U.S. patent application number 14/279619 was filed with the patent office on 2014-09-04 for enhancing spinosyn production with oxygen binding proteins.
The applicant listed for this patent is Dow AgroSciences LLC. Invention is credited to Lei Han, Nigel Mouncey.
Application Number | 20140248667 14/279619 |
Document ID | / |
Family ID | 47090473 |
Filed Date | 2014-09-04 |
United States Patent
Application |
20140248667 |
Kind Code |
A1 |
Han; Lei ; et al. |
September 4, 2014 |
ENHANCING SPINOSYN PRODUCTION WITH OXYGEN BINDING PROTEINS
Abstract
The invention describes the integration of polynucleotides into
chromosomal DNA of S. spinosa species, which are useful for the
production of insecticides, integrants thereof, and also to the use
of the integrants. The invention includes the stable integration
and expression of an oxygen-binding protein, VHb, which results in
increased spinosyn production.
Inventors: |
Han; Lei; (Carmel, IN)
; Mouncey; Nigel; (Indianapolis, IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dow AgroSciences LLC |
Indianapolis |
IN |
US |
|
|
Family ID: |
47090473 |
Appl. No.: |
14/279619 |
Filed: |
May 16, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13100202 |
May 3, 2011 |
8741603 |
|
|
14279619 |
|
|
|
|
Current U.S.
Class: |
435/76 |
Current CPC
Class: |
C07K 14/195 20130101;
C07K 14/805 20130101; C12P 19/62 20130101 |
Class at
Publication: |
435/76 |
International
Class: |
C12P 19/62 20060101
C12P019/62 |
Claims
1. A method for increasing a spinosyn titer comprising:
intergrating an oxygen binding protein into a spinosyn producing
strain, wherein the spinosyn titer is increased by at least
4.6%.
2. The method of claim 1 wherein the oxygen binding protein is a
globin protein.
3. The method of claim 2 wherein the globin protein is selected
from the group consisting of Vitreoscilla hemoglobin, Alcaligenes
eutrophus flavohemoprotein, horse heart myoglobin, E. coli
hemoprotein, B. subtilis hemoprotein, yeast flavohemoglobin,
soybean leghemoglobin, lupin leghemoglobin, and sperm whale
myoglobin, or their functional equivalents.
4. The method of claim 2 wherein the globin protein is Vitreoscilla
hemoglobin or a functional polymorphism thereof.
5. The method of claim 1 wherein the oxygen binding protein is
integrated into chromosomal DNA in a neutral site in a S. spinosa
genome.
6. The method of claim 1 wherein the spinosyn titers are increased
are selected from the group consisting of spinsoyn A+D, spinosyn
J+L, spinosyn A and spinosyn J.
7. A method of increasing spinosyn production, the method
comprising: culturing a spinosyn producing organism that expresses
a heterologous gene encoding an oxygen binding protein under
conditions appropriate for production of spinosyn; and collecting
spinosyn from a culture of an spinosyn producing organism that
expresses a heterologous gene encoding an oxygen binding
protein.
8. The method of claim 7 wherein the organism is S. spinosa.
9. The method of claim 7 wherein the heterologous gene is
integrated into a chromosome of the cell.
10. The method of claim 7 wherein the oxygen binding protein is a
globin protein.
11. The method of claim 10 wherein the globin protein is selected
from the group consisting of Vitreoscilla hemoglobin, Alcaligenes
eutrophus flavohemoprotein, horse heart myoglobin, E. coli
hemoprotein, B. subtilis hemoprotein, yeast flavohemoglobin,
soybean leghemoglobin, lupin leghemoglobin, and sperm whale
myoglobin, or their functional equivalents.
12. The method of claim 10 wherein the globin protein is
Vitreoscilla hemoglobin or a functional polymorphism thereof.
13. The method of claim 7 wherein the oxygen binding protein is
integrated into chromosomal DNA in a neutral site in a S. spinosa
genome.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/100,202, filed May 3, 2011, pending, the
disclosure of which is hereby incorporated herein in its entirety
by this reference.
FIELD OF THE INVENTION
[0002] The invention applies to the technical field of molecular
genetics wherein genes may be integrated into the chromosome of
Saccharopolyspora spinosa. One metabolic engineering approach
includes the integration and expression of an oxygen binding
protein such as a hemoglobin gene within a chromosomal DNA region
that results in increased spinosyn production, while at the same
time not having a negative effect on growth or other desired
metabolic characteristics of Saccharopolyspora spinosa.
BACKGROUND
[0003] As disclosed in U.S. Pat. No. 5,362,634, fermentation
product A83543 is a family of related compounds produced by
Saccharopolyspora spinosa. The known members of this family have
been referred to as factors or components, and each has been given
an identifying letter designation. These compounds are hereinafter
referred to as spinosyn A, B, etc. The spinosyn compounds are
useful for the control of arachnids, nematodes and insects, in
particular, Lepidoptera and Diptera species. The compounds are
considered environmentally friendly with an appealing toxicological
profile.
[0004] The naturally produced spinosyn compounds are macrolides
consisting of a 21-carbon tetracyclic lactone, which includes the
attachment of two deoxysugars: a neutral sugar (rhamnose) and an
amino sugar (forosamine) (see Kirst et al., (1991). If the amino
sugar is not present, the compounds have been referred to as the
pseudoaglycone of A, D, etc., and if the neutral sugar is not
present then the compounds have been referred to as the reverse
pseudoaglycone of A, D, etc. A more preferred nomenclature is to
refer to the pseudoaglycones as spinosyn A 17-Psa, spinosyn D
17-Psa, etc., and to the reverse pseudoaglycones as spinosyn A
9-Psa, spinosyn D 9-Psa, etc.
[0005] The naturally produced spinosyn compounds may be produced
via fermentation from S. spinosa strains NRRL 18395, 18537, 18538,
18539, 18719, 18720, 18743 and 18823 and derivatives therefrom.
These cultures have been deposited and made part of the stock
culture collection of the Midwest Area Northern Regional Research
Center, Agricultural Research Service, United States Department of
Agriculture, 1815 North University Street, Peoria, Ill., 61604.
[0006] U.S. Pat. No. 5,362,634 and corresponding European Patent
No. 0375316 B1 relate to spinosyns A, B, C, D, E, F, G, H, and J.
These compounds are said to be produced by culturing a strain of
the novel microorganism Saccharopolyspora spinosa selected from
NRRL 18395, NRRL 18537, NRRL 18538, and NRRL 18539.
[0007] WO 93/09126 relates to spinosyns L, M, N, Q, R, S, and T.
Also discussed therein are two spinosyn J producing strains: NRRL
18719 and NRRL 18720, and a strain that produces spinosyns Q, R, S,
and T: NRRL 18823.
[0008] WO 94/20518 and U.S. Pat. No. 5,670,486 relates to spinosyns
K, O, P, U, V, W, and Y, and derivatives thereof. Also discussed
therein is spinosyn K-producing strain NRRL 18743.
[0009] A challenge in producing spinosyn compounds arises from the
need to identify and validate neutral sites in the S. spinosa
genome, wherein a polynucleotide containing a gene expression
cassette could be integrated and stably expressed. The introduced
gene expression cassette can contain biosynthetic genes that
provide a method for producing new derivatives of the spinosyns
which may have a different spectrum of insecticidal activity or a
gene expression cassette which can increase the titer levels of
spinosyns, in addition to other gene expression cassettes which
would impart new beneficial characteristics to the existing
spinosyn production strains.
[0010] It would be advantageous to identify and introduce genes,
which result in increased production of spinosyn compounds.
SUMMARY OF THE INVENTION
[0011] The present invention relates to methods of polynucleotide
integration into chromosomal DNA of S. spinosa species, which are
useful for the production of insecticides, integrants thereof, and
also to the use of the integrants.
[0012] The invention further provides a genetically modified host
cell that harbors a spinosyn enhancing gene integrated into the S.
spinosa genome, which results in increased spinosyn production. As
such, S. spinosa titer levels result in improved A/D production or
J/L production in the shake flask fermentation.
[0013] The invention further provides a process for integrating an
oxygen-binding gene within S. spinosa. A particular embodiment of
the present invention utilizes the spinosyn enhancing properties
encoded by the VHb gene, wherein the VHb gene expression cassette
is borne on the chromosome of S. spinosa. The expression of the VHb
gene results in improved and increased spinosyn production. As
such, A/D spinosyn production in the shake flask fermentation of S.
spinosa is increased.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 depicts plasmid pDAB109000 containing the 977 bp
synthetic DNA fragment with pJ201.
[0015] FIG. 2 depicts plasmid pDAB109001, which resulted from
cloning of the hemoglobin gene expression cassette into pIJ773.
DETAILED DESCRIPTION OF THE INVENTION
[0016] There are many uses for integrated genes within the
chromosome of Saccharopolyspora spinosa. The cloned genes, either
native or heterologous, can be used to improve yields of spinosyns
and to produce new spinosyns. Improved yields can be obtained by
integrating into the genome of a strain a duplicate copy of the
gene for whatever enzyme is rate limiting in that strain. In cases
wherein the biosynthetic pathway is blocked in a particular mutant
strain due to lack of a required enzyme, production of the desired
spinosyns can be restored by integrating a copy of the required
gene. Wherein a biosynthetic pathway is disrupted, a different
precursor strain can be created.
[0017] This application illustrates that the over expression of the
Vitreoscilla hemoglobin gene sequence, hereinafter "VHb," in S.
spinosa results in increased spinosyn production. For S. spinosa
strain improvement, the stable transformation of a polynucleotide
was made by integrating a gene expression cassette into the genome
of S. spinosa. Integration of the gene via homologous recombination
using a part of chromosomal DNA and an insertion element was
accomplished. The chromosomal DNA can be inserted into the S.
spinosa genome. Based on this recombination and as a result of
application thereof, the aac(3) IV and VHb gene expression
cassettes were separately integrated into the chromosome of S.
spinosa at the obscurin polyketide synthase (PKS) locus resulting
in the inactivation of a native gene, obsA.
[0018] The following definitions are used herein and should be
referred to for interpretation of the claims and the specification.
Unless otherwise noted, all U.S. Patents and U.S. Patent
Applications referenced herein are incorporated by reference in
their entirety.
[0019] As used herein, the indefinite articles "a" and "an"
preceding an element or component of the invention are intended to
be nonrestrictive regarding the number of instances (i.e.,
occurrences) of the element or component. Therefore "a" or "an"
should be read to include one or at least one, and the singular
word form of the element or component also includes the plural
unless the number is obviously meant to be singular.
