U.S. patent application number 13/776179 was filed with the patent office on 2014-08-14 for novel methods for quantification of micrornas and small interfering rnas.
This patent application is currently assigned to Exiqon A/S. The applicant listed for this patent is Exiqon A/S. Invention is credited to Soren Morgenthaler Echwald, Nana Jacobsen, Sakari Kauppinen, Lars Kongsbak, Peter Mouritzen, Peter Stein Nielsen, Mikkel Norholm.
Application Number | 20140227689 13/776179 |
Document ID | / |
Family ID | 35449430 |
Filed Date | 2014-08-14 |
United States Patent
Application |
20140227689 |
Kind Code |
A1 |
Jacobsen; Nana ; et
al. |
August 14, 2014 |
NOVEL METHODS FOR QUANTIFICATION OF MICRORNAS AND SMALL INTERFERING
RNAS
Abstract
The invention relates to ribonucleic acids, probes and methods
for detection, quantification as well as monitoring the expression
of mature microRNAs and small interfering RNAs (siRNAs). The
invention furthermore relates to methods for monitoring the
expression of other non-coding RNAs, mRNA splice variants, as well
as detecting and quantifying RNA editing, allelic variants of
single transcripts, mutations, deletions, or duplications of
particular exons in transcripts, e.g., alterations associated with
human disease such as cancer. The invention furthermore relates to
methods for detection, quantification as well as monitoring the
expression of deoxy nucleic acids.
Inventors: |
Jacobsen; Nana; (Gentofte,
DK) ; Kongsbak; Lars; (Holte, DK) ; Kauppinen;
Sakari; (Smorum, DK) ; Echwald; Soren
Morgenthaler; (Humlebaek, DK) ; Mouritzen; Peter;
(Jyllinge, DK) ; Nielsen; Peter Stein; (Birkerod,
DK) ; Norholm; Mikkel; (Copenhagen, DK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Exiqon A/S; |
|
|
US |
|
|
Assignee: |
Exiqon A/S
Vedbaek
DK
|
Family ID: |
35449430 |
Appl. No.: |
13/776179 |
Filed: |
February 25, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12476193 |
Jun 1, 2009 |
8383344 |
|
|
13776179 |
|
|
|
|
11100897 |
Apr 7, 2005 |
8192937 |
|
|
12476193 |
|
|
|
|
60560148 |
Apr 7, 2004 |
|
|
|
60590856 |
Jul 23, 2004 |
|
|
|
60600961 |
Aug 12, 2004 |
|
|
|
60619291 |
Oct 15, 2004 |
|
|
|
60648221 |
Jan 28, 2005 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6809 20130101; C12Q 1/6809 20130101; C12Q 2561/101 20130101;
C12Q 2525/207 20130101; C12Q 2533/107 20130101; C12Q 2525/155
20130101; C12Q 2525/207 20130101; C12Q 2525/155 20130101; C12Q
1/6809 20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for quantitative determination of a short-length RNA,
which has a length of at most 100 nucleotides, comprising the steps
of: a) contacting the target nucleotide sequence with two
oligonucleotide tagging probes each comprising an anchor nucleotide
sequence and a recognition nucleotide sequence, wherein said
recognition nucleotide sequence is complementary to the target
sequence, and wherein the recognition sequence of the first tagging
probe hybridizes to a first region of the target sequence and the
second recognition sequence of the second tagging probe hybridizes
to a second region of the target sequence adjacent to the first
region of the target sequence; b) joining the two adjacent
recognition sequences of the hybridized tagging probes covalently
by ligation to form a contiguous nucleotide sequence, comprising a
sequence complementary to the target nucleotide sequence and the
two anchor nucleotide sequences, and c) quantifying the ligated
oligonucleotide molecules by PCR using primers corresponding to the
anchor nucleotide sequences and a labelled detection probe
comprising a target recognition sequence and a detection
moiety.
2. The method of according to claim 1, wherein at least one of the
anchor nucleotide sequences is a polynucleotide consisting of
identical nucleotides.
3. The method according to claim 1, wherein one or both of the
anchor nucleotide sequences do not occur naturally in the organism
from where the sample RNA is derived.
4. The method according to claim 1, wherein one of the tagging
probes contains a moiety that enables immobilisation onto a solid
support.
5. The method according to claim 1, wherein the sample in step (a)
is enriched for RNA of short length.
6. The method according to claim 1, wherein the labelled detection
probe comprises modified nucleotides.
7. The method according to claim 6, wherein the modified
nucleotides are LNA nucleotides.
8. The method according to claim 6, wherein the labelled detection
probe corresponds to or is complementary to a sequence in the
short-length RNA.
9. The method according to claim 1, wherein primers used in PCR
comprise modified nucleotides.
10. The method according to claim 9, wherein the modified
nucleotides are LNA nucleotides.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/476,193, filed Jun. 1, 2009, which is a
continuation of U.S. patent application Ser. No. 11/100,897, filed
Apr. 7, 2005, which claims the benefit of the filing date of the
U.S. provisional patent application 60/560,148, filed Apr. 7, 2004,
U.S. provisional patent application 60/590,856, filed Jul. 23,
2004, U.S. provisional patent application 60/600,961, filed Aug.
12, 2004, U.S. provisional patent application 60/619,291, filed
Oct. 15, 2004, and U.S. provisional patent application 60/648,221,
filed Jan. 28, 2005, each of which is hereby incorporated by
reference.
[0002] The present invention relates to nucleic acids, probes and
methods for detection, quantification as well as monitoring the
expression of mature microRNAs and small interfering RNAs (siRNAs).
The invention furthermore relates to methods for monitoring the
expression of other non-coding RNAs, mRNA splice variants, as well
as detecting and quantifying RNA editing, allelic variants of
single transcripts, mutations, deletions, or duplications of
particular exons in transcripts, e.g. alterations associated with
human disease, such as cancer. The invention furthermore relates to
methods for detection and quantification of a target DNA
sequence.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to the quantification of
target nucleotide sequences in a wide variety of nucleic acid
samples and more specifically to the methods employing the design
and use of oligonucleotide probes that are useful for detecting and
quantifying target nucleotide sequences, especially RNA target
sequences, such as microRNA and siRNA target sequences of interest
and for detecting differences between nucleic acid samples (e.g.,
such as samples from a cancer patient and a healthy patient).
[0004] Micro RNAs
[0005] The expanding inventory of international sequence databases
and the concomitant sequencing of nearly 200 genomes representing
all three domains of life--bacteria, archea and eukaryota--have
been the primary drivers in the process of deconstructing living
organisms into comprehensive molecular catalogs of genes,
transcripts and proteins. The importance of the genetic variation
within a single species has become apparent, extending beyond the
completion of genetic blueprints of several important genomes,
culminating in the publication of the working draft of the human
genome sequence in 2001 (Lander, Linton, Birren et al., 2001 Nature
409: 860-921; Venter, Adams, Myers et al., 2001 Science 291:
1304-1351; Sachidanandam, Weissman, Schmidt et al., 2001 Nature
409: 928-933). On the other hand, the increasing number of
detailed, large-scale molecular analyses of transcription
originating from the human and mouse genomes along with the recent
identification of several types of non-protein-coding RNAs, such as
small nucleolar RNAs, siRNAs, microRNAs and antisense RNAs,
indicate that the transcriptomes of higher eukaryotes are much more
complex than originally anticipated (Wong et al. 2001, Genome
Research 11: 1975-1977; Kampa et al. 2004, Genome Research 14:
331-342).
[0006] As a result of the Central Dogma: `DNA makes RNA, and RNA
makes protein`, RNAs have been considered as simple molecules that
just translate the genetic information into protein. Recently, it
has been estimated that although most of the genome is transcribed,
almost 97% of the genome does not encode proteins in higher
eukaryotes, but putative, non-coding RNAs (Wong et al. 2001, Genome
Research 11: 1975-1977). The non-coding RNAs (ncRNAs) appear to be
particularly well suited for regulatory roles that require highly
specific nucleic acid recognition. Therefore, the view of RNA is
rapidly changing from the merely informational molecule to comprise
a wide variety of structural, informational and catalytic molecules
in the cell.
[0007] Recently, a large number of small non-coding RNA genes have
been identified and designated as microRNAs (miRNAs) (for review,
see Ke et al. 2003, Curr. Opin. Chem. Biol. 7:516-523). The first
miRNAs to be discovered were the lin-4 and let-7 that are
heterochronic switching genes essential for the normal temporal
control of diverse developmental events (Lee et al. 1993, Cell
75:843-854; Reinhart et al. 2000, Nature 403: 901-906) in the
roundworm C. elegans. miRNAs have been evolutionarily conserved
over a wide range of species and exhibit diversity in expression
profiles, suggesting that they occupy a wide variety of regulatory
functions and exert significant effects on cell growth and
development (Ke et al. 2003, Curr. Opin. Chem. Biol. 7:516-523).
Recent work has shown that miRNAs can regulate gene expression at
many levels, representing a novel gene regulatory mechanism and
supporting the idea that RNA is capable of performing similar
regulatory roles as proteins. Understanding this RNA-based
regulation will help us to understand the complexity of the genome
in higher eukaryotes as well as understand the complex gene
regulatory networks.
[0008] miRNAs are 21-25 nucleotide (nt) RNAs that are processed
from longer endogenous hairpin transcripts (Ambros et al. 2003, RNA
9: 277-279). To date more than 719 microRNAs have been identified
in humans, worms, fruit flies and plants according to the miRNA
registry database hosted by Sanger Institute, UK, and many miRNAs
that correspond to putative genes have also been identified. Some
miRNAs have multiple loci in the genome (Reinhart et al. 2002,
Genes Dev. 16: 1616-1626) and occasionally, several miRNA genes are
arranged in tandem clusters (Lagos-Quintana et al. 2001, Science
294: 853-858). The fact that many of the miRNAs reported to date
have been isolated just once suggests that many new miRNAs will be
discovered in the future. A recent in-depth transcriptional
analysis of the human chromosomes 21 and 22 found that 49% of the
observed transcription was outside of any known annotation, and
furthermore, that these novel transcripts were both coding and
non-coding RNAs (Kampa et al. 2004, Genome Research 14: 331-342).
The identified miRNAs to date represent most likely the tip of the
iceberg, and the number of miRNAs might turn out to be very
large.
[0009] The combined characteristics of microRNAs characterized to
date (Ke et al. 2003, Curr. Opin. Chem. Biol. 7:516-523; Lee et al.
1993, Cell 75:843-854; Reinhart et al. 2000, Nature 403: 901-906)
can be summarized as:
[0010] 1. miRNAs are single-stranded RNAs of about 21-25 nt.
[0011] 2. They are cleaved from a longer endogenous double-stranded
hairpin precursor by the enzyme Dicer.
[0012] 3. miRNAs match precisely the genomic regions that can
potentially encode precursor RNAs in the form of double-stranded
hairpins.
[0013] 4. miRNAs and their predicted precursor secondary structures
are phylogenetically conserved.
[0014] Several lines of evidence suggest that the enzymes Dicer and
Argonaute are crucial participants in miRNA biosynthesis,
maturation and function (Grishok et al. 2001, Cell 106: 23-24).
Mutations in genes required for miRNA biosynthesis lead to genetic
developmental defects, which are, at least in part, derived from
the role of generating miRNAs. The current view is that miRNAs are
cleaved by Dicer from the hairpin precursor in the form of duplex,
initially with 2 or 3 nt overhangs in the 3' ends, and are termed
pre-miRNAs. Cofactors join the pre-miRNP and unwind the pre-miRNAs
into single-stranded miRNAs, and pre-miRNP is then transformed to
miRNP. miRNAs can recognize regulatory targets while part of the
miRNP complex. There are several similarities between miRNP and the
RNA-induced silencing complex, RISC, including similar sizes and
both containing RNA helicase and the PPD proteins. It has therefore
been proposed that miRNP and RISC are the same RNP with multiple
functions (Ke et al. 2003, Curr. Opin. Chem. Biol. 7:516-523).
Different effectors direct miRNAs into diverse pathways. The
structure of pre-miRNAs is consistent with the observation that 22
nt RNA duplexes with 2 or 3 nt overhangs at the 3' ends are
beneficial for reconstitution of the protein complex and might be
required for high affinity binding of the short RNA duplex to the
protein components (for review, see Ke et al. 2003, Curr. Opin.
Chem. Biol. 7:516-523).
[0015] Growing evidence suggests that miRNAs play crucial roles in
eukaryotic gene regulation. The first miRNAs genes to be
discovered, lin-4 and let-7, base-pair incompletely to repeated
elements in the 3' untranslated regions (UTRs) of other
heterochronic genes, and regulate the translation directly and
negatively by antisense RNA-RNA interaction (Lee et al. 1993, Cell
75:843-854; Reinhart et al. 2000, Nature 403: 901-906). Other
miRNAs are thought to interact with target mRNAs by limited
complementary and suppressed translation as well (Lagos-Quintana et
al. 2001, Science 294: 853-858; Lee and Ambros 2001, Science 294:
858-862). Many studies have shown, however, that given a perfect
complementarity between miRNAs and their target RNA, could lead to
target RNA degradation rather than inhibit translation (Hutvanger
and Zamore 2002, Science 297: 2056-2060), suggesting that the
degree of complementarity determines their functions. By
identifying sequences with near complementarity, several targets
have been predicted, most of which appear to be potential
transcriptional factors that are crucial in cell growth and
development. The high percentage of predicted miRNA targets acting
as developmental regulators and the conservation of target sites
suggest that miRNAs are involved in a wide range of organism
development and behaviour and cell fate decisions (for review, see
Ke et al. 2003, Curr. Opin. Chem. Biol. 7:516-523).
[0016] MicroRNAs and Human Disease
[0017] Analysis of the genomic location of miRNAs indicates that
they play important roles in human development and disease. Several
human diseases have already been pinpointed in which miRNAs or
their processing machinery might be implicated. One of them is
spinal muscular atrophy (SMA), a paediatric neurodegenerative
disease caused by reduced protein levels or loss-of-function
mutations of the survival of motor neurons (SMN) gene (Paushkin et
al. 2002, Curr. Opin. Cell Biol. 14: 305-312). Two proteins (Gemin3
and Gemin4) that are part of the SMN complex are also components of
miRNPs, whereas it remains to be seen whether miRNA biogenesis or
function is dysregulated in SMA and what effect this has on
pathogenesis. Another neurological disease linked to mi/siRNAs is
fragile X mental retardation (FXMR) caused by absence or mutations
of the fragile X mental retardation protein (FMRP) (Nelson et al.
2003, TIBS 28: 534-540), and there are additional clues that miRNAs
might play a role in other neurological diseases. Yet another
interesting finding is that the miR-224 gene locus lies within the
minimal candidate region of two different neurological diseases:
early-onset Parkinsonism and X-linked mental retardation (Dostie et
al. 2003, RNA: 9: 180-186). Links between cancer and miRNAs have
also been recently described. The most frequent single genetic
abnormality in chronic lymphocytic leukaemia (CLL) is a deletion
localized to chromosome 13q14 (50% of the cases). A recent study
determined that two different miRNA (miR15 and miR16) genes are
clustered and located within the intron of LEU2, which lies within
the deleted minimal region of the B-cell chronic lymphocytic
leukaemia (B-CLL) tumour suppressor locus, and both genes are
deleted or down-regulated in the majority of CLL cases (Calin et
al. 2002, Proc. Natl. Acad. Sci. U.S.A. 99: 15524-15529). It has
been anticipated that connections between miRNAs and human diseases
will only strengthen in parallel with the knowledge of miRNAs and
the gene networks that they control. Moreover, the understanding of
the regulation of RNA-mediated gene expression is leading to the
development of novel therapeutic approaches that will be likely to
revolutionize the practice of medicine (Nelson et al. 2003, TIBS
28: 534-540).
[0018] Small Interfering RNAs and RNAi
[0019] Some of the recent attention paid to small RNAs in the size
range of 21 to 25 nt is due to the phenomenon RNA interference
(RNAi), in which double-stranded RNA leads to the degradation of
any RNA that is homologous (Fire et al. 1998, Nature 391: 806-811).
RNAi relies on a complex and ancient cellular mechanism that has
probably evolved for protection against viral attack and mobile
genetic elements. A crucial step in the RNAi mechanism is the
generation of short interfering RNAs (siRNAs), double-stranded RNAs
that are about 22 nt long each. The siRNAs lead to the degradation
of homologous target RNA and the production of more siRNAs against
the same target RNA (Lipardi et al. 2001, Cell 107: 297-307). The
present view for the mRNA degradation pathway of RNAi is that
antiparallel Dicer dimers cleave long double-stranded dsRNAs to
form siRNAs in an ATP-dependent manner. The siRNAs are then
incorporated in the RNA-induced silencing complex (RISC) and
ATP-dependent unwinding of the siRNAs activates RISC (Zhang et al.
2002, EMBO J. 21: 5875-5885; Nykanen et al. 2001, Cell 107:
309-321). The active RISC complex is thus guided to degrade the
specific target mRNAs.
[0020] Detection and Analysis of MicroRNAs and siRNAs
[0021] The current view that miRNAs may represent a newly
discovered, hidden layer of gene regulation has resulted in high
interest among researchers around the world in the discovery of
miRNAs, their targets and mechanism of action. Detection and
analysis of these small RNAs is, however not trivial. Thus, the
discovery of more than 700 miRNAs to date has required taking
advantage of their special features. First, the research groups
have used the small size of the miRNAs as a primary criterion for
isolation and detection. Consequently, standard cDNA libraries
would lack miRNAs, primarily because RNAs that small are normally
excluded by sixe selection in the cDNA library construction
procedure. Total RNA from fly embryos, worms or HeLa cells have
been size fractionated so that only molecules 25 nucleotides or
smaller would be captured (Moss 2002, Curr. Biology 12: R138-R140).
Synthetic oligomers have then been ligated directly to the RNA
pools using T4 RNA ligase. Then the sequences have been
reverse-transcribed, amplified by PCR, cloned and sequenced (Moss
2002, Curr. Biology 12: R138-R140). The genome databases have
subsequently been queried with the sequences, confirming the origin
of the miRNAs from these organisms as well as placing the miRNA
genes physically in the context of other genes in the genome. The
vast majority of the cloned sequences have been located in intronic
regions or between genes, occasionally in clusters, suggesting that
the tandemly arranged miRNAs are processed from a single transcript
to allow coordinate regulation. Furthermore, the genomic sequences
have revealed the fold-back structures of the miRNA precursors
(Moss 2002, Curr. Biology 12: R138-R140).
[0022] The size and sometimes low level of expression of different
miRNAs require the use of sensitive and quantitative analysis
tools. Due to their small size of 21-25 nt, the use of quantitative
real-time PCR for monitoring expression of mature miRNAs is
excluded. Therefore, most miRNA researchers currently use Northern
blot analysis combined with polyacrylamide gels to examine
expression of both the mature and pre-miRNAs (Reinhart et al. 2000,
Nature 403: 901-906; Lagos-Quintana et al. 2001, Science 294:
853-858; Lee and Ambros 2001, Science 294: 862-864). Primer
extension has also been used to detect the mature miRNA (Zeng and
Cullen 2003, RNA 9: 112-123). The disadvantage of all the gel-based
assays (Northern blotting, primer extension, RNase protection
assays etc.) as tools for monitoring miRNA expression includes low
throughput and poor sensitivity. DNA microarrays would appear to be
a good alternative to Northern blot analysis to quantify miRNAs
since microarrays have excellent throughput. However, the drawbacks
of microarrays are the requirement of high concentrations of input
target for efficient hybridization and signal generation, poor
sensitivity for rare targets, and the necessity for post-array
validation using more sensitive assays such as real-time
quantitative PCR, which is not feasible. A recent report used cDNA
microarrays to monitor the expression of miRNAs during neuronal
development with 5 to 10 .mu.g aliquot of input total RNA as
target, but the mature miRNAs had to be separated from the miRNA
precursors using micro concentrators prior to microarray
hybridizations (Krichevsky et al. 2003, RNA 9: 1274-1281). A PCR
approach has also been used to determine the expression levels of
mature miRNAs (Grad et al. 2003, Mol. Cell 11: 1253-1263). This
method is useful to clone miRNAs, but highly impractical for
routine miRNA expression profiling, since it involves gel isolation
of small RNAs and ligation to linker oligonucleotides. Schmittgen
et al. (2004, Nucleic Acids Res. 32: e43) describe an alternative
method to Northern blot analysis, in which they use real-time PCR
assays to quantify the expression of miRNA precursors. The
disadvantage of this method is that it only allows quantification
of the precursor miRNAs, which does not necessarily reflect the
expression levels of mature miRNAs. In order to fully characterize
the expression of large numbers of miRNAs, it is necessary to
quantify the mature miRNAs, such as those expressed in human
disease, where alterations in miRNA biogenesis produce levels of
mature miRNAs that are very different from those of the precursor
miRNA. For example, the precursors of 26 miRNAs were equally
expressed in non-cancerous and cancerous colorectal tissues from
patients, whereas the expression of mature human miR143 and miR145
was greatly reduced in cancer tissues compared with non-cancer
tissues, suggesting altered processing for specific miRNAs in human
disease (Michael et al. 2003, Mol. Cancer Res. 1: 882-891). On the
other hand, recent findings in maize with miR166 and miR165 in
Arabidopsis thaliana, indicate that microRNAs act as signals to
specify leaf polarity in plants and may even form movable signals
that emanate from a signalling centre below the incipient leaf
(Juarez et al. 2004, Nature 428: 84-88; Kidner and Martienssen
2004, Nature 428: 81-84).
[0023] In conclusion, the biggest challenge in measuring the mature
miRNAs as well as siRNAs using real-time quantitative PCR is their
small size of the of 21-25 nt. The described method of invention
addresses the aforementioned practical problems in detection and
quantification of small RNA molecules, miRNAs as well as siRNAs,
and aims at ensuring the development of flexible, convenient and
inexpensive assays for accurate and specific quantification of
miRNA and sRNA transcripts.
[0024] RNA Editing and Alternative Splicing
[0025] RNA editing is used to describe any specific change in the
primary sequence of an RNA molecule, excluding other
mechanistically defined processes such as alternative splicing or
polyadenylation. RNA alterations due to editing fall into two broad
categories, depending on whether the change happens at the base or
nucleotide level (Gott 2003, C. R. Biologies 326 901-908). RNA
editing is quite widespread, occurring in mammals, viruses,
marsupials, plants, flies, frogs, worms, squid, fungi, slime molds,
dinoflagellates, kinetoplastid protozoa, and other unicellular
eukaryotes. The current list most likely represents only the tip of
the iceberg; based on the distribution of homologues of known
editing enzymes, as RNA editing almost certainly occurs in many
other species, including all metazoa. Since RNA editing can be
regulated in a developmental or tissue-specific manner, it is
likely to play a significant role in the etiology of human disease
(Gott 2003, C. R. Biologies 326 901-908).
[0026] A common feature for eukaryotic genes is that they are
composed of protein-encoding exons and introns. Introns are
characterized by being excised from the pre-mRNA molecule in RNA
splicing, as the sequences on each side of the intron are spliced
together. RNA splicing not only provides functional mRNA, but is
also responsible for generating additional diversity. This
phenomenon is called alternative splicing, which results in the
production of different mRNAs from the same gene. The mRNAs that
represent isoforms arising from a single gene can differ by the use
of alternative exons or retention of an intron that disrupts two
exons. This process often leads to different protein products that
may have related or drastically different, even antagonistic,
cellular functions. There is increasing evidence indicating that
alternative splicing is very widespread (Croft et al. Nature
Genetics, 2000). Recent studies have revealed that at least 80% of
the roughly 35,000 genes in the human genome are alternatively
spliced (Kampa et al. 2004, Genome Research 14: 331-342). Clearly,
by combining different types of modifications and thus generating
different possible combinations of transcripts of different genes,
alternative splicing together with RNA editing are potent
mechanisms for generating protein diversity. Analysis of the
alternative splice variants and RNA editing, in turn, represents a
novel approach to functional genomics, disease diagnostics and
pharmacogenomics.
[0027] Misplaced Control of Alternative Splicing as a Causative
Agent for Human Disease
[0028] The detection of the detailed structure of the
transcriptional output is an important goal for molecular
characterization of a cell or tissue. Without the ability to detect
and quantify the splice variants present in one tissue, the
transcript content or the protein content cannot be described
accurately. Molecular medical research shows that many cancers
result in altered levels of splice variants, so an accurate method
to detect and quantify these transcripts is required. Mutations
that produce an aberrant splice form can also be the primary cause
of such severe diseases such as spinal muscular dystrophy and
cystic fibrosis.
[0029] Much of the study of human disease, indeed much of genetics
is based upon the study of a few model organisms. The evolutionary
stability of alternative splicing patterns and the degree to which
splicing changes according to mutations and environmental and
cellular conditions influence the relevance of these model systems.
At present, there is little understanding of the rates at which
alternative splicing patterns or RNA editing change, and the
factors influencing these rates. Previously, other analysis methods
have been performed with the aim of detecting either splicing of
RNA transcripts per se in yeast, or of detecting putative exon
skipping splicing events in rat tissues, but neither of these
approaches had sufficient resolution to estimate quantities of
splice variants, a factor that could be essential to an
understanding of the changes in cell life cycle and disease. Thus,
improved methods are needed for nucleic acid amplification,
hybridization, and quantification. The present method of invention
enables to distinguish between mRNA splice variants as well as
RNA-edited transcripts and quantify the amount of each variant in a
nucleic acid sample, such as a sample derived from a patient.
[0030] Antisense Transcription in Eukaryotes
[0031] RNA-mediated gene regulation is widespread in higher
eukaryotes and complex genetic phenomena like RNA interference,
co-suppression, transgene silencing, imprinting, methylation, and
possibly position-effect variegation and transvection, all involve
intersecting pathways based on or connected to RNA signalling
(Mattick 2001; EMBO reports 2, 11: 986-991). Recent studies
indicate that antisense transcription is a very common phenomenon
in the mouse and human genomes (Okazaki et al. 2002; Nature 420:
563-573; Yelin et al. 2003, Nature Biotechnol.). Thus, antisense
modulation of gene expression in eukaryotic cells, e.g. human cells
appear to be a common regulatory mechanism. In light of this, the
present invention provides a method for quantification of
non-coding antisense RNAs, as well as a method for highly accurate
mapping of the overlapping regions between sense-antisense
transcriptional units.
SUMMARY OF THE INVENTION
[0032] The challenges of establishing genome function and
understanding the layers of information hidden in the complex
transcriptomes of higher eukaryotes call for novel, improved
technologies for detection, analysis and quantification of RNA
molecules in complex nucleic acid samples. Thus, it would be highly
desirable to be able to detect and quantify the expression of
mature microRNAs, siRNAs, RNA-edited transcripts as well as highly
homologous splice variants in the transcriptomes of eukaryotes
using methods based on specific and sensitive oligonucleotide
detection probes in a homogeneous assay system.
