U.S. patent application number 13/846155 was filed with the patent office on 2014-08-28 for polypeptide having phytase activity and increased temperature resistance of the enzyme activity, and nucleotide sequence coding said polypeptide.
This patent application is currently assigned to AB ENZYMES GMBH. The applicant listed for this patent is AB Enzymes GmbH. Invention is credited to Khanh Q. Nguyen, Bruno Winter.
Application Number | 20140242249 13/846155 |
Document ID | / |
Family ID | 39276360 |
Filed Date | 2014-08-28 |
United States Patent
Application |
20140242249 |
Kind Code |
A1 |
Nguyen; Khanh Q. ; et
al. |
August 28, 2014 |
POLYPEPTIDE HAVING PHYTASE ACTIVITY AND INCREASED TEMPERATURE
RESISTANCE OF THE ENZYME ACTIVITY, AND NUCLEOTIDE SEQUENCE CODING
SAID POLYPEPTIDE
Abstract
The invention relates to a recombinant DNA molecule encoding a
polypeptide having phytase activity and increased temperature
stability and increased proteolytic stability of the enzyme
activity. The DNA sequence has been obtained by variation of the
mature wild-type E. coli phytase sequence with defined amino acid
positions being modified in comparison to the wild-type sequence or
with the sequences having N- and/or C-terminal extensions,
respectively. The invention further relates to a method for
expressing the recombinant phytase as well as its use in the food
and animal feed technologies.
Inventors: |
Nguyen; Khanh Q.;
(Reichelsheim, DE) ; Winter; Bruno; (Stuttgart,
DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AB Enzymes GmbH |
Darmstadt |
|
DE |
|
|
Assignee: |
AB ENZYMES GMBH
Darmstadt
DE
|
Family ID: |
39276360 |
Appl. No.: |
13/846155 |
Filed: |
March 18, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12312381 |
Jul 14, 2009 |
8420369 |
|
|
PCT/EP2007/009522 |
Nov 2, 2007 |
|
|
|
13846155 |
|
|
|
|
Current U.S.
Class: |
426/588 ;
426/656; 435/196; 435/91.1 |
Current CPC
Class: |
C12N 9/16 20130101; C12Y
301/03026 20130101; A23K 10/14 20160501; A23L 29/06 20160801 |
Class at
Publication: |
426/588 ;
435/196; 435/91.1; 426/656 |
International
Class: |
C12N 9/16 20060101
C12N009/16; A23K 1/165 20060101 A23K001/165; A23L 1/03 20060101
A23L001/03 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 10, 2006 |
DE |
10 2006 053 059.4 |
Claims
1.-10. (canceled)
11. A polypeptide having phytase activity after expression in a
prokaryotic or eukaryotic host cell, and which is coded by a
recombinant DNA molecule having a DNA sequence selected from a) DNA
sequences obtained by variation of the mature wild-type Escherichia
coli phytase sequence, the variation being selected from the group
consisting of i) the mutation lysine.fwdarw.aspartic acid in
position 74 (K74D), ii) a combination of the mutations
asparagine.fwdarw.arginine in position 139 (N139R) and aspartic
acid.fwdarw.glutamic acid in position 142 (D142E), iii) a
combination of the mutations leucine.fwdarw.isoleucine in position
145 (L145I) and leucine.fwdarw.isoleucine in position 198 (L198I),
iv) a mutation valine.fwdarw.proline in position 200 (V200P), and
v) an N-terminal or C-terminal or an N-terminal and C-terminal
addition of a sequence section of the acidic phosphatase of
Aspergillus niger var. awamori or the phytase of Aspergillus niger,
b) DNA sequences that are 70 to 100 percent homologous to the
sequences listed under a), and c) DNA sequences which are related
to the sequences listed under a) and b) because of degeneration of
the genetic code, wherein the polypeptide has an increased
temperature and protease stability of phytase activity, or which is
obtained by the expression of a host cell transformed by the
same.
12. The polypeptide according to claim 11, characterized in that it
comprises a sequence, selected from SEQ ID NO:10, SEQ ID NO:12, SEQ
ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, and SEQ ID
NO:22.
13.-20. (canceled)
21. A composition comprising a polypeptide according to claim 11
optionally together with further auxiliary or active
ingredients.
22. The composition according to claim 21, characterized in that it
contains skimmed milk powder and/or calcium propionate.
23. The composition according to claim 21, characterized in that
the composition is a composition of food and animal feed.
24. The composition according to claim 21 characterized in that the
composition is a baking ingredient.
25.-35. (canceled)
36. A method for the production of a preparation for the
improvement of the phosphate utilisation from food and animal feed
comprising use of a polypeptide according to claim 11.
37. A method for the improvement of the rheological characteristics
of doughs for the production of bakery products comprising use of a
polypeptide according to claim 11.
38. A method for the production of a recombinant DNA molecule
which, after the expression in a prokaryotic or eukaryotic host
cell, codes for a polypeptide with phytase activity which has an
increased temperature and protease stability, the method
comprising: use of one or more variation of the mature wild-type E.
coli phytase sequence, the variation being selected from the group
consisting of: i) the mutation lysine.fwdarw.aspartic acid in
position 74 (K74D), ii) a combination of the mutations
asparagine.fwdarw.arginine in position 139 (N139R) and aspartic
acid.fwdarw.glutamic acid in position 142 (D142E), iii) a
combination of the mutations leucine.fwdarw.isoleucine in position
145 (L145I) and leucine.fwdarw.isoleucine in position 198 (L198I),
iv) a mutation valine.fwdarw.proline in position 200 (V200P), and
v) an N-terminal or C-terminal or an N-terminal and C-terminal
addition of a sequence section of the acidic phosphatase of
Aspergillus niger var. awamori or the phytase of Aspergillus
niger.
39. The method according to claim 38, wherein the variation is
K74D.
40. The method according to claim 38, wherein the variation is
N139R and D142E.
41. The method according to claim 38, wherein the variation is
L145I and L198I.
42. The method according to claim 38, wherein the variation is
V200P.
43. The method according to claim 38, wherein the variation is
K74D, N139R, D142E, and V200P.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. Ser. No.
12/312,381, filed Jul. 14, 2009 (now U.S. Pat. No. 8,420,369),
which was a National Phase entry of International Application No.
PCT/EP2007/009522, filed Nov. 2, 2007, which claimed the prior
benefit of German Application No. DE 10 2006 053 059.4, filed Nov.
10, 2006.
BACKGROUND OF THE INVENTION
[0002] The invention relates to a recombinant DNA molecule encoding
a polypeptide having phytase activity and increased temperature
stability and increased proteolytic stability of the enzyme
activity as well as the coded polypeptide itself. In particular,
the invention relates to a recombinant DNA molecule encoding a
polypeptide having phytase activity and increased temperature
stability and increased proteolytic stability of the enzyme
activity, whereby the DNA sequence has been obtained by variation
of the mature wild-type E. coli phytase sequence with defined amino
acid positions being modified in comparison to the wild-type
sequence or with the sequences having N- and/or C-terminal
extensions, respectively. The invention further relates to a method
for expressing the recombinant phytase as well as its use in the
food and animal feed technologies.
[0003] Phytic acid or
myoinositol-1,2,3,4,5,6-hexakisdihydrogenphosphate (abbreviated
myoinositol hexakisphosphate) represents the main source of
inositol and the principal storage form of phosphate in plant
seeds. In the seeds of legumes about 70% of the phosphate content
is present in the form of a mixture of potassium, magnesium and
calcium salts of the phytic acid. Seeds, grains and legumes are
important components of food and animal feed preparations, in
particular of animal feed preparations; but also in human nutrition
grains and legumes become more and more important.
[0004] The phosphate units of the phytic acid bind as complex
bivalent and trivalent cations like metal ions, i.e. in terms of
nutritional physiology important ions like calcium, iron, zinc and
magnesium as well as the trace elements manganese, copper and
molybdenum. Further, phytic acid also binds to a certain extent
proteins via electrostatic interaction.
[0005] Often, phytic acid and its salts, the phytates, are not
metabolised since they are not absorbed from the gastrointestinal
tract; i.e. neither the therein contained phosphorus nor the
chelated metal ions nor the bound proteins are available in terms
of nutritional physiology.
[0006] Since phosphorus represents an essential element for the
growth of all organisms food and animal feed have to be
supplemented by anorganic phosphorus. Very often, ions like iron or
calcium, which are essential in terms of nutritional physiology,
have to be supplemented. Moreover, the value of each diet in terms
of nutritional physiology is reduced since proteins are bound by
phytic acid. Consequently, phytic acid is often described as
anti-nutritional factor.
[0007] Further, due to the fact that the phytic acid is not
metabolised, the phosphorus of the phytate is excreted via the
gastrointestinal tract of the animals, leading to an undesired
phosphate pollution of the environment, which might be the cause,
for example, for eutrophication of water bodies, and to excessive
growth of algae.
[0008] Phytic acid or phytate (unless indicated otherwise, these
terms are used in the following as synonyms) can be metabolised by
phytases. Phytases catalyse the hydrolysis of phytate to
myoinositol and/or mono-, di-, tri-, tetra- and/or pentaphosphate
as well as anorganic phosphate. Two different forms of microbial
phytases are distinguished from each other: 1)
3-phytase/myoinositiolhexaphosphate-3-phosphohydrolase, EC 3.1.3.8;
2) 6-phytase/myoinositolhexaphosphate-6-phosphohydrolase, EC
3.1.3.26. The 3-phytase preferably hydrolyses first the ester bond
in position 3, the 6-phytase preferably first the ester bond in
position 6. Phytic acid containing plant seeds contain endogenous
phytase enzymes. When ingesting the same, the phytates in food or
animal feed are theoretically hydrolysable by endogenous plant
phytases, phytases from the intestinal flora and phytases from the
intestinal mucosa. In practice however, the potency of hydrolysis
of the endogenous plant phytases and the phytases found in the
intestine, if existing, is by far insufficient in order to assure
significantly the bioavailability of the phosphorus bound in the
phytates. Thus, exogenous phytases are often added to food and
animal feed.
[0009] Phytates can be produced by plants and by microorganisms.
Among the microorganisms phytase producing bacteria as well as
phytase producing fungi and yeasts are known.
[0010] The naturally occurring phytase producers, however, have the
disadvantage that phytase is generated only in certain amounts and
with defined characteristics. As described hereinbefore, though,
there exists an increased demand for phytase in particular in the
food and animal feed industries.
[0011] Although an increased demand for phytase in the food and
animal feed industries does exist and the use of phytase might be
advantageous only a few of the known phytases have found a broad
acceptance in the food and animal feed industries. Typical concerns
relate to the comparatively high production costs and/or the poor
stability, or activity of the enzyme in the desired application
environment. Moreover, such an enzyme has to fulfil certain
criteria in order to be industrially used. Those comprise a high
specific total activity, a low pH-optimum, resistance against
gastrointestinal proteases as well as temperature stability, or
thermostability. The temperature stability is an important
prerequisite for a successful industrial application since, for
example, enzymes are exposed to temperatures between 60.degree. C.
and 95.degree. C. in pelletising processes.
[0012] All known microbial phytases unfold at temperatures between
56.degree. C. and 78.degree. C. (Lehman et al., 2000), whereby they
lose their activity. Therefore there exists a particular demand for
phytases which possess a technologically sufficient activity also
at higher temperatures, or which are not inactivated.
[0013] Thus, an object of the present invention is to provide a
polypeptide having phytase activity which exhibits an increased
thermostability, or which possesses a technologically sufficient
activity at higher temperatures. Moreover, the polypeptide having
phytase activity should also possess an increased proteolytic
stability.
[0014] It is desired that the polypeptide be produced economically.
In particular, the phytase should have a higher thermostability
than the wild-type enzyme. Moreover, the phytase should keep the
essential characteristics of the natural E. coli-wild-type phytase
but feature an improved thermostability. Among the essential
characteristics of the natural wild-type phytase are in particular
the capability of improving the availability of phosphate in vivo
and in vitro by its activity as phytase as well as phosphatase, its
pH-optimum in an acidic environment with high residual activity in
a highly acidic environment as well as the applicability as
additive for baking.
[0015] An object of the present invention is further to provide a
gene for a polypeptide having phytase activity and having increased
thermostability as well as increased proteolytic stability. It is
desired that the polypeptide be produced economically and in a
cost-effective way. In particular, the expression of the
polypeptide in eukaryotic microorganisms should lead to a
polypeptide with increased thermostability compared to the
similarly produced wild-type phytase. Further are to be provided:
the DNA sequences encoding the polypeptide, corresponding DNA
constructs and vectors as well as a source for the recombinant
enzyme which is suitable for the commercial use for food and animal
feed in industrial processes and compositions containing the enzyme
according to the invention.
[0016] It was surprisingly found that at certain positions of the
E. coli wild-type phytase sequence mutations lead to an intrinsic
improvement of the thermostability, or temperature stability as
well as to an improvement of the proteolytic stability of the
protein phytase without affecting adversely the other effects and
essential characteristics of the wild-type E. coli phytase.
[0017] It was surprisingly found that a mutation in position 74
(K74D) of the amino acid sequence and/or a combination of mutations
in positions 139 (N139R) and 142 (D142E) and/or a combination of
mutations in positions 145 (L145I) and 198 (L198I) and/or a
mutation in position 200 (V200P) of the wild-type phytase of E.
coli as well as combinations of these mutations lead to an improved
thermostability of the protein phytase without affecting the
advantageous effects and essential characteristics of the wild-type
E. coli phytase. It was further found that the extension of E. coli
phytase by sequences of the acidic phosphatase of Aspergillus niger
var. awamori at the N-terminal or C-terminal end or at the
N-terminal and C-terminal ends, also in combination with the
afore-mentioned mutations leads to an improvement of the
thermostability and the proteolytic stability of the enzyme.
[0018] The invention thus relates to a recombinant DNA molecule
encoding a polypeptide having phytase activity after being
expressed in a prokaryotic or eukaryotic host cell, whereby the
recombinant DNA molecule comprises a DNA sequence selected from
[0019] a) DNA sequences encoding a polypeptide that has phytase
activity and is obtained by varying of the mature wild-type E. coli
phytase sequence, the variation being selected from among [0020] i)
the mutation lysine.fwdarw.aspartic acid in position 74 (K74D),
and/or [0021] ii) a combination of the mutations
asparagine.fwdarw.arginine in position 139 (N139R) and aspartic
acid.fwdarw.glutamic acid in position 142 (D142E), and/or [0022]
iii) a combination of the mutations leucine.fwdarw.isoleucine in
position 145 (L145I) and leucine.fwdarw.isoleucine in position 198
(L198I), and/or [0023] iv) a mutation valine proline in position
200 (V200P), and/or [0024] v) an N-terminal or C-terminal or an
N-terminal and C-terminal addition of a sequence section of the
acidic phosphatase of Aspergillus niger var. awamori or the phytase
of Aspergillus niger, [0025] b) DNA sequences that are 70 to 100
percent homologous to the sequences listed under a) [0026] c) DNA
sequences which are related to the sequences listed under a) and b)
because of the degeneration of the genetic code, whereby the
recombinant DNA molecule, when expressed in a suitable host cell,
has an increased temperature and protease stability of the enzyme
activity of the protein coded in said manner, whereby the
variations iii) and iv) are provided only in combination with a
variation i), ii) and v) as well as the polypeptide sequences coded
by said DNA.
[0027] Several phytases from E. coli are described in literature,
e.g. the appAgene from E. coli K-12 which codes a phytase (Dassa et
al., J. Bacteriol. 172:5497-5500 (1990)). This gene codes for a
periplasmatic enzyme which comprises acidic phosphatase activity as
well as phytase activity (cf Greiner et al., Arch. Biochim,
Biophys. 303:107-113 (1993)). Natural mutants of this enzyme are
known (cf, for example, Rodriguez et al., Biochem. Biophys. Res.
Comm. 257 :117-123 (1999)). Genetically modified mutants of E. coli
phytase have also been described which lead to an increased
temperature stability and/or an increased specific activity.
Rodriguez et al. (Arch. Biochem. Biophys. 382:105-112 (2000))
expressed wild-type AppA and several mutants created by
site-specific mutagenesis in Pichia pastoris in order to test the
effect of N-glycolysation on the temperature stability of the AppA
protein. Although the glycolysation has not been intensified a
mutant has been more active at a pH between 3.5 and 5.5 and has
shown more activity after the heating treatment than the wild type
protein produced in P. pastoris.
[0028] The patent family based on WO 03/057248 comprises the patent
applications US 2003/0170293 A1 and US 2003/0157646 A1. Therein,
the microbial production of a thermotolerant phytase for animal
feed is described. The mutant (Nov9X) of the E. coli strain B
phytase (appA) is expressed in E. coli, Pichia pastoris, and
Schizosaccaromyces pombe. The mutant Nov9X comprises 8 amino acid
mutations compared to the wild-type enzyme. The mutant has a better
thermostability in liquid at 70.degree. C. compared to the
wild-type enzyme. The host in which the enzyme is produced has also
an influence on its thermostability, as implied by the same work
group in US patent application US 2003/0157646 A1. The method of
counting the amino acid position is by two positions higher for
NOV9X than in the present invention (W48 NOV9X corresponds to W46
in the present invention).
[0029] In the patent applications WO 02/095003 and WO 2004/015084,
a number of point mutations of E. coli phytase are described; none
of them, however, leads to an increase of the thermostability.
Compared to the present invention, the counting in WO 2004/015084
is by 30 amino acid positions higher.
[0030] Publication document DE 10 2004 050 410 also describes E.
coli phytase mutants, with the aim, however, to increase the
secretion efficiency during production in filamentous fungi. No
information about the increase of the thermostability of the
mutants is given in said document.
[0031] Further, document Garrett et al.; Applied Environ.
Microbiol., 2004, 70 (5), 3041-3046, describes mutants of E. coli
phytase with an increased thermal and gastrointestinal
stability.
[0032] It is practically impossible to predict the effect of one or
several mutants on the characteristics of the enzyme activity under
conditions of higher temperatures. Higher temperatures generally
lead to a denaturation, or to an unfolding of the secondary and
tertiary structure of the protein.
[0033] The temperature stability or thermostability of proteins
depends on a number of interactions. The conformation of proteins
is maintained by a huge number of weak interactions. The
stabilisation can comprise all hierarchical levels of the protein
structure: local packing of the polypeptide chain, secondary and
supersecondary structural elements, domains and subunits of a
multimeric protein. There are various reasons which are described
concerning the increased temperature stability of a protein,
whereby the most common are: (a) the association of ion pairs
within and/or between subunits; (b) improved packing of the
hydrophobic core (van-der-Waals interactions); (c) additional
networks of hydrogen bridges; (d) increased tendency towards
secondary structure building; (e) increased dipole stabilisation
within the helix; (f) an increased polar surface; (g) reduced
number and a reduced total volume of cavities; (h) reduction of
conformational stress (loop stabilisation) and (i) resistance
against chemical modification (oxidation of methionine residues
and/or deamination of aspartic and glutamic residues).
