U.S. patent application number 14/046114 was filed with the patent office on 2014-09-04 for methods for detecting a polymorphism in the nfkb1 gene promoter.
This patent application is currently assigned to THE JOHNS HOPKINS UNIVERSITY. The applicant listed for this patent is The Johns Hopkins University. Invention is credited to Theodore M. Bayless, Steven R. Brant, Amir Karban, Esteban Mezey, Franklin Nouvet, Toshihiko Okazaki, James J. Potter.
Application Number | 20140249303 14/046114 |
Document ID | / |
Family ID | 46048337 |
Filed Date | 2014-09-04 |
United States Patent
Application |
20140249303 |
Kind Code |
A1 |
Brant; Steven R. ; et
al. |
September 4, 2014 |
METHODS FOR DETECTING A POLYMORPHISM IN THE NFKB1 GENE PROMOTER
Abstract
The present invention discloses a functional relationship
between a recognized disease condition and a polymorphism in the
nucleotide factor kappa B promoter (NFKB1). This relationship
provides a platform for methods of altering promoter activity and
for determining similar relationships between specific pathologies
and identified polymorphisms. A statistically significant risk of
developing ulcerative colitis was shown to be correlated with the
presence of an ATTG insertion/deletion in the NFKB1 promoter and is
likely to apply also to a variety of other inflammatory
diseases.
Inventors: |
Brant; Steven R.;
(Reisterstown, MD) ; Karban; Amir; (Baltimore,
MD) ; Nouvet; Franklin; (Severn, MD) ;
Bayless; Theodore M.; (Baltimore, MD) ; Potter; James
J.; (Baltimore, MD) ; Mezey; Esteban;
(Baltimore, MD) ; Okazaki; Toshihiko; (Baltimore,
MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Johns Hopkins University |
Baltimore |
MD |
US |
|
|
Assignee: |
THE JOHNS HOPKINS
UNIVERSITY
Baltimore
MD
|
Family ID: |
46048337 |
Appl. No.: |
14/046114 |
Filed: |
October 4, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13290678 |
Nov 7, 2011 |
|
|
|
14046114 |
|
|
|
|
10818037 |
Apr 5, 2004 |
8071304 |
|
|
13290678 |
|
|
|
|
60460438 |
Apr 5, 2003 |
|
|
|
Current U.S.
Class: |
536/23.5 ;
536/24.1; 536/24.31 |
Current CPC
Class: |
C12N 15/113 20130101;
C12Q 1/6883 20130101; A61P 29/00 20180101; C12Q 2600/156
20130101 |
Class at
Publication: |
536/23.5 ;
536/24.31; 536/24.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12N 15/113 20060101 C12N015/113 |
Goverment Interests
[0002] This invention was supported in part by a grant from the
National Institutes of Health DK58189. The United States Government
has rights in the invention.
Claims
1. An isolated polynucleotide probe for detecting a functional
polymorphism in a human NFKB1 promoter, comprising a nucleic acid
segment that binds to the functional polymorphic allele position in
the promoter but does not bind to wildtype NFKB promoter
allele.
2. An isolated polynucleotide probe for detecting an ATTG D allele
polymorphism of a human NFKB1 promoter, wherein said probe
specifically binds to the ATTG D allele but exhibits little or no
binding to the ATTG W allele of the NFKB1 promoter.
3. An isolated polynucleotide probe for detecting an ATTG W
polymorphism in a mammalian NFKB1 promoter, wherein said probe
specifically binds to the ATTG W allele of said promoter but
exhibits little or no binding to the ATTG D allele of the NFKB1
promoter.
4. The isolated polynucleotide probe of claim 2, which has an
oligonucleotide sequence of about 10-30 nucleotides complementary
to a NFKB1 promoter region comprising an ATTG D allele.
5. The isolated polynucleotide probe of claim 2 wherein the ATTG D
allele polymorphism is a -94 ins/del ATTG in SEQ ID NO:1.
6. The isolated polynucleotide probe of claim 2 selected from the
group consisting of SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5.
7. The isolated polynucleotide probe of claim 3 that has the
sequence of SEQ ID NO:2.
8. The isolated polynucleotide probe of claim 2 or claim 3 further
comprising a detectable label.
9. The isolated polynucleotide probe of claim 8 wherein the
detectable label is selected from the group consisting of a
fluorescent, colorimetric, radio-, and antibody label.
10. The isolated polynucleotide probe of claim 9 wherein the label
is a radioactive label.
11. The isolated oligonucleotide probe of claim 3 wherein the
promoter is a human NFKB1 promoter.
12. The isolated oligonucleotide probe of claim 2 wherein the
ATTG-D allele is an ATTG singlet polymorphism at position -94 of
SEQ ID NO:1.
13. The isolated oligonucleotide probe of claim 3 wherein the
ATTG-W allele is a duplet polymorphism at position -94 of SEQ ID
NO:1.
14-23. (canceled)
24. A kit for detecting a -94ins/del ATTG polymorphism in a NFKB1
promoter, said kit comprising at least one oligonucleotide probe
that selectively hybridizes to a -94delATTG, optionally at least
one oligonucleotide probe that selectively hybridizes to a
-94insATTG polymorphism, and directions for use.
25. The kit of claim 24 wherein the oligonucleotide probe is
detectably labeled.
26. The kit of claim 25 wherein the detectable label is a
fluorescent, radio-, antibody or colorimetric label.
27. The kit of claim 25 wherein the oligonucleotide probe for
detecting the -94delATTG polymorphism is selected from the group
consisting of SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.
28. The kit of claim 25 wherein the oligonucleotide probe for
detecting the -94insATTG polymorphism is a probe having the
sequence of SEQ ID NO:5.
29-35. (canceled)
36. An isolated human NFKB1 promoter gene comprising a nucleic acid
sequence that selectively binds to SEQ ID NO:4.
37. The promoter of claim 35 that selectively binds to SEQ ID
NO:5.
38. The promoter of claim 35 that comprises a -94del ATTG deletion
in SEQ ID NO:1.
39. The promoter of claim 35 that comprises an ATTG (SEQ ID NO:1
from position -91 to position -96) insertion/deletion.
40. The promoter gene of claim 35 consisting essentially of SEQ ID
NO: 1 and complements thereof.
41. An isolated oligonucleotide comprising a contiguous nucleotide
sequence of human NKFB1 promoter comprising an ATTG singlet as a
polymorphism -94ins/delATTG of SEQ ID NO:1 wherein said sequence
maintains NKFB1 promoter function.
42-43. (canceled)
Description
RELATED APPLICATIONS
[0001] This application a continuation of U.S. application Ser. No.
13/290,678, filed Nov. 7, 2011, which is a divisional of U.S.
patent application Ser. No. 10/818,037, filed Apr. 5, 2004, now
U.S. Pat. No. 8,071,304, issued Dec. 6, 2011, which claims benefit
of U.S. Provisional Patent Application Ser. No. 60/480,639 filed
Apr. 4, 2003, the entire contents of which are incorporated herein
by reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The field of the invention relates to nucleotide factor
kappa B promoter and to methods of controlling its activity in
connection with a wide range of diseases. The invention provides
methods of treating these diseases and provides protocols for
identifying individuals who are susceptible to or at increased risk
for an adverse response to stress, injury or infection. In
particular, the invention relates to inflammatory diseases and to
identification of at risk individuals who exhibit a singular
polymorphism in the nucleotide factor kappa-B (NFKB) promoter. The
polymorphism is functionally related to a high risk of disease.
[0005] 2. Background
[0006] Nuclear Factor-kB
[0007] NF-kB transcription factors play an important role in
regulating basic cellular functions. Abnormal NF-kB activities have
been implicated in numerous disease states such as cancers, AIDS,
autoimmunity and neurodegenerative diseases. Studies in mice
indicate that lack of both p50 and p105 caused by deletion of the
nfkb1 gene does not interfere with normal development but does
alter normal immune response to pathological infections (Lin and
Kobayashi, 2003).
[0008] Nuclear Factor-kB is a major transcription regulator of
immune response, apoptosis and cell-growth control genes and is
also an important mediator of the chronic inflammation associated
with a wide range of diseases and pathological conditions,
including cancer, infection, response to biological stressors and,
particularly, autoimmune diseases (Baldwin, 2001). Inflammatory
Bowel disease (IBD) in particular is thought to be associated with
NFKB (Schreiber, 1998). IBD includes Crohn's Disease (CD) and
ulcerative colitis (UC).
[0009] NF-.kappa.B is involved in the expression of several
cytokines and adhesion molecules. Cytokines, for example, are
produced by immune cells, and some induce proliferation and
differentiation of specific cells while others induce an acute
phase response in inflammation. Inflammation may be induced by
acute phase response proteins such as angiotensinogen, serum
amyloid protein, .alpha.1 acid glycoprotein, C3 complement or
complement factor B. There is thus an important role of NF-.kappa.B
modulating cytokine expression at the gene level.
[0010] NF-.kappa.B is thought to be involved in a wide variety of
human diseases, including atherosclerosis, asthma, arthritis,
cachexia, cancer, diabetes, euthyroid sick syndrome, AIDS,
inflammatory bowel disease and stroke.
[0011] In most cells before stimulation, NF-.kappa.B primarily
resides in the cytoplasm in inactive complexes through association
with a sequestering inhibitory protein, termed I.kappa.B. A wide
range of stimuli, including bacterial and viral products, cytokines
and oxidant-free radicals, activate NF-.kappa.B. These stimuli
promote NF-.kappa.B nuclear translocation by a mechanism that
involves I.kappa.B phosphorylation and the ubiquitin-proteosome
pathway. This phosphorylation appears to target I.kappa.B for
degradation and leads to its dissociation from the NF-.kappa.B
complex and subsequent translocation of NF-.kappa.B to the nucleus.
There, active NF-.kappa.B binds to genomic DNA at promoter regions
and thereby regulates gene transcription.
[0012] Inappropriate activation of NF-.kappa.B has been implicated
in inflammation associated with a variety of human diseases and
pathologic conditions, among them asthma, inflammatory arthritis,
septic shock, lung fibrosis, diabetes, cancer, AIDS,
atherosclerosis, stroke and IBD (Baldwin, 2001). Furthermore,
several anti-inflammatory and anti-cancer drugs work in part
through inhibition of NF-.kappa.B activation. For example, aspirin
and glucocorticoids inhibit NF-.kappa.B (15,16). Consistent with
NF-.kappa.B regulation of genes involved in the immune and
inflammatory responses, mice null for several of the NF-.kappa.B
subunits show defects in clearing bacterial infection along with
defects in B-cell and T-cell functions.
[0013] NF-.kappa.B is thought to play a central pathogenic role in
chronic intestinal inflammation. Activated NF-.kappa.B was
increased and found localized to the macrophages and epithelial
cells in the inflamed intestinal mucosa of CD and UC patients using
immunohistochemistry methods. Schreiber et al. (1998) have found
that CD and UC patients have increased NF-.kappa.B activity in
intestinal lamina propria cells. Additionally, the therapeutic
properties of mesalazine and sulfasalazine (the most common
specific medical therapies for mild to moderate UC) rely in part on
inhibition of NF-.kappa.B activation. Three CD associated mutations
in the NOD2/CARD15 gene on chromosome 16 all have a defect in their
ability to activate NF-.kappa.B. This may cause a defect in the
innate immune system's ability to protect the gut against invasive
bacteria (Hisamatsu, Suzuki et al., 2003).
Inflammatory Bowel Diseases
[0014] Ulcerative colitis (UC) and Crohn's disease (CD) are
idiopathic, chronic, frequently disabling, inflammatory bowel
diseases (IBD). UC is characterized by mucosal inflammation limited
to the colon, always involving the rectum and a variable extent of
the more proximal colon in a continuous manner. CD inflammation is
transmural, most often discontinuous and may involve any portion of
the gastrointestinal tract but most commonly involves the distal
ileum. The prevalence of IBD in the United States is
200-300/100,000 with a similar prevalence for UC and CD. IBD is
considered a complex genetic disorder involving multiple genes of
relatively low penetrance, since the familial patterns of
inheritance do not conform to simple Mendelian models. Overall,
10-20% of individuals with IBD report one or more relatives with
IBD. Relatives of CD patients have a 10-fold risk of developing CD
and relatives of UC patients have an 8-fold risk of developing UC.
However, these diseases appear to be genetically related, as
relatives of CD patients have a 4-fold risk of developing UC and
relatives of UC patients have a 2-fold risk of developing CD.
Ulcerative Colitis (UC)
[0015] A genetic contribution to the pathogenesis of UC has
remained largely unclear. While genome-wide searches have
identified several loci in linkage with the disease, case-control
studies have only shown a reproducible association between UC and
HLA class II genes, especially DRB1*0103 and DRB1*15 (Brant,
Okazaki, 2003). Most studies have focused on HLA class II genes,
although there is an increasing interest in the role of cytokines
in UC pathogenesis and on the polymorphic genes that may influence
cytokine secretion.