[0033] The present invention solves the current problems faced by
conventional approaches to homogeneous assays outlined above by
providing a method for the design, synthesis and combined use of
novel oligonucleotide tagging probes and detection probes with
sufficient sequence specificity and high affinity to short nucleic
acid targets, e.g. RNA target sequences--so that they are unlikely
to detect a random RNA target molecule and also unlikely to detect
pre-mature RNA molecules. Such tagging probes contain a sequence,
anchored to the tagging probes, essential as priming sites for
subsequent amplification of the nucleic acids by polymerase chain
reaction in real-time quantitative PCR assays. The method of
invention utilizes two anchored tagging probes, each designed in
combination to detect a complementary target sequence, e.g. a short
RNA sequence, where the first tagging probe hybridizes to a first
region within a target sequence and the second tagging probe
hybridizes to a second region within the same complementary target
sequence, e.g. a short RNA target sequence that is adjacent to the
first region. In the preferred mode, one of the tagging probes is
5' phosphorylated enabling covalent coupling of the two contiguous
tagging oligonucleotide probes hybridized to the complementary
target sequence by a ligase to form a single oligonucleotide
sequence. The background in the hybridization to the target RNA
sequence in complex nucleic acid samples is eliminated by the use
of two tagging probes, where the hybridization of both probes to
the complementary target sequence, e.g. short RNA target sequence
is required for the covalent joining of the two probes. The method
furthermore takes the advantage of substitution of the recognition
sequences with high-affinity nucleotide analogues, e.g. LNA, for
sensitive and specific hybridization to short target sequences,
e.g. miRNAs or siRNAs. The ligation reaction is followed by
quantitative real-time PCR of the target sequence, e.g. ribonucleic
acid-templated, covalently joined oligonucleotide molecules using
the anchor sequences attached to the tagging probes as priming
sites for the PCR primers and a short detection probe with
sufficient duplex stability to allow binding to the amplicon, and
employing any of a variety of detection principles used in
homogeneous assays. In the preferred mode, the detection probe is
substituted with duplex-stabilizing, high-affinity nucleotide
analogues, e.g. LNA, and preferably oxy-LNA, to allow use of short
detection probes in the real-time quantitative PCR assay.
[0034] In another approach the covalent joining of the tagging
probes hybridized to the target ribonucleic acid in the nucleic
acid sample is carried out using a thermostable ligase, which
allows repetitive cycles of denaturation, annealing and ligation at
elevated temperatures to be carried out in the target sequence
tagging reaction, thus generating a plurality of covalently joined
template molecules for the subsequent real-time quantitative PCR
assay. In the preferred mode the annealing temperature is adjusted
so as to allow discrimination between highly homologous target
ribonucleic acids in complex nucleic acid samples. In another
aspect the annealing temperature is adjusted to allow single
mismatch discrimination between highly homologous target
sequences.
[0035] In yet another approach the recognition sequence of the
first tagging probe is complementary to a sequence in the target
ribonucleic acid sequence, e.g. to the 3'-end of the mature
microRNA or siRNA or to a sequence located 3' to the RNA edited
nucleotide, splice junction, single nucleotide polymorphism or
point mutation in the target ribonucleic acid sequence. The said
first tagging probe, designated as RT tagging probe, is used as an
anchored primer in a reverse transcription reaction to generate a
primer extension product, complementary to the target RNA sequence
using a reverse transcriptase enzyme. The second tagging probe,
designated as 2.sup.nd strand tagging probe, is designed so that
its recognition sequence is complementary to the reverse
transcriptase-extended nucleotide sequence corresponding to the
5'-end of the mature microRNA or siRNA or located 5' to the RNA
edited nucleotide, splice junction, single nucleotide polymorphism
or point mutation in the ribonucleic acid target sequence The
2.sup.nd strand tagging probe is used as anchored primer to
generate the second strand complementary to the primer extension
product. The specificity of the reaction is based on the sequential
use of the two anchored tagging probes, hybridising to
complementary 3'-end and 5'-end regions of the target RNA and
complementary DNA sequences, respectively. In a preferred mode the
recognition sequence of the RT tagging probe is modified with
duplex-stabilizing, high-affinity nucleotide analogues e.g. LNA,
and preferably oxy-LNA, to allow use of high-stringency primer
annealing conditions. In yet another preferred mode the recognition
sequences of both tagging probes are modified with
duplex-stabilizing, high-affinity nucleotide analogues e.g. LNA,
and preferably oxy-LNA, to allow use of high-stringency primer
annealing conditions in both the reverse transcription and second
strand synthesis reactions, respectively. The second strand
reaction is followed by quantitative real-time PCR of the resulting
double-stranded target sequence, corresponding to an anchored
target ribonucleic acid sequence, e.g. a microRNA sequence, using
the anchor sequences attached to the tagging probes as priming
sites for the PCR primers and a short detection probe with
sufficient duplex stability to allow binding to the amplicon, and
employing any of a variety of detection principles used in
homogeneous assays. In the preferred mode, the detection probe is
substituted with duplex-stabilizing, high-affinity nucleotide
analogues, e.g. LNA, and preferably oxy-LNA, to allow use of short
detection probes in the real-time quantitative PCR assay. In yet
another preferred mode, the detection probe is furthermore
substituted with duplex-stabilizing LNA diaminopurine or LNA
2-thio-T high-affinity analogues in combination with LNA
monomers.
[0036] The present methods of invention are highly useful and
applicable for detection and quantification of individual small RNA
molecules in complex mixtures composed of hundreds of thousands of
different nucleic acids, such as detecting mature miRNAs or siRNAs,
when combined with a miRNA or sRNA target specific tagging probe
set and a miRNA or a sRNA detection probe. The recognition
sequences in the tagging probe set as well as the detection probe
are synthesized by substitution of high affinity nucleotide
analogues, e.g. LNA, and preferably oxy-LNA, allowing highly
sensitive and specific hybridization and ligation to occur at
elevated temperatures. By the use of short detection probes of the
invention, substituted with high affinity nucleotide analogues,
e.g. LNA, LNA diaminopurine and LNA 2-thio-thymidine, short
amplicons corresponding to mature miRNAs or siRNAs, including the
anchor primer sites from the tagging probe set can be monitored
directly in standard real-time quantitative PCR assays. The present
method is furthermore highly useful in the detection and
quantification of non-coding RNAs other than miRNAs or siRNAs,
antisense RNA transcripts, RNA-edited transcripts or highly
homologous, alternatively spliced transcripts in complex nucleic
acid samples, such as the human, mouse, rat, C. elegans, Drosophila
melanogaster, Arabidopsis thaliana, rice and maize transcriptomes
composed of hundreds of thousands of different ribonucleic acids in
their respective transcriptomes. The method is also directly
applicable to detecting, testing, diagnosing or quantifying miRNAs,
siRNAs, other non-coding RNAs, RNA-edited transcripts or
alternative mRNA splice variants implicated in or connected to
human disease in complex human nucleic acid samples, e.g. from
cancer patients.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0038] FIG. 2A shows the real-time quantitative PCR amplification
plot for the human miR-15a microRNA target sequence. The
sequence-specific LNA-modified microRNA tagging probes were
annealed, ligated and the ligated tagging probes were subsequently
detected using real-time PCR, anchor PCR primers and an
LNA-modified dual-labelled detection probe for the miR-15a microRNA
(solid squares) using a minus template as a negative control
(crosses). The specificity of the reaction was tested using a
reaction without ligase (open squares). The threshold cycle (Ct)
for the ligated microRNA probes using the miR-15a microRNA template
was 35.0 whereas no Ct values were detectable for the negative
control experiments (minus template and minus ligase). The
.DELTA.Rn is the baseline corrected normalized reporter signal (Rn)
and represents the Rn minus the baseline signal established in the
first few cycles of PCR. FIG. 2B shows the end-point analysis of
the real-time PCR reactions on a 2 agarose gel electrophoresis
stained with Gelstar (dilution 1:10000, Cambrex Bio Science, USA).
The ligated miR-15a tagging probes template shows a PCR fragment in
lane 1 (.about.65 bp). The negative control experiments (minus
template (lane 2) and minus ligase (lane 3)) showed shorter
fragments with a lower molecular weight than for the ligated
mir-15a tagging probes template. The No template control (NTC) in
the real-time PCR reaction was without any fragments on the agarose
gel electrophoresis (not shown).
[0039] FIG. 3 shows the real-time quantitative PCR amplification
plot for the human miR-15a microRNA target sequence and the
corresponding DNA 3'-blocked target. The RNA template (solid
squares) was replaced by a DNA template chemically blocked with a
phosphate at the 3'-end (solid triangles). Without ligase (open
triangles) the blocked DNA template could not be detected in the
LNA sequence-specific real-time PCR assay. The Ct values for the
RNA template and the DNA template were 35.0 and 33.3,
respectively.
[0040] FIG. 4 shows the real-time quantitative PCR amplification
plots for the human miR-15a and human miR-16 microRNA target
sequences. Sequence-specific microRNA target sequence recognition
of the method of invention was assessed by using the miR-15a
microRNA target (solid squares) in comparison with the miR-16
target (open circles) that has 72% sequence identity with the
miR-15a target sequence. Neither the minus template control
(crosses) nor the NTC in the real-time PCR reaction (black vertical
line) were shown to give any signals. The hybridization conditions
for the annealing of the LNA-modified miR-15a target
sequence-specific tagging probes towards the miR-15a target
resulted in a Ct value of 36.2, whereas the use of the same tagging
probes for the highly homologous miR-16 resulted in a Ct value of
39.9, corresponding to a 13-fold discriminative difference.
[0041] FIG. 5 shows the real-time quantitative PCR amplification
plots for the human miR-15a microRNA target sequence using two
different LNA-modified, dual-labelled detection probes. Two
different LNA-modified real-time PCR detection probes were designed
for the human miR-15a microRNA target sequence using the same
LNA-modified tagging probes ligated by the Quick T4 DNA ligation
kit. The use of the LNA-modified detection probes EQ15866 (solid
squares) and EQ15867 (solid triangles) in the real-time PCR assays
resulted in Ct values of 38.2 and 32.2, respectively. No signals
where detected from both the minus ligase controls (EQ15866 open
squares; EQ15867 open triangles).
[0042] FIG. 6 shows the real-time quantitative PCR amplification
plots for the human miR-15a target sequence using different molar
ratios between the target and the miR-15a tagging probes. The molar
ratios between target and tagging probes were 1:1 (solid square)
resulted in the highest end-point fluorescence signal (.DELTA.Rn
value), while the 1:5 molar ratios (open diamonds) resulted in the
lowest end-point signal (.DELTA.Rn value). A molar excess of the
miR-15a tagging probes (1:5 molar ratio (solid diamonds)) also
resulted in a specific end-point signal, whereas no fluorescence
signal was detected from NTC in the PCR reaction.
[0043] FIG. 7 shows the real-time quantitative PCR amplification
plots for the human miR-15a target sequence spiked into a complex
background of Torulla yeast total RNA using the miR-15a tagging
probes and the best-mode LNA-modified detection probe. The miR-15a
microRNA was spiked into 10 .mu.g of yeast total RNA at 2.4 .mu.M
(open squares) and 1 .mu.M (open circles) concentrations, annealed
with the miR-15a tagging probes at equimolar concentrations,
respectively, followed by ligation and miR-15a detection by
quantitative real-time PCR. The highest fluorescence signal was
observed from the miR-15a target sequence control (without the
complex yeast total RNA background (solid squares), while no
fluorescence signals were detected from the yeast total RNA sample
(vertical line). No contamination of the real-time PCR assays was
observed, as demonstrated with the NTC (crosses).
[0044] FIG. 8 shows the real-time quantitative PCR amplification
plot for the human miR-15a microRNA target sequence. The
sequence-specific LNA-modified microRNA tagging probes were
annealed, ligated and the ligated templates were subsequently
detected using real-time PCR, the anchor PCR primers and SYBR green
detection (solid squares) using a minus template as a negative
control (crosses). The specificity of the reaction was tested using
a reaction without ligase (open diamonds).
[0045] FIG. 9 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0046] FIG. 10 shows the structures of DNA, LNA and RNA
nucleosides.
[0047] FIG. 11 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0048] FIG. 12 shows the structures of LNA 2,6-diaminopurine and
LNA 2-thiothymidine nucleosides.
[0049] FIG. 13. Shows the real-time quantitative PCR amplification
plots for the human miR-15a microRNA using microRNA-templated
ligation with three different pairs of miR-15a tagging probes (I;
EQ16311/EQ16452, II; EQ16453/EQ16307, and III; EQ16447/EQ16307)).
Pair I: miR-15a template (solid squares) no template (open squares)
and no T4 DNA ligase (open diamonds), pair II: miR-15a template
(solid triangles), no template (open triangles) and no T4 DNA
ligase (dotted line), pair III: miR-15a template (solid circles),
no template (open circles) and no T4 DNA ligase (black line).
[0050] FIG. 14. Shows the real-time quantitative PCR amplification
plots demonstrating improved detection for the human miR-15a
microRNA by microRNA-templated ligation and LNA
2,6-diaminopurine-enhanced miR-15a detection probes. The detection
probe EQ16580 solid squares, EQ16581 solid triangles, EQ16582 solid
circles and EQ16583 crosses, and corresponding no template
controls; EQ16580 open squares, EQ16581 open triangles, EQ16582
open circles and EQ16583 black line.
[0051] FIG. 15. Standard curve for the human miR-15a real-time
quantitative PCR assay. The LNA-modified human miR-15a microRNA
tagging probes EQ16311/EQ16452 (pair I) was used in
miR-15a-templated ligation reactions, where the human miR-15a
template concentration was 50, 5, 0.5, 0.05, or 0.005 nM,
respectively. The ligated templates were subsequently detected
using real-time PCR by the anchor PCR primers and the LNA-modified
dual-labelled detection probe EQ15866 for the miR-15a microRNA
using a minus template as a negative control. Plotting of the cycle
threshold values versus log of template copy number was used to
generate the standard curve.
[0052] FIG. 16. Shows the real-time quantitative PCR amplification
plots demonstrating detection for the human mir-15a microRNA using
miR-15a microRNA-templated RT-PCR reaction and different
LNA-modified anchored tagging probes and an LNA-modified
dual-labelled detection probe. Three different pairs of microRNA
RT-PCR tagging probes were chosen pair IV: EQ16591/EQ16311, miR-15
template (solid squares), no template (black mark); pair V:
EQ16591/EQ16314 miR-15 template (solid diamonds), no template (open
triangle); and pair VI: EQ16589/EQ16314 miR15 template (solid
circles), no template (black line). Open circles depict the no
RT-PCR enzyme mix control.
[0053] FIG. 17. Shows the real-time quantitative PCR amplification
plots demonstrating improved detection of the human miR-15a by
microRNA-templated RT-PCR reaction using LNA
2,6-diaminopurine-enhanced miR-15a detection probes. The different
dual-labelled detection probes are shown as follows: EQ16580 (solid
triangles), EQ16581 (solid squares), EQ16582 (solid squares)
detection probes and no template negative control (solid line).
[0054] FIG. 18. Standard curve for the human miR-15a real-time
quantitative PCR assay. The LNA-modified microRNA tagging probes
EQ16624/EQ16620 (pair VII) for human miR-15a were used as a reverse
transcription primer (RT tagging probe) and 2.sup.nd strand tagging
probe. The RT-PCR reactions were performed with varying miR-15a
template concentration of 50, 5, 0.5, 0.05, or 0.005 nM,
respectively. The miR-15a was subsequently detected using real-time
PCR by using the anchor PCR primers and an LNA-modified
dual-labelled detection probe (EQ16582) for the miR-15a microRNA.
Plotting of the cycle threshold values versus log of template copy
number was used to generate the standard curve.
[0055] FIG. 19 Shows the real-time quantitative PCR amplification
plots demonstrating detection of the human miR-15a by
microRNA-templated RT-PCR reaction using varied annealing
temperatures 60.degree. C. (solid triangles), 55.degree. C. (solid
squares) and 50.degree. C. (solid diamonds). No signals were
detected for the no RT-PCR enzyme mix control and the no template
negative control.
[0056] FIG. 20. Shows the real-time quantitative PCR amplification
plots demonstrating detection for the human mir-15a microRNA using
miR-15a microRNA-templated RT-PCR reaction and different
LNA-modified dual-labelled detection probes. The different
dual-labelled detection probes are shown as follows:
miR-15a-templated real-time PCR and detection probe EQ16582 (solid
triangles), scrambled miR-16-templated real-time PCR and detection
probe EQ16582 (open triangles), miR-15a-templated real-time PCR and
detection probe EQ16679 (solid circles), scrambled miR-16-templated
real-time PCR and detection probe EQ16679 (open circles), and no
signals were detected for the no RT-PCR enzyme mix controls and the
no template negative controls.
[0057] FIG. 21. Shows the real-time quantitative PCR amplification
plots demonstrating detection for the human mir-15a microRNA using
miR-15a microRNA-templated RT and PCR reaction and LNA-modified
anchored tagging probes and an LNA-modified dual-labelled detection
probe. The samples are shown as follows: miR-15a-templated
real-time PCR (solid triangles), scrambled miR-16-templated
real-time PCR (solid squares), the no Superscript III negative
control (open squares), and the no template negative control (open
triangles).
[0058] FIG. 22 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0059] FIG. 23. Shows the real-time quantitative PCR amplification
plots demonstrating improved detection of the human miR-15a by
microRNA-templated RT-PCR reaction using LNA
2,6-diaminopurine-enhanced miR-15a detection probes. The graphs
depict the miR-15a microRNA target (open circles) in comparison
with the miR-16 target (solid triangles) that has 72% sequence
identity with the miR-15a target sequence. The negative controls
were no microRNA blocked tagging probe (open triangles), no second
strand LNA tagging probe (solid squares), and no Klenow Fragment
(3'.fwdarw.5' exo-) enzyme (open squares), whereas no Ct values
were detectable for the no hsa-miR-15a reverse primer 2 control
(line) or no Qiagen OneStep RT-PCR Enzyme mix control (line) in the
real-time PCR reaction.
[0060] FIG. 24. The amplification plots and the standard curve
(small graph) for the human miR-15a real-time quantitative PCR
assay. The LNA-modified human miR-15a microRNA tagging probes
EQ1695 and EQ16624 (pair IX) were used in miR-15a-templated RT-PCR
reactions with a 3'-blocked LNA-modified tagging probe as capture,
where the mature human miR-15a template was 500, 50, 5, 0.5, or
0.05 fmol, respectively, in the individual reactions The templates
were subsequently detected using real-time PCR by the anchor PCR
primers and the LNA-modified dual-labelled detection probe EQ15866
for the miR-15a microRNA using a minus template as a negative
control. Plotting of the cycle threshold values versus log of
template copy number was used to generate the standard curve.
[0061] FIG. 25. Shows the real-time quantitative PCR amplification
plots demonstrating detection of the human U6 snRNA-templated
RT-PCR reaction using LNA detection probe 1 .mu.L cDNA template
(solid squares), 5 .mu.L cDNA template (open squares), and no
template negative control (open triangles).
[0062] FIG. 26 shows the real-time quantitative PCR amplification
plots demonstrating detection of the hsa miR-7a templated RT-PCR
produced a sigmoid amplification plot with ample amount of signal
and a Ct value of 18.5.
[0063] FIG. 27 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0064] FIG. 28 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0065] FIG. 29 shows part of the Hsa miR-15a precursor sequence
with stem loop (SEQ ID NO: 72) (A), the mature Hsa miR-15a sequence
(SEQ ID NO: 73), and a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR (C-E).
[0066] C: Annealing a small LNA-modified oligo onto the RT primer
prior to the cDNA synthesis reaction will introduce a local double
helical structure in the RT-primer.
[0067] D: Reverse transcriptase reaction (RT): Because of the local
double helical structure of the RT-primer only the mature miR will
serve as template for the cDNA synthesis.
[0068] E: Following cDNA synthesis, the heat inactivation of the RT
enzyme also will melt off the small LNA-modified oligo from the
cDNA.
[0069] Real-time PCR:
[0070] Standard real-time PCR involving a "hot start" Taq
polymerase, if desired. The first cycle of PCR should be reduced
annealing temperature compared to the standard 60.degree. C., the
remaining PCR cycles can be performed at standard real-time PCR
conditions.
[0071] FIG. 30 shows part of the Hsa miR-143 precursor sequence
(SEQ ID NO: 74) (A), the mature Hsa miR-143 sequence (SEQ ID NO:
75) (B), and a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR (C-E).
[0072] C and D: Reverse transcriptase reaction (RT): The RT-primer
will anneal to both the mature miR and the pre-miR (if present in
the sample), and the reverse transcriptase enzyme will make a cDNA
copy of both molecules.
[0073] E: Annealing a small LNA-modified oligo onto the forward PCR
primer prior to the PCR reaction will introduce a local double
helical structure in the PCR primer.
[0074] Real-time PCR:
[0075] Because of the local double helical structure of the forward
PCR primer, the primer will preferably anneal to the cDNA derived
from the mature miR. The initial PCR cycle, which is actually a
primer extension reaction should be performed with a non "hot
start" Taq polymerase or a Klenow enzyme. The annealing temperature
should be around 45.degree. C. or low enough to ensure that the
local double helical structure of the forward PCR primer is stable.
The standard extension temperature of 60.degree. C. should work
fine. The remaining PCR cycles can be performed at standard
real-time PCR conditions.
[0076] FIG. 31 is a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0077] FIG. 32 shows the real-time quantitative PCR amplification
plot for the human miR 143 microRNA target sequence. The assay was
performed according to the schematic representation in FIG. 31 and
as described in Example 30. Open squares represent reaction with
purification in step 2 of Example 30, closed squares represent
reaction without purification in step 2 of Example 30. The curves
that do not rise from the baseline represent the corresponding "No
miR"-controls.
[0078] FIG. 33 shows a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR.
[0079] FIG. 34 shows part of the Hsa miR-143 precursor sequence
(SEQ ID NO: 76) (A), the mature Hsa miR-143 sequence (SEQ ID NO:
77) (B), and a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR (C-E).
[0080] C and D: Reverse transcriptase reaction (RT): The RT-primer
will anneal to both the mature miR and the pre-miR (if present in
the sample) and the reverse transcriptase enzyme will make a cDNA
copy of both molecules.
[0081] E: Annealing a small LNA-modified looped forward PCR primer
prior to the PCR reaction will introduce a local double helical
structure in the PCR primer.
[0082] Real-time PCR:
[0083] Because of the looped forward PCR primer, the primer will
preferably anneal to the cDNA derived from the mature miR. The
initial PCR cycle, which is actually a primer extension reaction
should be performed with a non "hot start" Taq polymerase or a
Klenow enzyme. The annealing temperature should be around
45.degree. C. or low enough to ensure that the local double helical
structure of the forward PCR primer is stable. The standard
extension temperature of 60.degree. C. should work fine. The
remaining PCR cycles can be performed at standard real-time PCR
conditions.
[0084] FIG. 35 Shows the real-time quantitative PCR amplification
plots demonstrating Ligation of an RNA adaptor to mature microRNA
followed by reverse transcription, and real-time PCR using an
LNA-modified detection probe with quencher Q2. The hsa-let-7a open
squares, the hsa-let-7g solid squares, no miRNA open triangles, and
no PCR template control solid triangles.
[0085] FIG. 36 shows a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR (A-D).
[0086] A: Total RNA samples (Mature microRNA target (18-23 nt) and
pri-/precursor microRNA).
[0087] B: The RNA adaptor oligonucleotide is ligated to the mature
microRNA target using T4 RNA ligase.
[0088] C: The reverse transcription is performed using a RT primer
which is complementary to the RNA adaptor oligonucleotide. This
universal sequence tag can be used for first strand synthesis of
all tagged miRNAs.
[0089] D: The cDNA product is used as template for a real-time PCR
using a reverse primer nested in the RT primer derived sequence and
a forward primer with partial complementarity to the reverse
transcribed mature microRNA sequence.
[0090] FIG. 37 shows a schematic presentation of one method of the
invention for quantification of microRNAs by sequence-specific
real-time quantitative RT-PCR (SEQ ID NOS: 78 and 79).
DEFINITIONS
[0091] For the purposes of the subsequent detailed description of
the invention the following definitions are provided for specific
terms, which are used in the disclosure of the present
invention:
[0092] In the following, "Blocker probe" or "blocker probes" refer
to a probe or probes, comprising a recognition sequence,
complementary to the target sequence, e.g. a short RNA target
sequence, an oligonucleotide, a primer. The said blocker probe is
used to prevent hybridization of sequence identical molecules
towards the complementary target sequence. Generally, the blocker
probe contains one, two or more LNA monomers and the 3'-terminus of
the blocker probe is modified to prohibit incorporation of the
blocker probe into a primer extension product. This "blocking" may
be achieved by using non-complementary bases or by adding a
chemical moiety such as biotin or a phosphate group to the
3'-hydroxyl group of the last nucleotide.
[0093] In the following, "dNTP" means a mixture of
2'-deoxyadenosine-5'-triphosphate,
2'-deoxycytidine-5'-triphosphate,
2'-deoxyguanosine-5'-triphosphate, and
2'-deoxythymidine-5'-triphosphate.
[0094] "RT-primer" refers to a primer, comprising a recognition
sequence, complementary to a sequence in the target
deoxyribonucleic and/or ribonucleic acid sequence, e.g. to the
3'-end of the mature microRNA or siRNA, or to an RNA-DNA chimerical
moiety, or to a sequence located 3' to a RNA-edited nucleotide,
splice junction, single nucleotide polymorphism or point mutation
in the target ribonucleic acid sequence, and an anchor sequence
essential for subsequent capture or amplification by PCR. The said
RT-primer is used as an anchored primer in a reverse transcription
reaction to generate a primer extension product, complementary to
the target RNA sequence using a reverse transcriptase enzyme.
[0095] The term "Capture probes" or "capture probe" refer to a
probe(s), comprising a recognition sequence, complementary to the
target sequence, e.g. a short RNA target sequence, and an anchor
sequence essential for subsequent capture, reverse transcription
reaction, or amplification by PCR. The anchor sequence function as
priming sites for the RT- or PCR primers in subsequent reverse
transcription reaction, real-time PCR, or as tags for capture
assays.
[0096] In the present context, the term "linker" means a
thermochemically and photochemically non-active distance-making
group that is used to join two or more different nucleotide
moieties of the types defined above. Linkers are selected on the
basis of a variety of characteristics including their
hydrophobicity, hydrophilicity, molecular flexibility and length
(e.g. see Hermanson et. al., "Immobilized Affinity Ligand
Techniques", Academic Press, San Diego, Calif. (1992), p. 137-ff).
Generally, the length of the linkers is less than or about 400
angstroms, in some applications preferably less than 100 angstroms.
The linker, thus, comprises a chain of carbon atoms optionally
interrupted or terminated with one or more heteroatoms, such as
oxygen atoms, nitrogen atoms, and/or sulphur atoms. Thus, the
linker may comprise one or more amide, ester, amino, ether, and/or
thioether functionalities, and optionally aromatic or
mono/polyunsaturated hydrocarbons, polyoxyethylene such as
polyethylene glycol, oligo/polyamides such as poly-(3-alanine,
polyglycine, polylysine, and peptides in general, oligosaccharides,
oligo/polyphosphates. Moreover the linker may consist of combined
units thereof. The length of the linker may vary, taking into
consideration the desired or necessary positioning and spatial
orientation of the "active/functional" part of the group in
question in relation to the 5- or 6-membered ring. In particularly
interesting embodiments, the linker includes a chemically cleavable
group. Examples of such chemically cleavable groups include
disulphide groups cleavable under reductive conditions, peptide
fragments cleavable by peptidases, etc.
