-ID:
humIGHV199) (SEQ ID NO: 11), IGHV3-11*01 (VBASE2-ID: humIGHV175)
(SEQ ID NO: 12), IGHV3-30*03 (VBASE2-ID: humIGHV195) (SEQ ID NO:
13), and IGHV3-48*01 (VBASE2-ID: humIGHV031) (SEQ ID NO: 14)
respectively.
TABLE-US-00002 TABLE 2 Forward Primer Sequence Reverse Sequence
(5'.fwdarw.3') (5'.fwdarw.3') GATCGGATCCACTGGTGAGGTGCAGCTGGT
GATCGCGGCCGCTGGAAGAGGCACGTT GGAGTC CTTTTCTTT (SEQ ID NO: 72) (SEQ
ID NO: 73) GATCGGATCCACTGGTCAGGTYCAGCTKGT GCAGTCTGG (SEQ ID NO:
113) Germline Amplified variable region Primers variable region Hum
IGHV 199 SEQ ID NO: 72 pAE18 VH-3a clone#2 (SEQ ID NO: 11) SEQ ID
NO: 73 (SEQ ID NO: 15) Hum IGHV 175 SEQ ID NO: 72 pAE18 VH-3a
clone#5 (SEQ ID NO: 12) SEQ ID NO: 73 (SEQ ID NO: 16) Hum IGHV 195
SEQ ID NO: 113 pAE18 VH-1b clone#16 (SEQ ID NO: 13) SEQ ID NO: 73
(SEQ ID NO: 17) Hum IGHV 031 SEQ ID NO: 113 pAE18 VH-1b clone#20
(SEQ ID NO: 14) SEQ ID NO: 73 (SEQ ID NO: 18)
Making Initial CDR Grafted Human Variable Regions
[0204] Human VH and VL fragments prepared above were used to
initiate humanization process. cDNAs were used as templates for CDR
grafting using overlap PCR assembly to provide first humanized
candidates based on the following heavy and light chains: VH2 (SEQ
ID NO: 19), VH5 (SEQ ID NO: 20), VH16 (SEQ ID NO: 21), VH20 (SEQ ID
NO: 22), VL39 (SEQ ID NO: 23), VL40 (SEQ ID NO: 24), VL43 (SEQ ID
NO: 25), and VL44 (SEQ ID NO: 26), in which original CDRs have been
replaced with FMC63 CDRs as shown in Table 3.
TABLE-US-00003 TABLE 3 FMC63 CDR regions. Heavy chain Light chain
SEQ SEQ Amino-acid ID Amino-acid ID sequence NO: sequence NO: CDR1
GVSLPDYGVS 27 RASQDISKYLN 30 CDR2 VIWGSETTYYNSALKS 28 HTSRLHS 31
CDR3 HYYYGGSYAMDY 29 QQGNTLPYT 32
[0205] VH2, VH5, VH16 and VH20 heavy chains were based on cDNA
encoding SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID
NO: 18, respectively, with CDRs exchanged for FMC63 CDRs using a
four-fragment assembly PCR strategy as described in Tables 4, and
5. A similar strategy was used for VL39, VL40, VL43, and VL44 as
shown in Tables 6, and 7.
[0206] For heavy chains, products of PCR-amplifications described
in Table 4, were subcloned by running a secondary PCR using adaptor
primers (sense primer, HindIII VJ2C (SEQ ID NO: 93); and anti-sense
primer, SalI adaptor (SEQ ID NO: 92)) to append a SalI site at the
3' end of the variable domain cDNA (see below). Amplifications
described in Table 6 allow direct Kappa chains cloning into a
mammalian cell expression vector (described below). In this
instance, products contained variable as well as full-length
constant kappa domain and were cloned in a mammalian cell
expression vector using a BamHI and NotI site strategy.
TABLE-US-00004 TABLE 4 Summary of templates and primers used to
construct 1st CDR-grafted heavy chain variable regions. Fragment 1
Fragment 2 Fragment 3 Fragment 4 Construct Template PCR primers PCR
primers PCR primers PCR primers VH2/FMC63 pAE18 VH-3a CMV-IE VH2
mCDR1 VH2 mCDR2 VH2 mCDR3 grafted clone#2 Forward linker Forward
linker Forward linker Forward (SEQ ID (SEQ ID NO: (SEQ ID NO: (SEQ
ID NO: (SEQ ID NO: (SEQ ID NO: NO: 19) 15) 74) 77) 79) 81) and and
and and VH2 mCDR1 VH2 mCDR2 VH2 mCDR3 BGH linker Reverse linker
Reverse linker Reverse Reverse (SEQ ID NO: (SEQ ID NO: (SEQ ID NO:
(SEQ ID NO: 76) 78) 80) 75) VH5/FMC63 pAE18 VH-3a CMV-IE VH5 mCDR1
VH5 mCDR2 VH5 mCDR3 grafted clone#5 Forward linker Forward linker
Forward linker Forward (SEQ ID (SEQ ID NO: (SEQ ID NO: (SEQ ID NO:
(SEQ ID NO: (SEQ ID NO: NO: 20) 16) 74) 83) 84) 86) and and and and
VH5 mCDR1 VH20 mCDR2 VH5 mCDR3 BGH linker Reverse linker Reverse
linker Reverse Reverse (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID
NO: 82) 89) 85) 75) VH16/FMC63 pAE18 VH-1b CMV-IE VH2 mCDR1 VH2
mCDR2 VH2 mCDR3 grafted clone#16 Forward linker Forward linker
Forward linker Forward (SEQ ID (SEQ ID NO: (SEQ ID NO: (SEQ ID NO:
(SEQ ID NO: (SEQ ID NO: NO: 21) 17) 74) 77) 79) 81) and and and and
VH5 mCDR1 VH2 mCDR2 VH16 mCDR3 BGH Reverse linker Reverse linker
Reverse linker (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: Reverse 75) 82)
78) (SEQ ID NO: 87) VH20/FMC63 pAE18 VH-1b CMV-IE VH2 mCDR1 VH20
mCDR2 VH2 mCDR3 grafted clone#20 Forward linker Forward linker
linker (SEQ ID (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: Forward Forward
NO: 22) 18) 74) 77) (SEQ ID NO: (SEQ ID NO: and and 90) 81) VH20
mCDR1 VH20 mCDR2 and and linker linker VH20 mCDR3 BGH Reverse
Reverse linker Reverse (SEQ ID NO: (SEQ ID NO: Reverse (SEQ ID NO:
88) 89) (SEQ ID NO: 75) 91)
TABLE-US-00005 TABLE 5 Sequences of primers used to construct
selected human heavy chain 1st CDR-grafted variable regions. Primer
Sequence (5'.fwdarw.3') CMV-IE CGC AAA TGG GCG GTA GGC GTG Forward
(SEQ ID NO: 74) BGH TAG AAG GCA CAG TCG AGG Reverse (SEQ ID NO: 75)
VH2 mCDR1 linker GCT CAC GCC GTA GTC GGG CAG GCT CAC GCC AGA CGC
TGC ACA Reverse GGA GAG TCT C (SEQ ID NO: 76) VH2 mCDR1 linker GGC
GTG AGC CTG CCC GAC TAC GGC GTG AGC TGG GTC CGC CAG GCT Forward CCA
GG (SEQ ID NO: 77) VH2 mCDR2 linker GGC GCT GTT GTA GTA GGT TGT CTC
GGA GCC CCA GAT CAC TGC CAC Reverse CCA CTC CAG CCC CTT G (SEQ ID
NO: 78) VH2 mCDR2 linker GGC TCC GAG ACA ACC TAC TAC AAC AGC GCC
CTG AAG AGC CGA Forward TTC ACC ATC TCC AGA GAC AAT TCC (SEQ ID NO:
79) VH2 mCDR3 linker CAT GGC GTA GCT GCC GCC GTA GTA GTA GTG TGT
GGT ACA GTA Reverse ATA CAC GGC (SEQ ID NO: 80) VH2 mCDR3 linker
CAC TAC TAC TAC GGC GGC AGC TAC GCC ATG GAC TAC TGG GGC Forward CAG
GGA ACC CTG (SEQ ID NO: 81) VH5 mCDR1 linker GCT CAC GCC GTA GTC
GGG CAG GCT CAC GCC AGA GGC TGC ACA Reverse GGA GAG TCT C' (SEQ ID
NO: 82) VH5 mCDR1 linker GGC GTG AGC CTG CCC GAC TAC GGC GTG AGC
TGG ATC CGC CAG GCT Forward CCA GGG (SEQ ID NO: 83) VH5 mCDR2
linker GGC TCC GAG ACA ACC TAC TAC AAC AGC GCC CTG AAG AGC CGA
Forward TTC ACC ATC TCC AGG GAC AAC GCC (SEQ ID NO: 84) VH5 mCDR3
linker GTA GTC CAT GGC GTA GCT GCC GCC GTA GTA GTA GTG CCC CGC
Reverse ACA GTA ATA AAC GGC (SEQ ID NO: 85) VH5 mCDR3 linker CAC
TAC TAC TAC GGC GGC AGC TAC GCC ATG GAC TAC TGG GGC CAG Forward GGA
ACC CTG GTC ACC (SEQ ID NO: 86) VH16 mCDR3 linker CAT GGC GTA GCT
GCC GCC GTA GTA GTA GTG TCT CGC ACA GTA ATA Reverse CAC GGC (SEQ ID
NO: 87) VH20 mCDR1 linker GCT CAC GCC GTA GTC GGG CAG GCT CAC GCC
AGA GGC TAC ACA Reverse GGA GAG TCT C (SEQ ID NO: 88) VH20 mCDR2
linker GGC GCT GTT GTA GTA GGT TGT CTC GGA GCC CCA GAT CAC TGA
Reverse AAC CCA CTC CAG CCC CTT C (SEQ ID NO: 89) VH20 mCDR2 linker
GGC TCC GAG ACA ACC TAC TAC AAC AGC GCC CTG AAG AGC CGA Forward TTC
ACC ATC TCC AGA GAC AAC GCC (SEQ ID NO: 90) VH20 mCDR3 linker CAT
GGC GTA GCT GCC GCC GTA GTA GTA GTG TCT CGC ACA GTA Reverse ATA CAC
AGC (SEQ ID NO: 91) SalI adaptor GATC GTCGAC GC TGA GGA GAC GGT GAC
CAG GG (SEQ ID NO: 92) HindIII VJ2C
GATCAAGCTTGCCGCCACCATGGAGACAGACACACTC Forward (SEQ ID NO: 93)
TABLE-US-00006 TABLE 6 Summary of templates and primers used to
construct 1st CDR-grafted light chain variable regions. Fragment 1
Fragment 2 Fragment 3 Fragment 4 Construct Template PCR primers PCR
primers PCR primers PCR primers VL39/FMC63 pAE18 VL-2a CMV-IE VL43
mCDR1 VL39 mCDR2 VL39 mCDR3 grafted clone#39 (SEQ ID NO: linker
linker Forward linker (SEQ ID NO: (SEQ ID NO: 74) Forward (SEQ ID
NO: Forward 23) 7) and (SEQ ID NO: 94) (SEQ ID NO: VL43 mCDR1 102)
and 96) linker Reverse and VL39 mCDR3 and (SEQ ID NO: VL43 mCDR2
linker Reverse NotI Kappa 101) linker (SEQ ID NO: Reverse Reverse
95) (SEQ ID NO: (SEQ ID NO: 112) 103) VL40/FMC63 pAE18 VL-2a CMV-IE
VL43 mCDR1 VL40 mCDR2 VL40 mCDR3 grafted clone#40 (SEQ ID NO:
linker Forward linker Forward linker Forward (SEQ ID NO: (SEQ ID
NO: 74) (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 24) 8) and 102) 98)
100) VL43 mCDR1 and and and linker Reverse VL40 mCDR2 VL40 mCDR3
NotI Kappa (SEQ ID NO: linker Reverse linker Reverse Reverse 101)
(SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 97) 99) 112) VL43/FMC63 pAE18
VL-2a CMV-IE VL43 mCDR1 VL43 mCDR2 VL43 mCDR3 grafted clone#43 (SEQ
ID NO: linker Forward linker Forward linker Forward (SEQ ID NO:
(SEQ ID NO: 74) (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 25) 9) and 102)
104) 106) VL43 mCDR1 and and and linker Reverse VL43 mCDR2 VL43
mCDR3 NotI Kappa (SEQ ID NO: linker Reverse linker Reverse Reverse
101) (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 103) 105) 112) VL44/FMC63
pAE18 VL-2a CMV-IE VL43 mCDR1 VL44 mCDR2 VL44 mCDR3 grafted
clone#44 (SEQ ID NO: linker Forward linker Forward linker Forward
(SEQ ID NO: (SEQ ID NO: 74) (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 26)
10) and 102) 109) 111) VL44 mCDR1 and and and linker Reverse VL44
mCDR2 VL44 mCDR3 NotI Kappa (SEQ ID NO: linker Reverse linker
Reverse Reverse 107) (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 108) 110)
112)
TABLE-US-00007 TABLE 7 Sequences of primers used to construct
selected human light chain 1st CDR - grafted variable regions.
Primer Sequence (5'.fwdarw.3') VL39 mCDR2 linker CAC ACC AGC CGG
CTG CAC AGC GGG GTC CCA TCA AGG TTC AGC GGC Forward (SEQ ID NO: 94)
VL39 mCDR3 linker GGT GTA GGG CAG TGT GTT GCC TTG CTG GCA GTA ATA
AGT TGC AAA Reverse ATC ATC (SEQ ID NO: 95) VL39 mCDR3 linker CAG
CAA GGC AAC ACA CTG CCC TAC ACC TTC GGC CAA GGG ACC AAG Forward GTG
G (SEQ ID NO: 96) VL40 mCDR2 linker GCT GTG CAG CCG GCT GGT GTG ATA
GAT CAG GAG GTT AGG AAC Reverse (SEQ ID NO: 97) VL40 mCDR2 linker
CAC ACC AGC CGG CTG CAC AGC GGG GTC CCA TCT CGG TTC AGC GGC Forward
(SEQ ID NO: 98) VL40 mCDR3 linker GGT GTA GGG CAG TGT GTT GCC TTG
CTG ACA GTA ATA AGT TGC AAA Reverse ATC TTC (SEQ ID NO: 99) VL40
mCDR3 linker CAG CAA GGC AAC ACA CTG CCC TAC ACC TTC GGC GGA GGG
ACC AAG Forward GTG (SEQ ID NO: 100) VL43 mCDR1 linker GTT CAG GTA
CTT GCT GAT GTC CTG GCT GGC CCG GCA AGT GAT GGT Reverse GAC TCT GTC
TCC (SEQ ID NO: 101) VL43 mCDR1 linker CGG GCC AGC CAG GAC ATC AGC
AAG TAC CTG AAC TGG TAT CAG CAG Forward AAA CCA GGG (SEQ ID NO:
102) VL43 mCDR2 linker GCT GTG CAG CCG GCT GGT GTG ATA GAT CAG GAG
CTT AGG GGC Reverse (SEQ ID NO: 103) VL43 mCDR2 linker CAC ACC AGC
CGG CTG CAC AGC GGG GTC CCA TCA AGG TTC AGT GGC Forward (SEQ ID NO:
104) VL43 mCDR3 linker GGT GTA GGG CAG TGT GTT GCC TTG CTG ACA GTA
GTA AGT TGC AAA Reverse ATC TTC (SEQ ID NO: 105) VL43 mCDR3 linker
CAG CAA GGC AAC ACA CTG CCC TAC ACC TTC GGC CCT GGG ACC AAA Forward
GTG G (SEQ ID NO: 106) VL44 mCDR1 linker GTT CAG GTA CTT GCT GAT
GTC CTG GCT GGC CCG ACA AGT GAT GGT Reverse GAC TCT GTC TCC (SEQ ID
NO: 107) VL44 mCDR2 linker GCT GTG CAG CCG GCT GGT GTG ATA GAT CAG
GAG GTT AGG GGC Reverse (SEQ ID NO: 108) VL44 mCDR2 linker CAC ACC
AGC CGG CTG CAC AGC GGG GTC CCA TCA AGG TTC AGC GGC Forward (SEQ ID
NO: 109) VL44 mCDR3 linker GGT GTA GGG CAG TGT GTT GCC TTG CTG ACA
ATA ATA AGT TGC AAA Reverse ATC TTC (SEQ ID NO: 110) VL44 mCDR3
linker CAG CAA GGC AAC ACA CTG CCC TAC ACC TTT GGC CAG GGG ACC AAG
Forward TTG G (SEQ ID NO: 111) NotI Kappa GATC GCGGCCGC TTA TCA ACA
CTC TCC CCT GTT GAA GC Reverse (SEQ ID NO: 112)
[0207] Engineered heavy and light chains coding DNA sequences were
ligated in independent vectors that are based on a modified pREP4
(Invitrogen, CA, USA) vector carrying CMV promoter and Bovine
Growth Hormone poly-adenylation signal. Light chain specific vector
allows expression of Kappa isotype light chains by ligating
variable Kappa light chain cDNA fragments in front of Kappa light
chain constant domain cDNA using BamHI and BsiWI restriction sites;
while heavy chain specific vector was engineered to ligate variable
heavy chain cDNA fragments in front of a cDNA encoding the
.gamma.1, hinge, .gamma.2, and .gamma.3 constant domains using
BamHI and SalI restriction sites. In both heavy and light chain
expression vectors, secretion was driven by the murine VJ2C leader
peptide containing the BamHI site. Note that BsiWI site is located
in the Kappa constant domain; while SalI site is situated in the
C.gamma.1 domain.
[0208] For transient expression of immunoglobulin candidates, equal
quantities of heavy and light chains vectors were co-transfected
into suspension-adapted HEK-EBNA cells (ATCC-CRL-10852) using
Polyethyleneimine (PEI). Typically, 100 ml of cells in suspension
at a density of 0.8-1.2 million cells per ml is transfected with a
DNA-PEI mixture containing 50 .mu.g of expression vector encoding
the heavy chain and 50 .mu.g expression vector encoding the light
chain. When recombinant expression vectors encoding antibody genes
are introduced into the host cells, antibodies are produced by
further culturing the cells for a period of 4 to 5 days to allow
for secretion into the culture medium (EX-CELL 293,
HEK293-serum-free medium, Sigma, Buchs, Switzerland), supplemented
with 0.1% pluronic acid, 4 mM glutamine, and 0.25 .mu.g/ml
geneticin). Antibodies were then purified from cell-free
supernatant using recombinant protein-A streamline media (GE,
Switzerland), and buffered exchanged into phosphate buffer saline
prior to assays.
[0209] Humanization strategy was based on the initial four grafted
heavy and light chains (above), which were combined in a pair-wise
fashion to derive 16 initial full-length immunoglobulin candidates.
These immunoglobulins were assessed for antigen-binding affinity by
half-maximal binding assays on B-cell lymphoma cell-lines (FACS)
and compared to a chimeric version of FMC63 (this was to
standardized level of staining from the anti-human Fc PE-labeled
detection-antibody, as described in Example 2). From this initial
work, immunoglobulin candidates that contained VH16 (SEQ ID NO: 21)
or VH20 (SEQ ID NO: 22) showed best binding to Raji cells in FACS
experiments, as seen in FIGS. 1A and 1B. The antibody consisting of
VH16 heavy chain paired to light VL43 had superior level of
expression in transient transfections as well as superior melting
temperature of its FAB fragment and consequently was selected for
further back-mutations and rational engineering as shown in Table
8.
TABLE-US-00008 TABLE 8 IgG transient expression level and FAB
stability of the 1st CDR-grafted antibodies. Antibody Expression
(mg/L) Tm Fab (.degree. C.) Chimeric FMC63 48 84.27 VH2/VL39 11
78.78 VH2/VL40 23 76.55 VH2/VL43 13 73.17 VH2/VL44 21 78.27
VH5/VL39 5 76.08 VH5/VL40 9 ND VH5/VL43 19 76.76 VH5/VL44 12 74.81
VH16/VL39 8 71.67 VH16/VL40 11 71.81 VH16/VL43 20 83.54 VH16/VL44 7
85.16 VH20/VL39 11 82.41 VH20/VL40 24 79.46 VH20/VL43 37 79.67
VH20/VL44 26 82.00
Back Mutations of the Human Frameworks
[0210] Since straight grafting of CDRs from FMC63 mouse antibody
led to human acceptors with low binding properties, it was
desirable to mutate certain residues in the frameworks back to
murine residues at some positions. This process called
back-mutation is the most unpredictable procedure in the
humanization of monoclonal antibodies, and necessitate the
identification of critical framework residues from the parent
antibody that need to be retained in order to substantially retain
the binding properties of the parent antibody while at the same
time minimizing the potential immunogenicity of the resultant
antibody. Tables 9 and 10 and FIGS. 2A and 2B show residues (Kabat
numbering) that may affect the conformations of CDRs and which were
selected as potential candidates for back mutations to murine
residues.
TABLE-US-00009 TABLE 9 Comparison of FMC63 and human acceptor light
chain frameworks. VH Kabat position FMC63 VH16 VH20 37 I V V 42 R G
G 48 L V V 49 G A S 67 L F F 71 K R R 78 V L L 94 K R R
TABLE-US-00010 TABLE 10 Comparison of FMC63 and human acceptor
heavy chain frameworks. VL Kabat VL39, VL40, position FMC63 VL43,
VL44 44 V P, P, P, P 71 Y F, F, F, F 87 F Y, Y, Y, Y
[0211] Among the eight possible back mutations for the heavy chain,
changes at position 37, 48, and 49 were discarded because of their
conservative nature. Hence four reshaped versions of VH16 were
made, and combined in a pair-wise fashion with all three back
mutants of VL 43. In addition reshaped variants were paired to
parental VH16 and VL43 to investigate the impact of each individual
back mutation. A total of 24 full-length immunoglobulin candidates
were investigated. The five heavy chain variants had the following
single point mutation compared to VH16 sequence: G42R, F67L, R71K,
L78V, and R94K; while, the three light chain variants had P44V,
F71Y, and Y87F, compared to VL43.
