U.S. patent application number 14/347961 was filed with the patent office on 2014-08-28 for method of treating mucoepidermoid carcinoma.
The applicant listed for this patent is DANA-FARBER CANCER INSTITUTE, INC.. Invention is credited to Jie Chen, James D. Griffin, Lizi Wu.
Application Number | 20140243396 14/347961 |
Document ID | / |
Family ID | 47016842 |
Filed Date | 2014-08-28 |
United States Patent
Application |
20140243396 |
Kind Code |
A1 |
Griffin; James D. ; et
al. |
August 28, 2014 |
METHOD OF TREATING MUCOEPIDERMOID CARCINOMA
Abstract
Imidazoquinolines, as set forth in formula (I), are useful for
inhibiting growth or proliferation of mucoepidermoid carcinoma
cells. The therapeutic and prophylactic treatments provided by this
invention are practiced by administering to a patient in need
thereof an amount of a compound of formula (I) that is effective to
inhibit growth or proliferation of the mucoepidermoid carcinoma
cells.
Inventors: |
Griffin; James D.; (Needham,
MA) ; Wu; Lizi; (Gainesville, FL) ; Chen;
Jie; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DANA-FARBER CANCER INSTITUTE, INC. |
Boston |
MA |
US |
|
|
Family ID: |
47016842 |
Appl. No.: |
14/347961 |
Filed: |
September 27, 2012 |
PCT Filed: |
September 27, 2012 |
PCT NO: |
PCT/US2012/057480 |
371 Date: |
March 27, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61541758 |
Sep 30, 2011 |
|
|
|
61660377 |
Jun 15, 2012 |
|
|
|
Current U.S.
Class: |
514/44A ;
514/293; 514/424; 514/455 |
Current CPC
Class: |
A61K 31/4015 20130101;
A61K 31/4745 20130101; A61K 31/4015 20130101; A61P 43/00 20180101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 45/06 20130101;
A61K 31/4745 20130101; A61K 31/352 20130101; A61P 35/00 20180101;
A61K 31/7088 20130101; C07D 471/04 20130101 |
Class at
Publication: |
514/44.A ;
514/293; 514/424; 514/455 |
International
Class: |
C07D 471/04 20060101
C07D471/04; A61K 45/06 20060101 A61K045/06; A61K 31/352 20060101
A61K031/352; A61K 31/7088 20060101 A61K031/7088; A61K 31/4745
20060101 A61K031/4745; A61K 31/4015 20060101 A61K031/4015 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under
federal grant number CA-66996 awarded by National Institutes of
Health. The government has certain rights in the invention.
Claims
1. A method for inhibiting growth or proliferation of
mucoepidermoid carcinoma cells comprising administering to a
patient in need thereof in an amount that is effective to inhibit
growth or proliferation of the mucoepidermoid carcinoma cells a
compound of the formula ##STR00011## wherein R.sup.1 and R.sup.2
are each independently methyl or ethyl; R.sup.3 is lower alkyl; and
R.sup.4 is pyridyl unsubstituted or substituted by halogen, cyano,
lower alkyl, lower alkoxy or piperazinyl unsubstituted or
substituted by lower alkyl; pyrimidinyl unsubstituted or
sub-stituted by lower alkoxy; quinolinyl unsubstituted or
substituted by halogen; or quinoxalinyl; or a pharmaceutically
acceptable salt thereof.
2. A method according to claim 1 wherein R.sup.1, R.sup.2, and
R.sup.3 are all methyl.
3. A method according to claim 2 wherein R.sup.4 is pyridyl
unsubstituted or substituted by lower alkyl or lower alkoxy.
4. A method according to claim 2 wherein R.sup.4 is quinolinyl
unsubstituted or substituted by halogen.
5. A method according to claim 1 wherein the compound of formula
(I) is
2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-yl-2,3-dihydroimidazo[4,5-c]qu-
inolin-1-yl)-phenyl]propionitrile or a pharmaceutically acceptable
salt thereof.
6. A method according to claim 1 wherein the amount of the compound
or salt of formula (I) that is effective to inhibit growth or
proliferation of the mucoepidermoid carcinoma cells is an
administered amount ranging from 0.001 to 1000 mg/kg.
7. A method for treating mucoepidermoid carcinoma comprising
administering to a patient in need thereof in an amount that is
effective to inhibit growth or proliferation of the mucoepidermoid
carcinoma cells a compound of the formula ##STR00012## wherein
R.sup.1 and R.sup.2 are each independently methyl or ethyl; R.sup.3
is lower alkyl; and R.sup.4 is pyridyl unsubstituted or substituted
by halogen, cyano, lower alkyl, lower alkoxy or piperazinyl
unsubstituted or substituted by lower alkyl; pyrimidinyl
unsubstituted or sub-stituted by lower alkoxy; quinolinyl
unsubstituted or substituted by halogen; or quinoxalinyl; or a
pharmaceutically acceptable salt thereof.
8. A method according to claim 7 wherein R.sup.1, R.sup.2, and
R.sup.3 are all methyl.
9. A method according to claim 9 wherein R.sup.4 is pyridyl
unsubstituted or substituted by lower alkyl or lower alkoxy.
10. A method according to claim 9 wherein R.sup.4 is quinolinyl
unsubstituted or substituted by halogen.
11. A method according to claim 8 wherein the compound of formula
(I) is
2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-yl-2,3-dihydroimidazo[4,5-c]qu-
inolin-1-yl)-phenyl]propionitrile or a pharmaceutically acceptable
salt thereof.
12. A method according to claim 8 wherein the amount of the
compound or salt of formula (I) that is effective to inhibit growth
or proliferation of the mucoepidermoid carcinoma cells is an
administered amount ranging from 0.001 to 1000 mg/kg.
13. A method according to claim 1 further comprising administering
to the patient a PDE4B inhibitor.
14. (canceled)
15. (canceled)
16. (canceled)
17. A method according to claim 13 wherein said PDE4B inhibitor is
rolipram.
18. A method according to claim 7 further comprising administering
to the patient a PDE4B inhibitor.
19. (canceled)
20. (canceled)
21. (canceled)
22. A method according to claim 18 wherein said PDE4B inhibitor is
rolipram.
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)
31. (canceled)
32. (canceled)
33. A method for inhibiting growth or proliferation of
mucoepidermoid carcinoma cells comprising administering to a
patient in need thereof in an amount that is effective to inhibit
growth or proliferation of the mucoepidermoid carcinoma cells a
PDE4B inhibitor, a PI3-kinase inhibitor or a PDE4B inhibitor and a
PI3-kinase inhibitor.
34. The method according to claim 33, wherein the PDE4B inhibitor
comprises an shRNA, rolipram or forskolin and combinations
thereof.
35. The method according to claim 34, wherein the shRNA is selected
from the group comprising SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3,
SEQ ID NO 4 and combinations thereof.
36. The method according to claim 33, further comprising
administering to a patient an effective amount of a compound of the
formula ##STR00013## wherein R.sup.1 and R.sup.2 are each
independently methyl or ethyl; R.sup.3 is lower alkyl; and R.sup.4
is pyridyl unsubstituted or substituted by halogen, cyano, lower
alkyl, lower alkoxy or piperazinyl unsubstituted or substituted by
lower alkyl; pyrimidinyl unsubstituted or sub-stituted by lower
alkoxy; quinolinyl unsubstituted or substituted by halogen; or
quinoxalinyl; or a pharmaceutically acceptable salt thereof.
37. The method according to claim 35, wherein the PI3-kinase
inhibitor comprises a shRNA.
38. The method according to claim 37, wherein the shRNA comprises
SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, and
combinations thereof.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of the filing date under
35 U.S.C. .sctn.119(e) of the following Provisional U.S. patent
application Ser. Nos. 61/660,377 filed Jun. 15, 2012, and
61/541,758, filed Sep. 30, 2011, which are hereby incorporated by
reference in their entirety.
BACKGROUND OF THE INVENTION
[0003] Mucoepidermoid carcinomas (MEC) are the most common
malignant salivary gland tumors and the second most frequent lung
tumors of bronchial gland origin. In addition, MEC have been
reported to occur in the trachea, esophagus, breast, pancreas,
cervix and thyroid gland. Systemic treatment of metastatic MEC
tumors has been disappointing.
[0004] There is a fusion oncogene that involves a t(11; 19)(q21;
p13) translocation in salivary gland MECs; Tonon, G., Modi, S., Wu,
L., Kubo, A., Coxon, A. B., Komiya, T., O'Neil, K., Stover, K.,
El-Naggar, A., Griffin, J. D., Kirsch, I. R., and Kaye, F. J.;
t(11;19)(q21;p13) translocation in mucoepidermoid carcinoma creates
a novel fusion product that disrupts a Notch signaling pathway. Nat
Genet, 2003, 33: 208-213. This translocation is detected in up to
80% of all MECs, and also in some benign tumors, including
Warthin's tumors and clear cell hidradenoma of the skin. The
translocation encodes a fusion protein, termed CRTC1-MAML2, which
consists of 42 amino acids of the N-terminal CREB (cAMP Response
Element Binding Protein)-binding domain of the CREB regulator CRTC1
and 981 amino acids from the C-terminal transactivation domain
(TAD) of Notch co-activator MAML2. MAML2 is a member of the Notch
co-activator mastermind family proteins and is required for Notch
signaling. CRTC1 (also known as MECT1, TORC1 or WAMTP1) belongs to
a family of conserved CREB co-activators (14, 15). Binding of CRTC1
to CREB enhances recruitment of TAFII130 to the CREB complex, and
thus activates downstream signaling.
[0005] There is abundant evidence that CRTC1-MAML2 is an oncogene.
For example, ectopic expression of CRTC1-MAML2, but not
over-expression of MAML2, induced foci formation. Tonon et al.,
supra. In addition, injection of CRTC1-MAML2 transfected RK3E cells
into nude mice caused tumor formation in vivo and sustained
expression of the fusion was required for tumorigenesis in these
mice; Komiya, T., Park, Y., Modi, S., Coxon, A. B., Oh, H., and
Kaye, F. J.; Sustained expression of Mect1-Mam12 is essential for
tumor cell growth in salivary gland cancers carrying the t(11;19)
translocation. Oncogene, 2006, 25: 6128-6132. It was reported that
CRTC1-MAML2 activates multiple cAMP/CREB genes by constitutively
activating CREB signaling; Wu, L., Liu, J., Gao, P., Nakamura, M.,
Cao, Y., Shen, H., and Griffin, J. D.; Transforming activity of
MECT1-MAML2 fusion oncoprotein is mediated by constitutive CREB
activation. Embo J, 2005, 24: 2391-2402 and Coxon, A., Rozenblum,
E., Park, Y. S., Joshi, N., Tsurutani, J., Dennis, P. A., Kirsch,
I. R., and Kaye, F. J.; Mect1-Mam12 fusion oncogene linked to the
aberrant activation of cyclic AMP/CREB regulated genes. Cancer Res,
2005, 65: 7137-7144. This report is consistent with a model where
the CRTC1 motif re-directs the strong coactivator MAML2 to CREB. It
has also been demonstrated that both the CREB-binding domain and
the TAD of CRTC1-MAML2 are required for the fusion to induce foci
formation in vitro; Wu et al., supra. The direct evidence that
CRTC1-MAML2 is an oncogene, coupled with its high frequency in MECs
suggests that this CRTC1-MAML2 protein or its downstream targets
are of therapeutic interest.
SUMMARY OF THE INVENTION
[0006] The present application is directed to a method for
inhibiting growth or proliferation of mucoepidermoid carcinoma
cells comprising administering to a patient in need thereof in an
amount that is effective to inhibit growth or proliferation of the
mucoepidermoid carcinoma cells a compound of the formula (I)
##STR00001##
wherein R.sup.1 and R.sup.2 are each independently methyl or ethyl;
R.sup.3 is lower alkyl; and R.sup.4 is pyridyl unsubstituted or
substituted by halogen, cyano, lower alkyl, lower alkoxy or
piperazinyl unsubstituted or substituted by lower alkyl;
pyrimidinyl unsubstituted or substituted by lower alkoxy;
quinolinyl unsubstituted or substituted by halogen; or
quinoxalinyl; or a pharmaceutically acceptable salt thereof.
[0007] The present invention also relates to a method for treating
mucoepidermoid carcinoma comprising administering to a patient in
need thereof in an amount that is effective to inhibit growth or
proliferation of the mucoepidermoid cells a compound of formula
(I).
[0008] In a further embodiment, the invention relates to a method
for inhibiting growth or proliferation of mucoepidermoid carcinoma
cells comprising administering to a patient in need thereof in an
amount that is effective to inhibit growth or proliferation of the
mucoepidermoid cells a compound of formula (I) in combination with
a PDE4B inhibitor.
[0009] In a still further embodiment, the invention relates to a
method for treating mucoepidermoid carcinoma comprising
administering to a patient in need thereof in an amount that is
effective to inhibit growth or proliferation of the mucoepidermoid
cells a compound of formula (I) in combination with a PDE4B
inhibitor.