[0034] The prior art furnishes no indications as to how the E. coli
wild-type phytase sequence is preferably to be altered in order to
gain an increase of the thermostability. Moreover, the prior art
furnishes no indications with respect to the afore-mentioned
mutations in the E. coli phytase sequence.
[0035] In particular, the prior art furnishes no indications that a
mutation in position 74 (K74D) of the amino acid sequence or a
combination of mutations in positions 139 (N139R) and 142 (D142E)
or a combination of mutations in positions 145 (L145I) and 198
(L198I) or a mutation in position 200 (V200P) of wild-type phytase
of E. coli or combinations of these mutations lead to an improved
thermostability of the protein phytase without affecting the
advantageous effects and essential characteristics of the wild-type
E. coli phytase. Moreover, the prior art furnishes no indications
that the supplementation of the E. coli phytase sequence by
sequences of the acidic phosphatase of Aspergillus niger var.
awamori at the N-terminal or C-terminal or at the N-terminal and
C-terminal, also in combination with the afore-mentioned mutations,
lead to an improvement of the thermostability of the enzyme.
DETAILED DESCRIPTION OF THE INVENTION
[0036] Preferable recombinant DNA molecules according to the
invention with the variations of the mature wild-type E. coli
phytase sequences according to the invention are the constructs
PhyM2, PhyM3, PhyM9 and PhyM10. They are presented in the following
table 1. The construct PhyM1 has been chosen as reference
product.
TABLE-US-00001 TABLE 1 Genotypes of the mutations PhyM1, PhyM2,
PhyM3, PhyM7, PhyM9 and PhyM10 Wild-type sequences disclosed as SEQ
ID NOS 23, 25, 27, 23, 23, 30, 23, 32, 34, 30, 36, 38 and 23,
respectively, in order of appearance. Mutation sequences disclosed
as SEQ ID NOS 24, 26, 28, 24, 29, 31, 24, 33, 35, 31, 37, 28 and
29, respectively, in order of appearance. AA Genotype Positions
Wild-type sequence Mutations PhyM1 200 E-L-K Val.sup.200 S-A-D
E-L-K Tyr.sup.200 S-A-D PhyM2 139 D-N-A-Asn.sup.139-V-T-D.sup.142-A
D-N-A-Arg.sup.139-V-T-E.sup.142-A 142
D-N-A-N.sup.139-V-T-ASp.sup.142-A D-N-A-R.sup.139-V-T-Glu.sup.142-A
200 E-L-K Val.sup.200 S-A-D E-L-K Tyr.sup.200 S-A-D PhyM3 200 E-L-K
Val.sup.200 S-A-D E-L-K Pro.sup.200 S-A-D PhyM7 74
L-L-A-Lys.sup.74-K-G L-L-A-Asp.sup.74-K-G 200 E-L-K Val.sup.200
S-A-D E-L-K Tyr.sup.200 S-A-D PhyM9 145 D-A-I Leu.sup.145S-R-A
D-A-I Ile.sup.145S-R-A 198 P-S-E Leu.sup.198 K-V-S P-S-E
Ile.sup.198 K-V-S PhyM10 74 L-L-A-Lys.sup.74-K-G
L-L-A-Asp.sup.74-K-G 139 N-A-Asn.sup.139-V-T-D.sup.142-A
D-N-A-Arg.sup.139-V-T-E.sup.142-A 142
N-A-N.sup.139-V-T-Asp.sup.142-A D-N-A-R.sup.139-V-T-Glu.sup.142-A
200 E-L-K Val.sup.200 S-A-D E-L-K Pro.sup.200 S-A-D
[0037] The following plasmids have been deposited at the Deutsche
Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ),
Mascheroder Weg 1b, 38124 Braunschweig on Oct. 18, 2006 in
accordance with the conditions of the Budapest treaty.
TABLE-US-00002 Plasmid Accession number pET-PhyM2 DSM 18715
pUC-PhyM3 DSM 18717 pET-PhyM7 DSM 18716 pUC-PhyM9 DSM 18718
pUC-PhyM10 DSM 18719 pPhy2005 DSM 18720 pPhy2006 DSM 18721
[0038] Surprisingly, mutations influencing the hydrophobic surface
of the protein (PhyM3, PhyM7 and PhyM9) as well as mutations
inserting an ionic bond in helix D (PhyM2), or stabilising Loop B4
via an ionic bridge (PhyM7) contribute significantly to an increase
of the thermostabililty of E. coli phytase.
[0039] Also the adding of sequence parts of the acidic phosphatase
of Aspergillus niger var. awamori, which lead in an acidic
phosphatase to a di- and tetramer production, had stabilising
effects on the E-coli phytase. The same can be said about the
adding of sequence parts of the Aspergillus niger phytase.
[0040] The polypeptides having phytase activity according to the
invention show an increased temperature or thermostability of their
enzyme activity compared to the E. coli wild-type enzyme. This
improvement of the thermostability can be measured in liquids via
Differential Scanning calorimetry (DSC). In particular, the
improvement of the thermostability can be seen from the highly
increased residual activity of the enzyme mutants compared to the
wild-type enzyme when being exposed to thermal stress as used when
pelleting animal feed. Further, the polypeptides according to the
invention possess an increased stability against proteolytic
decomposition as found in particular in the stomachs of poultry and
monogastrians. Since in the nutrition of animals, in particular
during the gastric passage, the phytase has to release the
phosphate from the phytic acid and its decompositions products,
said stability is of particular interest in order to keep the
dosage of the enzyme as low as possible. Due to the increased
temperature and/or proteolytic stability the phytases according to
the invention are especially suitable for applications with
increased temperature conditions or where an increased proteolytic
decomposition can be expected. Examples of use are the production
of the enzyme which has to be protected against the proteases of
the host strain, the production of pelleted animal feed, but also
the use as liquid enzyme for the post-pelleting application on the
pelleted animal feed. An increased temperature stability enables an
earlier application on the pellets which are not yet cooled down
which leads to a shortening of the evaporation time of the applied
liquid. Also from the microbiological point of view there are
advantages, since thus the high water content exists only temporary
at high temperatures at which most pathogenic germs cannot
grow.
[0041] The DNA sequence according to the invention encoding a
phytase comprises at least one of the following mutations or
combinations of mutations and/or an N-terminal or C-terminal or an
N-terminal and C-terminal addition of the coded polypeptide: [0042]
i) the mutation lysine.fwdarw.aspartic acid in position 74 (K74D),
and/or [0043] ii) a combination of the mutations
asparagine.fwdarw.arginine in position 139 (N139R) and aspartic
acid.fwdarw.glutamic acid in position 142 (D142E), and/or [0044]
iii) a combination of the mutations leucine.fwdarw.isoleucine in
position 145 (L145I) and leucine.fwdarw.isoleucine in position 198
(L198I), and/or [0045] iv) a mutation valine.fwdarw.proline in
position 200 (V200P), and/or [0046] v) an N-terminal or C-terminal
or an N-terminal and C-terminal addition of a sequence section of
the acidic phosphatase of Aspergillus niger var. awamori or the
phytase of Aspergillus niger.
[0047] The phytase sequence according to the invention comprises
preferably at least one and very preferably at least two of the
afore-mentioned variations. Any combinations of the afore-mentioned
mutation variants are possible in order to adapt the
thermostability of the phytase to the present conditions of the
special application. A preferred possible combination is the
combination of i), ii) and iv) which is in the following referred
to the genotype PhyM10.
[0048] Moreover, in addition to or instead of the described
mutations or combinations of mutations an N-terminal or C-terminal
or an N-terminal and C-terminal addition of a sequence section of
the acidic phosphatase of Aspergillus niger var. awamori can be
present. The sole existence of these sequence parts already leads
to an increase of the thermostability. The N-terminal part of the
acidic phosphatase of Aspergillus niger var. awamori represents the
first 51 amino acids of the mature protein (FSYGAAIPQS TQEKQFSQEF
RDGYSILKHY GGNGPYSERV SYGIARDPPTS) (SEQ ID NO: 39). The last 4
amino acids of this polypeptide replace the first 4 amino acids
(QSEP (SEQ ID NO: 40)) of the mature E. coli phytase. Also the
addition of parts of this sequence of the acidic phosphatase is
possible. Alternatively, the N-terminal part or parts of the first
40 amino acids of the mature protein of Aspergillus niger phytase
can be used (SCDTVDQGYQ CFSETSHLWG QYAPFFSLAN ESVISPEVPA) (SEQ ID
NO: 41). The addition to the E. coli phytase can also be effected
at other sites than the described position 4 as long as the enzyme
activity is maintained. For the C-terminal addition, the last 29
amino acids (LSFWWNYNTT TELNYRSSPI ACQEGDAMD) (SEQ ID NO: 42) of
the acidic phosphatase of Aspergillus niger var. awamori have been
fusioned with the C-terminal end of E. coli phytase. This fusion or
these fusions can also go along with other mutations of the E. coli
phytase and are not restricted to the other mutations described in
this invention. The mutation Lys43Cys would enable the disulphide
bridging between the new C-terminal part and the E. coli phytase
core and would consequently lead to an improved dimerization.
Further mutations, which would favour or stabilize van der Waals,
hydrophobic or ionic intermolecular bridgings and thus increase or
further improve the thermostability are possible. Examples for the
N- or C-terminal sequence additions can be found in the below
described embodiments Phy2005 and Phy2006.
[0049] The thermostability of the phytase according to the
invention can be further increased in products, e.g. by adding
substances in the ultrafiltration concentrate prior to drying or
granulation. For example, a stable formulation of the phytase
enzyme according to the invention can be produced by spraying a
mixture of a liquid enzyme solution on a filling material like
maltodextrine prior to drying said mixture, or by adding to the
liquid enzyme solution prior to drying 20%-60% skimmed milk powder
(w/w based on the total protein of the enzyme solution) and/or
1%-5% calcium propionate (w/w based on the total protein of the
enzyme solution) and adjusting the pH value to a defined value, in
particular to pH 5.2.+-.0.5. The reduction of the humidity and the
binding interactions of the phytase with the filling material
protect the enzyme in addition to the stability defined in its
structure against environmental stress like temperature extremes
which might arise during the production of the animal feed. Dry and
liquid formulations can be stabilized further if the activity of
potentially proteolytic enzymes is reduced which might appear as
side products in the liquid fermentation mixture used for the
production of the enzyme according to the invention.
[0050] The DNA sequence corresponding to the mutated phytase
sequence according to the invention can be realised by using any
codon usages. For example, the codon usage of the microorganism
used for the expression can be used, but also the E. coli usage or
a variation thereof. Moreover, the mutated E. coli phytase sequence
according to the invention can contain further sequence variations.
Any variations next to the afore-mentioned mutations can be
effected as long as the property of the increased temperature
stability is not unfavourably affected and as long as the enzymatic
activity and further essential characteristics of E. coli wild-type
phytase are maintained.
[0051] Corresponding variations are well known to a person skilled
in the recombinant DNA technology and comprise the afore-mentioned
mutations as well as the exemplary variations described below.
[0052] According to the invention, addition and/or deletion
molecules of the polypeptide modified according to the invention
can be used. Thus, the polypeptide with phytase activity modified
according to the invention can be lengthened by adding further
sequences on the N-terminal and/or C-terminal end. Thus, hybrid
molecules can be produced which have further advantageous
characteristics. For example, fusion proteins or naturally strongly
secretioned proteins can be added which improves the secretion
efficiency. For that purpose, the use of a part of the CBH2 protein
from Trichoderma reesei, from amino acid Met 1 to Ser 86, is
preferred.
[0053] According to the invention, sequence sections of the
polypeptide with phytase activity can also be deleted as long as
the property of the increased temperature stability along with the
maintenance of the phytase activity is not influenced.
[0054] The mutations, elongations and shortenings can be effected
by well-known means and in processes well known in the specific
field.
[0055] The afore-mentioned alterations of the polypeptide with
phytase activity correspond to corresponding mutations or
modifications of the corresponding DNA molecule. According to the
invention, even those sequences are taken into account, which
hybridise under relaxed and stringent conditions to the sequences
according to the invention. The stringent conditions are as
follows: hybridisation at 65.degree. C., 18 h in dextransulfate
solution (GenescreenPlus, DuPont), then the cleaning of the
filters, each 30 minutes, first with 6.times.SSC, twice
2.times.SSC, twice 2.times.SSC with 0.1% SDS and then with
0.2.times.SSC at 65.degree. C. (membrane transfer and detection
methods, Amersham).
[0056] Moreover, the invention also relates to those sequences
comprising, with the claimed nucleotide sequence and the claimed
parts thereof, a homology of at least 70%, preferably at least 80%,
even more preferably 90% and in particular at least 95% as long as
the corresponding sequences lead to an increase of the temperature
stability of the polypeptide with phytase activity coded thereby.
Preferably, the homology is 70 to 100%. The homology is defined as
degree of identity. For this purpose, the degree of identity is
preferably defined in the way that the number of residues of the
shorter sequence which takes part in the comparison and which
possesses a "corresponding" complement in the other sequence is
determined. For the purposes of the present invention the homology
is preferably determined by the usual way using the usual
algorithms. According to the invention, only the cDNAs of the
corresponding mature proteins are taken into consideration for the
comparison. According to the invention, similar, preferably
identical sequence complements are determined as homologous
sequences by known computer programs. An example for such a program
is the program Clone Manager Suite, which contains the program part
Align Plus and which is distributed by Scientific & Educational
Software, Durham, N.C., USA. For this purpose, a comparison of two
DNA sequences as defined above is drawn, under the option local
alignment either via the method FastScan-MaxScore or via the method
Needleman-Wunsch with maintenance of the default values. According
to the invention, the program version "Clone Manager 7 Align Plus
5" with the functions "Compare Two Sequences/Local Fast Scan-Max
Score/Compare DNA sequences" has especially been used for the
determination of the homology. For this purpose, the algorithms
available from the following sources have been used: Hirschberg, D.
S. (1975) A linear space algorithm for computing longest common
subsequences, Commun Assoc Comput Mach 18:341-343; Myers, E. W. and
W. Miller. (1988) Optimal alignments in linear space, CABIOS 4:1,
11-17; Chao, K-M, W. R. Pearson and W. Miller. (1992) Aligning two
sequences within a specified diagonal band, CABIOS 8:5,
481-487.
[0057] The invention further relates to DNA sequences, which due to
the degeneration of the genetic code are related to the sequences
according the invention as well as allelic variations thereof. The
degeneration of the genetic code can be caused by natural
degeneration or due to a specially chosen codon usage. Natural
allelic variants can be identified via the use of well-known
techniques of the molecular biology like e.g. the polymerase chain
reaction (PCR) and hybridisation techniques.
[0058] A DNA sequence encoding a polypeptide according to the
invention can be used to transform any host cells like e.g. cells
of fungi, yeasts, bacteria, plants or mammals. Such transformed
cells display a production and possibly a secretion of phytase with
increased thermostability. The phytase enzyme with phytase activity
produced in this way also leads to an efficient phosphate release
from phytates.
[0059] The terms protein, peptide and polypeptide should be used in
a mutually interchangeable way. A polypeptide or an enzyme with
phytase activity or a phytase should designate each enzyme which
can cause the release of anorganic phosphate from various
myoinositol phosphates. Examples for such myoinositol phosphate
(phytase) substrates are phytic acid and various salts thereof,
e.g. sodium phytate or potassium phytate or mixed salts. Various
position isomers of di-, tri-, tetra- or pentaphosphates can also
serve as phytate substrates. The phytase activity can be determined
by using any assay which uses one of these substrates. A phytase
variant according to the invention comprises polypeptide variants
which are derived from a special phytase by deletion or by addition
of one or several amino acids from/to the N-terminal and/or
C-terminal end(s) of the natural protein, by deletion or by
addition of one or several amino acids from/to one or several sites
on the natural protein or substitution of one or several amino
acids at one or several sites on the phytase. The production of
such variants is generally well-known in the field. For example,
amino acid sequence variants of the polypeptides can be produced by
mutation in the DNA. Processes for mutagenesis and nucleotide
sequence changes are well-known in the field (cf., for example,
Kunkel, Proc. Natl. Acad. Sci. USA, 82:488 (1985), Kunkel et al.,
Methods in Enzymol., 154:367 (1987), U.S. Pat. No. 4,873,192,
Walker and Gaastra, eds., Techniques in Molecular Biology, Mac
Millan Publishing Company, New York (1983)). Indications concerning
suitable amino acid substitutions, which do not significantly
affect the biological activity of the protein of interest, can be
found in the model of Dayhoff et al., Atlas of Protein Sequence and
Structure, Natl. Biomed. Res. Found., Washington, D.C. (1978).
Conservative substitutions like the exchange of an amino acid
against another with similar characteristics are preferred.
[0060] Amino acids which are exchangeable within a certain group
include, but are not limited to the amino acids listed in the
following table:
TABLE-US-00003 Aliphatic Non-Polar G A P I L V Polar and uncharged
C S T M N Q Polar and charged D E K R Aromatic H F W Y
[0061] The invention also relates to isolated or essentially
purified nucleic acid or protein compositions. Thereby, an isolated
and purified polynucleotide/polypeptide or segment thereof
designates a polynucleotide or polypeptide or segment thereof which
is isolated from its natural environment. An isolated polynucleic
acid segment or polypeptide can be present in purified form or can
be present in a non-natural environment like e.g. in a transgenic
host cell. For example, an isolated or purified polynucleotide
segment or protein or a biologically active part thereof is
essentially devoid of any further cellular material or culture
medium at the production by recombinant techniques or essentially
devoid of chemical precursors or other chemical compounds.
Preferred is an isolated polynucleotide devoid of sequences
(preferably protein coding sequences) which naturally flank the
nucleic acid (i.e. the sequences which are localised at the 5'- and
3'-ends of the nucleic acid) in the genomic DNA of the organism
from which the nucleic acid derives. For example, according to
different embodiments, the isolated nucleic acid molecule can
contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1
kb of nucleotide sequences which naturally flank the nucleic acid
molecule in the genomic DNA of the cell from which the nucleic acid
molecule is derived. A protein essentially devoid of cellular
material comprises compositions of protein or polypeptide with less
than about 70%, 50%, 30%, 20%, 10%, 5% (based on the dry weight) of
contaminating protein. When the protein according to the invention
or a fragment thereof is produced recombinantly, the culture medium
preferably comprises less than about 70%, 50%, 30%, 20%, 10% or 5%
(based on the dray weight) of the chemical precursors or
non-proteinaceous chemical substances. The invention also comprises
fragments and variants of the nucleotide sequences according to the
invention or proteins or protein segments which are coded thereby.
Fragment refers to a part of the nucleotide sequence or a part of
the amino acid sequence and thus to a part of the polypeptide or
protein which is coded thereby.
[0062] The invention also refers to expression cassettes which can
be used for the introduction of the open reading frame which codes
a phytase according to the invention into a host cell. They
preferably comprise a transcription initiation region which is
linked to the open reading frame. Such an expression cassette can
contain a multitude of restriction sites for the insertion of the
open reading frame and/or other DNAs, e.g. a transcription
regulator region and/or selectable genetic markers. The
transcription cassette comprises in the 5'.fwdarw.3'-direction of
the transcription a transcription and translation initiation
region, the DNA sequence of interest and a transcription and
translation termination region which is functional in a microbial
cell. The termination region can be native concerning the
transcription initiation region, can be native concerning the DNA
sequence of interest or can be derived from any other source.