[0097] In the present context a "solid support" may be chosen from
a wide range of polymer materials e.g. CPG (controlled pore glass),
polypropylene, polystyrene, polycarbonate or polyethylene and is
may take a variety of forms such as a tube, a microtiter well
plate, a stick, a bead, a particle, a filter etc. The
oligonucleotide may be immobilized to the solid support via its 5'-
or 3'-end (or via the terminus of a linker attached to the 5'- or
3'-end) by a variety of chemical or photochemical methods usually
employed in the immobilization of oligonucleotides or by
non-covalent coupling e.g. via binding of a biotinylated
oligonucleotide to immobilized streptavidin.
[0098] A "looped primer" refers to a probe, comprising a
recognition sequence, complementary to a sequence in the target
deoxyribonucleic acid sequence which recognition sequence is
complementary to the reverse transcriptase-extended nucleotide
sequence corresponding to the 5'-end of the mature microRNA or
siRNA or located 5' to the RNA edited nucleotide, splice junction,
single nucleotide polymorphism or point mutation in the initial
ribonucleic acid target sequence, and an anchor sequence essential
for subsequent capture or amplification by PCR. The said looped
primer is used as an anchored primer to generate the second nucleic
acid strand, which is complementary to the primer extension
product. Another aspect of the looped primer is that the anchor
sequence forms an intramolecular hairpin structure at the chosen
assay temperature mediated by complementary sequences at the 5'-
and the 3'-end of the oligonucleotide. The specificity of the
reaction is based on the sequential use of the two anchored tagging
probes with non-overlapping recognition sequences, hybridising to
complementary 3'-end and 5'-end regions of the target RNA and
complementary DNA sequences, respectively.
[0099] A "hairpin structure" refers to an intramolecular structure
of an oligonucleotide at the chosen assay temperature mediated by
hybridization of complementary sequences at the 5'- and the 3'-end
of the oligonucleotide.
[0100] "U" refers to a enzyme unit defined as the amount of enzyme
required to convert a given amount reactants to a product using a
defined time and temperature.
[0101] In the present context "ligand" means something, which
binds. Ligands comprise biotin and functional groups such as:
aromatic groups (such as benzene, pyridine, naphtalene, anthracene,
and phenanthrene), heteroaromatic groups (such as thiophene, furan,
tetrahydrofuran, pyridine, dioxane, and pyrimidine), carboxylic
acids, carboxylic acid esters, carboxylic acid halides, carboxylic
acid azides, carboxylic acid hydrazides, sulfonic acids, sulfonic
acid esters, sulfonic acid halides, semicarbazides,
thiosemicarbazides, aldehydes, ketones, primary alcohols, secondary
alcohols, tertiary alcohols, phenols, alkyl halides, thiols,
disulphides, primary amines, secondary amines, tertiary amines,
hydrazines, epoxides, maleimides, C.sub.1-C.sub.20 alkyl groups
optionally interrupted or terminated with one or more heteroatoms
such as oxygen atoms, nitrogen atoms, and/or sulphur atoms,
optionally containing aromatic or mono/polyunsaturated
hydrocarbons, polyoxyethylene such as polyethylene glycol,
oligo/polyamides such as poly-.beta.-alanine, polyglycine,
polylysine, peptides, oligo/polysaccharides, oligo/polyphosphates,
toxins, antibiotics, cell poisons, and steroids, and also "affinity
ligands", i.e. functional groups or biomolecules that have a
specific affinity for sites on particular proteins, antibodies,
poly- and oligosaccharides, and other biomolecules.
[0102] The singular form "a", an and the include plural references
unless the context clearly dictates otherwise. For example, the
term "a cell" includes a plurality of cells, including mixtures
thereof. The term "a nucleic acid molecule" includes a plurality of
nucleic acid molecules.
[0103] "Transcriptome" refers to the complete collection of
transcriptional units of the genome of any species. In addition to
protein-coding mRNAs, it also represents non-coding RNAs, such as
small nucleolar RNAs, siRNAs, microRNAs and antisense RNAs, which
comprise important structural and regulatory roles in the cell.
[0104] The term "amplicon" refers to small, replicating DNA
fragments.
[0105] "Sample" refers to a sample of cells, or tissue or fluid
isolated from an organism or organisms, including but not limited
to, for example, skin, plasma, serum, spinal fluid, lymph fluid,
synovial fluid, urine, tears, blood cells, organs, tumours, and
also to samples of in vitro cell culture constituents (including
but not limited to conditioned medium resulting from the growth of
cells in cell culture medium, recombinant cells and cell
components).
[0106] An "organism" refers to a living entity, including but not
limited to, for example, human, mouse, rat, Drosophila, C. elegans,
yeast, Arabidopsis thaliana, maize, rice, zebra fish, primates,
domestic animals, etc.
[0107] "Tagging probes" or "tagging probe" refer to a probe(s),
comprising a recognition sequence, complementary to the target
sequence, e.g. a short RNA target sequence, and an anchor sequence
essential for subsequent capture or amplification by PCR. "Two
tagging probes" or a "Pair of tagging probes" refer to two anchored
tagging probes, each designed to detect in combination a short
complementary target sequence, e.g. a short RNA sequence, where the
recognition sequence of the first tagging probe hybridizes to a
first region within a target sequence and the recognition sequence
of the second tagging probe hybridizes to a second region within
the same complementary target sequence, e.g. a short RNA target
sequence that is adjacent to the first region. In the method of
invention, one of the tagging probes is 5' phosphorylated enabling
covalent coupling of the two contiguous, non-overlapping tagging
oligonucleotide probes hybridized to the complementary target
sequence by a ligase to form a single oligonucleotide sequence. The
anchor sequences attached to the tagging probes are designed so
that they do not cross-hybridize to any target nucleic acid in a
given transcriptome or to each other under the hybridization
conditions used in the method of invention. The anchor sequences
function as priming sites for the PCR primers in subsequent
real-time quantitative PCR or as tags for capture assays.
[0108] "RT tagging probe" refers to a probe, comprising a
recognition sequence, complementary to a sequence in the target
ribonucleic acid sequence, e.g. to the 3'-end of the mature
microRNA or siRNA or to a sequence located 3' to a RNA-edited
nucleotide, splice junction, single nucleotide polymorphism or
point mutation in the target ribonucleic acid sequence, and an
anchor sequence essential for subsequent capture or amplification
by PCR. The said RT tagging probe is used as an anchored primer in
a reverse transcription reaction to generate a primer extension
product, complementary to the target RNA sequence using a reverse
transcriptase enzyme. "2.sup.nd strand tagging probe" refers to an
anchored tagging probe, which recognition sequence is complementary
to the reverse transcriptase-extended nucleotide sequence
corresponding to the 5'-end of the mature microRNA or siRNA or
located 5' to the RNA edited nucleotide, splice junction, single
nucleotide polymorphism or point mutation in the initial
ribonucleic acid target sequence. The 2.sup.nd strand tagging probe
is used as anchored primer to generate the second nucleic acid
strand, which is complementary to the primer extension product. The
specificity of the reaction is based on the sequential use of the
two anchored tagging probes with non-overlapping recognition
sequences, hybridising to complementary 3'-end and 5'-end regions
of the target RNA and complementary DNA sequences,
respectively.
[0109] "Two tagging probes" or a "Pair of tagging probes" refer to
two anchored tagging probes, each designed to detect in combination
a short complementary target sequence, e.g. a short RNA sequence,
where the recognition sequence of the first tagging probe
hybridizes to a first region within a target sequence and the
recognition sequence of the 2.sup.nd strand tagging probe
recognizing a sequence is complementary to the reverse
transcriptase-extended nucleotide sequence corresponding to the
5'-end of the mature microRNA or siRNA or located 5' to the RNA
edited nucleotide, splice junction, single nucleotide polymorphism
or point mutation in the initial ribonucleic acid target sequence.
The 2.sup.nd strand tagging probe is used as anchored primer to
generate the second nucleic acid strand, which is complementary to
the primer extension product.
[0110] The anchor sequences attached to each of the two tagging
probes are designed so that they do not cross-hybridize to any
target nucleic acid in a given transcriptome or to each other under
the hybridization conditions used in the method of invention. The
anchor sequences function as priming sites for the PCR primers in
subsequent real-time quantitative PCR or as tags for capture
assays.
[0111] The term "primer" may refer to more than one primer and
refers to an oligonucleotide, whether occurring naturally, as in a
purified restriction digest, or produced synthetically, which is
capable of acting as a point of initiation of synthesis along a
complementary strand when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is catalyzed. Such conditions include the
presence of four different deoxyribonucleoside triphosphates and a
polymerization-inducing agent such as DNA polymerase or reverse
transcriptase, in a suitable buffer ("buffer" includes substituents
which are cofactors, or which affect pH, ionic strength, etc.), and
at a suitable temperature. The primer is preferably single-stranded
for maximum efficiency in amplification by a polymerase or reverse
transcriptase, in a suitable buffer ("buffer" includes substituents
which are cofactors, or which affect pH, ionic strength, etc.), and
at a suitable temperature. The primer is preferably single-stranded
for maximum efficiency in amplification.
[0112] The terms "Detection probes" or "detection probe" refer to
labelled oligonucleotide, which forms a duplex structure with a
sequence within the amplified target nucleic acid, e.g. short RNA
target sequence, due to complementarity of the probe with a
sequence in the target region. The detection probe, preferably,
does not contain a sequence complementary to sequence(s) used to
prime the polymerase chain reaction. Generally the 3' terminus of
the probe will be "blocked" to prohibit incorporation of the probe
into a primer extension product. "Blocking" may be achieved by
using non-complementary bases or by adding a chemical moiety such
as biotin or a phosphate group to the 3' hydroxyl of the last
nucleotide, which may, depending upon the selected moiety, serve a
dual purpose by also acting as a label.
[0113] The terms "miRNA" and "microRNA" refer to 21-25 nt
non-coding RNAs derived from endogenous genes. They are processed
from longer (ca 75 nt) hairpin-like precursors termed pre-miRNAs.
MicroRNAs assemble in complexes termed miRNPs and recognize their
targets by antisense complementarity. If the microRNAs match 100
their target, i.e. the complementarity is complete, the target mRNA
is cleaved, and the miRNA acts like a sRNA. If the match is
incomplete, i.e. the complementarity is partial, then the
translation of the target mRNA is blocked.
[0114] The terms "Small interfering RNAs" or "siRNAs" refer to
21-25 nt RNAs derived from processing of linear double-stranded
RNA. siRNAs assemble in complexes termed RISC(RNA-induced silencing
complex) and target homologous RNA sequences for endonucleolytic
cleavage. Synthetic siRNAs also recruit RISCs and are capable of
cleaving homologous RNA sequences.
[0115] The term "RNA interference" (RNAi) refers to a phenomenon
where double-stranded RNA homologous to a target mRNA leads to
degradation of the targeted mRNA. More broadly defined as
degradation of target mRNAs by homologous siRNAs.
[0116] The term "Recognition sequence" refers to a nucleotide
sequence that is complementary to a region within the target
nucleotide sequence essential for sequence-specific hybridization
between the target nucleotide sequence and the recognition
sequence. The tagging probes as well as the detection probes of
invention contain a target sequence-specific recognition
sequence.
[0117] The term "Anchor sequences" refer to two nucleotide
sequences contiguously attached to the pair of tagging probes,
which anchor sequences are designed so that they do not
cross-hybridize with each other or with a target nucleotide
sequence or any nucleotide sequence in the nucleic acid sample,
containing the target nucleotide sequence.
[0118] The term "label" as used herein refers to any atom or
molecule which can be used to provide a detectable (preferably
quantifiable) signal, and which can be attached to a nucleic acid
or protein. Labels may provide signals detectable by fluorescence,
radioactivity, colorimetric, X-ray diffraction or absorption,
magnetism, enzymatic activity, and the like.
[0119] A label is a reporter group detectable either by itself or
as a part of a detection series. Examples of functional parts of
reporter groups are biotin, digoxigenin, fluorescent groups (groups
which are able to absorb electromagnetic radiation, e.g. light or
X-rays, of a certain wavelength, and which subsequently reemits the
energy absorbed as radiation of longer wavelength; illustrative
examples are DANSYL (5-dimethylamino)-1-naphthalenesulfonyl), DOXYL
(N-oxyl-4,4-dimethyloxazolidine), PROXYL
(N-oxyl-2,2,5,5-tetramethylpyrrolidine),
TEMPO(N-oxyl-2,2,6,6-tetramethylpiperidine), dinitrophenyl,
acridines, coumarins, Cy3 and Cy5 (trademarks for Biological
Detection Systems, Inc.), erythrosine, coumaric acid,
umbelliferone, Texas red, rhodamine, tetramethyl rhodamine, Rox,
7-nitrobenzo-2-oxa-1-diazole (NBD), pyrene, fluorescein, Europium,
Ruthenium, Samarium, and other rare earth metals), radio isotopic
labels, chemiluminescence labels (labels that are detectable via
the emission of light during a chemical reaction), spin labels (a
free radical (e.g. substituted organic nitroxides) or other
paramagnetic probes (e.g. Cu.sup.2+, Mg.sup.2+) bound to a
biological molecule being detectable by the use of electron spin
resonance spectroscopy). Especially interesting examples are
biotin, fluorescein, Texas Red, rhodamine, dinitrophenyl,
digoxigenin, Ruthenium, Europium, Cy5, Cy3, etc.
[0120] "Ligation" or "covalent coupling" refers to covalent
coupling of two adjacent nucleotide sequences, e.g. the tagging
oligonucleotide probe sequences of the invention, to form a single
nucleotide sequence. The reaction is catalyzed by the enzyme
ligase, which forms a phosphodiester bond between the 5'-end of one
nucleotide sequence and the 3'-end of the adjacent nucleotide
sequence, e.g. between the two adjacent tagging probes of
invention, annealed to their complementary, target nucleic acid
sequence.
[0121] "RNA-templated oligonucleotide ligation" refers to covalent
coupling of two adjacent oligonucleotide probe sequences annealed
to a complementary RNA target sequence, to form a single nucleotide
sequence. The reaction is catalyzed by the enzyme ligase, which
forms a phosphodiester bond between the 5'-end of one nucleotide
sequence and the 3'-end of the adjacent nucleotide sequence, e.g.
between the two adjacent tagging probes of invention.
[0122] The terms "PCR reaction", "PCR amplification", "PCR",
"pre-PCR" and "real-time quantitative PCR" are interchangeable
terms used to signify use of a nucleic acid amplification system,
which multiplies the target nucleic acids being detected. Examples
of such systems include the polymerase chain reaction (PCR) system
and the ligase chain reaction (LCR) system. Other methods recently
described and known to the person of skill in the art are the
nucleic acid sequence based amplification (NASBA.TM., Cangene,
Mississauga, Ontario) and Q Beta Replicase systems. The products
formed by said amplification reaction may or may not be monitored
in real time or only after the reaction as an end point
measurement.
[0123] As used herein, the terms "nucleic acid", "polynucleotide"
and "oligonucleotide" refer to primers, probes, oligomer fragments
to be detected, oligomer controls and unlabelled blocking oligomers
and shall be generic to polydeoxyribonucleotides (containing
2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose),
and to any other type of polynucleotide which is an N glycoside of
a purine or pyrimidine base, or modified purine or pyrimidine
bases. There is no intended distinction in length between the term
"nucleic acid", "polynucleotide" and "oligonucleotide", and these
terms will be used interchangeably. These terms refer only to the
primary structure of the molecule. Thus, these terms include
double- and single-stranded DNA, as well as double- and single
stranded RNA. The oligonucleotide is comprised of a sequence of
approximately at least 3 nucleotides, preferably at least about 6
nucleotides, and more preferably at least about 8-30 nucleotides
corresponding to a region of the designated target nucleotide
sequence. "Corresponding" means identical to or complementary to
the designated sequence. The oligonucleotide is not necessarily
physically derived from any existing or natural sequence but may be
generated in any manner, including chemical synthesis, DNA
replication, reverse transcription or a combination thereof.
[0124] The terms "oligonucleotide" or "nucleic acid" intend a
polynucleotide of genomic DNA or RNA, cDNA, semi synthetic, or
synthetic origin which, by virtue of its origin or manipulation:
(1) is not associated with all or a portion of the polynucleotide
with which it is associated in nature; and/or (2) is linked to a
polynucleotide other than that to which it is linked in nature; and
(3) is not found in nature. Because mononucleotides are reacted to
make oligonucleotides in a manner such that the 5'-phosphate of one
mononucleotide pentose ring is attached to the 3' oxygen of its
neighbour in one direction via a phosphodiester linkage, an end of
an oligonucleotide is referred to as the "5' end" if its 5'
phosphate is not linked to the 3' oxygen of a mononucleotide
pentose ring and as the "3' end" if its 3' oxygen is not linked to
a 5' phosphate of a subsequent mononucleotide pentose ring. As used
herein, a nucleic acid sequence, even if internal to a larger
oligonucleotide, also may be said to have a 5' and 3' ends. When
two different, non-overlapping oligonucleotides anneal to different
regions of the same linear complementary nucleic acid sequence, the
3' end of one oligonucleotide points toward the 5' end of the
other; the former may be called the "upstream" oligonucleotide and
the latter the "downstream" oligonucleotide.
[0125] By the term "SBC nucleobases" is meant "Selective Binding
Complementary" nucleobases, i.e. modified nucleobases that can make
stable hydrogen bonds to their complementary nucleobases, but are
unable to make stable hydrogen bonds to other SBC nucleobases. As
an example, the SBC nucleobase A', can make a stable hydrogen
bonded pair with its complementary unmodified nucleobase, T.
Likewise, the SBC nucleobase T' can make a stable hydrogen bonded
pair with its complementary unmodified nucleobase, A. However, the
SBC nucleobases A' and T' will form an unstable hydrogen bonded
pair as compared to the base pairs A'-T and A-T'. Likewise, a SBC
nucleobase of C is designated C' and can make a stable hydrogen
bonded pair with its complementary unmodified nucleobase G, and a
SBC nucleobase of G is designated G' and can make a stable hydrogen
bonded pair with its complementary unmodified nucleobase C, yet C'
and G' will form an unstable hydrogen bonded pair as compared to
the base pairs C'-G and C-G'. A stable hydrogen bonded pair is
obtained when 2 or more hydrogen bonds are formed e.g. the pair
between A' and T, A and T', C and G', and C' and G. An unstable
hydrogen bonded pair is obtained when 1 or no hydrogen bonds is
formed e.g. the pair between A' and T', and C' and G'. Especially
interesting SBC nucleobases are 2,6-diaminopurine (A', also called
D) together with 2-thio-uracil (U', also called
.sup.2SU)(2-thio-4-oxo-pyrimidine) and 2-thiothymine (T', also
called .sup.2ST)(2-thio-4-oxo-5-methyl-pyrimidine). FIG. 4
illustrates that the pairs A-.sup.2ST and D-T have 2 or more than 2
hydrogen bonds whereas the D-.sup.2ST pair forms a single
(unstable) hydrogen bond. Likewise the SBC nucleobases
pyrrolo-[2,3-d]pyrimidine-2(3H)-one (C', also called PyrroloPyr)
and hypoxanthine (G', also called I) (6-oxo-purine) are shown in
FIG. 9 where the pairs PyrroloPyr-G and C-I have 2 hydrogen bonds
each whereas the PyrroloPyr-I pair forms a single hydrogen
bond.
[0126] "SBC LNA oligomer" refers to a "LNA oligomer" containing at
least one LNA monomer where the nucleobase is a "SBC nucleobase".
By "LNA monomer with an SBC nucleobase" is meant a "SBC LNA
monomer". Generally speaking SBC LNA oligomers include oligomers
that besides the SBC LNA monomer(s) contain other modified or
naturally occurring nucleotides or nucleosides. By "SBC monomer" is
meant a non-LNA monomer with a SBC nucleobase. By "isosequential
oligonucleotide" is meant an oligonucleotide with the same sequence
in a Watson-Crick sense as the corresponding modified
oligonucleotide e.g. the sequences agTtcATg is equal to
agTscD.sup.2SUg where s is equal to the SBC DNA monomer 2-thio-t or
2-thio-u, D is equal to the SBC LNA monomer LNA-D and .sup.2SU is
equal to the SBC LNA monomer LNA .sup.2SU.
[0127] The complement of a nucleic acid sequence as used herein
refers to an oligonucleotide which, when aligned with the nucleic
acid sequence such that the 5' end of one sequence is paired with
the 3' end of the other, is in "antiparallel association." Bases
not commonly found in natural nucleic acids may be included in the
nucleic acids of the present invention include, for example,
inosine and 7-deazaguanine. Complementarity may not be perfect;
stable duplexes may contain mismatched base pairs or unmatched
bases. Those skilled in the art of nucleic acid technology can
determine duplex stability empirically considering a number of
variables including, for example, the length of the
oligonucleotide, percent concentration of cytosine and guanine
bases in the oligonucleotide, ionic strength, and incidence of
mismatched base pairs.
[0128] The melting temperature, or "Tm" measures stability of a
nucleic acid duplex. The T.sub.m of a particular nucleic acid
duplex under specified conditions is the temperature at which half
of the duplexes have disassociated.
[0129] As defined herein, "5'.fwdarw.3' nuclease activity" or "5'
to 3' nuclease activity" refers to that activity of a
template-specific nucleic acid polymerase including either a
5'.fwdarw.3' exonuclease activity traditionally associated with
some DNA polymerases whereby nucleotides are removed from the 5'
end of an oligonucleotide in a sequential manner, (i.e., E. coli
DNA polymerase I has this activity whereas the Klenow fragment does
not), or a 5'.fwdarw.3' endonuclease activity wherein cleavage
occurs more than one nucleotide from the 5' end, or both.
[0130] "Thermostable nucleic acid polymerase" refers to an enzyme
which is relatively stable to heat when compared, for example, to
polymerases from E. coli and which catalyzes the polymerization of
nucleosides. Generally, the enzyme will initiate synthesis at the
3'-end of the primer annealed to the target sequence, and will
proceed in the 5'-direction along the template, and if possessing a
5' to 3' nuclease activity, hydrolyzing or displacing intervening,
annealed probe to release both labelled and unlabelled probe
fragments or intact probe, until synthesis terminates. A
representative thermostable enzyme isolated from Thermus aquaticus
(Taq) is described in U.S. Pat. No. 4,889,818 and a method for
using it in conventional PCR is described in Saiki et al., (1988),
Science 239:487.
[0131] "Thermostable Reverse transciptase" refers to a reverse
transcriptase enzyme, which is more heat-stable compared to, for
example the Avian Myeloma Virus (AMV) reverse transcriptase or the
Moloney Monkey Leukaemia Virus (MMLV) reverse transcriptase.
[0132] The term "nucleobase" covers the naturally occurring
nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and
uracil (U) as well as non-naturally occurring nucleobases such as
xanthine, diaminopurine, 8-oxo-N.sup.6-methyladenine,
7-deazaxanthine, 7-deazaguanine, N.sup.4, N.sup.4-ethanocytosin,
N.sup.6,N.sup.6-ethano-2,6-diaminopurine, 5-methylcytosine,
5-(C.sup.3-C.sup.6)-alkynyl-cytosine, 5-fluorouracil,
5-bromouracil, pseudoisocytosine,
2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, isoguanine,
inosine and the "non-naturally occurring" nucleobases described in
Benner et al., U.S. Pat. No. 5,432,272 and Susan M. Freier and
Karl-Heinz Altmann, Nucleic Acid Research, 25: 4429-4443, 1997. The
term "nucleobase" thus includes not only the known purine and
pyrimidine heterocycles, but also heterocyclic analogues and
tautomers thereof. Further naturally and non naturally occurring
nucleobases include those disclosed in U.S. Pat. No. 3,687,808; in
chapter 15 by Sanghvi, in Antisense Research and Application, Ed.
S. T. Crooke and B. Lebleu, CRC Press, 1993; in Englisch, et al.,
Angewandte Chemie, International Edition, 30: 613-722, 1991 (see,
especially pages 622 and 623, and in the Concise Encyclopedia of
Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley
& Sons, pages 858-859, 1990, Cook, Anti-Cancer Drug Design 6:
585-607, 1991, each of which are hereby incorporated by reference
in their entirety).
[0133] The term "nucleosidic base" or "nucleobase analogue" is
further intended to include heterocyclic compounds that can serve
as like nucleosidic bases including certain "universal bases" that
are not nucleosidic bases in the most classical sense but serve as
nucleosidic bases. Especially mentioned as a universal base is
3-nitropyrrole or a 5-nitroindole. Other preferred compounds
include pyrene and pyridyloxazole derivatives, pyrenyl,
pyrenylmethylglycerol derivatives and the like. Other preferred
universal bases include, pyrrole, diazole or triazole derivatives,
including those universal bases known in the art.
[0134] "Universal base" refers to a naturally-occurring or
desirably a non-naturally occurring compound or moiety that can
pair with at least one and preferably all natural bases (e.g.,
adenine, guanine, cytosine, uracil, and/or thymine), and that has a
Tm differential of 15, 12, 10, 8, 6, 4, or 2oC or less as described
herein.
[0135] By "oligonucleotide," "oligomer," or "oligo" is meant a
successive chain of monomers (e.g., glycosides of heterocyclic
bases) connected via internucleoside linkages. The linkage between
two successive monomers in the oligo consist of 2 to 4, desirably
3, groups/atoms selected from --CH2-, --O--, --S--, --NRH--,
>C.dbd.O, >C.dbd.NRH, >C.dbd.S, --Si(R'')2-, --SO--,
--S(O)2-, --P(O)2-, --PO(BH3)-, --P(O,S)--, --P(S)2-, --PO(R'')--,
--PO(OCH3)-, and --PO(NHRH)--, where RH is selected from hydrogen
and C1-4-alkyl, and R'' is selected from C1-6-alkyl and phenyl.
Illustrative examples of such linkages are --CH2-CH2-CH2-,
--CH2-CO--CH2-, --CH2-CHOH--CH2-, --O--CH2-O--, --O--CH2-CH2-,
--O--CH2-CH.dbd. (including R5 when used as a linkage to a
succeeding monomer), --CH2-CH2-O--, --NRH--CH2-CH2-,
--CH2-CH2-NRH--, --CH2-NRH--CH2-, --O--CH2-CH2-NRH--,
--NRH--CO--O--, --NRH--CO--NRH--, --NRH--CS--NRH--,
--NRH--C(.dbd.NRH)--NRH--, --NRH--CO--CH2-NRH--, --O--CO--O--,
--O--CO--CH2-O--, --O--CH2-CO--O--, --CH2-CO--NRH--,
--O--CO--NRH--, --NRH--CO--CH2-, --O--CH2-CO--NRH--,
--O--CH2-CH2-NRH--, --CH.dbd.N--O--, --CH2-NRH--O--,
--CH2-O--N.dbd. (including R5 when used as a linkage to a
succeeding monomer), --CH2-O--NRH--, --CO--NRH--CH2-,
--CH2-NRH--O--, --CH2-NRH--CO--, --O--NRH--CH2-, --O--NRH--,
--O--CH2-S--, --S--CH2-O--, --CH2-CH2-S--, --O--CH2-CH2-S--,
--S--CH2-CH.dbd. (including R5 when used as a linkage to a
succeeding monomer), --S--CH2-CH2-, --S--CH2-CH2-O--,
--S--CH2-CH2-S--, --CH2-S--CH2-, --CH2-SO--CH2-, --CH2-SO2-CH2-,
--O--SO--O--, --O--S(O)2-O--, --O--S(O)2-CH2-, --O--S(O)2-NRH--,
--NRH--S(O)2-CH2-, --O--S(O)2-CH2-, --O--P(O)2-O--,
--O--P(O,S)--O--, --O--P(S)2-O--, --S--P(O)2-O--, --S--P(O,S)--O--,
--S--P(S)2-O--, --O--P(O)2-S--, --O--P(O,S)--S--, --O--P(S)2-S--,
--S--P(O)2-S--, --S--P(O,S)--S--, --S--P(S)2-S--,
--O--PO(R'')--O--, --O--PO(OCH3)-O--, --O--PO--(OCH2CH3)-O--,
--O--PO(OCH2CH2S--R)--O--, --O--PO(BH3)-O--, --O--PO(NHRN)--O--,
--O--P(O)2-NRH--, --NRH--P(O)2-O--, --O--P(O,NRH)--O--,
--CH2-P(O)2-O--, --O--P(O)2-CH2-, and --O--Si(R'')2-O--; among
which --CH2-CO--NRH--, --CH2-NRH--O--, --S--CH2-O--,
--O--P(O)2-O--, --O--P(O,S)--O--, --O--P(S)2-O--, --NRH--P(O)2-O--,
--O--P(O,NRH)--O--, --O--PO(R'')--O--, --O--PO(CH3)-O--, and
--O--PO(NHRN)--O--, where RH is selected form hydrogen and
C1-4-alkyl, and R'' is selected from C1-6-alkyl and phenyl, are
especially desirable. Further illustrative examples are given in
Mesmaeker et. al., Current Opinion in Structural Biology 1995, 5,
343-355 and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acids
Research, 1997, vol 25, pp 4429-4443. The left-hand side of the
internucleoside linkage is bound to the 5-membered ring as
substituent P* at the 3'-position, whereas the right-hand side is
bound to the 5'-position of a preceding monomer.
