U.S. patent application number 14/183438 was filed with the patent office on 2014-09-25 for 2'-branched nucleosides and flaviviridae mutation.
This patent application is currently assigned to Idenix Pharmaceuticals, Inc.. The applicant listed for this patent is Idenix Pharmaceuticals, Inc.. Invention is credited to Vadim BICHKO, Paolo LACOLLA, Lin QU, Jean-Pierre SOMMADOSSI, David N. STANDRING.
Application Number | 20140286900 14/183438 |
Document ID | / |
Family ID | 32326395 |
Filed Date | 2014-09-25 |
United States Patent
Application |
20140286900 |
Kind Code |
A1 |
SOMMADOSSI; Jean-Pierre ; et
al. |
September 25, 2014 |
2'-BRANCHED NUCLEOSIDES AND FLAVIVIRIDAE MUTATION
Abstract
The present invention discloses a method for the treatment of
Flaviviridae infection that includes the administration of a
2'-branched nucleoside, or a pharmaceutically acceptable prodrug
and/or salt thereof, to a human in need of therapy in combination
or alternation with a drug that directly or indirectly induces a
mutation in the viral genome at a location other than a mutation of
a nucleotide that results in a change from serine to a different
amino acid in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, or is
associated with such a mutation. The invention also includes a
method to detect a mutant strain of Flaviviridae and a method for
its treatment.
Inventors: |
SOMMADOSSI; Jean-Pierre;
(Boston, MA) ; LACOLLA; Paolo; (Capoterra, IT)
; STANDRING; David N.; (Milton, MA) ; BICHKO;
Vadim; (San Diego, CA) ; QU; Lin; (Webster,
TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Idenix Pharmaceuticals, Inc. |
Cambridge |
MA |
US |
|
|
Assignee: |
Idenix Pharmaceuticals,
Inc.
Cambridge
MA
|
Family ID: |
32326395 |
Appl. No.: |
14/183438 |
Filed: |
February 18, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12914914 |
Oct 28, 2010 |
8674085 |
|
|
14183438 |
|
|
|
|
10715729 |
Nov 17, 2003 |
7824851 |
|
|
12914914 |
|
|
|
|
60426675 |
Nov 15, 2002 |
|
|
|
Current U.S.
Class: |
424/85.7 |
Current CPC
Class: |
A61K 38/215 20130101;
A61P 31/14 20180101; C12Q 1/04 20130101; A61K 31/7052 20130101;
C12N 2770/24222 20130101; C12Q 1/707 20130101; C07K 14/005
20130101; C12Q 2600/156 20130101; A61K 31/7052 20130101; A61P 43/00
20180101; C07H 19/16 20130101; G01N 2333/186 20130101; C12N
2770/24122 20130101; C12N 2770/24022 20130101; A61K 45/06 20130101;
C12Q 1/18 20130101; C12Q 2600/158 20130101; A61K 2300/00 20130101;
A61K 31/7072 20130101; A61P 31/00 20180101; A61P 31/18 20180101;
A61K 38/21 20130101; C12Q 1/701 20130101; A61P 31/12 20180101; A61K
38/217 20130101; C07H 19/06 20130101; A61K 38/212 20130101 |
Class at
Publication: |
424/85.7 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; C12Q 1/04 20060101 C12Q001/04 |
Claims
1-86. (canceled)
87. A method of treating a hepatitis C virus infection in a host,
comprising: (a) administering an effective amount of a compound of
formula III: ##STR00026## or a pharmaceutically acceptable salt, a
stereoisomeric, tautomeric or polymorphic form thereof, wherein:
Base is uracil; R.sup.1 is mono-, di- or triphosphate, or a
stabilized phosphate; R.sup.2 is hydrogen; R.sup.6 is alkyl,
CH.sub.3, CF.sub.3, azido, cyano, alkenyl, alkynyl, Br-vinyl,
2-Br-ethyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
CF.sub.3, chloro, bromo, fluoro, iodo, NO.sub.2, NH.sub.2,
--NH(lower alkyl), --NH(acyl), --N(lower alkyl).sub.2, or
--N(acyl).sub.2; R.sup.7 is fluorine; and X is O, S, SO.sub.2, or
CH.sub.2; (b) identifying viral resistance to the compound of
formula III in the host by detecting an amino acid 282 Ser to Thr
mutation in the RNA polymerase region of the hepatitis C virus; and
c) administering to the host infected with the virus resistant to
the compound of formula III, an effective amount of one or more
drugs that directly or indirectly induce a mutation in a hepatitis
C virus at a location other than nucleotide 8443 (G to C) of the
HCV genome or amino acid 282 Ser to Thr of the RNA polymerase
region of HCV.
88. The method of claim 87, wherein the host is human.
89. The method of claim 87, wherein the compound of formula III is
in a pharmaceutically acceptable carrier or diluents.
90. The method of claim 87, wherein the drug in step (c) is
interferon.
91. The method of claim 87, wherein identifying viral resistance in
step (b) comprises assaying the blood of the host to test for
seroconversion from wild type to mutant hepatitis C virus.
92. The method of claim 87, wherein identifying viral resistance in
step (b) comprises phenotypic analysis of viral plaque growth from
a viral culture sample from the host.
93. The method of claim 92, wherein the phenotypic analysis of step
(b) comprises (i) obtaining a viral culture sample from the host;
(ii) culturing the sample and comparing the plaque growth between
the sample and wild type virus; and (iii) determining weather the
plaque growth of the sample is smaller than the plaque growth of
the wild type virus.
94. The method of claim 87, wherein identifying viral resistance in
step (b) comprises determination of the replication fitness of the
virus.
95. The method of claim 94, wherein the determination of the
replication fitness of the virus in step (b) comprises (i)
obtaining a viral culture sample from the host; (ii) determining
the replication fitness of the sample virus; and (iii) determining
whether the replicon fitness of the sample virus is less than than
the replicon fitness of the wild type virus.
96. The method of claim 87, wherein identifying viral resistance in
step (b) comprises detecting the presence of cytidine at nucleotide
8443 of the RNA polymerase region of the hepatitis C virus.
97. The method of claim 87, wherein identifying viral resistance in
step (b) comprises: (i) contacting a sample containing a hepatitis
C virus nucleic acid sequence with a detectable oligonucleotide
probe having a sequence complementary to a codon that encodes a
serine in the highly conserved consensus sequence, XRXSGXXXT, or
SEQ ID NO: 63, of domain B of the RNA polymerase region of the
hepatitis C virus; (ii) allowing the probe to hybridize to the
sequence; and (iii) detecting the hybridization of the probe to the
sequence.
Description
CROSS-REFERENCE
[0001] This application is a continuation of U.S. application Ser.
No. 12/914,914, filed Oct. 28, 2010, which is a continuation of
U.S. application Ser. No. 10/715,729, filed on Nov. 17, 2003, now
issued as U.S. Pat. No. 7,824,851, which claims priority to U.S.
Application No. 60/426,675, filed on Nov. 15, 2002, the disclosures
of which are hereby incorporated by reference in their
entireties.
FIELD OF THE INVENTION
[0002] This invention is a method for the treatment of Flaviviridae
infection in a host, such as a human, in need of such therapy, that
includes the administration of a 2'-branched nucleoside, or a
pharmaceutically acceptable salt, ester, or prodrug thereof, in
combination and/or alternation with one or more drugs that directly
or indirectly induce a mutation in a Flaviviridae at a location
other than a mutation of a nucleotide that results in a change from
serine to a different amino acid in the highly conserved consensus
sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA
polymerase region, and/or one or more drugs that are associated
with such a mutation. The invention also includes a method for the
treatment of Flaviviridae infection in a host, such as a human, in
need of such therapy, that includes the administration of a
2'-branched nucleoside, or a pharmaceutically acceptable salt,
ester, or prodrug thereof, in combination and/or alternation with
interferon. The invention also includes a method to detect a mutant
strain of Flaviviridae and a method for its treatment, and kits and
materials for such detection.
BACKGROUND OF THE INVENTION
[0003] The Flaviviridae family of viruses comprises at least three
distinct genera: pestiviruses, which cause disease in cattle and
pigs; flaviviruses, which are the primary cause of diseases such as
dengue fever and yellow fever; and hepaciviruses, whose sole member
is HCV. The flavivirus genus includes more than 68 members
separated into groups on the basis of serological relatedness
(Calisher et al., J. Gen. Virol, 1993, 70, 37-43). Clinical
symptoms vary and include fever, encephalitis and hemorrhagic fever
(Fields Virology, Editors: Fields, B. N., Knipe, D. M., and Howley,
P. M., Lippincott-Raven Publishers, Philadelphia, Pa., 1996,
Chapter 31, 931-959). Flaviviruses of global concern that are
associated with human disease include the dengue hemorrhagic fever
viruses (DHF), yellow fever virus, West Nile virus, shock syndrome
and Japanese encephalitis virus (Halstead, S. B., Rev. Infect.
Dis., 1984, 6, 251-264; Halstead, S. B., Science, 239:476-481,
1988; Monath, T. P., New Eng. J. Med., 1988, 319, 641-643).
[0004] The pestivirus genus includes bovine viral diarrhea virus
(BVDV), classical swine fever virus (CSFV, also called hog cholera
virus) and border disease virus (BDV) of sheep (Moennig, V. et al.
Adv. Vir. Res. 1992, 41, 53-98). Pestivirus infections of
domesticated livestock (cattle, pigs and sheep) cause significant
economic losses worldwide. BVDV causes mucosal disease in cattle
and is of significant economic importance to the livestock industry
(Meyers, G. and Thiel, H.-J., Advances in Virus Research, 1996, 47,
53-118; Moennig V., et al, Adv. Vir. Res. 1992, 41, 53-98). Human
pestiviruses have not been as extensively characterized as the
animal pestiviruses. However, serological surveys indicate
considerable pestivirus exposure in humans.
[0005] Pestiviruses and hepaciviruses are closely related virus
groups within the Flaviviridae family. Other closely related
viruses in this family include the GB virus A, GB virus A-like
agents, GB virus-B and GB virus-C (also called hepatitis G virus,
HGV). The hepacivirus group (hepatitis C virus; HCV) consists of a
number of closely related but genotypically distinguishable viruses
that infect humans. There are approximately 6 HCV genotypes and
more than 50 subtypes. HCV is a major cause of hepatitis globally.
Most HCV infections become persistent and about 75% of cases
develop chronic liver disease. Chronic HCV infection can lead to
development of cirrhosis, hepatocellular carcinoma and liver
failure. Due to the similarities between pestiviruses and
hepaciviruses, combined with the poor ability of hepaciviruses to
grow efficiently in cell culture, bovine viral diarrhea virus
(BVDV) is often used as a surrogate to study the HCV virus.
[0006] The genetic organization of pestiviruses and hepaciviruses
is very similar. These positive stranded RNA viruses possess a
single large open reading frame (ORF) encoding all the viral
proteins necessary for virus replication. These proteins are
expressed as a polyprotein that is co- and post-translationally
processed by both cellular and virus-encoded proteinases to yield
the mature viral proteins. The viral proteins responsible for the
replication of the viral genome RNA are located within
approximately the carboxy-terminal two-thirds of the ORF and are
termed nonstructural (NS) proteins. The genetic organization and
polyprotein processing of the nonstructural protein portion of the
ORF for pestiviruses and hepaciviruses is very similar. For both
the pestiviruses and hepaciviruses, the mature nonstructural (NS)
proteins, in sequential order from the amino-terminus of the
nonstructural protein coding region to the carboxy-terminus of the
ORF, consist of p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B.
[0007] The NS proteins of pestiviruses and hepaciviruses share
sequence domains that are characteristic of specific protein
functions. For example, the NS3 proteins of viruses in both groups
possess amino acid sequence motifs characteristic of serine
proteinases and of helicases (Gorbalenya et al. (1988) Nature
333:22; Bazan and Fletterick (1989) Virology 171:637-639;
Gorbalenya et al. (1989) Nucleic Acid Res. 17.3889-3897).
Similarly, the NS5B proteins of pestiviruses and hepaciviruses have
the motifs characteristic of RNA-directed RNA polymerases (Koonin,
E. V. and Dolja, V. V. (1993) Crit. Rev. Biochem. Molec. Biol.
28:375-430).
[0008] Furthermore, the actual roles and functions of the NS
proteins of pestiviruses and hepaciviruses in the lifecycle of the
viruses are directly analogous. In both cases, the NS3 serine
proteinase is responsible for all proteolytic processing of
polyprotein precursors downstream of its position in the ORF
(Wiskerchen and Collett (1991) Virology 184:341-350; Bartenschlager
et al. (1993) J. Virol. 67:3835-3844; Eckart et al. (1993) Biochem.
Biophys. Res. Comm. 192:399-406; Grakoui et al. (1993) J. Virol.
67:2832-2843; Grakoui et al. (1993) Proc. Natl. Acad. Sci. USA
90:10583-10587; Hijikata et al. (1993) J. Virol. 67:4665-4675; Tome
et al. (1993) J. Virol. 67:4017-4026). The NS4A protein, in both
cases, acts as a cofactor with the NS3 serine protease
(Bartenschlager et al. (1994) J. Virol. 68:5045-5055; Failla et al.
(1994) J. Virol. 68: 3753-3760; Lin et al. (1994) 68:8147-8157; Xu
et al. (1997) J. Virol. 71:5312-5322). The NS3 protein of both
viruses also functions as a helicase (Kim et al. (1995) Biochem.
Biophys. Res. Comm. 215: 160-166; Jin and Peterson (1995) Arch.
Biochem. Biophys., 323:47-53; Warrener and Collett (1995) J. Virol.
69:1720-1726). Finally, the NS5B proteins of pestiviruses and
hepaciviruses have the predicted RNA-directed RNA polymerases
activity (Behrens et al. (1996) EMBO J. 15:12-22; Lchmannet al.
(1997) J. Virol. 71:8416-8428; Yuan et al. (1997) Biochem. Biophys.
Res. Comm. 232:231-235; Hagedorn, PCT WO 97/12033; Zhong et al.
(1998) J. Virol. 72.9365-9369).
[0009] Examples of antiviral agents that have been identified as
active against the Flaviviridae family of viruses include:
[0010] (1) Interferon
[0011] Interferons (IFNs) are compounds that have been commercially
available for the treatment of chronic hepatitis for nearly a
decade. IFNs are glycoproteins produced by immune cells in response
to viral infection. IFNs inhibit viral replication of many viruses,
including HCV, and when used as the sole treatment for hepatitis C
infection, IFN suppresses serum HCV-RNA to undetectable levels.
Additionally, IFN normalizes serum amino transferase levels.
Unfortunately, the effects of IFN are temporary and a sustained
response occurs in only 8%-9% of patients chronically infected with
HCV (Gary L. Davis. Gastroenterology 118:S104-S114, 2000).
[0012] A number of patents disclose HCV treatments using
interferon-based therapies. For example, U.S. Pat. No. 5,980,884 to
Blatt et al. discloses methods for retreatment of patients
afflicted with HCV using consensus interferon. U.S. Pat. No.
5,942,223 to Bazer et al. discloses an anti-HCV therapy using ovine
or bovine interferon-tau. U.S. Pat. No. 5,928,636 to Alber et al.
discloses the combination therapy of interleukin-12 and interferon
alpha for the treatment of infectious diseases including HCV. U.S.
Pat. No. 5,908,621 to Glue et al. discloses the use of polyethylene
glycol modified interferon for the treatment of HCV. U.S. Pat. No.
5,849,696 to Chretien et al. discloses the use of thymosins, alone
or in combination with interferon, for treating HCV. U.S. Pat. No.
5,830,455 to Valtuena et al. discloses a combination HCV therapy
employing interferon and a free radical scavenger. U.S. Pat. No.
5,738,845 to Imakawa discloses the use of human interferon tau
proteins for treating HCV. Other interferon-based treatments for
HCV are disclosed in U.S. Pat. No. 5,676,942 to Testa et al., U.S.
Pat. No. 5,372,808 to Blatt et al., and U.S. Pat. No.
5,849,696.
[0013] (2) Ribavirin (Battaglia, A. M. et al., Ann. Pharmacother,
2000,. 34, 487-494); Berenguer, M. et al. Antivir. Ther., 1998, 3
(Suppl. 3), 125-136).
[0014] Ribavirin
(1-.beta.-D-ribofuranosyl-1-1,2,4-triazole-3-carboxamide) is a
synthetic, non-interferon-inducing, broad spectrum antiviral
nucleoside analog. It is sold under the trade names Virazole.TM.
(The Merck Index, 11th edition, Editor: Budavari, S., Merck &
Co., Inc., Rahway, N.J., pi304, 1989); Rebetol (Schering Plough)
and Co-Pegasus (Roche). U.S. Pat. No. 3,798,209 and RE29,835 (ICN
Pharmaceuticals) disclose and claim ribavirin. Ribavirin is
structurally similar to guanosine, and has in vitro activity
against several DNA and RNA viruses including Flaviviridae (Gary L.
Davis. Gastroenterology 118:S104-S114, 2000). U.S. Pat. No.
4,211,771 (to ICN Pharmaceuticals) discloses the use of ribavirin
as an antiviral agent. Ribavirin reduces serum amino transferase
levels to normal in 40% of patients, but it does not lower serum
levels of HCV-RNA (Gary L. Davis. Gastroenterology 118:S104-S114,
2000). Thus, ribavirin alone is not effective in reducing viral RNA
levels. Additionally, ribavirin has significant toxicity and is
known to induce anemia.
[0015] Combination of Interferon and Ribavirin
[0016] Schering-Plough sells ribavirin as Rebetol.RTM. capsules
(200 mg) for administration to patients with HCV. The U.S. FDA has
approved Rebetol capsules to treat chronic HCV infection in
combination with Schering's alpha interferon-2b products
Intron.RTM. A and PEG-Intron.TM.. Rebetol capsules are not approved
for monotherapy (i.e., administration independent of Intron.RTM.A
or PEG-Intron), although Intron A and PEG-Intron are approved for
monotherapy (i.e., administration without ribavirin). Hoffman La
Roche is selling ribavirin under the name Co-Pegasus in Europe and
the United States, also for use in combination with interferon for
the treatment of HCV. Other alpha interferon products include
Roferon-A (Hoffmann-La Roche), Infergen.RTM. (Intermune, formerly
Amgen's product), and Wellferon.RTM. (Wellcome Foundation) are
currently FDA-approved for HCV monotherapy. Interferon products
currently in development for HCV include: Roferon-A (interferon
alfa-2a) by Roche, PEGASYS (pegylated interferon alfa-2a) by Roche,
INFERGEN (interferon alfacon-1) by InterMune, OMNIFERON (natural
interferon) by Viragen, ALBUFERON by Human Genome Sciences, REBIF
(interferon beta-1a) by Ares-Serono, Omega Interferon by
BioMedicine, Oral Interferon Alpha by Amarillo Biosciences, and
Interferon gamma-1b by InterMune.
[0017] The combination of IFN and ribavirin for the treatment of
HCV infection has been reported to be effective in the treatment of
IFN naive patients (Battaglia, A. M. et al., Ann. Pharmacother.
34:487-494, 2000). Combination treatment is effective both before
hepatitis develops and when histological disease is present
(Berenguer, M. et al. Antivir. Ther. 3(Suppl. 3):125-136, 1998).
Currently, the most effective therapy for HCV is combination
therapy of pegylated interferon with ribavirin (2002 NIH Consensus
Development Conference on the Management of Hepatitis C). However,
the side effects of combination therapy can be significant and
include hemolysis, flu-like symptoms, anemia, and fatigue (Gary L.
Davis. Gastroenterology 118:S104-S114, 2000).
[0018] (3) Substrate-based NS3 protease inhibitors (for example,
Attwood et al., Antiviral peptide derivatives, PCT WO 98/22496,
1998; Attwood et al., Antiviral Chemistry and Chemotherapy 1999,
10, 259-273; Attwood et al., Preparation and use of amino acid
derivatives as anti-viral agents, German Patent Pub. DE 19914474;
Tung et al. Inhibitors of serine proteases, particularly hepatitis
C virus NS3 protease, PCT WO 98/17679), including alphaketoamides
and hydrazinoureas, and inhibitors that terminate in an
electrophile such as a boronic acid or phosphonate (Llinas-Brunet
et al., Hepatitis C inhibitor peptide analogues, PCT WO
99/07734).
[0019] (4) Non-substrate-based inhibitors, for example,
2,4,6-trihydroxy-3-nitro-benzamide derivatives (Sudo K. et al.,
Biochemical and Biophysical Research Communications, 1997, 238,
643-647; Sudo K. et al. Antiviral Chemistry and Chemotherapy, 1998,
9, 186), including RD3-4082 and RD3-4078, the former substituted on
the amide with a 14 carbon chain and the latter processing a
para-phenoxyphenyl group;
[0020] (5) Thiazolidine derivatives which show relevant inhibition
in a reverse-phase HPLC assay with an NS3/4A fusion protein and
NS5A/5B substrate (for example Sudo K. et al., Antiviral Research,
1996, 32, 9-18), especially compound RD-1-6250, possessing a fused
cinnamoyl moiety substituted with a long alkyl chain, RD4 6205 and
RD4 6193;
[0021] (6) Thiazolidines and benzanilides (for example Kakiuchi N.
et al. J. EBS Letters 421, 217-220; and Takeshita N. et al.
Analytical Biochemistry, 1997, 247, 242-246);
[0022] (7) A phenanthrenequinone possessing activity against
protease in a SDS-PAGE and autoradiography assay isolated from the
fermentation culture broth of Streptomyces sp., for example, Sch
68631 (Chu M. et al., Tetrahedron Letters, 1996, 37, 7229-7232),
and Sch 351633, isolated from the fungus Penicillium griscofuluum,
which demonstrates activity in a scintillation proximity assay (Chu
M. et al., Bioorganic and Medicinal Chemistry Letters 9,
1949-1952);
[0023] (8) Selective NS3 inhibitors, for example, those based on
the macromolecule elgin c, isolated from leech (Qasim M. A. et al.,
Biochemistry, 1997, 36, 1598-1607);
[0024] (9) Helicase inhibitors (for example Diana G. D. et al.,
Compounds, compositions and methods for treatment of hepatitis C,
U.S. Pat. No. 5,633,358; Diana G. D. et al., Piper idine
derivatives, pharmaceutical compositions thereof and their use in
the treatment of hepatitis C, PCT WO 97/36554);
[0025] (10) Polymerase inhibitors for example nucleotide analogues,
gliotoxin (Ferrari R. et al. Journal of Virology, 1999, 73,
1649-1654), and the natural product cerulenin (Lohmann V. et al.,
Virology, 1998, 249, 108-118);
[0026] (11) Antisense phosphorothioate oligodeoxynucleotides
(S-ODN) complementary to sequence stretches in the 5' non-coding
region (NCR) of the virus (Alt M. et al., Hepatology, 1995, 22,
707-717), or nucleotides 326-348 comprising the 3' end of the NCR
and nucleotides 371-388 located in the core coding region of the
HCV RNA (Alt M. et al., Archives of Virology, 1997, 142, 589-599;
Galderisi U. et al., Journal of Cellular Physiology, 1999, 181,
251-257).
[0027] (12) Inhibitors of IRES-dependent translation (Ikeda N et
al., Agent for the prevention and treatment of hepatitis C,
Japanese Patent Pub. JP-08268890; Kai Y. et al. Prevention and
treatment of viral diseases, Japanese Patent Pub. JP-10101591).
[0028] (13) Nuclease-resistant ribozymes (for example Maccjak, D.
J. et al., Hepatology 1999, 30, abstract 995).
[0029] (14) Nucleoside analogs have also been developed for the
treatment of Flaviviridae infections.
[0030] Idenix Pharmaceuticals, Ltd. discloses branched nucleosides,
and their use in the treatment of HCV and flaviviruses and
pestiviruses in US Patent Publication No. 2003/0050229 A1 and US
Patent Publication No. 2003/0060400 A1, which correspond to
International Publication Nos. WO 01/90121 and WO 01/92282. A
method for the treatment of hepatitis C infection (and flaviviruses
and pestiviruses) in humans and other host animals is disclosed in
the Idenix publications that includes administering an effective
amount of a biologically active 1', 2', 3' or 4'-branched (.beta.-D
or .beta.-L nucleosides or a pharmaceutically acceptable salt or
prodrug thereof, administered either alone or in combination,
optionally in a pharmaceutically acceptable carrier.
[0031] Other patent applications disclosing the use of certain
nucleoside analogs to treat hepatitis C virus include:
International Patent Publication Nos. WO 01/32153 (PCT/CA00/01316;
filed Nov. 3, 2000) and WO 01/60315 (PCT/CA01/00197; filed Feb. 19,
2001) filed by BioChem Pharma, Inc. (now Shire Biochem, Inc.); US
Patent Publication No. 2002/0147160 and the corresponding
International Patent Publication Nos. WO 02/057425 (PCT/US02/01531;
filed Jan. 18, 2002) and WO 02/057287 (PCT/US02/03086; filed Jan.
18, 2002) filed by Merck & Co., Inc.; US Patent Publication
Nos. 2003/083307 A1 and US 2003/008841 A1, and the corresponding
International Patent Publication Nos. WO 02/18404 (PCT/EPO1/09633;
published Aug. 21, 2001); WO 02/100415 and WO 02/094289, filed by
Hoffman-LaRoche; US Patent Publication No. 2003/028013 A1 and the
corresponding International Patent Publication Nos. WO 03/062255
and WO 03/061385 filed by Ribapharm; and WO 01/79246 and WO
02/32920 filed by Pharmasset.
[0032] (15) Miscellaneous compounds including
1-amino-alkylcyclohexanes (U.S. Pat. No. 6,034,134 to Gold et al.),
alkyl lipids (U.S. Pat. No. 5,922,757 to Chojkier et al.), vitamin
E and other antioxidants (U.S. Pat. No. 5,922,757 to Chojkier et
al.), squalene, amantadine, bile acids (U.S. Pat. No. 5,846,964 to
Ozeki et al.), N-(phosphonoacetyl)-L-aspartic acid, (U.S. Pat. No.
5,830,905 to Diana et al.), benzenedicarboxamides (U.S. Pat. No.
5,633,388 to Diana et al.), polyadenylic acid derivatives (U.S.
Pat. No. 5,496,546 to Wang et al.), 2',3'-dideoxyinosine (U.S. Pat.
No. 5,026,687 to Yarchoan et al.), and benzimidazoles (U.S. Pat.
No. 5,891,874 to Colacino et al.).
[0033] (16) Other compounds currently in clinical development for
treatment of hepatitis c virus include: Interleukin-10 by
Schering-Plough, IP-501 by Interneuron, Merimebodib VX-497 by
Vertex, AMANTADINE (Symmetrel) by Endo Labs Solvay, HEPTAZYME by
RPI, IDN-6556 by Idun Pharma., XTL-002 by XTL., HCV/MF59 by Chiron,
CIVACIR by NABI, LEVOVIRIN by ICN, VIRAMIDINE by ICN, ZADAXIN
(thymosin alfa-1) by Sei Clone, CEPLENE (histamine dihydrochloride)
by Maxim, VX 950/LY 570310 by Vertex/Eli Lilly, ISIS14803 by Isis
Pharmaceutical/Elan, IDN-6556 by Idun Pharmaceuticals, Inc. and JTK
003 by AKROS Pharma.
[0034] Drug-resistant variants of viruses can emerge after
prolonged treatment with an antiviral agent. Drug resistance most
typically occurs by mutation of a gene that encodes for an enzyme
used in viral replication, and, for example, in the case of HIV,
reverse transcriptase, protease, or DNA polymerase. It has been
demonstrated that the efficacy of a drug against viral infection
can be prolonged, augmented, or restored by administering the
compound in combination or alternation with a second, and perhaps
third, antiviral compound that is effective in combating the virus.
The pharmacokinetics, biodistribution, or other parameter of the
drug can be altered by such combination or alternation therapy. In
general, combination therapy is typically preferred over
alternation therapy because it induces multiple simultaneous
pressures on the virus. One cannot predict, however, what mutations
will be induced in the viral genome by a given drug, whether the
mutation is permanent or transient, or how an infected cell with or
without a mutated viral sequence will respond to therapy with other
agents in combination or alternation. This is exacerbated by the
fact that there is a paucity of data on the kinetics of drug
resistance in long-term cell cultures treated with modern antiviral
agents.
[0035] It is an object of the present invention to optimize the
treatment of HCV infection.
[0036] It is a further object to provide the optimal administration
of 2'-branched nucleosides, and in particular, 2'-branched
pyrimidine nucleosides, for the treatment of Flaviviridae
infections.
[0037] It is another object of the present invention to provide a
method and composition that includes 2'-branched nucleosides for
the treatment of patients infected with pestiviruses, flaviviruses,
or hepaciviruses that exhibit advantageous or improved
pharmacokinetic, biodistribution, metabolic, resistance or other
parameters over administration of 2'-branched pyrimidine
nucleosides alone.
[0038] It is yet another object of the present invention to provide
a method and composition for the treatment of patients infected
with Flaviviridae in which 2'-branched nucleosides, and in
particular, 2'-branched pyrimidine nucleosides are administered in
combination and/or alternation with one or more compounds that act
synergistically or advantageously with 2'-branched pyrimidine
nucleosides against the virus.
[0039] It is still another object of the present invention to
provide a method and composition for the treatment of patients
infected with a drug resistant form of pestiviruses, flaviviruses,
or hepaciviruses.
[0040] It is also an object of the invention to provide a method
and kit to identify a mutant strain of Flaviviridae.
SUMMARY OF THE INVENTION
[0041] It has been discovered that prolonged use of a 2'-branched
nucleoside, for example a 2'-branched nucleoside depicted below,
and in particular, a 2'-branched pyrimidine nucleoside, such as the
compound .beta.-D-2'-CH.sub.3-riboC, or a 2'-branched purine
nucleoside, including the compound
.beta.-D-2'-CH.sub.3-riboAdenosine or
.beta.-D-2'-CH.sub.3-ribo-6-N-methyl amino adenosine, is associated
with a mutation at a nucleotide that encodes for serine in the
highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of
domain B of the RNA polymerase region (FIG. 11) of Flaviviridae,
which results in a change in the amino acid residue serine to a
different amino acid, for example, threonine. This domain is found
in the NS5B region of the HCV genome, as well as in genomes of
other flaviviruses. It is highly conserved among all hepaci-,
pesti- and flavivirus genomes (FIG. 11, Lai et al. J. Virol. 1999,
73, 10129-36).
[0042] In one embodiment of the invention, the 2'-branched
nucleoside is of the general formula:
##STR00001##
or its pharmaceutically acceptable prodrug and/or salt, wherein
[0043] R.sup.1, R.sup.2, and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate
prodrug); acyl (including lower acyl); alkyl (including lower
alkyl); sulfonate ester (including alkyl or arylalkyl sulfonyl
including methanesulfonyl); benzyl, wherein the phenyl group is
optionally substituted with one or more substituents as described
in the definition of aryl given herein; lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or phosphate
when administered in vivo; and [0044] R.sup.4 is hydrogen, hydroxy,
alkyl (including lower alkyl), azido, cyano, alkenyl, alkynyl,
Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
chloro, bromo, fluoro, iodo, NO.sub.2, NH.sub.2, --NH(lower alkyl),
--NH(acyl), --N(lower alkyl).sub.2, or --N(acyl).sub.2; and Base is
a purine or pyrimidine as further described herein.
[0045] In a second embodiment of the invention, the 2'-branched
nucleoside is of the general formula:
##STR00002##
or its pharmaceutically acceptable prodrug and/or salt, wherein
[0046] Base is a purine or pyrimidine base as defined herein;
[0047] R.sup.1, R.sup.2 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate);
straight chained, branched or cyclic alkyl (including lower alkyl);
acyl (including lower acyl); CO-alkyl, CO-aryl, CO-alkoxyalkyl,
CO-aryloxyalkyl, CO-substituted aryl, sulfonate ester (including
alkyl or arylalkyl sulfonyl including methanesulfonyl); benzyl,
wherein the phenyl group is optionally substituted with one or more
substituents as described in the definition of aryl given herein;
alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or phosphate
when administered in vivo; [0048] R.sup.6 is alkyl (including lower
alkyl and halogenated alkyl), CH.sub.3, CF.sub.3, azido, cyano,
alkenyl, alkynyl, Br-vinyl, 2-Br-ethyl, --C(O)O(alkyl),
--C(O)O(lower alkyl), --O(acyl), --O(lower acyl), --O(alkyl),
--O(lower alkyl), --O(alkenyl), CF.sub.3, chloro, bromo, fluoro,
iodo, NO.sub.2, NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower
alkyl).sub.2, --N(acyl).sub.2; and [0049] R.sup.7 is hydrogen,
OR.sup.3, hydroxy, alkyl (including lower alkyl), azido, cyano,
alkenyl, alkynyl, Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl),
--O(acyl), --O(lower acyl), --O(alkyl), --O(lower alkyl),
--O(alkenyl), fluorine, chlorine, bromine, iodine, NO.sub.2,
NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower alkyl).sub.2,
--N(acyl).sub.2; and [0050] X is O, S, SO.sub.2 or CH.sub.2. and
Base is a purine or pyrimidine as further described herein.
[0051] In a third embodiment the invention, the 2'-branched
nucleoside is of the general formula:
##STR00003##
wherein: [0052] Base is a purine or pyrimidine base as defined
herein; [0053] R.sup.6 is alkyl (including lower alkyl and
halogenated alkyl), CH.sub.3, CF.sub.3, azido, cyano, alkenyl,
alkynyl, Br-vinyl, 2-Br-ethyl, --C(O)O(alkyl), --C(O)O(lower
alkyl), --O(acyl), --O(lower acyl), --O(alkyl), --O(lower alkyl),
--O(alkenyl), CF.sub.3, fluoro, chloro, bromo, iodo, NO.sub.2,
NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower alkyl).sub.2,
--N(acyl).sub.2; [0054] R.sup.7 is OR.sup.2, hydroxy, alkyl
(including lower alkyl), azido, cyano, alkenyl, alkynyl, Br-vinyl,
halo-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
fluorine, chlorine, bromine, iodine, NO.sub.2, NH.sub.2, --NH(lower
alkyl), --NH(acyl), --N(lower alkyl).sub.2, --N(acyl).sub.2; [0055]
R.sup.9 is hydrogen, OR.sup.3, hydroxy, alkyl (including lower
alkyl), azido, cyano, alkenyl, alkynyl, Br-vinyl, --C(O)O(alkyl),
--C(O)O(lower alkyl), --O(acyl), --O(lower acyl), --O(alkyl),
--O(lower alkyl), --O(alkenyl), chlorine, bromine, iodine,
NO.sub.2, NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower
alkyl).sub.2, --N(acyl).sub.2; [0056] R.sup.10 is H, alkyl
(including lower alkyl), fluorine, chlorine, bromine or iodine;
[0057] R.sup.1, R.sup.2 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate);
straight chained, branched or cyclic alkyl (including lower alkyl);
acyl (including lower acyl); CO-alkyl, CO-aryl, CO-alkoxyalkyl,
CO-aryloxyalkyl, CO-substituted aryl, sulfonate ester (including
alkyl or arylalkyl sulfonyl including methanesulfonyl); benzyl,
wherein the phenyl group is optionally substituted with one or more
substituents as described in the definition of aryl given herein;
alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or phosphate
when administered in vivo; and [0058] X is O, S, SO.sub.2 or
CH.sub.2.