[0212] From FACS experiments (as described in example 2), transient
expression levels and FAB stability measurements it was found that
back-mutations heavy chain R94K and/or light chain P44V
dramatically increase binding to Raji cells or NALM-6 cells while
improving expression level and maintaining good FAB stability as
shown in Table 11, and 12. These two positions alone restored about
half of the binding of parental FMC63 antibody.
TABLE-US-00011 TABLE 11 FACS staining of humanized back-mutated
anti-CD19 antibodies on Raji and NALM-6 tumour cell-lines. Values
(indicated as Raji, and NALM-6 for measurements on Raji and NALM-6
cells, respectively) correspond to antibodies mid-point
fluorescence (MPF) measure by flow-cytometry expressed as
percentage to that observed for the FMC63 chimeric antibody. VL43
VL43-P44V VL43-F71Y VL43-Y87F Raji NALM-6 Raji NALM-6 Raji NALM-6
Raji NALM-6 VH16 7.42 3.29 9.72 6.05 11.29 NA 10 NA VH16- NA 3.48
8.33 NA NA 3.97 8.43 3.65 G42R VH16- NA 2.40 NA 2.37 6.54 NA 4.35
NA F67L VH16- 4.43 NA 6.93 NA NA 2.67 4.19 NA R71K VH16- 10.77 NA
25.93 10.95 12.28 NA 17.95 NA L78V VH16- 27.06 14.38 52.87 32.86
41.82 23.47 31.82 NA R94K
TABLE-US-00012 TABLE 12 IgG transient expression level and FAB
stability of the humanized back-mutated anti-CD19 antibodies. VL43
VL43-P44V VL43-F71Y VL43-Y87F FAB Transient FAB Transient FAB
Transient FAB Transient Tm exp. level Tm exp. level Tm exp. level
Tm exp. level (.degree. C.) (mg/l) (.degree. C.) (mg/l) (.degree.
C.) (mg/l) (.degree. C.) (mg/l) VH16 83.54 20 81.04 29 83.9 25
82.97 24 VH16- 82.59 48 79.84 20 83.08 48 82.51 34 G42R VH16- 82.92
46 79.92 23 83.34 29 82.22 22 F67L VH16- 83.92 45 80.9 52 83.67 48
83.34 39 R71K VH16- 87.87 36 85.87 42 87.87 44 86.68 42 L78V VH16-
82.75 63 80.10 42 82.88 50 82.22 38 R94K
Germlining
[0213] Germline frameworks are typically better than individual
mature antibody framework as acceptor frameworks for humanized
antibodies because their lack of somatic mutations may lower the
degree of immunogenicity. VH16 is derived from healthy donor B-cell
mRNA using degenerate primers designed according to germline
sequences from VBASE2, and this procedure provides antibodies that
have not yet encountered any antigens. However, since the frequency
of truly naive antibodies depend heavily on the source of B cells,
mutations can also be observed with the above procedure (Klein U.
et al, 1997, Blood 89, p 1288-1298). Both VH16 and VL 43 had a low
contain of non-germline residues that were mutated back to
germline, these changes were VH16-Q6E, VL43-V3Q, and VL43-T7S as
shown in Table 13.
TABLE-US-00013 TABLE 13 FACS staining of humanized
back-mutated/germlined anti-CD19 antibodies on Raji tumour
cell-lines. Values (indicated as Raji) correspond to antibodies
mid-point fluorescence (MPF) measure by flow-cytometry expressed as
percentage to that observed for the FMC63 chimeric antibody. IgG
transient expression level and FAB stability of the humanized
back-mutated/germlined anti-CD19 antibodies are also indicated.
VL43 VL43-V3Q/T7S Transient FAB Transient FAB exp. level Tm exp.
level Tm Raji (mg/L) (.degree. C.) Raji (mg/L) (.degree. C.) VH16
7.14 20 83.54 4.93 28 83.51 VH16- R94K 26.79 60 82.75 27.78 13.5
82.36 VH16-Q6E ND 30 83.12 5.68 36 83.46
[0214] All germline changes were found to have no impact on
VH16-VL43 antibody, whether on its affinity nor on its FAB
stability and only transient level of expression was significantly
increased. Subsequently, VH16-VL43 variants with germline residues
at position VL43-V3Q, and VL43-T7S were used for affinity
improvement through rational design (below).
Affinity Improvement of Back Mutated Human Acceptors by Rational
Design and CDR Engineering
[0215] Tyrosine Mutants.
[0216] FMC63 CDRs have high tyrosine content: heavy chain CDR1
(position 32), heavy chain CDR2 (positions 58, and 59), heavy chain
CDR3 (positions 96, 97, 98, and 100b), light chain CDR1 (position
32), and light chain CDR3 (position 96). Of particular are the four
tyrosine residues in heavy chain CDR3 (Y96, Y97, Y98, and Y100b),
and the two other tyrosine residues found in heavy chain CDR1 and
light chain CDR1, both at position 32. These residues, may define
the putative interaction binding site for human CD19 molecule,
since in addition to their hydrophobic nature and the fact that
most of them are part of heavy chain CDR3, usually the most
important CDR as it often determine specificity, they also notably
protrude outside of the antibody binding-site plan in
VH16-R94K/VL43 3D-model. Taken together these observations allow
the identification of heavy chain CDR3 residues 96, 97, 98, 100b
and light chain CDR1 residue 32 as candidates for rational affinity
improvement. Tyrosine residues are unique because they have a dual
hydrophobic and polar nature by virtue of their aromatic ring and
hydroxyl group respectively. Hence, the above residues were mutated
for phenylalanine to increase hydrophobicity and probe the
importance of a polar versus hydrophobic content at these
positions. Phenylalanine mutants measurements in the context of the
heavy chain R94K mutations show that heavy chain mutant 32, 97, 98
as well as light chain mutant 32 are superior to parental molecule
VH16-R94K/VL43, with heavy chain mutant Y97F having 72.8% of
chimeric FMC63 affinity as shown in Table 14.
TABLE-US-00014 TABLE 14 FACS staining of humanized
back-mutated/affinity matured anti-CD19 antibodies on Raji tumour
cell-lines. Values (indicated as Raji) correspond to antibodies
mid-point fluorescence (MPF) measure by flow-cytometry expressed as
percentage to that observed for the FMC63 chimeric antibody. IgG
transient expression level and FAB stability of the humanized
back-mutated/affinity matured anti-CD19 antibodies are also
indicated. Relative Raji Transient exp. FAB Tm Antibody FACS
staining (mg/L) (.degree. C.) VH16 R94K Y32F VL43 62.5 17 82.51
VH16 R94K Y96F VL43 5.36 14 83.53 VH16 R94K Y97F VL43 72.82 17
81.53 VH16 R94K Y98F VL43 34.09 10 81.91 VH16 R94K Y100bF VL43
27.78 24 82.92 VH16 R94K VL43 Y32F 39.47 25 82.56
[0217] Light Chain-Pro 44 Mutants.
[0218] Light chain P44 is located at the bottom of the interface
between heavy and light chain, a location that could explain the
great affinity improvement when back mutated to valine. Two other
hydrophobic amino-acids were investigated at position 44 to
possibly tune (or better adjust) the interface between light and
heavy chain: isoleucine and leucine variants were constructed in
the context of the VH16-R94K variants as shown in Table 15.
Affinity and stability measurements revealed that isoleucine was
superior to the valine back-mutation at position 44, while change
for a leucine only provided a mild improvement despite being a more
logical choice.
TABLE-US-00015 TABLE 15 FACS staining of humanized
back-mutated/affinity matured anti-CD19 antibodies on Raji tumour
cell-lines. Values (indicated as Raji) correspond to antibodies
mid-point fluorescence (MPF) measure by flow-cytometry expressed as
percentage to that observed for the FMC63 chimeric antibody. IgG
transient expression level and FAB stability of the humanized
back-mutated/affinity matured anti-CD19 antibodies are also
indicated. Relative Raji Transient exp. FAB Tm Antibody FACS
staining (mg/L) (.degree. C.) VH16 R94K VL43 P44I 69.44 17 81.37
VH16 R94K VL43 P44L 37.50 18 80.10
[0219] Removal of a Potential Deamidation Site.
[0220] Deamidation is a major route of antibody degradation.
Deamidation of Asn to Asp is highly sequence-dependent and occurs
in regions of the protein which are known or predicted to be
flexible as in CDR regions (Bischoff and Kolbe (Journal of
Chromatography B, 662 (1994), 261-278); this usually involves Asn
residues located in CDRs. A high probability for deamidation of its
asparagine was identified in CDR3 of the FMC63 light chain at
position 91 to 93 (GNT). Hence to prevent putative deamidation, the
following changes were investigated in the context of the VH16-R94K
heavy chain: VL43-N92A, VL43-T93V and VL-43-T93A as shown in Table
16. It was found that both N92A and T93A maintain binding affinity.
N92A variant was also found to have improved FAB stability.
TABLE-US-00016 TABLE 16 FACS staining of humanized
back-mutated/deamidation site removed anti-CD19 antibodies on Raji
tumour cell-lines. Values (indicated as Raji) correspond to
antibodies mid-point fluorescence (MPF) measure by flow-cytometry
expressed as percentage to that observed for the FMC63 chimeric
antibody. IgG transient expression level and FAB stability of the
humanized back-mutated/deamidation-site-removed anti-CD19
antibodies are also indicated. Relative Raji Transient exp.
Antibody FACS staining (mg/L) FAB Tm (.degree. C.) VH16 VL43 7.14
20 83.54 VH16 R94K VL43 26.79 60 82.36 VH16 R94K VL43 25.86 33
84.09 N92A VK16 R94K VL43 17.44 34 82.43 T93V VH16 R94K VL43 34.09
35 82.81 T93A
[0221] Other improvements of VL43 human acceptor have been carried
out at position F71. Binding activity to Raji of VH16 R94K VL43
F71H (SEQ ID NO: 61), VH16 R94K VL43 F71S (SEQ ID NO: 62), and VH16
R94K VL43 F71T (SEQ ID NO: 63) was similar to binding activity of
VH16 R94K VL43.
Combining Back-Mutations and Rationally-Designed Mutations
[0222] To further increase binding to Raji cells, back mutations
and rationally design mutations were combined in a systematic
approach in which a limited number of combination were tested. Most
improved mutations identified from tyrosine switch to phenylalanine
in heavy and light chains (above) were combined with light chain
changes P44I, and N92A, as well as germline changes V3Q, and
T7S.
[0223] Although CDR changes have often an additive effect in terms
of affinity, when these CDR changes are combined with mutations
that affect framework, the outcome is not predictable. Table 17
shows the relative FACS staining for VH16/VL43 variants combining
germline, framework, back and CDR mutations. It was found that
combining heavy chain CDR changes Y32F, and Y97F with back
mutations R94K result in loss of binding, whereas Y32F combined
with heavy chain back mutation R94K and light chain change P44I and
N92A greatly improved binding, which by our mean of measurements
resulted in a relative mid-titration of staining superior to FMC63
chimera. Another favorable combination is both heavy chain CDR
mutation Y100BF and Y32F in the context of heavy chain back
mutation R94K, and light chain changes V3Q, T7S, Y32F, P44I and
N92A.
TABLE-US-00017 TABLE 17 FACS staining of humanized
back-mutated/germlined/affinity matured/ deamidation-site-removed
anti-CD19 antibodies on Raji tumour cell-lines. Values (indicated
as Raji) correspond to antibodies mid-point fluorescence (MPF)
measure by flow-cytometry expressed as percentage to that observed
for the FMC63 chimeric antibody. VL43 V3Q/T7S/ V3Q/T7S/ V3Q/T7S/
V3Q/T7S/ VH16 N92A Y32F/N92A P44I/N92A Y32F/P44I/N92A R94K 18.18
Low Saturation 83.33 111.11 Y32F/R94K 58.82 Low Saturation 133.33
Low Saturation R94K/Y97F Low Saturation No Binding NA Low
Saturation R94K/Y100.sub.BF NA NA 101.01 144.93 Y32F/R94K/Y97F
16.95 No Binding Low Saturation 6.67
[0224] Combinations which display high binding activity also retain
high transient expression level (Table 18) as well as high FAB
fragment thermostability (Table 19).
TABLE-US-00018 TABLE 18 IgG transient expression level of the
humanized back-mutated/ germlined/affinity
matured/deamidation-site-removed anti-CD19 antibodies. VL43
V3Q/T7S/ V3Q/T7S/ V3Q/T7S/ Y32F/ V3Q/T7S/ Y32F/ VH16 N92A N92A
P44I/N92A P44I/N92A R94K 15 45 47 34 Y32F/R94K 6.5 25 26 18
R94K/Y97F 23 31 25 22 R94K/Y100.sub.BF NA NA NA 32 Y32F/R94K/Y97F
20 32 26 24
TABLE-US-00019 TABLE 19 FAB stability (.degree. C.) of the
humanized back-mutated/germlined/affinity
matured/deamidation-site-removed anti-CD19 antibodies. VL43
V3Q/T7S/ V3Q/T7S/ V3Q/T7S/ Y32F/ V3Q/T7S/ Y32F/ VH16 N92A N92A
P44I/N92A P44I/N92A R94K 84.29 84.34 83.13 83.31 Y32F/R94K 84.45
84.31 83.21 83.39 R94K/Y97F 83.92 83.96 82.9 83.04 R94K/Y100.sub.BF
NA NA NA 83.42 Y32F/R94K/Y97F 83.93 83.96 82.77 83.01
Example 2
Binding of the CD19 Antibodies to B Cell-Derived Tumor Cell Lines:
Flow Cytometry Analysis
[0225] Binding of the CD19 humanized monoclonal antibodies by flow
cytometry to Raji tumor cells (human Burkitt lymphoma, DSMZ
ACC319), NALM-6 (human B cell precursor leukemia, DSMZ ACC128) and
SU-DHL-6 (human B cell lymphoma, DSMZ ACC572) (all cell lines from
DSMZ Braunschweig, Deutschland) was assessed. Cells were incubated
with serial dilutions of each humanized monoclonal antibody. An
irrelevant human IgG1 was used as a negative control. The cells
were washed and detected by a phycoerythrin-labeled (PE) anti-human
secondary antibody (eBioscience, CA, USA) and analyzed by flow
cytometry. To ensure comparable levels of staining between
humanized candidates and parental murine antibody, a chimeric
FMC63, i.e. an antibody which consists of the FMC63 murine heavy
variable domain fused to human IgG1 heavy constant domains as shown
in SEQ ID NO: 68 and the murine light variable domain fused to
kappa constant domain as shown in SEQ ID NO: 69, was used as
standard. Results for binding to Raji or NALM-6 are shown in Table
11, 13-17, and binding to the SU-DHL-6 cell line are shown in FIG.
3. All results in FIG. 3 were measures of the mean fluorescent
intensity (MFI) of cell staining. From MFI versus antibody
concentration curves, Mid-Point Fluorescence (MPF) value for each
anti-CD19 humanized antibody was calculated using the software
GraphPad Prism 5 (CA, USA). MPF of a dose response curve represents
the concentration of antibody (.mu.g/ml) where 50% of its maximal
staining is observed. Thus, antibodies with better binding activity
on cells have lower MPF (.mu.g/ml). In Tables 11, 13-17, values
represent relative MPF between the chimeric FMC63 and anti-CD19
humanized variants, and were calculated as follow: [1/(MPF chimeric
FMC63/MPF anti-CD19 humanized antibody)].times.100. Higher is the
percentage; better is the binding activity of the antibody.
[0226] FIG. 3 shows the dramatic improvement in affinity for
SU-DHL-6 cells along the different humanization steps from
VH16/VL43 antibody to VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A
antibody. The latter reaches strong affinity to B cells similar to
the FMC63 chimera. The affinity improvements of the FMC63 humanized
antibodies to cells are a direct result of mutations that
substantially retain and/or improve the binding properties of human
CDR-grafted acceptor frameworks as described above.
Example 3
Scatchard Binding Analysis of the Anti-CD19 Human Antibodies to
Raji Tumor Cells
Scatchard Binding Analysis of Humanized Antibodies to Raji-B Tumor
Cells
[0227] The constant binding affinity of an antibody to its target
can be determined with a saturation binding curve. At equilibrium,
the amounts of bound and free antibody to its binding site are
indicative of the dissociation binding constant Kd. Usually, for
one single binding site, the ratio bound/free versus bound antibody
has a linear correlation, where the slope corresponds to the
inverse of the binding constant Kd.
[0228] Tested antibodies were labelled with the fluorescent dye
europium (Eu.sup.3+) (PerkinElmer, MA, USA). Eu.sup.3+ offers the
possibility to quantify the amount of bound antibody molecules to
cells as well as free antibody molecules. Saturation of binding to
Raji cells by selected humanized candidates was followed via
Eu.sup.3+ using time resolved fluorescence. To demonstrate the
binding specificity of Eu.sup.3+-labelled candidates without
unspecific behaviour of the Eu.sup.3+ dye to the cell surface, a
negative isotype human IgG1 was also labelled with Eu.sup.3+.
[0229] Raji cells as described in Example 2 were grown in RPMI-1640
medium (Chemie Brunschwig AG, PAA, Basel, Switzerland) supplemented
with 10% fetal bovine serum (FBS, Chemie Brunschwig AG, PAA, Basel,
Switzerland), 2 mM ultraglutamine 1 (Lonza, Verviers, Belgium) and
1% penicillin/streptomycin (Chemie Brunschwig AG, PAA, Basel,
Switzerland). The cells were washed with the same culture medium
and adjusted to a final concentration of 1.times.10.sup.6 cells/ml.
A 100 .mu.l volume of Raji cells was seeded in U-bottomed 96-well
plate. Serial dilutions of Eu.sup.3+-labelled antibodies were
prepared into PBS-2.5% FBS-0.05% sodium azide (NaN3) into a
separate 96 well plate and cooled down to 4.degree. C. A 100 .mu.l
volume of each Eu.sup.3+-labelled antibody dilution was then
transferred on the Raji cells, corresponding to a final dilution
range for the Eu.sup.3+-labelled antibodies of 13.3 nM to 6.5 pM.
Cells were incubated with Eu.sup.3+-antibody for 15 minutes on ice
to reach equilibrium. The amount of free Eu.sup.3+-labelled
antibodies were measured by transferring aliquots of cell-free
supernatant (volumes were empirically adjusted depending on
antibody concentration; cells were spun at 1300 RPM for 2 min) into
a fresh plate containing 100 .mu.l of Delfia solution (PerkinElmer,
MA, USA; an enhancer of Eu.sup.3+ fluorescence). To ensure complete
removal of the supernatant, cells were spin down once more at 1300
RPM for 2 minutes. After the second centrifugation, the supernatant
was discarded, and cells were washed twice with 200 .mu.l of cold
binding buffer (PBS-2.5% FBS-0.05% NaN.sub.3). Cell pellets were
resuspended into 100 .mu.l of Delfia solution. Time resolved
fluorescence was measured for both plates (free or bound
Eu.sup.3+-antibody) with a spectrophotometer (Bio-Tek, synergy2,
VT, USA; excitation wavelength was 340 nm, emission wavelength was
615 nm, with time delay of 400 .mu.s and an acquisition time of
1000 .mu.s). The dissociation constant Kd was determined by
Scatchard analysis, where the slope of the linear representation of
bound versus bound/free represent 1/Kd. Kd were determined in
duplicate for each antibody and each fluorescence measurements were
performed in triplicate. In accordance with the binding assay
above, FIGS. 4A and 4B show striking Kd improvement along the
different mutation stages from antibody VH16-R94K/VL43 (Kd=47 nM)
to antibody VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A (Kd=10.9 nM).
The latter antibody has improved Kd to the parental chimeric FMC63
(11.8 nM).
Binding Competition Between the Europium-Labelled FMC63 Chimera and
Unlabelled Anti-CD19 Humanized Antibodies or Ki Determination
[0230] Another way to evaluate the binding affinity of each
humanized antibodies is to measure binding competition against the
parental chimeric FMC63 antibody on Raji cells. To inhibit the
binding of europium-labelled chimeric FMC63 (Eu.sup.3+-FMC63) to
the CD19 antigen expressed on Raji cells, increasing concentrations
of unlabelled antibody were added together with a constant amount
of Eu.sup.3+-FMC63. To that aim, 100 .mu.l volumes of Raji cells in
RPMI-1640 medium (Chemie Brunschwig AG, PAA, Basel, Switzerland)
supplemented with 10% fetal bovine serum (FBS, Chemie Brunschwig
AG, PAA, Basel, Switzerland), 2 mM ultraglutamine 1 (Lonza,
Verviers, Belgium) and 1% penicillin/streptomycin (Chemie
Brunschwig AG, PAA, Basel, Switzerland), prepared at concentration
of 1.times.10.sup.6 cells/ml were seeded in a U-bottomed 96-well
plate. Serial dilutions of the competitor antibodies were prepared
into a separate 96-well plate into PBS-2.5% FBS-0.05% NaN.sub.3 and
subsequently mixed with a constant amount of Eu.sup.3+-FMC63. The
antibody dilutions were cooled down to 4.degree. C. before 100 n1
was taken and added on the Raji cells. Final dilutions of
unlabelled humanized antibodies ranged from 100 nM up to 4.2 pM,
while the concentration of Eu.sup.3+-FMC63 was maintained at 0.2
nM. Cells were incubated with the antibodies for 15 minutes on ice.