[0136] By "LNA" or "LNA monomer" (e.g., an LNA nucleoside or LNA
nucleotide) or an LNA oligomer (e.g., an oligonucleotide or nucleic
acid) is meant a nucleoside or nucleotide analogue that includes at
least one LNA monomer. LNA monomers as disclosed in PCT Publication
WO 99/14226 are in general particularly desirable modified nucleic
acids for incorporation into an oligonucleotide of the invention.
Additionally, the nucleic acids may be modified at either the 3'
and/or 5' end by any type of modification known in the art. For
example, either or both ends may be capped with a protecting group,
attached to a flexible linking group, attached to a reactive group
to aid in attachment to the substrate surface, etc. Desirable LNA
monomers and their method of synthesis also are disclosed in U.S.
Pat. No. 6,043,060, U.S. Pat. No. 6,268,490, PCT Publications WO
01/07455, WO 01/00641, WO 98/39352, WO 00/56746, WO 00/56748 and WO
00/66604 as well as in the following papers: Morita et al., Bioorg.
Med. Chem. Lett. 12(1):73-76, 2002; Hakansson et al., Bioorg. Med.
Chem. Lett. 11(7):935-938, 2001; Koshkin et al., J. Org. Chem.
66(25):8504-8512, 2001; Kvaerno et al., J. Org. Chem.
66(16):5498-5503, 2001; Hakansson et al., J. Org. Chem.
65(17):5161-5166, 2000; Kvaerno et al., J. Org. Chem.
65(17):5167-5176, 2000; Pfundheller et al., Nucleosides Nucleotides
18(9):2017-2030, 1999; and Kumar et al., Bioorg. Med. Chem. Lett.
8(16):2219-2222, 1998.
[0137] Preferred LNA monomers, also referred to as "oxy-LNA" are
LNA monomers which include bicyclic compounds as disclosed in PCT
Publication WO 03/020739 wherein the bridge between R.sup.4 and
R.sup.2 as shown in formula (I) below together designate
--CH.sub.2--O-- or --CH.sub.2--CH.sub.2--O--.
[0138] By "LNA modified oligonucleotide" or "LNA substituted
oligonucleotide" is meant a oligonucleotide comprising at least one
LNA monomer of formula (I), described infra, having the below
described illustrative examples of modifications:
##STR00001##
[0139] wherein X is selected from --O--, --S--, --N(R.sup.N)--,
--C(R.sup.6R.sup.6*)--, --O--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--O--, --S--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--S--, --N(R.sup.N*)--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--N(R.sup.N*)--, and
--C(R.sup.6R.sup.6*)--C(R.sup.7R.sup.7*).
[0140] B is selected from a modified base as discussed above e.g.
an optionally substituted carbocyclic aryl such as optionally
substituted pyrene or optionally substituted pyrenylmethylglycerol,
or an optionally substituted heteroalicylic or optionally
substituted heteroaromatic such as optionally substituted
pyridyloxazole, optionally substituted pyrrole, optionally
substituted diazole or optionally substituted triazole moieties;
hydrogen, hydroxy, optionally substituted C.sub.1-4-alkoxy,
optionally substituted C.sub.1-4-alkyl, optionally substituted
C.sub.1-4-acyloxy, nucleobases, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands.
[0141] P designates the radical position for an internucleoside
linkage to a succeeding monomer, or a 5'-terminal group, such
internucleoside linkage or 5'-terminal group optionally including
the substituent R.sup.5. One of the substituents R.sup.2, R.sup.2*,
R.sup.3, and R.sup.3* is a group P* which designates an
internucleoside linkage to a preceding monomer, or a 2'/3'-terminal
group. The substituents of R.sup.1*, R.sup.4*, R.sup.5, R.sup.5*,
R.sup.6, R.sup.6*, R.sup.7, R.sup.7*, R.sup.N, and the ones of
R.sup.2, R.sup.2*, R.sup.3, and R.sup.3* not designating P* each
designates a biradical comprising about 1-8 groups/atoms selected
from --C(R.sup.aR.sup.b)--, --C(R.sup.a).dbd.C(R.sup.a)--,
--C(R.sup.a).dbd.N--, --C(Ra)--O--, --O--, --Si(Ra).sub.2,
--C(R.sup.a)--S, --S--, --SO.sub.2--, --C(R.sup.a)--N(R.sup.b)--,
--N(R.sup.a)--, and >C=Q, wherein Q is selected from --O--,
--S--, and --N(R.sup.a)--, and R.sup.a and R.sup.b each is
independently selected from hydrogen, optionally substituted
C.sub.1-12-alkyl, optionally substituted C.sub.2-12-alkenyl,
optionally substituted C.sub.2-12-alkynyl, hydroxy,
C.sub.1-12-alkoxy, C.sub.2-12-alkenyloxy, carboxy,
C.sub.1-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl,
aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl,
hetero-aryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino,
mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl,
amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands, where aryl and heteroaryl may be
optionally substituted, and where two geminal substituents R.sup.a
and R.sup.b together may designate optionally substituted methylene
(.dbd.CH.sub.2), and wherein two non-geminal or geminal
substituents selected from R.sup.a, R.sup.b, and any of the
substituents R.sup.1*, R.sup.2, R.sup.2*, R.sup.3, R.sup.3*,
R.sup.4*, R.sup.5, R.sup.5*, R.sup.6 and R.sup.6*, R.sup.7, and
R.sup.7* which are present and not involved in P, P* or the
biradical(s) together may form an associated biradical selected
from biradicals of the same kind as defined before; the pair(s) of
non-geminal substituents thereby forming a mono- or bicyclic entity
together with (i) the atoms to which said non-geminal substituents
are bound and (ii) any intervening atoms. Each of the substituents
R.sup.1*, R.sup.2, R.sup.2*, R.sup.3, R.sup.4*, R.sup.5, R.sup.5*,
R.sup.6 and R.sup.6*, R.sup.7, and R.sup.7* which are present and
not involved in P, P* or the biradical(s), is independently
selected from hydrogen, optionally substituted C.sub.1-12-alkyl,
optionally substituted C.sub.2-12-alkenyl, optionally substituted
C.sub.2-12-alkynyl, hydroxy, C.sub.1-12-alkoxy,
C.sub.2-12-alkenyloxy, carboxy, C.sub.1-12-alkoxycarbonyl,
C.sub.1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy,
arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy,
heteroarylcarbonyl, amino, mono- and di-(C.sub.1-6-alkyl)amino,
carbamoyl, mono- and di(C.sub.1-6-alkyl)-aminocarbonyl,
amino-C.sub.1-6-alkyl-aminocarbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkylaminocarbonyl,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands, where aryl and heteroaryl may be
optionally substituted, and where two geminal substituents together
may designate oxo, thioxo, imino, or optionally substituted
methylene, or together may form a spiro biradical consisting of a
1-5 carbon atom(s) alkylene chain which is optionally interrupted
and/or terminated by one or more heteroatoms/groups selected from
--O--, --S--, and --(NR.sup.N)-- where R.sup.N is selected from
hydrogen and C.sub.1-4-alkyl, and where two adjacent (non-geminal)
substituents may designate an additional bond resulting in a double
bond; and R.sup.N*, when present and not involved in a biradical,
is selected from hydrogen and C.sub.1-4-alkyl; and basic salts and
acid addition salts thereof.
[0142] Exemplary 5', 3', and/or 2' terminal groups include --H,
--OH, halo (e.g., chloro, fluoro, iodo, or bromo), optionally
substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g., methyl or
ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl),
aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy,
nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamino, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio, amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0143] It is understood that references herein to a nucleic acid
unit, nucleic acid residue, LNA monomer, or similar term are
inclusive of both individual nucleoside units and nucleotide units
and nucleoside units and nucleotide units within an
oligonucleotide. A "modified base" or other similar terms refer to
a composition (e.g., a non-naturally occurring nucleobase or
nucleosidic base), which can pair with a natural base (e.g.,
adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair
with a non-naturally occurring nucleobase or nucleosidic base.
Desirably, the modified base provides a T.sub.m differential of 15,
12, 10, 8, 6, 4, or 2.degree. C. or less as described herein.
Exemplary modified bases are described in EP 1 072 679 and WO
97/12896.
[0144] The term "chemical moiety" refers to a part of a molecule.
"Modified by a chemical moiety" thus refer to a modification of the
standard molecular structure by inclusion of an unusual chemical
structure. The attachment of said structure can be covalent or
non-covalent.
[0145] The term "inclusion of a chemical moiety" in an
oligonucleotide probe thus refers to attachment of a molecular
structure. Such as chemical moiety include but are not limited to
covalently and/or non-covalently bound minor groove binders (MGB)
and/or intercalating nucleic acids (INA) selected from a group
consisting of asymmetric cyanine dyes, DAPI, SYBR Green I, SYBR
Green II, SYBR Gold, PicoGreen, thiazole orange, Hoechst 33342,
Ethidium Bromide, 1-O-(1-pyrenylmethyl)glycerol and Hoechst 33258.
Other chemical moieties include the modified nucleobases,
nucleosidic bases or LNA modified oligonucleotides.
[0146] The term "Dual-labelled probe" refers to an oligonucleotide
with two attached labels. In one aspect, one label is attached to
the 5' end of the probe molecule, whereas the other label is
attached to the 3' end of the molecule. A particular aspect of the
invention contain a fluorescent molecule attached to one end and a
molecule which is able to quench this fluorophore by Fluorescence
Resonance Energy Transfer (FRET) attached to the other end. 5'
nuclease assay probes and some Molecular Beacons are examples of
Dual labelled probes.
[0147] "5' nuclease assay probe" refers to a dual labelled probe
which may be hydrolyzed by the 5'-3' exonuclease activity of a DNA
polymerase. A 5' nuclease assay probes is not necessarily
hydrolyzed by the 5'-3' exonuclease activity of a DNA polymerase
under the conditions employed in the particular PCR assay. The name
"5' nuclease assay" is used regardless of the degree of hydrolysis
observed and does not indicate any expectation on behalf of the
experimenter. The term "5' nuclease assay probe" and "5' nuclease
assay" merely refers to assays where no particular care has been
taken to avoid hydrolysis of the involved probe. "5' nuclease assay
probes" are often referred to as a "TaqMan assay probes", and the
"5' nuclease assay" as "TaqMan assay". These names are used
interchangeably in this application.
[0148] "Oligonucleotide analogue" refers to a nucleic acid binding
molecule capable of recognizing a particular target nucleotide
sequence. A particular oligonucleotide analogue is peptide nucleic
acid (PNA) in which the sugar phosphate backbone of an
oligonucleotide is replaced by a protein like backbone. In PNA,
nucleobases are attached to the uncharged polyamide backbone
yielding a chimeric pseudopeptide-nucleic acid structure, which is
homomorphous to nucleic acid forms.
[0149] "Molecular Beacon" refers to a single or dual labelled probe
which is not likely to be affected by the 5'-3' exonuclease
activity of a DNA polymerase. Special modifications to the probe,
polymerase or assay conditions have been made to avoid separation
of the labels or constituent nucleotides by the 5'-3' exonuclease
activity of a DNA polymerase. The detection principle thus rely on
a detectable difference in label elicited signal upon binding of
the molecular beacon to its target sequence. In one aspect of the
invention the oligonucleotide probe forms an intramolecular hairpin
structure at the chosen assay temperature mediated by complementary
sequences at the 5'- and the 3'-end of the oligonucleotide. The
oligonucleotide may have a fluorescent molecule attached to one end
and a molecule attached to the other, which is able to quench the
fluorophore when brought into close proximity of each other in the
hairpin structure. In another aspect of the invention, a hairpin
structure is not formed based on complementary structure at the
ends of the probe sequence instead the detected signal change upon
binding may result from interaction between one or both of the
labels with the formed duplex structure or from a general change of
spatial conformation of the probe upon binding--or from a reduced
interaction between the labels after binding. A particular aspect
of the molecular beacon contain a number of LNA residues to inhibit
hydrolysis by the 5'-3' exonuclease activity of a DNA
polymerase.
[0150] "High affinity nucleotide analogue" refers to a
non-naturally occurring nucleotide analogue that increases the
"binding affinity" of an oligonucleotide probe to its complementary
recognition sequence when substituted with at least one such
high-affinity nucleotide analogue.
[0151] As used herein, a probe with an increased "binding affinity"
for a recognition sequence compared to a probe which comprises the
same sequence but does not comprise a stabilizing nucleotide,
refers to a probe for which the association constant (K.sub.a) of
the probe recognition segment is higher than the association
constant of the complementary strands of a double-stranded
molecule. In another preferred embodiment, the association constant
of the probe recognition segment is higher than the dissociation
constant (K.sub.d) of the complementary strand of the recognition
sequence in the target sequence in a double stranded molecule.
[0152] Monomers are referred to as being "complementary" if they
contain nucleobases that can form hydrogen bonds according to
Watson-Crick base-pairing rules (e.g. G with C, A with T or A with
U) or other hydrogen bonding motifs such as for example
diaminopurine with T, 5-methyl C with G, 2-thiothymidine with A,
inosine with C, pseudoisocytosine with G, etc.
[0153] The term "succeeding monomer" relates to the neighbouring
monomer in the 5'-terminal direction and the "preceding monomer"
relates to the neighbouring monomer in the 3'-terminal
direction.
[0154] The term "target nucleic acid" or "target ribonucleic acid"
refers to any relevant nucleic acid of a single specific sequence,
e.g., a biological nucleic acid, e.g., derived from a patient, an
animal (a human or non-human animal), a plant, a bacteria, a fungi,
an archae, a cell, a tissue, an organism, etc. For example, where
the target ribonucleic acid or nucleic acid is derived from a
bacteria, archae, plant, non-human animal, cell, fungi, or
non-human organism, the method optionally further comprises
selecting the bacteria, archae, plant, non-human animal, cell,
fungi, or non-human organism based upon detection of the target
nucleic acid. In one embodiment, the target nucleic acid is derived
from a patient, e.g., a human patient. In this embodiment, the
invention optionally further includes selecting a treatment,
diagnosing a disease, or diagnosing a genetic predisposition to a
disease, based upon detection of the target nucleic acid.
[0155] "Target sequence" refers to a specific nucleic acid sequence
within any target nucleic acid.
[0156] The term "stringent conditions", as used herein, is the
"stringency" which occurs within a range from about
T.sub.m-5.degree. C. (5.degree. C. below the melting temperature
(T.sub.m) of the probe) to about 20.degree. C. to 25.degree. C.
below T.sub.m. As will be understood by those skilled in the art,
the stringency of hybridization may be altered in order to identify
or detect identical or related polynucleotide sequences.
Hybridization techniques are generally described in Nucleic Acid
Hybridization, A Practical Approach, Ed. Hames, B. D. and Higgins,
S. J., IRL Press, 1985; Gall and Pardue, Proc. Natl. Acad. Sci.,
USA 63: 378-383, 1969; and John, et al. Nature 223: 582-587,
1969.
[0157] The present invention also provides a kit for the isolation,
purification, amplification, detection, identification,
quantification, or capture of natural or synthetic nucleic acids,
where the kit comprises a reaction body and one or more LNA
modified oligonucleotides (oligomer) as defined herein. The LNA
modified oligonucleotides are preferably immobilised onto said
reactions body.
[0158] For the kits according to the invention, the reaction body
is preferably a solid support material, e.g. selected from
borosilicate glass, soda-lime glass, polystyrene, polycarbonate,
polypropylene, polyethylene, polyethyleneglycol terephthalate,
polyvinylacetate, polyvinylpyrrolidinone, polymethylmethacrylate
and polyvinylchloride, preferably polystyrene and polycarbonate.
The reaction body may be in the form of a specimen tube, a vial, a
slide, a sheet, a film, a bead, a pellet, a disc, a plate, a ring,
a rod, a net, a filter, a tray, a microtitre plate, a stick, or a
multi-bladed stick.
[0159] A written instruction sheet stating the optimal conditions
for use of the kit typically accompanies the kits.
DETAILED DESCRIPTION OF THE INVENTION
[0160] The present invention relates to the use of an
oligonucleotide for the isolation, purification, amplification,
detection, identification, quantification, or capture of microRNA
or small interfering RNAs characterized in that the oligonucleotide
contains a number of nucleoside analogues.
[0161] More particular the present invention provides methods for
detection and quantification of microRNA or small interfering RNAs
having a high sensitivity and good selectivity. According to the
invention the quantification of microRNA and small interfering RNAs
is detectable at levels of from 10 fmol to 10 amol RNA target or
less (10 zmol) in the sample corresponding to RNA target
concentration of from 100 .mu.M to 10 fM or less (10 aM).
[0162] In a preferred embodiment the invention comprises the
following steps as shown in FIG. 1 and FIG. 9:
[0163] 1) Two tagging probes are designed and synthesized so that
each consist of a high-affinity nucleotide sequence complementary
to 10-12 nt of the target sequence, e.g. a mature miRNA, and an
anchor DNA sequence without any complementarity to the target
sequence or each other. The two recognition element-containing
tagging probes are hybridized under stringent conditions in
combination to the target sequence in a complex nucleic acid sample
in solution, thereby bringing the two tagging probes to close
proximity as defined by the target, in which the 5'-end of one
tagging probe is adjacent to the 3'-end of the other tagging
probe.
[0164] 2) The target-specific tagging probes are joined by ligation
as the 5'-end of one of the probes is phosphorylated, using a DNA
ligase and the target sequence, e.g. a miRNA, as template. The
ligation reaction can be carried out at elevated temperatures using
thermo stable ligases, and thus cycled to increase the number of
copies of the template molecules for subsequent amplification by
PCR.
[0165] 3) Following target sequence-templated ligation of the
high-affinity tagging probes, the ligated probe molecules are used
as templates for quantitative real-time PCR, using a short
detection probe with sufficient duplex stability to allow binding
to the amplicon, and employing any of a variety of detection
principles used in homogeneous assays.
[0166] In a further preferred embodiment of the invention detection
and quantification comprises the steps shown in FIG. 27:
[0167] a) contacting the target ribonucleic acid sequence with a
oligonucleotide capture probe, wherein the recognition nucleotide
sequence is complementary to a sequence in the target sequence;
[0168] b) synthesis of a complementary strand to the anchor
nucleotide sequence in the capture probe using a DNA polymerase
enzyme and the target ribonucleic acid sequence as primer;
[0169] c) immobilization of the formed duplex on to a solid support
and an enrichment of the target sample follow by a release of the
target sequence from the solid support;
[0170] d) synthesis of a complementary DNA strand to the target
ribonucleic acid by reverse transcription using a reverse
transcriptase enzyme and the anchor nucleotide sequence in the
tagging probe as primer binding site;
[0171] e) replacing of the ribonucleic acid sequence in the
heteroduplex by synthesis of a second strand using a DNA polymerase
and a second tagging probe as primer, wherein said second tagging
probe consists of an anchor nucleotide sequence and a recognition
nucleotide sequence, wherein said recognition nucleotide sequence
is complementary to a sequence in the reverse
transcriptase-extended nucleic acid sequence; and
[0172] f) quantifying the resulting nucleic acids by real-time PCR
using primers corresponding to the anchor nucleotide sequences
attached to the oligonucleotide tagging probes and a labelled
detection probe comprising a target recognition sequence and a
detection moiety.
[0173] In a further preferred embodiment of the invention detection
and quantification comprises the steps shown in FIG. 28:
[0174] a) contacting the target ribonucleic acid sequence with a
oligonucleotide capture probe, wherein the recognition nucleotide
sequence is complementary to a sequence in the target sequence;
[0175] b) synthesis of a complementary strand to the anchor
nucleotide sequence in the capture probe using a DNA polymerase
enzyme and the target ribonucleic acid sequence as primer;
[0176] c) immobilization of the formed duplex on to a solid support
and an enrichment of the target sample;
[0177] d) synthesis of a complementary DNA strand to the target
ribonucleic acid by reverse transcription using a reverse
transcriptase enzyme and the capture probe as primer;
[0178] e) replacing of the ribonucleic acid sequence in the
heteroduplex by synthesis of a second strand using a DNA polymerase
and a second tagging probe as primer, and wherein said second
tagging probe consists of an anchor nucleotide sequence and a
recognition nucleotide sequence, wherein said recognition
nucleotide sequence is complementary to a sequence in the reverse
transcriptase-extended nucleic acid sequence;
[0179] f) following target sequence-templated PCR amplification
using a DNA polymerase and a pair of primers; and
[0180] e) quantifying the resulting nucleic acids by real-time PCR
using primers corresponding to the anchor nucleotide sequences
attached to the oligonucleotide tagging probes and a labelled
detection probe comprising a target recognition sequence and a
detection moiety.
[0181] One advantage for the immobilized capture probe methods is
that initial enrichment of the total RNA sample for
non-protein-coding RNAs, such as small nucleolar RNAs, siRNAs,
microRNAs and antisense RNAs, is not necessary. Preferably, the
capture probe will hybridize to the specific target in solution.
Secondly, when the capture probe is immobilized on the solid
support, unbound material can be removed and thereby enrichment for
the specific target has been performed.
[0182] In another further preferred embodiment the invention
comprises the following steps as shown in FIG. 11:
[0183] 1) Two tagging probes, the RT tagging probe and the 2.sup.nd
strand tagging probe are designed and synthesized so that each
consist of a nucleotide recognition sequence corresponding to 6-12
nt of the target ribonucleic acid sequence, e.g. a mature miRNA,
and an anchor sequence without any complementarity to the target
sequence or each other. The recognition sequence of the RT tagging
probe or both the RT and 2.sup.nd strand probes are modified by
high-affinity nucleotide analogues, e.g. LNA. The recognition
sequence in the RT tagging probe is complementary to a sequence in
the target ribonucleic acid sequence, e.g. to the 3'-end of the
mature microRNA or siRNA or to a sequence located 3' to a
RNA-edited nucleotide, splice junction, single nucleotide
polymorphism or point mutation in the target ribonucleic acid
sequence. The RT tagging probe is hybridized to the target RNA
sequence in a complex nucleic acid sample under stringent
hybridization conditions and used as an anchored primer in a
reverse transcription reaction to generate an anchored primer
extension product, complementary to the target RNA sequence using a
reverse transcriptase enzyme.
[0184] 2) The 2.sup.nd strand tagging probe comprises a recognition
sequence, which is complementary to the reverse
transcriptase-extended nucleotide sequence corresponding to the
5'-end of the mature microRNA or siRNA or located 5' to the RNA
edited nucleotide, splice junction, single nucleotide polymorphism
or point mutation in the initial ribonucleic acid target sequence.
The 2.sup.nd strand tagging probe is hybridized to the RT reaction
products under stringent hybridization conditions and subsequently
used as an anchored primer to generate the second strand by a DNA
polymerase, e.g. a thermostable DNA polymerase, which is
complementary to the primer extension product. The specificity of
the reaction is based on the sequential use of the anchored RT and
2.sup.nd strand tagging probes with non-overlapping recognition
sequences, hybridising to complementary 3'-end and 5'-end regions
of the target RNA and complementary DNA sequences, respectively.
The anchor sequences attached to the tagging probes are designed so
that they do not cross-hybridize to any target nucleic acid in a
given transcriptome or to each other under the hybridization
conditions used in the method of invention. The anchor sequences
function as priming sites for the PCR primers in subsequent
real-time quantitative PCR or as tags for capture assays. The
reverse transcription reaction as well as the second strand
reaction can be carried out at elevated temperatures due to the use
of high-affinity nucleotide analogues in the recognition sequences,
which is a novel component of the invention, using thermostable
reverse transcriptases and thermostable DNA polymerases, thus
increasing the specificity in the generation of the template
molecules for subsequent amplification by PCR. Another novel
component of the invention is the finding that the said
high-affinity recognition sequences, modified by e.g. LNA, can be
used as primers by a reverse transcriptase or a DNA polymerase, and
furthermore that such said high-affinity recognition sequences can
be used as a template to synthesize a complementary strand by a DNA
polymerase.
[0185] 3) Following the target RNA sequence-specific reverse
transcription and 2.sup.nd strand synthesis reactions, the
double-stranded molecules are used as templates for quantitative
real-time PCR, using a short detection probe with sufficient duplex
stability to allow binding to the amplicon, and employing any of a
variety of detection principles used in homogeneous assays.
[0186] The detection of binding is either direct by a measurable
change in the properties of one or more of the labels following
binding to the target (e.g. a molecular beacon type assay with or
without stem structure) or indirect by a subsequent reaction
following binding, e.g. cleavage by the 5' nuclease activity of the
DNA polymerase in 5' nuclease assays. The detection probe is yet
another novel component of the present invention. It comprises a
short oligonucleotide moiety which sequence has been selected to
enable specific detection of the short amplified DNA molecules
corresponding to the target sequence in the core segment and the
anchored sequences used as annealing sites for the PCR primers.
[0187] The novel, short detection probes designed to detect target
sequences, for example different mature miRNA target molecules, are
enabled by the discovery that very short 8-12-mer LNA-DNA chimeric,
mix-mer probes are compatible with real-time PCR based assays. In
one aspect of the present invention modified or nucleobase
analogues, nucleosidic bases or nucleotides are incorporated in the
tagging probes as well as the detection probe, possibly together
with minor groove binders and other modifications, that all aim to
stabilize the duplex formed between the probes and the target
molecule so that the shortest possible probe sequences can be used
to hybridized and detect the target molecules. In a preferred
aspect of the invention the modifications are incorporation of LNA
residues to reduce the length of the detection probe to 8 or 9 or
10 or 11 or 12 to 14 nucleotides while maintaining sufficient
stability of the formed duplex to be detectable under standard
real-time PCR assay conditions. In another preferred aspect of the
invention, the target recognition sequences in one or both tagging
probes for the ligation reaction or the recognition sequence in the
RT tagging probe or the recognition sequences in both the RT
tagging probe and the 2.sup.nd strand tagging probe for the RT-PCR
reaction, are substituted with LNA monomers at every second, every
third or every fourth nucleotide position with at least one DNA
nucleotide at the 3'-ends of both probes, respectively, allowing
highly specific and sensitive hybridization even at elevated
temperatures due to the increased duplex stability of LNA modified
oligonucleotide probes to their complementary target molecules,
particularly target RNA molecules.