NFKB Gene
[0016] NFKB1 may be the first of perhaps several modest polymorphic
risk genes that are involved with inflammation pathways associated
with UC. Other cytokine regulators of the pathway that have been
shown to have functional polymorphisms, and that ultimately
NF-.kappa.B protein activation, include interleukin 1 receptor
antagonist (IL1RN) and I.kappa.B-like gene (NFKBIL1). There is
conflicting evidence for an association of allele 2 of IL1RN, the
gene that encodes the interleukin 1 receptor antagonist and
preliminary evidence of an association of NFKBIL1 with UC (De la
Concha, Fernandez-Arquero, et al., 2000). An association of the
TNF(-857C) promoter polymorphism with IBD (both CD and UC) has also
been reported (van Heel, et al., 2002).
[0017] NFKB1 gene, located at chromosome 4q24 is an important
candidate gene for inflammatory bowel disease. The encoded Nuclear
Factor-KB (NF-.kappa.B) proteins are a family of transcription
factors that regulate various biological defense processes, most
notably innate and adaptive immune responses, acute phase reaction
and apoptosis. There are five members of the NF-.kappa.B family in
mammals: p50/p105, p65/RelA, c-Rel, RelB and p52/p100. Although
many dimeric forms of NF-.kappa.B have been detected, the major
form of NF-.kappa.B is a heterodimer of the p50 and p65/RelA
subunits, encoded by the genes NFKB1 and NFKB3, respectively. Human
NFKB1 encodes two proteins, a 105 kDa, non DNA-binding, cytoplasmic
molecule (p105), and a 50 kDa DNA-binding protein (p50) that
corresponds to the N-terminus of p105. The NFKB1 gene spans 156 kb
and has 24 exons with introns varying between 40 000 and 323 bp in
length (FIG. 1).
[0018] NFKB1 has also been implicated in numerous inflammatory
diseases and risk factors for immune-mediated conditions. An
association has been reported between an NFKB1 microsatellite and
type I diabetes in one instance. No associations have been found
with NFKB1 and the exon 12+77C>T polymorphism for multiple
sclerosis or Parkinson's disease (Wintermeyer, Riess, et al.,
2002). LD is likely incomplete between the exon 12 SNP and the
disclosed -94del/insATTG polymorphism. No functional NFKB1 genetic
polymorphisms other than the -94del/insATTG have been
described.
Deficiencies in the Art
[0019] There is a distinct need to identify and understand the role
of genetic factors in the development of human disease, and to
identify and treat those at risk for disease. Unfortunately, for
many conditions, early detection is not possible so that early
stage intervention and treatment opportunities are not available.
Identification of a direct functional relation between atypical
gene nucleotide sequences in polymorphic promoters and abnormal
biological function as manifested in various diseases has yet to be
established. Determination and location of the polymorphisms will
allow development of diagnostic probes for clinical disorders.
[0020] Establishment of a functional relation between a promoter
gene polymorphism and a pathology would provide new opportunities
for intervention at the most basic stage of disease development.
Interventions could be developed based on gene therapies, on
alteration of transcription factors or on modification of
identified nuclear binding proteins. Clearly, it would be desirable
to control abnormal gene function at the gene level rather than far
downstream in a damaging cascade of intertwined metabolic
cycles.
SUMMARY OF THE INVENTION
[0021] The present invention addresses several issues that pertain
to the understanding of the relationship between genetic
polymorphisms and human disease. It will now be possible to develop
treatment for pathologies associated with identified polymorphisms
and, importantly, to understand where and how to detect
polymorphisms that directly affect development of such
pathologies.
[0022] As used herein, it is understood that the "wildtype" NFKB1
promoter is defined as the published sequence (SEQ ID NO:1) and
shown in FIG. 1. It has a polymorphic repeat ATTG sequence referred
to as either a duplet or a doublet. The polymorphism repeat
sequence is interchangeably referred to as (1) Wildtype allele; (2)
ATTG duplet; (3) allele W; or (4) -94insATTG. The polymorphism is
found at position -94 (FIG. 1).
[0023] The inventors have found a singlet ATTG polymorphism that is
functionally related to a disease condition. This polymorphism is
variously referred to as: (1) Allele D; (2) deletion allele;
-94delATTG; and (4) ATTG singlet. The polymorphism is a variant at
position -94 (see FIG. 1) and differs from wildtype in that the
indicated nucleotides at position -94 have been deleted and the
ATTG bases inserted. The insertion may be referred to as a
-94ins/delATTG.
[0024] The inventors have discovered a NFKB1 promoter polymorphism
that results in altered promoter activity. The inventors have
directly linked a specific polymorphism in this promoter to a
well-characterized disease, making this the first demonstration of
a functionally related polymorphism in the human NFKB1 promoter.
Significantly, NFKB1 promoter activity is associated with a wide
spectrum of human diseases and is considered a veritable linchpin
in the biological cascades that are involved in such conditions as
inflammation and cell death (apoptosis).
[0025] In one aspect of the invention, a functional change in the
NFKB1 protein has been highly correlated with one form of
inflammatory bowel disease, particularly with ulcerative colitis.
Identification of an ATTG polymorphism now provides the basis for
the identification of individuals at risk for developing, or in
early stages of undetected, ulcerative colitis. This is the first
instance of an inheritable genetic trait that is associated with a
polymorphism in the NFKB1 promoter.
[0026] A four-base pair ATTG insertion/deletion polymorphism has
been identified in the human NFKB1 promoter sequence. The NFKB1
gene encodes human nuclear factor-Kappa B (NFkB) protein, that
exists as either of two subunits, the p105 subunit and the p50
subunits. The insertion polymorphism results in two ATTG sequences
in tandem (doublet) compared to only one (singlet) found in the
published reference sequence. Individuals with only singlet ATTG
sequence are at greater risk for developing ulcerative colitis than
those with a duplet insertion.
[0027] Oligonucleotides were designed that matched either the ATTG
deletion or insertion alleles of the -94del/insATTG polymorphism
(FIG. 1). Therefore, these oligonucleotides contained either a
single ATTG sequence or the ATTG douplet sequence and the 6
nucleotides of the promoter immediately 5' and the 6 nucleotides
immediately 3' of the ATTG singlet or doublet. Additionally, 5' and
3' overhang sequences were added to radioactively label the
oligomer. Thus the oligonucleotides were identical except for
having either one or two ATTG sequences in tandem in the center of
each oligonucleotide.
[0028] The duplet double-stranded oligonucleotide-bound mammalian
nuclear proteins, from rat and humans were as determined by
electrophoretic shift assays (EMSA). Nuclear protein binding to the
duplet oligonucleotide was inhibited in a dose dependent manner by
an NF-kappaB1 consensus oligonucleotide (SEQ ID NO:62). In
contrast, the singlet oligonucleotide showed no significant binding
to nuclear proteins of similar mobility. The ATTG
insertion/deletion (doublet/singlet) NFKB1 promoter polymorphism
therefore is a determinant of nuclear protein binding to the
promoter, probably a member of the NFkB gene family.
[0029] It is known that the NF-kB protein regulates the activity of
the NFKB1 gene by interaction of NFkB gene with the NFKB1 promoter.
The inventors have discovered that ATTG insertion/deletion promoter
polymorphism is an important determinant of nuclear protein
binding, and appears to specifically affect active NF-kB nuclear
protein binding to the promoter. The ATTG insertion/deletion thus
determines auto-regulation of NF-kB protein of its own (NFKB1) gene
transcription.
[0030] Individuals who carry only the NFKB1 singlet are not
expected to have the same degree of nuclear protein-NFKB1 promoter
interaction in comparison with individuals whose chromosomes have
the ATTG doublet NFKB1 polymorphism. This has been amply supported
by the data presented.
[0031] The -94ins/delATTG NKFB1 promoter polymorphism is a highly
significant discovery, not only because it has been shown to be a
determinant in developing ulcerative colitis, but also because it
is likely to be involved in other NF-.kappa.B mediated complex
genetic disorders. The inventors have demonstrated that this
polymorphism has functional attributes, making it highly likely to
be an important risk factor for immune mediated, complex genetic
disorders as well as other diseases where the NFKB1 gene products,
p50 or p105, play a role. Thus, NFKB1 associated functional genetic
determinants may determine risk of their development as well.
[0032] A particular embodiment of the invention relates to a new
method of identifying individuals at risk for one of the
inflammatory diseases, inflammatory bowel disease and, in
particular, the ulcerative colitis phenotype. This comprises first
determining the presence of the particular alleles (genotype) of
the ATTG ins/del polymorphism in the NKFB1 promoter. Individuals
that carry the -94delATTG allele and especially individuals
homozygous for this allele have a statistically greater risk of
developing inflammatory bowel disease and, in particular,
ulcerative colitis than individuals who do not have the -94ATTG
ins/del polymorphism.
[0033] The invention provides a new methods for assessing risk or
presence of disease, or dissecting disease pathophysiology by
measuring binding of cellular nuclear proteins to nucleic acid
segments isolated from the NFKB1 promoter. It is contemplated that
as other polymorphisms of NFKB1 promoter are identified and
associated with a disease manifestation, the NFKB1 polymorphisms
may exhibit decreased binding to nuclear proteins compared with
binding to wild type NFKB1 promoter that does not show this
polymorphism. Increased risk of developing the disease or having an
early stage of the disease could be determined by measuring
differences in binding properties.
[0034] It is further contemplated that individuals having symptoms
of inflammatory bowel disease can be treated with appropriate
compositions that enhance binding of nuclear proteins to NKFB1
promoter. Such compositions can be formulated in pharmaceutically
acceptable media suitable for human administration, preferably by
oral administration. In cases of ulcerative colitis, the enhancers
should be targeted to the colon where the effects of UC are
manifest. Effective formulations and delivery vehicles of the
appropriate compositions can be readily devised from well-known
sources and available materials.
[0035] It is also contemplated that one can use gene therapy to
identify a vector such as an attenuated virus that contains
-94insATTG allelic sequences and will deliver a corrective NFKB1
gene or the corrective promoter sequence of the NFKB1 gene to cells
in the targeted organ (such as the colon in persons with UC).
Alternatively, stabilized olignonucleotides can be used to bind
specifically to the NFKB1 promoter in-vivo to alter its activity in
persons with NFK1 promoter genetically associated diseases, or
persons at risk for such diseases. Such oligonucleotides can also
be ligated to specific molecules that will alter NFKB1 promoter
activity in order to specifically target these molecules to the
ATTG polymorphic region and perhaps to activate binding at the 3'
kappaB site or block binding by NFKB1-PIP. If an inhibitory element
of NFKB1 is identified that binds a nuclear protein, inhibition of
NFKB1 can be countered in persons with NFKB1 -94delATTG alleles by
using antisense RNAs to bind to this element to block further
down-regulation of NFKB1 promoter activity.
[0036] In another aspect of the invention, polynucleotide sequences
are provided to allow for the preparation of relatively short DNA
(or RNA) sequences that have the ability to specifically hybridize
to the -94delATTG allele of the NFKB1 promoter. In such aspects,
nucleic acid probes of an appropriate length are prepared based on
a consideration of a selected NFKB1 gene sequence. The ability of
such nucleic acid probes to specifically hybridize to the
-94delATTG sequence allows use in a variety of assays for detecting
the presence of complementary sequences in a given sample.
[0037] Preferred nucleic acid sequences employed for hybridization
probes include sequences that are complementary to at least a 10 to
30 or so long nucleotide stretch of the -94 delATTG del/ins region
of the NFKB1 promoter, as exemplified by the sequences shown as SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5. A size of at
least 10 nucleotides in length helps to ensure that the fragment
will be of sufficient length to form a duplex molecule that is both
stable and selective. Molecules having complementary sequences over
stretches greater than 10 bases in length are generally preferred
in order to increase stability and selectivity of the hybrid, and
thereby improve the quality and degree of specific hybrid
molecules. One generally prefers to design nucleic acid molecules
having gene-complementary stretches of 15 to 20 nucleotides. Longer
molecules may be prepared by chemical synthesis of the
fragment.
[0038] One may desire to employ varying conditions of hybridization
to achieve different degrees of selectivity of the probe toward the
target sequence. To obtain a high degree of selectivity, relatively
stringent conditions to form the hybrids should be used; for
example, low salt and/or high temperature conditions such as
provided by 0.02M-0.15M NaCl at temperatures of 50.degree. C. to
70.degree. C. These conditions are particularly selective and
tolerate little, if any, mismatch between the probe and the target
sequence.
