U.S. patent application number 14/120177 was filed with the patent office on 2014-08-28 for chimeric isoprenoid synthases and uses thereof.
The applicant listed for this patent is Kyoungwhan Back, Joseph Chappell. Invention is credited to Kyoungwhan Back, Joseph Chappell.
Application Number | 20140242660 14/120177 |
Document ID | / |
Family ID | 39642613 |
Filed Date | 2014-08-28 |
United States Patent
Application |
20140242660 |
Kind Code |
A1 |
Chappell; Joseph ; et
al. |
August 28, 2014 |
Chimeric isoprenoid synthases and uses thereof
Abstract
Provided is a chimeric isoprenoid synthase polypeptide including
a first domain from a first isoprenoid synthase joined to a second
domain from a second, heterologous, isoprenoid synthase, whereby
the chimeric isoprenoid synthase is capable of catalyzing the
production of isoprenoid reaction products that are not produced in
the absence of the second domain of the second, heterologous,
isoprenoid synthase. Also provided is a chimeric isoprenoid
synthase polypeptide including an asymmetrically positioned
heterologous domain, whereby the chimeric isoprenoid synthase is
capable of catalyzing the production of isoprenoid reaction
products that are not produced when the domain is positioned at its
naturally-occurring site in the isoprenoid synthase
polypeptide.
Inventors: |
Chappell; Joseph;
(Lexington, KY) ; Back; Kyoungwhan; (Pukgu,
KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Chappell; Joseph
Back; Kyoungwhan |
Lexington
Pukgu |
KY |
US
KR |
|
|
Family ID: |
39642613 |
Appl. No.: |
14/120177 |
Filed: |
May 2, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13694098 |
Oct 26, 2012 |
8741651 |
|
|
14120177 |
|
|
|
|
12927805 |
Nov 23, 2010 |
8354504 |
|
|
13694098 |
|
|
|
|
11932489 |
Oct 31, 2007 |
|
|
|
12927805 |
|
|
|
|
10717500 |
Nov 21, 2003 |
8106260 |
|
|
11932489 |
|
|
|
|
09514513 |
Feb 28, 2000 |
7186891 |
|
|
10717500 |
|
|
|
|
09134699 |
Aug 14, 1998 |
6072045 |
|
|
09514513 |
|
|
|
|
08631341 |
Apr 12, 1996 |
5824774 |
|
|
09134699 |
|
|
|
|
Current U.S.
Class: |
435/167 ;
435/193; 435/252.3; 435/254.2; 435/419 |
Current CPC
Class: |
C07K 2319/00 20130101;
C12N 15/8243 20130101; C12N 9/88 20130101; C12N 9/00 20130101; C12P
5/007 20130101; C12N 9/1003 20130101 |
Class at
Publication: |
435/167 ;
435/193; 435/252.3; 435/254.2; 435/419 |
International
Class: |
C12P 5/00 20060101
C12P005/00; C12N 9/10 20060101 C12N009/10 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0002] This invention was made in part with Government funding, and
the Government therefore has certain rights in the invention.
Claims
1. A method for producing a chimeric isoprenoid synthase
polypeptide, comprising: (a) providing a cell comprising DNA
encoding the chimeric isoprenoid synthase polypeptide, wherein the
encoded synthase comprises a first isoprenoid synthase polypeptide
domain joined to a second, different, isoprenoid synthase
polypeptide domain such that the chimeric isoprenoid synthase
polypeptide produces one or more isoprenoid products that are not
produced in the absence of the second domain of the second
synthase; and (b) culturing the cell under conditions in which the
chimeric isoprenoid synthase encoded by the DNA is expressed.
2. The method of claim 1, wherein the encoded chimeric isoprenoid
synthase comprises a first isoprenoid synthase polypeptide domain
joined to a second, different, isoprenoid synthase polypeptide
domain, interrupted by or including a ratio determinant domain,
whereby the chimeric isoprenoid synthase polypeptide encoded by the
DNA catalyzes the production of at least one isoprenoid synthase
reaction product that is not produced in the absence of the second
isoprenoid synthase polypeptide and another isoprenoid synthase
reaction product that is produced in the absence of the second
synthase polypeptide domain.
3. The method of claim 1, wherein the encoded chimeric isoprenoid
synthase catalyzes the production of at least one isoprenoid
synthase reaction product that is not produced in the absence of
the second synthase domain.
4. The method of claim 1, wherein the isoprenoid reaction
product(s) is/are cyclic.
5. The method of claim 1, wherein the second domain also determines
the ratio of isoprenoid reaction products.
6. The method of claim 1, wherein the chimeric isoprenoid synthase
polypeptide catalyzes the production of at least two different
isoprenoid reaction products.
7. The method of claim 1, wherein: the first isoprenoid synthase
polypeptide is from a plant isoprenoid synthase; and the second,
different, isoprenoid synthase polypeptide is from a second
isoprenoid synthase.
8. The method of claim 1, wherein one or both of the isoprenoid
synthases is a diterpene synthase.
9. A method for production of an isoprenoid product, comprising:
(a) providing a cell comprising DNA encoding a chimeric isoprenoid
synthase polypeptide, wherein the encoded synthase comprises a
first isoprenoid synthase polypeptide domain joined to a second,
different, isoprenoid synthase polypeptide domain, such that the
chimeric isoprenoid synthase polypeptide produces one or more
isoprenoid products that are not produced in the absence of the
second domain of the second synthase; and (b) culturing the cell
under conditions in which the encoded chimeric isoprenoid synthase
catalyzes the production of an isoprenoid product.
10. The method of claim 9, wherein the encoded chimeric synthase
comprises a first isoprenoid synthase polypeptide domain joined to
a second, different, isoprenoid synthase polypeptide domain,
interrupted by or including a ratio determinant domain, whereby the
chimeric isoprenoid synthase polypeptide encoded by the DNA
catalyzes the production of at least one isoprenoid synthase
reaction product that is not produced in the absence of the second
isoprenoid synthase polypeptide, and another isoprenoid synthase
reaction product that is produced in the absence of the second
synthase polypeptide domain.
11. The method of claim 9, wherein the encoded chimeric synthase
catalyzes the production of at least one isoprenoid synthase
reaction product that is not produced in the absence of the second
isoprenoid synthase domain.
12. The method of claim 9, wherein one or both of the isoprenoid
synthases is a diterpene synthase.
13. The method of claim 9, wherein the second domain also
determines the ratio of isoprenoid reaction products.
14. The method of claim 9, wherein the chimeric isoprenoid synthase
polypeptide catalyzes the production of at least two different
isoprenoid reaction products.
15. The method of claim 9, wherein: the first isoprenoid synthase
polypeptide is from a plant isoprenoid synthase; and the second,
different, isoprenoid synthase polypeptide is from a second
isoprenoid synthase.
16. The method of claim 1, wherein the chimeric isoprenoid synthase
is recovered.
17. The method of claim 9, wherein the isoprenoid product is
recovered.
18. A chimeric isoprenoid synthase polypeptide, comprising a first
isoprenoid synthase polypeptide domain joined to a second,
different, isoprenoid synthase polypeptide domain such that the
chimeric isoprenoid synthase polypeptide produces one or more
isoprenoid products that are not produced in the absence of the
second domain of the second synthase.
19. The chimeric isoprenoid synthase polypeptide of claim 18,
wherein the chimeric synthase catalyzes the production of at least
one isoprenoid synthase reaction product that is not produced in
the absence of the second isoprenoid synthase domain.
20. The chimeric isoprenoid synthase polypeptide of claim 18,
wherein one or both of the isoprenoid synthases is a diterpene
synthase.
21. The chimeric isoprenoid synthase polypeptide of claim 18,
wherein the second domain also determines the ratio of isoprenoid
reaction products.
22. The chimeric isoprenoid synthase polypeptide of claim 18,
wherein the chimeric isoprenoid synthase polypeptide catalyzes
production of at least two different isoprenoid reaction
products.
23. A host cell, comprising the chimeric isoprenoid synthase
polypeptide of claim 18.
24. A host cell, comprising nucleic acid encoding the chimeric
isoprenoid synthase polypeptide of claim 18.
25. The host cell of claim 23 that is a bacterial, yeast cell or a
plant cell.
26. The host cell of claim 24 that is a bacterial, yeast cell or a
plant cell.
27. The method of claim 1, further comprising isolating the
isoprenoid synthase.
28. The method of claim 9, further comprising isolating an
isoprenoid product.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of co-pending U.S. patent
application Ser. No. 13/694,098, filed Oct. 26, 2012, now allowed,
which is a continuation of U.S. patent application Ser. No.
12/927,805, filed Nov. 23, 2010, now issued U.S. Pat. No.
8,354,504, which is a continuation of U.S. patent application Ser.
No. 11/932,489, filed Oct. 31, 2007, now abandoned, which is a
continuation of U.S. patent application Ser. No. 10/717,500, filed
Nov. 21, 2003, now issued U.S. Pat. No. 8,106,260, which is a
continuation of U.S. patent application Ser. No. 09/514,513, filed
Feb. 28, 2000, now issued U.S. Pat. No. 7,186,891, which is a
divisional of U.S. patent application Ser. No. 09/134,699, filed
Aug. 14, 1998, now issued U.S. Pat. No. 6,072,045, which is a
continuation of U.S. patent application Ser. No. 08/631,341, filed
Apr. 12, 1996, now issued U.S. Pat. No. 5,824,774. The disclosure
of each of the above-referenced applications is incorporated herein
by reference in its entirety.
