U.S. patent application number 14/111265 was filed with the patent office on 2014-09-04 for modulators of mitochondrial protein import.
This patent application is currently assigned to The Regents of the University of California. The applicant listed for this patent is Deepa Dabir, Samuel A. Hasson, Carla M. Koehler, Kiyoko Miyata, Micheal A. Teitell. Invention is credited to Deepa Dabir, Samuel A. Hasson, Carla M. Koehler, Kiyoko Miyata, Micheal A. Teitell.
Application Number | 20140249193 14/111265 |
Document ID | / |
Family ID | 47009964 |
Filed Date | 2014-09-04 |
United States Patent
Application |
20140249193 |
Kind Code |
A1 |
Koehler; Carla M. ; et
al. |
September 4, 2014 |
MODULATORS OF MITOCHONDRIAL PROTEIN IMPORT
Abstract
The present invention provides compounds that modulate protein
translocation in mitochondria, compositions thereof, and methods of
identifying, making and using these.
Inventors: |
Koehler; Carla M.; (Los
Angeles, CA) ; Hasson; Samuel A.; (Los Angeles,
CA) ; Miyata; Kiyoko; (Los Angeles, CA) ;
Teitell; Micheal A.; (Tarzana, CA) ; Dabir;
Deepa; (Los Angeles, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Koehler; Carla M.
Hasson; Samuel A.
Miyata; Kiyoko
Teitell; Micheal A.
Dabir; Deepa |
Los Angeles
Los Angeles
Los Angeles
Tarzana
Los Angeles |
CA
CA
CA
CA
CA |
US
US
US
US
US |
|
|
Assignee: |
The Regents of the University of
California
Oakland
CA
|
Family ID: |
47009964 |
Appl. No.: |
14/111265 |
Filed: |
April 12, 2012 |
PCT Filed: |
April 12, 2012 |
PCT NO: |
PCT/US12/33279 |
371 Date: |
May 16, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61474724 |
Apr 12, 2011 |
|
|
|
Current U.S.
Class: |
514/383 ; 435/32;
435/375; 514/411; 514/468; 514/641; 548/264.8; 548/449; 549/458;
564/274 |
Current CPC
Class: |
C12Q 1/025 20130101;
A61K 31/343 20130101; A61K 31/137 20130101; A61P 35/00 20180101;
G01N 33/5079 20130101; A61P 25/16 20180101; C12Q 1/18 20130101;
A61K 31/15 20130101; A61P 25/28 20180101; A61K 31/4196 20130101;
A61K 31/404 20130101 |
Class at
Publication: |
514/383 ;
549/458; 514/468; 564/274; 514/641; 548/264.8; 548/449; 514/411;
435/375; 435/32 |
International
Class: |
A61K 31/343 20060101
A61K031/343; C12Q 1/18 20060101 C12Q001/18; A61K 31/404 20060101
A61K031/404; A61K 31/15 20060101 A61K031/15; A61K 31/4196 20060101
A61K031/4196 |
Goverment Interests
STATEMENT OF RIGHTS
[0001] This invention was made with Government support of Grant No.
GM061721, awarded by the National Institutes of Health. The
Government has certain rights in this invention.
Claims
1. A specific inhibitor of mitochondrial protein translocation,
which inhibitor modulates the assembly or function of mitochondria,
wherein the inhibitor specifically targets the protein
translocation pathway thereby modulating the assembly and function
of the mitochondrion with respect to protein translocation and
import.
2. The inhibitor of claim 1, which is a compound comprising a
structure of formula I, II or III: ##STR00008## a derivative
thereof, or pharmaceutically acceptable salt thereof, wherein each
R.sub.1, R.sub.2, and R.sub.3 is independently H, C1-C10
straight-chained or branched alkyl (substituted or unsubstituted),
C1-C10 cycloalkyl (substituted or unsubstituted), C1-C10
straight-chained or branched alkeynyl (substituted or
unsubstituted), C1-C10 cycloalkenyl (substituted or unsubstituted),
C1-C10 aryl (substituted or unsubstituted), phenyl, carboxyl,
hydroxyl, amino, carbonyl, carbonate, halo (F, Cl, Br, or I),
thiol, thiourea, urea, or triazole groups.
3. The inhibitor of claim 1, which is MitoBlock-1, MitoBlock-6, or
a formula according to any of A-D: ##STR00009## derivatives
thereof, or pharmaceutically acceptable salts thereof.
4. A composition comprising a specific inhibitor of mitochondrial
protein translocation, which inhibitor specifically targets the
protein translocation pathway thereby modulating the assembly and
function of the mitochondrion with respect to protein translocation
and import.
5. The composition of claim 4, wherein the inhibitor is a compound
of a structure of formula I, II or III: ##STR00010## a derivative
thereof, or pharmaceutically acceptable salt thereof, wherein each
R.sub.1, R.sub.2, and R.sub.3 is independently H, C1-C10
straight-chained or branched alkyl (substituted or unsubstituted),
C1-C10 cycloalkyl (substituted or unsubstituted), C1-C10
straight-chained or branched alkeynyl (substituted or
unsubstituted), C1-C10 cycloalkenyl (substituted or unsubstituted),
C1-C10 aryl (substituted or unsubstituted), phenyl, carboxyl,
hydroxyl, amino, carbonyl, carbonate, halo (F, Cl, Br, or I),
thiol, thiourea, urea, or triazole groups.
6. The composition of claim 4, wherein the inhibitor is
MitoBlock-1, MitoBlock-6 or a compound of a formula according to
any of A-D: ##STR00011## derivatives thereof, or pharmaceutically
acceptable salts thereof.
7. The composition of claim 4, further comprising a carrier.
8. The composition of claim 6, further comprising a carrier.
9. A method, comprising modulate the assembly or function of
mitochondria by applying to a body of mitochondria or a cell a
specific inhibitor of mitochondria protein translocation, wherein
the inhibitor specifically targets the protein translocation
pathway thereby modulating the assembly and function of the
mitochondrion with respect to protein translocation and import.
10. The method of claim 9, wherein the specific inhibitor is
according to claim 1.
11. The method of claim 9, wherein the specific inhibitor is
included in a composition.
12. The method of claim 11, wherein the composition further
comprises a carrier.
13. A method of treating or ameliorating a disorder, comprising
administering to a patient in need thereof a specific inhibitor of
mitochondria protein translocation, wherein the inhibitor
specifically targets the protein translocation pathway thereby
modulating the assembly and function of the mitochondrion with
respect to protein translocation and import.
14. The method of claim 13, wherein the specific inhibitor is
according to claim 1.
15. The method of claim 13, wherein the specific inhibitor is
included in a composition.
16. The method of claim 15, wherein the composition further
comprises a carrier.
17. The method of claim 11, wherein the disorder is a disease of
deafness-dystonia syndrome, cancer, Parkinson's disease, or
Alzheimer's disease.
18. A method for identifying a specific inhibitor of mitochondrial
protein translocation, comprising culturing a tim10-1 mutant strain
of yeast in a medium with a library of drug-like compounds,
identifying a drug-like compound as a hit compound if the drug-like
compound significantly inhibits growth of the tim10-1 mutant strain
of yeast, subjecting the hit compound to a counter screen which
comprises incubating the hit compound with the tim10-1 mutant
strain and an isogenic control strain carrying an integrated
version of the TIM10 gene at the leu2 locus, and identifying the
hit compound that selectively inhibits growth of the mutant strain
but not the isogenic control strain as a hit compound for second
counter screen where the second counter screen comprises:
incubating the hit compound for second counter screen with the
tim10-1 mutant strain and a tim10-1 mutant strain harboring a
plasmid containing a wild-type TIM10 gene, and identifying the hit
compound that selectively inhibits growth of the tim10-1 mutant but
not the tim10-1 mutant harboring a plasmid containing the wild-type
TIM10 gene; and designating the hit compound that selectively
inhibits growth of only the tim10-1 mutant in both the first
counter screen and the second counter screen as the specific
inhibitor of mitochondrial protein translocation ("MitoBloCk").
19. The method of claim 18, wherein the drug-like compound inhibits
growth of the tim10-1 mutant strain of yeast by 50% or above.
20. The method of claim 18, wherein the hit compound selectively
inhibits growth of the mutant strain by 50% or above.
21. The method of claim 18, wherein the hit compound selectively
inhibits growth of the mutant strain by 80% or above.
22. The method of claim 18, wherein the hit compound selectively
inhibits growth of the mutant strain by 90% or above.
23. The method of claim 18, wherein the hit compound selectively
inhibits growth of the mutant strain by 99% or above.
24. The method of claim 18, wherein the tim10-1 mutant has a
concentration of about 10 .mu.M.
25. The method of claim 18, comprising using an integrated robotic
system to perform any or all of the acts.
26. A method for identifying a specific inhibitor or activator of
mitochondrial disulfide relay pathways, comprising providing a
system of testing purified components of the mitochondrial
oxidative folding and disulfide relay pathway including Mia40,
Cmc1, Erv1, ALR, cytochrome c, and small Tim proteins in a medium
with a library of drug-like compounds, identifying a drug-like
compound as a hit compound if the drug-like compound significantly
inhibits or activates the activity of at least one of redox-active
enzymes, subjecting the hit compound to a counter screen which
comprises incubating the hit compound with a yeast or mammalian
cell line that reports the growth inhibition of a yeast strain or
mammalian cell line that had attenuated activity in its
mitochondrial disulfide relay pathway and an isogenic control
strain or cell line carrying a non-attenuated version of the
mitochondrial disulfide relay system, and identifying the hit
compound that selectively inhibits or promotes the growth of the
attenuated stain or cell line but not the strain or cell line as a
hit compound for second counter screen where the second counter
screen comprises: incubating the hit compound for second counter
screen with the a member of a redox-active enzyme family other than
ALR or Erv1, and identifying the hit compound that selectively
inhibits or activates the activity of ALR or Erv1 but not the
related redox-active enzyme; and designating the hit compound that
selectively inhibits or activates the activity of ALR or Ery in
both the first counter screen and the second counter screen as the
specific inhibitor of the mitochondrial disulfide relate system
("MitoBloCk").
27. The method of claim 26, wherein the drug-like compound inhibits
or activates the activity of ALR or Erv1 by 50% or above.
28. The method of claim 26, wherein the hit compound selectively
inhibits or activates the activity of ALR or Erv1 by 50% or
above.
29. The method of claim 26, wherein the hit compound selectively
inhibits or activates the activity of ALR or Erv1 by 80% or
above.
30. The method of claim 26, wherein the hit compound selectively
inhibits or activates the activity of ALR or Erv1 by 90% or
above.
31. The method of claim 26, wherein the hit compound selectively
inhibits or activates the activity of ALR or Erv1 by 99% or
above.
32. The method of claim 26, wherein the tim10-1 mutant has a
concentration of Erv1 or ALR is at or below its Michaelis-Menten
constant (Km).
33. The method of claim 18, wherein the tim10-1 mutant has a
concentration of Erv1 or ALR is at or below its Michaelis-Menten
constant (Km).
34. The method of claim 18, wherein the tim10-1 mutant has a
concentration of Erv1 or ALR is about 1 .mu.M.
35. The method of claim 26, comprising using an integrated robotic
system to perform any or all of the acts.
Description
FIELD OF THE INVENTION
[0002] The present invention generally relates to the field of
providing therapeutics.
BACKGROUND OF THE INVENTION
[0003] All eukaryotic cells contain specialized organs called
mitochondria that produce energy and house a host of metabolic
processes essential for life. To achieve a fully functional state,
mitochondria require proteins synthesized in the cell's cytosol to
be imported into the proper location on or within them. This
process is complicated because each mitochondrion is composed of
two distinct compartments arising from the set of lipid membranes
that surround them. Genetic, biochemical, and cellular studies have
identified a complex translocation system, including translocons on
the mitochondrial outer and inner membranes and intermembrane space
of the mitochondrial (Scheme I).
##STR00001##
[0004] The outer membrane contains the TOM (translocon of the outer
membrane) protein complex, whereas the inner membrane contains the
TIM23 (translocase of the inner membrane) and TIM22 complexes,
which differ in their substrate specificity. Defects in the TIM22
import pathway lead to an inherited disease called
deafness-dystonia syndrome, in which patients have deafness,
blindness, and dystonia.
[0005] There is a need for compounds that are specific inhibitors
of mitochondrial protein translocation. The inhibitors modulate the
assembly or function of mitochondria.
[0006] There is a need for compounds effective for a disorder
related to mitochondrial protein translocation.
[0007] The embodiments below address the above identified needs and
issues.
SUMMARY OF THE INVENTION
[0008] In one aspect of the present invention, it is provided a
method for identifying a specific inhibitor of mitochondrial
protein translocation, which method comprising culturing a tim10-1
mutant strain of yeast in a medium with a library of drug-like
compounds, identifying a drug-like compound as a hit compound if
the drug-like compound significantly inhibits growth of the tim10-1
mutant strain of yeast,
subjecting the hit compound to a counter screen which comprises
[0009] incubating the hit compound with the tim10-1 mutant strain
and an isogenic control strain carrying an integrated version of
the TIM10 gene at the leu2 locus, and
[0010] identifying the hit compound that selectively inhibits
growth of the mutant strain but not the isogenic control strain as
a hit compound for second counter screen where the second counter
screen comprises: [0011] incubating the hit compound for second
counter screen with the tim10-1 mutant strain and a tim10-1 mutant
strain harboring a plasmid containing a wild-type TIM10 gene, and
[0012] identifying the hit compound that selectively inhibits
growth of the tim10-1 mutant but not the tim10-1 mutant harboring a
plasmid containing the wild-type TIM10 gene; and designating the
hit compound that selectively inhibits growth of only the tim10-1
mutant in both the first counter screen and the second counter
screen as the specific inhibitor of mitochondrial protein
translocation ("MitoBloCk").
[0013] In some embodiments of the method, the drug-like compound
inhibits growth of the tim10-1 mutant strain of yeast by 50% or
above.
[0014] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 50% or above.
[0015] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 80% or above.
[0016] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 90% or above.
[0017] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 99% or above.
[0018] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of about 10 .mu.M.
[0019] In some embodiments of the method, in combination with any
of the above various embodiments, the method comprises an
integrated robotic system.
[0020] In another aspect of the present invention, it is provided a
method for identifying a specific inhibitor or activator of
mitochondrial disulfide relay pathways. The method comprises
providing a system of testing purified components of the
mitochondrial oxidative folding and disulfide relay pathway
including Mia40, Cmc1, Erv1, ALR, cytochrome c, and small Tim
proteins in a medium with a library of drug-like compounds,
identifying a drug-like compound as a hit compound if the drug-like
compound significantly inhibits or activates the activity of at
least one of redox-active enzymes, subjecting the hit compound to a
counter screen which comprises
[0021] incubating the hit compound with a yeast or mammalian cell
line that reports the growth inhibition of a yeast strain or
mammalian cell line that had attenuated activity in its
mitochondrial disulfide relay pathway and an isogenic control
strain or cell line carrying a non-attenuated version of the
mitochondrial disulfide relay system, and
[0022] identifying the hit compound that selectively inhibits or
promotes the growth of the attenuated stain or cell line but not
the strain or cell line as a hit compound for second counter screen
where the second counter screen comprises: [0023] incubating the
hit compound for second counter screen with the a member of a
redox-active enzyme family other than ALR or Erv1, and [0024]
identifying the hit compound that selectively inhibits or activates
the activity of ALR or Erv1 but not the related redox-active
enzyme; and designating the hit compound that selectively inhibits
or activates the activity of ALR or Erv in both the first counter
screen and the second counter screen as the specific inhibitor of
the mitochondrial disulfide relate system ("MitoBloCk").
[0025] In some embodiments of the method, the drug-like compound
inhibits or activates the activity of ALR or Erv1 by 50% or
above.
[0026] In some embodiments of the method, the hit compound
selectively inhibits or activates the activity of ALR or Erv1 by
50% or above.
[0027] In some embodiments of the method, the hit compound
selectively inhibits or activates the activity of ALR or Erv1 by
80% or above.
[0028] In some embodiments of the method, the hit compound
selectively inhibits or activates the activity of ALR or Erv1 by
90% or above.
[0029] In some embodiments of the method, the compound selectively
inhibits or activates the activity of ALR or Erv1 by 99% or
above.
[0030] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of Erv1 or ALR is at or below its Michaelis-Menten
constant (Km).
[0031] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of Erv1 or ALR is at or below its Michaelis-Menten
constant (Km).
[0032] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of Erv1 or ALR is about 1 .mu.M.
[0033] In some embodiments of the method, in combination with any
of the above various embodiments, the method comprises an
integrated robotic system.
[0034] In another aspect of the present invention, embodiments of
the invention herein provide a specific inhibitor of mitochondrial
protein translocation, which the inhibitor specifically targets the
protein translocation pathway thereby modulating the assembly and
function of the mitochondrion with respect to protein translocation
and import. In some embodiments, the inhibitors are molecules or
compounds, derivatives thereof or pharmaceutically acceptable salts
thereof. In some embodiments, the compound has a structure of
formula I, II or III:
##STR00002##
a derivative thereof, or pharmaceutically acceptable salt thereof,
wherein each R.sub.1, R.sub.2, and R.sub.3 is independently H,
C1-C10 straight-chained or branched alkyl (substituted or
unsubstituted), C1-C10 cycloalkyl (substituted or unsubstituted),
C1-C10 straight-chained or branched alkeynyl (substituted or
unsubstituted), C1-C10 cycloalkenyl (substituted or unsubstituted),
C1-C10 aryl (substituted or unsubstituted), phenyl, carboxyl,
hydroxyl, amino, carbonyl, carbonate, halo (F, Cl, Br, or I),
thiol, thiourea, urea, or triazole groups. In some embodiments, the
compound is
##STR00003##
a derivative thereof, or a pharmaceutically acceptable salt
thereof. In some embodiments, the compound has a structure of
formula A-D:
##STR00004##
derivatives thereof, or pharmaceutically acceptable salts
thereof.
[0035] The molecules are effective for treating or ameliorating
disorders related to mitochondrial protein import. In some
embodiments, the disorder is related to deafness-dystonia syndrome
(e.g., blindness, deafness, and dystonia). In some embodiments, the
disorder is a disease caused by defects in mitochondrial function.
Some examples of such diseases are cancer, Parkinson's disease, or
Alzheimer's disease.
[0036] In some embodiments, it is provided a composition comprising
the compound disclosed herein. Compositions can be formed to
include an effective amount of a compound disclosed herein. In some
embodiments, the composition can include a carrier, e.g., a
pharmaceutically acceptable carrier.
[0037] In some embodiments, it is provided a method of using the
compound. Generally, the method comprises modulating the assembly
and/or function of mitochondria by applying a compound disclosed
herein to a body of mitochondria or a cell. The cell can be
cultured cell, or an organism dissolved in solution, or a living
organism such as an animal (e.g., human being). In some
embodiments, the compound can be included in a composition which
optionally includes a pharmaceutically acceptable carrier.
[0038] Other embodiments of the present invention include method of
making the compound disclosed herein and method of forming a
composition disclosed herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0039] FIGS. 1A and 1B show a phenotypic analysis of the strains
used for the chemical synthetic-lethality screen for inhibitors of
the TIM22 protein import pathway. (A) Growth phenotypes of the
control (TIM10), the tim10-1 mutant, and tim10-1 suppressor
(tim10-1 tim9S) strains used in the screen. Strains were plated on
rich glucose (YPD) or ethanol-glycerol (YPEG) media and incubated
at 25.degree. C. or 37.degree. C. All of these strains were
isogenic except for their denoted genetic variation. (B)
Radiolabeled AAC was imported into isolated mitochondria in the
presence and absence of a membrane potential (.DELTA..psi.).
Aliquots were removed at the indicated time points and samples were
treated with carbonate extraction to confirm that AAC was inserted
into the IM.
[0040] FIGS. 2A and 2B show MitoBloCK-1 exhibits a chemical
synthetic lethality with the tim10-1 mutant. (A) The structure of
MitoBloCK-1, a tetrahydrodibenzofuran compound. (B) MIC.sub.50
analysis of two tim10 mutants (tim10-1 and tim10-73) and the
parental (TIM10) strain with MitoBloCK-1. Average % survival .+-.SD
of n=3 trials. The R.sup.2 values for tim10-1 and tim10-73 curve
fits were 0.98 and 0.99, respectively.
[0041] FIGS. 3A-3D show MitoBloCK-1 inhibits the import of
substrates that use the TIM22 import pathway. Import assays were
performed with radiolabeled precursors into mitochondria from the
tim10-1 tim9S suppressor strain, which has restored import of AAC.
Time course assays were completed with various concentrations of
MitoBloCK-1 or the vehicle control (1% DMSO). Non-imported
precursor was removed by protease treatment. Precursors include (A)
AAC, (B) the phosphate carrier (PIC), (C) Tom40, and (D) Hsp60,
Panels a-c represent precursors that use the TIM22 import pathway
whereas panel d is a substrate of the TIM23 import pathway. p,
precursor; m, mature.
[0042] FIGS. 4A and 4B show shows MitoBloCK-1 impairs substrate
binding by the Tim9-Tim10 complex. (A) AAC was imported into
mitochondria isolated from TIM10, tim10-1, and suppressor tim10-1
tim9S strains in the presence and absence of a .DELTA..psi.. Where
indicated, MitoBloCK-1 was included in the tim10-1 tim9S
mitochondria. After importing AAC 15 min, reactions were stopped
with either cold buffer or trypsin (protease). (B) AAC was imported
into tim10-1 tim9S mitochondria in the presence of 25 .mu.M
MitoBloCK-1 or uncoupled mitochondria (lanes 1-3), A fraction of
the import reaction was treated with the irreversible cysteine
crosslinker bismaleimidohexane (BMH) (lanes 4-6). BMH-treated
samples were divided and aliquots were subjected to
immunoprecipitation (IP) with either Tim22 (22), Tom40 (40), or
Tim9 (9) polyclonal antibodies bound to protein A-Sepharose beads
(lanes 7-12). In addition to the previously characterized Tim9-AAC
crosslink, a second crosslink of approximately 55 kD (denoted by *)
was prevalent in the MitoBloCK-1 and BMH treated sample (lane
6).
[0043] FIGS. 5A-5C show MitoBloCK-1 facilitates substrate
specificity analysis. Tim22 (A), Tim23 (B), and Tafazzin (C) were
imported into tim10-1 tim9S mitochondria in the presence of
MitoBloCK-1 or the vehicle (1% DMSO) followed by carbonate
extraction to confirm insertion into the membrane.
[0044] FIGS. 6A-6C show MitoBloCK-1 activity is influenced by
specific chemical characteristics and inhibits AAC imported into
mammalian mitochondria. (A) Analogs of MitobloCK-1 were purchased
from Chembridge and assayed in import assays with radiolabled AAC
as previously described. (B) AAC was imported into isolated mouse
liver mitochondria in the presence of 25 .mu.M MitoBloCK-1 as in
FIG. 3A. (C) Model of MitoBloCK-1 activity from experimental
evidence. See text for more details.
