U.S. patent application number 14/181594 was filed with the patent office on 2014-08-21 for immunoglobulin fc polypeptides.
This patent application is currently assigned to RESEARCH DEVELOPMENT FOUNDATION. The applicant listed for this patent is RESEARCH DEVELOPMENT FOUNDATION. Invention is credited to George GEORGIOU, Sang Taek JUNG, Sai REDDY.
Application Number | 20140235482 14/181594 |
Document ID | / |
Family ID | 43381018 |
Filed Date | 2014-08-21 |
United States Patent
Application |
20140235482 |
Kind Code |
A1 |
GEORGIOU; George ; et
al. |
August 21, 2014 |
IMMUNOGLOBULIN FC POLYPEPTIDES
Abstract
Methods and compositions involving polypeptides having an
aglycosylated antibody Fc domain. In certain embodiments,
polypeptides have an aglycosylated Fc domain that contains one or
more substitutions compared to a native Fc domain. Additionally,
some embodiments involve an Fc domain that is binds some Fc
receptors but not others. For example, polypeptides are provided
with an aglycosylated Fc domain that selectively binds Fc.gamma.RI
at a level within 2-fold of a glycosylated Fc domain, but that is
significantly reduced for binding to other Fc receptors.
Furthermore, methods and compositions are provided for promoting
antibody-dependent cell-mediated toxicity (ADCC) using a
polypeptide having a modified aglycosylated Fc domain and a second
non-Fc binding domain, which can be an antigen binding region of an
antibody or a non-antigen binding region. Some embodiments concern
antibodies with such polypeptides, which may have the same or
different non-Fc binding domain.
Inventors: |
GEORGIOU; George; (Austin,
TX) ; JUNG; Sang Taek; (Seoul, KR) ; REDDY;
Sai; (Austin, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RESEARCH DEVELOPMENT FOUNDATION |
Carson City |
NV |
US |
|
|
Assignee: |
RESEARCH DEVELOPMENT
FOUNDATION
Carson City
NV
|
Family ID: |
43381018 |
Appl. No.: |
14/181594 |
Filed: |
February 14, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12827386 |
Jun 30, 2010 |
8679493 |
|
|
14181594 |
|
|
|
|
61221999 |
Jun 30, 2009 |
|
|
|
Current U.S.
Class: |
506/9 |
Current CPC
Class: |
C07K 2317/732 20130101;
G01N 33/56911 20130101; C07K 16/005 20130101; C07K 2317/41
20130101; C07K 16/32 20130101; C07K 2317/72 20130101; C07K 2317/75
20130101; A61P 37/04 20180101; G01N 33/6857 20130101; C07K 16/00
20130101; C07K 2317/24 20130101; G01N 2500/10 20130101; C07K
2317/76 20130101 |
Class at
Publication: |
506/9 |
International
Class: |
G01N 33/569 20060101
G01N033/569 |
Claims
1.-67. (canceled)
68. A method for screening for an aglycosylated polypeptide having
an Fc domain that binds a specific Fc.gamma.R polypeptides
comprising: a) obtaining a population of Gram negative bacterial
cells, cells of which population express a aglycosylated
polypeptide comprising an Fc domain in their periplasm, wherein the
population expresses a plurality of different Fc domains; b)
contacting the bacterial cells with a first FcR polypeptide under
conditions to allow contact between the Fc.gamma.R polypeptide and
the aglycosylated Fc domains, wherein the Fc.gamma.R polypeptide is
Fc.gamma.RIa, Fc.gamma.RIIa, Fc.gamma.RIIb, Fc.gamma.RIIc,
Fc.gamma.RIIIa, Fc.gamma.RIIIb, or Fc.alpha.RI; c) selecting at
least one bacterial cell based on binding of the aglycosylated Fc
domain to the first FcR polypeptide.
69. The method of claim 68, further comprising identifying or
isolating the aglycosylated polypeptide from the selected bacterial
cell.
70. The method of claim 68, further comprising determining whether
an aglycosylated polypeptide in selected bacterial cells can bind
to other FcR polypeptides.
71. The method of claim 70, wherein determining whether an
aglycosylated polypeptide in selected bacterial cells can bind to
other FcR polypeptides comprises repeating steps a)-c) with a
second FcR polypeptide to determine whether the aglycosylated
polypeptide also binds the second FcR polypeptide.
72. The method of claim 71, wherein the steps a)-c) are repeated
with more than two different FcR polypeptides.
73. The method of claim 72, wherein the aglycosylated polypeptide
binds multiple FcR polypeptides.
74. The method of claim 68, wherein the bacterial cells are E. coli
cells.
75. The method of claim 68, wherein the Fc domain is an IgG, IgA or
IgE Fc domain.
76. The method of claim 75, wherein the IgG Fc domain is an IgG1 Fc
domain.
77. The method of claim 76, wherein the IgG1 Fc domain is the Fc
domain of an anti-HER2 antibody.
78. The method of claim 77, wherein the IgG1 Fc domain is the Fc
domain of the Fc domain of trastuzumab.
79. The method of claim 68, wherein the population of Gram negative
bacterial cells comprise a plurality of nucleic acids encoding said
plurality of aglycosylated Fc domains.
80. The method of claim 79, wherein the plurality of nucleic acids
further encodes a membrane secretion signal fused to said plurality
of aglycosylated Fc domains.
81. The method of claim 80, wherein the membrane secretion signal
is PelB.
82. The method of claim 80, wherein the membrane secretion signal
is DsbA.
83. The method of claim 68, wherein the aglycosylated Fc domain
comprises a hinge, CH2 and CH3 region.
84. The method of claim 68, wherein the aglycosylated polypeptide
comprises an eukaryotic Fc domain.
85. The method of claim 68, wherein the aglycosylated polypeptide
comprises a synthetic Fc domain.
86. The method of claim 84, wherein the FcR polypeptide comprises
an antibody-binding domain from one of the polypeptides of Table
1.
87. The method of claim 86, wherein the FcR polypeptide comprises
an antibody-binding domain from human Fc.gamma.RIa, Fc.gamma.RIIa,
Fc.gamma.RIIb, Fc.gamma.RIIc, Fc.gamma.RIIIa, Fc.gamma.RIIIb,
Fc.alpha.RI or C1q.
88. The method of claim 87, wherein the FcR polypeptide comprises
an antibody-binding domain from human Fc.gamma.RIa.
89. The method of claim 68, wherein the FcR polypeptide is
labeled.
90. The method of claim 89, wherein the FcR polypeptide is labeled
with a fluorophore, a radioisotope or an enzyme.
91. The method of claim 90, wherein the FcR polypeptide is labeled
with a fluorophore.
92. The method of claim 89, wherein the FcR polypeptide is fused to
a fluorescence protein or an enzyme.
93. The method of claim 92, wherein the FcR polypeptide is fused to
a green fluorescence protein GFP.
94. The method of claim 68, wherein the FcR polypeptide is
immobilized.
95. The method of claim 68, wherein the selecting of step (c) is
further defined as comprising at least two rounds of selection
wherein the sub-population of bacterial cells obtained in the first
round of selection is subjected to at least a second round of
selection based on the binding of the Fc polypeptide to FcR
polypeptide.
96. The method of claim 95, comprising two to ten rounds of
selection.
97. The method of claim 96, wherein the selecting is carried out by
FACS or magnetic separation.
98. The method of claim 68, further comprising contacting the
bacterial cells with at least two FcR polypeptides.
99. The method of claim 98, wherein the at least two FcR
polypeptides comprise distinct labels.
100. The method of claim 99, further comprising selecting bacterial
cells based on binding of the aglycosylated Fc domain to the at
least two FcR polypeptides.
101. The method of claim 99, further comprising selecting bacterial
cells based on binding of the aglycosylated Fc domain to at least
one FcR polypeptide and based on the aglycosylated Fc domain not
binding to at least one other FcR polypeptide.
102. The method of claim 68, further comprising disrupting the
outer membrane of the bacterial cells before contacting the
bacterial cells with an FcR polypeptide.
103. The method of claim 102, wherein disrupting the outer membrane
of the bacterial cell comprises treatment with hyperosmotic
conditions, treatment with physical stress, infecting the bacterium
with a phage, treatment with lysozyme, treatment with EDTA,
treatment with a digestive enzyme or treatment with a chemical that
disrupts the outer membrane.
104. The method of claim 103, wherein disrupting the outer membrane
of the bacterial cell comprises a combination of said methods.
105. The method of claim 102, wherein disrupting the outer membrane
of the bacterial cell comprises heating the bacterial cell with a
combination of physical, chemical and enzyme disruption of the
outer membrane.
106. The method of claim 102, wherein disrupting the outer membrane
of the bacterial cell further comprises removing the outer membrane
of said bacterium.
107. The method of claim 68, further comprising removing FcR
polypeptide not bound to the aglycosylated Fc domain.
108. The method of claim 68, wherein the bacteria are grown in a
media comprising sucrose, sorbitol, mannitol or trehalose.
109. The method of claim 68, wherein the bacteria are grown in a
media comprising trehalose.
110. The method of claim 68, further defined as a method of
producing a nucleic acid sequence encoding an antibody Fc
polypeptide having a specific affinity for an FcR polypeptide and
further comprising the step of cloning a nucleic acid sequence
encoding the Fc polypeptide from the bacterial cell to produce a
nucleic acid sequence encoding an antibody Fc polypeptide having a
specific affinity for an FcR polypeptide.
111. The method of claim 110, wherein cloning comprises
amplification of the nucleic acid sequence.
112. The method of claim 110, further defined as a method of
producing an antibody Fc polypeptide having a specific affinity for
an FcR polypeptide further comprising the step of expressing a
nucleic acid sequence encoding the antibody Fc polypeptide to
produce an antibody Fc polypeptide having a specific affinity for
an FcR polypeptide.
113. The method of claim 112, wherein the FcR polypeptide is an
Fc.gamma.RI polypeptide.
114. The method of claim 68, wherein the plurality of different Fc
domains are mutant variations of one Fc domain.
115. The method of claim 114, wherein the mutant variations were
generated randomly.
116. (canceled)
Description
[0001] This application is a divisional of U.S. application Ser.
No. 12/827,386, filed Jun. 30, 2010, which claims the priority
benefit of U.S. Provisional Application No. 61/221,999, filed Jun.
30, 2009. The entire text of each of the above referenced
disclosures is specifically incorporated herein by reference.
Furthermore, the entire disclosures of U.S. Application No.
60/915,183 filed on May 1, 2007 and U.S. Application No. 60/982,
652 filed on Oct. 25, 2007, are specifically incorporated herein by
reference in their entirety without disclaimer.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the field of
protein engineering. More particularly, it concerns improved
methods and compositions for the screening of combinatorial
antibody Fc libraries expressed in bacteria.
[0004] 2. Description of Related Art
[0005] Currently recombinant therapeutic antibodies have sales of
well over $10 bn/yr and with a forecast of annual growth rate of
20.9%, they are projected to increase to $25 bn/yr by 2010.
Monoclonal antibodies (mAbs) comprise the majority of recombinant
proteins currently in the clinic, with more than 150 products in
studies sponsored by companies located worldwide (Pavlou and
Belsey, 2005). In terms of therapeutic focus, the mAb market is
heavily focused on oncology and arthritis, immune and inflammatory
disorders, and products within these therapeutic areas are set to
continue to be the key growth drivers over the forecast period. As
a group, genetically engineered mAbs generally have higher
probability of FDA approval success than small-molecule drugs. At
least 50 biotechnology companies and all the major pharmaceutical
companies have active antibody discovery programs in place.
[0006] The original method for isolation and production of mAbs was
first reported at 1975 by Milstein and Kohler (Kohler and Milstein,
1975), and it involved the fusion of mouse lymphocyte and myeloma
cells, yielding mouse hybridomas. Therapeutic murine mAbs entered
clinical study in the early 1980s; however, problems with lack of
efficacy and rapid clearance due to patients' production of human
anti-mouse antibodies (HAMA) became apparent. These issues, as well
as the time and cost consuming related to the technology became
driving forces for the evolution of mAb production technology.
Polymerase Chain Reaction (PCR) facilitated the cloning of
monoclonal antibodies genes directly from lymphocytes of immunized
animals and the expression of combinatorial library of fragments
antibodies in bacteria (Orlandi et al., 1989). Later libraries were
created entirely by in vitro cloning techniques using naive genes
with rearranged complementarity determining region 3 (CDR3)
(Griffiths and Duncan, 1998; Hoogenboom et al., 1998). As a result,
the isolation of antibody fragments with the desired specificity
was no longer dependent on the immunogenicity of the corresponding
antigen. Moreover, the range of antigen specificities in synthetic
combinatorial libraries was greater than that found in a panel of
hybridomas generated from an immunized mouse. These advantages have
facilitated the development of antibody fragments to a number of
unique antigens including small molecular compounds (haptens)
(Hoogenboom and Winter, 1992), molecular complexes (Chames et al.,
2000), unstable compounds (Kjaer et al., 1998) and cell surface
proteins (Desai et al., 1998).
[0007] In microbial cells, display screening may be carried out by
flow cytometry. In particular, Anchored Periplasmic Expression
(APEx) is based on anchoring the antibody fragment on the
periplasmic face of the inner membrane of E. coli followed by
disruption of the outer membrane, incubation with fluorescently
labeled target and sorting of the spheroplasts (U.S. Pat. No.
7,094,571). APEx was used for the affinity maturation of antibody
fragments (Harvey et al., 2004; Harvey et al., 2006). In one study
over 200-fold affinity improvement was obtained after only two
rounds of screening.
[0008] One important mechanism underlying the potency of antibody
therapeutics is the ability of antibody to recruit immune cells to
a target antigen (or cell). Thus, the Fc region of an antibody is
crucial for recruitment of immunological cells and antibody
dependent cytotoxicity (ADCC). In particular, the nature of the
ADCC response elicited by antibodies depends on the interaction of
the Fc region with receptors (FcRs) located on the surface of many
cell types. Humans contain five different classes of Fc receptors.
In addition haplotypes, or genetic variants of different FcRs
belonging to a particular class are known. The binding of an
antibody to FcRs determines its ability to recruit other
immunological cells and the type of cell recruited. Hence, the
ability to engineer antibodies that can recruit only certain kinds
of cells can be critically important for therapy.
[0009] However, to the inventors' knowledge, previous attempts to
engineer Fc domains have been performed using mammalian-expressed
IgG molecules. Mammalian antibodies are glycosylated. The
carbohydrate chain is attached to the Fc region and alters the
conformation of the protein and enables the antibody to bind to
FcRs. In contrast, aglycosylated antibodies produced in bacteria
cannot bind to FcRs and therefore are unable to elicit ADCC. It is
desirable to engineer aglycosylated antibodies that are capable of
eliciting ADCC and thus benefit from the lower production costs
that are derived from bacterial expression.
[0010] Second, and most importantly, mammalian antibodies with
engineered Fc regions display increased binding to a particular FcR
of interest but in addition they are still capable of binding to
other FcRs with normal affinity. Thus, while such antibodies are
more selective than the molecules naturally produced by the immune
system they can nonetheless still mediate undesirable immunological
responses.
[0011] Nonetheless, all high throughput antibody screening
technologies available to-date rely on microbial expression of
antibody fragments. The use of antibody fragments rather than
intact or full length IgGs, in the construction and screening of
libraries has been dictated by limitations related to the
expression of the much larger IgGs in microorganisms. IgG libraries
have never before been expressed or screened using microorganisms
such as bacteria or yeasts. As a result the isolation of antigen
binding proteins has been carried out exclusively using antibody
fragments that are smaller and much easier to produce. Once
isolated, such antibody fragments have to then be fused to vectors
that express full length immunoglobulins which in turn are
expressed preferentially in mammalian cells such as CHO cells.
[0012] E. coli possesses a reducing cytoplasm that is unsuitable
for the folding of proteins with disulfide bonds which accumulate
in an unfolded or incorrectly folded state (Baneyx and Mujacic,
2004). In contrast to the cytoplasm, the periplasm of E. coli is
maintained in an oxidized state that allows the formation of
protein disulfide bonds. Notably, periplasmic expression has been
employed successfully for the expression of antibody fragments such
as Fvs, scFvs, Fabs or F(ab')2s (Kipriyanov and Little, 1999).
These fragments can be made relatively quickly in large quantities
with the retention of antigen binding activity. However, because
antibody fragments lack the Fc domain, they do not bind the FcRn
receptor and are cleared quickly; thus, they are only occasionally
suitable as therapeutic proteins (Knight et al., 1995). Until
recently, full-length antibodies could only be expressed in E. coli
as insoluble aggregates and then refolded in vitro (Boss et al.,
1984; Cabilly et al., 1984). Clearly this approach is not amenable
to the high throughput screening of antibody libraries since with
the current technology it is not possible to refold millions or
tens of millions of antibodies individually. A further problem is
that since E. coli expressed antibodies are not glycosylated, they
fail to bind to complement factor 1q (C1q) or Fc and many other Fc
receptors. However, aglycosylated Fc domains can bind to the
neonatal Fc receptor efficiently (FcRn). Consequently bacterially
expressed aglycosylated antibodies do exhibit serum persistence and
pharmacokinetics similar to those of fully glycosylated IgGs
produced in human cells. Nonetheless, since the aglycosylated
antibodies fail to elicit complement activation and can not mediate
the recruitment of immune cells such as macrophages, they have
previously been ineffective for many therapeutic applications.
[0013] Moreover, some studies have reported that binding of some Fc
receptors by Fc domains can have an activating effect while others
have an inhibitory one (Boruchov et al. 2005; Kalergis et al.,
2002). Different Fc.gamma.R effector functions include
(antibody-dependent cell-mediated cytotoxicity (ADCC), cytokine
release, phagocytosis, and maturation. Fc domains engineered to
have selective effector functions could provide physiological
benefits.
SUMMARY OF THE INVENTION
[0014] This disclosure provides compounds and methods involving
aglycosylated antibody Fc domains that bind to Fc receptors.
[0015] In some embodiments, there are compositions involving a
polypeptide that has an aglycosylated Fc domain from an antibody
("antibody Fc domain"). In additional embodiments, the
aglycosylated Fc domain is a variant of a wild-type Fc domain such
that the variation allows the Fc domain to specifically bind to one
or more Fc receptors. In some embodiments, a polypeptide with an
aglycosylated Fc domain variant is able to bind only a subset of Fc
receptors that a polypeptide with glycosylated version of the
wild-type Fc domain ("glycosylated wild-type Fc domain") can bind.
In specific embodiments, the polypeptide with an aglycosylated Fc
domain variant can specifically bind Fc.gamma.RI; in some cases, it
has the affinity or binding ability that is within 2-fold of a
polypeptide having a glycosylated wild-type Fc domain. In other
embodiments, additionally or alternatively, the polypeptide with an
aglycosylated Fc domain variant has significantly reduced affinity
or binding ability (50-fold or greater reduction) compared to a
polypeptide having a glycosylated wild-type Fc domain. In certain
embodiments, the polypeptide with an aglycosylated Fc domain
variant has a significantly reduced affinity to or ability to bind
Fc.gamma.RIIb. It is contemplated that a polypeptide may have an
affinity or binding ability for Fc.gamma.RI that is comparable
(within 2-fold), as well as significantly reduced affinity or
binding ability for Fc.gamma.RIIB, both as compared to a
polypeptide having a glycosylated wild-type Fc domain.
[0016] As used herein, the term "affinity" refers to the
equilibrium constant for the reversible binding of two agents and
is expressed as Kd. Affinity of a binding domain to its target can
be, for example, from about 100 nanomolar (nM) to about 0.1 nM,
from about 100 nM to about 1 picomolar (pM), or from about 100 nM
to about 1 femtomolar (fM); alternatively, it can be between 100 nM
and 1 nM or between 0.1 nM and 10 nM. Moreover, it is contemplated
that agents specifically bind when there is an affinity between the
two agents that is in the affinity ranges discussed above.
[0017] An antibody Fc domain may be the Fc domain of an IgA, IgM,
IgE, IgD or IgG antibody or a variant thereof. In certain
embodiments, the domain is an IgG antibody Fc domain such as an
IgG1, IgG2a, IgG2b, IgG3 or IgG4 antibody Fc domain. Furthermore,
the antibody Fc domain may be defined as a human Fc domain, in
which case it specifically binds one or more human Fc receptors. In
certain aspects, the Fc domain may be an IgG1 Fc domain, such as
the Fc domain of an anti-HER2 antibody, more specifically, the Fc
domain of trastuzumab. It is contemplated that in some embodiments
an entire polypeptide is aglycosylated or that in other embodiments
only a portion of the polypeptide is aglycosylated, such as the Fc
domain. It is also contemplated that a polypeptide may contain one
or more regions from an antibody in addition to the Fc domain. A
polypeptide may contain an antigen binding domain from an antibody.
Moreover, multiple polypeptides may form an antibody or
antibody-like protein.
[0018] In some embodiments, there is a polypeptide comprising an
aglycosylated antibody Fc domain capable of binding a human FcR
polypeptide, wherein the Fc domain comprises particular amino acid
substitutions. In some embodiments there are multiple amino acid
substitutions. In additional embodiments, there are up to eight
amino acid substitutions relative to the wild-type Fc domain
sequence. With substitutions in the human Fc domain, embodiments
include a polypeptide with a human Fc domain having an amino acid
substitution at amino acids 382 and 428 and at least one additional
substitution of any of the following amino acids: 224, 241, 251,
266, 269, 276, 279, 286, 295, 297, 300, 315, 325, 328, 330, 331,
332, 338, 340, 341, 348, 369, 378, 382, 392, 424, 426, 428 and/or
434. In some cases, it is specifically contemplated that the amino
acid at 329 of the human Fc domain is the wild-type sequence, that
is, a proline. In some embodiments a polypeptide has a human Fc
domain substitution at amino acid 382 that is a valine (V) instead
of glutamic acid (E) (E382V). Conventional single letter
abbreviations for amino acids are employed herein. In additional
embodiments, the polypeptide has a human Fc domain substitution at
amino acid 428 that is an isoleucine (M428I). In some cases, a
polypeptide has both the substitution at amino acid 382 that is a
valine (E382V) and the substitution at amino acid 428 that is an
isoleucine (M428I) in the human Fc domain. In some embodiments, a
polypeptide has a substitution in the human Fc domain at amino acid
328 that is a tryptophan (L328W). In additional embodiments, a
polypeptide has a human Fc domain substitution at amino acid 332
that is a tyrosine (I332Y). Other polypeptides include those having
a human Fc domain substitution at least at amino acids 328 and 332.
The substitution at amino acid 328 may be a tryptophan (L328W) and
the substitution at amino acid 332 may be a tyrosine (I332Y). In
additional embodiments, a polypeptide has a human Fc domain
substitution at amino acid 341, which is a valine (G341V) in
further embodiments. More embodiments involve a polypeptide with a
human Fc domain substitution at 382 and 428 and at least one
additional substitution in the domain in the following group:
H224R/Y, F241L, K251F, V266M, E269K, N276D, V279M, N286D, Q295R,
N297D, Y300C, N315D, N325S, L328W, A330V/E/I, P331A/S/E, I332Y,
K338I/R, K340N/Q, G341V, V348M, V369A, A378D, K392E, S424L, S4261I,
or N434S/D. Multiple additional substitutions are contemplated in
some embodiments.
[0019] In some embodiments, a polypeptide has an aglycosylated
human Fc domain with a substitution in amino acids 382 and 428 and
also has at least one additional substitution in the upper CH2
region. Some embodiments involve a polypeptide having at least one
additional human Fc domain substitution that is of an amino acid in
the following part of the upper CH2 region: 234L-2395; 264V-268H;
297N-299T; or 328L-3321.
[0020] In further embodiments, a polypeptide does not have the
additional substitution in the human Fc domain of G341V and/or
K338R. In other cases, however, the Fc domain may have a
substitution of G341V and at least one other substitution selected
from the group consisting of: H224Y, F241L, E269K, N276D, N286D,
Y300C, N325S, K338R, V348M, V369A, K392E, S424L, and N434D/S. In
some embodiments, the Fc domain has multiple other substitution
selected from the group. A polypeptide may have an Fc domain
substitution that includes a K338R substitution.
[0021] In some embodiments there are polypeptides with a human Fc
domain that has a set of substitutions selected from the group
consisting of a) K338R and G341V; b) N297D, N315D, and K340N, c)
K340N, d) K338I and K340N, e) K340Q and A378D; f) N325S and K340N,
g) H224Y, E269K, N325S, and G341V, h)G341V and K392E, i) K338R,
G341V, S424L and N434D, j) F241L and G341V, k) G341V, l) N276D and
G341V, m) G341V and V369A, n)N286D, G341V and N434S, o) N325S and
G341V, p)Y300C and G341V, q) G341V and V348M, r) E382V and M428I,
s) V266M; t) A330V, P331A and Q295R, u) A330E, P331E and V279M, v)
A330E and P331E, w) A330E, P331V and S426T, x) A330E and P331V, y)
A3301 and P331E, z) A330E, aa) P331S, and bb) A330V, P331S, H224R
and L251F. It is contemplated that in some embodiments there are
additional polypeptides that may include an Fc domain from a
non-human, in which case the recited substitutions can be
implemented in corresponding amino acids.
[0022] Embodiments involve a polypeptide having an aglycosylated Fc
domain that is capable of specifically binding one or more
particular human FcR polypeptides. In some embodiments, the
aglycosylated Fc domain has been mutated so that it can bind one or
more of Fc.gamma.RIa, Fc.gamma.RIIa, Fc.gamma.RIIb, Fc.gamma.RIIc,
Fc.gamma.RIIIa, Fc.gamma.RIIIb, or Fc.alpha.RI. It is contemplated
that the binding to one or more of these particular human FcR
polypeptides is within 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%
(or any range derivable therein) of the binding seen with a
glycosylated Fc region or that the binding is altered (increased or
decreased) by at least or at most 50, 60, 70, 80, 90, or 100% (or
any range derivable therein) relative to a wild-type glycosylated
Fc domain. Alternatively, relative binding capabilities between
polypeptides having a mutated and aglycosylated Fc domain and
polypeptides having a glycosylated and wild-type Fc domain may be
expressed in terms of X-fold differences (increased or decreased).
For example, there may be at least or at most at least 2-, 3-, 4-,
5-, 6-, 7-, 8-, 9-, or 10-fold difference, or any range derivable
therein).
[0023] In some embodiments, a polypeptide with a mutated
aglycosylated Fc domain is capable of specifically binding an
Fc.gamma.RI polypeptide. In some cases, it binds at a level within
2-fold of the level of binding by a polypeptide having a
glycosylated and wild-type Fc domain. In other embodiments, the
level of binding is within at least 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-,
or 10-fold a glycosylated and wild-type Fc domain. For example, the
K.sub.D value for a particular Fc receptor and either a polypeptide
with the aglycosylated Fc domain variant or a polypeptide with a
glycosylated and wild-type Fc domain is within at least 2- or
3-fold in embodiments described herein. In some embodiments, a
polypeptide has at least a 2-fold reduction in pH-dependent FcRn
binding compared to polypeptide with an aglycosylated wild-type
antibody Fc domain. In additional embodiments,
[0024] Polypeptides described herein may include a linker in some
embodiments. In further embodiments, the linker is a conjugatable
linker. In some embodiments, the polypeptide contains an Fc domain
from an antibody. It may contain other regions from an antibody,
such as another binding domain. The additional binding domain is
not an FcR binding domain in certain embodiments. In some
embodiments, it may contain an antigen binding site or domain from
an antibody. This would include all or part of the variable region
from an antibody. In other embodiments, a polypeptide contains an
Fc domain from an antibody but another binding domain that is a
non-FcR binding domain. In some embodiments, the non-Fc binding
region is not an antigen binding site of an antibody but
specifically binds a cell-surface protein. In some cases, a
cell-surface protein that the non-Fc binding region recognizes is a
receptor. In some embodiments, a cell-surface receptor is a
tyrosine kinase. In additional embodiments, a polypeptide has a
non-Fc binding region capable of binding multiple tyrosine kinase
receptors. In some embodiments, such a non-Fc binding region is
capable of binding one or more of VEGF receptors, PDGF receptors,
EGFR receptors, ErbB-2 receptors, EGF receptors, HGF receptors, and
other Src-like tyrosine kinase receptors, or a combination thereof.
It is also specifically contemplated that polypeptides have an
antigen binding region that recognizes one or more of these
receptor tyrosine kinases.
[0025] Other polypeptides include those having an aglycosylated Fc
domain capable of binding an FcR.gamma.I polypeptide and a second
binding domain, wherein the second binding domain is capable of
specifically binding a cell-surface molecule. In some embodiments,
the second binding domain is an antigen binding domain of an
antibody ("antibody antigen binding domain"). In some cases, the
second binding domain is not an antibody antigen binding domain. In
some embodiments, the second binding domain is capable of
specifically binding a cell-surface molecule that is a
proteinaceous molecule. The second binding domain may be a ligand
for a cell-surface receptor or it may be a receptor for a
cell-surface ligand.