[0039] In general, one may employ hybridization probes both as
reagents in solution hybridization and in embodiments employing a
solid phase. In embodiments involving a solid phase, the sample
containing the target DNA (or RNA) is adsorbed or affixed to a
selected matrix. The fixed single-stranded nucleic acid is then
subjected to specific hybridization under desired conditions. The
conditions depend, among others, on the criteria required,
depending on the GC content, target region of the nucleic acid,
and, importantly, the size of the probe. Following washing of the
hybridized surface to remove nonspecifically bound probe molecules,
specific hybridization is detected, or can be quantified, from the
properties of the label, depending on the type of label
employed.
[0040] Several effective probes are contemplated; however, each
will be capable of detecting a -94delATTG or a -94insATTG
polymorphism in a human NFKB1 promoter. A preferred probe will
selectively bind at the -94delATTG D allele of the kB promoter. The
probe or probes selectively bind to kB promoter regions containing
a singlet ATTG or ATTGATTG polymorphism or at least bind to that
region with little interference from binding to regions that lack
the polymorphism. Binding determination can be done by well-known
methods, as discussed, generally under stringent hybridization
conditions in order to preclude weak and nonspecific
interaction.
[0041] The probes of the invention may more readily be detected by
employing a detectable label, such as radioactive, enzymatic or
other ligands such as avidin/biotin, which provide a detectable
signal. In certain embodiments, an enzyme tag such as urease,
alkaline phosphatase or peroxidase, instead of radioactive labels
may be used. Antibody or fluorescent labels may also be
conveniently employed. In preferred embodiments, a fluorescent
label such as luciferase is employed.
[0042] In a related aspect, the present invention contemplates a
diagnostic assay kit for detecting the presence of an -94delATTG
polymorphism from a biological sample, particularly from humans.
Such a kit will contain a specific -94delATTG allele probe of the
present invention and may further contain reagents for detecting an
interaction between the probe and the target gene allele. The probe
is preferably labeled with a fluorescent tag, although other
well-known detectable labels may be suitable. Exemplary probes
designed to be highly specific for binding to the ATTG singlet
ins/del polymorphic region are SEQ ID NO:4 and SEQ ID NO:5.
[0043] In a preferred embodiment the kit will include at least one
probe specific for the ATTG singlet polymorphism and at least one
probe that selectively binds the ATTG duplet. Each probe may be
labeled with a different label so that the binding target can be
distinguished.
[0044] Also within the scope of the invention are methods of
treating individuals who exhibit symptoms of inflammatory bowel
disease, such as ulcerative colitis. Treatments include
administration of pharmaceutically acceptable compositions
containing substances that will promote binding of cellular nuclear
proteins and particularly NFKB1-PIP to the disclosed ATTG
polymorphic -94del NFKB1 allele. Such methods will apply equally
well to treating other diseases once the functional genetic
component has been identified as it has with the ATTG polymorphism
associated with UC.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1 shows the NFKB1 gene structure. The diagram for
genomic structure with the location of the 24 exons (top) and
sequence of the -740 bp 5' of exon 1 through +245 (bottom) are
shown. The transcription initiation site shown is the major site
identified by Ten, et al. (1992). The -94 ins/del ATTG polymorphism
is indicated in bold and large font. Pf(M) restrictions sites used
for genotyping and AP-1, kB and HIP-1 DNA binding motifs are
designated.
[0046] FIG. 2A-FIG. 2C show Electrophoretic Mobility Shift Assays
(EMSAs). The wildtype oligonucleotides (but not deletion
oligonucleotides) show specific binding to human colonic tissues
and epithelial culture cells. As illustrated in FIG. 2A, EMSA show
differential binding of nuclear proteins (NP) derived from two
human epithelial colonic cell lines, CaCo2 cells (`C`) or HT-29
cells (IT), to oligonucleotides of wildtype (`W`) or deletion
variants (`D` and `DL`). Sequence identities are given in (FIG.
2B). .sup.32P-labeled double-stranded oligonucleotides were
incubated with buffer (`dash`), or with NP extracts. (FIG. 2B).
[0047] EMSAs using oligonucleotides that span the promoter
polymorphic site reveal that strong binding to NP is observed with
the complete wildtype sequence and weak or non-detectable binding
with deletion or key mutation variants. NP derived from HeLa cells
was incubated with the 22 bp wildtype oligonucleotide (`W`, lane
1); or with 18 or 22 bp -94delATTG promoter polymorphism variants
(`D`, lane 2 or `DL`, lane 3, respectively); or with one of 3
mutant versions of the wildtype oligonucleotide (`Mut1, 2 or 3`).
(FIG. 2C) NP expressed in colon but not ileal tissues binds to
oligonucleotides of the wildtype NFKB1 promoter. EMSAs were
performed using NP extracts made from endoscopic mucosal biopsies
taken from normal colon and ileum. Equal amounts of NP were loaded
onto an 8% non-denaturing gel (samples done in duplicates). NP from
colon showed significantly greater binding to `W` oligonucleotides
than did NP from the ileum (compare lanes 1,2 versus lanes 7,8),
whereas NP from colon and ileum showed similar binding to `N`
oligonucleotides, that contain the canonical NF-.kappa.B p50/p65
protein binding consensus sequence (lanes 11,12 for colon and lanes
5,6 for ileum) used as a control. `D` oligonucleotides bind neither
deal nor colonic NP (lanes 3,4,9 and 10).
[0048] FIG. 3A and FIG. 3B represent the -94delATTG containing
luciferase construct showing significantly less luciferase activity
than the wild type construct. FIG. 3A is pGL3-W wild type promoter
construct (top) and pGL3-D, -94delATTG construct (bottom), which
were transiently transfected into HeLa and HT29 cells. FIG. 3B
shows relative luciferase activity for the NFKB1 pGLW (solid bars)
and pGL3-D (open bars) promoter (exon 1 constructs are shown at
baseline, and 6 hr and 24 hr following stimulation with
lipopolysaccharide (LPS, E. coli 055:B5 1 .mu.g/ml).
.sup.#P<=0.0005; *P<0.05.
[0049] FIG. 4 is an electromobility shift assay (EMSA) showing
binding properties of rat nuclear proteins to NF-kB1 promoter ATTG
deletion/insertion polymorphism. Nuclear proteins isolated from rat
liver extracts bind the NF-kB1 promoter polymorphism duplet ATTG,
but do not bind the NF-kB1 promoter polymorphism singlet ATTG.
Nuclear proteins isolated from rat liver extracts exhibit decreased
binding to the extended form of the singlet ATTG polymorphism of
the NF-kB1 promoter (extended by two nucleotides on each of the 5'
and 3' ends).
[0050] FIG. 4A is an EMSA showing the binding of various nuclear
extracts. HeLa cell nuclear extracts bind the duplet ATTG
polymorphism. Nuclear proteins from HeLa cell nuclear extracts do
not bind the singlet ATTG polymorphism. Nuclear proteins from HeLa
cell nuclear extracts bind the extended singlet ATTG polymorphism
to a lesser degree as compared to the duplet polymorphism. Other
nuclear proteins from human cell nuclear extracts as well as from
HeLa cell nuclear extracts bind equally to all three forms of the
ATTG polymorphism.
[0051] FIG. 5 shows oligonucleotide probe binding to CaCo2, HT29
and human colonic tissue.
[0052] FIG. 6 shows competition experiments using antibodies to
p50, p65, SP1, SP3, STAT and USF indicating that the bound probe
might be blocking antibody to protein. Identification of the bound
proteins employed EMSA
[0053] FIG. 7 shows fluorescent DNA sequence tracings of the
doublet and singlet ATTG and a tracing obtained from a
heterozygote.
DETAILED DESCRIPTION OF THE INVENTION
[0054] The invention is based on the discovery of a functional
relationship between a NFKB1 gene promoter polymorphism and a human
disease. The importance of the functional impact of a polymorphism
in the NFKB1 promoter is the effect observed on the promoter
activity. When NFKB1 protein binding to the NFKB1 gene promoter is
inhibited, overexpression of NFKB1 affects several pathways
involved in inflammatory response, particularly those related to
cytokines. Identification of a NFKB1 promoter with identified
functional polymorphisms now provides the capability to identify
individuals at risk for a wide variety of pathological function,
and to develop methods to restore normal promoter activity in those
individuals harboring such promoter polymorphisms.
[0055] NFKB1 encodes the genes for the p50 and p105 NF-.kappa.B
isoforms, ubiquitous transcription regulators important for
multiple diseases and pathological states associated with
inflammation and immunity, including inflammatory bowel disease
(IBD). NFKB1 is a gene suspected to be involved in IBD, and
particularly ulcerative colitis (UC), given the increased linkage
evidence observed for the region of chromosome 4q24 containing
NFKB1 in UC or mixed pedigrees, and given that an important mouse
colitis model links to the region of mouse nfkb1. Six nucleotide
variations detected from probands with increased linkage evidence
to the region were further analyzed. A 4 bp promoter polymorphism,
-94ins/delATTG, was chosen because it produced a relatively large
sequence change and because its location proximal to binding sites
important to promoter regulation.
[0056] Promoter-exon 1 constructs that contained the ATTG deletion
(D) allele showed significantly reduced promoter activity in vitro.
This was particularly pronounced following 24 h of exposure to LPS,
a potent activator of NF-.kappa.B. Additionally, nuclear protein
extracts from HT-29 human colonic epithelial cells and from HeLa
cell lines, and extracts from mucosal biopsies from normal human
colon tissues bound avidly and specifically to ATTG insertion (W)
containing oligonucleotides. Conversely, nuclear proteins bound
only weakly, or not at all, to ATTG deletion containing
oligonucleotides (D).
[0057] The results suggested that the -94ins/delATTG polymorphism:
(i) affects promoter activity of the NFKB1 gene, particularly
following stimulation of the innate immune system by bacterial cell
wall components (e.g. LPS); and (ii) contains nucleotides that,
depending on the specific allele, differentially bind to an
unidentified nuclear protein. Whether or not potential
up-regulation of NFKB1 promoter activity by nuclear protein binding
to the W and not the D allele accounts for the observed differences
in NFKB1 in vitro promoter activity or whether the differences in
activity is independent of this binding are not known. This may
involve the identification of the nuclear protein that binds well
to the W and not to the D oligonucleotides.
[0058] An important result of the cellular findings in the
disclosed genetic studies was the -94ins/delATTG polymorphism
evidenced from two independent functional assays, in vitro promoter
activity and differential nuclear protein binding, indicating that
the specific allele inherited has functional consequences. The
-94ins/delATTG polymorphism thus represents the first demonstration
of a functional NFKB1 polymorphism. Its association with diseases
(like UC, believed to be mediated by NF-.kappa.B) is therefore
significant because its presence can be used to identify
individuals not only exhibiting symptoms of these diseases but also
to determine those at risk for the disease.
[0059] Interestingly, the major locus, cdcsl, for the severe
colitis phenotype of C3H/HeJBir-IL10 knockout mice is located where
the mouse (nfkb1) homolog to human NFKB1 maps, and thus nfkb1 has
been previously proposed as a candidate gene for this mouse model
and NFKB1 as a candidate gene for human colitis. In a 1998 North
American genome-wide screen in multiplex IBD pedigrees, there was
evidence for linkage present on chromosome 4q24 where NFKB1 maps
(multipoint non-parametric logarithm of the odds, MLod=1.71,
P=2.5.times.10.sup.-3). Evidence for linkage in this region was
greater for the `mixed` families (containing at least one UC and
one CD patient); the uncorrected MLod was 2.76
(P=1.9.times.10.sup.-4). A British/German (Hampe, Schreiber, et
al., 1999) and a Canadian (Rioux, Silverberg, et al., 2000) IBD
genome-wide screens both found evidence to support linkage in the
same overall region, in UC sibling pairs and `all IBD` pedigrees,
respectively.
[0060] The -94ins/delATTG polymorphic alleles initially were tested
for association with UC, CD and IBD in 235 pedigrees containing one
or more affected offspring. Using several different analytic
schemes, the D allele was observed to be in LD with the UC
phenotype. However, the association was of borderline significance,
perhaps because of the limited sample size given the modest
transmission to non-transmission ratio. These findings were
strengthened by comparing the allele and genotype frequencies in
probands with those of controls. There was stronger evidence of D
allele association with UC using this method. The TDT results are
consistent with the case-control results, indicating that the
observed case-control association is unlikely to be secondary to
population stratification between cases and controls because the
TDT use of within family controls precludes this potential
problem.
[0061] The case-control association required separation of
non-Jewish and Jewish Caucasian cases and controls because it was
observed that allele frequencies were different for controls based
on ethnicity. The non-Jewish results were significant, yet the
Jewish results were not, perhaps secondary to small sample size
and/or a weaker genetic effect. Nonetheless, the trend of greater D
alleles in UC cases as compared to controls was similar for both
the Jewish and non-Jewish populations studied. It is more expected
for a potential functional polymorphic allele that associations
will be present for diseases independent of ethnicity. This finding
is not always observed, even for established associations; for
example, the functionally demonstrated 702Trp NOD2 allele (also
less common in Jewish than non-Jewish Caucasian patients) has been
observed to be even less common in Jewish CD patients than
controls. However, any significance of the NFKB1 promoter
polymorphism in the Jewish population remains uncertain, although
trends may be detected in a larger set of subjects.