[0010] In a further embodiment, the invention relates to a method
for inhibiting growth or proliferation of mucoepidermoid carcinoma
cells comprising administering to a patient in need thereof in an
amount that is effective to inhibit growth or proliferation of the
mucoepidermoid cells a PDE4B inhibitor, a PI3-kinase inhibitor or a
PDE4B inhibitor and a PI3-kinase inhibitor.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 illustrates identification of CRTC1-MAML2 Target
genes. A. qPCR analysis showed shRNA #D and #A down-regulated
CRTC1-MAML2 expression in H292 and H3118 cells compared to
luciferase (sh LUC) control. RT-qPCR experiments were performed in
triplicates. Columns: mean, bars: SD (n=3). *p<0.05, compared
with expression from shLUC infected cells (Student t test). B
Inhibition of CRTC1-MAML2 inhibited H3118 and H292 cell growth.
Columns: mean, bars: SD (n=3). *p<0.05, **p<0.01,
***p<0.001, compared with shLUC. C. qPCR analysis showed PDE4B
expression was down regulated in H292 and H3118 cells by knock-down
of CRTC1-MAML2. *p<0.05, compared with RNA expression from shLUC
infected cells. Columns: mean, bars: SD (n=3). D. Western-blot
analysis showed the down-regulation of PDE4B protein after
CRTC1-MAML2 knock-down. * indicates non-specific band. Image was
cropped and auto-leveled by Photoshop. A representative of three
independent experiments.
[0012] FIG. 2 illustrates inhibition of PDE4B by pharmacological
inhibitor rolipram plus forskolin prevents cell growth, causes cell
cycle arrest and induces apoptosis in fusion positive MEC cells.
Rolipram (R), forskolin (FK), Rolipram plus forskolin (R+FK) or
DMSO. Columns: mean, bars: SD (n>3), *p<0.05, **p<0.01,
***p<0.001, compared to HSY cell growth. B. 1.times.10.sup.5
cells were treated with 50 .mu.M R plus 20 .mu.M FK or DMSO for 24
hours. C. 1.times.10.sup.5 cells were treated with 50 .mu.M
rolipram plus 20 .mu.M forskolin with or DMSO for 48 hours.
Apoptosis assay was performed by PI and Annexin-V staining and
analyzed by flow cytometry. Columns: mean, bars: SD (n=3).
*p<0.05, compared with DMSO treated cells.
[0013] FIG. 3 illustrates knock-down of PDE4B inhibits fusion
positive MEC cell growth, causes cell cycle arrest and induces
apoptosis. A. H3118 cell lysate was prepared on day 5
post-transduction and subjected to western blot analysis. Image was
cropped and auto-leveled by Photoshop. A representative of three
independent experiments. B. 1.times.10.sup.5 MEC cells were
infected twice by shRNA No. 1 and No. 2 and cell number was count
on day 5 post-transduction by trypan blue exclusion. Columns: mean,
bars: SD (n>3). *p<0.05, **p<0.01, compared with scramble
control virus infected cell growth. C. 1.times.10.sup.5 cells were
infected twice by shRNA No. 2. Cell cycle was determined by PI
staining followed by FACS analysis on day 5 post-transduction, n=3.
D. 1.times.10.sup.5 cells were infected twice by shRNA No. 2.
Apoptosis assay was performed by PI and Annexin-V staining and
analyzed by flow cytometry on day 5 post-transduction, Columns:
mean, bars: SD (n=3). *p<0.05, compared with control cells.
[0014] FIG. 4 illustrates knock-down of PDE4B inhibited MEC cell
growth in vivo. A. Tumor volume in SCID hairless mice. Points: mean
of 5 tumors, bars: SD (n=5). ***p<0.001, compared to control
tumor. B. Representative picture of the tumors dissected from the
mice after sacrifice on day 30. Five pair (shPDE4B vs. scramble
control) of tumors was shown (n=5). C. Tumor weight from SCID
hairless mice. Tumors were weighted on day 30 at sacrifice.
Columns: mean, bars: SD (n=5). ***p<0.001, compared to control
tumor weight. D. RT-qPCR analysis of PDE4B expression from the
tumor biopsies. Columns: mean, bars: SD (n=3). ***p<0.001,
compared to control tumor.
[0015] FIG. 5 illustrates inhibition of PDE4B increased cellular
cAMP levels and inhibited PI3-kinase signaling. A. Pharmacological
inhibitor rolipram plus forskolin treatment increased cAMP levels
in MEC cells. Columns: mean, bars: SD (n=3). B. Knock-down of PDE4B
increased MEC cell cAMP level. n=3. **p<0.01, compared to
control cells. Columns: mean, bars: SD (n=3). C. Western blot
analysis showed the phospho-AKT levels after 30 min of 50 .mu.M
rolipram plus 20 .mu.M forskolin treatment in H3118 cells. The same
blot was stripped and probed with AKT or .beta.-actin antibody.
Image was cropped and auto-leveled by Photoshop. A representative
of three independent experiments. D. Western blot analysis showed
the phospho-AKT levels after PDE4B knock-down.
[0016] FIG. 6 illustrates PI3-kinase signaling contributes to MEC
cell growth. A. Effects of PI3-kinase inhibitor LY-294002 or
Compound A on MEC cell growth. (Left) Western blot analysis showed
phospho-AKT levels in H3118 cells after 1 hour of inhibitor
treatment. The same blot was stripped and probed with anti-AKT or
anti-V.-actin antibody. Image was cropped and auto-leveled by
Photoshop. A representative of three independent experiments.
(Right) MEC cell growth was measured by MTS assay on day 5 of
LY-294002 or Compound A treatment. Points: mean, bars: SD (n=3). B.
Effects of knock-down of PI3-kinase .alpha. or .beta. on MEC cell
growth. (Upper) Western blot analysis showed PI3-kinase .alpha. or
.beta. protein levels after lenti-viral infection. H3118 cell
lysates were prepared on day 5 post-transduction. Image was cropped
and auto-leveled by Photoshop. (Lower) Effects of knock-down of
PI3-kinase .alpha. or .beta. on MEC cell growth. 1.times.10.sup.5
cells were transduced twice with lenti-viruses harboring shRNAs
targeting PI3-K .alpha., .beta. or scramble control. Cell numbers
were counted by trypan blue exclusion on day 5 posttransduction.
Cell growth of scramble control virus infected cells was set to
100%, Columns: mean, bars: SD (n=3). **p<0.01, ***p<0.001
compared to control cells. C. Effects of Compound A in combination
of rolipram plus forskolin on of MEC cell growth. 1.times.10.sup.5
cells were treated with the combination of inhibitors listed. Cell
numbers were counted by trypan blue exclusion on day 5, Columns:
mean, bars: SD (n=3).
[0017] FIG. 7 illustrates qPCR analysis showing the down-regulation
of MAML2 expression in MEC cells infected with retro-viruses
harboring shRNA #A and #D. Total RNA was collected 48 hours
post-transduction and the experiments were performed in
triplicates. Columns: mean, bars: SD (n=3). *p<0.05, **p<0.01
compared with shLUC treated cells.
[0018] FIG. 8 illustrates qPCR validation of the expression changes
of Notch target gene HES2 and known CREB target genes in H3118
cells from array analysis. Columns: mean, bars: SD (n=3).
[0019] FIG. 9 is a table illustrating genes regulated by
CRTC1-MAML2 knockdown in H3118 cells (cut off fold>3 or <-3,
p<0.05) using Affymetrix U133A plus.sub.--2 microarrays.
DETAILED DESCRIPTION OF THE INVENTION
[0020] The current invention relates to the discovery that
imidazoquinolines, as set forth in formula (I), are useful for
inhibiting growth or proliferation of mucoepidermoid carcinoma
cells. The therapeutic and prophylactic treatments provided by this
invention are practiced by administering to a patient in need
thereof an amount of a compound of formula (I) that is effective to
inhibit growth or proliferation of the mucoepidermoid carcinoma
cells or for the treatment of mucoepidermoid carcinoma. In
additional embodiments, the imidazoquinolines are administered in
combination with a PDE4B inhibitor. In additional embodiments, a
PDE4B inhibitor is administered in an amount that is effective to
inhibit growth or proliferation of the mucoepidermoid carcinoma
cells or for the treatment of mucoepidermoid carcinoma.
[0021] The general terms used hereinbefore and hereinafter
preferably have within the context of this disclosure the following
meanings, unless otherwise indicated:
[0022] The prefix "lower" denotes a radical having up to and
including a maximum of 7 carbon atoms, preferably from 1 to 4
carbon atoms, the radicals in question being either linear or
branched.
[0023] Where the plural form is used for compounds, salts, and the
like, this is taken to mean also a single compound, salt, or the
like.
[0024] In a preferred embodiment, "alkyl" has up to a maximum of 12
carbon atoms and is especially lower alkyl.
[0025] "Lower alkyl" is preferably "alkyl" with from and including
1 to and including 7 carbon atoms, preferably from 1 to 4 carbon
atoms, and is linear or branched; preferably, lower alkyl is butyl,
such as n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, such as
n-propyl or isopropyl, ethyl or preferably methyl.
[0026] "Cycloalkyl" is preferably cycloalkyl with from and
including 3 up to and including 6 carbon atoms in the ring;
cycloalkyl is preferably cyclopropyl, cyclobutyl, cyclopently or
cyclohexyl.
[0027] The term "halogen" refers to fluorine, chlorine, bromine,
and iodine.
[0028] "Alkyl" which is substituted by halogen is preferably
perfluoro alkyl such as trifluoromethyl.
[0029] As used herein, the term "inhibit", "inhibiting", or
"inhibit the growth or proliferation" of the mucoepidermoid
carcinoma cell refers to slowing, interrupting, arresting or
stopping the growth of the mucoepidermoid cell, and does not
necessarily indicate a total elimination of the mucoepidermoid
carcinoma cell growth. The terms "inhibit" and "inhibiting", or the
like, denote quantitative differences between two states, refer to
at least statistically significant differences between the two
states. For example, "an amount effective to inhibit growth of
mucoepidermoid carcinoma cells" means that the rate of growth of
the cells will be at least statistically significantly different
from the untreated cells. Such terms are applied herein to, for
example, rates of cell proliferation
[0030] "Treating", "treat", or "treatment" within the context of
the instant invention, means an alleviation of symptoms associated
with a disorder or disease, or halt of further progression or
worsening of those symptoms, or prevention or prophylaxis of the
disease or disorder. For example, within the context of this
invention, successful treatment may include an alleviation of
symptoms related to mucoepidermoid carcinoma or a halting in the
progression of a disease such as PHTS.
[0031] "Mucoepidermoid carcinoma" refers to a distinct type of
tumor containing three cellular elements in varying proportions:
squamous cells, mucus-secreting cells, and intermediate cells.
Mucoepidermoid carcinomas are the most common malignant salivary
gland tumors and the second most frequent lung tumors of bronchial
gland origin.
[0032] As used herein, the term "pharmaceutically acceptable salts"
include those salts formed, for example, as acid addition salts,
preferably with organic or inorganic acids, from compounds of
formula I with a basic nitrogen atom, especially the
pharmaceutically acceptable salts. Suitable inorganic acids are,
for example, halogen acids, such as hydrochloric acid, sulfuric
acid, or phosphoric acid. Suitable organic acids are, for example,
carboxylic, phosphonic, sulfonic or sulfamic acids, for example
acetic acid, propionic acid, octanoic acid, decanoic acid,
dodecanoic acid, glycolic acid, lactic acid, fumaric acid, succinic
acid, malonic acid, adipic acid, pimelic acid, suberic acid,
azelaic acid, malic acid, tartaric acid, citric acid, amino acids,
such as glutamic acid or aspartic acid, maleic acid, hydroxymaleic
acid, methylmaleic acid, cyclohexanecarboxylic acid,
adamantanecarboxylic acid, benzoic acid, salicylic acid,
4-aminosalicylic acid, phthalic acid, phenylacetic acid, mandelic
acid, cinnamic acid, methane- or ethane-sulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-toluenesulfonic acid, 2-naphthalenesulfonic
acid, 1,5-naphthalene-disulfonic acid, 2- or
3-methylbenzenesulfonic acid, methylsulfuric acid, ethylsulfuric
acid, dodecylsulfuric acid, N-cyclohexylsulfamic acid, N-methyl-,
N-ethyl- or N-propyl-sulfamic acid, or other organic protonic
acids, such as ascorbic acid.