BACKGROUND OF THE INVENTION
[0003] This invention relates to modified isoprenoid synthase
enzymes, their encoding genes, and uses thereof.
[0004] The term isoprenoid is used to refer to a family of
compounds derived from the isoprene building block. In particular,
plant isoprenoids comprise a structurally diverse group of
compounds that can be divided into classes of primary and secondary
metabolites (FIG. 1). Isoprenoids that are primary metabolites
include sterols, carotenoids, growth regulators, and the polyprenol
substituents of dolichols, quinones, and proteins. These compounds
are essential for membrane integrity, photoprotection,
orchestration of developmental programs, and anchoring essential
biochemical functions to specific membrane systems, respectively.
Isoprenoids that are classified as secondary metabolites include
monoterpenes, sesquiterpenes, and diterpenes. These compounds are
said to mediate important interactions between plants and their
environment. For example, specific terpenoids have been correlated
with plant-plant (Stevens, In: Isopentoids in Plants, Nes, W. D.
Fuller, G., and Tsai, L.-S., eds., Marcel Dekker, New York, pp.
65-80, 1984), plant-insect (Gibson and Pickett, Nature 302:608,
1983), and plant-pathogen interactions (Stoessl et al.,
Phytochemistry 15:855, 1976).
[0005] The common denominator for this diverse array of compounds
is their universal five-carbon building block, isoprene. The
"biogenic isoprene rule" was employed to rationalize the
biosynthetic origins of all terpenoids derived from isoprene
(Ruzicka, Experientia 10:357, 1953). The polymerization of two
diphosphorylated isoprene building blocks (e.g., IPP and
dimethylallyl) generates geranyl diphosphate (GPP), a linear C10
intermediate that can be converted to cyclic or linear end-products
representing the monoterpenes, or used in another round of
polymerization. The addition of a third isoprene unit to GPP
generates farnesyl diphosphate (FPP), which can also be converted
to cyclic or linear products representing the sesquiterpene class.
Continuing the polymerization and chemical differentiation cycle
leads to the production of other classes of terpenoids named
according to the number of isoprene building blocks leading to
their biosynthesis, for example, the addition of a third IPP to FPP
generates geranylgeranyl diphosphate (GGPP).
[0006] These polymerization reactions are catalyzed by
prenyltransferases that direct the attack of a carbocation (an
electron deficient carbon atom resulting from the loss of the
diphosphate moiety of one substrate) to an electron-rich carbon
atom of the double bond on the IPP molecule (FIG. 2). The
electrophilic nature of these reactions is said to be unusual
relative to more general nucleophilic condensation reactions, but
this appears to be a common reaction among isoprenoid biosynthetic
enzymes and especially those enzymes involved in catalyzing the
cyclization of various isoprenoid intermediates (Gershenzon and
Croteau, In: Lipid Metabolism in Plants, Moore, T. S., ed., CRC
Press, Boca Raton, Fla., pp. 340-388). The enzymes responsible for
the cyclization of GPP, FPP, and GGPP are referred to as
monoterpene, sesquiterpene, and diterpene synthases or synthases,
and represent reactions committing carbon from the general
isoprenoid pathway to end products in the monoterpene,
sesquiterpene, and diterpene classes, respectively.
[0007] Two important biochemical distinctions between the
prenyltransferase and synthase reactions are illustrated in FIG. 2.
The prenyltransferases catalyze carbon-carbon bond formation
between two substrate molecules, whereas the synthases catalyze an
intramolecular carbon-carbon bond formation. The prenyltransferases
also catalyze reactions with very little variance in the
stereochemistry or length of the ensuing polymer.
Prenyltransferases differ in the length of the allyic substrates
that can be accepted in initiating these reactions. The synthases
are also substrate specific. However, diverse sesquiterpene
synthases, for example, can utilize the same substrate to produce
different reaction products.
[0008] The biosynthesis of isoprenoids such as cyclic terpenes is
said to be determined by key branch point enzymes referred to as
terpene synthases. The reactions catalyzed by terpene synthases are
complex, intramolecular cyclizations that may involve several
partial reactions. For example, the bioorganic rationale for the
cyclization of FPP by two sesquiterpene synthases are shown in FIG.
3. In step 1, the initial ionization of FPP is followed by an
intramolecular electrophillic attack between the carbon bearing the
diphosphate moiety and the distal double bond to form germacene A,
a macrocylic intermediate. Internal ring closure and formation of
the eudesmane carbonium ion constitutes step 2. For tobacco
5-epi-aristolochene synthase (TEAS), the terminal step is a hydride
shift, methyl migration, and deprotonation at C9 giving rise to
5-epi-aristolochene as depicted in step 3a. Hyoscyamus muticus
vetispiradiene synthase (HVS) shares a common mechanism at steps 1
and 2, but differs from TEAS in the third partial reaction in which
a ring contraction would occur due to alternative migration of an
electron pair. In each case, a monomeric protein of approximately
64 kD catalyzes the complete set of partial reactions and requires
no cofactors other than Mg.sup.+2.
SUMMARY OF THE INVENTION
[0009] In general, the invention features a chimeric isoprenoid
synthase polypeptide including a first domain from a first
isoprenoid synthase joined to a second domain from a second,
heterologous isoprenoid synthase, whereby the chimeric isoprenoid
synthase is capable of catalyzing the production of isoprenoid
reaction products that are not produced in the absence of the
second domain of the second, heterologous isoprenoid synthase. In
preferred embodiments, the chimeric isoprenoid synthase is capable
of catalyzing at least two different isoprenoid reaction products;
the isoprenoid reaction products are cyclic; the second domain of
the second, heterologous isoprenoid synthase also determines the
ratio of the isoprenoid reaction products of the chimeric
isoprenoid synthase; the first domain from the first isoprenoid
synthase is a plant isoprenoid synthase and the second domain from
the second, heterologous isoprenoid synthase is also from a plant
isoprenoid synthase.
[0010] Preferably, the chimeric isoprenoid synthase is chosen from
the group consisting of (a) the tobacco-Hyoscyamus CH4 chimeric
isoprenoid synthase; (b) the tobacco-Hyoscyamus CH10 chimeric
isoprenoid synthase; (c) the tobacco-Hyoscyamus CH11 chimeric
isoprenoid synthase; (d) the tobacco-Hyoscyamus CH12 chimeric
isoprenoid synthase; (e) the tobacco-Hyoscyamus CH13 chimeric
isoprenoid synthase; or (f) the tobacco-Hyoscyamus CH14 chimeric
isoprenoid synthase, all as described herein.
[0011] In preferred embodiments, the chimeric isoprenoid synthase
catalyzes the production of an isoprenoid reaction product that is
of agricultural, pharmaceutical, commercial, or industrial
significance (e.g., an antifungal agent, antibacterial agent, or
antitumor agent).
[0012] In other related aspects, the invention features DNA,
vectors, and cells (for example, E. coli, Saccharomyces cerevisiae,
animal or plant cells) encoding or containing a chimeric isoprenoid
synthase polypeptide.
[0013] In another aspect, the invention features a chimeric
isoprenoid synthase polypeptide including an asymmetrically
positioned homologous domain whereby the chimeric isoprenoid
synthase is capable of catalyzing the production of isoprenoid
reaction products (preferably, cyclic products) when the domain is
positioned at its naturally-occurring site in the isoprenoid
synthase polypeptide.
[0014] In another aspect, the invention features a method for
producing a chimeric isoprenoid synthase polypeptide, the method
involving: (a) providing a cell transformed with DNA encoding a
chimeric isoprenoid synthase positioned for expression in the cell;
(b) culturing the transformed cell under conditions for expressing
the DNA; and (c) recovering the chimeric isoprenoid synthase.
[0015] By "isoprenoid synthase" is meant a polypeptide that is
capable of catalyzing a reaction involving the intramolecular
carbon-carbon bond formation of an allylic diphosphate substrate
(for example, a C.sub.10, C.sub.15, or C.sub.20 allylic diphosphate
substrate) to an isoprenoid product (for example, a monoterpene,
diterpene, sesquiterpene, or sterol product). Examples of such
isoprenoid synthases include, without limitation, monoterpene
synthases (for example, limonene synthase), diterpene synthases
(for example, casbene synthase), and sesquiterpene synthases (for
example, 5-epi-aristolochene synthase, vetispiradiene synthase, and
cadinene synthase) that are responsible for cyclization of geranyl
diphosphate. (GPP), farnesyl diphosphate (FPP), and geranylgeranyl
diphosphate (GGPP), respectively. A number of terpene synthases
from plant and microbial sources have been isolated and
characterized (see, for example, Moestra and West, Arch. Biochem.
Biophys. 238:325, 1985; Hohn and Van Middlesworth, Arch. Biochem.
Biophys. 251:756, 1986; Hohn and Plattner, Arch. Biochem. Biophys.
272:137, 1989; Cane and Pargellis, Arch. Biochem. Biophys. 254:421,
1987; Munck and Croteau, Arch. Biochem. Biophys. 282:58, 1990;
Alonso et al., J. Biol. Chem. 267:7582, 1992; Savage et al., J.
Biol. Chem. 269:4012, 1994; Croteau et al., Arch. Biochem. Biophys.