[0045] FIGS. 7A-7B show phenotypic analysis of the strains used for
the chemical synthetic-lethality screen for inhibitors of the TIM22
protein import pathway. (A) Steady-state levels of mitochondrial
proteins determined by immunoblot analysis. Equivalent amounts of
purified mitochondria were prepared from each strain and
mitochondrial proteins were subsequently immunoblotted with
polyclonal antibodies. The antibody against AAC also cross-reacted
with porin (denoted by *) (B) Mitochondria were solubilized in
buffer with 1.6 mg/ml n-dodecylmaltoside and separated on a 6-16%
blue-native gel. Proteins were transferred to a PVDF membrane and
blotted with antibodies against Tim9 and Tim10.
[0046] FIG. 8 shows MitoBloCK-1 does not inhibit AAC import into
wild-type mitochondria. Import of AAC was performed as described in
3a into wild-type mitochondria. The rate of import was similar in
the presence of the vehicle DMSO or MitoBloCK-1.
[0047] FIGS. 9A-9F show MitoBloCK-1 inhibits the import of
substrates that use the TIM22 import pathway but not the TIM23 and
Mia40/Erv1 import pathways. Import assays were performed as
described in FIG. 3. Precursors include (A) Su9-DHFR, (B)
cytochrome b.sub.2-DHFR, (C) Tim10, (D) Tim9, (E) Mia40. Panels A-B
are proteins that use the TIM23 import pathway and panels C-D are
intermembrane space proteins that use the Mia40 import pathway. (F)
Import assays were performed with AAC into tim12-1 mutant
mitochondria. p, precursor; i, intermediate; m, mature.
[0048] FIGS. 10A-10H show MitoBloCK-1 does not impair general
mitochondrial function. Respiration measurements were performed
with an oxygen electrode using yeast mitochondria (M) from the
tim10 tim9S suppressor strain in the presence of (A) 1% DMSO
(vehicle control for drug) and (B) MitoBloCK-1. Respiration was
initiated with NADH addition. 25 .mu.M MitoBloCK-1 or 1% DMSO was
added once steady-state respiration had been established. As a
control, CCCP was added to uncouple the electron transport chain.
(C) Respiration for series with DMSO or MitoBloCK-1 addition was
quantitated (n=3). Bars represent mean rates with standard
deviations as error bars. (D) Membrane potential (.DELTA..psi.) of
mitochondria measurements of purified mitochondria were performed
with the fluorescent dye rhodamine 123 using a fluorimeter. Coupled
mitochondria (M) sequestered and quenched the dye fluorescence; 1%
DMSO was added to determine its effect on the .DELTA.. Collapse of
the .DELTA..psi. initiated by CCCP was included as a control. (E)
As in D, but 25 .mu.M MitoBloCK-1 was added to determine its effect
on the A. (F) 50 .mu.M MitoBloCK-1 (MB-1) was added to purified 100
ug/ml tim10-1 tim9S mitochondria for 30 min at 25.degree. C. in
import buffer and released proteins (S) were separated from
mitochondria (P) by centrifugation. Immunoblot analysis was
performed to determine fractionation for Hsp60, Tom40, AAC, cyt c,
and Tim10. As a control, treatment with the vehicle (1% DMSO) and
MitoBloCK-2 (MB-2, disrupts mitochondrial membranes) was included.
(G) As in `F`, but integrity was investigated with Coomassie
staining. (H) As in 7B, MitoBloCK-1 (25 and 50 .mu.M) was incubated
with mitochondria and assembly of the Tim9-Tim10 complex was
monitored by BN gels and immunoblotting with antibodies against Tim
10.
[0049] FIGS. 11A-11C show MitoBloCK-1 inhibits import into
mammalian mitochondria and growth of HeLa cells. (A) The effect of
MitoBloCK-1 (MB-1) on HeLa cells was demonstrated with an MTT cell
viability assay. Cultured cells were treated for 24-hours with DMSO
or 25 and 50 .mu.M MitoBloCK-1. Bars display mean cell viability
where 100% was defined as signal from untreated samples. Error bars
are standard deviations (n=3 trials). P value for t-tests between
DMSO and MitoBloCK-1 illustrated with bracket lines. (B, C) As a
control for FIG. 7B, the import of Hsp60 and Su9-DHFR that are
targeted to the matrix was also tested in isolated mouse liver
mitochondria in the presence and absence of a membrane potential.
Note for Su9-DEFR import, the mitochondria were not treated with
protease after import to remove non-imported Su9-DHFR because the
DHFR is resistant to protease degradation. The processed fowl
(mature, m) indicates the amount of precursor that has been
imported. p, precursor; m, mature.
[0050] FIGS. 12A-C show that MitoBloCK-6 inhibits Erv1 activity.
(A) The structure of MitoBloCK-6, Erv1 SAR compound-1 (ES-1) and
compound-2 (ES-2), and 3,5-dichlorosalicyclaldehyde. (B) IC.sub.50
analysis of MitoBloCK-6 in the in vitro Erv1 activity assay. 10
.mu.M Erv1 was incubated with varying concentrations of MitoBloCK-6
as described for the chemical screen (C) As in `B`, IC.sub.50
analysis with 3,5-dichlorosalicylaldehyde and Erv1.
[0051] FIGS. 13A-C illustrate the high-throughput screen to
identify Erv1 inhibitors. (A) Schematic of the Erv1 high-throughput
screen. (B) Summary of the screening analysis. (C) 2, 5, and 10
.mu.M of MitoBloCK-6 were preincubated with Amplex Red/HRP before
the reaction was initiated by the addition of 800 nM
H.sub.2O.sub.2. The fluorescence intensity was measured after 12
min. (n=5)
[0052] FIGS. 14A and B show that MitoBloCK-6 does not inhibit
PDI-mediated insulin reduction or succinate dehydrogenase activity.
(A) 160 .mu.M insulin was reacted with 3 units of PDI in the
presence of buffer, 1 mM bacitracin, or MitoBloCK-6 (MB-6).
Reduction of insulin chains was initiated by the addition of DTT.
The samples were incubated for 30 min at room temperature and then
the turbidity was measured at a wavelength of 630 nm using a
Bio-Tek plate-reader. (B) Succinate dehydrogenase activity was
measured in WT mitochondria using a Clark-type oxygen electrode.
Respiration was initiated with 10 mM succinate and, when
steady-state respiration was established, 25 or 50 .mu.M
MitoBloCK-6, 50 .mu.M ES-1, 50 .mu.M ES-2, or 1% DMSO was added.
Controls included 20 mM malonate that inhibits succinate
dehydrogenase activity and CCCP that uncouples electron transport.
The rate is reported as nmol O.sub.2 consumed/sec.
[0053] FIG. 15 demonstrate that MitoBloCK-6 is stable. MitoBloCK-6
at a final concentration of 3 mM was incubated with screening
buffer (30 mM Hepes, 100 mM NaCl, 1 mM EDTA) at pH 3.4, 6.5, and
7.4 in a reaction volume of 100 .mu.l at room temperature for 1
hour. The sample was injected into the LC-MS and retention was
monitored. As a control, 20 mM MitoBloCK-6 in 1% DMSO was also
analyzed.
[0054] FIGS. 16A-D show that MitoBloCK-6 inhibits the import of
substrates of the Mia40/Erv1 pathway. Radiolabeled precursors were
imported into WT mitochondria in the presence of 25 or 50 .mu.M
MitoBloCK-6, 50 .mu.M SAR compounds or the control 1% DMSO.
Non-imported precursor was removed by protease treatment. A 10%
standard (Std) from the translation reaction is included.
Precursors included (A) Mia40, (B) Cmc1, (C) Cox19, and (D) Tim8. A
10% standard (Std) from the translation reaction is included.
Import reactions were quantitated using a BioRad FX Molecular
Imager and the affiliated Quantity 1 software; 100% was set as the
amount of precursor imported into WT mitochondria at the endpoint
in the time course.
[0055] FIGS. 17A-D illustrate that MitoBloCK-6 inhibits import of
substrates of the Erv1 oxidative folding pathway. (A) In vitro
import assays were performed with TIM23 substrate cyt b.sub.2-DHFR
into isolated wild-type mitochondria in the presence of control 1%
DMSO or 50 .mu.M MitoBloCK-6 as described in FIG. 18C. (B) As in
`A` with Tim23 substrate Hsp60. In vitro import assays were
performed into isolated wild-type mitochondria in the presence of
control 1% DMSO, 25 or 50 .mu.M MitoBloCK-6 or 50 .mu.M ES-1 or
ES-2. Substrates included (C) Cox17 and (D) Erv1. A 10% standard
(Std) from the translation reaction is included. Import rates were
analyzed as described in FIG. 16.
[0056] FIGS. 18A-D show that MitoBloCK-6 inhibits the import of
substrates of the TIM22 import pathway but not the TIM23 import
pathway. As in FIG. 16, import assays were performed. Precursors
included TIM22 import substrates (A) Tim23 and (B) AAC. Aliquots
were removed at the indicated time points and samples were treated
with carbonate extraction to confirm that Tim23 and AAC were
inserted into the inner membrane. TIM23 import substrate was (C)
Su9-DHFR, (D) AAC was imported in the presence of DMSO or 25 .mu.M
MitoBloCK-6, aliquots were removed at indicated time points and
samples were subjected to Blue-Native PAGE analysis followed by
autoradiography (left panel) or incubated with antibodies against
Tom40 (right panel).
[0057] FIGS. 19A-E show that inhibition of import by MitoBloCK-6 is
dependent on the concentration of Erv1 in mitochondria. Import
assays of precursors (A) Mia40, (B) Cmc1 and (C) AAC were performed
as described in FIG. 16 into mitochondria derived from wild-type
yeast (WT) or yeast overexpressing Erv1 with a hexahistidine tag
(.uparw.Erv1) (Dabir et al., 2007). The concentration of
MitoBloCK-6 was varied from 5 to 50 .mu.M as indicated. A 10%
standard (Std) from the translation reaction was included. (D)
MIC.sub.50 analysis of the WT yeast strain lacking the drug pumps
(.DELTA.pdr5 .DELTA.snq2) with varying concentrations of
MitoBloCK-6. Average % survival .+-.SEM of n=6 trials. (E) As in
`D`, MIC.sub.50 analysis of the .DELTA.pdr5 .DELTA.snq2 yeast
strain that overexpresses Erv1-His from a high-copy plasmid
(.uparw.Erv1).
[0058] FIGS. 20A-C show that MitoBloCK-6 does not impair general
mitochondrial function. (A) 25 or 50 .mu.M MitoBloCK-6 (MB-6) was
added to purified 100 .mu.g/ml WT mitochondria for 30 min at
25.degree. C. in import buffer and released proteins (S) were
separated from mitochondria (P) by centrifugation. Proteins were
visualized by Coomassie staining (B) As in `A`, except immunoblot
analysis was performed to determine the fractionation for
aconitase, Mia40, Ccp1, AAC, Tim54, and cyt c. As a control,
treatment with the vehicle (1% DMSO) was included. (C) Respiration
measurements were performed with a Clark-type oxygen electrode
using 100 .mu.g/ml WT mitochondria in the presence of 1% DMSO or
MitoBloCK-6. Respiration was initiated with NADH addition. 25 .mu.M
MitoBloCK-6 or 1% DMSO was added once steady-state respiration had
been established. As a control, CCCP was added to uncouple the
electron transport chain. (D) The Clark-type oxygen electrode was
used to directly measure oxygen consumed when 10 .mu.M Erv1
oxidized DTT in the presence of MitoBloCK-6 or the control 1% DMSO.
The rate (nmol O.sub.2 consumed per second) was calculated in the
linear portion of the reaction.
[0059] FIGS. 21A-E demonstrate that MitoBloCK-6 impairs substrate
oxidation in vitro and disrupts Erv1 binding. (A) Mitochondria from
a strain expressing C-terminal histidine-tagged Erv1 were incubated
with 50 .mu.M MitoBloCK-6 or 1% DMSO for 30 min at 25.degree. C.
followed by solubilization in 1% digitonin buffer. As a control,
100 .mu.g of extract was withdrawn (T), and 500 .mu.g lysate was
incubated with Ni.sup.+2-agarose beads. The beads were washed and
bound proteins (B) were eluted with SDS-PAGE sample buffer. To test
effectiveness of binding, 100 .mu.g of the unbound protein fraction
(S) was also included. Proteins were analyzed by immunoblotting
with polyclonal antibodies against Mia40, Erv1, and cyt c. (B)
Recombinant Erv1 was preincubated with MitoBloCK-6 or 1% DMSO for 1
hr at 25.degree. C. and then Erv1 (1 .mu.M) was incubated with
reduced Tim13 (15 .mu.M) and Mia40 (1 .mu.M) in a time course assay
(Tienson et al., 2009). Aliquots were removed at the indicated
times and free thiols on Tim13 were modified with AMS addition.
Oxidized and reduced Tim13 were detected by non-reducing SDS-PAGE
and immunoblotting with antibodies against Tim13. (C, D, E) The
same reconstitution assay was performed as in `B` with reduced
Tim13 (C) or reduced Cmc1 (D,E) or mammalian ALR (E) and
H.sub.2O.sub.2 production was monitored over a 30-min time period
with the indicator Amplex Red and displayed as pmol H.sub.2O.sub.2
(n=3).
[0060] FIGS. 22A-E show that MitoBloCK-6 induces apoptosis in
pluripotent stem cells. (A) HSF1 cells were treated with 20 .mu.M
MitoBloCK-6 or 0.1% DMSO. As a positive control, apoptosis was
induced in cells by treatment with 20 .mu.M actinomycin D (ActD)
and 100 .mu.M z-VAD-fmk for 16 hours. Cells were fixed and analyzed
by immunofluorescence microscopy using antibodies against cyt c
(green) and Tomm20 (Red). Merged images are also depicted in
panels. (B) Quantification of data obtained in (A) and represented
as % of cells that lost the mitochondrial cyt c staining but
retained Tomm20 staining Data was collected from three independent
experiments. Error bars represent standard deviation. (C) As in
`A`, HSF1 cells were treated with 20 .mu.M MitoBloCK-6 or 20 .mu.M
ActD for the indicated time. Whole cell extracts were analyzed by
SDS-PAGE and immunoblotted with antibodies for caspase-3 fragment
and PARP. Tomm40 was included as a loading control. (D) As in `A`,
HSF1 cells were treated with 20 .mu.M MitoBloCK-6 for the indicated
times followed by staining for alkaline phosphatase activity. Scale
bar, 500 .mu.m. (E) Analysis of alkaline phosphatase activity in
HSF1 cells after treatment with either 0.1% DMSO, 20 .mu.M
MitoBloCK-6 or 20 .mu.M ES-1 for 24 hours. Scale bar, 500
.mu.m.
[0061] FIGS. 23 A-C demonstrate that MitoBloCK-6 does not inhibit
cell growth or alter mitochondrial morphology in HeLa cells. (A)
HeLa cells were transiently transfected with Su9-EGFP. Following
transfection, cells were treated for 12 hr with 50 .mu.M
MitoBloCK-6 or control 1% DMSO. As a positive control, cells were
incubated with 20 .mu.M CCCP to dissipate the membrane potential.
Mitochondria were also stained with 10 .mu.M MitoTracker Red.
Mitochondrial morphology was assessed by fluorescence microscopy
and the Mitotracker Red and GFP channels were superimposed (Merge).
(B) The effect of MitoBloCK-6 on the viability of HeLa cells was
assessed with a MTT-based toxicology assay. Cultured cells were
treated for 12-16 hr with DMSO or 50 .mu.M and 100 .mu.M
MitoBloCK-6. Bars display mean cell viability where 100% was
defined as signal from untreated samples. Error bars display
standard error of the mean (n=5). (C) The release of cyt c was
investigated. Cells were treated with 1% DMSO or 50 .mu.M
MitoBloCK-6 for 12-16 hr and fractionated into mitochondrial (M)
and cytosolic (C) fractions. Release of mitochondrial proteins was
assessed by immunoblot analysis with antibodies against cyt c,
Complex V (ATP synthase subunit alpha), pyruvate dehydrogenase
(PDH), and cytosolic GAPDH. Treatment with 1 .mu.M staurosporine
for 4 hr induced apoptosis and was included as a positive
control.
[0062] FIGS. 24A and B illustrate that MitoBloCK-6 inhibits growth
of pluripotent but not differentiated cells. (A) Brightfield images
of hSF1 cells, retinoic acid differentiated 4-day hSF1 cells, and
NHDF cells treated with 20 .mu.M MitoBloCK-6 or 0.1% DMSO for 16
hr. (B) As in `A`, cells were stained with Coomassie brilliant
blue. Scale bar, 750 .mu.m.
[0063] FIGS. 25A-I show that MitoBloCK-6 treatment impairs somite
and cardiac development in zebrafish. Embryos (3 hpf) were treated
with 2.5 .mu.M MitoBloCK-6 (B, E, H) or 1% DMSO (A,D,G) or embryos
were injected with an ATG morpholino against ALR (C,F). Development
was visualized by microscopy at 72 hpf (A-B) or 48 hpf (C).
Erythrocytes were visualized by o-dianisidine staining at 72 hpf
(D-E) or 48 hpf (F); arrows indicate regions of red blood
cellaccumulation in wild-type fish. Fluorescence microscopy of
zebrafish hearts (72 hpf) that contained a mitochondrial-targeted
DsRed included embryos treated with 1% DMSO (G), 2.5 .mu.M
MitoBloCK-6 (H), and buffer only (I).
DETAILED DESCRIPTION OF THE INVENTION
[0064] In one aspect of the present invention, it is provided a
method for identifying a specific inhibitor of mitochondrial
protein translocation, which method comprising culturing a tim10-1
mutant strain of yeast in a medium with a library of drug-like
compounds, identifying a drug-like compound as a hit compound if
the drug-like compound significantly inhibits growth of the tim10-1
mutant strain of yeast,
subjecting the hit compound to a counter screen which comprises
[0065] incubating the hit compound with the tim10-1 mutant strain
and an isogenic control strain carrying an integrated version of
the TIM10 gene at the leu2 locus, and
[0066] identifying the hit compound that selectively inhibits
growth of the mutant strain but not the isogenic control strain as
a hit compound for second counter screen where the second counter
screen comprises: [0067] incubating the hit compound for second
counter screen with the tim10-1 mutant strain and a tim10-1 mutant
strain harboring a plasmid containing a wild-type TIM10 gene, and
[0068] identifying the hit compound that selectively inhibits
growth of the tim10-1 mutant but not the tim10-1 mutant harboring a
plasmid containing the wild-type TIM10 gene; and designating the
hit compound that selectively inhibits growth of only the tim10-1
mutant in both the first counter screen and the second counter
screen as the specific inhibitor of mitochondrial protein
translocation ("MitoBloCk").
[0069] In some embodiments of the method, the drug-like compound
inhibits growth of the tim10-1 mutant strain of yeast by 50% or
above.
[0070] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 50% or above.
[0071] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 80% or above.
[0072] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 90% or above.
[0073] In some embodiments of the method, in combination with any
of the above various embodiments, the hit compound selectively
inhibits growth of the mutant strain by 99% or above.
[0074] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of about 10 .mu.M.
[0075] In some embodiments of the method, in combination with any
of the above various embodiments, the method comprises an
integrated robotic system.
[0076] In another aspect of the present invention, it is provided a
method for identifying a specific inhibitor or activator of
mitochondrial disulfide relay pathways. The method comprises
providing a system of testing purified components of the
mitochondrial oxidative folding and disulfide relay pathway
including Mia40, Cmc1, Erv1, ALR, cytochrome c, and small Tim
proteins in a medium with a library of drug-like compounds,
identifying a drug-like compound as a hit compound if the drug-like
compound significantly inhibits or activates the activity of at
least one of redox-active enzymes, subjecting the hit compound to a
counter screen which comprises
[0077] incubating the hit compound with a yeast or mammalian cell
line that reports the growth inhibition of a yeast strain or
mammalian cell line that had attenuated activity in its
mitochondrial disulfide relay pathway and an isogenic control
strain or cell line carrying a non-attenuated version of the
mitochondrial disulfide relay system, and
[0078] identifying the hit compound that selectively inhibits or
promotes the growth of the attenuated stain or cell line but not
the strain or cell line as a hit compound for second counter screen
where the second counter screen comprises: [0079] incubating the
hit compound for second counter screen with the a member of a
redox-active enzyme family other than ALR or Erv1, and [0080]
identifying the hit compound that selectively inhibits or activates
the activity of ALR or Erv1 but not the related redox-active
enzyme; and designating the hit compound that selectively inhibits
or activates the activity of ALR or Ery in both the first counter
screen and the second counter screen as the specific inhibitor of
the mitochondrial disulfide relate system ("MitoBloCk").
[0081] In some embodiments of the method, the drug-like compound
inhibits or activates the activity of ALR or Erv1 by 50% or
above.
[0082] In some embodiments of the method, the hit compound
selectively inhibits or activates the activity of ALR or Erv1 by
50% or above.
[0083] In some embodiments of the method, the hit compound
selectively inhibits or activates the activity of ALR or Erv1 by
80% or above.
[0084] In some embodiments of the method, the hit compound
selectively inhibits or activates the activity of ALR or Erv1 by
90% or above.
[0085] In some embodiments of the method, the compound selectively
inhibits or activates the activity of ALR or Erv1 by 99% or
above.
[0086] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of Erv1 or ALR is at or below its Michaelis-Menten
constant (Km).
[0087] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of Erv1 or ALR is at or below its Michaelis-Menten
constant (Km).
[0088] In some embodiments of the method, in combination with any
of the above various embodiments, the tim10-1 mutant has a
concentration of Erv1 or ALR is about 1 .mu.M.
[0089] In some embodiments of the method, in combination with any
of the above various embodiments, the method comprises an
integrated robotic system.
[0090] In another aspect of the present invention, embodiments of
the invention herein provide a specific inhibitor of mitochondrial
protein translocation, which the inhibitor specifically targets the
protein translocation pathway thereby modulating the assembly and
function of the mitochondrion with respect to protein translocation
and import. In some embodiments, the inhibitors are molecules or
compounds, derivatives thereof or pharmaceutically acceptable salts
thereof. In some embodiments, the compound has a structure of
formula I, II or III:
##STR00005##
a derivative thereof, or pharmaceutically acceptable salt thereof,
wherein each R.sub.1, R.sub.2, and R.sub.3 is independently H,
C1-C10 straight-chained or branched alkyl (substituted or
unsubstituted), C1-C10 cycloalkyl (substituted or unsubstituted),
C1-C10 straight-chained or branched alkeynyl (substituted or
unsubstituted), C1-C10 cycloalkenyl (substituted or unsubstituted),
C1-C10 aryl (substituted or unsubstituted), phenyl, carboxyl,
hydroxyl, amino, carbonyl, carbonate, halo (F, Cl, Br, or I),
thiol, thiourea, urea, or triazole groups. In some embodiments, the
compound is
##STR00006##
a derivative thereof, or a pharmaceutically acceptable salt
thereof. In some embodiments, the compound has a structure of
formula A-D:
##STR00007##
derivatives thereof, or pharmaceutically acceptable salts
thereof.
[0091] The molecules are effective for disorders related to
mitochondrial protein import. In some embodiments, the disorder is
related to deafness-dystonia syndrome (e.g., blindness, deafness,
and dystonia). In some embodiments, the disorder is a disease
caused by defects in mitochondrial function. Some examples of such
diseases are cancer, Parkinson's disease, or Alzheimer's
disease.