[0033] The term "PDE4B inhibitor" refers to any compound capable of
inhibiting the expression or activity of PDE4B, that is to say, in
particular, any compound inhibiting the transcription of the gene,
the maturation of RNA, the translation of mRNA, the
posttranslational modification of the protein, the enzymatic
activity of the protein, the interaction of same with a substrate,
etc. In some embodiments, the PDE4B inhibitor may be a short
hairpin RNA (shRNA) sequence. The term "short hairpin RNA" or
"shRNA" refers to RNA molecules having an RNA sequence that makes a
tight hairpin turn that can be used to silence gene expression via
RNA interference. The shRNA hairpin structure is cleaved by the
cellular machinery into siRNA, which is then bound to the
RNA-induced silencing complex (RISC). This complex binds to and
cleaves mRNAs which match the siRNA that is bound to it. The
sequence of the siRNA can correspond to the full length target
gene, or a subsequence thereof siRNA is "targeted" to a gene in
that the nucleotide sequence of the duplex portion of the siRNA is
substantially complementary to a nucleotide sequence of the
targeted gene. The siRNA sequence duplex needs to be of sufficient
length to bring the siRNA and target RNA together through
complementary base-pairing interactions. The siRNA of the invention
may be of varying lengths. The length of the siRNA is preferably
greater than or equal to ten nucleotides and of sufficient length
to stably interact with the target RNA; specifically 10-30
nucleotides; more specifically any integer between 10 and 30
nucleotides, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, and 30. By "sufficient length"
is meant a nucleotide of greater than or equal to 10 nucleotides
that is of a length great enough to provide the intended function
under the expected condition. The shRNA may be cloned into a vector
using recombinant DNA techniques.
[0034] The terms "substantially identical" or "substantial
identity," in the context of two or more nucleic acids or
polypeptide sequences, refer to two or more sequences or
subsequences that are the same or have a specified percentage of
amino acid residues or nucleotides that are the same (i.e., at
least about 60%, preferably 65%, 70%, 75%, preferably 80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity over a
specified region), when compared and aligned for maximum
correspondence over a comparison window, or designated region as
measured using one of the following sequence comparison algorithms
or by manual alignment and visual inspection. This definition, when
the context indicates, also refers analogously to the complement of
a sequence, such as an RNA nucleotide complementary to a DNA
nucleotide. Preferably, the substantial identity exists over a
region that is at least about 6-7 amino acids or 25 nucleotides in
length.
[0035] An example of an algorithm that is suitable for determining
percent sequence identity and sequence similarity is the BLAST
algorithm, which is described in Altschul et al., 1977, Nuc. Acids
Res. 25:3389-3402. BLAST is used, with the parameters described
herein, to determine percent sequence identity for the nucleic
acids and proteins of the invention. Software for performing BLAST
analysis is publicly available through the National Center for
Biotechnology Information (http://www.ncbi.nlm.nih gov/). This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al., supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0) and N (penalty score for
mismatching residues; always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) or 10, M=5, N=-4 and a comparison of both strands. For amino
acid sequences, the BLASTP program uses as defaults a wordlength of
3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see
Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA, 89:10915
(1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and
a comparison of both strands.
[0036] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin &
Altschul, Proc. Nat'l. Acad. Sci. USA, 90:5873-5787 (1993)). One
measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of
the probability by which a match between two nucleotide or amino
acid sequences would occur by chance. For example, a nucleic acid
is considered similar to a reference sequence if the smallest sum
probability in a comparison of the test nucleic acid to the
reference nucleic acid is less than about 0.2, more preferably less
than about 0.01, and most preferably less than about 0.001.
[0037] In a particular embodiment, the compound is an antisense
nucleic acid, capable of inhibiting the transcription of the PDE4B
or AKAP1 or GABA(A)RAPL1 gene or the translation of the
corresponding messenger. The antisense nucleic acid can comprise
all or part of the sequence of the PDE4B or AKAP1 or GABA(A)RAPL1
gene, a fragment thereof, the PDE4B or AKAP1 or GABA(A)RAPL1
messenger, or a sequence complementary to same. In particular, the
antisense molecule can comprise a region complementary to the
sequence comprised between residues 218-2383 of Genbank sequence
No. AF208023 or 766-2460 of Genbank sequence No. NM.sub.-002600,
and inhibit (or reduce) the translation thereof into protein. The
antisense molecule can be a DNA, RNA, ribozyme, etc. It can be
single stranded or double stranded. It can also be an RNA coded by
an antisense gene. It being an antisense oligonucleotide, it
typically comprises fewer than 100 bases, for example approximately
10 to 50 bases. Said oligonucleotide can be modified to improve its
stability, its resistance to nucleases, its penetration into the
cell, etc.
[0038] In some embodiments, practice of the present invention will
employ, unless otherwise indicated, conventional techniques of
molecular biology, immunology, microbiology, cell biology and
recombinant DNA, which are within the skill of the art. See e.g.,
Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY
MANUAL, (Current Edition); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY
(F. M. Ausubel et al. eds., (Current Edition)); the series METHODS
IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH
(Current Edition) ANTIBODIES, A LABORATORY MANUAL and ANIMAL CELL
CULTURE (R. I. Freshney, ed. (1987)). DNA Cloning: A Practical
Approach, vol. I & II (D. Glover, ed.); Oligonucleotide
Synthesis (N. Gait, ed., Current Edition); Nucleic Acid
Hybridization (B. Hames & S. Higgins, eds., Current Edition);
Transcription and Translation (B. Hames & S. Higgins, eds.,
Current Edition); Fundamental Virology, 2nd Edition, vol. I &
II (B. N. Fields and D. M. Knipe, eds.)
[0039] According to another embodiment, the compound is a peptide,
for example comprising a region of the PDE4B protein and capable of
antagonizing the activity of same.
[0040] According to another embodiment, the compound is a chemical
compound, natural or synthetic, in particular an organic or
inorganic molecule of plant, bacterial, viral, animal, eukaryotic,
synthetic or semisynthetic origin, capable of modulating the
expression or activity of PDE4B. Examples of chemical compounds
which are PDE4B inhibitors include rolipram, etazolate, cilomilast,
and piclamilast.
[0041] Additional examples of PDE4 inhibitors include the
following:
[0042] Arofylline; Cilomilast (Ariflo, SB-207,499) (a
second-generation PDE4 inhibitor with antiinflammatory effects that
target bronchoconstriction, mucus hypersecretion, and airway
remodeling associated with chronic obstructive pulmonary disease
(COPD) (Christensen, Siegfried B.; Guider, Aimee; Forster, Cornelia
J.; Gleason, John G.; Bender, Paul E.; Karpinski, Joseph M.;
Dewolf, Walter E.; Barnette, Mary S. et al. (1998)
"1,4-Cyclohexanecarboxylates: Potent and Selective Inhibitors of
Phosophodiesterase 4 for the Treatment of Asthma" Journal of
Medicinal Chemistry 41 (6): 821); CP-80633; Denbutylline;
Drotaverine (INN, also known as drotaverin) (an antispasmodic drug,
structurally related to the opium alkaloid papaverine); Etazolate
(SQ-20,009, EHT-0202) (anxiolytic drug; pyrazolopyridine derivative
(Hall, Judith A.; Morton, Ian (1999) Concise dictionary of
pharmacological agents: properties and synonyms. Kluwer Academic.
ISBN 0-7514-0499-3; Williams M (May 1983) "Anxioselective
anxiolytics". Journal of Medicinal Chemistry 26 (5): 619-28.
doi:10.1021/jm00359a001. PMID 6132997; Williams M, Risley E A
(February 1979) "Enhancement of the binding of 3H-diazepam to rat
brain membranes in vitro by SQ 20009, A novel anxiolytic,
gamma-aminobutyric acid (GABA) and muscimol". Life Sciences 24 (9):
833-41. doi:10.1016/0024-3205(79)90367-9. PMID 449623). Etazolate
acts as a positive allosteric modulator of the GABAA receptor at
the barbiturate binding site, as an adenosine antagonist of the A1
and A2 subtypes, and as a phosphodiesterase inhibitor selective for
the PDE4 isoform (Chasin M, Harris D N, Phillips M B, Hess S M
(September 1972)
"1-Ethyl-4-(isopropylidenehydrazino)-1H-pyrazolo-(3,4-b)-pyridine-5-carbo-
xylic acid, ethyl ester, hydrochloride (SQ 20009)--a potent new
inhibitor of cyclic 3',5'-nucleotide phosphodiesterases".
Biochemical Pharmacology 21 (18): 2443-50.
doi:10.1016/0006-2952(72)90414-5. PMID 4345859; Wang P, Myers J G,
Wu P, Cheewatrakoolpong B, Egan R W, Billah M M (May 1997)
"Expression, purification, and characterization of human
cAMP-specific phosphodiesterase (PDE4) subtypes A, B, C, and D".
Biochemical and Biophysical Research Communications 234 (2): 320-4.
doi:10.1006/bbrc.1997.6636. PMID 9177268; Gresele, Paolo; Gresele,
P. (2002) Platelets in thrombotic and non-thrombotic disorders:
pathophysiology, pharmacology and therapeutics. Cambridge, UK:
Cambridge University Press. ISBN 0-521-80261-X; Filaminast (primary
indication is asthma and COPD treatment (Giembycz, M A (2008) "Can
the anti-inflammatory potential of PDE4 inhibitors be realized:
guarded optimism or wishful thinking?". British Journal of
Pharmacology 155 (3): 288. doi:10.1038/bjp.2008.297. PMC 2567889.
PMID 18660832); Glaucine (alkaloid found in several different plant
species; has bronchodilator and antiinflammatory effects, acting as
a PDE4 inhibitor and calcium channel blocker, and is used medically
as an antitussive in some countries (Riihle K H, Criscuolo D,
Dieterich H A, Kohler D, Riedel G. Objective evaluation of
dextromethorphan and glaucine as antitussive agents. British
Journal of Clinical Pharmacology. 1984 May; 17(5):521-4. PMID
6375709); HT-0712 (experimental cognitive enhancing drug
(nootropic)); ICI-63197; Ibudilast (current development codes:
AV-411 or MN-166) is an antiinflammatory drug used mainly in Japan;
neuroprotective and bronchodilator drug used primarily in asthma
and stroke therapy. Its inhibitory action is greatest against PDE4,
however it also shows significant inhibitor activity against other
PDE subtypes. Depending on the dose, it can selectively inhibit
PDE4, or it can act as a non-selective phosphodiesterase inhibitor)
(Huang Z, Liu S, Zhang L, Salem M, Greig G M, Chan C C, Natsumeda
Y, Noguchi K. Preferential inhibition of human phosphodiesterase 4
by ibudilast. Life Sciences. 2006 May 1; 78(23):2663-8.);
Irsogladine; Luteolin (flavanoid; peanut extracted supplement;
possesses IGF-1 properties as well)(Yu M C, Chen J H, Lai C Y, Han
C Y, Ko W C (February 2010) "Luteolin, a non-selective competitive
inhibitor of phosphodiesterases 1-5, displaced [3H-rolipram from
high-affinity rolipram binding sites and reversed
xylazine/ketamine-induced anesthesia"]. Eur. J. Pharmacol. 627
(1-3): 269-75. doi:10.1016/j.ejphar.2009.10.031. PMID 19853596);
Mesembrine (alkaloid from herb Sceletium tortuosum); Piclamilast
(more potent than Rolipram) (de Visser Y P, Walther F J, Laghmani E
H, van Wijngaarden S, Nieuwland K, Wagenaar G T (2008)
"Phosphodiesterase-4 inhibition attenuates pulmonary inflammation
in neonatal lung injury." Eur Respir J 31 (3): 633-644);
Roflumilast (trade names Daxas, Daliresp)(licensed for treatment of
severe chronic obstructive pulmonary disease in the EU by Merck
Sharp & Dohme using the tradename Daxas)
(http://emc.medicines.org.uk/medicine/23416/SPC/DAXAS; 500
micrograms film-coated tablets); Ro20-1724; Rolipram (used as
investigative tool in pharmacological research; is being studied as
a possible alternative to current antidepressants (Bobon D, Breulet
M, Gerard-Vandenhove M A, Guiot-Goffioul F, Plomteux G,
Sastre-y-Hernandez M, Schratzer M, Troisfontaines B, von Frenckell
R, Wachtel H. (1988) "Is phosphodiesterase inhibition a new
mechanism of antidepressant action? A double blind double-dummy
study between rolipram and desipramine in hospitalized major and/or
endogenous depressives". Eur Arch Psychiatry Neurol Sci 238 (1):
2-6. PMID 3063534; Wachtel H. (1983) "Potential antidepressant
activity of rolipram and other selective cyclic adenosine
3',5'-monophosphate phosphodiesterase inhibitors".
Neuropharmacology 22 (3): 267-72. doi:10.1016/0028-3908(83)90239-3.
PMID 6302550). Recent studies show that rolipram may have
antipsychotic effects (Maxwell C R, Kanes S J, Abel T, Siegel S J.
(2004) "Phosphodiesterase inhibitors: a novel mechanism for
receptor-independent antipsychotic medications". Neuroscience 129
(1): 101-7. doi:10.1016/j.neuroscience.2004.07.038. PMID 15489033;
Kanes S J, Tokarczyk J, Siegel S J, Bilker W, Abel T, Kelly M P.