309:184, 1994; Vogeli et al., Plant Physiol. 93:182, 1990; Guo et
al., Arch. Biochem. Biophys. 308:103, 1994; and Gambliel and
Croteau, J Biol. Chem. 259:740, 1984). In general, terpene
synthases are soluble enzymes having a molecular weight of about 40
to 100 kD. Genes encoding a number of monoterpene, diterpene, and
sesquiterpene synthases have been described for a number of plant
and microbial organisms (see, for example, Hohn and Beremand, Gene
79:131, 1989; Proctor and Hohn, J. Biol. Chem. 268:4543, 1993;
Facchini and Chappell, Proc. Natl. Acad. Sci. 89:11088, 1992; Back
and Chappell, J. Biol. Chem. 270:7375, 1995; Colby et al., J. Biol.
Chem. 268:23016, 1993; Mau and West, Proc. Natl. Acad. Sci.
91:8497, 1994; Chen et al., Arch. Biochein. Biophys. 324:255, 1994;
and Cane et al., Biochemistry 33:5846, 1994).
[0016] By "polypeptide" or "protein" is meant any chain of amino
acids, regardless of length or post-translational modification (for
example, glycosylation or phosphorylation).
[0017] By "joined to" is meant covalently bonded either directly or
indirectly (i.e., the domains are separated by an intervening amino
acid sequence). Such domains may be bonded by any means, including,
without limitation, a peptide bond or chemical linkage.
[0018] By "domain" is meant a contiguous stretch of amino acids
within a polypeptide or protein.
[0019] By "isoprenoid" is meant a compound that is derived from an
isoprene building block. In particular, isoprenoid compounds
include, without limitation, monoterpenes, diterpenes,
sesquiterpenes, and sterols. As described herein, isoprenoids are
found in a variety of organisms, for example, animal, fungal, or
bacterial sources.
[0020] By "asymmetrically positioned" is meant located within the
chimeric polypeptide at a site which differs from its position in
the naturally-occurring polypeptide.
[0021] By "heterologous" is meant derived from different sources
(in this case, different polypeptides).
[0022] By "homologous" is meant derived from the same source (in
this case, the same polypeptide).
[0023] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DETAILED DESCRIPTION
[0024] The drawings will be first described.
DRAWINGS
[0025] FIG. 1 is a schematic illustration showing the isoprenoid
biosynthetic pathway with respect to the type of end products and
their respective physiological functions. Broken arrows indicate
multiple steps or reactions.
[0026] FIG. 2 is a schematic illustration showing the various
reactions that are catalyzed by prenyltransferases and terpene
synthases.
[0027] FIG. 3 is a schematic illustration showing a reaction
mechanism for the synthesis of eremophilane (tobacco
5-epi-aristolochene synthase, TEAS) and vetispiradiene (Hyoscyamus
vetispiradiene synthase, HVS) type sesquiterpene synthases. Partial
reactions 1 and 2 are considered common to both types of synthases.
Mechanistic differences in partial reactions 3a and 3b are
sufficient to account for the different reaction products
shown.
[0028] FIG. 4A is a schematic illustration showing the chimeric
constructs used to map catalytic domains within sesquiterpene
synthases. Line drawings depict composite diagrams for wildtype
(i.e., TEAS and HVS) and chimeric (CH1-CH14) sesquiterpene synthase
genes that were engineered into the bacterial expression vector
pGBT-T19. Gene constructs were prepared using a combination of the
available restriction endonuclease sites and amplification of
select regions using PCR and PCR primers harboring convenient
restriction endonuclease sites. Correspondence between unique
restriction endonuclease sites and amino acid positions are
noted.
[0029] FIG. 4B is a photograph of a TLC experiment showing synthase
enzyme activities in sonicated lysates of E. coli TB1 cells
expressing the TEAS, HVS, and chimeric synthase constructs
(CH1-CH14) and measured using .sup.3H-FPP. Reaction products were
separated by argentation-TLC and detected by autoradiography. The
radioactivity in 0.5 mm segments of each lane of an argentation-TLC
plate was determined in a scintillation counter, and radioactivity
associated with the zones for the TEAS and HVS specific products
was set to 100%.
[0030] FIG. 5 is a schematic illustration showing the
correspondence between exons and functional domains within
isoprenoid synthases. The upper diagram represents the organization
of exons within the TEAS gene, which is nearly identical to that of
the HVS and casbene synthase genes. The lower diagram shows the
alignment of functional domains to the exonic organization of the
TEAS and HVS genes. Exon numbers are shown within the upper
diagram, and all other numbers refer to amino acid positions, some
of which correspond to the noted restriction endonuclease
sites.
[0031] FIG. 6 is a schematic diagram showing a domain switching
strategy used to generate a quiescent synthase (QH1). Substituting
the inactive HVS domain corresponding to exon 4 into CH3 results in
a synthase having an altered enzyme activity.
[0032] FIG. 7 is a schematic diagram of a domain switching strategy
used for producing a chimeric quiescent-casbene synthase, and
possible reaction products.
[0033] FIG. 8 is a schematic illustration of a domain switching
strategy for producing a chimeric quiescent-cadinene synthase, and
possible reaction products.
CHIMERIC ISOPRENOID SYNTHASES
[0034] Plasmids designed for expressing a chimeric synthase were
generated by substituting a portion of a gene encoding a domain
from tobacco 5-epi-aristolochene synthase with a portion of a gene
encoding a domain from Hyoscyamus vetispiradiene synthase. These
plasmids were expressed in bacteria, and bacterial lysates were
prepared and assayed for sesquiterpene synthase activity. The
sesquiterpene synthase assays included an argentation-thin layer
chromatography (TLC) analysis which distinguished the aristocholene
and vetispiradiene reaction products (Back and Chappell, J. Biol.
Chem. 270:7375, 1995). As shown in FIG. 4A, fourteen chimeric
synthase constructs were generated and were assayed as follows.
[0035] Full-length cDNAs for the tobacco 5-epi-aristolochene
synthase (TEAS) and Hyoscyamus vetispiradiene synthase (HVS) were
cloned into the EcoRI/XhoI sites of pBluescript SK (Stratagene),
creating the pBSK-TEAS and pBSK-HVS plasmids, respectively (Back
and Chappell, J. Biol. Chem. 270:7375, 1995). The TEAS and HVS cDNA
inserts of these expression plasmids were oriented with their
translation start codons neighboring the EcoRI restriction site and
their 3' poly A tail flanked by the XhoI restriction site of the
pSK plasmid.
[0036] Chimeric synthases CH1, CH2, CH5, and CH7 were constructed
by utilizing the conserved HindIII and NdeI restriction sites found
between the tobacco and Hyoscyamus genes. CH1 was prepared by
ligating the 5' terminal portion of the TEAS gene (corresponding to
the EcoRI to HindIII fragment) with the 3' terminal portion of HVS
gene (corresponding to the HindIII to KpnI fragment) into the
bacterial expression vector pGBT-T19 (Gold Biotechnology)
predigested with EcoRI and KpnI.
[0037] CH2 was prepared by ligating the 5' terminal portion of the
TEAS gene (corresponding to the EcoRI to NdeI fragment) with the 3'
terminal portion of HVS gene (corresponding to the NdeI to KpnI
fragment) into pGBT-T19.
[0038] CH5 was prepared by ligating the 5' terminal portion of the
HVS gene (corresponding to the EcoRI to HindIII fragment) with the
3' terminal portion of TEAS gene (corresponding to the HindIII to
KpnI fragment) into pGBT-T19.
[0039] CH7 was prepared by ligating the 5' terminal portion of the
HVS gene (corresponding to the EcoRI to NdeI fragment) with the 3'
terminal portion of TEAS gene (corresponding to the NdeI to KpnI
fragment) into pGBT-T19.
[0040] CH3, CH4, CH12, and CH13 were constructed using conventional
polymerase chain reaction (PCR) methodologies, with primers
designed for the amplification of particular segments of the HVS
gene. To facilitate directional cloning and maintenance of reading
frame, primers were also designed to contain convenient restriction
sites.
[0041] CH3 was constructed as follows. An EcoRI/ClaI restriction
fragment of the TEAS gene was isolated and ligated to the ClaI/KpnI
fragment of the HVS gene. The HVS ClaI/KpnI fragment was prepared
by PCR methodology using 5'-d(GGGATCGATGACATAGCCACGTATGAGGTT)-3'
(SEQ ID NO: 1; ClaI restriction site underlined) as the forward
primer and 5'-d (AATACGACTCACTATAG)-3' (SEQ ID NO: 2) as the
reverse primer (corresponding to the T7 sequence found in the
multiple cloning site of pBSK) using pBSK-HVS as the DNA template.
The resulting restriction fragment was ligated into the EcoRI/KpnI
sites of the pGBT-T19 vector.
[0042] CH4 and CH13 were constructed in a similar manner, but using
the forward amplification primers
5'-d(CGAGTCAACATGGTTTATTGAGGGATA)-3' (SEQ ID NO: 3; HincII
restriction site underlined) and
5'-d(TATTCTAGATCTCTATGACGATTATGAA)-3' (SEQ ID NO: 4; XbaI
restriction site underlined), respectively.
