U.S. patent application number 14/081397 was filed with the patent office on 2014-08-21 for genetic polymorphisms associated with rheumatoid arthritis, methods of detection and uses thereof.
This patent application is currently assigned to Celera Corporation. The applicant listed for this patent is Celera Corporation. Invention is credited to Heather C. ALEXANDER, Ann B. BEGOVICH, Michele CARGILL, Victoria CARLTON, Steven J. SCHRODI.
Application Number | 20140234291 14/081397 |
Document ID | / |
Family ID | 32831198 |
Filed Date | 2014-08-21 |
United States Patent
Application |
20140234291 |
Kind Code |
A1 |
CARGILL; Michele ; et
al. |
August 21, 2014 |
GENETIC POLYMORPHISMS ASSOCIATED WITH RHEUMATOID ARTHRITIS, METHODS
OF DETECTION AND USES THEREOF
Abstract
The present invention is based on the discovery of genetic
polymorphisms that are associated with rheumatoid arthritis. In
particular, the present invention relates to nucleic acid molecules
containing the polymorphisms, variant proteins encoded by such
nucleic acid molecules, reagents for detecting the polymorphic
nucleic acid molecules and proteins, and methods of using the
nucleic acid and proteins as well as methods of using reagents for
their detection.
Inventors: |
CARGILL; Michele; (Orinda,
CA) ; BEGOVICH; Ann B.; (El Cerrito, CA) ;
CARLTON; Victoria; (San Francisco, CA) ; SCHRODI;
Steven J.; (Madison, WI) ; ALEXANDER; Heather C.;
(Alameda, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Celera Corporation |
Alameda |
CA |
US |
|
|
Assignee: |
Celera Corporation
Alameda
CA
|
Family ID: |
32831198 |
Appl. No.: |
14/081397 |
Filed: |
November 15, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12773642 |
May 4, 2010 |
|
|
|
14081397 |
|
|
|
|
10767471 |
Jan 30, 2004 |
7833706 |
|
|
12773642 |
|
|
|
|
60443566 |
Jan 30, 2003 |
|
|
|
60455444 |
Mar 18, 2003 |
|
|
|
60465241 |
Apr 25, 2003 |
|
|
|
60495115 |
Aug 15, 2003 |
|
|
|
60519270 |
Nov 13, 2003 |
|
|
|
Current U.S.
Class: |
424/130.1 ;
435/29; 435/6.11; 435/7.1; 435/7.92; 436/501; 506/10; 506/9;
514/21.2; 514/44A; 530/350; 530/387.9; 536/24.31 |
Current CPC
Class: |
C12Q 2600/118 20130101;
C07K 14/00 20130101; A61P 29/00 20180101; C12Q 2600/106 20130101;
C12Q 1/6883 20130101; G01N 33/5008 20130101; C12Q 2600/156
20130101; C07K 16/18 20130101; C12Q 2600/142 20130101 |
Class at
Publication: |
424/130.1 ;
536/24.31; 530/350; 530/387.9; 514/21.2; 514/44.A; 435/6.11;
436/501; 435/29; 506/9; 506/10; 435/7.92; 435/7.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07K 16/18 20060101 C07K016/18; G01N 33/50 20060101
G01N033/50; C07K 14/00 20060101 C07K014/00 |
Claims
1. A method of determining whether a human has an increased risk
for developing rheumatoid arthritis, comprising testing nucleic
acid from said human for the presence or absence of a polymorphism
in said human's nucleic acid, wherein said polymorphism is at
position 101 of any of SEQ ID NOS:10,916-49,582 and 50,231, and
correlating the presence or absence of said polymorphism with said
human having an increased risk for developing rheumatoid
arthritis.
2. The method of claim 1, wherein said nucleic acid is a nucleic
acid extract from a biological sample from said human.
3. The method of claim 2, wherein said biological sample is blood,
saliva, or buccal cells.
4. The method of claim 2, further comprising preparing said nucleic
acid extract from said biological sample prior to said testing
step.
5. The method of claim 4, further comprising obtaining said
biological sample from said human prior to said preparing step.
6. The method of claim 1, wherein said testing step comprises
nucleic acid amplification.
7. The method of claim 6, wherein said nucleic acid amplification
is carried out by polymerase chain reaction.
8. The method of claim 1, wherein said correlating step is
performed by computer software.
9. The method of claim 1, wherein said testing is carried out by a
process selected from the group consisting of: allele-specific
probe hybridization, allele-specific primer extension,
allele-specific amplification, sequencing, 5' nuclease digestion,
molecular beacon assay, oligonucleotide ligation assay, size
analysis, single-stranded conformation polymorphism (SSCP), and
denaturing gradient gel electrophoresis (DGGE).
10. A method of determining whether a human has an increased risk
for developing rheumatoid arthritis, comprising testing nucleic
acid from said human for the presence or absence of an LD
polymorphism in said human's nucleic acid, wherein said LD
polymorphism is in linkage disequilibrium with a polymorphism at
position 101 of any of SEQ ID NOS:10,916-49,582 and 50,231, and
correlating the presence or absence of said LD polymorphism with
said human having an increased risk for developing rheumatoid
arthritis.
11. An isolated polynucleotide which specifically hybridizes to a
segment of a nucleic acid molecule, wherein said segment includes a
polymorphism at position 101 of any of SEQ ID NOS:10,916-49,582 and
50,231.
12. A kit for detecting a polymorphism in a nucleic acid,
comprising the polynucleotide of claim 11, a buffer, and an
enzyme.
13. An isolated polypeptide encoded by the polynucleotide of claim
11, wherein the polypeptide comprises an amino acid sequence
selected from the group of SEQ ID NOS:670-1338.
14. An antibody that selectively binds to the polypeptide of claim
13.
15. A method for identifying an agent useful in therapeutically or
prophylactically treating rheumatoid arthritis, comprising
contacting the polypeptide of claim 13 with a candidate agent under
conditions suitable to allow formation of a binding complex between
the polypeptide and the candidate agent, and detecting the
formation of the binding complex, wherein the presence of the
complex identifies said agent.
16. The method of claim 15, further comprising determining whether
said agent modulates the function or activity of said
polypeptide.
17. A pharmaceutical composition comprising an agent identified by
the method of claim 15 and a pharmaceutically acceptable carrier
therefor.
18. A method for treating rheumatoid arthritis, comprising
administering to a human in need of such treatment a
pharmaceutically effective amount of an agent identified by the
method of claim 15.
19. The method of claim 1, further comprising administering a
therapeutic agent to said human to mitigate said increased risk for
developing rheumatoid arthritis.
20. A method for conducting a clinical trial in which a therapeutic
agent is evaluated in at least one human, the method comprising
testing nucleic acid from said human for the presence or absence of
a polymorphism in said human's nucleic acid, wherein said
polymorphism is at position 101 of any of SEQ ID NOS:10,916-49,582
and 50,231, and determining whether to include or exclude said
human in said clinical trial based on said genotype.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
non-provisional application Ser. No. 12/773,642, filed May 4, 2010,
which is a divisional application of U.S. non-provisional
application Ser. No. 10/767,471, filed Jan. 30, 2004 (issued as
U.S. Pat. No. 7,833,706 on Nov. 16, 2010), which is a
non-provisional application of U.S. provisional application Ser.
No. 60/443,566, filed Jan. 30, 2003, and of U.S. provisional
application Ser. No. 60/455,444, filed Mar. 18, 2003, and of U.S.
provisional application Ser. No. 60/465,241, filed Apr. 25, 2003,
and of U.S. provisional application Ser. No. 60/495,115, filed Aug.
15, 2003, and of U.S. provisional application Ser. No. 60/519,270,
filed Nov. 13, 2003, the contents of each of which are hereby
incorporated by reference in their entirety into this
application.
FIELD OF THE INVENTION
[0002] The present invention is in the field of diagnosis and
therapy of autoimmune diseases. In particular, the present
invention relates to specific single nucleotide polymorphisms
(SNPs) in the human genome, and their association with rheumatoid
arthritis and related pathologies such as other autoimmune
diseases. Based on differences in allele frequencies in the
rheumatoid arthritis patient population relative to normal
individuals, the naturally-occurring SNPs disclosed herein can be
used as targets for the design of diagnostic reagents and the
development of therapeutic agents, as well as for disease
association and linkage analysis. In particular, the SNPs of the
present invention are useful for identifying an individual who is
at an increased or decreased risk of developing rheumatoid
arthritis and for early detection of the disease, for providing
clinically important information for the prevention and/or
treatment of rheumatoid arthritis, and for screening and selecting
therapeutic agents. The SNPs disclosed herein are also useful for
human identification applications. Methods, assays, kits, and
reagents for detecting the presence of these polymorphisms and
their encoded products are provided.
BACKGROUND OF THE INVENTION
[0003] Autoimmune Diseases & Rheumatoid Arthritis
[0004] Autoimmune diseases are a major health issue, occurring in
up to 3% of the general population (Cooper & Stroehla, 2003,
Autoimmunity Rev. 2:119-125). Although the clinical phenotypes of
these diseases are distinct, they share certain common elements,
including geographical distributions, population frequencies,
therapeutic strategies, and some clinical features which suggest
potential similarities in the underlying mechanisms of these
diseases. Furthermore, the co-association of multiple autoimmune
diseases in the same individual or family supports the presence of
common environmental and genetic factors that predispose an
individual to autoimmunity (Vyse & Todd, 1996, Cell 85:311-318;
Cooper & Stroehla, 2003, Autoimmunity Rev. 2:119-125; Ueda et
al., 2003, Nature 423:506-511).
[0005] While the major histocompatability complex (MHC) is a known
susceptibility locus for many autoimmune diseases, a recent
comparison of 23 autoimmune or inflammatory genome-wide scans or
linkage studies have uncovered a clustering of non-MHC
susceptibility candidate loci (Becker et al., 1998, Proc. Natl.
Acad. Sci. USA 95:9979-9984; Jawaheer et al., 2001, Am. J. Human
Genet. 68:927-936). Examples of autoimmune diseases are rheumatoid
arthritis, type 1 diabetes, multiple sclerosis, systemic lupus
erythematosus, inflammatory bowel diseases, psoriasis, thyroiditis,
celiac disease, pernicious anemia, asthma, vitiligo,
glomerulonephritis, Graves' disease, myocarditis, Sjogren disease,
and primary systemic vasculitis.
[0006] Rheumatoid arthritis (RA) is one of the most common
autoimmune inflammatory disorders, with a prevalence of between
0.5-1% in most adult populations. It is found worldwide and affects
all ethnic groups, although it is more common in Europe and the
United States than in Asia (Abdel-Nasser et al., 1997, Semin.
Arthritis Rheum. 27:123-140; Silman & Hochberg, 1993,
Rheumatoid Arthritis, Epidemiology of the Rheumatic Diseases,
Oxford University Press, pp. 7-68) and there is a gradient in
Europe with a higher prevalence in the north (Cimmino et al., 1998,
Ann. Rheum. Diseases 57:315-318). RA can also occur in any age
group. Onset is typically between the ages of 40 and 60 years, and
the incidence increases with age until approximately 70-80 years,
at which point it declines (Abdel-Nasser et al., 1997, Semin.
Arthritis Rheum. 27: 123-140; Silman & Hochberg, 1993,
Epidemiology of the Rheumatic Diseases. Oxford University Press.
pp. 7-68). RA is two to three times more common in women than men,
depending on age (Linos et al., 1980, J. Chronic Diseases
33:73-77). The observations that (i) women in the postpartum period
are at increased risk for RA onset and (ii) women with RA commonly
experience remission during pregnancy followed by postpartum
relapse (Barrett et al., 1999, Arhritis Rheum. 42:1219-1227)
suggest that hormones play a role in disease onset.
[0007] RA is a chronic, progressive disease of unknown etiology
characterized by the infiltration of activated lymphocytes and
macrophages into the synovial lining of the affected joint. These
cells produce cytokines and degradative enzymes, which mediate
inflammation and destruction of the joint architecture, often
leading to permanent disability. RA is a systemic disease;
extra-articular manifestations are often present and can range from
relatively minor problems, such as rheumatoid nodules, to
life-threatening organ disease.
[0008] Clinically, RA is a highly heterogeneous disease varying
from very mild to severely disabling disease with upwards of one in
20 patients progressing to severe, erosive disease. Joint damage
occurs early in disease with the greatest progression to joint
abnormalities taking place during the first six years. Within three
years of disease onset, as many as 70% of patients show some
radiographic evidence of joint damage (Lipsky et al., 1994,
Rheumatoid Arthritis, Harrison's Principles of Internal Medicine,
13th ed. New York, McGraw-Hill, Inc., pp. 1648-1655). At present,
there is no cure for RA, and the joint damage is irreversible.
[0009] Although the course of RA is highly variable, most patients
with clinical, persistent RA eventually develop debilitating joint
damage and deformation, resulting in progressive functional
limitation. Consequently, RA is considered a highly disabling
disease with a considerable economic impact that some liken to that
of coronary artery disease (Allaire et al., 1994, Pharmacoeconomics
6:513-522). A 1993 study in the U.S. estimated total annual direct
costs of $5275 per patient with indirect costs as high as $21,000
per year (Merkesdal et al., 2001, Arthritis Rheum. 44:528-534).
[0010] RA is thought to be a complex disease precipitated by the
interplay of environmental and genetic factors. Although several
environmental triggers have been suggested, such as infection
(Harris, 1990, N. Engl. J. Med. 322:1277-1289), immunization
(Symmons and Chakravarty, 1993, Ann. Rheum. Dis. 52:843-844), diet
(Shapiro et al., 1996, Epidemiology 7:256-263), and smoking
(Symmons et al., 1997, Arthritis Rheum. 40:1955-1961), none have
been established. A genetic component to RA susceptibility has long
been indicated by data from twin and family studies. It is
estimated that the concordance between monozygotic twins is in the
range of 12-15% while the prevalence in siblings of RA probands is
approximately 2-4%, both well above the estimated background
population prevalence of 0.5-1% (Seldin et al., 1999, Arthritis
Rheum. 42:1071-1079). From these data, the disease heritability has
been estimated at approximately 60% (MacGregor et al., 2000,
Arthritis Rheum. 43:30-37) while the relative recurrence risk for
siblings (.lamda.s) of probands with RA is estimated at between 5
and 10 (Seldin et al. 1999; Jawaheer et al., 2001, Am. J. Hum.
Genet. 68:927-936).
[0011] Among the many genetic studies of small cohorts, the only
genes consistently associated with RA to-date are the MHC, i.e.
human leukocyte antigen (HLA)-linked genes, on the short arm of
human chromosome 6. It has been estimated that approximately
one-third to one-half of the total genetic contribution to RA can
be attributed to genes within the HLA complex (Deighton et al.,
1989, Clin. Genet. 36:178-182). This observation has been supported
by three recent genome-wide scans using RA-affected sibling pairs
(Cornelis et al., 1998, Proc. Natl. Acad. Sci. USA 95:10746-10750;
Jawaheer et al., 2001, Am. J. Hum. Genet. 68: 927-936; MacKay et
al., 2002, Arthritis Rheum. 46:632-639). The vast majority of HLA
studies of RA have focused on a direct role of HLA-DRB1 alleles
that encode a common structural element, but recent evidence
suggests that the HLA association is more complex and probably
involves other loci within this gene complex. Despite over 20 years
of research, it is still unclear whether the implicated HLA-DRB1
alleles are involved in RA susceptibility or severity of disease
(Weyand et al., 1998, Springer Semin. Immunopathol. 20:5-22; Fries
et al., 2002, Arthritis Rheum. 46:2320-2329).
[0012] The increasing availability of specific therapies that can
halt disease progression has magnified the need for accurate early
diagnosis of RA (Maini et al., 1999, Lancet 354:1932-1939; Lipsky
et al., 2000, N. Engl. J. Med. 343: 1594-1602; Weinblatt et al.,
1999, N. Engl. J. Med. 340: 253-259). Unfortunately, classifying an
arthritic disorder such as RA is challenging because no etiological
agent has been identified and no clinical or laboratory features
uniquely define the disease (Sangha, 2000, Rheumatology 39 (suppl.
2): 3-12). The most commonly used diagnostic criteria are those
adopted by the American College of Rheumatology in 1987 (Arnett et
al., 1988, Arthritis Rheum. 31: 315-324), which are based on a
combination of clinical, laboratory and radiological assessments. A
patient is classified as having RA if he or she satisfies at least
four of the following seven criteria: (i) morning stiffness lasting
at least one hour; (ii) arthritis of three or more joint areas;
(iii) arthritis of hand joints; (iv) symmetric arthritis; (v)
rheumatoid nodules; (vi) presence of serum rheumatoid factor (RF);
and (vii) radiographic changes in hand or wrist joints. Using these
criteria, a trained rheumatologist can usually diagnose RA in
individuals who have had disease for more than 12 weeks (Harrison
et al., 1998, J. Rheumatol. 25: 2324-2330). However, these criteria
are largely ineffective for patients during early stages of the
disease, such as during the first 12 weeks of disease (Green et
al., 1999, Arthritis Rheum. 42: 2184-2188), during which time
irreversible joint damage has already begun, and cannot predict
which patients will develop severe erosive disease and therefore
benefit from aggressive early disease modifying therapy.
[0013] Early initiation of therapy can provide considerable
benefit, not only by reducing pain and inflammation but also by
reducing or eliminating the loss of function that accompanies
persistent RA, especially when therapy is administered prior to the
occurrence of irreversible joint damage. Consequently, there is a
need for novel diagnostic markers that enable the detection of RA
at an early stage, or that enable the identification of individuals
who are predisposed to developing RA. While genome-wide linkage
scans of affected sibling pairs have revealed multiple linkage
peaks (Cornelis et al., 1998, Proc. Natl. Acad. Sci. USA 95:
10746-10750; Jawaheer et al., 2001, Am. J. Hum. Genet. 68: 927-936;
MacKay et al., 2002, Arthritis Rheum. 46: 632-639), specific
disease-associated genetic markers have not previously been
identified.
[0014] SNPs
[0015] The genomes of all organisms undergo spontaneous mutation in
the course of their continuing evolution, generating variant forms
of progenitor genetic sequences (Gusella, Ann. Rev. Biochem. 55,
831-854 (1986)). A variant form may confer an evolutionary
advantage or disadvantage relative to a progenitor form or may be
neutral. In some instances, a variant form confers an evolutionary
advantage to the species and is eventually incorporated into the
DNA of many or most members of the species and effectively becomes
the progenitor form. Additionally, the effects of a variant form
may be both beneficial and detrimental, depending on the
circumstances. For example, a heterozygous sickle cell mutation
confers resistance to malaria, but a homozygous sickle cell
mutation is usually lethal. In many cases, both progenitor and
variant forms survive and co-exist in a species population. The
coexistence of multiple forms of a genetic sequence gives rise to
genetic polymorphisms, including SNPs.
[0016] Approximately 90% of all polymorphisms in the human genome
are SNPs. SNPs are single base positions in DNA at which different
alleles, or alternative nucleotides, exist in a population. The SNP
position (interchangeably referred to herein as SNP, SNP site, or
SNP locus) is usually preceded by and followed by highly conserved
sequences of the allele (e.g., sequences that vary in less than
1/100 or 1/1000 members of the populations). An individual may be
homozygous or heterozygous for an allele at each SNP position. A
SNP can, in some instances, be referred to as a "cSNP" to denote
that the nucleotide sequence containing the SNP is an amino acid
coding sequence.
[0017] A SNP may arise from a substitution of one nucleotide for
another at the polymorphic site. Substitutions can be transitions
or transversions. A transition is the replacement of one purine
nucleotide by another purine nucleotide, or one pyrimidine by
another pyrimidine. A transversion is the replacement of a purine
by a pyrimidine, or vice versa. A SNP may also be a single base
insertion or deletion variant referred to as an "indel" (Weber et
al., "Human diallelic insertion/deletion polymorphisms", Am J Hum
Genet. 2002 October; 71(4):854-62).
[0018] A synonymous codon change, or silent mutation/SNP (terms
such as "SNP", "polymorphism", "mutation", "mutant", "variation",
and "variant" are used herein interchangeably), is one that does
not result in a change of amino acid due to the degeneracy of the
genetic code. A substitution that changes a codon coding for one
amino acid to a codon coding for a different amino acid (i.e., a
non-synonymous codon change) is referred to as a missense mutation.
A nonsense mutation results in a type of non-synonymous codon
change in which a stop codon is formed, thereby leading to
premature termination of a polypeptide chain and a truncated
protein. A read-through mutation is another type of non-synonymous
codon change that causes the destruction of a stop codon, thereby
resulting in an extended polypeptide product. While SNPs can be
bi-, tri-, or tetra-allelic, the vast majority of the SNPs are
bi-allelic, and are thus often referred to as "bi-allelic markers",
or "di-allelic markers".
[0019] As used herein, references to SNPs and SNP genotypes include
individual SNPs and/or haplotypes, which are groups of SNPs that
are generally inherited together. Haplotypes can have stronger
correlations with diseases or other phenotypic effects compared
with individual SNPs, and therefore may provide increased
diagnostic accuracy in some cases (Stephens et al. Science 293,
489-493, 20 Jul. 2001).
[0020] Causative SNPs are those SNPs that produce alterations in
gene expression or in the expression, structure, and/or function of
a gene product, and therefore are most predictive of a possible
clinical phenotype. One such class includes SNPs falling within
regions of genes encoding a polypeptide product, i.e. cSNPs. These
SNPs may result in an alteration of the amino acid sequence of the
polypeptide product (i.e., non-synonymous codon changes) and give
rise to the expression of a defective or other variant protein.
Furthermore, in the case of nonsense mutations, a SNP may lead to
premature termination of a polypeptide product. Such variant
products can result in a pathological condition, e.g., genetic
disease. Examples of genes in which a SNP within a coding sequence
causes a genetic disease include sickle cell anemia and cystic
fibrosis.
[0021] Causative SNPs do not necessarily have to occur in coding
regions; causative SNPs can occur in, for example, any genetic
region that can ultimately affect the expression, structure, and/or
activity of the protein encoded by a nucleic acid. Such genetic
regions include, for example, those involved in transcription, such
as SNPs in transcription factor binding domains, SNPs in promoter
regions, in areas involved in transcript processing, such as SNPs
at intron-exon boundaries that may cause defective splicing, or
SNPs in mRNA processing signal sequences such as polyadenylation
signal regions. Some SNPs that are not causative SNPs nevertheless
are in close association with, and therefore segregate with, a
disease-causing sequence. In this situation, the presence of a SNP
correlates with the presence of, or predisposition to, or an
increased risk in developing the disease. These SNPs, although not
causative, are nonetheless also useful for diagnostics, disease
predisposition screening, and other uses.
[0022] An association study of a SNP and a specific disorder
involves determining the presence or frequency of the SNP allele in
biological samples from individuals with the disorder of interest,
such as rheumatoid arthritis, and comparing the information to that
of controls (i.e., individuals who do not have the disorder;
controls may be also referred to as "healthy" or "normal"
individuals) who are preferably of similar age and race. The
appropriate selection of patients and controls is important to the
success of SNP association studies. Therefore, a pool of
individuals with well-characterized phenotypes is extremely
desirable.
[0023] A SNP may be screened in diseased tissue samples or any
biological sample obtained from a diseased individual, and compared
to control samples, and selected for its increased (or decreased)
occurrence in a specific pathological condition, such as
pathologies related to rheumatoid arthritis. Once a statistically
significant association is established between one or more SNP(s)
and a pathological condition (or other phenotype) of interest, then
the region around the SNP can optionally be thoroughly screened to
identify the causative genetic locus/sequence(s) (e.g., causative
SNP/mutation, gene, regulatory region, etc.) that influences the
pathological condition or phenotype. Association studies may be
conducted within the general population and are not limited to
studies performed on related individuals in affected families
(linkage studies).
[0024] Clinical trials have shown that patient response to
treatment with pharmaceuticals is often heterogeneous. There is a
continuing need to improve pharmaceutical agent design and therapy.
In that regard, SNPs can be used to identify patients most suited
to therapy with particular pharmaceutical agents (this is often
termed "pharmacogenomics"). Similarly, SNPs can be used to exclude
patients from certain treatment due to the patient's increased
likelihood of developing toxic side effects or their likelihood of
not responding to the treatment. Pharmacogenomics can also be used
in pharmaceutical research to assist the drug development and
selection process. (Linder et al. (1997), Clinical Chemistry, 43,
254; Marshall (1997), Nature Biotechnology, 15, 1249; International
Patent Application WO 97/40462, Spectra Biomedical; and Schafer et
al. (1998), Nature Biotechnology, 16, 3).
SUMMARY OF THE INVENTION
[0025] The present invention relates to the identification of novel
SNPs, unique combinations of such SNPs, and haplotypes of SNPs that
are associated with rheumatoid arthritis and related pathologies.
The polymorphisms disclosed herein are directly useful as targets
for the design of diagnostic reagents and the development of
therapeutic agents for use in the diagnosis and treatment of
rheumatoid arthritis and related pathologies.
[0026] Since autoimmune diseases share certain similar features
that may be due to common genetic factors that are involved in
their underlying mechanisms, the SNPs identified herein as being
associated with rheumatoid arthritis may also be used as markers
for other autoimmune diseases. Such autoimmune diseases include,
but are not limited to, type 1 diabetes, multiple sclerosis,
systemic lupus erythematosus, inflammatory bowel diseases,
psoriasis, thyroiditis, celiac disease, pernicious anemia, asthma,
vitiligo, glomerulonephritis, Graves' disease, myocarditis, Sjogren
disease, and primary systemic vasculitis. Moreover, the genes
containing the SNPs identified herein, and the transcripts and
proteins encoded by these genes, can be used in the treatment of
other autoimmune diseases, in addition to rheumatoid arthritis. For
example, the genes and encoded gene products can serve as targets
for the development of therapeutic agents (e.g., small molecule
compounds, antibodies, antisense/RNAi agents, etc.) or used
directly as therapeutic agents (e.g., therapeutic proteins, etc.)
for the treatment of not only rheumatoid arthritis, but various
other autoimmune diseases as well.
[0027] Based on the identification of SNPs associated with
rheumatoid arthritis, the present invention also provides methods
of detecting these variants as well as the design and preparation
of detection reagents needed to accomplish this task. The invention
specifically provides novel SNPs in genetic sequences involved in
rheumatoid arthritis, variant proteins encoded by nucleic acid
molecules containing such SNPs, antibodies to the encoded variant
proteins, computer-based and data storage systems containing the
novel SNP information, methods of detecting these SNPs in a test
sample, methods of identifying individuals who have an altered
(i.e., increased or decreased) risk of developing rheumatoid
arthritis based on the presence of a SNP disclosed herein or its
encoded product, methods of identifying individuals who are more or
less likely to respond to a treatment, methods of screening for
compounds useful in the treatment of a disorder associated with a
variant gene/protein, compounds identified by these methods,
methods of treating disorders mediated by a variant gene/protein,
and methods of using the novel SNPs of the present invention for
human identification.
[0028] In Tables 1-2, the present invention provides gene
information, transcript sequences (SEQ ID NOS:1-669), encoded amino
acid sequences (SEQ ID NOS:670-1338), genomic sequences (SEQ ID
NOS:10,552-10,915), transcript-based context sequences (SEQ ID
NOS:1339-10,551) and genomic-based context sequences (SEQ ID
NOS:10,916-49,582 and 50,231) that contain the SNPs of the present
invention, and extensive SNP information that includes observed
alleles, allele frequencies, populations/ethnic groups in which
alleles have been observed, information about the type of SNP and
corresponding functional effect, and, for cSNPs, information about
the encoded polypeptide product. The transcript sequences (SEQ ID
NOS:1-669), amino acid sequences (SEQ ID NOS:670-1338), genomic
sequences (SEQ ID NOS:10,552-10,915), transcript-based SNP context
sequences (SEQ ID NOS: 1339-10,551), and genomic-based SNP context
sequences (SEQ ID NOS:10,916-49,582 and 50,231) are also provided
in the Sequence Listing.
[0029] In a specific embodiment of the present invention, SNPs
which occur naturally in the human genome are provided as isolated
nucleic acid molecules. These SNPs are associated with rheumatoid
arthritis such that they can have a variety of uses in the
diagnosis and/or treatment of rheumatoid arthritis. In an
alternative embodiment, a nucleic acid of the invention is an
amplified polynucleotide, which is produced by amplification of a
SNP-containing nucleic acid template. In another embodiment, the
invention provides for a variant protein which is encoded by a
nucleic acid molecule containing a SNP disclosed herein.
[0030] In yet another embodiment of the invention, a reagent for
detecting a SNP in the context of its naturally-occurring flanking
nucleotide sequences (which can be, e.g., either DNA or mRNA) is
provided. In particular, such a reagent may be in the form of, for
example, a hybridization probe or an amplification primer that is
useful in the specific detection of a SNP of interest. In an
alternative embodiment, a protein detection reagent is used to
detect a variant protein which is encoded by a nucleic acid
molecule containing a SNP disclosed herein. A preferred embodiment
of a protein detection reagent is an antibody or an
antigen-reactive antibody fragment.
[0031] Also provided in the invention are kits comprising SNP
detection reagents, and methods for detecting the SNPs disclosed
herein by employing detection reagents. In a specific embodiment,
the present invention provides for a method of identifying an
individual having an increased or decreased risk of developing
rheumatoid arthritis by detecting the presence or absence of a SNP
allele disclosed herein. In another embodiment, a method for
diagnosis of rheumatoid arthritis by detecting the presence or
absence of a SNP allele disclosed herein is provided.
[0032] The nucleic acid molecules of the invention can be inserted
in an expression vector, such as to produce a variant protein in a
host cell. Thus, the present invention also provides for a vector
comprising a SNP-containing nucleic acid molecule,
genetically-engineered host cells containing the vector, and
methods for expressing a recombinant variant protein using such
host cells. In another specific embodiment, the host cells,
SNP-containing nucleic acid molecules, and/or variant proteins can
be used as targets in a method for screening and identifying
therapeutic agents or pharmaceutical compounds useful in the
treatment of rheumatoid arthritis.
[0033] An aspect of this invention is a method for treating
rheumatoid arthritis in a human subject wherein said human subject
harbors a gene, transcript, and/or encoded protein identified in
Tables 1-2, which method comprises administering to said human
subject a therapeutically or prophylactically effective amount of
one or more agents counteracting the effects of the disease, such
as by inhibiting (or stimulating) the activity of the gene,
transcript, and/or encoded protein identified in Tables 1-2.
[0034] Another aspect of this invention is a method for identifying
an agent useful in therapeutically or prophylactically treating
rheumatoid arthritis in a human subject wherein said human subject
harbors a gene, transcript, and/or encoded protein identified in
Tables 1-2, which method comprises contacting the gene, transcript,
or encoded protein with a candidate agent under conditions suitable
to allow formation of a binding complex between the gene,
transcript, or encoded protein and the candidate agent and
detecting the formation of the binding complex, wherein the
presence of the complex identifies said agent.
[0035] Another aspect of this invention is a method for treating
rheumatoid arthritis in a human subject, which method
comprises:
[0036] (i) determining that said human subject harbors a gene,
transcript, and/or encoded protein identified in Tables 1-2,
and
[0037] (ii) administering to said subject a therapeutically or
prophylactically effective amount of one or more agents
counteracting the effects of the disease.
[0038] Many other uses and advantages of the present invention will
be apparent to those skilled in the art upon review of the detailed
description of the preferred embodiments herein. Solely for clarity
of discussion, the invention is described in the sections below by
way of non-limiting examples.
[0039] Description of the Files Contained on the CD-R Named
CL001505CDR
[0040] The CD-R named CL001505CDR contains the following three text
(ASCII) files:
[0041] 1) File SEQLIST.sub.--1505.txt provides the Sequence
Listing. The Sequence Listing provides the transcript sequences
(SEQ ID NOS:1-669) and protein sequences (SEQ ID NOS:670-1338) as
shown in Table 1, and genomic sequences (SEQ ID NOS:10,552-10,915)
as shown in Table 2, for each rheumatoid arthritis-associated gene
that contains one or more SNPs of the present invention. Also
provided in the Sequence Listing are context sequences flanking
each SNP, including both transcript-based context sequences as
shown in Table 1 (SEQ ID NOS:1339-10,551) and genomic-based context
sequences as shown in Table 2 (SEQ ID NOS:10,916-49,582 and
50,231). The context sequences generally provide 100 bp upstream
(5') and 100 bp downstream (3') of each SNP, with the SNP in the
middle of the context sequence, for a total of 200 bp of context
sequence surrounding each SNP. File SEQLIST.sub.--1505.txt is
52,678 KB in size, and was created on Jan. 29, 2004.
[0042] 2) File TABLE1.sub.--1505.txt provides Table 1. File
TABLE1.sub.--1505.txt is 631 KB in size, and was created on Apr.
23, 2010.
[0043] 3) File TABLE2.sub.--1505.txt provides Table 2. File
TABLE2.sub.--1505.txt is 241 KB in size, and was created on Apr.
23, 2010.
[0044] The material contained on the CD-R labeled CL001505CDR is
hereby incorporated by reference pursuant to 37 CFR 1.77(b)(4).
TABLE-US-LTS-CD-00001 LENGTHY TABLES The patent application
contains a lengthy table section. A copy of the table is available
in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140234291A1).
An electronic copy of the table will also be available from the
USPTO upon request and payment of the fee set forth in 37 CFR
1.19(b)(3).
[0045] Description of Table 1 and Table 2
[0046] Table 1 and Table 2 (both provided on the CD-R) disclose the
SNP and associated gene/transcript/protein information of the
present invention. For each gene, Table 1 and Table 2 each provide
a header containing gene/transcript/protein information, followed
by a transcript and protein sequence (in Table 1) or genomic
sequence (in Table 2), and then SNP information regarding each SNP
found in that gene/transcript.
[0047] NOTE: SNPs may be included in both Table 1 and Table 2;
Table 1 presents the SNPs relative to their transcript sequences
and encoded protein sequences, whereas Table 2 presents the SNPs
relative to their genomic sequences (in some instances Table 2 may
also include, after the last gene sequence, genomic sequences of
one or more intergenic regions, as well as SNP context sequences
and other SNP information for any SNPs that lie within these
intergenic regions). SNPs can readily be cross-referenced between
Tables based on their hCV (or, in some instances, hDV)
identification numbers.
[0048] The gene/transcript/protein information includes: [0049] a
gene number (1 through n, where n=the total number of genes in the
Table) [0050] a Celera hCG and UID internal identification numbers
for the gene [0051] a Celera hCT and UID internal identification
numbers for the transcript (Table 1 only) [0052] a public Genbank
accession number (e.g., RefSeq NM number) for the transcript (Table
1 only) [0053] a Celera hCP and UID internal identification numbers
for the protein encoded by the hCT transcript (Table 1 only) [0054]
a public Genbank accession number (e.g., RefSeq NP number) for the
protein (Table 1 only) [0055] an art-known gene symbol [0056] an
art-known gene/protein name [0057] Celera genomic axis position
(indicating start nucleotide position-stop nucleotide position)
[0058] the chromosome number of the chromosome on which the gene is
located [0059] an OMIM (Online Mendelian Inheritance in Man; Johns
Hopkins University/NCBI) public reference number for obtaining
further information regarding the medical significance of each gene
[0060] alternative gene/protein name(s) and/or symbol(s) in the
OMIM entry
[0061] NOTE: Due to the presence of alternative splice forms,
multiple transcript/protein entries can be provided for a single
gene entry in Table 1; i.e., for a single Gene Number, multiple
entries may be provided in series that differ in their
transcript/protein information and sequences.
[0062] Following the gene/transcript/protein information is a
transcript sequence and protein sequence (in Table 1), or a genomic
sequence (in Table 2), for each gene, as follows: [0063] transcript
sequence (Table 1 only) (corresponding to SEQ ID NOS:1-669 of the
Sequence Listing), with SNPs identified by their IUB codes
(transcript sequences can include 5' UTR, protein coding, and 3'
UTR regions). (NOTE: If there are differences between the
nucleotide sequence of the hCT transcript and the corresponding
public transcript sequence identified by the Genbank accession
number, the hCT transcript sequence (and encoded protein) is
provided, unless the public sequence is a RefSeq transcript
sequence identified by an NM number, in which case the RefSeq NM
transcript sequence (and encoded protein) is provided. However,
whether the hCT transcript or RefSeq NM transcript is used as the
transcript sequence, the disclosed SNPs are represented by their
IUB codes within the transcript.) [0064] the encoded protein
sequence (Table 1 only) (corresponding to SEQ ID NOS:670-1338 of
the Sequence Listing) [0065] the genomic sequence of the gene
(Table 2 only), including 6 kb on each side of the gene boundaries
(i.e., 6 kb on the 5' side of the gene plus 6 kb on the 3' side of
the gene) (corresponding to SEQ ID NOS:10,552-10,915 of the
Sequence Listing).
[0066] After the last gene sequence, Table 2 may include additional
genomic sequences of intergenic regions (in such instances, these
sequences are identified as "Intergenic region:" followed by a
numerical identification number), as well as SNP context sequences
and other SNP information for any SNPs that lie within each
intergenic region (and such SNPs are identified as "INTERGENIC" for
SNP type).
[0067] NOTE: The transcript, protein, and transcript-based SNP
context sequences are provided in both Table 1 and in the Sequence
Listing. The genomic and genomic-based SNP context sequences are
provided in both Table 2 and in the Sequence Listing. SEQ ID NOS
are indicated in Table 1 for each transcript sequence (SEQ ID
NOS:1-669), protein sequence (SEQ ID NOS:670-1338), and
transcript-based SNP context sequence (SEQ ID NOS:1339-10,551), and
SEQ ID NOS are indicated in Table 2 for each genomic sequence (SEQ
ID NOS:10,552-10,915), and genomic-based SNP context sequence (SEQ
ID NOS:10,916-49,582 and 50,231).
[0068] The SNP information includes: [0069] context sequence (taken
from the transcript sequence in Table 1, and taken from the genomic
sequence in Table 2) with the SNP represented by its IUB code,
including 100 bp upstream (5') of the SNP position plus 100 bp
downstream (3') of the SNP position (the transcript-based SNP
context sequences in Table 1 are provided in the Sequence Listing
as SEQ ID NOS:1339-10,551; the genomic-based SNP context sequences
in Table 2 are provided in the Sequence Listing as SEQ ID
NOS:10,916-49,582 and 50,231). [0070] Celera hCV internal
identification number for the SNP (in some instances, an "hDV"
number is given instead of an "hCV" number) [0071] SNP position
[position of the SNP within the given transcript sequence (Table 1)
or within the given genomic sequence (Table 2)] [0072] SNP source
(may include any combination of one or more of the following five
codes, depending on which internal sequencing projects and/or
public databases the SNP has been observed in: "Applera"=SNP
observed during the re-sequencing of genes and regulatory regions
of 39 individuals, "Celera"=SNP observed during shotgun sequencing
and assembly of the Celera human genome sequence, "Celera
Diagnostics"=SNP observed during re-sequencing of nucleic acid
samples from individuals who have rheumatoid arthritis or a related
pathology, "dbSNP"=SNP observed in the dbSNP public database,
"HGBASE"=SNP observed in the HGBASE public database, "HGMD"=SNP
observed in the Human Gene Mutation Database (HGMD) public
database) (NOTE: multiple "Applera" source entries for a single SNP
indicate that the same SNP was covered by multiple overlapping
amplification products and the re-sequencing results (e.g.,
observed allele counts) from each of these amplification products
is being provided) [0073] Population/allele/allele count
information in the format of
[population1(first_allele,count|second_allele,count)population2(first_-
allele,count|second_allele,count) total (first_allele,total
count|second_allele,total count)]. The information in this field
includes populations/ethnic groups in which particular SNP alleles
have been observed ("cau"=Caucasian, "his"=Hispanic, "chn"=Chinese,
and "afr"=African-American, "jpn"=Japanese, "ind"=Indian,
"mex"=Mexican, "ain"="American Indian, "cra"=Celera donor,
"no_pop"=no population information available), identified SNP
alleles, and observed allele counts (within each population group
and total allele counts), where available ["-" in the allele field
represents a deletion allele of an insertion/deletion ("indel")
polymorphism (in which case the corresponding insertion allele,
which may be comprised of one or more nucleotides, is indicated in
the allele field on the opposite side of the "|"); "-" in the count
field indicates that allele count information is not
available].
[0074] NOTE: For SNPs of "Applera" SNP source, genes/regulatory
regions of 39 individuals (20 Caucasians and 19 African Americans)
were re-sequenced and, since each SNP position is represented by
two chromosomes in each individual (with the exception of SNPs on X
and Y chromosomes in males, for which each SNP position is
represented by a single chromosome), up to 78 chromosomes were
genotyped for each SNP position. Thus, the sum of the
African-American ("afr") allele counts is up to 38, the sum of the
Caucasian allele counts ("cau") is up to 40, and the total sum of
all allele counts is up to 78.
[0075] (NOTE: semicolons separate population/allele/count
information corresponding to each indicated SNP source; i.e., if
four SNP sources are indicated, such as "Celera", "dbSNP",
"HGBASE", and "HGMD", then population/allele/count information is
provided in four groups which are separated by semicolons and
listed in the same order as the listing of SNP sources, with each
population/allele/count information group corresponding to the
respective SNP source based on order; thus, in this example, the
first population/allele/count information group would correspond to
the first listed SNP source (Celera) and the third
population/allele/count information group separated by semicolons
would correspond to the third listed SNP source (HGBASE); if
population/allele/count information is not available for any
particular SNP source, then a pair of semicolons is still inserted
as a place-holder in order to maintain correspondence between the
list of SNP sources and the corresponding listing of
population/allele/count information) [0076] SNP type (e.g.,
location within gene/transcript and/or predicted functional effect)
["MIS-SENSE MUTATION"=SNP causes a change in the encoded amino acid
(i.e., a non-synonymous coding SNP); "SILENT MUTATION"=SNP does not
cause a change in the encoded amino acid (i.e., a synonymous coding
SNP); "STOP CODON MUTATION"=SNP is located in a stop codon;
"NONSENSE MUTATION"=SNP creates or destroys a stop codon; "UTR
5"=SNP is located in a 5' UTR of a transcript; "UTR 3"=SNP is
located in a 3' UTR of a transcript; "PUTATIVE UTR 5"=SNP is
located in a putative 5' UTR; "PUTATIVE UTR 3"=SNP is located in a
putative 3'UTR; "DONOR SPLICE SITE"=SNP is located in a donor
splice site (5' intron boundary); "ACCEPTOR SPLICE SITE"=SNP is
located in an acceptor splice site (3' intron boundary); "CODING
REGION"=SNP is located in a protein-coding region of the
transcript; "EXON"=SNP is located in an exon; "INTRON"=SNP is
located in an intron; "hmCS"=SNP is located in a human-mouse
conserved segment; "TFBS"=SNP is located in a transcription factor
binding site; "UNKNOWN"=SNP type is not defined; "INTERGENIC"=SNP
is intergenic, i.e., outside of any gene boundary] [0077] Protein
coding information (Table 1 only), where relevant, in the format of
[protein SEQ ID NO:#, amino acid position, (amino acid-1, codon1)
(amino acid-2, codon2)]. The information in this field includes SEQ
ID NO of the encoded protein sequence, position of the amino acid
residue within the protein identified by the SEQ ID NO that is
encoded by the codon containing the SNP, amino acids (represented
by one-letter amino acid codes) that are encoded by the alternative
SNP alleles (in the case of stop codons, "X" is used for the
one-letter amino acid code), and alternative codons containing the
alternative SNP nucleotides which encode the amino acid residues
(thus, for example, for missense mutation-type SNPs, at least two
different amino acids and at least two different codons are
generally indicated; for silent mutation-type SNPs, one amino acid
and at least two different codons are generally indicated, etc.).
In instances where the SNP is located outside of a protein-coding
region (e.g., in a UTR region), "None" is indicated following the
protein SEQ ID NO.
[0078] Description of Table 3
[0079] Table 3 provides sequences (SEQ ID NOS:49,583-50,230) of
primers that have been synthesized and used in the laboratory to
carry out allele-specific PCR reactions in order to assay the SNPs
disclosed in Table 4 during the course of rheumatoid arthritis
association studies.
[0080] Table 3 provides the following: [0081] the column labeled
"hCV" provides an hCV identification number for each SNP site
[0082] the column labeled "Alleles" designates the two alternative
alleles at the SNP site identified by the hCV identification number
that are targeted by the allele-specific primers (the
allele-specific primers are shown as "Sequence A" and "Sequence B")
[0083] the column labeled "Sequence A (allele-specific primer)"
provides an allele-specific primer that is specific for the first
allele designated in the "Alleles" column [0084] the column labeled
"Sequence B (allele-specific primer)" provides an allele-specific
primer that is specific for the second allele designated in the
"Alleles" column [0085] the column labeled "Sequence C (common
primer)" provides a common primer that is used in conjunction with
each of the allele-specific primers (the "Sequence A" primer and
the "Sequence B" primer) and which hybridizes at a site away from
the SNP position.
[0086] All primer sequences are given in the 5' to 3'
direction.
[0087] Each of the alleles designated in the "Alleles" column
matches (or is the reverse complement of, depending on the
orientation of the primer relative to the designated allele) the 3'
nucleotide of the allele-specific primer that is specific for that
allele. Thus, the first allele designated in the "Alleles" column
matches (or is the reverse complement of) the 3' nucleotide of the
"Sequence A" primer, and the second allele designated in the
"Alleles" column matches (or is the reverse complement of) the 3'
nucleotide of the "Sequence B" primer.
[0088] Description of Table 4
[0089] Table 4 provides results of statistical analyses for SNPs
disclosed in Tables 1-2 (SNPs can be cross-referenced between
tables based on their hCV identification numbers). The statistical
results shown in Table 4 provide support for the association of
these SNP alleles with rheumatoid arthritis.