(2006) "Rolipram: A specific phosphodiesterase 4 inhibitor with
potential antipsychotic activity". Neuroscience 144 (1): 239-46.
doi:10.1016/j.neuroscience.2006.09.026. PMID 17081698). Rolipram
shows promise in ameliorating Alzheimer's disease (Smith, Donna L;
Pozueta J, Gong B, Arancio O, Shelanski M (Sep. 14, 2009) "Reversal
of long-term dendritic spine alterations in Alzheimer disease
models". Proceedings of the National Academy of Sciences of the
United States 106 (39): 16877-16882. doi:10.1073/pnas.0908706106.
PMC 2743726. PMID 19805389), Parkinson's disease (M F, Beal; Cleren
C, Calingasan N Y, Yang L, Klivenyi P, Lorenzl S (2005. "Oxidative
Damage in Parkinson's Disease". U.S. Army Medical Research and
Materiel CommandFort Detrick, Md. 21702-5012), and in the
regeneration of severed spinal cord axonal bodies (Nikulina, E.
(Jun. 8, 2004) "The Phosphodiesterase Inhibitor Rolipram Delivered
after a Spinal Cord Lesion Promotes Axonal Regeneration and
Functional Recovery". Proceedings of the National Academy of
Sciences of the United States 101: 8786.
doi:10.1073/pnas.0402595101). Rolipram is under preclinical
investigation for treatment of spinal cord injuries; RPL-554
(LS-193,855) (acts as a long-acting inhibitor of the
phosphodiesterase enzymes PDE-3 and PDE-4, producing both
bronchodilator and antiinflammatory effects (Boswell-Smith V, Spina
D, Oxford A W, Comer M B, Seeds E A, Page C P. The Pharmacology of
Two Novel Long-Acting Phosphodiesterase 3/4 Inhibitors, RPL554
(9,10-Dimethoxy-2-(2,4,6-trimethylphenylimino)-3-(N-carbamoyl-2-aminoethy-
l)-3,4,6,7-tetrahydro-2H-pyrimido(6,1-a)isoquinolin-4-one) and
RPL565
(6,7-Dihydro-2-(2,6-diisopropylphenoxy)-9,10-dimethoxy-4H-pyrimido(6,1-a)-
isoquinolin-4-one). Journal of Pharmacology and Experimental
Therapeutics 2006; 318(2):840-848).; YM-976
[0043] Examples of PDE4B inhibitors tested in clinical trials or
currently in clinical trials include the following:
[0044] Cilomilast (Ariflo, SB-207,499) is currently in clinical
development by GlaxoSmithKline for COPD treatment; Drotaverine
(INN, also known as drotaverin) A few small 2003 studies found
drotaverine to be nearly 80% effective in treating renal colic
(Romics I, Molnar D L, Timberg G, et al. (July 2003) "The effect of
drotaverine hydrochloride in acute colicky pain caused by renal and
ureteric stones". BJU International 92 (1): 92-6.
doi:10.1046/j.1464-410X.2003.04262.x. PMID 12823389; Garmish O S,
Zabashnyi S I, Smirnova E V, Kobeliatski{hacek over (i)} IuIu
(February 2003) "[Preparation no-shpa forte for the treatment of
renal colic]" (in Russian). Klinichna Khirurhiia (2): 47-50. PMID
12784437) Drotaverine has also been studied in accelerating labor
by speeding up cervical dilation, but the results have been
conflicting (Singh K C, Jain P, Goel N, Saxena A (January 2004)
"Drotaverine hydrochloride for augmentation of labor".
International Journal of Gynaecology and Obstetrics 84 (1): 17-22.
doi:10.1016/50020-7292(03)00276-5. PMID 14698825; Madhu C,
Mahavarkar S, Bhave S (July 2009) "A randomised controlled study
comparing Drotaverine hydrochloride and Valethamate bromide in the
augmentation of labour". Archives of Gynecology and Obstetrics 282
(1): 11-5. doi:10.1007/s00404-009-1188-8. PMID 19644697; Gupta B,
Nellore V, Mittal S (March 2008) "Drotaverine hydrochloride versus
hyoscine-N-butylbromide in augmentation of labor". International
Journal of Gynaecology and Obstetrics 100 (3): 244-7.
doi:10.1016/j.ijgo.2007.08.020. PMID 18031745). Drotaverine has
been shown to be effective in paracervical block in managing pain
during hysteroscopy and endometrial biopsy when administered
together with mefenamic acid (Sharma J B, Aruna J, Kumar P, Roy K
K, Malhotra N, Kumar S (June 2009) "Comparison of efficacy of oral
drotaverine plus mefenamic acid with paracervical block and with
intravenous sedation for pain relief during hysteroscopy and
endometrial biopsy". Indian Journal of Medical Sciences 63 (6):
244-52. doi:10.4103/0019-5359.53394. PMID 19602758). IBS patients
presenting with predominant diarrhea are more likely to benefit
from Buscopan (Khalif I L, Quigley E M, Makarchuk P A, Golovenko O
V, Podmarenkova L F, Dzhanayev Y A (March 2009) "Interactions
between symptoms and motor and visceral sensory responses of
irritable bowel syndrome patients to spasmolytics
(antispasmodics)". Journal of Gastrointestinal and Liver Diseases
18 (1): 17-22. PMID 19337628). Drotaverin has also been tested in
combination with rimantadine for antiviral activity against A and B
type influenza (Zhilinskaya I N, Konovalova N I, Kiselev O I,
Ashmarin I P (2007) "No-Spa and Remantadin are the novel complex
preparations that inhibit effectively reproduction of the avian
influenza viruses". Doklady Biological Sciences 414 (1): 249-50.
doi:10.1134/50012496607030234). Drotaverin has an adverse effects
frequency of 0.9%, side effects being relatively uncommon (Tar A,
Singer J (March 2002) "[Safety profile of NO-SPA]" (in Hungarian).
Orvosi Hetilap 143 (11): 559-62. PMID 12583325). Drotaverine in
sold under brand name No-Spa (Chinoin Pharmaceutical and Chemical
Works, Hungary, a member of the Sanofi-Aventis); Etazolate
(SQ-20,009, EHT-0202) for the treatment of Alzheimer's disease.;
HT-0712; Roflumilast (trade names Daxas, Daliresp) was found to be
effective in clinical trials, however it produced several
dose-limiting side effects including nausea, diarrhea and headache.
Its development is continuing in an attempt to minimize the
incidence of side effects while retaining clinical efficacy (Spina,
D (October 2008) "PDE4 inhibitors: current status". British Journal
of Pharmacology 155 (3): 308-15. doi:10.1038/bjp.2008.307. ISSN
1476-5381. PMC 2567892. PMID 18660825) In June 2010, Daxas was
approved in the EU for severe COPD associated with chronic
bronchitis. In March 2011, Daliresp gained FDA approval in the US
for reducing COPD exacerbations; RPL-554 (LS-193,855) (being
developed by Verona Pharma as a potential treatment for asthma and
hayfever.)
[0045] Rolipram, also known as
4-(3-cyclopentyloxy-4-methoxyphenyl)pyrrolidin-2-one, has the
structure:
##STR00002##
Synthesis of rolipram is described in the two citations below.
Rolipram is commercially available (i.e. from Cayman Chemical,
Sigma-Aldrich). The clinical use of rolipram is limited because of
its behavioral and other side effects, and clinical development of
rolipram was abandoned due to the side effects associated with its
dosing. Newly developed selective PDE IV inhibitors with presumably
higher potency and lower toxicity are currently under
investigation. Rolipram has been described in Demnitz, J.;
LaVecchia, L.; Bacher, E.; Keller, T. H.; Muller, T.; Schu{umlaut
over (r)}ch, F.; Weber, H.-P.; Pombo-Villar, E. Enantiodivergent
Synthesis of (R)- and (S)-Rolipram. Molecules 1998, 3, 107-119.
Rolipram has been described for use in treatment of Alzheimer's
Disease in WO 2006/110588. Synthesis of Rolipram has been described
in Meng-Yang Chang, Pei-Pei Sun, Shui-Tein Chen, Nein-Chen Chang
ChemInform, Volume 35, Issue 19, May 11, 2004.
[0046] Compound A is a compound of formula (I), having the chemical
name
2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-yl-2,3-dihydroimidazo[4,5-c]qu-
inolin-1-yl)-phenyl]propionitrile, and the structure:
##STR00003##
or a pharmaceutically acceptable salt thereof. Compound A and a
method for preparing this compound is disclosed in International
Patent Application WO2006/122806 in Example 7 therein, which is
hereby incorporated by reference.
[0047] The compounds of formula (I) may be used alone or in
compositions together with a pharmaceutically acceptable carrier or
excipient. Pharmaceutical compositions of the present invention
comprise a therapeutically effective amount of a compound of
formula (I) formulated together with one or more pharmaceutically
acceptable carriers. As used herein, the term "pharmaceutically
acceptable carrier" means a non-toxic, inert solid, semi-solid or
liquid filler, diluent, encapsulating material or formulation
auxiliary of any type. Some examples of materials which can serve
as pharmaceutically acceptable carriers are sugars such as lactose,
glucose and sucrose; starches such as corn starch and potato
starch; cellulose and its derivatives such as sodium carboxymethyl
cellulose, ethyl cellulose and cellulose acetate; powdered
tragacanth; malt; gelatin; talc; excipients such as cocoa butter
and suppository waxes; oils such as peanut oil, cottonseed oil;
safflower oil; sesame oil; olive oil; corn oil and soybean oil;
glycols; such a propylene glycol; esters such as ethyl oleate and
ethyl laurate; agar; buffering agents such as magnesium hydroxide
and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic
saline; Ringer's solution; ethyl alcohol, and phosphate buffer
solutions, as well as other non-toxic compatible lubricants such as
sodium lauryl sulfate and magnesium stearate, as well as coloring
agents, releasing agents, coating agents, sweetening, flavoring and
perfuming agents, preservatives and antioxidants can also be
present in the composition, according to the judgment of the
formulator. Other suitable pharmaceutically acceptable excipients
are described in "Remington's Pharmaceutical Sciences," Mack Pub.
Co., New Jersey, 1991, incorporated herein by reference.
[0048] The compounds of formula (I) may be administered to humans
and other animals orally, parenterally, sublingually, by
aerosolization or inhalation spray, rectally, intracisternally,
intravaginally, intraperitoneally, bucally, or topically in dosage
unit formulations containing conventional nontoxic pharmaceutically
acceptable carriers, adjuvants, and vehicles as desired. Topical
administration may also involve the use of transdermal
administration such as transdermal patches or ionophoresis devices.
The term parenteral as used herein includes subcutaneous
injections, intravenous, intramuscular, intrasternal injection, or
infusion techniques.
[0049] Methods of formulation are well known in the art and are
disclosed, for example, in Remington: The Science and Practice of
Pharmacy, Mack Publishing Company, Easton, Pa., 19th Edition
(1995). Pharmaceutical compositions for use in the present
invention can be in the form of sterile, non-pyrogenic liquid
solutions or suspensions, coated capsules, suppositories,
lyophilized powders, transdermal patches or other forms known in
the art.
[0050] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions may be formulated according to
the known art using suitable dispersing or wetting agents and
suspending agents. The sterile injectable preparation may also be a
sterile injectable solution, suspension or emulsion in a nontoxic
parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-propanediol or 1,3-butanediol. Among the acceptable
vehicles and solvents that may be employed are water, Ringer's
solution, U.S.P. and isotonic sodium chloride solution. In
addition, sterile, fixed oils are conventionally employed as a
solvent or suspending medium. For this purpose any bland fixed oil
may be employed including synthetic mono- or diglycerides. In
addition, fatty acids such as oleic acid find use in the
preparation of injectables. The injectable formulations can be
sterilized, for example, by filtration through a
bacterial-retaining filter, or by incorporating sterilizing agents
in the form of sterile solid compositions which can be dissolved or
dispersed in sterile water or other sterile injectable medium prior
to use.
[0051] In order to prolong the effect of a drug, it is often
desirable to slow the absorption of the drug from subcutaneous or
intramuscular injection. This may be accomplished by the use of a
liquid suspension of crystalline or amorphous material with poor
water solubility. The rate of absorption of the drug then depends
upon its rate of dissolution which, in turn, may depend upon
crystal size and crystalline form. Alternatively, delayed
absorption of a parenterally administered drug form may be
accomplished by dissolving or suspending the drug in an oil
vehicle. Injectable depot forms are made by forming microencapsule
matrices of the drug in biodegradable polymers such as
polylactide-polyglycolide. Depending upon the ratio of drug to
polymer and the nature of the particular polymer employed, the rate
of drug release can be controlled. Examples of other biodegradable
polymers include poly(orthoesters) and poly(anhydrides). Depot
injectable formulations may also be prepared by entrapping the drug
in liposomes or microemulsions, which are compatible with body
tissues.