[0043] CH12 was prepared by ligating a PCR fragment corresponding
to the first 1326 nucleotides of CH4 with the ClaI/KpnI fragment of
the TEAS gene into the EcoRI/KpnI sites of the pGBT-T19 vector. The
CH4 fragment was prepared using forward amplification primer
5'-d(GGGAGCTCGAATTCCATGGCCTCAGCAGCAGTTGCAAACTAT)-3' (SEQ ID NO: 5;
EcoRI restriction site underlined and translation start codon in
bold) and reverse primer 5'-d(GGGATCGATAACTCTGCATAATGTAGCATT)-3'
(SEQ ID NO: 6; ClaI restriction site underlined).
[0044] Chimeric synthases CH6, CH8, CH9, CH10, CH11, and CH14 were
constructed as follows. Ligation of the EcoRI/HindIII fragment of
the HVS gene with the HindIII/KpnI fragment of CH3 generated CH6.
CH8 was created by ligating the EcoRI/NdeI fragment of HVS with the
NdeI/KpnI fragment of CH3. CH9 was created by ligating the
EcoRI/NdeI fragment of CH5 with the NdeI/KpnI fragment of HVS. CH10
was constructed by ligating the EcoRI/HindIII fragment of HVS with
the HindIII/KpnI fragment of CH4. CH11 was constructed by ligating
the EcoRI/NdeI fragment of HVS with the NdeI/KpnI fragment of CH4.
And CH14 was generated by substituting the EcoRI/NdeI fragment of
CH13 with the corresponding DNA fragment of pBSK-HVS. The
nucleotide junctions of the chimeric constructs were confirmed by
double-stranded DNA sequencing using the dideoxy nucleotide chain
termination kit, according to the manufacturer's instructions (U.S.
Biochemical Corp).
[0045] Chimeric synthases were expressed in E. coli TB1 cells.
Procedures for growth of the bacterial cells, induction of gene
expression, measurement of sesquiterpene synthase enzyme activity,
and the determination of total protein in the bacterial lysates
were performed according to the methods described by Back and
Chappell (Arch. Biochem. Biophys. 315:527, 1994; J. Biol. Chem.
270:7375, 1995). Reaction products were separated by developing G60
silica TLC plates impregnated with 15% silver nitrate in
benzene:hexane:diethyl ether (50:50:1). For qualitative
evaluations, TLC plates were sprayed with Enhance surface
fluorography spray (Dupont) and exposed to Kodak XAR-5 film for 2
to 5 days at -70.degree. C. For quantitative evaluations, 0.5 mm
zones of an entire lane from a TLC plates were scraped into
scintillation vials, and the radioactivity was determined using a
Packard 1500 Liquid Scintillation Counter. The dominant reaction
products generated by the synthase activities resulting from
expression of the TEAS, HVS, CH4, and CH14 constructs in bacterial
lysates were also verified by gas chromatography (GC) and gas
chromatography-mass spectroscopy (GC-MS) according to the
conditions described by Chappell et al. (Phytochemistry 26:2259,
1987) (data not shown). In addition, mass spectra profiles were
compared to that published for 5-epi-aristolochene (Anke and
Sterner, Planta Med. 57:344, 1991) and the predicted fragmentation
pattern for vetispiradiene (Enzell et al., Mass Spectrometry Rev.
3:395, 1984).
[0046] As shown in FIGS. 4A-B, the dominant reaction product
resulting from the expression of the tobacco TEAS gene expressed
was 5-epi-aristolochene, and vetispiradiene was found to be the
dominant reaction product resulting from the expression of the HVS
gene. The predominant reaction products generated by the expression
of CH1 and CH2 were also HVS-specific (i.e., vetispiradiene), with
enzyme specific activities similar to those found for HVS that was
expressed from the pBSK-HVS plasmid. These results indicated that
the amino-terminal half of TEAS and HVS were functionally
equivalent with respect to the HVS carboxy-terminus and do not
contribute to the specificity of the reaction product. CH7, having
an HVS amino terminus and a TEAS carboxy terminus, is the converse
construct of CH2, and the resulting synthase activity was expected
to result in expression of a TEAS-specific product (i.e.,
5-epi-aristolochene). Immunodetection assays revealed that synthase
protein produced upon expression of CH7 was found to be of the
correct size and expected abundance (data not shown); however, no
enzyme activity was detected. The lack of enzyme activity indicated
that interactions between the carboxy and amino terminal portions
of the protein contributed to enzyme activity. This interpretation
is further supported by comparing the specific activity of the
enzymes generated by the expression of the CH5 and CH6 constructs.
CH5 resulted in the expression of a product having a 10-fold lower
specific activity of synthase enzyme activity than the other
chimeric synthases, even though the absolute level of expressed
protein was similar to the other constructs (as determined by
immunodetection, data not shown). Substituting an HVS
carboxy-terminal region was found to restore the specific activity
to the synthase enzyme that was generated by CH6.
[0047] Comparison of CH2 and CH3 chimeric synthases provided
evidence for specificity of end-product formation residing within a
domain of approximately 181 amino acids, corresponding to the NdeI
and ClaI restriction sites within the TEAS and HVS genes.
Expression of CH4 unexpectedly resulted in the production of a
chimeric synthase protein capable of generating reaction products
reflective of both the TEAS and HVS enzymes. We interpreted this
result to indicate that amino acids 261 to 379 within the tobacco
5-epi-aristolochene synthase are responsible for the TEAS-specific
products (i.e., the region corresponding to the NdeI to HincII
fragment of the cDNA), while amino acids 379 to 442 within the
Hyoscyamus protein are responsible for the HVS-specific products
(i.e., the region corresponding to the HincII to ClaI fragment of
the cDNA).
[0048] Our interpretation was confirmed by evaluating the
expression products of CH11 and CH12. CH11 represented the
substitution of the NdeI to HincII fragment of the Hyoscyamus gene
with the corresponding tobacco gene fragment, and resulted in the
production of an enzyme having HVS- and TEAS-specificity. CH12
represented a substitution of the HincII to ClaI fragment of the
tobacco gene with the corresponding Hyoscyamus gene fragment, and
resulted in the production of an enzyme having HVS- and
TEAS-specificity. Comparing CH11 to CH13 provided a further
refinement in the domain characterization of the tobacco enzyme
responsible for the TEAS-specific products. The fact that CH13 was
found to be a multifunctional enzyme indicated that the 81 amino
acids encoded by the DNA fragment residing between the NdeI to XbaI
restriction sites of the tobacco cDNA were sufficient for formation
of the predominant TEAS specific products. This interpretation was
confirmed by substituting the domain contained within the NdeI/XbaI
HVS cDNA restriction fragment of CH14 with that of the TEAS gene
(FIG. 4A).
[0049] As shown in FIG. 4B, the predominant reaction product(s) of
the wildtype tobacco TEAS and Hyoscyamus HVS genes expressed in
bacteria migrated on silver nitrate-TLC plates with R.sub.f values
of 0.41 and 0.31, values consistent with previous characterization
of these products as 5-epi-aristolochene and vetispiradiene,
respectively (Back and Chappell, J Biol. Chem. 270:7375, 1995; Back
et al., Arch. Biochem. Biophys. 315:527, 1994). GC and GC-MS
analyses indicated that the predominant TEAS reaction products were
5-epi-aristolochene (70% of total products, based on percentage of
total peak areas from GC analysis) and a bicyclic sesquiterpene
(20%) ([M].sup.+ ion at m/z of 204). The predominant HVS reaction
product was vetispiradiene (>90%) ([M].sup.+ ion at m/z of 204
with a base peak at m/z 41 and a series of predictable ions at m/z
175, 108, 94, and 68), and the predominant reaction products of CH4
were 5-epi-aristolochene (18%), a bicyclic sesquiterpene (43%), and
vetispiradiene (32%) (data not shown).
[0050] In addition, studies relying on affinity purification of
histidine-tagged recombinant synthase proteins has revealed five
other minor reaction products, each representing approximately 1%
of the total products, with all five found at the same relative
abundance in all the reaction assays.
[0051] Ratio-Determinant Domain
[0052] Another domain of the synthase proteins was identified by
comparing the relative ratio of the predominant reaction products
produced by the multifunctional chimeric synthase enzymes (FIG.
4A). For example, the reaction products resulting from expression
of constructs CH4, CH10, CH11, and CH12 were generated in a ratio
of 60-70% TEAS-specific to 30-40% HVS-specific. In contrast, an
inverse ratio of reaction products resulted from expression of
constructs CH13 and CH14. This result indicated that the region
encompassed by the XbaI to HincII domain influenced the relative
ratio of reaction products generated by the multifunctional
chimeric synthase enzymes. These results indicated that two
separate and distinct domain's within the synthase peptide
contributed directly to the types of reaction products generated,
and are interrupted by another domain which we refer to as the
ratio-determinant domain (FIG. 5).
[0053] Site-Directed Mutagenesis
[0054] Additional analysis of the product specificity and ratio
determinant domains was determined using conventional site-directed
mutagenesis methodologies. The results of this analysis are
presented in Table I (below). For example, the DDXXD motif, found
within the aristolochene specific domain, is a conserved sequence
that is found in a variety of terpene biosynthetic enzymes
including TEAS and HVS. This acidic amino acid cluster is said to
coordinate a metal cofactor that is necessary to neutralize the
diphosphate moiety of FPP in an otherwise lipophilic pocket.