[0026] Embodiments also concern a nucleic acid that encodes any of
the polypeptides discussed herein. The nucleic acid may be isolated
and/or recombinant. It may be a nucleic acid segment that is
isolated and/or recombinant. In some embodiments, the nucleic acid
is DNA while in others it is RNA. In certain embodiments, the
nucleic acid is a DNA segment. In other embodiments, the nucleic
acid is an expression vector that is capable of expressing any of
the polypeptides having an Fc binding domain with one or more
substitutions that specifically binds a human FcR polypeptide. A
nucleic acid may encode one or more polypeptides discussed above,
which, depending on how the polypeptide is produced may or may not
be glycosylated.
[0027] In some embodiments, there are nucleic acids encoding a
polypeptide with an Fc domain capable of specifically binding a
human FcR polypeptide. The nucleic acid may be placed in a host
cell that can express the polypeptide, particularly an
aglycosylated version of the polypeptide. The host cell may be a
prokaryotic cell, such as a bacterial cell. Alternatively, the host
cell may be an eukaryotic cell, such as a mammalian cell. In some
embodiments, a host cell contains a first expression vector, though
it may comprises a second expression vector as well. Because some
antibodies are made of multiple polypeptides, a host cell that
expresses these polypeptides is contemplated in some embodiments.
For example, in some embodiments there is a host cell that includes
a second expression vector that encodes a polypeptide comprising an
immunoglobulin light chain.
[0028] In some embodiments, there is a population of host cells,
wherein the population contains a plurality of host cells that
express polypeptides having different Fc domains. It is
contemplated that the amino acid sequence of any two different Fc
domains differs in identity by less than 20%, 15%, 10%, 5% or
less.
[0029] In some embodiments there are methods of making the
polypeptides described herein (polypeptides having an aglycosylated
Fc region) as well as methods of using these polypeptides. Any of
these methods may be implemented with respect to any of the
polypeptides described herein.
[0030] In some embodiments there are methods for preparing an
aglycosylated polypeptide comprising: a) obtaining a host cell
capable of expressing an aglycosylated antibody comprising an Fc
domain capable of binding an FcR polypeptide, wherein the Fc domain
comprises an amino acid substitution at amino acids 382 and 428 and
at least one additional substitution of any of the following amino
acids: 224, 241, 251, 266, 269, 276, 279, 286, 295, 297, 300, 315,
325, 328, 330, 331, 332, 338, 340, 341, 348, 369, 378, 382, 392,
424, 426, 428 and/or 434; b) incubating the host cell in culture
under conditions to promote expression of the aglycosylated
antibody; and, c) purifying expressed antibody from the host cell.
In some embodiments, the host cell is a prokaryotic cell, such as a
bacterial cell. In other embodiments the host cell is a eukaryotic
cell and the polypeptide comprises a N297D substitution. In further
embodiments, methods involve collecting expressed antibody from the
supernatant, which may be done prior to purification.
[0031] In some embodiments methods involve purifying the antibody
from the supernatant. This may involve subjecting the antibodies
from the supernatant to filtration, HPLC, anion or cation exchange,
high performance liquid chromatography (HPLC), affinity
chromatography or a combination thereof. In some embodiments,
methods involve affinity chromatography using staphylococcal
Protein A, which binds the IgG Fc region. Other purification
methods are well known to those of ordinary skill in the art.
[0032] Other embodiments involve methods for inducing an immune
response in a subject. Polypeptides having an aglycosylated Fc
domain capable of binding an FcR polypeptide may be implemented in
such methods. In certain embodiments, an antibody that is
aglycosylated and that has an Fc domain capable of binding an
Fc.gamma.RI polypeptide is prescribed or administered to a subject.
Alternatively, methods may involve treating a subject with such an
antibody. Any of the polypeptides described herein may be used.
Certain embodiments involve a polypeptide having an aglycosylated
human Fc domain that comprises an amino acid substitution at amino
acids 382 and 428 and at least one additional substitution of any
of the following amino acids: 224, 241, 251, 266, 269, 276, 279,
286, 295, 297, 300, 315, 325, 328, 330, 331, 332, 338, 340, 341,
348, 369, 378, 382, 392, 424, 426, 428 and/or 434.
[0033] In some embodiments, the aglycosylated polypeptide or
antibody is capable of specifically binding an activating FcR
polypeptide, which refers to an FcR polypeptide that activates one
or more immune cells. Activating polypeptides include Fc.gamma.RI,
IIa, IIIa, IIb, and IIIc. Fc.gamma.RIIb is an inhibitory FcR
polypeptide. In further embodiments, the aglycosylated polypeptide
or antibody no longer binds an inhibitory FcR polypeptide at a
level comparable to a glycosylated, wild-type Fc domain. In
specific embodiments, an aglycosylated polypeptide or antibody
specifically binds an Fc.gamma.RI polypeptide. In further
embodiments, the aglycosylated polypeptide or antibody has a
reduced capability to bind an Fc.gamma.RIIb polypeptide, wherein
its affinity is at least 50-fold less than a glycosylated,
wild-type version of the polypeptide or antibody. In certain
embodiments, the aglycosylated antibody is an aglycosylated version
of a therapeutic antibody, which refers to an antibody used in
therapy or treatment for a disease or condition. Any antibody or
polypeptide discussed herein, including those discussed above, may
be used in implementing methods for inducing an immune response. An
example of a therapeutic antibody is trastuzumab.
[0034] In some embodiments, there are methods of inducing dendritic
cell- (DC) mediated cell killing against a target cell expressing a
targeted cell surface polypeptide comprising: a) contacting the
target cell with a polypeptide comprising a i) mutated and
aglycosylated Fc domain capable of specifically binding at least a
dendritic-cell activating FcR and ii) a second binding domain that
binds the targeted cell surface polypeptide; and b) exposing the
target cell to dendritic cells under conditions that promote
killing of the target cell. In some embodiments, the activating FcR
is an Fc.gamma.RI polypeptide. In additional embodiments, the
polypeptide with an aglycosylated Fc domain specifically binds to
an Fc.gamma.RIIB polypeptide at a level that is reduced compared to
a polypeptide having a glycosylated wild-type Fc domain. In some
embodiments, polypeptides have an Fc domain that comprises at least
one amino acid substitution in the following amino acids: 224, 241,
251, 266, 269, 276, 279, 286, 295, 297, 300, 315, 325, 328, 330,
331, 332, 340, 348, 369, 378, 382, 392, 424, 426, 428 and/or 434.
Additional polypeptides are discussed above and throughout this
application. In some embodiments, the target cell is a cancer cell.
Consequently, methods of treating cancer using aglycosylated and
mutated Fc domains in place of a glycosylated and wild-type Fc
domain in an antibody therapy are contemplated. Treatment of other
diseases or conditions involving antibodies that use glycosylated
and wild-type Fc domains can be similarly implemented with
aglycosylated and Fc variant polypeptides described herein.
[0035] Other embodiments concern methods for screening for an
aglycosylated polypeptide having an Fc domain that binds a one or
more specific FcR polypeptides comprising: a) obtaining a
population of Gram negative bacterial cells, cells of which
population express a aglycosylated polypeptide comprising an Fc
domain in their periplasm, wherein the population expresses a
plurality of different Fc domains; b) contacting the bacterial
cells with a first FcR polypeptide under conditions to allow
contact between the FcR polypeptide and the aglycosylated Fc
domains, wherein the FcR polypeptide is Fc.gamma.RIa,
Fc.gamma.RIIa, Fc.gamma.RIIb, Fc.gamma.RIIc, Fc.gamma.RIIIa,
Fc.gamma.RIIIb, or Fc.alpha.RI; and, c) selecting at least one
bacterial cell based on binding of the aglycosylated Fc domain to
the first FcR polypeptide. Methods may further involve identifying
or isolating the aglycosylated polypeptide from the selected
bacterial cell. Also, methods may involve determining whether an
aglycosylated polypeptide in selected bacterial cells can bind to
other FcR polypeptides. In some embodiments, determining whether an
aglycosylated polypeptide in selected bacterial cells can bind to
other FcR polypeptides comprises repeating steps a)-c) with a
second FcR polypeptide to determine whether the aglycosylated
polypeptide also binds the second FcR polypeptide. It is
contemplated that steps a)-c) may be repeated with more than two
different FcR polypeptides. In some embodiments, the aglycosylated
polypeptide binds multiple FcR polypeptides.
[0036] In some embodiments, methods involve bacterial cells that
are E. coli cells. In additional embodiments, the Fc domain is an
IgG, IgA or IgE Fc domain. In further embodiments, the population
of Gram negative bacterial cells comprise a plurality of nucleic
acids encoding the plurality of aglycosylated Fc domains. In some
cases the plurality of nucleic acids further encodes a membrane
secretion signal fused to the plurality of aglycosylated Fc
domains. A membrane secretion signal may be PelB or DsbA.
Additionally, the aglycosylated Fc domain may include a hinge, CH2
and CH3 region. In certain embodiments, the aglycosylated
polypeptide comprises an eukaryotic FcR domain. In some
embodiments, there is a polypeptide with an Fc domain that
specifically binds one of the polypeptides of Table 1. In certain
embodiments, the Fc domain binds human Fc.gamma.RIa, Fc.gamma.RIIa,
Fc.gamma.RIIb, Fc.gamma.RIIc, Fc.gamma.RIIIa, Fc.gamma.RIIIb,
Fc.alpha.RI or C1q. In other embodiments, it has reduced binding
affinity for Fc.gamma.RIIb relative to a glycosylated and wild-type
version of the Fc domain. Specific methods are disclosed in WO
2008/137475, which is hereby incorporated by reference.
[0037] Other embodiments involve methods for optimizing Fc binding
to one or more specific FcR polypeptides of an aglycosylated
polypeptide having an Fc domain comprising: a) obtaining a
population of Gram negative bacterial cells, cells of which
population express a aglycosylated polypeptide comprising an Fc
domain in their periplasm, wherein the population expresses a
plurality of different polypeptides expressing different mutated Fc
domains; b) contacting the bacterial cells with a first FcR
polypeptide under conditions to allow contact between the FcR
polypeptide and the aglycosylated Fc domains, wherein the FcR
polypeptide is Fc.gamma.RIa, Fc.gamma.RIIa, Fc.gamma.RIIb,
Fc.gamma.RIIc, Fc.gamma.RIIIa, Fc.gamma.RIIIb, or Fc.alpha.RI; and
c) selecting at least one bacterial cell based on binding of the
aglycosylated Fc domain to the first FcR polypeptide. Any of the
embodiments discuss above may apply to the implementation of these
methods.
[0038] Embodiments discussed in the context of a methods and/or
composition of the invention may be employed with respect to any
other method or composition described herein. Thus, an embodiment
pertaining to one method or composition may be applied to other
methods and compositions of the invention as well.
[0039] As used herein the terms "encode" or "encoding" with
reference to a nucleic acid are used to make the invention readily
understandable by the skilled artisan however these terms may be
used interchangeably with "comprise" or "comprising"
respectively.
[0040] As used herein the specification, "a" or "an" may mean one
or more. As used herein in the claim(s), when used in conjunction
with the word "comprising", the words "a" or "an" may mean one or
more than one.
[0041] The use of the term "or" in the claims is used to mean
"and/or" unless explicitly indicated to refer to alternatives only
or the alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." As used herein "another" may mean at least a second or
more.
[0042] Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[0043] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0044] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0045] FIG. 1: Mutation points of isolated aglycosylated Fc5 (382E
and 428M) represented on the 3D structure of glycosylated IgG1 Fc
(PBD Code: 1FC1).
[0046] FIG. 2. Two beta sheets including 382E in .beta.-sheet C and
428M in .beta.-sheet C of CH3 domain represented on the crystal
structure of glycosylated IgG. (PBD Code: 1FC1).
[0047] FIG. 3. Error prone PCR library for engineering
aglycosylated Fc5 domains.
[0048] FIG. 4. Fluorescence histogram of spheroplasts from
different rounds of sorting labeled with Fc.gamma.RIa-FITC.
[0049] FIG. 5. DNA sequences of isolated Fc mutant clones
exhibiting higher affinity to Fc.gamma.RIa than Fc5. Mean
fluorescence values for the respective clones labeled with
Fc.gamma.RIa are shown in parenthesis.
[0050] FIG. 6. Mutation points of isolated aglycosylated Fc601-619
represented on the 3D structure of glycosylated IgG1 Fc (PBD Code:
1FC1).
[0051] FIG. 7. Fluorescence histogram of spheroplasts for wild type
Fc, Fc5, and Fc601 labeled with 30 nM of Fc.gamma.RIa-FITC. M: Mean
fluorescence intensity.
[0052] FIG. 8. Mutation points of isolated aglycosylated Fc 601
(K338R, G341V, E382V, M428I) represented on the 3D structure of
glycosylated IgG1 Fc (PBD Code: 1FC1).
[0053] FIG. 9. Map of plasmid pSTJ4-Herceptin IgG1.
[0054] FIG. 10. Kinetic rates and equilibrium dissociation
constants of aglycosylated trastuzumab, trastuzumab-Fc5,
trastuzumab-Fc601, and glycosylated trastuzumab determined by
BIACore analysis for binding to Fc.gamma.RIa.
[0055] FIG. 11. ELISA assays for binding of trastuzumab antibodies
to Fc.gamma.RIIa-GST.
[0056] FIG. 12. ELISA assays for binding of trastuzumab antibodies
to Fc.gamma.RIIb-GST.
[0057] FIG. 13. ELISA assays for binding of trastuzumab antibodies
to Fc.gamma.RIIIa.
[0058] FIG. 14. ELISA assays for pH dependent binding to FcRn at pH
7.4 and 6.0. Plates were coated with aglycosylated trastuzumab,
trastuzumab-Fc5, trastuzumab-Fc601 or commercial glycosylated
trastuzumab and the binding of FcRn was detected using
anti-GST-HRP.
[0059] FIG. 15. Library for higher affinity to Fc.gamma.RIa than
Fc5 and for pH dependent FcRn binding.
[0060] FIG. 16. Gene assembly PCR for the construction of 4
sub-libraries that randomized upper CH2 region.
[0061] FIG. 17. DNA sequences of isolated Fc mutant clones
exhibiting higher affinity to Fc.gamma.RIa than Fc5. Mean
fluorescence values for the respective clones labeled with
Fc.gamma.RIa are shown in parenthesis.
[0062] FIG. 18. Summary of mutations in Fc701-709.
[0063] FIG. 19. Fluorescence histogram of spheroplasted cells for
wild type Fc, Fc5, Fc701, and Fc702 labeled with 1 nM of
Fc.gamma.RIa-FITC. M: Mean fluorescence intensity.
[0064] FIG. 20. Fluorescence histogram of spheroplasted cells for
wild type Fc, Fc5, Fc601, and Fc701 labeled with 1 nM of
Fc.gamma.RIa-FITC. M: Mean fluorescence intensity.
[0065] FIG. 21. Mutation points of isolated aglycosylated Fc5 (382E
and 428M) represented on the 3D structure of glycosylated IgG1 Fc
(PBD Code: 1FC1)
[0066] FIG. 22. Kinetic rates and equilibrium dissociation
constants of aglycosylated trastuzumab, trastuzumab-Fc5,
trastuzumab-Fc601, trastuzumab-Fc701 and glycosylated trastuzumab
determined by BIACore analysis for binding to Fc.gamma.RI.
[0067] FIG. 23. ELISA assays for pH dependent binding to FcRn at pH
7.4 and 6.0. Plates were coated with aglycosylated trastuzumab,
trastuzumab-Fc5, trastuzumab-Fc601, trasutuzumab-Fc701 or
commercial glycosylated trastuzumab and the binding of FcRn was
detected using anti-GST-HRP.
[0068] FIG. 24. Covalently anchored full length IgG display
system.
[0069] FIG. 25. Comparison of FACS signals between 2 plasmid
covalently anchored full length IgG display system and dicistronic
system. Trastuzumab full length IgGs were expressed using either
the 2 plasmid anchored full length IgG display system or
dicistronic full length IgG display system. M: Mean fluorescence
intensity. Spheroplasts were incubated with 30 nM Fc.gamma.RI-FITC
probe for detection.
[0070] FIG. 26. Comparison of FACS signals between the 2 plasmids
covalently anchored full length IgG display system and dicistronic
system. Trastuzumab full length IgGs were expressed using either
the 2 plasmids anchored full length IgG display system or
dicistronic full length IgG display system. M: Mean fluorescence
intensity. Spheroplasts were incubated with 30 nM Fc.gamma.RIIa-GST
and labeled with polyclonal anti-GST-FITC (1:200) probe for
detection.
[0071] FIG. 27. FACS analysis of trastuzumab full length IgG using
2 plasmids covalently anchored full length IgG display system and
dicistronic system. Spheroplasts expressing trastuzumab full length
IgGs were incubated with 30 nM Fc.gamma.RI-FITC probe for
detection. M: Mean fluorescence intensity.
[0072] FIG. 28. FACS analysis of trastuzumab full length IgG using
2 plasmids covalently anchored full length IgG display system and
dicistronic system. Spheroplasts expressing trastuzumab full length
IgGs were incubated with incubated with 30 nM Fc.gamma.RIIa-GST and
labeled with polyclonal anti-GST-FITC (1:200) probe for detection.
M: Mean fluorescence intensity.
[0073] FIG. 29. Library for randomization of upper CH2 region.
[0074] FIG. 30. ADCC assays with PBMC as effector cells and SkBr3
as the target cell. *, P<0.05.
[0075] FIG. 31. ADCC assays with mDCs as effector cells and SkBr3
as the target cell. *, P<0.05; **, P<0.01.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0076] The inventors previously overcame several major problems
with current immunotherapeutic technologies in providing
aglycosylated antibody Fc domains that are able to bind to Fc
receptor polypeptides. Additional Fc domains with engineered
properties have been developed. Further embodiments and advantages
are described below, though information about Fc libraries and
screening methods are provided.
I. PERIPLASMIC EXPRESSION
[0077] In some embodiments, polypeptide comprising an antibody Fc
domain may be expressed in the periplasmic space of a gram negative
bacteria. Furthermore, in some aspects an antibody Fc domain may be
anchored to the periplasmic face of the inner membrane. For
example, an Fc domain may be directly fused to a membrane spanning
or membrane bound polypeptide or may interact (e.g., via
protein-protein interactions) with a membrane spanning or membrane
bound polypeptide. Such a technique may be termed "Anchored
Periplasmic Expression" or "APEx".
[0078] The periplasmic compartment is contained between the inner
and outer membranes of Gram negative cells (see, e.g., Oliver,
1996). As a sub-cellular compartment, it is subject to variations
in size, shape and content that accompany the growth and division
of the cell. Within a framework of peptidoglycan heteroploymer is a
dense mileau of periplasmic proteins and little water, lending a
gel-like consistency to the compartment (Hobot et al., 1984; van
Wielink and Duine, 1990). The peptidoglycan is polymerized to
different extents depending on the proximity to the outer membrane,
close-up it forms the murein sacculus that affords cell shape and
resistance to osmotic lysis.
[0079] The outer membrane (see Nikaido, 1996) is composed of
phospholipids, porin proteins and, extending into the medium,
lipopolysaccharide (LPS). The molecular basis of outer membrane
integrity resides with LPS ability to bind divalent cations
(Mg.sup.2+ and Ca.sup.2+) and link each other electrostatically to
form a highly ordered quasi-crystalline ordered "tiled roof" on the
surface (Labischinski et al., 1985). The membrane forms a very
strict permeability barrier allowing passage of molecules no
greater than around 650 Da (Burman et al., 1972; Decad and Nikaido,
1976) via the porins. The large water filled porin channels are
primarily responsible for allowing free passage of mono and
disaccharides, ions and amino acids in to the periplasm compartment
(Nikaido and Nakae, 1979; Nikaido and Vaara, 1985). With such
strict physiological regulation of access by molecules to the
periplasm it may appear, at first glance, inconceivable that large
ligands (i.e., larger than the 650 Da exclusion limit) could be
employed in screening methods. However, the inventors have shown
that ligands greater than 2000 Da in size can diffuse into the
periplasm without disruption of the periplasmic membrane. Such
diffusion can be aided by one or more treatments of a bacterial
cell, thereby rendering the outer membrane more permeable, as is
described herein below.
[0080] Method for expressing polypeptides and in particular
antibodies in the periplasmic space are known in the art for
example see U.S. Pat. No. 7,094,571 and U.S. Patent Publ.
20030180937 and 20030219870 each incorporated herein by reference.
In some cases, a gram negative bacterial cell of the invention may
be defined as an E. coli cell. Furthermore, in some aspects a Gram
negative bacterial cell may be defined as a genetically engineered
bacterial cell such as a Jude-1 strain of E. coli.
II. PERMEABILIZATION OF THE OUTER MEMBRANE
[0081] In some embodiments, methods involve disrupting,
permeabilizing or removing the outer membrane of bacteria are well
known in the art, for example, see U.S. Pat. No. 7,094,571. For
instance, prior to contacting the bacterial cells with an FcR
polypeptide the outer membrane of the bacterial cell may be treated
with hyperosmotic conditions, physical stress, lysozyme, EDTA, a
digestive enzyme, a chemical that disrupts the outer membrane, or
by infecting the bacterium with a phage or a combination of the
foregoing methods. Thus, in some cases, the outer membrane may be
disrupted by lysozyme and EDTA treatment. Furthermore, in certain
embodiments, the bacterial outer membrane may be removed
entirely.
[0082] In one embodiment, methods are employed for increasing the
permeability of the outer membrane to one or more labeled ligands.
This can allow screening access of labeled ligands otherwise unable
to cross the outer membrane. However, certain classes of molecules,
for example, hydrophobic antibiotics larger than the 650 Da
exclusion limit, can diffuse through the bacterial outer membrane
itself, independent of membrane porins (Farmer et al., 1999). The
process may actually permeabilize the membrane on so doing (Jouenne
and Junter, 1990). Such a mechanism has been adopted to selectively
label the periplasmic loops of a cytoplasmic membrane protein in
vivo with a polymyxin B nonapeptide (Wada et al., 1999). Also,
certain long chain phosphate polymers (100 Pi) appear to bypass the
normal molecular sieving activity of the outer membrane altogether
(Rao and Torriani, 1988).
[0083] Conditions have been identified that lead to the permeation
of ligands into the periplasm without loss of viability or release
of the expressed proteins from the cells, but the invention may be
carried out without maintenance of the outer membrane. As
demonstrated herein Fc domains expressed or anchored candidate
binding polypeptides in the periplasmic space the need for
maintenance of the outer membrane (as a barrier to prevent the
leakage of the biding protein from the cell) to detect bound
labeled ligand is removed. As a result, cells expressing binding
proteins anchored to the outer (periplasmic) face of the
cytoplasmic membrane can be fluorescently labeled simply by
incubating with a solution of fluorescently labeled ligand in cells
that either have a partially permeabilized membrane or a nearly
completely removed outer membrane.
[0084] The permeability of the outer membrane of different strains
of bacterial hosts can vary widely. It has been shown previously
that increased permeability due to OmpF overexpression was caused
by the absence of a histone like protein resulting in a decrease in
the amount of a negative regulatory mRNA for OmpF translation
(Painbeni et al., 1997). Also, DNA replication and chromosomal
segregation is known to rely on intimate contact of the replisome
with the inner membrane, which itself contacts the outer membrane
at numerous points. A preferred host for library screening
applications is E. coli ABLEC strain, which additionally has
mutations that reduce plasmid copy number.
[0085] Treatments such as hyperosmotic shock can improve labeling
significantly. It is known that many agents including, calcium ions
(Bukau et al., 1985) and even Tris buffer (Irvin et al., 1981)
alter the permeability of the outer-membrane. Further, phage
infection stimulates the labeling process. Both the filamentous
phage inner membrane protein pIII and the large multimeric outer
membrane protein pIV can alter membrane permeability (Boeke et al.,
1982) with mutants in pIV known to improve access to maltodextrins
normally excluded (Marciano et al., 1999). Using the techniques of
the invention, comprising a judicious combination of strain, salt
and phage, a high degree of permeability may be achieved (Daugherty
et al., 1999). Cells comprising anchored or periplasm-associated
polypeptides bound to fluorescently labeled ligands can then be
easily isolated from cells that express binding proteins without
affinity for the labeled ligand using flow cytometry or other
related techniques. However, in some cases, it will be desired to
use less disruptive techniques in order to maintain the viability
of cells. EDTA and Lysozyme treatments may also be useful in this
regard.
III. ANTIBODY-BINDING POLYPEPTIDES
[0086] In certain aspects there are methods for identifying
antibody Fc domains with a specific affinity for antibody-binding
polypeptide such as an Fc receptor. In some embodiments, an Fc
domain is engineered to bind one or more specific Fc receptors.
Additionally or alternatively, an Fc domain may be engineered so
that it does not specifically bind one or more specific Fc
receptors.
[0087] In certain embodiments, there are compositions comprising a
proteinaceous molecule that has been modified relative to a native
or wild-type protein.
[0088] In some embodiments that proteinaceous compound has been
deleted of amino acid residues; in other embodiments, amino acid
residues of the proteinaceous compound have been replaced, while in
still further embodiments both deletions and replacements of amino
acid residues in the proteinaceous compound have been made.
Furthermore, a proteinaceous compound may include an amino acid
molecule comprising more than one polypeptide entity. As used
herein, a "proteinaceous molecule," "proteinaceous composition,"
"proteinaceous compound," "proteinaceous chain" or "proteinaceous
material" generally refers, but is not limited to, a protein of
greater than about 200 amino acids or the full length endogenous
sequence translated from a gene; a polypeptide of 100 amino acids
or greater; and/or a peptide of 3 to 100 amino acids. All the
"proteinaceous" terms described above may be used interchangeably
herein; however, it is specifically contemplated that embodiments
may be limited to a particular type of proteinaceous compound, such
as a polypeptide. Furthermore, these terms may be applied to fusion
proteins or protein conjugates as well. A protein may include more
than one polypeptide. An IgG antibody, for example, has two heavy
chain polypeptides and two light chain polypeptides, which are
joined to each other through disulfide bonds.
[0089] As used herein a "distinct Fc domain" may be defined as a
domain that differs from another Fc by as little as one amino acid.
Methods for making a library of distinct antibody Fc domains or
nucleic acids that encode antibodies are well known in the art and
exemplified herein. For example, in some cases Fc domains may be
amplified by error prone PCR as exemplified herein. Furthermore, in
certain cases a plurality of antibody Fc domains may comprise a
stretch (1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) amino acids that
have been randomized. In certain cases specific mutations may be
engineered into Fc domains. For example, in some aspects, residues
that are normally glycosylated in an antibody Fc domain may be
mutated. Furthermore, in certain aspects, residues that are
normally glycosylated (or adjacent residues) may be used as a site
for an insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino
acids. An amino acid insertion may be made at, or adjacent to, a
residue corresponding to amino acid 384 of the IgG1 Fc (SEQ ID
NO:2). In still further cases, a population of gram negative
bacteria according to the invention may be defined as comprising at
least about 1.times.10.sup.3, 1.times.10.sup.4, 1.times.10.sup.5,
1.times.10.sup.6, 1.times.10.sup.7, 1.times.10.sup.8, or more
distinct antibodies Fc domains. In some specific cases, a
population of Gram negative bacterial cells may be produced by a
method comprising the steps of: (a) preparing a plurality of
nucleic acid sequences encoding a plurality of distinct antibody Fc
domains; and (b) transforming a population of Gram negative
bacteria with said nucleic acids wherein the Gram negative bacteria
comprise a plurality of antibody Fc domains expressed in the
periplasm.
[0090] A variety of antibody-binding domains (e.g., FcR
polypeptides) are known in the art and may be used in the methods
and compositions of the invention. For example, in some aspects, an
FcR may have specificity for a particular type or subtype of Ig,
such as IgA, IgM, IgE or IgG (e.g., IgG1, IgG2a, IgG2b, IgG3 or
IgG4). Thus, in some embodiments the antibody-binding domain may be
defined as an IgG binding domain. The FcR polypeptide may comprise
an eukaryotic, prokaryotic, or synthetic FcR domain. For instance,
an antibody Fc-binding domain may be defined as a mammalian,
bacterial or synthetic binding domain. Some Fc-binding domains for
use in the invention include but are not limited to a binding
domain from one of the polypeptides of Table 1. For example, an
Fc-binding polypeptide may be encoded by an FCGR2A, FCGR2B, FCGR2C,
FCGR3A, FCGR3B, FCGR1A, Fcgr1, FCGR2, FCGR2, Fcgr2, Fcgr2, FCGR3,
FCGR3, Fcgr3, FCGR3, Fcgr3, FCGRT, mrp4, spa or spg gene.