[0059] In the case of BVDV infection, 2'-branched nucleosides, and,
in particular, 2'-branched pyrimidine nucleosides such as the
compound .beta.-D-2'-CH.sub.3-riboC induce a mutation from a
guanine (G) to cytidine (C) at reside 1214 of the RNA polymerase of
BVDV, which results in a change in the amino acid residue serine to
threonine at position 405 of the enzyme. This serine residue is
located in the conserved consensus sequence (XRXSGXXXT (SEQ ID NO:
63)) of the RNA polymerase domain B (FIGS. 5 and 11), identified by
mutational analysis (Lai V. C., Kao C.C., Ferrari E., Park J., Uss
A. S., Wright-Minogue J., Hong Z., and J. Y. Lau. "Mutational
analysis of bovine viral diarrhea virus RNA-dependent RNA
polymerase" J. Virol. 1999, 73, 10129-36).
[0060] In the case of HCV infection, 2'-branched nucleosides, and,
in particular, 2'-branched pyrimidine nucleosides such as the
compound .beta.-D-2'-CH.sub.3-riboC induce a mutation at a
nucleotide that encodes for Serine.sub.282 in the highly conserved
consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the
RNA polymerase region (FIG. 11), which results in a change from
serine to a different amino acid, such as threonine.
[0061] Furthermore, it has been discovered that 2'-branched
nucleosides and interferon act synergistically to inhibit
Flaviviridae. In particular 2'-branched pyrimidine nucleosides such
as the compound .beta.-D-2'-CH3-riboC or a 2'-branched purine
nucleosides such as the compound .beta.-D-2'-CH3-riboA or
.beta.-D-2'-CH3-ribo-6-N-methyl amino adenosine, and interferon
alpha-2b administered in combination and/or alternation act
synergistically to inhibit Flaviviridae. Moreover, it has been
discovered that the resistant viral populations, which emerge after
2'-branched nucleoside treatment, for example,
.beta.-D-2'-CH.sub.3-riboC treatment, show increased sensitivity to
subsequent treatment with interferon. Thus, sequential and/or
combination therapy of a 2'-branched nucleoside and interferon can
substantially reduce Flaviviridae infections.
[0062] One aspect of the present invention provides a method to
treat a Flaviviridae infection by administering a therapeutically
effective amount of a 2'-branched nucleoside, for example, a
2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC, or its pharmaceutically acceptable
prodrug and/or salt, to a host, such as a human, in need of such
therapy, in combination and/or alternation with one or more drugs
that directly or indirectly induce a mutation in a Flaviviridae at
a location other than a mutation of a nucleotide that results in a
change from serine to a different amino acid in the highly
conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain
B of the RNA polymerase region, and/or one or more drugs that are
associated with such a mutation. This highly conserved serine
residue corresponds to amino acid position 405 of the RNA
polymerase region of the BVDV genome. It also corresponds to amino
acid position 282 of the RNA polymerase region of the HCV genome
(FIG. 11; Lai et al. J. Virol., 1999, 73, 10129-36).
[0063] Another aspect of the present invention provides a method to
treat and/or to substantially cure a Flaviviridae infection in a
host infected with a Flaviviridae that contains a serine to
threonine mutation at the conserved serine residue of a
Flaviviridae (FIG. 11), for example, amino acid 405 of the RNA
polymerase region of BVDV or amino acid 282 of the RNA polymerase
of HCV, by administering a therapeutically effective amount of
interferon. In a specific embodiment, interferon alpha-2b is
administered to treat and/or to substantially cure the infection
caused by a mutated Flaviviridae virus.
[0064] The invention disclosed herein also minimally includes at
least the following embodiments: [0065] (i) A pharmaceutical
composition effective for the treatment of a Flaviviridae infection
in a host, such as a human, comprising an effective amount of a
2'-branched nucleoside, for example, a 2'-branched nucleoside, such
as .beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or its pharmaceutically acceptable
prodrug and/or salt, optionally in a pharmaceutically acceptable
carrier or diluent, in combination with one or more drugs that
directly or indirectly induce a mutation in a Flaviviridae at a
location other than a mutation of a nucleotide that results in a
change from serine to a different amino acid in the highly
conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain
B of the RNA polymerase region, for example, other than nucleotide
1214 (G to C) or 405 Ser to Thr of the RNA polymerase region of
BVDV or nucleotide 8443 (G to C) of the HCV genome or 282 Ser to
Thr of the RNA polymerase region of HCV (FIG. 11; Lai et al. J.
Virol., 1999, 73, 10129-36), and/or one or more drugs that are
associated with such a mutation. [0066] (ii) A pharmaceutical
composition effective for the treatment of a Flaviviridae infection
in a host, such as a human, comprising an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-- riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
prodrug and/or salt thereof, optionally in a pharmaceutically
acceptable carrier or diluent, in combination with interferon.
Interferons include: Intron-A (interferon alpha-2b) by Schering,
PEG-INTRON (pegylated interferon alpha-2b) by Schering, Roferon-A
(interferon alfa-2a) by Roche, PEGASYS (pegylated interferon
alfa-2a) by Roche, INFERGEN (interferon alfacon-1) by InterMune,
OMNIFERON (natural interferon) by Viragen, ALBUFERON by Human
Genome Sciences, REBIF (interferon beta-1a) by Ares-Serono, Omega
Interferon by BioMedicine, Oral Interferon Alpha by Amarillo
Biosciences, and Interferon gamma-1b by InterMune. [0067] (iii) A
pharmaceutical composition effective for the treatment of a
Flaviviridae infection in a host, such as a human, comprising:
[0068] an effective amount of a 2', 3' and/or 5'-prodrug of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
including the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-- ribo-6-N-methylaminopurine or a prodrug,
including the 3'-valine ester prodrug, or a pharmaceutically
acceptable salt thereof, or a pharmaceutically acceptable salt
thereof, optionally in a pharmaceutically acceptable carrier or
diluent; [0069] in combination with one or more drugs that directly
or indirectly induce a mutation in a Flaviviridae at a location
other than a mutation of a nucleotide that results in a change from
serine to a different amino acid in the highly conserved consensus
sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA
polymerase region, and/or one or more drugs that are associated
with such a mutation. [0070] (iv) A method for treating a
Flaviviridae infection in a host, such as a human, comprising
administering an effective amount of a 2'-branched nucleoside, such
as .beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or its pharmaceutically acceptable
prodrug and/or salt to the human, optionally in a pharmaceutically
acceptable carrier or diluent, in combination and/or alternation
with one or more drugs that directly or indirectly induce a
mutation in a Flaviviridae at a location other than a mutation of a
nucleotide that results in a change from serine to a different
amino acid in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, for
example, other than nucleotide 1214 (G to C) or 405 Ser to Thr of
the RNA polymerase region of BVDV or nucleotide 8443 (G to C) of
the HCV genome or 282 Ser to Thr of the RNA polymerase region of
HCV (FIG. 11; Lai et al. J. Virol., 1999, 73, 10129-36), and/or one
or more drugs that are associated with such a mutation. [0071] (v)
A method for treating a Flaviviridae infection in a host, such as a
human, comprising administering an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
prodrug and/or salt thereof to the host, optionally in a
pharmaceutically acceptable carrier or diluent, in combination
and/or alternation with interferon. Interferons include: Intron-A
(interferon alpha-2b) by Schering, PEG-INTRON (pegylated interferon
alpha-2b) by Schering, Roferon-A (interferon alfa-2a) by Roche,
PEGASYS (pegylated interferon alfa-2a) by Roche, INFERGEN
(interferon alfacon-1) by InterMune, OMNIFERON (natural interferon)
by Viragen, ALBUFERON by Human Genome Sciences, REBIF (interferon
beta-1a) by Ares-Serono, Omega Interferon by BioMedicine, Oral
Interferon Alpha by Amarillo Biosciences, and Interferon gamma-1b
by InterMune. [0072] (vi) A method for treating a patient infected
with a Flaviviridae virus that is resistant to a 2'-branched
nucleoside, such as .beta.-D-2'-branched pyrimidine nucleoside, for
example .beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the
3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, comprising administering an effective amount of
interferon, optionally in a pharmaceutically acceptable carrier or
diluent, optionally in a manner that substantially eliminates the
viral load. [0073] (iv) A method for treating a patient infected
with Flaviviridae comprising: [0074] administering an effective
amount of a 2', 3' and/or 5'-prodrug of a 2'-branched nucleoside,
such as .beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, optionally in a pharmaceutically acceptable carrier
or diluent; [0075] in combination and/or alternation with one or
more drugs that directly or indirectly induce a mutation in a
Flaviviridae at a location other than a mutation of a nucleotide
that results in a change from serine to a different amino acid in
the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63),
of domain B of the RNA polymerase region, and/or one or more drugs
that are associated with such a mutation. [0076] (v) A method for
treating a patient infected with Flaviviridae comprising: [0077]
(a) administering to the patient an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-- riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; optionally in a pharmaceutically acceptable carrier
or diluent; [0078] (b) assaying the blood of the patient to test
for seroconversion from wildtype to mutant virus; and [0079] (c)
administering an effective amount of interferon; optionally in a
pharmaceutically acceptable carrier or diluent. [0080] (vi) A
method for assaying a sample suspected of containing a Flaviviridae
resistant to a 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; comprising: [0081] (a) contacting a sample containing
a Flaviviridae nucleic acid sequence with a detectable
oligonucleotide probe having a sequence complementary a codon that
encodes a serine in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase region
of Flaviviridae (FIG. 11); [0082] (b) allowing the probe to
hybridize to the sequence; and [0083] (c) detecting the
hybridization of the probe the sequence. [0084] (vii) A method for
assaying a sample suspected of containing a Flaviviridae resistant
to a 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; comprising: [0085] (a) contacting a sample containing
a Flaviviridae nucleic acid sequence with a detectable
oligonucleotide probe having a sequence complementary to the
cytidine at nucleotide 1214 of the RNA polymerase region of BVDV or
the cytidine at nucleotide 8443 of HCV; [0086] (b) allowing the
probe to hybridize to the sequence; and [0087] (c) detecting the
hybridization of the probe to cytidine at nucleotide 1214 of the
RNA polymerase region of BVDV or at nucleotide 8443 of HCV. [0088]
(viii) A method for treating a patient infected with Flaviviridae
comprising: [0089] (a) administering an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; optionally in a pharmaceutically acceptable carrier
or diluent; [0090] (b) obtaining a viral sample from the patient;
[0091] (c) determining the replication fitness of the virus; [0092]
(d) determining whether the replication fitness of the virus in the
sample is less than the replication fitness of the wild-type virus,
which indicates resistance to the 2'-branched nucleoside, such as
.beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; and [0093] (e) administering an effective amount of
interferon to those patients that are resistant to the 2'-branched
nucleoside, such as .beta.-D-2'-branched pyrimidine nucleoside, for
example .beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the
3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof. [0094] (ix) A method for treating a patient infected
with Flaviviridae comprising: [0095] (a) administering an effective
amount of a 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; optionally in a pharmaceutically acceptable carrier
or diluent; [0096] (b) obtaining a viral culture sample from the
patient; [0097] (c) culturing the sample and comparing the plaque
growth between the sample and wild type virus; [0098] (d)
determining whether the plaque growth of the sample is smaller than
the plaque growth of the wildtype, which indicates resistance to
the 2'-branched nucleoside; and [0099] (e) administering an
effective amount of interferon to those patients that are resistant
to the 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof. [0100] (x) A method for diagnosing the presence of a
Flaviviridae resistant to a 2'-branched nucleoside, such as
.beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, in a patient comprising: [0101] (a) obtaining a
sample suspected of containing a Flaviviridae nucleic acid
sequence;
[0102] (b) contacting the sample with a detectable oligonucleotide
probe having a sequence complementary a codon that encodes a serine
in the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO:
63), of domain B of the RNA polymerase region of Flaviviridae (FIG.
11); [0103] (c) allowing the probe to hybridize to the sequence;
and [0104] (d) detecting the hybridization of the probe the
sequence to determine the presence of a Flaviviridae resistant to
the 2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof. [0105] (xi) A method for diagnosing of the presence
of a Flaviviridae resistant to the 2'-branched nucleoside, such as
.beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-- riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, in a patient comprising: [0106] (a) obtaining a
sample suspected of containing a Flaviviridae nucleic acid
sequence; [0107] (b) contacting the sample with a detectable
oligonucleotide probe having a sequence complementary to the
cytidine at nucleotide 1214 of the RNA polymerase region of BVDV or
the cytidine at nucleotide 8443 of HCV; [0108] (b) allowing the
probe to hybridize to the sequence; and [0109] (c) detecting the
hybridization of the probe to cytidine at nucleotide 1214 of the
RNA polymerase region of BVDV or at nucleotide 8443 of HCV to
determine the presence of a Flaviviridae resistant to to the
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example P.about.D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof.
[0110] The disclosed combination and/or alternation regimens are
useful in the prevention and treatment of Flaviviridae infections,
including BVDV, BDV, CSFV, DHF, yellow fever virus, shock syndrome,
Japanese encephalitis virus, and HCV.
[0111] In addition, the corresponding amino acid sequences of the
Flaviviridae viral markers diagnostic for long term response of
Flaviviridae carriers to 2'-branched nucleoside therapy can be
determined from the illustrative Flaviviridae nucleotide
sequences.
[0112] In addition to identifying viral markers for the purposes of
identifying Flaviviridae strains that are associated with
2'-branched nucleoside failure, the present invention can be
utilized to also identify Flaviviridae strains that respond to
2'-branched nucleoside therapy. In this respect, the absence of
viral markers correlated with 2'-branched nucleoside therapy can be
used to prescribe a course of treatment that includes 2'-branched
nucleoside as a modality for those individuals that carrier
Flaviviridae lacking viral markers correlated with 2'-branched
nucleoside therapy failure.
[0113] In another embodiment, the invention provides an
oligonucleotide primer for amplifying an Flaviviridae nucleic acid
sequence. In one embodiment, the oligonucleotide is at least 14
nucleotides in length and hybridizes under sequence-specific,
stringent hybridization conditions to a nucleotide sequence that
contains the marker correlated with therapy failure.
[0114] Oligonucleotide sequences used as the hybridizing region of
a primer can also be used as the hybridizing region of a probe.
Suitability of a primer sequence for use as a probe depends on the
hybridization characteristics of the primer. Similarly, an
oligonucleotide used as a probe can be used as a primer.
[0115] Additionally, the invention provides a method, materials and
a kit to detect proteins, peptides or peptide fragments that
contain amino acids (as described extensively herein) that are
predictive of the long term response of an Flaviviridae carrier to
2'-branched nucleoside therapy, or antibodies to those proteins,
peptides or peptide fragments. Host sera or tissue can be tested
for either the protein or peptide or the antibody to the protein or
peptide, depending on convenience and perhaps concentration of the
diagnostic material.
[0116] The protein, peptide or peptide fragment can be confirmed by
reaction with an antibody, preferably a monoclonal antibody, for
example using a Western blot method. Alternatively, the protein or
peptide can be isolated and sequenced or otherwise identified by
any means known in the art, including by 2D PAGE. In one
embodiment, a reactive antibody binds to an Flaviviridae protein or
peptide sequence that includes a threonine rather than serine in
the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63),
of domain B of the RNA polymerase region, for example at position
405 of the RNA polymerase region of BVDV genome or at position 282
of the RNA polymerase region of the HCV genome.
[0117] In another embodiment, the reactive antibody binds
specifically to a peptide sequence that includes a threonine rather
than serine in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, for
example at position 405 of the RNA polymerase region of BVDV genome
or at position 282 of the RNA polymerase region of the HCV genome,
which represent a specific point mutations in the RNA polymerase
region of Flaviviridae that is correlated with therapy failure.
[0118] In specific embodiments, an antibody is used that binds to
at least one peptide or peptide fragment encoded for by the nucleic
acid sequences in sequence ID Nos. 1-31.
[0119] In specific embodiments, an antibody is used that binds to
at least one peptide or peptide fragment encoded for by the nucleic
acid sequences in sequence ID Nos. 32-62.
BRIEF DESCRIPTION OF THE FIGURES
[0120] FIG. 1 shows the emergence of
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV from untreated BVDV.
[0121] FIG. 2 illustrates the phenotype of focus formation by (A)
the wild type (wt) BVDV (strain I-N-dIns), and by (B) the
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV (I-N-dIns
.beta.-D-2'-CH.sub.3-riboC-R).
[0122] FIG. 3 demonstrates the growth kinetics of wild-type BVDV
I-N-dIns and its .beta.-D-2'-CH.sub.3-riboC-resistant mutant,
I-N-dIns .beta.-D-2'-CH.sub.3-riboC-R (Resistant Mutant).
[0123] FIG. 4 shows the effect of .beta.-D-2'-CH.sub.3-riboC on the
virus yield in de novo-infected MDBK cells (wherein I-N-dIns is wt
BVDV, and the resistant mutant is I-N-dIns
.beta.-D-2'-CH.sub.3-riboC-R (.beta.-D-2'-CH.sub.3-riboC-resistant
BVDV)).
[0124] FIG. 5 is a schematic representation of the BVDV NS5B region
showing the proposed functional domains, based on the mutational
analysis (Vassilev, V. B. and R. O. Donis. (2000) Bovine viral
diarrhea virus induced apoptosis correlates with increased
intracellular viral RNA accumulation. Virus Res. 69 (2): 95-107).
The large arrow indicates the position of the only amino acid
change found in the NS5B region of the
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV (Ser 405 to Thr 405).
[0125] FIG. 6 illustrates the effect of interferon alpha-2b on the
virus yields in de novo-infected MDBK cells (I-N-dIns: wt BVDV;
I-N-dIns .beta.-D-2'-CH.sub.3-riboC-R:
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV (resistant mutant)).
[0126] FIG. 7 illustrates the effect of .beta.-D-2'-CH.sub.3-riboC
and interferon alpha-2b on BVDV (strain I-N-dIns) titers in
persistently infected MDBK cells
[0127] FIG. 8 demonstrates the effect of .beta.-D-2'-CH.sub.3-riboC
in combination with interferon alpha-2b on wild-type BVDV (strain
I-N-dIns) titers in persistently infected MDBK cells.
[0128] FIG. 9 shows the effect of .beta.-D-2'-CH.sub.3-riboC and
interferon alpha-2b (Intron A) on BVDV (strain NY-1) titers in
persistently infected MDBK cells.
[0129] FIG. 10 illustrates the effect of .beta.-D-2'-CH.sub.3-riboC
and interferon alpha-2b (Intron A) on wild-type BVDV (strain
I-N-dIns) titers in persistently infected MDBK cells.
[0130] FIG. 11 illustrates the alignment of the RNA Polymerase in
domain B of various Flaviviridae; bold type with larger font show
amino acids that are 100% conserved; underlined serine amino acid
residues are ones that may be mutated to threonine after treatment
with a 2'-branched nucleoside. [The 100% conserved serine residue
is also underlined and represents the amino acid that is mutated to
Threonine after treatment with a 2'-branched nucleoside
(Ser.sub.405 of the RNA polymerase region of BVDV; Ser.sub.282 of
the RNA polymerase region of HCV). See Lai et al. J. Virol. 1999,
73, 10129-36.]
DETAILED DESCRIPTION OF THE INVENTION
[0131] It has been discovered that prolonged use of a 2'-branched
nucleoside, for example a 2'-branched nucleoside depicted below,
and in particular, a 2'-branched pyrimidine nucleoside such as the
compound .beta.-D-2'-CH.sub.3-riboC, is associated with a mutation
at a nucleotide that encodes for serine in the highly conserved
consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the
RNA polymerase region (FIG. 11) of Flaviviridae resulting in a
change in the amino acid residue serine to a different amino acid,
for example, threonine. This domain is found in the NS5B region of
the HCV genome, as well as in genomes of other flaviviruses. It is
highly conserved among all hepaci-, pesti- and flavivirus genomes
(FIG. 11, Lai et al. J. Virol. 1999, 73, 10129-36).
[0132] In the case of BVDV infection, 2'-branched nucleosides, and,
in particular, 2'-branched pyrimidine nucleosides such as the
compound .beta.-D-2'-CH.sub.3-riboC induce a mutation from a
guanine (G) to cytidine (C) at reside 1214 of the RNA polymerase of
BVDV causing a change in the amino acid residue serine to threonine
at position 405 of the enzyme. This serine residue is located in
the conserved consensus sequence (XRXSGXXXT (SEQ ID NO: 63)) of the
RNA polymerase domain B (FIGS. 5 and 11), identified by mutational
analysis (Lai V. C., Kao C.C., Ferrari E., Park J., Uss A. S.,
Wright-Minogue J., Hong Z., and J. Y. Lau. "Mutational analysis of
bovine viral diarrhea virus RNA-dependent RNA polymerase" J. Virol.
1999, 73, 10129-36).
[0133] In the case of HCV infection, 2'-branched nucleosides, and,
in particular, 2'-branched pyrimidine nucleosides such as the
compound .beta.-D-2'-CH.sub.3-riboC induce a mutation at a
nucleotide that encodes for Serine.sub.282 in the highly conserved
consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the
RNA polymerase region (FIG. 11) resulting in a change from serine
to a different amino acid, such as threonine.
[0134] Furthermore, it has been discovered that 2'-branched
nucleosides and interferon act synergistically to inhibit
Flaviviridae. In particular 2'-branched pyrimidine nucleosides such
as the compound .beta.-D-2'-CH.sub.3-riboC and interferon alpha-2b
administered in combination and/or alternation act synergistically
to inhibit Flaviviridae.
[0135] Moreover, it has been discovered that the resistant viral
populations, which emerge after 2'-branched nucleoside treatment,
for example, .beta.-D-2'-CH.sub.3-riboC treatment, show increased
sensitivity to subsequent treatment with interferon. Thus,
sequential and/or combination therapy of a 2'-branched nucleoside
and interferon can substantially reduce Flaviviridae
infections.
[0136] One aspect of the present invention provides a method to
treat a Flaviviridae infection by administering a therapeutically
effective amount of a 2'-branched nucleoside, for example, a
2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC, or its pharmaceutically acceptable
prodrug and/or salt, to a host, such as a human, in need of such
therapy, in combination and/or alternation with one or more drugs
that directly or indirectly induce a mutation in a Flaviviridae at
a location other than a mutation of a nucleotide that results in a
change from serine to a different amino acid in the highly
conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain
B of the RNA polymerase region, and/or one or more drugs that are
associated with such a mutation. This highly conserved serine
residue corresponds to amino acid position 405 of the RNA
polymerase region of the BVDV genome. It also corresponds to amino
acid position 282 of the RNA polymerase region of the HCV genome
(FIG. 11; Lai et al. J. Virol., 1999, 73, 10129-36).
[0137] Another aspect of the present invention provides a method to
treat and/or to substantially cure a Flaviviridae infection in a
host infected with a Flaviviridae that contains a serine to
threonine mutation at the conserved serine residue of a
Flaviviridae (FIG. 11), for example, amino acid 405 of the RNA
polymerase region of BVDV or amino acid 282 of the RNA polymerase
of HCV, by administering a therapeutically effective amount of
interferon. In a specific embodiment, interferon alpha-2b is
administered to treat and/or to substantially cure the infection
casued by a mutated Flaviviridae virus.
[0138] The invention disclosed herein also minimally includes at
least the following embodiments: [0139] (i) A pharmaceutical
composition effective for the treatment of a Flaviviridae infection
in a host, such as a human, comprising an effective amount of a
2'-branched nucleoside, for example, a 2'-branched nucleoside, such
as .beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or its pharmaceutically acceptable
prodrug and/or salt, optionally in a pharmaceutically acceptable
carrier or diluent, in combination with one or more drugs that
directly or indirectly induce a mutation in a Flaviviridae at a
location other than a mutation of a nucleotide that results in a
change from serine to a different amino acid in the highly
conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain
B of the RNA polymerase region, for example, other than nucleotide
1214 (G to C) or 405 Ser to Thr of the RNA polymerase region of
BVDV or nucleotide 8443 (G to C) of the HCV genome or 282 Ser to
Thr of the RNA polymerase region of HCV (FIG. 11; Lai et al. J.
Virol., 1999, 73, 10129-36), and/or one or more drugs that are
associated with such a mutation. [0140] (ii) A pharmaceutical
composition effective for the treatment of a Flaviviridae infection
in a host, such as a human, comprising an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-- riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
prodrug and/or salt thereof, optionally in a pharmaceutically
acceptable carrier or diluent, in combination with interferon.
Interferons include: Intron-A (interferon alpha-2b) by Schering,
PEG-INTRON (pegylated interferon alpha-2b) by Schering, Roferon-A
(interferon alfa-2a) by Roche, PEGASYS (pegylated interferon
alfa-2a) by Roche, INFERGEN (interferon alfacon-1) by InterMune,
OMNIFERON (natural interferon) by Viragen, ALBUFERON by Human
Genome Sciences, REBIF (interferon beta-1a) by Ares-Serono, Omega
Interferon by BioMedicine, Oral Interferon Alpha by Amarillo
Biosciences, and Interferon gamma-1b by InterMune. [0141] (iii) A
pharmaceutical composition effective for the treatment of a
Flaviviridae infection in a host, such as a human, comprising:
[0142] an effective amount of a 2', 3' and/or 5'-prodrug of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
including the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-- ribo-6-N-methylaminopurine or a prodrug,
including the 3'-valine ester prodrug, or a pharmaceutically
acceptable salt thereof, or a pharmaceutically acceptable salt
thereof, optionally in a pharmaceutically acceptable carrier or
diluent; [0143] in combination with one or more drugs that directly
or indirectly induce a mutation in a Flaviviridae at a location
other than a mutation of a nucleotide that results in a change from
serine to a different amino acid in the highly conserved consensus
sequence, XRXSGXXXT (SEQ ID NO: 63),of domain B of the RNA
polymerase region, and/or one or more drugs that are associated
with such a mutation. [0144] (iv) A method for treating a
Flaviviridae infection in a host, such as a human, comprising
administering an effective amount of a 2'-branched nucleoside, such
as .beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or its pharmaceutically acceptable
prodrug and/or salt to the human, optionally in a pharmaceutically
acceptable carrier or diluent, in combination and/or alternation
with one or more drugs that directly or indirectly induce a
mutation in a Flaviviridae at a location other than a mutation of a
nucleotide that results in a change from serine to a different
amino acid in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, for
example, other than nucleotide 1214 (G to C) or 405 Ser to Thr of
the RNA polymerase region of BVDV or nucleotide 8443 (G to C) of
the HCV genome or 282 Ser to Thr of the RNA polymerase region of
HCV (FIG. 11; Lai et al. J. Virol., 1999, 73, 10129-36), and/or one
or more drugs that are associated with such a mutation. [0145] (v)
A method for treating a Flaviviridae infection in a host, such as a
human, comprising administering an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
prodrug and/or salt thereof to the host, optionally in a
pharmaceutically acceptable carrier or diluent, in combination
and/or alternation with interferon. Interferons include: Intron-A
(interferon alpha-2b) by Schering, PEG-INTRON (pegylated interferon
alpha-2b) by Schering, Roferon-A (interferon alfa-2a) by Roche,
PEGASYS (pegylated interferon alfa-2a) by Roche, INFERGEN
(interferon alfacon-1) by InterMune, OMNIFERON (natural interferon)
by Viragen, ALBUFERON by Human Genome Sciences, REBIF (interferon
beta-1a) by Ares-Serono, Omega Interferon by BioMedicine, Oral
Interferon Alpha by Amarillo Biosciences, and Interferon gamma-1b
by InterMune. [0146] (vi) A method for treating a patient infected
with a Flaviviridae virus that is resistant to a 2'-branched
nucleoside, such as .beta.-D-2'-branched pyrimidine nucleoside, for
example .beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the
3'-valine ester prodrug of P-- D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, comprising administering an effective amount of
interferon, optionally in a pharmaceutically acceptable carrier or
diluent, optionally in a manner that substantially eliminates the
viral load. [0147] (iv) A method for treating a patient infected
with Flaviviridae comprising: [0148] administering an effective
amount of a 2', 3' and/or 5'-prodrug of a 2'-branched nucleoside,
such as .beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, optionally in a pharmaceutically acceptable carrier
or diluent; [0149] in combination and/or alternation with one or
more drugs that directly or indirectly induce a mutation in a
Flaviviridae at a location other than a mutation of a nucleotide
that results in a change from serine to a different amino acid in
the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63),
of domain B of the RNA polymerase region, and/or one or more drugs
that are associated with such a mutation. [0150] (v) A method for
treating a patient infected with Flaviviridae comprising: [0151]
(a) administering to the patient an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; optionally in a pharmaceutically acceptable carrier
or diluent; [0152] (b) assaying the blood of the patient to test
for seroconversion from wildtype to mutant virus; and [0153] (c)
administering an effective amount of interferon; optionally in a
pharmaceutically acceptable carrier or diluent. [0154] (vi) A
method for assaying a sample suspected of containing a Flaviviridae
resistant to a 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
P-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine nucleoside,
for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; comprising: [0155] (a) contacting a sample containing
a Flaviviridae nucleic acid sequence with a detectable
oligonucleotide probe having a sequence complementary a codon that
encodes a serine in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase region
of Flaviviridae (FIG. 11); [0156] (b) allowing the probe to
hybridize to the sequence; and [0157] (c) detecting the
hybridization of the probe the sequence. [0158] (vii) A method for
assaying a sample suspected of containing a Flaviviridae resistant
to a 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; comprising: [0159] (a) contacting a sample containing
a Flaviviridae nucleic acid sequence with a detectable
oligonucleotide probe having a sequence complementary to the
cytidine at nucleotide 1214 of the RNA polymerase region of BVDV or
the cytidine at nucleotide 8443 of HCV; [0160] (b) allowing the
probe to hybridize to the sequence; and [0161] (c) detecting the
hybridization of the probe to cytidine at nucleotide 1214 of the
RNA polymerase region of BVDV or at nucleotide 8443 of HCV. [0162]
(viii) A method for treating a patient infected with Flaviviridae
comprising: [0163] (a) administering an effective amount of a
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; optionally in a pharmaceutically acceptable carrier
or diluent; [0164] (b) obtaining a viral sample from the patient;
[0165] (c) determining the replication fitness of the virus; [0166]
(d) determining whether the replication fitness of the virus in the
sample is less than the replication fitness of the wild-type virus,
which indicates resistance to the 2'-branched nucleoside, such as
.beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; and [0167] (e) administering an effective amount of
interferon to those patients that are resistant to the 2'-branched
nucleoside, such as .beta.-D-2'-branched pyrimidine nucleoside, for
example .beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the
3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof. [0168] (ix) A method for treating a patient infected
with Flaviviridae comprising: [0169] (a) administering an effective
amount of a 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof; optionally in a pharmaceutically acceptable carrier
or diluent; [0170] (b) obtaining a viral culture sample from the
patient; [0171] (c) culturing the sample and comparing the plaque
growth between the sample and wild type virus; [0172] (d)
determining whether the plaque growth of the sample is smaller than
the plaque growth of the wildtype, which indicates resistance to
the 2'-branched nucleoside; and [0173] (e) administering an
effective amount of interferon to those patients that are resistant
to the 2'-branched nucleoside, such as .beta.-D-2'-branched
pyrimidine nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a
prodrug, such as the 3'-valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a .beta.-D-2'-branched purine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof. [0174] (x) A method for diagnosing the presence of a
Flaviviridae resistant to a 2'-branched nucleoside, such as
.beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, in a patient comprising: [0175] (a) obtaining a
sample suspected of containing a Flaviviridae nucleic acid
sequence;
[0176] (b) contacting the sample with a detectable oligonucleotide
probe having a sequence complementary a codon that encodes a serine
in the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO:
63), of domain B of the RNA polymerase region of Flaviviridae (FIG.
11); [0177] (b) allowing the probe to hybridize to the sequence;
and [0178] (c) detecting the hybridization of the probe the
sequence to determine the presence of a Flaviviridae resistant to
the 2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3 `-valine ester prodrug, or a pharmaceutically acceptable
salt thereof. [0179] (xi) A method for diagnosing of the presence
of a Flaviviridae resistant to the 2`-branched nucleoside, such as
.beta.-D-2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'-valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
.beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-- riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof, in a patient comprising: [0180] (a) obtaining a
sample suspected of containing a Flaviviridae nucleic acid
sequence; [0181] (b) contacting the sample with a detectable
oligonucleotide probe having a sequence complementary to the
cytidine at nucleotide 1214 of the RNA polymerase region of BVDV or
the cytidine at nucleotide 8443 of HCV; [0182] (b) allowing the
probe to hybridize to the sequence; and [0183] (c) detecting the
hybridization of the probe to cytidine at nucleotide 1214 of the
RNA polymerase region of BVDV or at nucleotide 8443 of HCV to
determine the presence of a Flaviviridae resistant to to the
2'-branched nucleoside, such as .beta.-D-2'-branched pyrimidine
nucleoside, for example .beta.-D-2'-CH.sub.3-riboC or a prodrug,
such as the 3'-valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC,
or a .beta.-D-2'-branched purine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboA or
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine or a prodrug, such
as the 3'-valine ester prodrug, or a pharmaceutically acceptable
salt thereof.
[0184] The disclosed combination and/or alternation regimens are
useful in the prevention and treatment of Flaviviridae infections,
including BVDV, BDV, CSFV, DHF, yellow fever virus, shock syndrome,
Japanese encephalitis virus, and HCV.
[0185] In addition, the corresponding amino acid sequences of the
Flaviviridae viral markers diagnostic for long term response of
Flaviviridae carriers to 2'-branched nucleoside therapy can be
determined from the illustrative Flaviviridae nucleotide
sequences.
[0186] In addition to identifying viral markers for the purposes of
identifying Flaviviridae strains that are associated with
2'-branched nucleoside failure, the present invention can be
utilized to also identify Flaviviridae strains that respond to
2'-branched nucleoside therapy. In this respect, the absence of
viral markers correlated with 2'-branched nucleoside therapy can be
used to prescribe a course of treatment that includes 2'-branched
nucleoside as a modality for those individuals that carrier
Flaviviridae lacking viral markers correlated with 2'-branched
nucleoside therapy failure.