Substitution of the first aspartic acid residue (D301) of the DDXXD
motif with either glutamic acid (overall charge conservation) or
valine (net loss of acidic charge) residues (i.e., D301.fwdarw.E
and D301.fwdarw.V) resulted in the formation of an inactivated
enzyme. A conserved substitution of the second aspartic acid (D302)
with a glutamic acid residue (i.e., D302.fwdarw.E) also inactivated
chimeric synthase enzyme activity by 95%, and resulted in a slight
alteration of the product distribution of the multifunctional
enzyme.
TABLE-US-00001 TABLE I Mutation Specific target Mutated Product
ratio Activity gene amino Aristolochene Vetispiradiene (nmol/mg
h.sup.-1) CH4 acid 66% 34% 34 Substrate binding domain (Ndel/Xbal
region) Tobacco D301V No activity 0 CH4 R287A No activity 0 CH4
D301V No activity 0 CH4 D301E No activity 0 CH4 D302E 51% 49% 1.8
Ratio determinant domain (Xbal/HincII region) CH4 K3471 64% 36% 32
CH4 H360S 63% 32% 29 CH4 H364S 65% 35% 38 Hyoscyamus specific
domain (HincII/ClaI region) CH4 T408A 67% 33% 48 CH4 K420M 68% 32%
29 CH4 H422A 67% 33% 30 CH4 N436S 70% 30% 32 CH4 AT437, 438VI 61%
39% 33
[0055] The sites for directed substitutions within the
ratio-determinant domain (i.e., K347.fwdarw.I, H360.fwdarw.S,
H364.fwdarw.S) were inferred by an analysis of reports that
hypothesized the importance of charged amino acid residues (e.g.,
histidine or lysine) in synthase enzymology, and these sites
represented those amino acids which displayed the greatest charge
differences in comparisons between the TEAS and HVS primary
sequences. None of the three mutations analyzed had any effect on
overall catalytic activity or the ratio of products formed.
[0056] Amino acid substitutions within the HVS specific domain were
chosen on the basis of comparisons between secondary structural
predictions of the HVS and TEAS proteins. Those amino acids mutated
appeared to contribute disproportionately to structural distortions
in the secondary structure models of these two proteins, largely
because of charge considerations. However, as shown in Table I
(above), substitutions involving charged to non-charged (i.e.,
T408.fwdarw.A, K420.fwdarw.M, H422.fwdarw.A) or reduced charged
(N436.fwdarw.S, A437.fwdarw.T, V438.fwdarw.I) amino acids did not
affect overall enzyme activity, nor the synthesis rate of one
product or the other.
[0057] Quiescent Synthases
[0058] To generate a quiescent synthase, the inactive domain
corresponding to exon 4 of HVS is substituted with the
corresponding active domain of CH3, as outlined in FIG. 6. CH3
contains an inactive domain corresponding to exon 6 of TEAS, has
convenient NdeI and XbaI restriction sites for the desired
substitution, and can be overexpressed in bacteria to high levels.
Domain switching is accomplished using standard molecular
techniques, as described herein. In one particular example, a PCR
amplification product of HVS cDNA corresponding to exon 4,
encompassing amino acids 261 to 342 and containing appropriate NdeI
and XbaI sites within the primers, is substituted for the
corresponding region of CH3. In generating such constructs, care is
exercised to maintain appropriate amino acid residues and the
correct reading frame, and expression testing of the construct
entails a measurement of the protein level in the soluble and
insoluble fractions of bacterial lysates by immunoblotting
techniques, as well as by enzyme assays.
[0059] In addition, large scale enzyme reactions are performed, the
reaction product(s) are extracted into hexane, and the products are
purified by HPLC methods. Additional evaluation of the quiescent
enzyme reaction products is carried out using TLC, and comparing
the R.sub.f values of the experimental sample to those generated by
the TEAS and HVS enzymes. Retention times of the reaction products
(e.g., germacrene or germacrene-like reaction product) are also
monitored using GC, GC-MS, and NMR according to standard
methods.
[0060] The quiescent synthase is useful for providing sufficient
amounts of the germacrene reaction intermediate(s) (or derivatives
thereof) to confirming the chemical rationalization for the EAS and
VS reactions, and produces a template chimeric synthase that may be
used for the introduction of novel terminal steps in the overall
synthase reaction scheme.
[0061] Chimeric Casbene and Cadinene Synthases
[0062] Chimeric isoprenoid synthases are also useful for generating
novel macrocyclic isoprenoids or isoprenoids having altered
stereochemical properties. For example, isoprenoid synthases such
as casbene synthase, a diterpene synthase which catalyzes the
synthesis of a macrocyclic diterpene harboring a cyclopropyl side
group, and cadiene synthase, a sesquiterpene synthase that
catalyzes the synthesis of a bicyclic sesquiterpene, provide
domains useful for engineering enzymes capable of producing
macrocylic isoprenoids or isoprenoid reaction products having
altered sterochemical properties. A general scheme for producing
such chimeric synthases is presented in FIGS. 7 and 8.
[0063] To construct such chimeric casbene and cadienne synthases,
quiescent amino terminal domains (and other synthase domains as
necessary) are substituted with those from casbene and cadinene
synthase using convenient restriction sites and PCR amplification
of selected regions as described above. Sequences corresponding to
the N-terminal, plastid targeting sequence of the casbene synthase
are deleted in these constructs. Chimeric constructs are expressed
in bacteria, bacterial lysates are examined for chimeric synthase
activity, and reaction products are characterized as described
above, for example, using argentation-TLC. Constructs supporting
high levels of synthase activity in bacteria and/or activity
generating reaction products which migrate with Rfs different from
aristolochene and vetispiradiene standards are considered useful in
the invention. Reaction products are also analyzed for their
retention times by GC and subjected to GC-MS and NMR, as necessary.
Those domains of casbene synthase and cadinene synthase which
contribute to the synthesis of unique reaction products may also be
subjected to fine detail mapping using a strategy analogous to that
depicted in FIG. 4A.
[0064] Production of Other Chimeric Isoprenoid Svnthases
[0065] Using the standard molecular techniques described herein,
other chimeric synthases may be readily generated which include
domains from known or newly isolated synthase enzymes. Such
chimeric synthases may be tested for activity using, for example,
any appropriate enzyme assays known to those in the art, or by
standard immunodetection techniques.
[0066] The isolation of additional synthase coding sequences is
also possible using standard cloning strategies and techniques that
are well known in the art. For example, using all or a portion of
the amino acid sequence of a known synthase polypeptide, one may
readily design synthase-specific oligonucleotide probes, including
synthase degenerate oligonucleotide probes (i.e., a mixture of all
possible coding sequences for a given amino acid sequence). These
oligonucleotides may be based upon the sequence of either DNA
strand and any appropriate portion of synthase nucleotide sequence.
General methods for designing and preparing such probes are
provided, for example, in Ausubel et al., 1996, Current Protocols
in Molecular Biology, Wiley Interscience, New York, and Berger and
Kimmel, Guide to Molecular Cloning Techniques, 1987, Academic
Press, New York. These oligonucleotides are useful for synthase
gene isolation, either through their use as probes capable of
hybridizing to a synthase complementary sequences or as primers for
various amplification techniques, for example, polymerase chain
reaction (PCR) cloning strategies.
[0067] Hybridization techniques and screening procedures are well
known to those skilled in the art and are described, for example,
in Ausubel et al. (supra); Berger and Kimmel (supra); Chen at al.
Arch. Biochem. Biophys. 324:255, 1995; and Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York. If desired, a combination of different
oligonucleotide probes may be used for the screening of a
recombinant DNA library. The oligonucleotides may be
detectably-labeled using methods known in the art and used to probe
filter replicas from a recombinant DNA library. Recombinant DNA
libraries are prepared according to methods well known in the art,
for example, as described in Ausubel et al. (supra), or they may be
obtained from commercial sources.
[0068] As discussed above, synthase oligonucleotides may also be
used as primers in amplification cloning strategies, for example,
using PCR. PCR methods are well known in the art and are described,
for example, in PCR Technology, Erlich, ed., Stockton Press,
London, 1989; PCR Protocols: A Guide to Methods and Applications,
Innis et al., eds., Academic Press, Inc., New York, 1990; and
Ausubel et al. (supra). Primers are optionally designed to allow
cloning of the amplified product into a suitable vector, for
example, by including appropriate restriction sites at the 5' and
3' ends of the amplified fragment (as described herein). If
desired, a synthase gene may be isolated using the PCR "RACE"
technique, or Rapid Amplification of cDNA Ends (see, e.g., Innis et
al. (supra)). By this method, oligonucleotide primers based on a
synthase sequence are oriented in the 3' and 5' directions and are
used to generate overlapping PCR fragments. These overlapping 3'-
and 5'-end RACE products are combined to produce an intact
full-length cDNA. This method is described in Innis et al. (supra);
and Frohman et al., Proc. Natl. Acad. Sci. USA 85:8998, (1988).
[0069] Useful synthase sequences may be isolated from any
appropriate organism. Confirmation of a sequence's relatedness to
the synthase polypeptide family may be accomplished by a variety of
conventional methods, for example, sequence comparison. In
addition, the activity of any synthase protein may be evaluated
according to any of the techniques described herein.
[0070] Chimeric Isoprenoid Synthase Polypeptide Expression
[0071] Chimeric synthase polypeptides may be produced by
transformation of a suitable host cell with all or part of a
chimeric synthase DNA (for example, the chimeric synthase cDNAs
described above) in a suitable expression vehicle or with a plasmid
construct engineered for increasing the expression of a chimeric
synthase polypeptide in vivo.