[0052] Compositions for rectal or vaginal administration are
preferably suppositories which can be prepared by mixing the
compounds of this invention with suitable non-irritating excipients
or carriers such as cocoa butter, polyethylene glycol or a
suppository wax which are solid at ambient temperature but liquid
at body temperature and therefore melt in the rectum or vaginal
cavity and release the active compound.
[0053] Solid dosage forms for oral administration include capsules,
tablets, pills, powders, and granules. In such solid dosage forms,
the active compound is mixed with at least one inert,
pharmaceutically acceptable excipient or carrier such as sodium
citrate or dicalcium phosphate and/or a) fillers or extenders such
as starches, lactose, sucrose, glucose, mannitol, and silicic acid,
b) binders such as, for example, carboxymethylcellulose, alginates,
gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants
such as glycerol, d) disintegrating agents such as agar-agar,
calcium carbonate, potato or tapioca starch, alginic acid, certain
silicates, and sodium carbonate, e) solution retarding agents such
as paraffin, f) absorption accelerators such as quaternary ammonium
compounds, g) wetting agents such as, for example, acetyl alcohol
and glycerol monostearate, h) absorbents such as kaolin and
bentonite clay, and i) lubricants such as talc, calcium stearate,
magnesium stearate, solid polyethylene glycols, sodium lauryl
sulfate, and mixtures thereof. In the case of capsules, tablets and
pills, the dosage form may also comprise buffering agents.
[0054] Solid compositions of a similar type may also be employed as
fillers in soft and hard-filled gelatin capsules using such
excipients as lactose or milk sugar as well as high molecular
weight polyethylene glycols and the like.
[0055] The solid dosage forms of tablets, dragees, capsules, pills,
and granules can be prepared with coatings and shells such as
enteric coatings and other coatings well known in the
pharmaceutical formulating art. They may optionally contain
opacifying agents and can also be of a composition that they
release the active ingredient(s) only, or preferentially, in a
certain part of the intestinal tract, optionally, in a delayed
manner. Examples of embedding compositions that can be used include
polymeric substances and waxes.
[0056] The active compounds can also be in micro-encapsulated form
with one or more excipients as noted above. The solid dosage forms
of tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings, release
controlling coatings and other coatings well known in the
pharmaceutical formulating art. In such solid dosage forms the
active compound may be admixed with at least one inert diluent such
as sucrose, lactose or starch. Such dosage forms may also comprise,
as is normal practice, additional substances other than inert
diluents, e.g., tableting lubricants and other tableting aids such
a magnesium stearate and microcrystalline cellulose. In the case of
capsules, tablets and pills, the dosage forms may also comprise
buffering agents. They may optionally contain opacifying agents and
can also be of a composition that they release the active
ingredient(s) only, or preferentially, in a certain part of the
intestinal tract, optionally, in a delayed manner. Examples of
embedding compositions that can be used include polymeric
substances and waxes.
[0057] Liquid dosage forms for oral administration include
pharmaceutically acceptable emulsions, microemulsions, solutions,
suspensions, syrups and elixirs. In addition to the active
compounds, the liquid dosage forms may contain inert diluents
commonly used in the art such as, for example, water or other
solvents, solubilizing agents and emulsifiers such as ethyl
alcohol, isopropyl alcohol, ethyl carbonate, EtOAc, benzyl alcohol,
benzyl benzoate, propylene glycol, 1,3-butylene glycol,
dimethylformamide, oils (in particular, cottonseed, groundnut,
corn, germ, olive, castor, and sesame oils), glycerol,
tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid
esters of sorbitan, and mixtures thereof. Besides inert diluents,
the oral compositions can also include adjuvants such as wetting
agents, emulsifying and suspending agents, sweetening, flavoring,
and perfuming agents.
[0058] Dosage forms for topical or transdermal administration of a
compound of this invention include ointments, pastes, creams,
lotions, gels, powders, solutions, sprays, inhalants or patches.
The active component is admixed under sterile conditions with a
pharmaceutically acceptable carrier and any needed preservatives or
buffers as may be required. Ophthalmic formulations, ear drops, and
the like are also contemplated as being within the scope of this
invention.
[0059] The ointments, pastes, creams and gels may contain, in
addition to an active compound of this invention, excipients such
as animal and vegetable fats, oils, waxes, paraffins, starch,
tragacanth, cellulose derivatives, polyethylene glycols, silicones,
bentonites, silicic acid, talc and zinc oxide, or mixtures
thereof.
[0060] Compositions of the invention may also be formulated for
delivery as a liquid aerosol or inhalable dry powder. Liquid
aerosol formulations may be nebulized predominantly into particle
sizes that can be delivered to the terminal and respiratory
bronchioles.
[0061] Aerosolized formulations of the invention may be delivered
using an aerosol forming device, such as a jet, vibrating porous
plate or ultrasonic nebulizer, preferably selected to allow the
formation of an aerosol particles having with a mass medium average
diameter predominantly between 1 to 5 .mu.m. Further, the
formulation preferably has balanced osmolarity ionic strength and
chloride concentration, and the smallest aerosolizable volume able
to deliver effective dose of the compounds of the invention to the
site of the infection. Additionally, the aerosolized formulation
preferably does not impair negatively the functionality of the
airways and does not cause undesirable side effects.
[0062] Aerosolization devices suitable for administration of
aerosol formulations of the invention include, for example, jet,
vibrating porous plate, ultrasonic nebulizers and energized dry
powder inhalers, that are able to nebulize the formulation of the
invention into aerosol particle size predominantly in the size
range from 1-5 .mu.. Predominantly in this application means that
at least 70% but preferably more than 90% of all generated aerosol
particles are within 1-5 .mu.m rang. A jet nebulizer works by air
pressure to break a liquid solution into aerosol droplets.
Vibrating porous plate nebulizers work by using a sonic vacuum
produced by a rapidly vibrating porous plate to extrude a solvent
droplet through a porous plate. An ultrasonic nebulizer works by a
piezoelectric crystal that shears a liquid into small aerosol
droplets. A variety of suitable devices are available, including,
for example, AERONEB and AERODOSE vibrating porous plate nebulizers
(AeroGen, Inc., Sunnyvale, Calif.), SIDESTREAM nebulizers
(Medic-Aid Ltd., West Sussex, England), PARI LC and PARI LC STAR
jet nebulizers (Pari Respiratory Equipment, Inc., Richmond, Va.),
and AEROSONIC (DeVilbiss Medizinische Produkte (Deutschland) GmbH,
Heiden, Germany) and ULTRAAIRE (Omron Healthcare, Inc., Vernon
Hills, Ill.) ultrasonic nebulizers.
[0063] Compounds of the invention may also be formulated for use as
topical powders and sprays that can contain, in addition to the
compounds of this invention, excipients such as lactose, talc,
silicic acid, aluminum hydroxide, calcium silicates and polyamide
powder, or mixtures of these substances. Sprays can additionally
contain customary propellants such as chlorofluorohydrocarbons.
[0064] Transdermal patches have the added advantage of providing
controlled delivery of a compound to the body. Such dosage forms
can be made by dissolving or dispensing the compound in the proper
medium. Absorption enhancers can also be used to increase the flux
of the compound across the skin. The rate can be controlled by
either providing a rate controlling membrane or by dispersing the
compound in a polymer matrix or gel. The compounds of the present
invention can also be administered in the form of liposomes. As is
known in the art, liposomes are generally derived from
phospholipids or other lipid substances. Liposomes are formed by
mono- or multi-lamellar hydrated liquid crystals that are dispersed
in an aqueous medium. Any non-toxic, physiologically acceptable and
metabolizable lipid capable of forming liposomes can be used. The
present compositions in liposome form can contain, in addition to a
compound of the present invention, stabilizers, preservatives,
excipients, and the like. The preferred lipids are the
phospholipids and phosphatidyl cholines (lecithins), both natural
and synthetic. Methods to form liposomes are known in the art. See,
for example, Prescott (ed.), "Methods in Cell Biology," Volume XIV,
Academic Press, New York, 1976, p. 33 et seq.
[0065] A compound of formula (I) can be administered alone or in
combination with a PDE4B inhibitor, possible combination therapy
taking the form of fixed combinations or the administration of a
compound of formula (I) and a PDE4B inhibitor being staggered or
given independently of one another. Long-term therapy is equally
possible as is adjuvant therapy in the context of other treatment
strategies, as described above. Other possible treatments are
therapy to maintain the patient's status after tumor regression, or
even chemopreventive therapy, for example in patients at risk.
[0066] Effective amounts of the compounds of the invention
generally include any amount sufficient to detectably inhibit the
growth or proliferation of mucoepidermoid carcinoma cells, or by
detecting an inhibition or alleviation of symptoms of
mucoepidermoid carcinoma. The amount of active ingredient that may
be combined with the carrier materials to produce a single dosage
form will vary depending upon the host treated and the particular
mode of administration. It will be understood, however, that the
specific dose level for any particular patient will depend upon a
variety of factors including the activity of the specific compound
employed, the age, body weight, general health, sex, diet, time of
administration, route of administration, rate of excretion, drug
combination, and the severity of the particular disease undergoing
therapy. The therapeutically effective amount for a given situation
can be readily determined by routine experimentation and is within
the skill and judgment of the ordinary clinician.
[0067] According to the methods of treatment of the present
invention, mucoepidermoid tumor growth is reduced or prevented in a
patient such as a human or lower mammal by administering to the
patient an amount of a compound of formula (I), in such amounts and
for such time as is necessary to achieve the desired result. An
"amount that is effective to inhibit growth or proliferation of the
mucoepidermoid carcinoma cells" of a compound of formula (I) refers
to a sufficient amount of the compound to treat mucoepidermoid
tumor growth, at a reasonable benefit/risk ratio applicable to any
medical treatment.
[0068] If the compound of formula (I) is administered in
combination with a PDE4B inhibitor, the term "amount that is
effective to inhibit growth or proliferation of the mucoepidermoid
carcinoma cells" is understood to mean that amount of a compound of
formula (I) in combination with a specific PDE4B inhibitor to
achieve the desired effect. In other words, a suitable combination
therapy according to the current invention encompasses an amount of
the compound of formula (I) and an amount of PDE4B inhibitor,
either of which when given alone at that particular dose would not
constitute an effective amount, but administered in combination
would be an "amount that is effective to inhibit growth or
proliferation of the mucoepidermoid carcinoma cells".
[0069] It will be understood, however, that the total daily usage
of the compounds and compositions of the present invention will be
decided by the attending physician within the scope of sound
medical judgment. The specific therapeutically effective dose level
for any particular patient will depend upon a variety of factors
including the disorder being treated and the severity of the
disorder; the activity of the specific compound employed; the
specific composition employed; the age, body weight, general
health, sex and diet of the patient; the time of administration,
route of administration, and rate of excretion of the specific
compound employed; the duration of the treatment; drugs used in
combination or coincidental with the specific compound employed;
and like factors well known in the medical arts.
[0070] The dose of a compound of the formula (I) or a
pharmaceutically acceptable salt thereof to be administered to
warm-blooded animals, for example humans of approximately 70 kg
body weight, is preferably from approximately 3 mg to approximately
5 g, more preferably from approximately 10 mg to approximately 1.5
g, most preferably from about 100 mg to about 1000 mg per person
per day, divided preferably into 1 to 3 single doses which may, for
example, be of the same size. Usually, children receive half of the
adult dose.
[0071] The dose of the PDE4B inhibitor to be administered in
combination therapy to warm-blooded animals, for example humans, is
preferably from approximately 0.01 mg/kg to approximately 1000
mg/kg, more preferably from approximately 1 mg/kg to approximately
100 mg/kg, per day, divided preferably into 1 to 3 single doses
which may, for example, be of the same size. Usually children
receive half of the adult dose, and thus the preferential dose
range for the PDE4B inhibitor in children is 0.5 mg/kg to
approximately 500 mg/kg, per day, divided preferably into 1 to 3
single doses that may be of the same size.
[0072] Alternate embodiments of the compounds of formula (I) are
given below:
[0073] 1) Compounds where R.sup.1 is methyl;
[0074] 2) Compounds where R.sup.2 is methyl;
[0075] 3) Compounds where R.sup.3 is methyl;
[0076] 4) Compounds where R.sup.4 is: [0077] a. Pyridyl
unsubstituted or substituted by halogen, cyano, lower alkyl, lower
alkoxy or piperazinyl unsubstituted or substituted by lower alkyl;
[0078] b. Pyrimidinyl unsubstituted or substituted by lower alkoxy;
[0079] c. Quinolinyl unsubstituted or substituted by halogen;
[0080] d. Qunionlinyl; or [0081] e. Quinoxalinyl.