[0187] In another embodiment, the invention provides an
oligonucleotide primer for amplifying an Flaviviridae nucleic acid
sequence. In one embodiment, the oligonucleotide is at least 14
nucleotides in length and hybridizes under sequence-specific,
stringent hybridization conditions to a nucleotide sequence that
contains the marker correlated with therapy failure.
[0188] Oligonucleotide sequences used as the hybridizing region of
a primer can also be used as the hybridizing region of a probe.
Suitability of a primer sequence for use as a probe depends on the
hybridization characteristics of the primer. Similarly, an
oligonucleotide used as a probe can be used as a primer.
[0189] Additionally, the invention provides a method, materials and
a kit to detect proteins, peptides or peptide fragments that
contain amino acids (as described extensively herein) that are
predictive of the long term response of an Flaviviridae carrier to
2'-branched nucleoside therapy, or antibodies to those proteins,
peptides or peptide fragments. Host sera or tissue can be tested
for either the protein or peptide or the antibody to the protein or
peptide, depending on convenience and perhaps concentration of the
diagnostic material.
[0190] The protein, peptide or peptide fragment can be confirmed by
reaction with an antibody, preferably a monoclonal antibody, for
example using a Western blot method. Alternatively, the protein or
peptide can be isolated and sequenced or otherwise identified by
any means known in the art, including by 2D PAGE. In one
embodiment, a reactive antibody binds to an Flaviviridae protein or
peptide sequence that includes a threonine rather than serine in
the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63),
of domain B of the RNA polymerase region, for example at position
405 of the RNA polymerase region of BVDV genome or at position 282
of the RNA polymerase region of the HCV genome.
[0191] In another embodiment, the reactive antibody binds
specifically to a peptide sequence that includes a threonine rather
than serine in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, for
example at position 405 of the RNA polymerase region of BVDV genome
or at position 282 of the RNA polymerase region of the HCV genome,
which represent a specific point mutations in the RNA polymerase
region of Flaviviridae that is correlated with therapy failure.
[0192] In specific embodiments, an antibody is used that binds to
at least one peptide or peptide fragment encoded for by the nucleic
acid sequences in sequence ID Nos. 1-31.
[0193] In specific embodiments, an antibody is used that binds to
at least one peptide or peptide fragment encoded for by the nucleic
acid sequences in sequence ID Nos. 32-62.
I. DEFINITIONS
[0194] As used herein, the term "resistant virus" refers to a virus
that exhibits a three, and more typically, five or greater fold
increase in EC.sub.50 compared to naive virus.
[0195] The term "amino acid" includes naturally occurring and
synthetic .alpha., .beta. .gamma. or .delta. amino acids, and
includes but is not limited to, amino acids found in proteins, i.e.
glycine, alanine, valine, leucine, isoleucine, methionine,
phenylalanine, tryptophan, proline, serine, threonine, cysteine,
tyrosine, asparagine, glutamine, aspartate, glutamate, lysine,
arginine and histidine. In a preferred embodiment, the amino acid
is in the L-configuration, but can also be in the D-configuration.
Alternatively, the amino acid can be a derivative of alanyl,
valinyl, leucinyl, isoleuccinyl, prolinyl, phenylalaninyl,
tryptophanyl, methioninyl, glycinyl, serinyl, threoninyl,
cysteinyl, tyrosinyl, asparaginyl, glutaminyl, aspartoyl,
glutaroyl, lysinyl, argininyl, histidinyl, .beta.-alanyl,
.beta.-valinyl, .beta.-leucinyl, .beta.-isoleuccinyl,
.beta.-prolinyl, .beta.-phenylalaninyl, .beta.-tryptophanyl,
.beta.-methioninyl, .beta.-glycinyl, .beta.-serinyl,
.beta.-threoninyl, .beta.-cysteinyl, .beta.-tyrosinyl,
.beta.-asparaginyl, .beta.-glutaminyl, .beta.-aspartoyl,
.beta.-glutaroyl, .beta.-lysinyl, .beta.-argininyl or
.beta.-histidinyl.
[0196] The abbreviations of amino acids used herein are described
in Table 1.
TABLE-US-00001 TABLE 1 Amino Acids Codons Alanine Ala A GCA GCC GCG
GCU Cysteine Cys C UGC UGU Aspartic Acid Asp D GAC GAU GAC GAU
Glutamic Acid Glu E GAA GAG Phenylalanine Phe F UCC UUU Clycine Gly
G GGA GCG GGG GGU Histidine His H CAC CAU Isoleucine Ile I AUA AUC
AUU Lysine Lys K AAA AAG Leucine Leu L UUA UUG CUA CUC CUG GUU
Methionine Met M AUG Asparagine Asn N AAC AAU Proline Pro P CCA CCC
CCG CCU Glutamine Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG
CGU Serine Ser S AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC
ACG ACU Valine Val V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine
Tyr Y UAC UAU
[0197] "Amplification reagents" refer to the various buffers,
enzymes, primers, deoxynucleoside triphosphates (both conventional
and unconventional), and primers used to perform the selected
amplification procedure.
[0198] "Amplifying" or "Amplification", which typically refers to
an "exponential" increase in target nucleic acid, is being used
herein to describe both linear and exponential increases in the
numbers of a select target sequence of nucleic acid.
[0199] "Bind(s) substantially" refers to complementary
hybridization between an oligonucleotide and a target sequence and
embraces minor mismatches that can be accommodated by reducing the
stringency of the hybridization media to achieve the desired
priming for the PCR polymerases or detection of hybridization
signal.
[0200] "Hybridizing" refers the binding of two single stranded
nucleic acids via complementary base pairing.
[0201] "Nucleic acid" refers to a deoxyribonucleotide or
ribonucleotide polymer in either single- or double-stranded form,
and unless otherwise limited, would encompass known analogs of
natural nucleotides that can function in a similar manner as
naturally occurring nucleotides.
[0202] "Nucleotide polymerases" refers to enzymes able to catalyze
the synthesis of DNA or RNA from nucleoside triphosphate
precursors. In amplification reactions, the polymerases are
template-dependent and typically add nucleotides to the 3'-end of
the polymer being formed. The polymerase can be thermostable as
described in U.S. Pat. Nos. 4,889,818 and 5,079,352.
[0203] The term "oligonucleotide" refers to a molecule comprised of
two or more deoxyribonucleotides or ribonucleotides, such as
primers, probes, nucleic acid fragments to be detected, and nucleic
acid controls. The exact size of an oligonucleotide depends on many
factors and the ultimate function or use of the oligonucleotide.
Oligonucleotides can be prepared by any suitable method, including,
for example, cloning and restriction of appropriate sequences and
direct chemical synthesis by a method such as the phosphotriester
method of Narang et al., Meth. Enzymol. 1979, 68:90-99; the
phosphodiester method of Brown et al, Meth. Enzymol., 1979,
68:109-151; the diethylphosphoramidite method of Beaucage et al.,
Tetrahedron Lett., 1981, 22:1859-1862; and the solid support method
of U.S. Pat. No. 4,458,066.
[0204] The term "primer" refers to an oligonucleotide, whether
natural or synthetic, capable of acting as a point of initiation of
DNA synthesis under conditions in which synthesis of a primer
extension product complementary to a nucleic acid strand is
induced, i.e., in the presence of four different nucleoside
triphosphates and an agent for polymerization (i.e., DNA polymerase
or reverse transcriptase) in an appropriate buffer and at a
suitable temperature. A primer is preferably a single-stranded
oligodeoxyribonucleotide. The appropriate length of a primer
depends on the intended use of the primer but typically ranges from
about 14 or about 15 to 25 or 30 nucleotides. Short primer
molecules generally require cooler temperatures to form
sufficiently stable hybrid complexes with the template. A primer
need not reflect the exact sequence of the template but must be
sufficiently complementary to hybridize with a template.
[0205] The term "primer" can refer to more than one primer,
particularly in the case where there is some ambiguity in the
information regarding one or both ends of the target region to be
amplified. For instance, if a region shows significant levels of
polymorphism in a population, mixtures of primers can be prepared
that will amplify alternate sequences. A primer can be labeled, if
desired, by incorporating a label detectable by spectroscopic,
photochemical, biochemical, immunochemical, or chemical means. For
example, useful labels include 32P, fluorescent dyes,
electron-dense reagents, enzymes (as commonly used in an ELISA),
biotin, or haptens and proteins for which antisera or monoclonal
antibodies are available. A label can also be used to "capture" the
primer, so as to facilitate the immobilization of either the primer
or a primer extension product, such as amplified DNA, on a solid
support.
[0206] "Probe" refers to an oligonucleotide which binds through
complementary base pairing to a subsequence of a target nucleic
acid. It will be understood by one of skill in the art that probes
will typically substantially bind target sequences lacking complete
complementarity with the probe sequence depending upon the
stringency of the hybridization conditions. The probes are
preferably directly labeled as with isotopes or indirectly labeled
such as with biotin to which a streptavidin complex can later bind.
By assaying for the presence or absence of the probe, one can
detect the presence or absence of the target.
[0207] "Subsequence" refers to a sequence of nucleic acids that
comprise a part of a longer sequence of nucleic acids.
[0208] The term "target region" refers to a region of a nucleic
acid to be analyzed and can include a polymorphic region.
[0209] The term alkyl, as used herein, unless otherwise specified,
refers to a saturated straight, branched, or cyclic, primary,
secondary, or tertiary hydrocarbon typically of C.sub.1 to
C.sub.10, and specifically includes methyl, CF.sub.3, CCl.sub.3,
CFCl.sub.2, CF.sub.2Cl, ethyl, CH.sub.2CF.sub.3, CF.sub.2CF.sub.3,
propyl, isopropyl, cyclopropyl, butyl, isobutyl, /-butyl, pentyl,
cyclopentyl, isopentyl, neopentyl, hexyl, isohexyl, cyclohexyl,
cyclohexylmethyl, 3-methylpentyl, 2,2-dimethylbutyl, and
2,3-dimethylbutyl. The term includes both substituted and
unsubstituted alkyl groups, and particularly includes halogenated
alkyl groups, and even more particularly fluorinated alkyl groups.
Moieties with which the alkyl group can be substituted are selected
from the group consisting of halogen (fluoro, chloro, bromo or
iodo), hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy,
nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphate,
or phosphonate, either unprotected, or protected as necessary, as
known to those skilled in the art, for example, as taught in
Greene, et al., Protective Groups in Organic Synthesis, John Wiley
and Sons, Second Edition, 1991, hereby incorporated by
reference.
[0210] The term lower alkyl, as used herein, and unless otherwise
specified, refers to a C.sub.1 to C.sub.4 saturated straight,
branched, or if appropriate, a cyclic (for example, cyclopropyl)
alkyl group, including both substituted and unsubstituted forms.
Unless otherwise specifically stated in this application, when
alkyl is a suitable moiety, lower alkyl is preferred. Similarly,
when alkyl or lower alkyl is a suitable moiety, unsubstituted alkyl
or lower alkyl is preferred.
[0211] The term alkylamino or arylamino refers to an amino group
that has one or two alkyl or aryl substituents, respectively.
[0212] The term "protected" as used herein and unless otherwise
defined refers to a group that is added to an oxygen, nitrogen, or
phosphorus atom to prevent its further reaction or for other
purposes. A wide variety of oxygen and nitrogen protecting groups
are known to those skilled in the art of organic synthesis.
[0213] The term aryl, as used herein, and unless otherwise
specified, refers to phenyl, biphenyl, or naphthyl, and preferably
phenyl. The term includes both substituted and unsubstituted
moieties. The aryl group can be substituted with one or more
moieties selected from the group consisting of halogen (fluoro,
chloro, bromo or iodo), hydroxyl, amino, alkylamino, arylamino,
alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic
acid, phosphate, or phosphonate, either unprotected, or protected
as necessary, as known to those skilled in the art, for example, as
taught in Greene, et al., Protective Groups in Organic Synthesis,
John Wiley and Sons, Second Edition, 1991.
[0214] The term alkaryl or alkylaryl refers to an alkyl group with
an aryl substituent. The term aralkyl or arylalkyl refers to an
aryl group with an alkyl substituent.
[0215] The term halo, as used herein, includes chloro, bromo, iodo,
and fluoro.
[0216] The term base refers to any purine or pyrimidine base
including, but not limited to, guanine, adenine, hypoxanthine,
2,6-diaminopurine, 6-chloropurine, N.sup.6-alkylpurines,
N.sup.6-acylpurines (wherein acyl is C(O)(alkyl, aryl, alkylaryl,
or arylalkyl), N.sup.6-benzylpurine, N.sup.6-halopurine,
N.sup.6-vinylpurine, N.sup.6-acetylenic purine, N.sup.6-acyl punne,
N.sup.6-hydroxyalkyl purine, N.sup.6-thioalkyl purine,
N.sup.2-alkylpurines, N.sup.2-alkyl-6-thiopurines, thymine,
cytosine, 5-fluorocytosine, 5-methylcytosine, 6-azapyrimidine,
including 6-azacytosine, 2- and/or 4-mercaptopyrmidine, uracil,
5-halouracil, including 5-fluorouracil, C.sup.5-alkylpyrimidines,
C.sup.5-benzylpyrimidines, C.sup.5-halopyrimidines,
C.sup.5-vinylpyrimidine, C5-acetylenic pyrimidine, C5-acyl
pyrimidine, C.sup.5-hydroxyalkyl purine, C.sup.5-amidopyrimidine,
C.sup.5-cyanopyrimidine, C.sup.5-nitropyrimidine,
C.sup.5-amino-pyrimidine, N.sup.2-alkylpurines,
N.sup.2-alkyl-6-thiopurines, 5-azacytidinyl, 5-aza-uracilyl,
triazolopyridinyl, imidazolopyridinyl, pyrrolopyrimidinyl,
pyrazolopyrimidinyl,
a base of the formula:
##STR00004##
wherein: [0217] G and L are each independently CH or N; [0218] D is
N, CH, C--CN, C--NO.sub.2, C--C.sub.1-3 alkyl, C--NHCONH.sub.2,
C--CONQ.sup.11Q.sup.11, C--CSNQ.sup.11Q.sup.11, CCOOQ.sup.11,
C--C(.dbd.NH)NH.sub.2, C-hydroxy, C--C.sub.1-3alkoxy, C-amino, C--C
C.sub.1-4alkylamino, C-di(C.sub.1-4 alkyl)amino, C-halogen,
C-(1,3-oxazol-2-yl), C-(1,3-thiazol-2-yl), or C-(imidazol-2-yl);
wherein alkyl is unsubstituted or substituted with one to three
groups independently selected from halogen, amino, hydroxy,
carboxy, and C.sub.1-3 alkoxy; [0219] E is N or CQ.sup.5; [0220] W
is O, S, or NR; [0221] R is H, OH, alkyl; [0222] Q.sup.6 is H, OH,
SH, NH.sub.2, C.sub.1-4 alkylamino, di(C.sub.1-4 alkyl)amino,
C.sub.3-6 cycloalkylamino, [0223] halogen, [0224] C.sub.1-4 alkyl,
C.sub.1-4 alkoxy, or CF.sub.3; [0225] Q.sup.5 is H, C.sub.1-6
alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-4 alkylamino,
CF.sub.3, halogen, N, CN, NO.sub.2, NHCONH.sub.2,
CONQ.sup.11Q.sup.11, CSNQ.sup.11Q.sup.11, COOQ.sup.11,
C(.dbd.NH)NH.sub.2, hydroxy, C.sub.1-3alkoxy, amino, C.sub.1-4
alkylamino, di(C.sub.1-4 alkyl)amino, halogen, 1,3-oxazol-2-yl,
1,3-thiazol-2-yl, or imidazol-2-yl; wherein alkyl is unsubstituted
or substituted with one to three groups independently selected from
halogen, amino, hydroxy, carboxy, and C.sub.1-3 alkoxy;
[0226] Q.sup.7 and Q.sup.14 are each independently selected from
the group consisting of H, CF.sub.3, OH, SH, OR, SR C.sub.1-4
alkyl, amino, C.sub.1-4 alkylamino, C.sub.3-6 cycloalkylamino, and
di(C.sub.1-4 alkyl)amino;
[0227] Q.sup.11 is independently H or C.sub.1-6 alkyl;
[0228] Q.sup.8 is H, halogen, CN, carboxy, C.sub.1-4
alkyloxycarbonyl, N.sub.3, amino, C.sub.1-4 alkylamino,
di(C.sub.1-4 alkyl)amino, hydroxy, C.sub.1-6 alkoxy, C.sub.1-6
alkylthio, C.sub.1-6 alkylsulfonyl, (C.sub.1-4
alkyl).sub.0-2aminomethyl, NH.sub.2, CN, NO.sub.2, C.sub.1-3 alkyl,
NHCONH.sub.2, CONQ.sup.11Q.sup.11, CSNQ.sup.11Q.sup.11,
COOQ.sup.11, C(.dbd.NH)NH.sub.2, 1,3-oxazol-2-yl, 1,3-thiazol-2-yl,
or imidazol-2-yl, wherein alkyl is unsubstituted or substituted
with one to three groups independently selected from halogen,
amino, hydroxy, carboxy, and C.sub.1-3 alkoxy;
a base of the formula:
##STR00005##
wherein: [0229] T.sub.1 and T.sub.2 are independently selected from
N, CH, or C-Q.sup.16; [0230] Q.sup.16, U, and Y are independently
selected from is H, OH, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, cycloalkyl, CO-alkyl, CO-aryl, CO-alkoxyalkyl, chloro,
bromo, fluoro, iodo, OR.sup.4, NR.sup.4R.sup.5 or SR.sup.5,
Br-vinyl, --O-alkyl, --O-alkenyl, --O-alkynyl, --O-aryl, --O--
aralkyl, --O-acyl, --O-cycloalkyl, NH.sub.2, NH-alkyl, N-dialkyl,
NH-acyl, N-aryl, N-aralkyl, NH-cycloalkyl, SH, S-alkyl, S-acyl,
S-aryl, S-cycloalkyl, S-aralkyl, CN, N.sub.3, COOH, CONH.sub.2,
CO.sub.2-alkyl, CONH-alkyl, CON-dialkyl, OH, CF.sub.3, CH.sub.2OH,
(CH.sub.2).sub.mOH, (CH.sub.2).sub.mNH.sub.2, (CH.sub.2).sub.mCOOH,
(CH.sub.2).sub.mCN, (CH.sub.2).sub.mNO.sub.2,
(CH.sub.2).sub.mCONH.sub.2, C.sub.1-4 alkylamino, di(C.sub.1-4
alkyl)amino, C.sub.3-6 cycloalkylamino, C.sub.1-4 alkoxy, C.sub.1-4
alkoxycarbonyl, C.sub.1-6 alkylthio, C.sub.1-6 alkylsulfonyl,
(C.sub.1-4 alkyl).sub.0-2aminomethyl, or --NHC(.dbd.NH)NH.sub.2;
[0231] R.sup.4 and R.sup.5 are independently selected from
hydrogen, acyl (including lower acyl), or alkyl (including but not
limited to methyl, ethyl, propyl and cyclopropyl); [0232] m is 0,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; [0233] Z is S, SO, SO.sub.2,
C.dbd.O, or NQ.sup.20; [0234] Q.sup.20 is H or alkyl; and [0235]
V.sup.1 and V.sup.2 are independently selected from CH or N; a base
of the formula:
##STR00006##
[0235] wherein: [0236] T.sub.3 and T.sub.4 are independently
selected from N or CQ.sup.22; [0237] Q.sup.22 is independently
selected from H, OH, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, cycloalkyl, CO-alkyl, CO-aryl, CO-alkoxyalkyl, chloro,
bromo, fluoro, iodo, OR.sup.4, NR.sup.4R.sup.5 or SR.sup.S,
Br-vinyl, --O-alkyl, --O-alkenyl, --O-alkynyl, --O-aryl, --O--
aralkyl, --O-acyl, --O-cycloalkyl, NH.sub.2, NH-alkyl, N-dialkyl,
NH-acyl, N-aryl, N-aralkyl, NH-cycloalkyl, SH, S-alkyl, S-acyl,
S-aryl, S-cycloalkyl, S-aralkyl, CN, N.sub.3, COOH, CONH.sub.2,
CO.sub.2-alkyl, CONH-alkyl, CON-dialkyl, OH, CF.sub.3, CH.sub.2OH,
(CH.sub.2).sub.mOH, (CH.sub.2).sub.mNH.sub.2, (CH.sub.2).sub.mCOOH,
(CH.sub.2).sub.mCN, (CH.sub.2).sub.mNO.sub.2,
(CH.sub.2).sub.mCONH.sub.2, C.sub.1-4 alkylamino, di(C.sub.1-4
alkyl)amino, C.sub.3-6 cycloalkylamino, C.sub.1-4 alkoxy, C.sub.1-4
alkoxycarbonyl, C.sub.1-6 alkylthio, C.sub.1-6 alkylsulfonyl,
(C.sub.1-4 alkyl).sub.0-2aminomethyl, or --NHC(.dbd.NH)NH.sub.2;
[0238] T.sub.5 is NH; [0239] R.sup.4 and R.sup.5 are independently
selected from hydrogen, acyl (including lower acyl), or alkyl
(including but not limited to methyl, ethyl, propyl and
cyclopropyl); [0240] m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0241] T.sub.6, T.sub.7, T.sub.8, T.sub.9, T.sub.10, T.sub.11, and
T.sub.12 are independently selected from N or CH; [0242] U.sub.2 is
H, straight chained, branched or cyclic alkyl, CO-alkyl, CO-aryl,
CO-alkoxyalkyl, chloro, bromo, fluoro, iodo, OR.sup.4,
NR.sup.4R.sup.5 or SR.sup.5; [0243] Y.sub.2 is O, S, NH, NR or
CQ.sup.24Q.sup.26 where R is H, OH, or alkyl; [0244] Q.sup.24 and
Q.sup.26 are independently selected from H, alkyl, straight
chained, branched or cyclic alkyl, CO-alkyl, CO-aryl,
CO-alkoxyalkyl, chloro, bromo, fluoro, iodo, OR.sup.4,
NR.sup.4R.sup.5 or SR.sup.5.
[0245] Further examples of purine bases include, but are not
limited to, guanine, adenine, hypoxanthine, 2,6-diaminopurine,
6-chloropurine, and 6-N-methylamino purine. Functional oxygen and
nitrogen groups on the base can be protected as necessary or
desired. Suitable protecting groups are well known to those skilled
in the art, and include trimethylsilyl, dimethylhexylsilyl,
t-butyldimethylsilyl, and t-butyldiphenylsilyl, trityl, alkyl
groups, and acyl groups such as acetyl and propionyl,
methanesulfonyl, and p-toluenesulfonyl.
[0246] The term acyl or O-linked ester refers to a group of the
formula C(O)R', wherein R' is an straight, branched, or cyclic
alkyl (including lower alkyl), amino acid, aryl including phenyl,
alkaryl, aralkyl including benzyl, alkoxyalkyl including
methoxymethyl, aryloxyalkyl such as phenoxymethyl; or substituted
alkyl (including lower alkyl), aryl including phenyl optionally
substituted with chloro, bromo, fluoro, iodo, C.sub.1 to C.sub.4
alkyl or C.sub.1 to C.sub.4 alkoxy, sulfonate esters such as alkyl
or aralkyl sulphonyl including methanesulfonyl, the mono, di or
triphosphate ester, trityl or monomethoxy-trityl, substituted
benzyl, alkaryl, aralkyl including benzyl, alkoxyalkyl including
methoxymethyl, aryloxyalkyl such as phenoxymethyl. Aryl groups in
the esters optimally comprise a phenyl group. In particular, acyl
groups include acetyl, trifluoroacetyl, methylacetyl,
cyclopropylacetyl, propionyl, butyryl, hexanoyl, heptanoyl,
octanoyl, neo-heptanoyl, phenylacetyl, 2-acetoxy-2-phenylacetyl,
diphenylacetyl,
.alpha.-methoxy-.alpha.-trifluoromethyl-phenylacetyl, bromoacetyl,
2-nitro-benzeneacetyl, 4-chloro-benzeneacetyl,
2-chloro-2,2-diphenylacetyl, 2-chloro-2-phenylacetyl,
trimethylacetyl, chlorodifluoroacetyl, perfluoroacetyl,
fluoroacetyl, bromodifluoroacetyl, methoxyacetyl,
2-thiopheneacetyl, chlorosulfonylacetyl, 3-methoxyphenylacetyl,
phenoxyacetyl, tert-butylacetyl, trichloroacetyl,
monochloro-acetyl, dichloroacetyl, 7H-dodecafluoro-heptanoyl,
perfluoro-heptanoyl, 7H-dodeca-fluoroheptanoyl,
7-chlorododecafluoro-heptanoyl, 7-chloro-dodecafluoro-heptanoyl,
7H-dodecafluoroheptanoyl, 7H-dodeca-fluoroheptanoyl,
nona-fluoro-3,6-dioxaheptanoyl, nonafluoro-3,6-dioxaheptanoyl,
perfluoroheptanoyl, methoxybenzoyl, methyl
3-amino-5-phenylthiophene-2-carboxyl,
3,6-dichloro-2-methoxy-benzoyl,
4-(1,1,2,2-tetrafluoro-ethoxy)-benzoyl, 2-bromo-propionyl,
omega-aminocapryl, decanoyl, n-pentadecanoyl, stearyl,
3-cyclopentyl-propionyl, 1-benzene-carboxyl, O-acetylmandelyl,
pivaloyl acetyl, 1-adamantane-carboxyl, cyclohexane-carboxyl,
2,6-pyridinedicarboxyl, cyclopropane-carboxyl,
cyclobutane-carboxyl, perfluorocyclohexyl carboxyl,
4-methylbenzoyl, chloromethyl isoxazolyl carbonyl,
perfluorocyclohexyl carboxyl, crotonyl,
1-methyl-1H-indazole-3-carbonyl, 2-propenyl, isovaleryl,
1-pyrrolidinecarbonyl, 4-phenylbenzoyl.
[0247] As used herein, the term "substantially free of" or
"substantially in the absence of" refers to a nucleoside
composition that includes at least 95% to 98% by weight, and even
more preferably 99% to 100% by weight, of the designated enantiomer
of that nucleoside. In a preferred embodiment, in the methods and
compounds of this invention, the compounds are substantially free
of enantiomers.
[0248] Similarly, the term "isolated" refers to a nucleoside
composition that includes at least 95% to 98% by weight, and even
more preferably 99% to 100% by weight, of the nucleoside, the
remainder comprising other chemical species or enantiomers.
[0249] The term host, as used herein, refers to an unicellular or
multicellular organism in which the virus can replicate, including
cell lines and animals, and preferably a human. Alternatively, the
host can be carrying a part of the Flaviviridae viral genome, whose
replication or function can be altered by the compounds of the
present invention. The term host specifically refers to infected
cells, cells transfected with all or part of the Flaviviridae
genome and animals, in particular, primates (including chimpanzees)
and humans. In most animal applications of the present invention,
the host is a human patient. Veterinary applications, in certain
indications, however, are clearly anticipated by the present
invention (such as chimpanzees).
II. BRANCHED NUCLEOSIDES AND PRODRUGS THEREOF
[0250] In the broadest embodiment, the present invention provides a
method to treat a Flavivirdae infection that is resistant to a
2'-branched nucleoside. In one embodiment, the 2'-branched
nucleoside is a purine, or a purine derivative such as a
pyrrolo-purine. In a preferred embodiment, the 2'-branched
nucleoside is a pyrimidine. Other sub-embodiments include the
2'-alkyl and 2'-methyl-branched pyrimidine nucleosides, including
the 2'-branched uracil and 2'-branched cytosine nucleosides. In
another embodiment, the 2'-branched nucleoside is a purine. Other
sub-embodiments include the 2'-alkyl and 2'-methyl-branched purine
nucleosides, including the 2'-branched adenosine nucleosides and
the 2'-branched 6-N-methylamino purine nucleosides.
[0251] In a specific embodiment, the 2'-branched pyrimidine
nucleoside is represented by the compound
.beta.-D-2'-CH.sub.3-riboC, which is represented by the
formula:
##STR00007##
wherein R.sup.3 is H, phosphate (including mono-, di- or
triphosphate and a stabilized phosphate prodrug); acyl (including
lower acyl); alkyl (including lower alkyl); sulfonate ester
(including alkyl or arylalkyl sulfonyl including methanesulfonyl);
benzyl, wherein the phenyl group is optionally substituted with one
or more substituents as described in the definition of aryl given
herein; lipid (including a phospholipid); amino acid; carbohydrate;
peptide; cholesterol; or a pharmaceutically acceptable leaving
group that provides a compound wherein R.sup.3 is H or phosphate
when administered in vivo.
[0252] In another specific embodiment, the 2'-branched purine
nucleoside is represented by the compound
.beta.-D-2'-CH.sub.3-ribo-6-N-methylaminopurine, which is
represented by the formula:
##STR00008##
wherein R.sup.3 is H, phosphate (including mono-, di- or
triphosphate and a stabilized phosphate prodrug); acyl (including
lower acyl); alkyl (including lower alkyl); sulfonate ester
(including alkyl or arylalkyl sulfonyl including methanesulfonyl);
benzyl, wherein the phenyl group is optionally substituted with one
or more substituents as described in the definition of aryl given
herein; lipid (including a phospholipid); amino acid; carbohydrate;
peptide; cholesterol; or a pharmaceutically acceptable leaving
group that provides a compound wherein R.sup.3 is H or phosphate
when administered in vivo.
[0253] In one embodiment of the invention, the 2'-branched
nucleoside is of the general formula:
##STR00009##
or its pharmaceutically acceptable prodrug and/or salt, wherein
[0254] R.sup.1, R.sup.2, and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate
prodrug); acyl (including lower acyl); alkyl (including lower
alkyl); sulfonate ester (including alkyl or arylalkyl sulfonyl
including methanesulfonyl); benzyl, wherein the phenyl group is
optionally substituted with one or more substituents as described
in the definition of aryl given herein; lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or phosphate
when administered in vivo; and [0255] R.sup.4 is hydrogen, hydroxy,
alkyl (including lower alkyl), azido, cyano, alkenyl, alkynyl,
Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
chloro, bromo, fluoro, iodo, NO.sub.2, NH.sub.2, --NH(lower alkyl),
--NH(acyl), --N(lower alkyl).sub.2, or --N(acyl).sub.2; and Base is
a purine or pyrimidine as further described herein.
[0256] In another embodiment of the invention, the 2'-branched
nucleoside is of the general formula:
##STR00010##
or its pharmaceutically acceptable prodrug and/or salt, wherein
[0257] Base is a purine or pyrimidine base as defined herein;
[0258] R.sup.1, R.sup.2 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate);
straight chained, branched or cyclic alkyl (including lower alkyl);
acyl (including lower acyl); CO-alkyl, CO-aryl, CO-alkoxyalkyl,
CO-aryloxyalkyl, CO-substituted aryl, sulfonate ester (including
alkyl or arylalkyl sulfonyl including methanesulfonyl); benzyl,
wherein the phenyl group is optionally substituted with one or more
substituents as described in the definition of aryl given herein;
alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or phosphate
when administered in vivo; [0259] R.sup.6 is alkyl (including lower
alkyl and halogenated alkyl), CH.sub.3, CF.sub.3, azido, cyano,
alkenyl, alkynyl, Br-vinyl, 2-Br-ethyl, --C(O)O(alkyl),
--C(O)O(lower alkyl), --O(acyl), --O(lower acyl), --O(alkyl),
--O(lower alkyl), --O(alkenyl), CF.sub.3, chloro, bromo, fluoro,
iodo, NO.sub.2, NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower
alkyl).sub.2, --N(acyl).sub.2; and [0260] R.sup.7 is hydrogen,
OR.sup.3, hydroxy, alkyl (including lower alkyl), azido, cyano,
alkenyl, alkynyl, Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl),
--O(acyl), --O(lower acyl), --O(alkyl), --O(lower alkyl),
--O(alkenyl), fluorine, chlorine, bromine, iodine, NO.sub.2,
NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower alkyl).sub.2,
--N(acyl).sub.2; and [0261] X is O, S, SO.sub.2 or CH.sub.2. and
Base is a purine or pyrimidine as further described herein.
[0262] In yet another embodiment the invention, the 2'-branched
nucleoside is of the general formula:
##STR00011##
wherein: [0263] Base is a purine or pyrimidine base as defined
herein; [0264] R.sup.6 is alkyl (including lower alkyl and
halogenated alkyl), CH3, CF3, azido, cyano, alkenyl, alkynyl,
Br-vinyl, 2-Br-ethyl, --C(O)O(alkyl), --C(O)O(lower alkyl),
--O(acyl), --O(lower acyl), --O(alkyl), --O(lower alkyl),
--O(alkenyl), CF.sub.3, fluoro, chloro, bromo, iodo, NO.sub.2,
NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower alkyl).sub.2,
--N(acyl).sub.2; [0265] R.sup.7 is OR.sup.2, hydroxy, alkyl
(including lower alkyl), azido, cyano, alkenyl, alkynyl, Br-vinyl,
halo-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
fluorine, chlorine, bromine, iodine, NO.sub.2, NH.sub.2, --NH(lower
alkyl), --NH(acyl), --N(lower alkyl).sub.2, --N(acyl).sub.2; [0266]
R.sup.9 is hydrogen, OR.sup.3, hydroxy, alkyl (including lower
alkyl), azido, cyano, alkenyl, alkynyl, Br-vinyl, --C(O)O(alkyl),
--C(O)O(lower alkyl), --O(acyl), --O(lower acyl), --O(alkyl),
--O(lower alkyl), --O(alkenyl), chlorine, bromine, iodine,
NO.sub.2, NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower
alkyl).sub.2, --N(acyl).sub.2; [0267] R.sup.10 is H, alkyl
(including lower alkyl), fluorine, chlorine, bromine or iodine;
[0268] R.sup.1, R.sup.2 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate);
straight chained, branched or cyclic alkyl (including lower alkyl);
acyl (including lower acyl); CO-alkyl, CO-aryl, CO-alkoxyalkyl,
CO-aryloxyalkyl, CO-substituted aryl, sulfonate ester (including
alkyl or arylalkyl sulfonyl including methanesulfonyl); benzyl,
wherein the phenyl group is optionally substituted with one or more
substituents as described in the definition of aryl given herein;
alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or phosphate
when administered in vivo; and [0269] X is O, S, SO.sub.2 or
CH.sub.2.