[0062] The -94delATTG-UC association was replicated using an
independent, second set of non-Jewish UC cases and healthy
controls. The overall odds ratio (calculated from both sets of
samples) of the DD homozygote genotype was modest (odds ratio
1.59). The modest genotypic risk observed fits with models of
inheritance proposed for complex genetic disorders; multiple low
penetrant risk alleles of different genes have been hypothesized to
account for overall genetic risk (41). The weak linkage evidence
found in the family samples is not surprising (and may be even
greater than expected) given the low odds ratio of the risk
genotype. There can be other polymorphisms on other genes in the
region and even within non-coding regions of NFKB1 that may be
functional and contribute even greater risk to developing UC, yet
this does not invalidate the present observations that -94delATTG
is associated and has a functional effect.
[0063] The heterozygote (WD) genotype was not associated with IBD
risk. This indicates that a single W allele abrogates risk from
(and may be dominant over) the UC associated D allele.
[0064] In vitro promoter expression studies indicated that the D
allele may result in relatively decreased NFKB1 message and hence
decreased p50/p105 NF-.kappa.B protein production. This was
unexpected because it was in contrast to initial expectations in
view of the association of UC with increased levels of NF-.kappa.B.
Parallel findings have been observed for the CD associated NOD2
mutations: in vitro studies in NOD2 transfected cell lines show
that NOD2 mutations result in a decrease rather than an expected
increase in NF-.kappa.B activity (Bonen, Ogura, et al., 2003).
[0065] Recently, mutant NOD2 was shown to be defective in clearing
invasive bacteria in comparison to wild type NOD2 (Hisamatsu,
Suzuki, et al., 2003). Thus, one hypothesis is that poor activation
of NF-.kappa.B may weaken the normal cellular defenses against
intestinal bacteria by the innate immune system. This defect may
allow bacteria that cross the intestinal lumen to not be properly
cleared by the immune system, and hence contribute to on-going
intestinal inflammation characteristic of CD.
[0066] Thus decreased NFKB1 D allele gene expression appears to
cause a decrease in NF-kB p50/p65 heterodimers, major mediators of
inflammation, in turn affecting the ability of the colon to be
protected from colonic bacteria. Support for this concept is the
finding that p50 deficient mice have greater susceptibility to
infection from some (Listeria monocytogenes and Streptococcus
pneumoniae) but not all (Haemophilus influenza and Escherichia
coli) types of bacteria (Sha, Liou, et al., 1995).
[0067] Alternatively, reduced NFKB1 gene expression may result in
increased risk of UC because p50, unlike p65, does not contain a
transactivation domain and can in some cases inhibit inflammation.
p50 homodimers (also products of NFKB1) may be involved in blocking
p65 dimers from binding to promoters and activating genes involved
in inflammatory cascades (Erdman, Fox, et al., 2001). In mouse
macrophage cell lines, p50 over-expression was shown to inhibit
tumor necrosis factor-.alpha. (TNF-.alpha.) gene expression, and
the mechanism of p50 inhibition appears to depend on NF-.kappa.B
binding sites that have preferential affinity for p50 homodimers.
Overexpression of p50 homodimers has also been suggested as the
mechanism of LPS refractoriness following repetitive stimulation of
mononuclear phagocytes. Nonetheless, p50 may have dual roles as
p50-deficient mice are refractory to the induction of arthritis
models, and p50 alone can stimulate C-reactive protein expression,
although this induction is considerably less than p50/p65
heterodimer stimulation.
[0068] Additional polymorphisms or mutations in the promoter, exon
1 and exon 2 regions evaluated were not found to account for the
observed D association with UC. This was examined by sequencing
these same regions using DNA from an additional 12 unrelated
patients all with DD genotypes. No additional polymorphisms were
observed. Hence, including the seven D chromosomes reported in
Table 1, only the -94ins/delATTG and exon 1+252C>G polymorphisms
in 31 D containing chromosomes were found. Additionally, these two
polymorphisms are in near complete LD. The two most common
haplotypes (-94insATTG-exon 1+252C and -94delATTG-exon 1+252G) were
observed in 72 out of 74 total chromosomes genotyped. Therefore,
either polymorphism will yield essentially equivalent information
for testing potential NFKB1 promoter/exon-1 associations.
Genetically, it is unlikely that the D association with UC can be
easily separated from the expected corresponding exon 1+252G
association with UC if the exon 1+252C>G polymorphism also has
an effect on gene expression.
[0069] Extending the present promoter/exon-1 luciferase construct
studies to include the exon 1+252 polymorphism region and test
constructs that contain the D and W alleles with either the C or G
exon 1+252 alleles will determine if this polymorphism has a
similar effect. It is unlikely that there exist common,
functionally relevant, NFKB1 coding polymorphisms in exons 3
through 24. Although only a modest number of chromosomes were
screened in this study, Wintermeyer et al. (Wintermeyer, Riess, et
al, 2002) screened 96 Parkinson's disease patients and Miterski et
al. (Miterski, Bohringer, et al., 2002) screened a large number
(exact figures not reported) of multiple sclerosis patients and
healthy controls (apparently 100 controls given the Leu614Phe
frequency noted below) for NFKB1 coding polymorphisms/mutations.
Both studies used very high sensitivity methods of single-strand
conformation polymorphism analysis (SSCP) and reported success in
completely screening all exons, except for exons 1 and 2. The two
studies observed the relatively common exon 12+77C>T silent
polymorphism, a rare exon 8 silent polymorphism in one Parkinson's
disease patient and a Leu614Phe exon 17 mutation in 0.5% of
controls in the multiple sclerosis study.
[0070] The -94ins/delATTG promoter polymorphic site has functional
consequences. Electrophoretic mobility shift assays show that
oligonucleotides containing the wildtype (-94insATTG) sequence and
not those containing the deletion (-94delATTG) bind to a nuclear
protein, NFKB1-promoter interactive protein (NFKB1-PIP). Moreover,
wildtype -94insATTG binds to nuclear proteins isolated from colonic
epithelian cell lines and normal human colonic tissue, but not
ileal tissue. This complements findings that the -94ins/delATTG
association is associated with UC and not CD because UC involves
the colon whereas CD most often involves the ileum.
[0071] When NFKB1 promoter/luciferase reporter constructs designed
to assay transcriptional activation were transfected into HeLa and
HT29 cells, differential expression was observed between the
-94insATTG and -94delATTG constructs following lipopolysaccharide
(LPS) stimulation. NFKB1 promoter activity is auto-regulated by
NF-kB proteins via the Kb binding site. Located only 19 bp 3' of
the -94ins/delATTG polymorphism. The marked differential activity
following LPS stimulation as well as the proximity of the kB
binding site strongly suggests an interaction between the
-94insATTG polymorphism binding and the kB regulatory site. This
interaction may be altered for the -94delATTG polymorphism and
likely involves the NFLB1-PIP nuclear binding that is
characteristic of the -94insATTG polymorphism. The inventors
believe that loss of this binding plays an important role in the
genetic association of -94delATTG with UC.
EXAMPLES
Materials and Methods
Subjects for the TDT and Case-Control Studies
[0072] Informed consent for participation in molecular genetic
studies was obtained from all study subjects and ethical approval
was given from each center's institutional review boards. In
addition, DNA samples from two CEPH controls (133101, 133102) were
obtained from Coriell Institute for Medical Research (NIGMS Human
Genetic Mutant Cell Repository Camden, N.J.).
[0073] For TDT studies, DNA samples from all available parent/child
pedigrees with a UC offspring and a similar number of pedigrees
with a CD offspring were used. These pedigrees were from an
extended set of an IBD family collection, ascertained by the IBD
Genetic Studies of Johns Hopkins University, University of Chicago
and University of Pittsburgh, described previously (Ogura, Bonen,
et al., 2001). Briefly, DNA was purified from blood samples
obtained from North American, non-Hispanic Caucasian families with
one or more cases of IBD, diagnosed as UC, CD or indeterminate
colitis. The case notes of all patients were reviewed and diagnoses
were confirmed by standard endoscopic, histopathological, and
radiological criteria. Subjects were classified as Ashkenazi
Jewish. UC, CD or IBD probands from these pedigrees were also
compared with controls ascertained by Johns Hopkins University and
University of Chicago.
[0074] For the case-control replication, we genotyped DNA samples
from a separate set of non-Jewish, non-Hispanic, Caucasian UC
patients, that were not members of families genotyped for the TDT
studies and for whom DNA samples on parents were unavailable.
Additional DNA samples were genotyped from non-Jewish,
non-Hispanic, Caucasian UC patients recruited from the University
of Toronto IBD center. The `set B` non-Jewish, non-Hispanic control
DNA samples genotyped were from healthy individuals, randomly
ascertained from a population based cohort study, the NYCP for
longitudinal follow up for future development of cancer. The NYCP
has enrolled approximately 20 000 normal subjects from the New York
Metropolitan area between the ages of 35 and 60 since 1999. In
addition to blood samples, data on ethnicity of the subject, their
parents and grandparents, as well as a general medical history and
a family history of cancer is obtained during a face-to-face
interview of each subject.
Sequencing NFKB1 for Detection of Polymorphisms
[0075] To detect NFKB1 sequence variations, DNA samples were
initially sequenced from 12 subjects (all Caucasian, three Jewish)
to give 95% power to detect polymorphisms with a frequency of
>5% (Kruglyak, et al., 2001). Using NFKB1 specific primers
(Table 1), designed on the basis of the published NFKB1 genomic DNA
sequences (accession AF213884, gi 7012904), PCR was used to amplify
overlapping fragments of the promoter and exon 1 (from
position--889 5' of a NFKB1 major transcription initiation site)
and all 23 coding exons as well as >25 bp of each coding exon's
flanking intron sequence. PCR was performed, in a 50 .mu.l reaction
mixture containing 15 ng of genomic DNA, under the following
conditions: denaturation at 95.degree. C. for 30 s, annealing at
56.degree. C. and extension at 72.degree. C. for 1 min,
amplification for 35 cycles. The annealing temperature for
amplifying GC rich and promoter regions was 60.degree. C. Amplified
DNA fragments were purified by spin column centrifugation through a
selective adsorption silica-gel matrix (QIAquick PCR Purification
Kit Qiagen Cat. No. 28104) and then sequenced on an ABI 3700
fluorescent capillary sequencer. Sequences of amplified fragments
were compared with each other and with the published NFKB1 genomic
DNA sequence to identify variants. Additional UC DD homozygotes
were sequenced to identify more rare variants for the promoter,
exon 1 and exon 2 region that may be in LD with the D allele.