[0063] The term "open reading frame" (ORF) designates the amino
acid sequence which is coded between the translation start and stop
codons of a coding sequence. The terms "start codon" and "stop
codon" designate a unity of three adjacent nucleotides (codons) in
an encoding sequence which specify the chain start and stop of the
protein synthesis (mRNA translation).
[0064] "Functional link" or "operatively linked" designates in
connection with a nucleic acid a linkage as a part of the same
nucleic acid molecule in suitable positioning and orientation in
relation to the transcription initiation of the promoter. DNA,
which is operatively linked to the promoter, is under the
transcription initiation regulation of the promoter. Coding
sequences can be operatively linked to the regulatory sequence in
sense or antisense orientation. In relation to polypeptide
"functional linkage/operatively linked" designates the linkage as
part of the same polypeptide, i.e. via polypeptide bindings.
[0065] According to the invention any promoters can be used.
Promoter usually designates the nucleotic sequence upstream (5') in
relation to the coding sequence and controls the expression of the
coding sequence by providing the recognition of the RNA polymerase
and other factors required for the correct transcription. The
promoter according to the invention can comprise a minimal
promoter, i.e. a short DNA sequence from a TATA box and other
sequences specifying the transcription initiation site to which
regulatory elements for controlling the expression are added.
[0066] The promoter according to the invention can also comprise a
nucleic acid sequence comprising a minimal promoter and regulatory
elements which can control the expression of a coding sequence or
functional RNA. This type of promoter sequence consists of proximal
and distal upstream elements whereby the last named elements are
often designated as enhancer. Consequently, an enhancer is a DNA
sequence which can stimulate the promoter activity and which can be
an element being inherent in the promoter or an inserted
heterologous element in order to intensify the expression height or
tissue specificity of a promoter. It can function in both
orientations and can even function when being placed upstream or
downstream from the promoter. Enhancer as well as other upstream
promoter elements bind sequence specific DNA-binding proteins which
mediate their effects. In their entirety promoters can be derived
from a native gene or can be composed from different elements which
are derived from different native promoters or can even be composed
from synthetic DNA segments. A promoter can also contain DNA
sequences which are involved in the linkage of protein factors
which control the efficiency of the transcription initiation in
response to physiological or developmental conditiones.
[0067] Promoter elements, in particular TATA elements which are
inactive or a possess strongly reduced promoter activity in the
absence of an upstream activation are termed minimal promoters or
core promoters. In the presence of a suitable transcription factor
or suitable transcription factors respectively the minimal promoter
enables the transcription. Thus, a minimal or core promoter
consists only of all basic elements which are required for the
transcription initiation, e.g. a TATA box and/or an inhibitor.
[0068] The invention also relates to the DNA containing vectors
according to the invention. These vectors comprise various
plasmids, cosmids, phages and other vectors in double-stranded or
single-stranded, linear or circular form, which themselves can be
transmittable or mobilizable, if necessary, and which are either
able to transform a prokaryotic or eukaryotic host by integration
into the cellular genome or which exist in extrachromosomal form
(e.g. autonomically replicating plasmids with a replication
origin).
[0069] Vectors, plasmids, cosmids, artificial yeast chromosomes
(YACs), artificial bacteria chromosomes (BACs) and DNA segments for
the use of cell transformations generally comprise the phytase
encoding DNA according to the invention as well as other DNA like
cDNA, a gene or genes which are introduced into the cells. These
DNA constructs can comprise further structures like promoters,
enhancers, polylinkers or also regulatory genes, where required.
One of the DNA segments or genes which has/have been chosen for the
cellular introduction, conveniently codes/code a protein which is
expressed in the thus obtained transformed (recombinant) cells
which leads to a screenable or selectable feature and/or which
lends a better phenotype to the transformed cell.
[0070] The construction of vectors which can be used according to
the invention is known to the skilled person in the field in view
of the present disclosure (cf., for example, Sambrook et al.,
Molecular Cloning: A Laboratory Manual (2. ed., Coldspring Harbor
Laboratory Press, Plainview, N.Y. (1989)). The expression cassette
according to the invention can contain one or more restriction
sites in order to bring the phytase coding nucleotide under the
regulation of a regulatory sequence. The expression cassette can
also contain a termination signal operatively linked to the
polynucleotide as well as to regulatory sequences which are
required for the correct translation of the polynucleotide. The
expression cassette containing the polynucleotide according to the
invention can be chimeric, i.e. at least one of its components is
heterologous in relation to at least one of the other components.
The expression of the polynucleotide in the expression cassette can
be controlled by a constitutive promoter, an inducible promoter, a
regulated promoter, a viral promoter or a synthetic promoter.
[0071] The vectors can already contain regulatory elements, e.g.
promoters, or the DNA sequences according to the invention can be
manipulated in the way that they contain such elements. Suitable
promoter elements which can be used are known in the field, e.g.
the cbh 1 or cbh-2 promoter for Trichoderma reesei, or the
amy-promoter for Aspergillus oryzae, the xyI, glaA, alcA, aphA,
tpiA, gpdA, sucI and pkiA promoter for Aspergillus niger. Suitable
promoter elements which can be used for the expression in yeast are
known in the field, e.g. the pho5 promoter or the gap promoter for
the expression in Saccharomyces cerevisiae and for pichia pastoris,
e.g. the aoxI promoter or the fmd promoter or the mox promoter for
H. polymorpha.
[0072] DNA which is suitable for the introduction into cells can
also comprise, next to the DNA according to the invention, DNA
which has been derived from any source or which has been isolated
thereof. An example for a derived DNA is a DNA sequence which has
been identified as a useful fragment in a given organism and which
has then been chemically synthesised in essentially pure form. An
example for such a DNA is a suitable DNA sequence which has been
obtained, for example, by using restriction endonucleases so that
it can be manipulated further according to the invention, e.g. by
being amplified. Such a DNA is usually described as recombinant
DNA. Thus, a suitable DNA comprises completely synthesised DNA,
semi-synthesised DNA, DNA which has been isolated from biological
sources and DNA which has been derived from introduced RNA.
Generally, the introduced DNA is no original component of the
genotype of the recipient DNA, but according to the invention also
a gene from a given genotype can be isolated and possibly changed
and afterwards multiple copies of the gene can be introduced into
the same genotype, e.g. in order to intensify the production of a
given gene product.
[0073] The introduced DNA comprises without restrictions DNA from
genes like, for example, from bacteria, yeast, fungi or viruses.
The introduced DNA can comprise modified or synthetic genes, part
of genes or chimeric genes including genes from the same or from
different genotypes.
[0074] The DNA used for the transformation according to the
invention can be circular or linear, double-stranded or
single-stranded. Generally, the DNA is found in the form of a
chimeric DNA like a plasmid DNA containing coding regions which are
flanked by regulatory sequences which support the expression of the
recombinant DNA contained in the transformed cell. For example, the
DNA itself can contain a promoter or can consist of such a promoter
which is active in a cell, or which is derived from a source which
is different from the cell, or a promoter can be used which is
already contained in the cell, i.e. the transformation target
cell.
[0075] Generally, the introduced DNA is relatively small, less than
30 kb, in order to minimize the susceptibility against physical,
chemical or enzymatic decomposition which increases corresponding
to the size of the DNA.
[0076] The selection of a suitable expression vector depends on the
host cells. Yeast or fungi expression vectors can comprise a
replication origin, a suitable promoter and enhancer, but also
various required ribosome-binding sites, polyadenylation sites,
splice donor and acceptor sites, transcription termination
sequences and non-transcribed 5'-flanking sequences.
[0077] Examples for suitable host cells are: fungi cells of the
genus Aspergillus, Rhizopus, Trichoderma, Neurospora, Mucor,
Penicillium, etc., like, for example, yeasts of the genera
Kluyveromyces, Saccharomyces, Schizosaccharomyces, Trichosporon,
Schwanniomyces, Hansenula, Pichia and the like. Suitable host
systems are, for example, fungi like Aspergilli, e.g. Aspergillus
niger (ATCC 9142) or Aspergillus ficuum (NRLL 3135) or Trichoderma
(e.g. Trichoderma reseei QM6a) and yeasts like Saccharomyces, e.g.
Saccharomyces cerevisiae or Pichia, like, for example, Pichia
pastoris or Hansenula, e.g. H. polymorpha (DSMZ 70277). Such
microorganisms can be obtained by accredited depository authorities
like American Type Culture Collection (ATCC), Centraalbureau voor
Schimmelcultures (CBS) or Deutsche Sammlung fur Mikroorganismen and
Zellkulturen GmbH (DSMZ) or any other depository authority.
[0078] In the 5'-3'-transcription direction, the expression
cassette can contain a transcription and translation initiation
region of the polynucleotide according to the invention and a
transcription and termination region which functions in vivo or in
vitro. The termination region can be native in relation to the
transcription initiation region or can be native or from a
different origin in relation to the polynucleotide. The regulatory
sequences can be localised upstream (5' non-coding sequences),
within (Intron) or downstream (3' non-coding sequences) of a coding
sequence and can influence the transcription, the RNA processing or
the stability and/or the translation of the associated coding
sequences. Regulatory sequences can comprise without any
restrictions enhancers, promoters, repressor binding sites,
translation leader sequences, introns or polyadenylation signal
sequences. They can comprise native or synthetic sequences as well
as sequences which are a combination of synthetic and native
sequences.
[0079] The vector used in accordance with the invention can also
comprise suitable sequences for the amplification of the
expression.
[0080] Examples for promoters which are used in accordance with the
invention are promoters known for their controlling of the
expression in the eukaryotic cells. Various promoters with the
ability of expression in filamentous fungi can be used. Examples
are a promoter which is strongly induced by starch or cellulose,
e.g. a promoter for glucoamylase or .alpha.-amylase from the genus
Aspergillus or cellulase (cellobiohydrolase) from the genus
Trichoderma, a promoter for enzymes in the glycolytic metabolism
like, for example, phosphoglycerat kinase (PGK) and
glycerinaldehyde-3-phosphate-dehydrogenase (GPD), etc.
Cellobiohydrolase-I-, cellobiohydrolase-II-, amylase-,
glucoamylase-, xylanase- or enolase-promoters are preferred.
[0081] Two main methods to control the expression are known, i.e.
overexpression and underexpression. Overexpression can be achieved
by insertion of one or more additional copies of the chosen gene.
As regards the underexpression, there are two main methods, which
are usually referred to "antisense downregulation" and "sense
downregulation" in the field. Generally, these methods are termed
"gene silencing". Both methods lead to an inhibition of the
expression of the target gene.
[0082] Next to the use of a special promoter other types of
elements can influence the expression of transgenes. In particular
it was shown that introns possess the potential to intensify the
transgene expression.
[0083] The expression cassette can comprise further elements, e.g.
the ones which are regulated by endogenous or exogenous elements
like zinc finger proteins, including naturally occurring zinc
finger proteins or chimeric zinc finger proteins.
[0084] Further, the expression cassette used in accordance with the
invention can contain enhancer elements or upstream promoter
elements.
[0085] Vectors for the use in accordance with the invention can be
constructed in the way that they contain an enhancer element. The
constructs according to the invention thus comprise the gene of
interest together with a 3'-DNA sequence, which functions as signal
in order to terminate the transcription and to allow the
polyadenylation of the thereby obtained mRNA. Any signal sequences
can be used which enable the secretion of the chosen host organism.
Preferred signal sequences are the phytase signal sequence of
Aspergillus niger or signal sequences for the secretion from
filamentous fungi which are derived thereof.
[0086] A special leader sequence can also be used since the DNA
sequence between the transcription initiation site and the
initiation of the coding sequence, i.e. the non-translated leader
sequence can influence the gene expression. Preferred leader
sequences comprise sequences which regulate the optimal expression
of the attached gene, i.e. they comprise a preferred consensus
leader sequence which increases or maintains the mRNA stability and
prevents an unsuitable translation initiation. The choice of such
sequences is well-known to the person skilled in the art.
[0087] In order to improve the possibility for identifying the
transformants, a selectable or screenable genetic marker can be
ingested into the expression cassette. Such genetic markers are
well-known to the person skilled in the art.
[0088] The expression cassette or a vector construct containing the
expression cassette is introduced into a host cell. A multitude of
techniques are available which are well-known to the skilled person
in the field of the introduction of constructs into a host cell.
The transformation of microbial cells can be effected by using
polyethylene glycol, calcium chloride, viral infection,
DEAE-dextran, phage infections, electroporation and other methods
known in the field. The transformation of fungi can be effected
according to Pennila et al., Gene 61:155-164, 1987 The introduction
of a recombinant vector in yeasts can be effected by known methods
including electroporation, use of spheroplasts, lithium acetate and
the like.
[0089] As soon as the expression cassette according to the
invention, i.e. DNA sequence has been obtained the same can be
inserted in vectors according to known methods in order to
overexpress the coded polypeptide in suitable host systems.
However, also DNA sequences can be used as such to transform
suitable host systems of the invention in order to achieve an
overexpression of the coded polypeptide.
[0090] As soon as a DNA sequence according to the invention has
been expressed in a suitable host cell in a suitable medium the
coded phytase can be concentrated and/or isolated according to
known methods, either from the medium, in case the phytase is
secreted into the medium, or from the host organism, in case the
phytase is available in intracellular form, i.e. in periplasmatic
space. Known methods for the separation of the insoluble components
of the culture medium and the biomass, followed by methods for the
concentration of the phytase can be used for the production of
concentrated phytase solutions or as preparation for the drying of
phytase. For example, filtration processes or centrifugation
processes can be used for the separation of insoluble components,
followed by ultrafiltration processes for the concentration, or
crossflow filtration processes are used. The drying can be effected
by freeze drying and spray drying, granulation process, extrusion
or other processes. Known processes of the protein purification can
be used to isolate the phytases according to the invention. For
example, different chromatographic or gel chromatographic processes
can be used separately or in combination with each other. Depending
on the host cell used in a recombinant production process the
enzyme according to the invention can covalently be modified by
glycosylation or not. In eukaryotic cells the glycosylation of the
secreted proteins serves to modulate the protein folding, the
conformation stability, the thermic stability and the resistance
against proteolysis. In view of a specific use of the phytase a
glycosylated variant of the enzyme can be preferred compared to a
non-glycosylated variant. For example, the use of a glycosylated
phytase in animal feed serves as protection of the enzyme against
thermal denaturation during the feed pelletising and against
proteolytic inactivity during the gastric passage, whereby the
distribution of the active enzyme in the intestinal tract and to
the site of action is favored. With respect to the use in the food
processing, where the enzyme activity is desired only during
processing and not in the finished product, a phytase can be
preferred which is thermolabile, i.e. non-glycosylated and
sensitive against proteolytic decomposition/digestion.
[0091] The invention also relates to phytase compositions
containing the polypeptide according to the invention. Generally,
phytase compositions are liquid or dry. Liquid compositions
preferably contain the phytase enzyme in a purified or enriched
form. However, auxiliaries like e.g. a stabiliser like glycerine,
sorbitol or monopropylene glycol, additives like salts, sugar,
preservatives, agents for to adjust the pH value, proteins and
phytates or salts of myoinositol phosphates (a phytase substrate)
can be added. Typical liquid compositions are aqueous or oleaginous
suspensions. Liquid compositions can be added to a food or animal
feed prior to or after a possible pelletising, i.e. processing
step.
[0092] Dry compositions can be freeze dried, spray dried,
granulated or extruded compositions which can exclusively contain
the enzyme. Prior to drying substances can also be added for the
regulation of the pH value as well as further additives and filling
materials like maltodextrins, lactose, skimmed milk powder, salts
of bivalent cations like the ones of Mg, Ca, Zn, etc. Dry
compositions/compounds can be granulates which can easily mixed
with, for example, food or feed components, or, preferably, form a
component of a premix. The size of the particles of the enzyme
granulate is preferably compatible with the other component of the
mixture. This allows safe and benefit agents, for example, for the
incorporation of enzymes in processed food, premixes or animal
feed.
[0093] For example, a stable formulation of the phytase enzyme
according to the invention can be produced by spraying a mixture of
a liquid enzyme solution onto a filling material like maltodextrin
and by afterwards drying the mixture, or by adding to the liquid
enzyme solution prior to drying 20%-60% of the skimmed milk powder
(w/w based on the total protein of the enzyme solution) and/or
1%-5% of calcium propionate (w/w based on the total protein of the
enzyme solution) and adjusting the pH value to a defined value, in
particular pH 5.2.+-.0.5. The reduction of the humidity and the
binding interactions of the phytase with the filling material
additionally protect the enzyme next to its stability defined in
its structure against environmental influences like temperature
extremes which might occur during the production of the animal
feed. Dry and liquid formulations can further be stabilised by
reducing the activity of potentially proteolytic enzymes which
might be side products in the liquid fermentation mixture being
used for the enzyme according to the invention. The hereby produced
dry enzyme mixture can be used as animal feed additives in the use
of poultry farming and pig breeding. Moreover, a reduction of the
phosphate supplementation leads to a reduction of the phosphate
pollution which significantly reduces the environmental pollution
by intensive livestock breeding.
[0094] Once a dry enzyme preparation has been obtained, an
agglomeration granulate can be produced in further steps. For this
purpose, a mixer with high shearing forces is used whereby filling
material and enzyme co-agglomerate and a granulate is formed.
Absorption granulates are produced by the coating of cores of a
carrier by the enzyme according to the invention. Typical filling
materials are salts like disodium sulphate. Other filling materials
comprise kaolin, talc, magnesium aluminium silicate and cellulose
fibers. If required, binding materials like dextrins are also
incorporated into the agglomeration granulate.
[0095] Typical carriers comprise starch, e.g. in form of cassava,
potato and grain, in particular corn, rice and wheat, or products
containing protein like soy protein. Salts can also be used. If
necessary, the granulate is coated with a coating mixture. Such a
mixture comprises coating materials, preferably hydrophobic coating
materials, dehydrated palm oil and talc and, if necessary, other
additives like calcium carbonate or kaolin in order to improve the
bioavailability at the site of action.
[0096] In addition, mixtures with phytase can contain other
substances like colouring agents, flavouring agents, stabilisers,
vitamins, minerals, other food or animal feed enzymes and the like.
This relates in particular to the so-called premixes.
[0097] A food or animal feed additive is an essentially pure
compound or a composition of several compounds which is intended or
suitable for being added to food or animal feed. In particular, it
is a substance which influence according to its designated purpose
characteristics of a food or animal feed product or which become a
component of a food or animal feed product. Thus, a phytase
additive should design a phytase which is no natural component of
the substances which are mainly used in food and animal feed or
which is not contained in its natural concentration therein. For
example, the phytase is solely added to the animal feed, separated
from the animal feed substances, or in combination with other
animal feed additives. A typical premix usually comprises one or
several compounds like vitamins, minerals or animal feed supporting
enzymes and suitable carriers and/or excipients.