[0082] It is understood that additional embodiments of the
compounds of formula (I) can be selected by requiring one or more
of the embodiments (1) through (4) above of the compounds of
formula (I). For example, further alternate embodiments can be
obtained by combining (1) and (2); (1) and (3); (2) and (3); (1),
(2), and (3); (1) and (4)(a); (1) and (4)(b); (1) and (4)(c); (1)
and (4)(d); (1) and (4)(e); (2) and (4)(a); (2) and (4)(b); (2) and
(4)(c); (2) and (4)(d); (2) and (4)(e); (3) and (4)(a); (3) and
(4)(b); (3) and (4)(c); (3) and (4)(d); (3) and (4)(e); (1), (2),
and (4)(a); (1), (2), and (4)(b); (1), (2), and (4)(c); (1), (2),
and (4)(d); (1), (2), and (4)(e); (1), (3), and (4)(a); (1), (3),
and (4)(b); (1), (3), and (4)(c); (1), (3), and (4)(d); (1), (3),
and (4)(e); (2), (3), and (4)(a); (2), (3), and (4)(b); (2), (3),
and (4)(c); (2), (3), and (4)(d); (2), (3), and (4)(e); (1), (2),
(3), and (4)(a); (1), (2), (3), and (4)(b); (1), (2), (3), and
(4)(c); (1), (2), (3), and (4)(d); and (1), (2), (3), and
(4)(e).
[0083] The compounds of formula (I) may be prepared according to
PCT Patent Application Publication Number WO 2006/122806, published
Nov. 23, 2006, which is hereby incorporated by reference as if
fully set forth.
[0084] For example, the compounds of formula (I) may be synthesized
by reacting a compound of formula (II)
##STR00004##
wherein R.sub.1, R.sub.2, and R.sub.3 are as defined for a compound
of the formula (I) with a boronic acid of the formula (III)
R.sub.4--B(OH).sub.2 (III)
or of formula (IIIa)
##STR00005##
wherein R.sub.4 is as defined for a compound of the formula (I) in
the presence of a base and a catalyst in a suitable solvent; where
the above starting compounds (II) and (III) may also be present
with functional groups in protected form if necessary and/or in the
form of salts, provided a salt-forming group is present and the
reaction in salt form is possible; any protecting groups in a
protected derivative of a compound of the formula (I) are removed;
and, if so desired, an obtainable compound of formula (I) is
converted into another compound of formula (I), a free compound of
formula (I) is converted into a salt, an obtainable salt of a
compound of formula (I) is converted into the free compound or
another salt, and/or a mixture of isomeric compounds of formula (I)
is separated into the individual isomers.
[0085] Detailed Description of the Process:
[0086] In the more detailed description of the process below,
R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are as defined for compounds
of formula (I), unless otherwise indicated.
[0087] The reaction of compound of formula (II) and (III) is
preferably carried out under the conditions of a Suzuki-reaction,
preferably in a mixture of a polar aprotic solvent such as DMF and
water in the presence of a catalyst, especially a noble metal
catalyst, such as palladium (II), preferable
bis(triphenylphosphine)palladium (II) dichloride; in the presence
of a base such as potassium carbonate.
[0088] Protecting Groups
[0089] If one or more other functional groups, for example carboxy,
hydroxy, amino, or mercapto, are or need to be protected in a
compound of formulae (II) or (III), because they should not take
part in the reaction, these are such groups as are usually used in
the synthesis of peptide compounds, and also of cephalosporins and
penicillins, as well as nucleic acid derivatives and sugars.
[0090] The protecting groups may already be present in precursors
and should protect the functional groups concerned against unwanted
secondary reactions, such as acylations, etherifications,
esterifications, oxidations, solvolysis, and similar reactions. It
is a characteristic of protecting groups that they lend themselves
readily, i.e. without undesired secondary reactions, to removal,
typically by acetolysis, protonolysis, solvolysis, reduction,
photolysis or also by enzyme activity, for example under conditions
analogous to physiological conditions, and that they are not
present in the end-products. The specialist knows, or can easily
establish, which protecting groups are suitable with the reactions
mentioned hereinabove and hereinafter.
[0091] The protection of such functional groups by such protecting
groups, the protecting groups themselves, and their removal
reactions are described for example in standard reference works,
such as J. F. W. McOmie, "Protective Groups in Organic Chemistry",
Plenum Press, London and New York 1973, in T. W. Greene,
"Protective Groups in Organic Synthesis", Wiley, New York 1981, in
"The Peptides"; Volume 3 (editors: E. Gross and J. Meienhofer),
Academic Press, London and New York 1981, in "Methoden der
organischen Chemie" (Methods of organic chemistry), Houben Weyl,
4th edition, Volume 15/I, Georg Thieme Verlag, Stuttgart 1974, in
H.-D. Jakubke and H. Jescheit, "Aminosauren, Peptide, Proteine"
(Amino acids, peptides, proteins), Verlag Chemie, Weinheim,
Deerfield Beach, and Basel 1982, and in Jochen Lehmann, "Chemie der
Kohlenhydrate: Monosaccharide and Derivate" (Chemistry of
carbohydrates: monosaccharides and derivatives), Georg Thieme
Verlag, Stuttgart 1974.
[0092] Additional Process Steps
[0093] In the additional process steps, carried out as desired,
functional groups of the starting compounds which should not take
part in the reaction may be present in unprotected form or may be
protected for example by one or more of the protecting groups
mentioned hereinabove under "protecting groups". The protecting
groups are then wholly or partly removed according to one of the
methods described there.
[0094] Salts of a compound of formula I with a salt-forming group
may be prepared in a manner known per se. Acid addition salts of
compounds of formula (I) may thus be obtained by treatment with an
acid or with a suitable anion exchange reagent. A salt with two
acid molecules (for example a dihalogenide of a compound of formula
(I)) may also be converted into a salt with one acid molecule per
compound (for example a monohalogenide); this may be done by
heating to a melt, or for example by heating as a solid under a
high vacuum at elevated temperature, for example from 130 to
170.degree. C., one molecule of the acid being expelled per
molecule of a compound of formula (I).
[0095] Salts can usually be converted to free compounds, e.g. by
treating with suitable basic compounds, for example with alkali
metal carbonates, alkali metal hydrogencarbonates, or alkali metal
hydroxides, typically potassium carbonate or sodium hydroxide.
[0096] Stereoisomeric mixtures, e.g. mixtures of diastereomers, can
be separated into their corresponding isomers in a manner known per
se by means of suitable separation methods. Diastereomeric mixtures
for example may be separated into their individual diastereomers by
means of fractionated crystallization, chromatography, solvent
distribution, and similar procedures. This separation may take
place either at the level of a starting compound or in a compound
of formula (I) itself. Enantiomers may be separated through the
formation of diastereomeric salts, for example by salt formation
with an enantiomer-pure chiral acid, or by means of chromatography,
for example by HPLC, using chromatographic substrates with chiral
ligands.
[0097] It should be emphasized that reactions analogous to the
conversions mentioned in this chapter may also take place at the
level of appropriate intermediates.
[0098] General Process Conditions
[0099] All process steps described here can be carried out under
known reaction conditions, preferably under those specifically
mentioned, in the absence of or usually in the presence of solvents
or diluents, preferably such as are inert to the reagents used and
able to dissolve these, in the absence or presence of catalysts,
condensing agents or neutralizing agents, for example ion
exchangers, typically cation exchangers, for example in the H.sup.+
form, depending on the type of reaction and/or reactants at
reduced, normal, or elevated temperature, for example in the range
from -100.degree. C. to about 190.degree. C., preferably from about
-80.degree. C. to about 150.degree. C., for example at -80 to
-60.degree. C., at room temperature, at -20 to 40.degree. C. or at
the boiling point of the solvent used, under atmospheric pressure
or in a closed vessel, where appropriate under pressure, and/or in
an inert atmosphere, for example under argon or nitrogen.
[0100] Salts may be present in all starting compounds and
transients, if these contain salt-forming groups. Salts may also be
present during the reaction of such compounds, provided the
reaction is not thereby disturbed.
[0101] At all reaction stages, isomeric mixtures that occur can be
separated into their individual isomers, e.g. diastereomers or
enantiomers, or into any mixtures of isomers, e.g. racemates or
diastereomeric mixtures, typically as described under "Additional
process steps".
[0102] The solvents from which those can be selected which are
suitable for the reaction in question include for example water,
esters, typically lower alkyl-lower alkanoates, e.g ethyl acetate,
ethers, typically aliphatic ethers, e.g. diethylether, or cyclic
ethers, e.g. tetrahydrofuran, liquid aromatic hydrocarbons,
typically benzene or toluene, alcohols, typically methanol, ethanol
or 1- or 2-propanol, 1-butanol, nitriles, typically acetonitrile,
halogenated hydrocarbons, typically dichloromethane, acid amides,
typically dimethylformamide, bases, typically heterocyclic nitrogen
bases, e.g. pyridine, carboxylic acids, typically lower
alkanecarboxylic acids, e.g. acetic acid, carboxylic acid
anhydrides, typically lower alkane acid anhydrides, e.g. acetic
anhydride, cyclic, linear, or branched hydrocarbons, typically
cyclohexane, hexane, or isopentane, or mixtures of these solvents,
e.g. aqueous solutions, unless otherwise stated in the description
of the process. Such solvent mixtures may also be used in
processing, for example through chromatography or distribution.
[0103] The compounds of formula (I), including their salts, are
also obtainable in the form of hydrates, or their crystals can
include for example the solvent used for crystallization (present
as solvates).
[0104] In the preferred embodiment, a compound of formula (I) is
prepared according to or in analogy to the processes and process
steps defined in the Examples.
[0105] Starting Materials
[0106] New starting materials and/or intermediates, as well as
processes for the preparation thereof, are further disclosed in
International Patent Application No. WO 206/122806.
[0107] Starting materials of the formula (II) and (III) are known,
commercially available, or can be synthesized in analogy to or
according to methods that are known in the art.
[0108] For example, a compound of the formula (II) can be prepared
by the alkylation of an amino compound of the formula (IV),
##STR00006##
[0109] wherein R.sup.1 and R.sup.2 have the meanings as given under
formula (I) with a compound of formula (V)
R.sup.3--X (V)
[0110] wherein R.sup.3 has the meaning as given under formula (I)
and X is halogen or another suitable leaving group, in the presence
of a base, e.g. sodium hydroxide, in a suitable solvent, e.g. a
mixture of dichloromethane and water, preferably in the presence of
a phase transfer catalyst, e.g. tetrabutylammonium bromide, at a
temperature between 0.degree. C. and 50.degree. C., preferably at
room temperature.
[0111] A compound of the formula (IV) can be prepared by the
cyclization of a diamino compound of the formula (VI),
##STR00007##
[0112] wherein R.sup.1 and R.sup.2 have the meanings as given under
formula (I) with trichloromethyl chloroformate in the presence of a
base, such as triethylamine in an appropriate solvent, such as
dichloromethane.
[0113] A compound of the formula (VI) can be prepared by the
reduction of a nitro compound of the formula (VII),
##STR00008##
wherein R.sup.1 and R.sup.2 have the meanings as given under
formula (I).
[0114] The reduction preferably takes place in the presence of a
suitable reducing agent, such as hydrogen in the presence of an
appropriate catalyst, such as Raney nickel under pressure, e.g.
between 1.1 and 2 bar, in an appropriate solvent, e.g. an alcohol
or ether, such as methanol or tetrahydrofurane or a mixture
thereof. The reaction temperature is preferably between 0 and
80.degree. C., especially 15 to 30.degree. C.
[0115] A compound of the formula (VII) can be prepared by reaction
of a compound (VIII)
##STR00009##
[0116] wherein Y is halogen or another suitable leaving group, is
reacted with a compound of the formula (IX),
##STR00010##
[0117] wherein R.sup.1 and R.sup.2 are as defined for a compound of
the formula (I), at a temperature between 0.degree. C. and
50.degree. C., preferably at room temperature in a suitable
solvent, i.e. acetic acid.
[0118] All remaining starting materials such as starting materials
of the formula (III), (IV) and (V) are known, capable of being
prepared according to known processes, or commercially obtainable;
in particular, they can be prepared using processes as described in
International Patent Application No. WO 206/122806. The following
Example serves to illustrate the invention without limiting the
invention in its scope.
Example 1
[0119] In the present example, expression arrays were used to
identify genes whose expression is altered by CRTC1-MAML2, and
showed that one of the target genes, PDE4B, is required for
fusion-positive MEC cell growth in vitro and in vivo. The results
demonstrate that combined inhibition of PDE4B and PI3-kinase
signaling is a therapeutic strategy for treating MECs.
[0120] Material and Methods
[0121] Cell Line Culture:
[0122] H292, H3118, HSY (8), 293T and 293FT (Gifts from Dr. William
Hahn's lab, Dana-Farber Cancer Institute, Boston) cells were
cultured in Dulbecco's modified Eagle's medium (DMEM) (Mediatech,
Manassas, Va.), supplemented with 10% heat inactivated fetal bovine
serum (Lonza, Basel, Switzerland) and 1% penicillinstreptomycin
(Mediatech, Manassas, Va.). All cell lines were incubated at
37.degree. C., 5% CO.sub.2.