[0092] In some embodiments, it is provided a composition comprising
the inhibitor or compound disclosed herein. Compositions can be
formed to include an effective amount of a compound disclosed
herein. In some embodiments, the composition can include a carrier,
e.g., a pharmaceutically acceptable carrier.
[0093] In some embodiments, it is provided a method of using the
compound. Generally, the method comprises modulating the assembly
and/or function of mitochondria by applying a compound disclosed
herein to a body of mitochondria or a cell. The cell can be
cultured cell, or an organism dissolved in solution, or a living
organism such as an animal (e.g., human being). In some
embodiments, the compound can be included in a composition which
optionally includes a pharmaceutically acceptable carrier.
[0094] Other embodiments of the present invention include method of
making the compound disclosed herein and method of forming a
composition disclosed herein.
[0095] The present invention represents a significant innovation.
Prior to the discovery of these compounds, scientists could only
modulate the biogenesis of mitochondria using genetic manipulation
or non-specific drug treatments. Genetic manipulations are mostly
limited to single celled organisms such as yeast and are not
titratable or reversible. The available chemical tools for
mitochondrial biogenesis are limited in their utility since they
are either nonspecific inhibitors or metabolic poisons that block
cellular respiration. Recently, Nunnari and colleagues (U.S. patent
application publication No. 20050038051) discovered a drug compound
that regulated the fission and fusion of mitochondria. Their
discovery of mdivi-1 was the first drug that could specifically
alter mitochondrial dynamics. However, at this time there are no
known drugs that target the assembly of the mitochondrion with
respect to protein translocation1 import. Our invention
specifically targets the protein translocation pathway.
[0096] The studies disclosed in the present invention show that the
inhibition by the invention compounds is specific to the protein
import machinery. The following targets are the most probable ones
for studying the mechanism of action:
[0097] i. MitoBloCK-1: Tim9/1 0 chaperone complex;
[0098] ii. MitoBloCK-2: Tom40 outer membrane translocation
pore;
[0099] iii. MitoBloCK-3: Small Tim protein chaperones
[0100] iv. MitoBloCK-6: Redox cycling of small Tim protein
chaperones
[0101] We have shown that these drugs have activity in both
biochemical experiments with purified cellular components and in
live cells.
[0102] As used herein, the term "specific inhibitor of
mitochondrial protein translocation" refers to a small molecule
that specifically targets the protein translocation pathway so as
to modulate the assembly and function of the mitochondrion with
respect to protein translocation and import.
[0103] The term "tim10-1 mutant" is well known to a person of
ordinary skill in the art.
[0104] "Small Tim proteins" are well documented in the art and
marked by their conserved `twin Cx(3)C` motif separated by 11-16
residues (see, e.g., C M Koehler, Trends Biochem Sci. 29(1):1-4
(2004); Webb, C. T., et al., Mol. Cell. 21(1): 123-133 (2006); and
Mesecke, N., et al., Cell 121: 1059-1069 (2005)).
[0105] "Redox-active enzymes" are enzymes involved in redox
reactions in a biological system. These enzymes are well known in
the art and within the general knowledge of a person of ordinary
skill in the art.
Method of Making
[0106] A compound disclosed herein can be readily prepared
according to established methodology in the art of organic
synthesis. General methods of synthesizing the compound can be
found in, e.g., Stuart Warren and Paul Wyatt, Workbook for Organic
Synthesis: The Disconnection Approach, second Edition, Wiley,
2010.
Methods of Use
[0107] In a further aspect, it is provided a method of using the
compound disclosed herein. The method comprises applying the
compound of invention to a subject to treat, prevent, or ameliorate
a medical condition. The medical condition can be any disease or
disorder caused by or otherwise associated with mitochondria
protein translocation.
[0108] In some embodiments, the method can be conducted in living
bodies of mammals. In such a case, the compounds may be
administered to the mammals.
[0109] As used herein, the term disorder and medical condition
include deafness-dystonia syndrome, cancer, Parkinson's disease, or
Alzheimer's disease. In some embodiments, the deafness-dystonia
syndrome includes deafness, blindness, and dystonia
Pharmaceutical Compositions
[0110] In another aspect of the present invention, a pharmaceutical
composition for use in treatment or prevention of the diseases
caused by or otherwise associated with mitochondria protein
translocation. In some embodiments, the pharmaceutical composition
comprises as an effective ingredient a compound expressed by any
one of the aforementioned formulae a pharmacologically acceptable
salt or prodrug thereof.
[0111] The pharmaceutical composition preferably comprises a
compound described above or a pharmacologically acceptable salt or
prodrug thereof.
[0112] The pharmaceutical composition more preferably comprises a
compound shown in the aforementioned table.
[0113] In the aforementioned aspect of the present invention, the
pharmaceutical composition may contain a pharmacologically
acceptable carrier or excipients. An amount of the compound used in
the pharmaceutical composition is not limited as far as it is an
effective amount for treatment.
[0114] The pharmaceutical composition in the aspect of the present
invention may contain, as active ingredients, the aforementioned
compound and other compounds, or may contain a mixture of two or
more aforementioned compounds.
[0115] The pharmacologically acceptable salt in the present
specification is not specifically limited as far as it can be used
in medicaments. Examples of a salt that the compound of the present
invention forms with a base include the following: salts thereof
with inorganic bases such as sodium, potassium, magnesium, calcium,
and aluminum; salts thereof with organic bases such as methylamine,
ethylamine and ethanolamine; salts thereof with basic amino acids
such as lysine and ornithine; and ammonium salt. The salts may be
acid addition salts, which are specifically exemplified by acid
addition salts with the following: mineral acids such as
hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric
acid, nitric acid, and phosphoric acid:organic acids such as formic
acid, acetic acid, propionic acid, oxalic acid, malonic acid,
succinic acid, fumaric acid, maleic acid, lactic acid, malic acid,
tartaric acid, citric acid, methanesulfonic acid, and
ethanesulfonic acid; acidic amino acids such as aspartic acid and
glutamic acid.
[0116] Further, the compounds of the present invention include
hydrates thereof, various pharmaceutically acceptable solvates
thereof, and polymorphic crystals thereof.
[0117] The pharmaceutical compositions of the present invention can
be formulated in various dosage forms, which are exemplified by the
following: oral administration forms such as tablets, capsules,
powders, granules, pills, liquids, emulsions, suspensions,
solutions, spirits, syrups, extracts, and elixirs; parenteral
administration forms such as injections, for example, subcutaneous
injections, intravenous injections, intramuscular injections, and
intraperitoneal injections; transdermal administration forms,
plasters and pressure sensitive adhesives, ointments or lotions;
intramouth administration forms such as sublingual forms and oral
patch preparations; and nasal administration forms such as
aerosols, but are not limited thereto. These preparations can be
manufactured by using a known method generally used in a drug
manufacturing process. In one embodiment of the present invention,
the pharmaceutical composition of the present invention may be
administered for treating muscular disease as an injection such as
an intramuscular injection for administering directly into
muscle.
[0118] The pharmaceutical compositions may contain various kind of
ingredients generally used, for example, one or more
pharmaceutically acceptable fillers, disintegrators, diluents,
lubricants, flavoring agents, colorants, sweetening agents,
corrigents, suspending agents, humectants, emulsifying agents,
dispersing agents, auxiliary agents, preservatives, buffers,
binders, stabilizers, and coating agents. In addition, the
pharmaceutical composition of the present invention may be
sustained-release dosage forms or extended-release dosage
forms.
[0119] Dosage ranges of the pharmaceutical compositions are not
particularly limited, and can be determined in accordance with the
following: effectiveness of the ingredients contained therein; the
administration form; the route of administration; the type of
disease; the characteristics of the subject (e.g., body weight,
age, symptomatic conditions, and whether a subject is taking other
pharmaceutical agents); and the judgment of a physician in charge.
In general, a suitable dosage may fall, for example, within a range
of about 0.01 .mu.g to 100 mg, per 1 kg of the body weight of the
subject, and preferably within a range of about 0.1 .mu.g to 1 mg,
per 1 kg of body weight. However, the dosage may be altered using
conventional experiments for optimization of a dosage that are well
known in the art. The aforementioned dosage can be divided for
administration once to several times a day. Alternatively, periodic
administration once every few days or few weeks can be
employed.
[0120] The pharmaceutical compositions may be administered to a
patient whose biological sample obtained in advance is subjected to
a study for presence or absence of deafness-dystonia syndrome,
cancer, Parkinson's disease, or Alzheimer's disease. A biological
sample may be any ones insofar as it contains nucleic acids, and is
exemplified by cells, bloods, cerebrospinal fluids, bronchoalveolar
lavage fluids, expectorations, or other body fluids as well as
biopsy tissues. Nucleic acid samples can be prepared from the
biological samples for use. The nucleic acid samples can be
prepared by well known nucleic acid preparation methods. The
nucleic acid samples may be DNA or RNA. The nucleic acid samples
prepared may be used directly for detection, or may be subjected to
enzymatic amplification of predetermined region thereof by PCR or
other amplification methods in advance for analysis.
[0121] In terms of a route of administration of the pharmaceutical
composition, it may be either systemic administration or local
administration. The route of administration that is appropriate for
a particular disease, symptomatic condition, or other factors,
should be selected. For example, parenteral administration
including normal intravenous injection, intra-arterial
administration, subcutaneous administration, intracutaneous
administration, and intramuscular administration can be employed.
Oral administration can be also employed. Further, transmucosal
administration or transdermal administration can be employed.
[0122] Preferably the composition is adapted for oral
administration, e.g. in the form of a tablet, coated tablet,
dragee, hard or soft gelatin capsule, solution, emulsion or
suspension. In general the oral composition will comprise from 1 mg
to 400 mg of such agent. It is convenient for the subject to
swallow one or two tablets, coated tablets, dragees, or gelatin
capsules per day. However, the composition can also be adapted for
administration by any other conventional means of systemic
administration including rectally, e.g. in the form of
suppositories, parenterally, e.g. in the form of injection
solutions, or nasally.
[0123] The biologically active compounds can be processed with
pharmaceutically inert, inorganic or organic carriers for the
production of pharmaceutical compositions. Lactose, corn starch, or
derivatives thereof, talc, stearic acid or its salts and the like
can be used, for example, as such carriers for tablets, coated
tablets, dragees and hard gelatin capsules. Suitable carriers for
soft gelatin capsules are, for example, vegetable oils, waxes,
fats, semi-solid and liquid polyols and the like. Depending on the
nature of the active ingredient no carriers are, however, usually
required in the case of soft gelatin capsules, other than the soft
gelatin itself. Suitable carriers for the production of solutions
and syrups are, for example, water, polyols, glycerol, vegetable
oils and the like. Suitable carriers for suppositories are, for
example, natural or hardened oils, waxes, fats, semi-liquid or
liquid polyols and the like.
[0124] The pharmaceutical compositions can, moreover, contain
preservatives, solubilizers, stabilizers, wetting agents,
emulsifiers, sweeteners, colorants, flavorants, salts for varying
the osmotic pressure, buffers, coating agents or antioxidants. They
can also contain still other therapeutically valuable substances,
particularly antidiabetic or hypolipidemic agents that act through
mechanisms other than those underlying the effects of the compounds
of the invention. Agents which can advantageously be combined with
compounds of the invention in a single formulation include but are
not limited to biguanides such as metformin, insulin releasing
agents such as the sulfonylurea insulin releaser glyburide and
other sulfonylurea insulin releasers, cholesterol-lowering drugs
such as the "statin" HMG-CoA reductase inhibitors such as
atrovastatin, lovastatin, pravastatin and simvastatin, PPAR-alpha
agonists such as clofibrate and gemfibrozil, PPAR-gamma agonists
such as thiazolidinediones (e.g. rosiglitazone and pioglitazone,
alpha-glucosidase inhibitors such as acarbose (which inhibit starch
digestion), and prandial insulin releasers such as repaglinide. The
amounts of complementary agents combined with compounds of the
invention in single formulations are in accord with the doses used
in standard clinical practice. Established safe and effective dose
ranges for certain representative compounds are set forth
above.
[0125] The invention is described in more detail in the following
illustrative examples. Although the examples can represent only
selected embodiments of the invention, it should be understood that
the following examples are illustrative and not limiting.
EXAMPLES
[0126] The following examples illustrate, but not limit, the
embodiments of the invention.
Example 1
Studies on Substrate Specificity of the TIM22 Mitochondrial Import
Pathway Revealed with Small Molecule Inhibitor of Protein
Translocation
Summary
[0127] The TIM22 protein import pathway mediates the import of
membrane proteins into the mitochondrial inner membrane and
consists of two intermembrane space chaperone complexes, the
Tim9-Tim10 and Tim8-Tim13 complexes. To facilitate mechanistic
studies, we developed a chemical genetic approach to identify small
molecule agonists that caused lethality to a tim10-1 yeast mutant
at the permissive temperature. One molecule, MitoBloCK-1,
attenuated the import of the carrier proteins including the ADP/ATP
and phosphate carriers, but not proteins that used the TIM23 or the
Mia40/Erv1 translocation pathways. MitoBloCK-1 impeded binding of
the Tim9-Tim10 complex to the substrate during an early stage of
translocation, when the substrate was crossing the outer membrane.
As a probe to determine the substrate specificity of the small Tim
proteins, MitoBloCK-1 impaired the import of Tim22 and Tafazzin,
but not Tim23, indicating that the Tim9-Tim10 complex mediates the
import of a subset of inner membrane proteins. MitoBloCK-1 also
inhibited growth of mammalian cells and import of the ADP/ATP
carrier, but not TIM23 substrates, confirming that MitoBloCK-1 can
be used to understand mammalian mitochondrial import and
dysfunction linked to inherited human disease. Our approach of
screening chemical libraries for compounds causing synthetic
genetic lethality to identify inhibitors of mitochondrial protein
translocation in yeast validates the generation of new probes to
facilitate mechanistic studies in yeast and mammalian
mitochondria.
[0128] The mitochondrion has an outer (OM) and inner (IM) membrane
that separates the matrix from the intermembrane space (IMS). The
mitochondrion has developed an elaborate translocation system to
orchestrate the import and subsequent sorting of proteins to the
correct compartment (1). Proteins destined for the mitochondrion,
termed precursors until they reach their correct location, utilize
Translocase of the Outer Membrane (TOM) and Translocase of the
Inner Membrane (TIM) complexes, TIM23 and TIM22, to cross the OM
and IM, respectively. Proteins with a typical N-terminal targeting
sequence use the TIM23 translocation system, whereas proteins
destined for the IM use the TIM22 translocation system.
[0129] Components of the TIM22 translocation system include the
small Tim proteins, Tim8, Tim9, Tim10, Tim12, and Tim13, and the
membrane components Tim18, Tim22, and Tim54. The small Tim proteins
assemble in 70-kDa hexameric complexes (referred to as small Tim
complexes) in the IMS in which three Tim9 polypeptides partner with
three Tim10 polypeptides, and three Tim8 polypeptides partner with
three Tim13 polypeptides. Structural studies reveal that the
overall structure is similar to that of the Skp and prefoldin
chaperones (2), although the sequences are not conserved. The small
Tim proteins function as chaperones to maintain the hydrophobic
membrane proteins in an import competent state (3, 4). The 300-kDa
insertion complex in the IM consists of a fraction of Tim9 and
Tim10 with Tim12, Tim22, Tim18, and Tim54. The small Tim proteins
escort substrates to the insertion complex, which mediates protein
insertion into the membrane.
[0130] Substrates of the TIM22 complex include the carrier proteins
such as the ADP/ATP carrier (AAC) and the phosphate carrier (PiC)
and IM proteins Tim17, Tim22, and Tim23. In addition, the small Tim
proteins facilitate the insertion of outer membrane proteins Tom40
and porin and the cardiolipin remodeling enzyme Tafazzin (5-7). The
substrates cross the TOM complex as a loop in an unfolded state and
then the small Tim proteins bind to the substrate at an early stage
of translocation (4, 8, 9).
[0131] The Tim8-Tim13 and Tim9-Tim10 complexes display different
substrate binding preferences. The Tim9-Tim10 complex can be
efficiently cross-linked to carrier proteins and the import
components Tim17, Tim23, and Tim22 (10-12). The Tim8-Tim13 complex
can be cross-linked to Tim23 and the aspartate-glutamate carriers
(10-13). Mutations in the human homolog of Tim8, DDP1, cause the
X-linked disease deafness-dystonia syndrome (14, 15), and the
disease may be caused by a decrease in specific IM proteins (13).
Therefore, understanding the substrate specificity of the small Tim
proteins is important for understanding the molecular basis of
deafness-dystonia syndrome.
[0132] Mitochondrial assembly has been studied extensively using
classical yeast genetics and biochemical assays with purified
mitochondria. However, new strategies are needed to elucidate the
details of protein translocation and its role in development and
human disease. Important questions about the substrate specificity
of the small Tim proteins and the mechanism by which the small Tim
proteins bind substrate have not been resolved. These studies would
be facilitated by drug-like inhibitors that modulate protein
import. Here we report the development of a small molecule
screening approach to identify inhibitors of the TIM22 import
pathway. Taking advantage of our large collection of
temperature-sensitive mutants for the TIM22 import pathway, we
conducted a chemical genetic screen with a tim10-1 mutant to
identify small molecules that caused a synthetic lethality at the
permissive temperature of 25.degree. C. (16-19). Our results
indicate that a new set of tools for mechanistic studies in protein
translocation can be developed and may be useful for characterizing
protein translocation in mammalian mitochondria, where tools are
lacking
Results
A Screen to Identify Inhibitors of Mitochondrial Protein
Translocation
[0133] We exploited a large collection of temperature sensitive
mutants for the TIM22 import pathway (10, 16-18) and developed a
composite synthetic lethal screen to identify small molecule
inhibitors that blocked the TIM22 import pathway (19). The tim10-1
mutant was used as the starting strain (16); the strains used in
this study are described in Table S1. The rationale in this screen
was that small molecules might be identified that target the mutant
Tim10 protein or other components of the TIM22 pathway and thereby
cause lethality of the tim10-1 mutant at the permissive temperature
of 25.degree. C. This approach uses the well characterized
synthetic growth defects of the tim10-1 mutant to guide the design
of cells genetically sensitized for inhibition of the TIM22
pathway.
[0134] To generate a suitable strain for screening, genes for the
multidrug resistance pumps PDR5 and SNQ2 were disrupted to increase
the steady state intracellular concentration of the drugs in yeast
(19). The tim10-1 mutant grew similar to the parental strain
(designated TIMID) at 25.degree. C. but failed to grow at the
restrictive temperature of 37.degree. C. (FIG. 1A). Growth was
inhibited on media that contained glucose (YPD, supporting
fermentable growth) or ethanol-glycerol (YPEG, supporting
nonfermentable growth) as the sole carbon source. We verified that
the abundance of the mutant Tim10 was decreased in the tim10-1
strain; however, the abundance of other mitochondrial proteins was
not markedly decreased in mitochondria when the strain was grown at
25.degree. C. (FIG. 7A) (16). In addition, deletion of the
multidrug resistance pumps did not compromise growth or the
mitochondrial protein profiles of the tim10-1 mutant. In contrast,
when we investigated assembly of the soluble 70 kDa Tim9-Tim10
complex in the tim10-1 mutant, the complex was not detected by
immunoblot analysis (FIG. 7B). Moreover, in vitro import of the
TIM22 pathway substrate, AAC, was inhibited in comparison to
mitochondria from the parental strain (FIG. 1B). The tim10-1 mutant
thus has excellent growth properties for conducting a synthetic
genetic screen with small compounds to target the TIM22 import
pathway.
[0135] For subsequent testing of the compounds in biochemical
assays with isolated mitochondria, a suppressor strain, designated
tim10-1 tim9S, was used because growth of the tim10-1 mutant (FIG.
1A) and import of the carrier proteins were restored (FIG. 1B).
Suppression in this strain is caused by a Ser.fwdarw.Cys mutation
in Tim9; the mutated serine residue is nine amino acids after the
second CX.sub.3C motif (17). Whereas the specific mechanism of
suppression is not understood, the mutant Tim9 protein restored the
abundance of Tim10 (FIG. 7A) and the assembly of Tim9-Tim10
complexes, albeit of aberrant sizes (FIG. 7B).
[0136] The screen was conducted with an integrated robotic system
with plate scheduling. Briefly, diversity oriented commercial
libraries of drug-like compounds from Chembridge and Asinex were
screened against the tim10-1 strain at a concentration of
approximately 10 .mu.M. The screen encompassed a total of
approximately 50,000 compounds dissolved in DMSO. Yeast in YPD
medium was aliquoted into 384-well plates followed by compound
addition with robotic pinning into the assay wells. DMSO was the
vehicle for the small molecules, and several plate columns that
contained only 1% DMSO were included as a control with the pinned
compounds. As a negative control for growth, wells pinned with the
mitochondrial uncoupler CCCP, which caused lethality, were also
included. After 2 days of incubation at 25.degree. C., cultures in
each well were measured for optical density (O.D.) as a measure of
growth. A typical reading for the positive control was
OD.sub.600=0.8. Wells in which the growth was inhibited by >50%
were deemed as potential inhibitors and chosen for further
analysis. Approximately 600 inhibitors from the primary screen were
selected for hit confirmation and secondary screens.
[0137] To identify possible specific inhibitors of mitochondrial
protein translocation from the pool of hit compounds, two counter
screens were executed. In the first round, the initial hit
compounds were incubated with the tim10-1 mutant and the isogenic
control strain carrying an integrated version of the TIM10 gene at
the leu2 locus. Small molecules that inhibited growth of the mutant
but not the control strain at 10 .mu.M were advanced to the second
counter screen. In a second round, compounds were assayed for
selective growth inhibition of the tim10-1 mutant, but not the
tim10-1 mutant harboring a plasmid containing the wild-type TIM10
gene. The second counterscreen was a test for chemical genetic
rescue. Compounds that showed inhibition of only the tim10-1 mutant
in both counter screens were dubbed "MitoBloCK" compounds based on
their potential to inhibit protein translocation in mitochondria.
Of 25 potential "lead" inhibitors, MitoBloCK-1 was chosen for
additional analysis.
MitoBloCK-1 Inhibits Protein Import of TIM22 Substrates into
Mitochondria
[0138] MitoBloCK-1 is a tetrahydrodibenzofuran derivative that was
identified from the Chembridge library (FIG. 2A). The MIC.sub.50
for MitoBloCK-1 that inhibited growth of the tim10-1 mutant was
approximately 1 .mu.M (FIG. 2B). MitoBloCK-1 had a similar
MIC.sub.50 with another temperature sensitive tim10 mutant,
tim10-73. In contrast, the MIC.sub.50 for the isogenic control was
greater than 200 .mu.M. To understand the cell-based activity of
MitoBloCK-1, we also determined the MIC.sub.50 with other yeast
mutants that also were disrupted for prd5 and snq2 (Table 1). For
mutants within the TIM22 pathway, MitoBloCK-1 displayed an
MIC.sub.50 concentration of 11 .mu.M for the tim9-3 mutant and 10
.mu.M for the tim10-1 tim9S suppressor strain, respectively. In
contrast, the MIC.sub.50 for MitoBloCK-1 in the tim23 mutant was
greater than 200 .mu.M. Overexpression of import components, TIM8,
TIM9, TIM13, TIM22, and TIM23, in the tim10-1 mutant did not alter
the ability of MitoBloCK-1 to inhibit growth. Interestingly,
strains lacking the mitochondrial genome (denoted as rho null) were
also sensitive to MitoBloCK-1. Thus, MitoBloCK-1 specifically
inhibited growth of the tim9 and tim10 mutants, even in the
presence of the suppressing mutation in Tim9; this growth analysis
suggests MitoBloCK-1 targets the Tim9-Tim10 complex.