[0188] In a further preferred embodiment of the invention detection
and quantification comprises the steps shown in FIG. 22:
[0189] a) contacting the target ribonucleic acid sequence with an
oligonucleotide tagging probe of claims 1 to 3, wherein the
recognition nucleotide sequence is complementary to a sequence in
the target sequence;
[0190] b) synthesis of a complementary strand to the anchor
nucleotide sequence in the tagging probe using a DNA polymerase
enzyme and the target ribonucleic acid sequence as primer;
[0191] c) synthesis of a complementary DNA strand to the target
ribonucleic acid by reverse transcription using a reverse
transcriptase enzyme and the anchor nucleotide sequence in the
tagging probe as primer binding site;
[0192] d) replacing of the ribonucleic acid sequence in the
heteroduplex by synthesis of a second strand using a DNA polymerase
and a second tagging probe as primer, wherein said second tagging
probe consists of an anchor nucleotide sequence and a recognition
nucleotide sequence, wherein said recognition nucleotide sequence
is complementary to a sequence in the reverse
transcriptase-extended nucleic acid sequence; and
[0193] e) quantifying the resulting nucleic acids by real-time PCR
using primers corresponding to the anchor nucleotide sequences
attached to the oligonucleotide tagging probes and a labelled
detection probe comprising a target recognition sequence and a
detection moiety.
[0194] In a further preferred embodiment the invention comprises
the steps as shown in FIG. 29.
[0195] In a further preferred embodiment the invention comprises
the steps as shown in FIG. 30.
[0196] A further embodiment comprises the use of a LNA containing
"blocker probe" to prevent binding of the RT-primer to templates
exceeding the length of the mature miRNA transcript. The blocker
probe is designed to bind sequences complementary to the non-mature
miRNA regions within the pri-/precursor miRNA sequence flanking the
3' region of the mature miRNA sequence. The blocker probe is
further designed to partly overlap the mature sequence, hence
preventing binding of the RT-primer (as described in Example 12-16,
and as depicted in FIG. 11, step 1) to the pri-/precursor sequence
and allowing the RT tagging probe to anneal to the mature miRNA
sequences only. The reaction steps are depicted in FIG. 33, step 1
and in FIG. 22.2-22.4.
[0197] In another embodiment employing a mature miRNA sequence
(similar to the Hsa miR-15a sequence, FIG. 29) is detected
utilizing an RT-primer designed to inhibit binding to templates
exceeding a certain length i.e. such as the length of pri- and
pre-mature miRNA. The blocking is obtained by e.g. incorporating a
large molecular structure into the RT-primer, or by annealing a
short LNA-containing probe (blocker probe) to the primer to
introduce a duplex structure, positioned to prevent binding of the
primer to templates exceeding the length of the mature miRNA. The
blocked primer design allow a mature miRNA sequence to anneal only,
whereas longer templates does'nt anneal. The reaction steps are
depicted in FIG. 29.
[0198] In another embodiment, the RT-primer from the previous
embodiment also comprises one of the PCR primers in the reaction.
Optionally the other PCR primer may also be designed to inhibit
binding to templates exceeding a certain length. The reaction steps
are depicted in FIG. 29b.
[0199] Another embodiment employs the addition of an artificial
oligonucleotide template to the reaction. In cases where the miRNA
is expressed from the far 3''-end of the precursor molecule
(similar to the Hsa miR-143 sequence FIG. 30), the mature as well
as the precursor miRNA template contain a 3'-end suitable for
extension by a polymerase, e.g. the Klenow fragment. By employing a
RT-primer as depicted in FIG. 31, which is subsequently extended by
an RNA-directed DNA polymerase (e.g. reverse transcriptase), the
resulting template will differ in length depending on whether the
mature or precursor miRNA transcript serve as template. The
2.sup.nd strand tagging probe described in Example 12-16, and as
depicted in FIG. 11 step 2 has been exchanged by a 3'-blocked
artificial oligonucleotide template depicted in FIG. 31 to allow
the extension of the RT transcript originating from the mature
miRNA, only. The 3'-blocked artificial oligonucleotide is
subsequently used as a template to generate the primer site for
subsequent amplification by PCR.
[0200] In another embodiment where the miRNA is expressed from the
far 3''-end of the precursor molecule (similar to the Hsa miR-143
sequence, FIG. 30) the mature miRNA is detected utilizing a PCR
primer hybridizing to the 3'-end of the reverse transcribed miRNA
(the original 5'-end of the mature miRNA), and designed to inhibit
binding to templates exceeding a certain length i.e. such as the
length of the reverse transcribed pri-/precursor miRNA. This
blocking is obtained by e.g. incorporating a large molecular
structure into this PCR primer--e.g. being a looped primer--keeping
an anchor sequence and forming an intramolecular hairpin structure,
mediated by complementary sequences at the 5'- and the 3'-end of
the oligonucleotide, at the chosen assay temperature, or by
annealing a short LNA-containing probe (blocker probe) to the
primer to introduce a duplex structure, positioned to prevent
binding of the primer to templates exceeding the length of the
mature miRNA. The primer is specifically designed to allow a mature
processed miRNA sequence to anneal only, whereas longer templates
don't anneal. The reaction steps are depicted in FIG. 34.
[0201] In cells, microRNA molecules occur both as longer (over 70
nucleotides) pricursor and precursor molecules as well as in the
active form of mature miRNAs (17-25 nucleotides). One challenge in
the detection of microRNA molecules is to detect the mature form of
the molecule only, which is a 17-25 bp long single strand RNA
molecule.
[0202] In a preferred embodiment of the present invention, the
mature miRNA functions as a primer, i.e. the miRNA is hybridized to
a template and extended by an enzyme capable of RNA-primed
DNA-directed DNA synthesis. Secondly the detection relies on the
occurence of this extension and furthermore the occurence of
extension relies on having an --OH termination at the 3' end of the
miRNA available at the expected distance from the annealing site to
the template, which is used to ensure detection of processed mature
miRNA molecules only. The principle of using the target (in this
case miRNAs) as a primer in the detection reaction can be applied
to other detection formats using other targets (both DNA and
RNA).
General Aspect of the Invention
[0203] Many non-coding RNA molecules, such as microRNA molecules
are very short and do not accommodate placement of primers for both
reverse transcriptase, PCR amplification and optionally a labelled
detection probe for amplification and detection by PCR. One
solution for accommodating this is, according to the present
invention, to append additional sequence to the microRNA,
preferably by a method that enables the design of mature-specific
assays.
[0204] As described (cf. the Examples), such sequence(s) may be
appended by means of providing (by sequence specific hybridisation)
a template for a polymerase-reaction to the microRNA, and providing
a polymerase (e.g. a Klenow polymerase) and nucleotides to allow
extension, leading to the appending to the mature microRNA of a
sequence similar in part to that of the provided template. Such
appended sequences may accommodate in part primers for reverse
transcriptase, for PCR amplification or for a labelled detection
probe, alone or in combination with the nucleic acid sequence of
the microRNA.
[0205] Another means of appending additional sequence may be that
of a ligation reaction. In such a reaction, an adaptor nucleic acid
sequence may be attached to either the 3'-end, the 5'-end or both
ends of the microRNA molecule by means of a ligation reaction. Such
ligation reaction may be assisted by providing a "bridging" nucleic
acid sequence comprising a nucleotide sequence specific for a
terminal part of a mature target RNA sequence and a nucleotide
sequence specific for terminal part of said adapter molecule such
that the mature RNA target and said adaptor molecule are place in
close vicinity to each other upon sequence specific hybridisation.
Such sequence appended by ligation may accommodate in part primers
for reverse transcriptase, for PCR amplification or for a labelled
detection probe, alone or in combination with the nucleic acid
sequence of the microRNA.
[0206] Yet another means of appending additional sequence to a
target small RNA molecule may be that of a template-independent
polymerase reaction. In one such an embodiment a sample of small
target RNA molecules are subjected to a polymerase reaction,
providing a polyA tail to all microRNAs present in the sample. This
could for example be performed by using a polyA polymerase. In
another such embodiment a sample of small target RNA molecules are
subjected to a terminal transferase enzyme reaction, capable of
providing an A, C, G or T polynucleotide tail to all microRNAs
present in the sample when respective dATP, dCTP, dGTP or dTTPs are
added. Such a microRNA sample provided with a nucleotide tail of
similar nucleotides may be converted to cDNA by using a primer
comprising the complementary similar nucleotides in a reverse
transcriptase reaction, hence providing a cDNA sample of microRNAs
with an appended polynucleotide tail of similar nucleotides. By
overlapping part of the micro RNA sequence the RT-primer may also
be specific for a specific microRNA or a group or family of
microRNAs. Such a cDNA sample may subsequently serve a template for
a PCR amplification reaction using primers specific for specific
microRNA sequences, encompassed within the mature microRNA sequence
or partly overlapping the sequence appended by means of a template
independent polymerase reaction.
[0207] One such example is described in FIG. 37, where a total RNA
sample or an RNA sample fraction containing only RNAs of a size
below 200 nucleotides, is subjected to a polyA polymerase to append
to all microRNA target molecules a polyA nucleotide tail.
Subsequently, a poly T primer is used a primer in a reverse
transcriptase reaction to convert the RNA sample into cDNA. Said RT
reaction may further be rendered sequence specific by allowing the
RT-primer sequence to partly overlap the microRNA sequence specific
for a specific microRNA or group or family of microRNAs.
Subsequently, said cDNA sample is subjected to a PCR amplification
using PCR primers specific for a specific microRNA target and
optionally a labelled detection probe. Such PCR primers may partly
in total or partly overlap the appended sequence.
[0208] A broad aspect of the invention thus relates to a method for
quantitative determination of a short-length RNA (which can be any
of the small RNA types described herein), which has a length of at
most 100 nucleotides, comprising
[0209] a) preparing, from a sample comprising said short-length
RNA, a template polynucleotide which consists of 1) a single
stranded target sequence consisting of the sequence of said
short-length RNA, its corresponding DNA sequence or a nucleotide
sequence complementary to the sequence of said short-length RNA and
2) a 5' and/or a 3' adjacent nucleotide sequence,
[0210] b) using said template polynucleotide in a reverse
transcription or a nucleotide polymerization to obtain a strand of
cDNA, and
[0211] c) performing a quantitative real-time PCR (qPCR) including
as template(s) said cDNA and optionally the template
polynucleotide.
[0212] This aspect of the invention reflects the underlying concept
of the invention, namely that specific detection of short-length
RNA can be accomplished by ensuring a relatively high degree of
specificity in all of steps a to c and that the specificity in each
step adds to the general specificity of the method. One main
characteristic is the provision of the template polynucleotide in
step a, where said template includes appended sequences which can
serve as "handles" for primers in the subsequent steps, thus
providing space for all primers necessary and for the detection
probes used. As will appear from the description herein, these
"handles" can be both specific and non-specific for the
short-length RNA one desires to quantify--in the case of specific
sequences, these are appended in a reaction that preferentially or
specifically will add the sequences to the short-length RNA but not
to sequences which include the short-length RNA.
[0213] When using the term "corresponding to" is in the present
context meant that a nucleotide sequence that corresponds to a
reference nucleotide sequence is either identical to the reference
sequence or constitutes a sequence that is hybridizes stringently
to a sequence complementary to the reference nucleotide sequence.
Typically, this means that an RNA sequence can correspond to a DNA
sequence if the complementary sequence to the DNA sequence can be
transcribed to the RNA sequence in question.
[0214] The term "cDNA" in this context means a DNA fragment which
is obtained by means of either reverse transcription of the
template polynucleotide or by means of nucleotide polymerization
(such a DNA polymerization) based on the template nucleotide.
[0215] The short-length RNA is as mentioned at most 100
nucleotides, but much shorter RNA can be determined by means of the
method. RNA having lengths of at most 90, at most 80, at most 70,
at most 60, at most 50, at most 40, at most 30, and at most 25
nucleotide residues can conveniently be determined by means of the
present methods and kits, but even shorter RNAs such as those
having 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
and 25 nucleotide residues. Preferably, the short-length RNAs have
lengths between 16 and 25 nucleotide residues.
[0216] The primers used for the qPCR in step c are in one
embodiment selected from [0217] at least 2 oligonucleotides,
wherein at least one of said oligonucleotides corresponds to or is
complementary to a sequence in the 5' or 3' adjacent nucleotide
sequence--an embodiment which, especially if both primers relate to
the adjacent sequences, benefits from the existence in steps a and
b of sequence specific (for the short-length RNA or a sequence
derived therefrom) appending of the 5' and/or 3' sequences and/or
that step b has utilised an approach specific for the short-length
RNA; [0218] at least 2 oligonucleotides, wherein at least one of
said oligonucleotides corresponds to or is complementary to a
contiguous sequence in the template polynucleotide constituted by
part of the single stranded target sequence and part of the
adjacent 5' or 3' nucleotide sequence--an embodiment, where a
relatively high degree of specificity is present in step c due to
the specific recognition of part of the short-length RNA (or a
sequence derived therefrom) and where it may be advantageous that
the 5' or 3' nucleotide sequence has been appended based on a
sequence specific approach and/or that step b has utilised an
approach specific for the short-length RNA; and [0219] at least 2
oligonucleotides, wherein one corresponds to a first nucleotide
sequence in the single stranded target sequence and the other is
complementary to a second nucleotide sequence in the single
stranded target sequence--an embodiment, where a high degree of
specificity is present in step c due to the specific recognition of
the short-length RNA (or a sequence derived therefrom).
[0220] Said primers used for the qPCR may each independently
include a detectable label.
[0221] In another embodiment, the reaction in step (b) utilises a
reverse transcription primer or a DNA polymerization primer which
corresponds to or is complementary to the single stranded target
sequence or which corresponds to or is complementary to a
contiguous sequence in the template polynucleotide constituted by
part of the single stranded target sequence and part of the
adjacent 5' or 3' nucleotide sequence. It is preferred that the
reverse transcription primer or nucleotide polymerization primer is
specific for at least one short-length RNA; this reflects the fact
that a number of short-length RNAs falls in certain families having
a high degree of sequence identity.
[0222] The appended 5' and/or a 3' adjacent nucleotide sequence is
in some embodiments a polynucleotide consisting of identical
nucleotides (an effect which can be attained by utilising terminal
transferase enzymes for appending the sequence or, alternatively by
utilising a polymerase which adds identical nucleotide
residues).
[0223] At any rate, the single stranded target sequence and the 5'
and/or a 3' adjacent nucleotide sequence(s) may be covalently
joined but also non-covalently joined--the important issue is
whether the template sequence can be subjected to reverse
transcription or nucleotide polymerization in step b.
[0224] The 5' and/or a 3' adjacent nucleotide sequence in some
embodiments include(s) a detectable label, thus facilitating
subsequent detection.
[0225] In most embodiments the 5' and/or 3' adjacent nucleotide
sequence is joined to the single stranded target sequence by an
enzymatic reaction, but also non-enzymatic reactions are
envisaged.
[0226] Useful enzymes for adding identical nucleotides include,
using the IUBMB Enzyme Nomenclature are provided in the
following:
[0227] Transferases: EC 2.7.7.19 (polynucleotide
adenylyltransferase), EC 2.7.7.52 (RNA uridylyltransferase), and EC
2.7.7.31 (DNA nucleotidylexotransferase).
[0228] Ligases: EC 6.5.1.1 (DNA ligase (ATP)), EC 6.5.1.2 (DNA
ligase (NAD+)), and EC 6.5.1.3 (RNA ligase (ATP)).
[0229] In certain embodiments, the 5' and/or 3' adjacent nucleotide
sequence does not occur naturally in the organism from where the
sample RNA is derived. This is believed to reduce the risk of
detecting irrelevant sequences in the sample. It is preferred that
the 5' and/or 3' adjacent nucleotide sequence is non-mammalian.
[0230] In other embodiments, step (a) comprises preparation of the
template polynucleotide by ligation of the 5' and/or 3' adjacent
nucleotide sequence to the short-length RNA, or step (a) comprises
preparation of the template polynucleotide by joining the 5' and/or
3' adjacent nucleotide sequence to the short-length RNA in a
terminal transferase reaction, preferably in a poly-A transferase
reaction. The ligation can be both sequence specific (e.g. overhang
ligation) and blunt-end ligation, but it is preferred to utilise
overhang ligation. In a preferred version of overhang ligation, the
method involves annealing, to the short-length RNA, an
oligonucleotide in part complementary to the ligase-reactive end of
the 5' or 3' adjacent nucleotide sequence and in part complementary
to the ligase-reactive end of the short-length RNA molecule so as
to position the ligase-reactive end of the 5' or 3' adjacent
nucleotide sequence directly adjacent to the ligase-reactive end of
the small RNA molecule to allow overhang ligation.
[0231] One main advantage of using ligation or terminal
transferases is that all RNA in the sample can be rendered useful
for the subsequent steps (which then, on the other hand, should be
highly specific). This enables creation of e.g. a non-specific cDNA
library which can later be used for the more specific steps in b
and c.
[0232] Typically, ligation or the terminal transferase reaction is
only performed at the 3' end of the target sequence, but ligation
to the 5' end of the target sequence can be performed by
phosphorylating the 5' end of the target sequence prior to the
ligation reaction. At any rate, in order to avoid "self-ligation"
of the adjacent nucleotide sequences, it is preferred to block one
of the termini (since ligases require 3'-hydroxyl and 5'-phosphate
in the molecules to be ligated, this is a fairly easy task for the
skilled person). Hence, the 5' adjacent nucleotide sequence is
blocked at its 5' terminus and the 3' adjacent nucleotide sequence
is blocked at its 3' terminus prior to ligation, and since these
two nucleotide sequences are normally added in separate steps, it
is avoided that they self-ligate.
[0233] The 5' and/or 3' adjacent nucleotide sequence(s) is/are
preferentially or exclusively joined to a defined processing state
of said short-length RNA in step (a). This is to mean that the
means for appending the adjacent nucleotide sequence utilises a
sequence coupling step which depends on the presence of a free 3'
or 5' end in the short-length RNA (whereby discrimination is
introduced over e.g. a pre-mature RNA that includes the same
sequence but not in its relevant terminus). It is preferred that
the defined processing state of said RNA is the mature state.
[0234] Step (b) in many embodiments comprises reverse transcription
of the template polynucleotide to obtain the cDNA, (cf. e.g. FIG.
27). However, as mentioned above, step b may also comprise
nucleotide polymerisation in step b to obtain the cDNA (cf. e.g.
the embodiment of FIG. 31).
[0235] Instead of utilising ligation or terminal transferases, step
(a) may comprise a step of nucleotide polymerization to attach the
adjacent nucleotide sequences. The polymerase used for this purpose
can be both a template-independent and a template-dependent
polymerase. Typically employed polymerases are DNA polymerases.
[0236] Even though preferred embodiments utilise polymerization
which is template specific, the polymerization may also consist in
addition of a poly-A, poly-G, poly-T or a poly-C tail to the 3' end
of the target sequence.
[0237] However, as mentioned, the currently preferred embodiments
entail use of template specific approaches. In the cases of
detection of microRNA, it is one object of the invention to be able
to discriminate between mature and pre-mature microRNA, and in this
context it is important to look at two different situations: the
situation where the microRNA is situated in the 3' terminus of its
premature precursor and the situation where the microRNA is
situated in the 5' terminus of the premature precursor. To
discriminate the mature forms from each of these precursors,
different approaches have to be used.
[0238] The following embodiments addresses various ways of
achieving this discrimination, but is not in any way limited to the
quantification of microRNA, since the embodiments are useful when
quantifying or detecting any short-length RNA:
[0239] One embodiment (cf. FIG. 27) entails that step (a) comprises
preparation of the template polynucleotide by the steps of [0240]
annealing the 3' end of the short-length RNA to an oligonucleotide
capture probe (the 5' end of which is complementary to the 3' end
of the short-length RNA), and [0241] extending the short-length RNA
by nucleotide polymerization using the oligonucleotide capture
probe as template so as to obtain an extended short-length RNA
molecule which constitutes the template polynucleotide. Typically
the nucleotide polymerisation comprises a DNA polymerisation to so
as to obtain an RNA-DNA hybrid which constitutes the template
polynucleotide.
[0242] In this embodiment, step (b) preferably comprises that the
RNA-DNA hybrid strand is reverse transcribed to obtain the cDNA,
optionally after removal of material not annealing to the
oligonucleotide capture probe (can be obtained if the capture probe
includes a tag, that enables immobilisation). In the reverse
transcription, the primer used can be the oligonucleotide capture
probe itself or, alternatively, a separate reverse transcription
primer (often the case, when the capture probe can be
immobilised--in that case, the duplex is denatured and the template
is transferred to another vessel where the new primer and other
reagents are added).
[0243] Another embodiment (cf. FIG. 31) entails that step (a)
comprises preparation of the template polynucleotide by the steps
of [0244] annealing the 5' end of the short-length RNA to an
oligonucleotide capture probe the 3' end of which is complementary
to the 5' of the short-length RNA and the 5' end of which comprises
the 5' adjacent nucleotide sequence, and [0245] extending the
capture probe by reverse transcription using the short-length RNA
as template to obtain an extended capture probe constituting the
template polynucleotide. In this case the template polynucleotide
does not include any of the original short-length RNA.
[0246] This embodiment may further entail that step (b) comprises
that the short-length RNA is removed from the extended capture
probe (by e.g. elevating the temperature), the capture probe is
allowed to anneal at its 3' end to a helper oligonucleotide
comprising a nucleotide sequence complementary to the 3' adjacent
nucleotide sequence, and the capture probe is further elongated in
the 5'.fwdarw.3' direction to obtain the cDNA by means of DNA
polymerization using the helper oligonucleotide as template. Hence,
in this embodiment, there is addition of both a 5' and 3' adjacent
nucleotide sequence which are both added by means of a target
sequence specific approach.
[0247] As mentioned, both of these embodiments can benefit if the
capture oligonucleotide contains a moiety that enables
immobilisation onto a solid support. In such cases the capture
probe is typically immobilised after annealing so as to allow
removal of non-annealing material.
[0248] All the embodiments described herein may be optimised by
enriching the sample in step (a) for RNA of short lengths--this can
be done by various separation methods known to the skilled person
(size exclusion chromatography, electrophoresis etc). This reduces
the risk of obtaining false positive hits in the determination step
derived from sequences in mRNA and other long RNA fragments.
[0249] In accordance with the principles of the present invention,
step c can entail any of the detection methods described herein. It
is, however, preferred that step (c) comprises use of a detection
probe which comprises modified nucleotides (such as LNA
nucleotides). In most of these embodiments, the detection probe
corresponds to or is complementary to a sequence in the
short-length RNA, but if the earlier steps a and b are sufficiently
specific, this is not a necessity--in those cases the detection
probe could be specific for other parts of the reaction product
from step b.
[0250] Also the various primers (and/or capture probes and/or
helper oligonucleotides) used in reverse transcription or in DNA
polymerization or in general in steps a-c, may comprise modified
nucleotides. The main advantage is that the total length of primers
and other oligonucleotides can be reduced because e.g. LNA exhibits
a high degree of hybridization with DNA, so sequence specific
binding can be obtained using shorter oligonucleotides.
[0251] It is also possible to utilise, as a primer in the detection
in step c, the same primer used in step b, i.e. a primer
constituted by a primer used in the reverse transcription or
nucleotide polymerization of step (b). Again, if the degree of
specificity in the steps as a whole is sufficiently high to allow a
"noise-free" detection of the short-length RNA, then the use of
such a "recycled" primer in step c will not affect the method
significantly.
[0252] In accordance with the description of this general aspect of
the invention, the present invention also relates to a kit useful
in the quantitative determination of mature short-length RNA having
a length of at most 100 nucleotides, said kit comprising [0253] the
minimum number of reverse transcription primers and/or nucleotide
polymerization primers and/or primers for qPCR and/or
oligonucleotide capture probes and/or helper oligonucleotides
and/or oligonucleotide probes, which are used in a method described
herein, wherein the reverse transcription primers, nucleotide
polymerization primers, primers for qPCR, oligonucleotide capture
probes, helper oligonucleotides, and oligonucleotide probes share
the features described above; and [0254] instructions for
quantitative determination of the mature short-length RNA using the
reverse transcription primers and/or nucleotide polymerization
primers and/or primers for qPCR and/or oligonucleotide capture
probes and/or helper oligonucleotides and/or oligonucleotide
probes. All disclosures relating to the provision of kits apply
mutatis mutandis do this kit.
[0255] The kit may further comprise one or more enzymes and other
reagents as described herein.
[0256] As an example as such a "minimal kit", the following is
provided for exercising the method set forth in FIG. 27 (the
reference primers and probes are optional):
[0257] The miR-specific assay [0258] Biotinyleret LNA capture probe
[0259] miR-specific reverse primer [0260] miR-specific forward and
reverse primers [0261] miR-specific dual-labeled probe [0262] RNA
control oligonucleotide [0263] DNA control oligonucleotide
[0264] The reference U6 snoRNA assay [0265] Reference U6 snoRNA RT
primer/random hexamer primer [0266] Reference U6 snoRNA primers and
dual-labeled probe
TABLE-US-00001 [0266] Oligonucleotide amount: 1 assay 10 assays
concentration volume Biotinylated LNA 0.5 pmol 5 pmol 0.5 .mu.M 1
.mu.L capture probe miR-specific reverse 0.1 pmol 1 pmol 0.1 .mu.M
1 .mu.L verse primer miR-specific for- 2.025 pmol 20.25 pmol 0.9
.mu.M 2.25 .mu.L ward primer miR-specific reverse 2.025 pmol 20.25
pmol 0.9 .mu.M 2.25 .mu.L verse primer miR-specific dual- 0.3125
pmol 3.125 pmol 0.25 .mu.M 1.25 .mu.L labeled probe RNA control
oligonucleotide 0.01 pmol 0.1 pmol 0.01 .mu.M 1 .mu.L DNA control
oligonucleotide 0.01 pmol 0.1 pmol 0.01 .mu.M 1 .mu.L Reference U6
2 pmol 20 pmol 2 .mu.M 1 .mu.L snoRNA RT primer/random hexamer
primer Reference U6 2.025 pmol 20.25 pmol 0.9 .mu.M 2.25 .mu.L
snoRNA forward primer Reference U6 2.025 pmol 20.25 pmol 0.9 .mu.M
2.25 .mu.L snoRNA reverse primer Reference U6 0.3125 pmol 3.125
pmol 0.25 .mu.M 1.25 .mu.L snoRNA dual- labeled probe
FURTHER ASPECTS OF THE INVENTION
[0267] Once the appropriate target sequences have been selected,
LNA substituted tagging probes and detection probes are preferably
chemically synthesized using commercially available methods and
equipment as described in the art (Tetrahedron 54: 3607-30, 1998).
For example, the solid phase phosphoramidite method can be used to
produce short LNA probes (Caruthers, et al., Cold Spring Harbor
Symp. Quant. Biol. 47:411-418, 1982, Adams, et al., J. Am. Chem.
Soc. 105: 661 (1983).
[0268] LNA-containing-probes are typically labelled during
synthesis. The flexibility of the phosphoramidite synthesis
approach furthermore facilitates the easy production of LNAs
carrying all commercially available linkers, fluorophores and
labelling-molecules available for this standard chemistry. LNA may
also be labelled by enzymatic reactions e.g. by kinasing.