[0020] As used herein, the terms "comprising" and "including" mean
the presence of the stated features, integers, steps, or components
as referred to in the claims, but that it does not preclude the
presence or addition of one or more other features, integers,
steps, components or groups thereof. This means a composition, a
mixture, a process, a method, an article, or an apparatus that
"comprises" or "includes" a list of elements is not limited to only
those elements but may include others not expressly listed or
inherent to it. As used herein, "or" refers to an inclusive and an
exclusive "or." For example, a condition A or B is satisfied by any
one of the following: A is true (or present) and B is false (or not
present), A is false (or not present) and B is true (or present),
and both A and B are true (or present).
[0021] As used herein, the term "about" refers to modifying the
quantity of an ingredient or reactant of the invention or employed
refers to variation in the numerical quantity that can occur, for
example, through typical measuring and liquid handling procedures
used for making concentrates or use solutions in the real world;
through inadvertent error in these procedures; through differences
in the manufacture, source, or purity of the ingredients employed
to make the compositions or carry out the methods; and the like.
The term "about" also encompasses amounts that differ due to
different equilibrium conditions for a composition resulting from a
particular initial mixture. Whether or not modified by the term
"about," the claims include equivalents to the quantities.
[0022] As used herein, the term "invention" or "present invention"
is a non-limiting term and is intended to encompass all possible
variations as described in the specification and recited in the
claims.
[0023] As used herein, the terms "polypeptide" and "peptide" will
be used interchangeably to refer to a polymer of two or more amino
acids joined together by a peptide bond. In one aspect, this term
also includes post expression modifications of the polypeptide, for
example, glycosylations, acetylations, phosphorylations and the
like. Included within the definition are, for example, peptides
containing one or more analogues of an amino acid or labeled amino
acids and peptidomimetics. The peptides may comprise L-amino
acids.
[0024] As used herein, the terms "peptide of interest," "POI,"
"gene product," "target gene product," and "target coding region
gene product" refer to the desired heterologous peptide/protein
product encoded by the recombinantly expressed foreign gene. The
peptide of interest may include any peptide/protein product
including, but not limited to, proteins, fusion proteins, enzymes,
peptides, polypeptides, and oligopeptides. The peptide of interest
ranges in size from 2 to 398 amino acids in length.
[0025] As used herein, the term "genetic construct" refers to a
series of contiguous nucleic acids useful for modulating the
genotype or phenotype of an organism. Non-limiting examples of
genetic constructs include but are not limited to a nucleic acid
molecule, and open reading frame, a gene, an expression cassette, a
vector, a plasmid and the like.
[0026] As used herein, the term "endogenous gene" refers to a
native gene in its natural location in the genome of an
organism.
[0027] As used herein, a "foreign gene" refers to a gene not
normally found in the host organism, but that is introduced into
the host organism by gene transfer. Foreign genes can comprise
native genes inserted into a non-native organism, or chimeric
genes.
[0028] As used herein, the term "heterologous" with respect to
sequence within a particular organism/genome indicates that the
sequence originates from a foreign species, or, if from the same
species, is substantially modified from its native form in
composition and/or genomic locus by deliberate human intervention.
Thus, for example, heterologous gene expression refers to the
process of expressing a gene from one organism/genome by placing it
into the genome of a different organism/genome.
[0029] As used herein, the term "recombinant" refers to an
artificial combination of two otherwise separated segments of
sequence, e.g., by chemical synthesis or by the manipulation of
isolated segments of nucleic acids by genetic engineering
techniques. "Recombinant" also includes reference to a cell or
vector, that has been modified by the introduction of a
heterologous nucleic acid or a cell derived from a cell so
modified, but does not encompass the alteration of the cell or
vector by naturally occurring events (e.g., spontaneous mutation,
natural transformation, natural transduction, natural
transposition) such as those occurring without deliberate human
intervention.
[0030] The term "genetically engineered" or "genetically altered"
means the scientific alteration of the structure of genetic
material in a living organism. It involves the production and use
of recombinant DNA. More in particular it is used to delineate the
genetically engineered or modified organism from the naturally
occurring organism. Genetic engineering may be done by a number of
techniques known in the art, such as, e.g., gene replacement, gene
amplification, gene disruption, transfection, transformation using
plasmids, viruses, or other vectors. A genetically modified
organism, e.g., genetically modified microorganism, is also often
referred to as a recombinant organism, e.g., recombinant
microorganism.
[0031] As used herein, the term "disrupted" or "disruption" when
referring to a gene that has been manipulated or modified through
genetic engineering or through natural causes that change the
activity of a gene. Such gene activity may be increased or
decreased. Additionally, such disruption may abolish protein
function. To facilitate such a decrease, the copy number of the
genes may be decreased, such as for instance by underexpression or
disruption of a gene. A gene is said to be "underexpressed" if the
level of transcription of said gene is reduced in comparison to the
wild type gene. This may be measured by for instance Northern blot
analysis quantifying the amount of mRNA as an indication for gene
expression. As used herein, a gene is underexpressed if the amount
of generated mRNA is decreased by at least 1%, 2%, 5% 10%, 25%,
50%, 75%, 100%, 200% or even more than 500%, compared to the amount
of mRNA generated from a wild-type gene. Alternatively, a weak
promoter may be used to direct the expression of the
polynucleotide. In another embodiment, the promoter, regulatory
region and/or the ribosome binding site upstream of the gene can be
altered to achieve the reduced expression. The expression may also
be reduced by decreasing the relative half-life of the messenger
RNA. In another embodiment, the activity of the polypeptide itself
may be decreased by employing one or more mutations in the
polypeptide amino acid sequence, which decrease the activity. For
example, altering the affinity of the polypeptide for its
corresponding substrate may result in reduced activity. Likewise,
the relative half-life of the polypeptide may be decreased. In
either scenario, that being reduced gene expression or reduced
activity, the reduction may be achieved by altering the composition
of the cell culture media and/or methods used for culturing.
"Reduced expression" or "reduced activity," as used herein, means a
decrease of at least 5%, 10%, 25%, 50%, 75%, 100%, 200% or even
more than 500%, compared to a wild-type protein, polynucleotide,
gene; or the activity and/or the concentration of the protein
present before the polynucleotides or polypeptides are reduced. The
activity of the VHb protein may also be reduced by contacting the
protein with a specific or general inhibitor of its activity. The
terms "reduced activity," "decreased or abolished activity" are
used interchangeably herein.
[0032] In another embodiment, the promoter, regulatory region
and/or the ribosome binding site upstream of the gene can be
altered to achieve increased expression. The overexpression may
also be reduced by increasing the relative half-life of the
messenger RNA. In another embodiment, the activity of the
polypeptide itself may be increased by employing one or more
mutations in the polypeptide amino acid sequence, which increased
the activity. For example, altering the affinity of the polypeptide
for its corresponding substrate may result in increased activity.
Likewise, the relative half-life of the polypeptide may be
increased. In either scenario, that being gene overexpression or
increased activity, the increase may be achieved by altering the
composition of the cell culture media and/or methods used for
culturing. "Overexpression" or "increased activity," as used
herein, means an increase of at least 5%, 10%, 25%, 50%, 75%, 100%,
200% or even more than 500%, compared to a wild-type protein,
polynucleotide, gene; or the activity and/or the concentration of
the protein present before the polynucleotides or polypeptides are
reduced. The activity of the VHb protein may also be increased by
contacting the protein with a specific or general inhibitor of its
activity. The terms "Overexpression" and "increased activity" may
be used interchangeably.
[0033] Expression "control sequences" refers collectively to
promoter sequences, ribosome binding sites, transcription
termination sequences, upstream regulatory domains, enhancers, and
the like, which collectively provide for the transcription and
translation of a coding sequence in a host cell. Not all of these
control sequences need always be present in a recombinant vector so
long as the desired gene is capable of being transcribed and
translated.
[0034] "Recombination" refers to the reassortment of sections of
DNA or RNA sequences between two DNA or RNA molecules. "Homologous
recombination" occurs between two DNA molecules which hybridize by
virtue of homologous or complementary nucleotide sequences present
in each DNA molecule.
[0035] The terms "stringent conditions" or "hybridization under
stringent conditions" refers to conditions under which a probe will
hybridize preferentially to its target subsequence, and to a lesser
extent to, or not at all to, other sequences. "Stringent
hybridization" and "stringent hybridization wash conditions" in the
context of nucleic acid hybridization experiments such as Southern
and northern hybridizations are sequence dependent, and are
different under different environmental parameters. An extensive
guide to the hybridization of nucleic acids is found in Tijssen
(1993) Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes part I chapter 2
Overview of principles of hybridization and the strategy of nucleic
acid probe assays, Elsevier, N.Y. Generally, highly stringent
hybridization and wash conditions are selected to be about
5.degree. C. lower than the thermal melting point (T.sub.m) for the
specific sequence at a defined ionic strength and pH. The T.sub.m
is the temperature (under defined ionic strength and pH) at which
50% of the target sequence hybridizes to a perfectly matched probe.
Very stringent conditions are selected to be equal to the T.sub.m
for a particular probe.
[0036] An example of stringent hybridization conditions for
hybridization of complementary nucleic acids, which have more than
100 complementary residues on a filter in a Southern or Northern
blot is 50% formamide with 1 mg of heparin at 42.degree. C., with
the hybridization being carried out overnight. An example of highly
stringent wash conditions is 0.15 M NaCl at 72.degree. C. for about
15 minutes. An example of stringent wash conditions is a
0.2.times.SSC wash at 65.degree. C. for 15 minutes (see, Sambrook
et al., (1989) Molecular Cloning--A Laboratory Manual (2nd ed.)
Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press,
NY, for a description of SSC buffer). Often, a high stringency wash
is preceded by a low stringency wash to remove background probe
signal. An example medium stringency wash for a duplex of, e.g.,
more than 100 nucleotides, is 1.times.SSC at 45.degree. C. for 15
minutes. An example low stringency wash for a duplex of, e.g., more
than 100 nucleotides, is 4-6.times.SSC at 40.degree. C. for 15
minutes. In general, a signal to noise ratio of 2.times. (or
higher) than that observed for an unrelated probe in the particular
hybridization assay indicates detection of a specific
hybridization. Nucleic acids, which do not hybridize to each other
under stringent conditions are still substantially identical if the
polypeptides which they encode are substantially identical. This
occurs, e.g., when a copy of a nucleic acid is created using the
maximum codon degeneracy permitted by the genetic code.
[0037] The invention also relates to an isolated polynucleotide
hybridizable under stringent conditions, preferably under highly
stringent conditions, to a polynucleotide as of the present
invention.
[0038] As used herein, the term "hybridizing" is intended to
describe conditions for hybridization and washing under which
nucleotide sequences at least about 50%, at least about 60%, at
least about 70%, more preferably at least about 80%, even more
preferably at least about 85% to 90%, most preferably at least 95%
homologous to each other typically remain hybridized to each
other.