[0090] NOTE: SNPs can be cross-referenced between Tables 1-4 based
on the hCV identification number of each SNP. However, eight of the
SNPs disclosed in the tables may possess two different hCV
identification numbers, as follows: [0091] hCV11159941 is
equivalent to hCV26841917 [0092] hCV11690571 is equivalent to
hCV26545293 [0093] hCV15881845 is equivalent to hCV22274205 [0094]
hCV 15958164 is equivalent to hCV22274459 [0095] hCV16094684 is
equivalent to hCV22273515 [0096] hCV 16135142 is equivalent to
hCV25474376 [0097] hCV2479345 is equivalent to hCV11407883 [0098]
hCV9283503 is equivalent to hCV26774507
Description of Column Headings for Table 4:
TABLE-US-00001 [0099] TABLE 4 Column Heading Definition Marker hCV
identification number of the tested SNP Typed in Discovery "yes" =
marker has been genotyped in two independently-derived and
Replication? DNA sample sets (a Discovery Set and a Replication
Set); "no" = marker has been genotyped in a single DNA sample set
(a Discovery Set only) Study Sample set used in analysis
("Discovery"; "Replication, All Cases"; or "Replication, Probands")
Genotyping Method of SNP genotyping ("Individual" or "Pool"
genotyping) Stratum The stratum used for the analysis (see the
following table for further descriptions) Allele1 Allele of the SNP
for which allele frequencies are given (NOTE: Allele1 may be
depicted in Table 4 based on a different orientation, i.e., the
reverse complement, relative to how the same allele is depicted in
Tables 1-2) Case Freq Frequency of Allele1 in cases Control Freq
Frequency of Allele1 in controls Allelic p-value Fisher exact test
results for allelic association Odds Ratio Allelic odds ratio for
Allele1
Definition of Entries in the "Stratum" Column of Table 4 for
Stratification-Based Analysis:
TABLE-US-00002 [0100] Stratum Definition All All cases and matched
controls RF+ Rheumatoid factor positive cases and matched controls
Male Male cases and matched controls Female Female cases and
matched controls Onset <38 Cases who had disease onset before
the age of 38, and matched controls Onset 38-55 Cases who had
disease onset between the ages of 38 and 55, and matched controls
LR-0SE Cases with no risk shared epitopes at HLA-DRB1 (risk shared
epitopes are 1R, 10, 4K, and 4R), and matched controls (controls
are matched on age, sex, and grandparental countries of origin, not
on HLA-DRB1) LR-1SE Cases with one low risk shared epitope (1R or
10) at HLA-DRB1, and matched controls (controls are matched on age,
sex, and grandparental countries of origin, not on HLA-DRB1) HR-1SE
Cases with one high risk shared epitope (4K or 4R) at HLA-DRB1, and
matched controls (controls are matched on age, sex, and
grandparental countries of origin, not on HLA-DRB1) HR-2SE Cases
with two risk shared epitopes (1R, 10, 4K, or 4R) at HLA- DRB1, and
matched controls (controls are matched on age, sex, and
grandparental countries of origin, not on HLA-DRB1)
DESCRIPTION OF THE FIGURE
[0101] FIG. 1 provides a diagrammatic representation of a
computer-based discovery system containing the SNP information of
the present invention in computer readable form.
DETAILED DESCRIPTION OF THE INVENTION
[0102] The present invention provides SNPs associated with
rheumatoid arthritis, nucleic acid molecules containing SNPs,
methods and reagents for the detection of the SNPs disclosed
herein, uses of these SNPs for the development of detection
reagents, and assays or kits that utilize such reagents. The
rheumatoid arthritis-associated SNPs disclosed herein are useful
for diagnosing, screening for, and evaluating predisposition to
rheumatoid arthritis and related pathologies in humans.
Furthermore, such SNPs and their encoded products are useful
targets for the development of therapeutic agents.
[0103] Since autoimmune diseases share certain similar features
that may be due to common genetic factors that are involved in
their underlying mechanisms, the SNPs identified herein as being
associated with rheumatoid arthritis may also be used as markers
for other autoimmune diseases. Such autoimmune diseases include,
but are not limited to, type 1 diabetes, multiple sclerosis,
systemic lupus erythematosus, inflammatory bowel diseases,
psoriasis, thyroiditis, celiac disease, pernicious anemia, asthma,
vitiligo, glomerulonephritis, Graves' disease, myocarditis, Sjogren
disease, and primary systemic vasculitis. Moreover, the genes
containing the SNPs identified herein, and the transcripts and
proteins encoded by these genes, can be used in the treatment of
other autoimmune diseases, in addition to rheumatoid arthritis. For
example, the genes and encoded gene products can serve as targets
for the development of therapeutic agents (e.g., small molecule
compounds, antibodies, antisense/RNAi agents, etc.) or used
directly as therapeutic agents (e.g., therapeutic proteins, etc.)
for the treatment of not only rheumatoid arthritis, but various
other autoimmune diseases as well.
[0104] A large number of SNPs have been identified from
re-sequencing DNA from 39 individuals, and they are indicated as
"Applera" SNP source in Tables 1-2. Their allele frequencies
observed in each of the Caucasian and African-American ethnic
groups are provided. Additional SNPs included herein were
previously identified during shotgun sequencing and assembly of the
human genome, and they are indicated as "Celera" SNP source in
Tables 1-2. Furthermore, the information provided in Table 1-2,
particularly the allele frequency information obtained from 39
individuals and the identification of the precise position of each
SNP within each gene/transcript, allows haplotypes (i.e., groups of
SNPs that are co-inherited) to be readily inferred. The present
invention encompasses SNP haplotypes, as well as individual
SNPs.
[0105] Thus, the present invention provides individual SNPs
associated with rheumatoid arthritis, as well as combinations of
SNPs and haplotypes in genetic regions associated with rheumatoid
arthritis, polymorphic/variant transcript sequences (SEQ ID
NOS:1-669) and genomic sequences (SEQ ID NOS:10,552-10,915)
containing SNPs, encoded amino acid sequences (SEQ ID NOS:
670-1338), and both transcript-based SNP context sequences (SEQ ID
NOS: 1339-10,551) and genomic-based SNP context sequences (SEQ ID
NOS:10,916-49,582 and 50,231) (transcript sequences, protein
sequences, and transcript-based SNP context sequences are provided
in Table 1 and the Sequence Listing; genomic sequences and
genomic-based SNP context sequences are provided in Table 2 and the
Sequence Listing), methods of detecting these polymorphisms in a
test sample, methods of determining the risk of an individual of
having or developing rheumatoid arthritis, methods of screening for
compounds useful for treating disorders associated with a variant
gene/protein such as rheumatoid arthritis, compounds identified by
these screening methods, methods of using the disclosed SNPs to
select a treatment strategy, methods of treating a disorder
associated with a variant gene/protein (i.e., therapeutic methods),
and methods of using the SNPs of the present invention for human
identification.
[0106] The present invention provides novel SNPs associated with
rheumatoid arthritis, as well as SNPs that were previously known in
the art, but were not previously known to be associated with
rheumatoid arthritis. Accordingly, the present invention provides
novel compositions and methods based on the novel SNPs disclosed
herein, and also provides novel methods of using the known, but
previously unassociated, SNPs in methods relating to rheumatoid
arthritis (e.g., for diagnosing rheumatoid arthritis, etc.). In
Tables 1-2, known SNPs are identified based on the public database
in which they have been observed, which is indicated as one or more
of the following SNP types: "dbSNP"=SNP observed in dbSNP,
"HGBASE"=SNP observed in HGBASE, and "HGMD"=SNP observed in the
Human Gene Mutation Database (HGMD).
[0107] Particular SNP alleles of the present invention can be
associated with either an increased risk of having or developing
rheumatoid arthritis, or a decreased risk of having or developing
rheumatoid arthritis. SNP alleles that are associated with a
decreased risk of having or developing rheumatoid arthritis may be
referred to as "protective" alleles, and SNP alleles that are
associated with an increased risk of having or developing
rheumatoid arthritis may be referred to as "susceptibility" alleles
or "risk factors". Thus, whereas certain SNPs (or their encoded
products) can be assayed to determine whether an individual
possesses a SNP allele that is indicative of an increased risk of
having or developing rheumatoid arthritis (i.e., a susceptibility
allele), other SNPs (or their encoded products) can be assayed to
determine whether an individual possesses a SNP allele that is
indicative of a decreased risk of having or developing rheumatoid
arthritis (i.e., a protective allele). Similarly, particular SNP
alleles of the present invention can be associated with either an
increased or decreased likelihood of responding to a particular
treatment or therapeutic compound, or an increased or decreased
likelihood of experiencing toxic effects from a particular
treatment or therapeutic compound. The term "altered" may be used
herein to encompass either of these two possibilities (e.g., an
increased or a decreased risk/likelihood).
[0108] Those skilled in the art will readily recognize that nucleic
acid molecules may be double-stranded molecules and that reference
to a particular site on one strand refers, as well, to the
corresponding site on a complementary strand. In defining a SNP
position, SNP allele, or nucleotide sequence, reference to an
adenine, a thymine (uridine), a cytosine, or a guanine at a
particular site on one strand of a nucleic acid molecule also
defines the thymine (uridine), adenine, guanine, or cytosine
(respectively) at the corresponding site on a complementary strand
of the nucleic acid molecule. Thus, reference may be made to either
strand in order to refer to a particular SNP position, SNP allele,
or nucleotide sequence. Probes and primers, may be designed to
hybridize to either strand and SNP genotyping methods disclosed
herein may generally target either strand. Throughout the
specification, in identifying a SNP position, reference is
generally made to the protein-encoding strand, only for the purpose
of convenience.
[0109] References to variant peptides, polypeptides, or proteins of
the present invention include peptides, polypeptides, proteins, or
fragments thereof, that contain at least one amino acid residue
that differs from the corresponding amino acid sequence of the
art-known peptide/polypeptide/protein (the art-known protein may be
interchangeably referred to as the "wild-type", "reference", or
"normal" protein). Such variant peptides/polypeptides/proteins can
result from a codon change caused by a nonsynonymous nucleotide
substitution at a protein-coding SNP position (i.e., a missense
mutation) disclosed by the present invention. Variant
peptides/polypeptides/proteins of the present invention can also
result from a nonsense mutation, i.e. a SNP that creates a
premature stop codon, a SNP that generates a read-through mutation
by abolishing a stop codon, or due to any SNP disclosed by the
present invention that otherwise alters the structure,
function/activity, or expression of a protein, such as a SNP in a
regulatory region (e.g. a promoter or enhancer) or a SNP that leads
to alternative or defective splicing, such as a SNP in an intron or
a SNP at an exon/intron boundary. As used herein, the terms
"polypeptide", "peptide", and "protein" are used
interchangeably.
[0110] Isolated Nucleic Acid Molecules and SNP Detection Reagents
& Kits
[0111] Tables 1 and 2 provide a variety of information about each
SNP of the present invention that is associated with rheumatoid
arthritis, including the transcript sequences (SEQ ID NOS:1-669),
genomic sequences (SEQ ID NOS:10,552-10,915), and protein sequences
(SEQ ID NOS:670-1338) of the encoded gene products (with the SNPs
indicated by IUB codes in the nucleic acid sequences). In addition,
Tables 1 and 2 include SNP context sequences, which generally
include 100 nucleotide upstream (5') plus 100 nucleotides
downstream (3') of each SNP position (SEQ ID NOS:1339-10,551
correspond to transcript-based SNP context sequences disclosed in
Table 1, and SEQ ID NOS:10,916-49,582 and 50,231 correspond to
genomic-based context sequences disclosed in Table 2), the
alternative nucleotides (alleles) at each SNP position, and
additional information about the variant where relevant, such as
SNP type (coding, missense, splice site, UTR, etc.), human
populations in which the SNP was observed, observed allele
frequencies, information about the encoded protein, etc.
[0112] Isolated Nucleic Acid Molecules
[0113] The present invention provides isolated nucleic acid
molecules that contain one or more SNPs disclosed Table 1 and/or
Table 2. Isolated nucleic acid molecules containing one or more
SNPs disclosed in at least one of Tables 1-4 may be interchangeably
referred to throughout the present text as "SNP-containing nucleic
acid molecules". Isolated nucleic acid molecules may optionally
encode a full-length variant protein or fragment thereof. The
isolated nucleic acid molecules of the present invention also
include probes and primers (which are described in greater detail
below in the section entitled "SNP Detection Reagents"), which may
be used for assaying the disclosed SNPs, and isolated full-length
genes, transcripts, cDNA molecules, and fragments thereof, which
may be used for such purposes as expressing an encoded protein.
[0114] As used herein, an "isolated nucleic acid molecule"
generally is one that contains a SNP of the present invention or
one that hybridizes to such molecule such as a nucleic acid with a
complementary sequence, and is separated from most other nucleic
acids present in the natural source of the nucleic acid molecule.
Moreover, an "isolated" nucleic acid molecule, such as a cDNA
molecule containing a SNP of the present invention, can be
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or chemical precursors or
other chemicals when chemically synthesized. A nucleic acid
molecule can be fused to other coding or regulatory sequences and
still be considered "isolated". Nucleic acid molecules present in
non-human transgenic animals, which do not naturally occur in the
animal, are also considered "isolated". For example, recombinant
DNA molecules contained in a vector are considered "isolated".
Further examples of "isolated" DNA molecules include recombinant
DNA molecules maintained in heterologous host cells, and purified
(partially or substantially) DNA molecules in solution. Isolated
RNA molecules include in vivo or in vitro RNA transcripts of the
isolated SNP-containing DNA molecules of the present invention.
Isolated nucleic acid molecules according to the present invention
further include such molecules produced synthetically.
[0115] Generally, an isolated SNP-containing nucleic acid molecule
comprises one or more SNP positions disclosed by the present
invention with flanking nucleotide sequences on either side of the
SNP positions. A flanking sequence can include nucleotide residues
that are naturally associated with the SNP site and/or heterologous
nucleotide sequences. Preferably the flanking sequence is up to
about 500, 300, 100, 60, 50, 30, 25, 20, 15, 10, 8, or 4
nucleotides (or any other length in-between) on either side of a
SNP position, or as long as the full-length gene or entire
protein-coding sequence (or any portion thereof such as an exon),
especially if the SNP-containing nucleic acid molecule is to be
used to produce a protein or protein fragment.
[0116] For full-length genes and entire protein-coding sequences, a
SNP flanking sequence can be, for example, up to about 5 KB, 4 KB,
3 KB, 2 KB, 1 KB on either side of the SNP. Furthermore, in such
instances, the isolated nucleic acid molecule comprises exonic
sequences (including protein-coding and/or non-coding exonic
sequences), but may also include intronic sequences. Thus, any
protein coding sequence may be either contiguous or separated by
introns. The important point is that the nucleic acid is isolated
from remote and unimportant flanking sequences and is of
appropriate length such that it can be subjected to the specific
manipulations or uses described herein such as recombinant protein
expression, preparation of probes and primers for assaying the SNP
position, and other uses specific to the SNP-containing nucleic
acid sequences.
[0117] An isolated SNP-containing nucleic acid molecule can
comprise, for example, a full-length gene or transcript, such as a
gene isolated from genomic DNA (e.g., by cloning or PCR
amplification), a cDNA molecule, or an mRNA transcript molecule.
Polymorphic transcript sequences are provided in Table 1 and in the
Sequence Listing (SEQ ID NOS: 1-669), and polymorphic genomic
sequences are provided in Table 2 and in the Sequence Listing (SEQ
ID NOS:10,552-10,915). Furthermore, fragments of such full-length
genes and transcripts that contain one or more SNPs disclosed
herein are also encompassed by the present invention, and such
fragments may be used, for example, to express any part of a
protein, such as a particular functional domain or an antigenic
epitope.
[0118] Thus, the present invention also encompasses fragments of
the nucleic acid sequences provided in Tables 1-2 (transcript
sequences are provided in Table 1 as SEQ ID NOS:1-669, genomic
sequences are provided in Table 2 as SEQ ID NOS:10,552-10,915,
transcript-based SNP context sequences are provided in Table 1 as
SEQ ID NO:1339-10,551, and genomic-based SNP context sequences are
provided in Table 2 as SEQ ID NO:10,916-49,582 and 50,231) and
their complements. A fragment typically comprises a contiguous
nucleotide sequence at least about 8 or more nucleotides, more
preferably at least about 12 or more nucleotides, and even more
preferably at least about 16 or more nucleotides. Further, a
fragment could comprise at least about 18, 20, 22, 25, 30, 40, 50,
60, 80, 100, 150, 200, 250 or 500 (or any other number in-between)
nucleotides in length. The length of the fragment will be based on
its intended use. For example, the fragment can encode
epitope-bearing regions of a variant peptide or regions of a
variant peptide that differ from the normal/wild-type protein, or
can be useful as a polynucleotide probe or primer. Such fragments
can be isolated using the nucleotide sequences provided in Table 1
and/or Table 2 for the synthesis of a polynucleotide probe. A
labeled probe can then be used, for example, to screen a cDNA
library, genomic DNA library, or mRNA to isolate nucleic acid
corresponding to the coding region. Further, primers can be used in
amplification reactions, such as for purposes of assaying one or
more SNPs sites or for cloning specific regions of a gene.
[0119] An isolated nucleic acid molecule of the present invention
further encompasses a SNP-containing polynucleotide that is the
product of any one of a variety of nucleic acid amplification
methods, which are used to increase the copy numbers of a
polynucleotide of interest in a nucleic acid sample. Such
amplification methods are well known in the art, and they include
but are not limited to, polymerase chain reaction (PCR) (U.S. Pat.
Nos. 4,683,195; and 4,683,202; PCR Technology: Principles and
Applications for DNA Amplification, ed. H. A. Erlich, Freeman
Press, NY, N.Y., 1992), ligase chain reaction (LCR) (Wu and
Wallace, Genomics 4:560, 1989; Landegren et al., Science 241:1077,
1988), strand displacement amplification (SDA) (U.S. Pat. Nos.
5,270,184; and 5,422,252), transcription-mediated amplification
(TMA) (U.S. Pat. No. 5,399,491), linked linear amplification (LLA)
(U.S. Pat. No. 6,027,923), and the like, and isothermal
amplification methods such as nucleic acid sequence based
amplification (NASBA), and self-sustained sequence replication
(Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874, 1990). Based
on such methodologies, a person skilled in the art can readily
design primers in any suitable regions 5' and 3' to a SNP disclosed
herein. Such primers may be used to amplify DNA of any length so
long that it contains the SNP of interest in its sequence.
[0120] As used herein, an "amplified polynucleotide" of the
invention is a SNP-containing nucleic acid molecule whose amount
has been increased at least two fold by any nucleic acid
amplification method performed in vitro as compared to its starting
amount in a test sample. In other preferred embodiments, an
amplified polynucleotide is the result of at least ten fold, fifty
fold, one hundred fold, one thousand fold, or even ten thousand
fold increase as compared to its starting amount in a test sample.
In a typical PCR amplification, a polynucleotide of interest is
often amplified at least fifty thousand fold in amount over the
unamplified genomic DNA, but the precise amount of amplification
needed for an assay depends on the sensitivity of the subsequent
detection method used.
[0121] Generally, an amplified polynucleotide is at least about 16
nucleotides in length. More typically, an amplified polynucleotide
is at least about 20 nucleotides in length. In a preferred
embodiment of the invention, an amplified polynucleotide is at
least about 30 nucleotides in length. In a more preferred
embodiment of the invention, an amplified polynucleotide is at
least about 32, 40, 45, 50, or 60 nucleotides in length. In yet
another preferred embodiment of the invention, an amplified
polynucleotide is at least about 100, 200, 300, 400, or 500
nucleotides in length. While the total length of an amplified
polynucleotide of the invention can be as long as an exon, an
intron or the entire gene where the SNP of interest resides, an
amplified product is typically up to about 1,000 nucleotides in
length (although certain amplification methods may generate
amplified products greater than 1000 nucleotides in length). More
preferably, an amplified polynucleotide is not greater than about
600-700 nucleotides in length. It is understood that irrespective
of the length of an amplified polynucleotide, a SNP of interest may
be located anywhere along its sequence.
[0122] In a specific embodiment of the invention, the amplified
product is at least about 201 nucleotides in length, comprises one
of the transcript-based context sequences or the genomic-based
context sequences shown in Tables 1-2. Such a product may have
additional sequences on its 5' end or 3' end or both. In another
embodiment, the amplified product is about 101 nucleotides in
length, and it contains a SNP disclosed herein. Preferably, the SNP
is located at the middle of the amplified product (e.g., at
position 101 in an amplified product that is 201 nucleotides in
length, or at position 51 in an amplified product that is 101
nucleotides in length), or within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
12, 15, or 20 nucleotides from the middle of the amplified product
(however, as indicated above, the SNP of interest may be located
anywhere along the length of the amplified product).
[0123] The present invention provides isolated nucleic acid
molecules that comprise, consist of, or consist essentially of one
or more polynucleotide sequences that contain one or more SNPs
disclosed herein, complements thereof, and SNP-containing fragments
thereof.
[0124] Accordingly, the present invention provides nucleic acid
molecules that consist of any of the nucleotide sequences shown in
Table 1 and/or Table 2 (transcript sequences are provided in Table
1 as SEQ ID NOS:1-669, genomic sequences are provided in Table 2 as
SEQ ID NOS:10,552-10,915, transcript-based SNP context sequences
are provided in Table 1 as SEQ ID NO:1339-10,551, and genomic-based
SNP context sequences are provided in Table 2 as SEQ ID
NO:10,916-49,582 and 50,231), or any nucleic acid molecule that
encodes any of the variant proteins provided in Table 1 (SEQ ID
NOS:670-1338). A nucleic acid molecule consists of a nucleotide
sequence when the nucleotide sequence is the complete nucleotide
sequence of the nucleic acid molecule.
[0125] The present invention further provides nucleic acid
molecules that consist essentially of any of the nucleotide
sequences shown in Table 1 and/or Table 2 (transcript sequences are
provided in Table 1 as SEQ ID NOS:1-669, genomic sequences are
provided in Table 2 as SEQ ID NOS:10,552-10,915, transcript-based
SNP context sequences are provided in Table 1 as SEQ ID
NO:1339-10,551, and genomic-based SNP context sequences are
provided in Table 2 as SEQ ID NO:10,916-49,582 and 50,231), or any
nucleic acid molecule that encodes any of the variant proteins
provided in Table 1 (SEQ ID NOS:670-1338). A nucleic acid molecule
consists essentially of a nucleotide sequence when such a
nucleotide sequence is present with only a few additional
nucleotide residues in the final nucleic acid molecule.
[0126] The present invention further provides nucleic acid
molecules that comprise any of the nucleotide sequences shown in
Table 1 and/or Table 2 or a SNP-containing fragment thereof
(transcript sequences are provided in Table 1 as SEQ ID NOS:1-669,
genomic sequences are provided in Table 2 as SEQ ID
NOS:10,552-10,915, transcript-based SNP context sequences are
provided in Table 1 as SEQ ID NO:1339-10,551, and genomic-based SNP
context sequences are provided in Table 2 as SEQ ID
NO:10,916-49,582 and 50,231), or any nucleic acid molecule that
encodes any of the variant proteins provided in Table 1 (SEQ ID
NOS:670-1338). A nucleic acid molecule comprises a nucleotide
sequence when the nucleotide sequence is at least part of the final
nucleotide sequence of the nucleic acid molecule. In such a
fashion, the nucleic acid molecule can be only the nucleotide
sequence or have additional nucleotide residues, such as residues
that are naturally associated with it or heterologous nucleotide
sequences. Such a nucleic acid molecule can have one to a few
additional nucleotides or can comprise many more additional
nucleotides. A brief description of how various types of these
nucleic acid molecules can be readily made and isolated is provided
below, and such techniques are well known to those of ordinary
skill in the art (Sambrook and Russell, 2000, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Press, NY).
[0127] The isolated nucleic acid molecules can encode mature
proteins plus additional amino or carboxyl-terminal amino acids or
both, or amino acids interior to the mature peptide (when the
mature form has more than one peptide chain, for instance). Such
sequences may play a role in processing of a protein from precursor
to a mature form, facilitate protein trafficking, prolong or
shorten protein half-life, or facilitate manipulation of a protein
for assay or production. As generally is the case in situ, the
additional amino acids may be processed away from the mature
protein by cellular enzymes.
[0128] Thus, the isolated nucleic acid molecules include, but are
not limited to, nucleic acid molecules having a sequence encoding a
peptide alone, a sequence encoding a mature peptide and additional
coding sequences such as a leader or secretory sequence (e.g., a
pre-pro or pro-protein sequence), a sequence encoding a mature
peptide with or without additional coding sequences, plus
additional non-coding sequences, for example introns and non-coding
5' and 3' sequences such as transcribed but untranslated sequences
that play a role in, for example, transcription, mRNA processing
(including splicing and polyadenylation signals), ribosome binding,
and/or stability of mRNA. In addition, the nucleic acid molecules
may be fused to heterologous marker sequences encoding, for
example, a peptide that facilitates purification.
[0129] Isolated nucleic acid molecules can be in the form of RNA,
such as mRNA, or in the form DNA, including cDNA and genomic DNA,
which may be obtained, for example, by molecular cloning or
produced by chemical synthetic techniques or by a combination
thereof (Sambrook and Russell, 2000, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Press, NY). Furthermore,
isolated nucleic acid molecules, particularly SNP detection
reagents such as probes and primers, can also be partially or
completely in the form of one or more types of nucleic acid
analogs, such as peptide nucleic acid (PNA) (U.S. Pat. Nos.
5,539,082; 5,527,675; 5,623,049; 5,714,331). The nucleic acid,
especially DNA, can be double-stranded or single-stranded.
Single-stranded nucleic acid can be the coding strand (sense
strand) or the complementary non-coding strand (anti-sense strand).
DNA, RNA, or PNA segments can be assembled, for example, from
fragments of the human genome (in the case of DNA or RNA) or single
nucleotides, short oligonucleotide linkers, or from a series of
oligonucleotides, to provide a synthetic nucleic acid molecule.
Nucleic acid molecules can be readily synthesized using the
sequences provided herein as a reference; oligonucleotide and PNA
oligomer synthesis techniques are well known in the art (see, e.g.,
Corey, "Peptide nucleic acids: expanding the scope of nucleic acid
recognition", Trends Biotechnol. 1997 June; 15(6):224-9, and Hyrup
et al., "Peptide nucleic acids (PNA): synthesis, properties and
potential applications", Bioorg Med. Chem. 1996 January;
4(1):5-23). Furthermore, large-scale automated oligonucleotide/PNA
synthesis (including synthesis on an array or bead surface or other
solid support) can readily be accomplished using commercially
available nucleic acid synthesizers, such as the Applied Biosystems
(Foster City, Calif.) 3900 High-Throughput DNA Synthesizer or
Expedite 8909 Nucleic Acid Synthesis System, and the sequence
information provided herein.
[0130] The present invention encompasses nucleic acid analogs that
contain modified, synthetic, or non-naturally occurring nucleotides
or structural elements or other alternative/modified nucleic acid
chemistries known in the art. Such nucleic acid analogs are useful,
for example, as detection reagents (e.g., primers/probes) for
detecting one or more SNPs identified in Table 1 and/or Table 2.
Furthermore, kits/systems (such as beads, arrays, etc.) that
include these analogs are also encompassed by the present
invention. For example, PNA oligomers that are based on the
polymorphic sequences of the present invention are specifically
contemplated. PNA oligomers are analogs of DNA in which the
phosphate backbone is replaced with a peptide-like backbone
(Lagriffoul et al., Bioorganic & Medicinal Chemistry Letters,
4: 1081-1082 (1994), Petersen et al., Bioorganic & Medicinal
Chemistry Letters, 6: 793-796 (1996), Kumar et al., Organic Letters
3(9): 1269-1272 (2001), WO96/04000). PNA hybridizes to
complementary RNA or DNA with higher affinity and specificity than
conventional oligonucleotides and oligonucleotide analogs. The
properties of PNA enable novel molecular biology and biochemistry
applications unachievable with traditional oligonucleotides and
peptides.
[0131] Additional examples of nucleic acid modifications that
improve the binding properties and/or stability of a nucleic acid
include the use of base analogs such as inosine, intercalators
(U.S. Pat. No. 4,835,263) and the minor groove binders (U.S. Pat.
No. 5,801,115). Thus, references herein to nucleic acid molecules,
SNP-containing nucleic acid molecules, SNP detection reagents
(e.g., probes and primers), oligonucleotides/polynucleotides
include PNA oligomers and other nucleic acid analogs. Other
examples of nucleic acid analogs and alternative/modified nucleic
acid chemistries known in the art are described in Current
Protocols in Nucleic Acid Chemistry, John Wiley & Sons, N.Y.
(2002).
[0132] The present invention further provides nucleic acid
molecules that encode fragments of the variant polypeptides
disclosed herein as well as nucleic acid molecules that encode
obvious variants of such variant polypeptides. Such nucleic acid
molecules may be naturally occurring, such as paralogs (different
locus) and orthologs (different organism), or may be constructed by
recombinant DNA methods or by chemical synthesis. Non-naturally
occurring variants may be made by mutagenesis techniques, including
those applied to nucleic acid molecules, cells, or organisms.
Accordingly, the variants can contain nucleotide substitutions,
deletions, inversions and insertions (in addition to the SNPs
disclosed in Tables 1-2). Variation can occur in either or both the
coding and non-coding regions. The variations can produce
conservative and/or non-conservative amino acid substitutions.
[0133] Further variants of the nucleic acid molecules disclosed in
Tables 1-2, such as naturally occurring allelic variants (as well
as orthologs and paralogs) and synthetic variants produced by
mutagenesis techniques, can be identified and/or produced using
methods well known in the art. Such further variants can comprise a
nucleotide sequence that shares at least 70-80%, 80-85%, 85-90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity
with a nucleic acid sequence disclosed in Table 1 and/or Table 2
(or a fragment thereof) and that includes a novel SNP allele
disclosed in Table 1 and/or Table 2. Further, variants can comprise
a nucleotide sequence that encodes a polypeptide that shares at
least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, or 99% sequence identity with a polypeptide sequence disclosed
in Table 1 (or a fragment thereof) and that includes a novel SNP
allele disclosed in Table 1 and/or Table 2. Thus, an aspect of the
present invention that is specifically contemplated are isolated
nucleic acid molecules that have a certain degree of sequence
variation compared with the sequences shown in Tables 1-2, but that
contain a novel SNP allele disclosed herein. In other words, as
long as an isolated nucleic acid molecule contains a novel SNP
allele disclosed herein, other portions of the nucleic acid
molecule that flank the novel SNP allele can vary to some degree
from the specific transcript, genomic, and context sequences shown
in Tables 1-2, and can encode a polypeptide that varies to some
degree from the specific polypeptide sequences shown in Table
1.
[0134] To determine the percent identity of two amino acid
sequences or two nucleotide sequences of two molecules that share
sequence homology, the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in one or both of a first
and a second amino acid or nucleic acid sequence for optimal
alignment and non-homologous sequences can be disregarded for
comparison purposes). In a preferred embodiment, at least 30%, 40%,
50%, 60%, 70%, 80%, or 90% or more of the length of a reference
sequence is aligned for comparison purposes. The amino acid
residues or nucleotides at corresponding amino acid positions or
nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide as the corresponding position in the second sequence,
then the molecules are identical at that position (as used herein,
amino acid or nucleic acid "identity" is equivalent to amino acid
or nucleic acid "homology"). The percent identity between the two
sequences is a function of the number of identical positions shared
by the sequences, taking into account the number of gaps, and the
length of each gap, which need to be introduced for optimal
alignment of the two sequences.
[0135] The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. (Computational Molecular Biology, Lesk, A.
M., ed., Oxford University Press, New York, 1988; Biocomputing:
Informatics and Genome Projects, Smith, D. W., ed., Academic Press,
New York, 1993; Computer Analysis of Sequence Data, Part 1,
Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey,
1994; Sequence Analysis in Molecular Biology, von Heinje, G.,
Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M.
and Devereux, J., eds., M Stockton Press, New York, 1991). In a
preferred embodiment, the percent identity between two amino acid
sequences is determined using the Needleman and Wunsch algorithm
(J. Mol. Biol. (48):444-453 (1970)) which has been incorporated
into the GAP program in the GCG software package, using either a
Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14,
12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
[0136] In yet another preferred embodiment, the percent identity
between two nucleotide sequences is determined using the GAP
program in the GCG software package (Devereux, J., et al., Nucleic
Acids Res. 12(1):387 (1984)), using a NWSgapdna.CMP matrix and a
gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3,
4, 5, or 6.
[0137] In another embodiment, the percent identity between two
amino acid or nucleotide sequences is determined using the
algorithm of E. Myers and W. Miller (CABIOS, 4:11-17 (1989)) which
has been incorporated into the ALIGN program (version 2.0), using a
PAM120 weight residue table, a gap length penalty of 12, and a gap
penalty of 4.
[0138] The nucleotide and amino acid sequences of the present
invention can further be used as a "query sequence" to perform a
search against sequence databases to, for example, identify other
family members or related sequences. Such searches can be performed
using the NBLAST and XBLAST programs (version 2.0) of Altschul, et
al. (J. Mol. Biol. 215:403-10 (1990)). BLAST nucleotide searches
can be performed with the NBLAST program, score=100, wordlength=12
to obtain nucleotide sequences homologous to the nucleic acid
molecules of the invention. BLAST protein searches can be performed
with the XBLAST program, score=50, wordlength=3 to obtain amino
acid sequences homologous to the proteins of the invention. To
obtain gapped alignments for comparison purposes, Gapped BLAST can
be utilized as described in Altschul et al. (Nucleic Acids Res.
25(17):3389-3402 (1997)). When utilizing BLAST and gapped BLAST
programs, the default parameters of the respective programs (e.g.,
XBLAST and NBLAST) can be used. In addition to BLAST, examples of
other search and sequence comparison programs used in the art
include, but are not limited to, FASTA (Pearson, Methods Mol. Biol.
25, 365-389 (1994)) and KERR (Dufresne et al., Nat Biotechnol 2002
December; 20(12):1269-71). For further information regarding
bioinformatics techniques, see Current Protocols in Bioinformatics,
John Wiley & Sons, Inc., N.Y.
[0139] The present invention further provides non-coding fragments
of the nucleic acid molecules disclosed in Table 1 and/or Table 2.
Preferred non-coding fragments include, but are not limited to,
promoter sequences, enhancer sequences, intronic sequences, 5'
untranslated regions (UTRs), 3' untranslated regions, gene
modulating sequences and gene termination sequences. Such fragments
are useful, for example, in controlling heterologous gene
expression and in developing screens to identify gene-modulating
agents.
[0140] SNP Detection Reagents
[0141] In a specific aspect of the present invention, the SNPs
disclosed in Table 1 and/or Table 2, and their associated
transcript sequences (provided in Table 1 as SEQ ID NOS:1-669),
genomic sequences (provided in Table 2 as SEQ ID
NOS:10,552-10,915), and context sequences (transcript-based context
sequences are provided in Table 1 as SEQ ID NOS:1339-10,551;
genomic-based context sequences are provided in Table 2 as SEQ ID
NOS:10,916-49,582 and 50,231), can be used for the design of SNP
detection reagents. As used herein, a "SNP detection reagent" is a
reagent that specifically detects a specific target SNP position
disclosed herein, and that is preferably specific for a particular
nucleotide (allele) of the target SNP position (i.e., the detection
reagent preferably can differentiate between different alternative
nucleotides at a target SNP position, thereby allowing the identity
of the nucleotide present at the target SNP position to be
determined). Typically, such detection reagent hybridizes to a
target SNP-containing nucleic acid molecule by complementary
base-pairing in a sequence specific manner, and discriminates the
target variant sequence from other nucleic acid sequences such as
an art-known form in a test sample. An example of a detection
reagent is a probe that hybridizes to a target nucleic acid
containing one or more of the SNPs provided in Table 1 and/or Table
2. In a preferred embodiment, such a probe can differentiate
between nucleic acids having a particular nucleotide (allele) at a
target SNP position from other nucleic acids that have a different
nucleotide at the same target SNP position. In addition, a
detection reagent may hybridize to a specific region 5' and/or 3'
to a SNP position, particularly a region corresponding to the
context sequences provided in Table 1 and/or Table 2
(transcript-based context sequences are provided in Table 1 as SEQ
ID NOS:1339-10,551; genomic-based context sequences are provided in
Table 2 as SEQ ID NOS:10,916-49,582 and 50,231). Another example of
a detection reagent is a primer which acts as an initiation point
of nucleotide extension along a complementary strand of a target
polynucleotide. The SNP sequence information provided herein is
also useful for designing primers, e.g. allele-specific primers, to
amplify (e.g., using PCR) any SNP of the present invention.
[0142] In one preferred embodiment of the invention, a SNP
detection reagent is an isolated or synthetic DNA or RNA
polynucleotide probe or primer or PNA oligomer, or a combination of
DNA, RNA and/or PNA, that hybridizes to a segment of a target
nucleic acid molecule containing a SNP identified in Table 1 and/or
Table 2. A detection reagent in the form of a polynucleotide may
optionally contain modified base analogs, intercalators or minor
groove binders. Multiple detection reagents such as probes may be,
for example, affixed to a solid support (e.g., arrays or beads) or
supplied in solution (e.g., probe/primer sets for enzymatic
reactions such as PCR, RT-PCR, TaqMan assays, or primer-extension
reactions) to form a SNP detection kit.
[0143] A probe or primer typically is a substantially purified
oligonucleotide or PNA oligomer. Such oligonucleotide typically
comprises a region of complementary nucleotide sequence that
hybridizes under stringent conditions to at least about 8, 10, 12,
16, 18, 20, 22, 25, 30, 40, 50, 55, 60, 65, 70, 80, 90, 100, 120
(or any other number in-between) or more consecutive nucleotides in
a target nucleic acid molecule. Depending on the particular assay,
the consecutive nucleotides can either include the target SNP
position, or be a specific region in close enough proximity 5'
and/or 3' to the SNP position to carry out the desired assay.
[0144] Other preferred primer and probe sequences can readily be
determined using the transcript sequences (SEQ ID NOS:1-669),
genomic sequences (SEQ ID NOS:10,552-10,915), and SNP context
sequences (transcript-based context sequences are provided in Table
1 as SEQ ID NOS:1339-10,551; genomic-based context sequences are
provided in Table 2 as SEQ ID NOS:10,916-49,582 and 50,231)
disclosed in the Sequence Listing and in Tables 1-2. It will be
apparent to one of skill in the art that such primers and probes
are directly useful as reagents for genotyping the SNPs of the
present invention, and can be incorporated into any kit/system
format.
[0145] In order to produce a probe or primer specific for a target
SNP-containing sequence, the gene/transcript and/or context
sequence surrounding the SNP of interest is typically examined
using a computer algorithm which starts at the 5' or at the 3' end
of the nucleotide sequence. Typical algorithms will then identify
oligomers of defined length that are unique to the gene/SNP context
sequence, have a GC content within a range suitable for
hybridization, lack predicted secondary structure that may
interfere with hybridization, and/or possess other desired
characteristics or that lack other undesired characteristics.
[0146] A primer or probe of the present invention is typically at
least about 8 nucleotides in length. In one embodiment of the
invention, a primer or a probe is at least about 10 nucleotides in
length. In a preferred embodiment, a primer or a probe is at least
about 12 nucleotides in length. In a more preferred embodiment, a
primer or probe is at least about 16, 17, 18, 19, 20, 21, 22, 23,
24 or 25 nucleotides in length. While the maximal length of a probe
can be as long as the target sequence to be detected, depending on
the type of assay in which it is employed, it is typically less
than about 50, 60, 65, or 70 nucleotides in length. In the case of
a primer, it is typically less than about 30 nucleotides in length.
In a specific preferred embodiment of the invention, a primer or a
probe is within the length of about 18 and about 28 nucleotides.
However, in other embodiments, such as nucleic acid arrays and
other embodiments in which probes are affixed to a substrate, the
probes can be longer, such as on the order of 30-70, 75, 80, 90,
100, or more nucleotides in length (see the section below entitled
"SNP Detection Kits and Systems").
[0147] For analyzing SNPs, it may be appropriate to use
oligonucleotides specific for alternative SNP alleles. Such
oligonucleotides which detect single nucleotide variations in
target sequences may be referred to by such terms as
"allele-specific oligonucleotides", "allele-specific probes", or
"allele-specific primers". The design and use of allele-specific
probes for analyzing polymorphisms is described in, e.g., Mutation
Detection A Practical Approach, ed. Cotton et al. Oxford University
Press, 1998; Saiki et al., Nature 324, 163-166 (1986); Dattagupta,
EP235,726; and Saiki, WO 89/11548.
[0148] While the design of each allele-specific primer or probe
depends on variables such as the precise composition of the
nucleotide sequences flanking a SNP position in a target nucleic
acid molecule, and the length of the primer or probe, another
factor in the use of primers and probes is the stringency of the
condition under which the hybridization between the probe or primer
and the target sequence is performed. Higher stringency conditions
utilize buffers with lower ionic strength and/or a higher reaction
temperature, and tend to require a more perfect match between
probe/primer and a target sequence in order to form a stable
duplex. If the stringency is too high, however, hybridization may
not occur at all. In contrast, lower stringency conditions utilize
buffers with higher ionic strength and/or a lower reaction
temperature, and permit the formation of stable duplexes with more
mismatched bases between a probe/primer and a target sequence. By
way of example and not limitation, exemplary conditions for high
stringency hybridization conditions using an allele-specific probe
are as follows: Prehybridization with a solution containing
5.times. standard saline phosphate EDTA (SSPE), 0.5% NaDodS O.sub.4
(SDS) at 55.degree. C., and incubating probe with target nucleic
acid molecules in the same solution at the same temperature,
followed by washing with a solution containing 2.times.SSPE, and
0.1% SDS at 55.degree. C. or room temperature.
[0149] Moderate stringency hybridization conditions may be used for
allele-specific primer extension reactions with a solution
containing, e.g., about 50 mM KCl at about 46.degree. C.
Alternatively, the reaction may be carried out at an elevated
temperature such as 60.degree. C. In another embodiment, a
moderately stringent hybridization condition suitable for
oligonucleotide ligation assay (OLA) reactions wherein two probes
are ligated if they are completely complementary to the target
sequence may utilize a solution of about 100 mM KCl at a
temperature of 46.degree. C.
[0150] In a hybridization-based assay, allele-specific probes can
be designed that hybridize to a segment of target DNA from one
individual but do not hybridize to the corresponding segment from
another individual due to the presence of different polymorphic
forms (e.g., alternative SNP alleles/nucleotides) in the respective
DNA segments from the two individuals. Hybridization conditions
should be sufficiently stringent that there is a significant
detectable difference in hybridization intensity between alleles,
and preferably an essentially binary response, whereby a probe
hybridizes to only one of the alleles or significantly more
strongly to one allele. While a probe may be designed to hybridize
to a target sequence that contains a SNP site such that the SNP
site aligns anywhere along the sequence of the probe, the probe is
preferably designed to hybridize to a segment of the target
sequence such that the SNP site aligns with a central position of
the probe (e.g., a position within the probe that is at least three
nucleotides from either end of the probe). This design of probe
generally achieves good discrimination in hybridization between
different allelic forms.
[0151] In another embodiment, a probe or primer may be designed to
hybridize to a segment of target DNA such that the SNP aligns with
either the 5' most end or the 3'most end of the probe or primer. In
a specific preferred embodiment which is particularly suitable for
use in a oligonucleotide ligation assay (U.S. Pat. No. 4,988,617),
the 3' most nucleotide of the probe aligns with the SNP position in
the target sequence.
[0152] Oligonucleotide probes and primers may be prepared by
methods well known in the art. Chemical synthetic methods include,
but are limited to, the phosphotriester method described by Narang
et al., 1979, Methods in Enzymology 68:90; the phosphodiester
method described by Brown et al., 1979, Methods in Enzymology
68:109, the diethylphosphoamidate method described by Beaucage et
al., 1981, Tetrahedron Letters 22:1859; and the solid support
method described in U.S. Pat. No. 4,458,066.
[0153] Allele-specific probes are often used in pairs (or, less
commonly, in sets of 3 or 4, such as if a SNP position is known to
have 3 or 4 alleles, respectively, or to assay both strands of a
nucleic acid molecule for a target SNP allele), and such pairs may
be identical except for a one nucleotide mismatch that represents
the allelic variants at the SNP position. Commonly, one member of a
pair perfectly matches a reference form of a target sequence that
has a more common SNP allele (i.e., the allele that is more
frequent in the target population) and the other member of the pair
perfectly matches a form of the target sequence that has a less
common SNP allele (i.e., the allele that is rarer in the target
population). In the case of an array, multiple pairs of probes can
be immobilized on the same support for simultaneous analysis of
multiple different polymorphisms.
[0154] In one type of PCR-based assay, an allele-specific primer
hybridizes to a region on a target nucleic acid molecule that
overlaps a SNP position and only primes amplification of an allelic
form to which the primer exhibits perfect complementarity (Gibbs,
1989, Nucleic Acid Res. 17 2427-2448). Typically, the primer's
3'-most nucleotide is aligned with and complementary to the SNP
position of the target nucleic acid molecule. This primer is used
in conjunction with a second primer that hybridizes at a distal
site. Amplification proceeds from the two primers, producing a
detectable product that indicates which allelic form is present in
the test sample. A control is usually performed with a second pair
of primers, one of which shows a single base mismatch at the
polymorphic site and the other of which exhibits perfect
complementarity to a distal site. The single-base mismatch prevents
amplification or substantially reduces amplification efficiency, so
that either no detectable product is formed or it is formed in
lower amounts or at a slower pace. The method generally works most
effectively when the mismatch is at the 3'-most position of the
oligonucleotide (i.e., the 3'-most position of the oligonucleotide
aligns with the target SNP position) because this position is most
destabilizing to elongation from the primer (see, e.g., WO
93/22456). This PCR-based assay can be utilized as part of the
TaqMan assay, described below.
[0155] In a specific embodiment of the invention, a primer of the
invention contains a sequence substantially complementary to a
segment of a target SNP-containing nucleic acid molecule except
that the primer has a mismatched nucleotide in one of the three
nucleotide positions at the 3'-most end of the primer, such that
the mismatched nucleotide does not base pair with a particular
allele at the SNP site. In a preferred embodiment, the mismatched
nucleotide in the primer is the second from the last nucleotide at
the 3'-most position of the primer. In a more preferred embodiment,
the mismatched nucleotide in the primer is the last nucleotide at
the 3'-most position of the primer.
[0156] In another embodiment of the invention, a SNP detection
reagent of the invention is labeled with a fluorogenic reporter dye
that emits a detectable signal. While the preferred reporter dye is
a fluorescent dye, any reporter dye that can be attached to a
detection reagent such as an oligonucleotide probe or primer is
suitable for use in the invention. Such dyes include, but are not
limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2, Cy3, Cy5,
Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam, Tet,
Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and
Texas Red.
[0157] In yet another embodiment of the invention, the detection
reagent may be further labeled with a quencher dye such as Tamra,
especially when the reagent is used as a self-quenching probe such
as a TaqMan (U.S. Pat. Nos. 5,210,015 and 5,538,848) or Molecular
Beacon probe (U.S. Pat. Nos. 5,118,801 and 5,312,728), or other
stemless or linear beacon probe (Livak et al., 1995, PCR Method
Appl. 4:357-362; Tyagi et al., 1996, Nature Biotechnology 14:
303-308; Nazarenko et al., 1997, Nucl. Acids Res. 25:2516-2521;
U.S. Pat. Nos. 5,866,336 and 6,117,635).
[0158] The detection reagents of the invention may also contain
other labels, including but not limited to, biotin for streptavidin
binding, hapten for antibody binding, and oligonucleotide for
binding to another complementary oligonucleotide such as pairs of
zipcodes.
[0159] The present invention also contemplates reagents that do not
contain (or that are complementary to) a SNP nucleotide identified
herein but that are used to assay one or more SNPs disclosed
herein. For example, primers that flank, but do not hybridize
directly to a target SNP position provided herein are useful in
primer extension reactions in which the primers hybridize to a
region adjacent to the target SNP position (i.e., within one or
more nucleotides from the target SNP site). During the primer
extension reaction, a primer is typically not able to extend past a
target SNP site if a particular nucleotide (allele) is present at
that target SNP site, and the primer extension product can be
detected in order to determine which SNP allele is present at the
target SNP site. For example, particular ddNTPs are typically used
in the primer extension reaction to terminate primer extension once
a ddNTP is incorporated into the extension product (a primer
extension product which includes a ddNTP at the 3'-most end of the
primer extension product, and in which the ddNTP is a nucleotide of
a SNP disclosed herein, is a composition that is specifically
contemplated by the present invention). Thus, reagents that bind to
a nucleic acid molecule in a region adjacent to a SNP site and that
are used for assaying the SNP site, even though the bound sequences
do not necessarily include the SNP site itself, are also
contemplated by the present invention.