[0072] Those skilled in the field of molecular biology will
appreciate that any of a wide variety of expression systems may be
used to provide the recombinant protein. The precise host cell used
is not critical to the invention. The chimeric synthase protein may
be produced in a prokaryotic host, for example, E. coli TB1, or in
a eukaryotic host, for example, Saccharomyces cerevisiae, mammalian
cells (for example, COS 1 or NIH 3T3 cells), or any of a number of
plant cells including, without limitation, algae, tree species,
ornamental species, temperate fruit species, tropical fruit
species, vegetable species, legume species, monocots, dicots, or in
any plant of commercial or agricultural significance. Particular
examples of suitable plant hosts include, but are not limited to,
Conifers, Petunia, Tomato, Potato, Tobacco, Arabidopsis, Lettuce,
Sunflower, Oilseed rape, Flax, Cotton, Sugarbeet, Celery, Soybean,
Alfalfa, Medicago, Lotus, Vigna, Cucumber, Carrot, Eggplant,
Cauliflower, Horseradish, Morning Glory, Poplar, Walnut, Apple,
Asparagus, Rice, Maize, Millet, Onion, Barley, Orchard grass, Oat,
Rye, and Wheat.
[0073] Such cells are available from a wide range of sources
including: the American Type Culture Collection (Rockland, Md.); or
from any of a number seed companies, for example, W. Atlee Burpee
Seed Co. (Warminster, Pa.), Park Seed Co. (Greenwood, S.C.), Johnny
Seed Co. (Albion, Me.), or Northrup King Seeds (Harstville, S.C.).
Descriptions and sources of useful host cells are also found in
Vasil I.K., Cell Culture and Somatic Cell Genetics of Plants, Vol
I, II, III Laboratory Procedures and Their Applications Academic
Press, New York, 1984; Dixon, R. A., Plant Cell Culture-A Practical
Approach, IRL Press, Oxford University, 1985; Green et al., Plant
Tissue and Cell Culture, Academic Press, New York, 1987; and Gasser
and Fraley, Science 244:1293, (1989).
[0074] For prokaryotic expression, DNA encoding a chimeric synthase
polypeptide is carried on a vector operably linked to control
signals capable of effecting expression in the prokaryotic host. If
desired, the coding sequence may contain, at its 5' end, a sequence
encoding any of the known signal sequences capable of effecting
secretion of the expressed protein into the periplasmic space of
the host cell, thereby facilitating recovery of the protein and
subsequent purification. Prokaryotes most frequently used are
various strains of E. coli; however, other microbial strains may
also be used. Plasmid vectors are used which contain replication
origins, selectable markers, and control sequences derived from a
species compatible with the microbial host. Examples of such
vectors are found in Pouwels et al. (supra) or Ausubel et al.
(supra). Commonly used prokaryotic control sequences (also referred
to as "regulatory elements") are defined herein to include
promoters for transcription initiation, optionally with an
operator, along with ribosome binding site sequences. Promoters
commonly used to direct protein expression include the
beta-lactamase (penicillinase), the lactose (lac), the tryptophan
(Trp) (Goeddel et al., Nucl. Acids Res. 8:4057 (1980)), and the tac
promoter systems, as well as the lambda-derived P.sub.L promoter
and N-gene ribosome binding site (Simatake et al., Nature 292:128
(1981)).
[0075] One particular bacterial expression system for chimeric
synthase polypeptide production is the E. coli pET expression
system (Novagen). According to this expression system, DNA encoding
a chimeric synthase polypeptide is inserted into a pET vector in an
orientation designed to allow expression. Since the chimeric
synthase gene is under the control of the T7 regulatory signals,
expression of chimeric synthase is induced by inducing the
expression of T7 RNA polymerase in the host cell. This is typically
achieved using host strains which express T7 RNA polymerase in
response to IPTG induction. Once produced, recombinant chimeric
synthase polypeptide is then isolated according to standard methods
known in the art, for example, those described herein.
[0076] Another bacterial expression system for chimeric synthase
polypeptide production is the pGEX expression system (Pharmacia).
This system employs a GST gene fusion system that is designed for
high-level expression of a gene or gene fragment as a fusion
protein with rapid purification and recovery of the functional gene
product. The chimeric synthase protein of interest is fused to the
carboxyl terminus of the glutathione S-transferase protein from
Schistosoma japonicum and is readily purified from bacterial
lysates by affinity chromatography using Glutathione Sepharose 4B.
Fusion proteins can be recovered under mild conditions by elution
with glutathione. Cleavage of the glutathione S-transferase domain
from the fusion protein is facilitated by the presence of
recognition sites for site-specific proteases upstream of this
domain. For example, proteins expressed in pGEX-2T plasmids may be
cleaved with thrombin; those expressed in pGEX-3X may be cleaved
with factor Xa.
[0077] For eukaryotic expression, the method of transformation or
transfection and the choice of vehicle for expression of the
chimeric synthase polypeptide will depend on the host system
selected. Transformation and transfection methods of numerous
organisms, for example, the baker's yeast Saccharomyces cerevisiae,
are described, e.g., in Ausubel et al. (supra); Weissbach and
Weissbach, Methods for Plant Molecular Biology, Academic Press,
1989; Gelvin et al., Plant Molecular Biology Manual, Kluwer
Academic Publishers, 1990; Kindle, K., Proc. Natl. Acad. Sci. U.S.A
87:1228 (1990); Potrykus, I., Annu. Rev. Plant Physiol. Plant Mol.
Biology. 42:205 (1991); and BioRad (Hercules, Calif.) Technical
Bulletin #1687 (Biolistic Particle Delivery Systems). Expression
vehicles may be chosen from those provided, e.g., in Cloning
Vectors: A Laboratory Manual (P. H. Pouwels et al., 1985, Supp.
1987); Gasser and Fraley (supra); Clontech Molecular Biology
Catalog (Catalog 1992/93 Tools for the Molecular Biologist, Palo
Alto, Calif.); and the references cited above.
[0078] One preferred eukaryotic expression system is the mouse 3T3
fibroblast host cell transfected with a pMAMneo expression vector
(Clontech). pMAMneo provides: an RSV-LTR enhancer linked to a
dexamethasone-inducible MMTV-LTR promotor, an SV40 origin of
replication which allows replication in mammalian systems, a
selectable neomycin gene, and SV40 splicing and polyadenylation
sites. DNA encoding a chimeric synthase polypeptide is inserted
into the pMAMneo vector in an orientation designed to allow
expression. The recombinant chimeric synthase polypeptide is then
isolated as described below. Other preferable host cells which may
be used in conjunction with the pMAMneo expression vehicle include
COS cells and CHO cells (ATCC Accession Nos. CRL 1650 and CCL 61,
respectively).
[0079] Alternatively, if desired, a chimeric synthase polypeptide
is produced by a stably-transfected mammalian cell line. A number
of vectors suitable for stable transfection of mammalian cells are
available to the public, e.g., see Pouwels et al. (supra); methods
for constructing such cell lines are also publicly available, e.g.,
in Ausubel et al. (supra). In one example, cDNA encoding the
chimeric synthase polypeptide is cloned into an expression vector
which includes the dihydrofolate reductase (DHFR) gene. Integration
of the plasmid and, therefore, the chimeric synthase-encoding gene
into the host cell chromosome is selected for by inclusion of
0.01-300 .mu.M methotrexate in the cell culture medium (as
described in Ausubel et al., supra). This dominant selection can be
accomplished in most cell types. Recombinant protein expression can
be increased by DHFR-mediated amplification of the transfected
gene. Methods for selecting cell lines bearing gene amplifications
are described in Ausubel et al. (supra); such methods generally
involve extended culture in medium containing gradually increasing
levels of methotrexate. DHFR-containing expression vectors commonly
used for this purpose include pCVSE11-DHrF and pAdD26SV(A)
(described in Ausubel et al., supra). Any of the host cells
described above or, preferably, a DHFR-deficient CHO cell line (for
example, CHO DHFR-cells, ATCC Accession No. CRL 9096) are among the
host cells preferred for DHFR selection of a stably-transfected
cell line or DHFR-mediated gene amplification.
[0080] A chimeric synthase polypeptide is preferably produced by a
stably-transfected plant cell line or by a transgenic plant. A
number of vectors suitable for stable transfection of plant cells
or for the establishment of transgenic plants are available to the
public; such vectors are described in Pouwels et al. (supra),
Weissbach and Weissbach (supra), and Gelvin et al. (supra). Methods
for constructing such cell lines are described in, e.g., Weissbach
and Weissbach (supra), and Gelvin et al. (supra). Typically, plant
expression vectors include (1) a cloned chimeric synthase gene
under the transcriptional control of 5' and 3' regulatory sequences
and (2) a dominant selectable marker. Such plant expression vectors
may also contain, if desired, a promoter regulatory region (for
example, one conferring inducible or constitutive expression, or
environmentally- or developmentally-regulated, or pathogen- or
wound-inducible, or cell- or tissue-specific expression), a
transcription initiation start site, a ribosome binding site, an
RNA processing signal, a transcription termination site, and/or a
polyadenylation signal.
[0081] The chimeric synthase DNA sequence of the invention may, if
desired, be combined with other DNA sequences in a variety of ways.