[0039] In one embodiment, a nucleic acid of the invention is at
least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more homologous to a
nucleic acid sequence shown in this application or the complement
thereof.
[0040] Another non-limiting example of stringent hybridization,
conditions are hybridization in 6.times.sodium chloride/sodium
citrate (SSC) at about 45.degree. C., followed by one or more
washes in 1.times.SSC, 0.1% SDS at 50.degree. C., preferably at
55.degree. C. more preferably at 60.degree. C. and even more
preferably at 65.degree. C.
[0041] Highly stringent conditions can include incubations at
42.degree. C. for a period of several days, such as 2-4 days, using
a labeled DNA probe, such as a digoxigenin (DIG)-labeled DNA probe,
followed by one or more washes in 2.times.SSC, 0.1% SDS at room
temperature and one or more washes in 0.5.times.SSC, 0.1% SDS or
0.1.times.SSC, 0.1% SDS at 65-68.degree. C. In particular, highly
stringent conditions include, for example, 2 h to 4 days incubation
at 42.degree. C. using a DIG-labeled DNA probe (prepared by, e.g.,
using a DIG labeling system; Roche Diagnostics GmbH, 68298
Mannheim, Germany) in a solution such as DigEasyHyb solution (Roche
Diagnostics GmbH) with or without 100 .mu.g/ml salmon sperm DNA, or
a solution comprising 50% formamide, 5.times.SSC (150 mM NaCl, 15
mM trisodium citrate), 0.02% sodium dodecyl sulfate, 0.1%
N-lauroylsarcosine, and 2% blocking reagent (Roche Diagnostics
GmbH), followed by washing the filters twice for 5 to 15 minutes in
2.times.SSC and 0.1% SDS at room temperature and then washing twice
for 15-30 minutes in 0.5.times.SSC and 0.1% SDS or 0.1.times.SSC
and 0.1% SDS at 65-68.degree. C.
[0042] In some embodiments an isolated nucleic acid molecule of the
invention that hybridizes under highly stringent conditions to a
nucleotide sequence of the invention can correspond to a
naturally-occurring nucleic acid molecule. As used herein, a
"naturally-occurring" nucleic acid molecule refers to an RNA or DNA
molecule having a nucleotide sequence that occurs in nature (e.g.,
encodes a natural protein).
[0043] A skilled artisan will know which conditions to apply for
stringent and highly stringent hybridization conditions. Additional
guidance regarding such conditions is readily available in the art,
for example, in Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et
al., (eds.), 1995, Current Protocols in Molecular Biology, (John
Wiley & Sons, N.Y.).
[0044] Conventional notation is used herein to describe
polynucleotide sequences: the left-hand end of a single-stranded
polynucleotide sequence is the 5'-end; the left-hand direction of a
double-stranded polynucleotide sequence is referred to as the
5'-direction. The direction of 5' to 3' addition of nucleotides to
nascent RNA transcripts is referred to as the transcription
direction. The DNA strand having the same sequence as an mRNA is
referred to as the "coding strand"; sequences on the DNA strand
having the same sequence as an mRNA transcribed from that DNA and
which are located 5' to the 5'-end of the RNA transcript are
referred to as "upstream sequences"; sequences on the DNA strand
having the same sequence as the RNA and which are 3' to the 3' end
of the coding RNA transcript are referred to as "downstream
sequences."
[0045] A cloned fragment of DNA containing genes for spinosyn
biosynthetic enzymes would enable duplication of genes coding for
rate limiting enzymes in the production of spinosyns. This could be
used to increase yield in any circumstance when one of the encoded
activities limited synthesis of the desired spinosyn. A yield
increase in spinosyn AID was observed when genes linked to the
spinosyn polyketide synthase were duplicated by integrating a
cosmid containing them into S. spinosa (Madduri et al., 2001). In
another example, a yield increase of this type was achieved in
fermentations of Streptomyces fradiae by duplicating the gene
encoding a rate-limiting methyltransferase that converts macrocin
to tylosin (Baltz et al., 1997).
[0046] Specific intermediates (or their natural derivatives) could
be synthesized by mutant strains of S. spinosa in which certain
genes encoding enzymes for spinosyn biosynthesis have been
disrupted. Such strains can be generated by integrating, via
homologous recombination, a mutagenic plasmid containing an
internal fragment of the target gene. Upon plasmid integration, two
incomplete copies of the biosynthetic gene are formed, thereby
eliminating the enzymatic function it encoded. The substrate for
this enzyme, or some natural derivative thereof, should accumulate
upon fermentation of the mutant strain. Such a strategy was used
effectively to generate a strain of Saccharopolyspora erythraea
producing novel 6-deoxyerythromycin derivatives (Weber &
McAlpine, 1992).
[0047] Such strains could be generated by swapping the target
region, via double crossover homologous recombination, with a
mutagenic plasmid containing the new fragment between non-mutated
sequences, which flank the target region. The hybrid gene would
produce protein with altered functions, either lacking an activity
or performing a novel enzymatic transformation. A new derivative
would accumulate upon fermentation of the mutant strain. Such a
strategy was used to generate a strain of Saccharopolyspora
erythraea producing a novel anhydroerythromycin derivative (Donadio
et al., 1993).
[0048] Spinosyn biosynthetic genes and related ORFs were cloned and
the DNA sequence of each was determined. The cloned genes and ORFs
are designated hereinafter as spnA, spnB, spnC, spnD, spnE, spnF,
spnG, spnH, spnI, spnJ, spnK, spnL, spnM, spnN, spnO, spnP, spnQ,
spnR, spnS, ORFL15, ORFL16, ORFR1, ORFR2, S. spinosa gtt, S.
spinosa gdh, S. spinosa epi, and S. spinosa kre.
[0049] Saccharapolyspora spinosa produces a mixture of nine closely
related compounds collectively called "spinosyns." Within the
mixture, spinosyn A and D, known as spinosad, are the major
components and have the highest activity against key insect
targets. Spinosyn J and L, two of the minor components within the
spinosyn mixture, are the precursors for spinetoram, the second
generation spinosyn insecticide.
[0050] Spinosad is an insecticide produced by Dow AgroSciences
(Indianapolis, Ind.) that is comprised mainly of approximately 85%
spinosyn A and approximately 15% spinosyn D. Spinosyn A and D are
natural products produced by fermentation of Saccharopolyspora
spinosa, as disclosed in U.S. Pat. No. 5,362,634. Spinosad is an
active ingredient of several insecticidal formulations available
commercially from Dow AgroSciences, including the TRACER.TM.,
SUCCESS.TM., SPINTOR.TM., and CONSERVE.TM. insect control products.
For example, the TRACER product is comprised of about 44% to about
48% spinosad (w/v), or about 4 pounds of spinosad per gallon.
Spinosyn compounds in granular and liquid formulations have
established utility for the control of arachnids, nematodes, and
insects, in particular Lepidoptera, Thysanoptera, and Diptera
species. Spinosyn A and D is also referred to herein as Spinosyn
A/D.
[0051] Spinetoram is a mixture of 5,6-dihydro-3'-ethoxy spinosyn J
(major component) and 3'-ethoxy spinosyn L produced by Dow
AgroSciences. The mixture can be prepared by ethoxylating a mixture
of spinosyn J and spinosyn L, followed by hydrogenation. The 5,6
double bond of spinosyn J and its 3'-ethoxy is hydrogenated much
more readily than that of spinosyn L and its 3'-ethoxy derivative,
due to steric hindrance by the methyl group at C-5 in spinosyn L
and its 3'-ethoxy derivative. See, U.S. Pat. No. 6,001,981.
Spinosyn J and L is also referred to herein as Spinosyn J/L.
[0052] It has been demonstrated in this application that the over
expression of VHb, in S. spinosa results in increased spinosyn
production. Expression of the oxygen carrier protein, VHb, produces
elevated levels of the homodimeric hemoglobin under hypoxic growth
conditions (Zhang et al., 2007). Among hemoglobins VHb has an
average oxygen association rate constant and a rather high oxygen
dissociation rate constant (hundreds times higher than other
hemoglobins). This suggests that VHb is able to release the bound
oxygen more readily than all other hemoglobins (Zhang et al.,
2007). It has been shown that expression of the Vitreoscilla
hemoglobin gene in heterologous hosts often enhances cell growth
and protein production under oxygen-limited conditions (Khosla
& Bailey, 1988 ; Khosla et al., 1990).
[0053] Expression of VHb in several Actinomyces strains led to
increased antibiotic production including chlortetracycline,
monensin, erythromycin and actinorhodin (Zhang et al., 2007;
Magnolo et al., 1991). The recombinant Streptomyces coelicolor
strain expressing VHb produced tenfold more actinorhodin than the
wild-type strain under low DO levels (DO below 5% of air
saturation) (Magnolo et al., 1991). In addition actinorhodin
production by the VHb-expressing recombinant strain was less
susceptible to aeration conditions. Although erythromycin
production is in general not considered sensitive to DO levels as
long as the DO levels are above the minimal levels required for
growth, expression of VHb in an industrial erythromycin-producing
strain significantly increased erythromycin titers to 7.25 g/L from
4.25 g/L while reduced biomass accumulation under fed-batch
bioreactor fermentation conditions at scales between 10-15 liters
(Brunker et al., 1997; 1998; Minas et al., 1998).
[0054] Embodiments of the present invention provide for a
genetically modified host cell that harbors a spinosyn enhancing
gene integrated into the S. spinosa genome. The enhancing gene can
encode for an oxygen-binding protein. Furthermore, the
oxygen-binding protein can be any protein, which binds oxygen,
particularly those which bind oxygen reversibly such as the
globins. Preferred oxygen-binding proteins are those, which are
capable of increasing spinosyn production in S. spinosa.
[0055] Oxygen-binding proteins that may be used in the invention
include, but are not limited to, Vitreoscilla hemoglobin (VHb),
Alcaligenes eutrophus flavohemoprotein, horse heart myoglobin, E.
coli hemoprotein, B. subtilis hemoprotein, yeast flavohemoglobin,
soybean leghemoglobin, lupin leghemoglobin, and sperm whale
myoglobin. As noted above, the oxygen-binding protein may also be
one that is endogenous to the spinosyn-producing organism.
[0056] Genes encoding a large number of oxygen-binding proteins
have been cloned and their sequence determined. For example, known
polynucleotide sequences of globin proteins useful in the instant
invention include but are not limited to those encoding a
cyanobacterium myoglobin (Potts et al., 1992, Science
256:1690-1692), Scapharca inaequivalvis hemoglobin (Gambacurta et
al., 1993, FEBS Lett. 330:90-94), Aplysia limacina myoglobin
(Cutruzzola et al., 1996, Biochem. J. 314:83-90), Ascaris
hemoglobin (Sherman et al., 1992, Proc. Natl. Acad. Sci. USA
89:11696-11700), Pseudoterranova decipiens nematode hemoglobin
(Dixon et al., 1991, Natl. Acad. Sci. USA 88:5655-5659, and Dixon
et al., 1992, J. Mol. Evol. 35:131-136). Paramecium caudatum
hemoglobin (Yamauchi et al., 1992, Biochem. Biophvs. Res. Commun.