TABLE-US-00001 TABLE 1 PRIMERS USED FOR SEQUENCING NFKB1 and
EXPRESSION CONSTRUCTS Primer Name Forward primer 5' to 3' Reverse
primer 5' to 3' Promoter b tccagaaaaacactccacca
accttcgggtggattacctc SEQ ID NO: 6 SEQ ID NO: 7 Promoter c
ttcagttgtcactccaccca ggtggtagcaatggttttgg SEQ ID NO: 8 SEQ ID NO: 9
Promoter d aaagaaaactcccctctgcc ttccatttaagcgtgtctcag SEQ ID NO: 10
SEQ ID NO: 11 Promoter e tttaatctgtgaagagatgtgaatg
gtagggaagcccccagga SEQ ID NO: 12 SEQ ID NO: 13 Promoter f
gcccttaggggctatgga ctctggcttcctagcaggg SEQ ID NO: 14 SEQ ID NO: 15
Promoter g gttccccgaccattgattg aagcccgcacttctaggg SEQ ID NO: 16 SEQ
ID NO: 17 Pro c-F + h-R ttcagttgtcactccaccca ctctctcacttcctggctgg
SEQ ID NO: 18 SEQ ID NO: 19 Exon 2 gcgagcttaacacgagggta
gtgtgaaagcgggtgtaagtt SEQ ID NO: 20 SEQ ID NO: 21 Exon 3
acgtaaacgttgtccaaccc aaaccatacaaggggtaattgaga SEQ ID NO: 22 SEQ ID
NO: 23 Exon 4 tgccatcacctttcaacaaa tgaggctcaggacagtgtga SEQ ID NO:
24 SEQ ID NO: 25 Exon 5 tacggagccctctttcacag gaaggcaacccgtactcatt
SEQ ID NO: 26 SEQ ID NO: 27 Exon 6 tgtttccatgttgctggaga
gagggtctcagaaaggtccc SEQ ID NO: 28 SEQ ID NO: 29 Exon 7
aatgcatgtagccccaagag gatgaaaaccaaagcctgga SEQ ID NO: 30 SEQ ID NO:
31 Exon 8 ttgggctttataaaagcatgg ctggacatcaacctttcaagc SEQ ID NO: 32
SEQ ID NO: 33 Exon 9 ttggtcatgtgtgctaaggg gcagcagagggatgtttctt SEQ
ID NO: 34 SEQ ID NO: 35 Exon 10 Gactgaaccttttgatcttgttttt
Gagacaggaggatccctcaa SEQ ID NO: 36 SEQ ID NO: 37 Exon 11
ctccaggacacggtgttttt ctgtttgaggccaggagttc SEQ ID NO: 38 SEQ ID NO:
39 Exon 12 aacgcttcttgaaatttaccatc tcatagccactcaactcacaga SEQ ID
NO: 40 SEQ ID NO: 41 Exon 13 gtcctgtcacaccaaaggct
tgcattcatcaattatttgtcaaga SEQ ID NO: 42 SEQ ID NO: 43 Exon 14
ttttcttttccttttgcagc tgcttttccaaaggcataca SEQ ID NO: 44 SEQ ID NO:
45 Exon 15 tccttaagcatgccataccc ttccaacagatgacagcagc SEQ ID NO: 46
SEQ ID NO: 47 Exon 16 ttcaaaacattttagggccaa caaaggtttgtttttgtttttgc
SEQ ID NO: 48 SEQ ID NO: 49 Exon 17 cagtatggccccacctattg
agcacttttgggtgcaaatc SEQ ID NO: 50 SEQ ID NO: 51 Exons 18-19
tttactgtccctccccatga aagttgggtttgcattcctg SEQ ID NO: 52 SEQ ID NO:
53 Exon 20 atccaggagattgcctcaag aaaggcatgttctttgggg SEQ ID NO: 54
SEQ ID NO: 55 Exons 21-22 acattagggtaccaggccc aacggggaaaatctgaaggt
SEQ ID NO: 56 SEQ ID NO: 57 Exon 23 agccgaaacaggaaacttga
ccagggggtagagagacaca SEQ ID NO: 58 SEQ ID NO: 59 Exon 24
catgagctttttagagcccg tgctgtggtcagaaggaatg SEQ ID NO: 60 SEQ ID NO:
61
Genotyping the -94delATTG Promoter Polymorphism
[0076] A restriction enzyme digestion assay was used to genotype
the -94ins/delATTG polymorphism for Johns Hopkins, University of
Chicago and New York Cancer Project samples. A 289 bp PCR fragment
was amplified from genomic DNA using the `promoter e` forward and
`promoter f` reverse primers (Table 1, SEQ ID NO:12, SEQ ID:13, SEQ
ID NO:14, SEQ ID NO:15). Products were digested by the enzyme
PflM1, which cleaves the -94insATTG containing product twice and
the -94delATTG containing product once (FIG. 1), and analyzed on a
2.5% agarose gel.
[0077] University of Pittsburgh samples were genotyped for the
polymorphism using the same primers but with the forward primer end
labeled with fluorescent dye, and the presence or absence of the 4
bp deletion was determined by the size of the labeled PCR product
on an ABI 3700 sequencer.
[0078] The University of Toronto samples were genotyped using the
ABI Prism SNapShot kit. A 190 bp fragment of DNA, encompassing the
site of the -94delATTG polymorphism, was first amplified by PCR.
The PCR product was purified of unincorporated dNTPs as well as
single stranded DNA/primers using shrimp alkaline phosphatase and
exonuclease I, respectively. The purified fragment was then used as
the template for the SNapShot reaction. Primers that were
complimentary to the wild type -94insATTG sequence and deletion
-94delATTG sequence were designed in the 5' forward and 3' reverse
directions SEQ ID NO:6-SEQ ID NO:61) and differentially labeled by
a fluorophore. Each primer ended at the nucleotide immediately
preceding the 5'-most `A-nucleotide` of the PflMI restriction
enzyme cleavage site (FIG. 1). A single base pair extension
revealed each allele discriminated by size and differential
fluorophore emissions detected by 3100 and 3700 ABI sequencers and
data was analyzed with GeneScan and/or GeneMapper software.
[0079] Twelve DNA samples, four for each of the three possible
genotypes (homozygote wildtype, heterozygote and homozygote
deletion) whose sequences were determined by direct sequencing,
were used as blinded controls for all three genotyping methods.
Statistical Analysis
[0080] Transmission disequilibrium tests. The presence of LD
between the NFKB1 promoter polymorphism and UC, CD and IBD was
determined using the family-based association tests in Genehunter
2.1, FBAT (Family Based Association Test) and the PDT (Pedigree
Disequilibrium Test).
[0081] The TDT analysis implemented in Genehunter 2.1 performs the
traditional TDT (Spielman, McGinnis, et al., 1993) using all
genotyped parent child trios in the families. In this analysis,
transmissions from homozygous parents are not counted (they provide
a transmitted and an untransmitted copy of the same allele) and
cases where one parent is missing are used only when the genotyped
parent and the proband are both distinct heterozygotes. The cases
where both parents and the proband have the same heterozygous
genotypes are counted (as a transmission and non-transmission of
each allele).
[0082] Programs FBAT and PDT were used to test for LD independent
of linkage. Both FBAT and PDT allow for inclusion of triads,
discordant sibships as well as extended families and will
incorporate data from multiple affected sibships in the analysis
while adjusting for their non-independence. The FBAT also uses data
from nuclear families, sibships or a combination of the two, to
test for association between traits and genotypes. If data are
available on pedigrees, the program decomposes each pedigree into
individual nuclear families or sibships. The program constructs, by
default, a test of the null hypothesis: no linkage and no
association; testing for both, linkage in the presence of LD. Using
option `-e`, it computes the test statistic using the empirical
variance, as described by Lake et al. (Lake, Blacker, et al.,
2000). This option should be used when testing for association in
an area of known linkage and data from multiple sibs in a family
are used. Distortion of transmission from parents to offspring is
assessed by an observed/expected chi-square test.
[0083] The PDT summarizes the results in two global scores the
`sumPDT`, summarizing the level of significance from all families,
and the `avePDT`, weighting the contribution of larger families to
ensure that their contribution to the end result does not exceed
that of the smaller families.
[0084] Case-Control Analyses.
[0085] Comparison of allele frequencies and genotypes between cases
and controls was done using Fisher's exact test of proportions. For
individuals from multiply affected IBD pedigrees, only one
individual from each pedigree, specifically, the first individual
with UC, CD or IBD enrolled from their family into the study, was
used for the respective analyses.
Electrophoretic Mobility-Shift Assays (EMSAs)
[0086] Nuclear protein extracts were made from 90% confluent human
tissue-culture cells grown at 37.degree. C. with 5% CO.sub.2 in
DMEM supplemented with 10% fetal bovine serum (FBS) and
streptomycin/ampicillin, or were extracted from colonic and ileal
biopsies of normal mucosa from two individuals without IBD nor
other inflammatory disorders or diarrheal diseases, that had
undergone colonoscopy screening for colonic polyps. Biopsies were
obtained following informed consent. Each of the nuclear protein
extracts was made using the NE-PER kit from Pierce (Milwaukee,
Mich., Cat. #78833) as per manufacturer's instructions.
Complimentary single-stranded oligonucleotide probes were
synthesized based on the NFKB1 promoter (`W`, `D` and `DU; FIG. 2B)
or the canonical NF-.kappa.B p50/p65 protein binding consensus
sequence, 5`-AGTTGAGGGGACTTTCCCAGGC-3'; (SEQ ID NO:62) was used as
a control for equal protein loading. An additional 4-base overhang
(gatc) was added at the 5' ends of each oligonucleotide to optimize
end-labeling with .sup.32P. Complimentary oligomers were allowed to
anneal, and then radioactively labeled with dATP [.alpha.-.sup.32P]
and dCTP [.alpha.-.sup.32P]. Following purification by Qiagen the
labeled, double-stranded DNA oligomers were then incubated for 30
min with individual nuclear extract samples at room temperature.
Electrophoretic Mobility Shift Assays (EMSAs) were performed as
previously described.
Plasmid Construction of Luciferase Reporter Genes
[0087] The promoter-exon 1 region of the NFKB1 containing genomic
sequence from nucleotides -736 to +245 (FIG. 1) was prepared by PCR
amplification of either -94insATTG homozygote or -94delATTG
homozygote human genomic DNA using primers Pro c-F and Pro h-R
(Table 1; SEQ ID NO:18 AND SEQ ID NO:19). The PCR products were
purified by agarose gel electrophoresis, extracted from gel slices
(QIAprep miniprep kit; Qiagen Inc., Chatsworth, Calif.), and cloned
into the pCR II-TOPO vector (Invitrogen, San Diego, Calif.). After
restriction digestion with KpnI and XhoI, the NF-.kappa.B promoter
fragment was cloned directionally into the pGL3-Basic firefly
luciferase expression vector (Promega, Madison, Wis.) between
unique KpnI and XhoI sites. Restriction analysis and complete DNA
sequencing confirmed the orientation and integrity of each
construct's inserts.
Transient Transfection/Reporter Assay
[0088] HeLa human cervical adenocarcinoma and HT 29 human
epithelial colon cancer cell lines were obtained from American Type
Culture Collection (Rockville, Md.). Cells were grown in Dulbecco's
modified Eagle's (DME)/high glucose medium supplemented with 10%
fetal bovine serum, 1 mm sodium pyruvate, 100 U/ml of penicillin G
and 100 .mu.g/ml streptomycin (Life Technologies, Inc.) at
37.degree. C. in 5% CO.sub.2. Subconfluent cells cultured in
24-well dishes were transiently co-transfected with 0.4 .mu.g of
either pGL3-W or pGL3-D reporter vector (FIG. 3A and FIG. 3B) and 5
ng of the thymidine kinase promoter-Renilla luciferase control
vector (phRL-TK, Promega) using 0.6 .mu.l of FuGENE6 as per
manufacturer's specifications (Roche Molecular Biochemicals,
Indianapolis, Ind.). The phRL-TK vector contains the herpes simplex
virus thymidine kinase promoter and was co-transfected as an
internal control for transfection efficiency (Grentzmann, Ingram,
et al., 1998). The concentrations of each PGL3-W and PGL3-D vectors
were determined, following Qiagen purification procedure in
parallel, by an average of 10 spectrophotometric readings.
[0089] Transfection using pGL3-Basic vector without an insert was
used as a negative control. Twenty-four hours after transfection,
the cells were cultured in 10% serum medium or with exposure to 1
.mu.g/ml of E. coli derived lipopolysaccharides (LPS:Serotype 055:5
B) for 6-24 h. Cells were then lysed, and firefly and Renilla
luciferase activities were measured simultaneously in each sample
using the Dual-Luciferase Reporter Assay System according to the
manufacturer's instructions (Promega). Firefly luciferase
activities were normalized to Renilla luciferase activity as
`relative luciferase activity`. The data presented are means of six
independent experiments. The results are expressed as the mean plus
standard error of the mean. Statistical analyses were performed
using Stat View software for Macintosh version 5.0 (SAS Institute
Inc.). Unpaired Student's t-tests were used for comparisons. A
P-value of 0.05 was considered to be statistically significant.
EXAMPLES
Example 1
Polymorphism Detection in the NFKB1 Gene
[0090] The NFKB1 promoter, exon 1 and all 23 coding exons and their
flanking introns (FIG. 1, top) were sequenced using DNA from 12
unrelated subjects: two Centre d'Etude du Polymorphisme Humain
(CEPH) controls and 10 probands from pedigrees with the greatest
evidence for linkage, as noted by maximal family non-parametric
linkage (NPL) scores, to the NFKB1 region in a 1998 IBD genome
screen. Six nucleotide variations were detected (Table 2). Five
were novel: an insertion/deletion polymorphism of four bases in the
5' promoter region (-94ins/delATTG) (FIG. 1, bottom), an exon 1
polymorphism located within the 5' untranslated region of NFKB1
message and three intronic variants. A previously described exon
12+77 C>T silent polymorphism was also observed.
TABLE-US-00002 TABLE 2 FKB1 nucleotide variations detected CEPH
CEPH No. of rare/total Nucleotide charge 133101 133102 alleles
sequenced Promoter -94ins/delATTG ins/ins ins/del 7/24 Exon 1 +
252C > G C/C C/G 7/24 Exon 12 + 77C > T T/C C/C 2/24 IVS15 -
25G > T T/G GIG 3/24 IVS22 + 15C > T C/C C/T 1/24 IVS22 + 22C
> G C/G C/C 5/24
Genetic Association of the NFKB1 Promoter -94delATTG Allele with
UC
[0091] Of the six variations detected, only the -94ins/delATTG
appeared to have a potential functional role. It involved the
deletion of multiple nucleotides and is located between two
putative key promoter regulatory elements (FIG. 1), the most
proximal was a functional KB binding site located 19 base pairs 3'.