Preferably, an FcR polypeptide for use according to the invention
may be an Fc binding region from human Fc.gamma.RIa, Fc.gamma.RIIa,
Fc.gamma.RIIb, Fc.gamma.RIIc, Fc.gamma.RIIIa, Fc.gamma.RIIIb,
Fc.alpha.RI or C1q.
[0091] In still further embodiments of the invention an Fc
polypeptide may be anchored to the inner membrane of a Gram
negative bacteria. Methods and compositions for the anchoring of
polypeptides to the inner membrane of Gram negative bacterial have
previously been described (U.S. Pat. No. 7,094,571 and U.S. Patent
Publ. 20050260736). Thus, in some aspects, an Fc domain may be
fused to a polypeptide that is associated with or integrated in a
bacterial inner membrane. Such a fusion protein may comprise an N
terminal or C terminal fusion with an Fc domain and in some case
may comprise additional linker amino acids between the membrane
anchoring polypeptide and the Fc domain. In certain specific cases,
a membrane anchoring polypeptide may be the first six amino acids
encoded by the E. coli N1 pA gene, one or more transmembrane
.alpha.-helices from an E. coli inner membrane protein, a gene III
protein of filamentous phage or a fragment thereof, or an inner
membrane lipoprotein or fragment thereof. Thus, as an example, a
membrane anchoring polypeptide may be an inner membrane lipoprotein
or fragment thereof such as from AraH, MglC, MalF, MalG, MalC,
MalD, RbsC, RbsC, ArtM, ArtQ, GlnP, ProW, HisM, HisQ, LivH, LivM,
LivA, LivE, DppB, DppC, OppB, AmiC, AmiD, BtuC, ThuD, FecC, FecD,
FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB,
PotC, PotH, Pod, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb, B, DsbD,
TouB, TatC, CheY, TraB, ExbD, ExbB or Aas.
[0092] The skilled artisan will understand that methods for
selecting cells based upon their interaction (binding) with an FcR
are well known in the art. For example, an FcR may be immobilized
on a column or bead (e.g., a magnetic bead) and the bacterial cell
binding to the FcR separated by repeated washing of the bead (e.g.,
magnetic separation) or column. Furthermore, in some aspects a
target ligand may be labeled such as with a fluorophor, a
radioisotope or an enzyme. Thus, bacterial cells may, in some
cases, be selected by detecting a label on a bound FcR. For
example, a fluorophore may be used to select cells using
fluorescence activated cell sorting (FACS). Furthermore, in some
aspects, bacterial cells may be selected based on binding or lack
of binding two or more FcR polypeptides. For instance, bacteria may
be selected that display antibodies that bind to two FcR
polypeptides, wherein each FcR is used to select the bacterial
sequentially. Conversely, in certain aspects, bacteria may be
selected that display antibody Fc domains that bind to one FcR
(such as an FcR comprising a first label) but not to a second FcR
(e.g., comprising a second label). The foregoing method maybe used,
for example, to identify antibody Fc domains that bind to a
specific FcR but not a second specific FcR.
[0093] In certain embodiments the size of the at least one
proteinaceous molecule may comprise, but is not limited to, about
or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200,
210, 220, 230, 240, 250, 275, 300, 350, 400, 450, 500, 550, 600,
650, 700, 750, 800, 850, 900, 950, 1000 or greater amino molecule
residues, and any range derivable therein. Compounds may include
the above-mentioned number of contiguous amino acids from SEQ ID
NO:2 (human IgG Fc polypeptide) or from SEQ ID NOs 4-31 and these
may be further qualified as having a percent identity or homology
to SEQ ID NO:2 or any of SEQ ID NO:4-31 (discussed below). It is
contemplated that embodiments with respect to SEQ ID NO:2 may be
employed with respect to any other amino acid sequences described
herein, and vice versa, if appropriate.
[0094] As used herein, an "amino molecule" refers to any amino
acid, amino acid derivative or amino acid mimic as would be known
to one of ordinary skill in the art. In certain embodiments, the
residues of the proteinaceous molecule are sequential, without any
non-amino molecule interrupting the sequence of amino molecule
residues. In other embodiments, the sequence may comprise one or
more non-amino molecule moieties. In particular embodiments, the
sequence of residues of the proteinaceous molecule may be
interrupted by one or more non-amino molecule moieties.
[0095] A. Modified Proteins and Polypeptides
[0096] Embodiments concerns modified proteins and polypeptides,
particularly a modified protein or polypeptide that exhibits at
least one functional activity that is comparable to the unmodified
version, yet the modified protein or polypeptide possesses an
additional advantage over the unmodified version, such as provoking
ADCC, easier or cheaper to produce, eliciting fewer side effects,
and/or having better or longer efficacy or bioavailability. Thus,
when the present application refers to the function or activity of
"modified protein" or a "modified polypeptide" one of ordinary
skill in the art would understand that this includes, for example,
a protein or polypeptide that 1) performs at least one of the same
activities or has at least one of the same specificities as the
unmodified protein or polypeptide, but that may have a different
level of another activity or specificity; and 2) possesses an
additional advantage over the unmodified protein or polypeptide.
Determination of activity may be achieved using assays familiar to
those of skill in the art, particularly with respect to the
protein's activity, and may include for comparison purposes, for
example, the use of native and/or recombinant versions of either
the modified or unmodified protein or polypeptide. It is
specifically contemplated that embodiments concerning a "modified
protein" may be implemented with respect to a "modified
polypeptide," and vice versa. In addition to the modified proteins
and polypeptides discussed herein, embodiments may involve domains,
polypeptides, and proteins described in WO 2008/137475, which is
hereby specifically incorporated by reference.
[0097] Modified proteins may possess deletions and/or substitutions
of amino acids; thus, a protein with a deletion, a protein with a
substitution, and a protein with a deletion and a substitution are
modified proteins. In some embodiments these modified proteins may
further include insertions or added amino acids, such as with
fusion proteins or proteins with linkers, for example. A "modified
deleted protein" lacks one or more residues of the native protein,
but possesses the specificity and/or activity of the native
protein. A "modified deleted protein" may also have reduced
immunogenicity or antigenicity. An example of a modified deleted
protein is one that has an amino acid residue deleted from at least
one antigenic region--that is, a region of the protein determined
to be antigenic in a particular organism, such as the type of
organism that may be administered the modified protein.
[0098] Substitutional or replacement variants typically contain the
exchange of one amino acid for another at one or more sites within
the protein and may be designed to modulate one or more properties
of the polypeptide, particularly its effector functions and/or
bioavailability. Substitutions may or may not be conservative, that
is, one amino acid is replaced with one of similar shape and
charge. Conservative substitutions are well known in the art and
include, for example, the changes of: alanine to serine; arginine
to lysine; asparagine to glutamine or histidine; aspartate to
glutamate; cysteine to serine; glutamine to asparagine; glutamate
to aspartate; glycine to proline; histidine to asparagine or
glutamine; isoleucine to leucine or valine; leucine to valine or
isoleucine; lysine to arginine; methionine to leucine or
isoleucine; phenylalanine to tyrosine, leucine or methionine;
serine to threonine; threonine to serine; tryptophan to tyrosine;
tyrosine to tryptophan or phenylalanine; and valine to isoleucine
or leucine.
[0099] In addition to a deletion or substitution, a modified
protein may possess an insertion of residues, which typically
involves the addition of at least one residue in the polypeptide.
This may include the insertion of a targeting peptide or
polypeptide or simply a single residue. Terminal additions, called
fusion proteins, are discussed below.
[0100] The term "biologically functional equivalent" is well
understood in the art and is further defined in detail herein.
Accordingly, sequences that have between about 70% and about 80%,
or between about 81% and about 90%, or even between about 91% and
about 99% of amino acids that are identical or functionally
equivalent to the amino acids of a native polypeptide are included,
provided the biological activity of the protein is maintained. A
modified protein may be biologically functionally equivalent to its
native counterpart.
[0101] It also will be understood that amino acid and nucleic acid
sequences may include additional residues, such as additional N- or
C-terminal amino acids or 5' or 3' sequences, and yet still be
essentially as set forth in one of the sequences disclosed herein,
so long as the sequence meets the criteria set forth above,
including the maintenance of biological protein activity where
protein expression is concerned. The addition of terminal sequences
particularly applies to nucleic acid sequences that may, for
example, include various non-coding sequences flanking either of
the 5' or 3' portions of the coding region or may include various
internal sequences, i.e., introns, which are known to occur within
genes.
[0102] The following is a discussion based upon changing of the
amino acids of a protein to create an equivalent, or even an
improved, second-generation molecule. For example, certain amino
acids may be substituted for other amino acids in a protein
structure with or without appreciable loss of interactive binding
capacity with structures such as, for example, binding sites to
substrate molecules. Since it is the interactive capacity and
nature of a protein that defines that protein's biological
functional activity, certain amino acid substitutions can be made
in a protein sequence, and in its underlying DNA coding sequence,
and nevertheless produce a protein with like properties. It is thus
contemplated by the inventors that various changes may be made in
the DNA sequences of genes without appreciable loss of their
biological utility or activity, as discussed below. A proteinaceous
molecule has "homology" or is considered "homologous" to a second
proteinaceous molecule if one of the following "homology criteria"
is met: 1) at least 30% of the proteinaceous molecule has sequence
identity at the same positions with the second proteinaceous
molecule; 2) there is some sequence identity at the same positions
with the second proteinaceous molecule and at the nonidentical
residues, at least 30% of them are conservative differences, as
described herein, with respect to the second proteinaceous
molecule; or 3) at least 30% of the proteinaceous molecule has
sequence identity with the second proteinaceous molecule, but with
possible gaps of nonidentical residues between identical residues.
As used herein, the term "homologous" may equally apply to a region
of a proteinaceous molecule, instead of the entire molecule. If the
term "homology" or "homologous" is qualified by a number, for
example, "50% homology" or "50% homologous," then the homology
criteria, with respect to 1), 2), and 3), is adjusted from "at
least 30%" to "at least 50%." Thus it is contemplated that there
may homology of at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, or more between two proteinaceous
molecules or portions of proteinaceous molecules.
[0103] Alternatively, a modified polypeptide may be characterized
as having a certain percentage of identity to an unmodified
polypeptide or to any polypeptide sequence disclosed herein,
including SEQ ID NO:2 or any of SEQ ID NOs:4-31. The percentage
identity may be at most or at least 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any range
derivable therein) between two proteinaceous molecules or portions
of proteinaceous molecules. It is contemplated that percentage of
identity discussed above may relate to a particular region of a
polypeptide compared to an unmodified region of a polypeptide. For
instance, a polypeptide may contain a modified or mutant Fc domain
that can be characterized based on the identity of the amino acid
sequence of the modified or mutant Fc domain to an unmodified or
mutant Fc domain from the same species. A modified or mutant human
Fc domain characterized, for example, as having 90% identity to an
unmodified Fc domain means that 90% of the amino acids in that
domain are identical to the amino acids in the unmodified human Fc
domain (SEQ ID NO:2).
[0104] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte & Doolittle, 1982). It is
accepted that the relative hydropathic character of the amino acid
contributes to the secondary structure of the resultant protein,
which in turn defines the interaction of the protein with other
molecules, for example, enzymes, substrates, receptors, DNA,
antibodies, antigens, and the like.
[0105] It also is understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by
reference, states that the greatest local average hydrophilicity of
a protein, as governed by the hydrophilicity of its adjacent amino
acids, correlates with a biological property of the protein. As
detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity
values have been assigned to amino acid residues: arginine (+3.0);
lysine (+3.0); aspartate (+3.0.+-.1); glutamate (+3.0.+-.1); serine
(+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine
(-0.4); proline (-0.5.+-.1); alanine (-0.5); histidine (-0.5);
cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8);
isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5);
tryptophan (-3.4).
[0106] It is understood that an amino acid can be substituted for
another having a similar hydrophilicity value and still produce a
biologically equivalent and immunologically equivalent protein. In
such changes, the substitution of amino acids whose hydrophilicity
values are within .+-.2 is preferred, those that are within .+-.1
are particularly preferred, and those within .+-.0.5 are even more
particularly preferred.
[0107] As outlined above, amino acid substitutions generally are
based on the relative similarity of the amino acid side-chain
substituents, for example, their hydrophobicity, hydrophilicity,
charge, size, and the like. Exemplary substitutions that take into
consideration the various foregoing characteristics are well known
to those of skill in the art and include: arginine and lysine;
glutamate and aspartate; serine and threonine; glutamine and
asparagine; and valine, leucine and isoleucine.
[0108] A variety of Fc receptors to which Fc domains bind are well
known in the art and some examples of receptors are listed below in
Table 1.
TABLE-US-00001 TABLE 1 Selected FcR Polypeptides Protein name Gene
name Description Organisms Length (aa) Reference Fc-gamma FCGR2A
Low affinity Homo sapiens 317 (Stuart et al., RII-a immunoglobulin
(Human) 1987) (CD32) gamma Fc region receptor II-a precursor
Fc-gamma FCGR2A Low affinity Pan 316 RII-a immunoglobulin
troglodytes gamma Fc (Chimpanzee) region receptor II-a precursor
Fc-gamma FCGR2B Low affinity Homo sapiens 310 (Stuart et al., RII-b
immunoglobulin (Human) 1989) gamma Fc region receptor II-b
precursor Fc-gamma FCGR2C Low affinity Homo sapiens 323 (Stuart et
al., RII-c immunoglobulin (Human) 1989) gamma Fc region receptor
II-c precursor Fc-gamma FCGR3A Low affinity Homo sapiens 254
(Ravetch and RIIIa immunoglobulin (Human) Perussia, gamma Fc 1989)
region receptor III-A precursor Fc-gamma FCGR3B Low affinity Homo
sapiens 233 (Ravetch and RIIIb immunoglobulin (Human) Perussia,
gamma Fc 1989) region receptor III-B precursor Fc-gamma FCGR1A High
affinity Homo sapiens 374 (Allen and RI (CD64) immunoglobulin
(Human) Seed, 1988) gamma Fc receptor I precursor Fc-gamma Fcgr1
High affinity Mus musculus 404 (Sears et al., RI immunoglobulin
(Mouse) 1990) gamma Fc receptor I precursor Fc-gamma FCGR2 Low
affinity Bos taurus 296 (Zhang et al., RII immunoglobulin (Bovine)
1994) gamma Fc region receptor II precursor Fc-gamma FCGR2 Low
affinity Cavia 341 (Tominaga et RII immunoglobulin porcellus al.,
1990) gamma Fc (Guinea pig) region receptor II precursor Fc-gamma
Fcgr2 Low affinity Mus musculus 330 (Ravetch et RII immunoglobulin
(Mouse) al., 1986) gamma Fc region receptor II precursor Fc-gamma
Fcgr2 Low affinity Rattus 285 (Bocek and RII immunoglobulin
norvegicus Pecht, 1993) gamma Fc (Rat) region receptor II precursor
Fc-gamma FCGR3 Low affinity Bos taurus 250 (Collins et RIII
immunoglobulin (Bovine) al., 1997) gamma Fc region receptor III
precursor Fc-gamma FCGR3 Low affinity Macaca 254 RIII
immunoglobulin fascicularis gamma Fc (Crab eating region receptor
macaque) III precursor (Cynomolgus monkey) Fc-gamma Fcgr3 Low
affinity Mus musculus 261 (Ravetch et RIII immunoglobulin (Mouse)
al., 1986) gamma Fc region receptor III precursor Fc-gamma FCGR3
Low affinity Sus scrofa 257 (Halloran et RIII immunoglobulin (Pig)
al., 1994) gamma Fc region receptor III precursor Fc-gamma Fcgr3
Low affinity Rattus 267 (Zeger et al., RIII immunoglobulin
norvegicus 1990) gamma Fc (Rat) region receptor III precursor FcRn
FCGRT IgG receptor Homo sapiens 365 transporter (Human) FcRn large
subunit p51 precursor FcRn FCGRT IgG receptor Macaca 365
transporter fascicularis FcRn large (Crab eating subunit p51
macaque) precursor (Cynomolgus monkey) FcRn Fcgrt IgG receptor Mus
musculus 365 (Ahouse et transporter (Mouse) al., 1993) FcRn large
subunit p51 precursor FcRn Fcgrt IgG receptor Rattus 366 (Simister
and transporter norvegicus Mostov, FcRn large (Rat) 1989) subunit
p51 precursor MRP mrp4 Fibrinogen- and Streptococcus 388 (Stenberg
et protein Ig-binding pyogenes al., 1992) protein precursor Protein
B cAMP factor Streptococcus 226 (Ruhlmann et agalactiae al., 1988)
protein A spa Immunoglobulin Staphylococcus 516 (Uhlen et al.,
G-binding aureus (strain 1984) protein A NCTC 8325) precursor
protein A spa Immunoglobulin Staphylococcus 508 (Shuttleworth
G-binding aureus et al., 1987) protein A precursor protein A spa
Immunoglobulin Staphylococcus 450 (Kuroda et G-binding aureus
(strain al., 2001) protein A Mu50/ATCC precursor 700699) protein A
spa Immunoglobulin Staphylococcus 450 (Kuroda et G-binding aureus
(strain al., 2001) protein A N315) precursor protein G spg
Immunoglobulin Streptococcus 448 (Fahnestock G-binding sp. group G
et al., 1986) protein G precursor protein G spg Immunoglobulin
Streptococcus 593 (Olsson et al., G-binding sp. group G 1987)
protein G precursor protein H Immunoglobulin Streptococcus 376
(Gomi et al., G-binding pyogenes 1990) protein H serotype M1
precursor Protein sbi sbi Immunoglobulin Staphylococcus 436 (Zhang
et al., G-binding aureus (strain 1998) protein sbi NCTC 8325-4)
precursor Allergen Allergen Asp fl Aspergillus 32 Asp fl 1 1 causes
an flavus allergic reaction in human. Binds to IgE and IgG Allergen
Allergen Asp fl Aspergillus 20 Asp fl 2 2 causes an flavus allergic
reaction in human. Binds to IgE and IgG Allergen Allergen Asp fl
Aspergillus 32 Asp fl 3 3 causes an flavus allergic reaction in
human. Binds to IgE and IgG Fc-epsilon IgE receptor Homo sapiens RI
displayed on (Human) Mast cells, Eosinophils and Basophils Fc-alpha
RI IgA (IgA1, Homo sapiens (CD86) IgA2) receptor (Human) displayed
on Macrophages C1q C1QA C1q is Homo sapiens NP_057075.1, multimeric
(Human) C1QB complex that NP_000482.3, binds to C1QC antibody Fc
NP_758957.1 composed of 6 A chains, 6 B chains and 6 C chains
[0109] As discussed above, a polypeptide may comprise an
aglycosylated antibody Fc domain capable of binding an FcR
polypeptide. In some aspects, the aglycosylated Fc domain may be
further defined as having a specific affinity for an FcR
polypeptide under physiological conditions. For instance an Fc
domain may have an equilibrium dissociation constant between about
10.sup.-6 M to about 10.sup.-9 M under physiological conditions.
Furthermore in some aspects an aglycosylated Fc domain may be
defined as comprising one or more amino acid substitution or
insertion relative to a wild-type sequence, such as a human
wild-type sequence.
[0110] Means of preparing such a polypeptide include those
discussed in WO 2008/137475, which is hereby incorporated by
reference. One can alternatively prepare such polypeptides directly
by genetic engineering techniques such as, for example, by
introducing selected amino acid substitutions or insertions into a
known Fc background, wherein the insertion or substitution provides
an improved FcR binding capability to aglycosylated Fc regions. The
inventors have identified as particularly preferred substitutions
for achieving such improved FcR binding as those at positions 331,
382 and/or 428 of the Fc domain (for example, see Nagaoka and
Akaike 2003; such as P331, E382 and/or M428 of the human IgG Fc
domain sequence as shown U.S. Patent Publ. US20060173170,
incorporated herein by reference), and still more preferred are one
or more substations defined by P331L, E382V, M428I or M428L.
[0111] In addition to substitutions described in Tables 5 and 6
below, a polypeptide may have a substitution that includes one or
more of 426, 229, 322, 350, 361, 372, 442, 402, 224, 430, 238, 436,
310, 313, 384, 372, 380 or 331 of the Fc domain, such as 5426,
C229, K322, T350, N361, F372, 5442, G402, H224, E430, P238, Y436,
H310, W313, N384, F372, E380 or P331 of the human IgG Fc domain,
with the specific preferred examples being a) E382 and M428; b)
N361, E382 and M428; c) N361, F372, E382 and M428; d) H310, K322,
T350, E382, 5426 and 5442; e) C229R, E382 and M428; f) W313 and
M428; g) E382, N384 and M428; h) E380, E382 and N384; i) N361, E382
and M428; j) E382, M428 and Y436; k) P238, E382, S426, M428 and
E430; l) E380, E382, N384, S426, M428 and E430; m) E382, S426, M428
and E430; n) H224, E382, S426, M428 and E430; o) P331; p) 5239,
1253, Q347, E382; q) E382, G402 and M428; and r) E382, P331 and
M428. Particular substitutions include a) E382V and M428I; b)
E382V; c) N361D, E382V and M428I; d) N361D, F372L, E382V and M428I;
e) H310Y, K322R, T350A, E382V, S426T and S442P; f) C229R, E382V and
M428I; g) W313R and M428I; h) E382T, N384D and M428I; i) E380R,
E382M and N384E; j) N361S, E382V and M428I; k) E382V, M428I and
Y436A; 1) P238S, E382V, S426V, M428L and E430H; m) E380D, E382V,
N384R, S426V, M428L and E430D; n) E382V, S4261I, M428L and E430S;
o) H224R, E382V, S426T, M428S and E430P; p) P331L; q) S239L, 1253T,
Q347L, E382V; r) E382V, G402D and M428I; and s) E382V, P331L and
M428I.
[0112] There may be various insertion points in the Fc domain that,
upon insertion of additional amino acids, provide improved FcR
binding capability. Insertions of 5 to 15 amino acids are
contemplated. In some embodiments, 10 amino acids are inserted,
such as between amino acids N297 and 5298 of an Fc domain, such as
a human IgG Fc domain. Particular insertions at this position (as
well as substitutions) include a) RTETPVYMVM (SEQ ID NO:79); b)
WQVFNKYTKP (SEQ ID NO:80); c) LGDGSPCKAN (SEQ ID NO:81); d)
EVPLVWMWVS (SEQ ID NO:82) together with F241L and K326E; and e)
EQWGSQFGCG (SEQ ID NO:83) together with V282A.
[0113] The Fc domain may be a human IgG Fc that comprises an amino
acid substitution at an amino acid residue corresponding to E382 of
the IgG Fc domain. Furthermore, an aglycosylated Fc domain may
comprise an amino acid sequence insertion (e.g., about 1 to 5 amino
acids) adjacent to an amino acid residue corresponding to E382 of
the IgG Fc domain. Thus, in some specific aspects an Fc domain may
comprise a hydrophobic amino acid substitution at E382 such as an E
to V substitution. Furthermore, in some aspects an Fc domain of the
invention may comprise an amino acid substitution at a residue
corresponding to M428 (e.g., M428 to I), S426, C229, H310, K322,
T350, N361, F372 or S442 of the human IgG Fc. In certain specific
embodiments, an aglycosylated Fc domain may comprise an amino acid
substitution corresponding to those found in the Fc11 as described
in WO 2008/137475, which is hereby incorporated by reference. Hence
in a very specific case an aglycosylated Fc domain may comprise the
amino acid sequence of SEQ ID NO:2 (Fc5).
[0114] In some embodiments, an aglycosylated Fc domain comprises a
specific binding affinity for an FcR such as human Fc.gamma.RIa,
Fc.gamma.RIIa, Fc.gamma.RIIb, Fc.gamma.RIIc, Fc.gamma.RIIIa,
Fc.gamma.RIIIb, Fc.alpha.RI or C1q. Thus, in some aspects an
aglycosylated Fc domain of the invention is defined as an Fc domain
with a specific affinity for Fc.gamma.RIa. Furthermore, such an Fc
domain may be defined as having an equilibrium dissociation
constant, with respect to Fc.gamma.RIa binding, of about 10.sup.-6
M to about 10.sup.-9 M under physiological conditions.
[0115] B. Modified Antibodies and Proteinaceous Compounds with
Heterologous Regions
[0116] Embodiments concern a proteinaceous compound that may
include amino acid sequences from more than one naturally occurring
or native polypeptides or proteins. Embodiments discussed above are
contemplated to apply to this section, and vice versa. For
instance, a modified antibody is one that contains a modified Fc
domain with an antigen binding domain. Moreover, the antibody may
have two different antigen binding regions, such as a different
region on each of the two heavy chains. Alternatively or
additionally, in some embodiments, there are polypeptides
comprising multiple heterologous peptides and/or polypeptides
("heterologous" meaning they are not derived from the same
polypeptide). A proteinaceous compound or molecule, for example,
could include a modified Fc domain with a protein binding region
that is not from an antibody. In some embodiments, there are
polypeptides comprising a modified Fc domain with a protein binding
region that binds a cell-surface receptor. These proteinaceous
molecule comprising multiple functional domains may be two or more
domains chemically conjugated to one another or it may be a fusion
protein of two or more polypeptides encoded by the same nucleic
acid molecule. It is contemplated that proteins or polypeptides may
include all or part of two or more heterologous polypeptides.
[0117] Thus, a multipolypeptide proteinaceous compound may be
comprised of all or part of a first polypeptide and all or part of
a second polypeptide, a third polypeptide, a fourth polypeptide, a
fifth polypeptide, a sixth polypeptide, a seventh polypeptide, an
eight polypeptide, a ninth polypeptide, a tenth polypeptide, or
more polypeptides.