[0098] A ready-to-use phytase additive is an additive which is not
produce in situ in animal feed or in processed food. A ready-to-use
phytase additive can be administered to humans or animals directly
or preferably directly after mixing with other components of the
animal feed or the food. For example, an animal feed additive
according to this aspect of the present invention is mixed with
other animal feed and animal feed additives, obtaining a premix or
an supplementing animal feed. Such other animal feed components
comprise one or more other (preferably thermostabile) enzyme
supplements, other animal feed additives, mineral animal feed and
amino acids. The hereby obtained (combined) animal feed additives
can comprise several different compound types and can then be mixed
in their suitable amount with the animal feed like grain and
protein carriers by forming composite animal feed. The processing
of these components to animal feed after the mixture can be
effected by means of known processing devices like a double
pelletizer, a steam pelletizer, an expander or an extruder.
[0099] In a similar manner, a food additive according to this
embodiment of the invention can be mixed with other food components
whereby processed food products are produced. Such other food
components comprise one or more enzyme supplements, vitamins,
minerals and trace elements. The hereby obtained combined food
additive can then be mixed in a suitable amount with other food
components like grains and plant proteins in order to provide a
processed food. The processing of these components to a processed
food can be effected by using known processing devices.
[0100] In a preferred embodiment the phytase compositions according
to the invention additionally comprise an effective amount of one
or more enzymes for food or animal feed, preferably chosen from
galactosidases, beta-galactosidases, laccases, other phytases,
phosphatases, endoglucanases, in particular
endo-beta-1,4-glucanases, endo-beta-1,3(4)-glucanases,
endo-1,2-beta-glucanases and endo-1,3-alpha-glucanases, cellulases,
xylosidases, galactanases, in particular
arabinogalactan-endo-1,4-beta-galactosidases and
arabinogalactan-endo-1,3-beta-galactosidases, pectin-degrading
enzymes, in particular pectinases, pectin esterases, pectin lyases,
polygalacturonases, arabananases, rhamnogalacturonases,
rhamnogalacturonan acetylesterases,
rhamnogalacturonan-alpha-rhamnosidases, pectate lyases and
alpha-galacturonidases, mannanases, beta-mannosidases, mannan
acetylesterases, xylan acetylesterases, proteases, xylanases,
arabinoxylanases and lipolytic enzymes like lipases, phospholipases
and cutinases.
[0101] The animal feed according to the invention is administered
to the animal prior or during feeding. Preferably, the animal feed
additive according to the invention is administered to the animal
during feeding.
[0102] An effective amount of phytase in food or animal feed
consists of about 10-20.000 PPU/kg, preferably about 10-15.000
PPU/kg, more preferably about 10-10.000 PPU/kg, even more
preferably about 50-5.000 PPU/kg, in particular 50-2.000 PPU/kg of
animal feed or food.
[0103] The invention also relates to the use of phytase for the
processing and production of food and animal feed. Grains and
flours for food can be treated enzymatically with phytase in order
to reduce the phytin content of the raw materials. Reduced phytin
contents improve the quality of the food by increasing the
availability of essential minerals like iron, calcium and zinc. In
addition to the improvement of the quality of the food the use of
phytase during the processing can improve the total efficiency of
the food production. For example, the addition of phytase to white
soybean flakes during the production of a soy protein isolate can
significantly increase the yield and quality of the extractable
protein. Hereby, the phytase is only active during the production
and processing and no more in the finished product. This aspect is
in particular important for the production of dough and for baking
and the production of other ready-to-eat products on the basis of
grains. In a similar manner, animal feed components like toasted
soybean flour or canola flour can be pretreated with phytase prior
to the actual production process. The elimination of anti-nutritive
factors in animal feed components prior to the production leads to
a physiologically improved quality and to enriched/more valuable
animal feed ingredients. In this processing the phytase is active
during the production and is generally no more active in the
intestinal tract of the animal after ingestion of the treated
animal feed.
[0104] In addition to the use of phytase as animal feed processing
auxiliary the present invention relates to the use of the phytase
according to the invention as digestion aid. Phytase in tablet form
can be ingested together with the nourishment in order to
distribute the active enzyme in the gastrointestinal tract.
[0105] The phytase according to the invention can also be used in a
preferable way for monogastric as well as polygastric animals, in
particular for young calves. Animal feed for fish and crustaceans
can also be supplemented by phytase in order to improve the
utilisation of the animal feed and to reduce the content of the
secreted phosphorus in the intense animal breeding. The animal feed
according to the invention can also be administered to animals like
poultry, e.g. fattened chickens, turkeys, gooses, ducks, as well as
to pigs, horses, cows, sheep, goats, dogs and cats as well as to
fish and crustaceans. Particularly preferred is the administering
of the animal feed according to the invention to pigs and
poultry.
[0106] Phytase formulations according to the invention can also be
combined with other ingredients whereby new and particularly
advantageous animal feed compositions are formed. Since, as has
been shown before, the availability of vegetable phosphate in
soybean flour and grains is low due to the linkage to phytic acid,
anorganic phosphate is added to the animal feed in order to enable
an adequate phosphorus supply of the animals. However, these animal
feeds contain too much total phosphate and thus lead to a pollution
of the environment with phosphate. The animal feed according to the
invention comprises in particular the combination of a phytase
according to the invention with animal feed ingredients in order to
obtain an animal feed which contains significantly lesser contents
of added anorganic phosphorus. In a preferred embodiment the animal
feed according to the invention comprises typical animal feed
ingredients, micronutrients, trace elements, vitamins, etc. as well
as an effective amount of phytase and anorganic phosphorus, whereby
the amounts of the phytase and of the phosphours are between 50 and
20.000 units of phytase/kg of animal feed and less than 0.45% of
anorganic phosphorus, preferably between contents of 100-10.000
units of phytase/kg of animal feed and less than 0.225% of
anorganic phosphorus, more preferably contents of 150-10.000 units
of phytase/kg of animal feed and less than 0.15% of anorganic
phosphorus, even more preferably contents of 200-20.000 units of
phytase/kg of animal feed and no additional addition of anorganic
phosphorus.
[0107] The invention also relates to methods to improve the weight
gains and the feed conversion ratio (FCR) in the animal nutrition
as well as the use of the phytases according to the invention in
this method. A phytase according to the invention enables improved
weight gains and an improved feed conversion ratio, in particular
in connection with animal feed which contains little anorganic
phosphorus. According to the methods according to the invention the
content of anorganic phosphorus in animal feed can be reduced to
contents of less than 0.45%, preferably less than 0.255%.
Preferably, no anorganic phosphate is added. By increasing the
availability of phosphate as a consequence of the addition of the
enzyme according to the invention the bone mineralization of the
animals can significantly be improved, which is especially
important in the case of quickly growing animals.
[0108] According to another embodiment the invention relates to the
use of the enzyme according to the invention for baking, whereby
the development, elasticity and/or stability of the dough and/or
the volume, the structure offcrumb and/or the resistance against
staling. Although the enzyme preparation according to the invention
can be used for the production of dough or baked products of any
types of flour, e.g. on the basis of rye, barley, oat or corn, the
enzyme preparation according to the invention has been found
especially useful for the production of doughs or baker's products
made out of wheat or an essential wheat proportion. The bakery's
products which can be produced by using the enzyme preparation
according to the invention comprise bread, buns, baguette and the
like. For baking the enzyme preparation according to the invention
can be used with another enzyme activity like e.g. xylanase,
lipase, amylase, oxidase or laccase next to the phytase or can be
used in combinations with further enzymes like lipase, amylase,
oxidase (e.g. glucose oxidase, peroxidase).
BRIEF DESCRIPTION OF THE DRAWINGS
[0109] The enclosed figures further illustrate the invention:
[0110] FIG. 1: plasmid map of pET-PhyM2
[0111] FIG. 2: plasmid map of pAB490-PhyM2
[0112] FIG. 3: plasmid map of pUC-PhyM3
[0113] FIG. 4: plasmid map of pAB489-PhyM3
[0114] FIG. 5: plasmid map of pUC-PhyM10
[0115] FIG. 6: plasmid map of pAB600-PhyM10
[0116] FIG. 7: plasmid map of pPhy2005
[0117] FIG. 8: plasmid map of pAB-Phy2005
[0118] FIG. 9: plasmid map of pPhy2006
[0119] FIG. 10: plasmid map of pAB-Phy2006
[0120] FIG. 11A-B: sequence comparison between single mutants
according to the invention and variants on the basis of the
wild-type sequence (Dassa). The mutations, i.e. variants are
stressed. FIGS. 11A-B disclose SEQ ID NOS 49-57, respectively, in
order of appearance
[0121] The below examples further illustrate the invention.
EXAMPLES
Example 1
Determination of the Phytase Activity
[0122] The phytase activity has been measured in an assay mixture
of 0.5% of phytic acid (about 5 mM), 200 mM sodium citrate, pH 5.0.
After a 15-minute incubation at 37% C the reaction has been stopped
by adding an equal volume of 15% of trichloro acetic acid. The
released phosphate ions have been quantitatively determined, at 820
nm by mixing 100 .mu.l of the assay mixture with 900 .mu.l of
H.sub.2O and 1 ml of 0.6 M H.sub.2SO.sub.4, 2% of ascorbic acid and
0.5% of ammonium molybdate after incubation at 50.degree. C. and a
duration of 20 min. As reference potassium phosphate standard
solutions have been used.
Example 2
Construction of the plasmids pET-PhyM2 and pAB490-PhyM2 (genotype
PhyM2)
[0123] The construction of the plasmid pAB490-PhyM2 has been
effected by the following steps:
1. Construction of pET-PhyM2
[0124] The plasmid pET-PhyM2 contains the E. coli phytase sequence
(Dassa et al. 1990, accession number M58740 with V200Y) using the
codon usage of T. reesei (http://www.kazusa.or.jp/codon) with the
additional changes of the amino acids N139R and D142E.
[0125] The DNA sequence, which comprises with the CAG (Gin) codon
in position 1 an open reading frame of 1230 bp and which codes an
enzyme of 410 amino acids, has been inserted into the plasmid
pET26b(+) (Novagen, Germany, modified by Brain, Germany) by using
the codon usage of T. reesei (http://www.kazusa.or.jp/codon). For
the realisation of the mutagenesis an oligonucleotide-directed
method based on PCR has been used. Based on the plasmid containing
the coded gene for the wild-type Dassa amino acid sequence, for
each triplet to be substituted two complementary primers with the
corresponding mutations have been synthesised, whereby the mutation
is always localised in the middle of the primer. By means of the
two primers the whole plasmid has then been amplified. The obtained
plasmid with the mutations for the genotype M2 is termed
pET-PhyM2.
[0126] For the construction, the following primers have been used.
[0127] a) For the mutations at position 139:
TABLE-US-00004 [0127] (SEQ ID NO: 1)
ccaactggataacgcccgggtgaccgacgccat (SEQ ID NO: 2)
atggcgtcggtcacccgggcgttatccagttgg
[0128] b) For the subsequently inserted additional mutations at
position 142:
TABLE-US-00005 [0128] (SEQ ID NO: 3) gcccgggtgaccgaggccatcctcagc
(SEQ ID NO: 4) gctgaggatggcctcggtcacccgggc
[0129] The plasmid is illustrated in FIG. 1 and has been deposited
under the accession number DSM 18715 on Oct. 18, 2006.
2. Construction of pAB490-PhyM2
[0130] For the construction of the plasmid pAB490-PhyM2 the gene
PhyM2 coding for the E. coli phytase has been amplified from the
plasmid pET-PhyM2 via PCR. The PCR product has been cut with the
restriction enzymes SpeI and PacI and has been inserted into the
SpeI and PacI restriction sites after the T. reesei cbhII gene
fragment into the plasmid pAB490. Hereby, an open reading frame has
been formed which codes the fusion CBHLI-KexII-PhyM2.
[0131] The obtained plasmid is termed pAB490-PhyM2 (FIG. 2) and has
been mapped by restriction endonucleases. The phytase sequence has
been confirmed by sequencing.
[0132] The plasmid pAB490 is based on pUC18 and contains the cbhII
gene fragment (nucleotides 1-307 correspond to amino acids M1 to
S86, Teeri et al, 1987, gene 51: 43-52, accession number 16190)
under the control of the cbhI promoter and cbhI terminator from
plasmid pALK487 (WO 94/28117). A blunt-ended EcRI/SpeI fragment of
the plasmid pALK424 (WO 93/24621) having a length of 4.78 kb which
contains the amdS genetic marker and the 3' flanking cbhI sequences
has been inserted into the StuI restriction site at the 3' end of
the cbhI terminator. Moreover, further restriction sites (SpeI and
PacI) of the cbhII-gene fragment have been inserted downstream.
These restriction sites have been used for the direct cloning of
the phytase variants.
[0133] The expression cassette isolated from the plasmid
pAB490-PhyM2 contains the following genetic material: cbhI
(cellobiohydrolase I) promoter: the 2.2 kb EcoRI/SacII fragment
containing the cbhI promoter derives from Trichoderma reesei QM6a.
The promoter region also functions as homologous DNA (together with
the cbhI 3' fragment; see below) in order to control the
introduction of the transforming DNA into the cbhI locus.
[0134] cbhII gene fragment: The 307-bp cbhII gene fragment with its
signal sequence is directly under the control of the cbhI
promoter.
[0135] The E. coli phytase sequence containing the mutation of
amino acids N139R and D142E and V200Y is fusioned to the 3' end of
the cbhII gene fragment by means of a kexII restriction site. The
kex sequence contains the following amino acids: RTLVKR (SEQ ID NO:
43).
[0136] cbhI terminator: The BamHI/StuI fragment having a length of
0.75 kb and containing the cbhI terminator has been added after the
E. coli phytase in order to enable the termination of the
transcription.
[0137] amdS gene: The gene, including its promoter and its
terminator, has been isolated from Aspergillus nidualns VH1-TRSX6
and codes for acetamidase (Hynes et al., 1983, Mol. Cell. Biol. 3:
1430-1439; Kelly and Hynes, 1985, EMBO J. 4:475-479). The
acetamidase enables the strain to grow by using acetamide as sole
nitrogen source and this feature has been used for the selection of
the transformants.
[0138] cbhI 3' fragment: The fragment (1.7 kb, BamHI/EcoRI,
beginning at 1.4 kb after the stop codon of the gene) has been
isolated from T. reesei ALK02466. The strain ALK02466 derives from
the strain ALK0233 (Harkki et al., 1991, Enzyme Microb. Technol.
13: 227-233). The 3' fragment is used together with the promoter
region for the targeted integration of the phytase expression
cassette into the cbhI lokus via homologous recombination.
[0139] The sequence of the plasmid pAB490-PhyM2 has been confirmed
by the mapping via restriction enzymes and sequencing.
Example 3
Construction of the Plasmid pET-PhyM7 and pAB490-PhyM7 (Genotype
PhyM7)
[0140] The plasmid pET-PhyM7 contains the modified E. coli-Phytase
(Dassa et al. 1990, accession number M58740 with V200Y) sequence by
using the codon usage of T. reesei (http://www.kazusa.or.jp/codon)
with the additional mutation K74D. The construction as well as the
cloning of the plasmid pET-PhyM7 has been effected in analogy to
the in example 2 described production of the plasmid pET-PhyM2. The
primers used for the introduction of the mutations into amino acid
position 74 are:
TABLE-US-00006 (SEQ ID NO: 5) cggactcctggctgacaagggatgcccgc (SEQ ID
NO: 6) gcgggcatcccttgtcagccaggagtccg
[0141] The plasmid pET-PhyM7 has been deposited under accession
number DSM 18716 on Oct. 18, 2006.
[0142] The construction as well as the cloning of plasmid
pAB490-PhyM7 has been effected in analogy to the in example 2
described production of the plasmid pAB490-PhyM2. The sequence of
the plasmid pAB490-PhyM7 has been confirmed by sequencing. The
expression cassette isolated from the plasmid pAB490-PhyM7 thus
contains, with the exception of the new specific phytase sequence
of the genotype PhyM7, the same elements as described in example
2.
Example 4
Construction of the Plasmid pUC-PhyM3 and pAB489-PhyM3 (Genotype
PhyM3)
[0143] The phytase variant PhyM3 contains the E. coli phytase
(Dassa et al. 1990, accession number M58740) sequence by using the
codon usage of T. reesei (http://www.kazusa.or.jp/codon) with the
mutation V200P. The DNA sequence with the CAG (Gln) codon in
position 1 comprises an open reading frame of 1230 bp and codes an
enzyme with 410 amino acids. The signal peptide of the phytase of
A. niger having a length of 18 amino acids has been used to secrete
the phytase mutant of E. coli from Trichoderma reesei.
[0144] On the basis of the plasmid containing the coding gene for
the wild-type Dassa amino acid sequence the mutation V200P has been
effected via PCR in analogy to the principle of Tomic et al. (1990,
Nucleic Acids Research, 18 (6), 1656) and Vallette et al. (1989,
Nucleic Acids Research, 17 (2), 723-733). The PCR product has been
cut with AvrII and PacI and has been inserted into the SpeI and
PacI restriction sites after the T. reesei cbhI promoter into the
plasmid pAB489. In the newly obtained plasmid pAB489-PhyM3 the gene
of the E. coli phytase variant PhyM3 with the modified A. niger
phytase signal sequence -MGVSAILLPLYLLSGVTS-(SEQ ID NO: 44)
(Mullaney et al., Appl Microbiol Biotechnol, 1991, 35(5), 611-614,
accession number M94550) is directly under the control of the cbhI
promotor. The signal peptide of the phytase of A. niger having a
length of 18 amino acids has been used to secrete the phytase
mutant of E. coli from Trichoderma reesei. The 16 base pairs
(CCGCGGACTGCGCATC atg (SEQ ID NO: 45)) upstream from the start
codon, to which the T. reesei promotor (Shoemaker et al. 1983,
Bio/Technology 1, 691-696) belongs, have been changed after the
introduction of the AvrII-PacI phytase fragment into the SpeI and
PacI restriction sites in the plasmid pAB489 to CCGCGGACTAGGCATC
atg (SEQ ID NO: 46).
[0145] The construction pAB489-PhyM3 (FIG. 4) has been confirmed by
mapping and sequencing.
[0146] The construction of the plasmid pAB489 has been effected via
the following steps:
[0147] Plasmid pAB487 has been produced from the plasmid pALK487
(WO94/28117) by inserting further restriction sites (SpeI and PacI,
CCGCGGACTAGTCCTTAATTAACCGCGG (SEQ ID NO: 47)) into the SacII
position between the cbhI promotor and the cbhI terminator. The
SpeI-PacI-restriction sites are used for the direct cloning of the
phytase variants. A blunt-ended EcoRI/SpeI fragment of the plasmid
pALK424 (WO 93/24621) having a length of 4.78 kb which contains the
amdS genetic marker and the 3' flanking cbhI sequences has been
inserted into the StuI restriction site of pAB487, whereby the
vector pAB489 has been obtained.
[0148] The expression cassette isolated from pAB489-PhyM3 contains
the following genetic material:
[0149] cbhI (cellobiohydrolase I) promotor: The 2.2 kb EcoRI/SacII
fragment containing the cbhI promoter derives from Trichoderma
reesei QM6a. The promoter region also functions as homologous DNA
(together with the cbhI 3' fragment; see below) in order to control
the introduction of the transforming DNA into the cbhI locus.