The -94ins/delATTG polymorphism in 235 singleton and multiplex IBD
pedigrees was analyzed for association with UC, CD or IBD
phenotype.
[0092] Promoter and exon 1 numbering is based on the major
transcription initiation site of Ten et al. (1992) and reference
sequence AF213884. Alternatively, exon 1+252C>G and exon
12+77C>T may be described as 5'UTR-449C>G and C1143T based on
the open reading frame noted.
[0093] TDT analysis using the program Genehunter 2.1 showed 100
transmissions to 71 non-transmissions of the -94delATTG (D) allele
to UC offspring (P=0.027, Table 2). There was also increased
transmission of the D allele in all IBD pedigrees (206 to 170)
although this trend did not reach the 0.05 level of significance.
There was no evidence for association with the CD phenotype. The
results of non-parametric linkage analysis using Genehunter 2.1 on
the 126 families (96 informative) that contained either one or more
siblings or other non-parent child IBD affected relative pairs
showed slight evidence of linkage for the IBD phenotype (NPL 1.7;
P=0.04).
[0094] Two additional TDT programs were used, Family Based
Association Test (FBAT) (35) and the Pedigree Disequilibrium Test
(PDT). Both packages provide valid tests of LD independent of
linkage using different analytic schemes. Using the different
analytic outcomes provided, both tests showed borderline
significant LD evidence for the association of the D allele with
the UC phenotype, independent of linkage (FBAT, P=0.052; PDT,
global score sum P=0.047) (Table 2). The PDT also showed
significant evidence for IBD (P=0.035, Table 3).
TABLE-US-00003 TABLE 3 TDT association analyses showing families
with offspring with corresponding affection status Affection status
UC CD IBD No. of families.sup.a 131 122 235 No. of affecteds.sup.b
187 220 433 Total no. of trios 161 199 366 Simple trio pedigrees
105 57 122 Sibling pair pedigrees.sup.c 23 59 103 Extended
pedigrees.sup.d 3 6 10 Genehunter 2.1 Transmitted allele D 100 137
206 Non-transmitted allele D 71 126 170 .chi..sup.2 4.92 0.46 3.45
P-value 0.027 0.50 0.06 FBAT P-value 0.028 0.96 0.06 P-value-e
0.052 0.96 0.09 PDT Global score sum PDT .chi..sup.2 3.948 0.168
2.036 P-value 0.047 0.682 0.154 Global score ave PDT .chi..sup.2
3.424 1.08 4.45 P-value 0.064 0.299 0.035 .sup.a24 IBD families had
both UC and CD offspring and the UC and CD offspring were also
analyzed separately with the other pedigrees having only UC and CD
offspring, respectively. Six families had only offspring with
indeterminate colitis and were included only in the `IBD` analyses
and not the UC or CD analyses. .sup.bNumber of affecteds listed for
UC offspring families include only pedigree members with UC and
vice-versa for number of affecteds listed for CD offspring
families. .sup.cIncludes two UC and seven CD pedigrees with three
affected siblings, and one CD and one mixed pedigree with four
affected siblings. .sup.d`Extended pedigree`, pedigrees containing
more than one affected offspring with either one or more affected
cousin pairs, affected avuncular pairs or three generations of
affected individuals with DNA samples on grandparents, parents and
affected child. Numbers in bold denote P-values .ltoreq.0.05.
Case-Control Analysis and Replication of the -94delATTG Association
with UC
[0095] Based on these TDT results, the study was extended to
compare the frequency of the D allele and DD genotype in cases and
controls. Such case-control studies are frequently more powerful
measures of allelic association (depending on allele frequencies)
than comparable TDT analyses. These analyses were also performed to
determine the specific genotypes [homozygote insertion or wildtype
(WW), heterozygote (WD) or homozygote deletion (DD)] that resulted
in increased risk of the D allele in our UC and IBD pedigrees. The
D allele was more frequent in non-Jewish, unrelated UC or IBD
probands (from the same IBD pedigrees examined in the TDT analyses)
than among ethnically matched controls (P=0.015 and 0.014,
respectively; Table 4, set A). These UC and IBD probands were also
significantly more frequent carriers of the DD genotype (P=0.040
and 0.041, respectively) than controls. The D allele showed a trend
towards increased frequency in Jewish UC patients versus controls
(43.6 to 34.2%), although this did not reach statistical
significance (P=0.088). For both non-Jewish and Jewish ethnicities,
the relative increase in D allele frequencies and DD genotypes in
patients as compared to controls was greater for the subset of UC
patients than all IBD patients.
[0096] For a replication study, 141 new, unrelated non-Jewish UC
patients from the IBD Genetic Studies of Johns Hopkins, University
of Chicago and University of Pittsburgh were genotyped, along with
an independent set of 117 unrelated, non-Jewish UC patients from a
recently characterized University of Toronto cohort. D allele
frequencies for the second set of Hopkins/Chicago/Pittsburgh UC
samples (f=0.440) and the University of Toronto UC samples
(f=0.449) were similar. For controls, 653 non-Jewish Caucasians
obtained from a population based cohort study, the New York Cancer
Project (NYCP), were genotyped. For the total replicate sample set
(set B), the D allele and DD genotype frequencies for UC patients
were significantly greater than the respective control frequencies
(0.444 versus 0.391, P=0.021 and 0.205 versus 0.150, P=0.029,
respectively) (Table 4). Combining all unrelated non-Jewish
Caucasian UC samples (from sets A and B) and combining all
non-Jewish Caucasian controls shows that the homozygous DD genotype
provides a significant-yet moderate-risk for developing UC [0.214
versus 0.148, odds ratio 1.57 (95% confidence interval 1.14-2.16);
P=0.004]. The heterozygote (WD) genotype frequencies were similar
for all UC cases and controls (0.477 versus 0.479).
TABLE-US-00004 TABLE 4 Case-control analyses P-value,.sup.a DD D
allele P-value,.sup.a D allele versus DW or Set Phenotype No. WW WD
DD frequency frequency WW A Controls-NJ 149 0.389 0.470 0.141 0.376
UC-NJ 92 0.283 0.478 0.239 0.478 0.015 0.040 CD-NJ 74 0.311 0.527
0.162 0.426 0.170 0.410 IBD-NJ 156 0.295 0.481 0.224 0.465 0.014
0.041 Controls-J 142 0.430 0.458 0.113 0.342 UC-J 39 0.308 0.513
0.179 0.436 0.088 0.182 CD-J 48 0.417 0.438 0.146 0.365 0.385 0.352
IBD-J 79 0.354 0.506 0.139 0.392 0.167 0.353 B Controls-NJ 653
0.369 0.481 0.150 0.391 UC-NJ 258 0.318 0.477 0.205 0.444 0.0212
0.0285 A + B Controls-NJ 802 0.372 0.479 0.148 0.388 UC-NJ 350
0.309 0.477 0.214 0.453 0.0020 0.0043 NJ, non-Jewish; J, Ashkenazi
Jewish. .sup.aP-values are for comparisons between UC, CD or IBD
cases and ethnically matched controls for each set. Numbers in bold
denote P-values .ltoreq.0.05.
Example 2
-94Ins/delATTG Polymorphism Nuclear Protein Binding to NFKB1
Promoter
[0097] Electrophoretic Mobility Shift Assays (EMSA) were performed
to assess if the -94ins/delATTG polymorphism is within a binding
domain for nuclear proteins. Oligonucleotides that contained the
wildtype sequence (`W`) showed strong binding to nuclear protein
extracted from two human colonic epithelial cell lines, CaCo2 and
HT-29 (FIG. 2A). In contrast, the deletion oligonucleotide (`D`)
showed no binding. The `DL` oligonucleotide (containing only a
single ATTG deletion allele but with four additional NFKB1
nucleotides added 5' and 3' to make a deletion oligonucleotide with
the same length as `W`) appeared to allow minimal binding of
proteins of similar mobility. This binding was markedly less than
that of the `W` oligonucleotide.
[0098] To assess the specificity of the observed DNA-protein
interaction, mutations were made of the tandem ATTG residues at the
polymorphic site. Mutating the most 5' ATTG to CAGT (FIG. 2B, lane
4) resulted in a near complete loss of binding to HeLa-cell derived
nuclear protein (as compared to the `W` oligonucleotide, lane 1),
whereas mutating the second (i.e. 3') ATTG to CAGT resulted in no
detectable binding (lane 5). Furthermore, mutating the first `T` of
the second ATTG at this site reduced binding to negligible levels
(lane 6).
[0099] Nuclear protein binding observed using cell culture extracts
and human intestinal tissue extracts was investigated. Consistent
with the results from colonic cell lines, nuclear proteins
extracted from normal human colonic mucosa bound to `W` but not `D`
oligonucleotides (FIG. 2C, lanes 7-10). Alternatively, there was no
specific evidence that nuclear proteins of the same mobility from
normal terminal ileal mucosa bound to the `W` nor `D`
oligonucleotides (lanes 1-4). The presence of the binding protein
in colonic rather than ileal tissues is intriguing because of
showing that NFKB1 is genetically associated with UC, a disease
where inflammation only involves the colon, but is not associated
with CD, a disease where inflammation is frequently found limited
to the ileum without colonic involvement.
Example 3
NFKB1 Promoter-Luciferase Reporter Constructs Show Decreased
Promoter Activity for the Deletion Polymorphism in Transient
Transfection Experiments
[0100] HeLa and HT 29 cells were transiently transfected with
either pGL3-W or pGL3-D reporter constructs (FIG. 3A). These
constructs contained 736 bp of the 3' region of the NFKB1 promoter
with the W allele (ATTG.sub.2) or 732 bp of the same region with
the D allele (ATTG.sub.1). Each construct also included the most 5'
245 bp of exon 1 (i.e. the same sequences as shown in FIG. 1). The
regions cloned into both constructs include the Activator Protein-1
(AP-1) and KB nuclear protein binding consensus sequences in the
promoter, and the putative HIP-1, Housekeeping Initiator Protein I,
motif in exon 1. These transcriptional regulatory elements of NFKB1
have been previously identified and shown to be important for NFKB1
gene promoter activity (Ten et al., (1992); Cogswell et al., 1993).
The constructs did not include the exon 1+252C>G polymorphism
sequence. The thymidine kinase (TK) promoter-Renilla luciferase
plasmid (phRL-TK) was co-transfected to control for differences in
transfection efficiency.
[0101] pGL3-D transfected HeLa cells showed significantly reduced
relative luciferase activity at baseline (pGL3-W, 3.28.+-.0.08
versus pGL3-D, 2.52.+-.0.26, P=0.005; FIG. 3B). Incubation for 6 h
with 1 .mu.g/ml lipopolysaccharide extract (LPS), a potent
activator of both NF-.kappa.B and NFKB1 transcription, markedly
increased relative luciferase activity by more than 3-fold from
baseline for both pGL3-W and pGL3-D transfected HeLa cells. Yet LPS
stimulated pGL3-D activity remained significantly lower than
stimulated pGL3-W activity (FIG. 3B). At 24 h of LPS exposure,
pGL3-W but not pGL3-D transfected HeLa cells showed a further
increase in relative luciferase activity from that observed at 6 h.
In fact, pGL3-W induced relative luciferase activity was 82%
greater than pGL3-D relative luciferase activity at 24 h of LPS
exposure (pGL3-W, 17.46.+-.0.34 versus pGL3-D, 9.57.+-.0.16,
P<0.0001).
[0102] For HT-29 colonic epithelial cells, baseline relative
luciferase activity for both constructs was very low (<5% of
HeLa cells). There was a slight, but non-significant decrease in
the pGL3-D transfected versus pGL3-W transfected cells. Similar to
that observed for the HeLa cells, transfected HT-29 pGL3-W activity
was significantly higher than pGL3-D activity following 6 h of LPS
stimulation. Higher pGL3-W relative luciferase activity was most
pronounced following 24 h of LPS stimulation (pGL3-W, 4.42.+-.0.21
versus pGL3-D, 2.85.+-.0.15, P=0.0001). Transfected pGL3-basic
vector plasmid alone showed <0.01% of the relative luciferase
activity as compared to the PGL3-W or PGL3-D constructs at baseline
and after LPS stimulation for both cell types.
Example 4
Nuclear Protein Binding to ATTG Polymorphic Oligonucleotides
[0103] Oligonucleotides (FIG. 1) containing either an ATTG singlet
or ATTG duplet sequence and 6 bp of the NFKB1 promoter sequence
immediately 5' and 3' of this position, and 5' overhand sequences
were constructed by standard DNA oligo synthesis. A second
oligonucleotide having the complementary NFKB1 sequence and 5' over
hand sequence was developed for each ATTG polymorphic
oligonucleotide. These oligonucleotides were allowed to anneal to
form double stranded oligonucleotides, were end labeled with
P.sup.32 and then hybridized with nuclear proteins extracted from
mammalian or human cells or tissues. A double stranded
oligonucleotide containing an established NFKappa B binding
consensus sequence was similarly constructed but not labeled.