After reaching equilibrium, the cells were centrifuged at 1300 RPM
for 2 minutes and supernatant was discarded. Cell pellets were
washed twice with 200 .mu.l of cold binding buffer PBS-2.5%
FBS-0.05% NaN.sub.3, and resuspended into 100 .mu.l of Delfia
solution. Cell bound Eu.sup.3+-FMC63 was measured with time
resolved fluorescence as described above. The amount of
Eu.sup.3+-FMC63 (fmole) per well was determined and plotted versus
the total amount of unlabelled antibody. The inhibition binding
curve of Eu.sup.3+-FMC63 was further analysed with the GraphPad
Prism 5 software (CA, USA) using one-site competition model, and
total ligand fix concentration of 0.2 nM; inhibition binding
constants were in the nanomolar range. As shown in Table 20 and
according to experiments presented above, the framework VH16VL43
which does not include mutations, displays little affinity for Raji
cells (72.8 nM) while humanized variant
VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A exhibits a very high
affinity, equivalent to FMC63 chimera (1.9 nM versus 1.4 nM).
Results with standard deviation have been determined at least 3
times.
TABLE-US-00020 TABLE 20 Ki determination of humanized anti-CD19
antibodies. Antibody Ki (nM) FMC63 Chimera 1.4 .+-. 0.32 Isotype
control IgG1 No Competition VH16/VL43 72.8 VH16-R94K/VL43 7.6
VH16-R94K/VL43-V3Q-T7S-P44I-N92A 3.9 .+-. 1.02
VH16-R94K-Y100.sub.BF/VL43-V3Q-T7S-Y32F-P44I- 2.1 .+-. 0.5 N92A
VH16-R94K-Y100.sub.BF/VL43-V3Q-T7S-P44I-N92A 1.9
VH16-Y32F-R94K-Y97F/VL43-V3Q-T7S-N92A 49.9
Example 4
Assessment of Antibody-Dependent Cellular Cytotoxicity (ADCC)
Activity
[0231] ADCC activities of humanized anti-CD19 antibodies were
measured by lactate deshydrogenase (LDH)-releasing assay using the
CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega,
Madison, USA). Human peripheral blood mononuclear cells (PBMC) were
purified from citrated whole blood by standard Ficoll-paque
separation, resuspended in complete medium (RPMI-1640 medium
(Chemie Brunschwig AG, PAA, Basel, Switzerland) supplemented with
10% fetal bovine serum (FBS, Chemie Brunschwig AG, PAA, Basel,
Switzerland), 2 mM ultraglutamine 1 (Lonza, Verviers, Belgium) and
1% penicillin/streptomycin (Chemie Brunschwig AG, PAA, Basel,
Switzerland)), and 100 U/ml of human IL-2 (Sigma, Missouri, USA))
and incubated overnight at 37.degree. C. The following day, PBMC
were collected by centrifugation, washed twice and resuspended in
culture medium at a density of 8.times.10.sup.6 cells/ml. The
CD19.sup.+ cell line Raji as described in Example 2 was used as
target cells. Raji cells were washed twice and resuspended in
complete medium at a density of 0.2.times.10.sup.6 cells/ml. Fifty
microliters of antibody diluted at 1.5 ng/ml (final concentration
was 0.5 ng/ml) were mixed with 50 .mu.l of target cells, and added
to an equivalent volume of PBMC into a U-bottomed 96-well plate. A
target to effector ratio of 1:40 was used throughout the
experiments. After 4 hours incubation at 37.degree. C., cells were
centrifuged and 50 .mu.l samples of cell-free supernatant were
collected, transferred to a flat-bottomed 96-well plate, and
assayed. Percentage of lysis was calculated as follows: (Sample
release-Target spontaneous release-Effector spontaneous
release)/(Maximum release-Target spontaneous release)*100; where
Target spontaneous release is the fluorescence from wells which
only contained target cells, Effector spontaneous release is the
fluorescence from wells which only contained effector cells, and
Maximum release is the fluorescence from wells containing target
cells which have been treated with lysis buffer. Background
percentage of lysis obtained in absence of antibody
(Target+Effector cells) was subtracted from percentage of lysis of
sample.
[0232] FIG. 5A and FIG. 5B show little specific Raji lysis due to
IgG1 control.
[0233] However, humanized antibody-induced lysis was increased at
least three fold for the
VH16-R94K-Y100BF/VL43-V3Q-T7S-Y32F-P44I-N92A antibody or
VH16-R94K/VL43-V3Q-T7S-P44I-N92A antibody or
VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A or chimeric FMC63 (FIG. 5A
shows average of 3 different donors .+-.standard deviation, FIG. 5B
shows results from 1 donor performed in triplicate .+-.standard
deviation). This data demonstrates that selected humanized
anti-CD19 antibodies lead to cellular cytotoxicity of CD19.sup.+
expressing cells that is similar to the parental chimeric
FMC63.
Example 5
Apoptosis Induction by the Anti-CD19 Antibodies
[0234] To measure antibody-induced cell death, Raji cells as
described in Example 2 were prepared at 1.times.10.sup.6 cells/ml
in RPMI-1640 medium ((Chemie Brunschwig AG, PAA, Basel,
Switzerland) supplemented with 10% fetal bovine serum (FBS, Chemie
Brunschwig AG, PAA, Basel, Switzerland), 2 mM ultraglutamine 1
(Lonza, Verviers, Belgium) and 1% penicillin/streptomycin (Chemie
Brunschwig AG, PAA, Basel, Switzerland)), and 100 .mu.l per well in
a 96-well plate or 1 ml in a 24-well plate were seeded. Cells were
incubated at 37.degree. C., 5% CO.sub.2 for 15 min to 24 h with
antibody concentration ranging from 0.0016 to 1 .mu.g/ml (0.01
.mu.M to 6.6 .mu.M). After incubation, cells were centrifuged in a
U-bottom plate at 1300 RPM for 3 min and washed with 200 .mu.l of
PBS. One hundred .mu.l of 1.times. binding buffer (BD Pharmingen,
Allschwil, Switzerland) was added in each well, followed by 2.5
.mu.l of annexin V-FITC and 2.5 .mu.l propidium iodine (PI, BD
Pharmingen, Allschwil, Switzerland). Cells were incubated with
annexin-V and PI at room temperature before flow cytometry
analysis. Double staining with annexin-V and PI characterized the
dead-cell population while living cells are stained neither by
annexin-V nor PI.
[0235] FIG. 6 shows Annexin-V and PI staining of Raji cells
incubated with 1 .mu.g/ml antibody for 2.5 h. Surprisingly enough,
while VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A and
VH16-R94K/VL43-V3Q-T7S-P44I-N92A humanized anti-CD19 antibodies
induced strong annexin-V staining and cell death, the parental
chimeric FMC63 had no effect on apoptosis. On note, the slight
increase of annexin-V staining after chimeric FMC63 treatment
observed on FIG. 6 was not reproducible and not significant.
Strikingly, cells stained with annexin-V as early as 15 min after
addition of humanized anti-CD19 antibodies, and both staining
(Annexin-V plus PI) reached a plateau after 4 h incubation with
humanized anti-CD19 antibodies (not shown). The apoptotic mechanism
due to anti-CD19 antibodies is different from anti-FasL-induced
apoptosis on Raji cells. Indeed, FasL did not induce Annexin-V
staining on Raji cells (not shown). This result proves that
humanization gave new characteristics to the anti-CD19 antibody.
The new apoptotic characteristic given to humanized anti-CD19
antibodies in addition to their ability to trigger homotypic cell
adhesion (not shown) compared to the parental chimeric FMC63 was
unexpected and of extreme importance with regard to studies on
anti-CD20 antibodies. Indeed, Beers et al. have shown that
anti-CD20 antibodies with strong apoptotic and homotypic adhesion
properties had better B cell depletion ability in animal (Beers S.
A. et al, 2008, Blood 112, p 4170-4177). In addition, Raji cells
stained with annexin-V as early as 15 min after adding anti-CD19
antibodies. The staining reached a plateau after 4 h incubation.
This fast apoptotic event is superior to anti-CD20 antibodies,
which apoptotic effects are generally observed after 24 h (Chan H.
T. C. et al., Cancer Research, 63:5480-5489).
Example 6
Inhibition of Proliferation of Malignant B Cells In Vitro
[0236] Proliferation--alamarBlue
[0237] To measure inhibition of cell proliferation by antibodies,
cells (Raji or SU-DHL-6 as described in Example 2) were seeded at a
density of 2.times.10.sup.5 cells per ml, with 100 .mu.l per well.
Cells are incubated with 100 .mu.l of antibodies previously
sterilized and diluted in RPMI-1640 medium ((Chemie Brunschwig AG,
PAA, Basel, Switzerland) supplemented with 10% fetal bovine serum
(FBS, Chemie Brunschwig AG, PAA, Basel, Switzerland), 2 mM
ultraglutamine 1 (Lonza, Verviers, Belgium) and 1%
penicillin/streptomycin (Chemie Brunschwig AG, PAA, Basel,
Switzerland) to reach final concentrations of 0.0016 to 1 .mu.g/ml
(0.01 .mu.M to 6.6 .mu.M). Plates were incubated at 37.degree. C.,
5% CO.sub.2 for 72 hours. 20 .mu.l of alamarBlue (AbD Serotec,
Dusseldorf, Germany) was then added to cells for 4 to 8 h. Growing
cells cause a chemical reduction in fluorescence of alamarBlue
which is monitored by excitation at 540 nm and emission at 620 nm.
Percentage differences between treated and untreated cells (vehicle
only) were calculated from experiments performed in triplicate.
FIG. 7A shows level of proliferation of SU-DHL-6 after 72 h
incubation with antibodies. An irrelevant IgG1 and an anti-HLA-DR
antibody which strongly binds SU-DHL-6 were used as negative and
positive control, respectively. Humanized antibodies
VH16-R94K-Y100BF/VL43-V3Q-T7S-Y32F-P44I-N92A,
VH16-R94K/VL43-V3Q-T7S-P44I-N92A and
VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A (not shown) have strong
inhibitory function on cell proliferation even at concentration as
low as 0.01 .mu.g/ml. Therefore, in addition to the early induction
of apoptosis, anti-CD19 antibodies block B cell proliferation
within 72 h.
Clonogenicity
[0238] Clonogenic assay is another method to assess tumor cell
death by humanized anti-CD19 antibodies. The method is regularly
used to evaluate the anti-proliferative function of antibodies
(Chan H T C, Cancer Research 2003). We performed clonogenic assay
using the colony-forming cell assay and complete MethoCult medium
(StemCell Technologies, Grenoble, France). Raji cells (as described
in Example 2) were prepared at 1.times.10.sup.6 cells/ml and seeded
at 100 .mu.l/well in 96-well plates. Cells were then incubated with
100 .mu.l of antibodies previously sterilized and diluted in
RPMI-1640 medium ((Chemie Brunschwig AG, PAA, Basel, Switzerland)
supplemented with 10% fetal bovine serum (FBS, Chemie Brunschwig
AG, PAA, Basel, Switzerland), 2 mM ultraglutamine 1 (Lonza,
Verviers, Belgium) and 1% penicillin/streptomycin (Chemie
Brunschwig AG, PAA, Basel, Switzerland), antibody concentration was
0.2 .mu.g/ml) for 90 minutes. Raji cells plus antibodies were then
diluted in Iscove's medium to reach a count of 500 cells in 100
.mu.l, and finally mixed with 1.1 ml of MethoCult medium. 0.8 ml of
this preparation was dispensed in a 35 mm.times.10 mm dish using a
tuberculin syringe. Cells were incubated for 9 days at 37.degree.
C. (5% CO.sub.2) and colonies were counted with a microscope
(50.times. magnification). The results shown in FIG. 7B correlate
with humanized antibodies having surprising apoptotic properties
(annexin-V plus PI staining) previously observed in Example 5,
here, similarly, humanized antibodies show surprisingly good
anti-proliferative properties while the parental chimeric FMC63 had
very little or no effect on clonogenicity. Humanized anti-CD19
antibodies strongly decreased the number of Raji clones either by
inducing apoptosis and killing during the first 90 min of
incubation or by inhibiting cell division or both. This experiment
is representative of several experiments and was performed in
duplicate. The results confirm the effect of humanized anti-CD19
antibodies on B cell killing and inhibition of proliferation.
Example 7
Internalization of Anti-CD19 Monoclonal Antibody
Internalization Using Hum-Zap Assays
[0239] To evaluate antibody internalization, a secondary anti-human
antibody conjugated to the toxin saporin (Hum-Zap, Advanced
Targeting Systems, San Diego, Calif., USA) was used. When
internalized saporin, a ribosome-inactivating protein, induces cell
death, which can be subsequently monitored using alamarBlue assays.
Raji cells as described in Example 2 were seeded at
1.times.10.sup.5 cells/ml, 100 .mu.l per well in RPMI-1640 medium
(Chemie Brunschwig AG, PAA, Basel, Switzerland) supplemented with
10% fetal bovine serum (FBS, Chemie Brunschwig AG, PAA, Basel,
Switzerland), 2 mM ultraglutamine 1 (Lonza, Verviers, Belgium) and
1% penicillin/streptomycin (Chemie Brunschwig AG, PAA, Basel,
Switzerland). Antibodies were diluted in Hum-Zap previously
prepared at 100 ng/10 .mu.l in RPMI-1640 complete cell medium
(above). Ten .mu.l of the mixture antibody plus Hum-Zap were added
on Raji cells. The final concentrations of the antibodies ranged
from 0.5 to 0.005 .mu.g/ml. Cells with antibodies were then
incubated for 48 h before measurement of cytotoxicity using
alamarBlue. The percentage of cell proliferation was calculated as
followed: Fluorescence (emission 590 nm) of antibody-treated
cells/fluorescence (emission 590 nm) of control cells (Hum-Zap
only).times.100. Controls with antibodies and without Hum-Zap were
also performed and did not show any significant effects on cell
proliferation after 48 h. We observed internalization of the
humanized anti-CD19 antibodies (FIG. 8). The internalization of
CD19 subsequently to the interaction with antibodies has already
been described in previous studies but remained not significant
after 6 h and little after 24 h in Raji cells and in fresh B cells
from peripheral blood as well (Ingle G. S. et al, BJH, 2007, 140, p
46-58). Using Hum-Zap, the humanized anti-CD19
VH16-R94K/VL43-V3Q-T7S-P44I-N92A antibody internalizes very
similarly to the parental chimeric FMC63. However the antibody
VH16-R94K-Y100BF/VL43-V3Q-T7S-Y32F-P44I-N92A displays much less
internalization, with no internalization at 10 ng/ml. A high level
of internalization is only desirable when designing therapeutic
antibodies to be used as conjugate with a cytotoxic-payload or
toxin.
Example 8
Thermostability of Anti-CD19 Monoclonal Antibodies by Differential
Scanning Calorimetry
[0240] The thermal stability of the humanized anti-CD19 monoclonal
antibodies and chimeric FMC63 were compared using calorimetric
measurements as shown in Tables 8, 12-16, and 19. Monoclonal
antibodies melting profiles are characteristic of their isotypes
(Garber and Demarest (2007), BBRC 355:751-7), however the mid-point
melting temperature of the FAB fragment can be easily identified
even in the context of a full-length IgG. Such mid-point melting of
FAB portion was used to monitor monoclonal stability of humanized
candidates.
[0241] Calorimetric measurements were carried out on a VP-DSC
differential scanning microcalorimeter (MicroCal, Northampton, UK).
The cell volume was 0.128 ml, the heating rate was 1.degree.
C./min, and the excess pressure was kept at 64 p.s.i. All protein
fragments were used at a concentration of 1-0.5 mg/ml in PBS (pH
7.4). The molar heat capacity of each protein was estimated by
comparison with duplicate samples containing identical buffer from
which the protein had been omitted. The partial molar heat
capacities and melting curves were analyzed using standard
procedures. Thermograms were baseline corrected and concentration
normalized before being further analyzed using a Non-Two State
model in the software Origin v7.0.
Example 9
B Cell Depletion Studies
B Cell Depletion in Human Whole Blood
[0242] To assess the ability of humanized anti-CD19 antibodies to
deplete B cells in human whole blood, B cell depletion assays were
performed. Peripheral blood was obtained by venipuncture and was
diluted by 2 in RPMI-1640 medium ((Chemie Brunschwig AG, PAA,
Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS,
Chemie Brunschwig AG, PAA, Basel, Switzerland), 2 mM ultraglutamine
1 (Lonza, Verviers, Belgium) and 1% penicillin/streptomycin (Chemie
Brunschwig AG, PAA, Basel, Switzerland). Diluted whole blood was
seeded in a 24 well-plate (1-2 mL per well), 10 .mu.g/ml of
antibody or PBS (untreated) were added and plates were incubated
for 24 h at 37.degree. C., 5% CO.sub.2. The blood was lysed twice
with RBC lysis buffer (eBiosciences, THP Medical Products, Vienna,
Austria) for 5 min at room temperature and centrifuged at 1100 RPM
for 3 min. The cell pellet was washed with 2 ml of binding buffer
(PBS, 2.5% FCS, 100 mg/l MgCl.sub.2, 0.5 mM CaCl.sub.2, 0.05%
NaN.sub.3 and 10% Versene (v/v)). Cells were then resuspended in
0.5 ml of binding buffer and stained with either anti-CD19-PE-Cy5
or anti-CD20-PE, or anti-CD22-FITC antibodies. After 20 minutes
incubation on ice, cells were washed once with binding buffer and
analyzed by flow cytometry. The percentage of B-cells was
determined and the percent change was calculated as followed: (% of
B-cells in the untreated (PBS) cells-% of B-cells in the
antibody-treated cells)/(% of B-cells in the untreated (PBS)
cells).times.100.
[0243] 10 .mu.g/ml of the antibody was used on four blood donors as
shown in Table 21 and B cell depletion in whole blood was observed
after treatment with humanized anti-CD19 antibodies while. No
change in B cell number was observed after a control IgG1
treatment. Typically, CD19.sup.+ or CD20.sup.+ or CD22.sup.+ B
cells represented 9 to 10% of the leukocyte population when
incubated with the control IgG1. The antibody
VH16-R94K-Y100BF/VL43-V3Q-T7S-P44I-N92A had the highest impact on B
cell depletion (average=15.25%) while the parental chimeric FMC63
was the least efficient (average=7.25%).
TABLE-US-00021 TABLE 21 B-cell depletion from whole blood. % Change
Antibody (10 ug/ml) Donor 1 Donor 2 Donor 3 Donor 4 Average No Ab
(PBS) 0 0 0 0 0 Control IgG1 0 0 0 0 0 VH16-R94K/VL43- 5 4 22 19
12.5 .+-. 8.0 V3Q-T7S-P44I- N92A VH16-R94K- 15 20 10 16 15.25 .+-.
3.5 Y100.sub.BF/VL43- V3Q-T7S-P44I- N92A Chimeric FMC63 0 10 12 7
7.25 .+-. 4.54
Example 10
VH16 R94K-VL43 V3Q/T7S/P44I/N92A Variants with Enhanced
Complement-Mediated Effector Function
[0244] A number of variants were designed with the goal of
enhancing complement dependant cytotoxicity (CDC). In the same way
that Fc interactions with Fc.gamma. receptors binding mediates
ADCC, Fc interactions with the complement component C1q mediates
CDC. Although there is currently no structure available for the
Fc/C1q complex, several studies have mapped the binding site on
human IgG for C1q to a region centred on residues D270, K322, P329
and P331 (Idusogie et al., The Journal of Immunology, 2000,
164:4178-4184). Amino acid modifications were designed in the
D269-K334 region of the CH2 domain to explore variants that may
mediate enhanced CDC for VH16 R94K-VL43 V3Q/T7S/P44I/N92A.
[0245] The study shows that substitution of residues at position
E269, S298 and S324 resulted in variants with at least about 1.6
fold (FIG. 9) to a maximum of 5.5 fold (FIG. 10) increase in
CDC.
[0246] To create these variant cDNA coding sequences, a cDNA coding
the VH16 R94K heavy chain (SEQ ID NO: 64) cDNA was converted to
heavy chains VH16 R94K/324(NNK), VH16 R94K/S298A (SEQ ID NO: 114),
VH16 R94K/E269D/S298A (SEQ ID NO: 115), VH16 R94K/S298A/S324N (SEQ
ID NO: 116), VH16 R94K/E269D/S298A/S324N (SEQ ID NO: 117), by
standard mutagenesis. NNK at position 324 describes the
substitution of the wild-type serine encoding codon with a NNK
codon which provides substitution with all 20 amino acids (hard
randomization).
[0247] These variant coding DNA sequences were ligated in a vector
that is based on a modified pREP4 (Invitrogen, CA, USA) vector
carrying CMV promoter and Bovine Growth Hormone poly-adenylation
signal. In this expression-vector, secretion was driven by the
murine VJ2C leader peptide.
[0248] For transient expression, equal quantities of each heavy
chain and light chain vectors was co-transfected into
suspension-adapted HEK-EBNA cells (ATCC-CRL-10852) using
Polyethyleneimine (PEI). Typically, 100 ml of cells in suspension
at a density of 0.8-1.2 million cells per ml is transfected with a
DNA-PEI mixture containing 50 ng of expression vector encoding the
variant heavy chain and 50 ng expression vector encoding the VL43
V3Q/T7S/P44I/N92A (SEQ ID NO: 65) light chain. When recombinant
expression vectors encoding each engineered chain genes are
introduced into the host cells, the construct is produced by
further culturing the cells for a period of 4 to 5 days to allow
for secretion into the culture medium (EX-CELL 293,
HEK293-serum-free medium, Sigma, Buchs, Switzerland), supplemented
with 0.1% pluronic acid, 4 mM glutamine, and 0.25 ng/ml geneticin.
The construct was then purified from cell-free supernatant using
recombinant Streamline rProtein A media (GE, Switzerland), and used
for further analysis.
[0249] The expression levels of these variants are listed in Table
22.