182:195-200), Rhizobium meliloti hemoprotein (David et al., 1988,
Cell 54:671-683), and Saccharomyces cerevisiae (Shimada et al.,
1989, J. Biochem. 105:417-422). Particularly suitable for use in
the present invention are those oxygen-binding proteins which have
relatively high k.sub.off rates such as VHb (k.sub.off 5600
s.sup.-1; Orii and Webster, 1986, J. Biol. Chem. 261:3544-3547) or
relatively low oxygen affinity such as horse heart myoglobin
(K.sub.D 0.79 .mu.M; Wittenberg et al., 1985, in nitrogen fixation
research progress. H. J. Evand et al., Eds. Martinus Nijhoff
Publishers, Dordrecht, p. 354). Therefore, preferred oxygen binding
proteins can be those proteins with a k.sub.off rate for oxygen of
greater than 10 s.sup.-1, more preferred greater than 100 s-.sup.1,
or a K.sub.D for oxygen of more than 0.5 .mu.M, although it will be
understood that oxygen-binding proteins with rate constants outside
of these parameters will also be useful. As noted earlier, those
preferred oxygen-binding proteins include globins such as
hemoglobin, myoglobin, and leghemoglobins. The properties of many
oxygen-binding proteins, including globins, are disclosed
throughout the literature. Additionally, techniques for determining
the oxygen-binding properties of a protein such as a globin are
well known to one of skill in the art and can be performed without
undue experimentation.
[0057] As noted earlier one such oxygen-binding protein for use in
the instant invention, as described herein by way of working
example, is VHb. The complete sequence of the VHb gene is described
in U.S. Pat. No. 5,049,493. Mutants of VHb, which bind oxygen are
also within the scope of the present invention.
[0058] Mutants include, but are not limited to, "functional
polymorphism(s)," which, as used herein, refers to a change in the
base pair sequence of a gene that produces a qualitative or
quantitative change in the activity of the protein encoded by that
gene (e.g., a change in specificity of activity; a change in level
of activity). The term "functional polymorphism" includes
mutations, deletions and insertions.
[0059] In general, the step of detecting the polymorphism of
interest may be carried out by collecting a biological sample
containing DNA from the source, and then determining the presence
or absence of DNA containing the polymorphism of interest in the
biological sample.
[0060] Determining the presence or absence of DNA encoding a
particular mutation may be carried out with an oligonucleotide
probe labeled with a suitable detectable group, and/or by means of
an amplification reaction such as a polymerase chain reaction or
ligase chain reaction (the product of which amplification reaction
may then be detected with a labeled oligonucleotide probe or a
number of other techniques). Numerous different oligonucleotide
probe assay formats are known which may be employed to carry out
the present invention. See, e.g., U.S. Pat. No. 4,302,204 to Wahl
et al.; U.S. Pat. No. 4,358,535 to Falkow et al.; U.S. Pat. No.
4,563,419 to Ranki et al.; and U.S. Pat. No. 4,994,373 to
Stavrianopoulos et al.
[0061] Amplification of a selected, or target, nucleic acid
sequence may be carried out by any suitable means. See generally,
Kwoh et al., Am. Biotechnol. Lab. 8, 14-25 (1990). Examples of
suitable amplification techniques include, but are not limited to,
polymerase chain reaction, ligase chain reaction, strand
displacement amplification (see generally G. Walker et al., Proc.
Natl. Acad. Sci. USA 89, 392-396 (1992); G. Walker et al., Nucleic
Acids Res. 20, 1691-1696 (1992)), transcription-based amplification
(see D. Kwoh et al., Proc. Natl. Acad Sci. USA 86, 1173-1177
(1989)), self-sustained sequence replication (or "3SR") (see J.
Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874-1878 (1990)),
the Q.beta. replicase system (see P. Lizardi et al., BioTechnology
6, 1197-1202 (1988)), nucleic acid sequence-based amplification (or
"NASBA") (see R. Lewis, Genetic Engineering News 12 (9), 1 (1992)),
the repair chain reaction (or "RCR") (see R. Lewis, supra), and
boomerang DNA amplification (or "BDA") (see R. Lewis, supra).
Polymerase chain reaction is generally preferred.
[0062] Polymerase chain reaction (PCR) may be carried out in
accordance with known techniques. See, e.g., U.S. Pat. Nos.
4,683,195; 4,683,202; 4,800,159; and 4,965,188. In general, PCR
involves, first, treating a nucleic acid sample (e.g., in the
presence of a heat stable DNA polymerase) with one oligonucleotide
primer for each strand of the specific sequence to be detected
under hybridizing conditions so that an extension product of each
primer is synthesized which is complementary to each nucleic acid
strand, with the primers sufficiently complementary to each strand
of the specific sequence to hybridize therewith so that the
extension product synthesized from each primer, when it is
separated from its complement, can serve as a template for
synthesis of the extension product of the other primer, and then
treating the sample under denaturing conditions to separate the
primer extension products from their templates if the sequence or
sequences to be detected are present. These steps are cyclically
repeated until the desired degree of amplification is obtained.
Detection of the amplified sequence may be carried out by adding to
the reaction product an oligonucleotide probe capable of
hybridizing to the reaction product (e.g., an oligonucleotide probe
of the present invention), the probe carrying a detectable label,
and then detecting the label in accordance with known techniques,
or by direct visualization on a gel. Such probes may be from 5 to
500 nucleotides in length, preferably 5 to 250, more preferably 5
to 100 or 5 to 50 nucleic acids. When PCR conditions allow for
amplification of all allelic types, the types can be distinguished
by hybridization with an allelic specific probe, by restriction
endonuclease digestion, by electrophoresis on denaturing gradient
gels, or other techniques.
[0063] Ligase chain reaction (LCR) is also carried out in
accordance with known techniques. See, e.g., R. Weiss, Science 254,
1292 (1991). In general, the reaction is carried out with two pairs
of oligonucleotide probes: one pair binds to one strand of the
sequence to be detected; the other pair binds to the other strand
of the sequence to be detected. Each pair together completely
overlaps the strand to which it corresponds. The reaction is
carried out by, first, denaturing (e.g., separating) the strands of
the sequence to be detected, then reacting the strands with the two
pairs of oligonucleotide probes in the presence of a heat stable
ligase so that each pair of oligonucleotide probes is ligated
together, then separating the reaction product, and then cyclically
repeating the process until the sequence has been amplified to the
desired degree. Detection may then be carried out in like manner as
described above with respect to PCR.
[0064] DNA amplification techniques such as the foregoing can
involve the use of a probe, a pair of probes, or two pairs of
probes, which specifically bind to DNA containing the functional
polymorphism, but do not bind to DNA that does not contain the
functional polymorphism. Alternatively, the probe or pair of probes
could bind to DNA that both does and does not contain the
functional polymorphism, but produce or amplify a product (e.g., an
elongation product) in which a detectable difference may be
ascertained (e.g., a shorter product, where the functional
polymorphism is a deletion mutation). Such probes can be generated
in accordance with standard techniques from the known sequences of
DNA in or associated with a gene linked to VHb or from sequences
which can be generated from such genes in accordance with standard
techniques.
[0065] It will be appreciated that the detecting steps described
herein may be carried out directly Or indirectly. Other means of
indirectly determining allelic type include measuring polymorphic
markers that are linked to the particular functional polymorphism,
as has been demonstrated for the VNTR (variable number tandem
repeats).
[0066] Molecular biology comprises a wide variety of techniques for
the analysis of nucleic acid and protein sequences. Many of these
techniques and procedures form the basis of clinical diagnostic
assays and tests. These techniques include nucleic acid
hybridization analysis, restriction enzyme analysis, genetic
sequence analysis, and the separation and purification of nucleic
acids and proteins (See, e.g., J. Sambrook, E. F. Fritsch, and T.
Maniatis, Molecular Cloning: A Laboratory Manual, 2 Ed., Cold
spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989).
[0067] Most of these techniques involve carrying out numerous
operations (e.g., pipetting, centrifugation, and electrophoresis)
on a large number of samples. They are often complex and time
consuming, and generally require a high degree of accuracy. Many
techniques are limited in their application by a lack of
sensitivity, specificity, or reproducibility.
[0068] Nucleic acid hybridization analysis generally involves the
detection of a very small number of specific target nucleic acids
(DNA or RNA) with an excess of probe DNA, among a relatively large
amount of complex non-target nucleic acids. A reduction in the
complexity of the nucleic acid in a sample is helpful to the
detection of low copy numbers (i.e., 10,000 to 100,000) of nucleic
acid targets. DNA complexity reduction is achieved to some degree
by amplification of target nucleic acid sequences. (See, M. A.
Innis et al., PCR Protocols: A Guide to Methods and Applications,
Academic Press, 1990, Spargo et al., 1996, Molecular & Cellular
Probes, in regard to SDA amplification). This is because
amplification of target nucleic acids results in an enormous number
of target nucleic acid sequences relative to non-target sequences
thereby improving the subsequent target hybridization step.
[0069] The hybridization step involves placing the prepared DNA
sample in contact with a specific reporter probe at set optimal
conditions for hybridization to occur between the target DNA
sequence and probe. Hybridization may be performed in any one of a
number of formats. For example, multiple sample nucleic acid
hybridization analysis has been conducted in a variety of filter
and solid support formats (See Beltz et al., Methods in Enzymology,
Vol. 100, Part et al., Eds., Academic Press, New York, Chapter 19,
pp. 266-308, 1985). One format, the so-called "dot blot"
hybridization, involves the non-covalent attachment of target DNAs
to a filter followed by the subsequent hybridization to a
radioisotope labeled probe(s). "Dot blot" hybridization gained
wide-spread use over the past two decades during which time many
versions were developed (see Anderson and Young, in Nucleic Acid
Hybridization--A Practical Approach, Hames and Higgins, Eds., IRL
Press, Washington, D.C. Chapter 4, pp. 73-111, 1985). For example,
the dot blot method has been developed for multiple analyses of
genomic mutations (EPA 0228075 to Nanibhushan et al.) and for the
detection of overlapping clones and the construction of genomic
maps (U.S. Pat. No. 5,219,726 to Evans).