General Synthesis of 2'-Branched Nucleosides
[0270] 1. Glycosylation of the Nucleobase with an Appropriately
Modified Sugar
[0271] The key starting material for this process can be an
appropriately substituted sugar with a 2'-OH and 2'-H, with the
appropriate leaving group (LG), for example an acyl group or a
chloro, bromo, fluoro or iodo. The sugar can be purchased or can be
prepared by any known means including standard epimerization,
substitution, oxidation and reduction techniques. The substituted
sugar can then be oxidized with the appropriate oxidizing agent in
a compatible solvent at a suitable temperature to yield the
2'-modified sugar. Possible oxidizing agents are Jones reagent (a
mixture of chromic acid and sulfuric acid), Collins's reagent
(dipyridine Cr(VI) oxide, Corey's reagent (pyridinium
chlorochromate), pyridinium dichromate, acid dichromate, potassium
permanganate, MnO.sub.2, ruthenium tetroxide, phase transfer
catalysts such as chromic acid or permanganate supported on a
polymer, Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium molybdate,
NaBrO.sub.2--CAN, NaOCl in HOAc, copper chromite, copper oxide,
Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent
(aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0272] Then coupling of an organometallic carbon nucleophile, such
as a Grignard reagent, an organolithium, lithium dialkylcopper or
R.sup.4--SiMe.sub.3 (wherein R.sup.4 is defined below) in TBAF with
the ketone with the appropriate non-protic solvent at a suitable
temperature, yields the 2'-alkylated sugar. The alkylated sugar can
be optionally protected with a suitable protecting group,
preferably with an acyl or silyl group, by methods well known to
those skilled in the art, as taught by Greene et al. Protective
Groups in Organic Synthesis, John Wiley and Sons, Second Edition,
1991.
[0273] The optionally protected sugar can then be coupled to the
BASE by methods well known to those skilled in the art, as taught
by Townsend Chemistry of Nucleosides and Nucleotides, Plenum Press,
1994. For example, an acylated sugar can be coupled to a silylated
base with a lewis acid, such as tin tetrachloride, titanium
tetrachloride or trimethylsilyltriflate in the appropriate solvent
at a suitable temperature. Alternatively, a halo-sugar can be
coupled to a silylated base with the presence of
trimethylsilyltriflate.
[0274] Subsequently, the nucleoside can be deprotected by methods
well known to those skilled in the art, as taught by Greene et al.
Protective Groups in Organic Synthesis, John Wiley and Sons, Second
Edition, 1991.
[0275] In a particular embodiment, the 2'-C-branched ribonucleoside
is desired. The synthesis of a ribonucleoside is shown in Scheme 1.
Alternatively, the deoxyribonucleoside can be used. To obtain these
nucleosides, the formed ribonucleoside can optionally be protected
by methods well known to those skilled in the art, as taught by
Greene et al. Protective Groups in Organic Synthesis, John Wiley
and Sons, Second Edition, 1991, and then the 2'-OH can be reduced
with a suitable reducing agent. Optionally, the 2'-hydroxyl can be
activated to facilitate reduction; i.e. via the Barton
reduction.
##STR00012##
wherein: [0276] LG is a leaving group; [0277] R.sup.1, R.sup.2, and
R.sup.3 are independently H, phosphate (including mono-, di- or
triphosphate and a stabilized phosphate prodrug); acyl (including
lower acyl); alkyl (including lower alkyl); sulfonate ester
(including alkyl or arylalkyl sulfonyl including methanesulfonyl);
benzyl, wherein the phenyl group is optionally substituted with one
or more substituents as described in the definition of aryl given
herein; lipid (including a phospholipid); amino acid; carbohydrate;
peptide; cholesterol; or a pharmaceutically acceptable leaving
group that provides a compound wherein R.sup.1, R.sup.2 or R.sup.3
is independently H or phosphate when administered in vivo; and
[0278] R.sup.4 is hydrogen, hydroxy, alkyl (including lower alkyl),
azido, cyano, alkenyl, alkynyl, Br-vinyl, --C(O)O(alkyl),
--C(O)O(lower alkyl), --O(acyl), --O(lower acyl), --O(alkyl),
--O(lower alkyl), --O(alkenyl), chloro, bromo, fluoro, iodo,
NO.sub.2, NH.sub.2, --NH(lower alkyl), --NH(acyl), --N(lower
alkyl).sub.2, or --N(acyl).sub.2.
2. Modification of a Pre Formed Nucleoside
[0279] The key starting material for this process can be an
appropriately substituted nucleoside with a 2'-OH and 2'-H. The
nucleoside can be purchased or can be prepared by any known means
including standard coupling techniques. The nucleoside can be
optionally protected with suitable protecting groups, preferably
with acyl or silyl groups, by methods well known to those skilled
in the art, as taught by Greene et al. Protective Groups in Organic
Synthesis, John Wiley and Sons, Second Edition, 1991.
[0280] The appropriately protected nucleoside can then be oxidized
with the appropriate oxidizing agent in a compatible solvent at a
suitable temperature to yield the 2'-modified sugar. Possible
oxidizing agents are Jones reagent (a mixture of chromic acid and
sulfuric acid), Collins's reagent (dipyridine Cr(VI) oxide, Corey's
reagent (pyridinium chlorochromate), pyridinium dichromate, acid
dichromate, potassium permanganate, MnO.sub.2, ruthenium tetroxide,
phase transfer catalysts such as chromic acid or permanganate
supported on a polymer, Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium
molybdate, NaBrO.sub.2--CAN, NaOCl in HOAc, copper chromite, copper
oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley
reagent (aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0281] Subsequently, the nucleoside can be deprotected by methods
well known to those skilled in the art, as taught by Greene et al.
Protective Groups in Organic Synthesis, John Wiley and Sons, Second
Edition, 1991.
[0282] In a particular embodiment, the 2'-C-branched ribonucleoside
is desired. The synthesis of a ribonucleoside is shown in Scheme 2.
Alternatively, deoxyribonucleoside can be used. To obtain these
nucleosides, the formed ribonucleoside can optionally be protected
by methods well known to those skilled in the art, as taught by
Greene et al. Protective Groups in Organic Synthesis, John Wiley
and Sons, Second Edition, 1991, and then the 2'-OH can be reduced
with a suitable reducing agent. Optionally, the 2'-hydroxyl can be
activated to facilitate reduction; i.e. via the Barton
reduction.
##STR00013##
wherein: [0283] R.sup.1 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate
prodrug); acyl (including lower acyl); alkyl (including lower
alkyl); sulfonate ester (including alkyl or arylalkyl sulfonyl
including methanesulfonyl); benzyl, wherein the phenyl group is
optionally substituted with one or more substituents as described
in the definition of aryl given herein; lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1 or R.sup.3 is independently H or phosphate when
administered in vivo; and [0284] R.sup.4 is hydrogen, hydroxy,
alkyl (including lower alkyl), azido, cyano, alkenyl, alkynyl,
Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
chloro, bromo, fluoro, iodo, NO.sub.2, NH.sub.2, --NH(lower alkyl),
--NH(acyl), --N(lower alkyl).sub.2, or --N(acyl).sub.2.
General Synthesis of 2'-Branched Pyrimidine Nucleoside
[0285] 1. Glycosylation of the Pyrimidine with an Appropriately
Modified Sugar
[0286] A representative general method for the preparation of
2'-branched pyrimidine nucleoside is outlined in Scheme 3. This
scheme illustrates the 2' branched pyrimidine nucleoside in the
.beta.-D-ribo configuration. Alternatively, one skilled in the art
could modify the general scheme to produce 2'-.beta.-L-pyrimidine
nucleoside. The key starting material for this process can be an
appropriately substituted sugar with a 2'-OH and 2'-H, with the
appropriate leaving group (LG), for example an acyl group or a
chloro, bromo, fluoro or iodo. The sugar can be purchased or can be
prepared by any known means including standard epimerization,
substitution, oxidation and reduction techniques. The substituted
sugar can then be oxidized with the appropriate oxidizing agent in
a compatible solvent at a suitable temperature to yield the
2'-modified sugar. Possible oxidizing agents are Jones reagent (a
mixture of chromic acid and sulfuric acid), Collins's reagent
(dipyridine Cr(VI) oxide, Corey's reagent (pyridinium
chlorochromate), pyridinium dichromate, acid dichromate, potassium
permanganate, MnO.sub.2, ruthenium tetroxide, phase transfer
catalysts such as chromic acid or permanganate supported on a
polymer, Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium molybdate,
NaBrO.sub.2--CAN, NaOCl in HOAc, copper chromite, copper oxide,
Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent
(aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0287] Then coupling of an organometallic carbon nucleophile, such
as a Grignard reagent, an organolithium, lithium dialkylcopper or
R.sup.4--SiMe.sub.3 in TBAF with the ketone with the appropriate
non-protic solvent at a suitable temperature, yields the
2'-alkylated sugar. The alkylated sugar can be optionally protected
with a suitable protecting group, preferably with an acyl or silyl
group, by methods well known to those skilled in the art, as taught
by Greene et al. Protective Groups in Organic Synthesis. John Wiley
and Sons, Second Edition, 1991.
[0288] The optionally protected sugar can then be coupled to a
prymidine base by methods well known to those skilled in the art,
as taught by Townsend Chemistry of Nucleosides and Nucleotides.
Plenum Press, 1994. For example, an acylated sugar can be coupled
to a silylated pyrimidine, such as cytidine, with a lewis acid,
such as tin tetrachloride, titanium tetrachloride or
trimethylsilyltriflate in the appropriate solvent at a suitable
temperature. Alternatively, a halo-sugar can be coupled to a
silylated pyrimidine, such as a cytidine, with the presence of
trimethylsilyltriflate.
##STR00014##
wherein: [0289] R.sup.1, R.sup.2, and R.sup.3 are independently H,
phosphate (including mono-, di- or triphosphate and a stabilized
phosphate prodrug); acyl (including lower acyl); alkyl (including
lower alkyl); sulfonate ester (including alkyl or arylalkyl
sulfonyl including methanesulfonyl); benzyl, wherein the phenyl
group is optionally substituted with one or more substituents as
described in the definition of aryl given herein; lipid (including
a phospholipid); amino acid; carbohydrate; peptide; cholesterol; or
a pharmaceutically acceptable leaving group that provides a
compound wherein R.sup.1, R.sup.2 or R.sup.3 is independently H or
phosphate when administered in vivo; and [0290] R.sup.4 is
hydrogen, hydroxy, alkyl (including lower alkyl), azido, cyano,
alkenyl, alkynyl, Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl),
--O(acyl), --O(lower acyl), --O(alkyl), --O(lower alkyl),
--O(alkenyl), chloro, bromo, fluoro, iodo, NO.sub.2, NH.sub.2,
--NH(lower alkyl), --NH(acyl), --N(lower alkyl).sub.2, or
--N(acyl).sub.2.
2. Modification of a Pre Formed 2'-Branched Pyrimidine
Nucleoside
[0291] The key starting material for this process can be an
appropriately substituted 2'-branched pyrimidine nucleoside with a
2'-OH and 2'-H. The 2'-branched pyrimidine nucleoside can be
purchased or can be prepared by any known means including standard
coupling techniques. The 2'-branched pyrimidine nucleoside can be
optionally protected with suitable protecting groups, preferably
with acyl or silyl groups, by methods well known to those skilled
in the art, as taught by Greene et al. Protective Groups in Organic
Synthesis, John Wiley and Sons, Second Edition, 1991.
[0292] The appropriately protected 2'-branched pyrimidine
nucleoside can then be oxidized with the appropriate oxidizing
agent in a compatible solvent at a suitable temperature to yield
the 2'-modified sugar. Possible oxidizing agents are Jones reagent
(a mixture of chromic acid and sulfuric acid), Collins's reagent
(dipyridine Cr(VI) oxide, Corey's reagent (pyridinium
chlorochromate), pyridinium dichromate, acid dichromate, potassium
permanganate, MnO.sub.2, ruthenium tetroxide, phase transfer
catalysts such as chromic acid or permanganate supported on a
polymer, Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium molybdate,
NaBrO.sub.2--CAN, NaOCl in HOAc, copper chromite, copper oxide,
Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent
(aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0293] Subsequently, the 2'-branched pyrimidine nucleoside can be
deprotected by methods well known to those skilled in the art, as
taught by et al. Protective Groups in Organic Synthesis, John Wiley
and Sons, Second Edition, 1991.
[0294] In a particular embodiment, the 2'-C-branched ribonucleoside
is desired. The synthesis of a ribonucleoside is shown in Scheme 4.
Alternatively, deoxyribonucleoside can be used. To obtain these
nucleosides, the formed ribonucleoside can optionally be protected
by methods well known to those skilled in the art, as taught by
Greene et al. Protective Groups in Organic Synthesis. John Wiley
and Sons, Second Edition, 1991, and then the 2'-OH can be reduced
with a suitable reducing agent. Optionally, the 2'-hydroxyl can be
activated to facilitate reduction; i.e. via the Barton
reduction.
##STR00015##
wherein: [0295] R.sup.1 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate
prodrug); acyl (including lower acyl); alkyl (including lower
alkyl); sulfonate ester (including alkyl or arylalkyl sulfonyl
including methanesulfonyl); benzyl, wherein the phenyl group is
optionally substituted with one or more substituents as described
in the definition of aryl given herein; lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1 or R.sup.3 is independently H or phosphate when
administered in vivo; and [0296] R.sup.4 is hydrogen, hydroxy,
alkyl (including lower alkyl), azido, cyano, alkenyl, alkynyl,
Br-vinyl, --C(O)O(alkyl), --C(O)O(lower alkyl), --O(acyl),
--O(lower acyl), --O(alkyl), --O(lower alkyl), --O(alkenyl),
chloro, bromo, fluoro, iodo, NO.sub.2, NH.sub.2, --NH(lower alkyl),
--NH(acyl), --N(lower alkyl).sub.2, or --N(acyl).sub.2.
General Synthesis of 2'-Branched Purine Nucleoside
[0297] 1. Glycosylation of the Pyrimidine with an Appropriately
Modified Sugar
[0298] A representative general method for the preparation of
2'-branched purine nucleoside is outlined in Scheme 5 below. This
scheme illustrates the synthesis of 2'-branched purine nucleoside
in the .beta.-D-ribo configuration. Alternative, it is well
appreciated to those skilled in the art are able to prepare the
.beta.-L-ribo configuration using the appropriate starting
material. The starting material is a 3,5-bis protected alkyl
furanoside, such as methyl furanoside, of structural formula (i).
The C-2 hydroxyl group is then oxidized with a suitable oxidizing
agent, such as a chromium trioxide or chromate reagent or
Dess-Martin periodinane, or by Swern oxidation, to afford a C-2
ketone of structural formula (II). Addition of a Grignard reagent,
such as an alkyl, alkenyl, or alkynyl magnesium halide (for
example, MeMgBr, EtMgBr, vinylMgBr, allylMgBr, and ethynylMgBr) or
an alkyl, alkenyl, or alkynyl lithium, such as MeLi, across the
carbonyl double bond of (ii) in a suitable organic solvent, such as
tetrahydrofuran, diethyl ether, and the like, affords the C-2
tertiary alcohol of structural formula (iii). A good leaving group
(such as F, CI, Br, and I) is next introduced at the C-1
(anorneric) position of the furanose sugar derivative by treatment
of the furanoside of formula (iii) with a hydrogen halide in a
suitable organic solvent, such as hydrogen bromide in acetic acid,
to afford the intermediate furanosyl halide (iv). A C-sulfonate,
such as methanesulfonate (MeSO.sub.2O--), trifluoromethanesulfonate
(CF.sub.3SO.sub.2O--) or p-toluenesulfonate (--OTs), may also serve
as a useful leaving group in the subsequent reaction to generate
the glycosidic (nucleosidic) linkage. The nucleosidic linkage is
constructed by treatment of the intermediate of structural formula
(iv) with the metal salt (such as lithium, sodium, or potassium) of
an appropriately substituted 1H-pyrrolo[2,3-d]pyrimidine (v), such
as an appropriately substituted 4-halo-1H-pyrrolo[2,3-d]pyrimidine,
which can be generated in situ by treatment with an alkali hydride
(such as sodium hydride), an alkali hydroxide (such as potassium
hydroxide), an alkali carbonate (such as potassium carbonate), or
an alkali hexamethyldisilazide (such as NaHMDS) in a suitable
anhydrous organic solvent, such as acetonitrile, tetrahydrofuran,
1-methyl-2-pyrrolidinone, or N,N-dimethyl-formamide (DMF). The
displacement reaction can be catalyzed by using a phase-transfer
catalyst, such as TDA-1 or triethylbenzylammonium chloride, in a
two-phase system (solid-liquid or liquid-liquid). The optional
protecting groups in the protected nucleoside of structural formula
(vi) are then cleaved following established deprotection
methodologies, such as those described in T. W. Greene' and P. G.
M. Wuts, "Protective Groups in Organic Synthesis," P ed., John
Wiley & Sons, 1999. Optional introduction of an amino group at
the 4-position of the pyrrolo[2,3-d]pyrimidine nucleus is effected
by treatment of the 4-halo intermediate (vi) with the appropriate
amine, such as alcoholic ammonia or liquid ammonia, to generate a
primary amine at the C-4 position (--NH.sub.2), an alkylamine to
generate a secondary amine (--NHR), or a dialkylamine to generate a
tertiary amine (--NRR'). A 7H-pyrrolo[2,3-d]pyrimidin-4(3H)one
compound may be derived by hydrolysis of (vi) with aqueous base,
such as aqueous sodium hydroxide. Alcoholysis (such as
methanolysis) of 1-6 affords a C-4 alkoxide (--OR), whereas
treatment with an alkyl mercaptide affords a C-4 alkylthio (--SR)
derivative. Subsequent chemical manipulations well-known to
practitioners of ordinary skill in the art of organic/medicinal
chemistry may be required to attain the desired compounds of the
present invention.
##STR00016##
wherein: [0299] P.sup.1 and P.sup.2 are independently a protecting
group; alternatively, P.sup.1 and P.sup.2 can come together to form
a cyclic protecting group; [0300] R.sup.5 and R.sup.6 are
independently alkyl group; [0301] M is Li, Na, or K; [0302] X.sup.1
and X.sup.2 are independently F, CI, Br, or I; [0303] R.sup.7,
R.sup.8, and R.sup.9 are independently hydrogen, hydroxyl, halogen,
alkoxy, amino, alkylamino, or alkyl.
Synthesis of B-D-2'-CH.sub.3-riboC
##STR00017##
[0305] The following syntheses provided are non-limiting steps to
achieve the compound .beta.-D-2'-CH.sub.3-riboC. One of ordinary
skill in the art may modify the synthesis in any known manner to
achieve the compound .beta.-D-2'-CH.sub.3-riboC.
1. Glycosylation of the Nucleobase with an Appropriately Modified
Sugar
[0306] The key starting material for this process can be an
appropriately substituted sugar with a 2'-OH and 2'-H, with the
appropriate leaving group (LG), for example an acyl group or a
chloro, bromo, fluoro or iodo. The sugar can be purchased or can be
prepared by any known means including standard epimerization,
substitution, oxidation and reduction techniques. The substituted
sugar can then be oxidized with the appropriate oxidizing agent in
a compatible solvent at a suitable temperature to yield the
2'-modified sugar. Possible oxidizing agents are Jones reagent (a
mixture of chromic acid and sulfuric acid), Collins's reagent
(dipyridine Cr(VI) oxide, Corey's reagent (pyridinium
chlorochromate), pyridinium dichromate, acid dichromate, potassium
permanganate, MnO.sub.2, ruthenium tetroxide, phase transfer
catalysts such as chromic acid or permanganate supported on a
polymer, Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium molybdate,
NaBrO.sub.2--CAN, NaOCl in HOAc, copper chromite, copper oxide,
Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent
(aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0307] Then coupling of an organometallic carbon nucleophile, such
as a Grignard reagent, an organolithium, lithium dialkylcopper or
CH.sub.3--SiMe.sub.3 in TBAF with the ketone with the appropriate
non-protic solvent at a suitable temperature, yields the 2'-methyl
sugar. The methyl sugar can be optionally protected with a suitable
protecting group, preferably with an acyl or silyl group, by
methods well known to those skilled in the art, as taught by Greene
et al. Protective Groups in Organic Synthesis. John Wiley and Sons,
Second Edition, 1991.
[0308] The optionally protected sugar can then be coupled to the
BASE by methods well known to those skilled in the art, as taught
by Townsend Chemistry of Nucleosides and Nucleotides. Plenum Press,
1994. For example, an acylated sugar can be coupled to a silylated
base with a lewis acid, such as tin tetrachloride, titanium
tetrachloride or trimethylsilyltriflate in the appropriate solvent
at a suitable temperature. Alternatively, a halo-sugar can be
coupled to a silylated base with the presence of
trimethylsilyltriflate.
[0309] Subsequently, the 2'-methyl-nucleoside can be deprotected by
methods well known to those skilled in the art, as taught by Greene
et al. Protective Groups in Organic Synthesis. John Wiley and Sons,
Second Edition, 1991.
[0310] The synthesis of a 2'-methyl-nucleoside is shown in Scheme
6.
##STR00018##
wherein: [0311] LG is a leaving group; and [0312] R.sup.1, R.sup.2,
and R.sup.3 are independently H, phosphate (including mono-, di- or
triphosphate and a stabilized phosphate prodrug); acyl (including
lower acyl); alkyl (including lower alkyl); sulfonate ester
(including alkyl or arylalkyl sulfonyl including methanesulfonyl);
benzyl, wherein the phenyl group is optionally substituted with one
or more substituents as described in the definition of aryl given
herein; lipid (including a phospholipid); amino acid; carbohydrate;
peptide; cholesterol; or a pharmaceutically acceptable leaving
group that provides a compound wherein R.sup.1, R.sup.2 or R.sup.3
is independently H or phosphate when administered in vivo.
2. Modification of a Pre Formed 2'-Methyl Nucleoside
[0313] The key starting material for this process can be an
appropriately substituted 2'-methyl-cytidine nucleoside with a
2'-OH and 2'-H. The nucleoside can be purchased or can be prepared
by any known means including standard coupling techniques. The
nucleoside can be optionally protected with suitable protecting
groups, preferably with acyl or silyl groups, by methods well known
to those skilled in the art, as taught by Greene et al. Protective
Groups in Organic Synthesis. John Wiley and Sons, Second Edition,
1991.
[0314] The appropriately protected 2'-methyl-cytidine nucleoside
can then be oxidized with the appropriate oxidizing agent in a
compatible solvent at a suitable temperature to yield the 2'-methyl
sugar. Possible oxidizing agents are Jones reagent (a mixture of
chromic acid and sulfuric acid), Collins's reagent (dipyridine
Cr(VI) oxide, Corey's reagent (pyridinium chlorochromate),
pyridinium dichromate, acid dichromate, potassium permanganate,
MnO.sub.2, ruthenium tetroxide, phase transfer catalysts such as
chromic acid or permanganate supported on a polymer,
Cl.sub.2-pyridine, H.sub.2O.sub.2-ammonium molybdate,
NaBrO.sub.2--CAN, NaOCl in HOAc, copper chromite, copper oxide,
Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent
(aluminum t-butoxide with another ketone) and
N-bromosuccinimide.
[0315] Subsequently, the nucleoside can be deprotected by methods
well known to those skilled in the art, as taught by Greene et al.
Protective Groups in Organic Synthesis. John Wiley and Sons, Second
Edition, 1991.
[0316] The synthesis of a 2'-methyl-cytidine nucleoside is shown in
Scheme 7.
##STR00019##
wherein: [0317] R.sup.1 and R.sup.3 are independently H, phosphate
(including mono-, di- or triphosphate and a stabilized phosphate
prodrug); acyl (including lower acyl); alkyl (including lower
alkyl); sulfonate ester (including alkyl or arylalkyl sulfonyl
including methanesulfonyl); benzyl, wherein the phenyl group is
optionally substituted with one or more substituents as described
in the definition of aryl given herein; lipid (including a
phospholipid); amino acid; carbohydrate; peptide; cholesterol; or a
pharmaceutically acceptable leaving group that provides a compound
wherein R.sup.1 or R.sup.3 is independently H or phosphate when
administered in vivo.
Pharmaceutically Acceptable Prodrugs
[0318] The term "pharmaceutically acceptable prodrug and/or salt"
is used throughout the specification to describe any
pharmaceutically acceptable form (such as an ester, phosphate
ester, salt of an ester or a related group) of a nucleoside
compound which, upon administration to a patient, provides the
parent nucleoside compound. Pharmaceutically acceptable salts
include those derived from pharmaceutically acceptable inorganic or
organic bases and acids. Suitable salts include those derived from
alkali metals such as potassium and sodium, alkaline earth metals
such as calcium and magnesium, among numerous other acids well
known in the pharmaceutical art. Pharmaceutically acceptable
prodrugs refer to a compound that is metabolized, for example
hydrolyzed or oxidized, in the host to form the compound of the
present invention. Typical examples of prodrugs include compounds
that have biologically labile protecting groups on a functional
moiety of the active compound. Prodrugs include compounds that can
be oxidized, reduced, aminated, deaminated, hydroxylated,
dehydroxylated, hydrolyzed, dehydrolyzed, alkylated, dealkylated,
acylated, deacylated, phosphorylated, dephosphorylated to produce
the active compound. The compounds of this invention possess
antiviral activity against a Flaviviridae, or are metabolized to a
compound that exhibits such activity.
[0319] 2'-Branched nucleosides, including 2'-branched pyrimidine
nucleoside, such as .beta.-D-2'-CH.sub.3-riboC, or related
compounds administered as acylated or nucleoside prodrugs can be
used in combination or alternation therapy.
[0320] Any of the nucleosides described herein or other compounds
that contain a hydroxyl or amine function can be administered as a
nucleoside prodrug to increase the activity, bioavailability,
stability or otherwise alter the properties of the nucleoside. A
number of nucleoside prodrug ligands are known. In general,
alkylation, acylation or other lipophilic modification of the
hydroxyl group of the compound or of the mono, di or triphosphate
of the nucleoside will increase the stability of the nucleoside.
Examples of substituent groups that can replace one or more
hydrogens on the phosphate moiety or hydroxyl are alkyl, aryl,
steroids, carbohydrates, including sugars, 1,2-diacylglycerol and
alcohols. Many are described in R. Jones and N. Bischofberger,
Antiviral Research, 27 (1995) 1-17. Any of these can be used in
combination with the disclosed nucleosides or other compounds to
achieve a desire effect
[0321] The active nucleoside or other hydroxyl containing compound
can also be provided as an ether lipid (and particularly a 5'-ether
lipid for a nucleoside), as disclosed in the following references:
Kucera, L. S., N. Iyer, E. Leake, A. Raben, Modest E. K., D. L. W.,
and C. Piantadosi. 1990. "Novel membrane-interactive ether lipid
analogs that inhibit infectious HIV-1 production and induce
defective virus formation." AIDS Res. Hum. Retro Viruses.
6:491-501; Piantadosi, C., J. Marasco C. J., S. L. Morris-Natschke,
K. L. Meyer, F. Gumus, J. R. Surles, K. S. Ishaq, L. S. Kucera, N.
Iyer, C. A. Wallen, S. Piantadosi, and E. J. Modest. 1991.
"Synthesis and evaluation of novel ether lipid nucleoside
conjugates for anti-HIV activity." J. Med. Chem. 34:1408.1414;
Hosteller, K. Y., D. D. Richman, D. A. Carson, L. M. Stuhmiller, G.
M. T. van Wijk, and H. van den Bosch. 1992. "Greatly enhanced
inhibition of human immunodeficiency virus type 1 replication in
CEM and HT4-6C cells by 3'-deoxythymidine diphosphate
dimyristoylglycerol, a lipid prodrug of 3,-deoxythymidine."
Antimicrob. Agents Chemother. 36:2025.2029; Hostetier, K. Y., L. M.
Stuhmiller, H. B. Lenting, H. van den Bosch, and D. D. Richman,
1990. "Synthesis and antiretroviral activity of phospholipid
analogs of azidothymidine and other antiviral nucleosides." J.
Biol. Chem. 265:61127. Nonlimiting examples of U.S. patents that
disclose suitable lipophilic substituents that can be covalently
incorporated into the nucleoside or other hydroxyl or amine
containing compound, preferably at the 5'-OH position of the
nucleoside or lipophilic preparations, include U.S. Pat. No.
5,149,794 (Sep. 22, 1992, Yatvin et al.); U.S. Pat. No. 5,194,654
(Mar. 16, 1993, Hostetler et al., U.S. Pat. No. 5,223,263 (Jun. 29,
1993, Hostetler et al.); U.S. Pat. No. 5,256,641 (Oct. 26, 1993,
Yatvin et al.); U.S. Pat. No. 5,411,947 (May 2, 1995, Hostetler et
al.); U.S. Pat. No. 5,463,092 (Oct. 31, 1995, Hostetler et al.);
U.S. Pat. No. 5,543,389 (Aug. 6, 1996, Yatvin et al.); U.S. Pat.
No. 5,543,390 (Aug. 6, 1996, Yatvin et al.); U.S. Pat. No.
5,543,391 (Aug. 6, 1996, Yatvin et al.); and U.S. Pat. No.
5,554,728 (Sep. 10, 1996; Basava et al.), all of which are
incorporated herein by reference. Foreign patent applications that
disclose lipophilic substituents that can be attached to the
nucleosides of the present invention, or lipophilic preparations,
include WO 89/02733, WO 90/00555, WO 91/16920, WO 91/18914, WO
93/00910, WO 94/26273, WO 96/15132, EP 0 350 287, EP 93917054.4,
and WO 91/19721.
[0322] 2', 3' and 5'-Prodrugs of 2'-branched .beta.-D nucleosides,
or their pharmaceutically acceptable salts or pharmaceutically
acceptable formulations containing these compounds can be used to
treat Flaviviridae infections. Specifically, the 3'-valine ester
prodrug of .beta.-D-2'-CH.sub.3-riboC represented by the
formula:
##STR00020##
or its pharmaceutically acceptable salt, can be administered to a
subject for the treatment of a Flaviviridae infection.
[0323] In one embodiment, 2'-branched .beta.-D nucleoside
2'-prodrug includes biologically cleavable moieties at the 2'
and/or 5' positions. Preferred moieties are natural or synthetic D
or L amino acid esters, including D or L-valyl, though preferably
L-amino acid esters, such as L-valyl, and alkyl esters including
acetyl. Therefore, this invention specifically includes 2'-D or
L-amino acid ester and 2',5'-D or L-diamino acid ester, preferably
L-amino acid ester, of 2'-branched .beta.-D or .beta.-L nucleosides
with any desired purine or pyrimidine base, wherein the parent drug
optionally has an EC.sub.50 of less than 15 micromolar, and even
more preferably less than 10 micromolar; 2'-(alkyl or aryl) ester
or 2',5'-di(alkyl or aryl) ester of 2'-branched .beta.-D or
.beta.-L nucleosides with any desired purine or pyrimidine base,
wherein the parent drug optionally has an EC.sub.50 of less than 10
or 15 micromolar; and prodrugs of 2',5'-diesters of 2'-branched
.beta.-D or .beta.-L nucleosides wherein (i) the 2' ester is a
natural or synthetic D or L-amino acid ester, though preferably an
L-amino acid ester, and the 5'-ester is an alkyl or aryl ester;
(ii) both esters are independently natural or synthetic D or
L-amino acid ester, though preferably both are L-amino acid esters;
(iii) both esters are independently alkyl or aryl esters; and (iv)
the 2' ester is independently an alkyl or aryl ester and the
5'-ester is a natural or synthetic D or L-amino acid ester, though
preferably an L-amino acid ester, wherein the parent drug
optionally has an EC.sub.50 of less than 10 or 15 micromolar.
[0324] Examples of prodrugs falling within the invention are 2'-D
or L-valine ester of .beta.-D-2'-methyl-cytidine;
.beta.-D-2',6-dimethyl-cytidine; 2'-L-valine ester of
.beta.-D-2',6-dimethyl-thymidine; 2'-L-valine ester of
.beta.-D-2',8-dimethyl-adenosine; 2'-L-valine ester of
.beta.-D-2',8-dimethyl-guanosine; 2'-L-valine ester of
.beta.-D-2',6-dimethyl-5-fluorocytidine; 2'-L-valine ester of
.beta.-D-2',6-dimethyl-uridine; 2'-acetyl ester of
.beta.-D-2',6-dimethyl-cytidine; 2'-acetyl ester of
.beta.-D-2',6-dimethyl-thymidine; 2'-acetyl ester of
.beta.-D-2',8-dimethyl-adenosine; 2'-acetyl ester of
.beta.-D-2',8-dimethyl-guanosine; 2'-acetyl ester of
.beta.-D-2',6-dimethyl-5-fluoro-cytidine; and 2'-esters of
.beta.-D-2',6-dimethyl-(cytidine, 5-fluorocytidine, uridine or
thymidine) or 2'-esters of .beta.-D-2'-methyl-cytidine or
.beta.-D-2',8-dimethyl-(guanosine, adenosine or inosine) wherein
(i) the 2' ester is an amino acid ester; or (ii) the 2' ester is an
alkyl or aryl ester.
[0325] Additional examples of prodrugs falling within the invention
are 2',5'-L-divaline ester of .beta.-D-2'-methyl cytidine;
.beta.-D-2',6-dimethyl-cytidine (dival-2',6-diMe-L-dC);
2',5'-L-divaline ester of .beta.-D-2',6-dimethyl-thymidine;
2',5'-L-divaline ester of .beta.-D-2',8-dimethyl-adenosine;
2',5'-L-divaline ester of .beta.-D-2',8-dimethyl-guanosine;
2',5'-L-divaline ester of .beta.-D-2',6-dimethyl-5-fluoro-cytidine;
2',5'-L-divaline ester of .beta.-D-2',6-dimethyl-uridine;
2',5'-diacetyl ester of .beta.-D-2',6-dimethyl-cytidine;
2',5'-diacetyl ester of .beta.-D-2',6-dimethyl-thymidine;
2',5'-diacetyl ester of .beta.-D-2',8-dimethyl-adenosine;
2',5'-diacetyl ester of .beta.-D-2',8-dimethyl-guanosine;
2',5'-diacetyl ester of .beta.-D-2',6-dimethyl-5-fluoro-cytidine.;
and 2',5'-diesters of .beta.-D-2',6-dimethyl-(cytidine,
5-fluoro-cytidine, uridine or thymidine) or 2',5'-diesters of
.beta.-D-2'-methyl cytidine or .beta.-D-2',8-dimethyl-(guanosine,
adenosine or inosine) wherein (i) the 2' ester is an amino acid
ester and the 5'-ester is an alkyl or aryl ester; (ii) both esters
are amino acid esters; (iii) both esters are independently alkyl or
aryl esters; or (iv) the 2' ester is an alkyl or aryl ester and the
5'-ester is an amino acid ester.