[0160] SNP Detection Kits and Systems
[0161] A person skilled in the art will recognize that, based on
the SNP and associated sequence information disclosed herein,
detection reagents can be developed and used to assay any SNP of
the present invention individually or in combination, and such
detection reagents can be readily incorporated into one of the
established kit or system formats which are well known in the art.
The terms "kits" and "systems", as used herein in the context of
SNP detection reagents, are intended to refer to such things as
combinations of multiple SNP detection reagents, or one or more SNP
detection reagents in combination with one or more other types of
elements or components (e.g., other types of biochemical reagents,
containers, packages such as packaging intended for commercial
sale, substrates to which SNP detection reagents are attached,
electronic hardware components, etc.). Accordingly, the present
invention further provides SNP detection kits and systems,
including but not limited to, packaged probe and primer sets (e.g.,
TaqMan probe/primer sets), arrays/microarrays of nucleic acid
molecules, and beads that contain one or more probes, primers, or
other detection reagents for detecting one or more SNPs of the
present invention. The kits/systems can optionally include various
electronic hardware components; for example, arrays ("DNA chips")
and microfluidic systems ("lab-on-a-chip" systems) provided by
various manufacturers typically comprise hardware components. Other
kits/systems (e.g., probe/primer sets) may not include electronic
hardware components, but may be comprised of, for example, one or
more SNP detection reagents (along with, optionally, other
biochemical reagents) packaged in one or more containers.
[0162] In some embodiments, a SNP detection kit typically contains
one or more detection reagents and other components (e.g., a
buffer, enzymes such as DNA polymerases or ligases, chain extension
nucleotides such as deoxynucleotide triphosphates, and in the case
of Sanger-type DNA sequencing reactions, chain terminating
nucleotides, positive control sequences, negative control
sequences, and the like) necessary to carry out an assay or
reaction, such as amplification and/or detection of a
SNP-containing nucleic acid molecule. A kit may further contain
means for determining the amount of a target nucleic acid, and
means for comparing the amount with a standard, and can comprise
instructions for using the kit to detect the SNP-containing nucleic
acid molecule of interest. In one embodiment of the present
invention, kits are provided which contain the necessary reagents
to carry out one or more assays to detect one or more SNPs
disclosed herein. In a preferred embodiment of the present
invention, SNP detection kits/systems are in the form of nucleic
acid arrays, or compartmentalized kits, including
microfluidic/lab-on-a-chip systems.
[0163] SNP detection kits/systems may contain, for example, one or
more probes, or pairs of probes, that hybridize to a nucleic acid
molecule at or near each target SNP position. Multiple pairs of
allele-specific probes may be included in the kit/system to
simultaneously assay large numbers of SNPs, at least one of which
is a SNP of the present invention. In some kits/systems, the
allele-specific probes are immobilized to a substrate such as an
array or bead. For example, the same substrate can comprise
allele-specific probes for detecting at least 1; 10; 100; 1000;
10,000; 100,000 (or any other number in-between) or substantially
all of the SNPs shown in Table 1 and/or Table 2.
[0164] The terms "arrays", "microarrays", and "DNA chips" are used
herein interchangeably to refer to an array of distinct
polynucleotides affixed to a substrate, such as glass, plastic,
paper, nylon or other type of membrane, filter, chip, or any other
suitable solid support. The polynucleotides can be synthesized
directly on the substrate, or synthesized separate from the
substrate and then affixed to the substrate. In one embodiment, the
microarray is prepared and used according to the methods described
in U.S. Pat. No. 5,837,832, Chee et al., PCT application WO95/11995
(Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14:
1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93:
10614-10619), all of which are incorporated herein in their
entirety by reference. In other embodiments, such arrays are
produced by the methods described by Brown et al., U.S. Pat. No.
5,807,522.
[0165] Nucleic acid arrays are reviewed in the following
references: Zammatteo et al., "New chips for molecular biology and
diagnostics", Biotechnol Annu Rev. 2002; 8:85-101; Sosnowski et
al., "Active microelectronic array system for DNA hybridization,
genotyping and pharmacogenomic applications", Psychiatr Genet. 2002
December; 12(4):181-92; Heller, "DNA microarray technology:
devices, systems, and applications", Annu Rev Biomed Eng. 2002;
4:129-53. Epub 2002 Mar 22; Kolchinsky et al., "Analysis of SNPs
and other genomic variations using gel-based chips", Hum Mutat.
2002 April; 19(4):343-60; and McGall et al., "High-density genechip
oligonucleotide probe arrays", Adv Biochem Eng Biotechnol. 2002;
77:21-42.
[0166] Any number of probes, such as allele-specific probes, may be
implemented in an array, and each probe or pair of probes can
hybridize to a different SNP position. In the case of
polynucleotide probes, they can be synthesized at designated areas
(or synthesized separately and then affixed to designated areas) on
a substrate using a light-directed chemical process. Each DNA chip
can contain, for example, thousands to millions of individual
synthetic polynucleotide probes arranged in a grid-like pattern and
miniaturized (e.g., to the size of a dime). Preferably, probes are
attached to a solid support in an ordered, addressable array.
[0167] A microarray can be composed of a large number of unique,
single-stranded polynucleotides, usually either synthetic antisense
polynucleotides or fragments of cDNAs, fixed to a solid support.
Typical polynucleotides are preferably about 6-60 nucleotides in
length, more preferably about 15-30 nucleotides in length, and most
preferably about 18-25 nucleotides in length. For certain types of
microarrays or other detection kits/systems, it may be preferable
to use oligonucleotides that are only about 7-20 nucleotides in
length. In other types of arrays, such as arrays used in
conjunction with chemiluminescent detection technology, preferred
probe lengths can be, for example, about 15-80 nucleotides in
length, preferably about 50-70 nucleotides in length, more
preferably about 55-65 nucleotides in length, and most preferably
about 60 nucleotides in length. The microarray or detection kit can
contain polynucleotides that cover the known 5' or 3' sequence of a
gene/transcript or target SNP site, sequential polynucleotides that
cover the full-length sequence of a gene/transcript; or unique
polynucleotides selected from particular areas along the length of
a target gene/transcript sequence, particularly areas corresponding
to one or more SNPs disclosed in Table 1 and/or Table 2.
Polynucleotides used in the microarray or detection kit can be
specific to a SNP or SNPs of interest (e.g., specific to a
particular SNP allele at a target SNP site, or specific to
particular SNP alleles at multiple different SNP sites), or
specific to a polymorphic gene/transcript or genes/transcripts of
interest.
[0168] Hybridization assays based on polynucleotide arrays rely on
the differences in hybridization stability of the probes to
perfectly matched and mismatched target sequence variants. For SNP
genotyping, it is generally preferable that stringency conditions
used in hybridization assays are high enough such that nucleic acid
molecules that differ from one another at as little as a single SNP
position can be differentiated (e.g., typical SNP hybridization
assays are designed so that hybridization will occur only if one
particular nucleotide is present at a SNP position, but will not
occur if an alternative nucleotide is present at that SNP
position). Such high stringency conditions may be preferable when
using, for example, nucleic acid arrays of allele-specific probes
for SNP detection. Such high stringency conditions are described in
the preceding section, and are well known to those skilled in the
art and can be found in, for example, Current Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989),
6.3.1-6.3.6.
[0169] In other embodiments, the arrays are used in conjunction
with chemiluminescent detection technology. The following patents
and patent applications, which are all hereby incorporated by
reference, provide additional information pertaining to
chemiluminescent detection: U.S. patent application Ser. Nos.
10/620,332 and 10/620,333 describe chemiluminescent approaches for
microarray detection; U.S. Pat. Nos. 6,124,478, 6,107,024,
5,994,073, 5,981,768, 5,871,938, 5,843,681, 5,800,999, and 5773628
describe methods and compositions of dioxetane for performing
chemiluminescent detection; and U.S. published application
US2002/0110828 discloses methods and compositions for microarray
controls.
[0170] In one embodiment of the invention, a nucleic acid array can
comprise an array of probes of about 15-25 nucleotides in length.
In further embodiments, a nucleic acid array can comprise any
number of probes, in which at least one probe is capable of
detecting one or more SNPs disclosed in Table 1 and/or Table 2,
and/or at least one probe comprises a fragment of one of the
sequences selected from the group consisting of those disclosed in
Table 1, Table 2, the Sequence Listing, and sequences complementary
thereto, said fragment comprising at least about 8 consecutive
nucleotides, preferably 10, 12, 15, 16, 18, 20, more preferably 22,
25, 30, 40, 47, 50, 55, 60, 65, 70, 80, 90, 100, or more
consecutive nucleotides (or any other number in-between) and
containing (or being complementary to) a novel SNP allele disclosed
in Table 1 and/or Table 2. In some embodiments, the nucleotide
complementary to the SNP site is within 5, 4, 3, 2, or 1 nucleotide
from the center of the probe, more preferably at the center of said
probe.
[0171] A polynucleotide probe can be synthesized on the surface of
the substrate by using a chemical coupling procedure and an ink jet
application apparatus, as described in PCT application WO95/251116
(Baldeschweiler et al.) which is incorporated herein in its
entirety by reference. In another aspect, a "gridded" array
analogous to a dot (or slot) blot may be used to arrange and link
cDNA fragments or oligonucleotides to the surface of a substrate
using a vacuum system, thermal, UV, mechanical or chemical bonding
procedures. An array, such as those described above, may be
produced by hand or by using available devices (slot blot or dot
blot apparatus), materials (any suitable solid support), and
machines (including robotic instruments), and may contain 8, 24,
96, 384, 1536, 6144 or more polynucleotides, or any other number
which lends itself to the efficient use of commercially available
instrumentation.
[0172] Using such arrays or other kits/systems, the present
invention provides methods of identifying the SNPs disclosed herein
in a test sample. Such methods typically involve incubating a test
sample of nucleic acids with an array comprising one or more probes
corresponding to at least one SNP position of the present
invention, and assaying for binding of a nucleic acid from the test
sample with one or more of the probes. Conditions for incubating a
SNP detection reagent (or a kit/system that employs one or more
such SNP detection reagents) with a test sample vary. Incubation
conditions depend on such factors as the format employed in the
assay, the detection methods employed, and the type and nature of
the detection reagents used in the assay. One skilled in the art
will recognize that any one of the commonly available
hybridization, amplification and array assay formats can readily be
adapted to detect the SNPs disclosed herein.
[0173] A SNP detection kit/system of the present invention may
include components that are used to prepare nucleic acids from a
test sample for the subsequent amplification and/or detection of a
SNP-containing nucleic acid molecule. Such sample preparation
components can be used to produce nucleic acid extracts (including
DNA and/or RNA), proteins or membrane extracts from any bodily
fluids (such as blood, serum, plasma, urine, saliva, phlegm,
gastric juices, semen, tears, sweat, etc.), skin, hair, cells
(especially nucleated cells), biopsies, buccal swabs or tissue
specimens. The test samples used in the above-described methods
will vary based on such factors as the assay format, nature of the
detection method, and the specific tissues, cells or extracts used
as the test sample to be assayed. Methods of preparing nucleic
acids, proteins, and cell extracts are well known in the art and
can be readily adapted to obtain a sample that is compatible with
the system utilized. Automated sample preparation systems for
extracting nucleic acids from a test sample are commercially
available, and examples are Qiagen's BioRobot 9600, Applied
Biosystems' PRISM 6700, and Roche Molecular Systems' COBAS
AmpliPrep System.
[0174] Another form of kit contemplated by the present invention is
a compartmentalized kit. A compartmentalized kit includes any kit
in which reagents are contained in separate containers. Such
containers include, for example, small glass containers, plastic
containers, strips of plastic, glass or paper, or arraying material
such as silica. Such containers allow one to efficiently transfer
reagents from one compartment to another compartment such that the
test samples and reagents are not cross-contaminated, or from one
container to another vessel not included in the kit, and the agents
or solutions of each container can be added in a quantitative
fashion from one compartment to another or to another vessel. Such
containers may include, for example, one or more containers which
will accept the test sample, one or more containers which contain
at least one probe or other SNP detection reagent for detecting one
or more SNPs of the present invention, one or more containers which
contain wash reagents (such as phosphate buffered saline,
Tris-buffers, etc.), and one or more containers which contain the
reagents used to reveal the presence of the bound probe or other
SNP detection reagents. The kit can optionally further comprise
compartments and/or reagents for, for example, nucleic acid
amplification or other enzymatic reactions such as primer extension
reactions, hybridization, ligation, electrophoresis (preferably
capillary electrophoresis), mass spectrometry, and/or laser-induced
fluorescent detection. The kit may also include instructions for
using the kit. Exemplary compartmentalized kits include
microfluidic devices known in the art (see, e.g., Weigl et al.,
"Lab-on-a-chip for drug development", Adv Drug Deliv Rev. 2003 Feb.
24; 55(3):349-77). In such microfluidic devices, the containers may
be referred to as, for example, microfluidic "compartments",
"chambers", or "channels".
[0175] Microfluidic devices, which may also be referred to as
"lab-on-a-chip" systems, biomedical micro-electro-mechanical
systems (bioMEMs), or multicomponent integrated systems, are
exemplary kits/systems of the present invention for analyzing SNPs.
Such systems miniaturize and compartmentalize processes such as
probe/target hybridization, nucleic acid amplification, and
capillary electrophoresis reactions in a single functional device.
Such microfluidic devices typically utilize detection reagents in
at least one aspect of the system, and such detection reagents may
be used to detect one or more SNPs of the present invention. One
example of a microfluidic system is disclosed in U.S. Pat. No.
5,589,136, which describes the integration of PCR amplification and
capillary electrophoresis in chips. Exemplary microfluidic systems
comprise a pattern of microchannels designed onto a glass, silicon,
quartz, or plastic wafer included on a microchip. The movements of
the samples may be controlled by electric, electroosmotic or
hydrostatic forces applied across different areas of the microchip
to create functional microscopic valves and pumps with no moving
parts. Varying the voltage can be used as a means to control the
liquid flow at intersections between the micro-machined channels
and to change the liquid flow rate for pumping across different
sections of the microchip. See, for example, U.S. Pat. No.
6,153,073, Dubrow et al., and U.S. Pat. No. 6,156,181, Parce et
al.
[0176] For genotyping SNPs, an exemplary microfluidic system may
integrate, for example, nucleic acid amplification, primer
extension, capillary electrophoresis, and a detection method such
as laser induced fluorescence detection. In a first step of an
exemplary process for using such an exemplary system, nucleic acid
samples are amplified, preferably by PCR. Then, the amplification
products are subjected to automated primer extension reactions
using ddNTPs (specific fluorescence for each ddNTP) and the
appropriate oligonucleotide primers to carry out primer extension
reactions which hybridize just upstream of the targeted SNP. Once
the extension at the 3' end is completed, the primers are separated
from the unincorporated fluorescent ddNTPs by capillary
electrophoresis. The separation medium used in capillary
electrophoresis can be, for example, polyacrylamide,
polyethyleneglycol or dextran. The incorporated ddNTPs in the
single nucleotide primer extension products are identified by
laser-induced fluorescence detection. Such an exemplary microchip
can be used to process, for example, at least 96 to 384 samples, or
more, in parallel.
[0177] Uses of Nucleic Acid Molecules
[0178] The nucleic acid molecules of the present invention have a
variety of uses, especially in the diagnosis and treatment of
rheumatoid arthritis. For example, the nucleic acid molecules are
useful as hybridization probes, such as for genotyping SNPs in
messenger RNA, transcript, cDNA, genomic DNA, amplified DNA or
other nucleic acid molecules, and for isolating full-length cDNA
and genomic clones encoding the variant peptides disclosed in Table
1 as well as their orthologs.
[0179] A probe can hybridize to any nucleotide sequence along the
entire length of a nucleic acid molecule provided in Table 1 and/or
Table 2. Preferably, a probe of the present invention hybridizes to
a region of a target sequence that encompasses a SNP position
indicated in Table 1 and/or Table 2. More preferably, a probe
hybridizes to a SNP-containing target sequence in a
sequence-specific manner such that it distinguishes the target
sequence from other nucleotide sequences which vary from the target
sequence only by which nucleotide is present at the SNP site. Such
a probe is particularly useful for detecting the presence of a
SNP-containing nucleic acid in a test sample, or for determining
which nucleotide (allele) is present at a particular SNP site
(i.e., genotyping the SNP site).
[0180] A nucleic acid hybridization probe may be used for
determining the presence, level, form, and/or distribution of
nucleic acid expression. The nucleic acid whose level is determined
can be DNA or RNA. Accordingly, probes specific for the SNPs
described herein can be used to assess the presence, expression
and/or gene copy number in a given cell, tissue, or organism. These
uses are relevant for diagnosis of disorders involving an increase
or decrease in gene expression relative to normal levels. In vitro
techniques for detection of mRNA include, for example, Northern
blot hybridizations and in situ hybridizations. In vitro techniques
for detecting DNA include Southern blot hybridizations and in situ
hybridizations (Sambrook and Russell, 2000, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor,
N.Y.).
[0181] Probes can be used as part of a diagnostic test kit for
identifying cells or tissues in which a variant protein is
expressed, such as by measuring the level of a variant
protein-encoding nucleic acid (e.g., mRNA) in a sample of cells
from a subject or determining if a polynucleotide contains a SNP of
interest.
[0182] Thus, the nucleic acid molecules of the invention can be
used as hybridization probes to detect the SNPs disclosed herein,
thereby determining whether an individual with the polymorphisms is
at risk for rheumatoid arthritis or has developed early stage
rheumatoid arthritis. Detection of a SNP associated with a disease
phenotype provides a diagnostic tool for an active disease and/or
genetic predisposition to the disease.
[0183] The nucleic acid molecules of the invention are also useful
as primers to amplify any given region of a nucleic acid molecule,
particularly a region containing a SNP identified in Table 1 and/or
Table 2.
[0184] The nucleic acid molecules of the invention are also useful
for constructing recombinant vectors (described in greater detail
below). Such vectors include expression vectors that express a
portion of, or all of, any of the variant peptide sequences
provided in Table 1. Vectors also include insertion vectors, used
to integrate into another nucleic acid molecule sequence, such as
into the cellular genome, to alter in situ expression of a gene
and/or gene product. For example, an endogenous coding sequence can
be replaced via homologous recombination with all or part of the
coding region containing one or more specifically introduced
SNPs.
[0185] The nucleic acid molecules of the invention are also useful
for expressing antigenic portions of the variant proteins,
particularly antigenic portions that contain a variant amino acid
sequence (e.g., an amino acid substitution) caused by a SNP
disclosed in Table 1 and/or Table 2.
[0186] The nucleic acid molecules of the invention are also useful
for constructing vectors containing a gene regulatory region of the
nucleic acid molecules of the present invention.
[0187] The nucleic acid molecules of the invention are also useful
for designing ribozymes corresponding to all, or a part, of an mRNA
molecule expressed from a SNP-containing nucleic acid molecule
described herein.
[0188] The nucleic acid molecules of the invention are also useful
for constructing host cells expressing a part, or all, of the
nucleic acid molecules and variant peptides.
[0189] The nucleic acid molecules of the invention are also useful
for constructing transgenic animals expressing all, or a part, of
the nucleic acid molecules and variant peptides. The production of
recombinant cells and transgenic animals having nucleic acid
molecules which contain the SNPs disclosed in Table 1 and/or Table
2 allow, for example, effective clinical design of treatment
compounds and dosage regimens.
[0190] The nucleic acid molecules of the invention are also useful
in assays for drug screening to identify compounds that, for
example, modulate nucleic acid expression.
[0191] The nucleic acid molecules of the invention are also useful
in gene therapy in patients whose cells have aberrant gene
expression. Thus, recombinant cells, which include a patient's
cells that have been engineered ex vivo and returned to the
patient, can be introduced into an individual where the recombinant
cells produce the desired protein to treat the individual.
[0192] SNP Genotyping Methods
[0193] The process of determining which specific nucleotide (i.e.,
allele) is present at each of one or more SNP positions, such as a
SNP position in a nucleic acid molecule disclosed in Table 1 and/or
Table 2, is referred to as SNP genotyping. The present invention
provides methods of SNP genotyping, such as for use in screening
for rheumatoid arthritis or related pathologies, or determining
predisposition thereto, or determining responsiveness to a form of
treatment, or in genome mapping or SNP association analysis,
etc.
[0194] Nucleic acid samples can be genotyped to determine which
allele(s) is/are present at any given genetic region (e.g., SNP
position) of interest by methods well known in the art. The
neighboring sequence can be used to design SNP detection reagents
such as oligonucleotide probes, which may optionally be implemented
in a kit format. Exemplary SNP genotyping methods are described in
Chen et al., "Single nucleotide polymorphism genotyping:
biochemistry, protocol, cost and throughput", Pharmacogenomics J.
2003; 3(2):77-96; Kwok et al., "Detection of single nucleotide
polymorphisms", Curr Issues Mol. Biol. 2003 April; 5(2):43-60; Shi,
"Technologies for individual genotyping: detection of genetic
polymorphisms in drug targets and disease genes", Am J
Pharmacogenomics. 2002; 2(3):197-205; and Kwok, "Methods for
genotyping single nucleotide polymorphisms", Annu Rev Genomics Hum
Genet. 2001; 2:235-58. Exemplary techniques for high-throughput SNP
genotyping are described in Marnellos, "High-throughput SNP
analysis for genetic association studies", Curr Opin Drug Discov
Devel. 2003 May; 6(3):317-21. Common SNP genotyping methods
include, but are not limited to, TaqMan assays, molecular beacon
assays, nucleic acid arrays, allele-specific primer extension,
allele-specific PCR, arrayed primer extension, homogeneous primer
extension assays, primer extension with detection by mass
spectrometry, pyrosequencing, multiplex primer extension sorted on
genetic arrays, ligation with rolling circle amplification,
homogeneous ligation, OLA (U.S. Pat. No. 4,988,167), multiplex
ligation reaction sorted on genetic arrays, restriction-fragment
length polymorphism, single base extension-tag assays, and the
Invader assay. Such methods may be used in combination with
detection mechanisms such as, for example, luminescence or
chemiluminescence detection, fluorescence detection, time-resolved
fluorescence detection, fluorescence resonance energy transfer,
fluorescence polarization, mass spectrometry, and electrical
detection.
[0195] Various methods for detecting polymorphisms include, but are
not limited to, methods in which protection from cleavage agents is
used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes
(Myers et al., Science 230:1242 (1985); Cotton et al., PNAS 85:4397
(1988); and Saleeba et al., Meth. Enzymol. 217:286-295 (1992)),
comparison of the electrophoretic mobility of variant and wild type
nucleic acid molecules (Orita et al., PNAS 86:2766 (1989); Cotton
et al., Mutat. Res. 285:125-144 (1993); and Hayashi et al., Genet.
Anal. Tech. Appl. 9:73-79 (1992)), and assaying the movement of
polymorphic or wild-type fragments in polyacrylamide gels
containing a gradient of denaturant using denaturing gradient gel
electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)).
Sequence variations at specific locations can also be assessed by
nuclease protection assays such as RNase and S1 protection or
chemical cleavage methods.
[0196] In a preferred embodiment, SNP genotyping is performed using
the TaqMan assay, which is also known as the 5' nuclease assay
(U.S. Pat. Nos. 5,210,015 and 5,538,848). The TaqMan assay detects
the accumulation of a specific amplified product during PCR. The
TaqMan assay utilizes an oligonucleotide probe labeled with a
fluorescent reporter dye and a quencher dye. The reporter dye is
excited by irradiation at an appropriate wavelength, it transfers
energy to the quencher dye in the same probe via a process called
fluorescence resonance energy transfer (FRET). When attached to the
probe, the excited reporter dye does not emit a signal. The
proximity of the quencher dye to the reporter dye in the intact
probe maintains a reduced fluorescence for the reporter. The
reporter dye and quencher dye may be at the 5' most and the 3' most
ends, respectively, or vice versa. Alternatively, the reporter dye
may be at the 5' or 3' most end while the quencher dye is attached
to an internal nucleotide, or vice versa. In yet another
embodiment, both the reporter and the quencher may be attached to
internal nucleotides at a distance from each other such that
fluorescence of the reporter is reduced.
[0197] During PCR, the 5' nuclease activity of DNA polymerase
cleaves the probe, thereby separating the reporter dye and the
quencher dye and resulting in increased fluorescence of the
reporter. Accumulation of PCR product is detected directly by
monitoring the increase in fluorescence of the reporter dye. The
DNA polymerase cleaves the probe between the reporter dye and the
quencher dye only if the probe hybridizes to the target
SNP-containing template which is amplified during PCR, and the
probe is designed to hybridize to the target SNP site only if a
particular SNP allele is present.
[0198] Preferred TaqMan primer and probe sequences can readily be
determined using the SNP and associated nucleic acid sequence
information provided herein. A number of computer programs, such as
Primer Express (Applied Biosystems, Foster City, Calif.), can be
used to rapidly obtain optimal primer/probe sets. It will be
apparent to one of skill in the art that such primers and probes
for detecting the SNPs of the present invention are useful in
diagnostic assays for rheumatoid arthritis and related pathologies,
and can be readily incorporated into a kit format. The present
invention also includes modifications of the Taqman assay well
known in the art such as the use of Molecular Beacon probes (U.S.
Pat. Nos. 5,118,801 and 5,312,728) and other variant formats (U.S.
Pat. Nos. 5,866,336 and 6,117,635).
[0199] Another preferred method for genotyping the SNPs of the
present invention is the use of two oligonucleotide probes in an
OLA (see, e.g., U.S. Pat. No. 4,988,617). In this method, one probe
hybridizes to a segment of a target nucleic acid with its 3' most
end aligned with the SNP site. A second probe hybridizes to an
adjacent segment of the target nucleic acid molecule directly 3' to
the first probe. The two juxtaposed probes hybridize to the target
nucleic acid molecule, and are ligated in the presence of a linking
agent such as a ligase if there is perfect complementarity between
the 3' most nucleotide of the first probe with the SNP site. If
there is a mismatch, ligation would not occur. After the reaction,
the ligated probes are separated from the target nucleic acid
molecule, and detected as indicators of the presence of a SNP.
[0200] The following patents, patent applications, and published
international patent applications, which are all hereby
incorporated by reference, provide additional information
pertaining to techniques for carrying out various types of OLA:
U.S. Pat. Nos. 6,027,889, 6,268,148, 5,494,810, 5,830,711, and
6054564 describe OLA strategies for performing SNP detection; WO
97/31256 and WO 00/56927 describe OLA strategies for performing SNP
detection using universal arrays, wherein a zipcode sequence can be
introduced into one of the hybridization probes, and the resulting
product, or amplified product, hybridized to a universal zip code
array; U.S. application US01/17329 (and 09/584,905) describes OLA
(or LDR) followed by PCR, wherein zipcodes are incorporated into
OLA probes, and amplified PCR products are determined by
electrophoretic or universal zipcode array readout; U.S.
applications 60/427,818, 60/445,636, and 60/445,494 describe SNPlex
methods and software for multiplexed SNP detection using OLA
followed by PCR, wherein zipcodes are incorporated into OLA probes,
and amplified PCR products are hybridized with a zipchute reagent,
and the identity of the SNP determined from electrophoretic readout
of the zipchute. In some embodiments, OLA is carried out prior to
PCR (or another method of nucleic acid amplification). In other
embodiments, PCR (or another method of nucleic acid amplification)
is carried out prior to OLA.
[0201] Another method for SNP genotyping is based on mass
spectrometry. Mass spectrometry takes advantage of the unique mass
of each of the four nucleotides of DNA. SNPs can be unambiguously
genotyped by mass spectrometry by measuring the differences in the
mass of nucleic acids having alternative SNP alleles. MALDI-TOF
(Matrix Assisted Laser Desorption Ionization--Time of Flight) mass
spectrometry technology is preferred for extremely precise
determinations of molecular mass, such as SNPs. Numerous approaches
to SNP analysis have been developed based on mass spectrometry.
Preferred mass spectrometry-based methods of SNP genotyping include
primer extension assays, which can also be utilized in combination
with other approaches, such as traditional gel-based formats and
microarrays.
[0202] Typically, the primer extension assay involves designing and
annealing a primer to a template PCR amplicon upstream (5') from a
target SNP position. A mix of dideoxynucleotide triphosphates
(ddNTPs) and/or deoxynucleotide triphosphates (dNTPs) are added to
a reaction mixture containing template (e.g., a SNP-containing
nucleic acid molecule which has typically been amplified, such as
by PCR), primer, and DNA polymerase. Extension of the primer
terminates at the first position in the template where a nucleotide
complementary to one of the ddNTPs in the mix occurs. The primer
can be either immediately adjacent (i.e., the nucleotide at the 3'
end of the primer hybridizes to the nucleotide next to the target
SNP site) or two or more nucleotides removed from the SNP position.
If the primer is several nucleotides removed from the target SNP
position, the only limitation is that the template sequence between
the 3' end of the primer and the SNP position cannot contain a
nucleotide of the same type as the one to be detected, or this will
cause premature termination of the extension primer. Alternatively,
if all four ddNTPs alone, with no dNTPs, are added to the reaction
mixture, the primer will always be extended by only one nucleotide,
corresponding to the target SNP position. In this instance, primers
are designed to bind one nucleotide upstream from the SNP position
(i.e., the nucleotide at the 3' end of the primer hybridizes to the
nucleotide that is immediately adjacent to the target SNP site on
the 5' side of the target SNP site). Extension by only one
nucleotide is preferable, as it minimizes the overall mass of the
extended primer, thereby increasing the resolution of mass
differences between alternative SNP nucleotides. Furthermore,
mass-tagged ddNTPs can be employed in the primer extension
reactions in place of unmodified ddNTPs. This increases the mass
difference between primers extended with these ddNTPs, thereby
providing increased sensitivity and accuracy, and is particularly
useful for typing heterozygous base positions. Mass-tagging also
alleviates the need for intensive sample-preparation procedures and
decreases the necessary resolving power of the mass
spectrometer.
[0203] The extended primers can then be purified and analyzed by
MALDI-TOF mass spectrometry to determine the identity of the
nucleotide present at the target SNP position. In one method of
analysis, the products from the primer extension reaction are
combined with light absorbing crystals that form a matrix. The
matrix is then hit with an energy source such as a laser to ionize
and desorb the nucleic acid molecules into the gas-phase. The
ionized molecules are then ejected into a flight tube and
accelerated down the tube towards a detector. The time between the
ionization event, such as a laser pulse, and collision of the
molecule with the detector is the time of flight of that molecule.
The time of flight is precisely correlated with the mass-to-charge
ratio (m/z) of the ionized molecule. Ions with smaller m/z travel
down the tube faster than ions with larger m/z and therefore the
lighter ions reach the detector before the heavier ions. The
time-of-flight is then converted into a corresponding, and highly
precise, m/z. In this manner, SNPs can be identified based on the
slight differences in mass, and the corresponding time of flight
differences, inherent in nucleic acid molecules having different
nucleotides at a single base position. For further information
regarding the use of primer extension assays in conjunction with
MALDI-TOF mass spectrometry for SNP genotyping, see, e.g., Wise et
al., "A standard protocol for single nucleotide primer extension in
the human genome using matrix-assisted laser desorption/ionization
time-of-flight mass spectrometry", Rapid Commun Mass Spectrom.
2003; 17(11):1195-202.
[0204] The following references provide further information
describing mass spectrometry-based methods for SNP genotyping:
Bocker, "SNP and mutation discovery using base-specific cleavage
and MALDI-TOF mass spectrometry", Bioinformatics. 2003 July; 19
Suppl 1:144-153; Storm et al., "MALDI-TOF mass spectrometry-based
SNP genotyping", Methods Mol. Biol. 2003; 212:241-62; Jurinke et
al., "The use of MassARRAY technology for high throughput
genotyping", Adv Biochem Eng Biotechnol. 2002; 77:57-74; and
Jurinke et al., "Automated genotyping using the DNA MassArray
technology", Methods Mol. Biol. 2002; 187:179-92.
[0205] SNPs can also be scored by direct DNA sequencing. A variety
of automated sequencing procedures can be utilized ((1995)
Biotechniques 19:448), including sequencing by mass spectrometry
(see, e.g., PCT International Publication No. WO94/16101; Cohen et
al., Adv. Chromatogr. 36:127-162 (1996); and Griffin et al., Appl.
Biochem. Biotechnol. 38:147-159 (1993)). The nucleic acid sequences
of the present invention enable one of ordinary skill in the art to
readily design sequencing primers for such automated sequencing
procedures. Commercial instrumentation, such as the Applied
Biosystems 377, 3100, 3700, 3730, and 3730.times.1 DNA Analyzers
(Foster City, Calif.), is commonly used in the art for automated
sequencing.
[0206] Other methods that can be used to genotype the SNPs of the
present invention include single-strand conformational polymorphism
(SSCP), and denaturing gradient gel electrophoresis (DGGE) (Myers
et al., Nature 313:495 (1985)). SSCP identifies base differences by
alteration in electrophoretic migration of single stranded PCR
products, as described in Orita et al., Proc. Nat. Acad.
Single-stranded PCR products can be generated by heating or
otherwise denaturing double stranded PCR products. Single-stranded
nucleic acids may refold or form secondary structures that are
partially dependent on the base sequence. The different
electrophoretic mobilities of single-stranded amplification
products are related to base-sequence differences at SNP positions.
DGGE differentiates SNP alleles based on the different
sequence-dependent stabilities and melting properties inherent in
polymorphic DNA and the corresponding differences in
electrophoretic migration patterns in a denaturing gradient gel
(Erlich, ed., PCR Technology, Principles and Applications for DNA
Amplification, W.H. Freeman and Co, New York, 1992, Chapter 7).
[0207] Sequence-specific ribozymes (U.S. Pat. No. 5,498,531) can
also be used to score SNPs based on the development or loss of a
ribozyme cleavage site. Perfectly matched sequences can be
distinguished from mismatched sequences by nuclease cleavage
digestion assays or by differences in melting temperature. If the
SNP affects a restriction enzyme cleavage site, the SNP can be
identified by alterations in restriction enzyme digestion patterns,
and the corresponding changes in nucleic acid fragment lengths
determined by gel electrophoresis
[0208] SNP genotyping can include the steps of, for example,
collecting a biological sample from a human subject (e.g., sample
of tissues, cells, fluids, secretions, etc.), isolating nucleic
acids (e.g., genomic DNA, mRNA or both) from the cells of the
sample, contacting the nucleic acids with one or more primers which
specifically hybridize to a region of the isolated nucleic acid
containing a target SNP under conditions such that hybridization
and amplification of the target nucleic acid region occurs, and
determining the nucleotide present at the SNP position of interest,
or, in some assays, detecting the presence or absence of an
amplification product (assays can be designed so that hybridization
and/or amplification will only occur if a particular SNP allele is
present or absent). In some assays, the size of the amplification
product is detected and compared to the length of a control sample;
for example, deletions and insertions can be detected by a change
in size of the amplified product compared to a normal genotype.
[0209] SNP genotyping is useful for numerous practical
applications, as described below. Examples of such applications
include, but are not limited to, SNP-disease association analysis,
disease predisposition screening, disease diagnosis, disease
prognosis, disease progression monitoring, determining therapeutic
strategies based on an individual's genotype ("pharmacogenomics"),
developing therapeutic agents based on SNP genotypes associated
with a disease or likelihood of responding to a drug, stratifying a
patient population for clinical trial for a treatment regimen,
predicting the likelihood that an individual will experience toxic
side effects from a therapeutic agent, and human identification
applications such as forensics.
[0210] Analysis of Genetic Association Between SNPs and Phenotypic
Traits
[0211] SNP genotyping for disease diagnosis, disease predisposition
screening, disease prognosis, determining drug responsiveness
(pharmacogenomics), drug toxicity screening, and other uses
described herein, typically relies on initially establishing a
genetic association between one or more specific SNPs and the
particular phenotypic traits of interest.
[0212] Different study designs may be used for genetic association
studies (Modern Epidemiology, Lippincott Williams & Wilkins
(1998), 609-622). Observational studies are most frequently carried
out in which the response of the patients is not interfered with.
The first type of observational study identifies a sample of
persons in whom the suspected cause of the disease is present and
another sample of persons in whom the suspected cause is absent,
and then the frequency of development of disease in the two samples
is compared. These sampled populations are called cohorts, and the
study is a prospective study. The other type of observational study
is case-control or a retrospective study. In typical case-control
studies, samples are collected from individuals with the phenotype
of interest (cases) such as certain manifestations of a disease,
and from individuals without the phenotype (controls) in a
population (target population) that conclusions are to be drawn
from. Then the possible causes of the disease are investigated
retrospectively. As the time and costs of collecting samples in
case-control studies are considerably less than those for
prospective studies, case-control studies are the more commonly
used study design in genetic association studies, at least during
the exploration and discovery stage.
[0213] In both types of observational studies, there may be
potential confounding factors that should be taken into
consideration. Confounding factors are those that are associated
with both the real cause(s) of the disease and the disease itself,
and they include demographic information such as age, gender,
ethnicity as well as environmental factors. When confounding
factors are not matched in cases and controls in a study, and are
not controlled properly, spurious association results can arise. If
potential confounding factors are identified, they should be
controlled for by analysis methods explained below.
[0214] In a genetic association study, the cause of interest to be
tested is a certain allele or a SNP or a combination of alleles or
a haplotype from several SNPs. Thus, tissue specimens (e.g., whole
blood) from the sampled individuals may be collected and genomic
DNA genotyped for the SNP(s) of interest. In addition to the
phenotypic trait of interest, other information such as demographic
(e.g., age, gender, ethnicity, etc.), clinical, and environmental
information that may influence the outcome of the trait can be
collected to further characterize and define the sample set. In
many cases, these factors are known to be associated with diseases
and/or SNP allele frequencies. There are likely gene-environment
and/or gene-gene interactions as well. Analysis methods to address
gene-environment and gene-gene interactions (for example, the
effects of the presence of both susceptibility alleles at two
different genes can be greater than the effects of the individual
alleles at two genes combined) are discussed below.
[0215] After all the relevant phenotypic and genotypic information
has been obtained, statistical analyses are carried out to
determine if there is any significant correlation between the
presence of an allele or a genotype with the phenotypic
characteristics of an individual. Preferably, data inspection and
cleaning are first performed before carrying out statistical tests
for genetic association. Epidemiological and clinical data of the
samples can be summarized by descriptive statistics with tables and
graphs. Data validation is preferably performed to check for data
completion, inconsistent entries, and outliers. Chi-squared tests
and t-tests (Wilcoxon rank-sum tests if distributions are not
normal) may then be used to check for significant differences
between cases and controls for discrete and continuous variables,
respectively. To ensure genotyping quality, Hardy-Weinberg
disequilibrium tests can be performed on cases and controls
separately. Significant deviation from Hardy-Weinberg equilibrium
(HWE) in both cases and controls for individual markers can be
indicative of genotyping errors. If HWE is violated in a majority
of markers, it is indicative of population substructure that should
be further investigated. Moreover, Hardy-Weinberg disequilibrium in
cases only can indicate genetic association of the markers with the
disease (Genetic Data Analysis, Weir B., Sinauer (1990)).
[0216] To test whether an allele of a single SNP is associated with
the case or control status of a phenotypic trait, one skilled in
the art can compare allele frequencies in cases and controls.
Standard chi-squared tests and Fisher exact tests can be carried
out on a 2.times.2 table (2 SNP alleles.times.2 outcomes in the
categorical trait of interest). To test whether genotypes of a SNP
are associated, chi-squared tests can be carried out on a 3.times.2
table (3 genotypes.times.2 outcomes). Score tests are also carried
out for genotypic association to contrast the three genotypic
frequencies (major homozygotes, heterozygotes and minor
homozygotes) in cases and controls, and to look for trends using 3
different modes of inheritance, namely dominant (with contrast
coefficients 2, -1, -1), additive (with contrast coefficients 1, 0,
-1) and recessive (with contrast coefficients 1, 1, -2). Odds
ratios for minor versus major alleles, and odds ratios for
heterozygote and homozygote variants versus the wild type genotypes
are calculated with the desired confidence limits, usually 95%.
[0217] In order to control for confounders and to test for
interaction and effect modifiers, stratified analyses may be
performed using stratified factors that are likely to be
confounding, including demographic information such as age,
ethnicity, and gender, or an interacting element or effect
modifier, such as a known major gene (e.g., APOE for Alzheimer's
disease or HLA genes for autoimmune diseases), or environmental
factors such as smoking in lung cancer. Stratified association
tests may be carried out using Cochran-Mantel-Haenszel tests that
take into account the ordinal nature of genotypes with 0, 1, and 2
variant alleles. Exact tests by StatXact may also be performed when
computationally possible. Another way to adjust for confounding
effects and test for interactions is to perform stepwise multiple
logistic regression analysis using statistical packages such as SAS
or R. Logistic regression is a model-building technique in which
the best fitting and most parsimonious model is built to describe
the relation between the dichotomous outcome (for instance, getting
a certain disease or not) and a set of independent variables (for
instance, genotypes of different associated genes, and the
associated demographic and environmental factors). The most common
model is one in which the logit transformation of the odds ratios
is expressed as a linear combination of the variables (main
effects) and their cross-product terms (interactions) (Applied
Logistic Regression, Hosmer and Lemeshow, Wiley (2000)). To test
whether a certain variable or interaction is significantly
associated with the outcome, coefficients in the model are first
estimated and then tested for statistical significance of their
departure from zero.
[0218] In addition to performing association tests one marker at a
time, haplotype association analysis may also be performed to study
a number of markers that are closely linked together. Haplotype
association tests can have better power than genotypic or allelic
association tests when the tested markers are not the
disease-causing mutations themselves but are in linkage
disequilibrium with such mutations. The test will even be more
powerful if the disease is indeed caused by a combination of
alleles on a haplotype (e.g., APOE is a haplotype formed by 2 SNPs
that are very close to each other). In order to perform haplotype
association effectively, marker-marker linkage disequilibrium
measures, both D' and R.sup.2, are typically calculated for the
markers within a gene to elucidate the haplotype structure. Recent
studies (Daly et al, Nature Genetics, 29, 232-235, 2001) in linkage
disequilibrium indicate that SNPs within a gene are organized in
block pattern, and a high degree of linkage disequilibrium exists
within blocks and very little linkage disequilibrium exists between
blocks. Haplotype association with the disease status can be
performed using such blocks once they have been elucidated.
[0219] Haplotype association tests can be carried out in a similar
fashion as the allelic and genotypic association tests. Each
haplotype in a gene is analogous to an allele in a multi-allelic
marker. One skilled in the art can either compare the haplotype
frequencies in cases and controls or test genetic association with
different pairs of haplotypes. It has been proposed (Schaid et al,
Am. J. Hum. Genet., 70, 425-434, 2002) that score tests can be done
on haplotypes using the program "haplo.score". In that method,
haplotypes are first inferred by EM algorithm and score tests are
carried out with a generalized linear model (GLM) framework that
allows the adjustment of other factors.
[0220] An important decision in the performance of genetic
association tests is the determination of the significance level at
which significant association can be declared when the p-value of
the tests reaches that level. In an exploratory analysis where
positive hits will be followed up in subsequent confirmatory
testing, an unadjusted p-value <0.1 (a significance level on the
lenient side) may be used for generating hypotheses for significant
association of a SNP with certain phenotypic characteristics of a
disease. It is preferred that a p-value <0.05 (a significance
level traditionally used in the art) is achieved in order for a SNP
to be considered to have an association with a disease. It is more
preferred that a p-value <0.01 (a significance level on the
stringent side) is achieved for an association to be declared. When
hits are followed up in confirmatory analyses in more samples of
the same source or in different samples from different sources,
adjustment for multiple testing will be performed as to avoid
excess number of hits while maintaining the experiment-wise error
rates at 0.05. While there are different methods to adjust for
multiple testing to control for different kinds of error rates, a
commonly used but rather conservative method is Bonferroni
correction to control the experiment-wise or family-wise error rate
(Multiple comparisons and multiple tests, Westfall et al, SAS
Institute (1999)). Permutation tests to control for the false
discovery rates, FDR, can be more powerful (Benjamini and Hochberg,
Journal of the Royal Statistical Society, Series B 57, 1289-1300,
1995, Resampling-based Multiple Testing, Westfall and Young, Wiley
(1993)). Such methods to control for multiplicity would be
preferred when the tests are dependent and controlling for false
discovery rates is sufficient as opposed to controlling for the
experiment-wise error rates.
[0221] In replication studies using samples from different
populations after statistically significant markers have been
identified in the exploratory stage, meta-analyses can then be
performed by combining evidence of different studies (Modem
Epidemiology, Lippincott Williams & Wilkins, 1998, 643-673). If
available, association results known in the art for the same SNPs
can be included in the meta-analyses.
[0222] Since both genotyping and disease status classification can
involve errors, sensitivity analyses may be performed to see how
odds ratios and p-values would change upon various estimates on
genotyping and disease classification error rates.
[0223] It has been well known that subpopulation-based sampling
bias between cases and controls can lead to spurious results in
case-control association studies (Ewens and Spielman, Am. J. Hum.
Genet. 62, 450-458, 1995) when prevalence of the disease is
associated with different subpopulation groups. Such bias can also
lead to a loss of statistical power in genetic association studies.
To detect population stratification, Pritchard and Rosenberg
(Pritchard et al. Am. J. Hum. Gen. 1999, 65:220-228) suggested
typing markers that are unlinked to the disease and using results
of association tests on those markers to determine whether there is
any population stratification. When stratification is detected, the
genomic control (GC) method as proposed by Devlin and Roeder
(Devlin et al. Biometrics 1999, 55:997-1004) can be used to adjust
for the inflation of test statistics due to population
stratification. GC method is robust to changes in population
structure levels as well as being applicable to DNA pooling designs
(Devlin et al. Genet. Epidem. 20001, 21:273-284).
[0224] While Pritchard's method recommended using 15-20 unlinked
microsatellite markers, it suggested using more than 30 biallelic
markers to get enough power to detect population stratification.
For the GC method, it has been shown (Bacanu et al. Am. J. Hum.
Genet. 2000, 66:1933-1944) that about 60-70 biallelic markers are
sufficient to estimate the inflation factor for the test statistics
due to population stratification. Hence, 70 intergenic SNPs can be
chosen in unlinked regions as indicated in a genome scan (Kehoe et
al. Hum. Mol. Genet. 1999, 8:237-245).