[0118] Polypeptides or proteins (including antibodies) having an
antigen binding domain or region of an antibody and an
aglycosylated Fc domain can be used against any antigen or epitope,
including but not limited to proteins, subunits, domains, motifs,
and/or epitopes belonging to the following list of targets: 17-IA,
4-1BB, 4Dc, 6-keto-PGF1a, 8-iso-PGF2a, 8-oxo-dG, A1 Adenosine
Receptor, A33, ACE, ACE-2, Activin, Activin A, Activin AB, Activin
B, Activin C, Activin RIA, Activin RIA ALK-2, Activin RIB ALK-4,
Activin RIIA, Activin RIIB, ADAM, ADAM10, ADAM12, ADAM15,
ADAM17/TACE, ADAMS, ADAM9, ADAMTS, ADAMTS4, ADAMTS5, Addressins,
aFGF, ALCAM, ALK, ALK-1, ALK-7, alpha-1-antitrypsin, alpha-V/beta-1
antagonist, ANG, Ang, APAF-1, APE, APJ, APP, APRIL, AR, ARC, ART,
Artemin, anti-Id, ASPARTIC, Atrial natriuretic factor, av/b3
integrin, Axl, b2M, B7-1, B7-2, B7-H, B-lymphocyte Stimulator
(BlyS), BACE, BACE-1, Bad, BAFF, BAFF-R, Bag-1, BAK, Bax, BCA-1,
BCAM, Bc1, BCMA, BDNF, b-ECGF, bFGF, BID, Bik, BIM, BLC, BL-CAM,
BLK, BMP, BMP-2 BMP-2a, BMP-3 Osteogenin, BMP-4 BMP-2b, BMP-5,
BMP-6 Vgr-1, BMP-7 (OP-1), BMP-8 (BMP-8a, OP-2), BMPR, BMPR-IA
(ALK-3), BMPR-IB (ALK-6), BRK-2, RPK-1, BMPR-II (BRK-3), BMPs,
b-NGF, BOK, Bombesin, Bone-derived neurotrophic factor, BPDE,
BPDE-DNA, BTC, complement factor 3 (C3), C3a, C4, C5, C5a, C10,
CAl25, CAD-8, Calcitonin, cAMP, carcinoembryonic antigen (CEA),
carcinoma-associated antigen, Cathepsin A, Cathepsin B, Cathepsin
C/DPPI, Cathepsin D, Cathepsin E, Cathepsin H, Cathepsin L,
Cathepsin 0, Cathepsin S, Cathepsin V, Cathepsin X/ZIP, CBL, CCI,
CCK2, CCL, CCL1, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17,
CCL18, CCL19, CCL2, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25,
CCL26, CCL27, CCL28, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9/10,
CCR, CCR1, CCR10, CCR10, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8,
CCR9, CD1, CD2, CD3, CD3E, CD4, CD5, CD6, CD7, CD8, CD10, CD11a,
CD11b, CD11c, CD13, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22,
CD23, CD25, CD27L, CD28, CD29, CD30, CD30L, CD32, CD33 (p67
proteins), CD34, CD38, CD40, CD40L, CD44, CD45, CD46, CD49a, CD52,
CD54, CD55, CD56, CD61, CD64, CD66e, CD74, CD80 (B7-1), CD89, CD95,
CD123, CD137, CD138, CD140a, CD146, CD147, CD148, CD152, CD164,
CEACAM5, CFTR, cGMP, CINC, Clostridium botulinum toxin, Clostridium
perfringens toxin, CKb8-1, CLC, CMV, CMV UL, CNTF, CNTN-1, COX,
C-Ret, CRG-2, CT-1, CTACK, CTGF, CTLA-4, CX3CL1, CX3CR1, CXCL,
CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9,
CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCR,
CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, cytokeratin
tumor-associated antigen, DAN, DCC, DcR3, DC-SIGN, Decay
accelerating factor, des(1-3)-IGF-I (brain IGF-1), Dhh, digoxin,
DNAM-1, Dnase, Dpp, DPPIV/CD26, Dtk, EGAD, EDA, EDA-A1, EDA-A2,
EDAR, EGF, EGFR (ErbB-1), EMA, EMMPRIN, ENA, endothelin receptor,
Enkephalinase, eNOS, Eot, eotaxinl, EpCAM, Ephrin B2/EphB4, EPO,
ERCC, E-selectin, ET-1, Factor IIa, Factor VII, Factor VIIIc,
Factor IX, fibroblast activation protein (FAP), Fas, FcR1, FEN-1,
Ferritin, FGF, FGF-19, FGF-2, FGF3, FGF-8, FGFR, FGFR-3, Fibrin,
FL, FLIP, Flt-3, Flt-4, Follicle stimulating hormone, Fractalkine,
FZD1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9, FZD10, G250,
Gas 6, GCP-2, GCSF, GD2, GD3, GDF, GDF-1, GDF-3 (Vgr-2), GDF-5
(BMP-14, CDMP-1), GDF-6 (BMP-13, CDMP-2), GDF-7 (BMP-12, CDMP-3),
GDF-8 (Myostatin), GDF-9, GDF-15 (MIC-1), GDNF, GDNF, GFAP, GFRa-1,
GFR-alpha1, GFR-alpha2, GFR-alpha3, GITR, Glucagon, Glut 4,
glycoprotein IIb/IIIa (GP IIb/IIIa), GM-CSF, gp130, gp72, GRO,
Growth hormone releasing factor, Hapten (NP-cap or NIP-cap),
HB-EGF, HCC, HCMV gB envelope glycoprotein, HCMV) gH envelope
glycoprotein, HCMV UL, Hemopoietic growth factor (HGF), Hep B
gp120, heparanase, Her2, Her2/neu (ErbB-2), Her3 (ErbB-3), Her4
(ErbB-4), herpes simplex virus (HSV) gB glycoprotein, HSV gD
glycoprotein, HGFA, High molecular weight melanoma-associated
antigen (HMW-MM), HIV gp120, HIV IIIB gp120 V3 loop, HLA, HLA-DR,
HM1.24, HMFG PEM, HRG, Hrk, human cardiac myosin, human
cytomegalovirus (HCMV), human growth hormone (HGH), HVEM, 1-309,
IAP, ICAM, ICAM-1, ICAM-3, ICE, ICOS, IFNg, Ig, IgA receptor, IgE,
IGF, IGF binding proteins, IGF-1R, IGFBP, IGF-I, IGF-II, IL, IL-1,
IL-1R, IL-2, IL-2R, IL-4, IL-4R, IL-5, IL-5R, IL-6, IL-6R, IL-8,
IL-9, IL-10, IL-12, IL-13, IL-15, IL-18, IL-18R, IL-23, interferon
(INF)-alpha, INF-beta, INF-gamma, Inhibin, iNOS, Insulin A-chain,
Insulin B-chain, Insulin-like growth factor 1, integrin alpha2,
integrin alpha3, integrin alpha4, integrin alpha4/beta1, integrin
alpha4/beta7, integrin alpha5 (alphaV), integrin alpha5/beta1,
integrin alpha5/beta3, integrin alpha6, integrin beta1, integrin
beta2, interferon gamma, IP-10, I-TAC, JE, Kallikrein 2, Kallikrein
5, Kallikrein 6, Kallikrein 11, Kallikrein 12, Kallikrein 14,
Kallikrein 15, Kallikrein L1, Kallikrein L2, Kallikrein L3,
Kallikrein L4, KC, KDR, Keratinocyte Growth Factor (KGF), laminin
5, LAMP, LAP, LAP (TGF-1), Latent TGF-1, Latent TGF-1 bpl, LBP,
LDGF, LECT2, Lefty, Lewis-Y antigen, Lewis-Y related antigen,
LFA-1, LFA-3, Lfo, LIF, LIGHT, lipoproteins, LIX, LKN, Lptn,
L-Selectin, LT-a, LT-b, LTB4, LTBP-1, Lung surfactant, Luteinizing
hormone, Lymphotoxin Beta Receptor, Mac-1, MAdCAM, MAG, MAP2, MARC,
MCAM, MCAM, MCK-2, MCP, M-CSF, MDC, Mer, METALLOPROTEASES, MGDF
receptor, MGMT, MHC (HLA-DR), MIF, MIG, MIP, MIP-1-alpha, MK,
MMAC1, MMP, MMP-1, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15,
MMP-2, MMP-24, MMP-3, MMP-7, MMP-8, MMP-9, MPIF, Mpo, MSK, MSP,
mucin (Muc 1), MUC18, Muellerian-inhibitin substance, Mug, MuSK,
NAIP, NAP, NCAD, N-Cadherin, NCA 90, NCAM, NCAM, Neprilysin,
Neurotrophin-3, -4, or -6, Neurturin, Neuronal growth factor (NGF),
NGFR, NGF-beta, nNOS, NO, NOS, Npn, NRG-3, NT, NTN, OB, OGG1, OPG,
OPN, OSM, OX40L, OX40R, p150, p95, PADPr, Parathyroid hormone,
PARC, PARP, PBR, PBSF, PCAD, P-Cadherin, PCNA, PDGF, PDGF, PDK-1,
PECAM, PEM, PF4, PGE, PGF, PGI2, PGD2, PIN, PLA2, placental
alkaline phosphatase (PLAP), PIGF, PLP, PP14, Proinsulin,
Prorelaxin, Protein C, PS, PSA, PSCA, prostate specific membrane
antigen (PSMA), PTEN, PTHrp, Ptk, PTN, R51, RANK, RANKL, RANTES,
RANTES, Relaxin A-chain, Relaxin B-chain, renin, respiratory
syncytial virus (RSV) F, RSV Fgp, Ret, Rheumatoid factors, RLIP76,
RPA2, RSK, 5100, SCF/KL, SDF-1, SERINE, Serum albumin, sFRP-3, Shh,
SIGIRR, SK-1, SLAM, SLPI, SMAC, SMDF, SMOH, SOD, SPARC, Stat,
STEAP, STEAP-II, TACE, TACI, TAG-72 (tumor-associated
glycoprotein-72), TARC, TCA-3, T-cell receptors (e.g., T-cell
receptor alpha/beta), TdT, TECK, TEM1, TEM5, TEM7, TEM8, TERT,
testicular PLAP-like alkaline phosphatase, TfR, TGF, TGF-alpha,
TGF-beta, TGF-beta Pan Specific, TGF-beta RI (ALK-5), TGF-beta RII,
TGF-beta Rill), TGF-beta RIII, TGF-beta1, TGF-beta2, TGF-beta3,
TGF-beta4, TGF-beta5, Thrombin, Thymus Ck-1, Thyroid stimulating
hormone, Tie, TIMP, TIQ, Tissue Factor, TMEFF2, Tmpo, TMPRSS2, TNF,
TNF-alpha, TNF-alpha beta, TNF-beta2, TNFc, TNF-RI, TNF-RII,
TNFRSF10A (TRAIL R1 Apo-2, DR4), TNFRSF10B (TRAIL R2 DR5, KILLER,
TRICK-2A, TRICK-B), TNFRSF10C (TRAIL R3 DcR1, LIT, TRID), TNFRSF10D
(TRAIL R4 DcR2, TRUNDD), TNFRSF11A (RANK ODF R, TRANCE R),
TNFRSF11B (OPG OCIF, TR1), TNFRSF12 (TWEAK R FN14), TNFRSF13B
(TACI), TNFRSF13C (BAFF R), TNFRSF14 (HVEM ATAR, HveA, LIGHT R,
TR2), TNFRSF16 (NGFR p75NTR), TNFRSF17 (BCMA), TNFRSF18 (GITR
AITR), TNFRSF19 (TROY TAJ, TRADE), TNFRSF19L (RELT), TNFRSF1A (TNF
RI CD120a, p55-60), TNFRSF1B (TNF RII CD120b, p'75-80), TNFRSF26
(TNFRH3), TNFRSF3 (LTbR TNF RIII, TNFC R), TNFRSF4 (0X40 ACT35,
TXGP1 R), TNFRSF5 (CD40 p50), TNFRSF6 (Fas Apo-1, APT1, CD95),
TNFRSF6B (DcR3 M68, TR6), TNFRSF7 (CD27), TNFRSF8 (CD30), TNFRSF9
(4-1BB CD137, ILA), TNFRSF21 (DR6), TNFRSF22 (DcTRAIL R2 TNFRH2),
TNFRST23 (DcTRAIL R1 TNFRH1), TNFRSF25 (DR3 Apo-3, LARD, TR-3,
TRAMP, WSL-1), TNFSF10 (TRAIL Apo-2 Ligand, TL2), TNFSF11
(TRANCE/RANK Ligand ODF, OPG Ligand), TNFSF12 (TWEAK Apo-3 Ligand,
DR3 Ligand), TNFSF13 (APRIL TALL2), TNFSF13B (BAFF BLYS, TALL1,
THANK, TNFSF20), TNFSF14 (LIGHT HVEM Ligand, LTg), TNFSF15
(TL1A/VEGI), TNFSF18 (GITR Ligand AITR Ligand, TL6), TNFSF1A (TNF-a
Conectin, DIF, TNFSF2), TNFSF1B (TNF-b LTa, TNFSF1), TNFSF3 (LTb
TNFC, p33), TNFSF4 (0X40 Ligand gp34, TXGP1), TNFSF5 (CD40 Ligand
CD154, gp39, HIGM1, IMD3, TRAP), TNFSF6 (Fas Ligand Apo-1 Ligand,
APT1 Ligand), TNFSF7 (CD27 Ligand CD70), TNFSF8 (CD30 Ligand
CD153), TNFSF9 (4-1BB Ligand CD137 Ligand), TP-1, t-PA, Tpo, TRAIL,
TRAIL R, TRAIL-R1, TRAIL-R2, TRANCE, transferring receptor, TRF,
Trk, TROP-2, TSG, TSLP, tumor-associated antigen CA 125,
tumor-associated antigen expressing Lewis Y related carbohydrate,
TWEAK, TXB2, Ung, uPAR, uPAR-1, Urokinase, VCAM, VCAM-1, VECAD,
VE-Cadherin, VE-cadherin-2, VEFGR-1 (flt-1), VEGF, VEGFR, VEGFR-3
(fit-4), VEGI, VIM, Viral antigens, VLA, VLA-1, VLA-4, VNR
integrin, von Willebrands factor, WIF-1, WNT1, WNT2, WNT2B/13,
WNT3, WNT3A, WNT4, WNT5A, WNT5B, WNT6, WNT7A, WNT7B, WNT8A, WNT8B,
WNT9A, WNT9A, WNT9B, WNT10A, WNT10B, WNT11, WNT16, XCL1, XCL2,
XCR1, XCR1, XEDAR, XIAP, XPD, and receptors for hormones and growth
factors. In some embodiments, a polypeptide or protein has an
antigen binding domain specific for one or more cell surface tumor
antigens. Methods and compositions may be employed to target a
tumor cell for ADCC.
[0119] Fc domains can bind to an FcR, however, it is contemplated
that ADCC can be directed not only through an antigen binding
domain on the polypeptide containing the Fc domain, but through
some other protein binding domain. Consequently, embodiments
concern an Fc domain and a heterologous non-antigen binding domain.
In certain embodiments, the non-antigen binding domain bind to the
cell surface. Therefore, these agents require either chemical
conjugation to or fusion with agents/proteins which are capable of
binding to specific target cells. Embodiments further include
adjoining all or part of an aglycosylated Fc domain to all or part
of any of the proteins listed in Table 2. It is contemplated that
embodiments include, but are not limited to, the examples provided
in Table 2 and the description herein.
TABLE-US-00002 TABLE 2 Protein Genus Subgenus Species Subspecies 1)
Antibodies Polyclonal Monoclonal non-recombinant recombinant
chimeric single chain diabody multimeric 2) Ligands for cell- IL-1,
IL-2, IL-3, IL- surface receptors 4, IL-5, IL-6, IL-7, IL-8, IL-9,
IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18,
IL-19 Cytokines/growth factors Cytokines/growth factors for
receptor tyrosine kinases GM-CSF, G-CSF, M-CSF, EGF, VEGF, FGF,
PDGF, HGF, GDNF, Trk, AXL, LTK, TIE, ROR, DDR, KLG, RYK, MuSK
ligands 3) Non-Ab binding protein for cell- surface molecule
Binders of cell surface proteins Cluster of differentiation (CD)
molecules
[0120] A ligand for receptor may be employed to target a cell
expressing on its surface the receptor for the ligand. Ligands also
include, for instance, CD95 ligand, TRAIL, TNF (such as
TNF-.alpha.. or TNF-.beta.), growth factors, including those
discussed above, such as VEGF and cytokines, such as interferons or
interleukins and variants thereof.
[0121] Embodiments with multiple domains are also contemplated,
such as a VEGF Trap fusion protein that includes the second
extracellular domain of the VEGF receptor 1 (Flt-1) with the third
domain of the VEGF receptor 2 (KDR/FIK-1) and an IgG Fc region.
[0122] a. Fusion and Conjugated Proteins
[0123] A specialized kind of insertional variant is the fusion
protein. This molecule generally has all or a substantial portion
of the native molecule, linked at the N- or C-terminus, to all or a
portion of a second polypeptide.
[0124] Embodiments also concern conjugated polypeptides, such as
translated proteins, polypeptides and peptides, that are linked to
at least one agent to form a modified protein or polypeptide. In
order to increase the efficacy of molecules as diagnostic or
therapeutic agents, it is conventional to link or covalently bind
or complex at least one desired molecule or moiety. Such a molecule
or moiety may be, but is not limited to, at least one effector or
reporter molecule. Effector molecules comprise molecules having a
desired activity, e.g., cytotoxic activity. Non-limiting examples
of effector molecules which have been attached to antibodies
include toxins, anti-tumor agents, therapeutic enzymes,
radio-labeled nucleotides, antiviral agents, chelating agents,
cytokines, growth factors, and oligo- or poly-nucleotides. By
contrast, a reporter molecule is defined as any moiety that may be
detected using an assay. Non-limiting examples of reporter
molecules which have been conjugated to antibodies include enzymes,
radiolabels, haptens, fluorescent labels, phosphorescent molecules,
chemiluminescent molecules, chromophores, luminescent molecules,
photoaffinity molecules, colored particles or ligands, such as
biotin.
[0125] Any antibody of sufficient selectivity, specificity or
affinity may be employed as the basis for an antibody conjugate.
Such properties may be evaluated using conventional immunological
screening methodology known to those of skill in the art. Sites for
binding to biological active molecules in the antibody molecule, in
addition to the canonical antigen binding sites, include sites that
reside in the variable domain that can bind pathogens, B-cell
superantigens, the T cell co-receptor CD4 and the HIV-1 envelope
(Sasso et al., 1989; Shorki et al., 1991; Silvermann et al., 1995;
Cleary et al., 1994; Lenert et al., 1990; Berberian et al., 1993;
Kreier et al., 1991). In addition, the variable domain is involved
in antibody self-binding (Kang et al., 1988), and contains epitopes
(idiotopes) recognized by anti-antibodies (Kohler et al.,
1989).
[0126] Certain examples of antibody conjugates are those conjugates
in which the antibody is linked to a detectable label. "Detectable
labels" are compounds and/or elements that can be detected due to
their specific functional properties, and/or chemical
characteristics, the use of which allows the antibody to which they
are attached to be detected, and/or further quantified if desired.
Another such example is the formation of a conjugate comprising an
antibody linked to a cytotoxic or anti-cellular agent, and may be
termed "immunotoxins."
[0127] Amino acids such as selectively-cleavable linkers, synthetic
linkers, or other amino acid sequences may be used to separate
proteinaceous moieties.
[0128] C. Protein Purification
[0129] While some of the embodiments involve recombinant proteins,
embodiments may involve methods and processes for purifying
proteins, including modified proteins and recombinant proteins.
Generally, these techniques involve, at one level, the crude
fractionation of the cellular milieu to polypeptide and
non-polypeptide fractions. Having separated the polypeptide from
other proteins, the polypeptide of interest may be further purified
using chromatographic and electrophoretic techniques to achieve
partial or complete purification (or purification to homogeneity).
Analytical methods particularly suited to the preparation are
ion-exchange chromatography, exclusion chromatography;
polyacrylamide gel electrophoresis; isoelectric focusing. A
particularly efficient method of purifying peptides is fast protein
liquid chromatography or even HPLC. In addition, the conditions
under which such techniques are executed may be affect
characteristics, such as functional activity, of the purified
molecules.
[0130] Certain aspects concern the purification, and in particular
embodiments, the substantial purification, of an encoded protein or
peptide. The term "purified protein or peptide" as used herein, is
intended to refer to a composition, isolatable from other
components, wherein the protein or peptide is purified to any
degree relative to its naturally-obtainable state. A purified
protein or peptide therefore also refers to a protein or peptide,
free from the environment in which it may naturally occur. A
"substantially purified" protein or peptide
[0131] Generally, "purified" will refer to a protein or peptide
composition that has been subjected to fractionation to remove
various other components, and which composition substantially
retains its expressed biological activity. Where the term
"substantially purified" is used, this designation will refer to a
composition in which the protein or peptide forms the major
component of the composition, such as constituting about 50%, about
60%, about 70%, about 80%, about 90%, about 95%, about 96%, about
97%, about 98%, about 99%, about 99.2%, about 99.4%, about 99.6%,
about 99.8%, about 99.9% or more of the proteins in the
composition.
[0132] Various methods for quantifying the degree of purification
of the protein or peptide will be known to those of skill in the
art in light of the present disclosure. These include, for example,
determining the specific activity of an active fraction, or
assessing the amount of polypeptides within a fraction by SDS/PAGE
analysis. A preferred method for assessing the purity of a fraction
is to calculate the specific activity of the fraction, to compare
it to the specific activity of the initial extract, and to thus
calculate the degree of purity, herein assessed by a "-fold
purification number." The actual units used to represent the amount
of activity will, of course, be dependent upon the particular assay
technique chosen to follow the purification and whether or not the
expressed protein or peptide exhibits a detectable activity.
[0133] Various techniques suitable for use in protein purification
will be well known to those of skill in the art. These include, for
example, precipitation with ammonium sulphate, PEG, antibodies and
the like or by heat denaturation, followed by centrifugation;
chromatography steps such as ion exchange, gel filtration, reverse
phase, hydroxylapatite and affinity chromatography; isoelectric
focusing; gel electrophoresis; and combinations of such and other
techniques. As is generally known in the art, it is believed that
the order of conducting the various purification steps may be
changed, or that certain steps may be omitted, and still result in
a suitable method for the preparation of a substantially purified
protein or peptide.
[0134] There is no general requirement that the protein or peptide
always be provided in their most purified state. Indeed, it is
contemplated that less substantially purified products will have
utility in certain embodiments. Partial purification may be
accomplished by using fewer purification steps in combination, or
by utilizing different forms of the same general purification
scheme. For example, it is appreciated that a cation-exchange
column chromatography performed utilizing an HPLC apparatus will
generally result in a greater "-fold" purification than the same
technique utilizing a low pressure chromatography system. Methods
exhibiting a lower degree of relative purification may have
advantages in total recovery of protein product, or in maintaining
the activity of an expressed protein.
[0135] It is known that the migration of a polypeptide can vary,
sometimes significantly, with different conditions of SDS/PAGE
(Capaldi et al., 1977). It will therefore be appreciated that under
differing electrophoresis conditions, the apparent molecular
weights of purified or partially purified expression products may
vary.
[0136] The use of a peptide tag in combination with the methods and
compositions is also contemplated. A tag takes advantage of an
interaction between two polypeptides. A portion of one of the
polypeptides that is involved in the interaction may used as a tag.
For instance, the binding region of glutathione S transferase (GST)
may be used as a tag such that glutathione beads can be used to
enrich for a compound containing the GST tag. An epitope tag, which
an amino acid region recognized by an antibody or T cell receptor,
may be used. The tag may be encoded by a nucleic acid segment that
is operatively linked to a nucleic acid segment encoding a modified
protein such that a fusion protein is encoded by the nucleic acid
molecule. Other suitable fusion proteins are those with
.beta.-galactosidase, ubiquitin, hexahistidine (6.times.His), or
the like.
IV. ANTIBODY FC LIBRARIES
[0137] Examples of techniques that could be employed in conjunction
with embodiments for creation of diverse antibody Fc domains and/or
antibodies comprising such domains may employ techniques similar to
those for expression of immunoglobulin heavy chain libraries
described in U.S. Pat. No. 5,824,520. Previously employed Fc
libraries are discussed in WO 2008/137475, which is specifically
incorporated by reference.
V. SCREENING ANTIBODY FC DOMAINS
[0138] There are embodiments involving methods for identifying
molecules capable of binding to a particular FcR. They are
described herein, as well as in PCT Application WO 2008/137475,
which is hereby specifically incorporated by reference in its
entirety. The binding polypeptides screened may comprise a large
library of diverse candidate Fc domains, or, alternatively, may
comprise particular classes of Fc domains (e.g., engineered point
mutations or amino acid insertions) selected with an eye towards
structural attributes that are believed to make them more likely to
bind the target ligand. In one embodiment, the candidate binding
protein is an intact antibody, or a fragment or portion thereof
comprising an Fc domain.
[0139] To identify a candidate Fc domain capable of binding a
target ligand, one may carry out the steps of: providing a
population of Gram negative bacterial cells that express a distinct
antibody Fc domain; admixing the bacteria or phages and at least a
first labeled or immobilized target ligand (FcR polypeptide)
capable of contacting the antibody and identifying at least a first
bacterium expressing a molecule capable of binding the target
ligand.
[0140] In some aspects of the aforementioned method, the binding
between antibody Fc domain and a labeled FcR polypeptide will
prevent diffusing out of a bacterial cell. In this way, molecules
of the labeled ligand can be retained in the periplasm of the
bacterium comprising a permeabilized outer membrane. Alternatively,
the periplasm can be removed, whereby the Fc domain will cause
retention of the bound candidate molecule since Fc domains are
shown to associate with the inner membrane. The labeling may then
be used to isolate the cell expressing a binding polypeptide
capable of binding the FcR polypeptide, and in this way, the gene
encoding the Fc domain polypeptide isolated. The molecule capable
of binding the target ligand may then be produced in large
quantities using in vivo or ex vivo expression methods, and then
used for any desired application, for example, for diagnostic or
therapeutic applications. Furthermore, it will be understood that
isolated antibody Fc domains identified may be used to construct an
antibody fragment or full-length antibody comprising an antigen
binding domain.
[0141] In further embodiments, methods for producing bacteria of
the invention, may comprise at least two rounds of selection (step
c) wherein the sub-population of bacterial cells obtained in the
first round of selection is subjected to at least a second round of
selection based on the binding of the candidate antibody Fc domain
to an FcR. Furthermore in some aspects the sub-population of
bacterial cells obtained in the first round of selection may be
grown under permissive conditions prior to a second selection (to
expand the total number of cells). Thus, in some aspects, methods
may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more rounds of
selection. Furthermore, in some aspects, a sub-population of
bacterial cells obtained from each round of selection will be grown
under permissive conditions before a subsequent round of selection.
Cells isolated following one or more such rounds of selection may
be subjected to additional rounds of mutagenesis. In some cases,
selection will be performed after removing FcR polypeptide that is
not bound to the antibody. Furthermore, in some cases the
stringency of selection may be modified by adjusting the pH, salt
concentration, or temperature of a solution comprising bacteria
that display antibodies. Thus, in some aspects, it may be preferred
that a bacterial cell of the invention is grown at a
sub-physiological temperature such as at about 25.degree. C.
[0142] In still further aspects, a method of producing a bacterial
cell according to the invention may be further defined as a method
of producing a nucleic acid sequence encoding an Fc domain that
binds to at least a first FcR. Thus, a bacterial cell produced by
the methods herein may be used to clone a nucleic acid sequence
encoding the Fc domain having a specific affinity for an FcR
polypeptide. Methods for isolating and amplifying such a nucleic
acid from a cell for example by PCR are well known in the art and
further described below. Thus, a nucleic acid sequence produced by
the forgoing methods is included as part of the instant invention.
Furthermore, such a sequence maybe expressed in a cell to produce
an Fc domain having a specific affinity for an FcR. Thus, in some
aspects, the invention provides a method for producing an Fc domain
having a specific affinity for an FcR. Furthermore, the invention
includes antibody Fc domains produced by the methods of the
invention. It will be understood however that the antibody Fc
domains produced by such a screen may be combine with antibody
variable regions that have an affinity for a particular target
ligand and these antibodies are also included as part of the
invention.
[0143] A. Cloning of Fc domain Coding Sequences
[0144] The binding affinity of an antibody Fc or other binding
protein can, for example, be determined by the Scatchard analysis
of Munson & Pollard (1980). Alternatively, binding affinity can
be determined by surface plasmon resonance or any other well known
method for determining the kinetics and equilibrium constants for
protein:protein interactions. After a bacterial cell is identified
that produces molecules of the desired specificity, affinity,
and/or activity, the corresponding coding sequence may be cloned.
In this manner, DNA encoding the molecule can be isolated and
sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the antibody or binding protein).
[0145] Once isolated, the antibody Fc domain DNA may be placed into
expression vectors, which can then transfected into host cells such
as bacteria. The DNA also may be modified, for example, by the
addition of sequence for human heavy and light chain variable
domains, or by covalently joining to the immunoglobulin coding
sequence all or part of the coding sequence for a
non-immunoglobulin polypeptide. In that manner, "chimeric" or
"hybrid" binding proteins are prepared to have the desired binding
specificity. For instance, an identified antibody Fc domain may be
fused to a therapeutic polypeptide or a toxin and used to target
cells (in vitro or in vivo) that express a particular FcR.
[0146] Chimeric or hybrid Fc domains also may be prepared in vitro
using known methods in synthetic protein chemistry, including those
involving crosslinking agents. For example, targeted-toxins may be
constructed using a disulfide exchange reaction or by forming a
thioether bond. Examples of suitable reagents for this purpose
include iminothiolate and methyl-4-mercaptobutyrimidate.
[0147] It will be understood by those of skill in the art that
nucleic acids may be cloned from viable or inviable cells. In the
case of inviable cells, for example, it may be desired to use
amplification of the cloned DNA, for example, using PCR. This may
also be carried out using viable cells either with or without
further growth of cells.
[0148] B. Labeled Ligands
[0149] In one embodiment, an Fc domain is isolated which has
affinity for a labeled FcR polypeptide. By permeabilization and/or
removal of the periplasmic membrane of a Gram negative bacterium in
accordance with the invention, labeled ligands of potentially any
size may be screened. In the absence of removal of the periplasmic
membrane, it will typically be preferable that the labeled ligand
is less that 50,000 Da in size in order to allow efficient
diffusion of the ligand across the bacterial periplasmic
membrane.
[0150] As indicated above, it will typically be desired to provide
an FcR polypeptide which has been labeled with one or more
detectable agent(s). This can be carried out, for example, by
linking the ligand to at least one detectable agent to form a
conjugate. For example, it is conventional to link or covalently
bind or complex at least one detectable molecule or moiety. A
"label" or "detectable label" is a compound and/or element that can
be detected due to specific functional properties, and/or chemical
characteristics, the use of which allows the ligand to which it is
attached to be detected, and/or further quantified if desired.
Examples of labels which could be used include, but are not limited
to, enzymes, radiolabels, haptens, fluorescent labels,
phosphorescent molecules, chemiluminescent molecules, chromophores,
luminescent molecules, photoaffinity molecules, colored particles
or ligands, such as biotin.
[0151] In one embodiment of the invention, a visually-detectable
marker is used such that automated screening of cells for the label
can be carried out. In particular, fluorescent labels are
beneficial in that they allow use of flow cytometry for isolation
of cells expressing a desired binding protein or antibody. Examples
of agents that may be detected by visualization with an appropriate
instrument are known in the art, as are methods for their
attachment to a desired ligand (see, e.g., U.S. Pat. Nos.