[0326] In another embodiment, the 2'-branched .beta.-D nucleoside
3'-prodrug includes biologically cleavable moieties at the 3'
and/or 5' positions. Preferred moieties are natural or synthetic
.beta.-D or .beta.-L amino acid esters, such as valyl, though
preferably L-amino acids, such as L-valyl, and alkyl esters
including acetyl. Therefore, this invention specifically includes
3'-L-amino acid ester and 3',5'-L-diamino acid ester of a
2'-branched .beta.-D or .beta.-L nucleosides with any desired
purine or pyrimidine base, wherein the parent drug optionally has
an EC.sub.50 of less than 15 micromolar, and even more preferably
less than 10 micromolar; 3'-(alkyl or aryl) ester or
3',5'-L-di(alkyl or aryl) ester of 2'-branched .beta.-D or .beta.-L
nucleosides with any desired purine or pyrimidine base, wherein the
parent drug optionally has an EC.sub.50 of less than 10 or 15
micromolar; and prodrugs of 3',5'-diesters of 2'-branched .beta.-D
or .beta.-L nucleosides wherein (i) the 3' ester is a natural or
synthetic D or L amino acid ester and the 5'-ester is an alkyl or
aryl ester; (ii) both esters are natural or synthetic D or L-amino
acid esters; (iii) both esters are independently alkyl or aryl
esters; and (iv) the 3' ester is independently an alkyl or aryl
ester and the 5'-ester is a natural or synthetic D or L-amino acid
ester, wherein the parent drug optionally has an EC50 of less than
10 or 15 micromolar.
[0327] Examples of prodrugs falling within the invention are
3'-L-valine ester of .beta.-D-2'-methyl-cytidine;
.beta.-D-2',6-dimethyl-cytidine; 3'-L-valine ester of
.beta.-D-2',6-dimethyl-thymidine; 3'-L-valine ester of
.beta.-D-2',8-dimethyl-adenosine; 3'-L-valine ester of
.beta.-D-2',8-dimethyl-guanosine; 3'-L-valine ester of
.beta.-D-2',6-dimethyl-5-fluorocytidine; 3'-L-valine ester of
.beta.-D-2',6-dimethyl-uridine; 3'-acetyl ester of
.beta.-D-2',6-dimethyl-cytidine; 3'-acetyl ester of
.beta.-D-2',6-dimethyl-thymidine; 3'-acetyl ester of
.beta.-D-2',8-dimethyl-adenosine; 3'-acetyl ester of
.beta.-D-2',8-dimethyl-guanosine; 3'-acetyl ester of
.beta.-D-2'-methyl-cytidine; 3'-acetyl ester of
.beta.-D-2',6-dimethyl-5-fluoro-cytidine; and 3'-esters of
.beta.-D-2',6-dimethyl-(cytidine, 5-fluorocytidine, uridine or
thymidine) or 3'-esters of .beta.-D-2',8-dimethyl-(guanosine,
adenosine or inosine) wherein (i) the 3' ester is an amino acid
ester; or (ii) the 3' ester is an alkyl or aryl ester.
[0328] Additional examples of prodrugs falling within the invention
are 3',5'-L-divaline ester of .beta.-D-2'-methyl-cytidine;
.beta.-D-2',6-dimethyl-cytidine (dival-2',6-diMe-L-dC);
3',5'-L-divaline ester of .beta.-D-2',6-dimethyl-thymidine;
3',5'-L-divaline ester of .beta.-D-2',8-dimethyl-adenosine;
3',5'-L-divaline ester of .beta.-D-2',8-dimethyl-guanosine;
3',5'-L-divaline ester of .beta.-D-2',6-dimethyl-5-fluoro-cytidine;
3',5'-L-divaline ester of .beta.-D-2',6-dimethyl-uridine;
3',5'-diacetyl ester of .beta.-D-2',6-dimethyl-cytidine;
3',5'-diacetyl ester of .beta.-D-2',6-dimethyl-thymidine;
3',5'-diacetyl ester of .beta.-D-2',8-dimethyl-adenosine;
3',5'-diacetyl ester of .beta.-D-2',8-dimethyl-guanosine;
3',5'-diacetyl ester of .beta.-D-2',6-dimethyl-5-fluoro-cytidine;
and 3',5'-diesters of .beta.-D-2',6-dimethyl-(cytidine,
5-fluoro-cytidine, or .beta.-D-2'-methyl-cytidine, uridine or
thymidine) or 3',5'-diesters of .beta.-D-2',8-dimethyl-(guanosine,
adenosine or inosine) wherein (i) the 3' ester is an amino acid
ester and the 5'-ester is an alkyl or aryl ester; (ii) both esters
are amino acid esters; (iii) both esters are independently alkyl or
aryl esters; or (iv) the 3' ester is an alkyl or aryl ester and the
5'-ester is an amino acid ester.
[0329] In another embodiment, the prodrug of 2'-branched .beta.-D
nucleoside includes biologically cleavable moieties at the 2', 3'
and/or 5' positions. Preferred moieties are natural or synthetic D
or L amino acid esters, including D or L-valyl, though preferably
L-amino acid esters, such as L-valyl, and alkyl esters including
acetyl. Therefore, this invention specifically includes 2',3'-L or
D-diamino acid ester and 2',3',5'-L or D-triamino acid ester of
2'-branched .beta.-D or .beta.-L nucleosides, preferably L-amino
acid, with any desired purine or pyrimidine base, wherein the
parent drug optionally has an EC.sub.50 of less than 15 micromolar,
and even more preferably less than 10 micromolar; 2',3'-di(alkyl or
aryl) ester or 2',3',5'-L-tri(alkyl or aryl) ester of 2'-branched
.beta.-D or .beta.-L nucleosides with any desired purine or
pyrimidine base, wherein the parent drug optionally has an
EC.sub.50 of less than 10 or 15 micromolar; and prodrugs of
2',3'-diesters of 2'-branched .beta.-D or .beta.-L nucleosides
wherein (i) the 2' ester is an amino acid ester and the 3'-ester is
an alkyl or aryl ester; (ii) both esters are amino acid esters;
(iii) both esters are independently alkyl or aryl esters; and (iv)
the 2' ester is independently an alkyl or aryl ester and the
3'-ester is an amino acid ester, wherein the parent drug optionally
has an EC.sub.50 of less than 10 or 15 micromolar. Further,
2',3',5'-triesters of 2'-branched .beta.-D or .beta.-L nucleosides
wherein (i) all three esters are amino acid esters; (ii) all three
esters are independently alkyl or aryl esters; (iii) the 2' ester
is an amino acid ester, the 3' ester is an amino acid ester and the
5'-ester is an alkyl or aryl ester; (iv) the 2' ester is an amino
acid ester, the 3' ester is an alkyl or aryl ester and the 5'-ester
is an alkyl or aryl ester; (v) the 2' ester is an alkyl or aryl
ester, the 3' ester is an alkyl or aryl ester and the 5'-ester is
an amino acid ester; (vi) the 2' ester is an alkyl or aryl ester,
the 3' ester is an amino acid ester and the 5'-ester is an amino
acid ester; (vii) the 2' ester is an alkyl or aryl ester, the 3'
ester is an amino acid ester and the 5'-ester is an alkyl or aryl
ester; and (viii) the 2' ester is an amino acid ester, the 3' ester
is an alkyl or aryl ester and the 5'-ester is an amino acid ester;
wherein the parent drug optionally has an EC.sub.50 of less than 10
or 15 micromolar.
[0330] Examples of prodrugs falling within the invention include
2',3'-L-divaline ester of .beta.-D-2'-methyl-cytidine;
.beta.-D-2',6-dimethyl-cytidine (dival-2',6-diMe-L-dC);
2',3'-L-divaline ester of .beta.-D-2',6-dimethyl-thymidine;
2',3'-L-divaline ester of .beta.-D-2',8-dimethyl-adenosine;
2',3'-L-divaline ester of .beta.-D-2',8-dimethyl-guanosine;
2',3'-L-divaline ester of .beta.-D-2',6-dimethyl-5-fluoro-cytidine;
2',3'-L-divaline ester of .beta.-D-2',6-dimethyl-uridine;
2',3'-diacetyl ester of .beta.-D-2',6-dimethyl-cytidine;
2',3'-diacetyl ester of .beta.-D-2',6-dimethyl-thymidine;
2',3'-diacetyl ester of .beta.-D-2',8-dimethyl-adenosine;
2',3'-diacetyl of .beta.-D-2'-methyl-cytidine; 2',3'-diacetyl ester
of .beta.-D-2',8-dimethyl-guanosine; 2',3'-diacetyl ester of
.beta.-D-2',6-dimethyl-5-fluoro-cytidine; and 2',3'-diesters of
.beta.-D-2',6-dimethyl-(cytidine, 5-fluorocytidine, uridine or
thymidine) or 2',3'-diesters of .beta.-D-2',8-dimethyl-(guanosine,
adenosine or inosine) wherein (i) the 2' ester is an amino acid
ester and the 3'-ester is an alkyl or aryl ester; (ii) both esters
are amino acid esters; (iii) both esters are independently alkyl or
aryl esters; or (iv) the 2' ester is an alkyl or aryl ester and the
3'-ester is an amino acid ester.
[0331] Additional examples of prodrugs falling within the invention
include 2',3',5'-L-trivaline ester of .beta.-D-2'-methyl-cytidine;
.beta.-D-2',6-dimethyl-cytidine (trival-2',6-diMe-L-dC);
2',3',5'-L-trivaline ester of .beta.-D-2',6-dimethyl-thymidine;
2',3',5'-L-trivaline ester of .beta.-D-2',8-dimethyl-adenosine;
2',3',5'-L-trivaline ester of .beta.-D-2',8-dimethyl-guanosine;
2',3',5'-L-trivaline ester of
.beta.-D-2',6-dimethyl-5-fluoro-cytidine; 2',3',5'-L-trivaline
ester of .beta.-D-2', 6-dimethyl-uridine; 2',3',5'-triacetyl ester
of .beta.-D-2',6-dimethyl-cytidine; 2',3',5'-triacetyl ester of
.beta.-D-2',6-dimethyl-thymidine; 2',3',5'-triacetyl ester of
.beta.-D-2',8-dimethyl-adenosine; 2',3',5'-triacetyl ester of
.beta.-D-2',8-dimethyl-guanosine; 2',3',5'-triacetyl ester of
.beta.-D-2',6-dimethyl-5-fluoro-cytidine; and 2',3',5'-triesters of
.beta.-D-2',6-dimethyl-(cytidine, 5-fluorocytidine, uridine or
thymidine) and 2',3',5'-triesters of
.beta.-D-2',8-dimethyl-(guanosine, adenosine or inosine) wherein
(i) all three esters are amino acid esters; (ii) all three esters
are independently alkyl or aryl esters; (iii) the 2' ester is an
amino acid ester, the 3' ester is an amino acid ester and the
5'-ester is an alkyl or aryl ester; (iv) the 2' ester is an amino
acid ester, the 3' ester is an alkyl or aryl ester and the 5'-ester
is an alkyl or aryl ester; (v) the 2' ester is an alkyl or aryl
ester, the 3' ester is an alkyl or aryl ester and the 5'-ester is
an amino acid ester; (vi) the 2' ester is an alkyl or aryl ester,
the 3' ester is an amino acid ester and the 5'-ester is an amino
acid ester; (vii) the 2' ester is an alkyl or aryl ester, the 3'
ester is an amino acid ester and the 5'-ester is an alkyl or aryl
ester; and (viii) the 2' ester is an amino acid ester, the 3' ester
is an alkyl or aryl ester and the 5'-ester is an amino acid
ester.
[0332] Further examples of prodrugs falling within the invention
include prodrugs disclosed in U.S. Pat. Nos. 6,284,748 and
6,312,662. In particular, the prodrugs of the present invention
include compounds of the structure
##STR00021##
wherein: [0333] V, W and W' are independently selected from the
group consisting of --H, alkyl, aralkyl, alicyclic, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, 1-alkenyl,
and 1-alkynyl; or [0334] together V and Z are connected via an
additional 3-5 atoms to form a cyclic group containing 5-7 atoms,
optionally 1 heteroatom, substituted with hydroxy, acyloxy,
alkoxycarbonyloxy, or aryloxycarbonyloxy attached to a carbon atom
that is three atoms from both O groups attached to the phosphorus;
or [0335] together V and Z are connected via an additional 3-5
atoms to form a cyclic group, optionally containing 1 heteroatom,
that is fused to an aryl group at the beta and gamma position to
the O attached to the phosphorus; or [0336] together V and W are
connected via an additional 3 carbon atoms to form an optionally
substituted cyclic group containing 6 carbon atoms and substituted
with one substituent selected from the group consisting of hydroxy,
acyloxy, alkoxycarbonyloxy, alkylthiocarbonyloxy, and
aryloxycarbonyloxy, attached to one of said carbon atoms that is
three atoms from an O attached to the phosphorus; [0337] together Z
and W are connected via an additional 3-5 atoms to form a cyclic
group, optionally containing one heteroatom, and V must be aryl,
substituted aryl, heteroaryl, or substituted heteroaryl; [0338]
together W and W' are connected via an additional 2-5 atoms to form
a cyclic group, optionally containing 0-2 heteroatoms, and V must
be aryl, substituted aryl, heteroaryl, or heteroaryl; [0339] Z is
selected from the group consisting of --CHR.sup.2OH,
--CHR.sup.2OC(O)R.sup.3, --CHR.sup.2OC(S)R.sup.3,
--CHR.sup.2OC(S)OR.sup.3, --CHR.sup.2OC(O)SR.sup.3,
--CHR.sup.2OCO.sub.2R.sup.3, --OR.sup.2, --SR.sup.2,
--CHR.sup.2N.sub.3, --CH.sub.2aryl, --CH(aryl)OH,
--CH(CH.dbd.CR.sup.2.sub.2)OH, --CH(C.dbd.CR.sup.2)OH, --R.sup.2,
--NR.sup.2.sub.2, --OCOR.sup.3, --OCO.sub.2R.sup.3, --SCOR.sup.3,
--SCO.sub.2R.sup.3, --NHCOR.sup.2, --NHCO.sub.2R.sup.3,
--CH.sub.2NHaryl, --(CH.sub.2).sub.p--OR.sup.12, and
--(CH.sub.2).sub.p--SR.sup.12; [0340] p is an integer 2 or 3;
[0341] R.sup.2 is selected from the group consisting of R.sup.3 and
--H; [0342] R.sup.3 is selected from the group consisting of alkyl,
aryl, alicyclic, and aralkyl; [0343] R.sup.12 is selected from the
group consisting of --H, and lower acyl; [0344] M is selected from
the group that attached to PO.sub.3.sup.2-, P.sub.2O.sub.6.sup.3-
or P.sub.3O.sub.9.sup.4- is a the 2'-branched nucleoside, and is
attached to the phosphorus via a carbon, oxygen, sulfur or nitrogen
atom.
[0345] In one non-limiting example, the prodrug is attached to the
nucleoside as in the following compounds
##STR00022##
General Synthesis of 2' and/or 3'-Prodrugs
[0346] The key starting material for this process is an
appropriately substituted 2'-branched .beta.-D nucleosides. The
branched nucleoside can be purchased or can be prepared by any
known means including the techniques disclosed herein. The branched
nucleoside can be optionally protected with a suitable protecting
group, preferably with a silyl group, by methods well known to
those skilled in the art, as taught by Greene et al. Protective
Groups in Organic Synthesis, John Wiley and Sons, Second Edition,
1991. The protected branched nucleoside can then be coupled with a
suitable acyl doner, such as an acyl chloride and/or an acyl
anhydride with the appropriate protic or aprotic solvent at a
suitable temperature, to give the 2' and/or 3' prodrug of
2'-branched .beta.-D nucleoside. Alternatively, the protected
branched nucleoside can then be coupled with a suitable acyl, such
as a carboxylic acid, such as alkanoic acid and/or amino acid
residue, optionally with a suitable coupling agent, with the
appropriate aprotic solvent at a suitable temperature, to give the
2' and/or 3' prodrug of 2'-branched .beta.-D nucleoside. Possible
coupling reagents are any reagents that promote coupling, including
but are not limiting to, Mitsunobu reagents (e.g. diisopropyl
azodicarboxylate and diethyl azodicarboxylate) with
triphenylphosphine or various carbodiimides.
[0347] For example, simple amino-alcohols can be esterified using
acid chlorides in refluxing acetonitrile-benzene mixture (See
Scheme 8 below: Synthetic Communications, 1978, 8(5), 327-333;
hereby incorporated by reference). Alternatively, esterification
can be achieved using an anhydride, as described in J. Am. Chem.
Soc., 1999, 121(24), 5661-5664.
##STR00023##
III. DETECTION OF THE .beta.-D-2'-CH.sub.3-riboC INDUCED MUTATION
IN A FLAVIVIRIDAE GENOME
[0348] In one embodiment, a method is provided for treating a
patient infected with Flaviviridae comprising: [0349] (i)
administering an effective amount of
.beta..beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3'
valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
pharmaceutically acceptable salt thereof; [0350] (ii) identifying
viral resistance to .beta.-D-2'-CH.sub.3-riboC in the patient;
[0351] (iii) administering an effective amount of one or more drugs
that in combination and/or alternation with one or more drugs that
directly or indirectly induce a mutation in a Flaviviridae at a
location other than a mutation of a nucleotide that results in a
change from serine to a different amino acid in the highly
conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain
B of the RNA polymerase region, and/or one or more drugs that are
associated with such a mutation.
[0352] In another embodiment, a method is provided for treating a
patient infected with HCV comprising: [0353] (i) administering an
effective amount of .beta.-D-2'-CH.sub.3-riboC or a prodrug, such
as the 3' valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
pharmaceutically acceptable salt thereof; [0354] (ii) identifying
viral resistance to .beta.-D-2'-CH.sub.3-riboC in the patient;
[0355] (iii) administering an effective amount of one or more drugs
that directly or indirectly induce a mutation in a Flaviviridae at
a location other than a mutation of a nucleotide that results in a
change from serine at position 282 to a different amino acid, such
as threonine, in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, and/or
one or more drugs that is associated with such a mutation.
[0356] In one embodiment, a method is provided for treating a host
infected with BVDV comprising: [0357] (i) administering an
effective amount of .beta.-D-2'-CH.sub.3-riboC or a prodrug, such
as the 3' valine ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a
pharmaceutically acceptable salt thereof; [0358] (ii) identifying
viral resistance to .beta.-D-2'-CH.sub.3-riboC in the host; [0359]
(iii) administering an effective amount of one or more drugs that
directly or indirectly induce a mutation in a Flaviviridae at a
location other than a mutation of a nucleotide that results in a
change from serine at position 405 to a different amino acid, such
as threonine, in the highly conserved consensus sequence, XRXSGXXXT
(SEQ ID NO: 63), of domain B of the RNA polymerase region, and/or
one or more drugs that is associated with such a mutation.
[0360] In another embodiment, the invention provides a method for
treating a patient infected with Flaviviridae comprising: [0361]
(i) administering an effective amount of .beta.-D-2'-CH.sub.3-riboC
or a prodrug, such as the 3' valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a pharmaceutically acceptable salt
thereof; [0362] (ii) identifying viral resistance to
.beta.-D-2'-CH.sub.3-riboC in the patient; [0363] (iii)
administering an effective amount of interferon.
[0364] In certain embodiments, identification of viral resistance
to .beta.-D-2'-CH.sub.3-riboC in the patient can be determined by a
phenotypic analysis of viral plaque growth. In another embodiment,
identification of viral resistance to .beta.-D-2'-CH.sub.3-riboC in
the patient can be determined by the replication fitness of the
virus. In a further embodiment, identification of viral resistance
to .beta.-D-2'-CH.sub.3-riboC in the patient can be determined by
detecting the presence of cytidine at nucleotide 1214 of the RNA
polymerase region of BVDV or cytidine at nucleotide 8443 of
HCV.
[0365] In one embodiment, the present invention includes a method
for treating a patient infected with Flaviviridae comprising:
[0366] (i) administering an effective amount of
.beta.-D-2'-CH.sub.3-riboC or a prodrug, such as the 3' valine
ester prodrug of .beta.-D-2'-CH.sub.3-riboC, or a pharmaceutically
acceptable salt thereof; [0367] (ii) obtaining a viral culture
sample from the patient; [0368] (iii) culturing the sample and
comparing the plaque growth between the sample and wild type virus;
[0369] (iv) determining whether the plaque growth of the sample is
smaller than the plaque growth of the wildtype, which indicates
resistance to .beta.-D-2'-CH.sub.3-riboC; [0370] (v) administering
an effective amount of interferon to those patients that are
resistant to .beta.-D-2'-CH.sub.3-riboC.
[0371] In another embodiment, the invention provides a method for
treating a patient infected with Flaviviridae comprising: [0372]
(i) administering an effective amount of .beta.-D-2'-CH.sub.3-riboC
or a prodrug, such as the 3' valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a pharmaceutically acceptable salt
thereof; [0373] (ii) obtaining a viral sample from the patient;
[0374] (iii) determining the replication fitness of the viral;
[0375] (iv) determining whether the replication fitness of the
sample is less than the replication fitness of the wild-type virus,
which indicates resistance to .beta.-D-2'-CH.sub.3-riboC; [0376]
(v) administering an effective amount of interferon to those
patients that are resistant to .beta.-D-2'-CH.sub.3-riboC.
[0377] In one embodiment, viral plaque growth and/or viral
replication fitness can be quantitated by a viral plaque assay. In
other embodiments, other assays, such as the infectious center
assay, virus-inducible reporter assay, transformation assay, end
point dilution assay, or RT-PCR technology can be used to
quantitate viral titers (Flint et al. Principles of Virology (ASM)
Chapter 2; Wagner & Hewlett. Basic Virology (Blackwell),
Chapters 9 & 10).
[0378] A plaque assay can be conducted to quantitate viral plaque
growth and/or replication fitness. A dilute solution of the virus
can be applied to a culture dish that contains a monolayer of host
cells. The cells can be overlayed with a semisolid layer (such as a
viscous medium, for example, agar) to prevent virus diffusion from
one infected cell to another. After incubation the `plaques` can be
recognized, and the number of infective virus particles in the
original suspension estimated. One method to recognize the plaques
is through the use of antibody staining methods to detect viral
antigens within infected cells in the monolayer. These infected
cells can then be visualized using a chromagen or a fluorescent
label on the virus-specific antibody. The plaques can be observed
for phenotypic analysis and/or counted to determine viral titers.
Virus titers can be calculated in focus forming units (FFU)/mL,
using the following equation: T.sub.FFU/mL=N.times.5.times.D; where
T is a virus titer in FFU/mL; N is a number of plaques per well;
and D is a dilution factor for the corresponding virus sample. (For
example, if 12 plaques were found in a well corresponding to
10.sup.-5 dilution of virus sample, than
T=12.times.5.times.10.sup.5=6.times.10.sup.6 PFU/mL) and viral
replication fitness, which is the overall replicative ability to
produce infected progeny in a defined host environment, can then be
determined.
[0379] Another aspect of the invention is a method for detecting
the presence of the nucleotide 1214 G to C mutation of the RNA
polymerase region of BVDV (causing a mutation from Serine to
Threonine at amino acid 405). Since it is recognized that
Ser.sub.405, the amino acid position of the BVDV putative
functional NS5B domain B, is highly conserved among all hepaci-,
pesti- and flavivirus genomes (FIG. 11; Lai et al. J Virol., 1999,
73, 10129-36), the corresponding serine residues of the putative
functional NS5B domain B of other Flaviviridaes that are mutated
can be detected according to the embodiments of the present
invention. For example, Ser.sub.405 of the RNA polymerase domain of
BVDV corresponds to Ser.sub.282 of the RNA polymerase domain of
HCV.
[0380] Therefore, the embodiments of the present invention also
encompass a G to C mutation of nucleotide 8443 of the HCV genome
(which corresponds to nucleotide 1214 of the BVDV RNA polymerase
region).
[0381] In one embodiment, the invention provides a process for
detecting a mutation that indicates .beta.-D-2'-CH.sub.3-riboC
resistance, which includes contacting a sample containing a
Flaviviridae nucleic acid sequence with an oligonucleotide probe
having a sequence complementary to a section of the Flaviviridae
genome that includes the mutation; and then determining if the
oligonucleotide hybridizes to the viral nucleic acid.
[0382] In other embodiments, the invention provides a method for
treating a patient infected with Flaviviridae comprising: [0383]
(i) administering an effective amount of .beta.-D-2'-CH.sub.3-riboC
or a prodrug, such as the 3' valine ester prodrug of
.beta.-D-2'-CH.sub.3-riboC, or a pharmaceutically acceptable salt
thereof; [0384] (ii) assaying the blood of the patient to test for
seroconversion from wildtype to mutant virus; [0385] (iii)
administering an effective amount of interferon.
[0386] In yet another embodiment, the invention provides a method
for assaying a sample suspected of containing a
.beta.-D-2'-CH.sub.3-riboC-resistant Flaviviridae comprising:
[0387] (i) contacting a sample containing a Flaviviridae nucleic
acid sequence with a detectable oligonucleotide probe having a
sequence complementary to the cytidine at nucleotide 1214 of the
RNA polymerase region of BVDV or nucleotide 8443 of the HCV genome;
[0388] (ii) allowing the probe to hybridize to the sequence; [0389]
(iii) detecting the hybridization of the probe to cytidine at
nucleotide 1214 of the RNA polymerase region of BVDV or nucleotide
8443 of the HCV genome.
[0390] In a further embodiment, the invention provides a method for
assaying a sample suspected of containing a Thr instead of a Ser in
the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63),
of domain B of the RNA polymerase region of a Flaviviridae, which
indicates that the virus is hypersensitive to interferon treatment,
comprising: [0391] (i) contacting a sample suspected of containing
a Flaviviridae nucleic acid sequence with a detectable
oligonucleotide probe having a sequence complementary a codon that
encodes Thr in the position of Ser in the conserved consensus
sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA
polymerase region of a Flaviviridae; [0392] (ii) allowing the probe
to hybridize to the sequence; [0393] (iii) detecting the
hybridization of the probe to the sequence.
[0394] In another embodiment, the invention provides a method for
assaying a sample suspected of containing a Thr instead of a Ser at
amino acid position 405 or a cytidine at nucleotide 1214 of the RNA
polymerase region of BVDV, which indicates that the virus is
hypersensitive to interferon treatment, comprising: [0395] (i)
contacting a sample suspected of containing a BVDV nucleic acid
sequence with a detectable oligonucleotide probe having a sequence
complementary to the cytidine at nucleotide 1214 of the RNA
polymerase region; [0396] (ii) allowing the probe to hybridize to
the sequence; [0397] (iii) detecting the hybridization of the probe
to cytidine at nucleotide 1214 of the RNA polymerase region of
BVDV.
[0398] In another embodiment, the invention provides a method for
assaying a sample suspected of containing a Thr instead of a Ser in
the highly conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63),
of domain B of the RNA polymerase region at the highly conserved at
amino acid position 282 or a cytidine at nucleotide 8433 of the HCV
genome, which indicates that the virus is hypersensitive to
interferon treatment, comprising: [0399] (i) contacting a sample
suspected of containing a HCV nucleic acid sequence with a
detectable oligonucleotide probe having a sequence complementary to
the cytidine at nucleotide 8443; [0400] (ii) allowing the probe to
hybridize to the sequence; [0401] (iii) detecting the hybridization
of the probe to cytidine at nucleotide 8443 of the HCV genome.
Oligonucleotide Probes
[0402] Oligonucleotide probes are provided that are capable of
detecting the presence of a 2'-branched pyrimidine
nucleoside-induced mutation of Flaviviridae. The probes are
complementary to sequences of viral nucleic acids that include the
mutation. These probes can be used in processes and kits. The
oligonucleotide probes can detect the nucleotide cytidine at
nucleotide 1214 of the RNA polymerase region of BVDV or at
nucleotide 8443 of the RNA polymerase region of HCV, or other
nucleotides of Flaviviridae that encode the conserved serine of the
domain B of RNA polymerase within a Flaviviridae genome (FIG.
11).
[0403] The oligonucleotide probes are preferably at least 14
nucleotides in length, and in a preferred embodiment, are at least
15, 20, 25 or 30 nucleotides in length. It is generally not
preferred to use a probe that is greater than approximately 25 or
30 nucleotides in length. In one embodiment, the oligonucleotide
probe can be designed to identify the guanine to cytidine base
change at nucleotide 1214 of the RNA polymerase region of a BVDV.
In another embodiment, the oligonucleotide probe can be designed to
identify the guanine to cytidine base change at nucleotide 8443 of
HCV. The oligonucleotide probe can be designed such that the
mutated region is located in the interior section of the hybridized
segment, or alternatively can be on either the 3' or 5' end of the
hybridized segment. It is preferred that the mutated region be
located near the middle of the probe to allow efficient
hybridization.
[0404] Table 2 below provides illustrative embodiments of BVDV
nucleotide sequences that include nucleotide position 1214 of the
RNA polymerase region, alternatively referred to as nucleotide
position 11,136 (see Genebank accession number AJ133739; Vassilev
and Donis (2000) Virus Res 69(2) 95-107). Given these sequences,
one of ordinary skill using standard algorithms can construct
oligonucleotide probes that are complementary or substantially
complementary to the nucleotide sequences below. The rules for
complementary pairing are well known: cytidine ("C") always pairs
with guanine ("G") and thymine ("T") or uracil ("U") always pairs
with adenine ("A"). It is recognized that it is not necessary for
the probe to be 100% complementary to the target nucleic acid
sequence, as long as the probe sufficiently hybridizes and can
recognize the diagnostic nucleotide. A certain degree of base pair
mismatch can generally be tolerated.
TABLE-US-00002 TABLE 2 Nonlimiting examples of nucleic acid
sequences with a single point mutation at nucleotide 1214 (also
referred to as position 11,136: see Genebank accession number
AJ133739; Vassilev and Donis, Virus Res 2000, 69(2), 95-107) of the
RNA polymerase region of BVDV AGG 405 S
AAGTATATATAAGAAATGGGCAGAGAGGG ##STR00024##
GGCCAGCCAGACACAAGTGCTGGCAACAG. 405 T (Seq. ID No. 1)
AAGTATATATAAGAAATGGGCAGAGAGGG ACC . (Seq. ID No. 2)
AGTATATATAAGAAATGGGCAGAGAGGG ACC G. (Seq. ID No. 3)
GTATATATAAGAAATGGGCAGAGAGGG ACC GG. (Seq. ID No. 4)
TATATATAAGAAATGGGCAGAGAGGG ACC GGC. (Seq. ID No. 5)
ATATATAAGAAATGGGCAGAGAGGG ACC GGCC. (Seq. ID No. 6)
TATATAAGAAATGGGCAGAGAGGG ACC GGCCA. (Seq. ID No. 7)
ATATAAGAAATGGGCAGAGAGGG ACC GGCCAG. (Seq. ID No. 8)
TATAAGAAATGGGCAGAGAGGG ACC GGCCAGC. (Seq. ID No. 9)
ATAAGAAATGGGCAGAGAGGG ACC GGCCAGCC. (Seq. ID No. 10)
TAAGAAATGGGCAGAGAGGG ACC GGCCAGCCA. (Seq. ID No. 11)
AAGAAATGGGCAGAGAGGG ACC GGCCAGCCAG. (Seq. ID No. 12)
AGAAATGGGCAGAGAGGG ACC GGCCAGCCAGA. (Seq. ID No. 13)
GAAATGGGCAGAGAGGG ACC GGCCAGCCAGAC. (Seq. ID No. 14)
AAATGGGCAGAGAGGG ACC GGCCAGCCAGACA. (Seq. ID No. 15)
AATGGGCAGAGAGGG ACC GGCCAGCCAGACAC. (Seq. ID No. 16) ATGGGCAGAGAGGG
ACC GGCCAGCCAGACACA. (Seq. ID No. 17) TGGGCAGAGAGGG ACC
GGCCAGCCAGACACAA. (Seq. ID No. 18) GGGCAGAGAGGG ACC
GGCCAGCCAGACACAAG. (Seq. ID No. 19) GGCAGAGAGGG ACC
GGCCAGCCAGACACAAGT. (Seq. ID No. 20) GCAGAGAGGG ACC
GGCCAGCCAGACACAAGTG. (Seq. ID No. 21) CAGAGAGGG ACC
GGCCAGCCAGACACAAGTGC. (Seq. ID No. 22) AGAGAGGG ACC
GGCCAGCCAGACACAAGTGCT. (Seq. ID No. 23) GAGAGGG ACC
GGCCAGCCAGACACAAGTGCTG. (Seq. ID No. 24) AGAGGG ACC
GGCCAGCCAGACACAAGTGCTGG. (Seq. ID No. 25) GAGGG ACC
GGCCAGCCAGACACAAGTGCTGGC. (Seq. ID No. 26) AGGG ACC
GGCCAGCCAGACACAAGTGCTGGCA. (Seq. ID No. 27) GGG ACC
GGCCAGCCAGACACAAGTGCTGGCAA. (Seq. ID No. 28) GG ACC
GGCCAGCCAGACACAAGTGCTGGCAAC. (Seq. ID No. 29) G ACC
GGCCAGCCAGACACAAGTGCTGGCAACA. (Seq. ID No. 30)
GGCCAGCCAGACACAAGTGCTGGCAACAG. (Seq. ID No. 31)
[0405] Therefore, in one embodiment, the oligonucleotide has 1, 2,
3, 4, 5 or 6 mismatches in complementarity to the Flaviviridae
nucleotide sequence.
[0406] Other aspects of the present invention provide a method to
treat a Flaviviridae infection by administering a therapeutically
effective amount of a 2'-branched nucleoside, for example, a
2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC, or its pharmaceutically acceptable
prodrug and/or salt, to a human in need of therapy, in combination
and/or alternation with one or more drugs that directly or
indirectly induce a mutation in a Flaviviridae at a location other
than a mutation of a nucleotide that results in a change from
serine to a threonine in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase
region, and/or one or more drugs that is associated with such
mutation. The codons ACA, ACG or ACU, which also encode Threonine,
can be substituted for the codon ACC (in bold) in Table 2 above to
detect the presence of a Threonine in domain B of the RNA
polymerase region of BVDV.
[0407] Another aspect of the present invention provides a method to
treat and/or to substantially cure a Flaviviridae infection in a
host infected with a Flaviviridae that contains a Serine to
Threonine mutation in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase region
by administering a therapeutically effective amount of interferon.
Therefore, in other embodiments of the present invention, the
codons ACA, ACG or ACU, which also encode Threonine, can be
substituted for the codon ACC (in bold) in Table 2 above, for
example to detect the presence of a Threonine at residue 405 of the
RNA polymerase region of BVDV.
[0408] Table 3 below provides illustrative embodiments of HCV
nucleotide sequences that include nucleotide position 8443 of the
HCV genome (Genebank accession number AJ238799; Lohmann et al.