[0225] Once individual risk factors, genetic or non-genetic, have
been found for the predisposition to disease, the next step is to
set up a classification/prediction scheme to predict the category
(for instance, disease or no-disease) that an individual will be in
depending on his genotypes of associated SNPs and other non-genetic
risk factors. Logistic regression for discrete trait and linear
regression for continuous trait are standard techniques for such
tasks (Applied Regression Analysis, Draper and Smith, Wiley
(1998)). Moreover, other techniques can also be used for setting up
classification. Such techniques include, but are not limited to,
MART, CART, neural network, and discriminant analyses that are
suitable for use in comparing the performance of different methods
(The Elements of Statistical Learning, Hastie, Tibshirani &
Friedman, Springer (2002)).
[0226] Disease Diagnosis and Predisposition Screening
[0227] Information on association/correlation between genotypes and
disease-related phenotypes can be exploited in several ways. For
example, in the case of a highly statistically significant
association between one or more SNPs with predisposition to a
disease for which treatment is available, detection of such a
genotype pattern in an individual may justify immediate
administration of treatment, or at least the institution of regular
monitoring of the individual. Detection of the susceptibility
alleles associated with serious disease in a couple contemplating
having children may also be valuable to the couple in their
reproductive decisions. In the case of a weaker but still
statistically significant association between a SNP and a human
disease, immediate therapeutic intervention or monitoring may not
be justified after detecting the susceptibility allele or SNP.
Nevertheless, the subject can be motivated to begin simple
life-style changes (e.g., diet, exercise) that can be accomplished
at little or no cost to the individual but would confer potential
benefits in reducing the risk of developing conditions for which
that individual may have an increased risk by virtue of having the
susceptibility allele(s).
[0228] The SNPs of the invention may contribute to rheumatoid
arthritis in an individual in different ways. Some polymorphisms
occur within a protein coding sequence and contribute to disease
phenotype by affecting protein structure. Other polymorphisms occur
in noncoding regions but may exert phenotypic effects indirectly
via influence on, for example, replication, transcription, and/or
translation. A single SNP may affect more than one phenotypic
trait. Likewise, a single phenotypic trait may be affected by
multiple SNPs in different genes.
[0229] As used herein, the terms "diagnose", "diagnosis", and
"diagnostics" include, but are not limited to any of the following:
detection of rheumatoid arthritis that an individual may presently
have, predisposition screening (i.e., determining the increased
risk of an individual in developing rheumatoid arthritis in the
future, or determining whether an individual has a decreased risk
of developing rheumatoid arthritis in the future), determining a
particular type or subclass of rheumatoid arthritis in an
individual known to have rheumatoid arthritis, confirming or
reinforcing a previously made diagnosis of rheumatoid arthritis,
pharmacogenomic evaluation of an individual to determine which
therapeutic strategy that individual is most likely to positively
respond to or to predict whether a patient is likely to respond to
a particular treatment, predicting whether a patient is likely to
experience toxic effects from a particular treatment or therapeutic
compound, and evaluating the future prognosis of an individual
having rheumatoid arthritis. Such diagnostic uses are based on the
SNPs individually or in a unique combination or SNP haplotypes of
the present invention.
[0230] Haplotypes are particularly useful in that, for example,
fewer SNPs can be genotyped to determine if a particular genomic
region harbors a locus that influences a particular phenotype, such
as in linkage disequilibrium-based SNP association analysis.
[0231] Linkage disequilibrium (LD) refers to the co-inheritance of
alleles (e.g., alternative nucleotides) at two or more different
SNP sites at frequencies greater than would be expected from the
separate frequencies of occurrence of each allele in a given
population. The expected frequency of co-occurrence of two alleles
that are inherited independently is the frequency of the first
allele multiplied by the frequency of the second allele. Alleles
that co-occur at expected frequencies are said to be in "linkage
equilibrium". In contrast, LD refers to any non-random genetic
association between allele(s) at two or more different SNP sites,
which is generally due to the physical proximity of the two loci
along a chromosome. LD can occur when two or more SNPs sites are in
close physical proximity to each other on a given chromosome and
therefore alleles at these SNP sites will tend to remain
unseparated for multiple generations with the consequence that a
particular nucleotide (allele) at one SNP site will show a
non-random association with a particular nucleotide (allele) at a
different SNP site located nearby. Hence, genotyping one of the SNP
sites will give almost the same information as genotyping the other
SNP site that is in LD.
[0232] For diagnostic purposes, if a particular SNP site is found
to be useful for diagnosing rheumatoid arthritis, then the skilled
artisan would recognize that other SNP sites which are in LD with
this SNP site would also be useful for diagnosing the condition.
Various degrees of LD can be encountered between two or more SNPs
with the result being that some SNPs are more closely associated
(i.e., in stronger LD) than others. Furthermore, the physical
distance over which LD extends along a chromosome differs between
different regions of the genome, and therefore the degree of
physical separation between two or more SNP sites necessary for LD
to occur can differ between different regions of the genome.
[0233] For diagnostic applications, polymorphisms (e.g., SNPs
and/or haplotypes) that are not the actual disease-causing
(causative) polymorphisms, but are in LD with such causative
polymorphisms, are also useful. In such instances, the genotype of
the polymorphism(s) that is/are in LD with the causative
polymorphism is predictive of the genotype of the causative
polymorphism and, consequently, predictive of the phenotype (e.g.,
rheumatoid arthritis) that is influenced by the causative SNP(s).
Thus, polymorphic markers that are in LD with causative
polymorphisms are useful as diagnostic markers, and are
particularly useful when the actual causative polymorphism(s)
is/are unknown.
[0234] Linkage disequilibrium in the human genome is reviewed in:
Wall et al., "Haplotype blocks and linkage disequilibrium in the
human genome", Nat Rev Genet. 2003 August; 4(8):587-97; Garner et
al., "On selecting markers for association studies: patterns of
linkage disequilibrium between two and three diallelic loci", Genet
Epidemiol. 2003 January; 24(1):57-67; Ardlie et al., "Patterns of
linkage disequilibrium in the human genome", Nat Rev Genet. 2002
April; 3(4):299-309 (erratum in Nat Rev Genet. 2002 July;
3(7):566); and Remm et al., "High-density genotyping and linkage
disequilibrium in the human genome using chromosome 22 as a model";
Curr Opin Chem. Biol. 2002 February; 6(1):24-30.
[0235] The contribution or association of particular SNPs and/or
SNP haplotypes with disease phenotypes, such as rheumatoid
arthritis, enables the SNPs of the present invention to be used to
develop superior diagnostic tests capable of identifying
individuals who express a detectable trait, such as rheumatoid
arthritis, as the result of a specific genotype, or individuals
whose genotype places them at an increased or decreased risk of
developing a detectable trait at a subsequent time as compared to
individuals who do not have that genotype. As described herein,
diagnostics may be based on a single SNP or a group of SNPs.
Combined detection of a plurality of SNPs (for example, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 30,
32, 48, 50, 64, 96, 100, or any other number in-between, or more,
of the SNPs provided in Table 1 and/or Table 2) typically increases
the probability of an accurate diagnosis. For example, the presence
of a single SNP known to correlate with rheumatoid arthritis might
indicate a probability of 20% that an individual has or is at risk
of developing rheumatoid arthritis, whereas detection of five SNPs,
each of which correlates with rheumatoid arthritis, might indicate
a probability of 80% that an individual has or is at risk of
developing rheumatoid arthritis. To further increase the accuracy
of diagnosis or predisposition screening, analysis of the SNPs of
the present invention can be combined with that of other
polymorphisms or other risk factors of rheumatoid arthritis, such
as disease symptoms, pathological characteristics, family history,
diet, environmental factors or lifestyle factors.
[0236] It will, of course, be understood by practitioners skilled
in the treatment or diagnosis of rheumatoid arthritis that the
present invention generally does not intend to provide an absolute
identification of individuals who are at risk (or less at risk) of
developing rheumatoid arthritis, and/or pathologies related to
rheumatoid arthritis, but rather to indicate a certain increased
(or decreased) degree or likelihood of developing the disease based
on statistically significant association results. However, this
information is extremely valuable as it can be used to, for
example, initiate preventive treatments or to allow an individual
carrying one or more significant SNPs or SNP haplotypes to foresee
warning signs such as minor clinical symptoms, or to have regularly
scheduled physical exams to monitor for appearance of a condition
in order to identify and begin treatment of the condition at an
early stage. Particularly with diseases that are extremely
debilitating or fatal if not treated on time, the knowledge of a
potential predisposition, even if this predisposition is not
absolute, would likely contribute in a very significant manner to
treatment efficacy.
[0237] The diagnostic techniques of the present invention may
employ a variety of methodologies to determine whether a test
subject has a SNP or a SNP pattern associated with an increased or
decreased risk of developing a detectable trait or whether the
individual suffers from a detectable trait as a result of a
particular polymorphism/mutation, including, for example, methods
which enable the analysis of individual chromosomes for
haplotyping, family studies, single sperm DNA analysis, or somatic
hybrids. The trait analyzed using the diagnostics of the invention
may be any detectable trait that is commonly observed in
pathologies and disorders related to rheumatoid arthritis.
[0238] Another aspect of the present invention relates to a method
of determining whether an individual is at risk (or less at risk)
of developing one or more traits or whether an individual expresses
one or more traits as a consequence of possessing a particular
trait-causing or trait-influencing allele. These methods generally
involve obtaining a nucleic acid sample from an individual and
assaying the nucleic acid sample to determine which nucleotide(s)
is/are present at one or more SNP positions, wherein the assayed
nucleotide(s) is/are indicative of an increased or decreased risk
of developing the trait or indicative that the individual expresses
the trait as a result of possessing a particular trait-causing or
trait-influencing allele.
[0239] In another embodiment, the SNP detection reagents of the
present invention are used to determine whether an individual has
one or more SNP allele(s) affecting the level (e.g., the
concentration of mRNA or protein in a sample, etc.) or pattern
(e.g., the kinetics of expression, rate of decomposition, stability
profile, Km, Vmax, etc.) of gene expression (collectively, the
"gene response" of a cell or bodily fluid). Such a determination
can be accomplished by screening for mRNA or protein expression
(e.g., by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass
spectrometry), identifying genes having altered expression in an
individual, genotyping SNPs disclosed in Table 1 and/or Table 2
that could affect the expression of the genes having altered
expression (e.g., SNPs that are in and/or around the gene(s) having
altered expression, SNPs in regulatory/control regions, SNPs in
and/or around other genes that are involved in pathways that could
affect the expression of the gene(s) having altered expression, or
all SNPs could be genotyped), and correlating SNP genotypes with
altered gene expression. In this manner, specific SNP alleles at
particular SNP sites can be identified that affect gene
expression.
[0240] Pharmacogenomics and Therapeutics/Drug Development
[0241] The present invention provides methods for assessing the
pharmacogenomics of a subject harboring particular SNP alleles or
haplotypes to a particular therapeutic agent or pharmaceutical
compound, or to a class of such compounds. Pharmacogenomics deals
with the roles which clinically significant hereditary variations
(e.g., SNPs) play in the response to drugs due to altered drug
disposition and/or abnormal action in affected persons. See, e.g.,
Roses, Nature 405, 857-865 (2000); Gould Rothberg, Nature
Biotechnology 19, 209-211 (2001); Eichelbaum, Clin. Exp. Pharmacol.
Physiol. 23(10-11):983-985 (1996); and Linder, Clin. Chem.
43(2):254-266 (1997). The clinical outcomes of these variations can
result in severe toxicity of therapeutic drugs in certain
individuals or therapeutic failure of drugs in certain individuals
as a result of individual variation in metabolism. Thus, the SNP
genotype of an individual can determine the way a therapeutic
compound acts on the body or the way the body metabolizes the
compound. For example, SNPs in drug metabolizing enzymes can affect
the activity of these enzymes, which in turn can affect both the
intensity and duration of drug action, as well as drug metabolism
and clearance.
[0242] The discovery of SNPs in drug metabolizing enzymes, drug
transporters, proteins for pharmaceutical agents, and other drug
targets has explained why some patients do not obtain the expected
drug effects, show an exaggerated drug effect, or experience
serious toxicity from standard drug dosages. SNPs can be expressed
in the phenotype of the extensive metabolizer and in the phenotype
of the poor metabolizer. Accordingly, SNPs may lead to allelic
variants of a protein in which one or more of the protein functions
in one population are different from those in another population.
SNPs and the encoded variant peptides thus provide targets to
ascertain a genetic predisposition that can affect treatment
modality. For example, in a ligand-based treatment, SNPs may give
rise to amino terminal extracellular domains and/or other
ligand-binding regions of a receptor that are more or less active
in ligand binding, thereby affecting subsequent protein activation.
Accordingly, ligand dosage would necessarily be modified to
maximize the therapeutic effect within a given population
containing particular SNP alleles or haplotypes.
[0243] As an alternative to genotyping, specific variant proteins
containing variant amino acid sequences encoded by alternative SNP
alleles could be identified. Thus, pharmacogenomic characterization
of an individual permits the selection of effective compounds and
effective dosages of such compounds for prophylactic or therapeutic
uses based on the individual's SNP genotype, thereby enhancing and
optimizing the effectiveness of the therapy. Furthermore, the
production of recombinant cells and transgenic animals containing
particular SNPs/haplotypes allow effective clinical design and
testing of treatment compounds and dosage regimens. For example,
transgenic animals can be produced that differ only in specific SNP
alleles in a gene that is orthologous to a human disease
susceptibility gene.
[0244] Pharmacogenomic uses of the SNPs of the present invention
provide several significant advantages for patient care,
particularly in treating rheumatoid arthritis. Pharmacogenomic
characterization of an individual, based on an individual's SNP
genotype, can identify those individuals unlikely to respond to
treatment with a particular medication and thereby allows
physicians to avoid prescribing the ineffective medication to those
individuals. On the other hand, SNP genotyping of an individual may
enable physicians to select the appropriate medication and dosage
regimen that will be most effective based on an individual's SNP
genotype. This information increases a physician's confidence in
prescribing medications and motivates patients to comply with their
drug regimens. Furthermore, pharmacogenomics may identify patients
predisposed to toxicity and adverse reactions to particular drugs
or drug dosages. Adverse drug reactions lead to more than 100,000
avoidable deaths per year in the United States alone and therefore
represent a significant cause of hospitalization and death, as well
as a significant economic burden on the healthcare system (Pfost
et. al., Trends in Biotechnology, August 2000.). Thus,
pharmacogenomics based on the SNPs disclosed herein has the
potential to both save lives and reduce healthcare costs
substantially.
[0245] Pharmacogenomics in general is discussed further in Rose et
al., "Pharmacogenetic analysis of clinically relevant genetic
polymorphisms", Methods Mol. Med. 2003; 85:225-37. Pharmacogenomics
as it relates to Alzheimer's disease and other neurodegenerative
disorders is discussed in Cacabelos, "Pharmacogenomics for the
treatment of dementia", Ann Med. 2002; 34(5):357-79, Maimone et
al., "Pharmacogenomics of neurodegenerative diseases", Eur J.
Pharmacol. 2001 Feb. 9; 413(1):11-29, and Poirier, "Apolipoprotein
E: a pharmacogenetic target for the treatment of Alzheimer's
disease", Mol. Diagn. 1999 December; 4(4):335-41. Pharmacogenomics
as it relates to cardiovascular disorders is discussed in Siest et
al., "Pharmacogenomics of drugs affecting the cardiovascular
system", Clin Chem Lab Med. 2003 April; 41(4):590-9, Mukherjee et
al., "Pharmacogenomics in cardiovascular diseases", Prog Cardiovasc
Dis. 2002 May-June; 44(6):479-98, and Mooser et al.,
"Cardiovascular pharmacogenetics in the SNP era", J Thromb Haemost.
2003 July; 1(7):1398-402. Pharmacogenomics as it relates to cancer
is discussed in McLeod et al., "Cancer pharmacogenomics: SNPs,
chips, and the individual patient", Cancer Invest. 2003;
21(4):630-40 and Watters et al., "Cancer pharmacogenomics: current
and future applications", Biochim Biophys Acta. 2003 Mar. 17;
1603(2):99-111.
[0246] The SNPs of the present invention also can be used to
identify novel therapeutic targets for rheumatoid arthritis. For
example, genes containing the disease-associated variants ("variant
genes") or their products, as well as genes or their products that
are directly or indirectly regulated by or interacting with these
variant genes or their products, can be targeted for the
development of therapeutics that, for example, treat the disease or
prevent or delay disease onset. The therapeutics may be composed
of, for example, small molecules, proteins, protein fragments or
peptides, antibodies, nucleic acids, or their derivatives or
mimetics which modulate the functions or levels of the target genes
or gene products.
[0247] The SNP-containing nucleic acid molecules disclosed herein,
and their complementary nucleic acid molecules, may be used as
antisense constructs to control gene expression in cells, tissues,
and organisms. Antisense technology is well established in the art
and extensively reviewed in Antisense Drug Technology: Principles,
Strategies, and Applications, Crooke (ed.), Marcel Dekker, Inc.:
New York (2001). An antisense nucleic acid molecule is generally
designed to be complementary to a region of mRNA expressed by a
gene so that the antisense molecule hybridizes to the mRNA and
thereby blocks translation of mRNA into protein. Various classes of
antisense oligonucleotides are used in the art, two of which are
cleavers and blockers. Cleavers, by binding to target RNAs,
activate intracellular nucleases (e.g., RNaseH or RNase L) that
cleave the target RNA. Blockers, which also bind to target RNAs,
inhibit protein translation through steric hindrance of ribosomes.
Exemplary blockers include peptide nucleic acids, morpholinos,
locked nucleic acids, and methylphosphonates (see, e.g., Thompson,
Drug Discovery Today, 7 (17): 912-917 (2002)). Antisense
oligonucleotides are directly useful as therapeutic agents, and are
also useful for determining and validating gene function (e.g., in
gene knock-out or knock-down experiments).
[0248] Antisense technology is further reviewed in: Layery et al.,
"Antisense and RNAi: powerful tools in drug target discovery and
validation", Curr Opin Drug Discov Devel. 2003 July; 6(4):561-9;
Stephens et al., "Antisense oligonucleotide therapy in cancer",
Curr Opin Mol Ther. 2003 April; 5(2):118-22; Kurreck, "Antisense
technologies. Improvement through novel chemical modifications",
Eur J. Biochem. 2003 April; 270(8):1628-44; Dias et al., "Antisense
oligonucleotides: basic concepts and mechanisms", Mol Cancer Ther.
2002 March; 1(5):347-55; Chen, "Clinical development of antisense
oligonucleotides as anti-cancer therapeutics", Methods Mol. Med.
2003; 75:621-36; Wang et al., "Antisense anticancer oligonucleotide
therapeutics", Curr Cancer Drug Targets. 2001 November;
1(3):177-96; and Bennett, "Efficiency of antisense oligonucleotide
drug discovery", Antisense Nucleic Acid Drug Dev. 2002 June;
12(3):215-24.
[0249] The SNPs of the present invention are particularly useful
for designing antisense reagents that are specific for particular
nucleic acid variants. Based on the SNP information disclosed
herein, antisense oligonucleotides can be produced that
specifically target mRNA molecules that contain one or more
particular SNP nucleotides. In this manner, expression of mRNA
molecules that contain one or more undesired polymorphisms (e.g.,
SNP nucleotides that lead to a defective protein such as an amino
acid substitution in a catalytic domain) can be inhibited or
completely blocked. Thus, antisense oligonucleotides can be used to
specifically bind a particular polymorphic form (e.g., a SNP allele
that encodes a defective protein), thereby inhibiting translation
of this form, but which do not bind an alternative polymorphic form
(e.g., an alternative SNP nucleotide that encodes a protein having
normal function).
[0250] Antisense molecules can be used to inactivate mRNA in order
to inhibit gene expression and production of defective proteins.
Accordingly, these molecules can be used to treat a disorder, such
as rheumatoid arthritis, characterized by abnormal or undesired
gene expression or expression of certain defective proteins. This
technique can involve cleavage by means of ribozymes containing
nucleotide sequences complementary to one or more regions in the
mRNA that attenuate the ability of the mRNA to be translated.
Possible mRNA regions include, for example, protein-coding regions
and particularly protein-coding regions corresponding to catalytic
activities, substrate/ligand binding, or other functional
activities of a protein.
[0251] The SNPs of the present invention are also useful for
designing RNA interference reagents that specifically target
nucleic acid molecules having particular SNP variants. RNA
interference (RNAi), also referred to as gene silencing, is based
on using double-stranded RNA (dsRNA) molecules to turn genes off.
When introduced into a cell, dsRNAs are processed by the cell into
short fragments (generally about 21-22 bp in length) known as small
interfering RNAs (siRNAs) which the cell uses in a
sequence-specific manner to recognize and destroy complementary
RNAs (Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)).
Thus, because RNAi molecules, including siRNAs, act in a
sequence-specific manner, the SNPs of the present invention can be
used to design RNAi reagents that recognize and destroy nucleic
acid molecules having specific SNP alleles/nucleotides (such as
deleterious alleles that lead to the production of defective
proteins), while not affecting nucleic acid molecules having
alternative SNP alleles (such as alleles that encode proteins
having normal function). As with antisense reagents, RNAi reagents
may be directly useful as therapeutic agents (e.g., for turning off
defective, disease-causing genes), and are also useful for
characterizing and validating gene function (e.g., in gene
knock-out or knock-down experiments).
[0252] The following references provide a further review of RNAi:
Agami, "RNAi and related mechanisms and their potential use for
therapy", Curr Opin Chem. Biol. 2002 December; 6(6):829-34; Layery
et al., "Antisense and RNAi: powerful tools in drug target
discovery and validation", Curr Opin Drug Discov Devel. 2003 July;
6(4):561-9; Shi, "Mammalian RNAi for the masses", Trends Genet.
2003 January; 19(1):9-12), Shuey et al., "RNAi: gene-silencing in
therapeutic intervention", Drug Discovery Today 2002 October;
7(20):1040-1046; McManus et al., Nat Rev Genet. 2002 October;
3(10):737-47; Xia et al., Nat Biotechnol 2002 October;
20(10):1006-10; Plasterk et al., Curr Opin Genet Dev 2000 October;
10(5):562-7; Bosher et al., Nat Cell Biol 2000 February;
2(2):E31-6; and Hunter, Curr Biol 1999 Jun. 17; 9(12):R440-2).
[0253] A subject suffering from a pathological condition, such as
rheumatoid arthritis, ascribed to a SNP may be treated so as to
correct the genetic defect (see Kren et al., Proc. Natl. Acad. Sci.
USA 96:10349-10354 (1999)). Such a subject can be identified by any
method that can detect the polymorphism in a biological sample
drawn from the subject. Such a genetic defect may be permanently
corrected by administering to such a subject a nucleic acid
fragment incorporating a repair sequence that supplies the
normal/wild-type nucleotide at the position of the SNP. This
site-specific repair sequence can encompass an RNA/DNA
oligonucleotide that operates to promote endogenous repair of a
subject's genomic DNA. The site-specific repair sequence is
administered in an appropriate vehicle, such as a complex with
polyethylenimine, encapsulated in anionic liposomes, a viral vector
such as an adenovirus, or other pharmaceutical composition that
promotes intracellular uptake of the administered nucleic acid. A
genetic defect leading to an inborn pathology may then be overcome,
as the chimeric oligonucleotides induce incorporation of the normal
sequence into the subject's genome. Upon incorporation, the normal
gene product is expressed, and the replacement is propagated,
thereby engendering a permanent repair and therapeutic enhancement
of the clinical condition of the subject.
[0254] In cases in which a cSNP results in a variant protein that
is ascribed to be the cause of, or a contributing factor to, a
pathological condition, a method of treating such a condition can
include administering to a subject experiencing the pathology the
wild-type/normal cognate of the variant protein. Once administered
in an effective dosing regimen, the wild-type cognate provides
complementation or remediation of the pathological condition.
[0255] The invention further provides a method for identifying a
compound or agent that can be used to treat rheumatoid arthritis.
The SNPs disclosed herein are useful as targets for the
identification and/or development of therapeutic agents. A method
for identifying a therapeutic agent or compound typically includes
assaying the ability of the agent or compound to modulate the
activity and/or expression of a SNP-containing nucleic acid or the
encoded product and thus identifying an agent or a compound that
can be used to treat a disorder characterized by undesired activity
or expression of the SNP-containing nucleic acid or the encoded
product. The assays can be performed in cell-based and cell-free
systems. Cell-based assays can include cells naturally expressing
the nucleic acid molecules of interest or recombinant cells
genetically engineered to express certain nucleic acid
molecules.
[0256] Variant gene expression in a rheumatoid arthritis patient
can include, for example, either expression of a SNP-containing
nucleic acid sequence (for instance, a gene that contains a SNP can
be transcribed into an mRNA transcript molecule containing the SNP,
which can in turn be translated into a variant protein) or altered
expression of a normal/wild-type nucleic acid sequence due to one
or more SNPs (for instance, a regulatory/control region can contain
a SNP that affects the level or pattern of expression of a normal
transcript).
[0257] Assays for variant gene expression can involve direct assays
of nucleic acid levels (e.g., mRNA levels), expressed protein
levels, or of collateral compounds involved in a signal pathway.
Further, the expression of genes that are up- or down-regulated in
response to the signal pathway can also be assayed. In this
embodiment, the regulatory regions of these genes can be operably
linked to a reporter gene such as luciferase.
[0258] Modulators of variant gene expression can be identified in a
method wherein, for example, a cell is contacted with a candidate
compound/agent and the expression of mRNA determined. The level of
expression of mRNA in the presence of the candidate compound is
compared to the level of expression of mRNA in the absence of the
candidate compound. The candidate compound can then be identified
as a modulator of variant gene expression based on this comparison
and be used to treat a disorder such as rheumatoid arthritis that
is characterized by variant gene expression (e.g., either
expression of a SNP-containing nucleic acid or altered expression
of a normal/wild-type nucleic acid molecule due to one or more SNPs
that affect expression of the nucleic acid molecule) due to one or
more SNPs of the present invention. When expression of mRNA is
statistically significantly greater in the presence of the
candidate compound than in its absence, the candidate compound is
identified as a stimulator of nucleic acid expression. When nucleic
acid expression is statistically significantly less in the presence
of the candidate compound than in its absence, the candidate
compound is identified as an inhibitor of nucleic acid
expression.
[0259] The invention further provides methods of treatment, with
the SNP or associated nucleic acid domain (e.g., catalytic domain,
ligand/substrate-binding domain, regulatory/control region, etc.)
or gene, or the encoded mRNA transcript, as a target, using a
compound identified through drug screening as a gene modulator to
modulate variant nucleic acid expression. Modulation can include
either up-regulation (i.e., activation or agonization) or
down-regulation (i.e., suppression or antagonization) of nucleic
acid expression.
[0260] Expression of mRNA transcripts and encoded proteins, either
wild type or variant, may be altered in individuals with a
particular SNP allele in a regulatory/control element, such as a
promoter or transcription factor binding domain, that regulates
expression. In this situation, methods of treatment and compounds
can be identified, as discussed herein, that regulate or overcome
the variant regulatory/control element, thereby generating normal,
or healthy, expression levels of either the wild type or variant
protein.
[0261] The SNP-containing nucleic acid molecules of the present
invention are also useful for monitoring the effectiveness of
modulating compounds on the expression or activity of a variant
gene, or encoded product, in clinical trials or in a treatment
regimen. Thus, the gene expression pattern can serve as an
indicator for the continuing effectiveness of treatment with the
compound, particularly with compounds to which a patient can
develop resistance, as well as an indicator for toxicities. The
gene expression pattern can also serve as a marker indicative of a
physiological response of the affected cells to the compound.
Accordingly, such monitoring would allow either increased
administration of the compound or the administration of alternative
compounds to which the patient has not become resistant. Similarly,
if the level of nucleic acid expression falls below a desirable
level, administration of the compound could be commensurately
decreased.
[0262] In another aspect of the present invention, there is
provided a pharmaceutical pack comprising a therapeutic agent
(e.g., a small molecule drug, antibody, peptide, antisense or RNAi
nucleic acid molecule, etc.) and a set of instructions for
administration of the therapeutic agent to humans diagnostically
tested for one or more SNPs or SNP haplotypes provided by the
present invention.
[0263] The SNPs/haplotypes of the present invention are also useful
for improving many different aspects of the drug development
process. For example, individuals can be selected for clinical
trials based on their SNP genotype. Individuals with SNP genotypes
that indicate that they are most likely to respond to the drug can
be included in the trials and those individuals whose SNP genotypes
indicate that they are less likely to or would not respond to the
drug, or suffer adverse reactions, can be eliminated from the
clinical trials. This not only improves the safety of clinical
trials, but also will enhance the chances that the trial will
demonstrate statistically significant efficacy. Furthermore, the
SNPs of the present invention may explain why certain previously
developed drugs performed poorly in clinical trials and may help
identify a subset of the population that would benefit from a drug
that had previously performed poorly in clinical trials, thereby
"rescuing" previously developed drugs, and enabling the drug to be
made available to a particular rheumatoid arthritis patient
population that can benefit from it.
[0264] SNPs have many important uses in drug discovery, screening,
and development. A high probability exists that, for any
gene/protein selected as a potential drug target, variants of that
gene/protein will exist in a patient population. Thus, determining
the impact of gene/protein variants on the selection and delivery
of a therapeutic agent should be an integral aspect of the drug
discovery and development process. (Jazwinska, A Trends Guide to
Genetic Variation and Genomic Medicine, 2002 March; S30-S36).
[0265] Knowledge of variants (e.g., SNPs and any corresponding
amino acid polymorphisms) of a particular therapeutic target (e.g.,
a gene, mRNA transcript, or protein) enables parallel screening of
the variants in order to identify therapeutic candidates (e.g.,
small molecule compounds, antibodies, antisense or RNAi nucleic
acid compounds, etc.) that demonstrate efficacy across variants
(Rothberg, Nat Biotechnol 2001 March; 19(3):209-11). Such
therapeutic candidates would be expected to show equal efficacy
across a larger segment of the patient population, thereby leading
to a larger potential market for the therapeutic candidate.
[0266] Furthermore, identifying variants of a potential therapeutic
target enables the most common form of the target to be used for
selection of therapeutic candidates, thereby helping to ensure that
the experimental activity that is observed for the selected
candidates reflects the real activity expected in the largest
proportion of a patient population (Jazwinska, A Trends Guide to
Genetic Variation and Genomic Medicine, 2002 March; S30-S36).
[0267] Additionally, screening therapeutic candidates against all
known variants of a target can enable the early identification of
potential toxicities and adverse reactions relating to particular
variants. For example, variability in drug absorption,
distribution, metabolism and excretion (ADME) caused by, for
example, SNPs in therapeutic targets or drug metabolizing genes,
can be identified, and this information can be utilized during the
drug development process to minimize variability in drug
disposition and develop therapeutic agents that are safer across a
wider range of a patient population. The SNPs of the present
invention, including the variant proteins and encoding polymorphic
nucleic acid molecules provided in Tables 1-2, are useful in
conjunction with a variety of toxicology methods established in the
art, such as those set forth in Current Protocols in Toxicology,
John Wiley & Sons, Inc., N.Y.
[0268] Furthermore, therapeutic agents that target any art-known
proteins (or nucleic acid molecules, either RNA or DNA) may
cross-react with the variant proteins (or polymorphic nucleic acid
molecules) disclosed in Table 1, thereby significantly affecting
the pharmacokinetic properties of the drug. Consequently, the
protein variants and the SNP-containing nucleic acid molecules
disclosed in Tables 1-2 are useful in developing, screening, and
evaluating therapeutic agents that target corresponding art-known
protein forms (or nucleic acid molecules). Additionally, as
discussed above, knowledge of all polymorphic forms of a particular
drug target enables the design of therapeutic agents that are
effective against most or all such polymorphic forms of the drug
target.
[0269] Pharmaceutical Compositions and Administration Thereof
[0270] Any of the rheumatoid arthritis-associated proteins, and
encoding nucleic acid molecules, disclosed herein can be used as
therapeutic targets (or directly used themselves as therapeutic
compounds) for treating rheumatoid arthritis and related
pathologies, and the present disclosure enables therapeutic
compounds (e.g., small molecules, antibodies, therapeutic proteins,
RNAi and antisense molecules, etc.) to be developed that target (or
are comprised of) any of these therapeutic targets.
[0271] In general, a therapeutic compound will be administered in a
therapeutically effective amount by any of the accepted modes of
administration for agents that serve similar utilities. The actual
amount of the therapeutic compound of this invention, i.e., the
active ingredient, will depend upon numerous factors such as the
severity of the disease to be treated, the age and relative health
of the subject, the potency of the compound used, the route and
form of administration, and other factors.
[0272] Therapeutically effective amounts of therapeutic compounds
may range from, for example, approximately 0.01-50 mg per kilogram
body weight of the recipient per day; preferably about 0.1-20
mg/kg/day. Thus, as an example, for administration to a 70 kg
person, the dosage range would most preferably be about 7 mg to 1.4
g per day.
[0273] In general, therapeutic compounds will be administered as
pharmaceutical compositions by any one of the following routes:
oral, systemic (e.g., transdermal, intranasal, or by suppository),
or parenteral (e.g., intramuscular, intravenous, or subcutaneous)
administration. The preferred manner of administration is oral or
parenteral using a convenient daily dosage regimen, which can be
adjusted according to the degree of affliction. Oral compositions
can take the form of tablets, pills, capsules, semisolids, powders,
sustained release formulations, solutions, suspensions, elixirs,
aerosols, or any other appropriate compositions.
[0274] The choice of formulation depends on various factors such as
the mode of drug administration (e.g., for oral administration,
formulations in the form of tablets, pills, or capsules are
preferred) and the bioavailability of the drug substance. Recently,
pharmaceutical formulations have been developed especially for
drugs that show poor bioavailability based upon the principle that
bioavailability can be increased by increasing the surface area,
i.e., decreasing particle size. For example, U.S. Pat. No.
4,107,288 describes a pharmaceutical formulation having particles
in the size range from 10 to 1,000 nm in which the active material
is supported on a cross-linked matrix of macromolecules. U.S. Pat.
No. 5,145,684 describes the production of a pharmaceutical
formulation in which the drug substance is pulverized to
nanoparticles (average particle size of 400 nm) in the presence of
a surface modifier and then dispersed in a liquid medium to give a
pharmaceutical formulation that exhibits remarkably high
bioavailability.
[0275] Pharmaceutical compositions are comprised of, in general, a
therapeutic compound in combination with at least one
pharmaceutically acceptable excipient. Acceptable excipients are
non-toxic, aid administration, and do not adversely affect the
therapeutic benefit of the therapeutic compound. Such excipients
may be any solid, liquid, semi-solid or, in the case of an aerosol
composition, gaseous excipient that is generally available to one
skilled in the art.
[0276] Solid pharmaceutical excipients include starch, cellulose,
talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, magnesium stearate, sodium stearate, glycerol
monostearate, sodium chloride, dried skim milk and the like. Liquid
and semisolid excipients may be selected from glycerol, propylene
glycol, water, ethanol and various oils, including those of
petroleum, animal, vegetable or synthetic origin, e.g., peanut oil,
soybean oil, mineral oil, sesame oil, etc. Preferred liquid
carriers, particularly for injectable solutions, include water,
saline, aqueous dextrose, and glycols.
[0277] Compressed gases may be used to disperse a compound of this
invention in aerosol form. Inert gases suitable for this purpose
are nitrogen, carbon dioxide, etc.
[0278] Other suitable pharmaceutical excipients and their
formulations are described in Remington's Pharmaceutical Sciences,
edited by E. W. Martin (Mack Publishing Company, 18th ed.,
1990).
[0279] The amount of the therapeutic compound in a formulation can
vary within the full range employed by those skilled in the art.
Typically, the formulation will contain, on a weight percent (wt %)
basis, from about 0.01-99.99 wt % of the therapeutic compound based
on the total formulation, with the balance being one or more
suitable pharmaceutical excipients. Preferably, the compound is
present at a level of about 1-80 wt %.
[0280] Therapeutic compounds can be administered alone or in
combination with other therapeutic compounds or in combination with
one or more other active ingredient(s). For example, an inhibitor
or stimulator of a rheumatoid arthritis-associated protein can be
administered in combination with another agent that inhibits or
stimulates the activity of the same or a different rheumatoid
arthritis-associated protein to thereby counteract the affects of
rheumatoid arthritis.
[0281] For further information regarding pharmacology, see Current
Protocols in Pharmacology, John Wiley & Sons, Inc., N.Y.
[0282] Human Identification Applications
[0283] In addition to their diagnostic and therapeutic uses in
rheumatoid arthritis and related pathologies, the SNPs provided by
the present invention are also useful as human identification
markers for such applications as forensics, paternity testing, and
biometrics (see, e.g., Gill, "An assessment of the utility of
single nucleotide polymorphisms (SNPs) for forensic purposes", Int
J Legal Med. 2001; 114(4-5):204-10). Genetic variations in the
nucleic acid sequences between individuals can be used as genetic
markers to identify individuals and to associate a biological
sample with an individual. Determination of which nucleotides
occupy a set of SNP positions in an individual identifies a set of
SNP markers that distinguishes the individual. The more SNP
positions that are analyzed, the lower the probability that the set
of SNPs in one individual is the same as that in an unrelated
individual. Preferably, if multiple sites are analyzed, the sites
are unlinked (i.e., inherited independently). Thus, preferred sets
of SNPs can be selected from among the SNPs disclosed herein, which
may include SNPs on different chromosomes, SNPs on different
chromosome arms, and/or SNPs that are dispersed over substantial
distances along the same chromosome arm.
[0284] Furthermore, among the SNPs disclosed herein, preferred SNPs
for use in certain forensic/human identification applications
include SNPs located at degenerate codon positions (i.e., the third
position in certain codons which can be one of two or more
alternative nucleotides and still encode the same amino acid),
since these SNPs do not affect the encoded protein. SNPs that do
not affect the encoded protein are expected to be under less
selective pressure and are therefore expected to be more
polymorphic in a population, which is typically an advantage for
forensic/human identification applications. However, for certain
forensics/human identification applications, such as predicting
phenotypic characteristics (e.g., inferring ancestry or inferring
one or more physical characteristics of an individual) from a DNA
sample, it may be desirable to utilize SNPs that affect the encoded
protein.
[0285] For many of the SNPs disclosed in Tables 1-2 (which are
identified as "Applera" SNP source), Tables 1-2 provide SNP allele
frequencies obtained by re-sequencing the DNA of chromosomes from
39 individuals (Tables 1-2 also provide allele frequency
information for "Celera" source SNPs and, where available, public
SNPs from dbEST, HGBASE, and/or HGMD). The allele frequencies
provided in Tables 1-2 enable these SNPs to be readily used for
human identification applications. Although any SNP disclosed in
Table 1 and/or Table 2 could be used for human identification, the
closer that the frequency of the minor allele at a particular SNP
site is to 50%, the greater the ability of that SNP to discriminate
between different individuals in a population since it becomes
increasingly likely that two randomly selected individuals would
have different alleles at that SNP site. Using the SNP allele
frequencies provided in Tables 1-2, one of ordinary skill in the
art could readily select a subset of SNPs for which the frequency
of the minor allele is, for example, at least 1%, 2%, 5%, 10%, 20%,
25%, 30%, 40%, 45%, or 50%, or any other frequency in-between.
Thus, since Tables 1-2 provide allele frequencies based on the
re-sequencing of the chromosomes from 39 individuals, a subset of
SNPs could readily be selected for human identification in which
the total allele count of the minor allele at a particular SNP site
is, for example, at least 1, 2, 4, 8, 10, 16, 20, 24, 30, 32, 36,
38, 39, 40, or any other number in-between.
[0286] Furthermore, Tables 1-2 also provide population group
(interchangeably referred to herein as ethnic or racial groups)
information coupled with the extensive allele frequency
information. For example, the group of 39 individuals whose DNA was
re-sequenced was made-up of 20 Caucasians and 19 African-Americans.
This population group information enables further refinement of SNP
selection for human identification. For example, preferred SNPs for
human identification can be selected from Tables 1-2 that have
similar allele frequencies in both the Caucasian and
African-American populations; thus, for example, SNPs can be
selected that have equally high discriminatory power in both
populations. Alternatively, SNPs can be selected for which there is
a statistically significant difference in allele frequencies
between the Caucasian and African-American populations (as an
extreme example, a particular allele may be observed only in either
the Caucasian or the African-American population group but not
observed in the other population group); such SNPs are useful, for
example, for predicting the race/ethnicity of an unknown
perpetrator from a biological sample such as a hair or blood stain
recovered at a crime scene. For a discussion of using SNPs to
predict ancestry from a DNA sample, including statistical methods,
see Frudakis et al., "A Classifier for the SNP-Based Inference of
Ancestry", Journal of Forensic Sciences 2003; 48(4):771-782.
[0287] SNPs have numerous advantages over other types of
polymorphic markers, such as short tandem repeats (STRs). For
example, SNPs can be easily scored and are amenable to automation,
making SNPs the markers of choice for large-scale forensic
databases. SNPs are found in much greater abundance throughout the
genome than repeat polymorphisms. Population frequencies of two
polymorphic forms can usually be determined with greater accuracy
than those of multiple polymorphic forms at multi-allelic loci.
SNPs are mutationaly more stable than repeat polymorphisms. SNPs
are not susceptible to artefacts such as stutter bands that can
hinder analysis. Stutter bands are frequently encountered when
analyzing repeat polymorphisms, and are particularly troublesome
when analyzing samples such as crime scene samples that may contain
mixtures of DNA from multiple sources. Another significant
advantage of SNP markers over STR markers is the much shorter
length of nucleic acid needed to score a SNP. For example, STR
markers are generally several hundred base pairs in length. A SNP,
on the other hand, comprises a single nucleotide, and generally a
short conserved region on either side of the SNP position for
primer and/or probe binding. This makes SNPs more amenable to
typing in highly degraded or aged biological samples that are
frequently encountered in forensic casework in which DNA may be
fragmented into short pieces.
[0288] SNPs also are not subject to microvariant and "off-ladder"
alleles frequently encountered when analyzing STR loci.
Microvariants are deletions or insertions within a repeat unit that
change the size of the amplified DNA product so that the amplified
product does not migrate at the same rate as reference alleles with
normal sized repeat units. When separated by size, such as by
electrophoresis on a polyacrylamide gel, microvariants do not align
with a reference allelic ladder of standard sized repeat units, but
rather migrate between the reference alleles. The reference allelic
ladder is used for precise sizing of alleles for allele
classification; therefore alleles that do not align with the
reference allelic ladder lead to substantial analysis problems.
Furthermore, when analyzing multi-allelic repeat polymorphisms,
occasionally an allele is found that consists of more or less
repeat units than has been previously seen in the population, or
more or less repeat alleles than are included in a reference
allelic ladder. These alleles will migrate outside the size range
of known alleles in a reference allelic ladder, and therefore are
referred to as "off-ladder" alleles. In extreme cases, the allele
may contain so few or so many repeats that it migrates well out of
the range of the reference allelic ladder. In this situation, the
allele may not even be observed, or, with multiplex analysis, it
may migrate within or close to the size range for another locus,
further confounding analysis.
[0289] SNP analysis avoids the problems of microvariants and
off-ladder alleles encountered in STR analysis. Importantly,
microvariants and off-ladder alleles may provide significant
problems, and may be completely missed, when using analysis methods
such as oligonucleotide hybridization arrays, which utilize
oligonucleotide probes specific for certain known alleles.
Furthermore, off-ladder alleles and microvariants encountered with
STR analysis, even when correctly typed, may lead to improper
statistical analysis, since their frequencies in the population are
generally unknown or poorly characterized, and therefore the
statistical significance of a matching genotype may be
questionable. All these advantages of SNP analysis are considerable
in light of the consequences of most DNA identification cases,
which may lead to life imprisonment for an individual, or
re-association of remains to the family of a deceased
individual.
[0290] DNA can be isolated from biological samples such as blood,
bone, hair, saliva, or semen, and compared with the DNA from a
reference source at particular SNP positions. Multiple SNP markers
can be assayed simultaneously in order to increase the power of
discrimination and the statistical significance of a matching
genotype. For example, oligonucleotide arrays can be used to
genotype a large number of SNPs simultaneously. The SNPs provided
by the present invention can be assayed in combination with other
polymorphic genetic markers, such as other SNPs known in the art or
STRs, in order to identify an individual or to associate an
individual with a particular biological sample.
[0291] Furthermore, the SNPs provided by the present invention can
be genotyped for inclusion in a database of DNA genotypes, for
example, a criminal DNA databank such as the FBI's Combined DNA
Index System (CODIS) database. A genotype obtained from a
biological sample of unknown source can then be queried against the
database to find a matching genotype, with the SNPs of the present
invention providing nucleotide positions at which to compare the
known and unknown DNA sequences for identity. Accordingly, the
present invention provides a database comprising novel SNPs or SNP
alleles of the present invention (e.g., the database can comprise
information indicating which alleles are possessed by individual
members of a population at one or more novel SNP sites of the
present invention), such as for use in forensics, biometrics, or
other human identification applications. Such a database typically
comprises a computer-based system in which the SNPs or SNP alleles
of the present invention are recorded on a computer readable medium
(see the section of the present specification entitled
"Computer-Related Embodiments").
[0292] The SNPs of the present invention can also be assayed for
use in paternity testing. The object of paternity testing is
usually to determine whether a male is the father of a child. In
most cases, the mother of the child is known and thus, the mother's
contribution to the child's genotype can be traced. Paternity
testing investigates whether the part of the child's genotype not
attributable to the mother is consistent with that of the putative
father. Paternity testing can be performed by analyzing sets of
polymorphisms in the putative father and the child, with the SNPs
of the present invention providing nucleotide positions at which to
compare the putative father's and child's DNA sequences for
identity. If the set of polymorphisms in the child attributable to
the father does not match the set of polymorphisms of the putative
father, it can be concluded, barring experimental error, that the
putative father is not the father of the child. If the set of
polymorphisms in the child attributable to the father match the set
of polymorphisms of the putative father, a statistical calculation
can be performed to determine the probability of coincidental
match, and a conclusion drawn as to the likelihood that the
putative father is the true biological father of the child.
[0293] In addition to paternity testing, SNPs are also useful for
other types of kinship testing, such as for verifying familial
relationships for immigration purposes, or for cases in which an
individual alleges to be related to a deceased individual in order
to claim an inheritance from the deceased individual, etc. For
further information regarding the utility of SNPs for paternity
testing and other types of kinship testing, including methods for
statistical analysis, see Krawczak, "Informativity assessment for
biallelic single nucleotide polymorphisms", Electrophoresis 1999
June; 20(8):1676-81.
[0294] The use of the SNPs of the present invention for human
identification further extends to various authentication systems,
commonly referred to as biometric systems, which typically convert
physical characteristics of humans (or other organisms) into
digital data. Biometric systems include various technological
devices that measure such unique anatomical or physiological
characteristics as finger, thumb, or palm prints; hand geometry;
vein patterning on the back of the hand; blood vessel patterning of
the retina and color and texture of the iris; facial
characteristics; voice patterns; signature and typing dynamics; and
DNA. Such physiological measurements can be used to verify identity
and, for example, restrict or allow access based on the
identification. Examples of applications for biometrics include
physical area security, computer and network security, aircraft
passenger check-in and boarding, financial transactions, medical
records access, government benefit distribution, voting, law
enforcement, passports, visas and immigration, prisons, various
military applications, and for restricting access to expensive or
dangerous items, such as automobiles or guns (see, for example,
O'Connor, Stanford Technology Law Review and U.S. Pat. No.