TABLE-US-00022 TABLE 22 IgG transient expression level of VH16
R94K/VL43 V3Q-T7S-P44I-N92A heavy chain variants. Expression
Antibody (mg/L) VH16 R94K-VL43 V3Q/T7S/P44I/N92A 38 VH16
R94K/S324A-VL43 V3Q/T7S/P44I/N92A 48 VH16 R94K/S324V-VL43
V3Q/T7S/P44I/N92A 1.5 VH16 R94K/S324L-VL43 V3Q/T7S/P44I/N92A 20
VH16 R94K/S324I-VL43 V3Q/T7S/P44I/N92A 24 VH16 R94K/S324P-VL43
V3Q/T7S/P44I/N92A 15 VH16 R94K/S324T-VL43 V3Q/T7S/P44I/N92A 0.5
VH16 R94K/S324C-VL43 V3Q/T7S/P44I/N92A 10 VH16 R94K/S324M-VL43
V3Q/T7S/P44I/N92A 24 VH16 R94K/S324N-VL43 V3Q/T7S/P44I/N92A 54 VH16
R94K/S324Q-VL43 V3Q/T7S/P44I/N92A 44 VH16 R94K/S324F-VL43
V3Q/T7S/P44I/N92A 48 VH16 R94K/S324Y-VL43 V3Q/T7S/P44I/N92A 61 VH16
R94K/S324W-VL43 V3Q/T7S/P44I/N92A 62 VH16 R94K/S324R-VL43
V3Q/T7S/P44I/N92A 35 VH16 R94K/S324D-VL43 V3Q/T7S/P44I/N92A 42 VH16
R94K/S324G-VL43 V3Q/T7S/P44I/N92A 27 VH16 R94K/S324K-VL43
V3Q/T7S/P44I/N92A 7 VH16 R94K/S324E-VL43 V3Q/T7S/P44I/N92A 26 VH16
R94K/S324H-VL43 V3Q/T7S/P44I/N92A -- VH16 R94K/S298A-VL43
V3Q/T7S/P44I/N92A 54 VH16 R94K/E269D/S298A-VL43 V3Q/T7S/P44I/N92A
12 VH16 R94K/S298AS324N-VL43 V3Q/T7S/P44I/N92A 30 VH16
R94K/E269D/S298AS324N-VL43 11 V3Q/T7S/P44I/N92A
Complement Mediated Toxicity on Raji Cells
[0250] A cell-based assay was used to measure the capacity of the
variants to mediate CDC.
[0251] Lysis was measured using release of lactate dehydrogenase
(LDH) to monitor lysis of variant-opsonized Raji cells by baby
rabbit complement (Harlan Laboratories, C-0099F, AN VENRAY, The
Netherlands). Target cells were washed 2 times with complete medium
(RPMI-1640 medium (Chemie Brunschwig AG, PAA, Basel, Switzerland)
supplemented with 10% fetal bovine serum (FBS, Chemie Brunschwig
AG, PAA, Basel, Switzerland) and 1% Ultraglutamine (Lonza,
Verviers, Belgium)) by centrifugation and resuspension.
Variant-antibodies were added at the indicated final concentrations
of 1 .mu.g/ml. Baby rabbit serum was diluted to 7.5% with complete
medium and added to antibody-opsonized target cells. Plates were
incubated for 3 hours at 37.degree. C. Cell cytotoxicity was
measured using the Cyto Tox 96 Non-Radioactive Cytotoxicity Assay
kit (Promega, Madison, USA).
[0252] Representative data from this assay are shown in FIG. 9 and
FIG. 10.
[0253] FIG. 9 and FIG. 10 show little specific lysis due to IgG1
control antibody (Herceptin.RTM., Roche Pharma A.G., Reinach,
Switzerland); however, complement-induced lysis was increased at
least 1.6 fold (FIG. 9) to a maximum of 5.5 fold (FIG. 10) for the
VH16 R94K/S324N (SEQ ID NO: 118)-VL43 V3Q/T7S/P44I/N92A (SEQ ID NO:
65) antibody depending on the variability of the assay which is due
to the variation in raji cells viability; both VH16
R94K/S298A/S324N (SEQ ID NO: 116)-VL43 V3Q/T7S/P44I/N92A (SEQ ID
NO: 65) antibody and VH16 R94K/E269D/S298A/S324N (SEQ ID NO:
117)-VL43 V3Q/T7S/P44I/N92A (SEQ ID NO: 65) antibody also exhibited
improved CDC (at least 4.4 fold) over the parental antibody. FIGS.
9 and 10 show results in triplicate .+-.standard deviation.
Example 11
VH16 R94K-VL43 V3Q/T7S/P44I/N92A Variants with Enhanced
Antibody-Dependent Cellular Cytotoxicity (ADCC)
[0254] Anti-CD19 antibody variants investigated in the study
described in Example 10 with substitution of residues at position
E269, S298 were assessed for their ability to elicit ADCC.
[0255] ADCC activities of antibodies were measured by lactate
dehydrogenase (LDH)-releasing assay using the CytoTox 96
Non-Radoactive Cytotoxicity Assay kit (Promega, Madison, USA).
Human peripheral blood mononuclear cells (PBMC) were purified from
citrated whole blood by standard Ficoll-paque separation,
resuspended in complete medium (RPMI-1640 medium (Chemie Brunschwig
AG, PAA, Basel, Switzerland) supplemented with 10% fetal bovine
serum (FBS, Chemie Brunschwig AG, PAA, Basel, Switzerland), 2 mM
ultraglutamine 1 (Lonza, Verviers, Belgium) and 1%
penicillin/streptomycin (Chemie Brunschwig AG, PAA, Basel,
Switzerland)), and 100 U/ml of human IL-2 (Sigma, Missouri, USA))
and incubated overnight at 37.degree. C. The following day, PBMC
were collected by centrifugation, washed twice and resuspended in
culture medium at a density of 8.times.10.sup.6 cells/ml. The
CD19.sup.+ cell line Raji as described in Example 2 was used as
target cells. Raji cells were washed twice and resuspended in
complete medium at a density of 0.2.times.10.sup.6 cells/ml. Fifty
microliters of antibody diluted at 1.5 .mu.g/ml (final
concentration was 0.5 .mu.g/ml) were mixed with 50 .mu.l of target
cells, and added to an equivalent volume of PBMC into a U-bottomed
96-well plate. A target to effector ratio of 1:40 was used
throughout the experiments. After 4 hours incubation at 37.degree.
C., cells were centrifuged and 50 .mu.l samples of cell-free
supernatant were collected, transferred to a flat-bottomed 96-well
plate, and assayed. Percentage of lysis was calculated as follows:
(Sample release-Target spontaneous release-Effector spontaneous
release)/(Maximum release-Target spontaneous release)*100; where
Target spontaneous release is the fluorescence from wells which
only contained target cells, Effector spontaneous release is the
fluorescence from wells which only contained effector cells, and
Maximum release is the fluorescence from wells containing target
cells which have been treated with lysis buffer. Background
percentage of lysis obtained in absence of antibody
(Target+Effector cells) was subtracted from percentage of lysis of
sample.
[0256] FIG. 11 show no specific Raji lysis due to IgG control
antibody (Herceptin.RTM., Roche Pharma A.G., Reinach, Switzerland),
and some cytotoxicity for the parental antibody; data shown are the
mean cytotoxicity percentage .+-.SD of triplicate wells using PBMC
isolated from one donor. However, antibody-induced lysis was
increased at least 5 fold for the VH16-R94K/S298A (SEQ ID NO:
114)-VL43-V3Q/T7S/P44I/N92A (SEQ ID NO: 65) antibody and at least
6.8 fold for the VH16-R94K/E269D/S298A (SEQ ID NO:
115)-VL43-V3Q/T7S/P44I/N92A (SEQ ID NO: 65) antibody. This data
demonstrates that selected the anti-CD19 antibody variants have
enhanced cellular cytotoxicity towards CD 19.sup.+ expressing
cells.
Example 12
VH16 R94K-VL43 V3Q/T7S/P44I/N92A Variants with Enhanced
Complement-Mediated Effector Function Based ON Amino-Acids
Substitutions Derived from Human Ig-Gamma3 and Human
Ig-Gamma1/Ig-Gamma3 HInge-Fc Domains Shuffling
[0257] Human IgG3 antibodies have generally enhanced CDC to human
IgG1 antibodies, this due in part because IgG3 Fc has higher
C1q-binding affinity than IgG1 Fc (Schumaker V N et al.,
Biochemistry, 1976, 15:5175-81.)
[0258] Amino acid modifications in the Fc region of VH16 R94K were
undertaken based on the differences in sequence between the
human--IgG3 and human IgG1 Fc portions. In a complementary
approach, a shuffling of the human IgG1 hinge and constant domains
with the hinge and constant domains of the human IgG3 was performed
to generate a chimeric isotype of anti CD19 antibody with enhanced
CDC.
[0259] The study shows that substitution of residues at position
K274 and N276 and a chimeric variant consisting of the CH1 and the
hinge each from IgG1 and the Fc from IgG3 (designated by the 1133
suffix) resulted in an increase of 1.7 and 2.2 fold in CDC,
respectively.
[0260] To create a variant cDNA coding sequence with substitution
of residues at position K274 and N276, a cDNA coding the VH16 R94K
heavy chain (SEQ ID NO: 64) cDNA was converted to heavy chains VH16
R94K/K274Q (SEQ ID NO: 119), VH16 R94K/N276K (SEQ ID NO: 120), VH16
R94K/K334R (SEQ ID NO: 121), VH16 R94K/K274Q/N276K (SEQ ID NO:
122), and VH16 R94K/K274Q/N276K/K334R (SEQ ID NO: 123) by standard
mutagenesis techniques.
[0261] Furthermore by substituting a part of heavy chain gene
(encoding Kabat residues 231 to its carboxyl terminus) in the
expression vector for VH16 R94K-VL43 V3Q/T7S/P44I/N92A IgG1 with
the corresponding part of a human IgG3 heavy chain gene (NCBI
GenBank accession no. X03604.1, residues 161 to 377) a human anti
CD19 VH16 R94K(1133) (SEQ ID NO: 124)-VL43 V3Q/T7S/P44I/N92A (SEQ
ID NO: 65) chimeric isotype was generated.
[0262] These variant coding DNA sequences were ligated in a vector
that is based on a modified pREP4 (Invitrogen, CA, USA) vector
carrying CMV promoter and Bovine Growth Hormone poly-adenylation
signal. In the expression-vector, secretion was driven by the
murine VJ2C leader peptide.
[0263] For transient expression of these variants, equal quantities
of each heavy chain and light chain vectors was co-transfected into
suspension-adapted HEK-EBNA cells (ATCC-CRL-10852) using
Polyethyleneimine (PEI). Typically, 100 ml of cells in suspension
at a density of 0.8-1.2 million cells per ml is transfected with a
DNA-PEI mixture containing 50 .mu.g of expression vector encoding
the variant heavy chain and 50 .mu.g expression vector encoding the
VL43 V3Q/T7S/P44I/N92A (SEQ ID NO: 65) light chain. When
recombinant expression vectors encoding each engineered chain genes
are introduced into the host cells, the construct is produced by
further culturing the cells for a period of 4 to 5 days to allow
for secretion into the culture medium (EX-CELL 293,
HEK293-serum-free medium, Sigma, Buchs, Switzerland), supplemented
with 0.1% pluronic acid, 4 mM glutamine, and 0.25 .mu.g/ml
geneticin). The construct was then purified from cell-free
supernatant using recombinant Streamline rProtein A media (GE,
Switzerland), and used for further analysis.
[0264] The expression levels of these variants are listed in Table
23.
TABLE-US-00023 TABLE 23 IgG transient expression level of VH16
R94K/VL43 V3Q-T7S-P44I-N92A heavy chain variants. Expression
Antibody (mg/L) VH16 R94K/K274Q/N276K-VL43 V3Q/T7S/P44I/N92A 12
VH16 R94K (1133)-VL43 V3Q/T7S/P44I/N92A 21
Complement Mediated Toxicity on Raji Cells
[0265] A cell-based assay was used to measure the capacity of the
variants to mediate CDC according to example 10. Lysis was measured
using release of lactate dehydrogenase (LDH) to monitor lysis of
variant-opsonized Raji cells by baby rabbit complement (Harlan
Laboratories, C-0099F, AN VENRAY, The Netherlands). Target cells
were washed 2 times with complete medium (RPMI-1640 medium (Chemie
Brunschwig AG, PAA, Basel, Switzerland) supplemented with 10% fetal
bovine serum (FBS, Chemie Brunschwig AG, PAA, Basel, Switzerland)
and 1% Ultraglutamine (Lonza, Verviers, Belgium) by centrifugation
and resuspension. Variant-antibodies were added at the indicated
final concentration of 1 .mu.g/ml. Baby rabbit serum was diluted to
5% with complete medium and added to antibody-opsonized target
cells. Plates were incubated for 3 hours at 37.degree. C.
[0266] Cell cytotoxicity was measured using the Cyto Tox 96
Non-Radioactive Cytotoxicity Assay kit (Promega, Madison, USA).
Representative data from this assay is shown in FIG. 12.
[0267] FIG. 12 shows little specific lysis due to IgG1 control.
when compared to the parental antibody, Complement-induced lysis
was increased at least 1.7 fold for the VH16 R94K/K274Q/N276K (SEQ
ID NO: 122)-VL43 V3Q/T7S/P44I/N92A (SEQ ID NO: 65) antibody, 2 fold
for the VH16 R94K/K274Q/N276K/K334R (SEQ ID NO: 123)-VL43
V3Q/T7S/P44I/N92A (SEQ ID NO: 65) antibody and 2.2 fold for VH16
R94K(1133) (SEQ ID NO: 124)-VL43 V3Q/T7S/P44I/N92A (SEQ ID NO: 65)
antibody. FIG. 12 shows results performed in triplicate
.+-.standard deviation.
Example 13
Establishment of Cell Lines for Expression of Anti-CD19
Antibodies
[0268] A high yielding, mammalian protein expression system was
developed. The system is based on a well documented CHO cell line
(CHO-S, Invitrogen, Basel, Switzerland) that was adapted to
suspension growth in a chemically defined serum-free medium, a
highly efficient transfection method and a screening strategy for
identification of clonal populations of high-producer cell lines.
This mammalian protein expression system was used for the stable
expression of humanized variants of the anti CD19 antibody.
[0269] The plasmid carrying the cDNA sequence for the VL43
V3Q/T7S/P44I/N92A light chain (SEQ ID NO: 65) and the plasmid
pAE18_VH16_R94K carrying the cDNA sequence for VH16 R94K heavy
chain (SEQ ID NO: 64) used in Example 1 were both digested with
XbaI and HindIII to release the light and heavy chain inserts.
These inserts were isolated by gel electrophoresis, gel-extracted,
purified and further cloned into the multiple cloning site of an
expression vector based on pGL3 from Promega (Madison, Wis., USA),
that was previously digested with the same restriction enzymes and
prepared using the same gel electrophoresis and purification
methods. This yields two expression plasmids: the pGL41[18_HC]
plasmid and the pGL41[18_LC] plasmid respectively carrying the
heavy chain and the light chain of the VH16 R94K-VL43
V3Q/T7S/P44I/N92A anti CD19 antibody.
[0270] The vector pSV2neo, expressing the geneticin resistance gene
neo was purchased from Clontech (Mountain View, Calif., USA) and
the puromycin resistance vector pSV-Puro was obtained by cloning
the SV40 promoter and the puromycin resistance gene (pac) from
pBABE-Puro (Addgene, Camebridge, Mass., USA) into the pGL3 vector
from Promega. These four plasmids were linearized using a single
restriction site in the ampicillin resistance gene (ampR) and
purified from remaining salts by ethanolic precipitation.
Similarly, expression vectors for further humanization variants
(VH16 R94K/Y100.sub.BF (SEQ ID NO: 66)-VL43 V3Q/T7S/P44I/N92A (SEQ
ID NO: 65) and VH16 R94K/Y100.sub.BF (SEQ ID NO: 66)-VL43
V3Q/T7S/Y32F/P44I/N92A(SEQ ID NO: 67)) were cut out using the same
restriction enzymes as described above and cloned into the pGL41
backbone.
[0271] For stable integration into the host cell line CHO-S
(Invitrogen), cells are seeded in 10 ml at a density of
1.times.10.sup.6 cells per ml in a 50 ml bioreactor filter tube
(TPP, Trasadingen, Switzerland) and cultured overnight. Prior to
transfection, the chemically defined cell culture medium
(PowerCHO2, Lonza, Basel, Switzerland) was replaced with the
transfection medium (Opti-MEM, Invitrogen). Cells were transfected
with 12.5 .mu.g of the linearized vector cocktail containing the
mix of heavy and light chain expression plasmids, pSV-Puro and
pSV2neo using the polykationic transfection agent JetPEI
(Polyplus-transfections, Illkirch, France) according to
manufacturer's instructions. 4-5 hours after transfection, cells
were diluted with 1 volume of growth medium. The following day
cells were diluted in a ratio of 1 to 10, 1 to 20 or 1 to 30 in
growth medium containing 5.0 .mu.g/ml of puromycin and 500 ug/ml
geneticin and distributed in 96 well plates. After 14 days of
selection, drug resistant colonies were assayed using an antibody
specific-ELISA and positive individual clones were amplified for
antibody production analysis. The best performing clones were
diluted at the concentrations 1, 10 and 100 cells/ml in cell
culture medium (PowerCHO2, Lonza) in order to obtain clonal
populations. Finally, best producing clones yielded titers in the
range of 400 to 600 mg/L for the VH16 R94K-VL43 V3Q/T7S/P44I/N92A
antibody and 200-300 mg/L for the VH16 R94K/Y100.sub.BF-VL43
V3Q/T7S/P44I/N92A and VH16 R94K/Y100.sub.BF-VL43
V3Q/T7S/Y32F/P44I/N92A antibodies in a 12 day shaken-batch assay
using the PowerCHO2 cell culture medium supplemented with
glutamine.
Example 14
Production of Defucosylated Variants of Anti CD19 Antibody
[0272] In mammals, fucose residues are attached to innermost GlcNAc
residue of almost all complex-type Asn-linked oligosaccharides via
an .alpha.1,6 linkage. A stable cell line expressing the rat
beta-1,4-mannosyl-glycoprotein
4-beta-N-acetylglucosaminyltransferase (GNTIII) enzyme was
prepared. This enzyme introduces a bisecting N-Acetylglucosamine in
the N-linked oligosaccharides of glycoproteins like for example
antibodies. Such modification turns the antibody's Fc
oligosaccharide into an inaccessible substrate for the enzyme Fut8
which transfers a fucose residue to the reducing
N-Acetylglucosamine of glycan tree (Longmore and Schachter, 1982,
Carbohydr Res 365-92), thereby inhibiting fucosylation. The rat
gntIII gene was ordered from Imagenes (Berlin, Germany) and
amplified using specific primers. The amplicon was then digested
using the enzymes BamHI and HindIII, gel purified and cloned into
the BamHI, HindIII opened multiple cloning site of the expressing
vector pGLEX33; a mammalian expression vector based on the pcDNA3.1
plasmid from Invitrogen (Basel, Switzerland) under control of the
mouse CMV promoter. The resulting vector was called pGNTIII.
[0273] The puromycin resistance vector pSV-Puro was obtained by
cloning the SV40 promoter and the puromycin resistance gene (pac)
from pBABE-Puro (Addgene, Camebridge, Mass., USA) into the pGL3
vector from Promega (Madison, Wis., USA. The two plasmids were
linearized using a single restriction site in the ampicillin
resistance gene (ampR) and purified from remaining salts by
ethanolic precipitation.
[0274] For stable integration into the host cell line CHO-S
(Invitrogen), cells are seeded in 10 ml at a density of
1.times.10.sup.6 cells per ml in a 50 ml bioreactor filter tube
(TPP, Trasadingen, Switzerland) and cultured overnight. Prior to
transfection, the chemically defined cell culture medium
(PowerCHO2, Lonza, Basel, Switzerland) was replaced with the
transfection medium (Opti-MEM, Invitrogen). Cells were transfected
with 12.5 .mu.g of the linearized vector cocktail containing the
mix of pGNTIII and pSV-Puro using the polykationic transfection
agent JetPEI (Polyplus-transfections, Illkirch, France) according
to manufacturer's instructions. 4-5 hours after transfection, cells
were diluted with 1 volume of growth medium. The following day
cells were diluted in a ratio of 1 to 10, 1 to 20 or 1 to 30 in
growth medium containing 5.0 .mu.g/ml of puromycin and distributed
in 96 well plates. After 14 days of selection, drug resistant
colonies expressing the rat GNTIII gene were isolated.
[0275] A second stable cell line was prepared using the CHO-S cell
line from Invitrogen. The cells were transfected with a vector
expressing two small hairpin RNAs (shRNA) that knock down the
enzymes Fut8 (.alpha.1,6-fucosyltransferase) and GMD (GDP-mannose
4,6-dehydratase) using the shRNA sequences described previously
(Imai-Nishiya et al. 2007, BMC Biotechnol., 7:84) under control of
the human U6 promoter and the tRNA.sup.val promoter. The construct
was ordered from GeneArt A.G. (Regensburg, Germany). In detail, the
tRNA.sup.val promoter controls the expression of the Fut8 specific
shRNA and the U6 promoter controls the expression of the GMD
specific shRNA. The construct was flanked by NheI and NruI sites,
and these restriction sites were used to clone the digested and gel
purified fragment into the vector backbone of pGLEX1 (a modified
version of pcDNA3.1 (Invitrogen) previously digested with the same
enzymes.
[0276] The combined knockdown of these two enzymes of the de-novo
pathway has been shown to have synergistic effects in promoting the
absence of fucose in the N-linked oligosaccharide structure of IgG1
(Imai-Nishiya et al. 2007, BMC Biotechnol. 7:84), if the cells were
cultured in the absence of fucose. In presence of fucose the
reduction of the fucosylation would rely only on the knockdown of
the Fut8 enzyme as the GMD enzyme is not part of the salvage
pathway. The cells transfected with the double knockdown expression
cassettes were previously shown to have lost 90-98% of the
fucosylation in the N-linked oligosaccharides (Imai-Nishiya et al.