(1999) Science 285(5424)110-113). Nucleotide position 8443 of the
HCV genome corresponds to nucleotide position 11,136 of the BVDV
genome and represents the conserved Serine residue of the RNA
polymerase of Flaviviridae (Ser.sub.405 of the BVDV genome, which
corresponds to Ser.sub.282 of the HCV genome (see FIG. 11)) that is
mutated due to treatment with .beta.-D-2'-CH.sub.3-riboC. As stated
above, given these sequences, one of ordinary skill using standard
algorithms can construct oligonucleotide probes that are
complementary or substantially complementary to the nucleotide
sequences below.
TABLE-US-00003 TABLE 3 Nonlimiting examples of nucleic acid
sequences encompassing a single point mutation at nucleotide 8443
(Genebank accession number AJ238799; Lohmann et al. (1999) Science
285(5424)110-113) of the RNA polymerase region of HCV. AGC 282 S
AGAACTGCGGCTATCGCCGGTGCCGCGCG ##STR00025##
GGTGTACTGACGACCAGCTGCGGTAATAC. 282 T (Seq. ID No. 32)
AGAACTGCGGCTATCGCCGGTGCCGCGCG ACC . (Seq. ID No. 33)
GAACTGCGGCTATCGCCGGTGCCGCGCG ACC G. (Seq. ID No. 34)
AACTGCGGCTATCGCCGGTGCCGCGCG ACC GG. (Seq. ID No. 35)
ACTGCGGCTATCGCCGGTGCCGCGCG ACC GGT. (Seq. ID No. 36)
CTGCGGCTATCGCCGGTGCCGCGCG ACC GGTG. (Seq. ID No. 37)
TGCGGCTATCGCCGGTGCCGCGCG ACC GGTGT. (Seq. ID No. 38)
GCGGCTATCGCCGGTGCCGCGCG ACC GGTGTA. (Seq. ID No. 39)
CGGCTATCGCCGGTGCCGCGCG ACC GGTGTAC. (Seq. ID No. 40)
GGCTATCGCCGGTGCCGCGCG ACC GGTGTACT. (Seq. ID No. 41)
GCTATCGCCGGTGCCGCGCG ACC GGTGTACTG. (Seq. ID No. 42)
CTATCGCCGGTGCCGCGCG ACC GGTGTACTGA. (Seq. ID No. 43)
TATCGCCGGTGCCGCGCG ACC GGTGTACTGAC. (Seq. ID No. 44)
ATCGCCGGTGCCGCGCG ACC GGTGTACTGACG. (Seq. ID No. 45)
TCGCCGGTGCCGCGCG ACC GGTGTACTGACGA. (Seq. ID No. 46)
CGCCGGTGCCGCGCG ACC GGTGTACTGACGAC. (Seq. ID No. 47) GCCGGTGCCGCGCG
ACC GGTGTACTGACGACC. (Seq. ID No. 48) CCGGTGCCGCGCG ACC
GGTGTACTGACGACCA. (Seq. ID No. 49) CGGTGCCGCGCG ACC
GGTGTACTGACGACCAG. (Seq. ID No. 50) GGTGCCGCGCG ACC
GGTGTACTGACGACCAGC. (Seq. ID No. 51) GTGCCGCGCG ACC
GGTGTACTGACGACCAGCT. (Seq. ID No. 52) TGCCGCGCG ACC
GGTGTACTGACGACCAGCTG. (Seq. ID No. 53) GCCGCGCG ACC
GGTGTACTGACGACCAGCTGC. (Seq. ID No. 54) CCGCGCG ACC
GGTGTACTGACGACCAGCTGCG. (Seq. ID No. 55) CGCGCG ACC
GGTGTACTGACGACCAGCTGCGG. (Seq. ID No. 56) GCGCG ACC
GGTGTACTGACGACCAGCTGCGGT. (Seq. ID No. 57) CGCG ACC
GGTGTACTGACGACCAGCTGCGGTA, (Seq. ID No. 58) GCG ACC
GGTGTACTGACGACCAGCTGCGGTAA. (Seq. ID No. 59) CG ACC
GGTGTACTGACGACCAGCTGCGGTAAT. (Seq. ID No. 60) G ACC
GGTGTACTGACGACCAGCTGCGGTAATA. (Seq. ID No. 61) ACC
GGTGTACTGACGACCAGCTGCGGTAATAC. (Seq. ID No. 62)
[0409] Therefore, in one embodiment, the oligonucleotide has 1, 2,
3, 4, 5 or 6 mismatches in complementarity to the Flaviviridae
nucleotide sequence.
[0410] Other aspects of the present invention provide a method to
treat a Flaviviridae infection by administering a therapeutically
effective amount of a 2'-branched nucleoside, for example, a
2'-branched pyrimidine nucleoside, for example
.beta.-D-2'-CH.sub.3-riboC, or its pharmaceutically acceptable
prodrug and/or salt, to a human in need of therapy, in combination
and/or alternation with one or more drugs that directly or
indirectly induce a mutation in a Flaviviridae at a location other
than a mutation of a nucleotide that results in a change from
serine to a threonine in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase
region, and/or one or more drugs that is associated with such
mutation. As before, the codons ACA, ACG or ACU, which also encode
Threonine, can be substituted for the codon ACC (in bold) in Table
3, for example to detect the presence of a Threonine in domain B of
the RNA polymerase region of HCV.
[0411] Another aspect of the present invention provides a method to
treat and/or to substantially cure a Flaviviridae infection in a
host infected with a Flaviviridae that contains a Serine to
Threonine mutation in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase region
by administering a therapeutically effective amount of interferon.
The codons ACA, ACG or ACU, which also encode Threonine, can be
substituted for the codon ACC (in bold) in Table 3, as above, for
example to detect the presence of a Threonine at residue 282 of the
RNA polymerase region of HCV.
[0412] In another embodiment, the invention provides an
oligonucleotide primer for amplifying a Flaviviridae nucleic acid
sequence. In one embodiment, the oligonucleotide is at least 14
nucleotides in length and hybridizes under sequence-specific,
stringent hybridization conditions to a nucleotide sequence that
contains the mutation.
[0413] Oligonucleotide sequences used as the hybridizing region of
a primer can also be used as the hybridizing region of a probe.
Suitability of a primer sequence for use as a probe depends on the
hybridization characteristics of the primer. Similarly, an
oligonucleotide used as a probe can be used as a primer.
[0414] It will be apparent to those of skill in the art that,
provided with these embodiments, that specific primers and probes
can be prepared by, for example, the addition of nucleotides to
either the 5'- or 3'-ends, which nucleotides are complementary to
the target sequence or are not complementary to the target
sequence. So long as primer compositions serve as a point of
initiation for extension on the target sequences, and so long as
the primers and probes comprise at least 14 consecutive nucleotides
contained within those exemplified embodiments, such compositions
are within the scope of the invention.
[0415] The probe(s) herein can be selected by the following
non-limiting criteria, which are not considered exclusive or
determinative: (1) the probes are selected from the region of the
Flaviviridae genome that contains the mutation; (2) the probes lack
homology with any sequences of viral genomes that would be expected
to compromise the test; and (3) the probes lack secondary structure
formation in the amplified nucleic acid that, for example, can
interfere with nucleic acid extension by an amplification enzyme
such as E. coli DNA polymerase, such as the portion of the DNA
polymerase referred to as the Klenow fragment. Prevention of
secondary structure formation can be accomplished by employing up
to about 15% by weight, preferably 5-10% by weight, dimethyl
sulfoxide (DMSO) in the amplification medium and/or increasing the
amplification temperatures to 30.degree.-40.degree. C.
[0416] Further, the probe can have an approximate 50% content of
guanine and cytidine, and may not contain multiple consecutive
adenine and thymine residues at the 3'-end of the primer which can
result in less stable hybrids.
[0417] The probes of the invention can be about 10 to 30
nucleotides long, preferably at least 14, 15, 20, 25, or 30
nucleotides in length. The nucleotides as used in the present
invention can be ribonucleotides, deoxyribonucleotides and modified
nucleotides such as inosine or nucleotides containing modified
groups that do not essentially alter their hybridization
characteristics. Probe sequences are represented throughout the
specification as single stranded DNA oligonucleotides from the 5'-
to the 3'-end. Any of the probes can be used as such, or in their
complementary form, or in their RNA form (wherein T is replaced by
U).
[0418] The probes according to the invention can be prepared by
cloning of recombinant plasmids containing inserts including the
corresponding nucleotide sequences, optionally by cleaving the
latter from the cloned plasmids through the use of adequate
nucleases and recovering them, e.g. by fractionation according to
molecular weight. The probes according to the present invention can
also be synthesized chemically, for instance, by the conventional
phosphotriester or phosphodiester methods or automated embodiments
thereof. In one such automated embodiment diethylphosphoramidites
are used as starting materials and can be synthesized as described
by Beaucage et al., Tetrahedron Letters (1981), 22:1859-1862. One
method for synthesizing oligonucleotides on a modified solid
support is described in U.S. Pat. No. 4,458,066. It is also
possible to use a primer which has been isolated from a biological
source (such as a restriction endonuclease digest).
[0419] The oligonucleotides used as primers or probes can also
comprise nucleotide analogues such as phosphorothiates (Matsukura
et al., 1 967), alkylphosphorothiates (Miller et al., 1979),
peptide nucleic acids (Nielsen et al., 1991; Nielsen et al., 1993),
morpholino nucleic acids, locked nucleic acids, pseudocyclic
oligonucleobases, 2'-O-4'-C-ethylene bridged nucleic acids or can
contain intercalating agents (Asseline et al., 1984).
[0420] For designing probes with desired characteristics, the
following useful guidelines known to the person skilled in the art
can be applied. Because the extent and specificity of hybridization
reactions are affected by a number of factors, manipulation of one
or more of those factors will determine the exact sensitivity and
specificity of a particular probe, whether perfectly complementary
to its target or not. The importance and effect of various assay
conditions, explained further herein, are known to those skilled in
the art.
[0421] The stability of the probe to target nucleic acid hybrid
should be chosen to be compatible with the assay conditions. This
can be accomplished by avoiding long AT-rich sequences, by
terminating the hybrids with GC base pairs, and by designing the
probe with an appropriate T.sub.m. The beginning and end of the
probe should be chosen so that the length and % GC result in a
T.sub.m of about 2-10.degree. C. higher than the temperature at
which the final assay will be performed. The base composition of
the probe is significant because G-C base pairs exhibit greater
thermal stability due to additional hydrogen bonding as compared to
A-T base pairs. Thus, hybridization involving complementary nucleic
acids of higher G-C content will be stable at higher temperatures.
Conditions such as ionic strength and incubation temperature under
which the probe will be used should also be taken into account when
designing the probe. It is known that hybridization can increase as
the ionic strength of the reaction mixture increases, and that the
thermal stability of the hybrids can increase with increasing ionic
strength. On the other hand, chemical reagents, such as formamide,
urea, DIVISO and alcohols, which disrupt hydrogen bonds, can
increase the stringency of hybridization. Destabilization of
hydrogen bonds by such reagents can greatly reduce the T.sub.m. In
general, optimal hybridization for synthetic oligonucleotide probes
of about 10-50 bases in length occurs approximately 5.degree. C.
below the melting temperature for a given duplex. Incubation at
temperatures below the optimum can allow mismatched base sequences
to hybridize and can therefore result in reduced specificity. It is
desirable to have probes that hybridize only under conditions of
high stringency, in which only highly complementary nucleic acid
hybrids will form and/or hybrids without a sufficient degree of
complementarity will not form. Accordingly, the stringency of the
assay conditions determines the degree of complementarity needed
between two nucleic acid strands that form the hybrid. The degree
of stringency is chosen, for example, to maximize the difference in
stability between the hybrid formed with the target and the
non-target nucleic acid. In the present case, single base pair
changes need to be detected, which requires conditions of very high
stringency.
[0422] The length of the target nucleic acid sequence and the
length of the probe sequence should also be considered. In some
cases, there can be several sequences from a particular region,
varying in location and length, which will yield probes with the
desired hybridization characteristics. In other cases, one sequence
can be significantly better than another which differs merely by a
single base.
[0423] While it is possible for nucleic acids that are not
perfectly complementary to hybridize, the longest stretch of
perfectly complementary base sequences normally will determine
hybrid stability. While oligonucleotide probes of different lengths
and base compositions can be used, preferably oligonucleotide
probes of this invention are between about 14 and 30 bases in
length and optionally further have a sufficient sequence length
that is perfectly complementary to the target nucleic acid
sequence.
[0424] Regions in the target DNA or RNA that are known to form
strong internal structures inhibitory to hybridization are less
preferred. In one embodiment, probes with extensive
self-complementarity are avoided. As explained above, hybridization
is the association of two single strands of complementary nucleic
acids to form a hydrogen bonded double strand. It is implicit that
if one of the two strands is wholly or partially involved in a
hybrid that it will be less able to participate in formation of a
new hybrid. Intramolecular and intermolecular hybrids may be formed
within the molecules of a single probe if there is sufficient
self-complementarity. Such structures can be avoided through
careful probe design. By designing a probe so that a substantial
portion of the sequence of interest is single stranded, the rate
and extent of hybridization can be greatly increased. Computer
programs are available to search for this type of interaction.
However, in certain instances, it may not be possible to avoid this
type of interaction.
[0425] Specific primers and sequence specific oligonucleotide
probes can be used in a polymerase chain reaction that enables
amplification and detection of the viral genomic sequences.
[0426] One aspect of the invention relates to specific
oligonucleotide primers. The invention provides compositions
comprising an oligonucleotide primer for amplifying an Flaviviridae
nucleic acid wherein said primer is suitable for amplifying a
nucleic acid subsequence from a Flaviviridae mutation. For example,
the primer can be capable of detecting a G to C nucleotide change
at nucleotide 1214 of the RNA polymerase region of BVDV. In another
example, the primer can be capable of detecting a G to C nucleotide
change at nucleotide 8443 of HCV genome.
[0427] Amplification and Detection of a Flaviviridae Mutation
[0428] Another aspect of the invention relates to methods for
amplifying and detecting the presence of a Flaviviridae
mutation.
[0429] DNA or RNA can be extracted from a bodily sample, such as
blood or tissue material, such as liver, by a variety of techniques
known in the art. An unpure sample, for example samples taken from
plasma, serum or blood, can be treated with an amount of a reagent
effective to open the cells, fluids, tissues, viral capsids or
animal cell membranes of the sample, and to expose and/or separate
the strand(s) of the nucleic acid(s), before amplification. This
lysing and nucleic acid denaturing step to expose and separate the
strands will allow amplification to occur much more readily.
[0430] In one embodiment, the invention provides a process to
detect a mutation wherein a sample suspected of containing
Flaviviridae nucleic acid sequence(s) is amplified; the amplified
sequence is contacted with an oligonucleotide probe having a
sequence complementary to the nucleotide sequence of the mutation;
and the sequence is detected by hybridizing the probe to the
sequence. In one embodiment, amplification is achieved by the use
of the polymerase chain reaction method. In another embodiment, the
mutation is a nucleotide change from G to C at position 1214 of the
RNA polymerase region of the BVDV genome. In yet another
embodiment, the mutation is a nucleotide change from G to C at
position 8443 of the HCY genome.
[0431] Amplification
[0432] The amplification method used can be the polymerase chain
reaction (PCR; Saiki et al., 1988), ligase chain reaction (LCR;
Landgren et al., 1988; Wu &Wallace, 1989; Barany, 1991),
nucleic acid sequence-based amplification (NASBA; Guatelli et al.,
1990; Compton, 1991), transcription-based amplification system
(TAS; Kwoh et al., 1989), strand displacement amplification (SDA;
Duck, 1990;Walker et al., 1992), amplification by means of Q9
replicase (Lizardi et al., 1988; Lomeli et al., 1989), or any other
suitable method to amplify nucleic acid molecules known in the
art.
[0433] Polymerase Chain Reaction
[0434] The PCR process for amplification is generally well known in
the art (See, for example, U.S. Pat. Nos. 4,683,202 and 4,683,194).
The amplification process can involve an enzymatic chain reaction
for preparing, in exponential quantities relative to the number of
reaction steps involved, a specific nucleic acid sequence, given
that the ends of the required sequence are known in sufficient
detail that oligonucleotide primers can be synthesized that will
hybridize to them, and that a small amount of the sequence is
available to initiate the chain reaction. One primer is
complementary to the negative (-) strand and the other is
complementary to the positive (+) strand. Annealing the primers to
denatured nucleic acid followed by extension with an enzyme such as
the large fragment of DNA Polymerase I (Klenow) and nucleotides
results in newly synthesized (+) and (-) strands containing the
target sequence. Because these newly synthesized sequences are also
templates for the primers, repeated cycles of denaturing, primer
annealing and extension results in exponential accumulation of the
region defined by the primer. The product of the chain reaction
will be a discrete nucleic acid duplex with termini corresponding
to the ends of the specific primers employed.
[0435] Any specific nucleic acid sequence can be produced by the
present process. It is only necessary that a sufficient number of
bases at both ends of the sequence be known in sufficient detail so
that two oligonucleotide primers can be prepared which will
hybridize to different strands of the desired sequence and at
relative positions along the sequence such that an extension
product synthesized from one primer, when it is separated from its
template (compliment), can serve as a template for extension of the
other primer into a nucleic acid of defined length. The greater the
knowledge about the bases at both ends of the sequence, the greater
can be the specificity of the primers for the target nuclei acid
sequence, and thus the greater the efficiency of the process. It
will be understood that the word primer as used hereinafter can
refer to more than one primer, particularly in the case where there
is some ambiguity in the information regarding the terminal
sequence(s) of the fragment to be amplified. For instance, in the
case where a nucleic acid sequence is inferred from protein
sequence information a collection of primers containing sequences
representing all possible codon variations based on degeneracy of
the genetic code can be used for each strand. One primer from this
collection can be substantially conserved with the end of the
desired sequence to be amplified.
[0436] A specific nucleic acid sequence is produced by using the
diagnostic marker nucleic acid containing that sequence as a
template. If the target nucleic acid sequence of the sample
contains two strands, it is necessary to separate the strands of
the nucleic acid before they can be used as the template, either as
a separate step or simultaneously with the synthesis of the primer
extension products. This strand separation can be accomplished
using any suitable denaturing techniques, including physical,
chemical or enzymatic means, wherein the word "denaturing", as used
herein, includes all such means. One physical method of separating
the strands of the nucleic acid involves heating the nucleic acid
unit until it is denatured. Typical heat denaturation can involve
temperatures ranging from about 80-150.degree. C. for times ranging
from about 1 to 10 minutes. Strand separation can also be induced
by an enzyme from the class of enzymes known as helicases or the
enzyme RecA, which has helicase activity, and in the presence of
riboATP is known to denature DNA. Reaction conditions suitable for
separating the strands of nucleic acids with helicases are
described by Kuhn Hoffmann-Berling, CSH-Quantitative Biology, 43:63
(1978), and techniques for using RecA are reviewed in C. Radding,
Ann. Rev. Genetics, 16:405-37 (1982).
[0437] If the original nucleic acid containing the sequence to be
amplified is single stranded, its compliment is synthesized by
adding one or two oligonucleotide primers to it. If an appropriate
single primer is added, a primer extension product is synthesized
in the presence of the primer, an agent for polymerization, and the
four nucleoside triphosphates described below. The product will be
partially complementary to the single-stranded nucleic acid and
will hybridize with the nucleic acid strand to form a duplex of
unequal length strands that can then be separated into single
strands as described above to produce two single separated
complementary strands. Alternatively, two appropriate primers can
be added to the single-stranded nucleic acid and the reaction
carried out.
[0438] If the original nucleic acid constitutes the sequence to be
amplified, the primer extension product(s) produced will be
completely or substantially completely complementary to the strands
of the original nucleic acid and will hybridize with them to form a
duplex of equal length strands to be separated into single-stranded
molecules.
[0439] When the complementary strands of the nucleic acid or acids
are separated, whether the nucleic acid was originally double or
single stranded, the strands are ready to be used as a template for
the synthesis of additional nucleic acid strands. This synthesis is
performed under conditions allowing hybridization of primers to
templates to occur. Generally it occurs in a buffered aqueous
solution, to obtain, for example, a pH range of 7-9. A molar excess
(for genomic nucleic acid, usually about 10.sup.8: 1 primer:
template) of the two oligonucleotide primers can be added to the
buffer containing the separated template strands. It is understood,
however, that the amount of complementary strand cannot be known if
the process is used for diagnostic applications, so that the amount
of primer relative to the amount of complementary strand cannot be
determined with certainty. As a practical matter, however, the
amount of primer added will generally be in molar excess over the
amount of complementary strand (template) when the sequence to be
amplified is contained in a mixture of complicated long-chain
nucleic acid strands. A large molar excess is preferred to improve
the efficiency of the process.
[0440] The deoxyribonucleoside triphosphates dATP, dCTP, dGTP and
TTP are also added to the synthesis mixture, either separately or
together with the primers, in adequate amounts and the resulting
solution is heated to about 90-100.degree. C. for from about 1 to
10 minutes, for example from about 1 to 4 minutes. After this
heating period the solution is allowed to cool to room temperature,
which is preferable for the primer hybridization. To the cooled
mixture is added an appropriate agent for effecting the primer
extension reaction (called herein "agent for polymerization"), and
the reaction is allowed to occur under conditions known in the art.
The agent for polymerization can also be added together with the
other reagents if it is heat stable. This synthesis reaction can
occur from room temperature to a temperature above which the agent
for polymerization no longer functions. Thus, for example, if DNA
polymerase is used as the agent, the temperature is generally no
greater than about 40.degree. C. Most conveniently the reaction
occurs at room temperature.
[0441] The agent for polymerization can be any compound or system
that can function to accomplish the synthesis of primer extension
products, including enzymes. Suitable enzymes for this purpose
include, for example, E. coli DNA polymerase I, Klenow fragment of
E. coli DNA polymerase I, T4 DNA polymerase, other available DNA
polymerases, polymerase muteins, reverse transcriptase(s), and
other enzymes, including heat-stable enzymes (i.e., those enzymes
that perform primer extension after being subjected to temperatures
sufficiently elevated to cause denaturation), which can facilitate
combination of the nucleosides in the proper manner to form the
primer extension products that are complementary to each nucleic
acid strand. Generally, the synthesis will be initiated at the
3'-end of each primer and proceed in the 5' direction along the
template strand until synthesis terminates, producing molecules of
different lengths. Alternatively, agents for polymerization that
initiate synthesis at the 5'-end and proceed toward the 3'-end,
using the same process as described above, can be used.
[0442] The newly synthesized strand and its complementary nucleic
acid strand will form a double-stranded molecule under the
hybridizing conditions described above if the target sequence is
present, and this hybrid is used in the succeeding steps of the
process.
[0443] In the next step, the sample treated under hybridizing
conditions is subjected to denaturing conditions using any of the
procedures described above to provide single-stranded molecules if
the target sequence is present.
[0444] New nucleic acid is synthesized on the single-stranded
molecules. Additional agents for polymerization, nucleosides and
primers can be added if necessary for the reaction to proceed under
the conditions prescribed above. Again, the synthesis will be
initiated at one end of each of the oligonucleotide primers and
will proceed along the single strands of the template to produce
additional nucleic acid. After this step, half of the extension
product will consist of the specific nucleic acid sequence bounded
by the two primers.
[0445] The steps of denaturing and extension product synthesis can
be repeated as often as needed to amplify the target nucleic acid
sequence to the extent necessary for detection. As will be
described in further detail below, the amount of the specific
nucleic acid sequence produced will accumulate in an exponential
fashion.
[0446] When it is desired to produce more than one specific nucleic
acid sequence from the first nucleic acid or mixture of nucleic
acids, an appropriate number of different oligonucleotide primers
are utilized. For example, if two different specific nucleic acid
sequences are to be produced, four primers are utilized. Two of the
primers are specific for one of the specific nucleic acid sequences
and the other two primers are specific for the second specific
nucleic acid sequence. In this manner, each of the two different
specific sequences can be produced exponentially by the present
process.
[0447] The present invention can be performed in a step-wise
fashion where after each step new reagents are added, or
simultaneously or in a single-step manner, where all reagents are
added at the initial step, or partially step-wise and partially
simultaneous, where fresh reagent is added after a given number of
steps. If a method of denaturation, for example heat, is employed,
which can inactivate the agent for polymerization, as in the case
of a heat-labile enzyme, then it is necessary to replenish the
agent after every strand separation step. The simultaneous method
can be utilized when an enzymatic means is used for the strand
separation step. In the simultaneous procedure, the reaction
mixture can contain, in addition to the nucleic acid strand(s) with
the desired sequence, the strand-separating enzyme (e.g.,
helicase), an appropriate energy source for the strand-separating
enzyme (e.g. rATP), the four nucleoside triphosphates, the
oligonucleotide primers in molar excess, and the agent for
polymerization (e.g., Klenow fragment of E. coli DNA polymerase
I).
[0448] If heat is used for denaturation in a simultaneous process,
a heat-stable agent such as a thermostable polymerase can be
employed that will operate at an elevated temperature, for example
from about 50-105.degree. C. depending on the agent, at which
temperature the nucleic acid will consist of single and double
strands in equilibrium. For smaller lengths of nucleic acid, lower
temperatures of about 40-50.degree. C. can be employed. The upper
temperature range will depend on the temperature at which the
enzyme will degrade or the temperature above which an insufficient
level of primer hybridization will occur. Such a heat-stable enzyme
is described, e.g., by A. S. Kaledin et al., Biokhimiya, 45,
644-651 (1980). For this constant temperature reaction to succeed,
the primers have their 3' ends within 6-8 base pairs of each other.
Each step of the process will occur sequentially notwithstanding
the initial presence of all the reagents. Additional materials can
be added as necessary. After the appropriate length of time has
passed to produce the desired amount of the specific nucleic acid
sequence, the reaction can be halted by inactivating the enzymes in
any known manner or by separating the components of the
reaction.
[0449] The amplification can also be carried out using a
temperature-cycling reaction wherein the temperature is increased
incrementally to allow for extension, annealing and denaturation
using a heat-stable enzyme.
[0450] The process of the present invention can be conducted
continuously. In one embodiment of an automated process, the
reaction can be cycled through a denaturing region, a reagent
addition region, and a reaction region. In another embodiment, the
enzyme used for the synthesis of primer extension products can be
immobilized in a column. Other reaction components can be
continuously circulated by a pump through the column and a heating
coil in series, thus the nucleic acids produced can be repeatedly
denatured without inactivating the enzyme.
[0451] Flaviviridae genotyping using PCR techniques is commonly
known in the art. Further, after PCR has been performed on samples
suspected of containing a Flaviviridae, the Flaviviridae genome can
be sequenced.
[0452] Detection of Hybridization of the Probe and Target
Sequence
[0453] Suitable assay formats for detecting hybrids formed between
probes and target nucleic acid sequences in a sample are known in
the art (Sambrook et al., 1985). Detection of hybridization can be
accomplished whether or not the nucleic acid has been
amplified.
[0454] One method of detection is through the use of a labeled
probe capable of hybridizing with the unamplified or amplified
nucleic acid sequence and determining if the probe has hybridized.
Such probe necessarily contains the nucleotide that is suspected of
being mutated, such as 1214 of the RNA polymerase of BVDV or
nucleotide 8443 of the HCV genome.
[0455] Oligonucleotides can be labeled by incorporating a label
detectable by spectroscopic, photochemical, biochemical,
immunochemical, or chemical means. Useful labels include .sup.32P,
fluorescent dyes, electron-dense reagents, enzymes (as commonly
used in ELISAs), biotin, or haptens and proteins for which antisera
or monoclonal antibodies are available.
[0456] The nucleic acid can be detected by analyzing it by Northern
or Southern blots with or without radioactive probes. In one
embodiment, a small sample of DNA from, e.g., peripheral blood
suspected of containing Flaviviridae, is analyzed via a Southern
blot technique using oligonucleotide probes to detect the specific
nucleic acid viral marker. In another embodiment, a small sample of
DNA from, e.g., peripheral blood suspected of containing
Flaviviridae, is first amplified and then analyzed via a Southern
blot technique using oligonucleotide probes to detect the specific
nucleic acid viral marker.
[0457] Another method involves the oligomer restriction technique
(such as described in U.S. Pat. No. 4,683,194). In this procedure,
an amplified nucleic acid is denatured and hybridized in solution
to a labeled oligonucleotide probe which hybridizes specifically to
the target sequence (i.e., spans the particular conserved region
contained by the primers) and spans at least one restriction site
of interest. The duplex formed between target and probe will
reconstitute the restriction site, and when cleaved with
restriction enzyme, such as, e.g., BgII, PvuII, or HifI, releases a
labeled probe fragment which can be resolved from the full-length
probe by gel electrophoresis. The resulting gel is then
autoradiographed. Analysis of the amplified product by this method
can be rapid, i.e., within a few hours.
[0458] Another method that can be used to analyze an amplified
product is the dot blot method. In a dot-blot method, amplified
target DNA is immobilized on a solid support, such as a nylon
membrane. The membrane-target complex is incubated with labeled
probe under suitable hybridization conditions, unhybridized probe
is removed by washing under suitably stringent conditions, and the
membrane is monitored for the presence of bound probe.
[0459] An alternate format is a "reverse" dot-blot format, in which
an amplified target DNA is labeled and the probes are immobilized
on a solid support, such as a nylon membrane (see Saiki et al.,
1989, Proc. Natl. Acad. Sci. USA 86:6230, and PCT Patent
Publication No. 89/11548). The target DNA is typically labeled
during amplification by the incorporation of one or more labeled
primers. One or both of the primers can be labeled. The
membrane-probe complex is incubated with the labeled amplified
target DNA under suitable hybridization conditions, unhybridized
target DNA is removed by washing under suitably stringent
conditions, and the filter is then monitored for the presence of
bound target DNA.
[0460] Alternatively, the reverse dot-blot assay can be carried out
using a solid support having a plurality of probe hybridization
sites or wells. For example, a microwell plate is particularly
useful in large scale clinical applications of the present methods.
Probes can be immobilized to a microwell plate either by passive
binding or through a protein intermediate, such as bovine serum
albumin (BSA), which adheres to microwell plates. Reverse dot-blot
methods carried out in a microwell plate are described in U.S. Pat.
No. 5,232,829, and Loeffelholz et al, 1992, J. Clin. Microbiol.
30(11):2847-2851. In another embodiment of the invention, a reverse
dot-blot assay is carried out using microwell plates, and the
primers are labeled with biotin, as described in Levenson and
Chang, 1989, in PCR Protocols: A Guide to Methods and Applications,
(Innis et al., eds., Academic Press. San Diego) pages 99-112. The
probes are conjugated with BSA (see Tung et al., 1991, Bioconjugate
Chem. 2:464-465, incorporated herein by reference) and immobilized
on a microwell plate. Following amplification using the labeled
primers and hybridization with the immobilized probes, the
amplified nucleic acid is detected by first binding the biotin to
avidin-horseradish peroxidase (A-HRP) or streptavidin-horseradish
peroxidase (SAHRP), which is then detected by carrying out a
reaction in which the HRP catalyzes a color change of a
chromogen.
[0461] In an alternative method of immobilizing hybridization
duplexes for detection, BSA-conjugated probes are bound to magnetic
microparticles. The bound probes are hybridized in solution to
labeled amplification product. Following hybridization,
probe-target duplexes are removed from the solution magnetically,
and the magnetically immobilized hybridization duplexes are then
detected.
[0462] Another method of detection is referred to as a 5'-nuclease
assay in which the labeled detection probes are added during the
PCR amplification process. The probes are modified so as to prevent
them from acting as primers for DNA synthesis. Any probe which
hybridizes to target DNA during each synthesis step, i.e., during
primer extension, is degraded by the 5' to 3' exonuclease activity
of the DNA polymerase, e.g., Taq DNA polymerase. The degradation
product from the probe is then detected. Thus, the presence of
probe breakdown product indicates both that hybridization between
probe and target DNA occurred and that the amplification reaction
occurred. See also for example, U.S. Pat. No. 5,210,015.
[0463] The assay formats described above typically utilize labeled
oligonucleotides to facilitate detection of the hybrid duplexes.
Oligonucleotides can be labeled by any of the previously mentioned
techniques, such as incorporating a label detectable by
spectroscopic, photochemical, biochemical, immunochemical, or
chemical means. Useful labels include .sup.32P, fluorescent dyes,
electron-dense reagents, enzymes (as commonly used in ELISAS),
biotin, or haptens and proteins for which antisera or monoclonal
antibodies are available.
[0464] An alternative method for detecting the amplification of a
Flaviviridae nucleic acid is by monitoring the increase in the
total amount of double-stranded DNA in the reaction mixture (as
described in Higuchi et al., 1992, Bio/Technology 10:413-417;
Higuchi et al., 1993, Bio/Technology 11:1026-1030; and European
Patent Publication Nos. 487,218 and 512,334). The detection of
double-stranded target DNA relies on the increased fluorescence
that ethidium bromide (EtBr) and other DNA binding labels exhibit
when bound to double-stranded DNA. The increase of double-stranded
DNA resulting from the synthesis of target sequences results in a
detectable increase in fluorescence.
[0465] Yet another method useful for detecting Flaviviridae
mutations is through reverse hybridization assays. This is
especially useful if a multitude of probes are involved. In one
embodiment the selected set of probes are immobilized to a solid
support in known distinct locations (dots, lines or other figures).
In another embodiment the selected set of probes can be immobilized
to a membrane strip in a line fashion. Said probes can be
immobilized individually or as mixtures to delineated locations on
the solid support. In a specific embodiment, a line probe assay can
be used to screen for Flaviviridae genotypes containing the
mutation of the present invention. The line probe assay involves
multiple probes that are immobilized in parallel lines on a
membrane, then a reverse hybridization of amplified nucleic acid
fragments is performed. The hybrid can then be detected via a
biotin-streptavidin coupling with a non-radioactive color
developing system. See, for example, WO 97/40193.
[0466] Flaviviridae genotyping techniques can also be used to
analyze the presence of Flaviviridae mutations. For example,
sequence based phylogenetic analysis, differential hybridization,
PCR or fragment length polymorphism can be used.
[0467] Detection of Flaviviridae Protein/Peptide Markers
[0468] In another embodiment, the invention provides a process for
detecting viral markers diagnostic for long term 2'-branched
nucleoside therapy failure for Flaviviridae infection wherein a
sample containing Flaviviridae protein, peptides, or peptide
fragments is analyzed for such viral markers. The proteins,
peptides, or peptide fragments correlated with therapy failure can
be detected by any generally applicable protein detection
technology known in the art, including western blot, two
dimensional gel electrophoresis, enzyme linked immunosorbent assays
(ELISA), enhanced chemiluminescence (ECL), immunohistochemistry,
ELI-Spot assays, peptide sequencing, or antibody based protein
array technology. For example, protein expression of Flaviviridae
viral markers diagnostic for 2'-branched nucleoside treatment can
be analyzed with classical immunohistological methods. In these,
the specific recognition is provided by the primary antibody
(polyclonal or monoclonal) to the specific viral marker, but the
secondary detection system can utilize fluorescent, enzyme, or
other conjugated secondary antibodies. As a result, an
immunohistological staining of the Flaviviridae infected tissue
section for pathological examination is obtained.