[0070] Additional techniques for carrying out multiple sample
nucleic acid hybridization analysis include micro-formatted
multiplex or matrix devices (e.g., DNA chips) (see M. Barinaga, 253
Science, pp. 1489, 1991; W. Bains, 10 Bio/Technology, pp. 757-758,
1992). These methods usually attach specific DNA sequences to very
small specific areas of a solid support, such as micro-wells of a
DNA chip. These hybridization formats are micro-scale versions of
the conventional "dot blot" and "sandwich" hybridization
systems.
[0071] The micro-formatted hybridization can be used to carry out
"sequencing by hybridization" (SBH) (see M. Barinaga, 253 Science,
pp. 1489, 1991; W. Bains, 10 Bio/Technology, pp. 757-758, 1992).
SBH makes use of all possible n-nucleotide oligomers (n-mers) to
identify n-mers in an unknown DNA sample, which are subsequently
aligned by algorithm analysis to produce the DNA sequence (See,
almanac U.S. Pat. No. 5,202,231).
[0072] There are two formats for carrying out SBH. The first format
involves creating an array of all possible n-mers on a support,
which is then hybridized with the target sequence. The second
format involves attaching the target sequence to a support, which
is sequentially probed with all possible n-mers. Southern, (United
Kingdom Patent Application GB 8810400, 1988; E. M. Southern et al.,
13 Genomics 1008, 1992), proposed using the first format to analyze
or sequence DNA. Southern identified a known single point mutation
using PCR amplified genomic DNA. Southern also described a method
for synthesizing an array of oligonucleotides on a solid support
for SBH. Drmanac et al., (260 Science 1649-1652, 1993), used a
second format to sequence several short (116 bp) DNA sequences.
Target DNAs were attached to membrane supports ("dot blot" format).
Each filter was sequentially hybridized with 272 labeled 10-mer and
1-mer oligonucleotides. Wide ranges of stringency conditions were
used to achieve specific hybridization for each n-mer probe.
Washing times varied from 5 minutes to overnight using temperatures
from 0.degree. C. to 16.degree. C. Most probes required 3 hours of
washing at 16.degree. C. The filters had to be exposed from 2 to 18
hours in order to detect hybridization signals.
[0073] Generally, a variety of methods are available for detection
and analysis of the hybridization events. Depending on the reporter
group (fluorophore, enzyme, radioisotope, etc.) used to label the
DNA probe, detection and analysis are carried out fluorimetrically,
calorimetrically, or by autoradiography. By observing and measuring
emitted radiation, such as fluorescent radiation or particle
emission, information may be obtained about the hybridization
events. Even when detection methods have very high intrinsic
sensitivity, detection of hybridization events is difficult because
of the background presence of non-specifically bound materials.
Thus, detection of hybridization events is dependent upon how
specific and sensitive hybridization can be made. Concerning
genetic analysis, several methods have been developed that have
attempted to increase specificity and sensitivity.
[0074] One form of genetic analysis is analysis centered on
elucidation of single nucleic acid polymorphisms or ("SNPs").
Factors favoring the usage of SNPs are their high abundance in the
human genome (especially compared to short tandem repeats, (STRs)),
their frequent location within coding or regulatory regions of
genes (which can affect protein structure or expression levels),
and their stability when passed from one generation to the next
(Landegren et al., Genome Research, Vol. 8, pp. 769-776, 1998).
[0075] A SNP is defined as any position in the genome that exists
in two variants and the most common variant occurs less than 99% of
the time. In order to use SNPs as widespread genetic markers, it is
crucial to be able to genotype them easily, quickly, accurately,
and cost-effectively. Numerous techniques are currently available
for typing SNPs (for review, see Landegren et al., Genome Research,
Vol. 8, pp. 769-776, (1998), all of which require target
amplification. They include direct sequencing (Carothers et al.,
BioTechniques, Vol. 7, pp. 494-499, 1989), single-strand
conformation polymorphism (Orita et al., Proc. Natl. Acad. Sci.
USA, Vol. 86, pp. 2766-2770, 1989), allele-specific amplification
(Newton et al., Nucleic Acids Research, Vol. 17, pp. 2503-2516,
(1989), restriction digestion (Day and Humphries, Analytical
Biochemistry, Vol. 222, pp. 389-395, 1994), and hybridization
assays. In their most basic form, hybridization assays function by
discriminating short oligonucleotide reporters against matched and
mismatched targets. Many adaptations to the basic protocol have
been developed. These include ligation chain reaction (Wu and
Wallace, Gene, Vol. 76, pp. 245-254, 1989) and minisequencing
(Syvanen et al., Genomics, Vol. 8, pp. 684-692, 1990). Other
enhancements include the use of the 5'-nuclease activity of Taq DNA
polymerase (Holland et al., Proc. Natl. Acad. Sci. USA, Vol. 88,
pp. 7276-7280, 1991), molecular beacons (Tyagi and Kramer, Nature
Biotechnology, Vol. 14, pp. 303-308, 1996), heat denaturation
curves (Howell et al., Nature Biotechnology, Vol. 17, pp. 87-88,
1999) and DNA "chips" (Wang et al., Science, Vol. 280, pp.
1077-1082, 1998).
[0076] An additional phenomenon that can be used to distinguish
SNPs is the nucleic acid interaction energies or base-stacking
energies derived from the hybridization of multiple target specific
probes to a single target. (See, R. Ornstein et al., "An Optimized
Potential Function for the Calculation of Nucleic Acid Interaction
Energies," Biopolymers, Vol. 17, 2341-2360 (1978); J. Norberg and
L. Nilsson, Biophysical Journal, Vol. 74, pp. 394-402, (1998); and
J. Pieters et al., Nucleic Acids Research, Vol. 17, no. 12, pp.
4551-4565 (1989)). This base-stacking phenomenon is used in a
unique format in the current invention to provide highly sensitive
Tm differentials allowing the direct detection of SNPs in a nucleic
acid sample.
[0077] Additional methods have been used to distinguish nucleic
acid sequences in related organisms or to sequence DNA. For
example, U.S. Pat. No. 5,030,557 by Hogan et al., disclosed that
the secondary and tertiary structure of a single stranded target
nucleic acid may be affected by binding "helper" oligonucleotides
in addition to "probe" oligonucleotides causing a higher Tm to be
exhibited between the probe and target nucleic acid. That
application, however, was limited in its approach to using
hybridization energies only for altering the secondary and tertiary
structure of self-annealing RNA strands, which if left unaltered
would tend to prevent the probe from hybridizing to the target.
[0078] With regard to DNA sequencing, K. Khrapko et al., Federation
of European Biochemical Societies Letters, Vol. 256, no. 1,2, pp.
118-122 (1989), for example, disclosed that continuous stacking
hybridization resulted in duplex stabilization. Additionally, J.
Kieleczawa et al., Science, Vol. 258, pp. 1787-1791 (1992),
disclosed the use of contiguous strings of hexamers to prime DNA
synthesis wherein the contiguous strings appeared to stabilize
priming Likewise, L. Kotler et al., Proc. Natl. Acad. Sci. USA,
Vol. 90, pp. 4241-4245, (1993) disclosed sequence specificity in
the priming of DNA sequencing reactions by use of hexamer and
pentamer oligonucleotide modules. Further, S. Parinov et al.,
Nucleic Acids Research, Vol. 24, no. 15, pp. 2998-3004, (1996),
disclosed the use of base-stacking oligomers for DNA sequencing in
association with passive DNA sequencing microchips. Moreover, G.
Yershov et al., Proc. Natl. Acad. Sci. USA, Vol. 93, pp. 4913-4918
(1996), disclosed the application of base-stacking energies in SBH
on a passive microchip. In Yershov's example, 10-mer DNA probes
were anchored to the surface of the microchip and hybridized to
target sequences in conjunction with additional short probes, the
combination of which appeared to stabilize binding of the probes.
In that format, short segments of nucleic acid sequence could be
elucidated for DNA sequencing. Yershov further noted that in their
system the destabilizing effect of mismatches was increased using
shorter probes (e.g., 5-mers). Use of such short probes in DNA
sequencing provided the ability to discern the presence of
mismatches along the sequence being probed rather than just a
single mismatch at one specified location of the probe/target
hybridization complex. Use of longer probes (e.g., 8-mer, 10-mer,
and 13-mer oligos) was less functional for such purposes.
[0079] An additional example of methodologies that have used
base-stacking in the analysis of nucleic acids includes U.S. Pat.
No. 5,770,365 by Lane et al., wherein is disclosed a method of
capturing nucleic acid targets using a unimolecular capture probe
having a single stranded loop and a double stranded region which
acts in conjunction with a binding target to stabilize duplex
formation by stacking energies.
[0080] The nucleotide sequence may be conveniently modified by
site-directed mutagenesis in accordance with conventional methods.
Alternatively, the nucleotide sequence may be prepared by chemical
synthesis, including but not limited to, by using an
oligonucleotide synthesizer, wherein oligonucleotides are designed
based on the amino acid sequence of the desired polypeptide, and
preferably selecting those codons that are favored in the host cell
in which the recombinant polypeptide will be produced.
[0081] Novel spinosyns can also be produced by mutagenesis of the
cloned genes, and substitution of the mutated genes for their
unmutated counterparts in a spinosyn-producing organism.
Mutagenesis may involve, for example: 1) deletion or inactivation
of a ketoreductase, dehydratase or enoyl reductase (KR, DH, or ER)
domain so that one or more of these functions is blocked and the
strain produces a spinosyn having a lactone nucleus with a double
bond, a hydroxyl group, or a keto group that is not present in the
nucleus of spinosyn A (see Donadio et al., 1993); 2) replacement of
an AT domain so that a different carboxylic acid is incorporated in
the lactone nucleus (see Ruan et al., 1997); 3) addition of a KR,
DH, or ER domain to an existing PKS module so that the strain
produces a spinosyn having a lactone nucleus with a saturated bond,
hydroxyl group, or double bond that is not present in the nucleus
of spinosyn A; or 4) addition or subtraction of a complete PKS
module so that the cyclic lactone nucleus has a greater or lesser
number of carbon atoms. A hybrid PKS can be created by replacing
the spinosyn PKS loading domain with heterologous PKS loading. See,
e.g., U.S. Pat. No. 7,626,010. It has further been noted that
spinosyns via modification of the sugars that are attached to the
spinosyn lactone backbone can include modifications of the rhamnose
and/or forosamine moiety or attachment of different deoxy sugars.
The Salas group in Spain demonstrated that novel polyketide
compounds can be produced by substituting the existing sugar
molecule with different sugar molecules. Rodriguez et al., J. Mol.
Microbiol Biotechnol. July 2000; 2(3):271-6. The examples that
follow throughout the application help to illustrate the use of
mutagenesis to produce a spinosyn with modified functionality.