2007, BMC Biotechnol., 7:84). For stable integration into the host
cell line CHO-S (Invitrogen), the siRNA vector was linearized using
a single restriction site in the ampicillin resistance. The cells
were co-transfected with a selection plasmid and selected as
described above for the
[0277] The two cell lines were transiently transfected with
plasmids encoding both the VH16 R94K (SEQ ID NO: 64)-VL43
V3Q/T7S/P44I/N92A (SEQ ID NO: 65) antibody and the VH16
R94K/E269D/S298A (SEQ ID NO: 115)-VL43 V3Q/T7S/P44I/N92A (SEQ ID
NO: 65) antibody as described in Example 1 and 11,
respectively.
[0278] For the transient transfection, cells were seeded in 200 ml
at a density of 1.times.10.sup.6 cells per ml in a 1000 ml round
Schott bottle and cultured overnight. Prior to transfection, the
chemically defined cell culture medium (PowerCHO2, Lonza) was
replaced with 100 ml of the transfection medium (Opti-MEM,
Invitrogen). Cells were transfected with 250 .mu.g of the vector
cocktail containing a mix of 50% heavy chain and 50% light chain
DNA using the polykationic transfection agent JetPEI
(Polyplus-transfections) according to manufacturer's instructions.
4-5 hours after transfection, cells were diluted with 1 volume of
growth medium. The medium was harvested on day 5. After
centrifugation, the supernatant was filtered (0.2 .mu.m) and
purified by protein-A affinity chromatography (Hitrap, GE
healthcare, Zurich, Switzerland) on an Akta purifier system (GE
healthcare). The ADCC assays were performed as described in example
11.
[0279] Antibody variants produced in the shRNA and the GNTIII cell
lines described above are respectively designated by the shRNA or
GNTIII suffix. FIG. 13 shows that defucosylated variants have
increased ADCC over their fucosylated parental antibody by at least
2 fold.
Example 15
The Effect of Anti-CD19 Antibody on B-Cell Engraftment in Humanized
SCID Mice
[0280] This study was designed to assess the in vivo effect of
anti-CD19 treatment of huPBL SCID mice. Before the start of
treatment, 30 healthy female severe combined immunodeficiency
(SCID, HARLAN) mice, 5-6 weeks-old and weighing 16-20 g were
randomized based on body weight into one group of 2 animals and 4
groups of 7 animals. The mean body weight of each group was
comparable and not statistically different from the other groups
(analysis of variance). All mice were then submitted to whole body
irradiation using a .gamma.-source (1.8 Gy, 60Co, NRA BRETENIERE,
Dijon, France) at D0. At D1 and D8, mice received a single SC
injection of NK-cell depleting Ab (mCD122 antigen, Rat IgG2b
isotype, TM-Beta 1, BioXCell, USA) at 20 mg/kg.
[0281] Four freshly collected buffy coat samples from healthy
volunteer donors were obtained and the peripheral blood mononuclear
cells (PBMCs) were purified using gradient centrifugation according
to the Ficoll-Paque.RTM. plus procedure (Ref 07907, StemCell
Technologies) within 48 h after total blood collection. The
viability of PBMCs was assessed by 0.25% trypan blue exclusion
before in vivo injection. At D3, mice were IP injected with
3.times.10.sup.7 hPBMCs (500 .mu.L in PBS by IP route) from donors
#1, #2 and #3 (Groups 2 to 5, 2-3 mice per donor) or with PBS
(Group 1). At D14, mice from groups 2, 3, 4 and 5 received a single
IV injection of Herceptin.RTM. (negative control, 21.0 mg/ml, Batch
No B1492), Mabthera.RTM. (positive control, 10.0 mg/ml, Batch No
B2136), anti-CD 19 antibody variant VH16 R94K (SEQ ID NO: 64)-VL43
V3Q/T7S/P44I/N92A (SEQ ID NO: 65) or anti-CD 19 antibody variant
VH16 R94K/S324N (SEQ ID NO: 118)-VL43 V3Q/T7S/P44I/N92A (SEQ ID NO:
65) at 10 mg/kg/inj, respectively. The treatment schedule is
summarized in the table 24 below:
TABLE-US-00024 TABLE 24 Treatment schedule NK-cell depleting No. AB
Treatment Group mice Irradiation (D1, D8) HPBMC (D3) (D14, Q1Dx1) 1
2 Yes Yes No (PBS) No 2 7 Yes Yes 3 donors Herceptin .RTM. (10
mg/kg, IV) 2-3 mice/donor 3 7 Yes Yes 3 donors Mabthera .RTM. (10
mg/kg, IV) 2-3 mice/donor 4 7 Yes Yes 3 donors VH16 R94K-VL43 2-3
mice/donor V3Q/T7S/P44I/N92A (10 mg/kg, IV) 5 7 Yes Yes 3 donors
VH16 R94K/S324N-VL43 2-3 mice/donor V3Q/T7S/P44I/N92A (10 mg/kg,
IV)
[0282] The human B lymphocytes in the spleens were detected by
4-color flow cytometry analysis. For each sample, the human B
lymphocytes cells were quantified using cell surface expression of
hCD45(+), mCD45(-), hCD20(+) and hCD19(+) and PKH26 reference
microbeads (Ref P7458, Sigma). Antibodies described in table 25
below were used.
TABLE-US-00025 TABLE 25 Antibodies for detection of human B
lymphocytes cells Antigens Clone Isotype Fluorochrome Ref hCD19 4G7
Mouse IgG.sub.1, .kappa. PerCP BD.sup.a 345778 hCD45 H130 APC BD
555485 hCD20 L27 FITC BD 345792 mCD45 30-F11 Rat IgG.sub.2b,
.kappa. APC-Cy7 BD 557659 mIgG.sub.1 MOPC-21 Mouse IgG.sub.1 FITC
BD 555748 mIgG.sub.1 X40 PerCP BD 345817 mIgG.sub.1 MOPC-21 APC BD
555751 rIgG.sub.2b A95-1 Rat IgG.sub.2b, .kappa. APC-Cy7 BD 552773
.sup.aBD: Becton Dickinson Biosciences, Le Pont de Claix.
France
[0283] For the CD marker expression analyses, 100 000 cells from
spleens in 200 .mu.L staining buffer [PBS (Ref 17-516F, Lonza),
0.2% BSA (Ref A7030, Sigma) 0.02% NaN3 (Ref S2002, Sigma)] were
incubated in the dark for 20 min at room temperature with either a
mixed solution of hCD19 PerCP, hCD20 FITC, hCD45 APC and mCD45
APC-Cy7 antibodies or a mixed solution of mIgG 1-FITC,
rIgG2b-APC-Cy7, mIgG 1-APC and mIgG1-PerCP antibodies. Isotype
control antibodies were used in each case as negative controls.
[0284] The red blood cells were lysed using the "Fix and Lyse"
procedure. Briefly, "Fix and Lyse" buffer was prepared by adding 25
.mu.L of IOTest 3 10.times. Fixative Solution (Ref A07800, Beckman
Coulter) to 1 mL of VersaLyse (Ref A09777, Beckman Coulter) and 1
ml of the mixture was added to the stained cells. After being
vortexed and incubated for 10 min in the dark at room temperature,
cells were centrifuged and washed once with 3 mL of staining buffer
and resuspended in 0.5 mL of reference microbeads solution (PKH26,
Ref P7458, Sigma, 1/2 diluted in staining buffer). The samples were
stored on ice protected from light exposure until FACS analysis.
The stained cells were analyzed with a CyFlow.RTM. space flow
cytometer (Partec S.A.R.L.) using a 488 nm wavelength laser
excitation. The acquisition was stopped after a total of 10,000
hCD45(+) (if achievable) were collected for each sample. All the
events were saved during the acquisition.
[0285] FACS results were represented by dot plot showing FSC versus
SSC parameters (forward and side scatter detectors) in order to
visualize cells size and complexity, and by dot plots showing the
hCD45 (FITC) fluorescence intensities.
[0286] Calculation of absolute cell counts was achieved by using
the following formula:
A C N = C N B N .times. beads concentration 2 .times. V f .times. 1
V i ##EQU00001##
Where:
[0287] ACN was the absolute cell number per .mu.L
[0288] CN was the cell number.
[0289] BN was the bead number.
[0290] The beads concentration was specified at a latter date as
depending on the batch provided by the manufacturer.
[0291] Vf (expressed in mL) was the volume of microbeads solution
used to resuspended the cell pellet.
[0292] Vi (expressed in .mu.L) was the initial volume of blood used
for FACS analysis.
[0293] The individual ACN of total B cells in the spleens of
engrafted SCID mice at D18 are presented in FIG. 14. The individual
percentage of total B cells in spleens of engrafted SCID mice at
D18 are presented in FIG. 15.
[0294] All mice, except one mouse from group hPBMC & anti-CD 19
variant V18 (mouse No 3817), were successfully engrafted with
hPBMCs, resulting in detection of circulating human CD45+
leucocytes in mouse blood. The level of human CD45+ leucocytes was
over to 15% of blood cells in most of the mice transplanted with
hPBMC. Moreover, high levels of human cell reconstitution (reaching
31-73% hCD45+ leucocytes in blood cells) was observed in 52% of
engrafted mice. Levels of hCD45+ leucocytes were unchanged or
increased during the course of the experiment, reflecting the
engraftment efficiency of SCID mice transplanted with human PBMC.
Human CD45+ leucocytes were also detected in spleens 18 days after
transplantation and the average engraftment level was approximately
45% hCD45+ cell in spleen cells.
[0295] The human B cell populations in the spleens were analyzed
when mice were killed 4 days after dosing; that is to say 18 days
after transplantation. In all engrafted mice from the negative
control group, the spleens contained 5 to 11% B cells in hCD45+
leucocytes. Human B cells in the spleens constituted of either
hCD19+ or hCD20+ single-positive cells as well as hCD19+ hCD20+
double-positive B cells. Only low levels (<3%) of human B cells
were detected in the spleens from mice treated with Mabthera.RTM.,
anti-CD 19 antibody variant VH16 R94K-VL43 V3Q/T7S/P44I/N92A or
anti-CD 19 antibody variant VH16 R94K/S324N-VL43 V3Q/T7S/P44I/N92A
and the decrease of the human B cell population was statistically
significant in comparison with the Herceptin.RTM. group. On the
other hand, no statistical difference was observed in the B cell
depletion in the spleens between anti-CD 19 variant antibody VH16
R94K-VL43 V3Q/T7S/P44I/N92A or anti-CD 19 antibody variant VH16
R94K/S324N-VL43 V3Q/T7S/P44I/N92A and Mabthera.RTM. treatment.
[0296] Results demonstrated that a single IV injection of anti-CD
19 antibody variant VH16 R94K-VL43 V3Q/T7S/P44I/N92A or anti-CD 19
antibody variant VH16 R94K/S324N-VL43 V3Q/T7S/P44I/N92A at 10 mg/kg
resulted in a B cell depletion in the spleens of treated mice and
the response to the GBR antibodies was equivalent in intensity to
that of Mabthera.RTM..
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 126 <210> SEQ ID NO 1 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: FMC63-VH NCBI-CAA74659
<400> SEQUENCE: 1 Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu
Val Ala Pro Ser Gln 1 5 10 15 Ser Leu Ser Val Thr Cys Thr Val Ser
Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Ile Arg Gln
Pro Pro Arg Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp Gly
Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Leu
Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu 65 70 75 80 Lys
Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90
95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln
100 105 110 Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> SEQ
ID NO 2 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: FMC63-VL NCBI-CAA74660 <400> SEQUENCE: 2 Asp Ile
Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15
Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20
25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu
Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile
Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln
Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys
Leu Glu Ile Thr 100 105 <210> SEQ ID NO 3 <211> LENGTH:
94 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGKV087
[V1-5*03] <400> SEQUENCE: 3 Asp Ile Gln Met Thr Gln Ser Pro
Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Ser Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys
Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Tyr 85
90 <210> SEQ ID NO 4 <211> LENGTH: 94 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: humIGKV106 [V1-27*01] <400>
SEQUENCE: 4 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly
Ile Ser Asn Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys
Val Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala
Thr Tyr Tyr Cys Gln Lys Tyr Asn Ser Ala 85 90 <210> SEQ ID NO
5 <211> LENGTH: 94 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: humIGKV115 [V1-39*01] <400> SEQUENCE: 5 Asp Ile
Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr 20
25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu
Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln
Gln Ser Tyr Ser Thr 85 90 <210> SEQ ID NO 6 <211>
LENGTH: 94 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGKV094
[V1-12*01] <400> SEQUENCE: 6 Asp Ile Gln Met Thr Gln Ser Pro
Ser Ser Val Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe 85
90 <210> SEQ ID NO 7 <211> LENGTH: 213 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: donor amplified cDNA clone#39
<400> SEQUENCE: 7 Asp Ile Val Met Thr Gln Ser Pro Ser Thr Leu
Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Gln Ser Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser
Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser
Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp
Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Leu Trp Thr 85 90
95 Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala Pro
100 105 110 Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser
Gly Thr 115 120 125 Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
Arg Glu Ala Lys 130 135 140 Val Gln Trp Lys Val Asp Asn Ala Leu Gln
Ser Gly Asn Ser Gln Glu 145 150 155 160 Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr Tyr Ser Leu Ser Ser 165 170 175 Thr Leu Thr Leu Ser
Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala 180 185 190 Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe 195 200 205 Asn
Arg Gly Glu Cys 210 <210> SEQ ID NO 8 <211> LENGTH: 214
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: donor amplified cDNA
clone#40 <400> SEQUENCE: 8 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Gly Tyr Tyr 20 25 30 Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Lys Val Pro Asn Leu Leu Ile 35 40 45 Tyr Ala
Ala Ser Thr Leu Arg Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr
Leu Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser
Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185
190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
195 200 205 Phe Asn Arg Gly Glu Cys 210 <210> SEQ ID NO 9
<211> LENGTH: 214 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
donor amplified cDNA clone#43 <400> SEQUENCE: 9 Asp Ile Val
Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp
Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr 20 25
30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe
Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Ser Tyr Ser Thr Pro Leu 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val
Asp Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile Phe
Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val
Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys Val
Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155
160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser
165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys
Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro
Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210 <210>
SEQ ID NO 10 <211> LENGTH: 214 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: donor amplified cDNA clone#44 <400>
SEQUENCE: 10 Asp Ile Val Met Thr Gln Ser Pro Ser Ser Met Ser Ala
Ser Ile Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Gly Ile Thr Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Asn Leu Leu Ile 35 40 45 Tyr Gly Ser Ser Ser Leu Gln
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Phe Pro Tyr 85 90 95 Thr
Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala Ala 100 105
110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly
115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg
Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser
Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys
Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys
Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr
His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg
Gly Glu Cys 210 <210> SEQ ID NO 11 <211> LENGTH: 98
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: humIGHV199 [V3-33*01]
<400> SEQUENCE: 11 Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg <210> SEQ ID NO 12 <211> LENGTH: 98
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: humIGHV175 [V3-11*01]
<400> SEQUENCE: 12 Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Ile Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Ser
Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg <210> SEQ ID NO 13 <211> LENGTH: 98
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: humIGHV195 [V3-30*18]
<400> SEQUENCE: 13 Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser
Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg <210> SEQ ID NO 14 <211> LENGTH: 98
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: humIGHV031 [V3-48*01]
<400> SEQUENCE: 14 Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ser Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Ser
Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg <210> SEQ ID NO 15 <211> LENGTH: 233
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: donor amplified cDNA
clone#2 <400> SEQUENCE: 15 Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val
Ile Trp Tyr Asp Ser Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Thr Thr Asp Leu Leu Ala Ala Pro Thr Ser Arg Gly
Tyr Gly Asp Tyr 100 105 110 Leu Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly
Thr Leu Val Thr Val Ser 115 120 125 Ser Gly Ser Ala Ser Ala Pro Thr
Leu Phe Pro Leu Val Ser Cys Glu 130 135 140 Asn Ser Pro Ser Asp Thr
Ser Ser Val Ala Val Gly Cys Leu Ala Gln 145 150 155 160 Asp Phe Leu
Pro Asp Ser Ile Thr Phe Ser Trp Lys Tyr Lys Asn Asn 165 170 175 Ser
Asp Ile Ser Ser Thr Arg Gly Phe Pro Ser Val Leu Arg Gly Gly 180 185
190 Lys Tyr Ala Ala Thr Ser Gln Val Leu Leu Pro Ser Lys Asp Val Met
195 200 205 Gln Gly Thr Asp Glu His Val Val Cys Lys Val Gln His Pro
Asn Gly 210 215 220 Asn Lys Glu Lys Asn Val Pro Leu Pro 225 230
<210> SEQ ID NO 16 <211> LENGTH: 228 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: donor amplified cDNA clone#5
<400> SEQUENCE: 16 Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Asp 20 25 30 Tyr Met Ser Trp Ile Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Val
Ser Ser Gly Thr Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80
Leu Gln Met Asp Ser Leu Arg Val Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Gly Ala Gly Gly Leu Val Ser Ala Ala Gly Arg Ala Ala Pro
Arg 100 105 110 Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly
Ser Ala Ser 115 120 125 Ala Pro Thr Leu Phe Pro Leu Val Ser Cys Glu
Asn Ser Pro Ser Asp 130 135 140 Thr Ser Ser Val Ala Val Gly Cys Leu
Ala Gln Asp Phe Leu Pro Asp 145 150 155 160 Ser Ile Thr Phe Ser Trp
Lys Tyr Lys Asn Asn Ser Asp Ile Ser Ser 165 170 175 Thr Arg Gly Phe
Pro Ser Val Leu Arg Gly Gly Lys Tyr Ala Ala Thr 180 185 190 Ser Gln
Val Leu Leu Pro Ser Lys Asp Val Met Gln Gly Thr Asp Glu 195 200 205
His Val Val Cys Lys Val Gln His Pro Asn Gly Asn Lys Glu Lys Asn 210
215 220 Val Pro Leu Pro 225 <210> SEQ ID NO 17 <211>
LENGTH: 222 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: donor amplified
cDNA clone#16 <400> SEQUENCE: 17 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55
60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Val Gly Gly Gly Ser Ser Phe Asp Tyr Trp
Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Gly Ser Ala Ser
Ala Pro Thr Leu Phe Pro 115 120 125 Leu Val Ser Cys Glu Asn Ser Pro
Ser Asp Thr Ser Ser Val Ala Val 130 135 140 Gly Cys Leu Ala Gln Asp
Phe Leu Pro Asp Ser Ile Thr Phe Ser Trp 145 150 155 160 Lys Tyr Lys
Asn Asn Ser Asp Ile Ser Ser Thr Arg Gly Phe Pro Ser 165 170 175 Val
Leu Arg Gly Gly Lys Tyr Ala Ala Thr Ser Gln Val Leu Leu Pro 180 185
190 Ser Lys Asp Val Met Gln Gly Thr Asp Glu His Val Val Cys Lys Val
195 200 205 Gln His Pro Asn Gly Asn Lys Glu Lys Asn Val Pro Leu Pro
210 215 220 <210> SEQ ID NO 18 <211> LENGTH: 224
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: donor amplified cDNA
clone#20 <400> SEQUENCE: 18 Gln Val Gln Leu Val Gln Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys
Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Trp Met Ser Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr
Ile Val Ser Ser Gly Thr Asn Lys Tyr Tyr Ala Val Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Gly Ser Ile Met Gly Ala Glu Phe Phe Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Gly Ser
Ala Ser Ala Pro Thr Leu 115 120 125 Phe Pro Leu Val Ser Cys Glu Asn
Ser Pro Ser Asp Thr Ser Ser Val 130 135 140 Ala Val Gly Cys Leu Ala
Gln Asp Phe Leu Pro Asp Ser Ile Thr Phe 145 150 155 160 Ser Trp Lys
Tyr Lys Asn Asn Ser Asp Ile Ser Ser Thr Arg Gly Phe 165 170 175 Pro
Ser Val Leu Arg Gly Gly Lys Tyr Ala Ala Thr Ser Gln Val Leu 180 185
190 Leu Pro Ser Lys Asp Val Met Gln Gly Thr Asp Glu His Val Val Cys
195 200 205 Lys Val Gln His Pro Asn Gly Asn Lys Glu Lys Asn Val Pro
Leu Pro 210 215 220 <210> SEQ ID NO 19 <211> LENGTH:
120 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH2 <400>
SEQUENCE: 19 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr 85 90 95 Thr
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
20 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH5 <400> SEQUENCE: 20 Glu Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val
Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45
Ser Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50
55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
Leu 65 70 75 80 Gln Met Asp Ser Leu Arg Val Glu Asp Thr Ala Val Tyr
Tyr Cys Ala 85 90 95 Gly His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met
Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115
120 <210> SEQ ID NO 21 <211> LENGTH: 120 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16 <400> SEQUENCE: 21 Gln
Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr
20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn
Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser
Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly
Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val
Thr Val Ser Ser 115 120 <210> SEQ ID NO 22 <211>
LENGTH: 120 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH20
<400> SEQUENCE: 22 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 23 <211> LENGTH: 112 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VL39 <400> SEQUENCE: 23 Asp Ile Val Met
Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35
40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly
Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu
Ile Lys Arg Thr Val Ala Ala 100 105 110 <210> SEQ ID NO 24
<211> LENGTH: 112 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL40
<400> SEQUENCE: 24 Asp Ile Val Met Thr Gln Thr Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Val Pro Asn Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala
Ala 100 105 110 <210> SEQ ID NO 25 <211> LENGTH: 112
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43 <400> SEQUENCE:
25 Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser
Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro
Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val
Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr
Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr
Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro
Gly Thr Lys Val Asp Ile Lys Arg Thr Val Ala Ala 100 105 110
<210> SEQ ID NO 26 <211> LENGTH: 112 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL44 <400> SEQUENCE: 26 Asp
Ile Val Met Thr Gln Ser Pro Ser Ser Met Ser Ala Ser Ile Gly 1 5 10
15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr
20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu
Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr
Lys Leu Glu Ile Lys Arg Thr Val Ala Ala 100 105 110 <210> SEQ
ID NO 27 <211> LENGTH: 10 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: HCDR1 <400> SEQUENCE: 27 Gly Val Ser Leu Pro Asp
Tyr Gly Val Ser 1 5 10 <210> SEQ ID NO 28 <211> LENGTH:
16 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: HCDR2
<400> SEQUENCE: 28 Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
Asn Ser Ala Leu Lys Ser 1 5 10 15 <210> SEQ ID NO 29
<211> LENGTH: 12 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
HCDR3 <400> SEQUENCE: 29 His Tyr Tyr Tyr Gly Gly Ser Tyr Ala
Met Asp Tyr 1 5 10 <210> SEQ ID NO 30 <211> LENGTH: 11
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: LCDR1 <400> SEQUENCE:
30 Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn 1 5 10 <210>
SEQ ID NO 31 <211> LENGTH: 7 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: LCDR2 <400> SEQUENCE: 31 His Thr Ser Arg
Leu His Ser 1 5 <210> SEQ ID NO 32 <211> LENGTH: 9
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: LCDR3 <400> SEQUENCE:
32 Gln Gln Gly Asn Thr Leu Pro Tyr Thr 1 5 <210> SEQ ID NO 33
<211> LENGTH: 120 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-G42R <400> SEQUENCE: 33 Gln Val Gln Leu Val Gln Ser Gly
Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp
Val Arg Gln Ala Pro Arg Lys Gly Leu Glu Trp Val 35 40 45 Ala Val
Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60
Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65
70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120
<210> SEQ ID NO 34 <211> LENGTH: 120 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-F67L <400> SEQUENCE: 34
Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5
10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp
Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
Asn Ser Ala Leu Lys 50 55 60 Ser Arg Leu Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr
Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser 115 120 <210> SEQ ID NO 35 <211>
LENGTH: 120 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-R71K
<400> SEQUENCE: 35 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Lys Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 36 <211> LENGTH: 120 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VH16-L78V <400> SEQUENCE: 36 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser 115 120 <210> SEQ ID NO 37 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K <400>
SEQUENCE: 37 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
38 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43-P44V <400> SEQUENCE: 38 Asp Ile Val Met Thr
Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu
Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Val Lys Leu Leu Ile 35 40
45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn
Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile
Lys 100 105 <210> SEQ ID NO 39 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-F71Y <400>
SEQUENCE: 39 Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala
Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID
NO 40 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43-Y87F <400> SEQUENCE: 40 Asp Ile Val Met Thr
Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu
Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Asn
Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile
Lys 100 105 <210> SEQ ID NO 41 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-V3Q/T7S <400>
SEQUENCE: 41 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID
NO 42 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-Q6E <400> SEQUENCE: 42 Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly
Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys
50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala
Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser
115 120 <210> SEQ ID NO 43 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-Y32F/R94K <400>
SEQUENCE: 43 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Phe 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
44 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-R94K/Y96F <400> SEQUENCE: 44 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Phe Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser 115 120 <210> SEQ ID NO 45 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/Y97F <400>
SEQUENCE: 45 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Phe Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