5,021,236; 4,938,948; and 4,472,509, each incorporated herein by
reference). Such agents can include paramagnetic ions; radioactive
isotopes; fluorochromes; NMR-detectable substances and substances
for X-ray imaging.
[0152] Another type of FcR conjugate is where the ligand is linked
to a secondary binding molecule and/or to an enzyme (an enzyme tag)
that will generate a colored product upon contact with a
chromogenic substrate. Examples of such enzymes include urease,
alkaline phosphatase, (horseradish) hydrogen peroxidase or glucose
oxidase. I n such instances, it will be desired that cells selected
remain viable. Preferred secondary binding ligands are biotin
and/or avidin and streptavidin compounds. The use of such labels is
well known to those of skill in the art and are described, for
example, in U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350;
3,996,345; 4,277,437; 4,275,149 and 4,366,241; each incorporated
herein by reference.
[0153] Molecules containing azido groups also may be used to form
covalent bonds to proteins through reactive nitrene intermediates
that are generated by low intensity ultraviolet light (Potter &
Haley, 1983). In particular, 2- and 8-azido analogues of purine
nucleotides have been used as site-directed photoprobes to identify
nucleotide-binding proteins in crude cell extracts (Owens &
Haley, 1987; Atherton et al., 1985). The 2- and 8-azido nucleotides
have also been used to map nucleotide-binding domains of purified
proteins (Khatoon et al., 1989; King et al., 1989; and Dholakia et
al., 1989) and may be used as ligand binding agents.
[0154] Labeling can be carried out by any of the techniques well
known to those of skill in the art. For instance, FcR polypeptides
can be labeled by contacting the ligand with the desired label and
a chemical oxidizing agent such as sodium hypochlorite, or an
enzymatic oxidizing agent, such as lactoperoxidase. Similarly, a
ligand exchange process could be used. Alternatively, direct
labeling techniques may be used, e.g., by incubating the label, a
reducing agent such as SNCl.sub.2, a buffer solution such as
sodium-potassium phthalate solution, and the ligand. Intermediary
functional groups on the ligand could also be used, for example, to
bind labels to a ligand in the presence of
diethylenetriaminepentaacetic acid (DTPA) or ethylene
diaminetetracetic acid (EDTA).
[0155] Other methods are also known in the art for the attachment
or conjugation of a ligand to its conjugate moiety. Some attachment
methods involve the use of an organic chelating agent such as
diethylenetriaminepentaacetic acid anhydride (DTPA);
ethylenetriaminetetraacetic acid; N-chloro-p-toluenesulfonamide;
and/or tetrachloro-3.alpha.-6.alpha.-diphenylglycouril-3 attached
to the ligand (U.S. Pat. Nos. 4,472,509 and 4,938,948, each
incorporated herein by reference). FcR polypeptides also may be
reacted with an enzyme in the presence of a coupling agent such as
glutaraldehyde or periodate. Conjugates with fluorescein markers
can be prepared in the presence of these coupling agents or by
reaction with an isothiocyanate. In U.S. Pat. No. 4,938,948,
imaging of breast tumors is achieved using monoclonal antibodies
and the detectable imaging moieties are bound to the antibody using
linkers such as methyl-p-hydroxybenzimidate or
N-succinimidyl-3-(4-hydroxyphenyl)propionate. In still further
aspects an FcR polypeptide may be fused to a reporter protein such
as an enzyme as described supra or a fluorescence protein.
[0156] The ability to specifically label periplasmic expressed
proteins with appropriate fluorescent ligands also has applications
other than library screening. Specifically labeling with
fluorescent ligands and flow cytometry can be used for monitoring
production of Fc domains during protein manufacturing.
[0157] Once an Fc domain has been isolated, it may be desired to
link the molecule to at least one agent to form a conjugate to
enhance the utility of that molecule. For example, in order to
increase the efficacy of Fc domains or antibody molecules as
diagnostic or therapeutic agents, it is conventional to link or
covalently bind or complex at least one desired molecule or moiety.
Such a molecule or moiety may be, but is not limited to, at least
one effector or reporter molecule. Effector molecules comprise
molecules having a desired activity, e.g., cytotoxic activity.
Non-limiting examples of effector molecules which have been
attached to antibodies include toxins, anti-tumor agents,
therapeutic enzymes, radio-labeled nucleotides, antiviral agents,
chelating agents, cytokines, growth factors, and oligo- or
poly-nucleotides. By contrast, a reporter molecule is defined as
any moiety which may be detected using an assay. Techniques for
labeling such a molecule are known to those of skill in the art and
have been described herein above.
[0158] Labeled binding proteins such as Fc domains which have been
prepared in accordance with the invention may also then be
employed, for example, in immunodetection methods for binding,
purifying, removing, quantifying and/or otherwise generally
detecting biological components such as protein(s), polypeptide(s)
or peptide(s). Some immunodetection methods include enzyme linked
immunosorbent assay (ELISA), radioimmunoassay (RIA),
immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay,
bioluminescent assay, and Western blot to mention a few. The steps
of various useful immunodetection methods have been described in
the scientific literature, such as, e.g., Doolittle and Ben-Zeev,
1999; Gulbis and Galand, 1993; and De Jager R et al., 1993, each
incorporated herein by reference. Such techniques include binding
assays such as the various types of enzyme linked immunosorbent
assays (ELISAs) and/or radioimmunoassays (RIA) known in the
art.
[0159] The Fc domain molecules, including antibodies, may be used,
for example, in conjunction with both fresh-frozen and/or
formalin-fixed, paraffin-embedded tissue blocks prepared for study
by immunohistochemistry (IHC). The method of preparing tissue
blocks from these particulate specimens has been successfully used
in previous IHC studies of various prognostic factors, and/or is
well known to those of skill in the art (Abbondanzo et al.,
1990).
VI. AUTOMATED SCREENING WITH FLOW CYTOMETRY
[0160] In one embodiment of the invention, fluorescence activated
cell sorting (FACS) screening or other automated flow cytometric
techniques may be used for the efficient isolation of a bacterial
cell comprising a labeled ligand bound to an Fc domain. Instruments
for carrying out flow cytometry are known to those of skill in the
art and are commercially available to the public. Examples of such
instruments include FACS Star Plus, FACScan and FACSort instruments
from Becton Dickinson (Foster City, Calif.) Epics C from Coulter
Epics Division (Hialeah, Fla.) and MOFLO.TM. from Cytomation
(Colorado Springs, Co).
[0161] Flow cytometric techniques in general involve the separation
of cells or other particles in a liquid sample. Typically, the
purpose of flow cytometry is to analyze the separated particles for
one or more characteristics thereof, for example, presence of a
labeled ligand or other molecule. The basis steps of flow cytometry
involve the direction of a fluid sample through an apparatus such
that a liquid stream passes through a sensing region. The particles
should pass one at a time by the sensor and are categorized base on
size, refraction, light scattering, opacity, roughness, shape,
fluorescence, etc.
[0162] Rapid quantitative analysis of cells proves useful in
biomedical research and medicine. Apparati permit quantitative
multiparameter analysis of cellular properties at rates of several
thousand cells per second. These instruments provide the ability to
differentiate among cell types. Data are often displayed in
one-dimensional (histogram) or two-dimensional (contour plot,
scatter plot) frequency distributions of measured variables. The
partitioning of multiparameter data files involves consecutive use
of the interactive one- or two-dimensional graphics programs.
[0163] Quantitative analysis of multiparameter flow cytometric data
for rapid cell detection consists of two stages: cell class
characterization and sample processing. In general, the process of
cell class characterization partitions the cell feature into cells
of interest and not of interest. Then, in sample processing, each
cell is classified in one of the two categories according to the
region in which it falls. Analysis of the class of cells is very
important, as high detection performance may be expected only if an
appropriate characteristic of the cells is obtained.
[0164] Not only is cell analysis performed by flow cytometry, but
so too is sorting of cells. In U.S. Pat. No. 3,826,364, an
apparatus is disclosed which physically separates particles, such
as functionally different cell types. In this machine, a laser
provides illumination which is focused on the stream of particles
by a suitable lens or lens system so that there is highly localized
scatter from the particles therein. In addition, high intensity
source illumination is directed onto the stream of particles for
the excitation of fluorescent particles in the stream. Certain
particles in the stream may be selectively charged and then
separated by deflecting them into designated receptacles. A classic
form of this separation is via fluorescent-tagged antibodies, which
are used to mark one or more cell types for separation.
[0165] Other examples of methods for flow cytometry that could
include, but are not limited to, those described in U.S. Pat. Nos.
4,284,412; 4,989,977; 4,498,766; 5,478,722; 4,857,451; 4,774,189;
4,767,206; 4,714,682; 5,160,974; and 4,661,913, each of the
disclosures of which are specifically incorporated herein by
reference.
[0166] For the present invention, an important aspect of flow
cytometry is that multiple rounds of screening can be carried out
sequentially. Cells may be isolated from an initial round of
sorting and immediately reintroduced into the flow cytometer and
screened again to improve the stringency of the screen. Another
advantage known to those of skill in the art is that nonviable
cells can be recovered using flow cytometry. Since flow cytometry
is essentially a particle sorting technology, the ability of a cell
to grow or propagate is not necessary. Techniques for the recovery
of nucleic acids from such non-viable cells are well known in the
art and may include, for example, use of template-dependent
amplification techniques including PCR.
VII. AUTOMATED SCREENING WITH FLOW CYTOMETRY
[0167] Nucleic acid-based expression systems may find use, in
certain embodiments of the invention, for the expression of
recombinant proteins. For example, one embodiment of the invention
involves transformation of Gram negative bacteria with the coding
sequences for an antibody Fc domain, or preferably a plurality of
distinct Fc domains.
VIII. NUCLEIC ACID-BASED EXPRESSION SYSTEMS
[0168] Nucleic acid-based expression systems may find use, in
certain embodiments of the invention, for the expression of
recombinant proteins. For example, one embodiment of the invention
involves transformation of Gram negative bacteria with the coding
sequences for an antibody Fc domain, or preferably a plurality of
distinct Fc domains.
[0169] A. Methods of Nucleic Acid Delivery
[0170] Certain aspects of the invention may comprise delivery of
nucleic acids to target cells (e.g., gram negative bacteria). For
example, bacterial host cells may be transformed with nucleic acids
encoding candidate Fc domains potentially capable binding an FcR.
In particular embodiments of the invention, it may be desired to
target the expression to the periplasm of the bacteria.
Transformation of eukaryotic host cells may similarly find use in
the expression of various candidate molecules identified as capable
of binding a target ligand.
[0171] Suitable methods for nucleic acid delivery for
transformation of a cell are believed to include virtually any
method by which a nucleic acid (e.g., DNA) can be introduced into
such a cell, or even an organelle thereof. Such methods include,
but are not limited to, direct delivery of DNA such as by injection
(U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448,
5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each
incorporated herein by reference), including microinjection
(Harland and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated
herein by reference); by electroporation (U.S. Pat. No. 5,384,253,
incorporated herein by reference); by calcium phosphate
precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987;
Rippe et al., 1990); by using DEAE-dextran followed by polyethylene
glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al.,
1987); by liposome mediated transfection (Nicolau and Sene, 1982;
Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980;
Kaneda et al., 1989; Kato et al., 1991); by microprojectile
bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S.
Pat. Nos. 5,610,042; 5,322,783, 5,563,055, 5,550,318, 5,538,877 and
5,538,880, and each incorporated herein by reference); or by
agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S.
Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by
reference); by desiccation/inhibition-mediated DNA uptake (Potrykus
et al., 1985). Through the application of techniques such as these,
cells may be stably or transiently transformed.
[0172] B. Vectors
[0173] Vectors may find use with the current invention, for
example, in the transformation of a Gram negative bacterium with a
nucleic acid sequence encoding a candidate Fc domain which one
wishes to screen for ability to bind a target FcR. In one
embodiment of the invention, an entire heterogeneous "library" of
nucleic acid sequences encoding target polypeptides may be
introduced into a population of bacteria, thereby allowing
screening of the entire library. The term "vector" is used to refer
to a carrier nucleic acid molecule into which a nucleic acid
sequence can be inserted for introduction into a cell where it can
be replicated. A nucleic acid sequence can be "exogenous," or
"heterologous", which means that it is foreign to the cell into
which the vector is being introduced or that the sequence is
homologous to a sequence in the cell but in a position within the
host cell nucleic acid in which the sequence is ordinarily not
found. Vectors include plasmids, cosmids and viruses (e.g.,
bacteriophage). One of skill in the art may construct a vector
through standard recombinant techniques, which are described in
Maniatis et al., 1988 and Ausubel et al., 1994, both of which
references are incorporated herein by reference.
[0174] The term "expression vector" refers to a vector containing a
nucleic acid sequence coding for at least part of a gene product
capable of being transcribed. In some cases, RNA molecules are then
translated into a protein, polypeptide, or peptide. Expression
vectors can contain a variety of "control sequences," which refer
to nucleic acid sequences necessary for the transcription and
possibly translation of an operably linked coding sequence in a
particular host organism. In addition to control sequences that
govern transcription and translation, vectors and expression
vectors may contain nucleic acid sequences that serve other
functions as well and are described infra.
[0175] 1. Promoters and Enhancers
[0176] A "promoter" is a control sequence that is a region of a
nucleic acid sequence at which initiation and rate of transcription
are controlled. It may contain genetic elements at which regulatory
proteins and molecules may bind such as RNA polymerase and other
transcription factors. The phrases "operatively positioned,"
"operatively linked," "under control," and "under transcriptional
control" mean that a promoter is in a correct functional location
and/or orientation in relation to a nucleic acid sequence to
control transcriptional initiation and/or expression of that
sequence. A promoter may or may not be used in conjunction with an
"enhancer," which refers to a cis-acting regulatory sequence
involved in the transcriptional activation of a nucleic acid
sequence.
[0177] A promoter may be one naturally associated with a gene or
sequence, as may be obtained by isolating the 5' non-coding
sequences located upstream of the coding segment and/or exon. Such
a promoter can be referred to as "endogenous." Similarly, an
enhancer may be one naturally associated with a nucleic acid
sequence, located either downstream or upstream of that sequence.
Alternatively, certain advantages will be gained by positioning the
coding nucleic acid segment under the control of a recombinant or
heterologous promoter, which refers to a promoter that is not
normally associated with a nucleic acid sequence in its natural
environment. A recombinant or heterologous enhancer refers also to
an enhancer not normally associated with a nucleic acid sequence in
its natural environment. Such promoters or enhancers may include
promoters or enhancers of other genes, and promoters or enhancers
isolated from any other prokaryotic cell, and promoters or
enhancers not "naturally occurring," i.e., containing different
elements of different transcriptional regulatory regions, and/or
mutations that alter expression. In addition to producing nucleic
acid sequences of promoters and enhancers synthetically, sequences
may be produced using recombinant cloning and/or nucleic acid
amplification technology, including PCR.TM., in connection with the
compositions disclosed herein (see U.S. Pat. No. 4,683,202, U.S.
Pat. No. 5,928,906, each incorporated herein by reference).
[0178] Naturally, it will be important to employ a promoter and/or
enhancer that effectively directs the expression of the DNA segment
in the cell type chosen for expression. One example of such
promoter that may be used with the invention is the E. coli
arabinose or T7 promoter. Those of skill in the art of molecular
biology generally are familiar with the use of promoters,
enhancers, and cell type combinations for protein expression, for
example, see Sambrook et al. (1989), incorporated herein by
reference. The promoters employed may be constitutive,
tissue-specific, inducible, and/or useful under the appropriate
conditions to direct high level expression of the introduced DNA
segment, such as is advantageous in the large-scale production of
recombinant proteins and/or peptides. The promoter may be
heterologous or endogenous.
[0179] 2. Initiation Signals and Internal Ribosome Binding
Sites
[0180] A specific initiation signal also may be required for
efficient translation of coding sequences. These signals include
the ATG initiation codon or adjacent sequences. Exogenous
translational control signals, including the ATG initiation codon,
may need to be provided. One of ordinary skill in the art would
readily be capable of determining this and providing the necessary
signals. It is well known that the initiation codon must be
"in-frame" with the reading frame of the desired coding sequence to
ensure translation of the entire insert. The exogenous
translational control signals and initiation codons can be either
natural or synthetic. The efficiency of expression may be enhanced
by the inclusion of appropriate transcription enhancer
elements.
[0181] 3. Multiple Cloning Sites
[0182] Vectors can include a multiple cloning site (MCS), which is
a nucleic acid region that contains multiple restriction enzyme
sites, any of which can be used in conjunction with standard
recombinant technology to digest the vector (see Carbonelli et al.,
1999, Levenson et al., 1998, and Cocea, 1997, incorporated herein
by reference.) "Restriction enzyme digestion" refers to catalytic
cleavage of a nucleic acid molecule with an enzyme that functions
only at specific locations in a nucleic acid molecule. Many of
these restriction enzymes are commercially available. Use of such
enzymes is understood by those of skill in the art. Frequently, a
vector is linearized or fragmented using a restriction enzyme that
cuts within the MCS to enable exogenous sequences to be ligated to
the vector. "Ligation" refers to the process of forming
phosphodiester bonds between two nucleic acid fragments, which may
or may not be contiguous with each other. Techniques involving
restriction enzymes and ligation reactions are well known to those
of skill in the art of recombinant technology.
[0183] 4. Termination Signals
[0184] The vectors or constructs prepared in accordance with the
present invention will generally comprise at least one termination
signal. A "termination signal" or "terminator" is comprised of the
DNA sequences involved in specific termination of an RNA transcript
by an RNA polymerase. Thus, in certain embodiments, a termination
signal that ends the production of an RNA transcript is
contemplated. A terminator may be necessary in vivo to achieve
desirable message levels.
[0185] Terminators contemplated for use in the invention include
any known terminator of transcription described herein or known to
one of ordinary skill in the art, including but not limited to, for
example, rhp dependent or rho independent terminators. In certain
embodiments, the termination signal may be a lack of transcribable
or translatable sequence, such as due to a sequence truncation.
[0186] 5. Origins of Replication
[0187] In order to propagate a vector in a host cell, it may
contain one or more origins of replication sites (often termed
"ori"), which is a specific nucleic acid sequence at which
replication is initiated.
[0188] 6. Selectable and Screenable Markers
[0189] In certain embodiments of the invention, cells containing a
nucleic acid construct of the present invention may be identified
in vitro or in vivo by including a marker in the expression vector.
Such markers would confer an identifiable change to the cell
permitting easy identification of cells containing the expression
vector. Generally, a selectable marker is one that confers a
property that allows for selection. A positive selectable marker is
one in which the presence of the marker allows for its selection,
while a negative selectable marker is one in which its presence
prevents its selection. An example of a positive selectable marker
is a drug resistance marker.
[0190] Usually the inclusion of a drug selection marker aids in the
cloning and identification of transformants, for example, genes
that confer resistance to neomycin, puromycin, hygromycin, DHFR,
GPT, zeocin and histidinol are useful selectable markers. In
addition to markers conferring a phenotype that allows for the
discrimination of transformants based on the implementation of
conditions, other types of markers including screenable markers
such as GFP, whose basis is colorimetric analysis, are also
contemplated. Alternatively, screenable enzymes such as
chloramphenicol acetyltransferase (CAT) may be utilized. One of
skill in the art would also know how to employ immunologic markers,
possibly in conjunction with FACS analysis. The marker used is not
believed to be important, so long as it is capable of being
expressed simultaneously with the nucleic acid encoding a gene
product. Further examples of selectable and screenable markers are
well known to one of skill in the art.
[0191] C. Host Cells
[0192] In the context of expressing a heterologous nucleic acid
sequence, "host cell" refers to a prokaryotic cell, and it includes
any transformable organism that is capable of replicating a vector
and/or expressing a heterologous gene encoded by a vector. A host
cell can, and has been, used as a recipient for vectors. A host
cell may be "transfected" or "transformed," which refers to a
process by which exogenous nucleic acid is transferred or
introduced into the host cell. A transformed cell includes the
primary subject cell and its progeny.
[0193] In particular embodiments of the invention, a host cell is a
Gram negative bacterial cell. These bacteria are suited for use
with the invention in that they posses a periplasmic space between
the inner and outer membrane and, particularly, the aforementioned
inner membrane between the periplasm and cytoplasm, which is also
known as the cytoplasmic membrane. As such, any other cell with
such a periplasmic space could be used in accordance with the
invention. Examples of Gram negative bacteria that may find use
with the invention may include, but are not limited to, E. coli,
Pseudomonas aeruginosa, Vibrio cholera, Salmonella typhimurium,
Shigella flexneri, Haemophilus influenza, Bordotella pertussi,
Erwinia amylovora, Rhizobium sp. The Gram negative bacterial cell
may be still further defined as bacterial cell which has been
transformed with the coding sequence of a fusion polypeptide
comprising a candidate binding polypeptide capable of binding a
selected ligand. The polypeptide is anchored to the outer face of
the cytoplasmic membrane, facing the periplasmic space, and may
comprise an antibody coding sequence or another sequence. One means
for expression of the polypeptide is by attaching a leader sequence
to the polypeptide capable of causing such directing.
[0194] Numerous prokaryotic cell lines and cultures are available
for use as a host cell, and they can be obtained through the
American Type Culture Collection (ATCC), which is an organization
that serves as an archive for living cultures and genetic materials
(www.atcc.org). An appropriate host can be determined by one of
skill in the art based on the vector backbone and the desired
result. A plasmid or cosmid, for example, can be introduced into a
prokaryote host cell for replication of many vectors. Bacterial
cells used as host cells for vector replication and/or expression
include DH5c, JM109, and KC8, as well as a number of commercially
available bacterial hosts such as SURE.RTM. Competent Cells and
SOLOPACK.TM. Gold Cells (STRATAGENE.RTM., La Jolla). Alternatively,
bacterial cells such as E. coli LE392 could be used as host cells
for bacteriophage.
[0195] Many host cells from various cell types and organisms are
available and would be known to one of skill in the art. Similarly,
a viral vector may be used in conjunction with a prokaryotic host
cell, particularly one that is permissive for replication or
expression of the vector. Some vectors may employ control sequences
that allow it to be replicated and/or expressed in both prokaryotic
and eukaryotic cells. One of skill in the art would further
understand the conditions under which to incubate all of the above
described host cells to maintain them and to permit replication of
a vector. Also understood and known are techniques and conditions
that would allow large-scale production of vectors, as well as
production of the nucleic acids encoded by vectors and their
cognate polypeptides, proteins, or peptides.
[0196] D. Expression Systems
[0197] Numerous expression systems exist that comprise at least a
part or all of the compositions discussed above. Such systems could
be used, for example, for the production of a polypeptide product
identified in accordance with the invention as capable of binding a
particular ligand. Prokaryote-based systems can be employed for use
with the present invention to produce nucleic acid sequences, or
their cognate polypeptides, proteins and peptides. Many such
systems are commercially and widely available. Other examples of
expression systems comprise of vectors containing a strong
prokaryotic promoter such as T7, Tac, Trc, BAD, lambda pL,
Tetracycline or Lac promoters, the pET Expression System and an E.
coli expression system.
[0198] E. Candidate Binding Proteins and Antibodies
[0199] In certain embodiments, antibody Fc domains are expressed on
the cytoplasmic or in the periplasmic space membrane of a host
bacterial cell. By expression of a heterogeneous population of such
Fc domains, those polypeptides having a high affinity for a target
ligand (FcR) may be identified. The identified Fc domains may then
be used in various diagnostic or therapeutic applications, as
described herein.
[0200] As used herein, the term "Fc domain" is intended to refer
broadly to any immunoglobulin Fc region such as an IgG, IgM, IgA,
IgD or IgE Fc. The techniques for preparing and using various
antibody-based constructs and fragments are well known in the art.
Means for preparing and characterizing antibodies are also well
known in the art (See, e.g., Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory, 1988; incorporated herein by
reference).
[0201] Once an antibody having affinity for a target ligand is
identified, the Fc domain may be purified, if desired, using
filtration, centrifugation and various chromatographic methods such
as HPLC or affinity chromatography. Alternatively, Fc domains, or
polypeptides and peptides more generally, can be synthesized using
an automated peptide synthesizer.
IX. EXAMPLES
[0202] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Combinatorial Library Construction for Engineering Fc5
[0203] All plasmids and primers used in this study are described in
Table 3 and Table 4. For the screening of IgG1 Fc fragments
exhibiting higher binding affinity to Fc.gamma.RI than the
previously isolated Fc fragment (Fc5, containing amino acid
substitutions E328V/M428I) (FIGS. 1 and 2), the Fc5 gene was
subjected to random mutagenesis by error prone PCR. Standard error
prone PCR method (Fromant et al., 1995) was employed with the
template of the pPelBFLAG-Fc5 and two primers (STJ#196 and STJ#197)
synthesized from Integrated DNA Technologies (Coralville, Iowa).
The amplified PCR fragments were ligated into SfiI digested
pPelBFLAG. The resulting plasmids were transformed into E. coli
Jude-1(F' [Tn10(Tet.sup.r) proAB.sup.+ lacI.sup.q .DELTA.(lacZ)M15]
mcrA .DELTA.(mrr-hsdRMS-mcrBC) .phi.80dlacZ.DELTA.M15 .DELTA.lacX74
deoR recA1 araD139 .DELTA.(ara leu)7697 galU galK rpsL endA1 nupG)
(Kawarasaki et al., 2003). Based on the sequence of 20 library
clones randomly selected, the library was 7 x 108 individual
transformants with 0.264% error rate per gene (FIG. 3).
Example 2
Spheroplasting and High Throughput Flow Cytometry Screening for
Affinity Maturation of Fc5
[0204] The library cells cultured overnight at 37.degree. C. with
250 rpm shaking in Terrific Broth (Becton Dickinson Diagnostic
Systems Difco.TM., Sparks, Md.) with 2% (wt/vol) glucose
supplemented with chloramphenicol (50 .mu.g/ml) were diluted 1:50
in fresh TB media containing 0.5 M trehalose (Fisher Scientific,
Fair Lawn, N.J.) and chloramphenicol (40 .mu.g/ml). After 3 h
incubation at 37.degree. C. with 250 rpm shaking and then 20 min
cooling at 25.degree. C., the expression of Fc fragments was
induced with 1 mM isopropyl-1-thio-.beta.-D-galactopyranoside
(IPTG). After 5 hours culture at 25.degree. C., 4.5 ml of the
culture broth was harvested by centrifugation and washed two times
in 1 ml of cold 10 mM Tris-HCl (pH 8.0). After resuspension in 1 ml
of cold STE solution (0.5 M Sucrose, 10 mM Tris-HCl, 10 mM EDTA, pH
8.0), the cells were incubated with rotating mixing at 37.degree.
C. for 30 min, pelleted by centrifugation at 12,000.times.g for 1
min and washed in 1 ml of cold Solution A (0.5 M Sucrose, 20 mM
MgCl2, 10 mM MOPS, pH 6.8). The washed cells were incubated in 1 ml
of Solution A with 1 mg/ml of hen egg lysozyme at 37.degree. C. for
15 min. After centrifugation at 12,000.times.g for 1 min and the
resulting spheroplasts pellets were resuspended in 1 ml of cold
PBS.
[0205] For library screening, extracellular domain of recombinant
glycosylated Fc.gamma.RIa/CD64 (R&D Systems, Minneapolis,
Minn.) was labeled with FITC using FITC protein labeling kit
(Invitrogen, Carlsbad, Calif.). After the labeling reaction, the
affinity of FITC labeled Fc.gamma.RI for human IgG Fc was confirmed
by fluorescent ELISA displaying high fluorescence in the Fc
glycosylated human IgG-Fc coated wells comparing in the BSA coated
wells. Spheroplasts were labeled with 30 nM of Fc.gamma.RI-FITC. In
the subsequent round sorting, reduced concentration of
Fc.gamma.RIa-FITC (10, 3, and 1 nM for the 2.sup.nd, 3.sup.rd, and
4.sup.th round sorting, respectively) were used for labeling of
spheroplasts. More than 4.times.10.sup.8 spheroplasts were sorted
by MoFlo (Dako Cytomation, Fort Collins, Colo.) equipped with a 488
nm argon laser for excitation. In each round the top 3% of the
population showing the highest fluorescence due to
Fc.gamma.RIa-FITC binding was isolated by sorting and resorting
immediately after the initial sorting.