6,119,096).
[0295] Groups of SNPs, particularly the SNPs provided by the
present invention, can be typed to uniquely identify an individual
for biometric applications such as those described above. Such SNP
typing can readily be accomplished using, for example, DNA
chips/arrays. Preferably, a minimally invasive means for obtaining
a DNA sample is utilized. For example, PCR amplification enables
sufficient quantities of DNA for analysis to be obtained from
buccal swabs or fingerprints, which contain DNA-containing skin
cells and oils that are naturally transferred during contact.
[0296] Further information regarding techniques for using SNPs in
forensic/human identification applications can be found in, for
example, Current Protocols in Human Genetics, John Wiley &
Sons, N.Y. (2002), 14.1-14.7.
[0297] Variant Proteins, Antibodies, Vectors & Host Cells,
& Uses Thereof
[0298] Variant Proteins Encoded by SNP-Containing Nucleic Acid
Molecules
[0299] The present invention provides SNP-containing nucleic acid
molecules, many of which encode proteins having variant amino acid
sequences as compared to the art-known (i.e., wild-type) proteins.
Amino acid sequences encoded by the polymorphic nucleic acid
molecules of the present invention are provided as SEQ ID
NOS:670-1338 in Table 1 and the Sequence Listing. These variants
will generally be referred to herein as variant
proteins/peptides/polypeptides, or polymorphic
proteins/peptides/polypeptides of the present invention. The terms
"protein", "peptide", and "polypeptide" are used herein
interchangeably.
[0300] A variant protein of the present invention may be encoded
by, for example, a nonsynonymous nucleotide substitution at any one
of the cSNP positions disclosed herein. In addition, variant
proteins may also include proteins whose expression, structure,
and/or function is altered by a SNP disclosed herein, such as a SNP
that creates or destroys a stop codon, a SNP that affects splicing,
and a SNP in control/regulatory elements, e.g. promoters,
enhancers, or transcription factor binding domains.
[0301] As used herein, a protein or peptide is said to be
"isolated" or "purified" when it is substantially free of cellular
material or chemical precursors or other chemicals. The variant
proteins of the present invention can be purified to homogeneity or
other lower degrees of purity. The level of purification will be
based on the intended use. The key feature is that the preparation
allows for the desired function of the variant protein, even if in
the presence of considerable amounts of other components.
[0302] As used herein, "substantially free of cellular material"
includes preparations of the variant protein having less than about
30% (by dry weight) other proteins (i.e., contaminating protein),
less than about 20% other proteins, less than about 10% other
proteins, or less than about 5% other proteins. When the variant
protein is recombinantly produced, it can also be substantially
free of culture medium, i.e., culture medium represents less than
about 20% of the volume of the protein preparation.
[0303] The language "substantially free of chemical precursors or
other chemicals" includes preparations of the variant protein in
which it is separated from chemical precursors or other chemicals
that are involved in its synthesis. In one embodiment, the language
"substantially free of chemical precursors or other chemicals"
includes preparations of the variant protein having less than about
30% (by dry weight) chemical precursors or other chemicals, less
than about 20% chemical precursors or other chemicals, less than
about 10% chemical precursors or other chemicals, or less than
about 5% chemical precursors or other chemicals.
[0304] An isolated variant protein may be purified from cells that
naturally express it, purified from cells that have been altered to
express it (recombinant host cells), or synthesized using known
protein synthesis methods. For example, a nucleic acid molecule
containing SNP(s) encoding the variant protein can be cloned into
an expression vector, the expression vector introduced into a host
cell, and the variant protein expressed in the host cell. The
variant protein can then be isolated from the cells by any
appropriate purification scheme using standard protein purification
techniques. Examples of these techniques are described in detail
below (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.).
[0305] The present invention provides isolated variant proteins
that comprise, consist of or consist essentially of amino acid
sequences that contain one or more variant amino acids encoded by
one or more codons which contain a SNP of the present
invention.
[0306] Accordingly, the present invention provides variant proteins
that consist of amino acid sequences that contain one or more amino
acid polymorphisms (or truncations or extensions due to creation or
destruction of a stop codon, respectively) encoded by the SNPs
provided in Table 1 and/or Table 2. A protein consists of an amino
acid sequence when the amino acid sequence is the entire amino acid
sequence of the protein.
[0307] The present invention further provides variant proteins that
consist essentially of amino acid sequences that contain one or
more amino acid polymorphisms (or truncations or extensions due to
creation or destruction of a stop codon, respectively) encoded by
the SNPs provided in Table 1 and/or Table 2. A protein consists
essentially of an amino acid sequence when such an amino acid
sequence is present with only a few additional amino acid residues
in the final protein.
[0308] The present invention further provides variant proteins that
comprise amino acid sequences that contain one or more amino acid
polymorphisms (or truncations or extensions due to creation or
destruction of a stop codon, respectively) encoded by the SNPs
provided in Table 1 and/or Table 2. A protein comprises an amino
acid sequence when the amino acid sequence is at least part of the
final amino acid sequence of the protein. In such a fashion, the
protein may contain only the variant amino acid sequence or have
additional amino acid residues, such as a contiguous encoded
sequence that is naturally associated with it or heterologous amino
acid residues. Such a protein can have a few additional amino acid
residues or can comprise many more additional amino acids. A brief
description of how various types of these proteins can be made and
isolated is provided below.
[0309] The variant proteins of the present invention can be
attached to heterologous sequences to form chimeric or fusion
proteins. Such chimeric and fusion proteins comprise a variant
protein operatively linked to a heterologous protein having an
amino acid sequence not substantially homologous to the variant
protein. "Operatively linked" indicates that the coding sequences
for the variant protein and the heterologous protein are ligated
in-frame. The heterologous protein can be fused to the N-terminus
or C-terminus of the variant protein. In another embodiment, the
fusion protein is encoded by a fusion polynucleotide that is
synthesized by conventional techniques including automated DNA
synthesizers. Alternatively, PCR amplification of gene fragments
can be carried out using anchor primers which give rise to
complementary overhangs between two consecutive gene fragments
which can subsequently be annealed and re-amplified to generate a
chimeric gene sequence (see Ausubel et al., Current Protocols in
Molecular Biology, 1992). Moreover, many expression vectors are
commercially available that already encode a fusion moiety (e.g., a
GST protein). A variant protein-encoding nucleic acid can be cloned
into such an expression vector such that the fusion moiety is
linked in-frame to the variant protein.
[0310] In many uses, the fusion protein does not affect the
activity of the variant protein. The fusion protein can include,
but is not limited to, enzymatic fusion proteins, for example,
beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His
fusions, MYC-tagged, HI-tagged and Ig fusions. Such fusion
proteins, particularly poly-His fusions, can facilitate their
purification following recombinant expression. In certain host
cells (e.g., mammalian host cells), expression and/or secretion of
a protein can be increased by using a heterologous signal sequence.
Fusion proteins are further described in, for example, Terpe,
"Overview of tag protein fusions: from molecular and biochemical
fundamentals to commercial systems", Appl Microbiol Biotechnol.
2003 January; 60(5):523-33. Epub 2002 November 07; Graddis et al.,
"Designing proteins that work using recombinant technologies", Curr
Pharm Biotechnol. 2002 December; 3(4):285-97; and Nilsson et al.,
"Affinity fusion strategies for detection, purification, and
immobilization of recombinant proteins", Protein Expr Purif. 1997
October; 11(1):1-16.
[0311] The present invention also relates to further obvious
variants of the variant polypeptides of the present invention, such
as naturally-occurring mature forms (e.g., alleleic variants),
non-naturally occurring recombinantly-derived variants, and
orthologs and paralogs of such proteins that share sequence
homology. Such variants can readily be generated using art-known
techniques in the fields of recombinant nucleic acid technology and
protein biochemistry. It is understood, however, that variants
exclude those known in the prior art before the present
invention.
[0312] Further variants of the variant polypeptides disclosed in
Table 1 can comprise an amino acid sequence that shares at least
70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% sequence identity with an amino acid sequence disclosed in
Table 1 (or a fragment thereof) and that includes a novel amino
acid residue (allele) disclosed in Table 1 (which is encoded by a
novel SNP allele). Thus, an aspect of the present invention that is
specifically contemplated are polypeptides that have a certain
degree of sequence variation compared with the polypeptide
sequences shown in Table 1, but that contain a novel amino acid
residue (allele) encoded by a novel SNP allele disclosed herein. In
other words, as long as a polypeptide contains a novel amino acid
residue disclosed herein, other portions of the polypeptide that
flank the novel amino acid residue can vary to some degree from the
polypeptide sequences shown in Table 1.
[0313] Full-length pre-processed forms, as well as mature processed
forms, of proteins that comprise one of the amino acid sequences
disclosed herein can readily be identified as having complete
sequence identity to one of the variant proteins of the present
invention as well as being encoded by the same genetic locus as the
variant proteins provided herein.
[0314] Orthologs of a variant peptide can readily be identified as
having some degree of significant sequence homology/identity to at
least a portion of a variant peptide as well as being encoded by a
gene from another organism. Preferred orthologs will be isolated
from non-human mammals, preferably primates, for the development of
human therapeutic targets and agents. Such orthologs can be encoded
by a nucleic acid sequence that hybridizes to a variant
peptide-encoding nucleic acid molecule under moderate to stringent
conditions depending on the degree of relatedness of the two
organisms yielding the homologous proteins.
[0315] Variant proteins include, but are not limited to, proteins
containing deletions, additions and substitutions in the amino acid
sequence caused by the SNPs of the present invention. One class of
substitutions is conserved amino acid substitutions in which a
given amino acid in a polypeptide is substituted for another amino
acid of like characteristics. Typical conservative substitutions
are replacements, one for another, among the aliphatic amino acids
Ala, Val, Leu, and Be; interchange of the hydroxyl residues Ser and
Thr; exchange of the acidic residues Asp and Glu; substitution
between the amide residues Asn and Gln; exchange of the basic
residues Lys and Arg; and replacements among the aromatic residues
Phe and Tyr. Guidance concerning which amino acid changes are
likely to be phenotypically silent are found in, for example, Bowie
et al., Science 247:1306-1310 (1990).
[0316] Variant proteins can be fully functional or can lack
function in one or more activities, e.g. ability to bind another
molecule, ability to catalyze a substrate, ability to mediate
signaling, etc. Fully functional variants typically contain only
conservative variations or variations in non-critical residues or
in non-critical regions. Functional variants can also contain
substitution of similar amino acids that result in no change or an
insignificant change in function. Alternatively, such substitutions
may positively or negatively affect function to some degree.
Non-functional variants typically contain one or more
non-conservative amino acid substitutions, deletions, insertions,
inversions, truncations or extensions, or a substitution,
insertion, inversion, or deletion of a critical residue or in a
critical region.
[0317] Amino acids that are essential for function of a protein can
be identified by methods known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham et al.,
Science 244:1081-1085 (1989)), particularly using the amino acid
sequence and polymorphism information provided in Table 1. The
latter procedure introduces single alanine mutations at every
residue in the molecule. The resulting mutant molecules are then
tested for biological activity such as enzyme activity or in assays
such as an in vitro proliferative activity. Sites that are critical
for binding partner/substrate binding can also be determined by
structural analysis such as crystallization, nuclear magnetic
resonance or photoaffinity labeling (Smith et al., J. Mol. Biol.
224:899-904 (1992); de Vos et al. Science 255:306-312 (1992)).
[0318] Polypeptides can contain amino acids other than the 20 amino
acids commonly referred to as the 20 naturally occurring amino
acids. Further, many amino acids, including the terminal amino
acids, may be modified by natural processes, such as processing and
other post-translational modifications, or by chemical modification
techniques well known in the art. Accordingly, the variant proteins
of the present invention also encompass derivatives or analogs in
which a substituted amino acid residue is not one encoded by the
genetic code, in which a substituent group is included, in which
the mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (e.g.,
polyethylene glycol), or in which additional amino acids are fused
to the mature polypeptide, such as a leader or secretory sequence
or a sequence for purification of the mature polypeptide or a
pro-protein sequence.
[0319] Known protein modifications include, but are not limited to,
acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of flavin, covalent attachment of a heme moiety,
covalent attachment of a nucleotide or nucleotide derivative,
covalent attachment of a lipid or lipid derivative, covalent
attachment of phosphotidylinositol, cross-linking, cyclization,
disulfide bond formation, demethylation, formation of covalent
crosslinks, formation of cystine, formation of pyroglutamate,
formylation, gamma carboxylation, glycosylation, GPI anchor
formation, hydroxylation, iodination, methylation, myristoylation,
oxidation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination.
[0320] Such protein modifications are well known to those of skill
in the art and have been described in great detail in the
scientific literature. Several particularly common modifications,
glycosylation, lipid attachment, sulfation, gamma-carboxylation of
glutamic acid residues, hydroxylation and ADP-ribosylation, for
instance, are described in most basic texts, such as
Proteins--Structure and Molecular Properties, 2nd Ed., T. E.
Creighton, W. H. Freeman and Company, New York (1993); Wold, F.,
Posttranslational Covalent Modification of Proteins, B. C. Johnson,
Ed., Academic Press, New York 1-12 (1983); Seifter et al., Meth.
Enzymol. 182: 626-646 (1990); and Rattan et al., Ann. N.Y. Acad.
Sci. 663:48-62 (1992).
[0321] The present invention further provides fragments of the
variant proteins in which the fragments contain one or more amino
acid sequence variations (e.g., substitutions, or truncations or
extensions due to creation or destruction of a stop codon) encoded
by one or more SNPs disclosed herein. The fragments to which the
invention pertains, however, are not to be construed as
encompassing fragments that have been disclosed in the prior art
before the present invention.
[0322] As used herein, a fragment may comprise at least about 4, 8,
10, 12, 14, 16, 18, 20, 25, 30, 50, 100 (or any other number
in-between) or more contiguous amino acid residues from a variant
protein, wherein at least one amino acid residue is affected by a
SNP of the present invention, e.g., a variant amino acid residue
encoded by a nonsynonymous nucleotide substitution at a cSNP
position provided by the present invention. The variant amino acid
encoded by a cSNP may occupy any residue position along the
sequence of the fragment. Such fragments can be chosen based on the
ability to retain one or more of the biological activities of the
variant protein or the ability to perform a function, e.g., act as
an immunogen. Particularly important fragments are biologically
active fragments. Such fragments will typically comprise a domain
or motif of a variant protein of the present invention, e.g.,
active site, transmembrane domain, or ligand/substrate binding
domain. Other fragments include, but are not limited to, domain or
motif-containing fragments, soluble peptide fragments, and
fragments containing immunogenic structures. Predicted domains and
functional sites are readily identifiable by computer programs well
known to those of skill in the art (e.g., PROSITE analysis)
(Current Protocols in Protein Science, John Wiley & Sons, N.Y.
(2002)).
[0323] Uses of Variant Proteins
[0324] The variant proteins of the present invention can be used in
a variety of ways, including but not limited to, in assays to
determine the biological activity of a variant protein, such as in
a panel of multiple proteins for high-throughput screening; to
raise antibodies or to elicit another type of immune response; as a
reagent (including the labeled reagent) in assays designed to
quantitatively determine levels of the variant protein (or its
binding partner) in biological fluids; as a marker for cells or
tissues in which it is preferentially expressed (either
constitutively or at a particular stage of tissue differentiation
or development or in a disease state); as a target for screening
for a therapeutic agent; and as a direct therapeutic agent to be
administered into a human subject. Any of the variant proteins
disclosed herein may be developed into reagent grade or kit format
for commercialization as research products. Methods for performing
the uses listed above are well known to those skilled in the art
(see, e.g., Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Sambrook and Russell, 2000, and Methods in
Enzymology: Guide to Molecular Cloning Techniques, Academic Press,
Berger, S. L. and A. R. Kimmel eds., 1987).
[0325] In a specific embodiment of the invention, the methods of
the present invention include detection of one or more variant
proteins disclosed herein. Variant proteins are disclosed in Table
1 and in the Sequence Listing as SEQ ID NOS: 670-1338. Detection of
such proteins can be accomplished using, for example, antibodies,
small molecule compounds, aptamers, ligands/substrates, other
proteins or protein fragments, or other protein-binding agents.
Preferably, protein detection agents are specific for a variant
protein of the present invention and can therefore discriminate
between a variant protein of the present invention and the
wild-type protein or another variant form. This can generally be
accomplished by, for example, selecting or designing detection
agents that bind to the region of a protein that differs between
the variant and wild-type protein, such as a region of a protein
that contains one or more amino acid substitutions that is/are
encoded by a non-synonymous cSNP of the present invention, or a
region of a protein that follows a nonsense mutation-type SNP that
creates a stop codon thereby leading to a shorter polypeptide, or a
region of a protein that follows a read-through mutation-type SNP
that destroys a stop codon thereby leading to a longer polypeptide
in which a portion of the polypeptide is present in one version of
the polypeptide but not the other.
[0326] In another specific aspect of the invention, the variant
proteins of the present invention are used as targets for
diagnosing rheumatoid arthritis or for determining predisposition
to rheumatoid arthritis in a human. Accordingly, the invention
provides methods for detecting the presence of, or levels of, one
or more variant proteins of the present invention in a cell,
tissue, or organism. Such methods typically involve contacting a
test sample with an agent (e.g., an antibody, small molecule
compound, or peptide) capable of interacting with the variant
protein such that specific binding of the agent to the variant
protein can be detected. Such an assay can be provided in a single
detection format or a multi-detection format such as an array, for
example, an antibody or aptamer array (arrays for protein detection
may also be referred to as "protein chips"). The variant protein of
interest can be isolated from a test sample and assayed for the
presence of a variant amino acid sequence encoded by one or more
SNPs disclosed by the present invention. The SNPs may cause changes
to the protein and the corresponding protein function/activity,
such as through non-synonymous substitutions in protein coding
regions that can lead to amino acid substitutions, deletions,
insertions, and/or rearrangements; formation or destruction of stop
codons; or alteration of control elements such as promoters. SNPs
may also cause inappropriate post-translational modifications.
[0327] One preferred agent for detecting a variant protein in a
sample is an antibody capable of selectively binding to a variant
form of the protein (antibodies are described in greater detail in
the next section). Such samples include, for example, tissues,
cells, and biological fluids isolated from a subject, as well as
tissues, cells and fluids present within a subject.
[0328] In vitro methods for detection of the variant proteins
associated with rheumatoid arthritis that are disclosed herein and
fragments thereof include, but are not limited to, enzyme linked
immunosorbent assays (ELISAs), radioimmunoassays (RIA), Western
blots, immunoprecipitations, immunofluorescence, and protein
arrays/chips (e.g., arrays of antibodies or aptamers). For further
information regarding immunoassays and related protein detection
methods, see Current Protocols in Immunology, John Wiley &
Sons, N.Y., and Hage, "Immunoassays", Anal Chem. 1999 Jun. 15;
71(12):294R-304R.
[0329] Additional analytic methods of detecting amino acid variants
include, but are not limited to, altered electrophoretic mobility,
altered tryptic peptide digest, altered protein activity in
cell-based or cell-free assay, alteration in ligand or
antibody-binding pattern, altered isoelectric point, and direct
amino acid sequencing.
[0330] Alternatively, variant proteins can be detected in vivo in a
subject by introducing into the subject a labeled antibody (or
other type of detection reagent) specific for a variant protein.
For example, the antibody can be labeled with a radioactive marker
whose presence and location in a subject can be detected by
standard imaging techniques.
[0331] Other uses of the variant peptides of the present invention
are based on the class or action of the protein. For example,
proteins isolated from humans and their mammalian orthologs serve
as targets for identifying agents (e.g., small molecule drugs or
antibodies) for use in therapeutic applications, particularly for
modulating a biological or pathological response in a cell or
tissue that expresses the protein. Pharmaceutical agents can be
developed that modulate protein activity.
[0332] As an alternative to modulating gene expression, therapeutic
compounds can be developed that modulate protein function. For
example, many SNPs disclosed herein affect the amino acid sequence
of the encoded protein (e.g., non-synonymous cSNPs and nonsense
mutation-type SNPs). Such alterations in the encoded amino acid
sequence may affect protein function, particularly if such amino
acid sequence variations occur in functional protein domains, such
as catalytic domains, ATP-binding domains, or ligand/substrate
binding domains. It is well established in the art that variant
proteins having amino acid sequence variations in functional
domains can cause or influence pathological conditions. In such
instances, compounds (e.g., small molecule drugs or antibodies) can
be developed that target the variant protein and modulate (e.g.,
up- or down-regulate) protein function/activity.
[0333] The therapeutic methods of the present invention further
include methods that target one or more variant proteins of the
present invention. Variant proteins can be targeted using, for
example, small molecule compounds, antibodies, aptamers,
ligands/substrates, other proteins, or other protein-binding
agents. Additionally, the skilled artisan will recognize that the
novel protein variants (and polymorphic nucleic acid molecules)
disclosed in Table 1 may themselves be directly used as therapeutic
agents by acting as competitive inhibitors of corresponding
art-known proteins (or nucleic acid molecules such as mRNA
molecules).
[0334] The variant proteins of the present invention are
particularly useful in drug screening assays, in cell-based or
cell-free systems. Cell-based systems can utilize cells that
naturally express the protein, a biopsy specimen, or cell cultures.
In one embodiment, cell-based assays involve recombinant host cells
expressing the variant protein. Cell-free assays can be used to
detect the ability of a compound to directly bind to a variant
protein or to the corresponding SNP-containing nucleic acid
fragment that encodes the variant protein.
[0335] A variant protein of the present invention, as well as
appropriate fragments thereof, can be used in high-throughput
screening assays to test candidate compounds for the ability to
bind and/or modulate the activity of the variant protein. These
candidate compounds can be further screened against a protein
having normal function (e.g., a wild-type/non-variant protein) to
further determine the effect of the compound on the protein
activity. Furthermore, these compounds can be tested in animal or
invertebrate systems to determine in vivo activity/effectiveness.
Compounds can be identified that activate (agonists) or inactivate
(antagonists) the variant protein, and different compounds can be
identified that cause various degrees of activation or inactivation
of the variant protein.
[0336] Further, the variant proteins can be used to screen a
compound for the ability to stimulate or inhibit interaction
between the variant protein and a target molecule that normally
interacts with the protein. The target can be a ligand, a substrate
or a binding partner that the protein normally interacts with (for
example, epinephrine or norepinephrine). Such assays typically
include the steps of combining the variant protein with a candidate
compound under conditions that allow the variant protein, or
fragment thereof, to interact with the target molecule, and to
detect the formation of a complex between the protein and the
target or to detect the biochemical consequence of the interaction
with the variant protein and the target, such as any of the
associated effects of signal transduction.
[0337] Candidate compounds include, for example, 1) peptides such
as soluble peptides, including Ig-tailed fusion peptides and
members of random peptide libraries (see, e.g., Lam et al., Nature
354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)) and
combinatorial chemistry-derived molecular libraries made of D-
and/or L-configuration amino acids; 2) phosphopeptides (e.g.,
members of random and partially degenerate, directed phosphopeptide
libraries, see, e.g., Songyang et al., Cell 72:767-778 (1993)); 3)
antibodies (e.g., polyclonal, monoclonal, humanized,
anti-idiotypic, chimeric, and single chain antibodies as well as
Fab, F(ab').sub.2, Fab expression library fragments, and
epitope-binding fragments of antibodies); and 4) small organic and
inorganic molecules (e.g., molecules obtained from combinatorial
and natural product libraries).
[0338] One candidate compound is a soluble fragment of the variant
protein that competes for ligand binding. Other candidate compounds
include mutant proteins or appropriate fragments containing
mutations that affect variant protein function and thus compete for
ligand. Accordingly, a fragment that competes for ligand, for
example with a higher affinity, or a fragment that binds ligand but
does not allow release, is encompassed by the invention.
[0339] The invention further includes other end point assays to
identify compounds that modulate (stimulate or inhibit) variant
protein activity. The assays typically involve an assay of events
in the signal transduction pathway that indicate protein activity.
Thus, the expression of genes that are up or down-regulated in
response to the variant protein dependent signal cascade can be
assayed. In one embodiment, the regulatory region of such genes can
be operably linked to a marker that is easily detectable, such as
luciferase. Alternatively, phosphorylation of the variant protein,
or a variant protein target, could also be measured. Any of the
biological or biochemical functions mediated by the variant protein
can be used as an endpoint assay. These include all of the
biochemical or biological events described herein, in the
references cited herein, incorporated by reference for these
endpoint assay targets, and other functions known to those of
ordinary skill in the art.
[0340] Binding and/or activating compounds can also be screened by
using chimeric variant proteins in which an amino terminal
extracellular domain or parts thereof, an entire transmembrane
domain or subregions, and/or the carboxyl terminal intracellular
domain or parts thereof, can be replaced by heterologous domains or
subregions. For example, a substrate-binding region can be used
that interacts with a different substrate than that which is
normally recognized by a variant protein. Accordingly, a different
set of signal transduction components is available as an end-point
assay for activation. This allows for assays to be performed in
other than the specific host cell from which the variant protein is
derived.
[0341] The variant proteins are also useful in competition binding
assays in methods designed to discover compounds that interact with
the variant protein. Thus, a compound can be exposed to a variant
protein under conditions that allow the compound to bind or to
otherwise interact with the variant protein. A binding partner,
such as ligand, that normally interacts with the variant protein is
also added to the mixture. If the test compound interacts with the
variant protein or its binding partner, it decreases the amount of
complex formed or activity from the variant protein. This type of
assay is particularly useful in screening for compounds that
interact with specific regions of the variant protein (Hodgson,
Bio/technology, 1992, September 10(9), 973-80).
[0342] To perform cell-free drug screening assays, it is sometimes
desirable to immobilize either the variant protein or a fragment
thereof, or its target molecule, to facilitate separation of
complexes from uncomplexed forms of one or both of the proteins, as
well as to accommodate automation of the assay. Any method for
immobilizing proteins on matrices can be used in drug screening
assays. In one embodiment, a fusion protein containing an added
domain allows the protein to be bound to a matrix. For example,
glutathione-S-transferase/.sup.125I fusion proteins can be adsorbed
onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.)
or glutathione derivatized microtitre plates, which are then
combined with the cell lysates (e.g., .sup.35S-labeled) and a
candidate compound, such as a drug candidate, and the mixture
incubated under conditions conducive to complex formation (e.g., at
physiological conditions for salt and pH). Following incubation,
the beads can be washed to remove any unbound label, and the matrix
immobilized and radiolabel determined directly, or in the
supernatant after the complexes are dissociated. Alternatively, the
complexes can be dissociated from the matrix, separated by
SDS-PAGE, and the level of bound material found in the bead
fraction quantitated from the gel using standard electrophoretic
techniques.
[0343] Either the variant protein or its target molecule can be
immobilized utilizing conjugation of biotin and streptavidin.
Alternatively, antibodies reactive with the variant protein but
which do not interfere with binding of the variant protein to its
target molecule can be derivatized to the wells of the plate, and
the variant protein trapped in the wells by antibody conjugation.
Preparations of the target molecule and a candidate compound are
incubated in the variant protein-presenting wells and the amount of
complex trapped in the well can be quantitated. Methods for
detecting such complexes, in addition to those described above for
the GST-immobilized complexes, include immunodetection of complexes
using antibodies reactive with the protein target molecule, or
which are reactive with variant protein and compete with the target
molecule, and enzyme-linked assays that rely on detecting an
enzymatic activity associated with the target molecule.
[0344] Modulators of variant protein activity identified according
to these drug screening assays can be used to treat a subject with
a disorder mediated by the protein pathway, such as rheumatoid
arthritis. These methods of treatment typically include the steps
of administering the modulators of protein activity in a
pharmaceutical composition to a subject in need of such
treatment.
[0345] The variant proteins, or fragments thereof, disclosed herein
can themselves be directly used to treat a disorder characterized
by an absence of, inappropriate, or unwanted expression or activity
of the variant protein. Accordingly, methods for treatment include
the use of a variant protein disclosed herein or fragments
thereof.
[0346] In yet another aspect of the invention, variant proteins can
be used as "bait proteins" in a two-hybrid assay or three-hybrid
assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993)
Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924;
Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300)
to identify other proteins that bind to or interact with the
variant protein and are involved in variant protein activity. Such
variant protein-binding proteins are also likely to be involved in
the propagation of signals by the variant proteins or variant
protein targets as, for example, elements of a protein-mediated
signaling pathway. Alternatively, such variant protein-binding
proteins are inhibitors of the variant protein.
[0347] The two-hybrid system is based on the modular nature of most
transcription factors, which typically consist of separable
DNA-binding and activation domains. Briefly, the assay typically
utilizes two different DNA constructs. In one construct, the gene
that codes for a variant protein is fused to a gene encoding the
DNA binding domain of a known transcription factor (e.g., GAL-4).
In the other construct, a DNA sequence, from a library of DNA
sequences, that encodes an unidentified protein ("prey" or
"sample") is fused to a gene that codes for the activation domain
of the known transcription factor. If the "bait" and the "prey"
proteins are able to interact, in vivo, forming a variant
protein-dependent complex, the DNA-binding and activation domains
of the transcription factor are brought into close proximity. This
proximity allows transcription of a reporter gene (e.g., LacZ) that
is operably linked to a transcriptional regulatory site responsive
to the transcription factor. Expression of the reporter gene can be
detected, and cell colonies containing the functional transcription
factor can be isolated and used to obtain the cloned gene that
encodes the protein that interacts with the variant protein.
[0348] Antibodies Directed to Variant Proteins
[0349] The present invention also provides antibodies that
selectively bind to the variant proteins disclosed herein and
fragments thereof. Such antibodies may be used to quantitatively or
qualitatively detect the variant proteins of the present invention.
As used herein, an antibody selectively binds a target variant
protein when it binds the variant protein and does not
significantly bind to non-variant proteins, i.e., the antibody does
not significantly bind to normal, wild-type, or art-known proteins
that do not contain a variant amino acid sequence due to one or
more SNPs of the present invention (variant amino acid sequences
may be due to, for example, nonsynonymous cSNPs, nonsense SNPs that
create a stop codon, thereby causing a truncation of a polypeptide
or SNPs that cause read-through mutations resulting in an extension
of a polypeptide).
[0350] As used herein, an antibody is defined in terms consistent
with that recognized in the art: they are multi-subunit proteins
produced by an organism in response to an antigen challenge. The
antibodies of the present invention include both monoclonal
antibodies and polyclonal antibodies, as well as antigen-reactive
proteolytic fragments of such antibodies, such as Fab,
F(ab)'.sub.2, and Fv fragments. In addition, an antibody of the
present invention further includes any of a variety of engineered
antigen-binding molecules such as a chimeric antibody (U.S. Pat.
Nos. 4,816,567 and 4,816,397; Morrison et al., Proc. Natl. Acad.
Sci. USA, 81:6851, 1984; Neuberger et al., Nature 312:604, 1984), a
humanized antibody (U.S. Pat. Nos. 5,693,762; 5,585,089; and
5,565,332), a single-chain Fv (U.S. Pat. No. 4,946,778; Ward et
al., Nature 334:544, 1989), a bispecific antibody with two binding
specificities (Segal et al., J. Immunol. Methods 248:1, 2001;
Carter, J. Immunol. Methods 248:7, 2001), a diabody, a triabody,
and a tetrabody (Todorovska et al., J. Immunol. Methods, 248:47,
2001), as well as a Fab conjugate (dimer or trimer), and a
minibody.
[0351] Many methods are known in the art for generating and/or
identifying antibodies to a given target antigen (Harlow,
Antibodies, Cold Spring Harbor Press, (1989)). In general, an
isolated peptide (e.g., a variant protein of the present invention)
is used as an immunogen and is administered to a mammalian
organism, such as a rat, rabbit, hamster or mouse. Either a
full-length protein, an antigenic peptide fragment (e.g., a peptide
fragment containing a region that varies between a variant protein
and a corresponding wild-type protein), or a fusion protein can be
used. A protein used as an immunogen may be naturally-occurring,
synthetic or recombinantly produced, and may be administered in
combination with an adjuvant, including but not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substance such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanin, dinitrophenol, and the like.
[0352] Monoclonal antibodies can be produced by hybridoma
technology (Kohler and Milstein, Nature, 256:495, 1975), which
immortalizes cells secreting a specific monoclonal antibody. The
immortalized cell lines can be created in vitro by fusing two
different cell types, typically lymphocytes, and tumor cells. The
hybridoma cells may be cultivated in vitro or in vivo.
Additionally, fully human antibodies can be generated by transgenic
animals (He et al., J. Immunol., 169:595, 2002). Fd phage and Fd
phagemid technologies may be used to generate and select
recombinant antibodies in vitro (Hoogenboom and Chames, Immunol.
Today 21:371, 2000; Liu et al., J. Mol. Biol. 315:1063, 2002). The
complementarity-determining regions of an antibody can be
identified, and synthetic peptides corresponding to such regions
may be used to mediate antigen binding (U.S. Pat. No.
5,637,677).
[0353] Antibodies are preferably prepared against regions or
discrete fragments of a variant protein containing a variant amino
acid sequence as compared to the corresponding wild-type protein
(e.g., a region of a variant protein that includes an amino acid
encoded by a nonsynonymous cSNP, a region affected by truncation
caused by a nonsense SNP that creates a stop codon, or a region
resulting from the destruction of a stop codon due to read-through
mutation caused by a SNP). Furthermore, preferred regions will
include those involved in function/activity and/or protein/binding
partner interaction. Such fragments can be selected on a physical
property, such as fragments corresponding to regions that are
located on the surface of the protein, e.g., hydrophilic regions,
or can be selected based on sequence uniqueness, or based on the
position of the variant amino acid residue(s) encoded by the SNPs
provided by the present invention. An antigenic fragment will
typically comprise at least about 8-10 contiguous amino acid
residues in which at least one of the amino acid residues is an
amino acid affected by a SNP disclosed herein. The antigenic
peptide can comprise, however, at least 12, 14, 16, 20, 25, 50, 100
(or any other number in-between) or more amino acid residues,
provided that at least one amino acid is affected by a SNP
disclosed herein.
[0354] Detection of an antibody of the present invention can be
facilitated by coupling (i.e., physically linking) the antibody or
an antigen-reactive fragment thereof to a detectable substance.
Detectable substances include, but are not limited to, various
enzymes, prosthetic groups, fluorescent materials, luminescent
materials, bioluminescent materials, and radioactive materials.
Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, .beta.-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0355] Antibodies, particularly the use of antibodies as
therapeutic agents, are reviewed in: Morgan, "Antibody therapy for
Alzheimer's disease", Expert Rev Vaccines. 2003 February;
2(1):53-9; Ross et al., "Anticancer antibodies", Am J Clin Pathol.
2003 April; 119(4):472-85; Goldenberg, "Advancing role of
radiolabeled antibodies in the therapy of cancer", Cancer Immunol
Immunother. 2003 May; 52(5):281-96. Epub 2003 Mar. 11; Ross et al.,
"Antibody-based therapeutics in oncology", Expert Rev Anticancer
Ther. 2003 February; 3(1):107-21; Cao et al., "Bispecific antibody
conjugates in therapeutics", Adv Drug Deliv Rev. 2003 Feb. 10;
55(2):171-97; von Mehren et al., "Monoclonal antibody therapy for
cancer", Annu Rev Med. 2003; 54:343-69. Epub 2001 December 03;
Hudson et al., "Engineered antibodies", Nat. Med. 2003 January;
9(1):129-34; Brekke et al., "Therapeutic antibodies for human
diseases at the dawn of the twenty-first century", Nat Rev Drug
Discov. 2003 January; 2(1):52-62 (Erratum in: Nat Rev Drug Discov.
2003 March; 2(3):240); Houdebine, "Antibody manufacture in
transgenic animals and comparisons with other systems", Curr Opin
Biotechnol. 2002 December; 13(6):625-9; Andreakos et al.,
"Monoclonal antibodies in immune and inflammatory diseases", Curr
Opin Biotechnol. 2002 December; 13(6):615-20; Kellermann et al.,
"Antibody discovery: the use of transgenic mice to generate human
monoclonal antibodies for therapeutics", Curr Opin Biotechnol. 2002
December; 13(6):593-7; Pini et al., "Phage display and colony
filter screening for high-throughput selection of antibody
libraries", Comb Chem High Throughput Screen. 2002 November;
5(7):503-10; Batra et al., "Pharmacokinetics and biodistribution of
genetically engineered antibodies", Curr Opin Biotechnol. 2002
December; 13(6):603-8; and Tangri et al., "Rationally engineered
proteins or antibodies with absent or reduced immunogenicity", Curr
Med. Chem. 2002 December; 9(24):2191-9.
[0356] Uses of Antibodies
[0357] Antibodies can be used to isolate the variant proteins of
the present invention from a natural cell source or from
recombinant host cells by standard techniques, such as affinity
chromatography or immunoprecipitation. In addition, antibodies are
useful for detecting the presence of a variant protein of the
present invention in cells or tissues to determine the pattern of
expression of the variant protein among various tissues in an
organism and over the course of normal development or disease
progression. Further, antibodies can be used to detect variant
protein in situ, in vitro, in a bodily fluid, or in a cell lysate
or supernatant in order to evaluate the amount and pattern of
expression. Also, antibodies can be used to assess abnormal tissue
distribution, abnormal expression during development, or expression
in an abnormal condition, such as rheumatoid arthritis.
Additionally, antibody detection of circulating fragments of the
full-length variant protein can be used to identify turnover.
[0358] Antibodies to the variant proteins of the present invention
are also useful in pharmacogenomic analysis. Thus, antibodies
against variant proteins encoded by alternative SNP alleles can be
used to identify individuals that require modified treatment
modalities.
[0359] Further, antibodies can be used to assess expression of the
variant protein in disease states such as in active stages of the
disease or in an individual with a predisposition to a disease
related to the protein's function, particularly rheumatoid
arthritis. Antibodies specific for a variant protein encoded by a
SNP-containing nucleic acid molecule of the present invention can
be used to assay for the presence of the variant protein, such as
to screen for predisposition to rheumatoid arthritis as indicated
by the presence of the variant protein.
[0360] Antibodies are also useful as diagnostic tools for
evaluating the variant proteins in conjunction with analysis by
electrophoretic mobility, isoelectric point, tryptic peptide
digest, and other physical assays well known in the art.
[0361] Antibodies are also useful for tissue typing. Thus, where a
specific variant protein has been correlated with expression in a
specific tissue, antibodies that are specific for this protein can
be used to identify a tissue type.
[0362] Antibodies can also be used to assess aberrant subcellular
localization of a variant protein in cells in various tissues. The
diagnostic uses can be applied, not only in genetic testing, but
also in monitoring a treatment modality. Accordingly, where
treatment is ultimately aimed at correcting the expression level or
the presence of variant protein or aberrant tissue distribution or
developmental expression of a variant protein, antibodies directed
against the variant protein or relevant fragments can be used to
monitor therapeutic efficacy.
[0363] The antibodies are also useful for inhibiting variant
protein function, for example, by blocking the binding of a variant
protein to a binding partner. These uses can also be applied in a
therapeutic context in which treatment involves inhibiting a
variant protein's function. An antibody can be used, for example,
to block or competitively inhibit binding, thus modulating
(agonizing or antagonizing) the activity of a variant protein.
Antibodies can be prepared against specific variant protein
fragments containing sites required for function or against an
intact variant protein that is associated with a cell or cell
membrane. For in vivo administration, an antibody may be linked
with an additional therapeutic payload such as a radionuclide, an
enzyme, an immunogenic epitope, or a cytotoxic agent. Suitable
cytotoxic agents include, but are not limited to, bacterial toxin
such as diphtheria, and plant toxin such as ricin. The in vivo
half-life of an antibody or a fragment thereof may be lengthened by
pegylation through conjugation to polyethylene glycol (Leong et
al., Cytokine 16:106, 2001).
[0364] The invention also encompasses kits for using antibodies,
such as kits for detecting the presence of a variant protein in a
test sample. An exemplary kit can comprise antibodies such as a
labeled or labelable antibody and a compound or agent for detecting
variant proteins in a biological sample; means for determining the
amount, or presence/absence of variant protein in the sample; means
for comparing the amount of variant protein in the sample with a
standard; and instructions for use.
[0365] Vectors and Host Cells
[0366] The present invention also provides vectors containing the
SNP-containing nucleic acid molecules described herein. The term
"vector" refers to a vehicle, preferably a nucleic acid molecule,
which can transport a SNP-containing nucleic acid molecule. When
the vector is a nucleic acid molecule, the SNP-containing nucleic
acid molecule can be covalently linked to the vector nucleic acid.
Such vectors include, but are not limited to, a plasmid, single or
double stranded phage, a single or double stranded RNA or DNA viral
vector, or artificial chromosome, such as a BAC, PAC, YAC, or
MAC.
[0367] A vector can be maintained in a host cell as an
extrachromosomal element where it replicates and produces
additional copies of the SNP-containing nucleic acid molecules.
Alternatively, the vector may integrate into the host cell genome
and produce additional copies of the SNP-containing nucleic acid
molecules when the host cell replicates.
[0368] The invention provides vectors for the maintenance (cloning
vectors) or vectors for expression (expression vectors) of the
SNP-containing nucleic acid molecules. The vectors can function in
prokaryotic or eukaryotic cells or in both (shuttle vectors).
[0369] Expression vectors typically contain cis-acting regulatory
regions that are operably linked in the vector to the
SNP-containing nucleic acid molecules such that transcription of
the SNP-containing nucleic acid molecules is allowed in a host
cell. The SNP-containing nucleic acid molecules can also be
introduced into the host cell with a separate nucleic acid molecule
capable of affecting transcription. Thus, the second nucleic acid
molecule may provide a trans-acting factor interacting with the
cis-regulatory control region to allow transcription of the
SNP-containing nucleic acid molecules from the vector.
Alternatively, a trans-acting factor may be supplied by the host
cell. Finally, a trans-acting factor can be produced from the
vector itself. It is understood, however, that in some embodiments,
transcription and/or translation of the nucleic acid molecules can
occur in a cell-free system.
[0370] The regulatory sequences to which the SNP-containing nucleic
acid molecules described herein can be operably linked include
promoters for directing mRNA transcription. These include, but are
not limited to, the left promoter from bacteriophage .lamda., the
lac, TRP, and TAC promoters from E. coli, the early and late
promoters from SV40, the CMV immediate early promoter, the
adenovirus early and late promoters, and retrovirus long-terminal
repeats.
[0371] In addition to control regions that promote transcription,
expression vectors may also include regions that modulate
transcription, such as repressor binding sites and enhancers.
Examples include the SV40 enhancer, the cytomegalovirus immediate
early enhancer, polyoma enhancer, adenovirus enhancers, and
retrovirus LTR enhancers.
[0372] In addition to containing sites for transcription initiation
and control, expression vectors can also contain sequences
necessary for transcription termination and, in the transcribed
region, a ribosome-binding site for translation. Other regulatory
control elements for expression include initiation and termination
codons as well as polyadenylation signals. A person of ordinary
skill in the art would be aware of the numerous regulatory
sequences that are useful in expression vectors (see, e.g.,
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0373] A variety of expression vectors can be used to express a
SNP-containing nucleic acid molecule. Such vectors include
chromosomal, episomal, and virus-derived vectors, for example,
vectors derived from bacterial plasmids, from bacteriophage, from
yeast episomes, from yeast chromosomal elements, including yeast
artificial chromosomes, from viruses such as baculoviruses,
papovaviruses such as SV40, Vaccinia viruses, adenoviruses,
poxviruses, pseudorabies viruses, and retroviruses. Vectors can
also be derived from combinations of these sources such as those
derived from plasmid and bacteriophage genetic elements, e.g.,
cosmids and phagemids. Appropriate cloning and expression vectors
for prokaryotic and eukaryotic hosts are described in Sambrook and
Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0374] The regulatory sequence in a vector may provide constitutive
expression in one or more host cells (e.g., tissue specific
expression) or may provide for inducible expression in one or more
cell types such as by temperature, nutrient additive, or exogenous
factor, e.g., a hormone or other ligand. A variety of vectors that
provide constitutive or inducible expression of a nucleic acid
sequence in prokaryotic and eukaryotic host cells are well known to
those of ordinary skill in the art.
[0375] A SNP-containing nucleic acid molecule can be inserted into
the vector by methodology well-known in the art. Generally, the
SNP-containing nucleic acid molecule that will ultimately be
expressed is joined to an expression vector by cleaving the
SNP-containing nucleic acid molecule and the expression vector with
one or more restriction enzymes and then ligating the fragments
together. Procedures for restriction enzyme digestion and ligation
are well known to those of ordinary skill in the art.
[0376] The vector containing the appropriate nucleic acid molecule
can be introduced into an appropriate host cell for propagation or
expression using well-known techniques. Bacterial host cells
include, but are not limited to, E. coli, Streptomyces, and
Salmonella typhimurium. Eukaryotic host cells include, but are not
limited to, yeast, insect cells such as Drosophila, animal cells
such as COS and CHO cells, and plant cells.
[0377] As described herein, it may be desirable to express the
variant peptide as a fusion protein. Accordingly, the invention
provides fusion vectors that allow for the production of the
variant peptides. Fusion vectors can, for example, increase the
expression of a recombinant protein, increase the solubility of the
recombinant protein, and aid in the purification of the protein by
acting, for example, as a ligand for affinity purification. A
proteolytic cleavage site may be introduced at the junction of the
fusion moiety so that the desired variant peptide can ultimately be
separated from the fusion moiety. Proteolytic enzymes suitable for
such use include, but are not limited to, factor Xa, thrombin, and
enterokinase. Typical fusion expression vectors include pGEX (Smith
et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly,
Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse
glutathione S-transferase (GST), maltose E binding protein, or
protein A, respectively, to the target recombinant protein.
Examples of suitable inducible non-fusion E. coli expression
vectors include pTrc (Amann et al., Gene 69:301-315 (1988)) and pET
11d (Studier et al., Gene Expression Technology: Methods in
Enzymology 185:60-89 (1990)).
[0378] Recombinant protein expression can be maximized in a
bacterial host by providing a genetic background wherein the host
cell has an impaired capacity to proteolytically cleave the
recombinant protein (Gottesman, S., Gene Expression Technology:
Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)
119-128). Alternatively, the sequence of the SNP-containing nucleic
acid molecule of interest can be altered to provide preferential
codon usage for a specific host cell, for example, E. coli (Wada et
al., Nucleic Acids Res. 20:2111-2118 (1992)).
[0379] The SNP-containing nucleic acid molecules can also be
expressed by expression vectors that are operative in yeast.
Examples of vectors for expression in yeast (e.g., S. cerevisiae)
include pYepSec1 (Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa
(Kurjan et al., Cell 30:933-943 (1982)), pJRY88 (Schultz et al.,
Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San
Diego, Calif.).
[0380] The SNP-containing nucleic acid molecules can also be
expressed in insect cells using, for example, baculovirus
expression vectors. Baculovirus vectors available for expression of
proteins in cultured insect cells (e.g., Sf 9 cells) include the
pAc series (Smith et al., Mol. Cell. Biol. 3:2156-2165 (1983)) and
the pVL series (Lucklow et al., Virology 170:31-39 (1989)).