46 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-R94K/Y98F <400> SEQUENCE: 46 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Phe Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser 115 120 <210> SEQ ID NO 47 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/Y100bF
<400> SEQUENCE: 47 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Phe Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 48 <211> LENGTH: 107 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VL43-Y32F <400> SEQUENCE: 48 Asp Ile Val
Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp
Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Phe 20 25
30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe
Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val
Asp Ile Lys 100 105 <210> SEQ ID NO 49 <211> LENGTH:
107 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43-P44I
<400> SEQUENCE: 49 Asp Ile Val Met Thr Gln Thr Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105
<210> SEQ ID NO 50 <211> LENGTH: 107 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-P44L <400> SEQUENCE: 50
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Leu Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 51
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-N92A <400> SEQUENCE: 51 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His
Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu
Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100
105 <210> SEQ ID NO 52 <211> LENGTH: 107 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-T93V <400> SEQUENCE: 52
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Asn Val Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 53
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-T93A <400> SEQUENCE: 53 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His
Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Ala Leu
Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100
105 <210> SEQ ID NO 54 <211> LENGTH: 120 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-R94K/Y97W <400> SEQUENCE:
54 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro
Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr
Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp
Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg
Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Trp
Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr
Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO 55
<211> LENGTH: 120 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-Y32F/R94K/Y97F <400> SEQUENCE: 55 Gln Val Gln Leu Val
Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Phe 20 25 30 Gly
Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys
50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Phe Tyr Gly Gly Ser Tyr Ala
Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser
115 120 <210> SEQ ID NO 56 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-Y32F/P44I <400>
SEQUENCE: 56 Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala
Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Ile Ser Lys Phe 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID
NO 57 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43-V3Q/T7S/N92A <400> SEQUENCE: 57 Asp Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp
Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25
30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe
Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Gly Ala Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val
Asp Ile Lys 100 105 <210> SEQ ID NO 58 <211> LENGTH:
107 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION:
VL43-V3Q/T7S/Y32F/N92A <400> SEQUENCE: 58 Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Phe 20 25 30 Leu
Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala
Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile
Lys 100 105 <210> SEQ ID NO 59 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-V3Q/T7S/P44I/N92A
<400> SEQUENCE: 59 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105
<210> SEQ ID NO 60 <211> LENGTH: 107 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-V3Q/T7S/Y32F/P44I/N92A
<400> SEQUENCE: 60 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Phe 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105
<210> SEQ ID NO 61 <211> LENGTH: 107 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-F71H <400> SEQUENCE: 61
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp His Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 62
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-F71S <400> SEQUENCE: 62 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His
Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Ser Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu
Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100
105 <210> SEQ ID NO 63 <211> LENGTH: 107 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-F71T <400> SEQUENCE: 63
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Thr Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 64
<211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-- R94K heavy chain <400> SEQUENCE: 64 Gln Val Gln Leu
Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30
Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu
Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr
Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser
Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro
Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys
Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160
Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165
170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val
Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val
Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu
Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro
Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe
Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro
Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro
Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285
Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290
295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro
Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro
Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu
Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly
Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu
Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410
415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His
420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu
Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID NO 65
<211> LENGTH: 214 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-- V3Q/T7S/P44I/N92A light chain <400> SEQUENCE: 65 Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10
15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr
20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Ile Lys Leu
Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln Gly Ala Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr
Lys Val Asp Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val Phe
Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala
Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140
Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145
150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser
Leu Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys
His Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu Ser
Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210
<210> SEQ ID NO 66 <211> LENGTH: 450 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-- R94K Y100BF heavy chain
<400> SEQUENCE: 66 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Phe Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210
215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly
Lys 450 <210> SEQ ID NO 67 <211> LENGTH: 214
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43--
V3Q/T7S/Y32F/P44I/N92A light chain <400> SEQUENCE: 67 Asp Ile
Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Phe 20
25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Ile Lys Leu Leu
Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln
Gln Gly Ala Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys
Val Asp Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile
Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser
Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys
Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150
155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu
Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His
Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser
Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210
<210> SEQ ID NO 68 <211> LENGTH: 450 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: FMC63 chimeric Heavy Chain
<400> SEQUENCE: 68 Glu Val Lys Leu Gln Glu Ser Gly Pro Gly
Leu Val Ala Pro Ser Gln 1 5 10 15 Ser Leu Ser Val Thr Cys Thr Val
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Ile Arg
Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu 65 70 75 80
Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Ser Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210
215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly
Lys 450 <210> SEQ ID NO 69 <211> LENGTH: 214
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: FMC63 chimeric Light Chain
<400> SEQUENCE: 69 Asp Ile Gln Met Thr Gln Thr Thr Ser Ser
Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80
Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Arg Thr Val Ala
Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205
Phe Asn Arg Gly Glu Cys 210 <210> SEQ ID NO 70 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Table-1 Fwd
Primer <400> SEQUENCE: 70 gatcggatcc actggtgata ttgtgatgac
ycagwctcc 39 <210> SEQ ID NO 71 <211> LENGTH: 36
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: Table-1 Rev Primer
<400> SEQUENCE: 71 gatcgcggcc gcacactctc ccctgttgaa gctctt 36
<210> SEQ ID NO 72 <211> LENGTH: 36 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Table-2 Fwd Primer I <400>
SEQUENCE: 72 gatcggatcc actggtgagg tgcagctggt ggagtc 36 <210>
SEQ ID NO 73 <211> LENGTH: 36 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: Table-2 Rev Primer <400> SEQUENCE: 73
gatcgcggcc gctggaagag gcacgttctt ttcttt 36 <210> SEQ ID NO 74
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
CMV-IE Forward <400> SEQUENCE: 74 cgcaaatggg cggtaggcgt g 21
<210> SEQ ID NO 75 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: BGH Reverse <400> SEQUENCE: 75
tagaaggcac agtcgagg 18 <210> SEQ ID NO 76 <211> LENGTH:
52 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH2 mCDR1
linker Reverse <400> SEQUENCE: 76 gctcacgccg tagtcgggca
ggctcacgcc agacgctgca caggagagtc tc 52 <210> SEQ ID NO 77
<211> LENGTH: 50 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH2
mCDR1 linker Forward <400> SEQUENCE: 77 ggcgtgagcc tgcccgacta
cggcgtgagc tgggtccgcc aggctccagg 50 <210> SEQ ID NO 78
<211> LENGTH: 61 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH2
mCDR2 linker Reverse <400> SEQUENCE: 78 ggcgctgttg tagtaggttg
tctcggagcc ccagatcact gccacccact ccagcccctt 60 g 61 <210> SEQ
ID NO 79 <211> LENGTH: 66 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH2 mCDR2 linker Forward <400> SEQUENCE: 79
ggctccgaga caacctacta caacagcgcc ctgaagagcc gattcaccat ctccagagac
60 aattcc 66 <210> SEQ ID NO 80 <211> LENGTH: 51
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH2 mCDR3 linker Reverse
<400> SEQUENCE: 80 catggcgtag ctgccgccgt agtagtagtg
tgtggtacag taatacacgg c 51 <210> SEQ ID NO 81 <211>
LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH2 mCDR3
linker Forward <400> SEQUENCE: 81 cactactact acggcggcag
ctacgccatg gactactggg gccagggaac cctg 54 <210> SEQ ID NO 82
<211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH5
mCDR1 linker Reverse <400> SEQUENCE: 82 gctcacgccg tagtcgggca
ggctcacgcc agaggctgca caggagagtc tc 52 <210> SEQ ID NO 83
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH5
mCDR1 linker Forward <400> SEQUENCE: 83 ggcgtgagcc tgcccgacta
cggcgtgagc tggatccgcc aggctccagg g 51 <210> SEQ ID NO 84
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH5
mCDR2 linker Forward <400> SEQUENCE: 84 ggctccgaga caacctacta
caacagcgcc ctgaagagcc gattcaccat ctccagggac 60 aacgcc 66
<210> SEQ ID NO 85 <211> LENGTH: 57 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH5 mCDR3 linker Reverse <400>
SEQUENCE: 85 gtagtccatg gcgtagctgc cgccgtagta gtagtgcccc gcacagtaat
aaacggc 57 <210> SEQ ID NO 86 <211> LENGTH: 60
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH5 mCDR3 linker Forward
<400> SEQUENCE: 86 cactactact acggcggcag ctacgccatg
gactactggg gccagggaac cctggtcacc 60 <210> SEQ ID NO 87
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH16
mCDR3 linker Reverse <400> SEQUENCE: 87 catggcgtag ctgccgccgt
agtagtagtg tctcgcacag taatacacgg c 51 <210> SEQ ID NO 88
<211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH20
mCDR1 linker Reverse <400> SEQUENCE: 88 gctcacgccg tagtcgggca
ggctcacgcc agaggctaca caggagagtc tc 52 <210> SEQ ID NO 89
<211> LENGTH: 61 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH20
mCDR2 linker Reverse <400> SEQUENCE: 89 ggcgctgttg tagtaggttg
tctcggagcc ccagatcact gaaacccact ccagcccctt 60 c 61 <210> SEQ
ID NO 90 <211> LENGTH: 66 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH20 mCDR2 linker Forward <400> SEQUENCE: 90
ggctccgaga caacctacta caacagcgcc ctgaagagcc gattcaccat ctccagagac
60 aacgcc 66 <210> SEQ ID NO 91 <211> LENGTH: 51
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH20 mCDR3 linker Reverse
<400> SEQUENCE: 91 catggcgtag ctgccgccgt agtagtagtg
tctcgcacag taatacacag c 51 <210> SEQ ID NO 92 <211>
LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: SalI adaptor
<400> SEQUENCE: 92 gatcgtcgac gctgaggaga cggtgaccag gg 32
<210> SEQ ID NO 93 <211> LENGTH: 37 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: HindIII VJ2C Forward <400>
SEQUENCE: 93 gatcaagctt gccgccacca tggagacaga cacactc 37
<210> SEQ ID NO 94 <211> LENGTH: 45 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL39 mCDR2 linker Forward
<400> SEQUENCE: 94 cacaccagcc ggctgcacag cggggtccca
tcaaggttca gcggc 45 <210> SEQ ID NO 95 <211> LENGTH: 51
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL39 mCDR3 linker Reverse
<400> SEQUENCE: 95 ggtgtagggc agtgtgttgc cttgctggca
gtaataagtt gcaaaatcat c 51 <210> SEQ ID NO 96 <211>
LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL39 mCDR3
linker Forward <400> SEQUENCE: 96 cagcaaggca acacactgcc
ctacaccttc ggccaaggga ccaaggtgg 49 <210> SEQ ID NO 97
<211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL40
mCDR2 linker Reverse <400> SEQUENCE: 97 gctgtgcagc cggctggtgt
gatagatcag gaggttagga ac 42 <210> SEQ ID NO 98 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL40 mCDR2
linker Forward <400> SEQUENCE: 98 cacaccagcc ggctgcacag
cggggtccca tctcggttca gcggc 45 <210> SEQ ID NO 99 <211>
LENGTH: 51 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL40 mCDR3
linker Reverse <400> SEQUENCE: 99 ggtgtagggc agtgtgttgc
cttgctgaca gtaataagtt gcaaaatctt c 51 <210> SEQ ID NO 100
<211> LENGTH: 48 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL40
mCDR3 linker Forward <400> SEQUENCE: 100 cagcaaggca
acacactgcc ctacaccttc ggcggaggga ccaaggtg 48 <210> SEQ ID NO
101 <211> LENGTH: 57 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43 mCDR1 linker Reverse <400> SEQUENCE: 101
gttcaggtac ttgctgatgt cctggctggc ccggcaagtg atggtgactc tgtctcc 57
<210> SEQ ID NO 102 <211> LENGTH: 54 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43 mCDR1 linker Forward
<400> SEQUENCE: 102 cgggccagcc aggacatcag caagtacctg
aactggtatc agcagaaacc aggg 54 <210> SEQ ID NO 103 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43 mCDR2
linker Reverse <400> SEQUENCE: 103 gctgtgcagc cggctggtgt
gatagatcag gagcttaggg gc 42 <210> SEQ ID NO 104 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43 mCDR2
linker Forward <400> SEQUENCE: 104 cacaccagcc ggctgcacag
cggggtccca tcaaggttca gtggc 45 <210> SEQ ID NO 105
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL43
mCDR3 linker Reverse <400> SEQUENCE: 105 ggtgtagggc
agtgtgttgc cttgctgaca gtagtaagtt gcaaaatctt c 51 <210> SEQ ID
NO 106 <211> LENGTH: 49 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43 mCDR3 linker Forward <400> SEQUENCE: 106
cagcaaggca acacactgcc ctacaccttc ggccctggga ccaaagtgg 49
<210> SEQ ID NO 107 <211> LENGTH: 57 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL44 mCDR1 linker Reverse
<400> SEQUENCE: 107 gttcaggtac ttgctgatgt cctggctggc
ccgacaagtg atggtgactc tgtctcc 57 <210> SEQ ID NO 108
<211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
mCDR2 linker Reverse <400> SEQUENCE: 108 gctgtgcagc
cggctggtgt gatagatcag gaggttaggg gc 42 <210> SEQ ID NO 109
<211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
mCDR2 linker Forward <400> SEQUENCE: 109 cacaccagcc
ggctgcacag cggggtccca tcaaggttca gcggc 45 <210> SEQ ID NO 110
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
mCDR3 linker Reverse <400> SEQUENCE: 110 ggtgtagggc
agtgtgttgc cttgctgaca ataataagtt gcaaaatctt c 51 <210> SEQ ID
NO 111 <211> LENGTH: 49 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL44 mCDR3 linker Forward <400> SEQUENCE: 111
cagcaaggca acacactgcc ctacaccttt ggccagggga ccaagttgg 49
<210> SEQ ID NO 112 <211> LENGTH: 38 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: NotI Kappa Reverse <400>
SEQUENCE: 112 gatcgcggcc gcttatcaac actctcccct gttgaagc 38
<210> SEQ ID NO 113 <211> LENGTH: 39 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Table-2 Fwd Primer II <400>
SEQUENCE: 113 gatcggatcc actggtcagg tycagctkgt gcagtctgg 39
<210> SEQ ID NO 114 <211> LENGTH: 450 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-R94K/S298A heavy chain
<400> SEQUENCE: 114 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210
215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly
Lys 450 <210> SEQ ID NO 115 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/E269D/S298A heavy
chain <400> SEQUENCE: 115 Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile
Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70
75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr
Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr
Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser
Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp
Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly
Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190
Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195
200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys
Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu
Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro
Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys
Val Val Val Asp Val Ser His Asp 260 265 270 Asp Pro Glu Val Lys Phe
Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315
320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu
325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440
445 Gly Lys 450 <210> SEQ ID NO 116 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/S298A/S324N heavy
chain <400> SEQUENCE: 116 Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile
Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70
75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr
Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr
Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser
Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp
Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly
Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190
Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195
200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys
Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu
Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro
Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys
Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe
Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315
320 Glu Tyr Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala Pro Ile Glu
325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440
445 Gly Lys 450 <210> SEQ ID NO 117 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/E269D/S298A/S324N
heavy chain <400> SEQUENCE: 117 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55
60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185
190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Asp 260 265 270 Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 118 <211> LENGTH:
450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-R94K/S324N
heavy chain <400> SEQUENCE: 118 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55
60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185
190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 119 <211> LENGTH:
450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-R94K/K274Q
heavy chain <400> SEQUENCE: 119 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55
60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185
190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Gln
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 120 <211> LENGTH:
450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-R94K/N276K
heavy chain <400> SEQUENCE: 120 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55
60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185
190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys
Phe Lys Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 121 <211> LENGTH:
450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-R94K/K334R
heavy chain <400> SEQUENCE: 121 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55
60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185
190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Arg Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 122 <211> LENGTH:
450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/K274Q/N276K heavy chain <400> SEQUENCE: 122 Gln Val
Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20
25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser
Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly
Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr
Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu
Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu
Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150
155 160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala
Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val
Thr Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys
Asn Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys
Val Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro
Cys Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260 265 270
Asp Pro Glu Val Gln Phe Lys Trp Tyr Val Asp Gly Val Glu Val His 275
280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr
Arg 290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu
Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395
400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Met His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID NO 123
<211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/K274Q/N276K/K334R heavy chain <400> SEQUENCE: 123
Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5
10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp
Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr
Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe
Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135
140 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser
145 150 155 160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe
Pro Ala Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser
Val Val Thr Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr
Ile Cys Asn Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp
Lys Lys Val Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser
Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255
Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260
265 270 Asp Pro Glu Val Gln Phe Lys Trp Tyr Val Asp Gly Val Glu Val
His 275 280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
Thr Tyr Arg 290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn
Lys Ala Leu Pro Ala Pro Ile Glu 325 330 335 Arg Thr Ile Ser Lys Ala
Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro
Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385
390 395 400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
Val Asp 405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys
Ser Val Met His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys
Ser Leu Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID
NO 124 <211> LENGTH: 450 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-R94K(1133) heavy chain <400> SEQUENCE: 124
Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5
10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp
Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr
Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe
Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135
140 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser
145 150 155 160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe
Pro Ala Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser
Val Val Thr Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr
Ile Cys Asn Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp
Lys Lys Val Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser
Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255
Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260
265 270 Asp Pro Glu Val Gln Phe Lys Trp Tyr Val Asp Gly Val Glu Val
His 275 280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
Thr Phe Arg 290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn
Lys Ala Leu Pro Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser Lys Thr
Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro
Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380
Glu Ser Ser Gly Gln Pro Glu Asn Asn Tyr Asn Thr Thr Pro Pro Met 385
390 395 400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
Val Asp 405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Ile Phe Ser Cys
Ser Val Met His 420 425 430 Glu Ala Leu His Asn Arg Phe Thr Gln Lys
Ser Leu Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID
NO 125 <211> LENGTH: 556 <212> TYPE: PRT <213>
ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY:
MISC_FEATURE <222> LOCATION: (1)..(556) <223> OTHER
INFORMATION: human CD19 <400> SEQUENCE: 125 Met Pro Pro Pro
Arg Leu Leu Phe Phe Leu Leu Phe Leu Thr Pro Met 1 5 10 15 Glu Val
Arg Pro Glu Glu Pro Leu Val Val Lys Val Glu Glu Gly Asp 20 25 30
Asn Ala Val Leu Gln Cys Leu Lys Gly Thr Ser Asp Gly Pro Thr Gln 35
40 45 Gln Leu Thr Trp Ser Arg Glu Ser Pro Leu Lys Pro Phe Leu Lys
Leu 50 55 60 Ser Leu Gly Leu Pro Gly Leu Gly Ile His Met Arg Pro
Leu Ala Ile 65 70 75 80 Trp Leu Phe Ile Phe Asn Val Ser Gln Gln Met
Gly Gly Phe Tyr Leu 85 90 95 Cys Gln Pro Gly Pro Pro Ser Glu Lys
Ala Trp Gln Pro Gly Trp Thr 100 105 110 Val Asn Val Glu Gly Ser Gly
Glu Leu Phe Arg Trp Asn Val Ser Asp 115 120 125 Leu Gly Gly Leu Gly
Cys Gly Leu Lys Asn Arg Ser Ser Glu Gly Pro 130 135 140 Ser Ser Pro
Ser Gly Lys Leu Met Ser Pro Lys Leu Tyr Val Trp Ala 145 150 155 160
Lys Asp Arg Pro Glu Ile Trp Glu Gly Glu Pro Pro Cys Leu Pro Pro 165
170 175 Arg Asp Ser Leu Asn Gln Ser Leu Ser Gln Asp Leu Thr Met Ala
Pro 180 185 190 Gly Ser Thr Leu Trp Leu Ser Cys Gly Val Pro Pro Asp
Ser Val Ser 195 200 205 Arg Gly Pro Leu Ser Trp Thr His Val His Pro
Lys Gly Pro Lys Ser 210 215 220 Leu Leu Ser Leu Glu Leu Lys Asp Asp
Arg Pro Ala Arg Asp Met Trp 225 230 235 240 Val Met Glu Thr Gly Leu
Leu Leu Pro Arg Ala Thr Ala Gln Asp Ala 245 250 255 Gly Lys Tyr Tyr
Cys His Arg Gly Asn Leu Thr Met Ser Phe His Leu 260 265 270 Glu Ile
Thr Ala Arg Pro Val Leu Trp His Trp Leu Leu Arg Thr Gly 275 280 285