[0139] The ability of MitoBloCK-1 to inhibit import of
mitochondrial precursors was tested using the in vitro import assay
with radiolabeled substrates. For this analysis, mitochondria from
the tim10-1 tim9S strain were used because MitoBloCK-1 inhibited
growth of this strain (Table 1) and import of the model substrate,
AAC, was restored in comparison to the tim10-1 mutant (FIG. 1B). An
import time course was performed in the presence of the vehicle
DMSO or varying concentrations of MitoBloCK-1 (FIG. 3). In the
presence of DMSO, the import of the TIM22 substrate, AAC, was not
inhibited. However, AAC import was markedly decreased in the
tim10-1 tim9S mitochondria in the presence of 1 .mu.M MitoBloCK-1
or greater (FIG. 3A). In contrast, MitoBloCK-1 did not inhibit
import into WT mitochondria (FIG. 8). Thus, the MIC.sub.50 in the
import assays agree well with the cell growth assays (Table 1 and
FIG. 2B).
[0140] MitoBloCK-1 also inhibited the import of an additional
carrier protein, the phosphate carrier (PiC), and the outer
membrane protein Tom40, which requires the small Tim proteins for
import (7) (FIG. 3B,C). However, for fusion constructs Su9-DHFR and
cyt b.sub.2-DHFR as well as Hsp60 that use the TIM23 pathway,
MitoBloCK-1 did not impair import (FIG. 3D, 9A,B). In addition, the
import of substrates Tim9, Tim10, and Mia40 that use the Mia40/Erv1
import pathway (20) was not inhibited in the presence of
MitoBloCK-1 (FIG. 9C-E). Finally, MitoBloCK-1 did not inhibit the
import of AAC into tim12-1 mutant mitochondria (16), indicating
that import inhibition is specific for the tim10-1 mutant (FIG.
9F). Therefore, MitoBloCK-1 seems to specifically block the import
of the carrier proteins and Tom40, which rely on the TIM22 pathway
for translocation.
MitoBloCK-1 does not Nonspecifically Damage Mitochondria
[0141] A potential mechanism by which MitoBloCK-1 may inhibit
protein translocation indirectly is by the disruption of oxidative
phosphorylation or dissipation of the membrane potential. We
therefore used a battery of tests to determine if MitoBloCK-1
nonspecifically altered mitochondrial integrity or function. As a
first test, the ability of MitoBloCK-1 to interfere with
respiration was measured (FIG. 10A-C) (21). Mitochondria were
incubated in a chamber with an oxygen electrode and respiration was
initiated by the addition of NADH. The rate of oxygen consumption
was representative of mitochondria that were well coupled. The
subsequent addition of vehicle DMSO (FIG. 10A) or 25 .mu.M
MitoBloCK-1 (.about.25-fold above the biochemical MIC.sub.50) did
not significantly alter the rate of respiration (FIG. 10A-C)
(p=0.72). As a control, mitochondria were treated with the proton
ionophore CCCP; and respiration increased drastically, indicative
of uncoupled mitochondria (FIGS. 10A-C).
[0142] The membrane potential (.DELTA..psi.) of mitochondria was
measured with the fluorescent dye rhodamine 123, which is taken up
by mitochondria and then released when the .DELTA..psi. is
dissipated (22, 23). The relative change of fluorescence between
dye uptake and release is a relative measure of the .DELTA..psi.;
the dye that loads into coupled mitochondria (causing quenching and
a decrease in fluorescence) is released when treated with an
uncoupling agent such as CCCP (causing an increase in
fluorescence). The fluorescence did not change with addition of
either DMSO (FIG. 10D) or 25 .mu.M MitoBloCK-1 (FIG. 10E) in
contrast to the sharp increase in fluorescence upon CCCP addition.
Taken together, the oxygen electrode and dye uptake assays support
that MitoBloCK-1 is not a mitochondrial uncoupler.
[0143] Another potential mechanism that may alter protein
translocation is that the small molecules may nonspecifically
permeabilize mitochondrial membranes, and proteins may be released
from the mitochondrion, particularly those in the IMS. We therefore
incubated mitochondria with MitoBloCK-1 for 30 min followed by
centrifugation (FIGS. 10F,G). Released proteins were recovered in
the supernatant fraction and analyzed by immunoblot assays for key
proteins and Coomassie staining for the collective release of
proteins. As a positive control, MitoBloCK-2, another compound from
the screen that permeabilized mitochondrial membranes, was
included. Immunoblots revealed that the release of marker proteins
Tom40 (OM), cytochrome c and Tim10 (IMS), AAC (IM), and Hsp60
(matrix) was similar when mitochondria were treated with
MitoBloCK-1 or DMSO (FIG. 10F). In contrast, MitoBloCK-2 treatment
resulted in release of the marker proteins from mitochondria, and
Coomassie blue staining confirmed the extensive release
mitochondrial proteins (FIG. 10G). Finally, MitoBloCK-1 did not
alter steady-state stability of the Tim9-Tim10 complex because the
complex migrated as a 70 kDa complex in the presence of the small
molecule (FIG. 10H). From the aforementioned analysis, MitoBloCK-1
does not alter mitochondrial function or membranes nonspecifically
and seems to be a specific inhibitor of protein import for the
TIM22 pathway.
MitoBloCK-1 Impairs Substrate Binding by the Tim9-Tim10 Complex
[0144] MitoBloCK-1 can be used for mechanistic studies in protein
translocation. From our previous analysis of the tim10-1 and
tim12-1 mutants, we showed that Tim10 was required to mediate
translocation of AAC across the outer membrane and Tim12 was
required at a later step to mediate insertion of the AAC into the
IM (16); this analysis was determined by monitoring protease
sensitivity of the AAC precursor. We adapted this methodology to
determine where MitoBloCK-1 impaired AAC translocation. In
wild-type mitochondria, a small fraction of the AAC was trapped in
the IMS when protease was added to mitochondria in the absence of a
membrane potential (FIG. 4A, lane 4). However, in tim10-1 mutant
mitochondria, AAC failed to enter the IMS. Therefore, AAC that
accumulated at the outer membrane was degraded upon protease
addition (FIG. 4A, lane 6, 8), confirming that Tim10 is required
for a very early step in protein translocation (24, 25). We added
MitoBloCK-1 in this assay. In the presence of MitoBloCK-1, AAC was
sensitive to protease in the presence of a membrane potential (FIG.
4A, lane 12), similar to that of the tim10-1 mutant (FIG. 4A, lane
6). This result implies that MitoBloCK-1 blocks protein
translocation at a step similar to the block observed with the
tim10-1 mutant, namely translocation across the outer membrane.
[0145] The early obstruction in protein translocation by
MitoBloCK-1 suggested that binding between the Tim9-Tim10 complex
and substrate might be abrogated. We have previously used a
cross-linking and immunoprecipitation approach in tim10-1 tim9S
mitochondria to show that Tim9 binds to substrate during
translocation (18). MitoBloCK-1 was therefore added to import
assays that were subjected to cross-linking and immunoprecipitation
(FIG. 4B). In the absence of MitoBloCK-1, antibodies against Tim9
immunopreciptated a crosslinked product between Tim9 and AAC (FIG.
4B, lane 9). However, the presence of MitoBloCK-1 altered the
crosslinking pattern such that the crosslink to Tim9 decreased in
abundance (FIG. 4B, compare lane 4,6); instead another crosslinked
band, indicative of an interaction with another protein, became
more prevalent (FIG. 4B, lane 6 denoted by *). Following
immunoprecipitation, the crosslinked Tim9-AAC product was decreased
in the presence of MitoBloCK-1 (FIG. 4B, compare lane 9,12).
Additional immunoprecipitation assays with antibodies against Tom22
and Tom40 failed to immunoprecipitate crosslinked AAC, regardless
of whether MitoBloCK-1 was present. This may indicate that the
homobifunctional crosslinker BMH, which is reactive to free
sulfhydryls, did not have adequate sites for reactivity. As an
additional control, AAC with uncoupled mitochondria (incubated with
CCCP) lacked abundant crosslinks (FIG. 4B, lane 5). Therefore, this
analysis supports that MitoBloCK-1 impedes protein translocation at
an early stage by obstructing the substrate binding site of the
Tim9-Tim10 complex.
MitoBloCK-1 can be Used to Determine Substrates of the Tim9-Tim10
Complex.
[0146] A central question about the TIM22 pathway has been the
specificity of the small Tim complexes. Yeast contain both the
Tim8-Tim13 complex and the Tim9-Tim10 complex and a variety of
studies have suggested that they might have different substrate
specificities (10, 11, 13). Most precursors including the carriers,
Tim22, and Tim17 require the Tim9-Tim10 complex, whereas Tim23 and
the aspartate-glutamate carriers require the Tim8-Tim13 complex. In
addition, the small Tim proteins facilitate the import of outer
membrane proteins (5, 7). We therefore examined whether MitoBloCK-1
could be used to determine substrate specificity of the Tim9-Tim10
complex with precursors Tim22, Tim23, and Tafazzin (FIGS. 5A-C).
The import of Tim22 but not Tim23 was impaired in the presence of
MitoBloCK-1, indicating that Tim23 seems to require the Tim8-Tim13
complex for translocation across the outer membrane (FIGS. 5A,B).
Tafazzin is a cardiolipin remodeling enzyme that, when mutated,
causes the inherited disease Barth Syndrome (26). Tafazzin import
was impaired in mitochondria lacking functional Tim10 (6). When
Tafazzin was imported in the presence of MitoBloCK-1, import was
inhibited, confirming a role for the Tim9-Tim10 complex in the
biogenesis of Tafazzin (FIG. 5C). Studies with MitoBloCK-1 thus
support a role for the Tim9-Tim10 complex in the import of Tafazzin
and Tim22, but not Tim23.
[0147] Taking advantage of commercially available compounds similar
to MitoBloCK-1, we purchased additional compounds for an
abbreviated structure-activity relationship (SAR) study (FIG. 6A).
Similar compounds to MitoBloCK-1 were available in which the side
chain was substituted or the tricyclic ring was changed from a
dihydrobenzofuran to a carbazole. Analogs A and D were similar to
MitoBloCK-1 except that the thiourea of the side chain was
modified. Analogs B and C contained changes in the ring (carbazole)
as well as the side chain. These compounds were tested in the
import assay and Analog D was the only compound to inhibit import
of AAC but required an increased concentration of 50 .mu.M (FIG.
6A). A limited SAR analysis showed that properties of the ring
structure and side chain are important for MitoBloCK-1
activity.
[0148] The long-term goal with these MitoBloCK compounds is to
develop small molecules that inhibit protein translocation in
mammalian systems for mechanistic studies and for developing tools
to alter mitochondrial function with the objective of developing
disease models. As a first step, we tested whether MitoBloCK-1
might affect general mitochondrial function in mammalian cells and
measured cell viability in mammalian cells using an MTT assay (FIG.
11A). Given that mitochondrial protein import is essential for cell
survival, a reduction in translocation would be expected to reduce
cell viability. When cells were treated with 25 .mu.M and 50 .mu.M
MitoBloCK-1, viability significantly decreased in a dose-responsive
manner. We then tested whether MitoBloCK-1 inhibited import into
isolated mouse liver mitochondria (FIG. 6B). In the presence of 25
mM MitoBlock-1, the import of AAC was inhibited. In contrast, the
import of Su9-DHFR and Hsp60 was not altered in the presence of
MitoBloCK-1 (FIGS. 11B,11C) Thus, the addition of MitoBloCK-1 to
mammalian mitochondria disrupts the import of AAC, albeit at a
higher concentration than with yeast mitochondria.
DISCUSSION
[0149] MitoBloCK-1 is the first small molecule inhibitor that
blocks the import of substrates that use the TIM22 import pathway.
We started this screen with a genetic approach by developing a
composite synthetic lethal screen to identify small molecules that
inhibited growth of the tim10-1 mutant at the permissive
temperature of 25.degree. C. Although MitoBloCK-1 may have many
potential targets within a yeast cell, we devised a battery of
tests using growth analyses followed by biochemical assays to
determine the specific site of inhibition by MitoBloCK-1. Because
the small molecules may nonspecifically alter mitochondrial
function, we determined its effect on membrane potential,
respiration, and mitochondrial integrity; MitoBloCK-1 does not
generally damage mitochondria. Moreover, import assays showed that
import of TIM22 substrates was specifically inhibited and
crosslinking and immunoprecipitation assays showed that the
Tim9-Tim10 complex did not bind to substrate effectively. The
combination of these assays indicated that MitoBloCK-1 inhibits an
early step in protein translocation, when the Tim9-Tim10 complex
binds to substrate during translocation across the outer membrane
(FIG. 6C) (3, 16, 25).
[0150] The characterization of MitoBloCK-1 supports that the
chemical-genetic approach is important for developing probes to
study assembly of mitochondrial membranes. Mechanistic studies for
the assembly of outer and IM proteins still need refinement (1).
Our analysis shows that Tim9-Tim10 is important for the import of
Tafazzin, Tom40, the carrier proteins, and Tim22, but not Tim23,
which supports that the small Tim complexes have different
substrate specificity (3, 4, 10, 13). Therefore, development of
these probes will yield a new set of tools for studying
mitochondrial membrane biogenesis.
[0151] A potential drawback of MitoBloCK-1 is that import is
inhibited in the tim10-1 tim9S mitochondria but not wild-type
mitochondria. The small SAR studies suggest that particular
properties of MitoBloCK-1, such as the length of the side chain and
the dihydrobenzofuran ring, may be important for its function.
Therefore MitoBloCK-1 may serve as a starting point for developing
more potent analogs that inhibit protein import in wild-type yeast
mitochondria. In addition, the overall structure of the human small
Tim proteins is highly conserved with the yeast homologs (2), and
we clearly show that import into isolated mammalian mitochondria is
inhibited. Following the initial import assays in mammalian
mitochondria with an extended SAR approach may lead to the
refinement of small molecules that inhibit function of the
different mammalian small Tim proteins.
[0152] Mitochondria now have been implicated in a wide array of
degenerative diseases including Parkinson's and Alzheimer's
(27-30). For example, a defect in import has been linked to
Alzheimer's when the amyloid precursor protein arrests in the Tom40
translocon (30). These latest developments indicate that alteration
of protein translocation pathways may be important for (1)
mechanistic studies in these diseases and (2) to create model
systems to recapitulate the disease. Thus, having new and specific
tools available such as the MitoBloCK compounds may be important
for broad research in understanding how mitochondrial dysfunction
contributes to disease. The development of small molecule
inhibitors also serves as a technological advance over general
mitochondrial inhibitors (uncouplers and inhibitors of OXPHOS) that
uncouple mitochondria or irreversibly inhibit respiration.
Materials and Methods
Plasmids and Strains.
[0153] In general, a standard set of genetic and molecular
techniques were used to generate the strains in this study (31,
32). Screening strains were generated based on previously
characterized temperature sensitive mutants (see supplementary
table 1). The snq1 and pdr5 deletions were introduced in each
strain by strain mating with MDY326 or PCR-mediated deletion (33,
34). Overexpression strains were generated by transforming 2.mu.
yeast shuttle vectors carrying the gene of interest with the native
promoter into the tim10-1 strain using a standard LiCl protocol
(35). Transformed yeast was maintained on selective media
appropriate for the plasmid's auxotrophic marker. Strains lacking
mitochondrial DNA (rho null) were generated by two rounds of
selection of the parent on YPD plates supplemented with ethidium
bromide (40 .mu.g/ml) followed by two rounds of single colony
selection on YPD plates.
High-Throughput Screening.
[0154] A primary screen was performed using freshly streaked
tim10-1 diluted in YPD to an OD.sub.600 of approximately 0.0002 and
kept on ice throughout the screening run. A Titertek multidrop
(Huntsville, Ala.) was used dispense 40 .mu.L of cell suspension to
all wells of each clear 384-well plate (Greiner Bio One). After
yeast suspension warmed to room temperature, a Biomek FX (Beckman
Coulter) was used to pin transfer 0.5 .mu.L of compound from 1 mM
stock or DMSO to respective wells. Approximate screening
concentration was 12.5 .mu.M. All operations were performed by an
automated plate scheduler to ensure consistency across the
screening run. After completed compound transfer, all plates were
incubated at 25.degree. C. in a humidified incubator until the
OD.sub.600 reached approximately 0.8 in the control wells; the
control consisted of the tim10-1 mutant with the vehicle 1% DMSO.
Each plate was shaken in a Beckman orbital shaker to resuspend
settled cells, and the OD.sub.600 in each well was read by a Wallac
Victor plate reader (Perkin Elmer). The top 600 growth inhibitory
compounds were determined and assembled into two plates. Using a
similar screening methodology, hit compounds were reconfirmed with
the tim10-1 strain and growth inhibition was compared to the WT
strain (TIM10) as well as the "rescued" strain (tim10-1 TIM10 that
contained a copy of the wild-type TIMID genes on a centromeric
plasmid) strains. Compounds reordered from Asinex and Chembridge
were assayed for MIC.sub.50 using a similar automated technique in
384-well plates as previously described. Serial dilutions of
purchased compounds were performed with robotic automation in 100%
DMSO. Subsequently, compounds were pinned into assay plate wells
containing 50 .mu.L of the respective yeast strain in YPD medium
(starting OD.sub.600=0.0002). Growth duration and conditions were
similar to the original screen.
Biochemical Assays with Mitochondria and Additional Methods.
[0155] Media and Reagents. Media used in this study was purchased
from EMD Biosciences and US Biological. Chemical reagents were from
Chembridge, Asinex, and Sigma unless otherwise noted. YPD medium is
1% Bacto-yeast extract, 2% Bacto-peptone, dextrose added to 2%
after sterilization. Yeast cultures for mitochondrial preparation
and were either in YPEG (1% yeast extract, 2% peptone, 3% glycerol,
3% ethanol) or selective SEG medium (0.17% yeast nitrogen base,
0.5% ammonium sulfate, 3% glycerol, 3% ethanol) with appropriate
amino acid dropout mixture. YPD and YPEG plates used in growth
analysis included 2% agar. For MTT assays, cultured HeLa were grown
in DMEM high glucose medium (Invitrogen) with glutamine, sodium
pyruvate, 10% FBS, and penicillin-streptomycin (complete
medium).
[0156] Analysis and Statistics.
[0157] Unless otherwise stated, all results reported are
representative of three experimental replicates. Quantitative
analysis was performed in GraphPad Prism 5 software (GraphPad
Software, Inc.) unless otherwise stated. Statistical tests for
significant deviation between samples were performed with unpaired,
two-tailed t tests. The alpha threshold for significance was
<0.05 for all tests. In graphs, error bars represent standard
deviation from a given mean. Data transformation of rhodamine 123
fluorescence data was performed by setting the maximum OD=530 nm
value from a particular trace to 100%. All fluorimetry data was
scaled to the 0-100% range using GraphPad Prism's "normalize"
function.
[0158] Purification of Mitochondria.
[0159] Mitochondria were purified from yeast cells grown in YPEG or
selective SEG medium as described in previous studies (Glick B S,
Pon L A (1995). Methods Enzymol 260:213-223). Yeast cultures were
kept at a constant 25.degree. C. with vigorous shaking during
growth. After concentration was measured by BCA assay, mitochondria
were stored in 25 mg/ml aliquots at -80.degree. C. Mammalian
mitochondria were isolated from 2-4 freshly excised mouse livers by
differential centrifugation. Briefly, isolated livers were washed
3.times. with cold PBS and then suspended in 4-5 mL isolation
buffer (70 mM Sucrose, 220 mM mannitol, 2 mM HEPES-KOH, pH 7.4) per
gram of tissue. Livers were first chopped into small pieces and
then dounced 5.times. using a teflon dounce. Homogenized material
was then centrifuged at 1,000 RPM for 10 mm in a clinical
centrifuge and supernatants were transferred to fresh tubes.
Centrifugation at 1,000 RPM for 10 min was then repeated and
supernatants were transferred to microfuge tubes. Next, supernatant
material was spun for 10 min at 800.times.g (this process was
repeated a second time). The supernatants from these steps were
subjected to a high-speed (12,000.times.g for 20 min) spin to
pellet heavy membrane fractions. Pellets were washed in isolation
buffer and spun again (12,000.times.g for 20 min). After the final
centrifugation step, supernatants were discarded and heavy membrane
fraction was resuspended in mammalian import buffer (250 mM
sucrose, 5 mM magnesium acetate, 80 mM potassium acetate, 10 mM
sodium succinate, 1 mM dithiothreitol, 0.1 mM ADP, 20 mM Hepes-KOH,
pH 7.4) as described in Johnston A J, et al. (2002), J Biol Chem
277:42197-42204 and kept on ice. All subsequent imports were
performed within 1 hour of isolation of mammalian mitochondria.
Mitochondrial concentrations were determined by BCA assay.
[0160] Blue Native Gel Electrophoresis.
[0161] Steady-state levels of the small Tim complexes were analyzed
from mitochondria isolates from TIA110, titn10-1, and titn10-1
titn9S strains following established methods (Murphy M P, et al.,
(2001), Mol Cell Biol 21:6132-6138). Approximately 200 .mu.g of
mitochondria from each strain was solubilized at 5 mg/mL in 0.16%
n-dodecylmaltoside (Anatrace) for 30 minutes on ice. Following
removal of insoluble material (30 minute centrifugation at 14,000
RPM), solubilized protein supernatants were analyzed by blue native
gel electrophoresis on a 6 to 16% linear polyacrylamide gradient
(Dekker P J, et al., (1996), Biol Chem 377:535-538; Schagger H, et
al., (1994)m Anal Biochem 217:220-230; and Schagger H, von Jagow G
(1991), Anal Biochem 199:223-231).
[0162] Import of Radiolabeled Proteins into Mitochondria and
Crosslinking.
[0163] Prior to import into purified mitochondria,
.sup.35S-methionine and cysteine labeled proteins were generated
with TNT Quick Coupled Transcription/Translation kits (Promega) and
plasmids carrying the gene of interest. Transcription of genes was
driven by either a T7 or SP6 promoter. Import reactions were
conducted according to established methods. After frozen
mitochondria aliquots were thawed and added to the import buffer at
a final concentration of 100 .mu.g/mL, drug or DMSO vehicle was
added as indicated. A final vehicle concentration of 1% was used in
all experiments. Following 15 minute incubation at 25.degree. C.,
import reactions were initiated by the addition of 5-10 L of
translation mix. Aliquots were removed at intervals during the
reaction timecourse and import was terminated with either cold
buffer, 25 .mu.g/mL trypsin, or a combination of both. If trypsin
was added to digest unimported precursor protein, soybean trypsin
inhibitor (STI) was subsequently added in excess after 15 minute
incubation on ice. After a final recovery of by centrifugation
(8,000.times.g, 5 minutes), mitochondria were disrupted in Laemmli
sample buffer. Imports of membrane proteins (AAC, PiC, Tom40,
Tim22, and Tim23) included a carbonate extraction step to remove
proteins that had not inserted into the membrane (Koehler C M, et
al. (1998), Science 279:369-373). Samples from import reaction time
points were resolved by SDS polyacrylamide gel electrophoresis
(SDSPAGE) and gels were dried prior to exposing to film.