[0150] Signal sequence: The modified signal peptide of the A. niger
phytase has been used to secrete the E. coli phytase from
Trichoderma reesei.
[0151] The E. coli phytase with the mutation V200P sequence
including the A. niger phytase signal sequence has been inserted
between the cbhI promotor and the cbhI terminator.
[0152] cbhI terminator: The BamHI/StuI fragment having a length of
0.75 kb and containing the cbhI terminator has been added after the
E. coli phytase in order to enable the termination of the
transcription.
[0153] amdS gene: The gene, including its promoter and its
terminator, has been isolated from Aspergillus nidulans VH1-TRSX6
and codes for acetamidase (Hynes et al., 1983, Mol. Cell. Biol. 3:
1430-1439; Kelly and Hynes, 1985, EMBO J. 4:475-479). The
acetamidase enables the strain to grow by using acetamide as sole
nitrogen source and this feature has been used for the selection of
the transformants.
[0154] cbhI 3' fragment: The fragment (1.7 kb, BamHI/EcoRI,
beginning at 1.4 kb after the stop codon of the gene) has been
isolated from T. reesei ALK02466. The strain ALK02466 derives from
the strain ALK0233 (Harkki et al., 1991, Enzyme Microb. Technol.
13: 227-233). The 3' fragment is used together with the promoter
region for the targeted integration of the phytase expression
cassette into the cbhI lokus via homologous recombination.
[0155] The phytase variant PhyM3 Gen has been cloned into the
plasmid pAB2004. The obtained plasmid is termed pUC-PhyM3 (FIG. 3)
and is deposited under DSM 18717 in accordance with the
afore-mentioned conditions.
[0156] The plasmid pAB2004 is based on the plasmid pUC18 and has
been produced by insertion of further restriction sites into the
HindIII-EcoRI sites.
Example 5
Construction of the Plasmids pUC-PhyM9 and pAB489-PhyM9 (Genotype
Phyla)
[0157] The phytase variant PhyM9 contains the E. coli phytase
(Dassa et al. 1990, accession number M58740) sequence as synthetic
gene by using the codon usage of T. reesei
(http://www.kazusa.or.jp/codon) with the mutations L145I and L198I.
The DNA sequence with the CAG (Gln) codon in position 1 comprises
an open reading frame of 1230 bp and codes an enzyme with 410 amino
acids.
[0158] In the plasmid pAB489-PhyM9 the coding gene for the E. coli
phytase variant PhyM9 with the A. niger phytase signal sequence
(MGVSAVLLPLYLLSGVTS (SEQ ID NO: 48)) Mullaney et al., Appl
Microbiol Biotechnol, 1991, 35(5), 611-614, accession number
M94550) is directly under the control of the cbhI promotor. The
signal peptide of the phytase of A. niger having a length of 18
amino acids has been used to secrete the phytase mutant of E. coli
from Trichoderma reesei.
[0159] The construction of pAB489-PhyM9 and pUC-PhyM9 has been
effected in analogy to the plasmid pAB489-PhyM3 and pUC-PhyM3 in
example 4 and thus contains, with the exception of the A. niger
signal sequence and the specific E. coli phytase sequence the same
genetic elements.
[0160] The plasmid pUC-PhyM9 has been deposited under the accession
number DSM 18718 on Oct. 18, 2006.
Example 6
Construction of the Plasmides pUC-PhyM10 and pAB600-PhyM10, Coding
for Multiple Mutants (Genotype PhyM10)
[0161] The plasmid pAB600-PhyM10 contains the E. coli phytase
sequence with the changes of the amino acids K74D, N139R, D142E and
V200P. From the plasmids pAB490-PhyM2, pAB490-PhyM7 and
pAB489-PhyM3 the gene coding for the phytase variant PhyM10 has
been produced via PCR in analogy to the principle of Tomic et al.
(1990, Nucleic Acids Research, 18 (6), 1656) and Vallette et al.
(1989, Nucleic Acids Research, 17 (2), 723-733). The PCR product
has been cut with SpeI and PacI and has been inserted into the SpeI
and PacI restriction sites in the plasmid pAB600.
[0162] The obtained plasmid pAB600-PhyM10 (FIG. 6) has been
confirmed by mapping and sequencing.
[0163] In the plasmid pAB600-PhyM10 the E. coli phytase sequence
has been fusioned to the 3' end of the CBHII gene fragment by means
of a kexII restriction site. The kex sequence contains the
following amino acids: RTLVKR (SEQ ID NO: 43).
[0164] The construction of the plasmid pAB600 has been effected by
the following steps:
[0165] The plasmid pAB1280 is based on pUC18 and contains the cbhII
gene fragment (nucleotides 1-307 corresponds to amino acids M1 to
S86, Teeri et al, 1987, Gene 51: 43-52, accession number 16190)
under the control of the cbhI promotor and cbhI terminator from the
plasmid pALK487 (WO 94/28117). Moreover, further restriction sites
(SpeI and PacI) have been inserted downstream to the cbhII gene
fragment. These restriction sites are used for the direct cloning
of the phytase variants.
[0166] From the plasmid p3SR2 (Hynes et al., 1983, Mol. Cell. Biol.
3, 1430-1439; Kelly and Hynes, 1985, EMBO J. 4, 475-479) the
acetamidase (amdS) gene has been isolated via the PCR method as
AscI-NruI fragment and inserted into the plasmid pAB1280 which has
been cut with AscI/StuI.
[0167] For the amplification of the amdS gene the following primers
have been derived from the sequence information of the A. nidulans
acetamidase gene:
TABLE-US-00007 AmdS-AscI (SEQ ID NO: 7)
aggcgcgccctagtcatcattggataggcagattactcag AmdS-NruI (SEQ ID NO: 8)
ggaattctcgcgaaaggcaacaaccagctcacccctgag
[0168] The obtained plasmid has the designation pAB600 and has been
confirmed by mapping and sequencing.
[0169] The gene of the phytase variant PhyM10 has been cloned into
the plasmid pAB2004. The plasmid pUC-PhyM10 is illustrated in FIG.
5 and has been deposited under the accession number DSM 18719 on
Oct. 18, 2006.
Example 7
Construction of the Plasmids pPhy2005 and pAB-pHy2005 (Genotype
Phy2005)
[0170] The construction of the plasmid pAB-Phy2005 has been
effected by the following steps:
1. Construction of pPhy2005
[0171] The plasmid pPhy2005 contains the fusion from the A. niger
var. awamori acidic phosphatase (ap) gene (Piddington et al., 1993,
Gene 133 (1), 55-62; accession number L02420) and the E. coli
phytase gene by using the codon usage of T. reesei
(http://www.kazusa.or.jp/codon) (Dassa et al. 1990, accession
number M58740). Hereby, an open reading frame is obtained which
codes for a phytase variant with 457 amino acids whereby the first
four (4) amino acids of the E. coli phytase gene are substituted by
the first fifty-one (51) amino acids of the acidic phosphatase
gene. For the secretion of the protein consisting of the fusion of
acidic phosphatase of the E. coli phytase in T. reesei the signal
sequence of the acidic phosphatase has been used.
[0172] The fusion from the A. niger var. awamori acidic phosphatase
(ap) sequence and the E. coli phytase sequence which has been
produced by the use of the codon usage of T. reesei has been
synthesised and cloned into the plasmid pUC18. The obtained plasmid
pPhy2005 has been confirmed by sequencing.
[0173] The plasmid is illustrated in FIG. 7 and has been deposited
under the accession number DSM 18720 on Oct. 18, 2006.
2. Construction of pAB-Phy2005
[0174] For the construction of plasmid pAB-Phy2005, the sequence of
the fusion from the phosphatase-phytase of the plasmid pPhy2005 has
been restricted by AvrII and PacI and inserted into the SpeI and
PacI restriction sites after the T. reesei cbhII gene fragment into
the plasmid pAB489. The obtained plasmid has the designation
pAB-Phy2005 (FIG. 8) and has been mapped by restriction
endonucleases and confirmed by sequencing.
[0175] The expression cassette isolated from pAB-Phy2005, contains
the following genetic material:
[0176] cbhI (cellobiohydrolase I) promoter: the 2.2 kb EcoRI/SacII
fragment containing the cbhI promoter derives from Trichoderma
reesei QM6a. The promoter region also functions as homologous DNA
(together with the cbhI 3' fragment; see below) in order to control
the integration of the transforming DNA into the cbhI locus.
[0177] Acidic phosphatase gene fragment: The acidic phosphatase
gene fragment with its signal sequence is directly under the
control of the cbhI promoter. The 16 base pairs (CCGCGGACTGCGCATC
atg (SEQ ID NO: 46)) upstream from the start codon, to which the T.
reesei promotor (Shoemaker et al. 1983, Bio/Technology 1, 691-696)
belongs, have been changed after the incorporation of the
AvrII-PacI fusion phosphatase phytase fragment into
CCGCGGACTAGGCATC atg (SEQ ID NO: 47).
[0178] E. coli phytase gene: The synthetic E. coli phytase gene is
directly fusioned to the 3'-end of the acidic phosphatase sequence
into an open reading frame.
[0179] cbhI terminator: The BamHI/StuI fragment having a length of
0.75 kb and containing the cbhI terminator has been added after the
E. coli phytase in order to enable the termination of the
transcription.
[0180] amdS gene: The gene, including its promoter and its
terminator, has been isolated from Aspergillus nidulans VH1-TRSX6
and codes for acetamidase (Hynes et al., 1983, Mol. Cell. Biol. 3:
1430-1439; Kelly and Hynes, 1985, EMBO J. 4:475-479). The
acetamidase enables the strain to grow by using acetamide as sole
nitrogen source and this feature has been used for the selection of
the transformants.
[0181] cbhI 3' fragment: The fragment (1.7 kb, BamHI/EcoRI,
beginning at 1.4 kb after the stop codon of the gene) has been
isolated from T. reesei ALK02466. The strain ALK02466 derives from
the strain ALK0233 (Harkki et al., 1991, Enzyme Microb. Technol.
13: 227-233). The 3' fragment is used together with the promoter
region for the targeted integration of the phytase expression
cassette into the cbhl lokus via homologous recombination.
Example 8
Construction of the Plasmid pPhy2006 and pAB-Phy2006 (Genotype
Phy2006)
[0182] The construction of the plasmid pAB-Phy2006 has been
effected by the following steps:
1. Construction of pPhy2006
[0183] For the construction of the plasmid pPhy2006, the ap-gene
fragment having a length of 87 bp, which codes for the 29 amino
acids belonging to the C-terminus of the ap-gene of the acidic
phosphatase of A. niger var. Awamori, has been directly fusioned to
the last amino acid (leucin) of the DNA sequence coding for E. coli
phytase in the plasmid pPhy2005. Hereby, an open reading frame of
486 amino acids is obtained.
[0184] The fusion Phy2006 from the A. niger var. awamori acidic
phosphatase sequence and the produced E. coli phytase sequence by
means of the codon usage of T. reesei has been synthesised and
cloned into the plasmid pUC18. The new sequence contained in the
obtained plasmid pPhy2006 has been confirmed by sequencing.
[0185] The plasmid is illustrated in FIG. 9 and has been deposited
under the accession number DSM 18721 on Oct. 18, 2006.
2. Construction of QAB-Phy2006
[0186] The construction as well as the cloning of the plasmid
pAB-Phy2006 is identical with the production of the plasmid
pAB-Phy2005 described in example 7.
[0187] The sequence of the phytase variant pAB-Phy2006 (FIG. 10)
has been confirmed by sequencing.
Example 9
Transformation of T. reesei
[0188] T. reesei RH 3780d has been separately transformed with the
linearised expression cassettes isolated form the plasmids
pAB489-PhyM3, pAB490-PhyM2, pAB490-PhyM7, pAB489-PhyM9,
pAB600-PhyM10, pAB-Phy2005 and pAB-Phy2006. The techniques used for
transformation and handling of T. reesei have been those according
to Pennila et al. (1987, Gene 61: 155-164). The transformants have
been selected and purified twice by single spore isolation. Of all
transformants the ones with the highest secretion performance have
been chosen and processed for the production of enzyme material in
example 10. The used transformants are listed in the following
table 2.
TABLE-US-00008 TABLE 2 List of the transformants for further
experiments in the examples 10-13 Genotype Transformant Wt (pKDa4)
RH 31071 pKDa2 (V200Y; M1) RH 31068 PhyM2 RH 31575 PhyM3 RH 31545
PhyM7 RH 31507 PhyM9 RH 31686 PhyM10 RH 31898 Phy2005 RH 31676
Phy2006 RH 31677
Example 10
Production of an Enzyme with the Individual Mutants
[0189] A) Production of enzyme solutions by fermentation in shake
flasks
[0190] Transformants, which carry the expression cassettes from
examples 2 to 8, i.e. the transformants with the plasmid pKDa2 (M1)
and pKDa4 (wild-type amino acid sequence E. coli phytase according
to Dassa) from DE 10 2004 050 410, have been cultivated in shake
flasks with pH control on a DASGIP facility on a cellulase-induced
medium of the following composition: lactose 10.5% (w/v), DSG 5.25%
(w/v), (NH.sub.4).sub.2SO.sub.4 0.63% (w/v), tap water as balance,
adjusting of the pH value to 4.5 prior to the sterilisation. After
inoculation a pH ramp has been increased to a pH of 3.3 in the
shake flasks within 5 hours. The culture filtrates obtained after
the 6-day cultivation at a controlled pH value of 3.3 have been
used for the determination of the phytase activity and for the
analysis of the thermostability via differential scanning
kalorimetrie (DSC) (Example 11).
[0191] B) Production of Enzyme Granulates by Fermentation in
30-I-Bioreaktors and Drying in a ProCell5
[0192] The transformants from example 10A) have been cultivated in
the medium of example 10A) in 30-1-bioreactors at a pH value of pH
3.2.+-.0.2, 200 to 400 upm and an aeration rate of 0.5 vvm. At the
end of the 6-day fermentation the biomass has been separated by
filtration and the clear culture residue has been concentrated via
ultrafiltration (30 kDa cut-off membrane) by the factor 6. The
concentrate has been aseptically filtrated and then used for the
subsequent production of the enzyme granulates.
[0193] The granulates have been produced from the UF concentrates
by drying in a spraying granulator of the type ProCell5, Firma
Glatt Systemtechnik GmbH, Dresden, Germany. For this purpose, the
pH value of the UF concentrates has been adjusted to pH 5.2 and
prior to drying 50% (w/w) of skimmed milk powder with a lactose
content of 30% and 9.2% (w/w) of Ca-propionate, both ingredients
based on the total protein content of the UF concentrate, have been
added. The mixture has been dried by a 1.2 mm O two-component
nozzle with an air pressure rising from 1.2 to 2.2 bar at
80.degree.-90.degree. C. inlet air temperature. The activity yields
at drying have been within a range from 89 to 99%. The hereby
produced granulates have been used for the test in example 12.
Example 11
Determination of the Temperature Stability Via DSC
[0194] The samples from example 10A) have been buffered into a 100
mM sodium acetate buffer, pH 5.2, via a PD 10 column (Pharmacia).
For this purpose, 1.5 ml of the sample have been applied and eluted
with a 3.5 ml buffer in accordance with the instructions of the
producer. All DSC tests have been effected on a VP-DSC device
(MicroCal Inc., Northampton, Mass., USA) and the data have been
transferred to a PC in order to be evaluated by means of the
software Origin v7.0383 (OriginLab Corp. Northampton, Mass.,
USA).
[0195] Prior to the measuring the samples have been degased in a
ThermoVac2 (MicroCal Inc., Northampton, Mass.; USA) for 20 minutes
and tempered at 25.degree. C. in a water bath.
[0196] The measurements have been effected by the following
parameters:
A) Constant Device Parameter:
[0197] Cell volume: 0.51231 ml [0198] Reference heat resistance:
1009.1 ohms [0199] Cell heat resistance: 1002.7 ohms [0200]
Adiabatic rate: 0.88181 [0201] Delta T read: 3.676 B) VP-DSC Scan
Parameters have been as Follows: [0202] Scan rate (up and down):
1.degree. C. min.sup.-1 [0203] Temperature prior to scan cycle:
25.degree. C. [0204] Equilibration time prior to the cycle: 15 min
[0205] Equilibration time after the cycle: 0 min [0206] Filter: 10
s [0207] Feedback: none [0208] Start temperature: 25.degree. C.
[0209] End temperature: 105.degree. C. [0210] Cell pressure: 26.1
bis 28.7 psi
[0211] The following table 3 shows the melting temperature Tm (in
degrees Centigrade) and the shift of the melting temperature
.DELTA.T (in degrees Centigrade) of the mutant E. coli-phytases,
which have been produced in accordance with the afore-mentioned
examples, in comparison to the wild-type E. coli phytase (Dassa et
al., 1990) produced with the same host systems like the mutant E.
coli phytase variants and an E. coli phytase with a mutation (M1)
non-according to the invention, likewise produced with the same
host system like the mutant E. coli phytase variants according to
the invention.
TABLE-US-00009 TABLE 3 Melting temperature Tm [.degree. C.] and
shifting of the melting temperature .DELTA.T [.degree. C.] of the
E. coli phytase mutants compared to the wild-type protein, all
produced in T. reesei according to example 10A. Phytase
Sample/Genotype Tm [.degree. C.] .DELTA.T [.degree. C.] Wild-type
65.64 -- M1 65.01 -0.63 M2 66.75 +1.11 M3 66.04 +0.40 M7 66.21
+0.57 M9 66.27 +0.63 Phy2005 66.06 +0.42 Phy2006 66.06 +0.42
[0212] The results show that, when using any mutant according to
the invention, an increase of the melting temperature of the
protein has occurred which shows in a positive shift of the melting
point temperature. The increase of the melting point temperature is
equivalent to an increase of the temperature stability. The highest
improvement of the thermostability has hereby shown the double
mutation M2 with .DELTA.T=+1.11.degree. C. By contrast, the
mutation described in DE 10 2004 050 410 for the improvement of the
secretion height (V200Y=M1) showed a decrease of the
thermostability (.DELTA.T=-0.63.degree. C.).
[0213] Also the extensions at the N- or C-terminal ends have shown
improvements of the thermostability which has about the same order
like the one of the point mutation of M3.
Example 12
Measuring of the Thermostability when Pelleting
[0214] Enzyme granulates produced in accordance with example 10B)
have been premixed with wheat flour, type 550, in order to obtain
300 g of an enzyme containing premixture. This premixture has been
mixed at the biotechnological institute of the Research Institutes
for Food and Molecular Biotechnology, Kolding, Denmark with 15 kg
of animal feed in order to guarantee an optimal dilution for the
adding in 285 kg of animal feed and an easily determinable enzyme
activity in the pelleted material. The used amount of enzyme
granulate has lead to a phytase activity of about 3 to 6 enzyme
units per gram of animal feed in the mixture prior to the test
process. The 300 kg of animal feed which have been treated in the
pilot pelleting device have the composition of table 4.