[0123] Plasmids and Small Hairpin RNAs:
[0124] Small hairpin RNA (shRNA) sequences targeting the MAML2
moiety of CRTC1-MAML2 (sh #A, sh #D) or Luciferase (sh LUC) were
cloned into pSuperRetro-GFP/Neo Vector (Oligoengine Seattle,
Wash.). shRNA lenti-viral constructs targeting PDE4B (#1
TRCN0000048821, #2 TRCN0000048819), PI3-kinase .alpha. (#1
TRCN0000196582, #2 TRCN0000196795) and PI3-kinase .beta. (#1
TRCN0000039982, #2 TRCN0000010024) were obtained from Dana-Farber
RNAi Screening Facility. pLKO.1-scramble control vector was
obtained from Addgene (Addgene, Cambridge, Mass.). pMD2-VSV-G and
pCMV_dr8.sub.--91 were gifts from Dr. William Hahn. shRNA sequences
are provided in Table I.
TABLE-US-00001 TABLE I SEQ. Hairpin Sequence ID. Accession Symbol
Name Hairpin Sequence NO. NM_002600 PDE4B #1
CCGGGCTTGAGTAAATCCTACAGTTCTCGAG 1 TRCN0000048821
AACTGTAGGATTTACTCAAGCTTTTTG #2 CCGGGCGCAGAGAGTCATTTCTCTACTCGAG 2
TRCN0000048819 TAGAGAAATGACTCTCTGCGCTTTTTG AY040324 CRTC1- sh #A
GTAATCAACCTAACACATA 3 MAML2 sh #D GACAGAGCCTGGTAATGAT 4 shLUC
CATCACGTACGCGGAATAC 5 NM_006218 PIK3CA #1
GCCGGCCAGATGTATTGCTTGGTAAACTCGA 6 TRCN0000195203
GTTTACCAAGCAATACATCTGGTTTTTTG #2 CCCGGGCATTAGAATTTACAGCAAGACTCG 7
TRCN0000196582 AGTCTTGCTGTAAATTCTAATGCTTTTTTG NM_006219 PIK3CB #1
CCGGGCGGGAGAGTAGAATATGTTTCTCGA 8 TRCN0000039982
GAAACATATTCTACTCTCCCGCTTTTTG #2 CCGGTATCCTGTAGCGTGGGTAAATCTCGAG 9
TRCN0000010024 ATTTACCCACGCTACAGGATATTTTT
[0125] Viral Transduction and Infection:
[0126] As described in Chen et al. Genes Cancer, 1:822-835 (2010),
retroviruses were produced by transfecting sh #A, sh #D or shLUC
vectors together with packing plasmid pMD.MLV and pseudotyped
envelope pMD2-VSV-G into 293T cells. To produce lenti-virus,
lenti-viral vectors targeting PDE4B, PI3-kinase .alpha.,
PI3-kinase-.beta. or PLKO.1-scramble control plasmid together with
packing plasmid pCMV_dr8.sub.--91 and pMD2-VSV-G were transfected
into 293FT cells. Virus was collected 48 and 72 hours
post-transfection. Target cells were infected twice with virus for
6 hours.
[0127] Microarray Experiments:
[0128] H3118 or HSY cells were transduced twice with retro-virus
harboring shLUC or sh#D. GFP-positive cells were sorted 48 hours
post-transduction. Total RNA was extracted using Trizol reagents
(Invitrogen) and purified by RNAeasy Mini Column (QIAGEN).
Hybridization with Affymetrix U133A plus.sub.--2 microarray chips
was performed and analyzed at Dana-Farber Cancer Institute
Microarray Core. The d-Chip analysis software was used for the
analysis; Li, C. and Wong, W. H. Proc. Natl. Acad. Sci. USA (2009)
106: 268-273. Genes with three fold expression changes in H3118
cells were considered significant (n=3, p<=0.05).
[0129] Western Blot Analysis:
[0130] Fifty micrograms of cell extracts were separated by
SDS-polyacrylamide gels using standard methods, for example, Chen
et al. Genes Cancer, 1:822-835 (2010) and probed with the indicated
antibodies as recommended by the manufacturer. Films were scanned
by Scanwizard Pro7 software using ArtixScan 1800f scanner
(MicroTek). Images were processed and auto-leveled by Adobe
Photoshop software (Adobe, San Jose, Calif.).
[0131] Antibodies and Inhibitors:
[0132] PDE4B (NB100-2562, Novus Biologicals LLC, Littleton, Colo.),
phospho-AKT (#9271, Cell signaling Technology, Danvers, Mass.), AKT
(#9272, Cell signaling), PI3-Kinase .alpha. (#4249, Cell
signaling), PI3-Kinase .beta. (#3011, Cell Signaling), .beta.-actin
(Sigma). Forskolin (F 3917, Sigma), rolipram (PD-177, ENZO Life
Sciences, Plymouth Meeting, Pa.), LY-294002 (#440202, EMB
Biosciences, Gibbstown, N.J.), Compound A (Novartis Institute for
Biomedical Research, Boston, Mass.).
[0133] Quantitative Real-Time Reverse Transcription PCR (qPCR):
[0134] Total RNA was isolated by the Trizol method (Invitrogen).
qPCR was performed using ABI PRISM 7500 sequence detector (Applied
Biosystems, Foster City, Calif.) by SYBR method (Applied
Biosystems). The SYBR method uses SYBR Green I dye, which is a
highly specific, double-stranded DNA binding dye, to detect PCR
product as it accumulates during PCR cycles. All samples were
amplified in triplicates. The relative change of transcript amount
was normalized with the GAPDH mRNA expression levels (20). Primer
sequences are listed in Table II.
TABLE-US-00002 TABLE II SEQ. ID. Accession Symbol Forward primer
Reverse primer NO. NM_002046 GAPDH CAATGACCCCTTCATTGACC
GACAAGCTTCCCGTTCTCAG 10, 11 NM_004417 DUSP1 TCCTGCCCTTTCTGTACCTG
GGACAATTGGCTGAGACGTT 12, 13 NM_002135 NR4A1 AAAACGCCAAGTACATCTGCC
GGACAACTTCCTTCACCATGC 14, 15 NM_173200 NR4A3 CAAGAGACGTCGAAACCGATGT
ACGACCTCTCCTCCCTTTCA 16, 17 NM_002600 PDE4B TGTTGGAAAATCATCACCTTGCT
CTGAGTGTCTGACGCTGCTTCT 18, 19 NM_019089 HES2 CATGCTTGCCACCTCTTGCT
CCGTGACTGCTTGAGTTGTAGCT 20, 21 AY040324 MECT1- TTCGAGGAGGTCATGAAGGA
TTGCTGTTGGCAGGAGATAG 22, MAML2 23 NM_032427 MAML2
CTAACCCCTGCTCAAATCCA GCCTTGACAAATGTCGGTTT 24, 25
[0135] Cell Growth, MTS Assays, Cell Cycle Analysis and Apoptosis
Assay:
[0136] The Methods were described previously (Chen et al. Genes
Cancer, 1:822-835 (2010)). Cell growth: 1-2.times.10.sup.5 cells
were infected with lenti-virus harboring specific shRNAs. On day 5
post infection, cells were counted by trypan blue exclusion. MTS
proliferation assay (Promega, Madison, Wis.): 1-2.times.10.sup.3
cells were treated with LY-294002, Compound A or DMSO in the
concentration as indicated in FIG. 6A. MTS activities were measured
on day 5. Cell cycle analysis: 1.times.105 cells were treated with
inhibitors or infected with viruses. DNA amount was measured by
flow cytometry analysis (BD FACScans). Apoptosis assay:
1.times.10.sup.5 cells were treated with inhibitors or infected
with virus. Cell viability was measured using the Annexin-V-FLUOS
Staining Kit (Roche Diagnostics, Indianapolis, Ind.) by flow
cytometry analysis (BD FACScans).
[0137] cAMP Measurement:
[0138] Cells were trypsinized and washed once with 1.times.PBS
after treatment. The cell pellet was re-suspended in 100 .mu.l of
0.1M HCL. cAMP amount was measure by Direct Cyclic AMP Enzyme
Immunoassay Kit (#900-066, Assay Designs, Inc., Ann Arbor, Mich.)
according to the manufacturer's protocol. The acetylated version of
the kit was used.
[0139] In Vivo Murine Xenograft Model:
[0140] Mice were maintained and treated in accordance with
institutional guidelines of Dana Farber Cancer Institute Animal
Resource Facilities. H3118 cells were infected twice with shPDE4B-2
or scramble control virus. On day three post-transduction,
5.times.10.sup.6 shPDE4B cells were injected subcutaneously (s.c.)
into one flank of a SCID hairless (SHO) mice (Charles River
Laboratories International, Inc., Wilmington, Mass.) and
5.times.106 control cells were injected into the opposite flank
(Dubrovska et al., Proc Natl Acad Sci USA, 2009, 106: 268-273;
Serra et al. Cancer Res, 2008, 68: 8022-8030). A total of five mice
were used. The tumor volume was measured every two days starting
from day 10, volume=(length.times.width2).times.(.pi./6). Mice were
sacrificed on day 30. The tumors were excised and the weight was
measured.
[0141] Statistical Analysis:
[0142] The values were shown as the mean.+-.SD. Comparison were
performed using student's t test (GraphPad Software, Inc, San
Diego, Calif.). Significant p values were shown as p<0.05 (*),
p<0.01(**), p<0.001(***).
[0143] Results
[0144] Identification of CRTC1-MAML2 Target Genes
[0145] Previous studies aimed at identifying CRTC1-MAML2 target
genes (Wu et al., Embo J, 2005, 24: 2391-2402; Coxon et al., Cancer
Res, 2005, 65: 7137-7144) were based on over-expressing CRTC1-MAML2
in HeLa cells, which do not carry the fusion gene. Here, a system
was employed to identify these target genes by first silencing
fusion gene expression via small hairpin RNAs (shRNAs) in
fusion-dependent MEC cancer cells, and then examining global gene
expression profiles. Two retro-viral constructs were employed
carrying a GFP marker and shRNAs (shRNAs #A and #D) targeting the
MAML2 moiety of CRTC1-MAML2. Retrovirus carrying a shRNA targeting
luciferase (shLUC) was used as a non-silencing control. shRNAs #A
and #D specifically inhibited 30%-70% of CRTC1-MAML2 expression in
fusion positive MEC H292 (parotid origin) and H3118 cells
(pulmonary origin) compared to shLUC. HSY, an immortalized parotid
duct cell line was used as the fusion negative control (FIG. 1A).
MAML2 was down-regulated to similar extent in all three cell lines
(FIG. 7), suggesting effective viral infection. The two forms of
shCRTC1-MAML2 (#A and #D) significantly inhibited cell growth in
the fusion-positive cells including H292 and H3118 as compared to
the shLUC control retrovirus, while having no significant effect on
the growth of fusion-negative HSY cells (FIG. 1B). These data
indicate that these two forms of shCRTC1-MAML2 used specifically
inhibit both the fusion expression and cell growth in the fusion
positive MEC cells.
[0146] To identify CRTC1-MAML2 target genes, shRNA #D was used to
infect H3118 and HSY cells. GFP-positive cells were enriched by
flow-cytometry, total RNA was isolated and microarray analysis was
performed (U133 plus.sub.--2 array, Affimatrix). Expression of 128
genes was found to be altered by greater than or equal to 3 fold in
H3118 cells but not in HSY cells, comparing CRTC1-MAML2 knock-down
to luciferase knock-down in each cell type (FIG. 9). Among the
down-regulated genes were several known CREB target genes,
including STC1, NR4A1, NR4A2, NR4A3 and DUSP1 (Tullai et al. J Biol
Chem, 2007, 282: 9482-9491; Zhang et al., Proc Natl Acad Sci USA,
2005, 102: 4459-4464). The Notch target gene HES2 was up-regulated
7 fold upon CRTC1-MAML2 knock-down. qPCR assays were conducted to
verify the expression changes of selected CREB and Notch target
genes (FIG. 8).