[0206] The Fc genes in the spheroplasts were rescued by PCR
amplification using two specific primers (STJ#16 and STJ#220),
ligated into pPelBFLAG-Fc using SfiI restriction enzyme site, and
transformed in electrocompetent E. coli Jude-1 cells. The resulting
transformants were selected on chloramphenicol containing media and
then grown, spheroplasted as above in preparation for the next
round of sorting. High fluorescent clones were enriched as sorting
rounds go on (FIG. 4). After the 5.sup.th round of sorting, 19
individual clones exhibiting higher fluorescence than Fc5 were
isolated (FIG. 5). Except redundant mutations, all of the mutations
were in three distinct regions comprising upper CH2 part that might
directly contact to Fc.gamma.RIa, linker region located interface
of CH2 and CH3 domains, and CH3 region that might contribute
conformational change of Fc fragments for the binding to
Fc.gamma.RIa (FIG. 6). The highest fluorescent clone was Fc601 that
have 2 additional mutations (K338R, G341V) in Fc5 (E382V/M428I)
(FIGS. 7 and 8).
Example 3
Sequences of Selected Clones Displaying Higher Affinity Binding to
Fc.gamma.RIa than Fc5
[0207] Fc5 (Nucleotide Sequence #2 and Protein Sequence #2) have 2
mutations (E382V and M428I) in the sequence of wild type IgG1-Fc
(Nucleotide Sequence #1 and Protein Sequence #1). The engineered Fc
mutants exhibiting higher affinity to Fc.gamma.RIa than Fc5 have
substitution mutations in the sequence of Fc5. Isolated Fc mutants,
Fc601-Fc619 (Protein Sequence #3.about.#21), have substitution
mutations in the sequence of Fc5. The isolated mutants are
summarized in Table 5.
Example 4
Production and Purification of Full Length IgG1-Fc601
[0208] Trastuzumab (Herceptin.TM.) has been clinically used for the
treatment of breast metastatic carcinoma that overexpress HER2/neu
(Erb2) (Sergina and Moasser, 2007). For the clearance of the
metastatic carcinoma, trastuzumab antibodies recognize HER2/neu
(Erb2) and interact with surface Fc.gamma.Rs of immune cells
leading to antibody-dependent cell-mediated cytotoxicity (ADCC), an
essential effector function mechanism for therapeutic action (Lazar
et al., 2006; Sergina and Moasser, 2007). Fc fragment genes
engineered for high Fc.gamma.Rs affinity were incorporated to full
length trastuzumab antibodies. For the construction of
pSTJ4-Herceptin IgG1, E. coli codon optimized (Hoover and
Lubkowski, 2002) V.sub.L and V.sub.H domains of humanized 4D5
(anti-p185HER2) were synthesized by total gene synthesis with
overlap extension PCR using 12 oligonucleotides that included 2
external primers (STJ#302 and STJ#313) and 10 internal primers
(STJ#303-312) for V.sub.L and 14 primers total 2 external primers
(STJ#314 and STJ#327) and 12 internal primers (STJ#315-326) for
V.sub.H, respectively. The ligation of the amplified V.sub.L and
V.sub.H into pMAZ360-M18.1-Hum-IgG1 using NcoI/NotI for V.sub.L and
NheI/HindIII restriction endonuclease sites for V.sub.H generated
pSTJ4-Herceptin IgG1. For pSTJ4-Herceptin-Fc2a-IgG1 and
pSTJ4-Herceptin-Fc5-IgG1, Fc5 and Fc2a mutant genes were amplified
using the primers (STJ#290 and STJ#291) and the templates,
pPelBFLAG-Fc5 or pPelBFLAG-Fc601, ligated into pSTJ4-Herceptin IgG1
digested using SalI/EcoRV. For preparative production of
aglycosylated trastuzumab and trastuzumab-Fc5, and
trastuzumab-Fc601 in E. coli, dicistronic plasmids,
pSTJ4-Herceptin-IgG1, pSTJ4-Herceptin-Fc5-IgG1, and
pSTJ4-Herceptin-Fc601-IgG1 were constructed. These plasmids are
under the control of lac promoter in a dicistronic operon with PelB
leader peptide fusions to both heavy and light chains (FIG. 9).
[0209] After transformation of the plasmids into E. coli BL21(DE3)
(EMD Chemicals, Gibbstown, N.J.), cells were grown in LB complex
medium for overnight and then overnight cultured twice for
adaptation in R/2 medium (Jeong and Lee, 2003) consisting of: 2 g
of (NH.sub.4).sub.2HPO.sub.4, 6.75 g of KH.sub.2PO.sub.4, 0.93 g of
citric acid H.sub.2O, 0.34 g of MgSO.sub.4, 20 g of glucose, 0.05 g
of ampicillin and 5 ml of trace metal solution dissolved in 2 N HCl
(10 g of FeSO.sub.4-7H.sub.2O, 2.25 g ZnSO.sub.4-7H.sub.2O, 1 g of
CuSO.sub.4-5H.sub.2O, 0.35 g of MnSO.sub.4--H.sub.2O, 0.23 g of
Na.sub.2B.sub.4O.sub.7-10H.sub.2O, 1.5 g of CaCl.sub.2, and 0.1 g
of (NH.sub.4).sub.6Mo.sub.7O.sub.24 per L). E. coli BL21(DE3)
harboring pSTJ4-Herceptin-IgG1, pSTJ4-Herceptin-IgG1-Fc5, or
pSTJ4-Herceptin-IgG1-Fc601 were cultured in 500 mL baffled-flask
with 120 ml R/2 media at 30.degree. C. at 250 rpm for 8 h and then
inoculated to 3.3 L BioFlo 310 fermentor (New Brunswick Scientific
Co., Edison, N.J.) with 1.2 L R/2 medium. Fed-batch fermentation
was performed at 30.degree. C. using pH-stat glucose feeding
strategy. The dissolved oxygen (DO) concentration was maintained at
40% of air saturation using automatic cascade control by increasing
agitation speed from 100 rpm to 1000 rpm, air flow rate from 1 to 3
SLPM (Standard liquid per minute) and pure oxygen flow rate from 0
to 1.5 SLPM when required. The initial pH was adjusted to 6.8 and
controlled by the addition of 30% (v/v) ammonium hydroxide when it
decreased to less than 6.75 and by the supply of feeding solutions,
(700 g/L of glucose and 10 g/L of MgSO47H2O; before induction) and
(500 g/L glucose, 10 g/L of MgSO47H2O, and 100 g/L of yeast
extract; after induction), when it increased to more than 6.9. When
OD600 reached 100, the culture temperature was reduced to
25.degree. C. and 30 min later, protein expression was induced with
1 mM of isopropyl-1-thio-.beta.-D-galactopyranoside (IPTG). The
culture broth was harvested 7 h later at an OD.sub.600 of
.about.130-140. The yield of aglycosylated tertameric IgG was about
40 mg/L.
[0210] Cells were harvested by centrifugation at 11,000.times.g for
30 min and suspended in 1.2 L solution containing 100 mM Tris, 10
mM EDTA (pH 7.4) supplemented with 4 mg of lysozyme (per g of dry
cell weight) and 1 mM PMSF. Periplasmic proteins were released by
the incubation of the suspended solution with shaking at 250 rpm at
30.degree. C. for 16 h. After centrifugation at 14,000.times.g for
30 min, the supernatant was mixed with polyethyleneimine (MP
Biomedical, Solon, Ohio) to a final concentration of 0.2% (w/v)
recentrifuged at 14,000.times.g for 30 min, and filtered through
0.2 .mu.m filter. Clear filtrate was mixed with immobilized Protein
A agarose resin pre-equilibrated in 20 mM sodium phosphate buffer
(pH 7.0) and incubated at 4.degree. C. for 16 h. After washing with
200 ml of 20 mM sodium phosphate buffer (pH 7.0) and 200 ml of 40
mM sodium citrate (pH 5.0), wild type aglycosylated trastuzumab,
aglycosylated trastuzumab-Fc5, and aglycosylated trastuzumab-Fc601
were eluted from the resin using 15 ml of 0.1 M glycine (pH 3.0)
and neutralized immediately with 1M Tris (pH 8.0) solution. The
eluted samples were concentrated by ultrafiltration through a 10
kDa MW cutoff membrane and the retentate was applied to a Superdex
200 gel filtration column developed with PBS (pH 7.4).
Example 5
Affinity of Aglycosylated Trastuzumab-Fc601 to Fc Receptors
[0211] Affinity of full assembled aglycosylated trastuzumab
antibodies to Fc.gamma.RIa was measured by immobilizing
glycosylated trastuzumab (Clinical grade, Fox Chase Cancer Center
Pharmacy), aglycosylated trastuzumab, and aglycosylated
trastuzumab-Fc5, aglycosylated trastuzumab-Fc601 individually on
the CM-5 sensor chip. The soluble monomeric Fc.gamma.RIa in HBS-EP
(10 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20
surfactant) buffer was injected at flow rate of 30 .mu.l/min for 60
s with dissociation time 300 s. Regeneration of the ligand was
performed by single injection of 100 mM citric acid, pH 3.0.
Affinities of the soluble monomeric Fc.gamma.RIa with glycosylated
trastuzumab, aglycosylated trastuzumab, trastuzumab-Fc5, and
trastuzumab-Fc601 were obtained by injection of soluble
Fc.gamma.RIa in duplicate at concentrations of 0, 25, 50, 100, 200
nM for 60 s at a flow rate of 30 .mu.l/min over immobilized
glycosylated trastuzumab, trastuzumab, trastuzumab-Fc5, and
trastuzumab Fc601. Affinity of Fc.gamma.RIa toward wild type
aglycosylated trastuzumab was obtained by Fc.gamma.RIa injections
in duplicates at concentrations 0, 200, 300, 400, 500, and 600 nM
for 60 s at a flow rate 30 .mu.l/min over immobilized aglycosylated
trastuzumab. Binding curve at zero concentration was subtracted as
a blank. Equilibrium dissociation constants (K.sub.D) were
determined by fitting of equilibrium responses to steady-state
affinity model provided by BIAevaluation 3.0 software. As shown in
FIG. 10, trastuzumab-Fc601 bound to Fc.gamma.RIa with similar
affinity with commercial-grade glycosylated trastuzumab from CHO
cells and over 130 fold increased affinity compared with wild type
aglycosylated trastuzumab.
[0212] The affinity of the purified IgGs for the extracellular
domain of Fc.gamma.RIIa, Fc.gamma.RIIb, Fc.gamma.RIIIa was analyzed
by ELISA. 50 .mu.l of 4 .mu.g/ml of aglycosylated trastuzumab,
trastuzumab-Fc5, or trasuzumab-Fc601 purified from E. coli,
glycosylated IgG trastuzumab were diluted in 0.05 M
Na.sub.2CO.sub.3 (pH 9.6) buffer and used to coat 96 well
polystyrene ELISA wells (Corning, Corning, N.Y.) for 16 hr at
4.degree. C. After blocking with 1.times.PBS (pH 7.4), 0.5% BSA for
2 hr at room temperature, the plate was washed 4 times with PBS
containing 0.05% Tween20, and incubated with serially diluted
Fc.gamma.RIIa, Fc.gamma.RIIb C-terminal fused to GST (Berntzen et
al., 2005), Fc.gamma.RIIIa (R&D Systems, Minneapolis, Minn.) at
room temperature for 1 h. After washing 4 times with the same
buffer, 1:5,000 diluted anti-GST antibody HRP conjugate (Amersham
Pharmacia, Piscataway, N.J.) for Fc.gamma.RIIa and Fc.gamma.RIIb or
1:10,000 diluted anti-polyhistidine antibody HRP conjugate
(Sigma-Aldrich, St. Louis, Mo.) for Fc.gamma.RIIIa was added and
plates were washed and developed as described previously (Mazor et
al., 2007). To determine the binding of IgG to FcRn at pH 7.4, 2
.mu.g/ml FcRn preincubated with in PBS (pH 7.4) containing 1:5,000
diluted anti-GST-HRP at room temperature for 1 h as previously
described (Andersen et al., 2006) was added to plates coated with
trastuzumab antibodies. To evaluate binding at pH 6.0, ELISAs were
carried out as above except 20 mM MES was added to washing buffer
and sample dilution buffers and pH was adjusted to 6.0. As
expected, the aglycosylated tratuzumab exhibited low affinity to
Fc.gamma.RIIa or Fc.gamma.RIIb (EC.sub.50.gtoreq.1000-fold and
100-fold higher for GST fused Fc.gamma.RIIa and Fc.gamma.RIIb,
respectively, FIGS. 3 C and D) (FIG. 11 and FIG. 12),
Fc.gamma.RIIIa (FIG. 13). Trastuzumab-Fc601 antibody exhibited only
slightly higher affinity for Fc.gamma.RIIb. The neonatal FcRn
receptor binding to the interface of CH2 domain and the CH3 domain
is responsible for the endosomal recycling of IgG in plasma (Ghetie
and Ward, 2000). Trastuzumab-Fc5 did show its pH-dependent binding
(high affinity binding at pH 6.0 and its low binding at pH 7.4) to
the neonatal FcRn. However, trastuzumab-Fc601 exhibited much
reduced binding affinity to FcRn at pH 6.0 (FIG. 14).
Example 6
Library Construction for Higher Affinity to Fc.gamma.RIa than Fc5
and for pH Dependent FcRn Binding
[0213] Human FcRn has high affinity to human IgG under slightly
acidic pH condition and low affinity at neutral or basic pH (Ober
et al., 2004a; Ober et al., 2004b; Raghavan and Bjorkman, 1996;
Rodewald, 1976). The FcRn binding sites are located at the
interface of CH2 and CH3 domains, similar binding sites for
staphylococcal protein A (SpA) (Kim et al., 1994; Shields et al.,
2001). Fc601 showed improved Fc.gamma.RIa binding affinity than
Fc5. However, two additional mutations (K338R, G341V) of Fc601 in
lower CH2 region of IgG1 impaired the pH dependent FcRn binding
that is critical for the regulation of serum IgG concentration by
allowing pinocyosed IgGs to make strong IgG-FcRn complex in
acidified endosomes for recycling to blood across vascular
endothelial cell membrane instead of degradation in lysosomes
(Ghetie and Ward, 2000).
[0214] To isolate engineered Fc fragments showing higher affinity
to Fc.gamma.RIa than Fc5 and retaining the pH dependent FcRn
binding, new combinatorial libraries consisting of random amino
acids in upper CH2 region were constructed. The libraries are
composed of 4 sub-libraries. Four parts of upper CH2 region
(234L-239S, 264V-268H, 297N-299T, 328L-3321) (Kabat et al., 1991)
were substituted by random amino acids using NNS degenerate codons
(FIGS. 15 and 16). For the first sub-library, DNA fragments were
amplified using the primers (STJ#465 and STJ#220) and the template,
pPelBFLAG-Fc5. The N-terminal sequence extension of the PCR
amplified fragments using the primer STJ#473 generated the
sub-library replacing 5 amino acids in the region 234L-239S with
random amino acids. Gene assembly PCR products using DNA fragments
amplified by the primers (STJ#467 and STJ#220) and DNA fragments
amplified by the primers (STJ#473 and STJ#468) generated the second
sub-library that randomized 5 amino acid residues for 264V-268H.
The third sub-library randomized 297N-299T was generated using the
primer pairs (STJ#473/STJ#470 and STJ#469/STJ#220) and the fourth
sub-library (328L-3321) was generated using the primer pairs
(STJ#473/STJ#470 and STJ#469/STJ#220) using the same PCR template
plasmid, pPelBFLAG-Fc5. Based on the number of possible mutations,
the same amount of DNA from three sub-libraries (234L-239S;
264V-268H; 328L-3321) that randomized 5 amino acid residues were
mixed with and 20.sup.3/20.sup.5 fold amount of DNA from the third
sub-library (297N-299T) that randomized 3 amino acid residues. Each
of the three sub-libraries was subcloned into SfiI digested
pPelBFLAG. The resulting plasmids were transformed into E. coli
Jude-1(F' [Tn10(Tet.sup.r) proAB.sup.+ lacI.sup.q .DELTA.(lacZ)M15]
mcrA .DELTA.(mrr-hsdRMS-mcrBC) .phi.80dlacZ.DELTA.M15 .DELTA.lacX74
deoR recA1 araD139 .DELTA.(ara leu)7697 galU galK rpsL endA1 nupG)
(Kawarasaki et al., 2003).
Example 7
Screening of Fc Mutants Exhibiting Higher Affinity to Fc.gamma.RIa
than Fc5 and for pH Dependent FcRn Binding
[0215] The library cells composed of 4 sub-libraries were converted
to spheroplasts by the methods described in EXAMPLE 2. Over
4.times.10.sup.8 spheroplasts were sorted by MoFlo flow cytometry
(Dako Cytomation, Fort Collins, Colo.) equipped with an argon
laser. Following labeling of 10 nM (3 nM for the 2.sup.nd round, 1
nM for the 3.sup.rd round, 0.3 nM for the 4.sup.th round) of
Fc.gamma.RIa-FITC for 1 hr at room temperature, spheroplasts were
sorted with selectively gating the top 3% of the population showing
the highest fluorescence due to Fc.gamma.RIa-FITC binding. After
the initial sorting, collected spheroplasts were immediately
resorted. The Fc encoding genes were rescued by PCR using two
specific primers (STJ#16 and STJ#220) and ligated into SfiI
digested pPelBFLAG plasmid. The ligation mixture was transformed
into E. coli Jude-1. Transformants selected on chloramphenicol
containing media were grown, spheroplasted as above, and sorted.
After the 4.sup.th round of sorting, 8 individual clones exhibiting
higher fluorescence than Fc5 were isolated (FIG. 17). All of the
clones have consensus mutations in L328W and I332Y mutations. Also,
the amino acid residue 329P was well conserved suggesting the
critical role of the specific amino acid residue in the binding of
Fc.gamma.RIa (FIG. 18). The highest fluorescent clone was Fc701
that have L328W, A330V, P331A, I332Y mutations in 328L-3321 region
and one additional Q295R mutation (FIG. 19-21).
Example 8
Sequences of Selected Clones Displaying High Affinity Binding to
Fc.gamma.RIa Screened from Upper CH2 Randomization Library
[0216] The engineered Fc mutants exhibiting higher affinity to
Fc.gamma.RIa than Fc5 have substitution mutations in the sequence
of Fc5. Isolated Fc mutants Fc701-Fc708 (Protein Sequence
#22.about.#29) have mutations in the sequence of Fc5. Isolated
mutant showing higher affinity to Fc.gamma.RI than Fc5 are
summarized in Table 6.
Example 9
Characterization of Full Length Trastuzumab-Fc701 IgG1
[0217] Full length trastuzumab-Fc701 IgG1 was produced using the
fed batch fermentation and purified using Protein A affinity
chromatography followed by gel filtration chromatography as
described in EXAMPLE 4. To obtain kinetic rate constants for the
binding of full length trastuzumab-Fc701 to Fc.gamma.RIa, purified
trastuzuma-Fc701 was immobilized on CM5 sensor chip using amine
coupling method. The interaction between trastuzumab-Fc701 and
Fc.gamma.RIa was analyzed using the condition described in EXAMPLE
5. Trastuzumab-Fc701 bound to Fc.gamma.RIa with similar affinity
with trastuzumab Fc601 (FIG. 22). pH dependent FcRn binding was
analyzed using ELISA at pH 6.0 and at pH 7.4 as described in
EXAMPLE 5. As expected, all the trastuzumab antibodies including
trastuzumab-Fc701 did not show significant binding affinity to FcRn
at neutral pH 7.4. On the other hand, trastuzumab Fc701 showed
higher affinity binding to FcRn at pH 6.0 than wild type
aglycosylated or glycosylated trasutuzumab antibodies (FIG.
23).
TABLE-US-00003 TABLE 3 Plasmids used in this study. Plasmids
Relevant characteristics Reference or source pMoPac1 Cm.sup.r, lac
promoter, tetA gene, C-terminal (Hayhurst et al., 2003)
polyhistidine tag and c-myc tag pMoPac12 Ap.sup.r, lac promoter,
tetA gene, skp gene, C-terminal (Hayhurst et al., 2003)
polyhistidine tag and c-myc tag pMoPac1-FLAG-M18 NlpA fused M18
scFv gene, C-terminal FLAG tag (Jung et al., 2007) in pMoPac1
pPelBFLAG Cm.sup.r, lac promoter, tetA gene, skp gene, C- This
study terminal FLAG tag pPelBFLAG-Fc IgG1-Fc gene in pPelBFLAG This
study pPelBFLAG-Fc5 IgG1-Fc5 gene in pPelBFLAG This study
pPelBFLAG-Fc601 IgG1-Fc601 gene in pPelBFLAG This study
pPelBFLAG-Fc701 IgG1-Fc601 gene in pPelBFLAG This study
pMAZ360-M18.1-Hum-IgG M18.1 humanized IgG1 gene in pMAZ360 (Mazor
et al.) pSTJ4-Herceptin IgG1 Herceptin IgG1 gene in
pMAZ360-M18.1-Hum- This study IgG1 pSTJ4-Herceptin-Fc5-IgG1
Herceptin IgG1-Fc5 gene in pMAZ360-M18.1- This study Hum-IgG1
pSTJ4-Herceptin-Fc601- Herceptin IgG1-601 gene in pMAZ360-M18.1-
This study IgG1 Hum-IgG1 pSTJ4-Herceptin-Fc701- Herceptin IgG1-701
gene in pMAZ360-M18.1- This study IgG1 Hum-IgG1
TABLE-US-00004 TABLE 4 Primers used in this study. Seq Primer ID
Name No. Primer nucleotide sequence (5' a 3') STJ#16 32
TTGTGAGCGGATAACAATTTC STJ#196 33 CGCAGCGAGGCCCAGCCGGCCATGGCG
STJ#197 34 CGCAATTCGAATTCGGCCCCCGAGGCCCC STJ#220 35
CAATTTTGTCAGCCGCCTGAGCAGAAG STJ#302 36
GCGGAATTCCCATGGCGGATATTCAAATGACCC STJ#303 37
CAGACGCGCTTAAAGAAGACGGGCTTTGGGTCATTTGAATATCCGCCATG STJ#304 38
CGTCTTCTTTAAGCGCGTCTGTCGGTGATCGCGTGACCATCACGTGTCGT STJ#305 39
AGGCCACCGCCGTATTAACATCTTGGCTCGCACGACACGTGATGGTCACG STJ#306 40
GTTAATACGGCGGTGGCCTGGTATCAACAAAAACCGGGTAAAGCCCCGAA STJ#307 41
GAGTACAGAAAGCTGGCGCTGTAGATTAACAGCTTCGGGGCTTTACCCGG STJ#308 42
CAGCGCCAGCTTTCTGTACTCTGGCGTCCCGAGCCGCTTTTCTGGCAGCC STJ#309 43
TGCTAATGGTCAGCGTGAAGTCCGTACCGCTGCGGCTGCCAGAAAAGCGG STJ#310 44
ACTTCACGCTGACCATTAGCAGCCTGCAGCCGGAGGATTTCGCCACCTAT STJ#311 45
TGGCGGGGTGGTGTAGTGCTGCTGACAATAATAGGTGGCGAAATCCTCCG STJ#312 46
ACTACACCACCCCGCCAACCTTTGGCCAGGGTACGAAAGTGGAGATTAAA STJ#313 47
GACAGATGGTGCGGCCGCCGTGCGTTTAATCTCCACTTTCGTACCCTGG STJ#314 48
ATTGTTATTGCTAGCGGCTCAGCCGGCAATGGCG STJ#315 49
ACCAGACCACCGCCAGATTCCACTAATTGAACCTCCGCCATTGCCGGCTG STJ#316 50
TCTGGCGGTGGTCTGGTGCAGCCAGGCGGTAGCTTACGTCTGAGCTGTGC STJ#317 51
AGGTATCTTTGATGTTGAAGCCAGACGCTGCACAGCTCAGACGTAAGCTA STJ#318 52
TCTGGCTTCAACATCAAAGATACCTACATTCATTGGGTTCGCCAAGCCCC STJ#319 53
ATAGATACGGGCCACCCACTCCAGGCCTTTACCTGGGGCTTGGCGAACCC STJ#320 54
GAGTGGGTGGCCCGTATCTATCCAACCAATGGCTACACGCGTTATGCAGA STJ#321 55
GCGCTAATGGTGAAGCGGCCTTTCACAGAGTCTGCATAACGCGTGTAGCC STJ#322 56
CCGCTTCACCATTAGCGCCGACACCTCTAAGAACACCGCATATTTACAGA STJ#323 57
GTCCTCTGCGCGTAAAGAGTTCATCTGTAAATATGCGGTGTTCTTAGAGG STJ#324 58
AACTCTTTACGCGCAGAGGACACGGCGGTGTACTACTGCTCTCGTTGGGG STJ#325 59
AGTAGTCCATCGCGTAGAAACCGTCACCGCCCCAACGAGAGCAGTAGTAC STJ#326 60
GGTTTCTACGCGATGGACTACTGGGGTCAGGGTACGCTGGTCACGGTCAG STJ#327 61
GCCCTTGAAGCTTGCAGAGCTGACCGTGACCAGCGT STJ#465 62
CCCACCGTGCCCAGCACCTGAANNSNNSNNSGGANNSNNSGTCTTCCTCTTCCCCCCAAAACC- C
STJ#466 63
GGGTTTTGGGGGGAAGAGGAAGACSNNSNNTCCSNNSNNSNNTTCAGGTGCTGGGCACGGTGG- G
STJ#467 64
CCTGAGGTCACATGCGTGGTNNSNNSNNSNNSNNSGAAGACCCTGAGGTCAAGTTCAACTGG
STJ#468 65
CCAGTTGAACTTGACCTCAGGGTCTTCSNNSNNSNNSNNSNNACCACGCATGTGACCTCAGG
STJ#469 66 GCCGCGGGAGGAGCAGTACNNSNNSNNSTACCGTGTGGTCAGCGTCCTC
STJ#470 67 GAGGACGCTGACCACACGGTASNNSNNSNNGTACTGCTCCTCCCGCGGC
STJ#471 68
CAAGTGCAAGGTCTCCAACAAAGCCNNSNNSNNSNNSNNSGAGAAAACCATCTCCAAAGCCAA-
AGGG STJ#472 69
CCCTTTGGCTTTGGAGATGGTTTTCTCSNNSNNSNNSNNSNNGGCTTTGTTGGAGACCTTGCA-
CTTG STJ#473 70
CGCAGCGAGGCCCAGCCGGCCATGGCGGACAAAACTCACACATGCCCACCGTGCCCAGCACCT- G
STJ#471 71
CAAGTGCAAGGTCTCCAACAAAGCCNNSNNSNNSNNSNNSGAGAAAACCATCTCCAAAGCCAA-
AGGG STJ#472 72
CCCTTTGGCTTTGGAGATGGTTTTCTCSNNSNNSNNSNNSNNGGCTTTGTTGGAGACCTTGCA-
CTTG STJ#473 73
CGCAGCGAGGCCCAGCCGGCCATGGCGGACAAAACTCACACATGCCCACCGTGCCCAGCACCT- G
STJ#474 74 CGCAGCGAGGCCCAGCCGGCCATGGCGGAGGTTCAATTAGTGGAATCTG
STJ#475 75 CGCAGCGAGGCCCAGCCGGCCATGGCGGATATTCAAATGACCCAAAGCCCG
STJ#476 76 CGCAATTCGGCCCCCGAGGCCCCGCACTCTCCCCTGTTGAAGCTCTTTG
STJ#479 77 GACAAAACTCACACATGCCCACCGTGCC STJ#480 78
GGCACGGTGGGCATGTGTGAGTTTTGTC
TABLE-US-00005 TABLE 5 Mutations in Fc conferring higher affinity
to Fc.gamma.RI than Fc5 Fc mutants Mutations Fc601 K338R, G341V,
E382V, M428I Fc602 N297D, N315D, K340N, E382V, M428I Fc603 K340N,
E382V, M428I Fc604 K338I, K340N, E382V, M428I Fc605 K340Q, A378D,
E382V, M428I Fc606 N325S, K340N, E382V, M428I Fc607 H224Y, E269K,
N325S, G341V, E382V, M428I Fc608 G341V, E382V, K392E, M428I Fc609
K338R, G341V, E382V, S424L, M428I, N434D Fc610 F241L, G341V, E382V,
M428I Fc611 G341V, E382V, M428I Fc612 N276D, G341V, E382V, M428I
Fc613 G341V, V369A, E382V, M428I Fc614 N286D, G341V, E382V, M428I,
N434S Fc615 N325S, G341V, E382V, M428I Fc616 Y300C, G341V, E382V,
M428I Fc617 G341V, V348M, E382V, M428I Fc618 E382V, M428I, N434S
Fc619 V266M, E382V, M428I
TABLE-US-00006 TABLE 6 Mutations conferring higher affinity to
Fc.gamma.RI than Fc5 isolated from upper CH2 region randomization
library Fc mutants Mutations (in addition to E382V and M428I) Fc701
L328W, A330V, P331A, I332Y, Q295R Fc702 L328W, A330E, P331E, I332Y,
V279M Fc703 L328W, A330E, P331E, I332Y Fc704 L328W, A330E, P331V,
I332Y, S426T Fc705 L328W, A330E, P331V, I332Y Fc706 L328W, A330I,
P331E, I332Y Fc707 L328W, A330E, I332Y Fc708 L328W, P331S, I332Y
Fc709 L328W, A330V, P331S, I332Y, H224R, L251F
Example 10
Detailed Construction of Plasmids for Covalently Anchored Full
Length IgG Display System
[0218] Subcloning of PCR amplified and SfiI digested Fc gene
encoding human IgG1-Fc fragment, hinge, CH2 and CH3 region of human
IgG1 heavy chain (GeneBank Accession No. AF237583) into SfiI
digested pPelBFLAG generated pPelBFLAG-Fc. pBADN1pAHis-M18 was
performed by ligating XbaI-HindIII digested N1 pA fused M18 scFv
gene from pMoPac1-FLAG-M18 into pBAD30-KmR digested with same
restriction endonucleases. Ligation of SfiI digested trastuzumab
VL-Ck amplified using the primers (STJ#475 and STJ#476) and the
template, pSTJ4-Herceptin IgG1 into SfiI digested pBADN1pAHis-M18
generated pBADN1 pA-VL-Ck-His. PelB leader peptide fused
trastuzumab VL-Ck was amplified using the primers (STJ#16 and
STJ#340) and the template (pSTJ4-Herceptin IgG1), digested by
XbaI/HindIII endonucleases and ligated into pBAD-N1 pA-VL-Ck-His
digested with same endonucleases to generate pBADPelB-VL-Ck.
pBADPelB-VL-Ck-N1 pA-VL-Ck-His was constructed by ligating XbaI
digested PCR fragments amplified using the primers (STJ#70 and
STJ#332) and the template (pBADPelB-VL-Ck) into pBADN1 pA-VL-Ck-His
digested using the same endonuclease. Trastuzumab heavy chains were
amplified using the primers (STJ#474 and STJ#67) and the template
pSTJ4-Herceptin IgG1 for pPelB-Herceptin(H)-FLAG,
pPelB-Herceptin(H)-Fc5-FLAG, and pPelB-Herceptin(H)-Fc2a-FLAG,
respectively. Fc2a is an aglycosylated antibody variants optimized
for Fc.gamma.RII binding by two mutations (S298G/T299A) in the
upper CH2 region; it has been reported that IgG containing Fc2a
displays Fc.gamma.RIIa binding and effector functions comparable to
those of glycosylated antibodies (Sazinsky et al., 2008). For the
expression of correctly assembled, homodimeric wild type Fc and
Fc2a in the periplasmic space of E. coli, the plasmids
pDsbA-Fc-FLAG and pDsbA-Fc2a-FLAG were constructed for the export
of Fc via the DsbA signal peptide. The PCR amplified fragments were
digested with SfiI, ligated into pPelBFLAG digested with the same
endonuclease to generate pPelB-Herceptin(H)-FLAG,
pPelB-Herceptin(H)-Fc5-FLAG and pPelB-Herceptin(H)-Fc2a-FLAG.