[0164] Crosslinking and immunoprecipitation experiments were
derived from procedures previously utilized (3) with the inclusion
of MitoBloCK-1 or DMSO. Following import, a portion of the reaction
was subjected to crosslinking with 0.5 mM bis-maleimidohexane (BMH)
for 30 minutes on ice. After quenching crosslinking reactions with
1 mM f3-mercaptoethanol, a fraction of each sample was subjected to
immunoprecipitation with polyclonal antibodies against either Tim9,
Tom22, or Tom40. For each immunoprecipitation, 20'IL of antisera
was bound to 50 j.t1_, of protein A-sepharose slurry according to
established protocols (Murphy M P, et al., (2001), Mol Cell Biol
21:6132-6138).
[0165] Membrane Potential and Oxygen Consumption.
[0166] Oxygen consumption of tim10-1 tim9S mitochondria was
measured using methods previously described (8). Briefly, purified
tim10-1 tim9S mitochondria aliquots (25 mg/mL) were thawed on ice
and tested within 2 hours. A Clark-type oxygen electrode in a
stirred, thermostatically controlled 1.5-ml chamber at 25.degree.
C. (Oxytherm; Hansatech) facilitated measurement. State II
respiration was induced on a suspension of 100 .mu.g/mL
mitochondrial in 0.25 M sucrose, 20 mM KCl, 20 mM Tris-C1, 0.5 mM
EDTA, 4 mM KI-l.sub.2PO.sub.4, and 3 mM MgCl.sub.2, pH 7.2 after
adding 2 mM NADH. Consumption rate was monitored for approximately
2 min. Drug or DMSO was then added to a final vehicle concentration
of 1% and respiration was measured for another approximately 1.5
minutes. Uncoupled respiration was achieved by adding 10 .mu.M CCCP
to the chamber.
[0167] Membrane potential measurement assays were conducted with a
SPEX spectrofluorometer system (HORIBA Jobin Yvon) with a
magnetically stirred cuvette held at 25.degree. C. The quenching of
rhodamine 123 fluorescence (Em, =530 nm and Ex=485 nm) was used as
previously described (9) to detect changes in mitochondrial
membrane potential. Purified tim10-1 tim9S mitochondrial aliquots
were thawed and resuspended in respiration buffer (0.65 M mannitol,
0.3 mM EGTA, 3 mm tris-phosphate, 10 mM tris-maleate, pH 6.75).
Trials were started by adding 100 nM of rhodamine 123 to
respiration buffer. After a period of signal stabilization,
mitochondria were added to a concentration of 100 .mu.g/mL. Either
drug or DMSO was then added to a final vehicle concentration of 1%
following the establishment of baseline quenched fluorescence.
Finally, mitochondria were uncoupled with 3 .mu.M CCCP.
[0168] Cell Viability Assays.
[0169] Measurements of cell viability/toxicity were made with a MTT
based toxicology assay kit (Sigma-Aldrich). HeLa cells were grown
in 24-well tissue culture dishes to 80% confluency. Following this
cells were either left untreated or treated with 1% DMSO or drug in
complete medium for 12 hours. Following drug treatment, cells were
rinsed with phosphate buffered saline and incubated with complete
media with MTT solution supplement for additional 4 hours as
described in manufacturer's protocols. This media was removed and
500 .mu.L of MTT solubilization solution was added to dissolve the
formazan crystals. The formazan absorbance was measured at OD=570
nm on a Wallac Victor plate reader (Perkin Elmer) along with a
turbidity measurement at OD=630 nm. After turbidity subtraction,
the percent viability of each cell sample was calculated as:
[(absorbance of vehicle treated cells-absorbance of drug treated
cells)/(absorbance of vehicle treated cells)].times.100.
[0170] Miscellaneous.
[0171] Steady-state levels of mitochondrial proteins from lysed
aliquots of isolated mitochondria were resolved using SDS-PAGE.
Western blotting was performed using standard protocols with
polyclonal antibodies raised towards highly purified antigens.
Proteins were transferred to nitorocellulose membranes and immune
complexes were visualized with HRP labeled Protein A in a
chemiluminescence assay (Pierce). Chemiluminescent and
autoradiographic imaging was performed on film unless otherwise
noted. Unless otherwise stated, all results reported are
representative of three experimental replicates.
TABLE-US-00001 TABLE 1 Strain Genotype Comments Source tim 10-1 rho
his3, leu2, ura3, tim 10-1: LEU2, Strain was incubated on ethidium
bromide to This study null .DELTA.tim10::HIS3, pdr5.DELTA. 0::HGR,
remove mitochondrial DNA snq24 0::KANMX, rho null tim10-1 his3,
leu2, ura3, tim 10-1: LEU2, Strain used for the primaiy screen.
Original tim 10- Koehler CM, et al. .DELTA.tim10::HIS3, pdr5.DELTA.
0::HGR, 1 strain was mated to MDY326 and sporulated. A (1998),
Science snq2, 40::KANMX tetrad containing the tim10-1 allele and
drug 279: 369-373; this pump deletions were selected. study
tim10-73 ade8, his3, leu2, ura3, .DELTA. trp1 ::LEU2, Original tim
10-73 strain was mated to a Koehler CM, et al. .DELTA.tim10:
1-11S3, version of MDY326-trpl. After spontlation, (1998), Science
pdr5.DELTA.0::URA3, snq2A0:: KAMMX, a tetrad containing tim10-73
allele and drug 279: 369-373; this tim10-73: TRPI CEN1, pump
deletions were selected. study tim9-3 ade8, his3, leu2, trp 1,
ura3, .DELTA. Original tim9-3 strain was deleted for PDR5
Leuenberger D, et al., tim9: :TRP1, .DELTA.pdr5::HIS3, and SNQ2
using PCR mediated deletion. (2003) Traffic 4: 144-152;
.DELTA.snq2::URA 3, [ptim9-3: LEU2 this study GEN' tim23-2 ade8,
his3, leu2, trp 1, ura3, tim23- Original tim23-2 strain was deleted
for PDR5 Hwang DK, et al., 2: TRP 1, .DELTA.pdr5::HIS
.DELTA.snq2::LEU2 and SNQ2 using PCR mediated deletion. (2007), J
Cell Biol 178: 1161-1175 TIM10 rho his3, leu2, ura3, TIM10: URA3,
.DELTA.tim Strain was incubated on ethidium bromide to This study
null 10:: HIS3, remove mitochondrial DNA pdr5.DELTA. 0::HGR,
snq2.DELTA. 0::KANMx, rho null TIM 10 his3, leu2, ura3, Strain used
as primary screen control. The This study TIM10: URA3,
.DELTA.tim10:: HIS3, tim 10-1 strain used for screening was
pdr5.DELTA. 0::HGR, snq2.DELTA.0:: restored KANMx to wild-type at
the TIM10 locus by integration of the TIM10 allele to replace the
tim10-1 TIM10 his3, leu2, ura3, tim 10- Centromeric plasmid
carrying TIM10 under This study 1: LEU2, .DELTA.tim 10::HIS3, the
control of its native promoter was pdr5.DELTA.0::IIGR,
snq2.DELTA.0:: transformed into the tim10-1 screening KANMx,
[.pi.TIM10: URA 3 strain, This was used as a second control strain
in tim 10-1 tim9S his3, leu2, ura3, tim 10- Centromeric plasmid
carrying a suppressing Murphy MP, et al., (2001), 1: LEU2,
.DELTA.tim10::HIS3, pdr5 allele tim 9S under the control of the
TIM9 Mol Cell Biol 21: 6132-6138; .DELTA.0: :HGR,
snq2.DELTA.0::KANMx, promoter was transformed into the tim10-1
Koehler CM, et al. [ptim9S: URA3 CEN1] screening strain. (1998),
EMBO J 17: 6477-6486 tim 10-1 TIM9 his3, leu2, ura3, tim 10- A 2
.mu. plasmid carrying TIM9 under the This study (2 .quadrature.) 1:
LEU2, .DELTA. tim10::HIS3, control of its native promoter was pdr5
.DELTA. 0::HGR, snq2 .DELTA. 0:: transformed into the tim 10-1
screening KANMx, [pTIM9: URA 3] strain. 2 .mu.] tim 10-I TIM8 his3,
leu2, ura3, tim10- A 2 plasmid carrying TIM8 under the This study
(2 .mu.)) 1: LEU2, .DELTA. tim10::HIS3, control of its native
promoter was pdr5 .DELTA. 0::HGR, snq2 .DELTA. 0:: transformed into
the tim 10-1 screening KANMx, [pTIM8: URA 3] strain. tim10-I TIM/3
his3, leu2, ura3, tim 10- A 2 .mu. plasmid carrying TIM13 under the
This study (2 .mu.)) 1: LEU2, .DELTA. tim10::HIS3, control outs
native promoter was pdr5 .DELTA. 0::HGR, snq2 .DELTA. 0::
transformed into the tim10-1 screening KANMx, strain. [pTIM13: URA3
2 .mu.] Plasmid contained a high copy 2.mu. origin of tim10-1 TIM22
his3, leu2, ura3, tim I 0- A 2.mu. plasmid carrying TIM22 under the
This study (2 .mu.)) 1: LEU2, .DELTA. tim 10: :HIS3, control of its
native promoter was pdr5 .DELTA. 0::HGR, snq2 .DELTA. 0::
transformed into the tim 10-1 screening KANMx, strain. [pTIM22:
URA43 2 .mu.] Plasmid contained a high copy 2.mu. origin of
tim./0-1 TIM23 his3, leu2 ura3, tim10- A 2.mu. plasmid carrying
TIM23 under the This study (2/1) 1: LEU2, .DELTA. tim10:: HIS3,
control of its native promoter was pdr5 .DELTA. 0::HGR, snq2
.DELTA. 0:: transformed into the tim10-1 screening strain. KANMx,
[PTLA122: URA43 .mu.] tim 12-1 his3, leu2, ura3, trp 1, Strain used
as a control for import studies. Koehler CM, et al. ade8, tim12-1:
LEU2, The strain is deleted for TIM I 2 and contains (1998),
Science 279: 369-373; .DELTA. tim 12::HIS3 the tim 12-1 mutant
allele integrated at the LEU2 locus. M1DY326 his3, leu2, ura3,
Strain with multidrug pumps deleted. Duncan MC, et al., pdr5
.DELTA. 0::URA, snq2 .DELTA. 0:: (2007), Proc Natl Acad Sci KANMx
USA, 104: 6235-6240 MDY326-trpl his3, leu2, ztra3, The trp 1 allele
was deleted with LEU2 in This study .DELTA. trp I ::LEU2 MDY326.
pdr5 .DELTA. 0::URA, snq2 .DELTA. 0:: KANMx indicates data missing
or illegible when filed
REFERENCES
Example 1
[0172] 1. Chacinska A, Koehler C M, Milenkovic D, Lithgow T,
Pfanner N (2009) Importing mitochondrial proteins: machineries and
mechanisms. Cell 138:628-644. [0173] 2. Webb C T, Gorman M A,
Lazarou M, Ryan M T, Gulbis J M (2006) Crystal structure of the
mitochondrial chaperone TIM9.10 reveals a six-bladed
alpha-propeller. Mol Cell 21:123-133. [0174] 3. Curran S P,
Leuenberger D, Oppliger W, Koehler C M (2002) The Tim9p-Tim10p
complex binds to the transmembrane domains of the ADP-ATP carrier.
EMBO J. 21:942-953. [0175] 4. Curran S P, Leuenberger D, Schmidt E,
Koehler C M (2002) The role of the Tim8p-Tim13p complex in a
conserved import pathway for mitochondrial polytopic inner membrane
proteins. J Cell Biol 158:1017-1027. [0176] 5. Hoppins S C, Nargang
F E (2004) The Tim8-Tim13 complex of Neurospora crassa functions in
the assembly of proteins into both mitochondrial membranes. J.
Biol. Chem. 279:12396-12405. [0177] 6. Brandner K, et al. (2005)
Taz1, an outer mitochondrial membrane protein, affects stability
and assembly of inner membrane protein complexes: implications for
Barth Syndrome. Mol Biol Cell 16:5202-5214. [0178] 7. Wiedemann N,
et al. (2004) Biogenesis of the protein import channel Tom40 of the
mitochondrial outer membrane: intermembrane space components are
involved in an early stage of the assembly pathway. J. Biol. Chem.
279:18188-18194. [0179] 8. Leuenberger D, Curran S P, Wong D,
Koehler C M (2003) The Role of Tim9p in the Assembly of the TIM22
Import Complexes. Traffic 4:144-152. [0180] 9. Beverly K N, Sawaya
M R, Schmid E, Koehler C M (2008) The Tim8-Tim13 complex has
multiple substrate binding sites and binds cooperatively to Tim23.
J Mol Biol 382:1144-1156. [0181] 10. Leuenberger D, Bally N A,
Schatz G, Koehler C M (1999) Different import pathways through the
mitochondrial intermembrane space for inner membrane proteins. EMBO
J 17:4816-4822. [0182] 11. Davis A J, Sepuri N B, Holder J, Johnson
A E, Jensen R E (2000) Two intermembrane space TIM complexes
interact with different domains of Tim23p during its import into
mitochondria. J Cell Biol 150:1271-1282. [0183] 12. Davis A J,
Alder N N, Jensen R E, Johnson A E (2007) The Tim9p/10p and
Tim8p/13p complexes bind to specific sites on Tim23p during
mitochondrial protein import. Mol Biol Cell 18:475-486. [0184] 13.
Roesch K, Hynds P J, Varga R, Tranebjaerg L, Koehler C M (2004) The
calcium-binding aspartate/glutamate carriers, citrin and aralar1,
are new substrates for the DDP1/TIM108a-TIM1013 complex. Hum. Mol.
Genet. 13:2101-2111. [0185] 14. Jin H, et al. (1996) A novel
X-linked gene, DDP, shows mutations in families with deafness
(DFN-1), dystonia, mental deficiency and blindness. Nat Genet
14:177-180. [0186] 15. Koehler C M, et al. (1999) Human deafness
dystonia syndrome is a mitochondrial disease. Proc Natl Acad Sci
USA 96:2141-2146. [0187] 16. Koehler C M, et al. (1998) Import of
mitochondrial carriers mediated by essential proteins of the
intermembrane space. Science 279:369-373. [0188] 17. Koehler C M,
et al. (1998) Tim9p, an essential partner subunit of Tim10p for the
import of mitochondrial carrier proteins. EMBO J 17:6477-6486.
[0189] 18. Murphy M P, Leuenberger D, Curran S P, Oppliger W,
Koehler C M (2001) The essential function of the small Tim proteins
in the TIM22 import pathway does not depend on formation of the
soluble 70-kilodalton complex. Mol Cell Biol 21:6132-6138. [0190]
19. Duncan M C, Ho D G, Huang J, Jung M E, Payne G S (2007)
Composite synthetic lethal identification of membrane traffic
inhibitors. Proc Natl Acad Sci USA 104:6235-6240. [0191] 20.
Koehler C M, Beverly K N, Leverich E P (2006) Redox pathways of the
mitochondrion. Antioxid Redox Signal 8:813-822. [0192] 21. Claypool
S M, Oktay Y, Boontheung P, Loo J A, Koehler C M (2008) Cardiolipin
defines the interactome of the major ADP/ATP carrier protein of the
mitochondrial inner membrane. J Cell Biol 182:937-950. [0193] 22.
Goyon V, et al. (2008) Yeast cells depleted in Atp14p fail to
assemble Atp6p within the ATP synthase and exhibit altered
mitochondrial cristae morphology. J Biol Chem 283:9749-9758. [0194]
23. Emaus R K, Grunwald R, Lemasters J J (1986) Rhodamine 123 as a
probe of transmembrane potential in isolated rat-liver
mitochondria: spectral and metabolic properties. Biochim Biophys
Acta 850:436-448. [0195] 24. Koehler C M, Merchant S, Schatz G
(1999) How membrane proteins travel across the mitochondrial
intermembrane space. Trends Biochem Sci 24:428-432. [0196] 25. Ryan
M T, Muller H, Pfanner N (1999) Functional Staging of ADP/ATP
Carrier Translocation across the Outer Mitochondrial Membrane. J.
Biol. Chem. 274:20619-20627. [0197] 26. Claypool S M, McCaffery J
M, Koehler C M (2006) Mitochondrial mislocalization and altered
assembly of a cluster of Barth syndrome mutant tafazzins. J Cell
Biol 174:379-390. [0198] 27. Silvestri L, et al. (2005)
Mitochondrial import and enzymatic activity of PINK1 mutants
associated to recessive parkinsonism. Hum Mol Genet 14:3477-3492.
[0199] 28. Mills R D, et al. (2008) Biochemical aspects of the
neuroprotective mechanism of PTEN-induced kinase-1 (PINK1). J
Neurochem 105:18-33. [0200] 29. Hansson Petersen C A, et al. (2008)
The amyloid beta-peptide is imported into mitochondria via the TOM
import machinery and localized to mitochondrial cristae. Proc Natl
Acad Sci USA 105:13145-13150. [0201] 30. Devi L, Prabhu B M, Galati
D F, Avadhani N G, Anandatheerthavarada H K (2006) Accumulation of
amyloid precursor protein in the mitochondrial import channels of
human Alzheimer's disease brain is associated with mitochondrial
dysfunction. J Neurosci 26:9057-9068. [0202] 31. Sikorski R S,
Hieter P (1989) A system of shuttle vectors and yeast host strains
designed for efficient manipulation of DNA in Saccharomyces
cerevisiae. Genetics 122:19-27. [0203] 32. Guthrie C, Fink G R
(1991) Guide to yeast genetics and molecular biology (Academic
Press, San Diego, Calif.). [0204] 33. Gueldener U, Heinisch J,
Koehler G J, Voss D, Hegemann J H (2002) A second set of loxP
marker cassettes for Cre-mediated multiple gene knockouts in
budding yeast. Nucleic Acids Res 30:e23. [0205] 34. Guldener U,
Heck S, Fielder T, Beinhauer J, Hegemann J H (1996) A new efficient
gene disruption cassette for repeated use in budding yeast. Nucleic
Acids Res 24:2519-2524. [0206] 35. Schiestl R H, Manivasakam P,
Woods R A, Gietzt R D (1993) Introducing DNA into Yeast by
Transformation. Methods 5:79-85.
Example 2
Studies on a Small Molecule Inhibitor of Redox-Regulated Protein
Translocation in Mitochondria
Summary
[0207] The mitochondrial disulfide relay system of Mia40 and
Erv1/ALR facilitates import of the small Tim proteins and cysteine
rich proteins. A chemical screen identified small molecules that
inhibit Erv1 oxidase activity, thereby facilitating dissection of
the disulfide relay system in yeast and vertebrate mitochondria.
One molecule, MitoBloCK-6, attenuated the import of Erv1 substrates
into yeast mitochondria and inhibited oxidation of Tim13 and Cmc1
in in vitro reconstitution assays. In addition, MitoBloCK-6
revealed an unexpected role for Erv1 in the carrier import pathway,
namely transferring substrates from the TOM complex onto the small
Tim complexes. Cardiac and somite development was impaired in
MitoBloCK-6 exposed zebrafish embryos. Finally, MitoBloCK-6 induced
apoptosis via cytochrome c release in human embryonic stem cells
(hESCs) but not in differentiated cells, suggesting an
unprecedented function for ALR in hESC homeostasis. Our
target-based chemical screen validates this approach for generating
newtools to dissect the mitochondrial redox system in
vertebrates.
Introduction
[0208] The mitochondrion has translocons of the outer membrane
(TOM) and inner membrane (TIM) to import proteins from the cytosol.
Proteins with a typical N-terminal targeting sequence are imported
via the TIM23 pathway, whereas polytopic inner membrane proteins
use the TIM22 import pathway (Chacinska et al., 2009; Mokranjac and
Neupert, 2009; Schmidt et al., 2010). In contrast, most of the
proteins imported into the intermembrane space (IMS) lack a
mitochondrial targeting sequence and employ diverse routes for
mitochondrial import (Herrmann and Hell, 2005).
[0209] A recently identified pathway in the IMS mediates oxidation
of imported proteins that require disulfide bonds to acquire their
native conformation (Deponte and Hell, 2009; Koehler and Tienson,
2009; Riemer et al., 2011; Sideris and Tokatlidis, 2010;
Stojanovski et al., 2008b), such as the small Tim proteins and
proteins with a twin CX.sub.9C motif (Cavallaro, 2010). In the
small Tim proteins, the proximal N-terminal cysteine residues serve
as internal targeting sequences that are recognized by the IMS
oxidoreductase Mia40 (Milenkovic et al., 2009; Sideris et al.,
2009), which functions as a receptor to mediate translocation
across the outer membrane (Chacinska et al., 2004). Mia40 contains
a redox-active cysteine pair that is maintained in an oxidized
state by the sulfhydryl oxidase Erv1 (Tienson et al., 2009). As the
imported protein substrate is oxidized, electrons are passed from
Mia40 to Erv1, followed by transfer to molecular oxygen or
cytochrome c (cyt c) (Bien et al., 2010; Dabir et al., 2007).
Subsequently, cyt c can be reoxidized by cyt c oxidase of the
respiratory chain (Bien et al.) or by cyt c peroxidase (Dabir et
al., 2007). Thus, Mia40 and Erv1 constitute a mitochondrial
disulfide relay system that is also evolutionarily conserved.
[0210] Erv1 belongs to the Erv/ALR sulfhydryl oxidase family and
homologous proteins are found in the endoplasmic reticulum (Erv2)
of yeast, in the extracellular environment (Quiescin sulfhydryl
oxidase, QSOX), and in the poxvirus family (E10R) (Gerber et al.,
2001; Senkevich et al., 2002; Thorpe et al., 2002). In addition to
protein translocation, the role of Erv1 in various cellular
pathways is exemplified by a number of defects observed in cells
that lack functional Erv1 protein. For example, Erv1 is required
for the maturation of cytosolic iron-sulfur cluster containing
proteins (Lange et al., 2001). In ervl mutant yeast, heme
maturation is impaired (Dabir et al., 2007). Also, mutations in
mammalian Erv1 homolog, ALR, result in an autosomal-recessive
myopathy (Di Fonzo et al., 2009), and ALR has an essential
pro-survival role in the maintenance of pluripotent murine
embryonic stem cells (Todd et al., 2010b).
[0211] Erv1 has several key functions in the IMS, necessitating the
characterization of its homolog, ALR, to uncover basic mechanisms
in mitochondrial assembly in vertebrate systems. Because Erv1
donates electrons to cyt c, Erv1/ALR may have a central role in
apoptotic pathways that lead to cyt c release (Dabir et al., 2007).