[0469] Another method for detecting proteins, peptides, or peptide
fragments that are diagnostic for long term response of
Flaviviridae carriers to 2'-branched nucleoside therapy is the
western blot. In brief, a sample containing Flaviviridae protein,
peptide, or peptide fragments is separated via means of an
electrophoretic gel. The separated proteins are then transferred to
a medium such as nitrocellulose. Antibodies having a detectable
label such as streptavidin-alkaline phosphatase reactive to
specific Flaviviridae amino acid sequences correlated to
2'-branched nucleoside failure are then contacted onto the
nitrocellulose medium containing the Flaviviridae amino acid
sequences. Reactive antibodies will bind with the corresponding
Flaviviridae amino acid sequence, and can be detected using a
reagent such as nitoblue tetrazolium and 5-bromo-4-chloro-3-indlyl
phosphate (BCIP). See, for example, Jalkanen, M., et al., J. Cell.
Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell. Biol.
105:3087-3096 (1987).
[0470] Alternatively, reactive antibodies present in the sera of
Flaviviridae carriers can be used to detect the presence of
Flaviviridae viral markers that are diagnostic of 2'-branched
nucleoside treatment. Any known antibody assay technique known by
those skilled in the art, including enzyme immunoassay (EIA), can
be used. For example, in one embodiment a sample from an
Flaviviridae carrier containing Flaviviridae specific antibodies is
contacted with a solid support array containing specific
Flaviviridae peptides correlated with 2'-branched nucleoside
therapy success and/or failure. The reactive antibodies are then
detected using rabbit anti-human IgG antibodies labeled with
streptavidin-alkaline phosphatase and a reagent containing exposed
to nitoblue tetrazolium and 5-bromo-4-chloro-3-indlyl
phosphate.
[0471] Another method for detecting proteins, peptides, or peptide
fragments that are diagnostic for long term response of
Flaviviridae carriers to 2'-branched nucleoside therapy is by
sequencing the protein, peptide, or peptide fragment using
techniques known to one of ordinary skill in the art (see, for
example, Matsudaira, P., J Biol Chem 262: 10035-10038, (1987);
Salinovich, O. and Montelano, R., Anal. Biochem. 156: 341, (1986);
Tarr, G. E.: Manual Edman Sequencing System. In: Shively, J. E.,
(ed.) Methods of Protein Microcharacterization. The Humana Press
Inc., Clifton, N.J., 1986, pp. 155-194; and Fernandez, J., Andrews,
L. and Mische, S., Anal. Biochem. 218: 112-117, (1994)). For
example, one could use the Edman technique to determine the amino
acid sequence of the peptide. In brief, the Edman chemistry removes
amino acid residues from the N-terminus of a protein/peptide, one
at a time in sequence. Each cycle of Edman chemistry, needed for
the removal of each amino acid residue, consists of three steps: a
coupling with phenyl isothiocyanate (PITC) under mildly alkaline
conditions to form a phenylthiocarbamyl (PTC)-peptide; cleavage to
release the first residue as its anilinothiazolinone (ATZ)-amino
acid derivative; conversion of the ATZ derivative to a more stable
phenylthiohydantoin (PTH)-amino acid derivative. The PTH-amino acid
residue, removed in each cycle of Edman degradation, is identified
by small or micro bore RP-HPLC. A full description of the process
and possible pitfalls is given by Tarr, G. E.: Manual Edman
Sequencing System. In: Shively, J. E., (ed.) Methods of Protein
Microcharacterization. The Humana Press Inc., Clifton, N.J., 1986,
pp. 155-194. Alternatively, if a sample yields no N-terminal
sequence, the N-terminal residue is blocked, degraded during
preparative procedures, or for steric reasons unavailable to the
Edman chemistry reagents, then the sample can be subjected to
controlled specific proteolysis, where the peptides are
fractionated and then analyzed. This fractionation approach is
described by Fernandez, J., Andrews, L. and Mische, S.: An improved
procedure for enzymatic digestion of polyvinylidene
difluoride-bound proteins for internal sequence analysis. Anal.
Biochem. 218: 112-117, 1994.
[0472] Arrays
[0473] Another aspect of the present invention provides the use of
DNA, RNA or peptide arrays to detect Flaviviridae nucleic acid
viral markers. Such arrays include DNA macroarrays, DNA
microarrays, and DNA microchips. DNA arrays, for example, have been
described in U.S. Pat. No. 5,837,832, U.S. Pat. No. 5,807,522, U.S.
Pat. No. 6,007,987, U.S. Pat. No. 6,110,426, WO 99/05324, 99/05591,
WO 00/58516, WO 95/11995, WO 95/35505A1, WO 99/42813, JP10503841T2,
GR3030430T3, ES2134481T3, EP804731B1, DE69509925C0, CA2192095AA,
AU2862995A1, AU709276B2, AT180570, EP 1066506, and AU 2780499. Such
arrays can be incorporated into computerized methods for analyzing
hybridization results when the arrays are contacted with prepared
sample nucleotides, for example, as described in PCT Publication WO
99/05574, and U.S. Pat. Nos. 5,754,524; 6,228,575; 5,593,839; and
5,856,101. Methods for screening for disease markers are also known
to the art, for example, as described in U.S. Pat. Nos. 6,228,586;
6,160,104; 6,083,698; 6,268,398; 6,228,578; and 6,265,174. Further
descriptions of DNA array methods can, for example be found in:
Shoemaker D. D. et al., Nature 409(6822):922-927 (2001); Kane M.
D., et al., Nucleic Acids Res 28(22):4552-7 (2000); Taton T A, et
al., Science. 289(5485): 1757-60 (2000); Jorg Reichert et al.,
Anal. Chem., 72(24):6025-6029 (2000); Reinke V, Mol Cell
6(3):605-16 (2000); Marx J. Science 289:1670-1672 (2000); Lockhart
D. J. et al., Nature 405(6788):827-836 (2000); Cortese J. D., The
Scientist 14[17]:25 (2000); Cortese J. D., The Scientist 14[11]:26
(2000); Fritz J. et al., Science. 288(5464):316-8 (2000); Mark
Schena (Ed.), Microarray Biochip Technology, Eaton Publishing
Company, Distributed by TeleChem/arrayit.com; Scherf U., et al.,
Nat. Genet. 24(3):236-44 (2000); Ross D. T. et al., Nat. Genet.
24(3):227-35 (2000); Walt D. R., Science 287: 451-452 (2000);
Afshari C. A. et al., Cancer Res 59(19):4759-60 (1999); Gwynne P.
and Page G., Science, 1999 Aug. 6. (special advertising supplement;
has a list of microarray-related companies); Baldwin D. et al.,
Curr Opin Plant Biol 2(2):96-103 (1999); Pollack J. R. et al., Nat
Genet. 23(1):41-6 (1999); Khan J. et al., Electrophoresis
20(2):223-9 (1999); Gerhold D. et al., Trends Biochem Sei
24(5):168-73 (1999); Ekins R. and Chu F. W., Trends in
Biotechnology 17:217-218 (1999); Nuwaysir, E. F. et al., Molecular
Carcinogenesis 24:153-159 (1999); Sinclair, B. The Scientist,
13(11):18-20 (1999); The Chipping Forecast, Nature Genetics
(January 1999 Supplement); Schena, M. and Davis, R. W. Genes,
Genomes and Chips. In DNA Microarrays: A Practical Approach (ed. M.
Schena), Oxford University Press, Oxford, UK, 1999; Marton M. J. et
al., Nat. Med. 4(11):1293-301 (1998); Wang D. G. et al., Science
280(5366): 1077-82 (1998); Schena, M. and R. W. Davis. Parallel
Analysis with Biological Chips, in PCR Methods Manual (eds. M.
Innis, D. Gelfand, J. Sninsky), Academic Press, San Diego, 1998;
Lemieux, B. et al., Molecular Breeding 4:277-289 (1998); Schena, M.
et al., Trends in Biotechnology 16:301-306 (1998); Service, R. F.,
Science 282(5388):396-399 (1998); Service, R. F., Science
282(5388):399-401 (1998); Kricka, L., Nature Biotechnology 16:513
(1998); Housman, D., Nature Biotechnology 16(6):492-493 (1998);
Ramsay, G., Nature Biotechnology 16(1):40-44 (1998); Marshall, A.
et al., Nature Biotechnology 16(1):27-31 (1998); Kononen J. et al.,
Nat. Med. 4(7):844-847 (19998); Blanchard, A. P. (1998) Synthetic
DNA Arrays; in Genetic Engineering, Vol. 20, pp. 111-123, edited by
J. K. Setlow, Plenum Press, New York; Proudnikov D. et al., Anal
Biochem 259(1):34-41 (1998); Chen J. J. et al., Genomics
51(3):313-24 (1998); Wallace R. W., Molecular Medicine Today
3:384-389 (1998); Covacci, A. et al., Drug Development Research
41:180-192 (1997); Forozan, F. et al., Trends in Genetics
13:405-409 (1997); Blanchard, A. P. & L. Hood, Nature
Biotechnology 14:1649 (1996); Blanchard, A. P. et al., Biosensors
& Bioelectronics 11:687-690 (1996); DeRisi J. et al., Nat
Genet. 14(4):457-60 (1996); Shalon D. et al., Genome Res
6(7):639-45 (1996); Schena M. et al., Proc Natl Acad Sci USA
93(20): 10614-9 (1996); and Schena M. et al., Science
270(5235):467-70 (1995).
[0474] Probes on an array can be of varying lengths, including, but
not limited to, as short as about 10-30 nucleotides long or as long
as an entire Flaviviridae gene or Flaviviridae clone, which can be
up to several kilobases. In addition, sequences of the various
lengths as those described in Tables 2 and 3 (Seq ID Nos. 1-62) can
be used as probes. The array can be designed such that all probes
on the array can hybridize to their corresponding genes at about
the same hybridization stringency. Probes for arrays should be
unique at the hybridization stringencies used. A unique probe is
only able to hybridize with one type of nucleic acid per target. A
probe is not unique if at the hybridization stringency used, it
hybridizes with nucleic acids derived from two different genes,
i.e. related genes, or non-homologous sequences. The homology of
the sequence of the probe to the gene and the hybridization
stringency used help determine whether a probe is unique when
testing a selected sample. Probes also may not hybridize with
different nucleic acids derived from the same gene, i.e., splice
variants. Since the splice variants of interest are known, several
different probe sequences can be chosen from the target gene
sequence of interest for an array, such that each probe can only
hybridize to nucleic acid derived from one of the splice variants.
In one embodiment, arrays containing Seq ID Nos. 1-62 are used at
hybridization conditions allowing for selective hybridization. At
conditions of selective hybridization, probes hybridize with
nucleic acid from only one identified sequence. At conditions of
selective hybridization, probes hybridize with nucleic acid from
only one identified sequence. In another embodiment, arrays
containing any Flaviviridae sequence of interest are used at
hybridization conditions allowing for selective hybridization. At
conditions of selective hybridization, probes hybridize with
nucleic acid from only one identified sequence.
[0475] In one embodiment, the use of the microarray first requires
amplification of genes of interest, such as by reverse
transcription of mRNA or total RNA followed by polymerase chain
reaction using methods known in the art. As the nucleic acid is
copied, it is tagged with a label that can be used in the detection
and quantitation methods known in the art. The nucleic acid can be
labeled with radioactive or non-radioactive labels, but preferably
contain fluorescent labels. The labeled nucleic acid is introduced
to the microarray containing the sequence probes of interest and
allowed to react for a period of time. Thereafter, the substrate is
washed free of extraneous materials, leaving the nucleic acids on
the target bound to the fixed probe molecules allowing for
detection and quantitation by methods known in the art such as by
autoradiograph, liquid scintillation counting, and/or fluorescence.
As improvements are made in hybridization and detection techniques,
they can be readily applied by one of ordinary skill in the art. As
is well known in the art, if the probe molecules and target
molecules hybridize by forming a strong non-covalent bond between
the two molecules, it can be reasonably assumed that the probe and
target nucleic acid are essentially completely complementary if the
annealing and washing steps are carried out under conditions of
high stringency. The detectable label provides a means for
determining whether hybridization has occurred. By obtaining an
image of the array with a detection and quantitation method known
in the art such as autoradiography, liquid scintillation counting,
or fluorescence it can be determined if and to what extent
Flaviviridae gene sequences are present, by comparing intensities
at specific locations on the array. High quantitation signals
indicate that a particular sequence is present in a prepared
sample, and an absent quantitation signal shows that a particular
sequence is not present. The presence of various gene sequences
under different conditions can be directly compared, such as prior
to 2'-branched nucleoside treatment and during 2'-branched
nucleoside treatment. Similarly, it can be determined what
sequences are present in response to certain stimuli such as a
2'-branched nucleoside.
[0476] In one embodiment, the Flaviviridae sequence profile of a
patient can be tracked over time using DNA array technologies. In
an alternative embodiment, a patient with Flaviviridae receiving
2'-branched nucleoside as a modality, or other anti-Flaviviridae
modality, can be monitored, over time, for changes in the
aforementioned Flaviviridae genomic sequences in response to the
treatment.
[0477] Arrays containing Seq ID Nos. 1-62, or any other identified
Flaviviridae sequence of interest, can be made by any array
synthesis method known in the art, such as spotting technology or
solid phase synthesis via photolithography. Arrays can also be
printed on solid substrates, e.g., glass microscope slides. Before
printing, slides are prepared to provide a substrate for binding,
as known in the art. Arrays can be printed using any printing
techniques and machines known in the art. Printing involves placing
the probes on the substrate, attaching the probes to the substrate,
and blocking the substrate to prevent non-specific hybridization,
as known in the art. Preferably the arrays of this invention are
synthesized by solid phase synthesis using a combination of
photolithography and combinatorial chemistry. Some of the key
elements of probe selection and array design are common to the
production of all arrays. Strategies to optimize probe
hybridization, for example, are invariably included in the process
of probe selection. Hybridization under particular pH, salt, and
temperature conditions can be optimized by taking into account
melting temperatures and by using empirical rules that correlate
with desired hybridization behaviors (as described in Keller, G.
H., and M. M. Manak (1987) DNA Probes, Stockton Press, New York,
N.Y., pp. 169-170, hereby incorporated by reference). Computer
models can be used for predicting the intensity and
concentration-dependence of probe hybridization.
[0478] Moderate to high stringency conditions for hybridization are
known in the art. An example of high stringency conditions for a
blot are hybridizing at 68.degree. C. in
5.times.SSC/5.times.Denhardt's solution/0.1% SDS, and washing in
0.2.times.SSC/0.1% SDS at room temperature. An example of
conditions of moderate stringency are hybridizing at 68.degree. C.
in 5.times.SSC/5.times.Denhardt's solution/0.1% SDS and washing at
42.degree. C. in 3.times.SSC. The parameters of temperature and
salt concentration can be varied to achieve the desired level of
sequence identity between a probe and a target nucleic acid. See,
for example, Ausubel et al. (1995) Current Protocols in Molecular
Biology, John Wiley & Sons, NY, N.Y., for further guidance on
hybridization conditions. The melting temperature is described by
the following formula (Beltz, G. A. et al., [1983] Methods of
Enzymology, R. Wu, L. Grossman and K. Moldave [Eds.] Academic
Press, New York 100:266-285). Tm=81.5.degree. C.+16.6 Log
[Na+]+0.41(+G+C)-0.61(% formamide)-600/length of duplex in base
pairs.
[0479] Nucleic acids useful in this invention can be created by
Polymerase Chain Reaction (PCR) amplification. PCR products can be
confirmed by agarose gel electrophoresis. PCR is a repetitive,
enzymatic, primed synthesis of a nucleic acid sequence. This
procedure is well known and commonly used by those skilled in this
art (see, for example, Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202,
and 4,800,159; Saiki et al., Science 230:1350-1354 (1985)). PCR is
used to enzymatically amplify a DNA fragment of interest that is
flanked by two oligonucleotide primers that hybridize to opposite
strands of the target sequence. The primers are oriented with the
3'-ends pointing towards each other. Repeated cycles of heat
denaturation of the template, annealing of the primers to their
complementary sequences, and extension of the annealed primers with
a DNA polymerase result in the amplification of the segment defined
by the 5'-ends of the PCR primers. Since the extension product of
each primer can serve as a template for the other primer, each
cycle essentially doubles the amount of DNA template produced in
the previous cycle. This results in the exponential accumulation of
the specific target fragment, up to several million-fold in a few
hours. By using a thermostable DNA polymerase such as the Taq
polymerase, which is isolated from the thermophilic bacterium
Thermus aquaticus, the amplification process can be completely
automated. Other enzymes that can be used are known to those
skilled in the art.
[0480] Alternatively, probes made of peptide nucleic acids (PNAs)
can be used as substitutes for probes made of oligonucleotides for
the same uses as described above. The substitution of PNAs for
oligonucleotides is well known in the art: The synthesis of peptide
nucleic acids via preformed monomers has been described, for
example, in PCT patent applications WO 92/20702 and WO 92/20703.
Recent advances have also been reported on the synthesis,
structure, biological properties, and uses of PNAs. See, for
example, PCT Patent application WO 93/12129, U.S. Pat. No. U.S.
Pat. No. 6,617,422 to Neilsen P. E. et al., U.S. Pat. No. 5,539,083
to Cook et al., U.S. Patent application US20030059789A1, U.S. Pat.
No. 6,475,721 to Kleiber et al., Egholm et al., Nature: 365,
566-568 (1993), Nielsen et al., Science 254:1497-1500 (1991); and
Egholm et al., J. Am. Chem. Soc., 114:1895-1897 (1992).
[0481] Kits
[0482] A suitable test kit for use in an assay to determine the
resistance status of a Flaviviridae sample to 2'-Branched
nucleoside which makes use of a methodology according to one aspect
of the invention, comprises (1) an oligonucleotide being
complementary to a region of the wild-type DNA sequence (or its
corresponding RNA) or to a region of the mutant DNA sequence as
described herein; (2) materials required for polymerization of the
nucleic acid from the 3'-end of the oligonucleotide; and (3) a
means for determining the presence of an oligonucleotide primer
extended product. Polymerization materials include appropriate
enzymes, buffers, washing solutions, labels and substrates for the
label, if necessary. If PCR is used to amplify nucleic acid then
additional materials such as appropriate oligonucleotide primers
that will amplify a region of the wild-type DNA sequence (or its
corresponding RNA) or a region of the mutant DNA sequence as
described herein (or its corresponding RNA) and dNTP's
(deoxynucleoside triphosphates) should be included. Instructions
for conducting the assay can also be included.
[0483] A suitable test kit for use in an assay to determine the
sensitivity of a Flaviviridae sample to interferon which makes use
of a methodology according to another aspect of the invention
comprises an oligonucleotide being complementary to a region of the
wild-type DNA sequence (or its corresponding RNA) or to the
pertinent region of the mutant DNA sequence, along with materials
required to permit hybridization. Such materials include
appropriate buffers, washing solutions, labels, and substrates for
the labels, if necessary. In one embodiment, the oligonucleotide is
labeled. If PCR is used to amplify nucleic acid prior to
hybridisation then additional materials such as appropriate
oligonucleotide primers that will amplify a region of the wild-type
DNA sequence (or its corresponding RNA) or a region of the mutant
DNA sequence, appropriate enzymes and dNTP's (deoxynucleotide
triphosphates) should be included. Instructions for conducting the
assay can also be included.
[0484] In another embodiment, the invention provides a kit for the
detection of a marker of resistance to long term 2'-branched
nucleoside treatment of a Flaviviridae infection. The kit can
contain a compartment which contains an oligonucleotide probe which
binds substantially to a nucleic acid subsequence of the
Flaviviridae that contains the diagnostic marker. Alternatively,
the kit contains peptide nucleic acid (PNA) or other antisense
mimic probe in substitution for the oligonucleotide. The kit can
also contain reagents to detect the hybridization of the probe to
the Flaviviridae nucleic acid viral marker. The present invention
also includes kits that can contain a primer for the PCR
amplification of Flaviviridae nucleic acids. A kit can also contain
a means for detecting amplified Flaviviridae nucleic acids, such as
an oligonucleotide or peptide nucleic acid probe. In some cases,
the probe is fixed to an appropriate support membrane. Other
optional components of the kit include, for example, an agent to
catalyze the synthesis of primer extension products, the substrate
nucleoside triphosphates, means used to label (for example, an
avidin-enzyme conjugate and enzyme substrate and chromogen if the
label is biotin), the appropriate buffers for PCR or hybridization
reactions, and instructions for carrying out the present
method.
[0485] In addition, the kit can have a container which includes a
positive control containing one or more nucleic acids with a
sequence of the Flaviviridae viral genome correlated with therapy
failure and/or a container including a negative control without
such nucleic acids. Moreover, the kit can have a container for a
restriction enzyme capable of cleaving a nucleic acid containing
the target sequence at a site contained in a sequence in the
probe.
[0486] The invention also provides a kit for the detection and/or
genetic analysis of one or more viral markers of Flaviviridae that
are correlated with therapy failure that can be present in a
biological sample comprising the following components: (i) when
appropriate, a means for releasing, isolating or concentrating the
nucleic acids present in the sample; (ii) when appropriate, at
least one suitable primer pair; (iii) at least two probes as
defined above, possibly fixed to a solid support; (iv) a
hybridization buffer, or components necessary for producing said
buffer; (v) a wash solution, or components necessary for producing
said solution; (vi) when appropriate, a means for detecting the
hybrids resulting from the preceding hybridization; (vii) when
appropriate, a means for attaching said probe to a known location
on solid support; and/or (viii) instructions for carrying out the
present method.
[0487] Furthermore, the invention also provides for a kit that
contains peptide or peptide fragments corresponding to viral
markers correlated with 2'-branched nucleoside therapy failure that
can be used in an immunoassay to detect the presence of reactive
antibodies in a sample. The peptide can be in a stabilized solution
or lypholized. Such kit can contain an appropriate solution for
hydrolyzing a lyophilized peptide. The kit can also contain an
appropriate solid medium for blotting the aforementioned peptide
on. The kit can also contain an appropriate reagent for detecting
the presence of reactive antibodies to the peptide, such as an
anti-human IgG antibody labeled with streptavidin-alkaline
phosphatase. Furthermore, the kit can contain a detection agent
such as nitoblue tetrazolium and 5-bromo-4-chloro-3-indlyl
phosphate (BCIP).
[0488] Alternatively, the kit can contain antibodies reactive to
specific peptide sequences associated with 2'-branched nucleoside
therapy.
IV. TREATMENT OF FLAVIVIRIDAE INFECTIONS
[0489] Combination or Alternation Treatment with Anti-Flaviviridae
Agents
[0490] Drug-resistant variants of Flaviviridae can emerge after
prolonged treatment with an antiviral agent. Drug resistance most
typically occurs by mutation of a gene that encodes for an enzyme
used in viral replication. The efficacy of a drug against
Flaviviridae infection can be prolonged, augmented, or restored by
administering the compound in combination or alternation with a
second, and perhaps third, antiviral compound that induces a
different mutation from that caused by the principle drug.
Combination therapy induces multiple simultaneous stresses on the
virus. The pharmacokinetics, biodistribution, or other parameters
of the drug can be altered by such combination or alternation
therapy.
[0491] The present invention provides methods to achieve optimal
treatment of a Flaviviridae infection through administration of a
2'-branched nucleoside, or a pharmaceutically acceptable prodrug
and/or salt thereof, to a human in need of therapy in combination
and/or alternation with one or more drugs that directly or
indirectly induce a mutation in the viral genome at a location
other than a mutation of a nucleotide that results in a change from
serine to a different amino acid in the highly conserved consensus
sequence, XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA
polymerase region, and/or one or more drugs that is associated with
such mutation.
[0492] Interferon Treatment of Mutant Flaviviridae Infections
[0493] Another aspect of the present invention provides a method to
treat and/or to substantially cure a Flaviviridae infection in a
host infected with a Flaviviridae that contains a Serine to
Threonine mutation at the conserved serine amino acid residue of
Domain B of the RNA polymerase region of a Flavividae (FIG. 11) by
administering a therapeutically effective amount of interferon. In
one embodiment, a method is provided to treat and/or to
substantially cure a BVDV infection that contains a serine to
threonine mutation at amino acid position 405 of the RNA polymerase
region by administering a therapeutically effective amount of
interferon. In another embodiment, a method is provided to treat
and/or to substantially cure a HCV infection that contains a serine
to threonine mutation at amino acid position 282 of the RNA
polymerase region. of HCV by administering a therapeutically
effective amount of interferon. In a specific embodiment,
interferon alpha-2b is administered to treat and/or to
substantially cure the Flaviviridae infection.
[0494] In a further embodiment, a method is provided to treat
and/or to substantially cure a Flaviviridae infection in a host
suspected of being infected with BVDV comprising: (i) obtaining a
viral sample from the host; (ii) identifying whether the
Flaviviridae in the sample contains a Threonine at amino acid
residue 405 of the RNA polymerase; and (iii) administering an
effective amount of interferon to the host infected with a
Flaviviridae that contains a Serine to Threonine mutation at amino
acid 405 of the RNA polymerase region.
[0495] In another embodiment, a method is provided to treat and/or
to substantially cure a Flaviviridae infection in a host suspected
of being infected with HCV comprising: (i) obtaining a viral sample
from the host; (ii) identifying whether the Flaviviridae in the
sample contains a Threonine at amino acid residue 282 of the RNA
polymerase; and (iii) administering an effective amount of
interferon to the host infected with a Flaviviridae that contains a
Serine to Threonine mutation at amino acid 282 of the RNA
polymerase region.
[0496] Interferons include: Intron-A (interferon alpha-2b) by
Schering, PEG-INTRON (pegylated interferon alpha-2b) by Schering,
Roferon-A (interferon alfa-2a) by Roche, PEGASYS (pegylated
interferon alfa-2a) by Roche, INFERGEN (interferon alfacon-1) by
InterMune, OMNIFERON (natural interferon) by Viragen, ALBUFERON by
Human Genome Sciences, REBIF (interferon beta-1a) by Ares-Serono,
Omega Interferon by BioMedicine, Oral Interferon Alpha by Amarillo
Biosciences, and Interferon gamma-1b by InterMune.
[0497] Identification of the Serine to Threonine mutation at amino
acid position 405 of the RNA polymerase region of BVDV, or amino
acid position 282 of the RNA polymerase region of HCV, can be
accomplished by detecting the presence of a mutation in the
Flaviviridae genome that would allow for an amino acid change from
Serine to Threonine. In one embodiment, the presence of cytidine at
nucleotide 1214 of the RNA polymerase region of BVDV (where
nucleotide 1214 of the RNA polymerase region corresponds to
nucleotide 11,136 of the BVDV genome) can be used to detect the
amino acid change. In other embodiments, the following double
mutations can be detected: 1214 (G to C) and 1215 (C to A); 1214 (G
to C) and 1215 (C to G); or 1214 (G to C) and 1215 (C to U), which
result in an amino acid change from serine to threonine at position
405 of the RNA polymerase region of BVDV. In another embodiment,
the presence of cytidine at nucleotide 8443 of the HCV genome can
be used to detect the amino acid change. In other embodiments, the
following double mutations can be detected: 8443 (G to C) and 8444
(C to A); 8443 (G to C) and 8444 (C to G); or 8443 (G to C) and
8444 (C to U), which result in an amino acid change from serine to
threonine at position 282 of the RNA polymerase region of HCV. The
mutations can be detected using any of the detection techniques
described above, such as labeled probes, reverse hybridization
assays, southern blots or any other detection technique known to
one skilled in the art.
V. PREPARATION OF PHARMACEUTICAL COMPOSITIONS
[0498] Any host, including a human, exhibiting an infection caused
by a Flaviviridae virus can be treated by administering to the
patient an effective amount of a 2'-branched nucleoside or a
pharmaceutically acceptable prodrug and/or salt thereof, such as
.beta.-D-2'-CH.sub.3-riboC or its 3' valine ester prodrug, in the
presence of a pharmaceutically acceptable carrier or dilutent, for
any of the indications or modes of administration as described in
detail herein in combination or alternation with a drug that
induces a mutation in the viral genome at a location other than a
mutation of a nucleotide that results in a change from serine to a
different amino acid in the highly conserved consensus sequence,
XRXSGXXXT (SEQ ID NO: 63), of domain B of the RNA polymerase
region. The 2'-branched nucleoside, such as
.beta.-D-2'-CH.sub.3-riboC, or a pharmaceutically acceptable
prodrug and/or salt thereof can be administered alone or in
combination or alternation with other antiviral agents as described
herein. The active materials can be administered by any appropriate
route, for example, orally, parenterally, intravenously,
intradermally, subcutaneously, or topically, in liquid or solid
form.
[0499] A preferred dose of a compound will be in the range from
about 1 to 50 mg/kg, preferably 1 to 20 mg/kg, of body weight per
day, and more generally 0.1 to about 100 mg per kilogram body
weight of the recipient per day. The effective dosage range of the
pharmaceutically acceptable salts and prodrugs can be calculated
based on the weight of the parent nucleoside to be delivered. If
the prodrug and/or salt exhibits activity in itself, the effective
dosage can be estimated using the weight of the prodrug and/or
salt, or by other means known to those skilled in the art.
[0500] A compound can be conveniently administered in unit any
suitable dosage form, including but not limited to one containing 7
to 3000 mg, preferably 70 to 1400 mg, of active ingredient per unit
dosage form. For example, an oral dosage of 50-1000 mg of the
active ingredient is usually convenient.
[0501] Ideally the active ingredient should be administered to
achieve peak plasma concentrations of the active compound of from
about 0.2 to 70 .mu.M, preferably about 1.0 to 10 .mu.M. This can
be achieved, for example, by the intravenous injection of a 0.1 to
5% solution of the active ingredient, optionally in saline, or
administered as a bolus of the active ingredient.
[0502] The concentration of active compound in the drug composition
will depend on absorption, inactivation and excretion rates of the
drug as well as other factors known to those of skill in the art.
It is to be noted that dosage values will also vary with the
severity of the condition to be alleviated. It is to be further
understood that for any particular subject, specific dosage
regimens should be adjusted over time according to the individual
need and the professional judgment of the person administering or
supervising the administration of the compositions, and that the
concentration ranges set forth herein are exemplary only and are
not intended to limit the scope or practice of the claimed
composition. The active ingredient can be administered at once, or
can be divided into a number of smaller doses to be administered at
varying intervals of time.
[0503] A preferred mode of administration of the active compound is
oral. Oral compositions will generally include an inert diluent or
an edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition.
[0504] The tablets, pills, capsules, troches and the like can
contain any of the following ingredients, or compounds of a similar
nature: a binder such as microcrystalline cellulose, gum tragacanth
or gelatin; an excipient such as starch or lactose, a
disintegrating agent such as alginic acid, Primogel, or corn
starch; a lubricant such as magnesium stearate or Sterotes; a
glidant such as colloidal silicon dioxide; a sweetening agent such
as sucrose or saccharin; or a flavoring agent such as peppermint,
methyl salicylate, or orange flavoring. When the dosage unit form
is a capsule, it can contain, in addition to material of the above
type, a liquid carrier such as a fatty oil. In addition, dosage
unit forms can contain various other materials which modify the
physical form of the dosage unit, for example, coatings of sugar,
shellac, or other enteric agents.
[0505] The compound can be administered as a component of an
elixir, suspension, syrup, wafer, chewing gum or the like. A syrup
can contain, in addition to the active compounds, sucrose as a
sweetening agent and certain preservatives, dyes and colorings and
flavors.
[0506] The compound, or a pharmaceutically acceptable prodrug
and/or salt thereof, can also be mixed with other active materials
that do not impair the desired action, or with materials that
supplement the desired action, such as antibiotics, antifungals,
anti-inflammatories, or other antivirals, including other
nucleoside compounds. Solutions or suspensions used for parenteral,
intradermal, subcutaneous, or topical application can include the
following components: a sterile diluent such as water for
injection, saline solution, fixed oils, polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as ascorbic acid or sodium bisulfite; chelating
agents such as ethylenediaminetetraacetic acid; buffers such as
acetates, citrates or phosphates and agents for the adjustment of
tonicity such as sodium chloride or dextrose. The parental
preparation can be enclosed in ampoules, disposable syringes or
multiple dose vials made of glass or plastic.
[0507] If administered intravenously, preferred carriers are
physiological saline or phosphate buffered saline (PBS).
[0508] In a preferred embodiment, the active compounds are prepared
with carriers that will protect the compound against rapid
elimination from the body, such as a controlled release
formulation, including implants and microencapsulated delivery
systems. Biodegradable, biocompatible polymers can be used, such as
ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
collagen, polyorthoesters and polylactic acid. Methods for
preparation of such formulations will be apparent to those skilled
in the art. The materials can also be obtained commercially from
Alza Corporation.
[0509] Liposomal suspensions (including liposomes targeted to
infected cells with monoclonal antibodies to viral antigens) are
also preferred as pharmaceutically acceptable carriers. These can
be prepared according to methods known to those skilled in the art,
for example, as described in U.S. Pat. No. 4,522,811, which is
incorporated herein by reference in its entirety. For example,
liposome formulations can be prepared by dissolving appropriate
lipid(s), such as stearoyl phosphatidyl ethanolamine, stearoyl
phosphatidyl choline, arachadoyl phosphatidyl choline, and/or
cholesterol, in an inorganic solvent that is then evaporated,
leaving behind a thin film of dried lipid on the surface of the
container. An aqueous solution of the active compound or its
monophosphate, diphosphate, and/or triphosphate derivatives is then
introduced into the container. The container is swirled by hand to
free lipid material from the sides of the container and to disperse
lipid aggregates, thereby forming the liposomal suspension.
[0510] The active compound(s) are included in the pharmaceutically
acceptable carrier or diluent in an amount sufficient to deliver to
a patient a therapeutically effective amount of compound to inhibit
viral replication in vivo, especially Flaviviridae replication,
without causing serious toxic effects in the treated patient. By
"inhibitory amount" is meant an amount of active ingredient
sufficient to exert an inhibitory effect as measured by, for
example, an assay such as the ones described herein.
Controlled Release Formulations
[0511] The field of biodegradable polymers has developed rapidly
since the synthesis and biodegradability of polylactic acid was
reported by Kulkarni et al., in 1966 ("Polylactic acid for surgical
implants," Arch. Surg., 93:839). Examples of other polymers which
have been reported as useful as a matrix material for delivery
devices include polyanhydrides, polyesters such as polyglycolides
and polylactide-co-glycolides, polyamino acids such as polylysine,
polymers and copolymers of polyethylene oxide, acrylic terminated
polyethylene oxide, polyamides, polyurethanes, polyorthoesters,
polyacrylonitriles, and polyphosphazenes. See, for example, U.S.