[0082] The DNA from the spinosyn gene cluster region can be used as
a hybridization probe to identify homologous sequences. Thus, the
DNA cloned here could be used to locate additional plasmids from
the Saccharopolyspora spinosa gene libraries which overlap the
region described here but also contain previously uncloned DNA from
adjacent regions in the genome of Saccharopolyspora spinosa. In
addition, DNA from the region cloned here may be used to identify
non-identical but similar sequences in other organisms.
Hybridization probes are normally at least about 20 bases long and
are labeled to permit detection.
[0083] Various types of mutagenesis can be used in the invention
for a variety of purposes. They include, but are not limited to,
site-directed, random point mutagenesis, homologous recombination,
DNA shuffling or other recursive mutagenesis methods, chimeric
construction, mutagenesis using uracil containing templates,
oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA
mutagenesis, mutagenesis using gapped duplex DNA or the like, or
any combination thereof. Additional suitable methods include point
mismatch repair, mutagenesis using repair-deficient host strains,
restriction-selection and restriction-purification, deletion
mutagenesis, mutagenesis by total gene synthesis, double-strand
break repair, and the like. Mutagenesis, including but not limited
to, involving chimeric constructs, are also included in the present
invention. In one embodiment, mutagenesis can be guided by known
information of the naturally occurring molecule or altered or
mutated naturally occurring molecule, including but not limited to,
sequence, sequence comparisons, physical properties, crystal
structure or the like.
[0084] The texts and examples found herein describe these
procedures. Additional information is found in the following
publications and references cited within: Ling et al., Approaches
to DNA mutagenesis: an overview, Anal Biochem. 254(2): 157-178
(1997); Dale et al., Oligonucleotide-directed random mutagenesis
using the phosphorothioate method, Methods Mol. Biol. 57:369-374
(1996); Smith, In vitro mutagenesis, Ann. Rev. Genet. 19:423-462
(1985); Botstein & Shortle, Strategies and applications of in
vitro mutagenesis, Science 229:1193-1201(1985); Carter,
Site-directed mutagenesis, Biochem. J. 237:1-7 (1986); Kunkel, The
efficiency of oligonucleotide directed mutagenesis, in Nucleic
Acids & Molecular Biology (Eckstein, F. and Lilley, D. M. J.
eds., Springer Verlag, Berlin) (1987); Kunkel, Rapid and efficient
site-specific mutagenesis without phenotypic selection, Proc. Natl.
Acad. Sci. USA 82:488-492 (1985); Kunkel et al., Rapid and
efficient site-specific mutagenesis without phenotypic selection,
Methods in Enzymol. 154, 367-382 (1987); Bass et al., Mutant Trp
repressors with new DNA-binding specificities, Science 242:240-245
(1988); Methods in Enzymol. 100: 468-500 (1983); Methods in
Enzymol. 154: 329-350 (1987); Zoller & Smith,
Oligonucleotide-directed mutagenesis using M13-derived vectors: an
efficient and general procedure for the production of point
mutations in any DNA fragment, Nucleic Acids Res. 10:6487-6500
(1982); Zoller & Smith, Oligonucleotide-directed mutagenesis of
DNA fragments cloned into M13 vectors, Methods in Enzymol.
100:468-500 (1983); Zoller & Smith, Oligonucleotide-directed
mutagenesis: a simple method using two oligonucleotide primers and
a single-stranded DNA template, Methods in Enzymol. 154:329-350
(1987); Taylor et al., The use of phosphorothioate-modified DNA in
restriction enzyme reactions to prepare nicked DNA, Nucl. Acids
Res. 13: 8749-8764 (1985); Taylor et al., The rapid generation of
oligonucleotide-directed mutations at high frequency using
phosphorothioate-modified DNA, Nucl. Acids Res. 13: 8765-8787
(1985); Nakamaye & Eckstein, Inhibition of restriction
endonuclease Nci I cleavage by phosphorothioate groups and its
application to oligonucleotide-directed mutagenesis, Nucl. Acids
Res. 14: 9679-9698 (1986); Sayers et al., Y-T Exonucleases in
phosphorothioate-based oligonucleotide-directed mutagenesis, Nucl.
Acids Res. 16:791-802 (1988); Sayers et al., Strand specific
cleavage of phosphorothioate-containing DNA by reaction with
restriction endonucleases in the presence of ethidium bromide,
(1988) Nucl. Acids Res. 16: 803-814; Kramer et al., The gapped
duplex DNA approach to oligonucleotide-directed mutation
construction, Nucl. Acids Res. 12: 9441-9456 (1984); Kramer &
Fritz Oligonucleotide-directed construction of mutations via gapped
duplex DNA, Methods in Enzymol. 154:350-367 (1987); Kramer et al.,
Improved enzymatic in vitro reactions in the gapped duplex DNA
approach to oligonucleotide-directed construction of mutations,
Nucl. Acids Res. 16: 7207 (1988); Fritz et al.,
Oligonucleotide-directed construction of mutations: a gapped duplex
DNA procedure without enzymatic reactions in vitro, Nucl. Acids
Res. 16: 6987-6999 (1988); Kramer et al., Point Mismatch Repair,
Cell 38:879-887 (1984); Carter et al., Improved oligonucleotide
site-directed mutagenesis using M13 vectors, Nucl. Acids Res. 13:
4431-4443 (1985); Carter, Improved oligonucleotide-directed
mutagenesis using M13 vectors, Methods in Enzymol. 154: 382-403
(1987); Eghtedarzadeh & Henikoff, Use of oligonucleotides to
generate large deletions, Nucl. Acids Res. 14: 5115 (1986); Wells
et al., Importance of hydrogen-bond formation in stabilizing the
transition state of subtilisin, Phil. Trans. R. Soc. Lond. A 317:
415-423 (1986); Nambiar et al., Total synthesis and cloning of a
gene coding for the ribonuclease S protein, Science 223: 1299-1301
(1984); Sakamar and Khorana, Total synthesis and expression of a
gene for the a-subunit of bovine rod outer segment guanine
nucleotide-binding protein (transducin), Nucl. Acids Res. 14:
6361-6372 (1988); Wells et al., Cassette mutagenesis: an efficient
method for generation of multiple mutations at defined sites, Gene
34:315-323 (1985); Grundstrom et al., Oligonucleotide-directed
mutagenesis by microscale `shot-gun` gene synthesis, Nucl. Acids
Res. 13: 3305-3316 (1985); Mandecki, Oligonucleotide-directed
double-strand break repair in plasmids of Escherichia coli: a
method for site-specific mutagenesis, Proc. Natl. Acad. Sci. USA,
83:7177-7181 (1986); Arnold, Protein engineering for unusual
environments, Current Opinion in Biotechnology 4:450-455 (1993);
Sieber, et al., Nature Biotechnology, 19:456-460 (2001). W. P. C.
Stemmer, Nature 370, 389-91 (1994); and, I. A. Lorimer, I. Pastan,
Nucleic Acids Res. 23, 3067-8 (1995). Additional details on many of
the above methods can be found in Methods in Enzymology Volume 154,
which also describes useful controls for trouble-shooting problems
with various mutagenesis methods.
[0085] The terms "homology" or "percent identity" are used
interchangeably herein. For the purpose of this invention, it is
defined here that in order to determine the percent identity of two
amino acid sequences or of two nucleic acid sequences, the
sequences are aligned for optimal comparison purposes (e.g., gaps
may be introduced in the sequence of a first amino acid or nucleic
acid sequence for optimal alignment with a second amino or nucleic
acid sequence). The amino acid residues or nucleotides at
corresponding amino acid positions or nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same amino acid residue or nucleotide as the corresponding position
in the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % identity=number of identical positions/total
number of positions (i.e., overlapping positions.times.100).
Preferably, the two sequences are the same length.
[0086] The skilled person will be aware of the fact that several
different computer programs are available to determine the homology
between two sequences. For instance, a comparison of sequences and
determination of percent identity between two sequences may be
accomplished using a mathematical algorithm. In a preferred
embodiment, the percent identity between two amino acid sequences
is determined using the Needleman and Wunsch (J. Mol. Biol. (48):
444-453 (1970)) algorithm, which has been incorporated into the GAP
program in the GCG software package (available on the internet at
the accelrys website, more specifically at
<http://www.accelrys.com>), using either a Blossom 62 matrix
or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6 or 4
and a length weight of 1, 2, 3, 4, 5 or 6. The skilled person will
appreciate that all these different parameters will yield slightly
different results but that the overall percentage identity of two
sequences is not significantly altered when using different
algorithms.
[0087] In yet another embodiment, the percent identity between two
nucleotide sequences is determined using the GAP program in the GCG
software package (available on the internet at the accelrys
website, more specifically at <http://www.accelrys.com>),
using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70 or
80 and a length weight of 1, 2, 3, 4, 5 or 6. In another
embodiment, the percent identity between two amino acid or
nucleotide sequences is determined using the algorithm of E. Meyers
and W. Miller (CABIOS, 4: 11-17 (1989) which has been incorporated
into the ALIGN program (version 2.0) (available on the internet at
the vega website, more specifically ALIGN--IGH Montpellier, or more
specifically at <http://vegaigh.cnrs.fr/bin/align-guess.cgi>)
using a PAM120 weight residue table, a gap length penalty of 12 and
a gap penalty of 4.
[0088] The nucleic acid and protein sequences of the present
invention may further be used as a "query sequence" to perform a
search against public databases to, for example, identify other
family members or related sequences. Such searches may be performed
using the BLASTN and BLASTX programs (version 2.0) of Altschul, et
al., (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches may
be performed with the BLASTN program, score=100, word length=12 to
obtain nucleotide sequences homologous to the nucleic acid
molecules of the present invention. BLAST protein searches may be
performed with the BLASTX program, score=50, word length=3 to
obtain amino acid sequences homologous to the protein molecules of
the present invention. To obtain gapped alignments for comparison
purposes, Gapped BLAST may be utilized as described in Altschul et
al., (1997) Nucleic Acids Res. 25 (17): 3389-3402. When utilizing
BLAST and Gapped BLAST programs, the default parameters of the
respective programs (e.g., BLASTX and BLASTN) may be used.
(Available on the internet at the ncbi website, more specifically
at <www.ncbi.nlm.nih.gov>).