The chimeric synthase DNA sequence of the invention may be employed
with all or part of the gene sequences normally associated with a
synthase protein. In its component parts, a DNA sequence encoding a
chimeric synthase protein is combined in a DNA construct having a
transcription initiation control region capable of promoting
transcription and translation in a host cell.
[0082] In general, the constructs will involve regulatory regions
functional in plants which provide for production of a chimeric
synthase protein as discussed herein. The open reading frame coding
for the chimeric synthase protein or functional fragment thereof
will be joined at its 5' end to a transcription initiation
regulatory region such as the sequence naturally found in the 5'
upstream region of a synthase structural gene. Numerous other
transcription initiation regions are available which provide for
constitutive or inducible regulation.
[0083] For applications when developmental, cell, tissue, hormonal,
environmental, or pathogen-inducible expression are desired,
appropriate 5' upstream non-coding regions are obtained from other
genes; for example, from genes regulated during seed development,
embryo development, leaf development, or in response to a
pathogen.
[0084] Regulatory transcript termination regions may also be
provided in DNA constructs of this invention as well. Transcript
termination regions may be provided by the DNA sequence encoding a
synthase protein or any convenient transcription termination region
derived from a different gene source. The transcript termination
region will contain preferably at least 1-3 kb of sequence 3' to
the structural gene from which the termination region is derived.
Such genetically-engineered plants are useful for a variety of
industrial and agricultural applications as discussed below.
Importantly, this invention is applicable to gymnosperms and
angiosperms, and will be readily applicable to any new or improved
transformation or regeneration method.
[0085] An example of a useful plant promoter according to the
invention is a caulimovirus promoter, for example, a cauliflower
mosaic virus (CaMV) promoter. These promoters confer high levels of
expression in most plant tissues, and the activity of these
promoters is not dependent on virally encoded proteins. CaMV is a
source for both the 35S and 19S promoters. In most tissues of
transgenic plants, the CaMV 35S promoter is a strong promoter (see,
e.g., Odell et al., Nature 313:810 (1985)). The CaMV promoter is
also highly active in monocots (see, e.g., Dekeyser et al., Plant
Cell 2:591 (1990); Terada and Shimamoto, Mol. Gen. Genet. 220:389,
(1990)). Moreover, activity of this promoter can be further
increased (i.e., between 2-10 fold) by duplication of the CaMV 35S
promoter (see e.g., Kay et al., Science 236:1299 (1987); Ow et al.,
Proc. Natl. Acad. Sci. U.S.A. 84:4870 (1987); and Fang et al.,
Plant Cell 1:141 (1989)).
[0086] Other useful plant promoters include, without limitation,
the nopaline synthase promoter (An et al., Plant Physiol. 88:547
(1988)) and the octopine synthase promoter (Fromm et al., Plant
Cell 1:977 (1989)).
[0087] For certain applications, it may be desirable to produce the
chimeric synthase gene product in an appropriate tissue, at an
appropriate level, or at an appropriate developmental time. For
this purpose, there are an assortment of gene promoters, each with
its own distinct characteristics embodied in its regulatory
sequences, shown to be regulated in response to the environment,
hormones, and/or developmental cues. These include gene promoters
that are responsible for heat-regulated gene expression (see, e.g.,
Callis et al., Plant Physiol. 88:965 (1988); Takahashi and Komeda,
Mol. Gen. Genet. 219:365 (1989); and Takahashi et al. Plant J.
2:751 (1992)), light-regulated gene expression (e.g., the pea
rbcS-3A described by Kuhlemeier et al. (Plant Cell 1:471 (1989);
the maize rbcS promoter described by Schaffner and Sheen, (Plant
Cell 3:997 (1991); or the chlorophyll a/b-binding protein gene
found in pea described by Simpson et al. (EMBO J4:2723 (1985)),
hormone-regulated gene expression (for example, the abscisic acid
(ABA) responsive sequences from the Em gene of wheat described by
Marcotte et al. (Plant Cell 1:969 (1989); the ABA-inducible HVA1
and HVA22, and the rd29A promoters described for barley and
Arabidopsis by Straub et al. (Plant Cell 6:617 (1994), Shen et al.
(Plant Cell 7:295 (1994)), and wound-induced gene expression (for
example, of wunI described by Siebertz et al. (Plant Cell 1:961
(1989)), or organ-specific gene expression (for example, of the
tuber-specific storage protein gene described by Roshal et al.
(EMBO J. 6:1155 (1987); the 23-kDa zein gene from maize described
by Schernthaner et al. (EMBO J 7:1249 (1988); or the French bean
13-phaseolin gene described by Bustos et al. (Plant Cell 1:839
(1989)); and pathogen-inducible gene expression described by
Chappell et al. in U.S. Ser. Nos. 08/471,983, 08/443,639, and
08/577,483, hereby incorporated by reference.
[0088] Plant expression vectors may also optionally include RNA
processing signals, for example, introns, which have been shown to
be important for efficient RNA synthesis and accumulation (Callis
et al., Genes and Dev. 1:1183 (1987)). The location of the RNA
splice sequences can dramatically influence the level of transgene
expression in plants. In view of this fact, an intron may be
positioned upstream or downstream of a chimeric synthase
polypeptide-encoding sequence in the transgene to modulate levels
of gene expression.
[0089] In addition to the aforementioned 5' regulatory control
sequences, the expression vectors may also include regulatory
control regions which are generally present in the 3' regions of
plant genes (Thornburg et al., Proc. Natl. Acad. Sci. U.S.A. 84:744
(1987); An et al., Plant Cell 1:115 (1989)). For example, the 3'
terminator region may be included in the expression vector to
increase stability of the mRNA. One such terminator region may be
derived from the PI-II terminator region of potato. In addition,
other commonly used terminators are derived from the octopine or
nopaline synthase signals.
[0090] The plant expression vector also typically contains a
dominant selectable marker gene used to identify those cells that
have become transformed. Useful selectable genes for plant systems
include genes encoding antibiotic resistance genes, for example,
those encoding resistance to hygromycin, kanamycin, bleomycin,
G418, streptomycin, or spectinomycin. Genes required for
photosynthesis may also be used as selectable markers in
photosynthetic-deficient strains. Alternatively, the
green-fluorescent protein from the jellyfish Aequorea victoria may
be used as a selectable marker (Sheen et al., Plant J. 8:777, 1995;
Chiu et al., Current Biology 6:325 (1996)). Finally, genes encoding
herbicide resistance may be used as selectable markers; useful
herbicide resistance genes include the bar gene encoding the enzyme
phosphinothricin acetyltransferase and conferring resistance to the
broad spectrum herbicide Basta.RTM. (Hoechst AG, Frankfurt,
Germany).
[0091] Efficient use of selectable markers is facilitated by a
determination of the susceptibility of a plant cell to a particular
selectable agent and a determination of the concentration of this
agent which effectively kills most, if not all, of the transformed
cells. Some useful concentrations of antibiotics for tobacco
transformation include, e.g., 75-100 .mu.g/ml (kanamycin), 20-50
.mu.g/ml (hygromycin), or 5-10 .mu.g/ml (bleomycin). A useful
strategy for selection of transformants for herbicide resistance is
described, e.g., by Vasil et al., supra.
[0092] It should be readily apparent to one skilled in the art of
molecular biology, especially in the field of plant molecular
biology, that the level of gene expression is dependent, not only
on the combination of promoters, RNA processing signals, and
terminator elements, but also on how these elements are used to
increase the levels of selectable marker gene expression.
[0093] Plant Transformation
[0094] Upon construction of the plant expression vector, several
standard methods are available for introduction of the vector into
a plant host, thereby generating a transgenic plant. These methods
include (1) Agrobacterium-mediated transformation (A. tumefaciens
or A. rhizogenes) (see, e.g., Lichtenstein and Fuller In: Genetic
Engineering, vol 6, PWJ Rigby, ed, London, Academic Press, 1987;
and Lichtenstein, C. P., and Draper, J, In: DNA Cloning, Vol II, D.
M. Glover, ed, Oxford, IRI Press, 1985)), (2) the particle delivery
system (see, e.g., Gordon-Kamm et al., Plant Cell 2:603 (1990); or
BioRad Technical Bulletin 1687, supra), (3) microinjection
protocols (see, e.g., Green et al., supra), (4) polyethylene glycol
(PEG) procedures (see, e.g., Draper et al., Plant Cell Physiol.
23:451 (1982); or e.g., Zhang and Wu, Theor. Appl. Genet. 76:835
(1988)), (5) liposome-mediated DNA uptake (see, e.g., Freeman et
al., Plant Cell Physiol. 25:1353 (1984)), (6) electroporation
protocols (see, e.g., Gelvin et al., supra; Dekeyser et al., supra;
Fromm et al., Nature 319:791 (1986); Sheen, Plant Cell 2:1027
(1990); or Jang and Sheen Plant Cell 6:1665 (1994)), and (7) the
vortexing method (see, e.g., Kindle supra). The method of
transformation is not critical to the present invention. Any method
which provides for efficient transformation may be employed. As
newer methods are available to transform crops or other host cells,
they may be directly applied.