TABLE-US-00010 TABLE 4 Composition of the animal feed to be
pelletised Component [%] Wheat Ad 75 Hipro Soy 48 20 Soy bean oil
4.75 Vitamins/Minerals, Beta Avitren 90 0.25 Enzyme premix* 300 g
*contains phytase with genotype wt, PhyM1, PhyM2, PhyM3, PhyM7,
PhyM9, Phy2005, or Phy2006
Pelleting Conditions:
[0215] Horizontal mixer with 7001 volume, 48 ppm. The amount to be
mixed lies in the range of 80 to 300 kg per h.
[0216] Connected to the mixer is a horizontal conveying screw for
the emptying of the mixer, the speed of the conveying screw being
adapted to the subsequent step.
[0217] After the mixing in the horizontal mixer there is a thermal
treatment in a KahI cascade mixer (Conditioner) with a length of
130 cm, a diameter of 30 cm, 155 upm and 37 chambers. Throughout is
300 kg per h. Animal feeds and enzymes have a contact of about 30 s
with saturated steam and are thus heated to a temperature between
70.degree. and 95.degree. C. The steam which is provided by a Dan
Stoker high-pressure boiler streams with an overpressure of 2 bar
through a pressure regulation valve in the cascade mixer. The valve
regulates the amount of steam which streams into the cascade mixer
and which there leads to the heatening of the animal feed
(including the enzyme).
[0218] The conditioned material is pelleted by a Simon Heesen press
and afterwards cooled by air in a perforated box perfused by 1500
m.sup.3 h.sup.-1. The pelleting press runs with 500 upm at a power
input of 7.5 kW and thus produces pellets of 3.times.20 mm.
[0219] The treatment in the cascade mixer caused a thermal load of
the enzyme contained in the pelleted material. Subsequent to the
production of the pellet the recovery of the phytase activity in
the pelleted animal feed has been determined. In the following
table 5 the recovery of the phytase activity in the pelleted animal
feed is indicated in relation to the temperature during the
treatment.
TABLE-US-00011 TABLE 5 Recovery of the phytase acitivity in animal
feed after conditioning at 70.degree. to 95.degree. C. and
subsequent pelletising. All enzymes were expressed recombinantly
using T. reesei. Recovery of phytase activity [%] T [.degree. C.]
wt M1 M2 M3 M7 M9 Phy2005 Phy2006 70 93.0 64.0 103.1 101.6 109.5
108.4 97.6 93.6 75 90.3 47.8 104.9 90.7 88.2 105.0 85.4 90.1 80
46.6 27.8 73.0 43.7 55.5 55.3 32.9 58.6 85 7.8 5.9 37.9 9.2 16.8
11.0 7.6 27.5 90 1.3 0.0 9.7 2.8 5.4 3.0 0.6 11.8 95 0.5 0.0 4.9
0.0 1.4 0.0 1.0 0.5
[0220] The results show that the change in the thermostability
which has been found during the measurings via DSC in liquids have
also been found in the "dry" pelleting tests. Hereby, the
improvement of the thermostability in relation to the wild-type
enzyme is not constant in all mutants within the whole measured
temperature range. M2 has shown in the DSC test the highest
temperature stability. Also in the pelleting test the best
stabilisation has been achieved by mutation in an isolated region
by the double mutation M2 which inserts an ionic linking/bridging
in helix D of the E. coli phytase. The mutant non-according to the
invention M1 shows, as in the DSC test, a decline of the
thermostability in comparison to expressed wild-type enzyme in
Trichoderma reesei. The mutation 3, in itself non-according to the
invention either, shows similar thermostability characteristics as
the wild-type enzyme. The variant Phy2005 carrying only the
N-terminal extension by the corresponding part of the acidic
phosphatase from A. niger var. Awamori is not as stable with
respect to higher temperatures as Phy2006 which contains the N- as
well as the C-terminal extensions. This can be seen as an
indication that these extensions can contribute to an association
of the E. coli phytase molecules in analogy to the dimerisation of
the acidic phosphatase under normal conditions and thus improve the
thermostability.
Example 13
Measuring of the Proteolytic Stability in an In-Vitro Process
[0221] For the determination of the proteolytic in-vitro stability,
enzyme samples from example 10A) have been used, i.e. samples of
the transformants M1 (the mutation non-according to the invention),
M2, M3, M7, Phy2005 and Phy2006, produced with the transformants of
table 2.
[0222] 20 ml of a pepsin solution (Merck 7190) containing 20
protease units per ml in glycin-HCL buffer pH 2.5), whereby the
activity is referred to haemoglobin, pH 1.6, 25.degree. C.,
according to the producer, have been temperated at 40.degree. C. 10
ml of a phytase solution (diluted by 1:100) have been added and the
solution has been complemented to 50 ml and afterwards incubated
for 30 minutes at 40.degree. C., pH 2.5. The reaction has been
stopped by immersion in an ice/water bath and the pH value has been
immediately increased by sodium hydroxide solution to pH 5 and the
solution has thus been diluted to 100 ml. The phytase activity has
then been measured according to example 1.
[0223] 10 ml of the solution, which has been treated with pepsin,
have been adjusted to a pH value of 7. 30 ml of a pancreatin
solution (Merck 7130) containing 30 protease units (Casein, pH 8.0,
35.degree. C.), in 0.05 M Tris-HCl buffer (pH 7.0) have been added.
The solution has then been diluted with Tris-HCl buffer, pH 7, to
50 ml and incubated in a water bath at 40.degree. C. for 30
minutes. The reaction has been stopped by immersion in an ice/water
bath and the pH value has been immediately decreased by HCl to pH 5
and the solution has thus been diluted to 100 ml. The phytase
activity has then been measured according to example 1. The results
are illustrated in table 6.
TABLE-US-00012 TABLE 6 Recovery of activity after treating the
enzyme mutants with pepsin and subsequently with pancreatin.
Residual activity after Residual activity after pepsin and
pancreatin Genotype pepsin treatment [%] treatment [%] PhyM1 84 71
PhyM2 111 85 PhyM3 112 80 PhyM7 101 75 Phy2005 110 99 Phy2006 109
78
[0224] The results show for all mutants according to the invention
a very high proteolytic stability in the presence of pepsin and
pancreatin, compared to the reference mutant PhyM1, under in-vitro
conditions as they appear in the stomachs of monogastrians, e.g.
pigs. The here shown high proteolytic stability illustrates that
the enzyme mutants are especially suitable for the use in the
animal feed field.
Sequence CWU 1
1
57133DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1ccaactggat aacgcccggg tgaccgacgc cat
33233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2atggcgtcgg tcacccgggc gttatccagt tgg
33327DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3gccaacgtga ccgaggccat cctcagc 27427DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
4gctgaggatg gcctcggtca cgttggc 27529DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5cggactcctg gctgacaagg gatgcccgc 29629DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6gcgggcatcc cttgtcagcc aggagtccg 29740DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7aggcgcgccc tagtcatcat tggataggca gattactcag 40839DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8ggaattctcg cgaaaggcaa caaccagctc acccctgag 3991230DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
9cag agc gag ccc gag ctg aag ctg gag tcg gtc gtg atc gtc agc cgc
48Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1
5 10 15 cac ggc gtg cgt gct cct acc aag gcc acg cag ctg atg cag gac
gtc 96His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp
Val 20 25 30 acc cct gac gcc tgg ccc acc tgg ccc gtc aag ctt ggc
tgg ctg act 144Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly
Trp Leu Thr 35 40 45 cct cgc ggc ggt gag ctc atc gcc tac ctc gga
cac tac caa cgc cag 192Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly
His Tyr Gln Arg Gln 50 55 60 cgt ctg gtt gcc gac gga ctc ctg gct
aag aag gga tgc ccg cag tct 240Arg Leu Val Ala Asp Gly Leu Leu Ala
Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 ggc cag gtc gcg att atc gcc
gat gtc gac gag cgt acc cgt aag acc 288Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 ggc gaa gcc ttc gct
gcc ggc ctc gct cct gac tgt gcc atc acg gtc 336Gly Glu Ala Phe Ala
Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 cac acc cag
gca gac acg tcc agc ccc gat ccg ctg ttt aac cct ctc 384His Thr Gln
Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 aag
act ggc gtc tgc caa ctg gat aac gcc cgg gtg acc gag gcc atc 432Lys
Thr Gly Val Cys Gln Leu Asp Asn Ala Arg Val Thr Glu Ala Ile 130 135
140 ctc agc agg gct gga ggt tcc atc gcc gac ttc acc ggc cat cgg cag
480Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160 acg gcg ttc cgc gag ctg gag cgg gtc ctt aat ttt ccc
cag tcg aac 528Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn 165 170 175 ctg tgc ctc aag cgt gag aag cag gac gag agc
tgt tcc ctg acc cag 576Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln 180 185 190 gca ctc ccg tcg gaa ctc aag tac agc
gcc gac aac gtc tcc ctt acc 624Ala Leu Pro Ser Glu Leu Lys Tyr Ser
Ala Asp Asn Val Ser Leu Thr 195 200 205 ggt gcc gtt agc ctc gct tcc
atg ctg acg gag atc ttc ctc ctg cag 672Gly Ala Val Ser Leu Ala Ser
Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 caa gcg cag gga atg
ccc gag cct ggg tgg ggc cgc att acc gat tct 720Gln Ala Gln Gly Met
Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 cac cag
tgg aac acc ctg ctc tcg ctt cac aac gcc cag ttc tat ctg 768His Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255
ctc caa cgc acg ccc gag gtt gcc cgc agc cgc gcc acc ccg ctg ctc
816Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270 gac ctc atc aag act gcg ctg acg ccc cac cct ccg cag aag
cag gct 864Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys
Gln Ala 275 280 285 tac ggt gtc acc ctc ccc act tcc gtc ctg ttt atc
gcc ggt cac gac 912Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile
Ala Gly His Asp 290 295 300 acc aac ctg gcc aat ctc ggc ggc gct ctg
gag ctc aac tgg acg ctt 960Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu
Glu Leu Asn Trp Thr Leu 305 310 315 320 ccc gga cag ccg gat aac act
ccc cct ggc ggt gag ctg gtg ttc gaa 1008Pro Gly Gln Pro Asp Asn Thr
Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 cgc tgg cgt cgg ctc
agc gac aac tcc cag tgg att cag gtt tcg ctg 1056Arg Trp Arg Arg Leu
Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 gtc ttc cag
acc ctg cag cag atg cgc gac aaa acg ccc ctg tcc ctc 1104Val Phe Gln
Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 aat
acc cct ccc ggc gag gtc aag ctg acc ctg gca ggc tgt gaa gag 1152Asn
Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375
380 cgc aac gcc cag ggc atg tgc tct ctc gct ggc ttt acg caa atc gtg
1200Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400 aac gag gcc cgc atc ccc gct tgc tct ctg 1230Asn Glu
Ala Arg Ile Pro Ala Cys Ser Leu 405 410 10410PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
10Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1
5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp
Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly
Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly
His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala
Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala
Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln
Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys
Thr Gly Val Cys Gln Leu Asp Asn Ala Arg Val Thr Glu Ala Ile 130 135
140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Tyr Ser
Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser
Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met
Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260
265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln
Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala
Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu
Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr
Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr
Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385
390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
111230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 11cag agc gag ccc gag ctg aag ctg gag tcg
gtc gtg atc gtc agc cgc 48Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser
Val Val Ile Val Ser Arg 1 5 10 15 cac ggc gtg cgt gct cct acc aag
gcc acg cag ctg atg cag gac gtc 96His Gly Val Arg Ala Pro Thr Lys
Ala Thr Gln Leu Met Gln Asp Val 20 25 30 acc cct gac gcc tgg ccc
acc tgg ccc gtc aag ctt ggc tgg ctg act 144Thr Pro Asp Ala Trp Pro
Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 cct cgc ggc ggt
gag ctc atc gcc tac ctc gga cac tac caa cgc cag 192Pro Arg Gly Gly
Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 cgt ctg
gtt gcc gac gga ctc ctg gct aag aag gga tgc ccg cag tct 240Arg Leu
Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80
ggc cag gtc gcg att atc gcc gat gtc gac gag cgt acc cgt aag acc
288Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95 ggc gaa gcc ttc gct gcc ggc ctc gct cct gac tgt gcc atc
acg gtc 336Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile
Thr Val 100 105 110 cac acc cag gca gac acg tcc agc ccc gat ccg ctg
ttt aac cct ctc 384His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu
Phe Asn Pro Leu 115 120 125 aag act ggc gtc tgc caa ctg gat aac gcc
aac gtg acc gac gcc atc 432Lys Thr Gly Val Cys Gln Leu Asp Asn Ala
Asn Val Thr Asp Ala Ile 130 135 140 ctc agc agg gct gga ggt tcc atc
gcc gac ttc acc ggc cat cgg cag 480Leu Ser Arg Ala Gly Gly Ser Ile
Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 acg gcg ttc cgc gag
ctg gag cgg gtc ctt aat ttt ccc cag tcg aac 528Thr Ala Phe Arg Glu
Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 ctg tgc ctc
aag cgt gag aag cag gac gag agc tgt tcc ctg acc cag 576Leu Cys Leu
Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 gca
ctc ccg tcg gaa ctc aag ccc tcc gcg gac aac gtc tcc ctt acc 624Ala
Leu Pro Ser Glu Leu Lys Pro Ser Ala Asp Asn Val Ser Leu Thr 195 200
205 ggt gcc gtt agc ctc gct tcc atg ctg acg gag atc ttc ctc ctg cag
672Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220 caa gcg cag gga atg ccc gag cct ggg tgg ggc cgc att acc
gat tct 720Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr
Asp Ser 225 230 235 240 cac cag tgg aac acc ctg ctc tcg ctt cac aac
gcc cag ttc tat ctg 768His Gln Trp Asn Thr Leu Leu Ser Leu His Asn
Ala Gln Phe Tyr Leu 245 250 255 ctc caa cgc acg ccc gag gtt gcc cgc
agc cgc gcc acc ccg ctg ctc 816Leu Gln Arg Thr Pro Glu Val Ala Arg
Ser Arg Ala Thr Pro Leu Leu 260 265 270 gac ctc atc aag act gcg ctg
acg ccc cac cct ccg cag aag cag gct 864Asp Leu Ile Lys Thr Ala Leu
Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 tac ggt gtc acc ctc
ccc act tcc gtc ctg ttt atc gcc ggt cac gac 912Tyr Gly Val Thr Leu
Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 acc aac ctg
gcc aat ctc ggc ggc gct ctg gag ctc aac tgg acg ctt 960Thr Asn Leu
Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320
ccc gga cag ccg gat aac act ccc cct ggc ggt gag ctg gtg ttc gaa
1008Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335 cgc tgg cgt cgg ctc agc gac aac tcc cag tgg att cag gtt
tcg ctg 1056Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val
Ser Leu 340 345 350 gtc ttc cag acc ctg cag cag atg cgc gac aaa acg
ccc ctg tcc ctc 1104Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr
Pro Leu Ser Leu 355 360 365 aat acc cct ccc ggc gag gtc aag ctg acc
ctg gca ggc tgt gaa gag 1152Asn Thr Pro Pro Gly Glu Val Lys Leu Thr
Leu Ala Gly Cys Glu Glu 370 375 380 cgc aac gcc cag ggc atg tgc tct
ctc gct ggc ttt acg caa atc gtg 1200Arg Asn Ala Gln Gly Met Cys Ser
Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 aac gag gcc cgc atc
ccc gct tgc tct ctg 1230Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405
410 12410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 12Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val
Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala
Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr
Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu
Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val
Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly
Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90
95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val
Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp
Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu
Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg
Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro
Ser Glu Leu Lys Pro Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly
Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215
220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln
Phe Tyr Leu 245
250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu
Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln
Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe
Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala
Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn
Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg
Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe
Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370
375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile
Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
131230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 13cag agc gag ccc gag ctg aag ctg gag tcg
gtc gtg atc gtc agc cgc 48Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser
Val Val Ile Val Ser Arg 1 5 10 15 cac ggc gtg cgt gct cct acc aag
gcc acg cag ctg atg cag gac gtc 96His Gly Val Arg Ala Pro Thr Lys
Ala Thr Gln Leu Met Gln Asp Val 20 25 30 acc cct gac gcc tgg ccc
acc tgg ccc gtc aag ctt ggc tgg ctg act 144Thr Pro Asp Ala Trp Pro
Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 cct cgc ggc ggt
gag ctc atc gcc tac ctc gga cac tac caa cgc cag 192Pro Arg Gly Gly
Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 cgt ctg
gtt gcc gac gga ctc ctg gct gac aag gga tgc ccg cag tct 240Arg Leu
Val Ala Asp Gly Leu Leu Ala Asp Lys Gly Cys Pro Gln Ser 65 70 75 80
ggc cag gtc gcg att atc gcc gat gtc gac gag cgt acc cgt aag acc
288Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95 ggc gaa gcc ttc gct gcc ggc ctc gct cct gac tgt gcc atc
acg gtc 336Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile
Thr Val 100 105 110 cac acc cag gca gac acg tcc agc ccc gat ccg ctg
ttt aac cct ctc 384His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu
Phe Asn Pro Leu 115 120 125 aag act ggc gtc tgc caa ctg gat aac gcc
aac gtg acc gac gcc atc 432Lys Thr Gly Val Cys Gln Leu Asp Asn Ala
Asn Val Thr Asp Ala Ile 130 135 140 ctc agc agg gct gga ggt tcc atc
gcc gac ttc acc ggc cat cgg cag 480Leu Ser Arg Ala Gly Gly Ser Ile
Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 acg gcg ttc cgc gag
ctg gag cgg gtc ctt aat ttt ccc cag tcg aac 528Thr Ala Phe Arg Glu
Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 ctg tgc ctc
aag cgt gag aag cag gac gag agc tgt tcc ctg acc cag 576Leu Cys Leu
Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 gca
ctc ccg tcg gaa ctc aag tac agc gcc gac aac gtc tcc ctt acc 624Ala
Leu Pro Ser Glu Leu Lys Tyr Ser Ala Asp Asn Val Ser Leu Thr 195 200
205 ggt gcc gtt agc ctc gct tcc atg ctg acg gag atc ttc ctc ctg cag
672Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220 caa gcg cag gga atg ccc gag cct ggg tgg ggc cgc att acc
gat tct 720Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr
Asp Ser 225 230 235 240 cac cag tgg aac acc ctg ctc tcg ctt cac aac
gcc cag ttc tat ctg 768His Gln Trp Asn Thr Leu Leu Ser Leu His Asn
Ala Gln Phe Tyr Leu 245 250 255 ctc caa cgc acg ccc gag gtt gcc cgc
agc cgc gcc acc ccg ctg ctc 816Leu Gln Arg Thr Pro Glu Val Ala Arg
Ser Arg Ala Thr Pro Leu Leu 260 265 270 gac ctc atc aag act gcg ctg
acg ccc cac cct ccg cag aag cag gct 864Asp Leu Ile Lys Thr Ala Leu
Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 tac ggt gtc acc ctc
ccc act tcc gtc ctg ttt atc gcc ggt cac gac 912Tyr Gly Val Thr Leu
Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 acc aac ctg
gcc aat ctc ggc ggc gct ctg gag ctc aac tgg acg ctt 960Thr Asn Leu
Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320
ccc gga cag ccg gat aac act ccc cct ggc ggt gag ctg gtg ttc gaa
1008Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335 cgc tgg cgt cgg ctc agc gac aac tcc cag tgg att cag gtt
tcg ctg 1056Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val
Ser Leu 340 345 350 gtc ttc cag acc ctg cag cag atg cgc gac aaa acg
ccc ctg tcc ctc 1104Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr
Pro Leu Ser Leu 355 360 365 aat acc cct ccc ggc gag gtc aag ctg acc
ctg gca ggc tgt gaa gag 1152Asn Thr Pro Pro Gly Glu Val Lys Leu Thr
Leu Ala Gly Cys Glu Glu 370 375 380 cgc aac gcc cag ggc atg tgc tct
ctc gct ggc ttt acg caa atc gtg 1200Arg Asn Ala Gln Gly Met Cys Ser
Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 aac gag gcc cgc atc
ccc gct tgc tct ctg 1230Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405
410 14410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 14Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val
Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala
Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr
Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu
Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val
Ala Asp Gly Leu Leu Ala Asp Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly
Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90
95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val
Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp
Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu
Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg
Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro
Ser Glu Leu Lys Tyr Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly
Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215
220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln
Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg
Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro
His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr
Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn
Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly
Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340
345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser
Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly
Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly
Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys
Ser Leu 405 410 151230DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 15cag agc gag ccc gag
ctg aag ctg gag tcg gtc gtg atc gtc agc cgc 48Gln Ser Glu Pro Glu
Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 cac ggc gtg
cgt gct cct acc aag gcc acg cag ctg atg cag gac gtc 96His Gly Val
Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 acc
cct gac gcc tgg ccc acc tgg ccc gtc aag ctt ggc tgg ctg act 144Thr
Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40
45 cct cgc ggc ggt gag ctc atc gcc tac ctc gga cac tac caa cgc cag
192Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln
50 55 60 cgt ctg gtt gcc gac gga ctc ctg gct aag aag gga tgc ccg
cag tct 240Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro
Gln Ser 65 70 75 80 ggc cag gtc gcg att atc gcc gat gtc gac gag cgt
acc cgt aag acc 288Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg
Thr Arg Lys Thr 85 90 95 ggc gaa gcc ttc gct gcc ggc ctc gct cct
gac tgt gcc atc acg gtc 336Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro
Asp Cys Ala Ile Thr Val 100 105 110 cac acc cag gca gac acg tcc agc
ccc gat ccg ctg ttt aac cct ctc 384His Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 aag act ggc gtc tgc caa
ctg gat aac gcc aac gtg acc gac gcc atc 432Lys Thr Gly Val Cys Gln
Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 atc tct aga gct
gga ggt tcc atc gcc gac ttc acc ggc cat cgg cag 480Ile Ser Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 acg
gcg ttc cgc gag ctg gag cgg gtc ctt aat ttt ccc cag tcg aac 528Thr
Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170
175 ctg tgc ctc aag cgt gag aag cag gac gag agc tgt tcc ctg acc cag
576Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190 gca ctc ccg tcg gaa atc aag gtg tcc gcg gac aac gtc tcc
ctt acc 624Ala Leu Pro Ser Glu Ile Lys Val Ser Ala Asp Asn Val Ser
Leu Thr 195 200 205 ggt gcc gtt agc ctc gct tcc atg ctg acg gag atc
ttc ctc ctg cag 672Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile
Phe Leu Leu Gln 210 215 220 caa gcg cag gga atg ccc gag cct ggg tgg
ggc cgc att acc gat tct 720Gln Ala Gln Gly Met Pro Glu Pro Gly Trp
Gly Arg Ile Thr Asp Ser 225 230 235 240 cac cag tgg aac acc ctg ctc
tcg ctt cac aac gcc cag ttc tat ctg 768His Gln Trp Asn Thr Leu Leu
Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 ctc caa cgc acg ccc
gag gtt gcc cgc agc cgc gcc acc ccg ctg ctc 816Leu Gln Arg Thr Pro
Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 gac ctc atc
aag act gcg ctg acg ccc cac cct ccg cag aag cag gct 864Asp Leu Ile
Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 tac
ggt gtc acc ctc ccc act tcc gtc ttg ttt atc gcc ggt cac gac 912Tyr
Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295
300 acc aac ctg gcc aat ctc ggc ggc gct ctg gag ctc aac tgg acg ctt
960Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320 ccc gga cag ccg gat aac act ccc cct ggc ggt gag ctg
gtg ttc gaa 1008Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu
Val Phe Glu 325 330 335 cgc tgg cgt cgg ctc agc gac aac tcc cag tgg
att cag gtt tcg ctg 1056Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp
Ile Gln Val Ser Leu 340 345 350 gtc ttc cag acc ctg cag cag atg cgc
gac aaa acg ccc ctg tcc ctc 1104Val Phe Gln Thr Leu Gln Gln Met Arg
Asp Lys Thr Pro Leu Ser Leu 355 360 365 aat acc cct ccc ggc gag gtc
aag ctg acc ctg gca ggc tgt gaa gag 1152Asn Thr Pro Pro Gly Glu Val
Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 cgc aac gcc cag ggc
atg tgc tct ctc gct ggc ttt acg caa atc gtg 1200Arg Asn Ala Gln Gly
Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 aac gag
gcc cgc atc ccc gct tgc tct ctg 1230Asn Glu Ala Arg Ile Pro Ala Cys
Ser Leu 405 410 16410PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 16Gln Ser Glu Pro Glu Leu
Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg
Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro
Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50
55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln
Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr
Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp
Cys Ala Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro
Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu
Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 Ile Ser Arg Ala Gly
Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala
Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180
185 190 Ala Leu Pro Ser Glu Ile Lys Val Ser Ala Asp Asn Val Ser Leu
Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe
Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly
Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser
Leu His Asn Ala Gln Phe Tyr Leu 245 250
255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys
Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile
Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu
Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr
Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu
Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln
Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn
Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375
380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
171230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 17cag agc gag ccc gag ctg aag ctg gag tcg
gtc gtg atc gtc agc cgc 48Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser
Val Val Ile Val Ser Arg 1 5 10 15 cac ggc gtg cgt gct cct acc aag
gcc acg cag ctg atg cag gac gtc 96His Gly Val Arg Ala Pro Thr Lys
Ala Thr Gln Leu Met Gln Asp Val 20 25 30 acc cct gac gcc tgg ccc
acc tgg ccc gtc aag ctt ggc tgg ctg act 144Thr Pro Asp Ala Trp Pro
Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 cct cgc ggc ggt
gag ctc atc gcc tac ctc gga cac tac caa cgc cag 192Pro Arg Gly Gly
Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 cgt ctg
gtt gcc gac gga ctc ctg gct gac aag gga tgc ccg cag tct 240Arg Leu
Val Ala Asp Gly Leu Leu Ala Asp Lys Gly Cys Pro Gln Ser 65 70 75 80
ggc cag gtc gcg att atc gcc gat gtc gac gag cgt acc cgt aag acc
288Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95 ggc gaa gcc ttc gct gcc ggc ctc gct cct gac tgt gcc atc
acg gtc 336Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile
Thr Val 100 105 110 cac acc cag gca gac acg tcc agc ccc gat ccg ctg
ttt aac cct ctc 384His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu
Phe Asn Pro Leu 115 120 125 aag act ggc gtc tgc caa ctg gat aac gcc
cgg gtg acc gag gcc atc 432Lys Thr Gly Val Cys Gln Leu Asp Asn Ala
Arg Val Thr Glu Ala Ile 130 135 140 ctc agc agg gct gga ggt tcc atc
gcc gac ttc acc ggc cat cgg cag 480Leu Ser Arg Ala Gly Gly Ser Ile
Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 acg gcg ttc cgc gag
ctg gag cgg gtc ctt aat ttt ccc cag tcg aac 528Thr Ala Phe Arg Glu
Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 ctg tgc ctc
aag cgt gag aag cag gac gag agc tgt tcc ctg acc cag 576Leu Cys Leu
Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 gca
ctc ccg tcg gaa ctc aag ccc tcc gcg gac aac gtc tcc ctt acc 624Ala
Leu Pro Ser Glu Leu Lys Pro Ser Ala Asp Asn Val Ser Leu Thr 195 200
205 ggt gcc gtt agc ctc gct tcc atg ctg acg gag atc ttc ctc ctg cag
672Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220 caa gcg cag gga atg ccc gag cct ggg tgg ggc cgc att acc
gat tct 720Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr
Asp Ser 225 230 235 240 cac cag tgg aac acc ctg ctc tcg ctt cac aac
gcc cag ttc tat ctg 768His Gln Trp Asn Thr Leu Leu Ser Leu His Asn
Ala Gln Phe Tyr Leu 245 250 255 ctc caa cgc acg ccc gag gtt gcc cgc
agc cgc gcc acc ccg ctg ctc 816Leu Gln Arg Thr Pro Glu Val Ala Arg
Ser Arg Ala Thr Pro Leu Leu 260 265 270 gac ctc atc aag act gcg ctg
acg ccc cac cct ccg cag aag cag gct 864Asp Leu Ile Lys Thr Ala Leu
Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 tac ggt gtc acc ctc
ccc act tcc gtc ctg ttt atc gcc ggt cac gac 912Tyr Gly Val Thr Leu
Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 acc aac ctg
gcc aat ctc ggc ggc gct ctg gag ctc aac tgg acg ctt 960Thr Asn Leu
Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320
ccc gga cag ccg gat aac act ccc cct ggc ggt gag ctg gtg ttc gaa
1008Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335 cgc tgg cgt cgg ctc agc gac aac tcc cag tgg att cag gtt
tcg ctg 1056Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val
Ser Leu 340 345 350 gtc ttc cag acc ctg cag cag atg cgc gac aaa acg
ccc ctg tcc ctc 1104Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr
Pro Leu Ser Leu 355 360 365 aat acc cct ccc ggc gag gtc aag ctg acc
ctg gca ggc tgt gaa gag 1152Asn Thr Pro Pro Gly Glu Val Lys Leu Thr
Leu Ala Gly Cys Glu Glu 370 375 380 cgc aac gcc cag ggc atg tgc tct
ctc gct ggc ttt acg caa atc gtg 1200Arg Asn Ala Gln Gly Met Cys Ser
Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 aac gag gcc cgc atc
ccc gct tgc tct ctg 1230Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405
410 18410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 18Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val
Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala
Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr
Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu
Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val
Ala Asp Gly Leu Leu Ala Asp Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly
Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90
95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Arg Val
Thr Glu Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp
Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu
Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg
Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro
Ser Glu Leu Lys Pro Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly
Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215
220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln
Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg
Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro
His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr
Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn
Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly
Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340
345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser
Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly
Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly
Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys
Ser Leu 405 410 191371DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 19ttc tcc tac ggc gct
gcc att cct cag tca acc cag gag aag cag ttc 48Phe Ser Tyr Gly Ala
Ala Ile Pro Gln Ser Thr Gln Glu Lys Gln Phe 1 5 10 15 tct cag gag
ttc cgc gat ggc tac agc atc ctc aag cac tac ggt ggt 96Ser Gln Glu
Phe Arg Asp Gly Tyr Ser Ile Leu Lys His Tyr Gly Gly 20 25 30 aac
gga ccc tac tcc gag cgt gtg tcc tac ggt atc gcc cgc gat ccc 144Asn
Gly Pro Tyr Ser Glu Arg Val Ser Tyr Gly Ile Ala Arg Asp Pro 35 40
45 ccg act agt gag ctg aag ctg gag tcg gtc gtg atc gtc agc cgc cac
192Pro Thr Ser Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg His
50 55 60 ggc gtg cgt gct cct acc aag gcc acg cag ctg atg cag gac
gtc acc 240Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp
Val Thr 65 70 75 80 cct gac gcc tgg ccc acc tgg ccc gtc aag ctt ggc
tgg ctg act cct 288Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly
Trp Leu Thr Pro 85 90 95 cgc ggc ggt gag ctc atc gcc tac ctc gga
cac tac caa cgc cag cgt 336Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly
His Tyr Gln Arg Gln Arg 100 105 110 ctg gtt gcc gac gga ctc ctg gct
aag aag gga tgc ccg cag tct ggc 384Leu Val Ala Asp Gly Leu Leu Ala
Lys Lys Gly Cys Pro Gln Ser Gly 115 120 125 cag gtc gcg att atc gcc
gat gtc gac gag cgt acc cgt aag acc ggc 432Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys Thr Gly 130 135 140 gaa gcc ttc gct
gcc ggc ctc gct cct gac tgt gcc atc acg gtc cac 480Glu Ala Phe Ala
Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val His 145 150 155 160 acc
cag gca gac acg tcc agc ccc gat ccg ctg ttt aac cct ctc aag 528Thr
Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu Lys 165 170
175 act ggc gtc tgc caa ctg gat aac gcc aac gtg acc gac gcc atc ctc
576Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu
180 185 190 agc agg gct gga ggt tcc atc gcc gac ttc acc ggc cat cgg
cag acg 624Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg
Gln Thr 195 200 205 gcg ttc cgc gag ctg gag cgg gtc ctt aat ttt ccc
cag tcg aac ctg 672Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn Leu 210 215 220 tgc ctc aag cgt gag aag cag gac gag agc
tgt tcc ctg acc cag gca 720Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln Ala 225 230 235 240 ctc ccg tcg gaa ctc aag gtg
agc gcc gac aac gtc tcc ctt acc ggt 768Leu Pro Ser Glu Leu Lys Val
Ser Ala Asp Asn Val Ser Leu Thr Gly 245 250 255 gcc gtt agc ctc gct
tcc atg ctg acg gag atc ttc ctc ctg cag caa 816Ala Val Ser Leu Ala
Ser Met Leu Thr Glu Ile Phe Leu Leu Gln Gln 260 265 270 gcg cag gga
atg ccc gag cct ggg tgg ggc cgc att acc gat tct cac 864Ala Gln Gly
Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser His 275 280 285 cag
tgg aac acc ctg ctc tcg ctt cac aac gcc cag ttc tat ctg ctc 912Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu 290 295
300 caa cgc acg ccc gag gtt gcc cgc agc cgc gcc acc ccg ctg ctc gac
960Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp
305 310 315 320 ctc atc aag act gcg ctg acg ccc cac cct ccg cag aag
cag gct tac 1008Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys
Gln Ala Tyr 325 330 335 ggt gtc acc ctc ccc act tcc gtc ctg ttt atc
gcc ggt cac gac acc 1056Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile
Ala Gly His Asp Thr 340 345 350 aac ctg gcc aat ctc ggc ggc gct ctg
gag ctc aac tgg acg ctt ccc 1104Asn Leu Ala Asn Leu Gly Gly Ala Leu
Glu Leu Asn Trp Thr Leu Pro 355 360 365 gga cag ccg gat aac act ccc
cct ggc ggt gag ctg gtg ttc gaa cgc 1152Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe Glu Arg 370 375 380 tgg cgt cgg ctc agc
gac aac tcc cag tgg att cag gtt tcg ctg gtc 1200Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser Leu Val 385 390 395 400 ttc cag
acc ctg cag cag atg cgc gac aaa acg ccc ctg tcc ctc aat 1248Phe Gln
Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn 405 410 415
acc cct ccc ggc gag gtc aag ctg acc ctg gca ggc tgt gaa gag cgc
1296Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg
420 425 430 aac gcc cag ggc atg tgc tct ctc gct ggc ttt acg caa atc
gtg aac 1344Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile
Val Asn 435 440 445 gag gcc cgc atc ccc gct tgc tct ctg 1371Glu Ala
Arg Ile Pro Ala Cys Ser Leu 450 455 20457PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
20Phe Ser Tyr Gly Ala Ala Ile Pro Gln Ser Thr Gln Glu Lys Gln Phe 1
5 10 15 Ser Gln Glu Phe Arg Asp Gly Tyr Ser Ile Leu Lys His Tyr Gly
Gly 20 25 30 Asn Gly Pro Tyr Ser Glu Arg Val Ser Tyr Gly Ile Ala
Arg Asp Pro 35 40 45 Pro Thr Ser Glu Leu Lys Leu Glu Ser Val Val
Ile Val Ser Arg His 50 55 60 Gly Val Arg Ala Pro Thr Lys Ala Thr
Gln Leu Met Gln Asp Val Thr 65 70 75 80 Pro Asp Ala Trp Pro Thr Trp
Pro Val Lys Leu Gly Trp Leu Thr Pro 85 90 95 Arg Gly Gly Glu Leu
Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln Arg 100 105 110 Leu Val Ala
Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser Gly 115 120 125 Gln
Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr Gly 130 135
140 Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val His
145 150 155 160 Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu Lys 165 170
175 Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu
180 185 190 Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg
Gln Thr 195 200 205 Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn Leu 210 215 220 Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln Ala 225 230 235 240 Leu Pro Ser Glu Leu Lys Val
Ser Ala Asp Asn Val Ser Leu Thr Gly 245 250 255 Ala Val Ser Leu Ala
Ser Met Leu Thr Glu Ile Phe Leu Leu Gln Gln 260 265 270 Ala Gln Gly
Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser His 275 280 285 Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu 290 295
300 Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp
305 310 315 320 Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys
Gln Ala Tyr 325 330 335 Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile
Ala Gly His Asp Thr 340 345 350 Asn Leu Ala Asn Leu Gly Gly Ala Leu
Glu Leu Asn Trp Thr Leu Pro 355 360 365 Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe Glu Arg 370 375 380 Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser Leu Val 385 390 395 400 Phe Gln
Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn 405 410 415
Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg 420
425 430 Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
Asn 435 440 445 Glu Ala Arg Ile Pro Ala Cys Ser Leu 450 455
211458DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 21ttc tcc tac ggc gct gcc att cct cag tca
acc cag gag aag cag ttc 48Phe Ser Tyr Gly Ala Ala Ile Pro Gln Ser
Thr Gln Glu Lys Gln Phe 1 5 10 15 tct cag gag ttc cgc gat ggc tac
agc atc ctc aag cac tac ggt ggt 96Ser Gln Glu Phe Arg Asp Gly Tyr
Ser Ile Leu Lys His Tyr Gly Gly 20 25 30 aac gga ccc tac tcc gag
cgt gtg tcc tac ggt atc gcc cgc gat ccc 144Asn Gly Pro Tyr Ser Glu
Arg Val Ser Tyr Gly Ile Ala Arg Asp Pro 35 40 45 ccg act agt gag
ctg aag ctg gag tcg gtc gtg atc gtc agc cgc cac 192Pro Thr Ser Glu
Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg His 50 55 60 ggc gtg
cgt gct cct acc aag gcc acg cag ctg atg cag gac gtc acc 240Gly Val
Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val Thr 65 70 75 80
cct gac gcc tgg ccc acc tgg ccc gtc aag ctt ggc tgg ctg act cct
288Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr Pro
85 90 95 cgc ggc ggt gag ctc atc gcc tac ctc gga cac tac caa cgc
cag cgt 336Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg
Gln Arg 100 105 110 ctg gtt gcc gac gga ctc ctg gct aag aag gga tgc
ccg cag tct ggc 384Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys
Pro Gln Ser Gly 115 120 125 cag gtc gcg att atc gcc gat gtc gac gag
cgt acc cgt aag acc ggc 432Gln Val Ala Ile Ile Ala Asp Val Asp Glu
Arg Thr Arg Lys Thr Gly 130 135 140 gaa gcc ttc gct gcc ggc ctc gct
cct gac tgt gcc atc acg gtc cac 480Glu Ala Phe Ala Ala Gly Leu Ala
Pro Asp Cys Ala Ile Thr Val His 145 150 155 160 acc cag gca gac acg
tcc agc ccc gat ccg ctg ttt aac cct ctc aag 528Thr Gln Ala Asp Thr
Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu Lys 165 170 175 act ggc gtc
tgc caa ctg gat aac gcc aac gtg acc gac gcc atc ctc 576Thr Gly Val
Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu 180 185 190 agc
agg gct gga ggt tcc atc gcc gac ttc acc ggc cat cgg cag acg 624Ser
Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln Thr 195 200
205 gcg ttc cgc gag ctg gag cgg gtc ctt aat ttt ccc cag tcg aac ctg
672Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn Leu
210 215 220 tgc ctc aag cgt gag aag cag gac gag agc tgt tcc ctg acc
cag gca 720Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr
Gln Ala 225 230 235 240 ctc ccg tcg gaa ctc aag gtg agc gcc gac aac
gtc tcc ctt acc ggt 768Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn
Val Ser Leu Thr Gly 245 250 255 gcc gtt agc ctc gct tcc atg ctg acg
gag atc ttc ctc ctg cag caa 816Ala Val Ser Leu Ala Ser Met Leu Thr
Glu Ile Phe Leu Leu Gln Gln 260 265 270 gcg cag gga atg ccc gag cct
ggg tgg ggc cgc att acc gat tct cac 864Ala Gln Gly Met Pro Glu Pro
Gly Trp Gly Arg Ile Thr Asp Ser His 275 280 285 cag tgg aac acc ctg
ctc tcg ctt cac aac gcc cag ttc tat ctg ctc 912Gln Trp Asn Thr Leu
Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu 290 295 300 caa cgc acg
ccc gag gtt gcc cgc agc cgc gcc acc ccg ctg ctc gac 960Gln Arg Thr
Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp 305 310 315 320
ctc atc aag act gcg ctg acg ccc cac cct ccg cag aag cag gct tac
1008Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala Tyr
325 330 335 ggt gtc acc ctc ccc act tcc gtc ctg ttt atc gcc ggt cac
gac acc 1056Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His
Asp Thr 340 345 350 aac ctg gcc aat ctc ggc ggc gct ctg gag ctc aac
tgg acg ctt ccc 1104Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn
Trp Thr Leu Pro 355 360 365 gga cag ccg gat aac act ccc cct ggc ggt
gag ctg gtg ttc gaa cgc 1152Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe Glu Arg 370 375 380 tgg cgt cgg ctc agc gac aac tcc
cag tgg att cag gtt tcg ctg gtc 1200Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser Leu Val 385 390 395 400 ttc cag acc ctg cag
cag atg cgc gac aaa acg ccc ctg tcc ctc aat 1248Phe Gln Thr Leu Gln
Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn 405 410 415 acc cct ccc