Classically, mitochondrial protein import has been studied using
yeast genetics and biochemical assays. However, new approaches are
needed to elucidate disease mechanisms and dissect essential
functions in mammalian cells. Here we report a small molecule
screening approach to identify Erv1 inhibitors, with the goal of
developing a set of probes that can modulate the pathway quickly
and recapitulate disease phenotypes. We have taken advantage of the
previously developed in vitro Amplex Red assay for monitoring Erv1
activity to identify inhibitors (Dabir et al., 2007). Our results
indicate that the small drug-like inhibitor characterized here is
specific for Erv1/ALR and can be used to reveal normal functions
and disease mechanisms in mammalian mitochondria.
Materials and Methods
High-Throughput Screen for Erv1 Modulators.
[0212] The primary chemical screen used fresh recombinant Erv1 (in
buffer 30 mM Hepes, pH 7.4, 100 mM NaCl, 1 mM EDTA) at a
concentration of 10 .mu.M, which was expressed as described
previously. A Titertek multidrop (Beckman Coulter) was used to
dispense 25 .mu.l Erv1 or 25 .mu.l of catalytically inactive enzyme
Erv1C133S into wells of a clear bottom 384-well plate (Greiner Bio
One). A Biomek FX (Beckman Coulter) was used to pin transfer 0.5
.mu.l of compound from 1 mM stock or DMSO to respective wells.
Approximate screening concentration was 12.5 .mu.M. After completed
compound transfer, all plates were incubated at 25.degree. C. in a
humidified incubator for 1 hour. A Titertek multidrop was used to
dispense 15 .mu.l of Amplex Red-horseradish peroxidase (HRP)
(Sigma) mix into all wells of the 384-well plate. The final
concentration of Amplex Red and HRP were 46 .mu.M and 0.092 U/ml,
respectively. The Amplex Red-HRP solution was shielded from light
during the entire experiment. The plates were incubated for an
additional 10 min and then 15 .mu.l of the substrate DTT (20
.mu.M)
TABLE-US-00002 Strain Genotype Source WT his3 leu2 ade8 trp1 ura3
This study MDY326 his3 leu2, ura3, pdr5.DELTA.0::URA 3
snq2.DELTA.0::KANMx This study Erv1-His his3 leu2 ade8 trp1 ura3
erv1::HIS3[pERV1- This study 10XHis:LEU2 2.mu.] erv1-12 his3 leu2
ade8 trp1 ura3 erv1::HIS3 [perv1-12: This study TRP1 CEN]
was added to initiate the reduction of O.sub.2 to H.sub.2O.sub.2.
The plates were incubated for 12 minutes to achieve a maximal
signal-to-noise ratio in the kinetic liner range. Plates were then
read at an endpoint using an excitation wavelength of 545 nm and an
emission wavelength of 590 nm. All operations were performed by an
automated plate scheduler to ensure consistency across the
screening run. We chose compounds that inhibited Erv1 activity by
greater than 50%. Using a similar screening methodology as above,
hit compounds were reconfirmed. Compounds that were available were
ordered from Asinex and Chembridge and assayed for IC.sub.50 using
a similar automated technique in 384-well plates as previously
described. Serial dilutions of purchased compounds were performed
with robotic automation in 100% DMSO. Subsequently, compounds were
pinned into assay plate wells containing 10 .mu.M Erv1, Erv2, or
ALR.
[0213] For MIC.sub.50 analysis in the yeast strains, serial
dilution of MitoBloCK-6 (0.5 .mu.l) was pinned into assay plate
wells containing 50 .mu.l of yeast (Table 2) in rich
ethanol-glycerol media (starting OD.sub.600=0.0002). Plates were
then incubated at 25.degree. C. in a humidified chamber for 40
hours. Each plate was shaken in a Beckman orbital shaker to
resuspend settled cells, and the OD.sub.600 in each well was read
by a Wallac Victor plate reader (Perkin Elmer).
Table 2. Strains Used in Example 2.
[0214] To assess the effect of MitoBloCK-6 on H.sub.2O.sub.2
production, 25 .mu.l of buffer (30 mM Hepes, pH 7.4, 100 mM NaCl, 1
mM EDTA) containing 2 .mu.M, 5 .mu.M, or 10 .mu.M MitoBloCK-6 was
aliquoted into assay well plate. 15 .mu.l of the Amplex Red/HRP was
added, and the plates were incubated at room temperature for 30
minutes. The reaction was initiated with addition of 800 nM
H.sub.2O.sub.2 solution and the fluorescence was measured after 10
min.
Assays
[0215] MitoBloCK-6 was analyzed using a battery of established in
vitro, yeast, mammalian cell-based, and zebrafish assays. These are
described in detail in the Supplemental Data.
Plasmids and Strains
[0216] Recombinant Erv1 and Mia40 were expressed and purified under
native conditions as described previously (Dabir et al., 2007;
Tienson et al., 2009). Recombinant Tim13 was purified under
denaturing conditions as described previously (Beverly et al.,
2008). Recombinant Cmc1 was generously provided by Dr. Barrientos
(Univ. of Miami). Recombinant long form ALR, residues 1 to 205, was
purified under native conditions (Daithankar et al., 2010).
Proteins Tim13, Mia40, Erv1 and Cmc1 were detected with polyclonal
antibodies and immunoblot analysis. Table 2 lists the strains used
in this study.
Media and Reagents
[0217] Media used in this study was purchased from EMD Biosciences
and US Biological. Chemical reagents were from Chembridge, Asinex,
and Sigma unless otherwise noted. Yeast cultures for mitochondrial
preparation were grown in YPEG (1% yeast extract, 2% peptone, 3%
glycerol, 3% ethanol). For MTT assays and fluorescence microscopy,
cultured HeLa and HEK293 cells were grown in DMEM high glucose
medium (Invitrogen) with glutamine, sodium pyruvate, 10% FBS, and
penicillin-streptomycin (complete medium).
Analysis and Statistics
[0218] Unless otherwise stated, all results reported are
representative of three experimental replicates. Quantitative
analysis was performed in GraphPad Prism 5 software unless
otherwise stated. Statistical tests for significant deviation
between samples were performed with unpaired, two-tailed t-tests.
The alpha threshold for significance was <0.05 for all tests. In
graphs, error bars represent standard error from a given mean.
Mass Spectrometry
[0219] LC-MS experiments were carried out on a Waters Acquity UPLC
connected to a Waters LCT-Premier XE Time of Flight Instrument
controlled by MassLynx 4.1 software. The mass spectrometer was
equipped with a Multi-Mode Source operated in the electrospray
mode. Briefly, samples of MitoBloCK-6, ES-1, and ES-2 were
separated using an Acquity BEH C18 1.7 um column (2.1.times.50 mm,
Waters) and were eluted with a gradient of 0.5 mL/min
water/acetonitrile with 2, 80, and 95% acetonitrile at 0.5, 2.5 and
3.5 min, respectively. Mass spectra were recorded from 80 to 2000
Daltons. All solvents were LC-MS/MS Grade and purchased from Fisher
Scientific.
Purification of Mitochondria
[0220] Mitochondria were purified from yeast cells grown in YPEG as
described in previous studies (Glick and Pon, 1995). Yeast cultures
were kept at 25.degree. C. with vigorous shaking during growth.
Mitochondria concentration was measured by BCA assay and stored in
25 mg/ml aliquots at -80.degree. C.
Import of Radiolabeled Proteins into Yeast Mitochondria
[0221] Prior to import into purified mitochondria,
.sup.35S-methionine and cysteine labeled proteins were generated
with TNT Quick Coupled Transcription/Translation kits (Promega) and
plasmids carrying the gene of interest. Transcription of genes was
driven by either a T7 or SP6 promoter. Import reactions were
conducted as previously described (Hasson et al., 2010). After
frozen mitochondria aliquots were thawed and added to the import
buffer at a final concentration of 100 .mu.g/ml, MitoBloCK-6 or
DMSO vehicle was added as indicated. A final concentration of 1%
DMSO was used in all experiments. Following incubation at
25.degree. C. for 15 min, import reactions were initiated by the
addition of 5-10 .mu.l of translation mix. Aliquots were removed at
intervals during the reaction time course and import was terminated
with addition either of cold buffer or 25 .mu.g/ml trypsin, or the
combination. If trypsin was added to digest non-imported precursor
protein, soybean trypsin inhibitor was subsequently added in excess
after 15 min incubation on ice. After a final recovery of by
centrifugation (8,000.times.g, 5 min), mitochondria were disrupted
in Laemmli sample buffer. Imports of membrane proteins (AAC and
Tim23) included a carbonate extraction step to remove proteins that
had not inserted into the membrane (Koehler et al., 1998a). Samples
from import reaction time points were resolved by SDS-PAGE and
visualized by autoradiography. Blue-native gel analysis was
performed as described previously (Koehler et al., 1998b).
Oxygen Consumption Measurements
[0222] Oxygen consumption of WT mitochondria was measured using
methods previously described (Claypool et al., 2008a). Briefly,
purified WT mitochondria (25 mg/ml) were thawed on ice and tested
within 2 hours. Oxygen consumption assays were performed with a
Clark-type oxygen electrode in a stirred thermostatically
controlled 1.5-ml chamber at 25.degree. C. (Oxytherm, Hansatech).
State II respiration was induced in a suspension of 100 .mu.g/ml
mitochondria in 0.25 M sucrose, 20 mM KCl, 20 mM Tris-C1, 0.5 mM
EDTA, 4 mM KH.sub.2PO.sub.4, and 3 mM MgCl.sub.2, pH 7.2 after
adding 2 mM NADH. Consumption rate was monitored for approximately
2 min. MitoBloCK-6 or DMSO was then added to a final vehicle
concentration of 1% and respiration was measured for another
approximately 1.5 min. Uncoupled respiration was achieved by the
addition of 10 .mu.M CCCP to the chamber. For assessing succinate
dehydrogenase activity, respiration was induced in a suspension of
200 .mu.g/ml mitochondria in the buffer described above after
addition of 10 mM succinate. Consumption rate was monitored for
approximately 3 mins. MitoBloCK-6, SAR compounds, or DMSO was then
added and respiration measured for another 3 mins. Uncoupled
respiration was achieved as described above.
[0223] The effect of MitoBloCK-6 or vehicle on oxygen reduction by
Erv1 was assayed with the Clark-type oxygen electrode in 1 ml of
air-saturated Hepes buffer (pH 7.4) (Dabir et al., 2007) containing
100 mM NaCl and 0.5 mM EDTA. Oxygen consumption was initiated by
addition of Erv1 to a final concentration of 2 .mu.M in the
reaction mixture containing 2 mM DTT. To test the effect of
MitoBloCK-6 or vehicle, Erv1 was pre-incubated with the desired
MitoBloCK-6 concentration for 2 min before addition of DTT.
Reconstitution Studies
[0224] Reconstitution studies with reduced Tim13 were performed as
described previously (Tienson et al., 2009). Briefly, 15 .mu.M
reduced Tim13 or reduced Cmc1 was incubated with 1 .mu.M Mia40 and
1 .mu.M Erv1 or ALR for 3 h at 25.degree. C. Where indicated, Erv1
was pretreated with either vehicle or MitoBloCK-6 for 1 hr at
25.degree. C. before adding to the reconstitution mix.
H.sub.2O.sub.2 levels in the reconstitution assays were measured
using the Amplex Red Hydrogen Peroxide/Peroxidase Assay kit
according to the manufacturer's protocol (Dabir et al., 2007)
(Invitrogen). In brief, Erv1 or ALR and Mia40 were mixed at
concentrations mentioned above with 25 .mu.l of the Amplex
Red/horseradish peroxidase reaction mix. The reaction was initiated
with the addition of reduced Tim13 or reduced Cmc1. The Erv1 or
ALR-catalyzed reduction of O.sub.2 to H.sub.2O.sub.2 was measured
by a FlexStation plate reader (Molecular Devices) controlled via
the SoftMax Pro software package (Molecular Devices) for data
acquisition. The reaction was performed at a shorter time period
than the reconstitution assays because the Amplex Red assay is very
sensitive (Dabir et al., 2007).
Cell Manipulations
[0225] For microscopy experiments, HeLa or HEK293 cells were
transiently transfected with Su9-EGFP (Lipofectamine, Invitrogen)
at 80% confluency. 12 hours post transfection, cells were
co-labeled with Mitotracker red CMXRos (Invitrogen) and visualized
with a microscope (Axiovert 200M Carl Zeiss) using a Plan-Fluor 63x
oil objective. Images were acquired at room temperature with a
charge-coupled device camera (ORCA ER, Hamamatsu Photonics)
controlled by Axiovision software (Carl Zeiss). Image files were
processed by Photoshop software (Adobe). Membrane potential was
disrupted with 20 .mu.M CCCP (Sigma-Aldrich). For cyt c release
assays, a cell fractionation kit (MitoSciences) was used. Briefly,
HeLa or HEK293 cells were grown in 10 cm.sup.2 dishes to 80%
confluency and then cells were treated with DMSO or MitoBloCK-6 in
complete medium for 12-16 h. To induce apoptosis as a positive
control, cells were treated with 1 .mu.M of staurosporine for 4 h.
Cells were fractionated to obtain cytosolic and mitochondrial
fractions; 100 .mu.g of each fraction was analyzed by SDS-PAGE.
Blots were probed with ApoTrack cyt c apoptosis antibody cocktail
(MitoSciences).
Measurements for cell viability were made with a MTT based
toxicology assay kit (Sigma) as described previously (Hasson et
al., 2010). Briefly, HeLa cells were grown in 24-well tissue
culture dishes to 80% confluency. Cells were then treated with DMSO
or MitoBloCK-6 in complete medium for 12 h and reacted with MTT
solution supplement for additional 4 hr as described in
manufacturer's protocols. Percentage viability of each cell sample
was calculated as: [(absorbance of vehicle treated
cells)-(absorbance of MitoBloCK-6 treated cells)/(absorbance of
vehicle treated cells)].times.100.
Assays in Embryonic Stem Cells
[0226] Human embryonic stem cell (hESCs) line hSF1 was cultured in
Stem Pro SFM (Gibco) supplemented with 10 ng/ml bFGF on Matrigel
(BD Biosciences) coated plates under 5% CO.sub.2, 95% air.
Differentiation involved culturing cells in Stem Pro SFM with 10
.mu.M retinoic acid (Acros Organics) for 4 days. Cells were treated
with the specific concentration of the compounds or 1% DMSO as a
control. For the induction of apoptosis, cells were exposed to 20
.mu.M actinomycin D (Sigma) with or without 100 .mu.M z-VAD-FMK (MP
Biomedical). Following treatment, cells were fixed with 3.7%
formaldehyde for indirect immunofluorescence study or lysed with
Triton buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X-100,
1 mM EDTA) for analysis by SDS-PAGE. Bright field images were
acquired with Exi Blue (QImaging). Immunofluorescent images were
acquired with a 63x oil immersion objective on an LSM 5 PASCAL
Laser Scanning Microscope (Carl Zeiss). Antibodies against cyt c
(BD Pharmingen), Tom20 (Santa Cruz), cleaved caspase-3 (Cell
Signaling) and poly (ADP-ribose) polymerase (Cell Signaling) were
purchased from the indicated vendors. Alkaline phosphatase activity
staining was performed with the leukocyte alkaline phosphatase kit
(Sigma) as per manufacturer's protocol. Coomassie brilliant blue
staining was performed by staining cells with Coomassie brilliant
blue solution (0.25% Coomassie brilliant blue R250, 45% methanol,
10% acetic acid) for 1 hour at room temperature. Cells were washed
with phosphate-buffered saline followed by visualization as
described above.
Zebrafish Manipulations
[0227] Zebrafish displaying fluorescent hearts were derived from
transgenic TL fish expressing a fusion of the CoxIV targeting
sequence with DsRed regulated by a cmlc2 (cardiac myocyte light
chain-2) promoter (Shu et al., 2007). Zebrafish used for
o-dianisidine staining of red blood cells in DMSO and MitoBloCK-6
treated fish were albino lines generated from crosses of TL and Tu
fish. Line AB were injected with the ALR morpholino. Lines were
maintained in a 14-hr light/10-hr dark cycle and mated for one hour
to obtain synchronized embryonic development. Embryos were grown
for 3 hpf in E3 buffer (5 mM sodium chloride, 0.17 mM potassium
chloride, 0.33 mM calcium chloride, 0.33 mM magnesium sulfate) and
then incubated with E3 buffer supplemented with 1% DMSO or
MitoBloCK-6 for 3 days at 28.5.degree. C. Following treatment,
embryos were imaged using a Leica MZ16F fluorescent stereoscope
(TexasRed filter set) at 5.times. magnification. Alternatively,
3-day embryos were stained with o-dianisidine[40% (v/v) ethanol,
0.01 M sodium acetate, 0.65% hydrogen peroxide, 0.6 mg/ml
o-dianisidine] and incubated for 15 min in complete darkness.
Embryos were then washed with E3 buffer to remove residual stain
and stereoscopically imaged under white light using a Leica S8AP0
at 1.575.times. magnification. For comparison, AB embryos at the
one-cell stage were micro-injected with 4 ng of an ATG morpholino
targeted to zebrafish ALR protein (GAGGGTTGCCAGATCTCTGTTAAAT) (SEQ
ID NO:1). Embryos were allowed to mature to 2 dpf and then imaged
like the MitoBloCK-6 treated embryos; embryos were imaged at day 2
because of concerns with morpholino dilution. Images were resized
to 300 dpi without resampling using Adobe Photoshop software.
Results
A Chemical Screen to Identify Inhibitors of Erv1 Oxidase
Activity
[0228] We previously developed an assay to test the sulfhydryl
oxidase activity of recombinant Erv1 protein based on the oxidation
of a non-physiologic substrate, DTT, which produces hydrogen
peroxide (H.sub.2O.sub.2) (Dabir et al., 2007). H.sub.2O.sub.2
production was measured using a standard fluorometric assay with
Amplex Red and horseradish peroxidase (HRP). The assay was adapted
in high throughput format and a chemical screen was conducted on an
integrated robotic system with plate scheduling (FIG. 13A).
Briefly, diversity oriented commercial libraries of 50,000
drug-like compounds from Chembridge (Lumsden et al., 2007; Webb,
2005), Kwon (Castellano et al., 2007), and Asinex (Lumsden et al.,
2007) at 10 .mu.M concentration were screened for inhibition of
Erv1 activity. Erv1 (10 .mu.M) was aliquoted into 384-well plates
followed by compound addition with robotic pinning into the assay
wells. DMSO (1%, vehicle) was included in several plate columns as
a carrier control with the pinned compounds. As a negative control,
10 .mu.M catalytically inactive Erv1 (Erv1C133S) was also aliquoted
into several plate columns. Incubation of the pinned compounds with
Erv1 for 1 h at 25.degree. C. was followed by addition of Amplex
Red-HRP and then DTT (20 .mu.M) to initiate the oxidase assay.
After 12 min, the reaction was in the kinetic linear range and a
high signal-to-noise ratio was achieved. Fluorescence intensity was
measured and reactions that were inhibited by more than 50% were
picked as potential Erv1 inhibitors and selected for secondary
analysis. In total, 184 primary candidate inhibitors were
identified (FIG. 13B). A total of 40 plates were processed with a
Z' greater than 0.8 across the screen, indicating that the screen
was consistent and robust.
[0229] To eliminate false positives, a counter screen was used to
test whether the small molecule compounds directly inhibited the
Amplex Red-HRP assay. H.sub.2O.sub.2 (800 nM) was reacted with
Amplex Red-HRP in the presence of the small molecules; this is the
approximate amount of H.sub.2O.sub.2 that was produced by Erv1
during the assay. Those compounds that did not inhibit the Amplex
Red assay directly and showed >50% inhibition of Erv1 activity
(.about.29 compounds) were selected for additional characterization
and designated as "MitoBloCK" compounds based on their potential to
inhibit Erv1 activity. Of these potential "lead" inhibitors,
MitoBloCK-6 was chosen for additional analysis. FIG. 13C verifies
that MitoBloCK-6 does not directly hinder the Amplex Red-HRP
reaction.
MitoBloCK-6 Inhibits Erv1/Mia40 Activity
[0230] MitoBloCK-6 is
2,4-dichloro-6-((((phenylamino)phenyl)imino)methyl)phenol) from the
Chembridge library (FIG. 12A), consisting of a
3,5-dichlorosalicylaldehyde derivative. Upon reordering,
MitoBloCK-6 showed the same Erv1 inhibitory activity as the
original aliquot from the Chembridge library. The IC.sub.50 for
MitoBloCK-6 that inhibited Erv1 oxidase activity in the in vitro
Amplex Red-HRP assay was 900 nM (FIG. 12B). We also tested
MitoBloCK-6 as an inhibitor of ALR (Farrell and Thorpe, 2005) and
the yeast paralog in the endoplasmic reticulum, Erv2 (Gross et al.,
2002) using the in vitro Amplex Red-HRP assay. The IC.sub.20 for
MitoBloCK-6 inhibiting ALR and Erv2 was 700 nM and 1.4 .mu.M,
respectively (unpublished data).
[0231] To determine whether MitoBloCK-6 generally impaired redox
active enzymes, we investigated the oxidiative folding properties
of protein disulfide isomerase (PDI). MitoBloCK-6 did not inhibit
the ability of PDI to reduce insulin (FIG. 14A). Because
MitoBloCK-6 may potentially hinder FAD-containing enzymes,
succinate dehydrogenase activity of the mitochondrial respiratory
chain was measured in the presence of MitoBloCK-6 (FIG. 14B).
Isolated mitochondria were incubated in a Clarke-type oxygen
electrode and oxygen consumption was measured with succinate
addition. The oxygen consumption rate was indicative of
well-coupled mitochondria and subsequent addition of DMSO vehicle
or MitoBloCK-6 did not alter the oxygen consumption rate. As
controls, succinate dehydrogenase activity was disrupted with the
inhibitor malonate, and CCCP addition indicated that respiring
mitochondria could be uncoupled. Because a
3,5-dichlorosalicylaldehyde is a potential degradation product of
MitoBloCK-6, and the 3,5-dichlorosalicylaldehyde moiety may instead
inhibit Erv1 (Doom and Petersen, 2003), commercially available
3,5-dichlorosalicylaldehyde replaced MitoBloCK-6 in the in vitro
Amplex Red-HRP assay (FIG. 12C). The addition of 100 .mu.M
3,5-dichlorosalicylaldehyde did not inhibit Erv1 activity. We
assessed MitoBloCK-6 stability in our screening conditions at pH
6.5 and 7.4 using liquid chromatography-mass spectrometry (LC-MS)
analysis (FIG. 15). Analysis at pH 3.4 was also included, because
an acidic pH favors hydrolysis of the imine linkage to release the
3,5-dichlorosalicylaldehyde (Kirdant et al., 2011). MitoBloCK-6 was
stable over this pH range as supported by a similar retention time
(3.03 min) and a constant area under the curve in the LC-MS
analysis (FIG. 15). Thus, MitoBloCK-6 is a stable compound that
specifically inhibits Erv1 activity.