[0219] Tables 7 and 8 summarize the plasmids and primers used for
Examples 10-14.
Example 11
Preparation of Spheroplasts and FACS Analysis for the Covalently
Anchored Full Length IgG Display System to Engineer IgG Heavy
Chain
[0220] To use bacterial full length IgG display system for library
screening, four factors should be considered, Firstly, IgG heavy
chains and light chains must be well expressed. Secondly, the heavy
and light chains should be assembled well in E. coli. Thirdly,
binding ligands should be accessible to the full length IgG in
bacterial cells. Finally, fourth, the anchoring of the displayed
full length IgG should be robust during library screening.
[0221] Two plasmid co-expression plasmids were used for stable,
covalent anchoring of full length IgG (FIG. 24). The
pBADPelB-VL-Ck-N1 pA-VL-Ck-His plasmid enables the expression of
the N1 pA leader peptide fused IgG light chain (VL-Ck) and the PelB
leader peptide fused IgG light chain (VL-Ck). Thus a portion of the
light chain becomes anchored on the periplasmic side of the inner
membrane where it associates with heavy chain to produce tetrameric
full length, IgG. pPelB-Herceptin(H)-FLAG is a high copy number
plasmid encoding the IgG heavy chain under the control of the lac
promoter. The plasmid pBADPelB-VL-Ck-N1 pA-VL-Ck-His was
transformed with pPelB-Herceptin(H)-FLAG,
pPelB-Herceptin(H)-Fc5-FLAG, or pPelB-Herceptin(H)-Fc2a-FLAG for
wild type trastuzumab, traszumab-Fc5, or trastuzumab-Fc2a,
respectively into E. coli Jude-1(F' [Tn10(Tet.sup.r) proAB.sup.+
lacI.sup.q .DELTA.(lacZ)M15] mcrA .DELTA.(mrr-hsdRMS-mcrBC)
480dlacZ.DELTA.M15 .DELTA.lacX74 deoR recA1 araD139 A(ara leu)7697
galU galK rpsL endA1 nupG) (Kawarasaki et al., 2003). The
transformed E. coli cells were cultured overnight at 37.degree. C.
with 250 rpm shaking in Terrific Broth (Becton Dickinson Diagnostic
Systems Difco.TM., Sparks, Md.) with 2% (wt/vol) glucose
supplemented with chloramphenicol (50 .mu.g/ml) and kanamycin (50
g/ml).
[0222] The overnight cultured cells were diluted 1:100 in fresh 7
ml of TB medium with chloramphenicol (5.sub.0 .mu.g/ml) and
kanamycin (50 g/ml) in 125 ml Erlenmeyer flask. After incubation at
37.degree. C. for 2 h and cooling at 25.degree. C. for 20 min with
250 rpm shaking, protein expression was induced with 1 mM of
isopropyl-1-thio-D-galactopyranoside (IPTG). 20 h after IPTG
induction, 6 ml of the culture broth was harvested by
centrifugation and washed two times in 1 ml of cold 10 mM Tris-HCl
(pH 8.0). After resuspension in 1 ml of cold STE solution (0.5 M
Sucrose, 10 mM Tris-HCl, 10 mM EDTA, pH 8.0), the cells were
incubated with rotating mixing at 37.degree. C. for 30 min,
pelleted by centrifugation at 12,000.times.g for 1 min and washed
in 1 ml of cold Solution A (0.5 M Sucrose, 20 mM MgCl2, 10 mM MOPS,
pH 6.8). The washed cells were incubated in 1 ml Solution A with 1
mg/ml of hen egg lysozyme at 37.degree. C. for 15 min. After
centrifugation at 12,000.times.g for 1 min the resulting
spheroplast pellets were resuspended in 1 ml of cold PBS. 300 .mu.l
of the spheroplasts were further diluted in 700 .mu.l of PBS was
labeled with 30 nM Fc.gamma.RI-FITC to analyze the binding of
Fc.gamma.RIa. For the FACS analysis of Fc.gamma.RIIa binding,
spheroplasts were incubated with 90 nM Fc.gamma.RIIa C-terminal
fused to GST (Berntzen et al., 2005), washed in 1 ml of PBS, and
labeled with polyclonal goat anti-GST-FITC (Abcam, Cambridge,
Mass.) diluted 1:200 in 1 ml of PBS. After incubation for 1 h with
vigorous shaking at 25.degree. C. in dark condition, the mixture
was pelleted by centrifugation at centrifuged at 12,000.times.g for
1 min and resuspended in 1 ml of PBS. The fluorescently labeled
spheroplasts were diluted in 2.5 ml of PBS and analyzed on BD
FACSCalibur (BD Bioscience, San Jose, Calif.).
Example 12
FACS Analysis
[0223] For affinity maturation using FACS sorting method based on
gating selective fluorescence and scattering regions, it is
required to get distinguishable high or low fluorescence signal
comparing a negative control with low coefficient of variation
(CV=[Standard Deviation/Mean Value].times.100). The fluorescence
for the 2 plasmids covalently anchored full length IgG display
systems was compared with that for the dicistronic plasmids,
pSTJ4-Herceptin IgG, pSTJ4-Herceptin-IgG1-Fc5 or
pSTJ4-Herceptin-IgG1-Fc2a.
[0224] The fluorescent profile of spheroplasts expressing inner
membrane anchored (via the N1 pA-VL-Ck polypeptide) wild type full
length IgG trastuzumab and spheroplasts expressing soluble IgG from
a dicistronic vector system (Mazor et al., 2007) were compared. The
2 plasmids anchored full length IgG display system clearly
exhibited dramatically improved signal intensity and CV value upon
labeling with Fc.gamma.RIa-FITC. The fluorescence signal for the
anchored full length IgG display system was tested with cells
cultured at 12.degree. C. or 25.degree. C. in TB. Spheroplasts
generated from trastuzumab-Fc5 displaying cells using the 2
plasmids covalently anchored full length IgG display system
cultured at 25.degree. C. exhibited much higher fluorescence and
improved CV upon labeling with Fc.gamma.RI-FITC relative to
spheroplasts expressing a wild type trastuzumab (FIG. 25). Also, in
the FACS analysis to measure the affinity of spheroplasts for
Fc.gamma.RIIa-GST (FIG. 26), 2 plasmids covalently anchored full
length IgG display system cultured at 25.degree. C. in TB showed
surprisingly improved signal intensity and CV providing a selective
display system for real affinity maturation of full length IgG
(FIG. 27 and FIG. 28).
Example 13
Construction of Error Prone PCR Library for IgG Fc Engineering
[0225] An error prone PCR library of the CH2-CH3 region in anchored
IgG was constructed by standard error prone PCR (Fromant et al.,
1995) using the wt Fc as the template and two primers (STJ#196 and
STJ#197). The amplified PCR fragments were ligated into pPelBFLAG
with SfiI restriction sites for error prone PCR library. The
library Fc fragments were amplified using the primers (STJ#479 and
STJ#67). For trastuzumab heavy chain (VH-CH1-Hinge-CH2-CH3) library
with randomized Fc region, VH-CH1 fragments were amplified using
the primers (STJ#474 and STJ#480) from the template,
pSTJ4-Herceptin IgG. Gene assembly PCR from 2 fragments,
Hinge-CH2-CH3 regions and VH-CH1 regions using the primer (STJ#474
and STJ#67) generated trastuzumab heavy chain
(VH-CH1-Hinge-CH2-CH3) library that randomized Fc region. The gene
assembled PCR fragments were ligated into pPelBFLAG with SfiI
restriction sites. The resulting plasmids were transformed into E.
coli Jude-1(F' [Tn10(Tet.sup.r) proAB.sup.+ lacI.sup.q
.DELTA.(lacZ)M15] mcrA A(mrr-hsdRMS-mcrBC) 80dlacZ.DELTA.M15
.DELTA.lacX74 deoR recA1 araD139 A(ara leu)7697 galU galK rpsL
endA1 nupG) (Kawarasaki et al., 2003). The library consisted
9.2.times.10.sup.8 individual transformants with 0.49% error rate
per gene based on the sequencing of 20 library clones randomly
selected.
Example 14
Construction of Upper CH2 Region Randomization Library for IgG Fc
Engineering
[0226] These libraries are composed of 4 sub-libraries. Four parts
of upper CH2 region (234L-239S, 264V-268H, 297N-299T, 328L-3321)
(Kabat et al., 1991) were substituted by random amino acids using
NNS degenerate codons (FIG. 29). For the first sub-library, DNA
fragments were amplified using the primers (STJ#465 and STJ#220)
and the template, pPelBFLAG-Fc. A 5' sequence extension using the
primer STJ#473 was used to generate a sub-library replacing 5 amino
acids in the region 234L-239S with random amino acids. Gene
assembly PCR products using DNA fragments amplified using the
primers (STJ#467 and STJ#220) and DNA fragments amplified using the
primers (STJ#473 and STJ#468) generated the second sub-library that
randomized 5 amino acid residues for 264V-268H. In the third
sub-library residues 297N-299T were randomized using the primer
pairs (STJ#473/STJ#470 and STJ#469/STJ#220) and the fourth
sub-library (328L-3321) was generated using the primer pairs
(STJ#473/STJ#470 and STJ#469/STJ#220) using the same PCR template
plasmid, pPelBFLAG-Fc5. Based on the number of possible mutations,
the same amount of DNA from three sub-libraries (234L-239S;
264V-268H; 328L-3321) that randomized 5 amino acid residues were
mixed with and 20.sup.3/20.sup.5 fold amount of DNA from the third
sub-library (297N-299T) that randomized 3 amino acid residues. Each
of the three sub-libraries was subcloned into SfiI digested
pPelBFLAG. For trastuzumab heavy chain (VH-CH1-Hinge-CH2-CH3)
library that randomized upper CH2 region, VH1-CH1 fragments were
amplified using the primers (STJ#474 and STJ#480) from the
template, pSTJ4-Herceptin IgG. Gene assembly PCR from 2 fragments,
Hinge-CH2-CH3 regions and VH1-CH1 regions using the primer (STJ#474
and STJ#67) generated trastuzumab heavy chain
(VH-CH1-Hinge-CH2-CH3) library that randomized upper CH2 region.
The gene assembled PCR fragments were ligated into pPelBFLAG with
SfiI restriction sites. The resulting plasmids were transformed
into E. coli Jude-1. The constructed library size was over
3.times.10.sup.8 individual transformants based on the sequence of
20 library clones randomly selected.
TABLE-US-00007 TABLE 7 Plasmids used in this study. Plasmids
Relevant characteristics Reference or source pMoPac1 Cm.sup.r, lac
promoter, tetA gene, C-terminal (Hayhurst et al., polyhistidine tag
and c-myc tag 2003) pMoPac12 Ap.sup.r, lac promoter, tetA gene, skp
gene, C- (Hayhurst et al., terminal polyhistidine tag and c-myc tag
2003) pMoPac1-FLAG- NlpA fused M18 scFv gene, C-terminal (Jung et
al., 2007) M18 FLAG tag in pMoPac1 pPelBFLAG-M18 Cm.sup.r, lac
promoter, tetA gene, skp gene, C- This study terminal FLAG tag
pPelBFLAG-Fc IgG1-Fc gene in pPelBFLAG This study pPelBFLAG-Fc5
IgG1-Fc5 gene in pPelBFLAG This study pPelBFLAG-Fc2a IgG1-Fc2a gene
in pPelBFLAG This study pMAZ360-M18.1- M18.1 humanized IgG1 gene in
pMAZ360 (Mazor et al.) Hum-IgG pSTJ4-Herceptin Trastuzumab IgG1
gene in pMAZ360- This study IgG1 M18.1-Hum-IgG1 pSTJ4-Herceptin
Trastuzumab IgG1-Fc5 gene in This study IgG1-Fc5
pMAZ360-M18.1-Hum-IgG1 pSTJ4-Herceptin Trastuzumab IgG1-Fc2a gene
in This study IgG1-Fc2a pMAZ360-M18.1-Hum-IgG1 pPelB-Herceptin(H)-
IgG1 heavy chain gene in pPelBFLAG This study FLAG
pPelB-Herceptin(H)- IgG1-Fc5 heavy chain gene in This study
Fc5-FLAG pPelBFLAG pPelB-Herceptin(H)- IgG1-Fc2a heavy chain gene
in This study Fc2a-FLAG pPelBFLAG pMAZ360-M18.1- M18.1 humanized
IgG1 gene in pMAZ360 (Mazor et al.) Hum-IgG pSTJ4-Herceptin
Trastuzumab IgG1 gene in pMAZ360- This study IgG1 M18.1-Hum-IgG1
pSTJ4-Herceptin Trastuzumab IgG1-Fc5 gene in This study IgG1-Fc5
pMAZ360-M18.1-Hum-IgG1 pSTJ4-Herceptin Trastuzumba IgG1-Fc2a gene
in This study IgG1-Fc2a pMAZ360-M18.1-Hum-IgG1 pDsbA DsbA signal
sequence gene in pTrc99A This study pDsbA-Fc-FLAG DsbA fused
IgG1-Fc gene, C-terminal This study FLAG tag in pTrc99A
pDsbA-Fc5-FLAG DsbA fused IgG1-Fc5 gene, C-terminal This study FLAG
tag in pTrc99A pDsbA-Fc2a-FLAG DsbA fused IgG1-Fc2a gene,
C-terminal This study FLAG tag in pTrc99A pBAD30 Apr, BAD promoter
(Guzman et al., 1995) pBAD30-KmR Km.sup.r, BAD promoter (Jung et
al., 2007) pBADNlpAHis-M18 NlpA fused M18 scFv, C-terminal This
study polyhistidine tag in pBAD30 pBAD-PelB-VL-Ck- PelB fused
trastuzumab VL-Ck domain, This study His C-terminal polyhistidine
tag and c-myc tag in pBAD30-KmR pBAD-PelB-VL-Ck- PelB fused
trastuzumab VL-Ck domain This study NlpA-VL-Ck-His and NlpA fused
trastuzumab VL-Ck-His in pBAD30-KmR
TABLE-US-00008 TABLE 8 Primers used in this study. Primer Name
Primer nucleotide sequence (5'.fwdarw.3') STJ#16
TTGTGAGCGGATAACAATTTC STJ#67
AATTCGGCCCCCGAGGCCCCTTTACCCGGGGACAGGGAGAGGCTCTTCTGCGTG STJ#70
CTACCTGACGCTTTTTATCGC STJ#144
TTTTAGGGGTCGACGACAAAACTCACACATGCCCACCGTG STJ#145
TTTAAGGGAAGCTTCTATTAGGCGCGCCCTTTGTCATCG STJ#147
GGCAAATTCTGTTTTATCAGACCGCTTCTG STJ#196 CGCAGCGAGGCCCAGCCGGCCATGGCG
STJ#197 CGCAATTCGAATTCGGCCCCCGAGGCCCC STJ#220
CAATTTTGTCAGCCGCCTGAGCAGAAG STJ#290
TTTTAGGGGTCGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCG
STJ#291 GGCCACCGGATATCTTATTATTTACCCGGGGACAGGGAGAGG STJ#302
GCGGAATTCCCATGGCGGATATTCAAATGACCC STJ#303
CAGACGCGCTTAAAGAAGACGGGCTTTGGGTCATTTGAATATCCGCCATG STJ#304
CGTCTTCTTTAAGCGCGTCTGTCGGTGATCGCGTGACCATCACGTGTCGT STJ#305
AGGCCACCGCCGTATTAACATCTTGGCTCGCACGACACGTGATGGTCACG STJ#306
GTTAATACGGCGGTGGCCTGGTATCAACAAAAACCGGGTAAAGCCCCGAA STJ#307
GAGTACAGAAAGCTGGCGCTGTAGATTAACAGCTTCGGGGCTTTACCCGG STJ#308
CAGCGCCAGCTTTCTGTACTCTGGCGTCCCGAGCCGCTTTTCTGGCAGCC STJ#309
TGCTAATGGTCAGCGTGAAGTCCGTACCGCTGCGGCTGCCAGAAAAGCGG STJ#310
ACTTCACGCTGACCATTAGCAGCCTGCAGCCGGAGGATTTCGCCACCTAT STJ#311
TGGCGGGGTGGTGTAGTGCTGCTGACAATAATAGGTGGCGAAATCCTCCG STJ#312
ACTACACCACCCCGCCAACCTTTGGCCAGGGTACGAAAGTGGAGATTAAA STJ#313
GACAGATGGTGCGGCCGCCGTGCGTTTAATCTCCACTTTCGTACCCTGG STJ#314
ATTGTTATTGCTAGCGGCTCAGCCGGCAATGGCG STJ#315
ACCAGACCACCGCCAGATTCCACTAATTGAACCTCCGCCATTGCCGGCTG STJ#316
TCTGGCGGTGGTCTGGTGCAGCCAGGCGGTAGCTTACGTCTGAGCTGTGC STJ#317
AGGTATCTTTGATGTTGAAGCCAGACGCTGCACAGCTCAGACGTAAGCTA STJ#318
TCTGGCTTCAACATCAAAGATACCTACATTCATTGGGTTCGCCAAGCCCC STJ#319
ATAGATACGGGCCACCCACTCCAGGCCTTTACCTGGGGCTTGGCGAACCC STJ#320
GAGTGGGTGGCCCGTATCTATCCAACCAATGGCTACACGCGTTATGCAGA STJ#321
GCGCTAATGGTGAAGCGGCCTTTCACAGAGTCTGCATAACGCGTGTAGCC STJ#322
CCGCTTCACCATTAGCGCCGACACCTCTAAGAACACCGCATATTTACAGA STJ#323
GTCCTCTGCGCGTAAAGAGTTCATCTGTAAATATGCGGTGTTCTTAGAGG STJ#324
AACTCTTTACGCGCAGAGGACACGGCGGTGTACTACTGCTCTCGTTGGGG STJ#325
AGTAGTCCATCGCGTAGAAACCGTCACCGCCCCAACGAGAGCAGTAGTAC STJ#326
GGTTTCTACGCGATGGACTACTGGGGTCAGGGTACGCTGGTCACGGTCAG STJ#327
GCCCTTGAAGCTTGCAGAGCTGACCGTGACCAGCGT STJ#332
GGGAATTCTAGACTATTAGCACTCTCCCCTGTTGAAGCTCTTTG STJ#340
TTTAAGGGAAGCTTCTATTAGCACTCTCCCCTGTTGAAGCTCTTTG STJ#422
CTAGGGAGCCGCGGGAGGAGCAGTACAACGGCGCGTACCGTGTGGTCAGCGTCCTC STJ#465
CCCACCGTGCCCAGCACCTGAANNSNNSNNSGGANNSNNSGTCTTCCTCTTCCCCCCAAAACCC
STJ#466
GGGTTTTGGGGGGAAGAGGAAGACSNNSNNTCCSNNSNNSNNTTCAGGTGCTGGGCACGGTGGG
STJ#467
CCTGAGGTCACATGCGTGGTNNSNNSNNSNNSNNSGAAGACCCTGAGGTCAAGTTCAACTGG
STJ#468
CCAGTTGAACTTGACCTCAGGGTCTTCSNNSNNSNNSNNSNNACCACGCATGTGACCTCAGG
STJ#469 GCCGCGGGAGGAGCAGTACNNSNNSNNSTACCGTGTGGTCAGCGTCCTC STJ#470
GAGGACGCTGACCACACGGTASNNSNNSNNGTACTGCTCCTCCCGCGGC STJ#471
CAAGTGCAAGGTCTCCAACAAAGCCNNSNNSNNSNNSNNSGAGAAAACCATCTCCAAAGCCAAAGG-
G STJ#472
CCCTTTGGCTTTGGAGATGGTTTTCTCSNNSNNSNNSNNSNNGGCTTTGTTGGAGACCTTGCACTT-
G STJ#473
CGCAGCGAGGCCCAGCCGGCCATGGCGGACAAAACTCACACATGCCCACCGTGCCCAGCACCTG
STJ#474 CGCAGCGAGGCCCAGCCGGCCATGGCGGAGGTTCAATTAGTGGAATCTG STJ#475
CGCAGCGAGGCCCAGCCGGCCATGGCGGATATTCAAATGACCCAAAGCCCG STJ#476
CGCAATTCGGCCCCCGAGGCCCCGCACTCTCCCCTGTTGAAGCTCTTTG STJ#479
GACAAAACTCACACATGCCCACCGTGCC STJ#480
GGCACGGTGGGCATGTGTGAGTTTTGTC
Example 15
Isolation and Differentation of Human Monocyte-Derived Dendritic
Cells (mDCs) for Antibody-Dependent Cytotoxicity Assays
[0227] Buffy coats (Gulf Coast Blood Center, Galveston, Tex.) was
added to histopaque solution (Sigma) at 1:1 volume, avoiding mixing
of the contents. The blood-histopaque solution was centrifuged at
1600 RPM for 30 minutes at 23.degree. C. without centrifugation
braking. The peripheral blood mononuclear cell layer was isolated
following gradient centrifugation, and washed twice through
centrifugation with wash buffer (PBS, 2.5% Fetal Bovine Serum
(FBS), 1 mM ethylenediaminetetraacetic acid (EDTA)). Cells were
then resuspended in Iscove's Modified Dulbecco's Medium (IMDM,
Cambrex) and added to a 24 well plate and incubated at 37.degree.
C. for 2h to allow monocytes to adhere to the plate. Typically,
PBMCs from a 50 ml volume of blood was resuspended in 24 ml of
IMDM, and plated at 1 ml/well. Media and non-adherent cells were
then aspirated and adherent cells were washed 5 times with wash
buffer. Cells were then resuspended with 1 ml/well of growth media
consisting of IMDM (Cambrex), 10% FBS, and recombinant cytokines
Interleukin-4 (IL-4, R&D systems) at 200 ng/ml and granulocyte
macrophage colony stimulating factor (GM-CSF, R&D systems) at
200 ng/ml. Additional IL-4 and GM-CSF were added at 200 ng/ml each
on day 2 and 5 without changing media. DC differentiation was
measured by flow cytometry by staining with a fluorescent antibody
against the DC-specific surface marker CD11c (eBioscience).
Example 16
Antibody Dependent Cellular Cytotoxicity (ACCC) Assays
[0228] The breast cancer cell line SkBr3 that expresses high levels
of Her2 was used as the target for ADCC assays. Cells were labeled
with the isotope Na.sup.51CrO.sub.4 (Perkin Elmer Life Sciences) at
100 uCi/10.sup.6 cells for 1 h at 37.degree. C. Cells were then
washed twice with PBS and resuspended in Roswell Park Memorial
Institute medium-1640 with glutamax (RPMI) and added to a 96 well
plate at 10.sup.4 cells/well. Aglycosylated wildtype trastuzumab,
trastuzumab-Fc5, and trastuzumab-Fc601 (prepared as described in
Example 4) and glycosylated trastumab (Clinical grade, Genentech)
and relevant controls were added to the target cells in triplicate
wells and incubated at 37.degree. C. for 1 h. The plate was then
centrifuged at 2000 RPM for 1 minute and washed with PBS. Effector
cells, either fully differentiated mDCs (day 7) or freshly isolated
PBMCs, were resuspended in RPMI, 2% low IgG FBS (Invitrogen),
lipopolysaccharide (LPS) at 250 ng/10.sup.6 cells and added to the
wells at various ratios. Target cells and mDCs were incubated at
37.degree. C. for 24h. The isotope levels present in cell media
were then measured in a liquid scinitillation counter for chromium
51. Incubation of target cells with SDS was used as a positive
control for maximum lysis and incubation with no effector cells was
used as background lysis. When mDCs are used as the effector cells,
aglycosylated trastuzumab-Fc5 and trastuzumab-601 show very high
levels of ADCC and glycosylated trastuzumab induces very low ADCC
(FIG. 31). Presumably this is because Fc-601 and Fc-5 bind only to
Fc.gamma.RI and not to the inhibitor receptor Fc.gamma.RIIb which
is also expressed on the surface of monocyted derived DCs. On the
other hand, Herceptin displays binding to all Fc.gamma.R receptors
including Fc.gamma.RIIb and binding to the latter receptor likely
inhibits target cell activation and killing. With PBMCs as the
effectors cells, glycosylated trastuzumab that can engage all the
Fc receptors and can activate NK cells demonstrates high ADCC. In
contrast, aglycosylated trastuzumab-Fc5 and trastuzumab-601 show
low ADCC (FIG. 30).
[0229] All of the methods disclosed and claimed herein can be made
and executed without undue experimentation in light of the present
disclosure. While the compositions and methods of this invention
have been described in terms of preferred embodiments, it will be
apparent to those of skill in the art that variations may be
applied to the methods and in the steps or in the sequence of steps
of the method described herein without departing from the concept,
spirit and scope of the invention. More specifically, it will be
apparent that certain agents which are both chemically and
physiologically related may be substituted for the agents described
herein while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
REFERENCES
[0230] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference.