[0089] Suitable expression vectors for use in the present invention
include prokaryotic and eukaryotic vectors (e.g., plasmid,
phagemid, or bacteriophage), include mammalian vectors and plant
vectors. Suitable prokaryotic vectors include plasmids such as, but
not limited to, those commonly used for DNA manipulation in
Actinomyces, (for example, pSET152, pOJ260, pIJ101, pJV1, pSG5,
pHJL302, pSAM2, pKC1250). Such plasmids are disclosed by Kieser et
al., ("Practical Streptomyces Genetics," 2000). Other suitable
vectors can include plasmids such as those capable of replication
in E. coli (for example, pBR322, ColE1, pSC101, PACYC 184, itVX,
pRSET, pBAD (Invitrogen, Carlsbad, Calif.) and the like). Such
plasmids are disclosed by Sambrook (cf. "Molecular Cloning: A
Laboratory Manual," second edition, edited by Sambrook, Fritsch,
& Maniatis, Cold Spring Harbor Laboratory, (1989)) and many
such vectors are commercially available. Bacillus plasmids include
pC194, pC221, pT127, and the like, and are disclosed by Gryczan
(In: The Molecular Biology of the Bacilli, Academic Press, NY
(1982), pp. 307-329). Suitable Streptomyces plasmids include pli101
(Kendall et al., J. Bacteriol. 169:4177-4183, 1987), and
Streptomyces bacteriophages include but not limited to such as
.psi.C31 (Chater et al., In: Sixth International Symposium on
Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986),
pp. 45-54). Pseudomonas plasmids are reviewed by John et al., (Rev.
Infect. Dis. 8:693-704, 1986), and Izaki (Jpn. J. Bacteriol.
33:729-742, 1978).
[0090] Suppression of the expression of particular genes is an
important tool both for research and for the development of
genetically engineered organisms more fitted for a particular
purpose. Gene silencing can be accomplished by the introduction of
a transgene corresponding to the gene of interest in the antisense
orientation relative to its promoter (see, e.g., Sheehy et al.,
Proc. Nat'l Acad. Sci. USA 85:8805 8808 (1988); Smith et al.,
Nature 334:724 726 (1988)), or in the sense orientation relative to
its promoter (Napoli et al., Plant Cell 2:279 289 (1990); van der
Krol et al., Plant Cell 2:291 299 (1990); U.S. Pat. No. 5,034,323;
U.S. Pat. No. 5,231,020; and U.S. Pat. No. 5,283,184), both of
which lead to reduced expression of the transgene as well as the
endogenous gene.
[0091] Posttranscriptional gene silencing has been reported to be
accompanied by the accumulation of small (20 to 25 nucleotide)
fragments of antisense RNA, which can be synthesized from an RNA
template and represent the specificity and mobility determinants of
the process (Hamilton & Baulcombe, Science 286:950 952 (1999)).
It has become clear that in a range of organisms the introduction
of dsRNA (double-stranded RNA) is an important component leading to
gene silencing (Fire et al., Nature 391:806 811 (1998); Timmons
& Fire, Nature 395:854 (1998); WO99/32619; Kennerdell &
Carthew, Cell 95:1017 1026 (1998); Ngo et al., Proc. Nat'l Acad.
Sci. USA 95:14687 14692 (1998); Waterhouse et al., Proc. Nat'l
Acad. Sci. USA 95:13959 13964 (1998); WO99/53050; Cogoni &
Macino, Nature 399:166 169 (1999); Lohmann et al., Dev. Biol.
214:211 214 (1999); Sanchez-Alvarado & Newmark, Proc. Nat'l
Acad. Sci. USA 96:5049 5054 (1999)). In bacteria the suppressed
gene does not need to be an endogenous bacterial gene, since both
reporter transgenes and virus genes are subject to
posttranscriptional gene silencing by introduced transgenes
(English et al., Plant Cell 8:179 188 (1996); Waterhouse et al.,
supra). However, in all of the above cases, some sequence
similarity may be preferred between the introduced transgene and
the gene that is suppressed.
[0092] The examples which follow are set forth to illustrate the
present invention, and are not to be construed as limiting
thereof.
EXAMPLES
Construction of a Hemoglobin Gene Expression Cassette
[0093] A hemoglobin gene expression cassette was designed to
contain the following key features: i) the apramycin resistance
gene (originally from Klebsiella pneumoniae under GenBank Accession
Number X99313; Kieser et al., 2001) promoter (aac3(IV) promoter)
which is functional in S. spinosa; ii) codon optimized Vitreoscilla
hemoglobin gene VHb (Table 1) designed using a S. spinosa codon
preference table and GeneDesigner software (DNA 2.0, Menlo Park,
Calif.); and iii) the aph transcription terminator sequence (Pulido
and Jimenez, 1987). The selection and arrangement of these gene
elements ensure stable VHb transcription and optimum protein
expression, thereby providing robust expression of the hemoglobin
protein. The hemoglobin gene expression cassette (SEQ ID NO:1) was
synthesized by DNA 2.0 (Menlo Park, Calif.). The resulting 977 by
synthetic HinDIII flanked fragment was cloned into the pJ201 vector
(FIG. 1) and was sequenced by DNA2.0 to confirm sequence accuracy
prior to shipment. The resulting plasmid was designated as pDAB
109000.
[0094] Table 1. Comparison of Vitreoscilla hemoglobin gene (VHb)
codons and the synthetic hemoglobin gene preferred codons for
optimal expression in S. spinosa. The synthetic VHb codons are
preferred in S. spinosa and were selected to replace the preferred
codons from the Vitreoscilla hemoglobin gene using the GeneDesigner
software.
TABLE-US-00001 Amino Acid Leu Arg Thr Ile Lys Ala Val Pro His
Vitreoscilla VHb TTA CGT ACC ATT AAA GCC GTT CCT CAT codon TTG CGC
ACT GCT GTA CCA GCA GTC Synthetic VHb codon CTG CGG ACG ATC AAG GCG
GTG CCG CAC Amino Acid Asp Gly Ser Asn Cys Phe Gln Glu Tyr
Vitreoscilla VHb GAT GGT TCT AAT TGT TTT CAA GAA TAT codon
Synthetic VHb codon GAC GGC TCG AAC TGC TTC CAG GAG TAC
Introduction of the Hemoglobin Gene Expression Cassette into Cosmid
Clone 1E3
[0095] The obscurin gene cluster was chosen as the site for
integration of the hemoglobin gene expression cassette because
disruption of the obscurin gene cluster does not reduce spinosyn
production. The hemoglobin gene expression cassette was cloned into
cosmid 1E3 (which contains a genomic DNA partial obscurin gene
cluster). This cosmid was engineered to facilitate stable
integration of the hemoglobin gene expression cassette within the
obscurin gene cluster of the genome of S. spinosa.
[0096] The hemoglobin gene expression cassette was first cloned
into vector pIJ773 (John Innes Centre, Norwich, UK) via a
conventional cloning method. This cassette, in addition to the
apramycin resistance gene and oriT flanked by FRT recombination
sequences was then cloned into cosmid 1E3 via PCR targeting (Gust
et al., 2002). Briefly, the hemoglobin gene expression cassette was
first amplified using pDAB109000 as a template and the following
primers, aac3-VHb Forward (SEQ ID NO:2
5'-CGCTGAAAAGCTTCTGACGCCG-3') and aac3-VHb Reverse (SEQ ID NO:3
5'-CAACCCGTACCACGGCCTCT-3'). The amplified PCR fragment was
digested with HindIII/Kpa to generate two fragments; a 864 by
HindIII/KpnI fragment and a 83 by HindIII/KpnI fragment. The 864 by
HindIII/KpnI fragment, carrying the hemoglobin gene expression
cassette including the transcription terminator, was gel purified
and cloned into vector pIJ773 which had been digested with
HindIII/KpnI. A total of 38 transformants grown on Luria-Bertani
media (LB) containing 50 .mu.g/mL of apramycin were selected for
further analysis and confirmation. After overnight growth in liquid
LB containing apramycin at 50 .mu.g/mL, cells were harvested by
centrifugation at 13,000 RPM in a microcentrifuge for 2
minutes.
[0097] Cell pellets carrying the control plasmid pDAB 109000
produced a reddish color indicating the presence of the hemoglobin
protein. However, only seven of the recombinant clones produced
visible reddish cell pellets ranging from light red to a more
intense red color. These seven clones were selected and advanced to
the next step which included plasmid DNA isolation and restriction
enzyme digestions. Two of the seven clones, clone 22 and clone 30,
produced the desired restriction patterns based on restriction
analysis using the following enzymes NdeI, HindIII/KpnI and
NdeI/KpnI. The hemoglobin gene region of both clones and the PCR
fragment carrying the hemoglobin gene expression cassette were
sequenced. The hemoglobin gene region of clone 22 and the PCR
fragment was completely sequenced and the sequence data confirmed
that the desired synthetic hemoglobin gene was amplified without
any errors and was cloned into pIJ773 (FIG. 2). The resulting
plasmid was labeled as pDAB109001.
[0098] Integration of the FRT aac3(IV) gene expression
cassette::oriT::FRT synthetic hemoglobin gene expression cassette
into cosmid clone 1E3 was carried out as described via a modified
PCR Targeting protocol (Gust et al., 2002). The following
modifications were incorporated into the protocol: i) the host E.
coli for introducing the recombinant cosmid clone carrying the
hemoglobin gene expression cassette was E. coli BW25141/pKD78
acquired from The Coli Genetic Stock Center (CGSC) at Yale
University; ii) lambda red recombinase expression plasmid pKD78,
derived from pKD46 (Datsenko and Wanner, 2000); and iii) the
following PCR primers, obsA Internal Strep stem loop (SEQ ID NO:4
5' -GAAGAAGGCGGCGTCGAACTGGTCGACCTCGGTGAGGAAGGTACCTCCGACCGC
ACGGC-3') and obsA 5' FRT aac3 (SEQ ID NO:5 5'-GGCAATGCGCAGAGTTCG
TAGTGCGGGAGCCATTTGATGTGTAGGCTGGAGCTGCTTC-3') were designed and
used. The resulting amplification produced a 2,216 by fragment
consisting of (FRT::aac3(IV)::oriT::FRT::VHb) within cosmid clone
1E3.
[0099] Integration within cosmid clone 1E3 was designed to occur at
the 5' end of obsA, resulting in the removal of 600 bp of the obsA
coding sequence. This ensures complete disruption of the first
polyketide synthase enzyme within the obscurin gene cluster. Once
integrated, the hemoglobin gene expression cassette was orientated
in such a way that its coding sequence was in the opposite
orientation of the obsA coding sequence. This directionality
prevents transcription readthrough from the putative obsA promoter,
which could potentially result in undesired transcription. Putative
recombinant clones carrying the (FRT::aac3(IV)::oriT::FRT::VHb)
fragment were isolated and confirmed by restriction analysis.
Restriction digestion using BamHI indicated that the recombinant
cosmid clones carrying the hemoglobin gene cassette had different
restriction patterns as compared to the parent cosmid clone, 1E3.
Moreover restriction digestion using NdeI and ClaI, intended to
re-generate the synthetic hemoglobin gene coding sequence, revealed
that only the three recombinant clones produced a the 444 bp
fragment carrying the entire coding region of the synthetic
hemoglobin gene.