[0104] Cells were purified from tissues and from cells in culture
from rat liver, human HELA cells, Caco2 cells, HT29 cells, and
human colon biopsies using Ficoll density gradient centrifugation.
Nuclear proteins were purified from the purified cells or tissues
using the method of Standke et al. (1994) and Waxman et al.
(1995).
[0105] Electromobility shift assays (EMSA's) were performed as
follows: Double-stranded oligonucleotides were prepared by
combining and heating equimolar amounts of the complementary
single-stranded DNA to 95.degree. C. for 10 min in a solution
containing 50 mM Tris-HCl, pH 7.5, and 100 mM NaCl followed by
cooling to room temperature over 3 h. The annealed oligonucleotides
were diluted to a concentration of 2 .mu.M and stored at
-20.degree. C. EMSA were carried out in 25 .mu.l containing 25 mM
HEPES, pH 7.8, 50 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 10%
glycerol, and 2 .mu.g of poly (dl.dC) (Pharmacia LKB Biotechnology
Inc.). End-labeled DNA (0.1-0.5 ng) were incubated with various
amounts of nuclear extracts for 20 min at room temperature after
which 5 .mu.l of 0.2% bromphenol blue/xylene cyanol were added, and
samples were loaded on a 4 or 5% nondenaturing polyacrylamide gel
(acrylamide:bisacrylamide=39:1) in low ionic strength. For
competition experiments, nuclear extracts were first incubated with
unlabeled oliognucleotides in molar excess for 5 min at room
temperature prior to the addition of labeled DNA. For the
"supershift" experiment, 1 .mu.l of rabbit antiserum directed
against NFKB p65, P50, AP2, and USF or non-immune serum was added
to the reaction mixture at the end of the binding reaction, and an
additional 30 min of incubation was carried out before loading
samples onto the gel.
[0106] Protein extract was electrophoresed on polyacrylamide gels.
Shift and "supershift" of labeled oligonucleotide was observed by
autoradiography. The position of gel migration of autoradiography
bands that denoted the labeled oligonucleotide mobility was
compared from either (1) labeled oligonucleotide that had been
mixed with nuclear protein extract alone or (2) with protein
extract and antibody both in comparison to (3) the position of
bands of the labeled oligonucleotide alone (without protein extract
or antibody).
[0107] Rat liver nuclear protein extract showed binding to the
duplet oligo A in the form of two bands that showed markedly
decreased migration and thus relative high molecular weight (FIG.
4). No shift was seen with extract incubated with oligo B and
minimal binding occurred with incubation with oligo C as denoted by
similarly sized but relatively faint bands in comparison to those
seen with oligo A. The two bands that bound to oligo A were
competed with in a dose dependent manner by the NFKappa B unlabeled
consensus sequence. FIG. 4A also shows that Hela cell protein
extract had proteins of similar size (as the rat liver proteins)
that caused by migration of oligo A to be slowed and was also
competed with by oligo D. This extract showed virtually no binding
to oligo B and minimal binding to oligo C.
[0108] FIG. 5 shows oligonucleotide binding to CaCo2, HT29 and
human colonic tissue. SUPERSHIFT experiments with antibodies to
p50, p65, SP1, SP3, STAT and USF did not exhibit a mobility change
(FIG. 6), indicating that in this experiment the oligomer might be
blocking the binding of antibody to protein or that protein bound
to the labeled oligomer is possibly a novel promoter binding
protein.
[0109] Oligonucleotides that contain the NFKB1 ATTG singlet
polymorphism show markedly decreased to absent binding of rat and
human nuclear proteins in comparison to oligonucleotides that
contain the NFKB1 duplet ATTG polymorphism. Competition studies
suggest that at least some of the proteins that differentially bind
to the ATTG polymorphic region are proteins (or subunits) of the
NFKappaB family or proteins with similar nuclear binding
properties.
Example 5
Identification of NFKB1-PIP
[0110] The novel NFKB1-PIP protein will be isolated and
characterized as follows. The same NFKB1 -94insATTG double stranded
oligonucleotide probe (W) found to bind in EMSA tests will be
biotinylated at the 5' end with 15-atom spacer (Biotin-TEG; Qiagen]
and hybridized to nuclear protein purified from HeLa cells. The
probe/NFKB1-PIP complex will be magnetically separated from the
nuclear protein pool using streptavidin-conjugated magnetic
microbeads. Following enzymatic digestion, the molecular weight of
NFKB1-PIP peptide fragments will be determined by matrix-assisted
laser desorption/ionization-time of flight mass spectrometry
(MALDI-TOF MS) available at the Johns Hopkins Digestive Disease
Center Proteomics Core Facility. Concurrently, the same
purification assay, but using the -94delATTG probe, will be
performed as a negative control. An in-silico screen (TBLASTN) of
the public databases using the peptide sequence as probes will be
used to identify the cDNA. If the NFKB1-PIP matching cDNAs are
novel or incomplete, the full coding region of NFKB1-PIP will be
obtained by RT-PCR amplification and 5' & 3' rapid
amplification of cDNA ends (RACE) using human colon RNA and
NFKB1-PIP-specific oligonucleotide primers. If there is no match
for NFKB1-PIP, nucleotide probes from the sequenced NFKB1-PIP
peptides will be developed to screen human colon cDNA libraries.
Additionally, a search of transcription factors databases yielded 6
potential binding elements to the -94insATTG. These factors can be
evaluated as possible candidates using various immunochemistry and
molecular biology techniques.
Example 6
NFKB1-PIP Expression and Localization
[0111] NFKB1-PIP/GFP (green fluorescent protein) fusion expression
vector will be constructed and transfected into an appropriate cell
line. To confirm that the expressed NFKB1-PIP clone is the correct
protein, EMSAs will be performed using the "W" probe to analyze the
gel's fluorescence pattern. Confocal microscopy will be used to
determine if NFKB1 PIP/GFP protein is localized in the nucleus
before and after LPS stimulation in lymphocyte, HeLa and HT29
cells. The NFKB1-PIP tissue distribution will be determined by
using cDNA fragments identified in Example 5 to probe commercially
available multiple tissue Northern Blot Panels (Clontech).
Expression profiles will be quantified using real-time PCR in
individual cell components of the colon; notably, epithelial cells,
lymphocytes, macrophages, monocytes and fibroblasts isolated from
resected human colon tissue. Real-time PCR will be used to
determine if there are differences in expression levels of
NFKB1-PIP in colon and small intestine biopsy tissues from a
collection of 60 samples from IBD patients and normal controls in
the John Hopkins University repository (Baltimore, Md.).
Example 7
Regulation of NKFB1 Expression by NFKB1-PIP
[0112] NFKB1-PIP levels will be reduced in HT29 and HeLa cells by
introducing NFKB1-PIP short interfering RNA (siRNA). Using
previously developed NFKB1 promoter luciferase reporter constructs
(Karban & Okazaki, 2004), the effect of this reduction on the
baseline and LPS-stimulated activities of the NFKB1 wildtype
promoter will be assessed.
[0113] A transcription binding database has been searched and
several transcription factors that are know to have consensus
binding sequences in common with NFKB1-94insATTG (duplet)allele
region but not (or markedly less binding) to the -94delATTG
(singlet) allele region (Tables 5-7).
[0114] NFKB1-PIP isolated using the described method will be tested
for homology to these transcription factors. Alternatively,
supershift assays (similar to that as shown for the experiments in
FIG. 5) using antibody to any of these known transcription factors
can be used to confirm NFKB1-PIP. Immunoprecipitation with such
antibodies of NFKB1-pIP hybridized to "W" oligonucleotide may also
be employed.
Jasper Transcription Factors
TABLE-US-00005 [0115] TABLE 5 Sequenceview Transcription attg2
factor Sequence From To Score Strand c-MYB_1 gaccattg 4 11 7.065 +
SEQ ID NO: 63 Yin-Yang accatt 5 10 7.027 + SEQ ID NO: 64 SOX-9
ccattgatt 6 14 10.640 - SEQ ID NO: 65 ATHB5 cattgattg 7 15 9.967 +
SEQ ID NO: 66 Gfi cattgattgg 7 16 10.236 - SEQ ID NO: 67 Athb-1
attgattg 8 15 7.554 - SEQ ID NO: 68 Sox-5 attgatt 8 14 6.624 - SEQ
ID NO: 69 Nkx ttgattg 9 15 5.189 + SEQ ID NO: 70 GATA-1 tgattg 10
15 5.403 + SEQ ID NO: 71 GATA-2 tgatt 10 14 4.000 + SEQ ID NO: 72
GATA-3 tgattg 10 15 7.127 + SEQ ID NO: 73
##STR00001##
[0116] The methods, techniques and compositions disclosed and
claimed herein can be made and executed without undue
experimentation in light of the present disclosure. While the
compositions and methods of this invention have been illustrated
with several examples and preferred embodiments, it will be
apparent to those of skill in the art that variations may be
applied to the methods and compositions, in the steps or in the
sequence of steps and in modifications of the compositions without
departing from the concept, spirit and scope of the invention.
Accordingly, the exclusive rights sought to be patented are as
described in the claims below.
Example 8
[0117] Double stranded oligonucleotides that contain the ATTG
doublet and the NFKB1 nucleotides immediately 5' of the doublet and
the NFKB1 nucleotides immediately 3' of the doublet bind to a
nuclear protein of humans and rats (termed NFKB1-promoter
interactive protein or "NFKB1-PIP"). It is likely that other
species contain homologous isoforms of this NFKB1-PIP. NFKIB 1-PIP
will interact with the NFKB1 promoter DNA in humans that have the
-94insATTG allele to a greater degree than humans that have the
-94delATTG allele. The inventors have developed a method to
identify NFKB1-PIP by using double stranded oligonucleotides that
contain the ATTG duplet and surroundihgNFKB1 sequences. Examples of
suitable oligonucleotides include: oligonucleotide "W",
5'-CCCGACCATTGATTGGGCCCGG-3' (SEQ. ID NO:74). This "W"
oligonucleotide can be used (with or without minor modifications
such as creating a four base nucleotide overhand extension of
5'-GATC-3') to "trap" the NFKB1-PIP. Attaching the "W"
oligonucleotide to a magnetic bead, to a resin in a column or to a
heavy molecule such as a polymer can be used to bind and then
isolate NFKB1-PIP.
[0118] In contrast, because NFKB1-PIP binds poorly or not at all to
identical olignonucleotides to "W" but with either a single ATG or
a mutation in the 3' ATG (e.g. AATG), these ATTG singlet or mutated
ATTG-doublet olignonucleotides can be used in a similar fashion to
bind proteins that are not NFKB1-PIP but also bid the "W"
oligonucleotide. Because these latter olignoucleotides do not bind
the NFKB1-PIP well, these latter oligonucleotides can be used to
remove non-specific proteins that are not NFKB1-PIP or to compare
the sequence of proteins that bind these latter olignucleotides
with the proteins that bind the "W" olignoucleotide or similar
olignucleotides, all in an effort to identify NFKIB 1-PIP.
[0119] Isolating NFKB1-PIP will identify an important nuclear
protein that has consequences of regulating nuclear protein
activity such as NFKB1. NFKB1-PIP is likely also to be involved in
regulating inflammation, acute stress reactions and apoptosis. It
may provide protection of person with the -94insATTG allele from
diseases like UC. NFKB1-PIP may be involved with either protection
or pathophysiology of other diseases that involve NFKB1 and will
likely have effects on other genes, either directly on their
promoter or other sequences or indirectly through important
pathways.
[0120] Control of NFKB1 promoter activity may be attained by
identifying chemicals or RNA or DNA molecules that enhance or
interfere with NFKB1-PIP binding to NFKB1 promoter in persons with
the -94insATTG allele. The identified olignonucleotide sequences
that bind strongly to NFKB1-PIP or oligonucleotides or with
comparable effects may be used to identify those molecules that
alter the NFKB1-PIP interaction with NFKB1 promoter. Similarly, the
olignoucleotide molecules that bind poorly or not at all to
NFKB1-PIP but are identical except for a single ATTG (e.g.,
oligonucleotide "D") or a mutant of the ATTG duplet can be used to
identify molecules that allow NFKB1-PIP to bind to the NFKB1
delATTG promoter.
[0121] Furthermore, the disclosed constructs (see FIG. 2A and
methods below) that contain allele specific NFKB1 promoter sequence
(either the ATG duplet or singlet) with the downstream (3')
reporter elements (luciferase or other reporter element) or a
similar allele specific construct of the promoter (also possibly
containing the exon 1+252C>G polymorphisms in linkage
disequilibirum, Table 2) can be used as an assay to identify agents
and test potential therapeutic methods to enhance or inhibit
activity of the promoter region in an allele specific manner.