[0231] U.S. Pat. No. 3,817,837 [0232] U.S. Pat. No. 3,826,364
[0233] U.S. Pat. No. 3,850,752 [0234] U.S. Pat. No. 3,939,350
[0235] U.S. Pat. No. 3,996,345 [0236] U.S. Pat. No. 4,275,149
[0237] U.S. Pat. No. 4,277,437 [0238] U.S. Pat. No. 4,284,412
[0239] U.S. Pat. No. 4,366,241 [0240] U.S. Pat. No. 4,472,509
[0241] U.S. Pat. No. 4,498,766 [0242] U.S. Pat. No. 4,661,913
[0243] U.S. Pat. No. 4,683,195 [0244] U.S. Pat. No. 4,683,202
[0245] U.S. Pat. No. 4,714,682 [0246] U.S. Pat. No. 4,767,206
[0247] U.S. Pat. No. 4,774,189 [0248] U.S. Pat. No. 4,800,159
[0249] U.S. Pat. No. 4,857,451 [0250] U.S. Pat. No. 4,883,750
[0251] U.S. Pat. No. 4,938,948 [0252] U.S. Pat. No. 4,988,618
[0253] U.S. Pat. No. 4,989,977 [0254] U.S. Pat. No. 5,021,236
[0255] U.S. Pat. No. 5,160,974 [0256] U.S. Pat. No. 5,302,523
[0257] U.S. Pat. No. 5,322,783 [0258] U.S. Pat. No. 5,384,253
[0259] U.S. Pat. No. 5,464,765 [0260] U.S. Pat. No. 5,478,722
[0261] U.S. Pat. No. 5,538,877 [0262] U.S. Pat. No. 5,538,880
[0263] U.S. Pat. No. 5,550,318 [0264] U.S. Pat. No. 5,563,055
[0265] U.S. Pat. No. 5,567,326 [0266] U.S. Pat. No. 5,580,859
[0267] U.S. Pat. No. 5,589,466 [0268] U.S. Pat. No. 5,610,042
[0269] U.S. Pat. No. 5,656,610 [0270] U.S. Pat. No. 5,702,932
[0271] U.S. Pat. No. 5,736,524 [0272] U.S. Pat. No. 5,779,907
[0273] U.S. Pat. No. 5,780,448 [0274] U.S. Pat. No. 5,789,215
[0275] U.S. Pat. No. 5,824,520 [0276] U.S. Pat. No. 5,843,650
[0277] U.S. Pat. No. 5,846,709 [0278] U.S. Pat. No. 5,846,783
[0279] U.S. Pat. No. 5,849,497 [0280] U.S. Pat. No. 5,849,546
[0281] U.S. Pat. No. 5,849,547 [0282] U.S. Pat. No. 5,858,652
[0283] U.S. Pat. No. 5,866,366 [0284] U.S. Pat. No. 5,882,864
[0285] U.S. Pat. No. 5,912,148 [0286] U.S. Pat. No. 5,916,776
[0287] U.S. Pat. No. 5,916,779 [0288] U.S. Pat. No. 5,922,574
[0289] U.S. Pat. No. 5,928,905 [0290] U.S. Pat. No. 5,928,906
[0291] U.S. Pat. No. 5,932,451 [0292] U.S. Pat. No. 5,935,825
[0293] U.S. Pat. No. 5,939,291 [0294] U.S. Pat. No. 5,942,391
[0295] U.S. Pat. No. 5,945,100 [0296] U.S. Pat. No. 5,981,274
[0297] U.S. Pat. No. 5,994,624 [0298] U.S. Pat. No. 7,094,571
[0299] U.S. Pat. No. 7,094,571 [0300] U.S. Patent Publ. 20030180937
[0301] U.S. Patent Publ. 20030219870 [0302] U.S. Patent Publ.
20050260736 [0303] U.S. Patent Publ. 20060173170 [0304] Abbondanzo
et al., Breast Cancer Res. Treat., 16:182(151), 1990. [0305] Ahouse
et al., J. Immunol., 151:6076-6088, 1993. [0306] Allen and Seed,
Nucleic Acids Res., 16:11824, 1988. [0307] Andersen et al., Eur. J.
Immunol., 36:3044-3051, 2006. [0308] Andersen et al., Eur. J.
Immunol., 36:3044-3051, 2006. [0309] Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory, 1988 [0310] Atherton et al.,
Biol. Reprod., 32(1):155-171, 1985. [0311] Ausubel et al., In:
Current Protocols in Molecular Biology, John, Wiley & Sons,
Inc, NY, 1994. [0312] Baneyx and Mujacic, Nat. Biotechnol.,
22:1399-1408, 2004. [0313] Bellus, J. Macromol. Sci. Pure Appl.
Chem., A31(1): 1355-1376, 1994. [0314] Berntzen et al., J. Immunol.
Methods, 298:93-104, 2005. [0315] Berntzen et al., J. Immunol.
Methods, 298:93-104, 2005. [0316] Berntzen et al., J. Immunol.
Methods, 298:93-104, 2005. [0317] Better et al., Science, 240:
1041-10433, 1988. [0318] Bocek and Pecht, FEBS Lett., 331, 86-90,
1993. [0319] Boeke et al., Mol. Gen. Genet., 186, 1982. [0320] Boss
et al., Nucleic Acids Res., 12:3791-3806, 1984. [0321] Bowden and
Georgiou, J. Biol. Chem., 265:16760-16766, 1990. [0322] Bukau et
al., J. Bacteriol., 163:61, 1985. [0323] Burman et al., J.
Bacteriol., 112:1364, 1972. [0324] Cabilly et al., Proc. Natl.
Acad. Sci. USA, 81:3273-3277, 1984. [0325] Carbonelli et al., FEMS
Microbiol Lett., 177:75-82. 1999 [0326] Chames et al., Proc. Natl.
Acad. Sci. USA, 97:7969-7974, 2000. [0327] Chen and Okayama, Mol.
Cell Biol., 7(8):2745-2752, 1987. [0328] Cocea, Biotechniques,
23(5):814-816, 1997. [0329] Collins et al., Immunogenetics,
45:440-443, 1997. [0330] Daugherty et al., Protein Eng., 12:613
621, 1999. [0331] De Jager et al., Semin. Nucl. Med.,
23(2):165-179, 1993.
[0332] de Kruif and Logtenberg, J. Biol. Chem., 271:7630-7634,
1996. [0333] Decad and Nikaido, J. Bacteriol., 128:325, 1976.
[0334] Desai et al., Cancer Res., 58:2417-2425, 1998. [0335]
Dholakia et al., J. Biol. Chem., 264(34):20638-20642, 1989. [0336]
Doolittle and Ben-Zeev, Methods Mol Biol, 109:215-237, 1999. [0337]
Eigenbrot et al., J. Molec. Biol., 229:969-995, 1993. [0338] Elbein
et al., Glycobiology, 13:17R-27, 2003. [0339] European Appln. 320
308 [0340] European Appln. 329 822 [0341] Fahnestock et al., J.
Bacteriol., 167:870-880, 1986. [0342] Farmer et al., FEMS
Microbiol. Lett., 176:11, 1999. [0343] Fechheimer, et al., Proc
Natl. Acad. Sci. USA, 84:8463-8467, 1987. [0344] Fraley et al.,
Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. [0345] Francisco et
al., Proc. Natl. Acad. Sci. USA, 90:10444-10448, 1993. [0346]
Frohman, In: PCR Protocols: A Guide To Methods And Applications,
Academic Press, N.Y., [0347] 1990. [0348] Fromant et al.,
Analytical Biochem., 224:347-353, 1995. [0349] Fromant et al.,
Analytical Biochem., 224:347-353, 1995. [0350] Fromant et al.,
Analytical Biochemistry, 224:347-353, 1995. [0351]
Garinot-Schneider et al., J. Mol. Biol., 260:731-742, 1996. [0352]
GB Appln. 2 202 328 [0353] Georgiou and Segatori, Current Opin.
Biotech., 16:538-545, 2005. [0354] Ghetie and Ward, Annu. Rev.
Immunol., 18:739-766, 2000. [0355] Ghetie and Ward, Annu. Rev.
Immunol., 18:739-766, 2000. [0356] Gomi et al., J. Immunol.,
144:4046-4052, 1990. [0357] Gopal, Mol. Cell Biol., 5:1188-1190,
1985. [0358] Graham and Van Der Eb, Virology, 52:456-467, 1973.
[0359] Griffiths and Duncan, Curr. Opin. Biotechnol., 9:102-108,
1998. [0360] Gulbis and Galand, Hum. Pathol., 24(12):1271-1285,
1993. [0361] Guzman et al., J. Bacteriol., 177:4121-30, 1995.
[0362] Guzman et al., J. Bacteriol., 177:4121-4130, 1995. [0363]
Halloran et al., J. Immunol., 153:2631-2641, 1994. [0364] Harland
and Weintraub, J. Cell Biol., 101(3):1094-1099, 1985. [0365] Harvey
et al., J. Immunol. Methods, 308:43-52, 2006. [0366] Harvey et al.,
Proc. Natl. Acad. Sci. USA, 101, 9193-9198, 2004. [0367] Hayhurst
et al., J. Immunol. Methods, 276:185-196, 2003. [0368] Hayhurst et
al., J. Immunol. Methods, 276:185-196, 2003. [0369] Hayhurst et
al., J. Immunol. Methods, 276:185-196, 2003. [0370] Hobot et al.,
J. Bacteriol., 160:143, 1984. [0371] Hoogenboom and Winter, J. Mol.
Biol., 227:381-388, 1992. [0372] Hoogenboom et al.,
Immunotechnology., 4:1-20, 1998. [0373] Hoover and Lubkowski, Nucl.
Acids Res., 30:e43, 2002. [0374] Hoover and Lubkowski, Nucleic
Acids Res., 30:e43, 2002. [0375] Innis et al., Proc. Natl. Acad.
Sci. USA, 85(24):9436-9440, 1988. [0376] Irvin et al., J.
Bacteriol., 145:1397, 1981. [0377] Jefferis, Biotechnol. Prog.,
21:11-16, 2005. [0378] Jeong and Lee, Appl. Environ. Microbiol.,
69:1295-1298, 2003. [0379] Jeong and Lee, Appl. Environ.
Microbiol., 69:1295-1298, 2003. [0380] Jouenne and Junter, FEMS
Microbiol. Lett., 56:313, 1990. [0381] Jung et al., Biotechnol
Bioeng, 98:39-47, 2007 [0382] Jung et al., Biotechnol. Bioeng.,
98:39-47, 2007. [0383] Jung et al., Biotechnol. Bioeng., 98:39-47,
2007. [0384] Jung et al., Protein Expr. Purif., 31:240-246, 2003.
[0385] Kabat et al., In: Sequences of Proteins of Immunological
Interest, U.S. Dept. Health and Hum. [0386] Serv., Bethesda, Md.,
1991. [0387] Kabat et al., In: Sequences of Proteins of
Immunological Interest, U.S. Dept. of Health and Hum. [0388] Serv.,
Bethesda, 1991. [0389] Kaeppler et al., Plant Cell Reports,
9:415-418, 1990. [0390] Kaneda et al., Science, 243:375-378, 1989.
[0391] Kato et al, J. Biol. Chem., 266:3361-3364, 1991. [0392]
Kawarasaki et al., Nucleic Acids Res., 31:e126, 2003. [0393]
Kawarasaki et al., Nucleic Acids Res., 31:e126, 2003. [0394]
Khatoon et al., Ann. Neurol, 26(2):210-215, 1989. [0395] Kim et
al., Eur. J. Immunol., 24:2429-2434, 1994. [0396] King et al., J.
Biol. Chem., 264(17):10210-10218, 1989. [0397] Kipriyanov and
Little, Mol. Biotechnol., 12:173-201, 1999. [0398] Kjaer et al.,
FEBS Lett., 431:448-452, 1998. [0399] Knight et al., Mol. Immunol.,
32:1271-1281, 1995. [0400] Kohler and Milstein, Nature,
256:495-497, 1975. [0401] Kouzarides and Ziff, Nature,
336:646-6451, 1988. [0402] Kuroda et al., Lancet., 357:1225-1240,
2001. [0403] Kwoh et al., Proc. Natl. Acad. Sci. USA, 86:1173,
1989. [0404] Labischinski et al., J. Bacteriol., 162:9, 1985.
[0405] Landschulz et al., Science, 240:1759-1764, 1988. [0406]
Lazar et al., Proc. Natl. Acad. Sci. USA, 103:4005-4010, 2006.
[0407] Lazar et al., Proc. Natl. Acad. Sci. USA, 103:4005-4010,
2006. [0408] Lei et al., J. Bacteriol., 169:4379-4383, 1987. [0409]
Levenson et al., Hum. Gene Ther., 9(8):1233-1236, 1998. [0410] Li
et al., J. Mol. Biol., 337:743-759, 2004. [0411] Maniatis, et al.,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press,
Cold Spring Harbor, N.Y., 1988. [0412] Marciano et al., Science,
284:1516, 1999. [0413] Masaki et al., Nucleic Acids Res.,
13:1623-1635, 1985. [0414] Mazor et al., Nat. Biotech.,
25(5):563-565, 2007. [0415] Mazor et al., Nat. Biotech., 25:563-5,
2007. [0416] Munson and Pollard, Anal. Biochem., 107:220, 1980.
[0417] Nagaoka and Akaike, Protein Engineering, 16: 243-245, 2003.
[0418] Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982.
[0419] Nicolau et al., Methods Enzymol., 149:157-176, 1987. [0420]
Nikaido and Nakae, Adv. Microb. Physiol., 20:163, 1979. [0421]
Nikaido and Vaara, Microbiol. Rev., 49:1, 1985. [0422] Nikaido, J.
Bacteriology, 178(20):5853-5859, 1996. [0423] O'Brien et al.,
Protein Expr. Purif., 24:43-50, 2002. [0424] Ober et al., J.
Immunol., 172:2021-2029, 2004b. [0425] Ober et al., Proc. Natl.
Acad. Sci. USA, 101:11076-11081, 2004a. [0426] Olsson et al., Eur.
J. Biochem., 168:319-324, 1987. [0427] Orlandi et al., Proc. Natl.
Acad. Sci. USA, 86:3833-3837, 1989. [0428] Osborn et al., J. Biol.
Chem, 247:3973-3986, 1972. [0429] Owens and Haley, Biochem.
Biophys. Res. Commun., 142(3):964-971, 1987. [0430] Painbeni et
al., Proc Natl. Acad. Sci. USA, 94:6712, 1997. [0431] Pavlou and
Belsey, Eur. J. Pharm. Biopharm., 59:389-396, 2005. [0432] PCT
Appln. PCT/US87/00880 [0433] PCT Appln. PCT/US89/01025 [0434] PCT
Appln. WO 88/10315 [0435] PCT Appln. WO 89/06700 [0436] PCT Appln.
WO 90/07641 [0437] PCT Appln. WO 93/06213 [0438] PCT Appln. WO
94/09699 [0439] PCT Appln. WO 95/06128 [0440] Potrykus et al., Mol.
Gen. Genet., 199(2):169-177, 1985. [0441] Potter and Haley, Methods
Enzymol, 91:613-633, 1983. [0442] Purvis et al., Appl. Environ.
Microbiol., 71:3761-3769, 2005. [0443] Raghavan and Bjorkman, Annu.
Rev. Cell Dev. Biol., 12:181-220, 1996. [0444] Rao and Torriani, J.
Bacteriol., 170, 5216, 1988. [0445] Ravetch and Perussia et al., J.
Exp. Med., 170:481-497, 1989. [0446] Ravetch et al., Science,
234:718-725, 1986. [0447] Rippe, et al., Mol. Cell Biol.,
10:689-695, 1990. [0448] Rodewald, J. Cell Biol., 71:666-669, 1976.
[0449] Ruhlmann et al., FEBS Lett., 235:262-266, 1988. [0450]
Sambrook et al., In: Molecular cloning: a laboratory manual,
2.sup.nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989. [0451] Sazinsky et al., Proc. Natl. Acad. Sci.
USA, 105:20167-20172, 2008. [0452] Schierle et al., J. Bacteriol.,
185:5706-5713, 2003. [0453] Sears et al., J. Immunol., 144:371-378,
1990. [0454] Sergina and Moasser, Trends in Molec. Med.,
13:527-534, 2007. [0455] Sergina, and Moasser, Trends in Molec.
Med., 13:527-534, 2007. [0456] Shields et al., J. Biol. Chem.,
276:6591-6604, 2001. [0457] Shuttleworth et al., Gene,
58(2-3):283-295, 1987. [0458] Simister and Mostov, Nature,
337(6203):184-187, 1989. [0459] Sondermann et al., J. Mol. Biol.,
309:737-749, 2001. [0460] Stenberg et al., Mol. Microbiol.,
6:1185-1194, 1992. [0461] Stengelin et al., Embo J, 7:1053-1059,
1988. [0462] Stuart et al., Embo J., 8:3657-3666, 1989. [0463]
Stuart et al., J. Exp. Med., 166:1668-1684, 1987. [0464] Tominaga
et al., Biochem. Biophys. Res. Commun., 168:683-689, 1990. [0465]
Uhlen et al., J. Biol. Chem., 259:1695-702, 1984. [0466] Van
Wielink and Duine, Trends Biochem Sci., 15:136, 1990. [0467] Wada
et al., J. Biol. Chem., 274:17353-17357, 1999. [0468] Walker et
al., Nucleic Acids Res., 20(7):1691-1696, 1992. [0469] Wong et al.,
Gene, 10:87-94, 1980. [0470] Wright and Morrison, Trends Biotech.,
15:26-32, 1997. [0471] Zeger et al., Proc. Natl. Acad. Sci. USA,
87:3425-3429, 1990. [0472] Zhang et al., Immunogenetics,
39:423-437, 1994. [0473] Zhang et al., Microbiology, 144(Pt
4):985-991, 1998.
Sequence CWU 1
1
781681DNAHomo sapiens 1gacaaaactc acacatgccc accgtgccca gcacctgaac
tcctgggggg accgtcagtc 60ttcctcttcc ccccaaaacc caaggacacc ctcatgatct
cccggacccc tgaggtcaca 120tgcgtggtgg tggacgtgag ccacgaagac
cctgaggtca agttcaactg gtacgtggac 180ggcgtggagg tgcataatgc
caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240cgtgtggtca
gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag
300tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc
caaagccaaa 360gggcagcccc gagaaccaca ggtgtacacc ctgcccccat
cccgggatga gctgaccaag 420aaccaggtca gcctgacctg cctggtcaaa
ggcttctatc ccagcgacat cgccgtggag 480tgggagagca atgggcagcc
ggagaacaac tacaagacca cacctcccgt gctggactcc 540gacggctcct
tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg
600aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac
gcagaagagc 660ctctccctgt ccccgggtaa a 6812227PRTHomo sapiens 2Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Met 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
3681DNAHomo sapiens 3gacaaaactc acacatgccc accgtgccca gcacctgaac
tcctgggggg accgtcagtc 60ttcctcttcc ccccaaaacc caaggacacc ctcatgatct
cccggacccc tgaggtcaca 120tgcgtggtgg tggacgtgag ccacgaagac
cctgaggtca agttcaactg gtacgtggac 180ggcgtggagg tgcataatgc
caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240cgtgtggtca
gtgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaaa
300tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc
caaagccaaa 360gggcagcccc gagaaccaca ggtgtacacc ctgcccccat
cccgggatga gctgaccaag 420aaccaggtca gcctgacctg cctggtcaaa
ggcttctatc ccagcgacat cgccgtggag 480tgggtgagca atgggcagcc
ggagaacaac tacaagacca cacctcccgt gctggactcc 540gacggctcct
tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg
600aacgtcttct catgctccgt gatacatgag gctctgcaca accactacac
gcagaagagc 660ctctccctgt ccccgggtaa a 6814227PRTHomo sapiens 4Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
5227PRTHomo sapiens 5Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
100 105 110 Glu Lys Thr Ile Ser Arg Ala Lys Val Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 6227PRTHomo sapiens 6Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asp Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asp Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile Ser Lys Ala Asn Gly
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 7227PRTHomo sapiens 7Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Asn Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
8227PRTHomo sapiens 8Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
100 105 110 Glu Lys Thr Ile Ser Ile Ala Asn Gly Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 9227PRTHomo sapiens 9Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile Ser Lys Ala Gln Gly
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Asp Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 10227PRTHomo sapiens 10Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Ser Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Asn Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
11227PRTHomo sapiens 11Asp Lys Thr Tyr Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His 35 40 45 Lys Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Ser Lys Ala Leu Pro Ala Pro Ile
100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Val Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 12227PRTHomo sapiens 12Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1
5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
Met 20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
Val Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
Asp Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu
Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr
Val Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys
Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr
Ile Ser Lys Ala Lys Val Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr
Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135
140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
145 150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Glu Thr
Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn
Val Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His
Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
13227PRTHomo sapiens 13Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
100 105 110 Glu Lys Thr Ile Ser Arg Ala Lys Val Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Leu Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asp His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 14227PRTHomo sapiens 14Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Leu Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Val
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 15227PRTHomo sapiens 15Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Val Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
16227PRTHomo sapiens 16Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asp Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Val Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 17227PRTHomo sapiens 17Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Val
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Ala
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 18227PRTHomo sapiens 18Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asp Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Val Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Ser His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
19227PRTHomo sapiens 19Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Val Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Ser Lys Ala Leu Pro Ala Pro Ile
100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Val Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 20227PRTHomo sapiens 20Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Cys 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Val
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 21227PRTHomo sapiens 21Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Val Gln Pro Arg Glu Pro Gln Met 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
22227PRTHomo sapiens 22Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Ser His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 23227PRTHomo sapiens 23Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Met
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
24227PRTHomo sapiens 24Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Met Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Arg Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Trp Pro Val Ala Tyr
100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 25227PRTHomo sapiens 25Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Met Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Met Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Trp Pro Glu Glu Tyr 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 26227PRTHomo sapiens 26Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Met
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Trp Pro Glu Glu Tyr 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
27227PRTHomo sapiens 27Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Met Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Trp Pro Glu Val Tyr
100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Thr Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 28227PRTHomo sapiens 28Asp Lys Thr His Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Met Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Trp Pro Glu Val Tyr 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 29227PRTHomo sapiens 29Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10
15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
20 25 30 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Met
Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val
Leu His Gln Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys
Val Ser Asn Lys Ala Trp Pro Ile Glu Tyr 100 105 110 Glu Lys Thr Ile
Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr
Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140
Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145
150 155 160 Trp Val Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro 165 170 175 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val 180 185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Ile 195 200 205 His Glu Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser 210 215 220 Pro Gly Lys 225
30227PRTHomo sapiens 30Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met 20 25 30 Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val Asp Met Ser His 35 40 45 Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 65 70 75 80 Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 85 90
95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Trp Pro Glu Pro Tyr
100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Ile 195 200 205 His
Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 210 215
220 Pro Gly Lys 225 31227PRTHomo sapiens 31Asp Lys Thr Arg Thr Cys
Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Phe Met 20 25 30 Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Met Ser His 35 40 45
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50
55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Trp Pro Val Ser Tyr 100 105 110 Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg Glu Pro Gln Val 115 120 125 Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys Asn Gln Val Ser 130 135 140 Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 Trp Val
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180
185 190 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val
Ile 195 200 205 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
Ser Leu Ser 210 215 220 Pro Gly Lys 225 3221DNAHomo sapiens
32ttgtgagcgg ataacaattt c 213327DNAHomo sapiens 33cgcagcgagg
cccagccggc catggcg 273429DNAHomo sapiens 34cgcaattcga
attcggcccc
cgaggcccc 293527DNAHomo sapiens 35caattttgtc agccgcctga gcagaag
273633DNAHomo sapiens 36gcggaattcc catggcggat attcaaatga ccc
333750DNAHomo sapiens 37cagacgcgct taaagaagac gggctttggg tcatttgaat
atccgccatg 503850DNAHomo sapiens 38cgtcttcttt aagcgcgtct gtcggtgatc
gcgtgaccat cacgtgtcgt 503950DNAHomo sapiens 39aggccaccgc cgtattaaca
tcttggctcg cacgacacgt gatggtcacg 504050DNAHomo sapiens 40gttaatacgg
cggtggcctg gtatcaacaa aaaccgggta aagccccgaa 504150DNAHomo sapiens
41gagtacagaa agctggcgct gtagattaac agcttcgggg ctttacccgg
504250DNAHomo sapiens 42cagcgccagc tttctgtact ctggcgtccc gagccgcttt
tctggcagcc 504350DNAHomo sapiens 43tgctaatggt cagcgtgaag tccgtaccgc
tgcggctgcc agaaaagcgg 504450DNAHomo sapiens 44acttcacgct gaccattagc
agcctgcagc cggaggattt cgccacctat 504550DNAHomo sapiens 45tggcggggtg
gtgtagtgct gctgacaata ataggtggcg aaatcctccg 504650DNAHomo sapiens
46actacaccac cccgccaacc tttggccagg gtacgaaagt ggagattaaa
504749DNAHomo sapiens 47gacagatggt gcggccgccg tgcgtttaat ctccactttc
gtaccctgg 494834DNAHomo sapiens 48attgttattg ctagcggctc agccggcaat
ggcg 344950DNAHomo sapiens 49accagaccac cgccagattc cactaattga
acctccgcca ttgccggctg 505050DNAHomo sapiens 50tctggcggtg gtctggtgca
gccaggcggt agcttacgtc tgagctgtgc 505150DNAHomo sapiens 51aggtatcttt
gatgttgaag ccagacgctg cacagctcag acgtaagcta 505250DNAHomo sapiens
52tctggcttca acatcaaaga tacctacatt cattgggttc gccaagcccc
505350DNAHomo sapiens 53atagatacgg gccacccact ccaggccttt acctggggct
tggcgaaccc 505450DNAHomo sapiens 54gagtgggtgg cccgtatcta tccaaccaat
ggctacacgc gttatgcaga 505550DNAHomo sapiens 55gcgctaatgg tgaagcggcc
tttcacagag tctgcataac gcgtgtagcc 505650DNAHomo sapiens 56ccgcttcacc
attagcgccg acacctctaa gaacaccgca tatttacaga 505750DNAHomo sapiens
57gtcctctgcg cgtaaagagt tcatctgtaa atatgcggtg ttcttagagg
505850DNAHomo sapiens 58aactctttac gcgcagagga cacggcggtg tactactgct
ctcgttgggg 505950DNAHomo sapiens 59agtagtccat cgcgtagaaa ccgtcaccgc
cccaacgaga gcagtagtac 506050DNAHomo sapiens 60ggtttctacg cgatggacta
ctggggtcag ggtacgctgg tcacggtcag 506136DNAHomo sapiens 61gcccttgaag
cttgcagagc tgaccgtgac cagcgt 366264DNAHomo
sapiensmisc_feature(23)..(24)n is a, c, g, or t 62cccaccgtgc
ccagcacctg aannsnnsnn sggannsnns gtcttcctct tccccccaaa 60accc
646364DNAHomo sapiensmisc_feature(26)..(27)n is a, c, g, or t
63gggttttggg gggaagagga agacsnnsnn tccsnnsnns nnttcaggtg ctgggcacgg
60tggg 646462DNAHomo sapiensmisc_feature(21)..(22)n is a, c, g, or
t 64cctgaggtca catgcgtggt nnsnnsnnsn nsnnsgaaga ccctgaggtc
aagttcaact 60gg 626562DNAHomo sapiensmisc_feature(29)..(30)n is a,
c, g, or t 65ccagttgaac ttgacctcag ggtcttcsnn snnsnnsnns nnaccacgca
tgtgacctca 60gg 626649DNAHomo sapiensmisc_feature(20)..(21)n is a,
c, g, or t 66gccgcgggag gagcagtacn nsnnsnnsta ccgtgtggtc agcgtcctc
496749DNAHomo sapiensmisc_feature(23)..(24)n is a, c, g, or t
67gaggacgctg accacacggt asnnsnnsnn gtactgctcc tcccgcggc
496867DNAHomo sapiensmisc_feature(26)..(27)n is a, c, g, or t
68caagtgcaag gtctccaaca aagccnnsnn snnsnnsnns gagaaaacca tctccaaagc
60caaaggg 676967DNAHomo sapiensmisc_feature(29)..(30)n is a, c, g,
or t 69ccctttggct ttggagatgg ttttctcsnn snnsnnsnns nnggctttgt
tggagacctt 60gcacttg 677064DNAHomo sapiens 70cgcagcgagg cccagccggc
catggcggac aaaactcaca catgcccacc gtgcccagca 60cctg 647167DNAHomo
sapiensmisc_feature(26)..(27)n is a, c, g, or t 71caagtgcaag
gtctccaaca aagccnnsnn snnsnnsnns gagaaaacca tctccaaagc 60caaaggg
677267DNAHomo sapiensmisc_feature(29)..(30)n is a, c, g, or t
72ccctttggct ttggagatgg ttttctcsnn snnsnnsnns nnggctttgt tggagacctt
60gcacttg 677364DNAHomo sapiens 73cgcagcgagg cccagccggc catggcggac
aaaactcaca catgcccacc gtgcccagca 60cctg 647449DNAHomo sapiens
74cgcagcgagg cccagccggc catggcggag gttcaattag tggaatctg
497551DNAHomo sapiens 75cgcagcgagg cccagccggc catggcggat attcaaatga
cccaaagccc g 517649DNAHomo sapiens 76cgcaattcgg cccccgaggc
cccgcactct cccctgttga agctctttg 497728DNAHomo sapiens 77gacaaaactc
acacatgccc accgtgcc 287828DNAHomo sapiens 78ggcacggtgg gcatgtgtga
gttttgtc 28
* * * * *