ggc gag gtc aag ctg acc ctg gca ggc tgt gaa gag cgc 1296Thr Pro Pro
Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg 420 425 430 aac
gcc cag ggc atg tgc tct ctc gct ggc ttt acg caa atc gtg aac 1344Asn
Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val Asn 435 440
445 gag gcc cgg atc ccc gct tgc tct ctg ttg agc ttc tgg tgg aac tac
1392Glu Ala Arg Ile Pro Ala Cys Ser Leu Leu Ser Phe Trp Trp Asn Tyr
450 455 460 aac acc acg acg gag ctg aac tac cgc tct agc cct att gcc
tgc cag 1440Asn Thr Thr Thr Glu Leu Asn Tyr Arg Ser Ser Pro Ile Ala
Cys Gln 465 470 475 480 gag ggt gat gct atg gac 1458Glu Gly Asp Ala
Met Asp 485 22486PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 22Phe Ser Tyr Gly Ala Ala Ile Pro
Gln Ser Thr Gln Glu Lys Gln Phe 1 5 10 15 Ser Gln Glu Phe Arg Asp
Gly Tyr Ser Ile Leu Lys His Tyr Gly Gly 20 25 30 Asn Gly Pro Tyr
Ser Glu Arg Val Ser Tyr Gly Ile Ala Arg Asp Pro 35 40 45 Pro Thr
Ser Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg His 50 55 60
Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val Thr 65
70 75 80 Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu
Thr Pro 85 90 95 Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr
Gln Arg Gln Arg 100 105 110 Leu Val Ala Asp Gly Leu Leu Ala Lys Lys
Gly Cys Pro Gln Ser Gly 115 120 125 Gln Val Ala Ile Ile Ala Asp Val
Asp Glu Arg Thr Arg Lys Thr Gly 130 135 140 Glu Ala Phe Ala Ala Gly
Leu Ala Pro Asp Cys Ala Ile Thr Val His 145 150 155 160 Thr Gln Ala
Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu Lys 165 170 175 Thr
Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu 180 185
190 Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln Thr
195 200 205 Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser
Asn Leu 210 215 220 Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser
Leu Thr Gln Ala 225 230 235 240 Leu Pro Ser Glu Leu Lys Val Ser Ala
Asp Asn Val Ser Leu Thr Gly 245 250 255 Ala Val Ser Leu Ala Ser Met
Leu Thr Glu Ile Phe Leu Leu Gln Gln 260 265 270 Ala Gln Gly Met Pro
Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser His 275 280 285 Gln Trp Asn
Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu 290 295 300 Gln
Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp 305 310
315 320 Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
Tyr 325 330 335 Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly
His Asp Thr 340 345 350 Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu
Asn Trp Thr Leu Pro 355 360 365 Gly Gln Pro Asp Asn Thr Pro Pro Gly
Gly Glu Leu Val Phe Glu Arg 370 375 380 Trp Arg Arg Leu Ser Asp Asn
Ser Gln Trp Ile Gln Val Ser Leu Val 385 390 395 400 Phe Gln Thr Leu
Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn 405 410 415 Thr Pro
Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg 420 425 430
Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val Asn 435
440 445 Glu Ala Arg Ile Pro Ala Cys Ser Leu Leu Ser Phe Trp Trp Asn
Tyr 450 455 460 Asn Thr Thr Thr Glu Leu Asn Tyr Arg Ser Ser Pro Ile
Ala Cys Gln 465 470 475 480 Glu Gly Asp Ala Met Asp 485
237PRTEscherichia coli 23Glu Leu Lys Val Ser Ala Asp 1 5
247PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 24Glu Leu Lys Tyr Ser Ala Asp 1 5
258PRTEscherichia coli 25Asp Asn Ala Asn Val Thr Asp Ala 1 5
268PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 26Asp Asn Ala Arg Val Thr Glu Ala 1 5
278PRTEscherichia coli 27Asp Asn Ala Asn Val Thr Asp Ala 1 5
288PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 28Asp Asn Ala Arg Val Thr Glu Ala 1 5
297PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 29Glu Leu Lys Pro Ser Ala Asp 1 5
306PRTEscherichia coli 30Leu Leu Ala Lys Lys Gly 1 5
316PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 31Leu Leu Ala Asp Lys Gly 1 5 327PRTEscherichia
coli 32Asp Ala Ile Leu Ser Arg Ala 1 5 337PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 33Asp
Ala Ile Ile Ser Arg Ala 1 5 347PRTEscherichia coli 34Pro Ser Glu
Leu Lys Val Ser 1 5 357PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 35Pro Ser Glu Ile Lys Val Ser
1 5 367PRTEscherichia coli 36Asn Ala Asn Val Thr Asp Ala 1 5
378PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 37Asp Asn Ala Arg Val Thr Glu Ala 1 5
387PRTEscherichia coli 38Asn Ala Asn Val Thr Asp Ala 1 5
3951PRTAspergillus niger 39Phe Ser Tyr Gly Ala Ala Ile Pro Gln Ser
Thr Gln Glu Lys Gln Phe 1 5 10 15 Ser Gln Glu Phe Arg Asp Gly Tyr
Ser Ile Leu Lys His Tyr Gly Gly 20 25 30 Asn Gly Pro Tyr Ser Glu
Arg Val Ser Tyr Gly Ile Ala Arg Asp Pro 35 40 45 Pro Thr Ser 50
404PRTEscherichia coli 40Gln Ser Glu Pro 1 4140PRTAspergillus niger
41Ser Cys Asp Thr Val Asp Gln Gly Tyr Gln Cys Phe Ser Glu Thr Ser 1
5 10 15 His Leu Trp Gly Gln Tyr Ala Pro Phe Phe Ser Leu Ala Asn Glu
Ser 20 25 30 Val Ile Ser Pro Glu Val Pro Ala 35 40
4229PRTAspergillus niger 42Leu Ser Phe Trp Trp Asn Tyr Asn Thr Thr
Thr Glu Leu Asn Tyr Arg 1 5 10 15 Ser Ser Pro Ile Ala Cys Gln Glu
Gly Asp Ala Met Asp 20 25 436PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 43Arg Thr Leu Val Lys Arg 1 5
4418PRTAspergillus niger 44Met Gly Val Ser Ala Ile Leu Leu Pro Leu
Tyr Leu Leu Ser Gly Val 1 5 10 15 Thr Ser 4519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 45ccgcggactg cgcatcatg 194619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 46ccgcggacta ggcatcatg 194728DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 47ccgcggacta gtccttaatt aaccgcgg
284818PRTAspergillus niger 48Met Gly Val Ser Ala Val Leu Leu Pro
Leu Tyr Leu Leu Ser Gly Val 1 5 10 15 Thr Ser 49410PRTEscherichia
coli 49Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser
Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met
Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys
Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr
Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu
Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile
Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala
Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His
Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120
125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile
130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His
Arg Gln 145 150 155
160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu
Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn
Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr
Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro
Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr
Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg
Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp
Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280
285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp
Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly
Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser
Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln
Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly
Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala
Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 50410PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
50Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1
5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp
Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly
Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly
His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala
Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala
Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln
Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys
Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135
140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Tyr Ser
Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser
Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met
Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260
265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln
Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala
Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu
Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr
Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr
Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385
390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
51410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 51Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val
Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala
Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr
Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu
Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val
Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly
Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90
95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Arg Val
Thr Glu Ala Ile 130 135 140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp
Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu
Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg
Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro
Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly
Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215
220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln
Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg
Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro
His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr
Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn
Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly
Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340
345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser
Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly
Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly
Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys
Ser Leu 405 410 52410PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 52Gln Ser Glu Pro Glu Leu
Lys Leu Glu Ser Val Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg
Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro
Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50
55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln
Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr
Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp
Cys Ala Ile Thr Val 100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro
Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu
Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135 140 Leu Ser Arg Ala Gly
Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala
Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180
185 190 Ala Leu Pro Ser Glu Leu Lys Pro Ser Ala Asp Asn Val Ser Leu
Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe
Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly
Arg Ile Thr Asp Ser 225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser
Leu His Asn Ala Gln Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu
Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys
Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly
Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305
310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val
Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile
Gln Val Ser Leu 340 345 350 Val Phe Gln Thr Leu Gln Gln Met Arg Asp
Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu Val Lys
Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln Gly Met
Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn Glu Ala
Arg Ile Pro Ala Cys Ser Leu 405 410 53410PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
53Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1
5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp
Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly
Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly
His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala
Asp Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala
Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln
Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys
Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile 130 135
140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Val Ser
Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser
Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met
Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260
265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln
Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala
Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu
Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr
Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr
Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385
390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
54410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 54Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val
Val Ile Val Ser Arg 1 5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala
Thr Gln Leu Met Gln Asp Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr
Trp Pro Val Lys Leu Gly Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu
Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln 50 55 60 Arg Leu Val
Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly
Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90
95 Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110 His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu 115 120 125 Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val
Thr Asp Ala Ile 130 135 140 Ile Ser Arg Ala Gly Gly Ser Ile Ala Asp
Phe Thr Gly His Arg Gln 145 150 155 160 Thr Ala Phe Arg Glu Leu Glu
Arg Val Leu Asn Phe Pro Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg
Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro
Ser Glu Ile Lys Val Ser Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly
Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215
220 Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240 His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln
Phe Tyr Leu 245 250 255 Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg
Ala Thr Pro Leu Leu 260 265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro
His Pro Pro Gln Lys Gln Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr
Ser Val Leu Phe Ile Ala Gly His Asp 290 295 300 Thr Asn Leu Ala Asn
Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly
Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu 325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340
345 350 Val Phe Gln Thr Leu Gln Gln Met
Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr Pro Pro Gly Glu
Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380 Arg Asn Ala Gln
Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385 390 395 400 Asn
Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410 55410PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
55Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg 1
5 10 15 His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp
Val 20 25 30 Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly
Trp Leu Thr 35 40 45 Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly
His Tyr Gln Arg Gln 50 55 60 Arg Leu Val Ala Asp Gly Leu Leu Ala
Asp Lys Gly Cys Pro Gln Ser 65 70 75 80 Gly Gln Val Ala Ile Ile Ala
Asp Val Asp Glu Arg Thr Arg Lys Thr 85 90 95 Gly Glu Ala Phe Ala
Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val 100 105 110 His Thr Gln
Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu 115 120 125 Lys
Thr Gly Val Cys Gln Leu Asp Asn Ala Arg Val Thr Glu Ala Ile 130 135
140 Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160 Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro
Gln Ser Asn 165 170 175 Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser
Cys Ser Leu Thr Gln 180 185 190 Ala Leu Pro Ser Glu Leu Lys Pro Ser
Ala Asp Asn Val Ser Leu Thr 195 200 205 Gly Ala Val Ser Leu Ala Ser
Met Leu Thr Glu Ile Phe Leu Leu Gln 210 215 220 Gln Ala Gln Gly Met
Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser 225 230 235 240 His Gln
Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu 245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu 260
265 270 Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln
Ala 275 280 285 Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala
Gly His Asp 290 295 300 Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu
Leu Asn Trp Thr Leu 305 310 315 320 Pro Gly Gln Pro Asp Asn Thr Pro
Pro Gly Gly Glu Leu Val Phe Glu 325 330 335 Arg Trp Arg Arg Leu Ser
Asp Asn Ser Gln Trp Ile Gln Val Ser Leu 340 345 350 Val Phe Gln Thr
Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu 355 360 365 Asn Thr
Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu 370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val 385
390 395 400 Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu 405 410
56457PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 56Phe Ser Tyr Gly Ala Ala Ile Pro Gln Ser Thr
Gln Glu Lys Gln Phe 1 5 10 15 Ser Gln Glu Phe Arg Asp Gly Tyr Ser
Ile Leu Lys His Tyr Gly Gly 20 25 30 Asn Gly Pro Tyr Ser Glu Arg
Val Ser Tyr Gly Ile Ala Arg Asp Pro 35 40 45 Pro Thr Ser Glu Leu
Lys Leu Glu Ser Val Val Ile Val Ser Arg His 50 55 60 Gly Val Arg
Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val Thr 65 70 75 80 Pro
Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr Pro 85 90
95 Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln Arg
100 105 110 Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln
Ser Gly 115 120 125 Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr
Arg Lys Thr Gly 130 135 140 Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp
Cys Ala Ile Thr Val His 145 150 155 160 Thr Gln Ala Asp Thr Ser Ser
Pro Asp Pro Leu Phe Asn Pro Leu Lys 165 170 175 Thr Gly Val Cys Gln
Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu 180 185 190 Ser Arg Ala
Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln Thr 195 200 205 Ala
Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn Leu 210 215
220 Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln Ala
225 230 235 240 Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser
Leu Thr Gly 245 250 255 Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile
Phe Leu Leu Gln Gln 260 265 270 Ala Gln Gly Met Pro Glu Pro Gly Trp
Gly Arg Ile Thr Asp Ser His 275 280 285 Gln Trp Asn Thr Leu Leu Ser
Leu His Asn Ala Gln Phe Tyr Leu Leu 290 295 300 Gln Arg Thr Pro Glu
Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp 305 310 315 320 Leu Ile
Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala Tyr 325 330 335
Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp Thr 340
345 350 Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
Pro 355 360 365 Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val
Phe Glu Arg 370 375 380 Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile
Gln Val Ser Leu Val 385 390 395 400 Phe Gln Thr Leu Gln Gln Met Arg
Asp Lys Thr Pro Leu Ser Leu Asn 405 410 415 Thr Pro Pro Gly Glu Val
Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg 420 425 430 Asn Ala Gln Gly
Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val Asn 435 440 445 Glu Ala
Arg Ile Pro Ala Cys Ser Leu 450 455 57486PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
57Phe Ser Tyr Gly Ala Ala Ile Pro Gln Ser Thr Gln Glu Lys Gln Phe 1
5 10 15 Ser Gln Glu Phe Arg Asp Gly Tyr Ser Ile Leu Lys His Tyr Gly
Gly 20 25 30 Asn Gly Pro Tyr Ser Glu Arg Val Ser Tyr Gly Ile Ala
Arg Asp Pro 35 40 45 Pro Thr Ser Glu Leu Lys Leu Glu Ser Val Val
Ile Val Ser Arg His 50 55 60 Gly Val Arg Ala Pro Thr Lys Ala Thr
Gln Leu Met Gln Asp Val Thr 65 70 75 80 Pro Asp Ala Trp Pro Thr Trp
Pro Val Lys Leu Gly Trp Leu Thr Pro 85 90 95 Arg Gly Gly Glu Leu
Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln Arg 100 105 110 Leu Val Ala
Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser Gly 115 120 125 Gln
Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr Gly 130 135
140 Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val His
145 150 155 160 Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn
Pro Leu Lys 165 170 175 Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val
Thr Asp Ala Ile Leu 180 185 190 Ser Arg Ala Gly Gly Ser Ile Ala Asp
Phe Thr Gly His Arg Gln Thr 195 200 205 Ala Phe Arg Glu Leu Glu Arg
Val Leu Asn Phe Pro Gln Ser Asn Leu 210 215 220 Cys Leu Lys Arg Glu
Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln Ala 225 230 235 240 Leu Pro
Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr Gly 245 250 255
Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln Gln 260
265 270 Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
His 275 280 285 Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe
Tyr Leu Leu 290 295 300 Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala
Thr Pro Leu Leu Asp 305 310 315 320 Leu Ile Lys Thr Ala Leu Thr Pro
His Pro Pro Gln Lys Gln Ala Tyr 325 330 335 Gly Val Thr Leu Pro Thr
Ser Val Leu Phe Ile Ala Gly His Asp Thr 340 345 350 Asn Leu Ala Asn
Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu Pro 355 360 365 Gly Gln
Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu Arg 370 375 380
Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu Val 385
390 395 400 Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser
Leu Asn 405 410 415 Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly
Cys Glu Glu Arg 420 425 430 Asn Ala Gln Gly Met Cys Ser Leu Ala Gly
Phe Thr Gln Ile Val Asn 435 440 445 Glu Ala Arg Ile Pro Ala Cys Ser
Leu Leu Ser Phe Trp Trp Asn Tyr 450 455 460 Asn Thr Thr Thr Glu Leu
Asn Tyr Arg Ser Ser Pro Ile Ala Cys Gln 465 470 475 480 Glu Gly Asp
Ala Met Asp 485
* * * * *
References