Additionally, because NFKB1 -94delATTG has lower promoter activity
than the -94insATTG and it has been shown by Ten et al. and others
that NF-.kappa.B binding to the KB site 5' of nucleotide-61 (SEQ.
ID NO:1) increases NFKB1 promoter activity, NFKB1 promoter activity
can be specifically enhanced in individuals that contain the
-94delATTG by stabilizing NF-.kappa.B protein binding to this -62
KB site. This construct can be used to differentially test binding
enhancement based on the specific -94ins or del ATTG allele.
REFERENCES
[0122] Baldwin, A. S., Jr. Series Introduction: The transcription
factor NF-B and human disease. JCI-2001; 107:3-6. [0123] Bonen, D.
K., Ogura, Y., Nicolae, D. L., Inohara, N., k Saab, L., Tanabke,
T., Chen, F. F., Foster, S. J., Duerr, R. H., Brant, S. R., et al.
(2003) Crohn's disease-associated NOD2 variants share a signaling
defect in response to lipopolysaccharide and peptidoglycan.
Gastroenterology, 124, 140-146. [0124] Brant, S. R. and Okazaki, T.
(2003) The genetics of IBD. In Bernstein, C. N. (ed.), The
Inflammatory Bowel Disease Yearbook, Remedica, London, pp. 79-128.
[0125] De la Concha, E. G., Fernandez-Arquerio, M., Lopez-Nava, G.,
Martin E., Allcock, R. J., Conejero, L., Paredes, J. G. and
Diaz-Rubio, M. (2000) Susceptibility to severe ulcerative colitis
is associated with polymorphism in the central MHC gene IKBL,
Gastroenterology, 119, 1491-1495. [0126] Erdman, S., Fox, J. G.,
Dangler, C. A., Feldman, D., and Horwitz, B. H. (2001)
Typhlocolities in NF-kappa B-deficient mice, J. Immunol., 166,
1443-1447. [0127] Grentzmann, G., Ingram, J. A., Kelly, P. J.,
Gesteland, R. F. and Atkins, J. F. (1998) A dual-luciferase
reporter system for studying recoding signals. RNA, 4, 479-486.
[0128] Hampe, J., Schreiber, S., Shaw, S. H., Lau, K. F., Bridger,
S., MacPherson, A. J., Cardon, L. R., Sakul, H., Harris, T. J.,
Bucker, A. et al. (1999) A genomewide analysis provides evidence
for novel linkages in inflammatory bowel disease in a large
European cohort. Am. J. Hum. Genet., 64, 808-816. [0129] Hisamatsu,
T., Suzuki, M., Reinecker, H. C., Nadeau, W. J. McCormick, B. A.
and Podolsky, D. K. (2003) CARD15/NOD2 functions as an
antibacterial factor in human intestinal epithelial cells.
Gastroenterology, 124, 993-1000. [0130] Kruglyak, L., and Nickerson
D. (2001) Variation is the spice of life, Nat. Genet., 27, 234-236.
[0131] Lake, S. L., Blacker, D. and Laird, N. M. (2000)
Family-based tests of association in the presence of linkage. Am.
J. Hum. Genet., 67, 1515-1525. [0132] Miterski, N., Bohringer, S.,
Klein, W., Sindern, E., Haupts, M., Shimrigk, S, and Epplen, J. T.
(2002) Inhibitors in the NFkappaB cascade comprise prime candidate
genes predisposing to multiple sclerosis, especially in selected
combinations. Genes Immun., 3, 211-219. [0133] Ogura, Y., Bonen, D.
K., Inohara, N., Nicolae, D. L., Chen, F. F., Ramos, R., frameshift
mutation in NOD2 associated with susceptibility to Crohn's disease,
Nature, 411, 603-606. [0134] Rioux, J. D., Silberberg, M. S., Daly,
M. J., Steinhart, A. H., McLeod, R. S., Griffith, A. M., Green, T.,
Brettin, T. S., Stone, V., Bull, S. B. et al (2000) Genomewide
search in Canadian families with inflammatory bowel disease reveals
two novel susceptibility loci. Am J. Hum. Genet., 66, 1863-1870.
[0135] Schreiber, S, Nikolaus, S, and Hampe, J. Activation of
nuclear factor kappa B inflammatory bowel disease, Gut. 1998 April
42(4): 477-84 [0136] Sha, W. C., Liou H. C., Tuomanen E. I., and
Baltimore D. (1995) Targeted disruption of the p50 subunit of
NF-kappa B leads to multifocal defects in immune responses, Cell,
80, 321-330. [0137] Spielman, R. S., McGinnis, R. E. and Ewens, W.
J. (1993). Transmission test for linkage disequilibrium: the
insulin gene region and insulin-dependent diabetes mellitus (IDDM),
Am. J. Hum. Genet., 52, 506-516. [0138] Ten, R. M., Paya, C. V.,
Israel, N., Le Bail, O., Mattei, M. B. Virelizier, J. L.,
Kkourilsky, P., Israel, A. The characterization of the promoter of
the gene encoding the p50 subunit of NF-.kappa.B indicates that it
participates in its own regulation. EMBO 1992; 11:195-203. [0139]
Potter, J. J., Mezey, E., Cornelius, P., Crabb, D. W., Yang, V. W.
the first 22 base pairs of the proximal promoter of the rat class I
alcohol dehydrogenase gene is bipartite and interacts with multiple
DNA binding proteins. Arch. Biochem Biophys. 1992 June;
295(2):360-8. [0140] Standke, G. J. R., Meier, V. S., Groner, B.
Mammary gland factor activated by Prolactin in mammary epithelial
cells and acute-phase response factor activated by interleukin-6 in
liver cells share DNA binding and Transactivation potential.
Molecular Endocrinology 8(4) 469-477 1994 [0141] Waxman, D. J.,
Ram, P. A., Park, S. Choi, H. K. Intermittent plasma growth hormone
triggers tyrosine phosphorylation and nuclear translocation of
liver-expressed, Stat 5-related DNA binding protein. J. Biol. Chem.
270(22) 13262-13270, 1995. [0142] Wintermeyer, P., Riess, O.,
Schols, L., Przuntek, H., Miterski, B., Epplen, J. T. and Kruger,
R. (2002) Mutation analysis and association studies of nuclear
factor-kappaB 1 in sporadic Parkinson's disease patients, J. Neural
Transm., 109, 1181-1188. [0143] Karban and Okazaki, 2004
Sequence CWU 1
1
871983DNAHomo sapiens 1ttttcagttg tcactccacc cagtagtgaa acaatgagct
ctaaaatata tatttcggct 60caagctttct tatgtgggga ggtaatccac ccgaaggtat
ccccagcctg tacctaatac 120agtgcccagc actaaagcag ctcagatgcc
agtgaatggt ggccactggg aggcctgtca 180gtgggtgcca gtagcggtct
cttcagagaa aaagaaaact cccctctgcc agatcagtat 240tttatgagct
gtgaaccaaa accattgcta ccaccatcac tataattcta tccacagtaa
300ttatcataaa ggcctaacaa tgccttgtag atgaacattc tgagtaactg
ctctataacc 360aggagattta agaccgcacc aaaaaccagt agagggttat
actttactgg gcacaagtcg 420tttatgataa cgaaattgta gtttaatctg
tgaagagatg tgaatgtaac tgagacacgc 480taaatggaat atacagatga
gctttatttt tatatctggc atgcttggat ccatgccgac 540cctccagctg
ctcgggcctg cccttagggg ctatggacgc atgactctat cagcggcact
600gccaccgccg ccgcctccgt gctgcctgcg ttccccgacc attgattggg
cccggcaggc 660gcttcctggg ggcttcccta ccggctccag cccttgggat
tcgggagcgc cctgctagga 720agccagagcc ccgcaggggc cgcggcgtcc
aggccgccta acgcgcgccc ctcgcccggc 780gccccgaagc ggccccgagg
ggcgggagcc gaggcgagcg gcaaggccgg gccgggggcg 840cacagcgccc
ctagaagtgc gggcttcccc cacccccggc agcgacccta cctcccgccc
900ccgctgcgtg cgcgcgtgtg tccgtctgtc tgtatgctct ctcgacgtca
gtgggaattt 960ccagccagga agtgagagag tga 983222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
2ccgggcccaa tcaatggtcg gg 22318DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 3ccgggcccaa tggtcggg
18420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 4gccgggccca atggtcgggg 20515DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
5cgggcccaat ggtcg 15620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6tccagaaaaa cactccacca
20720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7accttcgggt ggattacctc 20820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8ttcagttgtc actccaccca 20920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9ggtggtagca atggttttgg
201020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10aaagaaaact cccctctgcc 201121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11ttccatttaa gcgtgtctca g 211225DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 12tttaatctgt gaagagatgt
gaatg 251318DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 13gtagggaagc ccccagga 181418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14gcccttaggg gctatgga 181519DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 15ctctggcttc ctagcaggg
191619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16gttccccgac cattgattg 191718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17aagcccgcac ttctaggg 181820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 18ttcagttgtc actccaccca
201920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19ctctctcact tcctggctgg 202020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20gcgagcttaa cacgagggta 202121DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 21gtgtgaaagc gggtgtaagt t
212220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22acgtaaacgt tgtccaaccc 202324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23aaaccataca aggggtaatt gaga 242420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24tgccatcacc tttcaacaaa 202520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 25tgaggctcag gacagtgtga
202620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 26tacggagccc tctttcacag 202720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27gaaggcaacc cgtactcatt 202820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 28tgtttccatg ttgctggaga
202920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29gagggtctca gaaaggtccc 203020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30aatgcatgta gccccaagag 203120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 31gatgaaaacc aaagcctgga
203221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 32ttgggcttta taaaagcatg g 213321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33ctggacatca acctttcaag c 213420DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 34ttggtcatgt gtgctaaggg
203520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 35gcagcagagg gatgtttctt 203625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36gactgaacct tttgatcttg ttttt 253720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37gagacaggag gatccctcaa 203820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 38ctccaggaca cggtgttttt
203920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39ctgtttgagg ccaggagttc 204023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40aacgcttctt gaaatttacc atc 234122DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 41tcatagccac tcaactcaca ga
224220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42gtcctgtcac accaaaggct 204325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43tgcattcatc aattatttgt caaga 254420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
44ttttcttttc cttttgcagc 204520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 45tgcttttcca aaggcataca
204620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 46tccttaagca tgccataccc 204720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47ttccaacaga tgacagcagc 204821DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 48ttcaaaacat tttagggcca a
214923DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 49caaaggtttg tttttgtttt tgc 235020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
50cagtatggcc ccacctattg 205120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 51agcacttttg ggtgcaaatc
205220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 52tttactgtcc ctccccatga 205320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53aagttgggtt tgcattcctg 205420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 54atccaggaga ttgcctcaag
205519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 55aaaggcatgt tctttgggg 195619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
56acattagggt accaggccc 195720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 57aacggggaaa atctgaaggt
205820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 58agccgaaaca ggaaacttga 205920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
59ccagggggta gagagacaca 206020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 60catgagcttt ttagagcccg
206120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 61tgctgtggtc agaaggaatg 206222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic consensus
sequence 62agttgagggg actttcccag gc 22638DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
transcription factor 63gaccattg 8646DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
transcription factor 64accatt 6659DNAArtificial SequenceDescription
of Artificial Sequence Illustrative transcription factor
65ccattgatt 9669DNAArtificial SequenceDescription of Artificial
Sequence Illustrativ transcription factor 66cattgattg
96710DNAArtificial SequenceDescription of Artificial Sequence
Illustrative transcription factor 67cattgattgg 10688DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
transcription factor 68attgattg 8697DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
transcription factor 69attgatt 7707DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
transcription factor 70ttgattg 7716DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
transcription factor 71tgattg 6725DNAArtificial SequenceDescription
of Artificial Sequence Illustrative transcription factor 72tgatt
5736DNAArtificial SequenceDescription of Artificial Sequence
Illustrative transcription factor 73tgattg 67422DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 74cccgaccatt gattgggccc gg 227518DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 75cccgaccatt gggcccgg 187621DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 76ccgacccagt attgggcccg g 217722DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 77cccgaccatt gcagtggccc gg 227822DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 78cccgaccatt gaatgggccc gg 227922DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 79tccccgacca ttgggcccgg ca 228020DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 80cgaccattga ttgggcccgg 208116DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 81cgaccattgg gcccgg 168220DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 82cgaccattga ttgngncngg 208320DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 83cgaccattgg ggcngncngg 208420DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 84cgaccattga ttgggcccgg 208516DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 85cgaccattgg gcccgg 168620DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 86cgaccattga ttgggcccgg 208716DNAArtificial
SequenceDescription of Artificial Sequence Illustrative
oligonucleotide 87cgaccattgg gcccgg 16
* * * * *