[0232] The import of Erv1 substrates was tested with an in
organello import assay. Substrates included twin CX.sub.9C proteins
(Mia40, Cmc1, Cox19, and Cox17), twin CX.sub.3C protein Tim8, and
Erv1 (FIGS. 16, 17) (Hofmann et al., 2005; Horn et al., 2008;
Riemer et al., 2011; Terziyska et al., 2007). Energized
mitochondria were preincubated with 20 to 50 .mu.M MitoBloCK-6 or
1% DMSO for 15 min, followed by the addition of the radiolabeled
substrate. A time course assay was performed and aliquots were
removed and treated with protease to remove non-imported
precursors. Import of the twin CX.sub.9C proteins and Erv1 was
strongly decreased, whereas the import of Tim8 was impaired by 40%
upon treatment with MitoBloCK-6 compared to import in presence of
1% DMSO. We also investigated the import of additional substrates,
Tim23 and AAC of the TIM22 import pathway and Su9-DHFR, cyt
b.sub.2-DHFR, and Hsp60 of the TIM23 import pathway (FIGS. 17, 18).
At 20 .mu.M, the import of Tim23 and AAC was decreased by
approximately 50% (FIGS. 18A,B), whereas the import of TIM23
substrates was not impaired even with 50 .mu.M MitoBloCK-6 (FIGS.
17A,B, 18C). Given that Erv1 played an unprecedented role in the
import of TIM22 substrates, we investigated the import of AAC using
blue-native (BN) gel analysis (FIG. 18D). Previous studies have
defined the steps of AAC translocation from the cytosol to the
inner membrane using mutants and biochemical manipulations (Curran
et al., 2002; Ryan et al., 1999; Truscott et al., 2002).
Specifically, AAC accumulates in a 500 kDa complex with the TOM
complex at the outer membrane in a tim10-2 mutant or in the absence
of ATP, and then is passed to the Tim9-Tim10 complex; the mature
form of AAC subsequently assembles as a dimer in a 90 kDa complex
in the inner membrane. After importing AAC in the presence
MitoBloCK-6 or control DMSO, the mitochondria were solubilized in
1% digitonin and separated on BN gels followed by autoradiography.
In the presence of DMSO, AAC accumulated in the 90 kDa complex that
is indicative of an assembled AAC dimer (AAC.sup.2). Moreover, the
AAC dimer was protected from exogenous protease, verifying that AAC
is indeed present in the inner membrane. In contrast, the addition
of MitoBloCK-6 resulted in AAC accumulation in a 500 kDa complex
with the TOM complex (FIG. 18D) and this AAC intermediate was
sensitive to protease, confirming localization at the outer
membrane. MitoBloCK-6 analysis supports a role for Erv1 in
transferring AAC from the TOM complex to the Tim9-Tim10 complex in
the intermembrane space. Therefore, in addition to the
cysteine-rich substrates, Erv1 plays a key role in the TIM22 import
pathway.
[0233] To confirm specificity of MitoBloCK-6, we purchased two
additional compounds, termed ES-1 and ES-2 (Erv1-SAR), for an
abbreviated structure-activity relationship (SAR) study (FIG. 12A).
Whereas ES-2 inhibited Erv1 function in the in vitro assays, ES-1
did not inhibit Erv1 activity (unpublished data). When included in
the import assays, ES-2 mirrored MitoBloCK-6 in its ability to
impair import, but ES-1 had no effect (FIGS. 16, 17C,D). Thus, ES-2
and MitoBloCK-6 seem to specifically inhibit Erv1 function, but
ES-1, like 3,5-dichlorosalicylaldehyde, did not abrogate Erv1
function.
[0234] To confirm that mitochondrial Erv1 is the target of
MitoBloCK-6, an increased abundance of Erv1 should require an
increased MitoBloCK-6 concentration to inhibit protein import.
Previously, we designed a yeast strain in which Erv1 with a
C-terminal hexahistidine tag (designated .uparw.Erv1) was expressed
from a high copy plasmid (Dabir et al., 2007). This strain
contained an approximate 5-fold increase in Erv1 with no aberrant
phenotypes detected. The import of Mia40, Cmc1, and AAC proteins
was tested in isolated WT and .uparw.Erv1 mitochondria. For Mia40
and Cmc1, the concentration of MitoBloCK-6 that was required to
inhibit import increased from 10 .mu.M to 50 .mu.M (FIGS. 19A,B). A
similar trend was detected for AAC import, with a concentration
increase from 15 .mu.M to 30 .mu.M (FIG. 19C). Combined, the data
strongly support that Erv1 is the target of MitoBloCK-6.
[0235] To evaluate the cell-based activity of MitoBloCK-6, we also
determined the MIC.sub.50 with the .DELTA.pdr5.DELTA.snq2 yeast
strain in which the genes for the multi-drug resistance pumps PDR5
and SNQ2 were disrupted in the wild-type strain (Duncan et al.,
2007; Hasson et al., 2010). Deletion of these pumps increases the
steady state intracellular concentration of drugs in yeast. The
MIC.sub.50 was 15.2 .mu.M (FIG. 19D), which is similar to the
IC.sub.50 concentration that inhibited protein import. As in the
import assays (FIGS. 19A-C), we measured the MIC.sub.50 with the
.DELTA.pdr5.DELTA.snq2 strain overexpressing Erv1 from a high copy
plasmid (Dabir et al., 2007). The MIC.sub.50 increased to 28.3
.mu.M when Erv1 was overexpressed (FIG. 19E).
Mitochondria are not Damaged by MitoBloCK-6
[0236] A potential mechanism by which MitoBloCK-6 could alter
protein translocation is to nonspecifically permeabilize membranes,
resulting in the release of mitochondrial proteins, particularly
from the IMS. We have previously shown that MitoBloCK-2, an
inhibitor of the TIM22 import pathway, nonspecifically
permeabilizes mitochondrial membranes (Hasson et al., 2010). We
incubated energized mitochondria with 1% DMSO or MitoBloCK-6
followed by centrifugation. Released proteins were recovered in the
supernatant fraction and analyzed by Coomassie staining for the
collective release of proteins (FIG. 20A) and by immunoblot assay
for key proteins (FIG. 20B). The results from Coomassie staining
indicated that MitoBlock-6 did not alter mitochondrial membrane
integrity, because proteins were not released into the supernatant
fraction (FIG. 20A). Similarly, immunoblot analysis showed that
marker proteins aconitase (matrix), AAC and Tim54 (inner membrane),
and IMS proteins Mia40, Ccp1, and cyt c were not released with
MitoBloCK-6 or DMSO treatment (FIG. 20B).
[0237] Another potential mechanism by which MitoBloCK-6 may disrupt
protein translocation is indirect, by dissipation of the membrane
potential (.DELTA..psi.) or disruption of oxidative
phosphorylation, both of which can be measured with a Clark-type
oxygen sensing electrode (FIG. 20C) (Claypool et al., 2008b).
Isolated mitochondria were incubated in a 0.5 ml chamber at
25.degree. C. with an oxygen electrode and respiration was
initiated with NADH. The measured oxygen consumption rate was
indicative of well-coupled mitochondria. The subsequent addition of
DMSO vehicle or MitoBloCK-6 did not alter the oxygen consumption
rate. As a control, mitochondria were treated with the protonophore
carbonyl cyanide m-chlorophenylhydrazone (CCCP) and respiration
increased drastically, indicative of uncoupled mitochondria (FIG.
20C). Taken together, MitoBloCK-6 does not alter mitochondrial
function or disrupt mitochondrial integrity and functions
biochemically as a specific inhibitor of Erv1.
MitoBloCK-6 Impairs Substrate Oxidation
[0238] To determine how MitoBloCK-6 inhibited Erv1 function, we
investigated whether MitoBloCK-6 altered Erv1 interactions with
partner proteins in isolated mitochondria (FIG. 21A). MitoBloCK-6
was preincubated with mitochondria isolated from the Erv1-His
strain followed by solubilization in 1.0% digitonin and Erv1-His
was purified with Ni.sup.+2 agarose. In DMSO treated cells, a small
fraction of the Mia40 and half of the cyt c co-purified with Erv1,
as reported previously (Tienson et al., 2009). However, in the
presence of MitoBloCK-6, binding of Mia40 and cyt c to Erv1 was
decreased by 75% and 95% respectively (FIG. 21A).
[0239] If MitoBloCK-6 interferes with Mia40-Erv1 binding, then the
oxidation of substrates may be inhibited in vitro. We therefore
evaluated Tim13 oxidation and subsequent production of
H.sub.2O.sub.2 in vitro (FIG. 21B) (Tienson et al., 2009). Erv1 was
preincubated with DMSO or MitoBloCK-6 for 1 h at 25.degree. C.
Then, the oxidation of Tim13 was reconstituted by incubating
reduced Tim13 with catalytic amounts of Erv1 and Mia40 in an
aerobic environment. Oxidation was monitored over a time course by
the addition of 4-acetamido-4-maleimidylstilbene-2,2-disulfonic
acid (AMS) followed by non-reducing SDS-PAGE and immunoblot
analysis with antibodies against Tim13. AMS addition causes an
increase in molecular mass of 0.5 kDa per addition to a cysteine
residue. In the presence of DMSO, reconstitution proceeded normally
and approximately 80% was oxidized after three hours. By contrast,
only 15% of Tim13 was oxidized in the presence of MitoBloCK-6 (FIG.
21B). As Tim13 was oxidized, H.sub.2O.sub.2 production was
monitored using the Amplex Red-HRP assay (FIG. 21C) (Tienson et
al., 2009). The addition of MitoBloCK-6 caused a significant
decrease in H.sub.2O.sub.2 production compared to the control
reactions. We also tested the oxidation of Cmc1 (Horn et al.,
unpublished data), a substrate of Mia40/Erv1 pathway, with Erv1
(FIG. 21D) and ALR (FIG. 21E). An increase in MitoBloCK-6
concentration correlated with a dose-dependent decrease in
H.sub.2O.sub.2 production. Thus, MitoBloCK-6 specifically blocks
the oxidation of Tim13 and Cmc1 in vitro for both Erv1 and ALR.
[0240] As an additional test for MitoBloCK-6 inhibition of Erv1
oxidase activity, we measured the oxygen consumption rate by Erv1
with an oxygen electrode in the presence of excess DTT (Dabir et
al., 2007). When Erv1 was added alone or with DMSO, the oxygen
consumption rate was similar (FIG. 20D). By contrast, the addition
of MitoBloCK-6 resulted in a concentration-dependent decrease in
the oxygen consumption rate. Results from these analyses show that
MitoBloCK-6 selectively inhibits Erv1 and ALR oxidase activity in
vitro.
MitoBloCK-6 Inhibits ALR Function in Vertebrate Mitochondria
[0241] The long-term goal in developing the MitoBloCK compounds is
to adapt them for studies in vertebrate mitochondria, such as
recapitulating biochemical phenotypes similar to those in cells
derived from patients with mutations in ALR (Di Fonzo et al.,
2009). In addition, MitoBloCK-6 may be useful for studies of
apoptosis, iron sulfur cluster and heme export (Dabir et al.,
2007), and cell differentiation (Todd et al., 2010b), because ALR
has been implicated in these pathways. Since MitoBloCK-6 inhibits
ALR oxidase activity in vitro, we asked whether MitoBloCK-6
disrupts mitochondrial function in mammalian cells by investigating
mitochondrial morphology, a general readout for mitochondrial
defects. HeLa cells were transiently transfected with mitochondrial
matrix targeted Su9-EGFP and co-labeled with Mitotracker-Red (FIG.
23A). Cells were treated with 50 .mu.M MitoBloCK-6 for 12-16 h and
mitochondrial morphology and integrity was visualized by
microscopy. In cells treated with DMSO, Su9-EGFP co-localized with
Mitotracker staining and the mitochondrial network was distributed
as in the untreated cells. However, the addition of CCCP caused the
mitochondrial network to collapse around the nucleus. MitoBloCK-6
addition did not disrupt the mitochondrial network (FIG. 23A), even
at concentrations up to 100 .mu.M MitoBloCK-6 (unpublished data).
We also examined cell viability with a
1-(4,5-dimethylthiazol)-3,5-diphenylformazan (MTT) assay (FIG.
23B). MitoBloCK-6 (100 .mu.M) did not significantly reduce cell
viability. In addition, treatment of HEK293 cells with MitoBloCK-6
showed similar results (unpublished data). Because Erv1 passes
electrons to cyt c, ALR may play a role in apoptosis in mammalian
cells. Therefore, we queried specifically whether cyt c was
released in cells exposed to MitoBloCK-6 (FIG. 23C). Cells
incubated with a positive control, staurosporine, showed cyt c
release and detection in the cytoplasmic fraction as an indication
of apoptosis. However, 50 .mu.M MitoBloCK-6 treatment for 12-16 h
failed to initiate cyt c release (FIG. 23C). Whereas MitoBloCK-6
inhibits ALR function in vitro, this inhibitory activity is
surprisingly lacking in HeLa and HEK293 cells
[0242] ALR was identified in a set of common genes that are
enriched in embryonic, neuronal, and hematopoietic stem cells
(Ivanova et al., 2002; Ramalho-Santos et al., 2002), and ALR has a
pro-survival role in maintaining pluripotent embryonic stem cells
(Todd et al., 2010a). Thus, ALR may have a specific and different
role in pluripotent stem cells than in differentiated cells, such
as HeLa and HEK293 cells. Therefore, we determined whether
MitoBloCK-6 affected hESC survival. HSF1 hESCs and normal human
dermal fibroblasts (NHDFs), which represent a differentiated cell
type, were exposed with 20 .mu.M MitoBloCK-6 or 0.1% DMSO and
visualized using brightfield microscopy (FIG. 24A), including
staining with Coomassie brilliant blue to visualize colony
morphologies (FIG. 24B)(Mochizuki and Furukawa, 1987). MitoBloCK-6
exposure resulted in marked HSF1 cell death, whereas DMSO exposure
did not cause cell death or alter overall colony morphology.
MitoBlock-6 may trigger stem cell apoptosis. Release of cyt c was
examined in HSF1 cells exposed to MitoBloCK-6 (FIG. 22A) using
antibodies against cyt c and visualized by fluorescence microscopy
(Waterhouse et al., 2001). MitoBloCK-6 addition resulted in a shift
in cyt c localization from mitochondria (marked with Tomm20) into
the cytosol (shown as diffuse staining that did not overlap with
Tomm20 staining) Quantification indicated that the number of cells
in which cyt c was released was similar with addition of
MitoBloCK-6 or Actinomycin D, a known apoptosis inducer (FIG. 22B).
In addition, downstream events in apoptosis, poly ADP-ribose
polymerase (PARP) and caspase-3 cleavage were also detected with
MitoBloCK-6 exposure (FIG. 22C).
[0243] To confirm that MitoBloCK-6 specifically inhibited the
survival of hESCs and not of differentiated cells, HSF1 cells were
induced to differentiate with 10 .mu.M retinoic acid followed by
MitoBloCK-6 exposure (FIG. 24). Again, the images show that colony
morphology remained intact when HSF1 cells were differentiated with
retinoic acid treatment and cells did not die. To assess the
earliest time point at which MitoBloCK-6 perturbed hESC viability,
a time course assay was performed and hESCs were stained for
alkaline phosphatase activity (Shamblott et al., 1998). hESC
viability started to decline after 5 hours post treatment (FIG.
22D). To confirm the specificity of MitoBloCK-6, the 20 .mu.M SAR
compounds ES-1 and ES-2 were applied to hESCs and stained for
alkaline phosphatase activity. Whereas ES-1 had no effect on cell
growth (FIG. 22E), ES-2 inhibited cell growth similar to
MitoBloCK-6 (unpublished data). Taken together, MitoBloCK-6 does
not inhibit mitochondrial function in differentiated cells, but
hESCs were susceptible to MitoBloCK-6 and apoptosis was induced.
The data confirm a key role for ALR in hESC maintenance and show
that MitoBloCK-6 is a unique small molecule reagent that identifies
this function.
[0244] Having characterized the effects of MitoBloCK-6 in vitro and
in primary cell culture systems, we applied MitoBloCK-6 to
developing zebrafish embryos, which is a useful in vivo vertebrate
model. The effect of MitoBlock-6 on mitochondrial function and
zebrafish development was tested using previously established
parameters (Mendelsohn et al., 2006; Murphey and Zon, 2006).
Zebrafish embryos were placed in either 1% DMSO or 2.5 .mu.M
MitoBloCK-6 at 3 h post fertilization (hpf) and allowed to develop
until 72 hpf. Higher concentrations of MitoBloCK-6 were toxic to
the fish. MitoBloCK-6 but not DMSO incubated embryos displayed
ventral curvature of the body and cardiac edema (FIGS. 25A,B).
Furthermore, we also treated fish with MitoBloCK-6 from 3 to 24
hpf, followed by removal of MitoBloCK-6, and the zebrafish embryos
were identical to those exposed to DMSO at 72 hpf, indicating that
the effects of MitoBloCK-6 are reversible (unpublished data).
Because ALR may play a role in FeS cluster assembly and export
(Lange et al., 2001), erythropoiesis may be defective (Shaw et al.,
2006). Therefore, embryos were stained with o-dianisidine, which
binds to heme (Lumsden et al., 2007), as a method to visualize
hematopoietic development. Whereas embryos exposed to 1% DMSO or
MitoBloCK-6 showed normal hematopoiesis, embryos treated with
MitoBloCK-6 showed erythrocyte pooling along the yolk sac prior to
entering the lower chamber of the heart and an absence of red blood
cells in the tail (FIG. 25D,E). To confirm that the observed
phenotypes were specifically caused by ALR inhibition via
MitoBloCK-6, 1-cell embryos were also injected with 4 ng of an ATG
morpholino targeted to ALR (FIG. 25C,F). This morpholino prevents
ALR translation in embryos. The phenotypes observed from the
morpholino-injected embryos were identical to that of MitoBlock-6
exposure, strongly suggesting that ALR is specifically targeted.
Cardiac development was also investigated in a transgenic zebrafish
line in which DsRed is targeted to mitochondria under control of
the heart specific cardiac myosin light chain promoter cmlc2 (FIGS.
25G-I) (Shu et al., 2007). Cardiac development at day 3 in embryos
exposed to DMSO was similar to that of wild-type fish in that the
heart is looped and the mitochondria are also very bright (FIGS.
25G I). In contrast, MitoBloCK-6 exposure retarded cardiac
development in that the hearts failed to loop by day 2, instead
becoming stringy and extended. In addition, the mitochondria were
less fluorescent (FIG. 25H), which is likely indicative of
dysfunctional mitochondria. This developmental defect is supported
by a decreased heart rate of 50% and 25% in embryos treated with
MitoBloCK-6 and the ALR morpholino, respectively. Taken together,
the data strongly suggest that MitoBloCK-6 blocks ALR function in
zebrafish, which inhibits somite and cardiac development.
Discussion
[0245] We have identified MitoBloCK-6 as the first selective
inhibitor of the Mia40/Erv1 redox-mediated import pathway. Based on
the assay in which oxidation of substrate DTT by Erv1 was
inhibited, the mechanism by which MitoBloCK-6 may attenuate Erv1
activity is to potentially interfere with binding or electron
transfer between Mia40, cyt c, and/or oxygen. Because the
inhibitors were identified in an in vitro assay, it is possible
that the small molecules might lack specificity in vivo and
generally inhibit mitochondrial function. However, we have used a
variety of approaches to show that MitoBloCK-6 specifically
inhibits Erv1 function. MitoBloCK-6 is a stable compound and the
potential breakdown product, 3,5-dichlorosalicyclaldehyde, does not
inhibit Erv1 function. Instead, the hydroxyl group at the
ortho-position likely stabilizes the compound (Crugeiras et al.,
2009), and a similar class of molecules has been identified in a
small molecule screen for inhibitors of Type III secretion
(Nordfelth et al., 2005). A small SAR study also supports that
similar compound ES-2 inhibits Erv1 function, but ES-1 does not. In
addition, MitoBloCK-6 did not alter mitochondrial integrity and
respiration; therefore, MitoBloCK-6 does not generally damage
mitochondria. Instead, our biochemical assays show that MitoBloCK-6
inhibits oxidation of physiologic substrates Tim13 and Cmc1 and
inhibits hydrogen peroxide production.
[0246] MitoBloCK-6 also inhibits Erv1 in isolated mitochondria,
suggesting that small molecules are valuable for mechanistic
studies. As expected, import assays showed that import of
substrates of the Erv1-Mia40 pathway was specifically inhibited and
this inhibition was dependent on steady-state Erv1 levels, because
increased Erv1 expression correlated with increased MitoBloCK-6
addition. Import of CX.sub.9C proteins was reduced more than
CX.sub.3C protein Tim8. Pfanner and colleagues have shown that a
ternary complex is formed by the substrate, Mia40, and Erv1
(Stojanovski et al., 2008a); MitoBloCK-6 may potentially interfere
with the formation of this ternary complex in a substrate-specific
manner. Strong inhibition of Mia40 import by MitoBloCK-6 was also
unexpected, because full-length Mia40 in yeast uses the TIM23
pathway (as in FIG. 16A), but a truncated version, similar to human
Mia40, that contains the core cysteine residues uses the Mia40/Erv1
pathway (Chacinska et al., 2008). That MitoBloCK-6 blocks Mia40
import suggests that the Erv1 pathway may be important for
coordinating disulfide assembly in the imported Mia40, because
mia40 mutants with cysteine mutations that prevent correct
disulfide bond formation are not viable (Terziyska et al., 2009).
Surprisingly, import of substrates of the TIM22 pathway (AAC and
Tim23) was also reduced, which suggests a broader role for the
Mia40/Erv1 pathway in protein translocation. Detailed analysis of
the import pathway supports a role for Erv1 in transferring the
TIM22 substrates from the outer membrane TOM complex to the
intermembrane space small Tim complexes (FIG. 18D). Redox
regulation may be important in the TIM22 pathway, because the small
Tim proteins may undergo redox regulation and the cysteine-rich
protein Hot13 may also participate (Curran et al., 2004).
Alternatively, MitoBloCK-6 inhibition of Erv1 may change the redox
potential of the IMS, which may alter import ability of the small
Tim proteins. Additional experiments will be required to determine
how MitoBloCK-6 specifically alters the TIM22 pathway. Thus,
MitoBloCK-6 is advantageous for mechanistic studies in protein
translocation because MitoBloCK-6 acts immediately upon addition to
mitochondria.
ALR has a Key Function in hESC Maintenance and Zebrafish
Development
[0247] Our strategy of screening with the yeast protein Erv1 was
also constructive because MitoBloCK-6 inhibited the human homolog
ALR with an improved IC.sub.50 of 700 nM. Our biochemical assays
also support that MitoBloCK-6 is an effective ALR inhibitor,
because the oxidation of Cmc1 was inhibited (FIG. 21E).
High-resolution crystallography and NMR studies of four Erv1 family
proteins, Arabidopsis thaliana Erv1 (Vitu et al., 2006), rat ALR
(Wu et al., 2003), human ALR (Banci et al., 2011), and yeast Erv2
(Gross et al., 2002), reveal that the structure is highly
conserved. Given that MitoBloCK-6 inhibits activity for Erv1, ALR,
and Erv2, MitoBloCK-6 likely binds to a conserved region. An
abbreviated SAR analysis suggests that ES2 has similar inhibitory
properties as MitoBLoCK-6; both could share a similar steric volume
in inhibiting Erv1. Thus, our screen has produced small molecules
that work across species. This also has been shown in an in vivo
screen in which we determined that MitoBloCK-1 of yeast Tim10 also
inhibited Tim10 in mammalian mitochondria (Hasson et al., 2010).