[0381] In certain embodiments of the invention, the SNP-containing
nucleic acid molecules described herein are expressed in mammalian
cells using mammalian expression vectors. Examples of mammalian
expression vectors include pCDM8 (Seed, B. Nature 329:840 (1987))
and pMT2PC (Kaufman et al., EMBO J. 6:187-195 (1987)).
[0382] The invention also encompasses vectors in which the
SNP-containing nucleic acid molecules described herein are cloned
into the vector in reverse orientation, but operably linked to a
regulatory sequence that permits transcription of antisense RNA.
Thus, an antisense transcript can be produced to the SNP-containing
nucleic acid sequences described herein, including both coding and
non-coding regions. Expression of this antisense RNA is subject to
each of the parameters described above in relation to expression of
the sense RNA (regulatory sequences, constitutive or inducible
expression, tissue-specific expression).
[0383] The invention also relates to recombinant host cells
containing the vectors described herein. Host cells therefore
include, for example, prokaryotic cells, lower eukaryotic cells
such as yeast, other eukaryotic cells such as insect cells, and
higher eukaryotic cells such as mammalian cells.
[0384] The recombinant host cells can be prepared by introducing
the vector constructs described herein into the cells by techniques
readily available to persons of ordinary skill in the art. These
include, but are not limited to, calcium phosphate transfection,
DEAE-dextran-mediated transfection, cationic lipid-mediated
transfection, electroporation, transduction, infection,
lipofection, and other techniques such as those described in
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.).
[0385] Host cells can contain more than one vector. Thus, different
SNP-containing nucleotide sequences can be introduced in different
vectors into the same cell. Similarly, the SNP-containing nucleic
acid molecules can be introduced either alone or with other nucleic
acid molecules that are not related to the SNP-containing nucleic
acid molecules, such as those providing trans-acting factors for
expression vectors. When more than one vector is introduced into a
cell, the vectors can be introduced independently, co-introduced,
or joined to the nucleic acid molecule vector.
[0386] In the case of bacteriophage and viral vectors, these can be
introduced into cells as packaged or encapsulated virus by standard
procedures for infection and transduction. Viral vectors can be
replication-competent or replication-defective. In the case in
which viral replication is defective, replication can occur in host
cells that provide functions that complement the defects.
[0387] Vectors generally include selectable markers that enable the
selection of the subpopulation of cells that contain the
recombinant vector constructs. The marker can be inserted in the
same vector that contains the SNP-containing nucleic acid molecules
described herein or may be in a separate vector. Markers include,
for example, tetracycline or ampicillin-resistance genes for
prokaryotic host cells, and dihydrofolate reductase or neomycin
resistance genes for eukaryotic host cells. However, any marker
that provides selection for a phenotypic trait can be
effective.
[0388] While the mature variant proteins can be produced in
bacteria, yeast, mammalian cells, and other cells under the control
of the appropriate regulatory sequences, cell-free transcription
and translation systems can also be used to produce these variant
proteins using RNA derived from the DNA constructs described
herein.
[0389] Where secretion of the variant protein is desired, which is
difficult to achieve with multi-transmembrane domain containing
proteins such as G-protein-coupled receptors (GPCRs), appropriate
secretion signals can be incorporated into the vector. The signal
sequence can be endogenous to the peptides or heterologous to these
peptides.
[0390] Where the variant protein is not secreted into the medium,
the protein can be isolated from the host cell by standard
disruption procedures, including freeze/thaw, sonication,
mechanical disruption, use of lysing agents, and the like. The
variant protein can then be recovered and purified by well-known
purification methods including, for example, ammonium sulfate
precipitation, acid extraction, anion or cationic exchange
chromatography, phosphocellulose chromatography,
hydrophobic-interaction chromatography, affinity chromatography,
hydroxylapatite chromatography, lectin chromatography, or high
performance liquid chromatography.
[0391] It is also understood that, depending upon the host cell in
which recombinant production of the variant proteins described
herein occurs, they can have various glycosylation patterns, or may
be non-glycosylated, as when produced in bacteria. In addition, the
variant proteins may include an initial modified methionine in some
cases as a result of a host-mediated process.
[0392] For further information regarding vectors and host cells,
see Current Protocols in Molecular Biology, John Wiley & Sons,
N.Y.
[0393] Uses of Vectors and Host Cells, and Transgenic Animals
[0394] Recombinant host cells that express the variant proteins
described herein have a variety of uses. For example, the cells are
useful for producing a variant protein that can be further purified
into a preparation of desired amounts of the variant protein or
fragments thereof. Thus, host cells containing expression vectors
are useful for variant protein production.
[0395] Host cells are also useful for conducting cell-based assays
involving the variant protein or variant protein fragments, such as
those described above as well as other formats known in the art.
Thus, a recombinant host cell expressing a variant protein is
useful for assaying compounds that stimulate or inhibit variant
protein function. Such an ability of a compound to modulate variant
protein function may not be apparent from assays of the compound on
the native/wild-type protein, or from cell-free assays of the
compound. Recombinant host cells are also useful for assaying
functional alterations in the variant proteins as compared with a
known function.
[0396] Genetically-engineered host cells can be further used to
produce non-human transgenic animals. A transgenic animal is
preferably a non-human mammal, for example, a rodent, such as a rat
or mouse, in which one or more of the cells of the animal include a
transgene. A transgene is exogenous DNA containing a SNP of the
present invention which is integrated into the genome of a cell
from which a transgenic animal develops and which remains in the
genome of the mature animal in one or more of its cell types or
tissues. Such animals are useful for studying the function of a
variant protein in vivo, and identifying and evaluating modulators
of variant protein activity. Other examples of transgenic animals
include, but are not limited to, non-human primates, sheep, dogs,
cows, goats, chickens, and amphibians. Transgenic non-human mammals
such as cows and goats can be used to produce variant proteins
which can be secreted in the animal's milk and then recovered.
[0397] A transgenic animal can be produced by introducing a
SNP-containing nucleic acid molecule into the male pronuclei of a
fertilized oocyte, e.g., by microinjection or retroviral infection,
and allowing the oocyte to develop in a pseudopregnant female
foster animal. Any nucleic acid molecules that contain one or more
SNPs of the present invention can potentially be introduced as a
transgene into the genome of a non-human animal.
[0398] Any of the regulatory or other sequences useful in
expression vectors can form part of the transgenic sequence. This
includes intronic sequences and polyadenylation signals, if not
already included. A tissue-specific regulatory sequence(s) can be
operably linked to the transgene to direct expression of the
variant protein in particular cells or tissues.
[0399] Methods for generating transgenic animals via embryo
manipulation and microinjection, particularly animals such as mice,
have become conventional in the art and are described in, for
example, U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et
al., U.S. Pat. No. 4,873,191 by Wagner et al., and in Hogan, B.,
Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used
for production of other transgenic animals. A transgenic founder
animal can be identified based upon the presence of the transgene
in its genome and/or expression of transgenic mRNA in tissues or
cells of the animals. A transgenic founder animal can then be used
to breed additional animals carrying the transgene. Moreover,
transgenic animals carrying a transgene can further be bred to
other transgenic animals carrying other transgenes. A transgenic
animal also includes a non-human animal in which the entire animal
or tissues in the animal have been produced using the homologously
recombinant host cells described herein.
[0400] In another embodiment, transgenic non-human animals can be
produced which contain selected systems that allow for regulated
expression of the transgene. One example of such a system is the
cre/loxP recombinase system of bacteriophage P1 (Lakso et al. PNAS
89:6232-6236 (1992)). Another example of a recombinase system is
the FLP recombinase system of S. cerevisiae (O'Gorman et al.
Science 251:1351-1355 (1991)). If a cre/loxP recombinase system is
used to regulate expression of the transgene, animals containing
transgenes encoding both the Cre recombinase and a selected protein
are generally needed. Such animals can be provided through the
construction of "double" transgenic animals, e.g., by mating two
transgenic animals, one containing a transgene encoding a selected
variant protein and the other containing a transgene encoding a
recombinase.
[0401] Clones of the non-human transgenic animals described herein
can also be produced according to the methods described in, for
example, Wilmut, I. et al. Nature 385:810-813 (1997) and PCT
International Publication Nos. WO 97/07668 and WO 97/07669. In
brief, a cell (e.g., a somatic cell) from the transgenic animal can
be isolated and induced to exit the growth cycle and enter G.sub.o
phase. The quiescent cell can then be fused, e.g., through the use
of electrical pulses, to an enucleated oocyte from an animal of the
same species from which the quiescent cell is isolated. The
reconstructed oocyte is then cultured such that it develops to
morula or blastocyst and then transferred to pseudopregnant female
foster animal. The offspring born of this female foster animal will
be a clone of the animal from which the cell (e.g., a somatic cell)
is isolated.
[0402] Transgenic animals containing recombinant cells that express
the variant proteins described herein are useful for conducting the
assays described herein in an in vivo context. Accordingly, the
various physiological factors that are present in vivo and that
could influence ligand or substrate binding, variant protein
activation, signal transduction, or other processes or
interactions, may not be evident from in vitro cell-free or
cell-based assays. Thus, non-human transgenic animals of the
present invention may be used to assay in vivo variant protein
function as well as the activities of a therapeutic agent or
compound that modulates variant protein function/activity or
expression. Such animals are also suitable for assessing the
effects of null mutations (i.e., mutations that substantially or
completely eliminate one or more variant protein functions).
[0403] For further information regarding transgenic animals, see
Houdebine, "Antibody manufacture in transgenic animals and
comparisons with other systems", Curr Opin Biotechnol. 2002
December; 13(6):625-9; Petters et al., "Transgenic animals as
models for human disease", Transgenic Res. 2000; 9(4-5):347-51;
discussion 345-6; Wolf et al., "Use of transgenic animals in
understanding molecular mechanisms of toxicity", J Pharm Pharmacol.
1998 June; 50(6):567-74; Echelard, "Recombinant protein production
in transgenic animals", Curr Opin Biotechnol. 1996 October;
7(5):536-40; Houdebine, "Transgenic animal bioreactors", Transgenic
Res. 2000; 9(4-5):305-20; Pirity et al., "Embryonic stem cells,
creating transgenic animals", Methods Cell Biol. 1998; 57:279-93;
and Robl et al., "Artificial chromosome vectors and expression of
complex proteins in transgenic animals", Theriogenology. 2003 Jan.
1; 59(1):107-13.
[0404] Computer-Related Embodiments
[0405] The SNPs provided in the present invention may be "provided"
in a variety of mediums to facilitate use thereof. As used in this
section, "provided" refers to a manufacture, other than an isolated
nucleic acid molecule, that contains SNP information of the present
invention. Such a manufacture provides the SNP information in a
form that allows a skilled artisan to examine the manufacture using
means not directly applicable to examining the SNPs or a subset
thereof as they exist in nature or in purified form. The SNP
information that may be provided in such a form includes any of the
SNP information provided by the present invention such as, for
example, polymorphic nucleic acid and/or amino acid sequence
information such as SEQ ID NOS:1-669, SEQ ID NOS:670-1338, SEQ ID
NOS:10,552-10,915, SEQ ID NOS:1339-10,551, and SEQ ID
NOS:10,916-49,582 and 50,231; information about observed SNP
alleles, alternative codons, populations, allele frequencies, SNP
types, and/or affected proteins; or any other information provided
by the present invention in Tables 1-2 and/or the Sequence
Listing.
[0406] In one application of this embodiment, the SNPs of the
present invention can be recorded on a computer readable medium. As
used herein, "computer readable medium" refers to any medium that
can be read and accessed directly by a computer. Such media
include, but are not limited to: magnetic storage media, such as
floppy discs, hard disc storage medium, and magnetic tape; optical
storage media such as CD-ROM; electrical storage media such as RAM
and ROM; and hybrids of these categories such as magnetic/optical
storage media. A skilled artisan can readily appreciate how any of
the presently known computer readable media can be used to create a
manufacture comprising computer readable medium having recorded
thereon a nucleotide sequence of the present invention. One such
medium is provided with the present application, namely, the
present application contains computer readable medium (CD-R) that
has nucleic acid sequences (and encoded protein sequences)
containing SNPs provided/recorded thereon in ASCII text format in a
Sequence Listing along with accompanying Tables that contain
detailed SNP and sequence information (transcript sequences are
provided as SEQ ID NOS:1-669, protein sequences are provided as SEQ
ID NOS:670-1338, genomic sequences are provided as SEQ ID
NOS:10,552-10,915, transcript-based context sequences are provided
as SEQ ID NOS:1339-10,551, and genomic-based context sequences are
provided as SEQ ID NOS:10,916-49,582 and 50,231).
[0407] As used herein, "recorded" refers to a process for storing
information on computer readable medium. A skilled artisan can
readily adopt any of the presently known methods for recording
information on computer readable medium to generate manufactures
comprising the SNP information of the present invention.
[0408] A variety of data storage structures are available to a
skilled artisan for creating a computer readable medium having
recorded thereon a nucleotide or amino acid sequence of the present
invention. The choice of the data storage structure will generally
be based on the means chosen to access the stored information. In
addition, a variety of data processor programs and formats can be
used to store the nucleotide/amino acid sequence information of the
present invention on computer readable medium. For example, the
sequence information can be represented in a word processing text
file, formatted in commercially-available software such as
WordPerfect and Microsoft Word, represented in the form of an ASCII
file, or stored in a database application, such as OB2, Sybase,
Oracle, or the like. A skilled artisan can readily adapt any number
of data processor structuring formats (e.g., text file or database)
in order to obtain computer readable medium having recorded thereon
the SNP information of the present invention.
[0409] By providing the SNPs of the present invention in computer
readable form, a skilled artisan can routinely access the SNP
information for a variety of purposes. Computer software is
publicly available which allows a skilled artisan to access
sequence information provided in a computer readable medium.
Examples of publicly available computer software include BLAST
(Altschul et at, J. Mol. Biol. 215:403-410 (1990)) and BLAZE
(Brutlag et at, Comp. Chem. 17:203-207 (1993)) search
algorithms.
[0410] The present invention further provides systems, particularly
computer-based systems, which contain the SNP information described
herein. Such systems may be designed to store and/or analyze
information on, for example, a large number of SNP positions, or
information on SNP genotypes from a large number of individuals.
The SNP information of the present invention represents a valuable
information source. The SNP information of the present invention
stored/analyzed in a computer-based system may be used for such
computer-intensive applications as determining or analyzing SNP
allele frequencies in a population, mapping disease genes,
genotype-phenotype association studies, grouping SNPs into
haplotypes, correlating SNP haplotypes with response to particular
drugs, or for various other bioinformatic, pharmacogenomic, drug
development, or human identification/forensic applications.
[0411] As used herein, "a computer-based system" refers to the
hardware means, software means, and data storage means used to
analyze the SNP information of the present invention. The minimum
hardware means of the computer-based systems of the present
invention typically comprises a central processing unit (CPU),
input means, output means, and data storage means. A skilled
artisan can readily appreciate that any one of the currently
available computer-based systems are suitable for use in the
present invention. Such a system can be changed into a system of
the present invention by utilizing the SNP information provided on
the CD-R, or a subset thereof, without any experimentation.
[0412] As stated above, the computer-based systems of the present
invention comprise a data storage means having stored therein SNPs
of the present invention and the necessary hardware means and
software means for supporting and implementing a search means. As
used herein, "data storage means" refers to memory which can store
SNP information of the present invention, or a memory access means
which can access manufactures having recorded thereon the SNP
information of the present invention.
[0413] As used herein, "search means" refers to one or more
programs or algorithms that are implemented on the computer-based
system to identify or analyze SNPs in a target sequence based on
the SNP information stored within the data storage means. Search
means can be used to determine which nucleotide is present at a
particular SNP position in the target sequence. As used herein, a
"target sequence" can be any DNA sequence containing the SNP
position(s) to be searched or queried.
[0414] As used herein, "a target structural motif," or "target
motif," refers to any rationally selected sequence or combination
of sequences containing a SNP position in which the sequence(s) is
chosen based on a three-dimensional configuration that is formed
upon the folding of the target motif. There are a variety of target
motifs known in the art. Protein target motifs include, but are not
limited to, enzymatic active sites and signal sequences. Nucleic
acid target motifs include, but are not limited to, promoter
sequences, hairpin structures, and inducible expression elements
(protein binding sequences).
[0415] A variety of structural formats for the input and output
means can be used to input and output the information in the
computer-based systems of the present invention. An exemplary
format for an output means is a display that depicts the presence
or absence of specified nucleotides (alleles) at particular SNP
positions of interest. Such presentation can provide a rapid,
binary scoring system for many SNPs simultaneously.
[0416] One exemplary embodiment of a computer-based system
comprising SNP information of the present invention is provided in
FIG. 1. FIG. 1 provides a block diagram of a computer system 102
that can be used to implement the present invention. The computer
system 102 includes a processor 106 connected to a bus 104. Also
connected to the bus 104 are a main memory 108 (preferably
implemented as random access memory, RAM) and a variety of
secondary storage devices 110, such as a hard drive 112 and a
removable medium storage device 114. The removable medium storage
device 114 may represent, for example, a floppy disk drive, a
CD-ROM drive, a magnetic tape drive, etc. A removable storage
medium 116 (such as a floppy disk, a compact disk, a magnetic tape,
etc.) containing control logic and/or data recorded therein may be
inserted into the removable medium storage device 114. The computer
system 102 includes appropriate software for reading the control
logic and/or the data from the removable storage medium 116 once
inserted in the removable medium storage device 114.
[0417] The SNP information of the present invention may be stored
in a well-known manner in the main memory 108, any of the secondary
storage devices 110, and/or a removable storage medium 116.
Software for accessing and processing the SNP information (such as
SNP scoring tools, search tools, comparing tools, etc.) preferably
resides in main memory 108 during execution.
Examples
Statistical Analysis of SNP allele Association with Rheumatoid
Arthritis
[0418] The association of SNP alleles in the human genome with
rheumatoid arthritis (RA) was tested using genomic DNA from
individuals in two independently collected case-control sample
sets, a "Discovery Set" and a "Replication Set".
[0419] The Discovery Set consisted of 475 unrelated cases with
rheumatoid arthritis and 475 controls (one control matched to each
patient on age, sex, and grandparental country of origin). All
cases in the Discovery Set met the American College of Rheumatology
(ACR) criteria for rheumatoid arthritis and were positive for the
autoantibody rheumatoid factor. All subjects who were included had
signed informed, written consent and the study protocol was IRB
approved.
[0420] The Replication Set consisted of 840 cases in 463 families
(families consisted of one to six affected siblings), and 926
controls (two controls matched to a single patient, referred to as
a proband, from each family on the basis of age, sex, and
grandparental country of origin). All cases in the Replication Set
met the ACR criteria for rheumatoid arthritis. The Replication Set
was considered in two different ways for analysis: as "Replication
Set, All Cases," with 840 patients and 926 controls (statistics
given are unadjusted for the relatedness of the cases); or as
"Replication Set, Probands," using only proband cases, with 463
cases and 926 controls. All subjects who were included had signed
informed, written consent and the study protocol was IRB
approved.
[0421] DNA was extracted from blood samples using standard
protocols. Some markers were genotyped individually to generate a
specific genotype for every individual. The remaining markers were
genotyped on pools of DNA, in which DNA from about 40 individuals
was pooled together, and allele frequencies were estimated for the
pool. Cases were pooled together on the basis of shared
characteristics such as age, gender, and HLA-DRB1 genotype.
Controls were pooled based on the pooling of the matched case.
Genotypes and pool allele frequencies were measured using a PRISM
7900HT sequence detection PCR system (Applied Biosystems) by
allele-specific PCR, similar to the method described by Germer et
al (Germer S., Holland M. J., Higuchi R. 2000, Genome Res. 10:
258-266). Primers for the allele-specific PCR reactions are
disclosed in Table 3.
[0422] Association of a SNP allele with RA was calculated by
applying a Fisher exact test to the counts of each allele in cases
and controls. The counts of alleles were determined exactly from
independent genotyping or estimated from pooled genotyping. Tests
of association were carried out using all cases and controls
(stratum=All) in several substrata based on characteristics of the
cases (e.g., onset <38, male). No correction for multiple
testing was made.
[0423] Effect sizes were estimated by allelic odds ratios. The
reported "Allele1" may be under-represented in cases (with a lower
allele frequency in cases than in controls and an odds ratio less
than 1, indicating that Allele1 is associated with protection from
RA and the other allele is a risk factor for RA) or
over-represented in cases (with a higher allele frequency in cases
than in controls and an odds ratio greater than 1, indicating that
Allele1 is a risk factor in the development of RA).
[0424] For markers that have been genotyped in the Discovery Set
only, markers listed in Table 4 have a significant p-value of
allelic association (less than 0.05) in the All stratum.
[0425] For markers that have been genotyped in both the Discovery
Set and the Replication Set, markers listed in Table 4 have
replicated, significant p-values of allelic association (less than
0.05) in the stratum indicated. Results in the Discovery Set were
compared to results in the "Replication Set, All Cases" and in the
"Replication Set, Probands". If a marker was significantly
associated in the All stratum of the Discovery Set, association in
either the All or RF+ strata of the Replication Set was assessed to
determine if the association was replicated (as all cases in the
Discovery Set were RF+, both comparisons are appropriate). If
association of a marker was not replicated in the All or RF+
strata, replicated association was tested within substrata (for
example, a marker showing association in the Male stratum of the
Discovery Set and the Male stratum of the "Replication Set,
Probands" would be considered replicated; conversely, a marker
showing association in the Male stratum of the Discovery Set and
the Female stratum of the Replication Set would not be sufficient
to be considered replicated). Replicated markers are listed in
Table 4 only if Allele1 was protective in both sample sets or was a
risk factor in both sample sets (markers for which Allele1 was
protective in one sample set and a risk factor in another sample
set are not listed in Table 4). Replication of a significant
association provides further verification that a SNP is associated
with RA.
[0426] hCV25755336 is an example of a marker that was typed in the
Discovery Set only. For hCV25755336, Allele1 (G) is a risk allele
(OR>1) that is significantly associated with the development of
RA in the All stratum of the Discovery Set.
[0427] hCV8367900 is an example of a replicated marker typed in
both sample sets. For hCV8367900, Allele1 (T) is a protective
allele (OR<1) that is significantly associated with not having
RA in the All stratum of the Discovery Set, the "Replication Set,
All Cases", and the "Replication Set, Probands". It was also
significantly associated with not having RA in the RF+ stratum of
the "Replication Set, All Cases" and the "Replication Set,
Probands". Because it was replicated in the All stratum (by being
significant in the All strata of the Discovery Set and the All or
RF+ strata of at least one of the Replication Sets), not all
substratum in which it was also replicated are listed.
[0428] hCV9505893 is another example of a replicated marker typed
in both sample sets. For hCV9505893, Allele1 (G) is a risk allele
(OR>1) that is significantly associated with having RA in the
All stratum of the Discovery Set and the RF+ stratum of the
"Replication Set, All Cases". Because it was replicated in the
All/RF+ strata, the substratum in which it was also replicated is
not listed.
[0429] hCV3191771 is an example of replicated marker in a
substratum. For hCV3191771, Allele1 (G) is protective (OR<1) in
the Discovery Set and the "Replication Set, Probands" when patients
with two risk shared epitopes at HLA-DRB1 are compared to controls
matched on age, sex, and grandparental country of origin.
[0430] hCV16021387 is an example of a replicated marker typed in
both sample sets. For hCV16021387, Allele1 (A) is a risk allele
(OR>1) that is significantly associated with having RA in the
All stratum of the Discovery Set, the "Replication Set, All Cases",
and the "Replication Set, Probands". It was also significantly
associated with having RA in the RF+ stratum of the "Replication
Set, All Cases" and the "Replication Set, Probands". The Allelic
p-value listed for the All stratum of "Replication Set, Probands"
is 6.11208E-09, which is standard scientific notation for
6.11208.times.10.sup.-9 (0.00000000611208).
[0431] Although the specific examples described herein are directed
towards rheumatoid arthritis, the skilled artisan will appreciate
that, since autoimmune diseases share certain similar features that
may be due to common genetic factors that are involved in their
underlying mechanisms, the SNPs identified herein as being
associated with rheumatoid arthritis may also be used as markers
for other autoimmune diseases. Such autoimmune diseases include,
but are not limited to, type 1 diabetes, multiple sclerosis,
systemic lupus erythematosus, inflammatory bowel diseases,
psoriasis, thyroiditis, celiac disease, pernicious anemia, asthma,
vitiligo, glomerulonephritis, Graves' disease, myocarditis, Sjogren
disease, and primary systemic vasculitis. Moreover, the genes
containing the SNPs identified herein, and the transcripts and
proteins encoded by these genes, can be used in the treatment of
other autoimmune diseases, in addition to rheumatoid arthritis. For
example, the genes and encoded gene products can serve as targets
for the development of therapeutic agents (e.g., small molecule
compounds, antibodies, antisense/RNAi agents, etc.) or used
directly as therapeutic agents (e.g., therapeutic proteins, etc.)
for the treatment of not only rheumatoid arthritis, but various
other autoimmune diseases as well.
[0432] All publications and patents cited in this specification are
herein incorporated by reference in their entirety. Various
modifications and variations of the described compositions, methods
and systems of the invention will be apparent to those skilled in
the art without departing from the scope and spirit of the
invention. Although the invention has been described in connection
with specific preferred embodiments and certain working examples,
it should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the above-described modes for carrying out the
invention that are obvious to those skilled in the field of
molecular biology, genetics and related fields are intended to be
within the scope of the following claims.
TABLE-US-00003 TABLE 3 Sequence A Sequence B Al- (allele- (allele-
Sequence C hCV leles specific primer) specific primer) (common
primer) hCV108175 C/T ATTGCTTTTGCTACATTGTTG AAATTGCTTTTGCTACATTGTTA
CTTTCAAAGCAATGTGAGATTC (SEQ ID NO: 49583) (SEQ ID NO: 49584) (SEQ
ID NO: 49585) hCV11159941 C/T CCCGTTGGTTCCGAAAG CCCGTTGGTTCCGAAAA
TGAATAGCCATTAGAAAAAACTGT (SEQ ID NO: 49586) (SEQ ID NO: 49587) (SEQ
ID NO: 49588) hCV11195029 A/G GGATGGTCTTCTCTTTGTCAA
GGATGGTCTTCTCTTTGTCAG TTTGATGCCAACCCATATG (SEQ ID NO: 49589) (SEQ
ID NO: 49590) (SEQ ID NO: 49591) hCV11276786 A/T
CATTTGTATTTCTTCTGGGGA CATTTGTATTTCTTCTGGGGT TCCTAAGCCAGCCTATTCTAAA
(SEQ ID NO: 49592) (SEQ ID NO: 49593) (SEQ ID NO: 49594)
hCV11297739 G/T TCAGCTCATGATGTGTGATG CTCAGCTCATGATGTGTGATT
CCTGTATGCAGCTTAAGTTGATAA (SEQ ID NO: 49595) (SEQ ID NO: 49596) (SEQ
ID NO: 49597) hCV11356754 C/T GCTTCACATCACATACATCG
GGCTTCACATCACATACATCA TCCAATTCCTGCCTCATG (SEQ ID NO: 49598) (SEQ ID
NO: 49599) (SEQ ID NO: 49600) hCV11405566 A/G CGGCTCGAGGTTTCAT
CGGCTCGAGGTTTCAC ACTGGGCCTGGAGTGTAGT (SEQ ID NO: 49601) (SEQ ID NO:
49602) (SEQ ID NO: 49603) hCV11407883 C/G CTCCTGAAAGGGTTGAACTC
TCCTGAAAGGGTTGAACTG CAACTCCTGGGCTGAATG (SEQ ID NO: 49604) (SEQ ID
NO: 49605) (SEQ ID NO: 49606) hCV11514490 A/C
ACACATTGGAGAAAGACCTATTT CACATTGGAGAAAGACCTATTG GCAAGCGAGAAAACTGTGT
(SEQ ID NO: 49607) (SEQ ID NO: 49608) (SEQ ID NO: 49609)
hCV11559107 A/G TGAGATTTTGAAGACATCTGGTA GAGATTTTGAAGACATCTGGTG
CTGAATGCAAGCTGATGACT (SEQ ID NO: 49610) (SEQ ID NO: 49611) (SEQ ID
NO: 49612) hCV11597077 A/C GAAGTTCTTACCACACTGACTACA
GAAGTTCTTACCACACTGACTACC AATAACTGTGGGAAAATACTTAACAC (SEQ ID NO:
49613) (SEQ ID NO: 49614) (SEQ ID NO: 49615) hCV11600233 G/T
GCAGAGCATTGTGTTCG CGCAGAGCATTGTGTTCT GGTATCTGCAAGGATGAGAAAC (SEQ ID
NO: 49616) (SEQ ID NO: 49617) (SEQ ID NO: 49618) hCV1166773 G/C
CCTTTTAGGGTTTTCTGATTATG CCTTTTAGGGTTTTCTGATTATC
CAGACGAGAAACCAGAATGAT (SEQ ID NO: 49619) (SEQ ID NO: 49620) (SEQ ID
NO: 49621) hCV11681250 A/G TTTGCAAAGAACTTGATTTCTT
TTTGCAAAGAACTTGATTTCTC TCCAGTGCAGCATTTACCTA (SEQ ID NO: 49622) (SEQ
ID NO: 49623) (SEQ ID NO: 49624) hCV11688904 A/G
GGCTTCTACCCTCTGGAGA GCTTCTACCCTCTGGAGG CCACTTCTGGAAGGTTCTGTA (SEQ
ID NO: 49625) (SEQ ID NO: 49626) (SEQ ID NO: 49627) hCV11690571 A/G
CATCCAGAGGAAGCATGA ATCCAGAGGAAGCATGG TTGTGCTGGGAGATCTGAG (SEQ ID
NO: 49628) (SEQ ID NO: 49629) (SEQ ID NO: 49630) hCV11691179 A/G
GTGTGGCGGAGCAGT TGTGGCGGAGCAGC CCCCGGCGACCTATAG (SEQ ID NO: 49631)
(SEQ ID NO: 49632) (SEQ ID NO: 49633) hCV11691237 G/T
TCACGGTGCTGTCCG CCTCACGGTGCTGTCCT GCTTTGCCCTGCATTTCT (SEQ ID NO:
49634) (SEQ ID NO: 49635) (SEQ ID NO: 49636) hCV11720402 C/T
TGGGAAATTCAAGGCG CTGGGAAATTCAAGGCA TTTAAGTCCTGGGTAAACTAAATAGA (SEQ
ID NO: 49637) (SEQ ID NO: 49638) (SEQ ID NO: 49639) hCV11735875 C/T
TGAGTTTGTATTTTCCAAGGAC ATGAGTTTGTATTTTCCAAGGAT
GCTCCATAGAAAGACAATTTACTG (SEQ ID NO: 49640) (SEQ ID NO: 49641) (SEQ
ID NO: 49642) hCV11758437 C/G TTGTGAAGCCCTAGATTTCC
TGTGAAGCCCTAGATTTCG TTGGCAAAGGAGAACACAA (SEQ ID NO: 49643) (SEQ ID
NO: 49644) (SEQ ID NO: 49645) hCV11917903 C/G AAACTGGTATGTGGGCG
AAAACTGGTATGTGGGCC TCCCCCTGACTCCTTACTT (SEQ ID NO: 49646) (SEQ ID
NO: 49647) (SEQ ID NO: 49648) hCV11972291 A/G TGTTGGCTGAGAGATAAGCTA
GTTGGCTGAGAGATAAGCTG CGTTGACATGGACTTTGAAGT (SEQ ID NO: 49649) (SEQ
ID NO: 49650) (SEQ ID NO: 49651) hCV11972326 C/G
TTCTTTTAAAGGATTGGTAAACTC TTCTTTTAAAGGATTGGTAAACTG
AGAGCAGAACGAGGTTTTATTT (SEQ ID NO: 49652) (SEQ ID NO: 49653) (SEQ
ID NO: 49654) hCV11976630 C/T AACTGAACGCAGGCCTC AACTGAACGCAGGCCTT
CATTCTGACCTCAACAACTTCA (SEQ ID NO: 49655) (SEQ ID NO: 49656) (SEQ
ID NO: 49657) hCV11976644 G/T TGCAGTCATAAATCTCATCAG