Gly Trp Lys Val Ser Ala Val Thr Leu Ala Tyr Leu Ile Phe Cys Leu 290
295 300 Cys Ser Leu Val Gly Ile Leu His Leu Gln Arg Ala Leu Val Leu
Arg 305 310 315 320 Arg Lys Arg Lys Arg Met Thr Asp Pro Thr Arg Arg
Phe Phe Lys Val 325 330 335 Thr Pro Pro Pro Gly Ser Gly Pro Gln Asn
Gln Tyr Gly Asn Val Leu 340 345 350 Ser Leu Pro Thr Pro Thr Ser Gly
Leu Gly Arg Ala Gln Arg Trp Ala 355 360 365 Ala Gly Leu Gly Gly Thr
Ala Pro Ser Tyr Gly Asn Pro Ser Ser Asp 370 375 380 Val Gln Ala Asp
Gly Ala Leu Gly Ser Arg Ser Pro Pro Gly Val Gly 385 390 395 400 Pro
Glu Glu Glu Glu Gly Glu Gly Tyr Glu Glu Pro Asp Ser Glu Glu 405 410
415 Asp Ser Glu Phe Tyr Glu Asn Asp Ser Asn Leu Gly Gln Asp Gln Leu
420 425 430 Ser Gln Asp Gly Ser Gly Tyr Glu Asn Pro Glu Asp Glu Pro
Leu Gly 435 440 445 Pro Glu Asp Glu Asp Ser Phe Ser Asn Ala Glu Ser
Tyr Glu Asn Glu 450 455 460 Asp Glu Glu Leu Thr Gln Pro Val Ala Arg
Thr Met Asp Phe Leu Ser 465 470 475 480 Pro His Gly Ser Ala Trp Asp
Pro Ser Arg Glu Ala Thr Ser Leu Gly 485 490 495 Ser Gln Ser Tyr Glu
Asp Met Arg Gly Ile Leu Tyr Ala Ala Pro Gln 500 505 510 Leu Arg Ser
Ile Arg Gly Gln Pro Gly Pro Asn His Glu Glu Asp Ala 515 520 525 Asp
Ser Tyr Glu Asn Met Asp Asn Pro Asp Gly Pro Asp Pro Ala Trp 530 535
540 Gly Gly Gly Gly Arg Met Gly Thr Trp Ser Thr Arg 545 550 555
<210> SEQ ID NO 126 <211> LENGTH: 5 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Glycine Serine Linker <400>
SEQUENCE: 126 Gly Gly Gly Gly Ser 1 5
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 126
<210> SEQ ID NO 1 <211> LENGTH: 120 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: FMC63-VH NCBI-CAA74659 <400>
SEQUENCE: 1 Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro
Ser Gln 1 5 10 15 Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser
Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Ile Arg Gln Pro Pro Arg
Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp Gly Ser Glu Thr
Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Leu Thr Ile Ile
Lys Asp Asn Ser Lys Ser Gln Val Phe Leu 65 70 75 80 Lys Met Asn Ser
Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 Lys His
Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110
Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> SEQ ID NO 2
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
FMC63-VL NCBI-CAA74660 <400> SEQUENCE: 2 Asp Ile Gln Met Thr
Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val
Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu
Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40
45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu
Glu Gln 65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn
Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile
Thr 100 105 <210> SEQ ID NO 3 <211> LENGTH: 94
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: humIGKV087 [V1-5*03]
<400> SEQUENCE: 3 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu
Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Gln Ser Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser
Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser
Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp
Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Tyr 85 90
<210> SEQ ID NO 4 <211> LENGTH: 94 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: humIGKV106 [V1-27*01] <400>
SEQUENCE: 4 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly
Ile Ser Asn Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys
Val Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala
Thr Tyr Tyr Cys Gln Lys Tyr Asn Ser Ala 85 90 <210> SEQ ID NO
5 <211> LENGTH: 94 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: humIGKV115 [V1-39*01] <400> SEQUENCE: 5 Asp Ile
Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr 20
25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu
Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln
Gln Ser Tyr Ser Thr 85 90 <210> SEQ ID NO 6 <211>
LENGTH: 94 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGKV094
[V1-12*01] <400> SEQUENCE: 6 Asp Ile Gln Met Thr Gln Ser Pro
Ser Ser Val Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe 85
90 <210> SEQ ID NO 7 <211> LENGTH: 213 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: donor amplified cDNA clone#39
<400> SEQUENCE: 7 Asp Ile Val Met Thr Gln Ser Pro Ser Thr Leu
Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Gln Ser Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser
Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser
Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp
Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Leu Trp Thr 85 90
95 Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala Pro
100 105 110 Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser
Gly Thr 115 120 125 Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro
Arg Glu Ala Lys 130 135 140 Val Gln Trp Lys Val Asp Asn Ala Leu Gln
Ser Gly Asn Ser Gln Glu 145 150 155 160 Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr Tyr Ser Leu Ser Ser 165 170 175 Thr Leu Thr Leu Ser
Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala 180 185 190 Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe 195 200 205 Asn
Arg Gly Glu Cys 210 <210> SEQ ID NO 8 <211> LENGTH: 214
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: donor amplified cDNA
clone#40 <400> SEQUENCE: 8 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Gly Tyr Tyr 20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Val Pro Asn Leu Leu Ile 35
40 45 Tyr Ala Ala Ser Thr Leu Arg Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu
Asn Ser Tyr Leu Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu
Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro
Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val Val
Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln
Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155 160
Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165
170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val
Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val
Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210 <210> SEQ
ID NO 9 <211> LENGTH: 214 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: donor amplified cDNA clone#43 <400> SEQUENCE: 9
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys
Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Ser Tyr Ser Thr Pro Leu 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val
Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr
Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135
140 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln
145 150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr
Ser Leu Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu
Lys His Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu
Ser Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210
<210> SEQ ID NO 10 <211> LENGTH: 214 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: donor amplified cDNA clone#44
<400> SEQUENCE: 10 Asp Ile Val Met Thr Gln Ser Pro Ser Ser
Met Ser Ala Ser Ile Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Gly Ile Thr Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile 35 40 45 Tyr Gly Ser Ser
Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Phe Pro Tyr 85
90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala
Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205
Phe Asn Arg Gly Glu Cys 210 <210> SEQ ID NO 11 <211>
LENGTH: 98 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGHV199
[V3-33*01] <400> SEQUENCE: 11 Gln Val Gln Leu Val Glu Ser Gly
Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val
Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg <210> SEQ ID NO 12 <211>
LENGTH: 98 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGHV175
[V3-11*01] <400> SEQUENCE: 12 Gln Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp
Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr
Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg <210> SEQ ID NO 13 <211>
LENGTH: 98 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGHV195
[V3-30*18] <400> SEQUENCE: 13 Gln Val Gln Leu Val Glu Ser Gly
Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val
Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg <210> SEQ ID NO 14 <211>
LENGTH: 98 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: humIGHV031
[V3-48*01] <400> SEQUENCE: 14 Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ser Met Asn Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr
Ile Ser Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys
85 90 95 Ala Arg <210> SEQ ID NO 15 <211> LENGTH: 233
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: donor amplified cDNA
clone#2 <400> SEQUENCE: 15 Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val
Ile Trp Tyr Asp Ser Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Thr Thr Asp Leu Leu Ala Ala Pro Thr Ser Arg Gly
Tyr Gly Asp Tyr 100 105 110 Leu Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly
Thr Leu Val Thr Val Ser 115 120 125 Ser Gly Ser Ala Ser Ala Pro Thr
Leu Phe Pro Leu Val Ser Cys Glu 130 135 140 Asn Ser Pro Ser Asp Thr
Ser Ser Val Ala Val Gly Cys Leu Ala Gln 145 150 155 160 Asp Phe Leu
Pro Asp Ser Ile Thr Phe Ser Trp Lys Tyr Lys Asn Asn 165 170 175 Ser
Asp Ile Ser Ser Thr Arg Gly Phe Pro Ser Val Leu Arg Gly Gly 180 185
190 Lys Tyr Ala Ala Thr Ser Gln Val Leu Leu Pro Ser Lys Asp Val Met
195 200 205 Gln Gly Thr Asp Glu His Val Val Cys Lys Val Gln His Pro
Asn Gly 210 215 220 Asn Lys Glu Lys Asn Val Pro Leu Pro 225 230
<210> SEQ ID NO 16 <211> LENGTH: 228 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: donor amplified cDNA clone#5
<400> SEQUENCE: 16 Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Asp 20 25 30 Tyr Met Ser Trp Ile Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Val
Ser Ser Gly Thr Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80
Leu Gln Met Asp Ser Leu Arg Val Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Gly Ala Gly Gly Leu Val Ser Ala Ala Gly Arg Ala Ala Pro
Arg 100 105 110 Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly
Ser Ala Ser 115 120 125 Ala Pro Thr Leu Phe Pro Leu Val Ser Cys Glu
Asn Ser Pro Ser Asp 130 135 140 Thr Ser Ser Val Ala Val Gly Cys Leu
Ala Gln Asp Phe Leu Pro Asp 145 150 155 160 Ser Ile Thr Phe Ser Trp
Lys Tyr Lys Asn Asn Ser Asp Ile Ser Ser 165 170 175 Thr Arg Gly Phe
Pro Ser Val Leu Arg Gly Gly Lys Tyr Ala Ala Thr 180 185 190 Ser Gln
Val Leu Leu Pro Ser Lys Asp Val Met Gln Gly Thr Asp Glu 195 200 205
His Val Val Cys Lys Val Gln His Pro Asn Gly Asn Lys Glu Lys Asn 210
215 220 Val Pro Leu Pro 225 <210> SEQ ID NO 17 <211>
LENGTH: 222 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: donor amplified
cDNA clone#16 <400> SEQUENCE: 17 Gln Val Gln Leu Val Gln Ser
Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala
Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55
60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Val Gly Gly Gly Ser Ser Phe Asp Tyr Trp
Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Gly Ser Ala Ser
Ala Pro Thr Leu Phe Pro 115 120 125 Leu Val Ser Cys Glu Asn Ser Pro
Ser Asp Thr Ser Ser Val Ala Val 130 135 140 Gly Cys Leu Ala Gln Asp
Phe Leu Pro Asp Ser Ile Thr Phe Ser Trp 145 150 155 160 Lys Tyr Lys
Asn Asn Ser Asp Ile Ser Ser Thr Arg Gly Phe Pro Ser 165 170 175 Val
Leu Arg Gly Gly Lys Tyr Ala Ala Thr Ser Gln Val Leu Leu Pro 180 185
190 Ser Lys Asp Val Met Gln Gly Thr Asp Glu His Val Val Cys Lys Val
195 200 205 Gln His Pro Asn Gly Asn Lys Glu Lys Asn Val Pro Leu Pro
210 215 220 <210> SEQ ID NO 18 <211> LENGTH: 224
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: donor amplified cDNA
clone#20 <400> SEQUENCE: 18 Gln Val Gln Leu Val Gln Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys
Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Trp Met Ser Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr
Ile Val Ser Ser Gly Thr Asn Lys Tyr Tyr Ala Val Ser Val 50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65
70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Gly Ser Ile Met Gly Ala Glu Phe Phe Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Gly Ser
Ala Ser Ala Pro Thr Leu 115 120 125 Phe Pro Leu Val Ser Cys Glu Asn
Ser Pro Ser Asp Thr Ser Ser Val 130 135 140 Ala Val Gly Cys Leu Ala
Gln Asp Phe Leu Pro Asp Ser Ile Thr Phe 145 150 155 160 Ser Trp Lys
Tyr Lys Asn Asn Ser Asp Ile Ser Ser Thr Arg Gly Phe 165 170 175 Pro
Ser Val Leu Arg Gly Gly Lys Tyr Ala Ala Thr Ser Gln Val Leu 180 185
190 Leu Pro Ser Lys Asp Val Met Gln Gly Thr Asp Glu His Val Val Cys
195 200 205 Lys Val Gln His Pro Asn Gly Asn Lys Glu Lys Asn Val Pro
Leu Pro 210 215 220 <210> SEQ ID NO 19 <211> LENGTH:
120 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH2 <400>
SEQUENCE: 19 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr 85 90 95 Thr
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120
<210> SEQ ID NO 20 <211> LENGTH: 120 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH5 <400> SEQUENCE: 20 Glu Val
Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20
25 30 Gly Val Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45 Ser Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser
Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr Leu 65 70 75 80 Gln Met Asp Ser Leu Arg Val Glu Asp
Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Gly His Tyr Tyr Tyr Gly Gly
Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr
Val Ser Ser 115 120 <210> SEQ ID NO 21 <211> LENGTH:
120 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16
<400> SEQUENCE: 21 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 22 <211> LENGTH: 120 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VH20 <400> SEQUENCE: 22 Gln Val Gln Leu
Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu
Arg Leu Ser Cys Val Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30
Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45 Ser Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu
Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser
Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr
Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser
Ser 115 120 <210> SEQ ID NO 23 <211> LENGTH: 112
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL39 <400> SEQUENCE:
23 Asp Ile Val Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser
Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro
Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val
Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr
Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr
Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gln
Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100 105 110
<210> SEQ ID NO 24 <211> LENGTH: 112 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL40 <400> SEQUENCE: 24 Asp
Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10
15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr
20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Val Pro Asn Leu
Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100 105 110 <210> SEQ
ID NO 25 <211> LENGTH: 112 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43 <400> SEQUENCE: 25 Asp Ile Val Met Thr Gln
Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45
Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50
55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln
Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr
Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys
Arg Thr Val Ala Ala 100 105 110 <210> SEQ ID NO 26
<211> LENGTH: 112 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
<400> SEQUENCE: 26 Asp Ile Val Met Thr Gln Ser Pro Ser Ser
Met Ser Ala Ser Ile Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala
Ala 100 105 110 <210> SEQ ID NO 27 <211> LENGTH: 10
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: HCDR1 <400> SEQUENCE:
27 Gly Val Ser Leu Pro Asp Tyr Gly Val Ser 1 5 10 <210> SEQ
ID NO 28 <211> LENGTH: 16 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: HCDR2 <400> SEQUENCE: 28 Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser 1 5 10 15
<210> SEQ ID NO 29 <211> LENGTH: 12 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: HCDR3 <400> SEQUENCE: 29 His
Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr 1 5 10 <210> SEQ
ID NO 30 <211> LENGTH: 11 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: LCDR1 <400> SEQUENCE: 30 Arg Ala Ser Gln Asp Ile
Ser Lys Tyr Leu Asn 1 5 10 <210> SEQ ID NO 31 <211>
LENGTH: 7 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: LCDR2
<400> SEQUENCE: 31 His Thr Ser Arg Leu His Ser 1 5
<210> SEQ ID NO 32 <211> LENGTH: 9 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: LCDR3 <400> SEQUENCE: 32 Gln
Gln Gly Asn Thr Leu Pro Tyr Thr 1 5 <210> SEQ ID NO 33
<211> LENGTH: 120 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-G42R <400> SEQUENCE: 33 Gln Val Gln Leu Val Gln Ser Gly
Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp
Val Arg Gln Ala Pro Arg Lys Gly Leu Glu Trp Val 35 40 45 Ala Val
Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60
Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65
70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120
<210> SEQ ID NO 34 <211> LENGTH: 120 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-F67L <400> SEQUENCE: 34
Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5
10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp
Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
Asn Ser Ala Leu Lys 50 55 60 Ser Arg Leu Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr
Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser 115 120 <210> SEQ ID NO 35 <211>
LENGTH: 120 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-R71K
<400> SEQUENCE: 35 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Lys Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 36 <211> LENGTH: 120 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VH16-L78V <400> SEQUENCE: 36 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser 115 120 <210> SEQ ID NO 37 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K <400>
SEQUENCE: 37 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
38 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43-P44V <400> SEQUENCE: 38 Asp Ile Val Met Thr
Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu
Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Val Lys Leu Leu Ile 35 40
45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn
Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile
Lys
100 105 <210> SEQ ID NO 39 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-F71Y <400>
SEQUENCE: 39 Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala
Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID
NO 40 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43-Y87F <400> SEQUENCE: 40 Asp Ile Val Met Thr
Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu
Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Asn
Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile
Lys 100 105 <210> SEQ ID NO 41 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-V3Q/T7S <400>
SEQUENCE: 41 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID
NO 42 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-Q6E <400> SEQUENCE: 42 Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly
Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys
50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95 Arg His Tyr Tyr Tyr Gly Gly Ser Tyr Ala
Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser
115 120 <210> SEQ ID NO 43 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-Y32F/R94K <400>
SEQUENCE: 43 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Phe 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
44 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-R94K/Y96F <400> SEQUENCE: 44 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Phe Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser 115 120 <210> SEQ ID NO 45 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/Y97F <400>
SEQUENCE: 45 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Phe Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> SEQ ID NO
46 <211> LENGTH: 120 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-R94K/Y98F <400> SEQUENCE: 46 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys
50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Phe Gly Gly Ser Tyr Ala
Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser
115 120 <210> SEQ ID NO 47 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/Y100bF
<400> SEQUENCE: 47 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Phe Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 48 <211> LENGTH: 107 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VL43-Y32F <400> SEQUENCE: 48 Asp Ile Val
Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp
Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Phe 20 25
30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe
Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val
Asp Ile Lys 100 105 <210> SEQ ID NO 49 <211> LENGTH:
107 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43-P44I
<400> SEQUENCE: 49 Asp Ile Val Met Thr Gln Thr Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105
<210> SEQ ID NO 50 <211> LENGTH: 107 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-P44L <400> SEQUENCE: 50
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Leu Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 51
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-N92A <400> SEQUENCE: 51 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His
Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu
Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100
105 <210> SEQ ID NO 52 <211> LENGTH: 107 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-T93V <400> SEQUENCE: 52
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Asn Val Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 53
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-T93A <400> SEQUENCE: 53 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His
Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Ala Leu
Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100
105 <210> SEQ ID NO 54 <211> LENGTH: 120 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-R94K/Y97W <400> SEQUENCE:
54 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro
Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Trp Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser 115 120 <210> SEQ ID NO 55 <211> LENGTH: 120
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-Y32F/R94K/Y97F
<400> SEQUENCE: 55 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Phe 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Phe Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210>
SEQ ID NO 56 <211> LENGTH: 107 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VL43-Y32F/P44I <400> SEQUENCE: 56 Asp Ile
Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Phe 20
25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Ile Lys Leu Leu
Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln
Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys
Val Asp Ile Lys 100 105 <210> SEQ ID NO 57 <211>
LENGTH: 107 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION:
VL43-V3Q/T7S/N92A <400> SEQUENCE: 57 Asp Ile Gln Met Thr Gln
Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45
Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50
55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln
Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr
Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys
100 105 <210> SEQ ID NO 58 <211> LENGTH: 107
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL43-V3Q/T7S/Y32F/N92A
<400> SEQUENCE: 58 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Phe 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105
<210> SEQ ID NO 59 <211> LENGTH: 107 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-V3Q/T7S/P44I/N92A <400>
SEQUENCE: 59 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His
Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85 90 95 Thr
Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID
NO 60 <211> LENGTH: 107 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43-V3Q/T7S/Y32F/P44I/N92A <400> SEQUENCE: 60
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Phe 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Ile Lys
Leu Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 61
<211> LENGTH: 107 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VL43-F71H <400> SEQUENCE: 61 Asp Ile Val Met Thr Gln Thr Pro
Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His
Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60
Ser Gly Ser Gly Thr Asp His Thr Leu Thr Ile Ser Ser Leu Gln Pro 65
70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu
Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100
105 <210> SEQ ID NO 62 <211> LENGTH: 107 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-F71S <400> SEQUENCE: 62
Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5
10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Lys
Tyr
20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45 Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Ser Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln Gly Asn Thr Leu Pro Tyr 85 90 95 Thr Phe Gly Pro Gly Thr
Lys Val Asp Ile Lys 100 105 <210> SEQ ID NO 63 <211>
LENGTH: 107 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43-F71T
<400> SEQUENCE: 63 Asp Ile Val Met Thr Gln Thr Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Thr Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 105
<210> SEQ ID NO 64 <211> LENGTH: 450 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-- R94K heavy chain <400>
SEQUENCE: 64 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln
Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val
Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu
Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys
His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105
110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr
Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro
Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu Thr Ser Gly
Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr
Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser Ser Leu Gly
Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205 Pro Ser Asn
Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210 215 220 Lys
Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 225 230
235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys
Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330 335 Lys Thr
Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350
Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu 355
360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn
Val Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu His Asn His
Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly Lys 450
<210> SEQ ID NO 65 <211> LENGTH: 214 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43-- V3Q/T7S/P44I/N92A light chain
<400> SEQUENCE: 65 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys Arg Thr Val Ala
Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205
Phe Asn Arg Gly Glu Cys 210 <210> SEQ ID NO 66 <211>
LENGTH: 450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH16-- R94K
Y100BF heavy chain <400> SEQUENCE: 66 Gln Val Gln Leu Val Gln
Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45
Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50
55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Phe
Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala
Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser
Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val
Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175
Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180
185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His
Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys
Ser Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro
Glu Leu Leu Gly Gly 225 230 235 240
Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245
250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His
Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val
Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr
Asn Ser Thr Tyr Arg 290 295 300 Val Val Ser Val Leu Thr Val Leu His
Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val
Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser
Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu
Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365
Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370
375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys
Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe
Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu His Asn His Tyr Thr
Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210>
SEQ ID NO 67 <211> LENGTH: 214 <212> TYPE: PRT
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: VL43-- V3Q/T7S/Y32F/P44I/N92A light chain
<400> SEQUENCE: 67 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Asp Ile Ser Lys Phe 20 25 30 Leu Asn Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Ile Lys Leu Leu Ile 35 40 45 Tyr His Thr Ser
Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Thr Leu Pro Tyr 85
90 95 Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys Arg Thr Val Ala
Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu
Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205
Phe Asn Arg Gly Glu Cys 210 <210> SEQ ID NO 68 <211>
LENGTH: 450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: FMC63 chimeric
Heavy Chain <400> SEQUENCE: 68 Glu Val Lys Leu Gln Glu Ser
Gly Pro Gly Leu Val Ala Pro Ser Gln 1 5 10 15 Ser Leu Ser Val Thr
Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser
Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu 35 40 45 Gly
Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55
60 Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu
65 70 75 80 Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr
Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Ser Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys
Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185
190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 69 <211> LENGTH:
214 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: FMC63 chimeric
Light Chain <400> SEQUENCE: 69 Asp Ile Gln Met Thr Gln Thr
Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile
Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr 20 25 30 Leu Asn Trp
Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr
His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln
65 70 75 80 Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu
Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Arg
Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser
Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185
190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
195 200 205 Phe Asn Arg Gly Glu Cys 210 <210> SEQ ID NO 70
<211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Table-1 Fwd Primer
<400> SEQUENCE: 70 gatcggatcc actggtgata ttgtgatgac ycagwctcc
39 <210> SEQ ID NO 71 <211> LENGTH: 36 <212>
TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Table-1 Rev Primer <400>
SEQUENCE: 71 gatcgcggcc gcacactctc ccctgttgaa gctctt 36 <210>
SEQ ID NO 72 <211> LENGTH: 36 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: Table-2 Fwd Primer I <400> SEQUENCE: 72
gatcggatcc actggtgagg tgcagctggt ggagtc 36 <210> SEQ ID NO 73
<211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Table-2 Rev Primer <400> SEQUENCE: 73 gatcgcggcc gctggaagag
gcacgttctt ttcttt 36 <210> SEQ ID NO 74 <211> LENGTH:
21 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: CMV-IE Forward
<400> SEQUENCE: 74 cgcaaatggg cggtaggcgt g 21 <210> SEQ
ID NO 75 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: BGH Reverse <400> SEQUENCE: 75 tagaaggcac
agtcgagg 18 <210> SEQ ID NO 76 <211> LENGTH: 52
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH2 mCDR1 linker Reverse
<400> SEQUENCE: 76 gctcacgccg tagtcgggca ggctcacgcc
agacgctgca caggagagtc tc 52 <210> SEQ ID NO 77 <211>
LENGTH: 50 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH2 mCDR1
linker Forward <400> SEQUENCE: 77 ggcgtgagcc tgcccgacta
cggcgtgagc tgggtccgcc aggctccagg 50 <210> SEQ ID NO 78
<211> LENGTH: 61 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH2
mCDR2 linker Reverse <400> SEQUENCE: 78 ggcgctgttg tagtaggttg
tctcggagcc ccagatcact gccacccact ccagcccctt 60 g 61 <210> SEQ
ID NO 79 <211> LENGTH: 66 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH2 mCDR2 linker Forward <400> SEQUENCE: 79
ggctccgaga caacctacta caacagcgcc ctgaagagcc gattcaccat ctccagagac
60 aattcc 66 <210> SEQ ID NO 80 <211> LENGTH: 51
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH2 mCDR3 linker Reverse
<400> SEQUENCE: 80 catggcgtag ctgccgccgt agtagtagtg
tgtggtacag taatacacgg c 51 <210> SEQ ID NO 81 <211>
LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VH2 mCDR3
linker Forward <400> SEQUENCE: 81 cactactact acggcggcag
ctacgccatg gactactggg gccagggaac cctg 54 <210> SEQ ID NO 82
<211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH5
mCDR1 linker Reverse <400> SEQUENCE: 82 gctcacgccg tagtcgggca
ggctcacgcc agaggctgca caggagagtc tc 52 <210> SEQ ID NO 83
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH5
mCDR1 linker Forward <400> SEQUENCE: 83 ggcgtgagcc tgcccgacta
cggcgtgagc tggatccgcc aggctccagg g 51 <210> SEQ ID NO 84
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH5
mCDR2 linker Forward <400> SEQUENCE: 84 ggctccgaga caacctacta
caacagcgcc ctgaagagcc gattcaccat ctccagggac 60 aacgcc 66
<210> SEQ ID NO 85 <211> LENGTH: 57 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH5 mCDR3 linker Reverse <400>
SEQUENCE: 85 gtagtccatg gcgtagctgc cgccgtagta gtagtgcccc gcacagtaat
aaacggc 57 <210> SEQ ID NO 86 <211> LENGTH: 60
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH5 mCDR3 linker Forward
<400> SEQUENCE: 86 cactactact acggcggcag ctacgccatg
gactactggg gccagggaac cctggtcacc 60 <210> SEQ ID NO 87
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH16
mCDR3 linker Reverse <400> SEQUENCE: 87 catggcgtag ctgccgccgt
agtagtagtg tctcgcacag taatacacgg c 51 <210> SEQ ID NO 88
<211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH20
mCDR1 linker Reverse <400> SEQUENCE: 88 gctcacgccg tagtcgggca
ggctcacgcc agaggctaca caggagagtc tc 52 <210> SEQ ID NO 89
<211> LENGTH: 61 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VH20
mCDR2 linker Reverse <400> SEQUENCE: 89 ggcgctgttg tagtaggttg
tctcggagcc ccagatcact gaaacccact ccagcccctt 60 c 61 <210> SEQ
ID NO 90 <211> LENGTH: 66 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH20 mCDR2 linker Forward <400> SEQUENCE: 90
ggctccgaga caacctacta caacagcgcc ctgaagagcc gattcaccat ctccagagac
60
aacgcc 66 <210> SEQ ID NO 91 <211> LENGTH: 51
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH20 mCDR3 linker Reverse
<400> SEQUENCE: 91 catggcgtag ctgccgccgt agtagtagtg
tctcgcacag taatacacag c 51 <210> SEQ ID NO 92 <211>
LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: SalI adaptor
<400> SEQUENCE: 92 gatcgtcgac gctgaggaga cggtgaccag gg 32
<210> SEQ ID NO 93 <211> LENGTH: 37 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: HindIII VJ2C Forward <400>
SEQUENCE: 93 gatcaagctt gccgccacca tggagacaga cacactc 37
<210> SEQ ID NO 94 <211> LENGTH: 45 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL39 mCDR2 linker Forward
<400> SEQUENCE: 94 cacaccagcc ggctgcacag cggggtccca
tcaaggttca gcggc 45 <210> SEQ ID NO 95 <211> LENGTH: 51
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VL39 mCDR3 linker Reverse
<400> SEQUENCE: 95 ggtgtagggc agtgtgttgc cttgctggca
gtaataagtt gcaaaatcat c 51 <210> SEQ ID NO 96 <211>
LENGTH: 49 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL39 mCDR3
linker Forward <400> SEQUENCE: 96 cagcaaggca acacactgcc
ctacaccttc ggccaaggga ccaaggtgg 49 <210> SEQ ID NO 97
<211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL40
mCDR2 linker Reverse <400> SEQUENCE: 97 gctgtgcagc cggctggtgt
gatagatcag gaggttagga ac 42 <210> SEQ ID NO 98 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL40 mCDR2
linker Forward <400> SEQUENCE: 98 cacaccagcc ggctgcacag
cggggtccca tctcggttca gcggc 45 <210> SEQ ID NO 99 <211>
LENGTH: 51 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL40 mCDR3
linker Reverse <400> SEQUENCE: 99 ggtgtagggc agtgtgttgc
cttgctgaca gtaataagtt gcaaaatctt c 51 <210> SEQ ID NO 100
<211> LENGTH: 48 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL40
mCDR3 linker Forward <400> SEQUENCE: 100 cagcaaggca
acacactgcc ctacaccttc ggcggaggga ccaaggtg 48 <210> SEQ ID NO
101 <211> LENGTH: 57 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43 mCDR1 linker Reverse <400> SEQUENCE: 101
gttcaggtac ttgctgatgt cctggctggc ccggcaagtg atggtgactc tgtctcc 57
<210> SEQ ID NO 102 <211> LENGTH: 54 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL43 mCDR1 linker Forward
<400> SEQUENCE: 102 cgggccagcc aggacatcag caagtacctg
aactggtatc agcagaaacc aggg 54 <210> SEQ ID NO 103 <211>
LENGTH: 42 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43 mCDR2
linker Reverse <400> SEQUENCE: 103 gctgtgcagc cggctggtgt
gatagatcag gagcttaggg gc 42 <210> SEQ ID NO 104 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: VL43 mCDR2
linker Forward <400> SEQUENCE: 104 cacaccagcc ggctgcacag
cggggtccca tcaaggttca gtggc 45 <210> SEQ ID NO 105
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL43
mCDR3 linker Reverse <400> SEQUENCE: 105 ggtgtagggc
agtgtgttgc cttgctgaca gtagtaagtt gcaaaatctt c 51 <210> SEQ ID
NO 106 <211> LENGTH: 49 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL43 mCDR3 linker Forward <400> SEQUENCE: 106
cagcaaggca acacactgcc ctacaccttc ggccctggga ccaaagtgg 49
<210> SEQ ID NO 107 <211> LENGTH: 57 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VL44 mCDR1 linker Reverse
<400> SEQUENCE: 107 gttcaggtac ttgctgatgt cctggctggc
ccgacaagtg atggtgactc tgtctcc 57 <210> SEQ ID NO 108
<211> LENGTH: 42 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
mCDR2 linker Reverse <400> SEQUENCE: 108 gctgtgcagc
cggctggtgt gatagatcag gaggttaggg gc 42 <210> SEQ ID NO 109
<211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
mCDR2 linker Forward <400> SEQUENCE: 109 cacaccagcc
ggctgcacag cggggtccca tcaaggttca gcggc 45 <210> SEQ ID NO 110
<211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: VL44
mCDR3 linker Reverse <400> SEQUENCE: 110 ggtgtagggc
agtgtgttgc cttgctgaca ataataagtt gcaaaatctt c 51 <210> SEQ ID
NO 111 <211> LENGTH: 49 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VL44 mCDR3 linker Forward
<400> SEQUENCE: 111 cagcaaggca acacactgcc ctacaccttt
ggccagggga ccaagttgg 49 <210> SEQ ID NO 112 <211>
LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: NotI Kappa
Reverse <400> SEQUENCE: 112 gatcgcggcc gcttatcaac actctcccct
gttgaagc 38 <210> SEQ ID NO 113 <211> LENGTH: 39
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: Table-2 Fwd Primer II
<400> SEQUENCE: 113 gatcggatcc actggtcagg tycagctkgt
gcagtctgg 39 <210> SEQ ID NO 114 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/S298A heavy chain
<400> SEQUENCE: 114 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210
215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly
Lys 450 <210> SEQ ID NO 115 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/E269D/S298A heavy
chain <400> SEQUENCE: 115 Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile
Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70
75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr
Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr
Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser
Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp
Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly
Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190
Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195
200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys
Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu
Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro
Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys
Val Val Val Asp Val Ser His Asp 260 265 270 Asp Pro Glu Val Lys Phe
Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315
320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu
325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440
445 Gly Lys 450 <210> SEQ ID NO 116 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/S298A/S324N heavy
chain <400> SEQUENCE: 116 Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile
Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70
75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr
Trp Gly Gln
100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro
Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly
Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro
Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu Thr
Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser Gly
Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser Ser
Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205 Pro
Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210 215
220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly
225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp Tyr
Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro Arg
Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu Tyr
Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330 335
Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 340
345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser
Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala
Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys
Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe Phe
Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln Gln
Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu His
Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly Lys
450 <210> SEQ ID NO 117 <211> LENGTH: 450 <212>
TYPE: PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: VH16-R94K/E269D/S298A/S324N heavy
chain <400> SEQUENCE: 117 Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile
Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70
75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr
Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr
Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser
Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp
Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly
Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190
Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195
200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys
Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu
Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro
Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys
Val Val Val Asp Val Ser His Asp 260 265 270 Asp Pro Glu Val Lys Phe
Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg 290 295 300 Val Val
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315
320 Glu Tyr Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala Pro Ile Glu
325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430 Glu
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440
445 Gly Lys 450 <210> SEQ ID NO 118 <211> LENGTH: 450
<212> TYPE: PRT <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: VH16-R94K/S324N heavy chain
<400> SEQUENCE: 118 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210
215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu
Tyr Lys Cys Lys Val Asn Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp
405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Met His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID NO 119
<211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/K274Q heavy chain <400> SEQUENCE: 119 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala
Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155
160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val
165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr
Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn
Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val
Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys
Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu
Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr
Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp
Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280
285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg
290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn
Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu
Pro Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln
Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp
Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn
Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400
Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405
410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met
His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser
Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID NO 120
<211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/N276K heavy chain <400> SEQUENCE: 120 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala
Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155
160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val
165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr
Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn
Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val
Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys
Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu
Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr
Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp
Pro Glu Val Lys Phe Lys Trp Tyr Val Asp Gly Val Glu Val His 275 280
285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg
290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn
Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu
Pro Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly Gln
Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp
Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn
Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400
Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405
410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met
His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser
Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID NO 121
<211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/K334R heavy chain <400> SEQUENCE: 121 Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20 25
30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala
Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly Ser
Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val
Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Ala
Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu Gly
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155
160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val
165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr
Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn
Val Asn His Lys
195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 290 295 300 Val
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310
315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu 325 330 335 Arg Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395 400 Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435
440 445 Gly Lys 450 <210> SEQ ID NO 122 <211> LENGTH:
450 <212> TYPE: PRT <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/K274Q/N276K heavy chain <400> SEQUENCE: 122 Gln Val
Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp Tyr 20
25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser
Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr Gly Gly
Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr
Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu
Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140 Leu
Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150
155 160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala
Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val
Thr Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys
Asn Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys
Val Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys Pro Pro
Cys Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser Val Phe
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255 Ser Arg
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260 265 270
Asp Pro Glu Val Gln Phe Lys Trp Tyr Val Asp Gly Val Glu Val His 275
280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr
Arg 290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu
Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu 325 330 335 Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380 Glu Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385 390 395
400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Met His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID NO 123
<211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
VH16-R94K/K274Q/N276K/K334R heavy chain <400> SEQUENCE: 123
Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5
10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Leu Pro Asp
Tyr 20 25 30 Gly Val Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Ala Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr
Asn Ser Ala Leu Lys 50 55 60 Ser Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Lys His Tyr Tyr Tyr
Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe
Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135
140 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser
145 150 155 160 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe
Pro Ala Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser
Val Val Thr Val Pro 180 185 190 Ser Ser Ser Leu Gly Thr Gln Thr Tyr
Ile Cys Asn Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp
Lys Lys Val Glu Pro Lys Ser Cys Asp 210 215 220 Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 225 230 235 240 Pro Ser
Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255
Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 260
265 270 Asp Pro Glu Val Gln Phe Lys Trp Tyr Val Asp Gly Val Glu Val
His 275 280 285 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
Thr Tyr Arg 290 295 300 Val Val Ser Val Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys 305 310 315 320 Glu Tyr Lys Cys Lys Val Ser Asn
Lys Ala Leu Pro Ala Pro Ile Glu 325 330 335 Arg Thr Ile Ser Lys Ala
Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 340 345 350 Thr Leu Pro Pro
Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu 355 360 365 Thr Cys
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 370 375 380
Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 385
390 395 400 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
Val Asp 405 410 415 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys
Ser Val Met His 420 425 430 Glu Ala Leu His Asn His Tyr Thr Gln Lys
Ser Leu Ser Leu Ser Pro 435 440 445 Gly Lys 450 <210> SEQ ID
NO 124 <211> LENGTH: 450 <212> TYPE: PRT <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: VH16-R94K(1133) heavy chain
<400> SEQUENCE: 124 Gln Val Gln Leu Val Gln Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Val Ser Leu Pro Asp Tyr 20 25 30 Gly Val Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp
Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly
Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175 Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190 Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205
Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp 210
215 220 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly 225 230 235 240 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255 Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270 Asp Pro Glu Val Gln Phe Lys Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285 Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ser Thr Phe Arg 290 295 300 Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 305 310 315 320 Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335 Lys Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350 Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val
Ser Leu 355 360 365 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380 Glu Ser Ser Gly Gln Pro Glu Asn Asn Tyr
Asn Thr Thr Pro Pro Met 385 390 395 400 Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415 Lys Ser Arg Trp Gln
Gln Gly Asn Ile Phe Ser Cys Ser Val Met His 420 425 430 Glu Ala Leu
His Asn Arg Phe Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445 Gly
Lys 450 <210> SEQ ID NO 125 <211> LENGTH: 556
<212> TYPE: PRT <213> ORGANISM: Homo sapiens
<220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222>
LOCATION: (1)..(556) <223> OTHER INFORMATION: human CD19
<400> SEQUENCE: 125 Met Pro Pro Pro Arg Leu Leu Phe Phe Leu
Leu Phe Leu Thr Pro Met 1 5 10 15 Glu Val Arg Pro Glu Glu Pro Leu
Val Val Lys Val Glu Glu Gly Asp 20 25 30 Asn Ala Val Leu Gln Cys
Leu Lys Gly Thr Ser Asp Gly Pro Thr Gln 35 40 45 Gln Leu Thr Trp
Ser Arg Glu Ser Pro Leu Lys Pro Phe Leu Lys Leu 50 55 60 Ser Leu
Gly Leu Pro Gly Leu Gly Ile His Met Arg Pro Leu Ala Ile 65 70 75 80
Trp Leu Phe Ile Phe Asn Val Ser Gln Gln Met Gly Gly Phe Tyr Leu 85
90 95 Cys Gln Pro Gly Pro Pro Ser Glu Lys Ala Trp Gln Pro Gly Trp
Thr 100 105 110 Val Asn Val Glu Gly Ser Gly Glu Leu Phe Arg Trp Asn
Val Ser Asp 115 120 125 Leu Gly Gly Leu Gly Cys Gly Leu Lys Asn Arg
Ser Ser Glu Gly Pro 130 135 140 Ser Ser Pro Ser Gly Lys Leu Met Ser
Pro Lys Leu Tyr Val Trp Ala 145 150 155 160 Lys Asp Arg Pro Glu Ile
Trp Glu Gly Glu Pro Pro Cys Leu Pro Pro 165 170 175 Arg Asp Ser Leu
Asn Gln Ser Leu Ser Gln Asp Leu Thr Met Ala Pro 180 185 190 Gly Ser
Thr Leu Trp Leu Ser Cys Gly Val Pro Pro Asp Ser Val Ser 195 200 205
Arg Gly Pro Leu Ser Trp Thr His Val His Pro Lys Gly Pro Lys Ser 210
215 220 Leu Leu Ser Leu Glu Leu Lys Asp Asp Arg Pro Ala Arg Asp Met
Trp 225 230 235 240 Val Met Glu Thr Gly Leu Leu Leu Pro Arg Ala Thr
Ala Gln Asp Ala 245 250 255 Gly Lys Tyr Tyr Cys His Arg Gly Asn Leu
Thr Met Ser Phe His Leu 260 265 270 Glu Ile Thr Ala Arg Pro Val Leu
Trp His Trp Leu Leu Arg Thr Gly 275 280 285 Gly Trp Lys Val Ser Ala
Val Thr Leu Ala Tyr Leu Ile Phe Cys Leu 290 295 300 Cys Ser Leu Val
Gly Ile Leu His Leu Gln Arg Ala Leu Val Leu Arg 305 310 315 320 Arg
Lys Arg Lys Arg Met Thr Asp Pro Thr Arg Arg Phe Phe Lys Val 325 330
335 Thr Pro Pro Pro Gly Ser Gly Pro Gln Asn Gln Tyr Gly Asn Val Leu
340 345 350 Ser Leu Pro Thr Pro Thr Ser Gly Leu Gly Arg Ala Gln Arg
Trp Ala 355 360 365 Ala Gly Leu Gly Gly Thr Ala Pro Ser Tyr Gly Asn
Pro Ser Ser Asp 370 375 380 Val Gln Ala Asp Gly Ala Leu Gly Ser Arg
Ser Pro Pro Gly Val Gly 385 390 395 400 Pro Glu Glu Glu Glu Gly Glu
Gly Tyr Glu Glu Pro Asp Ser Glu Glu 405 410 415 Asp Ser Glu Phe Tyr
Glu Asn Asp Ser Asn Leu Gly Gln Asp Gln Leu 420 425 430 Ser Gln Asp
Gly Ser Gly Tyr Glu Asn Pro Glu Asp Glu Pro Leu Gly 435 440 445 Pro
Glu Asp Glu Asp Ser Phe Ser Asn Ala Glu Ser Tyr Glu Asn Glu 450 455
460 Asp Glu Glu Leu Thr Gln Pro Val Ala Arg Thr Met Asp Phe Leu Ser
465 470 475 480 Pro His Gly Ser Ala Trp Asp Pro Ser Arg Glu Ala Thr
Ser Leu Gly 485 490 495 Ser Gln Ser Tyr Glu Asp Met Arg Gly Ile Leu
Tyr Ala Ala Pro Gln 500 505 510 Leu Arg Ser Ile Arg Gly Gln Pro Gly
Pro Asn His Glu Glu Asp Ala 515 520 525 Asp Ser Tyr Glu Asn Met Asp
Asn Pro Asp Gly Pro Asp Pro Ala Trp 530 535 540 Gly Gly Gly Gly Arg
Met Gly Thr Trp Ser Thr Arg 545 550 555 <210> SEQ ID NO 126
<211> LENGTH: 5 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Glycine Serine Linker <400> SEQUENCE: 126 Gly
Gly Gly Gly Ser 1 5
* * * * *