Furthermore, Nunnari and colleagues identified mdivi-1 as an
inhibitor of the yeast fission component Drp1 (Cassidy-Stone et
al., 2008). mdivi-1 also abrogates mammalian Drp1 and retards
apoptosis by preventing mitochondrial outer membrane
permeabilization.
[0248] Whereas MitoBloCK-6 inhibits activity of the Erv1 family in
vitro, a surprising finding was that MitoBloCK-6 did not inhibit
growth or function of differentiated cells such as HEK293, HeLa and
COST cells in vivo. An initial reason may be that a factor in the
media inhibited MitoBloCK-6 action. However, several types of media
were tested, including the permissive hESC media with
differentiated cells, and MitoBloCK-6 remained inactive. In
contrast, MitoBloCK-6 specifically induced apoptosis in hESCs,
suggesting ALR may have a distinct role in pluripotent stem cell
maintenance. Published studies support a role for ALR in stem
cells, because ALR expression is enriched in embryonic, neuronal,
and hematopoietic stem cells (Ivanova et al., 2002; Ramalho-Santos
et al., 2002). ALR has been reported to have a pro-survival role in
maintaining mouse pluripotent embryonic stem cells by interacting
with Drp1 (Todd et al., 2010a). However, Drp1 is a cytosolic
protein mediating mitochondrial fission and it is not apparent how
IMS-localized ALR associates with Drp1; our data supports the model
that ALR inactivation by MitoBlock-6 results in cyt c release and
the mitochondrial network collapses as a consequence of apoptosis
(Parone et al., 2006). We and others have shown that Erv1 and ALR
shuttle electrons to cyt c (Bihlmaier et al., 2007; Dabir et al.,
2007; Farrell and Thorpe, 2005). In differentiated cells,
approximately 85% of the cyt c population is distributed in the
cristae in association with the respiratory complexes and 15% is
located in the IMS in the region between the inner and outer
membrane (Bernardi and Azzone, 1981); this 85% population of cyt c
is released from the cristae during apoptosis in differentiated
cells (Scorrano et al., 2002). However, hESC mitochondria lack
numerous cristae and display decreased respiration compared to
differentiated cells (Zhang et al., 2011), so the population of cyt
c that associates with ALR may be the critical pool that is
released during apoptosis. As a result of our preliminary finding,
MitoBloCK-6 is an excellent tool to understand the contribution of
mitochondrial to pluripotent stem cell function and
differentiation. Additional studies are ongoing to understand how
MitoBloCK-6 induces apoptosis in hESCs.
[0249] In contrast to differentiated culture cells, zebrafish
provide a powerful model system for characterizing ALR function
because cells are not transformed and are in their normal
physiologic setting of cell-cell and cell-extracellular matrix
interactions (Murphey and Zon, 2006). The embryos are also in
simple buffered water, so MitoBloCK-6 uptake may be enhanced.
Defects in mitochondrial biogenesis in zebrafish display varied
phenotypes. Mutations in the Tomm22 import component result in
defects in liver development (Curado et al., 2010) and mutations in
Fe--S cluster biogenesis typically impact erythropoiesis (Shaw et
al., 2006; Wingert et al., 2005). Indeed, MitoBloCK-6 also elicited
gross morphologic and cardiac defects in zebrafish that were akin
to ALR downregulation. Overall, characterization of MitoBloCK-6
supports that the chemical approach is valid for developing probes
to study protein translocation and understand the role of protein
import in development.
REFERENCES
Example 2
[0250] Banci, L., Bertini, I., Calderone, V., Cefaro, C.,
Ciofi-Baffoni, S., Gallo, A., Kallergi, E., Lionaki, E., Pozidis,
C., and Tokatlidis, K. (2011). Molecular recognition and substrate
mimicry drive the electron-transfer process between MIA40 and ALR.
Proc Natl Acad Sci USA 108, 4811-4816. [0251] Bernardi, P., and
Azzone, G. F. (1981). Cytochrome c as an electron shuttle between
the outer and inner mitochondrial membranes. J Biol Chem 256,
7187-7192. [0252] Beverly, K. N., Sawaya, M. R., Schmid, E., and
Koehler, C. M. (2008). The Tim8-Tim13 complex has multiple
substrate binding sites and binds cooperatively to Tim23. J Mol
Biol 382, 1144-1156. [0253] Bien, M., Longen, S., Wagener, N.,
Chwalla, I., Herrmann, J. M., and Riemer, J. (2010). Mitochondrial
disulfide bond formation is driven by intersubunit electron
transfer in Erv1 and proofread by glutathione. Mol Cell 37,
516-528. [0254] Bihlmaier, K., Mesecke, N., Terziyska, N., Bien,
M., Hell, K., and Herrmann, J. M. (2007). The disulfide relay
system of mitochondria is connected to the respiratory chain. J
Cell Biol 179, 389-395. [0255] Cassidy-Stone, A., Chipuk, J. E.,
Ingerman, E., Song, C., Yoo, C., Kuwana, T., Kurth, M. J., Shaw, J.
T., Hinshaw, J. E., Green, D. R., et al. (2008). Chemical
inhibition of the mitochondrial division dynamin reveals its role
in Bax/Bak-dependent mitochondrial outer membrane permeabilization.
Dev Cell 14, 193-204. [0256] Castellano, S., Fiji, H. D.,
Kinderman, S. S., Watanabe, M., Leon, P., Tamanoi, F., and Kwon, O.
(2007). Small-molecule inhibitors of protein
geranylgeranyltransferase type I. J Am Chem Soc 129, 5843-5845.
[0257] Cavallaro, G. (2010). Genome-wide analysis of eukaryotic
twin CX9C proteins. Mol Biosyst 6, 2459-2470. [0258] Chacinska, A.,
Guiard, B., Muller, J. M., Schulze-Specking, A., Gabriel, K.,
Kutik, S., and Pfanner, N. (2008). Mitochondrial biogenesis,
switching the sorting pathway of the intermembrane space receptor
Mia40. J Biol Chem 283, 29723-29729. [0259] Chacinska, A., Koehler,
C. M., Milenkovic, D., Lithgow, T., and Pfanner, N. (2009).
Importing mitochondrial proteins: machineries and mechanisms. Cell
138, 628-644. [0260] Chacinska, A., Pfannschmidt, S., Wiedemann,
N., Kozjak, V., Sanjuan Szklarz, L. K., Schulze-Specking, A.,
Truscott, K. N., Guiard, B., Meisinger, C., and Pfanner, N. (2004).
Essential role of Mia40 in import and assembly of mitochondrial
intermembrane space proteins. EMBO J 23, 3735-3746. [0261]
Claypool, S. M., Boontheung, P., McCaffery, J. M., Loo, J. A., and
Koehler, C. M. (2008a). The cardiolipin transacylase, tafazzin,
associates with two distinct respiratory components providing
insight into Barth syndrome. Mol Biol Cell 19, 5143-5155. [0262]
Claypool, S. M., Oktay, Y., Boontheung, P., Loo, J. A., and
Koehler, C. M. (2008b). Cardiolipin defines the interactome of the
major ADP/ATP carrier protein of the mitochondrial inner membrane.
J Cell Biol 182, 937-950. [0263] Crugeiras, J., Rios, A., Riveiros,
E., and Richard, J. P. (2009). Substituent effects on the
thermodynamic stability of imines formed from glycine and aromatic
aldehydes: implications for the catalytic activity of
pyridoxal-5'-phosphate. J Am Chem Soc 131, 15815-15824. [0264]
Curado, S., Ober, E. A., Walsh, S., Cortes-Hernandez, P., Verkade,
H., Koehler, C. M., and Stainier, D. Y. (2010). The mitochondrial
import gene tomm22 is specifically required for hepatocyte survival
and provides a liver regeneration model. Dis Model Mech 3, 486-495.
[0265] Curran, S. P., Leuenberger, D., Leverich, E. P., Hwang, D.
K., Beverly, K. N., and Koehler, C. M. (2004). The role of Hotl3p
and redox chemistry in the mitochondrial TIM22 import pathway. J
Biol Chem 279, 43744-43751. [0266] Curran, S. P., Leuenberger, D.,
Oppliger, W., and Koehler, C. M. (2002). The Tim9p-Tim10p complex
binds to the transmembrane domains of the ADP-ATP carrier. EMBO J
21, 942-953. [0267] Dabir, D. V., Leverich, E. P., Kim, S. K.,
Tsai, F. D., Hirasawa, M., Knaff, D. B., and Koehler, C. M. (2007).
A role for cytochrome c and cytochrome c peroxidase in electron
shuttling from Erv1. EMBO J 26, 4801-4811. [0268] Daithankar, V.
N., Schaefer, S. A., Dong, M., Bahnson, B. J., and Thorpe, C.
(2010). Structure of the human sulfhydryl oxidase augmenter of
liver regeneration and characterization of a human mutation causing
an autosomal recessive myopathy. Biochemistry 49, 6737-6745. [0269]
Deponte, M., and Hell, K. (2009). Disulphide bond formation in the
intermembrane space of mitochondria. J Biochem 146, 599-608. [0270]
Di Fonzo, A., Ronchi, D., Lodi, T., Fassone, E., Tigano, M.,
Lamperti, C., Corti, S., Bordoni, A., Fortunato, F., Nizzardo, M.,
et al. (2009). The mitochondrial disulfide relay system protein
GFER is mutated in autosomal-recessive myopathy with cataract and
combined respiratory-chain deficiency. Am J Hum Genet 84, 594-604.
[0271] Doom, J. A., and Petersen, D. R. (2003). Covalent adduction
of nucleophilic amino acids by 4-hydroxynonenal and 4-oxononenal.
Chem Biol Interact 143-144, 93-100. [0272] Duncan, M. C., Ho, D.
G., Huang, J., Jung, M. E., and Payne, G. S. (2007). Composite
synthetic lethal identification of membrane traffic inhibitors.
Proc Natl Acad Sci USA 104, 6235-6240. [0273] Farrell, S. R., and
Thorpe, C. (2005). Augmenter of liver regeneration: a
flavin-dependent sulfhydryl oxidase with cytochrome c reductase
activity. Biochemistry 44, 1532-1541. [0274] Gerber, J.,
Muhlenhoff, U., Hofhaus, G., Lill, R., and Lisowsky, T. (2001).
Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase
of the Erv1p/Alrp protein family. J Biol Chem 276, 23486-23491.
[0275] Glick, B. S., and Pon, L. A. (1995). Isolation of highly
purified mitochondria from Saccharomyces cerevisiae. Methods
Enzymol 260, 213-223. [0276] Gross, E., Sevier, C. S., Vala, A.,
Kaiser, C. A., and Fass, D. (2002). A new FAD-binding fold and
intersubunit disulfide shuttle in the thiol oxidase Erv2p. Nat
Struct Biol 9, 61-67. [0277] Hasson, S. A., Damoiseaux, R., Glavin,
J. D., Dabir, D. V., Walker, S. S., and Koehler, C. M. (2010).
Substrate specificity of the TIM22 mitochondrial import pathway
revealed with small molecule inhibitor of protein translocation.
Proc Natl Acad Sci USA 107, 9578-9583. [0278] Herrmann, J. M., and
Hell, K. (2005). Chopped, trapped or tacked-protein translocation
into the IMS of mitochondria. Trends Biochem Sci 30, 205-211.
[0279] Hofmann, S., Rothbauer, U., Muhlenbein, N., Baiker, K.,
Hell, K., and Bauer, M. F. (2005). Functional and mutational
characterization of human MIA40 acting during import into the
mitochondrial intermembrane space. J Mol Biol 353, 517-528. [0280]
Horn, D., Al-Ali, H., and Barrientos, A. (2008). Cmc1p is a
conserved mitochondrial twin CX9C protein involved in cytochrome c
oxidase biogenesis. Mol Cell Biol 28, 4354-4364. [0281] Ivanova, N.
B., Dimos, J. T., Schaniel, C., Hackney, J. A., Moore, K. A., and
Lemischka, I. R. (2002). A stem cell molecular signature. Science
298, 601-604. [0282] Kirdant, A. S., Shelke, V. A., Shankarwar, S.
G., Shankarwar, A. G., and Chondhekar, T. K. (2011). Kinetic study
of hydrolysis of N-salicylidene-m-methyl aniline
spectrophotometrically. J Chem Pharm Res 3, 790-796. [0283]
Koehler, C. M., Jarosch, E., Tokatlidis, K., Schmid, K., Schweyen,
R. J., and Schatz, G. (1998a). Import of mitochondrial carriers
mediated by essential proteins of the intermembrane space. Science
279, 369-373. [0284] Koehler, C. M., Merchant, S., Oppliger, W.,
Schmid, K., Jarosch, E., Dolfini, L., Junne, T., Schatz, G., and
Tokatlidis, K. (1998b). Tim9p, an essential partner subunit of
Tim10p for the import of mitochondrial carrier proteins. EMBO J 17,
6477-6486. [0285] Koehler, C. M., and Tienson, H. L. (2009). Redox
regulation of protein folding in the mitochondrial intermembrane
space. Biochim Biophys Acta 1793, 139-145. [0286] Lange, H.,
Lisowsky, T., Gerber, J., Muhlenhoff, U., Kispal, G., and Lill, R.
(2001). An essential function of the mitochondrial sulfhydryl
oxidase Erv1p/ALR in the maturation of cytosolic Fe/S proteins.
EMBO Rep 2, 715-720. [0287] Lumsden, A. L., Henshall, T. L., Dayan,
S., Lardelli, M. T., and Richards, R. I. (2007).
Huntingtin-deficient zebrafish exhibit defects in iron utilization
and development. Hum Mol Genet 16, 1905-1920. [0288] Mendelsohn, B.
A., Yin, C., Johnson, S. L., Wilm, T. P., Solnica-Krezel, L., and
Gitlin, J. D. (2006). Atp7a determines a hierarchy of copper
metabolism essential for notochord development. Cell Metab 4,
155-162. [0289] Milenkovic, D., Ramming, T., Muller, J. M., Wenz,
L. S., Gebert, N., Schulze-Specking, A.,
[0290] Stojanovski, D., Rospert, S., and Chacinska, A. (2009).
Identification of the signal directing Tim9 and Tim10 into the
intermembrane space of mitochondria. Mol Biol Cell 20, 2530-2539.
[0291] Mochizuki, Y., and Furukawa, K. (1987). Application of
coomassie brilliant blue staining to cultured hepatocytes. Cell
Biol Int Rep 11, 367-371. [0292] Mokranjac, D., and Neupert, W.
(2009). Thirty years of protein translocation into mitochondria:
unexpectedly complex and still puzzling. Biochim Biophys Acta 1793,
33-41. [0293] Murphey, R. D., and Zon, L. I. (2006). Small molecule
screening in the zebrafish. Methods 39, 255-261. [0294] Nordfelth,
R., Kauppi, A. M., Norberg, H. A., Wolf-Watz, H., and Elofsson, M.
(2005). Small-molecule inhibitors specifically targeting type III
secretion. Infect Immun 73, 3104-3114. [0295] Parone, P. A., James,
D. I., Da Cruz, S., Mattenberger, Y., Donze, 0., Barja, F., and
Martinou, J. C. (2006) Inhibiting the mitochondrial fission
machinery does not prevent Bax/Bak-dependent apoptosis. Mol Cell
Biol 26, 7397-7408. [0296] Ramalho-Santos, M., Yoon, S., Matsuzaki,
Y., Mulligan, R. C., and Melton, D. A. (2002). "Stemness":
transcriptional profiling of embryonic and adult stem cells.
Science 298, 597-600. [0297] Riemer, J., Fischer, M., and Herrmann,
J. M. (2011). Oxidation-driven protein import into mitochondria:
Insights and blind spots. Biochim Biophys Acta 1808, 981-989.
[0298] Ryan, M. T., Muller, H., and Pfanner, N. (1999). Functional
Staging of ADP/ATP Carrier Translocation across the Outer
Mitochondrial Membrane. J Biol Chem 274, 20619-20627. [0299]
Schmidt, O., Pfanner, N., and Meisinger, C. (2010). Mitochondrial
protein import: from proteomics to functional mechanisms. Nat Rev
Mol Cell Biol 11, 655-667. [0300] Scorrano, L., Ashiya, M., Buttle,
K., Weiler, S., Oakes, S. A., Mannella, C. A., and Korsmeyer, S. J.
(2002). A distinct pathway remodels mitochondrial cristae and
mobilizes cytochrome c during apoptosis. Dev Cell 2, 55-67. [0301]
Senkevich, T. G., White, C. L., Koonin, E. V., and Moss, B. (2002).
Complete pathway for protein disulfide bond formation encoded by
poxviruses. Proc Natl Acad Sci USA 99, 6667-6672. [0302] Shamblott,
M. J., Axelman, J., Wang, S., Bugg, E. M., Littlefield, J. W.,
Donovan, P. J., Blumenthal, P. D., Huggins, G. R., and Gearhart, J.
D. (1998). Derivation of pluripotent stem cells from cultured human
primordial germ cells. Proc Natl Acad Sci USA 95, 13726-13731.
[0303] Shaw, G. C., Cope, J. J., Li, L., Corson, K., Hersey, C.,
Ackermann, G. E., Gwynn, B., Lambert, A. J., Wingert, R. A.,
Traver, D., et al. (2006). Mitoferrin is essential for erythroid
iron assimilation. Nature 440, 96-100. [0304] Shu, X., Huang, J.,
Dong, Y., Choi, J., Langenbacher, A., and Chen, J. N. (2007).
Na,K-ATPase alpha2 and Ncx4a regulate zebrafish left-right
patterning. Development 134, 1921-1930. [0305] Sideris, D. P.,
Petrakis, N., Katrakili, N., Mikropoulou, D., Gallo, A.,
Ciofi-Baffoni, S., Banci, L., Bertini, I., and Tokatlidis, K.
(2009). A novel intermembrane space-targeting signal docks
cysteines onto Mia40 during mitochondrial oxidative folding. J Cell
Biol 187, 1007-1022. [0306] Sideris, D. P., and Tokatlidis, K.
(2010). Oxidative protein folding in the mitochondrial
intermembrane space. Antioxid Redox Signal 13, 1189-1204. [0307]
Stojanovski, D., Milenkovic, D., Muller, J. M., Gabriel, K.,
Schulze-Specking, A., Baker, M. J., Ryan, M. T., Guiard, B.,
Pfanner, N., and Chacinska, A. (2008a). Mitochondrial protein
import: precursor oxidation in a ternary complex with disulfide
carrier and sulfhydryl oxidase. J Cell Biol 183, 195-202. [0308]
Stojanovski, D., Muller, J. M., Milenkovic, D., Guiard, B.,
Pfanner, N., and Chacinska, A. (2008b). The MIA system for protein
import into the mitochondrial intermembrane space. Biochim Biophys
Acta 1783, 610-617. [0309] Terziyska, N., Grumbt, B., Bien, M.,
Neupert, W., Herrmann, J. M., and Hell, K. (2007). The sulfhydryl
oxidase Erv1 is a substrate of the Mia40-dependent protein
translocation pathway. FEBS Lett 581, 1098-1102. [0310] Terziyska,
N., Grumbt, B., Kozany, C., and Hell, K. (2009). Structural and
functional roles of the conserved cysteine residues of the
redox-regulated import receptor Mia40 in the intermembrane space of
mitochondria. J Biol Chem 284, 1353-1363. [0311] Thorpe, C.,
Hoober, K. L., Raje, S., Glynn, N. M., Burnside, J., Turi, G. K.,
and Coppock, D. L. (2002). Sulfhydryl oxidases: emerging catalysts
of protein disulfide bond formation in eukaryotes. Arch Biochem
Biophys 405, 1-12. [0312] Tienson, H. L., Dabir, D. V., Neal, S.
E., Loo, R., Hasson, S. A., Boontheung, P., Kim, S. K., Loo, J. A.,
and Koehler, C. M. (2009). Reconstitution of the Mia40-Erv1
oxidative folding pathway for the small tim proteins. Mol Biol Cell
20, 3481-3490. [0313] Todd, L. R., Damin, M. N., Gomathinayagam,
R., Horn, S. R., Means, A. R., and Sankar, U. (2010a). Growth
factor ervl-like modulates Drp1 to preserve mitochondrial dynamics
and function in mouse embryonic stem cells. Mol Biol Cell 21,
1225-1236. [0314] Todd, L. R., Gomathinayagam, R., and Sankar, U.
(2010b). A novel Gfer-Drp1 link in preserving mitochondrial
dynamics and function in pluripotent stem cells. Autophagy 6,
821-822. [0315] Truscott, K. N., Wiedemann, N., Rehling, P.,
Muller, H., Meisinger, C., Pfanner, N., and Guiard, B. (2002).
Mitochondrial import of the ADP/ATP carrier: the essential TIM
complex of the intermembrane space is required for precursor
release from the TOM complex. Mol Cell Biol 22, 7780-7789. [0316]
Vitu, E., Bentzur, M., Lisowsky, T., Kaiser, C. A., and Fass, D.
(2006). Gain of function in an ERV/ALR sulfhydryl oxidase by
molecular engineering of the shuttle disulfide. J Mol Biol 362,
89-101. [0317] Waterhouse, N. J., Goldstein, J. C., Kluck, R. M.,
Newmeyer, D. D., and Green, D. R. (2001). The (Holey) study of
mitochondria in apoptosis. Methods Cell Biol 66, 365-391. [0318]
Webb, T. R. (2005). Current directions in the evolution of compound
libraries. Curr Opin Drug Discov Devel 8, 303-308. [0319] Wingert,
R. A., Galloway, J. L., Barut, B., Foott, H., Fraenkel, P., Axe, J.
L., Weber, G. J., Dooley, K., Davidson, A. J., Schmid, B., et al.
(2005). Deficiency of glutaredoxin 5 reveals Fe--S clusters are
required for vertebrate haem synthesis. Nature 436, 1035-1039.
[0320] Wu, C. K., Dailey, T. A., Dailey, H. A., Wang, B. C., and
Rose, J. P. (2003). The crystal structure of augmenter of liver
regeneration: A mammalian FAD-dependent sulfhydryl oxidase. Protein
Sci 12, 1109-1118. [0321] Zhang, J., Khvorostov, I., Hong, J. S.,
Oktay, Y., Vergnes, L., Nuebel, E., Wahjudi, P. N., Setoguchi, K.,
Wang, G., Do, A., et al. (2011). UCP2 regulates energy metabolism
and differentiation potential of human pluripotent stem cells. EMBO
J 30, 4860-4873.
[0322] While particular embodiments of the present invention have
been shown and described, it will be obvious to those skilled in
the art that changes and modifications can be made without
departing from the embodiments of this invention in its broader
aspects and, therefore, the appended claims are to encompass within
their scope all such changes and modifications as fall within the
true spirit and scope of the embodiments of this invention.
Sequence CWU 1
1
1125DNAArtificial SequenceATG morpholino targeted to zebrafish ALR
protein 1gagggttgcc agatctctgt taaat 25
* * * * *