[0269] Detection probes according to the invention can comprise
single labels or a plurality of labels. In one aspect, the
plurality of labels comprise a pair of labels which interact with
each other either to produce a signal or to produce a change in a
signal when hybridization of the detection probe to a target
sequence occurs.
[0270] In another aspect, the detection probe comprises a
fluorophore moiety and a quencher moiety, positioned in such a way
that the hybridized state of the probe can be distinguished from
the unhybridized state of the probe by an increase in the
fluorescent signal from the nucleotide. In one aspect, the
detection probe comprises, in addition to the recognition element,
first and second complementary sequences, which specifically
hybridize to each other, when the probe is not hybridized to a
recognition sequence in a target molecule, bringing the quencher
molecule in sufficient proximity to said reporter molecule to
quench fluorescence of the reporter molecule. Hybridization of the
target molecule distances the quencher from the reporter molecule
and results in a signal, which is proportional to the amount of
hybridization.
[0271] In another aspect polymerization of strands of nucleic acids
can be detected using a polymerase with 5' nuclease activity.
Fluorophore and quencher molecules are incorporated into the probe
in sufficient proximity such that the quencher quenches the signal
of the fluorophore molecule when the probe is hybridized to its
recognition sequence. Cleavage of the probe by the polymerase with
5' nuclease activity results in separation of the quencher and
fluorophore molecule, and the presence in increasing amounts of
signal as nucleic acid sequences.
[0272] Suitable samples of target nucleic acid molecules may
comprise a wide range of eukaryotic and prokaryotic cells,
including protoplasts; or other biological materials, which may
harbour target nucleic acids. The methods are thus applicable to
tissue culture animal cells, animal cells (e.g., blood, serum,
plasma, reticulocytes, lymphocytes, urine, bone marrow tissue,
cerebrospinal fluid or any product prepared from blood or lymph) or
any type of tissue biopsy (e.g. a muscle biopsy, a liver biopsy, a
kidney biopsy, a bladder biopsy, a bone biopsy, a cartilage biopsy,
a skin biopsy, a pancreas biopsy, a biopsy of the intestinal tract,
a thymus biopsy, a mammae biopsy, a uterus biopsy, a testicular
biopsy, an eye biopsy or a brain biopsy, e.g., homogenized in lysis
buffer), archival tissue nucleic acids, plant cells or other cells
sensitive to osmotic shock and cells of bacteria, yeasts, viruses,
mycoplasmas, protozoa, rickettsia, fungi and other small microbial
cells and the like.
[0273] Various amplifying reactions are well known to one of
ordinary skill in the art and include, but are not limited to PCR,
RT-PCR, LCR, in vitro transcription, rolling circle PCR, OLA and
the like. Multiple primers can also be used in multiplex PCR for
detecting a set of specific target molecules.
[0274] Preferably, the tagging probes as well as the detection
probes of the invention are modified in order to increase the
binding affinity of the probes for the target sequence by at least
two-fold compared to probes of the same sequence without the
modification, under the same conditions for hybridization or
stringent hybridization conditions. The preferred modifications
include, but are not limited to, inclusion of nucleobases,
nucleosidic bases or nucleotides that have been modified by a
chemical moiety or replaced by an analogue to increase the binding
affinity. The preferred modifications may also include attachment
of duplex-stabilizing agents e.g., such as minor-groove-binders
(MGB) or intercalating nucleic acids (INA). Additionally, the
preferred modifications may also include addition of
non-discriminatory bases e.g., such as 5-nitroindole, which are
capable of stabilizing duplex formation regardless of the
nucleobase at the opposing position on the target strand. Finally,
multi-probes composed of a non-sugar-phosphate backbone, e.g. such
as PNA, that are capable of binding sequence specifically to a
target sequence are also considered as a modification. All the
different binding affinity-increasing modifications mentioned above
will in the following be referred to as "the stabilizing
modification(s)", and the tagging probes and the detection probes
will in the following also be referred to as "modified
oligonucleotide". More preferably the binding affinity of the
modified oligonucleotide is at least about 3-fold, 4-fold, 5-fold,
or 20-fold higher than the binding of a probe of the same sequence
but without the stabilizing modification(s).
[0275] Most preferably, the stabilizing modification(s) is
inclusion of one or more LNA nucleotide analogs. Probes from 6 to
30 nucleotides according to the invention may comprise from 1 to 8
stabilizing nucleotides, such as LNA nucleotides. When at least two
LNA nucleotides are included, these may be consecutive or separated
by one or more non-LNA nucleotides. In one aspect, LNA nucleotides
are alpha and/or xylo LNA nucleotides.
[0276] The invention also provides a probe library comprising
tagging probes and detection probes with stabilizing modifications
as defined above. Preferably, the detection probes are less than
about 20 nucleotides in length and more preferably less than 15
nucleotides, and most preferably about 7 or 8 or 9 or 10 or 11
nucleotides. Also, preferably, the tagging probes are less than
about 40 nucleotides in length and more preferably less than 35
nucleotides, and most preferably about 20 or 30 nucleotides. Also,
preferably, the tagging probes ligation reaction and the RT tagging
probe and the 2.sup.nd strand tagging probe for the RT-PCR reaction
are composed of a high-affinity tagging recognition sequence of
less than about 15 nucleotides in length and more preferably less
than 14 nucleotides, and most preferably between 6 and 13
nucleotides, and furthermore of an anchored sequence as a primer
site for PCR primers of less than about 30 nucleotides in length
and more preferably less than 25 nucleotides, and most preferably
between 15 to 20 nucleotides. The probe libraries containing
labelled detection probes may be used in a variety of applications
depending on the type of detection element attached to the
recognition element. These applications include, but are not
limited to, dual or single labelled assays such as 5' nuclease
assay, molecular beacon applications (see, e.g., Tyagi and Kramer
Nat. Biotechnol. 14: 303-308, 1996) and other FRET-based
assays.
[0277] The problems with existing quantification assays for
microRNAs, siRNAs, RNA-edited transcripts, alternative splice
variants and antisense non-coding RNAs as outlined above are
addressed by the use of the probes of the invention in combination
with any of the methods of the invention consisting of a set of RNA
tagging probes and detection probes or sets of RNA RT tagging
probes combined with 2.sup.nd strand tagging probes and detection
probes, selected so as to recognize or detect a majority of all
discovered and detected miRNAs, RNA-edited transcripts, siRNAs,
alternative splice variants and antisense non-coding RNAs in a
given cell type from a given organism. In one aspect, the probe
library comprises probes that tag and detect mammalian mature
miRNAs, e.g., such as mouse, rat, rabbit, monkey, or human miRNAs.
By providing a cost-efficient useful method for quantitative
real-time and end-point PCR assays for mature miRNAs, RNA-edited
transcripts, siRNAs, alternative splice variants and antisense
non-coding RNAs, the present invention overcomes the limitations
discussed above especially for conventional miRNA assays and sRNA
assays. The detection element of the detection probes according to
the invention may be single or double labelled (e.g. by comprising
a label at each end of the probe, or an internal position). Thus,
probes according to the invention can be adapted for use in 5'
nuclease assays, molecular beacon assays, FRET assays, and other
similar assays. In one aspect, the detection probe comprises two
labels capable of interacting with each other to produce a signal
or to modify a signal, such that a signal or a change in a signal
may be detected when the probe hybridizes to a target sequence. A
particular aspect is when the two labels comprise a quencher and a
reporter molecule.
[0278] In another aspect, the probe comprises a target-specific
recognition segment capable of specifically hybridizing to a target
molecule comprising the complementary recognition sequence. A
particular detection aspect of the invention referred to as a
"molecular beacon with a stem region" is when the recognition
segment is flanked by first and second complementary
hairpin-forming sequences which may anneal to form a hairpin. A
reporter label is attached to the end of one complementary sequence
and a quenching moiety is attached to the end of the other
complementary sequence. The stem formed when the first and second
complementary sequences are hybridized (i.e., when the probe
recognition segment is not hybridized to its target) keeps these
two labels in close proximity to each other, causing a signal
produced by the reporter to be quenched by fluorescence resonance
energy transfer (FRET). The proximity of the two labels is reduced
when the probe is hybridized to a target sequence and the change in
proximity produces a change in the interaction between the labels.
Hybridization of the probe thus results in a signal (e.g.
fluorescence) being produced by the reporter molecule, which can be
detected and/or quantified.
[0279] In yet another aspect, the target detection probe comprises
a reporter and a quencher molecule at opposing ends of the short
target recognition sequence, so that these moieties are in
sufficient proximity to each other, that the quencher substantially
reduces the signal produced by the reporter molecule. This is the
case both when the probe is free in solution as well as when it is
bound to the target nucleic acid. A particular detection aspect of
the invention referred to as a "5' nuclease assay" is when the
detection probe may be susceptible to cleavage by the 5' nuclease
activity of the DNA polymerase. This reaction may possibly result
in separation of the quencher molecule from the reporter molecule
and the production of a detectable signal. Thus, such probes can be
used in amplification-based assays to detect and/or quantify the
amplification process for a target nucleic acid.
[0280] The invention also provides a method, system and computer
program embedded in a computer readable medium ("a computer program
product") for designing tagging probes and detection probes
comprising at least one stabilizing nucleobase. The method
comprises querying a database of target sequences (e.g., such as
the miRNA registry at
http://www.sanger.ac.uk/Software/Rfam/mirna/index.shtml) and
designing probes which: i) have sufficient binding stability to
bind their respective target sequence under stringent hybridization
conditions, ii) have limited propensity to form duplex structures
with itself, and iii) are capable of binding to and
detecting/quantifying at least about 60%, at least about 70%, at
least about 80%, at least about 90% or at least about 95% of all
the target sequences in the given database of.
[0281] Capture Probe Design Program.
[0282] The invention also provides a method, system and computer
program embedded in a computer readable medium ("a computer program
product") for designing the sequence of nucleotides to implement
the capture probe.
[0283] The method consists of the following steps:
[0284] a) Initial guess of one or mores sequence(s) of nucleotides
to implement the capture probe(s).
[0285] b) Iterative improvement of the initial guesses based on the
fulfillment of conditions and aims.
[0286] c) Stopping the algorithm when there is a sufficient
fulfillment of the conditions and aims also including the computing
time used on the current method.
[0287] The melting temperature is designated "Tm".
[0288] Detailed description of the three steps:
[0289] A) The initial guess is based on the miRNA sequence to match
a list of suitable reverse primers found by using a primer finding
software (primer3). Random sequences are generated to fill up not
initialized parts of the capture probe. The random generation is
guided by the use of di-nucleotide Tm tables to ensure sequences
with Tm in the neighborhood of the aimed Tm value.
[0290] B) The iterative improvement will be directed by a scoring
function based on the aims and conditions and of di-nucleotide Tm
tables. Random changes are made to avoid suboptimal iteration.
[0291] C) The algorithm stops when a scoring function based on the
aims, conditions and computation time is fulfilled.
[0292] The aims to obtain the primer and probe conditions listed
below:
[0293] 1. The Melting Temperature Condition for the Hybridization
of the Capture Probe Towards the miRNA
[0294] The melting temperature of the duplex formed by the capture
probe and the miRNA is extended to be suitable for a DNA polymerase
extension reaction. The oligonucleotide length within this duplex
ought to satisfy the Tm condition for a DNA polymerase extension
reaction mentioned above. The miRNA hybridized to the 3'-end of the
capture probe.
[0295] 2. The Melting Temperature Condition for the Duplex Formed
by the Capture Probe and the DNA Polymerase-Extended miRNA
[0296] The Tm of the duplex formed by the capture probe and the DNA
polymerase-extended miRNA target is not allowed to exceed the
temperature by means of which the heteroduplex can be denatured
without destroying the RNA-DNA target.
[0297] 3. The Relationship Between the Capture Probe and the
Reverse Transcription (RT) Primer
[0298] The RT primer is sequence identical to the 5' end of the
capture probe and hybridizes to the 3'-end of the DNA
polymerase-extended miRNA. The Tm for this duplex formed by RT
primer and DNA polymerase-extended miRNA has to be suitable for a
first strand synthesis using a reverse transcriptase.
[0299] 4. The Differentiation Between the Mature and Precursor
miRNA.
[0300] The 3'-end of the precursor miRNA is not allowed to
hybridize with a significant amount of oligonucleotides to the
capture probe under the given hybridization conditions for the
capture reaction. Likewise the preceding monomers after the mature
miRNA sequence motive within the precursor miRNA sequence are not
allowed to hybridize to the non-miRNA-related capture probe
sequence.
[0301] A general condition for every designed probe and primers is
the requirement of low self-annealing and low
self-hybridization.
[0302] Dual-Labeled Probe Design Program.
[0303] The invention also provides a method, system and computer
program embedded in a computer readable medium ("a computer program
product") for designing nucleotide sequences to implement into the
dual-labeled probe. The dual-labeled probe is used for detection of
a particular miRNA or a particular family of miRNA's with maximal
specificity.
[0304] The dual-labeled probe must fulfill the following
conditions: [0305] a) A requirement of low self-annealing and low
self-hybridization. [0306] b) Must anneal to the target by having a
suitable Tm to function in the PCR reaction. [0307] c) Must not
anneal to the primers in the PCR reaction.
[0308] The method consist of the following steps:
[0309] A) A design of probes with maximal specificity toward miRNA
or a family of miRNA's. The preferred probes that fulfil the
conditions, called dual-labeled probe matches, are investigated by
the ability of the dual-labeled probes to bind to other miRNA's. A
dual-labeled probe match is then assigned a specificity score
according to a scoring function. A sequence match, length of the
sequence, and the use of LNA-modified nucleotides in the sequence
determine a dual-labeled probe match.
[0310] B) Dual-labeled probe matches are scored by how well they
fulfil the conditions above. The dual-labeled probes are scored by
how well they fulfil the conditions above according to the scoring
functions. The specificity score and the scores from the conditions
are then used to deside the best nucleotide sequence of
dual-labeled probe.
[0311] The quencher is preferably selected from dark quencher as
disclosed in EP Application No. 2004078170.0, in particular
compounds selected from
1,4-bis-(3-hydroxypropylamino)-anthraquinone,
1-(3-(4,4'-dimethoxy-trityloxy)propylamino)-4-(3-hydroxypropylamino)-anth-
raquinone,
1-(3-(2-cyanoethoxy(diisopropylamino)phosphinoxy)propylamino)-4-
-(3-(4,4'-dimethoxytrityloxy)propylamino)-anthraquinone (#Q1),
1,5-bis-(3-hydroxy-propylamino)anthraquinone,
1-(3-hydroxypropylamino)-5-(3-(4,4'-dimethoxytrityloxy)propylamino)-anthr-
aquinone,
1-(3-(cyanoethoxy(diisopropylamino)phosphinoxy)propylamino)-5-(3-
-(4,4'-dimethoxytrityloxy)propylamino)-anthraquinone (#Q2),
1,4-bis-(4-(2-hydroxyethyl)phenylamino)anthraquinone,
1-(4-(2-(4,4'-dimethoxy-trityloxy)ethyl)phenylamino)-4-(4-(2-hydroethyl)p-
henylamino)-anthraquinone,
1-(4-(2-(2-cyanoethoxy(diisopropylamino)phosphinoxy)ethyl)phenylamino)-4--
(4-(2-(4,4'-dimethoxy-trityloxy)ethyl)phenylamino)anthraquinone,
and 1,8-bis-(3-hydroxy-propylamino)-anthraquinone; or alternatively
selected from 6-methyl-Quinizarin,
1,4-bis(3-hydroxypropylamino)-6-methylanthraquinone,
1-(3-(4,4'-dimethoxy-trityloxy)propylamino)-4-(3-hydroxypropylamino)-6(7)-
-methyl-anthraquinone,
1-(3-(2-cyanoethoxy(diisopropylamino)phosphinoxy)propylamino)-4-(3-(4,4'--
dimethoxy-trityloxy)propylamino)-6(7)-methylanthraquinone,
1,4-bis(4-(2-hydroethyl)phenylamino)-6-methyl-anthraquinone,
1,4-Dihydroxy-2,3-dihydro-6-carboxy-anthraquinone,
1,4-bis(4-methyl-phenylamino)-6-carboxy-anthraquinone,
1,4-bis(4-methyl-phenylamino)-6-(N-(6,7-dihydroxy-4-oxoheptane-1-yl))carb-
oxamido-anthraquinone,
1,4-bis(4-methyl-phenylamino)-6-(N-(7-dimethoxytrityloxy-6-hydroxy-4-oxo--
heptane-1-yl))carboxamido-anthraquinone,
1,4-Bis(4-methyl-phenylamino)-6-(N-(7-(2-cyanoethoxy(diisopropylamino)pho-
sphinoxy)-6-hydroxy-4-oxo-heptane-1-yl))carboxamido-anthraquinone,
1,4-bis(propylamino)-6-carboxy-anthraquinone,
1,4-bis(propylamino)-6-(N-(6,7-dihydroxy-4-oxo-heptane-1-yl))carboxamido--
anthraquinone,
1,4-bis(propylamino)-6-(N-(7-dimethoxytrityloxy-6-hydroxy-4-oxo-heptane-1-
-yl))carboxamido-anthraquinone,
1,5-bis(4-(2-hydroethyl)phenylamino)-anthraquinone,
1-(4-(2-hydroethyl)phenylamino)-5-(4-(2-(4,4'-dimethoxy-trityloxy)ethyl)p-
henylamino)-anthraquinone,
1-(4-(2-(cyanoethoxy(diisopropylamino)phosphinoxy)ethyl)phenylamino)-5-(4-
-(2-(4,4'-dimethoxytrityloxy)ethyl)phenylamino)-anthraquinone,
1,8-bis(3-hydroxypropylamino)anthraquinone,
1-(3-hydroxypropylamino)-8-(3-(4,4'-dimethoxy-trityloxy)propylamino)-anth-
raquinone, 1,8-bis(4-(2-hydroethyl)phenylamino)-anthraquinone, and
1-(4-(2-hydroethyl)phenylamino)-8-(4-(2-(4,4'-dimethoxytrityloxy)ethyl)ph-
enylamino)-anthraquinone.
[0312] One preferred method for covalent coupling of
oligonucleotides on different solid supports is photochemical
immobilization using a photochemically active anthraquinone
attached to the 5'- or 3'-end of the oligonucleotide as described
in WO 96/31557 or in WO 99/14226.
[0313] In another preferred embodiment the high affinity and
specificity of LNA modified oligonucleotides is exploited in the
sequence specific capture and purification of natural or synthetic
nucleic acids. In one aspect, the natural or synthetic nucleic
acids are contacted with the LNA modified oligonucleotide
immobilised on a solid surface. In this case hybridisation and
capture occurs simultaneously. The captured nucleic acids may be,
for instance, detected, characterised, quantified or amplified
directly on the surface by a variety of methods well known in the
art or it may be released from the surface, before such
characterisation or amplification occurs, by subjecting the
immobilised, modified oligonucleotide and captured nucleic acid to
dehybridising conditions, such as for example heat or by using
buffers of low ionic strength.
[0314] In another aspect the LNA modified oligonucleotide carries a
ligand covalently attached to either the 5' or 3' end. In this case
the LNA modified oligonucleotide is contacted with the natural or
synthetic nucleic acids in solution whereafter the hybrids formed
are captured onto a solid support carrying molecules that can
specifically bind the ligand.
[0315] In one preferred aspect, the target sequence database
comprises nucleic acid sequences corresponding to human, mouse,
rat, Drosophila melanogaster, C. elegans, Arabidopsis thaliana,
maize, fugu, zebrafish, Gallus Gallus, vira or rice miRNAs.
[0316] In another aspect, the method further comprises calculating
stability based on the assumption that the recognition sequence
comprises at least one stabilizing nucleotide, such as an LNA
molecule. In one preferred aspect the calculated stability is used
to eliminate probes with inadequate stability from the database of
virtual candidate probes prior to the initial query against the
database of target sequence to initiate the identification of
optimal probe recognition sequences.
[0317] In another aspect, the method further comprises calculating
the capability for a given probe sequence to form a duplex
structure with itself based on the assumption that the sequence
comprises at least one stabilizing nucleotide, such as an LNA
molecule. In one preferred aspect the calculated propensity is used
to eliminate probe sequences that are likely to form probe duplexes
from the database of virtual candidate probes.
[0318] A preferred embodiment of the invention are kits for the
detection or quantification of target miRNAs, siRNAs, RNA-edited
transcripts, non-coding antisense transcripts or alternative splice
variants comprising libraries of tagging probes and target
detection probes. In one aspect, the kit comprises in silico
protocols for their use. In another aspect, the kit comprises
information relating to suggestions for obtaining inexpensive DNA
primers. The probes contained within these kits may have any or all
of the characteristics described above. In one preferred aspect, a
plurality of probes comprises at least one stabilizing nucleotide,
such as an LNA nucleotide. In another aspect, the plurality of
probes comprises a nucleotide coupled to or stably associated with
at least one chemical moiety for increasing the stability of
binding of the probe. The kits according to the invention allow a
user to quickly and efficiently develop an assay for different
miRNA targets, sRNA targets, RNA-edited transcripts, non-coding
antisense transcripts or alternative splice variants.
[0319] In general, the invention features the design of high
affinity oligonucleotide probes that have duplex stabilizing
properties and methods highly useful for a variety of target
nucleic acid detection, amplification, and quantification methods
(e.g., monitoring expression of microRNAs or siRNAs by real-time
quantitative PCR). Some of these oligonucleotide probes contain
novel nucleotides created by combining specialized synthetic
nucleobases with an LNA backbone, thus creating high affinity
oligonucleotides with specialized properties such as reduced
sequence discrimination for the complementary strand or reduced
ability to form intramolecular double stranded structures. The
invention also provides improved methods for detecting and
quantifying nucleic acids in a complex nucleic acid sample. Other
desirable modified bases have decreased ability to self-anneal or
to form duplexes with oligonucleotide probes containing one or more
modified bases.
EXAMPLES
[0320] The invention will now be further illustrated with reference
to the following examples. It will be appreciated that what follows
is by way of example only and that modifications to detail may be
made while still falling within the scope of the invention.
[0321] In the following Examples probe reference numbers designate
the LNA-oligonucleotide sequences shown in the synthesis examples
below.
[0322] Assessment of sensitivity and specificity of the real-time
quantitative PCR assays for the human miR-15a microRNA target
sequence.
[0323] Materials and Methods
[0324] 1. Design and Synthesis of the Oligonucleotide Tagging
Probes and Detection Probes for MicroRNA Detection and
Quantification.
[0325] The RNA oligonucleotides (EQ15885 and EQ15886) were
purchased at DNA Technology (Aarhus, Denmark) and purified by
reverse phase chromatography (RPHPLC). The RNA oligonucleotides
were dissolved in Diethyl pyrocarbonate- (DEPC) treated H.sub.2O
and the concentrations were determined on a NanoDrop ND-1000
(NanoDrop technologies, USA). Otherwise, the oligonucleotides were
synthesised or standard DNA oligonucleotides were purchased at DNA
technology.
TABLE-US-00002 TABLE I The design of the microRNA tagging probes,
synthetic transcription templates and detection probes. 3'- EQ No
Name 5'-end Sequence.sup.a end 7396 M13 for gtaaaacgacggccagt (SEQ
ID NO: 1) 7655 pTRIamp18 M13 rev gaaacagctatgacatg (SEQ ID NO: 2)
15848 hsa-miR-15a micROLA probe 1 aTgtGctGcTaactggccgtcgttttac (SEQ
ID NO: 3) 15849 hsa-miR-15a micROLA probe 2
gaaacagctatgacatgcacAaamCcaTt (SEQ ID NO: 4) 15852 hsa-miR-15a DNA
phos tagcagcacataatggtttgtg P (SEQ ID NO: 5) 15853 hsa-miR-16 DNA
phos tagcagcacgtaaatattggcg P (SEQ ID NO: 6) 15866 hsa-miR-15 A_02
6-Fitc aATGGTTTG#Q1z P 15867 hsa-miR-15 A_03 6-Fitc tGTGmCTGmCT#Q1z
P 15885 hsa-miR-15a RNA uagcagcacauaaugguuugug (SEQ ID NO: 7) 15886
hsa-miR-16 RNA uagcagcacguaaauauuggcg (SEQ ID NO: 8) 15887 hsa
miR-15a M13 for ex cgtaaaacgacggccagt (SEQ ID NO: 9) 15888 hsa
miR-15a M13 rev ex caagtcttgaaacagctatgacatg (SEQ ID NO: 10)
.sup.aLNA (upper cases), DNA (lower cases), RNA (italic and lower
cases), 5-methyl C (mC); Fluorescein (6-FITC (Glenn Research, Prod.
Id. No. 10-1964)), #Q1 (Prepared as described in Example 8a), z
(5-nitroindole (Glenn Research, Prod. Id. No. 10-1044)), and
Phosphate (P).
[0326] The human miR-15a microRNA tagging probe with the 3'-end
recognition sequence was enzymatically 5'-phosphorylated in a 50
.mu.L reaction using 10 U T4 polynucleotide kinase (New England
Biolabs (NEB) USA), 400 .mu.mol hsa-miR-15a microRNA probe 1
(EQ15848), and 1.times.T4 DNA ligase buffer (NEB, USA). The
reaction was incubated 30 min at 37.degree. C. and heat inactivated
10 min at 70.degree. C. The kinase was removed by adding 50 .mu.L
DECP-treated H.sub.2O and filtering the reaction through an YM-30
Microcon spin column (Millipore, USA) 3 min 14000.times.g. The
concentration of the phosphorylated tagging probe was determined on
a NanoDrop ND-1000 (NanoDrop technologies, USA).
[0327] 2. MicroRNA-Templated Ligation Reactions
[0328] The ligation reaction was performed in 20 .mu.L consisting
of 120 nM miR-15a RNA template (EQ15885), 120 nM of each microRNA
tagging probe (phosphylated EQ15848 (see above) and EQ15849), 10 mM
Tris-HCl pH 7.0 (Ambion, USA), 10 mM MgCl.sub.2 (PE Biosystems,
USA), 0.05.times.T4 DNA ligase buffer [2.5 mM TRIS-HCl, 0.5 mM
MgCl.sub.2, 0.5 mM DTT, 50 .mu.M ATP, 1.25 .mu.g/mL BSA, pH
7.5@25.degree. C.; (NEB, USA)]. The reactions were pre-incubated
for 15 min at 37.degree. C. and 800 U T4 DNA ligase was added and
incubated for additional 2 hours at 37.degree. C. Finally the
reactions were heat-inactivated 20 min at 65.degree. C. The
ligation reaction was repeated using miR-15a DNA (EQ15852), miR-16
RNA (EQ15886) as target or no template instead of the miR-15a RNA
target. In addition to the 1:1 molar ratio of the target:microRNA
tagging probes the ratios 5:1 and 1:5 were used in separate
ligation reactions.
[0329] The ligation reaction performed using the Quick ligation kit
(NEB, USA) was carried out according to the supplier's
instructions. In brief, the oligonucleotides were the same as
described above, In a 20 .mu.L reaction mixture, the
oligonucleotides and 1.times. quick ligation buffer (NEB, USA) were
incubated 15 min at 25.degree. C. and 1 .mu.L Quick T4 DNA ligase
(NEB, USA) was added and the incubation was prolonged for
additional 30 min. The enzyme was heat-inactivated for 20 min at
65.degree. C.