[0095] The following is an example outlining one particular
technique, an Agrobacterium-mediated plant transformation. By this
technique, the general process for manipulating genes to be
transferred into the genome of plant cells is carried out in two
phases. First, cloning and DNA modification steps are carried out
in E. coli, and the plasmid containing the gene construct of
interest is transferred by conjugation or electroporation into
Agrobacterium. Second, the resulting Agrobacterium strain is used
to transform plant cells. Thus, for the generalized plant
expression vector, the plasmid contains an origin of replication
that allows it to replicate in Agrobacterium and a high copy number
origin of replication functional in E. coli. This permits facile
production and testing of transgenes in E. coli prior to transfer
to Agrobacterium for subsequent introduction into plants.
Resistance genes can be carried on the vector, one for selection in
bacteria, for example, streptomycin, and another that will function
in plants, for example, a gene encoding kanamycin resistance or
herbicide resistance. Also present on the vector are restriction
endonuclease sites for the addition of one or more transgenes and
directional T-DNA border sequences which, when recognized by the
transfer functions of Agrobacterium, delimit the DNA region that
will be transferred to the plant.
[0096] In another example, plant cells may be transformed by
shooting into the cell tungsten microprojectiles on which cloned
DNA is precipitated. In the Biolistic Apparatus (Bio-Rad) used for
the shooting, a gunpowder charge (22 caliber Power Piston Tool
Charge) or an air-driven blast drives a plastic macroprojectile
through a gun barrel. An aliquot of a suspension of tungsten
particles on which DNA has been precipitated is placed on the front
of the plastic macroprojectile. The latter is fired at an acrylic
stopping plate that has a hole through it that is too small for the
macroprojectile to pass through. As a result, the plastic
macroprojectile smashes against the stopping plate, and the
tungsten microprojectiles continue toward their target through the
hole in the plate. For the present invention, the target can be any
plant cell, tissue, seed, or embryo. The DNA introduced into the
cell on the microprojectiles becomes integrated into either the
nucleus or the chloroplast.
[0097] In general, transfer and expression of transgenes in plant
cells are now routine practices to those skilled in the art, and
have become major tools to carry out gene expression studies in
plants and to produce improved plant varieties of agricultural or
commercial interest.
[0098] Transgenic Plant Regeneration
[0099] Plants cells transformed with plant expression vectors can
be regenerated, for example, from single cells, callus tissue, or
leaf discs according to standard plant tissue culture techniques.
It is well known in the art that various cells, tissues, and organs
from almost any plant can be successfully cultured to regenerate an
entire plant; such techniques are described, e.g., in Vasil supra;
Green et al., supra; Weissbach and Weissbach, supra; and Gelvin et
al., supra.
[0100] In one particular example, a cloned chimeric synthase
polypeptide under the control of the EAS4 promoter and the nopaline
synthase terminator and carrying a selectable marker (for example,
kanamycin resistance) is transformed into Agrobacterium.
Transformation of leaf discs (for example, of tobacco leaf discs),
with vector-containing Agrobacterium is carried out as described by
Horsch et al. (Science 227:1229 (1985)). Putative transformants are
selected after a few weeks (for example, 3 to 5 weeks) on plant
tissue culture media containing kanamycin (e.g., 100 .mu.g/ml).
Kanamycin-resistant shoots are then placed on plant tissue culture
media without hormones for root initiation. Kanamycin-resistant
plants are then selected for greenhouse growth. If desired, seeds
from self-fertilized transgenic plants can then be sowed in
soil-less medium and grown in a greenhouse. Kanamycin-resistant
progeny are selected by sowing surfaced sterilized seeds on
hormone-free kanamycin-containing media. Analysis for the
integration of the transgene is accomplished by standard techniques
(see, for example, Ausubel et al. supra; Gelvin et al. supra).
[0101] Transgenic plants expressing the selectable marker are then
screened for transmission of the transgene DNA by standard
immunoblot and DNA detection techniques. Each positive transgenic
plant and its transgenic progeny are unique in comparison to other
transgenic plants established with the same transgene. Integration
of the transgene DNA into the plant genomic DNA is in most cases
random, and the site of integration can profoundly effect the
levels and the tissue and developmental patterns of transgene
expression. Consequently, a number of transgenic lines are usually
screened for each transgene to identify and select plants with the
most appropriate expression profiles.
[0102] Transgenic lines are generally evaluated for levels of
transgene expression. Expression at the RNA level is determined
initially to identify and quantitate expression-positive plants.
Standard techniques for RNA analysis are employed and include PCR
amplification assays using oligonucleotide primers designed to
amplify only transgene RNA templates and solution hybridization
assays using transgene-specific probes (see, e.g., Ausubel et al.,
supra). The RNA-positive plants are then analyzed for protein
expression by Western immunoblot analysis using specific antibodies
to the chimeric synthase (see, e.g., Ausubel et al., supra). In
addition, in situ hybridization and immunocytochemistry according
to standard protocols can be done using transgene-specific
nucleotide probes and antibodies, respectively, to localize sites
of expression within transgenic tissue.
[0103] Once the recombinant chimeric synthase protein is expressed
in any cell or in a transgenic plant (for example, as described
above), it may be isolated, e.g., using affinity chromatography. In
one example, an anti-chimeric synthase antibody (e.g., produced as
described in Ausubel et al., supra, or by any standard technique)
may be attached to a column and used to isolate the polypeptide.
Lysis and fractionation of chimeric synthase-producing cells prior
to affinity chromatography may be performed by standard methods
(see, e.g., Ausubel et al., supra). Once isolated, the recombinant
protein can, if desired, be further purified, for example, by high
performance liquid chromatography (see, e.g., Fisher, Laboratory
Techniques In Biochemistry And Molecular Biology, eds., Work and
Burdon, Elsevier, 1980).
[0104] These general techniques of polypeptide expression and
purification can also be used to produce and isolate useful
chimeric synthase fragments or analogs.
[0105] Use
[0106] The invention described herein is useful for a variety of
agricultural, pharmaceutical, industrial, and commercial purposes.
For example, the methods, DNA constructs, proteins, and transgenic
organisms, including the bacteria, yeast, and plants described
herein, are useful for improving isoprenoid synthesis,
manufacturing, and production.
[0107] Our results presented above demonstrate that it is possible
to modulate isoprenoid synthase activity by providing chimeric
synthases. In this manner, various synthase reaction products may
be modified, controlled, or manipulated, resulting in enhancement
of production of numerous synthase reaction products, for example,
the production of novel monoterpenes, diterpenes, and
sesquiterpenes. Such compounds are useful as phytoalexins,
insecticides, perfumes, and pharmaceuticals such as anti-bacterial
and fungal agents.
[0108] A number of chimeric isoprenoid synthases may be engineered
that are useful, for example, for the production of compounds
having anti-fungal, anti-bacterial, anti-malarial, and anti-tumor
properties. For example, for the production of chimeric synthases
capable of catalyzing the production of anti-fungal isoprenoids,
the C-terminal domain of casbene synthase (Mau and West, Proc.
Natl. Acad. Sci. 91:8497, 1994) is joined to the N-terminal domain
of TEAS, HVS, or CH9. To produce a chimeric synthase capable of
catalyzing, the production of anti-bacterial compounds, the
C-terminal domain of cyclofamesenone synthase (Habtermariam et al.,
J. Nat. Prod. 56:140, 1993) is joined to the N-terminal domain of
TEAS, HVS, or CH9. Production of anti-malarial compounds is
achieved using chimeric synthases having a C-terminal domain from
artemisian synthase (El-Feraly et al., J. Nat. Prod. 52:196, 1989)
and an N-terminal domain from TEAS, HVS, or CH9. Synthases capable
of producing anti-tumor compounds are produced by joining the
C-terminal domain of taxadiene synthase (Koepp et al., J. Biol.
Chem. 270:8686, 1995) or helenalin synthase (Lee et al., Science
196: 533, 1977) with the N-terminal domain of TEAS, HVS, or
CH9.
[0109] The invention is also useful for the production of chimeric
synthases which are capable of generating insecticides. Such
chimeric synthases are engineered by joining the C-terminal domain
of cadenine synthase (Chen et al., Arch. Biochem. Biophys. 324:
255, 1995) to the N-terminal domain of TEAS, HVS, and CH9.
[0110] Finally, chimeric synthases are also useful for generating
novel flavorings and perfumes. In one particular example, for the
production of novel flavorings and aromas, a chimeric synthase is
engineered by joining the C-terminal domain of limonene synthase
(Colby et al., J Biol. Chem. 268: 23016, 1993) to the C-terminal
domain of TEAS, HVS, or CH9.
[0111] All publications and patents mentioned in this specification
are herein incorporated by reference to the same extent as if each
individual publication or patent was specifically and individually
indicated to be incorporated by reference.
Other Embodiments
[0112] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention,
and can make various changes and modifications of the invention to
adapt it to various usages and conditions. Thus, other embodiments
are also within the claims.
Sequence CWU 1
1
6130DNAArtificial SequenceSynthesized 1gggatcgatg acatagccac
gtatgaggtt 30217DNAArtificial SequenceSynthesized 2aatacgactc
actatag 17327DNAArtificial SequenceSynthesized 3cgagtcaaca
tggtttattg agggata 27428DNAArtificial SequenceSynthesized
4tattctagat ctctatgacg attatgaa 28542DNAArtificial
SequenceSynthesized 5gggagctcga attccatggc ctcagcagca gttgcaaact at
42630DNAArtificial SequenceSynthesized 6gggatcgata actctgcata
atgtagcatt 30
* * * * *