TTGCAGTCATAAATCTCATCAT AGCAATGGGCACTCAGTC (SEQ ID NO: 49658) (SEQ
ID NO: 49659) (SEQ ID NO: 49660) hCV11976652 A/G TGGGTCAGCCCAACAT
TGGGTCAGCCCAACAC TTGAAGAAGGAATGATCACTCTT (SEQ ID NO: 49661) (SEQ ID
NO: 49662) (SEQ ID NO: 49663) hCV12055895 C/T CGCACTTCTCCAGC
CCGCACTTCTCCAGT AGGCCATAAAGAGGCAGTAC (SEQ ID NO: 49664) (SEQ ID NO:
49665) (SEQ ID NO: 49666) hCV12064788 A/G TGGGTCAGCCCAACAT
TGGGTCAGCCCAACAC TTGAAGAAGGAATGATCACTCTT (SEQ ID NO: 49667) (SEQ ID
NO: 49668) (SEQ ID NO: 49669) hCV12074174 C/G AATTAGCAACATCATCCTTGG
AATTAGCAACATCATCCTTGC GCCAGCTCCATATTGAAGTAAT (SEQ ID NO: 49670)
(SEQ ID NO: 49671) (SEQ ID NO: 49672) hCV12074801 C/T
CACAGTGAATGGTGGGG TCACAGTGAATGGTGGGA AGCTGGGCTGGGTCTAGT (SEQ ID NO:
49673) (SEQ ID NO: 49674) (SEQ ID NO: 49675) hCV1231817 C/T
GCCAACTCCATCCG GGCCAACTCCATCCA CATCCGTCACCTCAGAGATG (SEQ ID NO:
49676) (SEQ ID NO: 49677) (SEQ ID NO: 49678) hCV1248029 A/G
TACCTGAAACTCTGACGCAT ACCTGAAACTCTGACGCAC TGTTTCCAGGTTCAATTTCA (SEQ
ID NO: 49679) (SEQ ID NO: 49680) (SEQ ID NO: 49681) hCV1253735 C/T
ACAATGTGAGGATCTTCATG CACAATGTGAGGATCTTCATA CACCCACATTGTGTGCATATA
(SEQ ID NO: 49682) (SEQ ID NO: 49683) (SEQ ID NO: 49684) hCV1283127
C/G CAGGCATGACATTGAAAC CAGGCATGACATTGAAAG CAGAATGTAGTCTCGATTCTTCTTC
(SEQ ID NO: 49685) (SEQ ID NO: 49686) (SEQ ID NO: 49687) hCV1283131
C/T CCCAGGCTAAGAACCTGAC CCCAGGCTAAGAACCTGAT CAAAGTGCTGAGCGTACTTG
(SEQ ID NO: 49688) (SEQ ID NO: 49689) (SEQ ID NO: 49690) hCV1347729
C/T TGGAGATGTTCACCTGGTC TGGAGATGTTCACCTGGTT GACAGGTTGTTGACATTTTACAA
(SEQ ID NO: 49691) (SEQ ID NO: 49692) (SEQ ID NO: 49693) hCV1347731
A/G AGCTCTTCCTTCTTCATCA GCTCTTCCTTCTTCATCG
TGAACTCTAGGAATCATTTGAAAAT (SEQ ID NO: 49694) (SEQ ID NO: 49695)
(SEQ ID NO: 49696) hCV1413258 A/G TAGGAGGGTGAAAAGTGGA
GGAGGGTGAAAAGTGGG GGCAGCGTGCTCAGAC (SEQ ID NO: 49697) (SEQ ID NO:
49698) (SEQ ID NO: 49699) hCV1468814 C/T ATCTTTGCCAATGATTTTATTAC
AATCTTTGCCAATGATTTTATTAT GAATCCAAACGATCCAGATAC (SEQ ID NO: 49700)
(SEQ ID NO: 49701) (SEQ ID NO: 49702) hCV1545307 A/G
CCCCCTTACCTTGGAAGA CCCCTTACCTTGGAAGG GGCAGTCGCTGGAGATTAT (SEQ ID
NO: 49703) (SEQ ID NO: 49704) (SEQ ID NO: 49705) hCV15760047 T/G
AGAAACACCTTCTGTGACTGA GAAACACCTTCTGTGACTGC CCCAACATCCTCATCTGTCT
(SEQ ID NO: 49706) (SEQ ID NO: 49707) (SEQ ID NO: 49708)
hCV15852026 A/G CCTTTGCATTCCTTAGCA CCTTTGCATTCCTTAGCG
GCCAGAGGCCAAGATGA (SEQ ID NO: 49709) (SEQ ID NO: 49710) (SEQ ID NO:
49711) hCV15867521 C/T CGTGTCCTTCCCAACG TCGTGTCCTTCCCAACA
GGAGAAGACCCTGGAATTCT (SEQ ID NO: 49712) (SEQ ID NO: 49713) (SEQ ID
NO: 49714) hCV15874455 C/T GGCTGCGATTCCG GTGGCTGCGATTCCA
GCAATGGGCATGATTTCA (SEQ ID NO: 49715) (SEQ ID NO: 49716) (SEQ ID
NO: 49717) hCV15876778 C/T GGCGATATTGGTGAGAAAC GGCGATATTGGTGAGAAAT
CTCCTTCCTCCCACTGTG (SEQ ID NO: 49718) (SEQ ID NO: 49719) (SEQ ID
NO: 49720) hCV15879463 C/T TTTTGTCCCAGTGCTGAG TTTTGTCCCAGTGCTGAA
TCTCCGGCCGCATAC (SEQ ID NO: 49721) (SEQ ID NO: 49722) (SEQ ID NO:
49723) hCV15881845 C/G ACAAAAGAATGTCCTTTCAGAC
ACAAAAGAATGTCCTTTCAGAG TCCTCATTGGAATGGATTTAT (SEQ ID NO: 49724)
(SEQ ID NO: 49725) (SEQ ID NO: 49726) hCV15888165 A/T
TGAGAGTTGGATCTGGCAA TGAGAGTTGGATCTGGCAT CCCAGGAACCCATATTTAGAA (SEQ
ID NO: 49727) (SEQ ID NO: 49728) (SEQ ID NO: 49729) hCV15941749 C/T
AGGCGGAGACAGC CAAGGCGGAGACAGT GGGCAGCAGGAAAGATCT (SEQ ID NO: 49730)
(SEQ ID NO: 49731) (SEQ ID NO: 49732) hCV15958164 C/G
ACTCCACTGGGAGAGGG ACTCCACTGGGAGAGGC CCACAGCCACATGGTATGT (SEQ ID NO:
49733) (SEQ ID NO: 49734) (SEQ ID NO: 49735) hCV15976147 C/G
CTAGCATTGAACTGAATGAGC CTAGCATTGAACTGAATGAGG CAGCCTGCGATGATGAT (SEQ
ID NO: 49736) (SEQ ID NO: 49737) (SEQ ID NO: 49738) hCV16006934 G/A
GGACCTGCTTTGGCG TGGACCTGCTTTGGCA CCTCGGTGGGTTTTCAAG (SEQ ID NO:
49739) (SEQ ID NO: 49740) (SEQ ID NO: 49741) hCV16006940 C/G
CGTCCACCTTCTCCAAG CGTCCACCTTCTCCAAC CCAGCGTTAGCATCTCATAC (SEQ ID
NO: 49742) (SEQ ID NO: 49743) (SEQ ID NO: 49744) hCV16021387 A/G
CCTCCACTTCCTGTAT CCTCCACTTCCTGTAC CCCATCCCACACTTTATTTTATAC (SEQ ID
NO: 49745) (SEQ ID NO: 49746) (SEQ ID NO: 49747) hCV16023642 C/T
TGCCTATGAATTGTCAACATC TGCCTATGAATTGTCAACATT ACTTCTGGCCAGCAATAAAT
(SEQ ID NO: 49748) (SEQ ID NO: 49749) (SEQ ID NO: 49750)
hCV16046615 A/T TTTAACAGATTCTGGAAGCATAGT TTAACAGATTCTGGAAGCATAGA
AGAGGAATCCAAAGACAAAGTTAT (SEQ ID NO: 49751) (SEQ ID NO: 49752) (SEQ
ID NO: 49753) hCV16062492 A/G CCTGGGATTTGGGGATT CCTGGGATTTGGGGATC
TGTGCCGAAGTGAAGAAGTC (SEQ ID NO: 49754) (SEQ ID NO: 49755) (SEQ ID
NO: 49756) hCV16094684 G/C TGTGGCTTCTTTTCAGAGC TGTGGCTTCTTTTCAGAGG
GGTAACAGGCACGGAAGTAT (SEQ ID NO: 49757) (SEQ ID NO: 49758) (SEQ ID
NO: 49759) hCV16135142 C/G CTCCTCCTGCAGATCACTC TCCTCCTGCAGATCACTG
CCAAGAAGCCAGCTCATTTA (SEQ ID NO: 49760) (SEQ ID NO: 49761) (SEQ ID
NO: 49762) hCV16135464 C/T CGACTCCTCCTCAGCCC CGACTCCTCCTCAGCCT
TGCAGCCACGCAGAAA (SEQ ID NO: 49763) (SEQ ID NO: 49764) (SEQ ID NO:
49765) hCV16142950 A/G CAAAGCACTTTCATGTACATTATT
CAAAGCACTTTCATGTACATTATC CCTAAGCCCAGATTTCTACTCT (SEQ ID NO: 49766)
(SEQ ID NO: 49767) (SEQ ID NO: 49768) hCV16166772 A/C
CGAGACTTCCTGCTACGTTT CGAGACTTCCTGCTACGTTG CCCATTACCTGGCTTAGTATCTG
(SEQ ID NO: 49769) (SEQ ID NO: 49770) (SEQ ID NO: 49771)
hCV16194374 T/C GAGGATCCTGAACTCCAA GAGGATCCTGAACTCCAG
CGAGGAAGAGGACTGAATGA (SEQ ID NO: 49772) (SEQ ID NO: 49773) (SEQ ID
NO: 49774) hCV16229390 G/T CTGGGAAGCTTCTGGAC CTGGGAAGCTTCTGGAA
CTTTAAAGCCTGATTCTTGACAT (SEQ ID NO: 49775) (SEQ ID NO: 49776) (SEQ
ID NO: 49777) hCV163035 C/T GGAAGTGACAACACAAAACC
CGGAAGTGACAACACAAAACT CCGCCCAGGATTCTCTA (SEQ ID NO: 49778) (SEQ ID
NO: 49779) (SEQ ID NO: 49780) hCV1653105 C/T CCTGGAACTTTGATTGTGATAC
CCTGGAACTTTGATTGTGATAT TCTCCCGCCTTACTCTGTTA
(SEQ ID NO: 49781) (SEQ ID NO: 49782) (SEQ ID NO: 49783) hCV1654841
A/C AAACGCAGGGATTGGTTA AACGCAGGGATTGGTTC CATGTGCCTCTCTTGGTATCT (SEQ
ID NO: 49784) (SEQ ID NO: 49785) (SEQ ID NO: 49786) hCV1671515 C/T
GGTGAGATAGTCCAGAAAGC GGGTGAGATAGTCCAGAAAGT GGGCCGAGGTCATCTT (SEQ ID
NO: 49787) (SEQ ID NO: 49788) (SEQ ID NO: 49789) hCV1709713 A/G
GCCCCATCTTGCTGAT GCCCCATCTTGCTGAC CCGGGTTTTTGAGAAGTAGAT (SEQ ID NO:
49790) (SEQ ID NO: 49791) (SEQ ID NO: 49792) hCV1724443 A/G
CCGCCTCGGTCGTT CCGCCTCGGTCGTC GCAATCGTGGAAGATCAGATA (SEQ ID NO:
49793) (SEQ ID NO: 49794) (SEQ ID NO: 49795) hCV1773247 C/T
CCAGCATAGGTGCAAACC ACCAGCATAGGTGCAAACT GAGTACTGCCTGTTCCTGATAC (SEQ
ID NO: 49796) (SEQ ID NO: 49797) (SEQ ID NO: 49798) hCV1815793 G/T
CATTTTTCAACTACCTTTCTGTG TCATTTTTCAACTACCTTTCTGTT
GGTGAGGTTGATGAAAAGAGA (SEQ ID NO: 49799) (SEQ ID NO: 49800) (SEQ ID
NO: 49801) hCV1839329 C/G AGGGTTTCTCCTCTGTATGAC
AGGGTTTCTCCTCTGTATGAG GAATGGCCAGTTAAAAGAATCT (SEQ ID NO: 49802)
(SEQ ID NO: 49803) (SEQ ID NO: 49804) hCV1844607 C/T
GCTCTCTAGCTGTGATGCC AGCTCTCTAGCTGTGATGCT TGAGGAATGGGTTGATGAC (SEQ
ID NO: 49805) (SEQ ID NO: 49806) (SEQ ID NO: 49807) hCV2004708 A/C
CATTGCTTTCCTAGGTGATAT CATTGCTTTCCTAGGTGATAG TTCTTCAGGGAACATTTGTATG
(SEQ ID NO: 49808) (SEQ ID NO: 49809) (SEQ ID NO: 49810) hCV204710
A/G TTTGAGTGTTGCTGGAACA TTGAGTGTTGCTGGAACG TCGCCTCCCTCACTGAC (SEQ
ID NO: 49811) (SEQ ID NO: 49812) (SEQ ID NO: 49813) hCV2083657 G/T
CTCGGATGGTGTTGGTAC CTCGGATGGTGTTGGTAA TGTGGTACAGCAGTCACTAAGA (SEQ
ID NO: 49814) (SEQ ID NO: 49815) (SEQ ID NO: 49816) hCV2095401 C/G
CTGTACAGCCCCTGAAAG CTGTACAGCCCCTGAAAC AGCAGTCCTGAGTTCTTTAAGAG (SEQ
ID NO: 49817) (SEQ ID NO: 49818) (SEQ ID NO: 49819) hCV2104738 C/T
CAGGCGGAAAACTCTCTG TCAGGCGGAAAACTCTCTA TCAAACTCTCCTCAGATGTTACAG
(SEQ ID NO: 49820) (SEQ ID NO: 49821) (SEQ ID NO: 49822) hCV2153710
A/G GGGTATCACCCTTGGATAAA GGGTATCACCCTTGGATAAG TCCCAGACTGCTTTGTAGATG
(SEQ ID NO: 49823) (SEQ ID NO: 49824) (SEQ ID NO: 49825) hCV216064
A/G TTTATTTTTCAGCAACACTTGAT TTTATTTTTCAGCAACACTTGAC
GGATGTCCTGACAGAAGAAAG (SEQ ID NO: 49826) (SEQ ID NO: 49827) (SEQ ID
NO: 49828) hCV2190540 A/G AAAGTGCTGGGATTATAGTCATA
AAGTGCTGGGATTATAGTCATG CAAATACTCAGCAACCAAAAGTC (SEQ ID NO: 49829)
(SEQ ID NO: 49830) (SEQ ID NO: 49831) hCV22273515 C/G
TGTGGCTTCTTTTCAGAGC TGTGGCTTCTTTTCAGAGG GGTAACAGGCACGGAAGTAT (SEQ
ID NO: 49832) (SEQ ID NO: 49833) (SEQ ID NO: 49834) hCV2250399 A/C
TGAAAACTCAGTCCAAGTCCTA GAAAACTCAGTCCAAGTCCTC CCTTATTGCCCGTTTAACAT
(SEQ ID NO: 49835) (SEQ ID NO: 49836) (SEQ ID NO: 49837) hCV2259574
A/T AATGTGGACACTGAAGAGACA CAATGTGGACACTGAAGAGACT
CATCACAGGGCAGAGTTTTAG (SEQ ID NO: 49838) (SEQ ID NO: 49839) (SEQ ID
NO: 49840) hCV2437234 G/A ATGCTGCCTGAGTCACAC ATGCTGCCTGAGTCACAT
TGTTCATTCAACAAGTCTTTATTG (SEQ ID NO: 49841) (SEQ ID NO: 49842) (SEQ
ID NO: 49843) hCV2438216 A/G GCCCACTGTCCCCA CCCACTGTCCCCG
CAGAGCCCCACAGTCTTT (SEQ ID NO: 49844) (SEQ ID NO: 49845) (SEQ ID
NO: 49846) hCV2438322 C/T GGTCCTTGAGGGAAACG AGGTCCTTGAGGGAAACA
TCCACCTATCCGCCTCTAG (SEQ ID NO: 49847) (SEQ ID NO: 49848) (SEQ ID
NO: 49849) hCV2455742 C/T GCATCGCATCCAAGATG GAGCATCGCATCCAAGATA
CCTGGGAGGCTGATGAC (SEQ ID NO: 49850) (SEQ ID NO: 49851) (SEQ ID NO:
49852) hCV2479345 C/G CTCCTGAAAGGGTTGAACTC TCCTGAAAGGGTTGAACTG
CAACTCCTGGGCTGAATG (SEQ ID NO: 49853) (SEQ ID NO: 49854) (SEQ ID
NO: 49855) hCV2495658 C/T AACTAAAAATCAGTGAGATGAGTG
CAACTAAAAATCAGTGAGATGAGTA CACCTGACTCACTCTTCTTTACTT (SEQ ID NO:
49856) (SEQ ID NO: 49857) (SEQ ID NO: 49858) hCV25472930 A/C
CACCTGTGACCAGCAGCT CCTGTGACCAGCAGCG CAATCTGGAAGGAACATCAAG (SEQ ID
NO: 49859) (SEQ ID NO: 49860) (SEQ ID NO: 49861) hCV25472931 A/C
GGGCAGTAGGCTGACTT GGGCAGTAGGCTGACTG GCCGGAGCTCCTGTTT (SEQ ID NO:
49862) (SEQ ID NO: 49863) (SEQ ID NO: 49864) hCV25473136 C/T
ACTGAAAGCATTTTAATGGACTAC ACTGAAAGCATTTTAATGGACTAT
TCGTTTCATTTTCATCATTGTATA (SEQ ID NO: 49865) (SEQ ID NO: 49866) (SEQ
ID NO: 49867) hCV25474376 C/G CTCCTCCTGCAGATCACTC
TCCTCCTGCAGATCACTG CCAAGAAGCCAGCTCATTTA (SEQ ID NO: 49868) (SEQ ID
NO: 49869) (SEQ ID NO: 49870) hCV25592530 C/T CTGAGACAGCAGAGGC
TCTGAGACAGCAGAGGT GCCCAGGCTCTAGACACTAA (SEQ ID NO: 49871) (SEQ ID
NO: 49872) (SEQ ID NO: 49873) hCV25603489 C/T CCTGGACAAGCTCATTCG
TCCTGGACAAGCTCATTCA CCTGGGTGGCCACTCTA (SEQ ID NO: 49874) (SEQ ID
NO: 49875) (SEQ ID NO: 49876) hCV25606044 C/T GCTGGTTCCTGGGGG
GCTGGTTCCTGGGGA CCCACCATCAACAGGTACTT (SEQ ID NO: 49877) (SEQ ID NO:
49878) (SEQ ID NO: 49879) hCV25606714 A/G
AACTATAATGATAGCTGCTGTTAGTT AACTATAATGATAGCTGCTGTTAGTC
TTCACAACAAAGGCAGAGTAA (SEQ ID NO: 49880) (SEQ ID NO: 49881) (SEQ ID
NO: 49882) hCV25607005 A/G AGGCCTGGAAGAACATCT GCCTGGAAGAACATCC
GGGCCTCCTACCTGTCATA (SEQ ID NO: 49883) (SEQ ID NO: 49884) (SEQ ID
NO: 49885) hCV25608626 A/G GCCTCCAGCCGCTA CCTCCAGCCGCTG
CGGTCTTTGCTGGTACTGC (SEQ ID NO: 49886) (SEQ ID NO: 49887) (SEQ ID
NO: 49888) hCV25619242 A/C TCCTTTTCAAAGCCAACAA TCCTTTTCAAAGCCAACAC
TTTCTAACCATTTTAATACAGGTCATA (SEQ ID NO: 49889) (SEQ ID NO: 49890)
(SEQ ID NO: 49891) hCV25627747 A/T GGATGCCCCAAGGGT GGATGCCCCAAGGGA
CACTTCAGGTGTGTCAACAATG (SEQ ID NO: 49892) (SEQ ID NO: 49893) (SEQ
ID NO: 49894) hCV25627998 C/T TCTTTCAAAAACCACTGCC
ACTCTTTCAAAAACCACTGCT AGGGAAACTGCATTTCTTAATC (SEQ ID NO: 49895)
(SEQ ID NO: 49896) (SEQ ID NO: 49897) hCV25630843 G/T
CAGCCCCACGTGCC CAGCCCCACGTGCA GATGCTGATGGAACAAGTGA (SEQ ID NO:
49898) (SEQ ID NO: 49899) (SEQ ID NO: 49900) hCV25630844 C/T
CACCCATCTGAAGAGCAC CACCCATCTGAAGAGCAT GGCTTTGGTTGCTTTCTCT (SEQ ID
NO: 49901) (SEQ ID NO: 49902) (SEQ ID NO: 49903) hCV25630845 A/G
GAAGATGGAGAAATGCAGCT AGATGGAGAAATGCAGCC TGGCTGCCTTGAGTCAG (SEQ ID
NO: 49904) (SEQ ID NO: 49905) (SEQ ID NO: 49906) hCV25636098 A/G
CCCTCCAGGTTGTTACCA CCTCCAGGTTGTTACCG AGACTGCAGCAAAACTCTGATA (SEQ ID
NO: 49907) (SEQ ID NO: 49908) (SEQ ID NO: 49909) hCV25638257 A/G
TGATCCTTTTTAATCCAGGTT TGATCCTTTTTAATCCAGGTC TGGGCTCAGCTGAACTCTA
(SEQ ID NO: 49910) (SEQ ID NO: 49911) (SEQ ID NO: 49912)
hCV25640226 G/C GCGGTCTCCATGCC GCGGTCTCCATGCG GCCAGGTCCCATTTGAG
(SEQ ID NO: 49913) (SEQ ID NO: 49914) (SEQ ID NO: 49915)
hCV25641653 C/G CTCCCGCTTCTGGAAC CTCCCGCTTCTGGAAG
AATCACGGGATTTTCTTTAGAG (SEQ ID NO: 49916) (SEQ ID NO: 49917) (SEQ
ID NO: 49918) hCV25649928 G/A AAGACTTTTTCCAGGAATGC
GAAGACTTTTTCCAGGAATGT TTCTTAAAGGGTCATGAAACTTAC (SEQ ID NO: 49919)
(SEQ ID NO: 49920) (SEQ ID NO: 49921) hCV25650933 G/T
GCCGTGAACTCGCAG GCCGTGAACTCGCAT GGGTGTCACCAGGAAGAG (SEQ ID NO:
49922) (SEQ ID NO: 49923) (SEQ ID NO: 49924) hCV25653443 A/T
CTTCTGGGCTTTAAAAAGACTA TTCTGGGCTTTAAAAAGACTT
AAATGGTCAGGTAATTATGTTATCA (SEQ ID NO: 49925) (SEQ ID NO: 49926)
(SEQ ID NO: 49927) hCV25654189 C/G TGGTGAGACTCCAGGGTAG
TGGTGAGACTCCAGGGTAC TCAAAGCCTTGTGACATTCTA (SEQ ID NO: 49928) (SEQ
ID NO: 49929) (SEQ ID NO: 49930) hCV25654485 C/T CCATGACCTGCTCAACG
CCATGACCTGCTCAACA TTGCTGAGCCTGAACTCTG (SEQ ID NO: 49931) (SEQ ID
NO: 49932) (SEQ ID NO: 49933) hCV25742456 C/G GCGTCGCTGTCGAGG
GCGTCGCTGTCGAGC GCTTCCACTCCTTGAGGTATT (SEQ ID NO: 49934) (SEQ ID
NO: 49935) (SEQ ID NO: 49936) hCV25744634 C/T AGCCTCTCCTGGACCG
GAGCCTCTCCTGGACCA AGATCCAAAGGAGAAACACAA (SEQ ID NO: 49937) (SEQ ID
NO: 49938) (SEQ ID NO: 49939) hCV25745882 C/A TCGGGCTTGCACAAAG
TCGGGCTTGCACAAAT GGCGGCCTTTCTGAGT (SEQ ID NO: 49940) (SEQ ID NO:
49941) (SEQ ID NO: 49942) hCV25745992 G/T GGGGTTGATGTGGGATC
TGGGGTTGATGTGGGATA AACTCCCCAAAACAAAGATCT (SEQ ID NO: 49943) (SEQ ID
NO: 49944) (SEQ ID NO: 49945) hCV25747046 A/G GCTGTGACGCTTGTCAA
GCTGTGACGCTTGTCAG GATCTGCGCCCTGGAC (SEQ ID NO: 49946) (SEQ ID NO:
49947) (SEQ ID NO: 49948) hCV25747791 C/G CACTGCTGAGCCCTGAG
CACTGCTGAGCCCTGAC CACGTTTCGTCTGCTTTTACT (SEQ ID NO: 49949) (SEQ ID
NO: 49950) (SEQ ID NO: 49951) hCV25751699 C/T TGACTCAACTCCCAAGGG
CTGACTCAACTCCCAAGGA CGGTTCTGCTGTGAGTGAT (SEQ ID NO: 49952) (SEQ ID
NO: 49953) (SEQ ID NO: 49954) hCV25755336 A/G
CAGTGAAGCCTTTATTGTAAGTACT AGTGAAGCCTTTATTGTAAGTACC
CAGCGTTGAGTCTTTCTTTACTT (SEQ ID NO: 49955) (SEQ ID NO: 49956) (SEQ
ID NO: 49957) hCV25755889 G/A AATATTCTCCCAGCATTGTTC
AATATTCTCCCAGCATTGTTT GTTTTGGAGTCAGAAGATTGTATTA (SEQ ID NO: 49958)
(SEQ ID NO: 49959) (SEQ ID NO: 49960) hCV25756622 C/G
AGCAGCACTGTACCTGTCTG GTAGCAGCACTGTACCTGTCTC TGGCTTTGCACTTTCACAT
(SEQ ID NO: 49961) (SEQ ID NO: 49962) (SEQ ID NO: 49963)
hCV25759203 C/T AGATTCTGGTCCTCTTATTGATAC AGATTCTGGTCCTCTTATTGATAT
AAAAAGTTCTTGACAAGTTATTATGAG (SEQ ID NO: 49964) (SEQ ID NO: 49965)
(SEQ ID NO: 49966) hCV25762283 G/T CCCGTCCGCGCAG CCCGTCCGCGCAT
TCCGGCATGTTCATCTCT (SEQ ID NO: 49967) (SEQ ID NO: 49968) (SEQ ID
NO: 49969) hCV25768636 A/G AGAATTTGGCCACAAAGAGT AATTTGGCCACAAAGAGC
CCCCGCCAGACATCTT (SEQ ID NO: 49970) (SEQ ID NO: 49971) (SEQ ID NO:
49972) hCV25771405 A/T CACAGAGCAGGAAGAGCA TCACAGAGCAGGAAGAGCT
CAGGAAGAAGTTTCATCTGTGAT (SEQ ID NO: 49973) (SEQ ID NO: 49974) (SEQ
ID NO: 49975) hCV25922909 C/T GACATCACAGGGATGAAGG
TGACATCACAGGGATGAAGA AAGGATGTGTCTTGAATATGTATGT (SEQ ID NO: 49976)
(SEQ ID NO: 49977) (SEQ ID NO: 49978) hCV25924724 C/T
GCGGCACCACCTGAC GCGGCACCACCTGAT CGGATTTCCTAGCTTCTCAACTA (SEQ ID NO:
49979) (SEQ ID NO: 49980) (SEQ ID NO: 49981) hCV25926376 A/G
GTGGTGGGGGAGCA TGGTGGGGGAGCG GCAGCCTAGGGTGAACAT (SEQ ID NO: 49982)
(SEQ ID NO: 49983) (SEQ ID NO: 49984) hCV25930645 G/A
AGTTTTCCCCTTGATCATAC AGTTTTCCCCTTGATCATAT CTGTTTGGGACCAAGAATTC (SEQ
ID NO: 49985) (SEQ ID NO: 49986) (SEQ ID NO: 49987) hCV25932834 A/G
GTGCTTCCACTTTAAATTTCTTAT GTGCTTCCACTTTAAATTTCTTAC
GCCAATGTCACATTCACTGTA (SEQ ID NO: 49988) (SEQ ID NO: 49989) (SEQ ID
NO: 49990) hCV25933676 G/T AGCTCATTCGCCACATAC AGCTCATTCGCCACATAA
GTTTTCCTTGTTTCAGATTTAGTG (SEQ ID NO: 49991) (SEQ ID NO: 49992) (SEQ
ID NO: 49993)
hCV25934391 A/G GATGCAGGAAATAAGACAATAATA TGCAGGAAATAAGACAATAATG
AGAAAGTCCAATAAAAATCTGAACT (SEQ ID NO: 49994) (SEQ ID NO: 49995)
(SEQ ID NO: 49996) hCV25940434 A/G GCTTTGGTCGCACAGTGT
CTTTGGTCGCACAGTGC CACAAATGGAAAGGTAAATGAC (SEQ ID NO: 49997) (SEQ ID
NO: 49998) (SEQ ID NO: 49999) hCV25942539 G/A GGATCCGACCGTTGAG
GGATCCGACCGTTGAA TCATTTTGAACTCATTTTTTCTAGA (SEQ ID NO: 50000) (SEQ
ID NO: 50001) (SEQ ID NO: 50002) hCV25953007 C/T CCAGGTCCGAGGATCAAC
CCAGGTCCGAGGATCAAT CAAGCCCTCATTTCACCA (SEQ ID NO: 50003) (SEQ ID
NO: 50004) (SEQ ID NO: 50005) hCV25953077 A/C TGACCGGCTTGTAGGACT
GACCGGCTTGTAGGACG CCTTATCACCCCTTTCTCAG (SEQ ID NO: 50006) (SEQ ID
NO: 50007) (SEQ ID NO: 50008) hCV25958453 A/G
AAGTTCCTCTGTTTTGTGTGTT AAGTTCCTCTGTTTTGTGTGTC
CCTCAAATGCCTACCTGATAAT (SEQ ID NO: 50009) (SEQ ID NO: 50010) (SEQ
ID NO: 50011) hCV25960573 A/G TGCTGGAGGAGTCACTTGT
GCTGGAGGAGTCACTTGC GCAAAATGCCCTTCAATG (SEQ ID NO: 50012) (SEQ ID
NO: 50013) (SEQ ID NO: 50014) hCV25967527 T/C CAGCCAGATGGAAGCATT
CAGCCAGATGGAAGCATC ACCAAGTCAGAGAATGACATAGAT (SEQ ID NO: 50015) (SEQ
ID NO: 50016) (SEQ ID NO: 50017) hCV25972265 C/A
GAGCCAGTGTAACACACATG GAGCCAGTGTAACACACATT GAGACTCTGGCATGCTAACTC
(SEQ ID NO: 50018) (SEQ ID NO: 50019) (SEQ ID NO: 50020)
hCV25972553 C/T GTAGAATAAGATGACCACAATCG CGTAGAATAAGATGACCACAATCA
TGTTTCACTGGTGATTCTTCTACT (SEQ ID NO: 50021) (SEQ ID NO: 50022) (SEQ
ID NO: 50023) hCV25983354 T/G CCAGCTTCTAATCCAAAATT
CCAGCTTCTAATCCAAAATG TTCAATGGCTTCAGCAACTAT (SEQ ID NO: 50024) (SEQ
ID NO: 50025) (SEQ ID NO: 50026) hCV25984541 G/A GGAGGCTGGAACTTCG
TGGAGGCTGGAACTTCA CCTCAATACCCTGTCTTAGATTGT (SEQ ID NO: 50027) (SEQ
ID NO: 50028) (SEQ ID NO: 50029) hCV25992555 A/G AACCATCCTGTCCTTCCA
ACCATCCTGTCCTTCCG CCCCCCATTCCTCAAG (SEQ ID NO: 50030) (SEQ ID NO:
50031) (SEQ ID NO: 50032) hCV25993353 A/G TACCAGAGATGATGCCGA
CCAGAGATGATGCCGG CCCCTCGCCACAGTC (SEQ ID NO: 50033) (SEQ ID NO:
50034) (SEQ ID NO: 50035) hCV25996731 C/T CAACCCCTGTTCCTCTG
CCAACCCCTGTTCCTCTA GTGAGCAGGGAGAGAATCTC (SEQ ID NO: 50036) (SEQ ID
NO: 50037) (SEQ ID NO: 50038) hCV2619261 G/T CTGAGTTCTGATTTCACACG
CCTGAGTTCTGATTTCACACT AAGCTGGGTGGACTTTAGATAC (SEQ ID NO: 50039)
(SEQ ID NO: 50040) (SEQ ID NO: 50041) hCV2628820 A/C
CATCCTCCCAGCTACATGA ATCCTCCCAGCTACATGC GGACCTCCTGCCACTTG (SEQ ID
NO: 50042) (SEQ ID NO: 50043) (SEQ ID NO: 50044) hCV2744375 G/T
AAGCTATTTGTGGGTTGTATTTC TTAAGCTATTTGTGGGTTGTATTTA
CTGAGATGGAAATCAACAGAATATA (SEQ ID NO: 50045) (SEQ ID NO: 50046)
(SEQ ID NO: 50047) hCV2926821 C/T CGTCCATCCATTCATCTCAC
CGTCCATCCATTCATCTCAT CACCATCCCCACACAACT (SEQ ID NO: 50048) (SEQ ID
NO: 50049) (SEQ ID NO: 50050) hCV2936823 C/T GGCGCACTCGTCATTG
GGCGCACTCGTCATTA CACCAGCGGGAAGTCTT (SEQ ID NO: 50051) (SEQ ID NO:
50052) (SEQ ID NO: 50053) hCV2950320 C/T TCCTTACCGGCATCG
CTCCTTACCGGCATCA CACAGAGGCTGAACTTTGTAAAC (SEQ ID NO: 50054) (SEQ ID
NO: 50055) (SEQ ID NO: 50056) hCV2978734 C/G GGTCACCCTCCAATACAATAAC
GGTCACCCTCCAATACAATAAG TGACTTGCAATGGAAAGAGAC (SEQ ID NO: 50057)
(SEQ ID NO: 50058) (SEQ ID NO: 50059) hCV2986466 A/G
TGCAGGCAGAGGAAGAT TGCAGGCAGAGGAAGAC TGCCTTTCAGATCCTTTCTACT (SEQ ID
NO: 50060) (SEQ ID NO: 50061) (SEQ ID NO: 50062) hCV2995653 A/G
GGGAATTGGACAGTATGTGT GGAATTGGACAGTATGTGC CCTACCCTCATTGTGTGACA (SEQ
ID NO: 50063) (SEQ ID NO: 50064) (SEQ ID NO: 50065) hCV3015606 C/T
GGAGAAAAGAAGTGTGGGAC GGAGAAAAGAAGTGTGGGAT TCTTTGGGCAGAGATTCTGT (SEQ
ID NO: 50066) (SEQ ID NO: 50067) (SEQ ID NO: 50068) hCV3026486 C/T
GGCTGATGGTCCTGGTG AGGCTGATGGTCCTGGTA GCTAAAACAGCAAAATGTGTCTT (SEQ
ID NO: 50069) (SEQ ID NO: 50070) (SEQ ID NO: 50071) hCV3052660 A/G
CACCCTGTGATGGAAAGTAGTA CCCTGTGATGGAAAGTAGTG TGGTGATGGTGACTGTGACT
(SEQ ID NO: 50072) (SEQ ID NO: 50073) (SEQ ID NO: 50074) hCV3076433
C/T ACTGGAGGGCCACC CACTGGAGGGCCACT TGGGTAACTGCATTGACAAA (SEQ ID NO:
50075) (SEQ ID NO: 50076) (SEQ ID NO: 50077) hCV3151199 A/G
CGTACGTACCATTTCCCT CGTACGTACCATTTCCCC CAGGCATCCCTGAAGAACTA (SEQ ID
NO: 50078) (SEQ ID NO: 50079) (SEQ ID NO: 50080) hCV3191771 A/G
GTTGTCATTGATGTCCAAAAT GTTGTCATTGATGTCCAAAAC GGAGCTGGTGCTAGACAAAC
(SEQ ID NO: 50081) (SEQ ID NO: 50082) (SEQ ID NO: 50083) hCV3226838
A/G TGTCCCTTAACTGCTCTCA GTCCCTTAACTGCTCTCG GGGAGCAGTTTGAACTTCTG
(SEQ ID NO: 50084) (SEQ ID NO: 50085) (SEQ ID NO: 50086) hCV3233692
A/G GGAAGGGTCCCGTGAA GGAAGGGTCCCGTGAG TGACCCCTTTGTTGTGAGTC (SEQ ID
NO: 50087) (SEQ ID NO: 50088) (SEQ ID NO: 50089) hCV3246662 C/T
GCCGGCTTCTTCCG CAGCCGGCTTCTTCCA GCACGGCCTTTGAGTATCTT (SEQ ID NO:
50090) (SEQ ID NO: 50091) (SEQ ID NO: 50092) hCV3248144 C/T
ACCATGTAGTGGAGTGG TCACCATGTAGTGGAGTGA CGTGACCCAGCTATTCATT (SEQ ID
NO: 50093) (SEQ ID NO: 50094) (SEQ ID NO: 50095) hCV3266627 C/G
TCTGCCAGTGCTGGTG TTCTGCCAGTGCTGGTC GGCCTCGGTGATCAACTT (SEQ ID NO:
50096) (SEQ ID NO: 50097) (SEQ ID NO: 50098) hCV3274630 A/G
TCCTTCACGCAGAGCA CCTTCACGCAGAGCG AGGCAGAAAGCTTTCTTGAG (SEQ ID NO:
50099) (SEQ ID NO: 50100) (SEQ ID NO: 50101) hCV3277068 C/T
AGATGTTACAACTTGATCAGTCG CAGATGTTACAACTTGATCAGTCA CGGCAGGATGGTTCTGTA
(SEQ ID NO: 50102) (SEQ ID NO: 50103) (SEQ ID NO: 50104) hCV3293859
A/G GTGGCGGGAGGTGAA GTGGCGGGAGGTGAG TGACTCACCCACATGACAGT (SEQ ID
NO: 50105) (SEQ ID NO: 50106) (SEQ ID NO: 50107) hCV3293876 C/T
CAGTCAGATGCCAGAGG CCAGTCAGATGCCAGAGA CCATGGCCACGGATTAC (SEQ ID NO:
50108) (SEQ ID NO: 50109) (SEQ ID NO: 50110) hCV443471 C/T
TGTGAGTACGGAACTGCTTAC TGTGAGTACGGAACTGCTTAT TGTGTGCCCTTCTTAAGTGTA
(SEQ ID NO: 50111) (SEQ ID NO: 50112) (SEQ ID NO: 50113) hCV478645
A/C GCACCACTTCATCAATTAGGTA GCACCACTTCATCAATTAGGTC
GGGATGCCTAATCACTCTATCT (SEQ ID NO: 50114) (SEQ ID NO: 50115) (SEQ
ID NO: 50116) hCV549404 A/G ACCTTGGCTCAGTATACCTACA
CCTTGGCTCAGTATACCTACG CCAGCACATTAAAATTGATGAT (SEQ ID NO: 50117)
(SEQ ID NO: 50118) (SEQ ID NO: 50119) hCV549896 A/G
AATCAGAACCCATCACAAT AATCAGAACCCATCACAAC GCCGGATGAAGCAATAGA (SEQ ID
NO: 50120) (SEQ ID NO: 50121) (SEQ ID NO: 50122) hCV589914 C/G
GCGTACAGGAGAAGAAACAC GCGTACAGGAGAAGAAACAG GTTCTTCCCAGCCTGAGATA (SEQ
ID NO: 50123) (SEQ ID NO: 50124) (SEQ ID NO: 50125) hCV652816 C/T
TGGACGGTGCTCCC CTGGACGGTGCTCCT GGGAAGCCGTAGGAACAA (SEQ ID NO:
50126) (SEQ ID NO: 50127) (SEQ ID NO: 50128) hCV730311 C/T
CTGCTGCTCCAGGAATC CTGCTGCTCCAGGAATT AGCCATCCTGATTCTCTGAG (SEQ ID
NO: 50129) (SEQ ID NO: 50130) (SEQ ID NO: 50131) hCV7454533 C/T
CCTTTACATCAGGGACACG GCCTTTACATCAGGGACACA CGACTTACCAGTTTCATTCTGTATC
(SEQ ID NO: 50132) (SEQ ID NO: 50133) (SEQ ID NO: 50134) hCV7461647
A/G TGGGTCTGGTGCAGTCTACTA GGGTCTGGTGCAGTCTACTG
CCTTGTCTTGGAATTCAAACTATG (SEQ ID NO: 50135) (SEQ ID NO: 50136) (SEQ
ID NO: 50137) hCV7469249 C/T GCCCTTCCTTCCTCATC GCCCTTCCTTCCTCATT
AGGCTCTCCATTTTCTTTGTAG (SEQ ID NO: 50138) (SEQ ID NO: 50139) (SEQ
ID NO: 50140) hCV7499127 A/G CTCCAGCCTGTTGGTGA TCCAGCCTGTTGGTGG
GAACAGCACTGAAATCCTTTCT (SEQ ID NO: 50141) (SEQ ID NO: 50142) (SEQ
ID NO: 50143) hCV7513726 C/T TGGCACAGTTCCTGTGG CTGGCACAGTTCCTGTGA
TTAAAGGCAGTCTCTCTGTCTACT (SEQ ID NO: 50144) (SEQ ID NO: 50145) (SEQ
ID NO: 50146) hCV7514692 A/C GCCCCAACACCAGAGAA GCCCCAACACCAGAGAC
CCACCACCACTCACCAGA (SEQ ID NO: 50147) (SEQ ID NO: 50148) (SEQ ID
NO: 50149) hCV7586912 C/T TCCTACCCAGCTCTGCTC TCCTACCCAGCTCTGCTT
GGATGACGCCTCGTAGTCT (SEQ ID NO: 50150) (SEQ ID NO: 50151) (SEQ ID
NO: 50152) hCV773663 A/G GCCCTCTGCAGATCAT GCCCTCTGCAGATCAC
TTCCACCTCGTAGGTTGTCT (SEQ ID NO: 50153) (SEQ ID NO: 50154) (SEQ ID
NO: 50155) hCV7912052 A/G GCTGGCCTCCCCTTAT GCTGGCCTCCCCTTAC
CGCCGAGAAGGCATACA (SEQ ID NO: 50156) (SEQ ID NO: 50157) (SEQ ID NO:
50158) hCV7912061 G/A CCCTAGGCACAGCTGG GCCCTAGGCACAGCTGA
GCCTGGAACTTTGAGAAGTT (SEQ ID NO: 50159) (SEQ ID NO: 50160) (SEQ ID
NO: 50161) hCV795929 A/G CAAATAACTCACATCACACAA
CAAATAACTCACATCACACAG CCAGACACAGGTAGGTAAGA (SEQ ID NO: 50162) (SEQ
ID NO: 50163) (SEQ ID NO: 50164) hCV8301529 T/C CACTCCGGTCAGAATTCAA
CACTCCGGTCAGAATTCAG CAGCTGCTAAAAGGATTTCTGT (SEQ ID NO: 50165) (SEQ
ID NO: 50166) (SEQ ID NO: 50167) hCV8303385 C/T
CCTAAACTGGAAAGTTCTTCG ACCTAAACTGGAAAGTTCTTCA CTCTCCCTGTGGTTCATTTC
(SEQ ID NO: 50168) (SEQ ID NO: 50169) (SEQ ID NO: 50170) hCV8367900
C/T GGCAGTTCCTCCCCG GGCAGTTCCTCCCCA CAGCTCCTGGCTCAGCTAG (SEQ ID NO:
50171) (SEQ ID NO: 50172) (SEQ ID NO: 50173) hCV8714838 A/G
GGCCAGAAGGACAGGT GCCAGAAGGACAGGC GGAGTTGGACCACTTCTTCA (SEQ ID NO:
50174) (SEQ ID NO: 50175) (SEQ ID NO: 50176) hCV8719596 C/T
CTTTGTCCATTTTCATCTTCAG CTTTGTCCATTTTCATCTTCAA
TTTTATTAGGTGGATACTTTAATACTGAT (SEQ ID NO: 50177) (SEQ ID NO: 50178)
(SEQ ID NO: 50179) hCV874079 A/G TCTGCTCTGGGAACAAAA
TCTGCTCTGGGAACAAAG GCCTCCCGCATCATC (SEQ ID NO: 50180) (SEQ ID NO:
50181) (SEQ ID NO: 50182) hCV8766013 G/T GATCCTAGCAGTCACAGTTTG
GATCCTAGCAGTCACAGTTTT TCTCCAATGGCCAAAAATAC (SEQ ID NO: 50183) (SEQ
ID NO: 50184) (SEQ ID NO: 50185) hCV8827110 A/T
ATAGATTTCATATCCATTGTCGTAT TAGATTTCATATCCATTGTCGTAA
AAATGGTGGGTTTGAACCTA (SEQ ID NO: 50186) (SEQ ID NO: 50187) (SEQ ID
NO: 50188) hCV8844728 C/G GGCTGGTTCTTTTTCCTTG GGCTGGTTCTTTTTCCTTC
GCAGGTCTCTGAACAGCTCTATA (SEQ ID NO: 50189) (SEQ ID NO: 50190) (SEQ
ID NO: 50191) hCV8848880 C/A CTCCACCTTGCAGTCATAAC
TCCACCTTGCAGTCATAAA TGGGCACTCAGTCACAGA (SEQ ID NO: 50192) (SEQ ID
NO: 50193) (SEQ ID NO: 50194) hCV8848884 A/C
TATGTCAGAGCTCACAGAGACTT TGTCAGAGCTCACAGAGACTG TTTCAGGATGGGATTCACA
(SEQ ID NO: 50195) (SEQ ID NO: 50196) (SEQ ID NO: 50197) hCV8870139
G/T CCCCAGGGGGAACAC CCCCAGGGGGAACAA CCCAGTGGCTCAACAACTT (SEQ ID NO:
50198) (SEQ ID NO: 50199) (SEQ ID NO: 50200) hCV8915168 A/G
TGCAGCGTTCAGCAAA TGCAGCGTTCAGCAAG GCCGGCTGTTTCTCTAGG (SEQ ID NO:
50201) (SEQ ID NO: 50202) (SEQ ID NO: 50203) hCV8942480 A/G
GGCATACCACACCAGACAA GGCATACCACACCAGACAG AATAAATCACTGGATTTGTTTAGTTAG
(SEQ ID NO: 50204) (SEQ ID NO: 50205) (SEQ ID NO: 50206) hCV8954669
A/G GTGGAAAAATGGCTGAAGA TGGAAAAATGGCTGAAGG
TCAGGGCTCCTACACTTTAGAT (SEQ ID NO: 50207) (SEQ ID NO: 50208) (SEQ
ID NO: 50209) hCV9142770 A/C AGTAGGTGTTCAACAACCTGTT
GTAGGTGTTCAACAACCTGTG AAAGAGCATCAATTGGAAAAC (SEQ ID NO: 50210) (SEQ
ID NO: 50211) (SEQ ID NO: 50212) hCV9272397 A/G
CTTAGGAGAGGCTTGTCTGA TTAGGAGAGGCTTGTCTGG TTGGCACAGTGAGGATAATC (SEQ
ID NO: 50213) (SEQ ID NO: 50214) (SEQ ID NO: 50215) hCV9283503 C/G
AATGACATAAATACATACAAGACACAC AATGACATAAATACATACAAGACACAG
TTCCTGATGGGACAGAAATATA (SEQ ID NO: 50216) (SEQ ID NO: 50217) (SEQ
ID NO: 50218) hCV9484175 C/T GAAGAGCCACAAGCCTG GGAAGAGCCACAAGCCTA
GAGAGGCACTTTTGGTATTCA (SEQ ID NO: 50219) (SEQ ID NO: 50220) (SEQ ID
NO: 50221) hCV9487784 A/G AGGAGCCTCCAGGGAA AGGAGCCTCCAGGGAG
CAAGCAAGGAAATCAGTAACTTC (SEQ ID NO: 50222) (SEQ ID NO: 50223) (SEQ
ID NO: 50224) hCV9505893 A/G GCTCTGCAGCTCTTCAGACT
CTCTGCAGCTCTTCAGACC CCTGTTGCCACAGTGAGAA (SEQ ID NO: 50225) (SEQ ID
NO: 50226) (SEQ ID NO: 50227) hCV9692842 C/T TGTAATTGCCTGGAGCAC
TGTAATTGCCTGGAGCAT GGAAATAAGCATCAGGAACTAACTA (SEQ ID NO: 50228)
(SEQ ID NO: 50229) (SEQ ID NO: 50230)
TABLE-US-00004 TABLE 4 Typed in Discovery and Case Control Odds
Marker Replication? Study Genotyping Stratum Allele1 Freq Freq
Allelic p-value Ratio hCV25603489 yes Discovery Pool All T 3.50%
1.90% 0.045879259 1.88 hCV25603489 yes Replication, Probands Pool
All T 4.08% 2.38% 0.015767416 1.74 hCV25603489 yes Replication,
Probands Pool RF+ T 4.44% 2.45% 0.015226013 1.85 hCV2190540 yes
Discovery Pool Male G 39.81% 48.31% 0.032038947 0.71 hCV2190540 yes
Replication, All Cases Pool Male G 38.84% 51.43% 0.001493275 0.60
hCV2190540 yes Replication, Probands Pool Male G 40.00% 51.43%
0.019922507 0.63 hCV25472931 yes Discovery Pool LR-1SE C 16.93%
37.90% 0.023279092 0.33 hCV25472931 yes Replication, Probands Pool
LR-1SE C 20.62% 37.94% 0.037346491 0.42 hCV25940434 yes Discovery
Pool All G 0.81% 2.16% 0.023139332 0.37 hCV25940434 yes
Replication, All Cases Pool All G 0.40% 1.12% 0.021181706 0.36
hCV25940434 yes Replication, Probands Pool All G 0.33% 1.13%
0.029546939 0.29 hCV25940434 yes Replication, Probands Pool RF+ G
0.29% 1.08% 0.0471926 0.27 hCV8367900 yes Discovery Pool All T
66.19% 70.95% 0.029619811 0.80 hCV8367900 yes Replication, All
Cases Pool All T 64.26% 68.12% 0.016922593 0.84 hCV8367900 yes
Replication, Probands Pool All T 63.69% 68.05% 0.025163725 0.82
hCV8367900 yes Replication, All Cases Pool RF+ T 63.25% 68.00%
0.009428834 0.81 hCV8367900 yes Replication, Probands Pool RF+ T
63.27% 68.00% 0.024895419 0.81 hCV874079 yes Discovery Pool All A
15.98% 11.30% 0.002630751 1.49 hCV874079 yes Replication, All Cases
Individual All A 16.63% 14.15% 0.044029734 1.21 hCV25762283 yes
Discovery Pool All G 17.64% 86.27% 0.019475979 1.35 hCV25762283 yes
Replication, Probands Individual All G 20.82% 17.67% 0.049108027
1.23 hCV16021387 yes Discovery Individual All A 13.79% 8.84%
0.000659444 1.65 hCV16021387 yes Replication, All Cases Individual
All A 16.85% 8.32% 1.48936E-14 2.23 hCV16021387 yes Replication,
Probands Individual All A 15.77% 8.32% 6.11208E-09 2.06 hCV16021387
yes Replication, All Cases Individual RF+ A 17.60% 7.92%
3.45944E-15 2.48 hCV16021387 yes Replication, Probands Individual
RF+ A 16.49% 7.92% 1.48939E-09 2.30 hCV108175 yes Discovery Pool
All T 15.85% 19.78% 0.026791875 0.76 hCV108175 yes Replication, All
Cases Pool All T 17.58% 20.48% 0.028829558 0.83 hCV108175 yes
Replication, Probands Pool All T 16.31% 20.55% 0.007259321 0.75
hCV108175 yes Replication, All Cases Pool RF+ T 16.60% 20.61%
0.007705207 0.77 hCV108175 yes Replication, Probands Pool RF+ T
16.00% 20.61% 0.008210488 0.73 hCV1844607 yes Discovery Pool All T
12.19% 15.57% 0.039622016 0.75 hCV1844607 yes Replication, All
Cases Pool All T 12.80% 15.87% 0.009586655 0.78 hCV1844607 yes
Replication, Probands Pool All T 12.65% 16.02% 0.022379837 0.76
hCV1844607 yes Replication, All Cases Pool RF+ T 13.12% 16.23%
0.021858619 0.78 hCV1844607 yes Replication, Probands Pool RF+ T
12.20% 16.23% 0.010963771 0.72 hCV25638257 yes Discovery Pool
Female G 16.64% 23.28% 0.003019705 0.66 hCV25638257 yes
Replication, Probands Pool Female G 20.99% 25.12% 0.027378014 0.79
hCV3151199 yes Discovery Pool HR-1SE G 69.05% 43.12% 1.94576E-05
2.94 hCV3151199 yes Replication, Probands Pool HR-1SE G 72.71%
56.60% 1.30068E-05 2.04 hCV25649928 yes Discovery Pool All A 98.45%
99.45% 0.040341979 0.35 hCV25649928 yes Replication, All Cases Pool
All A 99.08% 99.65% 0.045951802 0.38 hCV25649928 yes Replication,
Probands Pool All A 98.88% 99.65% 0.017173535 0.31 hCV3026486 yes
Discovery Pool LR-1SE T 37.64% 59.54% 0.030436382 0.41 hCV3026486
yes Replication, Probands Pool LR-1SE T 26.60% 42.42% 0.044741533
0.49 hCV1653105 yes Discovery Individual All C 29.01% 34.85%
0.007506913 0.76 hCV1653105 yes Replication, All Cases Individual
All C 30.24% 35.34% 0.001405826 0.79 hCV1653105 yes Replication,
Probands Individual All C 30.78% 35.34% 0.017185142 0.81 hCV1653105
yes Replication, All Cases Individual RF+ C 30.62% 34.40%
0.031838297 0.84 hCV11405566 yes Discovery Individual All A 26.60%
30.93% 0.041544028 0.81 hCV11405566 yes Replication, All Cases
Individual All A 27.12% 30.67% 0.021269677 0.84 hCV11405566 yes
Replication, Probands Individual All A 26.95% 30.67% 0.046707226
0.83 hCV22273515 yes Discovery Individual All G 23.23% 28.18%
0.015154923 0.77 hCV22273515 yes Replication, All Cases Individual
All G 23.51% 28.40% 0.000960474 0.77 hCV22273515 yes Replication,
Probands Individual All G 23.22% 28.40% 0.003585905 0.76
hCV16094684 yes Discovery Pool All C 22.75% 28.31% 0.006184042 0.75
hCV16094684 yes Replication, All Cases Pool All C 24.19% 29.53%
0.000357769 0.76 hCV16094684 yes Replication, Probands Pool All C
23.45% 29.39% 0.000892585 0.74 hCV16094684 yes Replication,
Probands Pool RF+ C 24.00% 28.59% 0.022259259 0.79 hCV1347729 yes
Discovery Individual All T 28.95% 34.43% 0.011474103 0.78
hCV1347729 yes Replication, All Cases Individual All T 30.30%
35.15% 0.002292028 0.80 hCV1347729 yes Replication, Probands
Individual All T 30.89% 35.15% 0.026846383 0.82 hCV1347729 yes
Replication, All Cases Individual RF+ T 30.70% 34.22% 0.046776388
0.85 hCV1347731 yes Discovery Individual All A 29.01% 34.26%
0.01486531 0.78 hCV1347731 yes Replication, All Cases Individual
All A 30.15% 35.19% 0.001575757 0.80 hCV1347731 yes Replication,
Probands Individual All A 30.63% 35.19% 0.017010922 0.81 hCV1347731
yes Replication, All Cases Individual RF+ A 30.52% 34.27%
0.034841951 0.84 hCV15879463 yes Discovery Individual All T 23.18%
28.19% 0.014916897 0.77 hCV15879463 yes Replication, All Cases
Individual All T 23.36% 28.36% 0.000812578 0.77 hCV15879463 yes
Replication, Probands Individual All T 23.22% 28.36% 0.004088083
0.76 hCV12074174 yes Discovery Pool Female G 68.38% 60.83%
0.006622018 1.39 hCV12074174 yes Replication, All Cases Pool Female
G 68.73% 64.79% 0.032425238 1.19 hCV1166773 yes Discovery Pool All
C 88.02% 82.68% 0.001163769 1.54 hCV1166773 yes Replication,
Probands Individual RF+ C 87.01% 83.88% 0.0484668 1.29 hCV9505893
yes Discovery Pool All G 18.55% 14.10% 0.010827786 1.39 hCV9505893
yes Replication, All Cases Individual RF+ G 17.09% 14.34%
0.04491127 1.23 hCV2104738 yes Discovery Pool All T 14.97% 18.48%
0.036903661 0.78 hCV2104738 yes Replication, All Cases Pool All T
15.17% 23.27% 1.32407E-09 0.59 hCV2104738 yes Replication, Probands
Pool All T 15.00% 23.29% 2.69952E-07 0.58 hCV2104738 yes
Replication, All Cases Pool RF+ T 14.41% 23.02% 6.89913E-09 0.56
hCV2104738 yes Replication, Probands Pool RF+ T 14.76% 23.02%
2.90912E-06 0.58 hCV25627747 yes Discovery Pool All T 0.02% 0.65%
0.03100355 0.03 hCV25627747 yes Replication, All Cases Pool All T
0.11% 0.94% 0.000892469 0.11 hCV25627747 yes Replication, Probands
Pool All T 0.06% 0.95% 0.010446397 0.06 hCV25627747 yes
Replication, All Cases Pool RF+ T 0.00% 0.95% 0.000121254 0.00
hCV25627747 yes Replication, Probands Pool RF+ T 0.00% 0.95%
0.003981773 0.00 hCV8719596 yes Discovery Pool All T 99.45% 99.96%
0.03108557 0.07 hCV8719596 yes Replication, All Cases Pool All T
99.53% 99.93% 0.016485271 0.16 hCV8719596 yes Replication, Probands
Pool All T 99.43% 99.92% 0.017727182 0.13 hCV8719596 yes
Replication, All Cases Pool RF+ T 99.39% 99.91% 0.013757434 0.15
hCV8719596 yes Replication, Probands Pool RF+ T 99.32% 99.91%
0.017708019 0.13 hCV22274459 yes Discovery Pool All C 25.29% 18.74%
0.000596934 1.47 hCV22274459 yes Replication, All Cases Individual
All C 23.45% 20.05% 0.015722483 1.22 hCV22274459 yes Replication,
Probands Individual All C 23.65% 20.05% 0.030439024 1.23
hCV25768636 yes Discovery Pool All G 67.22% 72.47% 0.0142237 0.78
hCV25768636 yes Replication, All Cases Pool All G 66.35% 69.78%
0.032877444 0.85 hCV7912061 yes Discovery Pool All A 21.16% 26.51%
0.006073849 0.74 hCV7912061 yes Replication, All Cases Pool All A
23.69% 28.80% 0.000662293 0.77 hCV7912061 yes Replication, Probands
Pool All A 23.62% 29.01% 0.003015339 0.76 hCV7912061 yes
Replication, All Cases Pool RF+ A 24.60% 28.56% 0.01861363 0.82
hCV7912061 yes Replication, Probands Pool RF+ A 24.38% 28.56%
0.037181438 0.81 hCV7912052 yes Discovery Individual All A 27.30%
34.50% 0.000811571 0.71 hCV7912052 yes Replication, Probands Pool
All A 32.00% 36.59% 0.017247195 0.82 hCV7912052 yes Replication,
All Cases Pool All A 31.67% 36.31% 0.003991609 0.81 hCV25607005 yes
Discovery Individual All A 9.62% 6.26% 0.008008216 1.59 hCV25607005
yes Replication, All Cases Individual All A 9.23% 6.69% 0.005770604
1.42 hCV25607005 yes Replication, Probands Individual All A 8.84%
6.69% 0.04479743 1.35 hCV25607005 yes Replication, All Cases
Individual RF+ A 9.24% 6.80% 0.018517849 1.40 hCV25933676 yes
Discovery Pool All T 93.15% 95.72% 0.016620725 0.61 hCV25933676 yes
Replication, All Cases Pool All T 94.93% 96.50% 0.024061424 0.68
hCV25933676 yes Replication, Probands Pool All T 94.32% 96.49%
0.008746611 0.60 hCV9142770 yes Discovery Pool All C 35.44% 30.14%
0.014513671 1.27 hCV9142770 yes Replication, All Cases Pool All C
36.70% 31.10% 0.000545921 1.28 hCV9142770 yes Replication, Probands
Pool All C 36.53% 31.32% 0.007444197 1.26 hCV9142770 yes
Replication, All Cases Pool RF+ C 37.11% 30.44% 0.000220965 1.35
hCV9142770 yes Replication, Probands Pool RF+ C 36.99% 30.44%
0.001619195 1.34 hCV12074801 yes Discovery Pool All T 24.17% 19.13%
0.007582014 1.35 hCV12074801 yes Replication, All Cases Pool All T
24.79% 21.97% 0.046506951 1.17 hCV12074801 yes Replication,
Probands Pool All T 25.98% 22.12% 0.030906803 1.24 hCV12074801 yes
Replication, All Cases Pool RF+ T 25.90% 22.36% 0.02967123 1.21
hCV12074801 yes Replication, Probands Pool RF+ T 26.96% 22.36%
0.014951763 1.28 hCV11276786 yes Discovery Pool Male T 5.10% 9.92%