[0330] 3. Real-Time Polymerase Chain Reaction (PCR) Assays
[0331] 3.1. MicroRNA Real-Time PCR Assays Using SYBR Green
Detection
[0332] The reaction comprised (50 .mu.L) 1.times.SYBR.RTM. Green
PCR Master Mix (Applied Biosystems, USA) 200 nM of M13 forward
primer (EQ7396), 200 nM M13 reverse primer (EQ7655) and 2.5 .mu.L
ligation reaction (described above). Cycling procedure: 10 min
95.degree. C., 50 cycles of 15 sec 95.degree. C., 1 min 45.degree.
C., 1 min 60.degree. C., and finally dissociation 20 min from
60.degree. C. to 95.degree. C. in an ABI Prism.RTM. 7000 Sequence
Detection System.
[0333] 3.2. MicroRNA Real-Time PCR Assays Using LNA-Modified
Detection Probes
[0334] The reaction (50 .mu.L) was 1.times. QuantiTect Probe PCR
master mix (Qiagen, Germany) 200 nM hsa miR-15a M13 forward primer
(EQ15887), 200 nM hsa miR-15a M13 reverse primer (EQ15888), 100 nM
LNA sequence-specific probe (EQ15866 or EQ15867), 2.5 .mu.L
ligation reaction (described above). Cycling procedure: 15 min
95.degree. C., 50 cycles of 20 sec 95.degree. C., 1 min 60.degree.
C. in an ABI Prism.RTM. 7000 Sequence Detection System.
[0335] In the following, dUTP means
2'-deoxyuridine-5'-triphosphate
Example 1
Real-Time Quantitative PCR Assay for the Human miR-15a MicroRNA
Target Sequence
[0336] The sequence-specific LNA-modified microRNA tagging probes
were annealed and ligated. The ligated templates were subsequently
detected using real-time PCR, anchor PCR primers and an
LNA-modified dual-labelled detection probe for the miR-15a microRNA
using a minus template as a negative control. The specificity of
the reaction was tested using a reaction without ligase. The
threshold cycle (Ct), which represents the PCR cycle at which an
increase in reporter fluorescence above a baseline signal can first
be detected, for the ligated microRNA probes, using the miR-15a
microRNA template was 35.0 (FIG. 2A), whereas no Ct values were
detectable for the negative control experiments (minus template and
minus ligase, respectively). The normalized reporter signal (Rn) is
measured over the PCR reaction, which represents the fluorescence
signal of the reporter dye divided by the fluorescence signal of
the passive reference dye. During PCR, Rn increases as amplicon
copy number increases, until the reaction approaches a plateau. The
baseline corrected Rn (.DELTA.Rn) represents the Rn minus the
baseline signal that was established in the first few cycles of
PCR. For end-point analysis (FIG. 2B) the real-time PCR samples (4
.mu.L) were applied on a 2% agarose gel stained with 1:10000
Gelstar and electrophoresis in 1.times.TBE buffer (90 mM
Tris-borate, 2 mM EDTA, pH 8.3) for 2 hours at 8 V/cm. Lane 1 shows
the ligated miR-15a tagging probes as template in the real-time
PCR. The negative controls were Lane 2: minus template, and Lane 3:
without ligase.
Example 2
Real-Time Quantitative PCR Assay for the Human miR-15a MicroRNA
Target Sequence and the Corresponding DNA 3'-Blocked Target
[0337] The RNA template was replaced by a DNA template, which was
chemically blocked with a phosphate at the 3'-end. Without addition
of ligase in the ligation reaction, the blocked DNA template could
not be detected in the LNA sequence-specific real-time PCR assay.
The Ct values for the RNA template and the DNA template were 35.0
and 33.3, respectively (FIG. 3).
Example 3
Specificity of the Real-Time Quantitative PCR Assays for the Human
miR-15a and Human miR-16 MicroRNA Target Sequences
[0338] Sequence-specific microRNA target sequence recognition of
the method of invention was assessed by using the miR-15a microRNA
target in comparison with the human miR-16 target that has 72%
sequence identity with the miR-15a target sequence. Neither the
minus template control nor the no template control (NTC) in the
real-time PCR reaction were shown to give any signals. Using the
hybridization conditions for the annealing of the LNA-modified
miR-15a target sequence-specific tagging probes as described above
towards the miR-15a target resulted in a Ct value of 36.2, whereas
the use of the same tagging probes for the highly homologous miR-16
resulted in a Ct value of 39.9, corresponding to a 13-fold
discriminative difference (FIG. 4).
Example 4
Real-Time Quantitative PCR Assays for the Human miR-15a MicroRNA
Target Sequence Using Two Different LNA-Modified, Dual-Labeled
Detection Probes
[0339] Two different LNA-modified real-time PCR detection probes
were designed for the human miR-15a microRNA target sequence using
the same LNA-modified tagging probes ligated by the Quick T4 DNA
ligation kit. The use of the LNA-modified detection probes EQ15866
and EQ15867 in the real-time PCR assays resulted in Ct values of
38.2 and 32.2, respectively (FIG. 5). No signals where detected
from both the minus ligase controls (EQ15866 open squares; EQ15867
open triangles).
Example 5
Real-Time Quantitative PCR Assays for the Human miR-15a Target
Sequence Using Different Molar Ratios Between the Target and the
miR-15a Tagging Probes
[0340] The molar ratios between target and tagging probes were 1:1
resulted in the highest end-point fluorescence signal (FIG. 6)
(.DELTA.Rn value), while the 1:5 molar ratios resulted in the
lowest end-point signal (.DELTA.Rn value). A molar excess of the
miR-15a tagging probes (1:5 molar ratio) also resulted in a
specific end-point signal (FIG. 6), whereas the No template control
(NTC) in the PCR reaction did not show any significant fluorescence
signal.
Example 6
Real-Time Quantitative PCR Assays for the Human miR-15a Target
Sequence Spiked into a Complex Background of Torulla Yeast RNA
Using the miR-15a Tagging Probes and the Best-Mode LNA-Modified
Detection Probe
[0341] The miR-15a microRNA was spiked into 10 .mu.g of Torulla
yeast RNA at 2.4 .mu.M and 1 .mu.M concentrations, annealed with
the miR-15a tagging probes at equimolar concentrations,
respectively, followed by ligation and miR-15a detection by
quantitative real-time PCR. The highest fluorescence signal was
observed from the miR-15a target sequence control (without the
complex yeast total RNA background), while no fluorescence signals
were detected from the yeast total RNA sample (FIG. 7). No
contamination of the real-time PCR assays were observed, as
demonstrated with the minus template control.
Example 7
Real-Time Quantitative PCR Assay for the Human miR-15a MicroRNA
Target Sequence Using SYBR Detection
[0342] The sequence-specific LNA-modified microRNA tagging probes
were annealed and ligated. The ligated templates were readily
detected using real-time PCR, the anchor PCR primers and SYBR green
detection (FIG. 8), whereas no signals were detected from the minus
template or minus ligase controls.
Example 8a
Preparation of
1-(3-(2-cyanoethoxy(diisopropylamino)phosphinoxy)pro-pylamino)-4-(3-(4,4'-
-dimethoxy-trityloxy)propylamino)-anthraquinone (3) Quencher
"Q1"
##STR00002##
[0343] 1,4-Bis(3-hydroxypropylamino)-anthraquinone (1)
[0344] Leucoquinizarin (9.9 g; 0.04 mol) is mixed with
3-amino-1-propanol (10 mL) and Ethanol (200 mL) and heated to
reflux for 6 hours. The mixture is cooled to room temperature and
stirred overnight under atmospheric conditions. The mixture is
poured into water (500 mL) and the precipitate is filtered off
washed with water (200 mL) and dried. The solid is boiled in
ethylacetate (300 mL), cooled to room temperature and the solid is
collected by filtration.
[0345] Yield: 8.2 g (56%)
1-(3-(4,4'-dimethoxy-trityloxy)propylamino)-4-(3-hydroxypropylamino)anthra-
quinone (2)
[0346] 1,4-Bis(3-hydroxypropylamino)-anthraquinone (7.08 g; 0.02
mol) is dissolved in a mixture of dry N,N-dimethylformamide (150
mL) and dry pyridine (50 mL). Dimethoxytritylchloride (3.4 g; 0.01
mol) is added and the mixture is stirred for 2 hours. Additional
dimethoxytritylchloride (3.4 g; 0.01 mol) is added and the mixture
is stirred for 3 hours. The mixture is concentrated under vacuum
and the residue is redissolved in dichloromethane (400 mL) washed
with water (2.times.200 ml) and dried (Na.sub.2SO.sub.4). The
solution is filtered through a silica gel pad (o 10 cm; h 10 cm)
and eluted with dichloromethane until mono-DMT-anthraquinone
product begins to elude where after the solvent is the changed to
2% methanol in dichloromethane. The pure fractions are combined and
concentrated resulting in a blue foam.
[0347] Yield: 7.1 g (54%)
[0348] .sup.1H-NMR (CDCl.sub.3): 10.8 (2H, 2xt, J=5.3 Hz, NH), 8.31
(2H, m, AqH), 7.67 (2H, dt, J=3.8 and 9.4, AqH), 7.4-7.1 (9H, m,
ArH+AqH), 6.76 (4H, m, ArH) 3.86 (2H, q, J=5.5 Hz, CH.sub.2OH),
3.71 (6H, s, CH.sub.3), 3.54 (4H, m, NCH.sub.2), 3.26 (2H, t, J=5.7
Hz, CH.sub.2ODMT), 2.05 (4H, m, CCH.sub.2C), 1.74 (1H, t, J=5 Hz,
OH).
1-(3-(2-cyanoethoxy(diisopropylamino)phosphinoxy)propylamino)-4-(3-(4,4'-d-
imethoxy-trityloxy)propylamino)-anthraquinone (3)
[0349]
1-(3-(4,4'-dimethoxy-trityloxy)propylamino)-4-(3-hydroxypropylamino-
)-anthraquinone (0.66 g; 1.0 mmol) is dissolved in dry
dichloromethane (100 mL) and added 3 .ANG. molecular sieves. The
mixture is stirred for 3 hours and then added
2-cyanoethyl-N,N,N',N'-tetraisopropylphosphordiamidite (335 mg; 1.1
mmol) and 4,5-dicyanoimidazole (105 mg; 0.9 mmol). The mixture is
stirred for 5 hours and then added sat. NaHCO.sub.3 (50 mL) and
stirred for 10 minutes. The phases are separated and the organic
phase is washed with sat. NaHCO.sub.3 (50 mL), brine (50 mL) and
dried (Na.sub.2SO.sub.4). After concentration the phosphoramidite
is obtained as a blue foam and is used in oligonucleotide synthesis
without further purification.
[0350] Yield: 705 mg (82%)
[0351] .sup.31P-NMR (CDCl.sub.3): 150.0
[0352] .sup.1H-NMR (CDCl.sub.3): 10.8 (2H, 2xt, J=5.3 Hz, NH), 8.32
(2H, m, AqH), 7.67 (2H, m, AqH), 7.5-7.1 (9H, m, ArH+AqH), 6.77
(4H, m, ArH) 3.9-3.75 (4H, m), 3.71 (6H, s, OCH.sub.3), 3.64-3.52
(3.54 (6H, m), 3.26 (2H, t, J=5.8 Hz, CH.sub.2ODMT), 2.63 (2H, t,
J=6.4 Hz, CH.sub.2CN) 2.05 (4H, m, CCH.sub.2C), 1.18 (12H, dd,
J=3.1 Hz, CCH.sub.3).
Example 8b
Preparation of 1-(3-(cyanoethoxy(diisopropylamino)phosphinoxy) pro
pylamino)-5-(3-(4,4'-dimethoxy-trityloxy)propylamino)-anthraquinone
(6) Quencher "Q2"
##STR00003##
[0353] 1,5-Bis(3-hydroxpropylamino)-anthraquinone (4)
[0354] 1,5-Dichloroanthraquinone (2.8 g; 10 mmol) is mixed with
3-amino-1-propanol (10 mL) in DMSO (50 mL) and heated to
130.degree. C. for 4 hours. The mixture is cooled to
.about.80.degree. and added water (150 mL). When the mixture has
reached RT the formed precipitate is isolated by filtration, washed
with water (2.times.50 mL), boiled in toluene (200 mL) and the
un-dissolved product is isolated by filtration and dried. Yield:
3.2 g (90%).
1-(3-hydroxpropylamino)-5-(3-(4,4'-dimethoxy-trityloxy)propylamino)-anthra-
quinone (5)
[0355] 1,5-Bis(3-hydroxypropylamino)-anthraquinone (1.4 g; 4 mmol)
is co-evaporated with pyridine (50 mL) and then resuspended in
pyridine (50 mL) added dimethoxytritylchloride (1.4 g; 4.1 mmol)
and stirred overnight. The mixture is concentrated and the residue
redissolved in dichloromethane (150 mL), washed with sat.
NaHCO.sub.3 (2.times.50 mL), brine (50 mL), dried
(Na.sub.2SO.sub.4) and concentrated. Purify on silica gel column
(MeOH/dichloromethane 2/98). After concentration of the appropriate
fractions the mono-DMT compound is obtained as a red foam. Yield:
0.9 g (34%). .sup.1H-NMR (CDCl.sub.3): 9.7 (2H, 2xt, NH), 7.6-6.7
(19H, m, ArH), 3.86 (2H, q, J=5.5 Hz, CH.sub.2), 3.74 (6H, s,
CH.sub.3), 3.48 (4H, m, NCH.sub.2), 3.26 (2H, t, J=5.9 Hz), 2.05
(4H, m, CH.sub.2), 1.45 (1H, t, J=5 Hz).
1-(3-(cyanoethoxy(diisopropylamino)phosphinoxy)propylamino)-5-(3-(4,4'-dim-
ethoxytrityloxy)propylamino)-anthraquinone (6)
[0356]
1-(3-hydroxypropylamino)-5-(3-(4,4'-dimethoxy-trityloxy)propylamino-
)-anthraquinone (0.4 g; 0.61 mmol) is dissolved in dry
dichloromethane (50 mL) and added 3 .ANG. molecular sieves. The
mixture is stirred for 3 hours and then added
2-cyanoethyl-N,N,N',N'-tetraisopropylphosphordiamidite (200 mg;
0.66 mmol) and 4,5-dicyanoimidazole (71 mg; 0.6 mmol). The mixture
is stirred for 2 hours and then added sat. NaHCO.sub.3 (50 mL) and
stirred for 10 minutes. The phases are separated and the organic
phase is washed with sat. NaHCO.sub.3 (50 mL), brine (50 mL) and
dried (Na.sub.2SO.sub.4). After concentration the phosphoramidite
is obtained as a red foam and is used in oligonucleotide synthesis
without further purification. Yield: 490 mg (93%). .sup.31P-NMR
(CDCl.sub.3): 148.3.
[0357] Materials and Methods Used in Examples 9 to 11.
[0358] 1. MicroRNA-Templated Ligation Reaction Using Trehalose
[0359] The ligation reaction was performed in 20 .mu.L consisting
of 50 nM miR-15a RNA template (EQ15885, Table I), 500 nM of each of
the microRNA tagging probe, 10 mM Tris-HCl pH 7.0 (Ambion, USA), 10
mM MgCl.sub.2 (Ambion, USA), 0.05.times.T4 DNA ligase buffer [2.5
mM Tris-HCl, 0.5 mM MgCl.sub.2, 0.5 mM DTT, 50 .mu.M ATP, 1.25
.mu.g/mL BSA, pH 7.5 at 25.degree. C.; (NEB, USA)], 24 g/100 mL
trehalose (Sigma-Aldrich, USA), 0.05 .mu.g/.mu.L Torulla yeast RNA
(Ambion, USA). The reactions were pre-incubated for 15 min at
42.degree. C. and 800 U T4 DNA ligase (NEB, USA) were added and
incubated for 1 hour at 42.degree. C. in a thermocycler DYAD.TM.
(MJ Research DNA engine, USA). Finally the reactions were
heat-inactivated for 20 min at 95.degree. C. The ligation reaction
was repeated without template instead of the miR-15a RNA
target.
[0360] 2. MicroRNA Real-Time PCR Assays Using LNA-Modified
Detection Probe
[0361] The reaction (50 .mu.L) was 1.times.PCR buffer [contains
Tris-HCl, KCl, (NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2; pH 8.7
(20.degree. C.)] (Qiagen, Germany), MgCl.sub.2 to a final
concentration of 4 mM, 200 nM of each dATP, dCTP, dGTP and 600 nM
dUTP (Applied Biosystems, USA)"); 200 nM hsa-miR-15a forward primer
2 (EQ16444, Table II), 200 nM hsa-miR-15a reverse primer 2
(EQ16445, Table II), 250 nM LNA sequence-specific miR-15a detection
probe (EQ15866, Table I), 0.1.times.ROX Reference Dye (Invitrogen,
USA), 5 .mu.L ligation reaction (as described above) and 2.5 U
HotStarTaq DNA polymerase (Qiagen, Germany). Cycling procedure: 10
min 95.degree. C., 50 cycles of 20 sec 95.degree. C., 1 min
60.degree. C. in an Applied Biosystems 7500 Real Time PCR
System.
TABLE-US-00003 TABLE II The design of different microRNA tagging
probes, detection probes and real-time PCR primers used in examples
9 to 16. Oligo id 5'- 3'- (EQ No) Oligonucleotide name end Sequence
(5'-3').sup.a end 16444 hsa-miR-15a Forward primer 2
gtaaaacgacggccagttag (SEQ ID NO: 11) 16445 hsa-miR-15a Reverse
primer 2 ccgaaacagctatgacatgc (SEQ ID NO: 12) 16307 hsa-miR-15a
micROLA probe 1.1 P atgtgctgctaactggccgtcgttttac DNA (SEQ ID NO:
13) 16311 hsa-miR-15a micROLA probe 2.1
gaaacagctatgacatgcacaaaccatt DNA (SEQ ID NO: 14) 16314 hsa-miR-15a
micROLA probe 2.4 gaaacagctatgacatgmCamCaaAccAtt (SEQ ID NO: 15)
16447 hsa-miR-15a micROLA probe 3.4 gaaacagctatgacatgCacAaaCcatt
(SEQ ID NO: 16) 16452 hsa-miR-15a micROLA probe 3.9 P
aTgtgmCtgcTaactggccgtcgttttac (SEQ ID NO: 17) 16453 hsa-miR-15a
micROLA probe 3.10 gaaacagctatgacatgcAcaaAccaTt (SEQ ID NO: 18)
16580 axkOL140 6-Fitc aGmCAmCATAAT#Q1z P (SEQ ID NO: 19) 16581
axkOL142 6-Fitc aGmCAmCXTAAT#Q1z P (SEQ ID NO: 20) 16582 axkOL143
6-Fitc aGmCXmCXTAAT#Q1z P (SEQ ID NO: 21) 16583 axkOL144 6-Fitc
aGmCXmCXTXAT#Q1z P (SEQ ID NO: 22) 16589 hsa-miR-15a FP 3 LNA_3 2
DNA gtaaaacgacggccagttaGcaGcamCat (SEQ ID NO: 23) 16591 hsa-miR-15a
FP 3 DNA gtaaaacgacggccagttagcagcacat (SEQ ID NO: 24) 16618
hsa-miR-15a RT 4.1 DNA gaaacagctatgacatgcacaaacc (SEQ ID NO: 25)
16620 hsa-miR-15a RT 4.3 LNA gaaacagctatgacatgmCacAaamCc (SEQ ID
NO: 26) 16623 hsa-miR-15a FP 4.6 DNA gtaaaacgacggccagttagcagcaca
(SEQ ID NO: 27) 16624 hsa-miR-15a FP 4.7 LNA
gtaaaacgacggccagtTagmCagmCaca (SEQ ID NO: 28) 16679 axkOL150 6-Fitc
aGmCXmCXZAX#Q1z P .sup.aLNA (uppercase), DNA (lowercase), 5-methyl
C (mC); Fluorescein (6-FITC (Glenn Research, Prod. Id. No.
10-1964)), #Q1 (Prepared as described in Example 8a), z
(5-nitroindole (Glenn Research, Prod. Id. No. 10-1044)), Phosphate
(P), X denotes LNA-2,6-diaminopurine, and Z denotes
LNA-2-thiothymidine.
Example 9
Real-Time Quantitative PCR for the Human miR-15a MicroRNA Using
MicroRNA-Templated Ligation with Three Different Sets of miR-15a
Tagging Probe Pairs
[0362] The sequence-specific LNA-modified microRNA tagging probes
were annealed and ligated. Three different pairs of human miR-15a
microRNA tagging probes were chosen (Table II): Pair I.
EQ16311/EQ16452, II. EQ16453/EQ16307, and III. EQ16447/EQ16307) and
the ligation reactions were performed as described above. The
ligated templates were subsequently detected using real-time PCR as
described above, by the anchor PCR primers and an LNA-modified
dual-labelled detection probe for the miR-15a microRNA using a
minus template as a negative control. The specificity of the
ligation reaction was tested using a reaction without addition of
the T4 DNA ligase. The threshold cycles (Ct), which represent the
PCR cycles at which an increase in reporter fluorescence above a
baseline signal can first be detected, for the miR-15a microRNA
template were 17.2, 30.5 and 28.7 for the microRNA tagging probes
pairs I, II, and III, respectively (FIG. 13). While no Ct values
were detectable for the negative control experiments performed with
pairs II and III (minus template and minus ligase, respectively),
the Ct values from the negative controls performed with pair I were
detectable after cycle no. 37 and 39, respectively, which is still
acceptable when compared to the corresponding Ct value of 17.2
(FIG. 13). The normalized reporter signal (Rn) was measured over
the entire PCR cycling program, which represents the fluorescence
signal of the reporter dye divided by the fluorescence signal of
the passive reference dye. During PCR, Rn increases as amplicon
copy number increases, until the reaction approaches a plateau. The
baseline corrected Rn (.DELTA.Rn) represents the Rn minus the
baseline signal that was established in the first few cycles of
PCR.
Example 10
Improved Real-Time Quantitative PCR for the Human miR-15a MicroRNA
Using MicroRNA-Templated Ligation and LNA
2,6-Diaminopurine-Enhanced Detection Probes
[0363] The real-time PCR reactions were repeated using the
LNA-modified sequence-specific microRNA tagging probes
EQ16311/EQ16452 (pair I in Example 9) in human miR-15a-templated
ligation reaction as described above. The ligated templates were
subsequently detected using real-time quantitative PCR as described
above, by anchor PCR primers and LNA-modified dual-labelled
detection probes (EQ16580, EQ16581, EQ16582 or EQ16583, Table II)
for the miR-15a microRNA using a minus template as a negative
control. The specificity of the ligation reaction was tested using
a reaction without addition of T4 DNA ligase. The Ct values using
the human miR-15a microRNA template spiked into a complex
background of Torulla yeast RNA were highly comparable, i.e. 30.4,
30.0, 29.9 and 30.6 for LNA-modified dual-labelled detection probes
EQ16580, EQ16581, EQ16582 and EQ16583, respectively (FIG. 14, Table
II). In contrast, no Ct values were detectable for the negative
control experiments (minus template and minus ligase, FIG. 14). By
substituting one to two of the LNA A nucleotides with the LNA
2,6-diaminopurine monomers significantly enhanced the baseline
corrected fluorescence signal, .DELTA.Rn, detected in the microRNA
assay, whereas substitution with a third LNA 2,6-diaminopurine
monomer (EQ 16583, Table II) did not enhance the fluorescence
signal further, showing comparable results with the double LNA
2,6-diaminopurine-substituted miR-15a detection probe (EQ 16582,
Table II, FIG. 14).
Example 11
Real-Time Quantitative PCR Standard Curve Generated for the Human
miR-15a MicroRNA Using the MicroRNA-Templated Ligation Reaction as
Template
[0364] The LNA-modified human miR-15a microRNA tagging probe pair
EQ16311/EQ16452 (pair I in Example 9) was used in miR-15a-templated
ligation reactions as described above, where the human miR-15a
template concentration was 50, 5, 0.5, 0.05, or 0.005 nM,
respectively. The ligated templates were subsequently detected
using real-time quantitative PCR as described above, by the anchor
PCR primers and the LNA-modified dual-labelled detection probe
(EQ15866, Table I) for the miR-15a microRNA using a minus template
as a negative control. The specificity of the ligation reaction was
tested using a reaction without ligase. The Ct value using the
miR-15a microRNA template were 17.6, 22.0, 25.9, 29.6, and 35.6 for
the 50, 5, 0.5, 0.05, and 0.005 nM concentrations of the miR-15a
microRNA, respectively, whereas no Ct values were detectable for
the negative control experiments (minus template and minus ligase).
The Ct value is inversely proportional to the logarithm of the
initial template copy number. Therefore, a standard curve is
generated by plotting the Ct values against the logarithm of the
copy number as depicted in FIG. 15. By linear regression analysis
the slope and the intercept were determined. The slope of the
titration curve was -4.31 and the intercept 30.9.
Example 12
Real-Time Quantitative PCR for the Human miR-15a MicroRNA Using
MicroRNA-Templated RT-PCR Reactions with LNA-Modified Tagging
Probes and an LNA-Modified Dual-Labelled Detection Probe
[0365] 1. MicroRNA Reverse Transcription and Second Strand Reaction
with LNA-Modified Tagging Probes.
[0366] The reverse transcription and PCR (RT-PCR) reaction was
performed in 50 .mu.L consisting of 2 nM miR-15a RNA template
(EQ15885, Table I), 600 nM of each microRNA tagging probe, 1.times.
OneStep RT-PCR buffer [contains Tris-HCl, KCl,
(NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2, DTT, pH 8.7
(20.degree. C.)] (Qiagen, Germany), 400 .mu.M of each dNTP (Qiagen,
Germany), 20 U SUPERase-In (Ambion, USA), 0.05 .mu.g/.mu.L Torulla
yeast RNA, and 2 .mu.L Qiagen OneStep RT-PCR Enzyme mix (Qiagen,
Germany). The thermocycler DYAD.TM. (MJ Research DNA engine, USA)
was pre-heated to the start temperature. Temperature profile was 30
min 50.degree. C., 15 min 95.degree. C., 1 min 50.degree. C., 3 min
72.degree. C., and cooled down to 4.degree. C., finally. The RT-PCR
reaction was repeated without template as negative control.
[0367] 2. MicroRNA Real-Time Quantitative PCR Assays Using
LNA-Modified Detection Probes
[0368] The PCR reaction (50 .mu.L) in 1.times.PCR buffer [contains
Tris-HCl, KCl, (NH.sub.4).sub.2SO.sub.4, pH 8.7 (20.degree. C.)]
(Qiagen, Germany), MgCl.sub.2 to a final concentration of 4 mM, 200
nM of each of dATP, dCTP, dGTP and 600 nM dUTP (Applied Biosystems,
USA)"); 200 nM hsa-miR-15a forward primer 2 (EQ16444, Table II),
200 nM hsa-miR-15a reverse primer 2 (EQ16445, Table II), 250 nM LNA
sequence-specific detection probe (EQ15866, Table I), 0.1.times.ROX
reference dye (Invitrogen, USA), 5 .mu.L of the RT-PCR reaction as
template (described above) and 2.5 U HotStarTaq DNA polymerase
(Qiagen, Germany). Cycling procedure: 10 min 95.degree. C., 50
cycles of 20 sec 95.degree. C., 1 min 60.degree. C. in an Applied
Biosystems 7500 Real Time PCR System (Applied Biosystems, USA).