[0147] In addition to known CREB target genes, we found that
expression of phosphodiesterase 4B (PDE4B), was down-regulated
17-fold in H3118 cells upon CRTC1-MAML2 depletion. Further, both
shRNAs #A and #D significantly inhibited PDE4B expression in H3118
and H292 cells, but not in fusion negative HSY cells (FIG. 1C). The
protein level of PDE4B was reduced by CRTC1-MAML2 depletion in
fusion-positive H3118 cells but not in HSY cells (FIG. 1D). PDE4B
is a member of the type IV, cyclic AMP (cAMP)-specific
phosphodiesterase family that regulates the cellular concentrations
of cyclic nucleotides, and is implicated in signal transduction
(Houslay, M., Trends Biochem Sci, 35: 91-100, (2010); Lynch et al,
Curr Tip Dev Biol, 2006, 75: 225-259). PDE4B has been reported to
contribute to the tumor formation in other cancers, such as
leukemia and lymphoma (Smith et al. Blood, 2005, 105:308-316). As
activation of CREB signaling is one of the mechanisms through which
CRTC1-MAML2 exerts its oncogenic activity, the question of whether
PDE4B is regulated in a CREB-dependent manner was investigated. The
adenylyl cyclase activator forskolin, a cAMP/CREB signaling inducer
did not change PDE4B expression in MEC cells (data not shown),
suggesting the promoter of PDE4B does not harbor functional CREB
sites. This is consistent with the report by Zhang et al. showing
that the expression of PED4B was not changed in HEK293T and
pancreatic islet cells by forskolin treatment (Zhang et al., Proc
Natl Acad Sci USA, 2005, 102: 4459). In addition, there was no
detectable CREB and phospho-CBP (CREB Binding Protein) binding on
the promoter of PDE4B in HEK293T, hepatocyte and pancreatic islet
cells by ChIP on CHIP analysis (Zhang et al., Proc Natl Acad Sci
USA, 2005, 102: 4459). Furthermore, the expression of PDE4B was not
affected by shRNA-mediated CREB depletion in MEC cells (data not
shown). These results suggested that PDE4B might be regulated by
CRTC1-MAML2 independent of CREB signaling.
[0148] Inhibition of PDE4B by Rolipram, in Combination with
Forskolin Treatment Inhibits Cell Growth, Causes Cell Cycle Arrest
and Induces Apoptosis in MEC Cells
[0149] Besides the functions in regulating cellular cAMP levels,
the potential role of PDE4B in CRTC1-MAML2 mediated carcinogenesis
in MEC was investigated. Pharmacological inhibitor of PDE4,
rolipram together with cAMP activator forskolin inhibited H292 and
H3118 cell growth by 50%-60% compared to HSY cells (FIG. 2A). The
cell growth was not changed by rolipram treatment alone, but the
inhibitory effect was greatly enhanced by combining both rolipram
and forskolin, suggesting possible regulation of cAMP signaling in
MEC positive cell growth (FIG. 2A). The growth of fusion negative
HSY cells was not affected by PDE4B inhibition, indicating that HSY
cells do not depend on PDE4B for optimal growth (FIG. 2A), though
the expression level of PDE4B is similar in HSY cells compared to
H292 and H3118 cells (data not shown). The molecular mechanisms of
the cell growth inhibition were further determined by analyzing
cell cycle profile and cell apoptotic rate. Twenty four hours of
rolipram plus forskolin treatment caused H292 and H3118 cell cycle
arrest at G1/G0 phase compared to DMSO control (58% vs. 39% in H292
cells, 74% vs. 31% in H3118 cells). While the cell cycle of HSY was
not affected (56% vs. 57%) (FIG. 2C), Rolipram plus forskolin also
significantly induced apoptosis in H292 and H3118 cells, but not
HSY cells (FIG. 2B). Taken together these data demonstrated that
inhibition of PDE4B prevented fusion positive MEC cell growth by
inducing cell cycle arrest and apoptosis.
[0150] Depletion of PDE4B by shRNA Inhibits Cell Growth, Causes
Cell Cycle Arrest and Induces Apoptosis in MEC Cells
[0151] Since more potent and PDE4B isoform-specific inhibitors are
still under development (Pages et al., Expert Opin Ther Pat, 2009,
19: 1501-1519; Srivani et al., Curr Pharm Des, 2008, 14:
3854-3872), two shRNAs (#1 and #2) were used to specifically
knock-down PDE4B (FIG. 3A). Upon depletion of PDE4B by infecting
cells with lenti-viruses harboring the shRNAs, the growth of H292
and H3118 cells was significantly inhibited by 74% and 83%
respectively compared to non-specific scramble control (FIG. 3B).
The down-regulation of PDE4B caused slight growth reduction in HSY
cells, but to a much less extent compared to H292 and H3118 cells.
In addition, knock-down of PDE4B caused H292 and H3118 cell cycle
arrest at G0/G1 phase compared to scramble control (78% vs. 50% in
H292 cells, 79% vs. 57% in H3118 cells), while HSY cells had much
less effect (FIG. 3C). Furthermore, H292 and H3118 cells underwent
significant apoptosis after PDE4B down-regulation, while HSY cells
had no significant effect (FIG. 3D). These data suggested that
specific down-regulation of PDE4B by shRNAs inhibited MEC cell
growth through cell cycle arrest and apoptosis, which was
consistent with the effects of the pharmacological inhibitors of
PDE4B on MEC cells.
[0152] PDE4B is Required for MEC Cell Growth In Vivo
[0153] The functional significance of PDE4B in CRTC1-MAML2 mediated
carcinogenesis in vivo was also evaluated. Five million H3118 cells
infected with lenti-virus harboring shRNA targeting PDE4B (shPDE4B)
were injected s.c. into one flank of a SCID hairless mouse and five
million control cells were injected into the opposite flank. Tumor
volume was measured every two days. Cells with PDE4B knock-down
grew significantly slower than control cells in vivo (FIG. 4A). The
mice were sacrificed after 30 days and the weights of the tumors
were measured. The average weight of the tumors with PDE4B
down-regulation was 88% less than the controls (FIG. 4C). The
expression of PDE4B was repressed by 71% in the tumor biopsies with
PDE4B down-regulation compared to controls (FIG. 4D). Taken
together, these data demonstrated that PDE4B has an important role
in fusion positive MEC cell growth in vivo.
[0154] Inhibition of PDE4B Increases Cellular cAMP Levels in MEC
Cells and Down-Regulates PI3-Kinase Signaling
[0155] As PDE4B is an enzyme that hydrolyzes cAMP, inhibition of
PDE4B was investigated to determine whether inhibition would
increase cellular cAMP levels in CRTC1-MAML2 positive cells. As
determined, rolipram plus forskolin treatment increased cAMP levels
by 7-fold compared to DMSO control in H292 cells. In H3118 cells,
forskolin treatment alone increased cAMP levels by 4-fold, while
combination of rolipram and forskolin further increased cAMP level
to 8-fold. These inhibitors had no effect on HSY cells (FIG. 5A).
Specific knockdown of PDE4B by shRNA significantly increased cAMP
levels in H292 and H3118 cells compared to scramble control, while
HSY cells had little effect (FIG. 5B). These data indicated that
PDE4B specifically regulated cAMP levels in fusion positive MEC
cells.
[0156] As the more potent PDE4B specific inhibitors are yet to be
identified, the signaling pathways that are downstream of PDE4B
were investigated and more effective inhibitors for the CRTC1-MAML2
signaling were sought. Smith et al. reported that PI3-kinase/AKT
signaling is one of the downstream pathways of PDE4B (Smith et al.
Blood, 2005, 105:308-316). After inhibiting PDE4B by rolipram plus
forskolin or shRNA knock-down, decreased phospho-AKT levels were
observed in fusion positive MEC cells compared to control treated
cells, indicating that inhibition of PDE4B leads to down-regulation
of PI3-kinase/AKT signaling (FIGS. 5C and D).
[0157] PI3-Kinase Signaling Contributes to MEC Cell Growth
[0158] PI3-kinase/AKT signaling plays an important role in cell
growth and survival (Courtney et al., J Clin Oncol, 28: 1075-1083,
2010) and may promote cell growth in a PDE4B-dependent manner in
some cancers (Smith et al. Blood, 2005, 105:308-316; McEwan et al.,
Cancer Res, 2007, 67: 5248-5257). Therefore, the contribution of
PI3-kinase signaling to PDE4B mediated tumorigenesis in MEC was
investigated. PI3-kinase inhibitors LY-294002 and Compound A
inhibited H292 and H3118 cell growth in a dose dependent manner,
with IC50 of LY around 4-10 .mu.M and IC50 of Compound A around
6-20 nM (FIG. 6A). MEC cells express PI3-kinase isoforms .alpha.,
.beta. and .delta., with .alpha. and .beta.5- to 20-fold more
abundant than .delta. (data not shown). In order to investigate
whether specific PI3-kinase isoforms play a more important role in
the regulation of MEC cell growth, shRNAs were used to specifically
knock-down .alpha. and .beta. and investigate the growth inhibitory
effects on MEC cells. The down-regulation of PI3-kinase was isoform
specific, as knock-down of .alpha. had no effects on the protein
levels of .beta. and vice versa (FIG. 6B) Inhibition of PI3-kinase
.alpha. in H292 and H3118 cells inhibited 70%-90% of cell growth,
while knock-down of PI3-kinase .beta. reduced 20%-50% of the cell
growth (FIG. 6B), suggesting multiple PI3-kinases contribute to MEC
cell growth. Moreover, Compound A, a PI3-kinase inhibitor in phase
II clinical trials, had additive effect in inhibiting MEC cell
growth when combined with rolipram and forskolin (FIG. 6C). These
data suggested that PI3-kinase signaling contributed significantly
to MEC cell growth, and the combination of PDE4B and PI3-kinase
inhibitors could have synergistic activity in MEC.
[0159] In summary, PDE4B is a novel CRTC1-MAML2 downstream target
gene. Inhibition of PDE4B by either pharmacological inhibitors or
shRNAs prevented MEC cell growth in vitro and in vivo through
inducing cell cycle arrest and apoptosis. In addition, PI3-kinase
signaling significantly contributed to MEC cell growth,
demonstrating that the PI3-kinase inhibitors of formula (I), either
alone or in combination with PDE4B inhibitors represent a promising
therapeutic strategy in treating MECs.
[0160] The definitions and disclosures provided herein govern and
supersede all others incorporated by reference. Although the
invention herein has been described in connection with preferred
embodiments thereof, it will be appreciated by those skilled in the
art that additions, modifications, substitutions, and deletions not
specifically described may be made without departing from the
spirit and scope of the invention as defined in the appended
claims. It is therefore intended that the foregoing detailed
description be regarded as illustrative rather than limiting, and
that it be understood that it is the following claims, including
all equivalents, that are intended to define the spirit and scope
of this invention.
Sequence CWU 1
1
25158DNAArtificial SequenceSynthetic hairpin sequence 1ccgggcttga
gtaaatccta cagttctcga gaactgtagg atttactcaa gctttttg
58258DNAArtificial SequenceSynthetic hairpin sequence 2ccgggcgcag
agagtcattt ctctactcga gtagagaaat gactctctgc gctttttg
58319DNAArtificial SequenceSynthetic hairpin sequence 3gtaatcaacc
taacacata 19419DNAArtificial SequenceSynthetic hairpin sequence
4gacagagcct ggtaatgat 19519DNAArtificial SequenceSynthetic hairpin
sequence 5catcacgtac gcggaatac 19660DNAArtificial SequenceSynthetic
hairpin sequence 6gccggccaga tgtattgctt ggtaaactcg agtttaccaa
gcaatacatc tggttttttg 60760DNAArtificial SequenceSynthetic hairpin
sequence 7cccgggcatt agaatttaca gcaagactcg agtcttgctg taaattctaa
tgcttttttg 60858DNAArtificial SequenceSynthetic hairpin sequence
8ccgggcggga gagtagaata tgtttctcga gaaacatatt ctactctccc gctttttg
58957DNAArtificial SequenceSynthetic hairpin sequence 9ccggtatcct
gtagcgtggg taaatctcga gatttaccca cgctacagga tattttt
571020DNAArtificial SequenceSynthetic forward primer 10caatgacccc
ttcattgacc 201120DNAArtificial SequenceSynthetic reverse primer
11gacaagcttc ccgttctcag 201220DNAArtificial SequenceSynthetic
forward primer 12tcctgccctt tctgtacctg 201320DNAArtificial
SequenceSynthetic reverse primer 13ggacaattgg ctgagacgtt
201421DNAArtificial SequenceSynthetic forward primer 14aaaacgccaa
gtacatctgc c 211521DNAArtificial SequenceSynthetic reverse primer
15ggacaacttc cttcaccatg c 211622DNAArtificial SequenceSynthetic
forward primer 16caagagacgt cgaaaccgat gt 221720DNAArtificial
SequenceSynthetic reverse primer 17acgacctctc ctccctttca
201823DNAArtificial SequenceSynthetic forward primer 18tgttggaaaa
tcatcacctt gct 231922DNAArtificial SequenceSynthetic reverse primer
19ctgagtgtct gacgctgctt ct 222020DNAArtificial SequenceSynthetic
forward primer 20catgcttgcc acctcttgct 202123DNAArtificial
SequenceSynthetic reverse primer 21ccgtgactgc ttgagttgta gct
232220DNAArtificial SequenceSynthetic forward primer 22ttcgaggagg
tcatgaagga 202320DNAArtificial SequenceSynthetic reverse primer
23ttgctgttgg caggagatag 202420DNAArtificial SequenceSynthetic
forward primer 24ctaacccctg ctcaaatcca 202520DNAArtificial
SequenceSynthetic reverse primer 25gccttgacaa atgtcggttt 20
* * * * *
References