0.023537655 0.49 hCV11276786 yes Replication, All Cases Pool Male T
3.95% 10.30% 0.002104266 0.36 hCV25619242 yes Discovery Pool All A
16.28% 21.76% 0.0028552 0.70 hCV25619242 yes Replication, All Cases
Individual RF+ A 19.70% 23.60% 0.011436825 0.79 hCV25636098 yes
Discovery Pool All A 2.20% 4.19% 0.013585911 0.51 hCV25636098 yes
Replication, All Cases Individual All A 2.02% 3.78% 0.001966371
0.53 hCV25636098 yes Replication, All Cases Individual RF+ A 1.70%
3.96% 0.00033036 0.42 hCV25636098 yes Replication, Probands
Individual RF+ A 1.95% 3.96% 0.009345542 0.48 hCV8766013 yes
Discovery Pool All T 56.91% 52.34% 0.047506349 1.20 hCV8766013 yes
Replication, All Cases Pool All T 56.60% 51.78% 0.004073975 1.21
hCV8766013 yes Replication, Probands Pool All T 56.45% 51.62%
0.016391198 1.22 hCV8766013 yes Replication, All Cases Pool RF+ T
57.64% 51.68% 0.00182079 1.27 hCV8766013 yes Replication, Probands
Pool RF+ T 57.05% 51.68% 0.016870774 1.24 hCV8827110 yes Discovery
Pool All T 25.78% 35.94% 2.28375E-06 0.62 hCV8827110 yes
Replication, All Cases Pool All T 25.91% 31.36% 0.000351363 0.77
hCV8827110 yes Replication, Probands Pool All T 24.82% 31.18%
0.000572331 0.73 hCV8827110 yes Replication, All Cases Pool RF+ T
24.73% 30.88% 0.000290143 0.74 hCV8827110 yes Replication, Probands
Pool RF+ T 24.42% 30.88% 0.001089677 0.72 hCV11559107 yes Discovery
Pool All G 81.34% 85.75% 0.011035042 0.72 hCV11559107 yes
Replication, All Cases Pool All G 79.13% 84.63% 2.49654E-05 0.69
hCV11559107 yes Replication, Probands Pool All G 79.38% 84.74%
0.000543523
0.69 hCV11559107 yes Replication, All Cases Pool RF+ G 78.57%
84.06% 0.000245648 0.70 hCV11559107 yes Replication, Probands Pool
RF+ G 79.11% 84.06% 0.003761844 0.72 hCV25653443 yes Discovery Pool
female A 0.15% 1.52% 0.011378829 0.10 hCV25653443 yes Replication,
Probands Individual female A 0.13% 0.94% 0.027291851 0.14
hCV16046615 yes Discovery Pool All T 21.75% 25.84% 0.035953726 0.80
hCV16046615 yes Replication, All Cases Pool All T 22.46% 25.63%
0.027439695 0.84 hCV795929 yes Discovery Pool All G 14.21% 18.85%
0.006610958 0.71 hCV795929 yes Replication, All Cases Individual
All G 13.66% 16.17% 0.04112972 0.82 hCV795929 yes Replication,
Probands Individual All G 13.04% 16.17% 0.032069803 0.78 hCV3191771
yes Discovery Pool HR-2SE G 77.85% 85.67% 0.028624479 0.59
hCV3191771 yes Replication, Probands Pool HR-2SE G 71.95% 78.12%
0.025810501 0.72 hCV2083657 yes Discovery Pool All T 7.97% 5.33%
0.021882828 1.54 hCV2083657 yes Replication, All Cases Pool All T
7.33% 5.35% 0.01811205 1.40 hCV2083657 yes Replication, Probands
Pool All T 7.24% 5.35% 0.048866918 1.38 hCV2083657 yes Replication,
All Cases Pool RF+ T 7.09% 5.23% 0.047762772 1.38 hCV25755889 yes
Discovery Pool All A 99.30% 99.94% 0.038717379 0.09 hCV25755889 yes
Replication, All Cases Pool RF+ A 98.87% 99.60% 0.03980729 0.35
hCV2926821 yes Discovery Pool All T 52.19% 57.35% 0.026900588 0.81
hCV2926821 yes Replication, All Cases Pool All T 55.91% 61.41%
0.001014958 0.80 hCV2926821 yes Replication, All Cases Pool RF+ T
56.11% 61.22% 0.00629113 0.81 hCV652816 yes Discovery Pool All T
33.74% 29.10% 0.033450119 1.24 hCV652816 yes Replication, All Cases
Pool All T 32.00% 28.29% 0.01692692 1.19 hCV652816 yes Replication,
Probands Pool All T 32.07% 28.33% 0.045430523 1.19 hCV11972326 yes
Discovery Pool All G 20.90% 25.02% 0.033687969 0.79 hCV11972326 yes
Replication, All Cases Pool RF+ G 19.03% 23.33% 0.005565171 0.77
hCV11972326 yes Replication, Probands Pool RF+ G 18.40% 23.33%
0.007416424 0.74 hCV25756622 yes Discovery Pool All G 79.76% 75.79%
0.04105929 1.26 hCV25756622 yes Replication, All Cases Pool All G
80.84% 77.75% 0.024980353 1.21 hCV25756622 yes Replication,
Probands Pool All G 83.00% 77.85% 0.00178917 1.39 hCV25756622 yes
Replication, All Cases Pool RF+ G 81.99% 78.55% 0.022761669 1.24
hCV25756622 yes Replication, Probands Pool RF+ G 83.43% 78.55%
0.006642366 1.37 hCV7461647 yes Discovery Pool All G 5.72% 8.19%
0.037611465 0.68 hCV7461647 yes Replication, All Cases Pool RF+ G
6.82% 9.00% 0.03644323 0.74 hCV3266627 yes Discovery Pool HR-1SE C
31.56% 47.69% 0.009111669 0.51 hCV3266627 yes Replication, All
Cases Individual HR-1SE C 43.89% 50.17% 0.036753395 0.78 hCV3266627
yes Discovery Pool Onset <38 C 32.46% 45.57% 0.004692968 0.57
hCV3266627 yes Replication, Probands Individual Onset <38 C
42.68% 49.03% 0.039399438 0.77 hCV9487784 yes Discovery Pool All A
23.52% 12.72% 1.41814E-09 2.11 hCV9487784 yes Replication, All
Cases Individual All A 36.07% 14.15% 2.38499E-52 3.42 hCV9487784
yes Replication, Probands Individual All A 35.53% 14.15%
9.20159E-37 3.34 hCV9487784 yes Replication, All Cases Individual
RF+ A 38.61% 14.42% 2.07661E-50 3.73 hCV9487784 yes Replication,
Probands Individual RF+ A 38.18% 14.42% 2.02007E-36 3.67 hCV3248144
yes Discovery Pool HR-2SE T 17.03% 25.06% 0.048182229 0.61
hCV3248144 yes Replication, Probands Pool HR-2SE T 13.34% 20.09%
0.006003298 0.61 hCV25744634 yes Discovery Pool All T 2.87% 7.58%
2.63952E-06 0.36 hCV25744634 yes Replication, All Cases Individual
All T 3.65% 6.97% 1.21172E-05 0.51 hCV25744634 yes Replication,
Probands Individual All T 3.25% 6.97% 3.98118E-05 0.45 hCV25744634
yes Replication, All Cases Individual RF+ T 3.49% 6.81% 7.02219E-05
0.49 hCV25744634 yes Replication, Probands Individual RF+ T 3.13%
6.81% 0.000215344 0.44 hCV15760047 yes Discovery Pool All G 2.98%
4.81% 0.033393769 0.61 hCV15760047 yes Replication, All Cases Pool
All G 2.20% 4.46% 0.000180957 0.48 hCV15760047 yes Replication,
Probands Pool All G 2.37% 4.45% 0.007682849 0.52 hCV15760047 yes
Replication, All Cases Pool RF+ G 1.74% 4.45% 5.41433E-05 0.38
hCV15760047 yes Replication, Probands Pool RF+ G 1.93% 4.45%
0.001992502 0.42 hCV8301529 yes Discovery Pool All C 92.07% 94.55%
0.035029178 0.67 hCV8301529 yes Replication, All Cases Pool All C
91.78% 94.26% 0.004204353 0.68 hCV8301529 yes Replication, Probands
Pool All C 92.15% 94.27% 0.038345289 0.71 hCV8301529 yes
Replication, All Cases Pool RF+ C 91.99% 94.51% 0.009615307 0.67
hCV8301529 yes Replication, Probands Pool RF+ C 92.05% 94.51%
0.029291017 0.67 hCV25759203 yes Discovery Pool Female T 95.14%
97.64% 0.023252337 0.47 hCV25759203 yes Replication, All Cases Pool
Female T 94.99% 96.72% 0.026271509 0.64 hCV25747791 yes Discovery
Pool All G 99.59% 98.15% 0.002466592 4.54 hCV25747791 yes
Replication, All Cases Pool All G 99.76% 99.19% 0.021535469 3.36
hCV8303385 yes Discovery Individual All T 17.31% 13.35% 0.017853995
1.36 hCV8303385 yes Replication, All Cases Individual All T 16.91%
13.28% 0.002909867 1.33 hCV25650933 yes Discovery Individual All T
16.45% 11.36% 0.00167969 1.54 hCV25650933 yes Replication, All
Cases Individual All T 15.27% 11.83% 0.003020328 1.34 hCV25650933
yes Replication, Probands Individual All T 14.83% 11.83%
0.030003238 1.30 hCV25930645 yes Discovery Pool HR-2SE A 95.58%
99.95% 0.000881309 0.01 hCV25930645 yes Replication, Probands Pool
HR-2SE A 95.38% 98.28% 0.012998803 0.36 hCV2619261 yes Discovery
Pool All T 32.93% 38.68% 0.009817998 0.78 hCV2619261 yes
Replication, All Cases Pool All T 33.36% 39.27% 0.000271555 0.77
hCV2619261 yes Replication, Probands Pool All T 33.12% 39.63%
0.000916519 0.75 hCV2619261 yes Replication, All Cases Pool RF+ T
33.08% 39.04% 0.001080682 0.77 hCV2619261 yes Replication, Probands
Pool RF+ T 33.16% 39.04% 0.006093006 0.77 hCV2950320 yes Discovery
Pool Male T 14.36% 7.47% 0.007486426 2.08 hCV2950320 yes
Replication, All Cases Pool Male T 13.20% 6.35% 0.003257151 2.24
hCV2950320 yes Replication, Probands Pool Male T 14.26% 6.35%
0.005992173 2.45 hCV25934391 yes Discovery Pool HR-1SE G 72.83%
85.14% 0.011818004 0.47 hCV25934391 yes Replication, Probands Pool
HR-1SE G 80.50% 87.05% 0.018454692 0.61 hCV2744375 yes Discovery
Pool All T 88.63% 92.03% 0.015994155 0.67 hCV2744375 yes
Replication, All Cases Pool All T 89.61% 91.58% 0.043198675 0.79
hCV25972553 yes Discovery Pool All T 57.47% 52.42% 0.027015382 1.23
hCV25972553 yes Replication, All Cases Pool All T 55.69% 50.00%
0.000738409 1.26 hCV25972553 yes Replication, Probands Pool All T
55.79% 50.00% 0.004443393 1.26 hCV25972553 yes Replication, All
Cases Pool RF+ T 55.51% 49.34% 0.0012697 1.28 hCV25972553 yes
Replication, Probands Pool RF+ T 55.14% 49.34% 0.008110305 1.26
hCV25473136 yes Discovery Pool Male T 91.88% 83.43% 0.001172864
2.25 hCV25473136 yes Replication, All Cases Pool Male T 90.99%
81.36% 0.000374319 2.31 hCV25473136 yes Replication, Probands Pool
Male T 89.32% 81.36% 0.024670283 1.92 hCV1413258 yes Discovery Pool
Female G 82.09% 74.90% 0.001590237 1.54 hCV1413258 yes Replication,
All Cases Pool Female G 78.57% 73.98% 0.004948573 1.29 hCV1413258
yes Replication, Probands Pool Female G 78.56% 73.98% 0.019266924
1.29 hCV1413258 yes Discovery Pool HR-1SE G 81.46% 70.38%
0.046033661 1.85 hCV1413258 yes Replication, Probands Pool HR-1SE G
81.36% 74.83% 0.04426868 1.47 hCV11720402 yes Discovery Pool All T
39.31% 44.70% 0.01773467 0.80 hCV11720402 yes Replication, All
Cases Pool All T 40.22% 45.27% 0.002741399 0.81 hCV11720402 yes
Replication, Probands Pool All T 40.84% 45.10% 0.036902948 0.84
hCV11720402 yes Replication, All Cases Pool RF+ T 40.64% 45.91%
0.005312239 0.81 hCV11720402 yes Replication, Probands Pool RF+ T
40.27% 45.91% 0.009968486 0.79 hCV25472930 yes Discovery Pool
Female C 9.95% 6.00% 0.016146024 1.73 hCV25472930 yes Replication,
Probands Pool Female C 8.93% 6.47% 0.038767083 1.42 hCV2004708 yes
Discovery Pool LR-1SE C 32.28% 60.36% 0.005596267 0.31 hCV2004708
yes Replication, Probands Pool LR-1SE C 38.23% 55.85% 0.032904768
0.49 hCV25640226 yes Discovery Pool All C 91.63% 88.76% 0.030924151
1.39 hCV25640226 yes Replication, All Cases Pool All C 91.02%
88.12% 0.005950157 1.37 hCV25640226 yes Replication, Probands Pool
All C 90.67% 88.08% 0.044790792 1.31 hCV25640226 yes Replication,
All Cases Pool RF+ C 91.35% 88.25% 0.007425925 1.41 hCV25640226 yes
Replication, Probands Pool RF+ C 91.13% 88.25% 0.032892031 1.37
hCV11597077 yes Discovery Pool All A 46.34% 51.24% 0.031144846 0.82
hCV11597077 yes Replication, All Cases Individual RF+ A 45.04%
48.96% 0.036466659 0.85 hCV1839329 yes Discovery Pool All G 45.62%
50.17% 0.04350832 0.83 hCV1839329 yes Replication, All Cases
Individual RF+ G 45.12% 48.95% 0.039858409 0.86 hCV11735875 yes
Discovery Pool HR-1SE C 20.75% 8.48% 0.009569938 2.82 hCV11735875
yes Replication, Probands Individual HR-1SE C 18.03% 11.22%
0.006484705 1.74 hCV1253735 yes Discovery Pool All T 84.32% 88.11%
0.016722125 0.73 hCV1253735 yes Replication, All Cases Pool All T
84.06% 87.67% 0.001912589 0.74 hCV1253735 yes Replication, Probands
Pool All T 84.26% 87.62% 0.017369356 0.76 hCV1773247 yes Discovery
Pool All T 6.36% 8.74% 0.045985585 0.71 hCV1773247 yes Replication,
All Cases Pool All T 5.69% 8.12% 0.005436031 0.68 hCV1773247 yes
Replication, Probands Pool All T 5.84% 8.25% 0.024677255 0.69
hCV1773247 yes Replication, All Cases Pool RF+ T 5.90% 8.58%
0.007182091 0.67 hCV1773247 yes Replication, Probands Pool RF+ T
5.98% 8.58% 0.031138079 0.68 hCV16142950 yes Discovery Pool All G
41.72% 46.94% 0.02361255 0.81 hCV16142950 yes Replication, All
Cases Pool All G 46.59% 51.06% 0.00856573 0.84 hCV16142950 yes
Replication, All Cases Pool RF+ G 45.24% 50.92% 0.002756781 0.80
hCV25592530 yes Discovery Pool Female T 13.90% 19.51% 0.008024342
0.67 hCV25592530 yes Replication, Probands Pool Female T 16.06%
20.60% 0.008827259 0.74 hCV11758437 yes Discovery Pool All G 58.30%
63.51% 0.021357508 0.80 hCV11758437 yes Replication, All Cases Pool
All G 55.07% 59.27% 0.011734382 0.84 hCV204710 yes Discovery Pool
All G 73.30% 77.70% 0.028736073 0.79 hCV204710 yes Replication, All
Cases Pool RF+ G 75.14% 78.99% 0.014702128 0.80 hCV8915168 yes
Discovery Individual All A 24.03% 29.83% 0.004893574 0.74
hCV8915168 yes Replication, All Cases Individual All A 24.46%
28.79% 0.003802791 0.80 hCV8915168 yes Replication, Probands
Individual All A 24.30% 28.79% 0.01291231 0.79 hCV8915168 yes
Replication, All Cases Individual RF+ A 23.67% 28.52% 0.003439631
0.78 hCV8915168 yes Replication, Probands Individual RF+ A 22.99%
28.52% 0.005147306 0.75 hCV443471 yes Discovery Individual HR-2SE T
31.15% 39.69% 0.044411024 0.69 hCV443471 yes Replication, All Cases
Individual HR-2SE T 30.84% 38.61% 0.002059442 0.71 hCV25606714 yes
Discovery Pool Male G 95.81% 98.86% 0.046126005 0.26 hCV25606714
yes Replication, Probands Pool Male G 96.76% 99.38% 0.044064752
0.19 hCV25606714 yes Discovery Pool LR-0SE G 93.52% 99.98%
0.029253637 0.00 hCV25606714 yes Replication, Probands Pool LR-0SE
G 93.05% 99.50% 0.016507932 0.07 hCV25992555 yes Discovery Pool All
G 99.83% 98.96% 0.037981673 6.11 hCV25992555 yes Replication, All
Cases Pool All G 99.81% 98.46% 1.19354E-05 8.09 hCV25992555 yes
Replication, Probands Pool All G 99.80% 98.44% 0.001308492 7.90
hCV25992555 yes Replication, All Cases Pool RF+ G 99.98% 98.49%
1.20186E-06 72.68 hCV25992555 yes Replication, Probands Pool RF+ G
99.98% 98.49% 0.000159669 68.56 hCV3246662 yes Discovery Pool
Female T 28.61% 35.86% 0.007863989 0.72
hCV3246662 yes Replication, All Cases Pool Female T 29.97% 34.12%
0.020251551 0.83 hCV25608626 yes Discovery Pool All G 86.02% 82.47%
0.032646381 1.31 hCV25608626 yes Replication, All Cases Pool RF+ G
83.04% 80.05% 0.045922497 1.22 hCV11356754 yes Discovery Pool All T
55.31% 59.83% 0.046168174 0.83 hCV11356754 yes Replication, All
Cases Pool All T 58.24% 61.89% 0.027662855 0.86 hCV11356754 yes
Replication, Probands Pool All T 57.45% 61.84% 0.030908833 0.83
hCV11356754 yes Replication, All Cases Pool RF+ T 56.91% 61.76%
0.0097314 0.82 hCV11356754 yes Replication, Probands Pool RF+ T
57.29% 61.76% 0.042384241 0.83 hCV730311 yes Discovery Pool Onset
38-55 T 6.19% 2.50% 0.004465734 2.57 hCV730311 yes Replication, All
Cases Individual Onset 38-55 T 5.47% 3.04% 0.017325269 1.84
hCV25960573 yes Discovery Pool All G 20.26% 24.58% 0.027949114 0.78
hCV25960573 yes Replication, All Cases Pool RF+ G 20.99% 25.31%
0.007209935 0.78 hCV1671515 yes Discovery Pool Female T 81.36%
75.34% 0.011171605 1.43 hCV1671515 yes Replication, All Cases Pool
Female T 79.06% 75.46% 0.026482124 1.23 hCV1671515 yes Replication,
Probands Pool Female T 79.69% 75.46% 0.025821619 1.28 hCV16062492
yes Discovery Pool LR-1SE G 73.35% 52.43% 0.037656345 2.50
hCV16062492 yes Replication, Probands Pool LR-1SE G 76.73% 55.63%
0.00713712 2.63 hCV25983354 yes Discovery Pool Male G 0.01% 4.35%
5.28316E-05 0.00 hCV25983354 yes Replication, All Cases Pool Male G
0.01% 6.15% 6.58998E-07 0.00 hCV25983354 yes Replication, Probands
Pool Male G 0.01% 6.15% 0.000366416 0.00 hCV25983354 yes Discovery
Pool HR-1SE G 0.00% 10.30% 4.29167E-05 0.00 hCV25983354 yes
Replication, Probands Pool HR-1SE G 0.00% 10.23% 4.96093E-10 0.00
hCV25747046 yes Discovery Pool Female G 10.87% 15.11% 0.028795907
0.69 hCV25747046 yes Replication, All Cases Pool Female G 13.12%
16.65% 0.010556758 0.76 hCV1815793 yes Discovery Pool HR-2SE T
35.88% 49.40% 0.004101901 0.57 hCV1815793 yes Replication, Probands
Pool HR-2SE T 36.93% 45.44% 0.011611886 0.70 hCV11297739 yes
Discovery Pool All T 15.15% 11.92% 0.037849694 1.32 hCV11297739 yes
Replication, All Cases Pool All T 14.03% 11.01% 0.00683445 1.32
hCV11297739 yes Replication, Probands Pool All T 14.10% 10.91%
0.020584376 1.34 hCV11297739 yes Replication, All Cases Pool RF+ T
14.41% 11.27% 0.014462494 1.33 hCV11297739 yes Replication,
Probands Pool RF+ T 14.61% 11.27% 0.027092349 1.35 hCV7586912 yes
Discovery Pool All T 76.15% 71.00% 0.014418809 1.30 hCV7586912 yes
Replication, Probands Pool All T 78.19% 74.77% 0.046254089 1.21
hCV16166772 yes Discovery Pool All C 12.33% 9.41% 0.03914869 1.35
hCV16166772 yes Replication, All Cases Pool All C 10.02% 7.91%
0.03335215 1.30 hCV16166772 yes Replication, All Cases Pool RF+ C
10.12% 7.62% 0.018974499 1.36 hCV25942539 yes Discovery Pool All A
34.48% 29.38% 0.016005087 1.26 hCV25942539 yes Replication,
Probands Pool All A 37.80% 33.06% 0.015056544 1.23 hCV3076433 yes
Discovery Pool All T 26.07% 35.44% 1.19047E-05 0.64 hCV3076433 yes
Replication, All Cases Individual RF+ T 31.18% 35.59% 0.012681072
0.82 hCV3015606 yes Discovery Pool All T 46.37% 50.93% 0.043615926
0.83 hCV3015606 yes Replication, All Cases Pool All T 47.40% 52.07%
0.005736671 0.83 hCV3015606 yes Replication, All Cases Pool RF+ T
47.83% 52.43% 0.015394887 0.83 hCV3015606 yes Replication, Probands
Pool RF+ T 47.76% 52.43% 0.038060373 0.83 hCV9283503 yes Discovery
Pool All G 48.76% 55.50% 0.003801901 0.76 hCV9283503 yes
Replication, All Cases Pool All G 50.28% 54.70% 0.009380237 0.84
hCV9283503 yes Replication, Probands Pool All G 50.21% 54.45%
0.038082293 0.84 hCV9283503 yes Replication, All Cases Pool RF+ G
50.17% 55.21% 0.007932113 0.82 hCV9283503 yes Replication, Probands
Pool RF+ G 50.09% 55.21% 0.024005749 0.81 hCV1248029 yes Discovery
Pool All G 49.80% 42.79% 0.002382314 1.33 hCV1248029 yes
Replication, All Cases Individual All G 47.67% 43.08% 0.006722118
1.20 hCV1248029 yes Replication, All Cases Individual RF+ G 47.40%
42.91% 0.016405472 1.20 hCV2095401 yes Discovery Pool Male G 67.65%
75.90% 0.028526168 0.66 hCV2095401 yes Replication, Probands Pool
Male G 60.87% 73.06% 0.006459057 0.57 hCV3226838 yes Discovery Pool
Male G 41.54% 55.23% 0.000685889 0.58 hCV3226838 yes Replication,
All Cases Pool Male G 42.07% 51.68% 0.017571452 0.68 hCV3226838 yes
Replication, Probands Pool Male G 40.04% 51.68% 0.019922507 0.62
hCV1283127 yes Discovery Individual All G 26.66% 33.01% 0.002860114
0.74 hCV1283127 yes Replication, All Cases Individual All G 27.56%
30.67% 0.045376785 0.86 hCV1283127 yes Replication, All Cases
Individual RF+ G 27.88% 31.49% 0.037702138 0.84 hCV1283131 yes
Discovery Individual All C 12.66% 9.34% 0.022171575 1.41 hCV1283131
yes Replication, All Cases Individual All C 14.64% 9.23%
6.62902E-07 1.69 hCV1283131 yes Replication, Probands Individual
All C 15.12% 9.23% 5.44977E-06 1.75 hCV1283131 yes Replication, All
Cases Individual RF+ C 15.53% 9.16% 1.83404E-07 1.82 hCV1283131 yes
Replication, Probands Individual RF+ C 15.58% 9.16% 7.31461E-06
1.83 hCV9692842 yes Discovery Individual All T 17.95% 14.12%
0.027583095 1.33 hCV9692842 yes Replication, Probands Pool All T
18.57% 12.61% 4.22269E-05 1.58 hCV9692842 yes Replication, Probands
Pool RF+ T 19.49% 12.24% 4.81155E-06 1.74 hCV9692842 yes
Replication, All Cases Pool All T 19.44% 12.59% 2.81804E-08 1.67
hCV9692842 yes Replication, All Cases Pool RF+ T 21.10% 12.24%
2.22566E-10 1.92 hCV1231817 yes Discovery Pool Female T 60.77%
67.35% 0.016022557 0.75 hCV1231817 yes Replication, All Cases Pool
Female T 58.89% 63.28% 0.021130308 0.83 hCV11514490 yes Discovery
Pool male A 16.03% 10.49% 0.048434467 1.63 hCV11514490 yes
Replication, Probands Individual male A 17.61% 11.08% 0.041511164
1.72 hCV15976147 yes Discovery Individual All G 1.71% 0.53%
0.015908686 3.27 hCV15976147 yes Replication, All Cases Individual
All G 1.25% 0.38% 0.003891619 3.34 hCV15976147 yes Replication,
Probands Individual All G 1.19% 0.38% 0.02080022 3.17 hCV15976147
yes Replication, All Cases Individual RF+ G 1.41% 0.45% 0.009091213
3.13 hCV15976147 yes Replication, Probands Individual RF+ G 1.43%
0.45% 0.020719529 3.17 hCV16194374 yes Discovery Pool All C 4.08%
6.55% 0.024035986 0.61 hCV16194374 yes Replication, All Cases Pool
RF+ C 5.12% 7.31% 0.015852406 0.68 hCV16194374 yes Discovery Pool
Male C 2.98% 6.79% 0.044519945 0.42 hCV16194374 yes Replication,
All Cases Pool Male C 3.90% 8.25% 0.032368257 0.45 hCV9272397 yes
Discovery Pool All A 49.21% 42.07% 0.002022714 1.33 hCV9272397 yes
Replication, All Cases Individual All A 49.76% 44.18% 0.001025442
1.25 hCV9272397 yes Replication, Probands Individual All A 49.78%
44.18% 0.005894549 1.25 hCV9272397 yes Replication, All Cases
Individual RF+ A 50.82% 43.72% 0.000155648 1.33 hCV9272397 yes
Replication, Probands Individual RF+ A 50.39% 43.72% 0.002535487
1.31 hCV25924724 yes Discovery Pool All T 83.42% 86.75% 0.046080833
0.77 hCV25924724 yes Replication, All Cases Pool All T 83.18%
85.64% 0.045520864 0.83 hCV25924724 yes Replication, Probands Pool
All T 82.49% 85.53% 0.043158192 0.80 hCV25924724 yes Replication,
All Cases Pool RF+ T 82.91% 85.62% 0.047355326 0.81 hCV25993353 yes
Discovery Pool All G 24.74% 20.63% 0.037297858 1.26 hCV25993353 yes
Replication, All Cases Pool All G 19.63% 16.90% 0.03615817 1.20
hCV7454533 yes Discovery Pool Male T 40.92% 50.50% 0.017589388 0.68
hCV7454533 yes Replication, All Cases Pool Male T 42.31% 50.30%
0.04774614 0.72 hCV549404 yes Discovery Pool LR-0SE G 8.76% 0.36%
0.013576787 26.79 hCV549404 yes Replication, Probands Pool LR-0SE G
13.41% 4.04% 0.013863131 3.68 hCV25641653 yes Discovery Individual
All G 43.05% 49.68% 0.001749155 0.75 hCV25641653 yes Replication,
Probands Individual RF+ G 45.97% 50.52% 0.042230374 0.83
hCV15881845 yes Discovery Individual All C 5.27% 7.58% 0.048985507
0.68 hCV15881845 yes Replication, All Cases Individual All C 5.36%
7.02% 0.043262494 0.75 hCV15881845 yes Replication, All Cases
Individual RF+ C 4.66% 6.95% 0.008969727 0.65 hCV25967527 yes
Discovery Pool All C 99.73% 98.52% 0.007299426 5.58 hCV25967527 yes
Replication, All Cases Pool All C 99.45% 98.84% 0.046088278 2.15
hCV25967527 yes Replication, All Cases Pool RF+ C 99.60% 98.85%
0.03316308 2.91 hCV8714838 yes Discovery Pool All G 38.89% 43.93%
0.025484527 0.81 hCV8714838 yes Replication, All Cases Individual
All G 40.57% 44.69% 0.014069995 0.85 hCV2936823 yes Discovery Pool
All T 33.95% 41.06% 0.001755868 0.74 hCV2936823 yes Replication,
All Cases Individual All T 38.45% 42.73% 0.010750447 0.84
hCV1654841 yes Discovery Pool Onset 38-55 A 32.19% 41.02%
0.003715442 0.68 hCV1654841 yes Replication, All Cases Individual
Onset 38-55 A 31.95% 37.15% 0.03116307 0.79 hCV1654841 yes
Replication, Probands Individual Onset 38-55 A 30.28% 37.15%
0.015329657 0.73 hCV8954669 yes Discovery Pool Male G 37.27% 46.93%
0.013574462 0.67 hCV8954669 yes Replication, Probands Pool Male G
37.37% 48.36% 0.025274815 0.64 hCV25751699 yes Discovery Pool All T
57.03% 62.54% 0.016996032 0.79 hCV25751699 yes Replication, All
Cases Pool All T 61.36% 65.04% 0.023138645 0.85 hCV25745882 yes
Discovery Pool Male A 29.76% 39.49% 0.012880766 0.65 hCV25745882
yes Replication, All Cases Pool Male A 28.23% 38.44% 0.007333812
0.63 hCV16229390 yes Discovery Individual All G 27.67% 33.58%
0.00591709 0.76 hCV16229390 yes Replication, All Cases Individual
All G 29.38% 35.03% 0.000359481 0.77 hCV16229390 yes Replication,
Probands Individual All G 28.14% 35.03% 0.000262438 0.73
hCV16229390 yes Replication, All Cases Individual RF+ G 28.85%
34.94% 0.000511784 0.76 hCV16229390 yes Replication, Probands
Individual RF+ G 27.40% 34.94% 0.000279774 0.70 hCV7499127 yes
Discovery Pool All G 31.74% 36.50% 0.026144581 0.81 hCV7499127 yes
Replication, All Cases Pool All G 31.52% 39.99% 1.6743E-07 0.69
hCV7499127 yes Replication, Probands Pool All G 30.16% 40.08%
4.25266E-07 0.65 hCV7499127 yes Replication, All Cases Pool RF+ G
30.89% 39.69% 1.41213E-06 0.68 hCV7499127 yes Replication, Probands
Pool RF+ G 30.09% 39.69% 6.88819E-06 0.65 hCV1709713 yes Discovery
Pool All G 8.29% 11.96% 0.007908651 0.67 hCV1709713 yes
Replication, Probands Individual All G 7.38% 10.21% 0.014851566
0.70 hCV1709713 yes Replication, All Cases Individual RF+ G 8.26%
10.55% 0.040867294 0.76 hCV1709713 yes Replication, Probands
Individual RF+ G 7.18% 10.55% 0.009834543 0.66 hCV16006940 yes
Discovery Pool All C 45.01% 49.68% 0.043403566 0.83 hCV16006940 yes
Replication, All Cases Individual RF+ C 47.71% 52.01% 0.022983979
0.84 hCV1724443 yes Discovery Pool All G 43.39% 49.90% 0.004383893
0.77 hCV1724443 yes Replication, All Cases Individual All G 38.65%
42.32% 0.027901318 0.86 hCV1724443 yes Replication, All Cases
Individual RF+ G 37.19% 42.38% 0.004822046 0.80 hCV773663 yes
Discovery Pool All G 9.09% 6.28% 0.030986252 1.49 hCV773663 yes
Replication, All Cases Pool All G 7.03% 5.19% 0.023776666 1.38
hCV773663 yes Replication, All Cases Pool RF+ G 7.48% 5.25%
0.018813069 1.46 hCV2628820 yes Discovery Pool All C 75.02% 79.09%
0.043446577 0.79 hCV2628820 yes Replication, All Cases Pool All C
76.71% 80.83% 0.002958868 0.78 hCV2628820 yes Replication, Probands
Pool All C 76.61% 80.96% 0.008924443 0.77 hCV2628820 yes
Replication, All Cases Pool RF+ C 76.13% 80.92% 0.002241465 0.75
hCV2628820 yes Replication, Probands Pool RF+ C 76.00% 80.92%
0.00647635 0.75 hCV589914 yes Discovery Pool All G 53.70% 48.08%
0.016995833 1.25 hCV589914 yes Replication, All Cases Pool All G
51.25% 46.35% 0.003743931 1.22 hCV589914 yes Replication, Probands
Pool All G 50.72% 46.40% 0.031290456 1.19 hCV589914 yes
Replication, All Cases Pool RF+ G 52.47% 45.81% 0.000489735
1.31
hCV589914 yes Replication, Probands Pool RF+ G 51.35% 45.81%
0.015064359 1.25 hCV3274630 yes Discovery Pool All A 42.72% 49.36%
0.00376044 0.77 hCV3274630 yes Replication, All Cases Individual
All A 45.76% 50.38% 0.006264619 0.83 hCV3274630 yes Replication,
Probands Individual All A 45.25% 50.38% 0.011192048 0.81 hCV3274630
yes Replication, All Cases Individual RF+ A 44.29% 50.78%
0.000514166 0.77 hCV3274630 yes Replication, Probands Individual
RF+ A 43.90% 50.78% 0.001982975 0.76 hCV25627998 yes Discovery Pool
All T 0.92% 0.17% 0.038080194 5.49 hCV25627998 yes Replication, All
Cases Pool All T 1.33% 0.55% 0.019829797 2.43 hCV25627998 yes
Replication, Probands Pool All T 1.34% 0.56% 0.041259124 2.41
hCV11600233 yes Discovery Pool HR-2SE T 59.49% 43.04% 0.000485016
1.94 hCV11600233 yes Replication, All Cases Pool HR-2SE T 61.09%
50.16% 0.00077991 1.56 hCV11690571 yes Discovery Pool All G 94.84%
92.18% 0.024895104 1.56 hCV11690571 yes Replication, All Cases Pool
All G 95.02% 92.69% 0.005138991 1.51 hCV11690571 yes Replication,
Probands Pool All G 95.21% 92.92% 0.024265047 1.51 hCV11690571 yes
Replication, All Cases Pool RF+ G 95.48% 93.16% 0.011792415 1.55
hCV11690571 yes Replication, Probands Pool RF+ G 95.95% 93.16%
0.006516882 1.74 hCV12055895 yes Discovery Pool All T 89.01% 84.70%
0.006453778 1.46 hCV12055895 yes Replication, All Cases Pool All T
86.23% 82.62% 0.003006586 1.32 hCV12055895 yes Replication,
Probands Pool All T 85.85% 82.52% 0.028283202 1.29 hCV12055895 yes
Replication, All Cases Pool RF+ T 86.26% 82.23% 0.003752911 1.36
hCV12055895 yes Replication, Probands Pool RF+ T 86.30% 82.23%
0.014601385 1.36 hCV12064788 yes Discovery Pool All G 91.94% 87.50%
0.001531213 1.63 hCV12064788 yes Replication, All Cases Pool All G
93.50% 87.35% 6.00139E-10 2.08 hCV12064788 yes Replication,
Probands Pool All G 93.50% 87.29% 3.34024E-07 2.09 hCV12064788 yes
Replication, All Cases Pool RF+ G 94.22% 87.59% 1.73651E-09 2.31
hCV12064788 yes Replication, Probands Pool RF+ G 93.89% 87.59%
1.41069E-06 2.18 hCV1468814 yes Discovery Pool Male T 87.97% 79.61%
0.004031757 1.87 hCV1468814 yes Replication, All Cases Pool Male T
87.48% 80.67% 0.017542901 1.67 hCV1468814 yes Replication, Probands
Pool Male T 89.06% 80.67% 0.027009572 1.95 hCV15852026 yes
Discovery Pool All G 88.30% 85.13% 0.042753162 1.32 hCV15852026 yes
Replication, All Cases Pool All G 89.94% 86.49% 0.001749278 1.40
hCV15852026 yes Replication, All Cases Pool RF+ G 90.34% 87.79%
0.034437583 1.30 hCV15941749 yes Discovery Pool All T 36.11% 40.60%
0.047505446 0.83 hCV15941749 yes Replication, All Cases Pool All T
36.15% 42.53% 9.86493E-05 0.77 hCV15941749 yes Replication,
Probands Pool All T 33.86% 42.59% 1.07647E-05 0.69 hCV15941749 yes
Replication, All Cases Pool RF+ T 36.06% 42.50% 0.000490082 0.76
hCV15941749 yes Replication, Probands Pool RF+ T 34.33% 42.50%
0.000150358 0.71 hCV16006934 yes Discovery Pool All A 20.70% 17.08%
0.046211396 1.27 hCV16006934 yes Replication, All Cases Pool All A
24.05% 20.41% 0.009436009 1.23 hCV16006934 yes Replication, All
Cases Pool RF+ A 24.05% 20.81% 0.040570497 1.21 hCV16023642 yes
Discovery Pool All T 93.53% 96.55% 0.004062535 0.52 hCV16023642 yes
Replication, All Cases Pool All T 92.61% 94.42% 0.028086446 0.74
hCV16023642 yes Replication, Probands Pool All T 91.59% 94.32%
0.006806874 0.66 hCV16023642 yes Replication, Probands Pool RF+ T
91.52% 94.19% 0.016978699 0.67 hCV2153710 yes Discovery Pool All G
70.58% 78.27% 0.000122531 0.67 hCV2153710 yes Replication, All
Cases Pool All G 74.85% 79.18% 0.002308953 0.78 hCV2153710 yes
Replication, Probands Pool All G 73.95% 79.15% 0.00258196 0.75
hCV2153710 yes Replication, All Cases Pool RF+ G 74.77% 79.94%
0.001252083 0.74 hCV2153710 yes Replication, Probands Pool RF+ G
74.85% 79.94% 0.005412316 0.75 hCV216064 yes Discovery Pool All G
24.12% 31.35% 0.000486751 0.70 hCV216064 yes Replication, All Cases
Individual All G 24.79% 28.55% 0.011959926 0.83 hCV216064 yes
Replication, Probands Individual All G 24.62% 28.55% 0.029922943
0.82 hCV216064 yes Replication, All Cases Individual RF+ G 23.85%
28.29% 0.007499249 0.79 hCV216064 yes Replication, Probands
Individual RF+ G 23.12% 28.29% 0.008053711 0.76 hCV2250399 yes
Discovery Pool male A 41.98% 30.06% 0.00184943 1.68 hCV2250399 yes
Replication, All Cases Individual male A 45.03% 32.95% 0.000874184
1.67 hCV2250399 yes Replication, Probands Individual male A 47.73%
32.95% 0.001196062 1.86 hCV2259574 yes Discovery Pool Male T 18.24%
25.01% 0.036181592 0.67 hCV2259574 yes Replication, All Cases Pool
Male T 18.69% 26.36% 0.023141099 0.64 hCV2259574 yes Replication,
Probands Pool Male T 15.27% 26.36% 0.005356738 0.50 hCV25972265 yes
Discovery Pool Onset 38-55 A 25.11% 19.27% 0.026638525 1.40
hCV25972265 yes Replication, All Cases Individual Onset 38-55 A
22.92% 18.38% 0.025578056 1.32 hCV25972265 yes Discovery Pool
HR-2SE A 26.34% 17.94% 0.031262995 1.64 hCV25972265 yes
Replication, All Cases Individual HR-2SE A 24.13% 19.06% 0.02140711
1.35 hCV25972265 yes Replication, Probands Individual HR-2SE A
24.61% 19.06% 0.03120769 1.39 hCV3277068 yes Discovery Pool All T
32.39% 28.06% 0.045717416 1.23 hCV3277068 yes Replication, All
Cases Pool All T 34.97% 29.69% 0.00079947 1.27 hCV3277068 yes
Replication, Probands Pool All T 35.10% 29.51% 0.003379771 1.29
hCV3277068 yes Replication, All Cases Pool RF+ T 35.39% 29.32%
0.000563192 1.32 hCV3277068 yes Replication, Probands Pool RF+ T
36.22% 29.32% 0.000883004 1.37 hCV478645 yes Discovery Pool All C
41.92% 47.06% 0.023811653 0.81 hCV478645 yes Replication, All Cases
Pool RF+ C 43.41% 47.40% 0.036510196 0.85 hCV8844728 yes Discovery
Pool All G 0.26% 1.22% 0.020812078 0.21 hCV8844728 yes Replication,
All Cases Pool All G 0.37% 1.14% 0.010606669 0.32 hCV8870139 yes
Discovery Pool All T 27.45% 22.10% 0.006775991 1.33 hCV8870139 yes
Replication, All Cases Individual All T 38.04% 34.27% 0.020574439
1.18 hCV9484175 yes Discovery Pool All T 49.64% 56.48% 0.002825824
0.76 hCV9484175 yes Replication, All Cases Pool All T 59.41% 63.85%
0.007604773 0.83 hCV9484175 yes Replication, All Cases Pool RF+ T
58.68% 63.73% 0.007262101 0.81 hCV2995653 no Discovery Pool All G
3.67% 6.19% 0.011215026 0.58 hCV3293876 no Discovery Pool All T
7.99% 13.68% 6.52139E-05 0.55 hCV25755336 no Discovery Pool All G
21.35% 16.29% 0.004889825 1.40 hCV11688904 no Discovery Pool All G
0.82% 2.50% 0.004237938 0.32 hCV25742456 no Discovery Pool All G
93.95% 96.65% 0.008820847 0.54 hCV549896 no Discovery Pool All G
99.06% 97.12% 0.002342088 3.13 hCV2479345 no Discovery Pool All G
42.52% 48.52% 0.008695748 0.78 hCV11407883 no Discovery Pool All G
41.73% 46.38% 0.041993034 0.83 hCV25926376 no Discovery Pool All G
62.23% 67.50% 0.016378471 0.79 hCV2438322 no Discovery Pool All T
22.54% 18.77% 0.04149316 1.26 hCV2455742 no Discovery Pool All T
51.99% 62.58% 4.31627E-06 0.65 hCV2495658 no Discovery Pool All T
84.11% 77.95% 0.000560178 1.50 hCV25745992 no Discovery Pool All T
2.16% 3.79% 0.040972564 0.56 hCV25654189 no Discovery Pool All G
0.69% 1.77% 0.042040535 0.38 hCV25932834 no Discovery Pool All G
18.87% 14.06% 0.00643918 1.42 hCV2438216 no Discovery Pool All G
70.76% 75.70% 0.014991722 0.78 hCV25771405 no Discovery Pool All T
99.21% 98.25% 0.042040535 2.25 hCV11976644 no Discovery Pool All C
10.49% 5.40% 2.99785E-05 2.05 hCV8848880 no Discovery Pool All A
92.28% 87.58% 0.000589391 1.69 hCV11976630 no Discovery Pool All T
49.63% 57.00% 0.001280773 0.74 hCV11976652 no Discovery Pool All G
91.82% 87.68% 0.003201827 1.58 hCV8848884 no Discovery Pool All C
95.93% 93.47% 0.024035986 1.65 hCV16135464 no Discovery Pool All T
40.23% 32.67% 0.000601702 1.39 hCV1545307 no Discovery Pool All G
98.26% 96.58% 0.01973113 2.00 hCV3293859 no Discovery Pool All G
80.78% 71.65% 4.43295E-06 1.66 hCV25953077 no Discovery Pool All C
84.46% 78.31% 0.000632511 1.51 hCV11691237 no Discovery Pool All T
84.36% 80.13% 0.016520772 1.34 hCV15867521 no Discovery Pool All T
9.28% 3.93% 2.79459E-06 2.50 hCV11917903 no Discovery Pool All G
90.86% 96.08% 4.07917E-06 0.41 hCV25654485 no Discovery Pool All T
2.03% 5.04% 0.000282044 0.39 hCV11691179 no Discovery Pool All G
90.36% 94.81% 0.000215461 0.51 hCV7469249 no Discovery Pool All T
91.00% 86.39% 0.00175466 1.59 hCV11972291 no Discovery Pool All G
99.69% 91.08% 6.04968E-23 31.34 hCV25996731 no Discovery Pool All T
27.35% 21.57% 0.003929944 1.37 hCV25958453 no Discovery Pool All G
88.73% 92.27% 0.009574728 0.66 hCV2437234 no Discovery Pool All A
69.82% 74.89% 0.013933548 0.78 hCV8942480 no Discovery Pool All G
94.01% 96.18% 0.032944592 0.62 hCV11681250 no Discovery Pool All G
38.58% 46.30% 0.000708847 0.73 hCV11195029 no Discovery Pool All G
28.33% 23.87% 0.028405891 1.26 hCV2978734 no Discovery Pool All G
74.20% 69.80% 0.036126242 1.24 hCV15888165 no Discovery Pool All T
99.20% 98.03% 0.034459004 2.50 hCV25474376 no Discovery Pool All G
72.84% 78.59% 0.003825161 0.73 hCV2986466 no Discovery Pool All G
92.89% 89.05% 0.004007103 1.61 hCV16135142 no Discovery Pool All G
73.32% 78.80% 0.00603893 0.74 hCV25606044 no Discovery Pool All T
13.72% 10.55% 0.035135266 1.35 hCV25953007 no Discovery Pool All T
2.93% 4.84% 0.033393769 0.59 hCV11159941 no Discovery Pool All T
97.44% 95.76% 0.042779017 1.69 hCV25984541 no Discovery Pool All A
9.55% 12.92% 0.02429628 0.71 hCV25922909 no Discovery Pool All T
99.93% 97.98% 1.93164E-05 29.33 hCV7514692 no Discovery Pool All C
21.77% 27.48% 0.004741751 0.73 hCV15874455 no Discovery Pool All T
5.27% 7.92% 0.026009759 0.65 hCV15876778 no Discovery Pool All T
20.62% 14.77% 0.000759591 1.50 hCV25630844 no Discovery Pool All T
19.38% 13.68% 0.001039291 1.52 hCV25630843 no Discovery Pool All T
19.72% 14.80% 0.005261751 1.41 hCV25630845 no Discovery Pool All G
80.80% 85.27% 0.010285352 0.73 hCV3233692 no Discovery Pool All G
77.92% 85.34% 2.54815E-05 0.61 hCV3052660 no Discovery Pool All G
96.00% 93.64% 0.022783838 1.63 hCV7513726 no Discovery Pool All T
15.39% 9.54% 0.000131463 1.72 hCV163035 no Discovery Pool All T
64.80% 69.68% 0.027764206 0.80
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140234291A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140234291A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References