Pat. Nos. 4,891,225 and 4,906,474 to Langer (polyanhydrides),
4,767,628 to Hutchinson (polylactide, polylactide-co-glycolide
acid), and 4,530,840 to Tice, et al. (polylactide, polyglycolide,
and copolymers). See also U.S. Pat. No. 5,626,863 to Hubbell, et al
which describes photopolymerizable biodegradable hydrogels as
tissue contacting materials and controlled release carriers
(hydrogels of polymerized and crosslinked macromers comprising
hydrophilic oligomers having biodegradable monomelic or oligomeric
extensions, which are end capped monomers or oligomers capable of
polymerization and crosslinking); and WO 97/05185 to Focal, Inc.
directed to multiblock biodegradable hydrogels for use as
controlled release agents for drug delivery and tissue treatment
agents.
[0512] Degradable materials of biological origin, such as
crosslinked gelatin, are well known. Hyaluronic acid has been
crosslinked and used as a degradable swelling polymer for
biomedical applications (U.S. Pat. No. 4,957,744 to Della Valle et.
al.; (1991) "Surface modification of polymeric biomaterials for
reduced thrombogenicity," Polym. Mater. Sci. Eng.,
62:731-735]).
[0513] Many dispersion systems are currently in use, or being
explored for use, as carriers of substances, and particularly of
biologically active compounds. Dispersion systems used for
pharmaceutical and cosmetic formulations can be categorized as
either suspensions or emulsions. Suspensions are defined as solid
particles ranging in size from a few manometers up to hundreds of
microns, dispersed in a liquid medium using suspending agents.
Solid particles include microspheres, microcapsules, and
nanospheres. Emulsions are defined as dispersions of one liquid in
another, stabilized by an interfacial film of emulsifiers such as
surfactants and lipids. Emulsion formulations include water in oil
and oil in water emulsions, multiple emulsions, microemulsions,
microdroplets, and liposomes. Microdroplets are unilamellar
phospholipid vesicles that consist of a spherical lipid layer with
an oil phase inside, as defined in U.S. Pat. Nos. 4,622,219 and
4,725,442 issued to Haynes. Liposomes are phospholipid vesicles
prepared by mixing water-insoluble polar lipids with an aqueous
solution. The unfavorable entropy caused by mixing the insoluble
lipid in the water produces a highly ordered assembly of concentric
closed membranes of phospholipid with entrapped aqueous
solution.
[0514] U.S. Pat. No. 4,938,763 to Dunn, et al., discloses yet
anther method for drug delivery by forming an implant in situ by
dissolving a nonreactive, water insoluble thermoplastic polymer in
a biocompatible, water soluble solvent to form a liquid, placing
the liquid within the body, and allowing the solvent to dissipate
to produce a solid implant. The polymer solution can be placed in
the body via syringe. The implant can assume the shape of its
surrounding cavity. In an alternative embodiment, the implant is
formed from reactive, liquid oligomeric polymers which contain no
solvent and which cure in place to form solids, usually with the
addition of a curing catalyst.
[0515] A number of patents disclose drug delivery systems that can
be used to administer a 2'-branched nucleoside, or pharmaceutically
acceptable prodrug and/or salt thereof, in combination and/or
alternation with a drug that induces a mutation in the viral genome
at a location other than a mutation of a nucleotide that results in
a change from serine to a different amino acid in the highly
conserved consensus sequence, XRXSGXXXT (SEQ ID NO: 63), of domain
B of the RNA polymerase region. U.S. Pat. No. 5,749,847 discloses a
method for the delivery of nucleotides into organisms by
electrophoration. U.S. Pat. No. 5,718,921 discloses the use of
microspheres comprising a polymer and drug dispersed therein as a
delivery system. U.S. Pat. No. 5,629,009 discloses a delivery
system for the controlled release of bioactive factors. U.S. Pat.
No. 5,578,325 discloses the use of nanoparticles and microparticles
of non-linear hydrophilic hydrophobic multiblock copolymers for
drug delivery. U.S. Pat. No. 5,545,409 discloses a delivery system
for the controlled release of bioactive factors. U.S. Pat. No.
5,494,682 discloses the use of ionically cross-linked polymeric
microcapsules as a drug delivery system.
[0516] U.S. Pat. No. 5,728,402 to Andrx Pharmaceuticals, Inc.
describes a controlled release formulation that includes an
internal phase that comprises the active drug, its salt or prodrug,
in admixture with a hydrogel forming agent, and an external phase
which comprises a coating that resists dissolution in the stomach.
U.S. Pat. Nos. 5,736,159 and 5,558,879 to Andrx Pharmaceuticals,
Inc. disclose controlled release formulations for drugs with little
water solubility in which a passageway is formed in situ. U.S. Pat.
No. 5,567,441 to Andrx Pharmaceuticals, Inc. discloses a once-a-day
controlled release formulation. U.S. Pat. No. 5,508,040 discloses a
multiparticulate pulsatile drug delivery system. U.S. Pat. No.
5,472,708 discloses a pulsatile particle based drug delivery
system. U.S. Pat. No. 5,458,888 describes a controlled release
tablet formulation which can be made using a blend having an
internal drug containing phase and an external phase which
comprises a polyethylene glycol polymer which has a weight average
molecular weight of from 3,000 to 10,000. U.S. Pat. No. 5,419,917
discloses methods for the modification of the rate of release of a
drug form a hydrogel which is based on the use of an effective
amount of a pharmaceutically acceptable ionizable compound that is
capable of providing a substantially zero-order release rate of
drug from the hydrogel. U.S. Pat. No. 5,458,888 discloses a
controlled release tablet formulation.
[0517] U.S. Pat. No. 5,641,745 to Elan Corporation, plc discloses a
controlled release pharmaceutical formulation which comprises the
active drug in a biodegradable polymer to form microspheres or
nanospheres. The biodegradable polymer is suitably poly-D,L-lactide
or a blend of poly-D,L-lactide and poly-D,L-lactide-co-glycolide.
U.S. Pat. No. 5,616,345 to Elan Corporation plc describes a
controlled absorption formulation for once a day administration
that includes the active compound in association with an organic
acid, and a multi-layer membrane surrounding the core and
containing a major proportion of a pharmaceutically acceptable
film-forming, water insoluble synthetic polymer and a minor
proportion of a pharmaceutically acceptable film-forming water
soluble synthetic polymer. U.S. Pat. No. 5,641,515 discloses a
controlled release formulation based on biodegradable
nanoparticles. U.S. Pat. No. 5,637,320 discloses a controlled
absorption formulation for once a day administration. U.S. Pat.
Nos. 5,580,580 and 5,540,938 are directed to formulations and their
use in the treatment of neurological diseases. U.S. Pat. No.
5,533,995 is directed to a passive transdermal device with
controlled drug delivery. U.S. Pat. No. 5,505,962 describes a
controlled release pharmaceutical formulation.
[0518] The following examples illustrate various embodiments of the
invention and are not intended to be limiting in any respect.
EXAMPLES
Example 1
Isolation of .beta.-D-2'-CH.sub.3-riboC-Resistant BVDV
[0519] Persistent BVDV infection was established in MDBK cell line
(ATCC, Manassas, Va., Catalog #: CCL-22) by in vitro infection of
naive cells with a noncytophatic (ncp) BVDV (strain I-N-dIns; Dr.
R. Donis, U. of Nebraska, Lincoln, Nebr.). The multiplicity of
infection (MOI) was 0.01. Cells were passaged twice per week
(splitting ratio 1:15) until the stable high-level of infection
(10.sup.6-10.sup.7 focus forming units (FFU) per mL) was achieved,
as was determined by a focus assay. Next, the persistently infected
cells were grown in 6-well culture plates with 8 .mu.M or without
.beta.-D-2'-CH.sub.3-riboC (Idenix Pharmaceuticals). Cell cultures
were passaged every three to four days by splitting with a ratio of
1:15 to 1:20. After eight passages, cell cultures grown in the
presence of .beta.-D-2'-CH.sub.3-riboC were expanded to T-75
culture flask, freeze/thawed twice, and used as a virus stock of
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV for further
characterization. The virus titers in cell cultures were monitored
at the end of each passage by the virus focus assay.
[0520] To conduct the virus focus assay, MDBK cells were seeded
onto 6-well plates containing 2.times.10.sup.5 cells per well and
grown at 37.degree. C./5% CO.sub.2 for at least 5 hours before use.
The test samples (culture supernatants combined with cell
monolayers) were frozen/thawed twice, serially diluted by 10-fold
in medium, and used to inoculate test cells in 6-well plates at 0.2
mL per well. The inoculum was removed after 1 hour of adsorption,
and the cells were overlaid with 3 mL of 0.5% agarose in complete
growth medium (1.times.DMEM (Cellgro), supplemented with 8% horse
serum, penicillin, streptomycin, L-glutamine, sodium pyruvate, and
25 mM HEPES). After 3 days of incubation at 37.degree. C./5%
CO.sub.2, the plates were fixed for 1 hour with 3 mL of 7.4%
formaldehyde in PBS, and washed with PBS. The cell monolayers were
permeabilized with 1 mL of PBS-0.25% Triton X-100 per well for 10
minutes, and incubated with 0.5 mL of goat anti-BVDV antiserum
(VMDR, Inc.; diluted 1:1000 in PBS-0.25% Triton X-100) for 1 hour.
The antiserum was then removed, and cell monolayers were washed
with PBS (twice for 15 min) and incubated with 0.5 mL of
peroxidase-conjugated donkey anti-goat antibody (diluted 1:1000 in
PBS-0.25% Triton X-100) for another 1 hour. After the antibody was
removed, the cell monolayers were washed with PBS (twice for 15
min), and incubated with 0.5 mL of diaminobenzidine (DAB)
peroxidase substrate solution (Vector Laboratories) at room
temperature until virus foci become visible (approximately 15
minutes). All incubations were carried out with rocking. The
staining was stopped by washing with water and the plates were
allowed to air dry. Virus titers were calculated in FFU/mL, using
the following equation: T.sub.ffu/mL=N.times.5.times.D; where T is
a virus titer in FFU/mL; N is a number of foci per well; and D is a
dilution factor for the corresponding virus sample. (For example,
if 12 foci were found in a well corresponding to 10.sup.-5 dilution
of virus sample, than T=12.times.5.times.10.sup.5=6.times.10.sup.6
FFU/mL).
[0521] Typically, virus titers reached 10.sup.6-10.sup.7 FFU/mL
after 2-3 passages, and did not change significantly after further
passaging over at least 2 months. When such a persistently infected
cell line was treated with 8 .mu.M .beta.-D-2'-CH.sub.3-riboC, the
virus titer declined rapidly and the virus was no longer detectable
after two passages (FIG. 1). However, after additional passaging in
the presence of the inhibitor, virus reappeared in culture
(typically, at passage 3 to 5), and virus titer reached plateau at
10.sup.5 FFU/mL, about ten-fold lower than that of untreated
culture (FIG. 1). This 10-fold difference in virus titers was
observed even after 28 days of treatment. This experiment was
repeated three times and similar results were obtained. The
phenotype of the reappeared virus was remarkably different from the
initial wild type virus: it yielded much smaller foci, typically, 3
to 10 times smaller in diameter then those of the wild type virus
(FIG. 2). This phenotype did not change after prolonged passaging
in culture in the presence of the inhibitor for at least 72 days,
but, it quickly reverted to the wild type phenotype (large foci)
after the discontinuation of the treatment.
[0522] Taken together, these data demonstrate that the wild type
virus disappeared from cell culture after treatment, and the
.beta.-D-2'-CH.sub.3-riboC-resistant virus variant demonstrated
lesser replication fitness in tissue culture.
Example 2
Virus Growth Kinetics
[0523] The growth kinetics of both wild type and the
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV were compared. MDBK cells
were seeded onto 6-well plates (2.times.10.sup.5 cells per well)
and grown at 37.degree. C./5% CO.sub.2 overnight. Cells were
infected with BVDV I-N-dIns or the
.beta.-D-2'-CH.sub.3-riboC-resistant mutant, I-N-dIns
.beta.-D-2'-CH.sub.3-riboC-R, at a multiplicity of infection of
0.1. After a 1-hour adsorption, the inoculum was removed, and cells
were washed with PBS and then overlaid with 2 mL of fresh growth
medium. For BVDV I-N-dIns .beta.-D-2'-CH.sub.3-riboC-R, duplicate
wells were prepared in the presence or absence of 8 .mu.M
.beta.-D-2'-CH.sub.3-riboC. Cell cultures were incubated at
37.degree. C./5% CO.sub.2. At 0 (the end of the adsorption period),
6, 12, 24, 36, 48, 60, 72 hours post-infection, the cultures were
frozen/thawed twice, and virus titers were quantified by the focus
assay as described above.
[0524] At 12 hours post-infection, the wild type virus progeny
reached a significant level of over 10.sup.4 FFU/mL, consistent
with the BVDV complete life cycle being 8-14 hours. In contrast,
the progeny of the resistant virus variant was still undetectable
at that point (FIG. 3). The replication of the resistant virus was
first detected at 24 hours post-infection. At 36 hours
post-infection, the replication of the resistant virus was still
about 100-fold less efficient than that of the wild type virus.
These data clearly demonstrate that the
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV replicates significantly
slower than the wild type virus, especially at the early stages of
the infection. These data are also consistent with the results
presented in FIGS. 1 and 2.
Example 3
Evaluation of the Resistance to .beta.-D-2'-CH.sub.3-riboC
[0525] The selected BVDV variant (I-N-dIns
.beta.-D-2'-CH.sub.3-riboC-R) is more resistant to
.beta.-D-2'-CH.sub.3-riboC than the wild type BVDV since it can
stably replicate to a reasonably high levels in MDBK cells in the
presence of the compound for a long period of time (at least 72
days) without changes in the phenotype nor in the virus titer
levels. To quantitate this resistance, a virus yield reduction
assay was performed, using both the wild type and the variant
virus.
[0526] To conduct the virus yield reduction assay, MDBK cells were
seeded onto 24-well plates (1.times.10.sup.5 cells per well) and
grown at 37.degree. C./5% CO.sub.2 overnight. Cells were infected
with BVDV at a multiplicity of infection of 0.1. After 1-hour
adsorption, the inoculum was removed, and cells were washed with
PBS and then overlaid with 1 mL of fresh growth medium, containing
serial 2-fold dilutions of the test compound (0-32 .mu.M for
.beta.-D-2'-CH.sub.3-riboC and 0-800 IU/mL for Intron.RTM.A). After
incubation at 37.degree. C./5% CO.sub.2 for 48 hours, the plates
were frozen/thawed at -70.degree. C. twice to lyse the cell
cultures. The virus titer in the cell culture was quantified by
focus assay as described above. The 50%, 90%, and 4-log effective
concentrations (Mean values.+-.Standard Deviation) for the test
compound were based on duplicate wells. The EC.sub.50, EC.sub.90
and EC.sub.4-log values were derived by curve fitting using XLFit
software. The EC.sub.50, EC.sub.90, and EC.sub.4 log are
concentrations of test compound, which will reduce viral titer by
50%, 90%, and 99.99%, respectively.
[0527] The generation of the infectious wild type BVDV particles
was very efficiently inhibited by .beta.-D-2'-CH.sub.3-riboC, with
an EC.sub.50 and EC.sub.90 values of 0.59.+-.0.12 .mu.M and
1.49.+-.0.28 .mu.M, respectively (FIG. 4 and Table 4). At
.beta.-D-2'-CH.sub.3-riboC concentration of 7.14.+-.1.26 .mu.M the
wild type virus yield was reduced by 4 logs, and at 16 .mu.M virus
titers dropped below the detection limit (<10 FFU/mL). In
contrast, no effect on the resistant virus yield was observed at
the highest .beta.-D-2'-CH.sub.3-riboC concentration tested (32
.mu.M). Thus, the I-N-dIns .beta.-D-2'-CH.sub.3-riboC-R virus was
at least 54-fold more resistant to the inhibitor than the wild type
virus, based on the EC.sub.50 values obtained by the virus yield
reduction assay (>32 .mu.M versus 0.59.+-.0.12 .mu.M).
TABLE-US-00004 TABLE 4 Results of BVDV Yield Reduction Assay
Compound BVDV strain Biotype.sup.1 EC.sub.50 (.mu.M) EC.sub.90
(.mu.M) EC.sub.4 log (.mu.M) .beta.-D-2`-CH.sub.3-riboC I-N-dIns
ncp 0.59 .+-. 0.12 1.49 .+-. 0.28 7.14 .+-. 1.26 I-N-dIns
.beta.-D-2`- ncp >32 >32 >32 CH.sub.3-riboC-R I-NADL cp
0.68 .+-. 0.08 1.73 .+-. 0.11 8.22 .+-. 0.05 I-NADL S3674T cp
>32 >32 >32 IFN I-N-dIns ncp 2.64 .+-. 1.40 119 .+-. 34.1
>800 I-N-dIns .beta.-D-2`- ncp 0.19 .+-. 0.04 3.15 .+-. 0.72
>800 CH.sub.3-riboC-R .sup.1cp = cytopathic; ncp =
noncytopathic
Example 4
Nucleic Acid Sequence Analysis: Identification of the Genetic
Mutation(s) Responsible for the
.beta.-D-2'-CH.sub.3-riboC-Resistant Phenotype
[0528] Based on the nature of the inhibitor, i.e. the nucleoside
analog, the viral polymerase was considered as a plausible
molecular target. Thus, we begun with the sequencing of the NS5B
region for both wild type and the
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV. The viral RNA was
extracted from the tissue culture lysates after 8 passages of
treatment with or without .beta.-D-2'-CH.sub.3-riboC (FIG. 1), the
entire NS5B region was subjected to the RT-PCR and sequencing.
Viral RNA was extracted from cell cultures using QIAamp.RTM. Viral
RNA Mini Kit (QIAGEN) according to the manufacture's protocol. The
whole NS5B region was transcribed and amplified using QIAGEN.RTM.
OneStep RT-PCR Kit. PCR products were purified using QIAquick.RTM.
PCR Purification Kit (QIAGEN) and sequenced using the ABI
PRISM.RTM. Sequencing protocol on an automated ABI DNA Sequencer
(Perkin-Elmer) at the Tufts Core Facility, Boston, Mass.
[0529] Each region was sequenced in both directions using at least
two independent RT-PCR products. No mutations were found in the
wild type virus when compared to the previously published sequence
of the BVDV (strain I-N-dIns) full-length genome (Vassilev, V. B.
and R. O. Donis. (2000) Virus Res. 69 (2): 95-107). Bovine viral
diarrhea virus (BVDV) induced apoptosis correlates with increased
intracellular viral RNA accumulation. Only one nucleotide
substitution was found in the I-N-dIns .beta.-D-2'-CH.sub.3-riboC-R
virus: 1214G to C, changing amino acid residue Ser to Thr at
position 405. Interestingly, this amino acid position is located to
the putative functional NS5B domain B (FIG. 5), identified by
mutational analysis (Lai V. C., Kao C.C., Ferrari E., Park J., Uss
A. S., Wright-Minogue J., Hong Z., and J. Y. Lau. "Mutational
analysis of bovine viral diarrhea virus RNA-dependent RNA
polymerase" J. Virol., 1999, 73, 10129-36). This domain is also
found in the NS5B region of HCV genome, as well as in genomes of
other flaviviruses. Moreover, the amino acid position Ser.sub.405
is highly conserved among all pesti- and flavivirus genomes.
Example 5
Hypersensitivity to Intron A
[0530] Comparison of the wild type I-N-dIns virus and I-N-dIns
.beta.-D-2'-CH.sub.3-riboC-R variant was conducted for their
sensitivity to the Intron A in de novo-infected MDBK cells using
the virus yield reduction assay, as described above. Again, we
found a remarkable difference between the two viruses. The wild
type virus was moderately inhibited by the Intron A with an
EC.sub.90 value of 119.+-.34.1 .mu.M and an approximate 1.5 log
reduction in virus yield at the highest drug concentration tested
(FIG. 6). In contrast, the I-N-dIns .beta.-D-2'-CH.sub.3-riboC-R
variant virus was found to be much more sensitive to Intron A, with
an EC.sub.90 value of 3.15.+-.0.72 .mu.M and the maximum reduction
in the viral yield of nearly 4 log (FIG. 6). Based on comparison of
the EC.sub.90 values, the .beta.-D-2'-CH.sub.3-riboC-resistant
virus was approximately 40 times more sensitive to the Intron A
than the wild type BVDV.
Example 6
Combination Treatment with .beta.-D-2'-CH.sub.3-riboC and Intron
A
[0531] The effect of Intron A, alone or in combination with
.beta.-D-2'-CH.sub.3-riboC, on the wild type BVDV was further
studied in the persistently infected MDBK cells. In one
experimental setting, the virus titers were determined after 7 days
(two passages) of single or double treatment with several inhibitor
concentrations. The results of this experiment, presented in Tables
5A and 5B, and also in FIGS. 7 and 8, can be summarized as follows.
.beta.-D-2'-CH.sub.3-riboC alone strongly inhibited BVDV (strain
I-N-dIns) propagation in a dose-dependent manner under described
experimental conditions. Treatment with 8 .mu.M
.beta.-D-2'-CH.sub.3-riboC reduced virus titer 6.2 logs (FIG. 7).
Interferon alpha-2b alone had minimal antiviral effect (0.1
log-reduction in virus titers). Single treatment with 2 .mu.M
.beta.-D-2'-CH.sub.3-riboC or 2000 IU/mL interferon alpha-2b
reduced viral titers 1.61 logs and 0.1 log, respectively. The
effect of a combination treatment with the same concentrations was
2.22 logs, which was 0.51 log higher than the calculated additive
effect (1.71 log). Single treatment with 4 .mu.M
.beta.-D-2'-CH.sub.3-riboC or 2000 IU/mL interferon alpha-2b
reduced viral titers 2.06 logs and 0.1 log, respectively (Table 5B,
FIG. 8). The effect of a combination treatment with same
concentrations was 4.56 logs, which was 2.4 logs higher than the
calculated additive effect (2.16 log). Thus,
.beta.-D-2'-CH.sub.3-riboC and interferon alpha-2b acted
synergistically to inhibit BVDV, especially when
.beta.-D-2'-CH.sub.3-riboC was used at a concentration of 4
.mu.M.
TABLE-US-00005 TABLE 5A Effect of .beta.-D-2`-CH.sub.3-riboC and
interferon alpha-2b on BVDV (strain I-N-dIns) titers in
persistently infected MDBK cells. Numbers represent BVDV titer
values in FFU/mL. 0 .mu.M 2 .mu.M 4 .mu.M 8 .mu.M
.beta.-D-2`-CH.sub.3- .beta.-D-2`-CH.sub.3- .beta.-D-2`-CH.sub.3-
.beta.-D-2`-CH.sub.3- riboC riboC riboC riboC 0 IU/mL 4.03 .times.
106 .+-. 1.25 .times. 105 .+-. 3.58 .times. 104 .+-. 2.50 .times.
100 .+-. Interferon 2.34 .times. 106 3.54 .times. 104 1.06 .times.
103 2.89 .times. 100 alpha-2b 5 IU/mL 6.44 .times. 106 .+-. 2.63
.times. 105 .+-. 1.00 .times. 104 .+-. 1.25 .times. 100 .+-.
Interferon 3.15 .times. 106 7.42 .times. 104 3.54 .times. 103 2.50
.times. 100 alpha-2b 50 IU/mL 8.85 .times. 106 .+-. 2.13 .times.
105 .+-. 5.75 .times. 102 .+-. 0.00 .times. 100 .+-. Interferon
4.53 .times. 106 6.72 .times. 104 4.84 .times. 102 0.00 .times. 100
alpha-2b 200 IU/mL 5.38 .times. 106 .+-. 5.75 .times. 104 .+-. 2.38
.times. 102 .+-. 0.00 .times. 100 .+-. Interferon 3.03 .times. 106
1.32 .times. 104 2.06 .times. 102 0.00 .times. 100 alpha-2b 1000
IU/mL 2.60 .times. 106 .+-. 3.93 .times. 104 .+-. 1.34 .times. 102
.+-. 0.00 .times. 100 .+-. Interferon 1.14 .times. 106 1.80 .times.
105 2.35 .times. 102 0.00 .times. 100 alpha-2b 2000 IU/mL 3.23
.times. 106 .+-. 2.44 .times. 104 .+-. 1.12 .times. 102 .+-. 0.00
.times. 100 .+-. Interferon 1.77 .times. 106 2.07 .times. 104 1.93
.times. 102 0.00 .times. 100 alpha-2b
TABLE-US-00006 TABLE 5B Effect of .beta.-D-2`-CH.sub.3-riboC and
interferon alpha-2b on BVDV - (strain I-N-dIns) titers in
persistently infected MDBK cells. Numbers represent log values of
the BVDV titers. 0 .mu.M 2 .mu.M 4 .mu.M 8 .mu.M .beta.-D-2`-
.beta.-D-2`- .beta.-D-2`- .beta.-D-2`- CH.sub.3-riboC
CH.sub.3-riboC CH.sub.3-riboC CH.sub.3-riboC 0 IU/mL 6.61 5.10 4.55
0.40 Interferon alpha-2b 5 IU/mL 6.81 5.42 4.00 0.10 Interferon
alpha-2b 50 IU/mL 6.95 5.33 2.76 0.00 Interferon alpha-2b 200 IU/mL
6.73 4.76 2.38 0.00 Interferon alpha-2b 1000 IU/mL 6.41 4.59 2.13
0.00 Interferon alpha-2B 2000 IU/mL 6.51 4.39 2.05 0.00 Interferon
alpha-2B
[0532] In another experimental setting, treatment time was extended
to 10 days and the viral titers (strain NY-1) were monitored after
each passage (every three to four days). Again, similar synergistic
inhibitory effect of .beta.-D-2'-CH.sub.3-riboC and interferon
alpha-2b was observed (FIG. 9). Notably, when cell cultures were
treated with 8 .mu.M of .beta.-D-2'-CH.sub.3-riboC in combination
with 200 IU/mL of Intron A, the virus became undetectable after 7
days of treatment and did not reappear after further passaging for
at least 27 days. These data are in agreement with our previously
described finding, which is that
.beta.-D-2'-CH.sub.3-riboC-resistant BVDV variant, arising after
treatment of the persistently infected cells, is sensitive to the
Intron A. Taken together, these data further suggest that the
resistant virus populations, emerging after treatment of the
persistent virus infection with .beta.-D-2'-CH.sub.3-riboC, can be
eliminated by subsequent treatment with the Intron A.
[0533] This invention has been described with reference to specific
embodiments. Variations and modifications of the invention, will be
obvious to those skilled in the art from the foregoing detailed
description of the invention.
Sequence CWU 1
1
77161DNAPestivirus sp. 1aagtatatat aagaaatggg cagagaggga ccggccagcc
agacacaagt gctggcaaca 60g 61232DNAPestivirus sp. 2aagtatatat
aagaaatggg cagagaggga cc 32332DNAPestivirus sp. 3agtatatata
agaaatgggc agagagggac cg 32432DNAPestivirus sp. 4gtatatataa
gaaatgggca gagagggacc gg 32532DNAPestivirus sp. 5tatatataag
aaatgggcag agagggaccg gc 32632DNAPestivirus sp. 6atatataaga
aatgggcaga gagggaccgg cc 32732DNAPestivirus sp. 7tatataagaa
atgggcagag agggaccggc ca 32832DNAPestivirus sp. 8atataagaaa
tgggcagaga gggaccggcc ag 32932DNAPestivirus sp. 9atataagaaa
tgggcagaga gggaccggcc ag 321032DNAPestivirus sp. 10ataagaaatg
ggcagagagg gaccggccag cc 321132DNAPestivirus sp. 11taagaaatgg
gcagagaggg accggccagc ca 321232DNAPestivirus sp. 12aagaaatggg
cagagaggga ccggccagcc ag 321332DNAPestivirus sp. 13agaaatgggc
agagagggac cggccagcca ga 321432DNAPestivirus sp. 14gaaatgggca
gagagggacc ggccagccag ac 321532DNAPestivirus sp. 15aaatgggcag
agagggaccg gccagccaga ca 321632DNAPestivirus sp. 16aatgggcaga
gagggaccgg ccagccagac ac 321732DNAPestivirus sp. 17atgggcagag
agggaccggc cagccagaca ca 321832DNAPestivirus sp. 18tgggcagaga
gggaccggcc agccagacac aa 321932DNAPestivirus sp. 19gggcagagag
ggaccggcca gccagacaca ag 322032DNAPestivirus sp. 20ggcagagagg
gaccggccag ccagacacaa gt 322132DNAPestivirus sp. 21gcagagaggg
accggccagc cagacacaag tg 322232DNAPestivirus sp. 22cagagaggga
ccggccagcc agacacaagt gc 322332DNAPestivirus sp. 23agagagggac
cggccagcca gacacaagtg ct 322432DNAPestivirus sp. 24gagagggacc
ggccagccag acacaagtgc tg 322532DNAPestivirus sp. 25agagggaccg
gccagccaga cacaagtgct gg 322632DNAPestivirus sp. 26gagggaccgg
ccagccagac acaagtgctg gc 322732DNAPestivirus sp. 27agggaccggc
cagccagaca caagtgctgg ca 322832DNAPestivirus sp. 28gggaccggcc
agccagacac aagtgctggc aa 322932DNAPestivirus sp. 29ggaccggcca
gccagacaca agtgctggca ac 323032DNAPestivirus sp. 30gaccggccag
ccagacacaa gtgctggcaa ca 323129DNAPestivirus sp. 31ggccagccag
acacaagtgc tggcaacag 293261DNAHepatitis C virus 32agaactgcgg
ctatcgccgg tgccgcgcga ccggtgtact gacgaccagc tgcggtaata 60c
613332DNAHepatitis C virus 33agaactgcgg ctatcgccgg tgccgcgcga cc
323432DNAHepatitis C virus 34gaactgcggc tatcgccggt gccgcgcgac cg
323532DNAHepatitis C virus 35aactgcggct atcgccggtg ccgcgcgacc gg
323632DNAHepatitis C virus 36actgcggcta tcgccggtgc cgcgcgaccg gt
323732DNAHepatitis C virus 37ctgcggctat cgccggtgcc gcgcgaccgg tg
323832DNAHepatitis C virus 38tgcggctatc gccggtgccg cgcgaccggt gt
323932DNAHepatitis C virus 39gcggctatcg ccggtgccgc gcgaccggtg ta
324032DNAHepatitis C virus 40cggctatcgc cggtgccgcg cgaccggtgt ac
324132DNAHepatitis C virus 41ggctatcgcc ggtgccgcgc gaccggtgta ct
324232DNAHepatitis C virus 42gctatcgccg gtgccgcgcg accggtgtac tg
324332DNAHepatitis C virus 43ctatcgccgg tgccgcgcga ccggtgtact ga
324432DNAHepatitis C virus 44tatcgccggt gccgcgcgac cggtgtactg ac
324532DNAHepatitis C virus 45atcgccggtg ccgcgcgacc ggtgtactga cg
324632DNAHepatitis C virus 46tcgccggtgc cgcgcgaccg gtgtactgac ga
324732DNAHepatitis C virus 47cgccggtgcc gcgcgaccgg tgtactgacg ac
324832DNAHepatitis C virus 48gccggtgccg cgcgaccggt gtactgacga cc
324932DNAHepatitis C virus 49ccggtgccgc gcgaccggtg tactgacgac ca
325032DNAHepatitis C virus 50cggtgccgcg cgaccggtgt actgacgacc ag
325132DNAHepatitis C virus 51ggtgccgcgc gaccggtgta ctgacgacca gc
325232DNAHepatitis C virus 52gtgccgcgcg accggtgtac tgacgaccag ct
325332DNAHepatitis C virus 53tgccgcgcga ccggtgtact gacgaccagc tg
325432DNAHepatitis C virus 54gccgcgcgac cggtgtactg acgaccagct gc
325532DNAHepatitis C virus 55ccgcgcgacc ggtgtactga cgaccagctg cg
325632DNAHepatitis C virus 56cgcgcgaccg gtgtactgac gaccagctgc gg
325732DNAHepatitis C virus 57gcgcgaccgg tgtactgacg accagctgcg gt
325832DNAHepatitis C virus 58cgcgaccggt gtactgacga ccagctgcgg ta
325932DNAHepatitis C virus 59gcgaccggtg tactgacgac cagctgcggt aa
326032DNAHepatitis C virus 60cgaccggtgt actgacgacc agctgcggta at
326132DNAHepatitis C virus 61gaccggtgta ctgacgacca gctgcggtaa ta
326232DNAHepatitis C virus 62accggtgtac tgacgaccag ctgcggtaat ac
32639PRTArtificialHIGHLY CONSERVED CONSENSUS SEQUENCE OF DOMAIN B
OF THE RNA POLYMERASE REGION OF FLAVIVIRIDAE 63Xaa Arg Xaa Ser Gly
Xaa Xaa Xaa Thr1 56414PRTPestivirus sp. 64Lys Arg Pro Arg Val Ile
Gln Tyr Pro Glu Ala Lys Thr Arg1 5 10656PRTPestivirus sp. 65Asp Thr
Lys Ala Trp Asp1 56610PRTPestivirus sp. 66Ser Gly Gln Pro Asp Thr
Ser Ala Gly Asn1 5 10673PRTPestivirus sp. 67Gly Asp
Asp1684PRTPestivirus sp. 68Glu Ala Gly Lys1694PRTPestivirus sp.
69Cys Ser Arg Asp17013PRTHepatitis C virus 70Cys Arg Ala Ser Gly
Val Leu Thr Thr Ser Cys Gly Asn1 5 107113PRTHepatitis C virus 71Cys
Arg Ala Ser Gly Val Leu Thr Thr Ser Cys Gly Asn1 5
107213PRTPestivirus sp. 72Gln Arg Gly Ser Gly Gln Pro Asp Thr Ser
Ala Gly Asn1 5 107313PRTPestivirus sp. 73Gln Arg Gly Ser Gly Gln
Pro Asp Thr Ser Ala Gly Asn1 5 107413PRTHepatitis G virus 74Cys Arg
Ser Ser Gly Val Leu Thr Thr Ser Ala Ser Asn1 5 107513PRTGBV-A-like
virus 75Cys Arg Ser Ser Gly Val Tyr Thr Thr Ser Ser Ser Asn1 5
107613PRTFlavivirus sp. 76Gln Arg Gly Ser Gly Gln Val Val Thr Tyr
Ala Leu Asn1 5 107713PRTFlavivirus sp. 77Gln Arg Gly Ser Gly Gln
Val Gly Thr Tyr Gly Leu Asn1 5 10
* * * * *