Conjugation of the (FRT::aac3(IV)::oriT::FRT::VHb) Gene Expression
Cassette into S. spinosa Strains
[0100] Mycelial conjugation between the donor strain, Escherichia
coli S17, containing the FRT::aac3(IV) gene expression
cassette::oriT::FRT::synthetic hemoglobin gene expression cassette
within cosmid 1E3 and the spinosyn producing strain, DAS-2, was
completed. Mycelial conjugation between the donor strain and the
recipient S. spinosa strain was carried out according to the method
described by Matsushima et al., (1994). Colonies initially
identified as resistant to apramycin and nalidixic acid on the
conjugation media were patched onto Brain Heart Infusion agar media
(BHI) containing 50 .mu.g/mL of apramycin and 25 .mu.g/mL of
nalidixic acid to confirm the antibiotic resistance phenotype of
the colonies. Colonies having the desired antibiotic resistance
phenotype were presumed to contain the
FRT::aac3(IV)::oriT::FRT::VHb cassette integrated within the obsA
locus of the obscurin gene cluster. To confirm the presence of the
apramycin resistance gene, aac3(IV), genomic DNA of the putative
transconjugants was isolated using the PURELUTE.TM. Bacterial
Genomic Kit (Edge BioSystems, Gaithersburg, Md.) according to
manufacturer's instructions. This genomic DNA (gDNA) was used as
template for PCR amplification size confirmation of a 785 bp
aac3(IV) DNA fragment using the FAILSAFE.TM. PCR System (Epicentre
Biotechnologies, Madison, Wis.).
Confirmation of the Presence of a Hemoglobin Gene in
Transconjugants
[0101] To confirm that the synthetic hemoglobin gene was present in
the transconjugants, the genomic DNA of a select number of
transconjugants was isolated (via the PURELUTE.TM. Bacterial
Genomic Kit) and used as template for PCR amplification of the
hemoglobin gene (via the FAILSAFE.TM. PCR System). Recombinant
strains produced a PCR product of 395 bp, corresponding to the size
of the hemoglobin gene coding region intended for amplification.
The PCR fragments were purified and DNA sequencing of both strands
was completed to further confirm the presence of the VHb gene.
Alignment of the sequence derived from the PCR fragments with the
synthetic hemoglobin gene sequence synthesized by DNA2.0 indicated
that these recombinant strains carried the hemoglobin gene with
sequence identical to the designed DNA sequence.
Hemoglobin Gene Expression Under Fermentation Conditions
[0102] Expression of the synthetic hemoglobin gene in the
recombinant strain carrying the hemoglobin gene expression cassette
under fermentation conditions was determined. Recombinant strains
containing the VHb expression cassette were grown under shake flask
fermentation conditions, and the corresponding total RNA samples
were isolated via the RIBOPURE.TM.-Bacteria kit (Ambion, Austin,
Tex.) and prepared for use as template in the RT-PCR assay.
Fermentation of the double crossover mutant was performed under
conditions described by Burns et al., (WO 2003070908). Analysis of
the fermentation broth for the presence of spinosyn factors can be
carried out under conditions described by Baltz et al., (U.S. Pat.
No. 6,143,526). To confirm the presence of the spinosyn factors in
the supernatant, extracts of the fermentation broth were dried down
in a SpeedVac overnight followed by partition of the residue
between water and ether. The ether layer was dried by evaporation
under N.sub.2 stream. The sample was then dissolved in
acetone-d.sub.6 and transferred to an NMR tube for 1D proton NMR
acquisition. The NMR profiles were compared to those of spinosyn
standards.
[0103] Total RNA preparation was treated with DNaseI (Ambion,
Austin, Tex.) immediately following RNA purification according to
manufacturer's instructions. RT-PCR of the synthetic hemoglobin
gene using the isolated total RNA was carried out using OneStep
RT-PCR kit (Qiagen, Valencia, Calif.) according to manufacturer's
directions. Primers for amplification of the coding region of the
synthetic hemoglobin gene were SynHemo Forward (SEQ ID NO:6
5'-CAGACGATCAACATCATCAAGGCG-3') and SynHemo Reverse (SEQ ID NO:7
5'-ACCTGGATGAACACGTCCGC-3'). The recombinant strains containing the
VHb expression cassette produced a specific fragment of 395 bp
corresponding to the hemoglobin gene coding region intended for
amplification. In the same assay, total RNA isolated from the
non-recombinant control strains did not produce a PCR fragment
corresponding in size to the synthetic hemoglobin gene. These
results confirmed that a synthetic hemoglobin gene, driven by the
apramycin resistance gene promoter, was transcribed and expressed
in S. spinosa under fermentation conditions.
Effect of Hemoglobin Gene Expression on Spinosad Production
[0104] The impact of the hemoglobin gene expression on spinosad
(A/D) production was evaluated by growing the recombinant strains
under shake flask fermentation conditions as described above. The
fermentation results were compared to spinosyn A/D levels produced
in the respective parent strain, which does not carry the
hemoglobin gene. The number of recombinant strains selected for
evaluation in shake flasks was based on the number of
transconjugants available for testing and the desire to obtain
data, which would determine whether the expression of the synthetic
hemoglobin gene produces increased levels of spinosad A/D.
[0105] Seven recombinant strains derived from DAS-2 were tested.
All of which outperformed the parent strain, DAS-2, in spinosad
production. The parent strain accumulated spinosad within the
expected range. The statistically significant increase in spinosad
A/D production ranged from 4.6% to 12.9% for the strains, which
contained the VHb gene (Table 2). The consistency among the
recombinant strains in outperforming the control strain in spinosad
production under shake flask fermentation conditions resulted in a
significant percent increase of spinosad A/D titers. This increase
in spinosad titers indicated that the recombinant strains as a
whole have acquired enhanced spinosad production capability due to
the presence of the synthetic hemoglobin gene in the genome.
Expression of the synthetic hemoglobin gene under shake flask
fermentation conditions indicates that the expression of the
hemoglobin gene increases spinosad production.
TABLE-US-00002 TABLE 2 Comparison of DAS-2 and DAS-2 VHb
recombinant strain containing a chromosomally integrated VHb gene
in spinosad production. Spinosyn Titers Relative to Control Major
Spinosyn in Percentage at Day 10 of Strain ID Factors Fermentation
DAS-2 A/D 100.0 DAS-2 VHb1 A/D 107.4 DAS-2 VHb4 A/D 104.6 DAS-2
VHb5 A/D 108.0 DAS-2 VHb6 A/D 110.5 DAS-2 VHb7 A/D 112.9 DAS-2 VHb8
A/D 110.4 DAS-2 VHb9 A/D 105.6
[0106] Based on the fermentation results reported above, the
following recombinant strains, DAS-2 VHb7 and DAS-2 VHb8, were
cryogenically preserved in 20% glycerol using actively growing
vegetative cultures. A dedicated shake flask fermentation study was
carried out to: i) evaluate the cryo preserved strains; ii) ensure
reproducibility of the fermentation results; and iii) provide
evidence for advancement of select strains for future work. In this
study the control strains produced spinosad at the expected levels,
and the entire study was conducted without any unexpected
deviations from the operating protocol. Each recombinant strain
outperformed both control strains during and at the end of the
fermentation cycle confirming the initial observations from the
shake flask fermentation studies. The increase in spinosad levels
relative to the control strains from the recombinant strains was
statistically significant.
[0107] The obscurin polyketide synthase gene cluster was used for
integration and expression of a codon optimized hemoglobin gene in
S. spinosa strain, DAS-2. Integration and expression of the
hemoglobin gene resulted in improved A/D production in the shake
flask fermentation of S. spinosa, DAS-2.
[0108] All patents and publications referenced are incorporated by
reference herein in their entirety. The foregoing is illustrative
of the present invention, and is not to be construed as limiting
thereof. The invention is defined by the following claims, with
equivalents of the claims to be included therein.
Sequence CWU 1
1
71977DNAArtificial SequenceHemoglobin Gene Expression Cassette
1aagcttgaat tcgatatcag cccggtacct cgccgccaac ccgtaccacg gcctctgacg
60gctccggcca agccgcggaa agcgggggcc gggcgccggt ctccaggcgg ccgggtacct
120ccgaccgcac ggccgcttcc ggagtggtcc ggaagcggcc tgcggagcgc
cctgcggggc 180ggctatcgat tcactccacc gcctgcgcgt acaggtccgc
ctccacctgg atgaacacgt 240ccgcgatcac gccgtacgcc ttgccccacg
cgtccaggat gtcgtccgtc gccgcgtcgc 300ccagcacctc cttgatcgcg
cccagcagct cctggcccac gatcgggtag tgcgccgccg 360ccacgcccgc
ctggcagtgc ttcaccgcga tcttcttcac cgccggcagg atcgccggca
420ggttctcgat gttctgcgcc gccgccagca ccgtcatcgc cagcgccttc
ggctgctcca 480gcgactcctg ccggcccatg tcgaacagcg gccgcacctc
cgggtgcttc gcgaacaggt 540tcttgtagaa cgtggtcgtg atcgtcacgc
cgtgctcctt cagcaccggc accgtcgcct 600tgatgatgtt gatcgtctgc
tggtccagca tatgattgca ctccaccgct gatgacatca 660gtcgatcata
gcacgatcaa cggcactgtt gcaaatagtc ggtggtgata aacttatcat
720ccccttttgc tgatggagct gcacatgaac ccattcaaag gccggcattt
tcagcgtgac 780atcattctgt gggccgtacg ctggtactgc aaatacggca
tcagttaccg tgagctgcat 840tttccgctgc ataaccctgc ttcggggtca
ttatagcgat tttttcggta tatccatcct 900ttttcgcacg atatacagga
ttttgccaaa gggttcgtgt agactttcct tggtgtatcc 960aacggcgtca gaagctt
977222DNAArtificial Sequenceaac3-vhb Forward Primer 2cgctgaaaag
cttctgacgc cg 22320DNAArtificial Sequenceaac3-vhb Reverse Primer
3caacccgtac cacggcctct 20459DNAArtificial SequenceobsA Internal
Strep Stem Loop Primer 4gaagaaggcg gcgtcgaact ggtcgacctc ggtgaggaag
gtacctccga ccgcacggc 59558DNAArtificial SequenceobsA 5' FRT aac3
Primer 5ggcaatgcgc agagttcgta gtgcgggagc catttgatgt gtaggctgga
gctgcttc 58624DNAArtificial SequenceSynHemo Forward Primer
6cagacgatca acatcatcaa ggcg 24720DNAArtificial SequenceSynHemo
Reverse Primer 7acctggatga acacgtccgc 20
* * * * *
References