[0369] The LNA-modified microRNA tagging probes for human miR-15a
were annealed and extended as a reverse transcription primer (RT
tagging probe) and 2.sup.nd strand tagging probe. Three different
pairs of microRNA tagging probes were chosen (Table II): Pair IV.
EQ16591/EQ16311, V. EQ16591/EQ16314, and VI. EQ16589/EQ16314. The
miR-15a RT-PCR reactions were performed as described above. The
templates were subsequently detected using real-time PCR as
described above, using anchor PCR primers and an LNA-modified
dual-labelled detection probe (EQ15866, Table I) for the miR-15a
microRNA with a minus template as a negative control. The
specificity of the microRNA RT-PCR assay was assessed using a
reaction without addition of OneStep RT-PCR Enzyme mix. The Ct
value, which represents the PCR cycle at which an increase in
reporter fluorescence above a baseline signal can first be
detected, for the microRNA probes, using the miR-15a microRNA
template were 19.2, 28.2 and 22.0 for pair IV, V, and VI,
respectively (FIG. 16). Whereas no Ct values were detectable for
the negative control experiments performed with pairs V and VI
(minus template and minus ligase, respectively), the corresponding
Ct values from the negative controls with the pair V were 39.0 and
39.9 for the no template and no RT-PCR enzyme mix, respectively,
which is still acceptable values. The Rn signal was measured over
the entire real-time PCR program, which represents the fluorescence
signal of the reporter dye divided by the fluorescence signal of
the passive reference dye. During PCR, Rn increased as amplicon
copy number increased, until the reaction approaches a plateau. The
.DELTA.Rn represents the .DELTA.Rn minus the baseline signal that
was established in the first few cycles of PCR.
Example 13
Improved Real-Time Quantitative PCR for the Human miR-15a MicroRNA
Using MicroRNA-Templated RT-PCR Reactions with LNA-Modified Tagging
Probes and LNA 2,6-Diaminopurine-Enhanced Detection Probes
[0370] 1. MicroRNA Reverse Transcription and Second Strand Reaction
with LNA-Modified Tagging Probes.
[0371] The RT-PCR reaction was performed in 25 .mu.L consisting of
2 nM miR-15a RNA template (EQ15885, Table I), 60 nM of each
microRNA tagging probe, 1.times. OneStep RT-PCR buffer [contains
Tris-HCl, KCl, (NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2, DTT, pH
8.7 (20.degree. C.)] (Qiagen, Germany), 400 .mu.M of each of dNTP
(Qiagen, Germany), 10 U SUPERase-In (Ambion, USA), 0.05 .mu.g/.mu.L
Torulla yeast RNA, and 1 .mu.L Qiagen OneStep RT-PCR Enzyme mix
(Qiagen, Germany). The thermocycler DYAD.TM. (MJ Research DNA
engine, USA) was heated to the reaction start temperature.
Temperature profile was 30 min 50.degree. C., 15 min 95.degree. C.,
1 min 50.degree. C., 3 min 72.degree. C., and cooled down to
4.degree. C., finally. The RT-PCR reaction was repeated without
template as negative control instead of the miR-15a RNA target.
[0372] 2. MicroRNA Real-Time Quantitative PCR Assays Using
LNA-Modified Detection Probes.
[0373] The reaction (25 .mu.L) was 1.times.PCR buffer [contains
Tris-HCl, KCl, (NH.sub.4).sub.2SO.sub.4, pH 8.7 (20.degree. C.)]
(Qiagen, Germany), MgCl.sub.2 to a final concentration of 4 mM, 200
nM of each of dATP, dCTP, dGTP and 600 nM dUTP (Applied Biosystems,
USA); 200 nM hsa-miR-15a forward primer 2 (EQ16444, Table II), 200
nM hsa-miR-15a reverse primer 2 (EQ16445, Table II), 250 nM LNA
detection probe (EQ15866, Table I), 0.1.times.ROX reference dye
(Invitrogen, USA), 5 .mu.L of the RT-PCR reaction (described above)
and 1.25 U HotStarTaq DNA polymerase (Qiagen, Germany). Cycling
procedure: 10 min 95.degree. C., 50 cycles of 20 sec 95.degree. C.,
1 min 60.degree. C. in an Applied Biosystems 7500 Real Time PCR
System (Applied Biosystems, USA).
[0374] The LNA-modified microRNA tagging probes EQ16591/EQ16314
(pair V in Example 12) for human miR-15a microRNA were annealed and
extended as a reverse transcription primer (RT tagging probe) and
2.sup.nd strand tagging probe as described above. The miR-15 RT-PCR
reactions were subsequently detected using real-time PCR as
described above, the anchor PCR primers and LNA-modified
dual-labelled detection probes (EQ16580, EQ16581, and EQ16582,
Table II) for the miR-15a microRNA using a minus template as a
negative control. The Ct values using the miR-15a microRNA template
were 33.0, 33.2, and 33.7 for LNA-modified dual-labelled detection
probes EQ16580, EQ16581, and EQ16582, respectively (FIG. 17),
whereas no Ct values were detectable for the negative control
experiments (minus template and minus OneStep RT-PCR Enzyme mix).
By substituting one to two of the LNA A nucleotides with the LNA
2,6-diaminopurine monomers significantly enhanced the baseline
corrected fluorescence signal, .DELTA.Rn, detected in the microRNA
assay (FIG. 17).
Example 14
Real-Time Quantitative PCR Standard Curve Generated for the Human
miR-15a MicroRNA Using MicroRNA-Templated RT-PCR Reactions as
Template
[0375] The LNA-modified microRNA tagging probes EQ16624/EQ16620
(pair VII) for human miR-15a microRNA were annealed and extended as
a reverse transcription primer (RT tagging probe) and 2.sup.nd
strand tagging probe. The RT-PCR reactions were performed as
described above, where the human miR-15a microRNA template
concentration was 50, 5, 0.5, 0.05, or 0.005 nM, respectively. The
miR-15a RT-PCR reactions were subsequently detected using real-time
quantitative PCR as described above, by using the anchor PCR
primers and an LNA-modified dual-labelled detection probes
(EQ16582) for the miR-15a microRNA using a minus template as a
negative control. The specificity of the microRNA RT-PCR reaction
was assessed using a reaction without addition of the OneStep
RT-PCR Enzyme mix. The Ct values using the miR-15a microRNA
template were 22.2, 26.5, 30.6, 33.6, and 37.8 for the 50, 5, 0.5,
0.05, and 0.005 nM concentrations of the miR-15a microRNA,
respectively, whereas no Ct values were detectable for the negative
control experiments (minus template and minus OneStep RT-PCR Enzyme
mix). The Ct value is inversely proportional to the logarithm of
the initial template copy number. Therefore, a standard curve is
generated by plotting the Ct values against the logarithm of the
copy number as depicted in FIG. 18. By linear regression analysis
the slope and the intercept is determined. The slope of the
titration curve was -3.81 and the intercept 34.0.
Example 15
Real-Time Quantitative PCR for the Human miR-15a MicroRNA Using
MicroRNA-Templated RT-PCR Reactions as Template and Elevated
Annealing Temperatures
[0376] The LNA-modified microRNA tagging probes EQ16624/EQ16620
(pair VII) for human miR-15a microRNA were annealed and extended as
a reverse transcription primer (RT tagging probe) and 2.sup.nd
strand tagging probe. The annealing temperature profile was changed
from 50.degree. C. to either 55.degree. C. or 60.degree. C. for
both the reverse transcription primer and 2.sup.nd strand tagging
probe. The RT-PCR reactions were performed as described above. The
miR-15a RT-PCR reactions were subsequently detected using real-time
quantitative PCR as described above, by using the anchor PCR
primers and an LNA-modified dual-labelled detection probes
(EQ16582) for the miR-15a microRNA using a minus template as a
negative control. The specificity of the microRNA RT-PCR reaction
was assessed using a reaction without addition of the OneStep
RT-PCR Enzyme mix. The Ct values using the miR-15a microRNA
template were 28.6, 29.3, and 31.0 for the 50, 55 and 60.degree. C.
annealing temperature, respectively (FIG. 19), whereas no Ct values
were detectable for the negative control experiments (minus
template and minus OneStep RT-PCR Enzyme mix).
Example 16
Improved Real-Time Quantitative PCR for the Human miR-15a MicroRNA
Using MicroRNA-Templated RT-PCR Reactions with LNA-Modified Tagging
Probes and LNA 2,6-Diaminopurine/LNA 2-Thiothymidine-Enhanced
Detection Probes
[0377] 1. MicroRNA Reverse Transcription and Second Strand Reaction
with LNA-Modified Tagging Probes.
[0378] The RT-PCR reaction was performed in 50 .mu.L consisting of
2 nM miR-15a RNA template (EQ15885, Table I), 60 nM of each
microRNA tagging probe, 1.times. OneStep RT-PCR buffer [contains
Tris-HCl, KCl, (NH.sub.4).sub.2SO.sub.4, 1.5 mM MgCl.sub.2, DTT, pH
8.7 (20.degree. C.)] (Qiagen, Germany), 400 .mu.M of each dNTP
(Qiagen, Germany), 20 U SUPERase-In (Ambion, USA), 0.05 .mu.g/.mu.L
Torulla yeast RNA (Ambion, USA), and 2 .mu.L Qiagen OneStep RT-PCR
Enzyme mix (Qiagen, Germany). The thermocycler DYAD.TM. (MJ
R.sup.e-- search DNA engine, USA) was heated to the reaction start
temperature. Temperature profile was 30 min 50.degree. C., 15 min
95.degree. C., 1 min 50.degree. C., 3 min 72.degree. C., and cooled
down to 4.degree. C., finally. The RT-PCR reaction was repeated
without template as negative control instead of the miR-15a RNA
target.
[0379] 2. MicroRNA Real-Time Quantitative PCR Assays Using
LNA-Modified Detection Probes.
[0380] The reaction (25 .mu.L) was 1.times.PCR buffer [contains
Tris-HCl, KCl, (NH.sub.4).sub.2SO.sub.4, pH 8.7 (20.degree. C.)]
(Qiagen, Germany), MgCl.sub.2 to a final concentration of 4 mM, 200
nM of each of dATP, dCTP, dGTP and 600 nM dUTP (Applied
Biosystems)"); 200 nM hsa-miR-15a forward primer 2 (EQ16444, Table
II), 200 nM hsa-miR-15a reverse primer 2 (EQ16445, Table II), 250
nM LNA detection probe (EQ15866, Table I), 0.1.times.ROX reference
dye (Invitrogen, USA), 5 .mu.L of the RT-PCR reaction (described
above) and 1.25 U HotStarTaq DNA polymerase (Qiagen, Germany).
Cycling procedure: 10 min 95.degree. C., 50 cycles of 20 sec
95.degree. C., 1 min 60.degree. C. in an Applied Biosystems 7500
Real Time PCR System (Applied Biosystems, USA).
[0381] The microRNA tagging probes EQ16623/EQ16618 (pair VIII) for
human miR-15a microRNA were annealed and extended as a reverse
transcription primer (RT tagging probe) and 2.sup.nd strand tagging
probe as described above. The miR-15 RT-PCR reactions were
subsequently detected using real-time PCR as described above, the
anchor PCR primers and LNA-modified dual-labelled detection probes
(EQ16852 and EQ16679, Table II) for the miR-15a microRNA using a
scramble control miR-16 microRNA (EQ15886, Table I) and a minus
template as a negative controls. The Ct values using the miR-15a
microRNA template were 25.6 and 30.1 for LNA-modified dual-labelled
detection probes EQ16582 and EQ16679, respectively (FIG. 19), The
Ct values for the scrambled miR-16 microRNA control were 33.3 and
undetectable for LNA-modified dual-labelled detection probes
EQ16582 and EQ16679, respectively, whereas no Ct values were
detectable for the negative control experiments (minus template and
minus OneStep RT-PCR Enzyme mix). By substituting the LNA A and LNA
T nucleotides with the LNA 2,6-diaminopurine and LNA
2-thiothymidine monomers significantly enhanced discrimination
between the perfectly matched and the scrambled microRNA templates
detected in the microRNA assay (FIG. 20).
TABLE-US-00004 TABLE III The design of blocked microRNA tagging
probe used in Example 17 Oligo id (EQ No) Oligonucleotide name
3'-end Sequence (5'-3').sup.a 16695 hsa-miR-15a RT 4.3 LNA P
gaaacagctatgacatgmCacAaamCc (SEQ ID NO: 29) .sup.aLNA (uppercase),
DNA (lowercase), 5-methyl C (mC); and Phosphate (P).
Example 17
Real-Time Quantitative PCR for the Human miR-15a MicroRNA Using
MicroRNA-templated RT-PCR Reactions with a 3'-Blocked LNA-Modified
Tagging Probe and a LNA Modified Detection Probe
[0382] 1. MicroRNA 1. Strand Transcription Reaction with a Blocked
LNA-Modified Tagging Probe.
[0383] The reverse transcription (RT) reaction was performed in 20
.mu.L consisting of 25 nM miR-15a RNA template (EQ15885, Table I),
50 nM microRNA blocked tagging probe (EQ16695), 200 nM hsa-miR-15a
reverse primer 2 (EQ16445, Table 1), 1.times. First strand buffer
(50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl.sub.2, pH 8.3 20.degree. C.)
(Invitrogen, USA), 5 mM DTT (Invitrogen, USA), 500 .mu.M of each of
dNTP (Applied Biosystems, USA), 10 U SUPERase-In (Ambion, USA),
0.05 .mu.g/.mu.L Torulla yeast RNA, and 1 U Superscript III reverse
transcriptase (Invitrogen, USA). The mir-15a template, the microRNA
blocked tagging probe and the reverse primer were mix and heated 10
min at 70.degree. C. and quenched on ice. The thermocycler DYAD.TM.
(MJ Research DNA engine, USA) was heated to the reaction start
temperature. Temperature profile was 60 min 55.degree. C., 15 min
70.degree. C. and cooled down to 4.degree. C., finally. The first
strand synthesis was repeated without template or Superscript III
as negative control instead of the miR-15a RNA target. The first
strand reaction was also repeated using miR-16 RNA (EQ15886) as
target instead of the miR-15a RNA target.
[0384] 2. MicroRNA Second Strand Time Release PCR Amplification
with an LNA-Modified Tagging Probe.
[0385] The reaction (50 .mu.L) was 1.times. AmpliTaq Gold buffer
(Applied Biosystems, USA) 1.5 mM MgCl.sub.2, 200 nM second strand
LNA tagging probe (EQ16624, Table II, 20 .mu.L of the RT reaction
(described above) and 1.25 U AmpliTaq Gold.RTM. DNA Polymerase
(Applied Biosystems, USA). Cycling procedure: 10 cycles of 1 min
95.degree. C. and 1 min 55.degree. C. in a DYAD.TM. thermocycler
(MJ Research DNA engine, USA).
[0386] 3. MicroRNA Real-Time Quantitative PCR Assays Using an
LNA-Modified Detection Probe.
[0387] The reaction (25 .mu.L) was 1.times.PCR buffer [contains
Tris-HCl, KCl, (NH4)2SO4, pH 8.7 (20.degree. C.)] (Qiagen,
Germany), MgCl.sub.2 to a final concentration of 4 mM, 200 nM of
each of dATP, dCTP, dGTP and 600 nM dUTP (Applied Biosystems, USA);
200 nM hsa-miR-15a forward primer 2 (EQ16444, Table II), The
hsa-miR-15a reverse primer 2 (EQ16445, Table II) to a final
concentration of 200 nM, 250 nM LNA detection probe (EQ15866, Table
I), 0.1.times.ROX reference dye (Invitrogen, USA), 5 .mu.L of the
1.sup.st and 2.sup.nd strand reaction (described above) and 1.25 U
HotStarTaq DNA polymerase (Qiagen, Germany). Cycling procedure: 10
min 95.degree. C., 45 cycles of 20 sec 95.degree. C., 1 min
60.degree. C. in an Applied Biosystems 7500 Real Time PCR System
(Applied Biosystems, USA).
[0388] The LNA-modified microRNA tagging probe EQ16695 (RT tagging
probe) for human miR-15a microRNA and the hsa-miR-15a reverse
primer were annealed and extended as a reverse transcription
primers. The first strand reaction was followed by the 2.sup.nd
strand tagging probe was annealed and extended as described above.
The miR-15 RT and PCR reactions were subsequently detected using
real-time PCR as described above, the anchor PCR primers and
LNA-modified dual-labelled detection probes (EQ16582, Table II) for
the miR-15a microRNA using a minus template as a negative control.
The Ct values using the miR-15a microRNA template were 37.1 for
LNA-modified dual-labelled detection probes EQ16582, (FIG. 21),
whereas no Ct values were detectable for the miR-16 microRNA
template and the negative control experiments (minus template and
minus Superscript III).
Example 18
Real-Time Quantitative PCR for the Mature Human miR-15a MicroRNA
Using miRNA-Templated RT-PCR with a 3'-Blocked LNA-Modified Tagging
Probe and an LNA Modified Detection Probe
[0389] 1. MicroRNA Primer Extension with a Blocked LNA-Modified
miRNA Tagging Probe Using an Enzyme Capable of RNA-Primed
DNA-Directed DNA-Synthesis.
[0390] The miRNA primer extension reaction was performed in 20
.mu.L. First 500 nmol miR-15a RNA template (EQ15885, Table I), 1
.mu.g Torulla yeast RNA (Ambion, USA) and 25 nM microRNA blocked
tagging probe (EQ16695, Table II) were mixed, heated 10 min at
70.degree. C. and quenched on ice. 1.times. EcoPol buffer (NEB,
USA), 500 .mu.M of each dNTP (Applied Biosystems, USA), 10 U
SUPERase-In (Ambion, USA) 5 U Klenow Fragment (3'.fwdarw.5' exo-)
enzyme (NEB, USA) and DEPC-treated H.sub.2O to total volume of 20
.mu.L were added. The thermocycler DYAD.TM. (MJ Research DNA
engine, USA) was heated to 37.degree. C. and cycled using the
following profile; 30 min 37.degree. C., 20 min 75.degree. C.
followed by cooling down to 4.degree. C.
[0391] 2. Amplification of Mature miRNA by RT-PCR Using an
LNA-Modified Tagging Probe and an Enzyme Capable of DNA-Primed
RNA/DNA-Directed DNA Synthesis.
[0392] The primer extension reaction from step nr 1 was diluted to
50 .mu.L reaction mixture containing the following; 60 nM second
strand LNA tagging probe (EQ16624, Table II), 200 nM hsa-miR-15a
reverse primer 2 (EQ16445, Table I), 400 .mu.M of each of dNTP,
1.times. Qiagen OneStep RT-PCR buffer (Qiagen, USA), 2 .mu.L Qiagen
OneStep RT-PCR Enzyme mix (contains Omniscript.TM. Reverse
Transcriptase, SensiScript.TM. Reverse Transcriptase and
HotStarTaq.RTM. DNA polymerase; the dNTPs, buffer and enzymes were
purchased from Qiagen, USA) and DEPC-treated H.sub.2O up to a final
volume of 50 .mu.L. The thermocycler DYAD.TM. (MJ Research DNA
engine, USA) was heated to 50.degree. C. And cycled using the
following temperature profile; 30 min 50.degree. C., 15 min
95.degree. C. and 10 cycles of 1 min 95.degree. C., 1 min
55.degree. C., 2 min 72.degree. C., followed by cooling down to
4.degree. C.
[0393] The reaction was also repeated using miR-16 RNA (EQ15886,
Table I) as target instead of the miR-15a RNA target. As negative
controls either the microRNA blocked tagging probe, second strand
LNA tagging probe, hsa-miR-15a reverse primer 2, Klenow Fragment
(3'.fwdarw.5' exo-) enzyme or Qiagen OneStep RT-PCR Enzyme were
omitted in the respective reaction mixtures.
[0394] 3. miRNA Real-Time Quantitative PCR Using an LNA-Modified
Detection Probe.
[0395] The real-time PCR reaction mixture (25 .mu.L) contained
1.times.PCR buffer [contains Tris-HCl, KCl, (NH4).sub.2SO.sub.4, pH
8.7 (20.degree. C.)] (Qiagen, Germany), MgCl.sub.2 to a final
concentration of 4 mM, 200 nM of each of dATP, dCTP, dGTP and 600
nM dUTP (Applied Biosystems, USA); 200 nM hsa-miR-15a forward
primer 2 (EQ16444, Table II), the hsa-miR-15a reverse primer 2
(EQ16445, Table II) to a final concentration of 300 nM, 250 nM LNA
detection probe (EQ15866, Table I), 0.1.times.ROX reference dye
(Invitrogen, USA), 5 .mu.L of the 1.sup.st and 2.sup.nd strand
reaction (described above) and 1.25 U HotStarTaq DNA polymerase
(Qiagen, Germany). Cycling procedure: 10 min 95.degree. C., 40
cycles of 20 sec 95.degree. C., 1 min 60.degree. C. in an Applied
Biosystems 7500 Real-Time PCR System (Applied Biosystems, USA).
[0396] The LNA-modified microRNA tagging probe EQ16695 (1.sup.st
strand tagging probe) for human miR-15a which is blocked at its 3'
end was used to tag the mature miR-15a and extended by using the
miR-15 as primer employing a RNA-primed DNA-directed DNA
polymerase. The reverse transcription reaction was performed by
annealing an RT-primer and extended by a RNA/DNA-directed DNA
polymerase reaction. Finally the 2.sup.nd strand tagging probe was
annealed and extended by a DNA-directed DNA polymerase reaction.
The tagged human miRNA template generated by miR-15a primer
extension reaction, reverse transcription and PCR respectively, was
subsequently detected using real-time PCR as described above, the
anchor PCR primers and LNA-modified dual-labelled detection probe
(EQ16582, Table II) for the miR-15a microRNA using a no template as
a negative control. The Ct value using the miR-15a microRNA
template was 14.9 for LNA-modified dual-labelled detection probes
EQ16582, (FIG. 23), whereas the Ct values for the miR-16 microRNA
template was 23.4 while the Ct values for the negative control
experiments were 32.3, 27.7, and 29.9 for the no microRNA blocked
tagging probe, no second strand LNA tagging probe, and no Klenow
Fragment (3'.fwdarw.5' exo-) enzyme reactions, respectively. No
detectable Ct values were obtained for the negative control
experiments (no hsa-miR-15a reverse primer 2 or no Qiagen OneStep
RT-PCR Enzyme mix.)
Example 19
Real-Time Quantitative PCR Standard Curve Generated for the Mature
Human miR-15a MicroRNA Using miRNA-Templated RT-PCR with a
3'-Blocked LNA-Modified Tagging Probe
[0397] The LNA-modified human miR-15a microRNA tagging probe pair
EQ1695/EQ16624 (pair IX in Example 18) was used in
miR-15a-templated RT-PCR with a 3'-blocked LNA-modified tagging
probe as described above (Example 18), where the human miR-15a
template concentration was 500, 50, 5, 0.5, or 0.05 fmol
respectively. The miRNA-15a template was subsequently detected
using real-time quantitative PCR as described above, by the anchor
PCR primers and the LNA-modified dual-labelled detection probe
(EQ15866, Table I) for the miR-15a microRNA using a minus template
as a negative control. The Ct values were 18.4, 21.1, 24.7, 28.5,
and 32.0, respectively, for 500, 50, 5, 0.5, and 0.05 fmol of the
miR-15a microRNA template, respectively, whereas the Ct value was
36.8 for the negative control experiment without template. The Ct
value is inversely proportional to the logarithm of the initial
template copy number. Therefore, a standard curve was generated by
plotting the Ct values against the logarithm of the copy number as
depicted in FIG. 24. By linear regression analysis the slope and
the intercept were determined. The slope of the titration curve was
-3.45 and the intercept 27.4.
TABLE-US-00005 TABLE IV The design of the microRNA 3'-blocked
tagging probes. 5'- 3'- EQ No. Name end Sequences end 16858
P-hsa-miR-15a rt gaaacagctatgacatgmCacAaamC P 5.1 LNA (SEQ ID NO:
30) 16859 P-hsa-miR-15a rt gaaacagctatgacatgmCacAaAmC P 5.2 LNA
(SEQ ID NO: 31) 16860 P-hsa-miR-15a rt gaaacagctatgacatgmCacAAamC P
5.3 LNA (SEQ ID NO: 32) 16861 P-hsa-miR-15a rt
gaaacagctatgacatgmCacAAAmC P 5.4 LNA (SEQ ID NO: 33) 16862
hsa-miR-15a rt 5.5 gaaacagctatgacatgmCacAaamCc LNA (SEQ ID NO: 34)
16863 hsa-miR-15a rt 5.6 gaaacagctatgacatgmCacAaamC LNA (SEQ ID NO:
35) 16864 hsa-miR-15a rt 5.7 gaaacagctatgacatgmCacAaAmC LNA (SEQ ID
NO: 36) 16865 hsa-miR-15a rt 5.8 gaaacagctatgacatgmCacAAamC LNA
(SEQ ID NO: 37) 16866 hsa-miR-15a rt 5.9 gaaacagctatgacatgmCacAAAmC
LNA (SEQ ID NO: 38) 16867 hsa-miR-15a rt gaaacagctatgacatgmCACAAAmC
5.10 LNA (SEQ ID NO: 39) 16868 hsa-miR-15a rt
gaaacagctatgacatgmCAmCAAA 5.11 LNA (SEQ ID NO: 40) 16869
hsa-miR-15a rt gaaacagctatgacatgmCAmCAA 5.12 LNA (SEQ ID NO: 41)
16882 hsa-miR-15a rt 6.1 gaaacagctatgacatgmCAmCAAAmCmCATT LNA (SEQ
ID NO: 42) 16883 hsa-miR-15a rt 6.2 gaaacagctatgacatgmCAmCAAAmCmCAT
LNA (SEQ ID NO: 43) 16884 hsa-miR-15a rt 6.3
gaaacagctatgacatgmCAmCAAAmCmCA LNA (SEQ ID NO: 44) 16885
hsa-miR-15a rt 6.4 gaaacagctatgacatgmCAmCAAAmCmC LNA (SEQ ID NO:
45) .sup.aLNA (upper cases), DNA (lower cases), 5-methyl C (mC),
and Phosphate (P).
TABLE-US-00006 TABLE V The design of U6 snRNA detection probe and
real-time PCR primers used in Example 20. Oligo id Oligonucleotide
name 5'- Sequence (5'-3').sup.a 3'- (EQ No) end end 17159 U6 snRNA
RT primer tatggaacgcttcacgaatttgcg (SEQ ID NO: 46) 17160 U6 snRNA
forward primer cgcttcggcagcacatatac (SEQ ID NO: 47) 17167 U6 snRNA
detection probe 6-Fitc CAGGgGcmC#Q1z P .sup.aLNA (uppercase), DNA
(lowercase), 5-methyl C (mC); Fluorescein (6-FITC (Glenn Research,
Prod. Id. No. 10-1964)), #Q1 (Prepared as described in Example 8a),
z (5-nitroindole (Glenn Research, Prod. Id. No. 10-1044)),
Phosphate (P).
Example 20
Real-Time PCR for the Homo sapiens U6 snRNA
[0398] 1. U6 snRNA Reverse Transcription
[0399] The reverse transcription (RT) reaction was performed in 20
.mu.L containing 1 .mu.g Quantitative PCR Human Reference Total RNA
template (Stratagene, USA), 5 .mu.g pd(N).sub.6 random hexamer
(Amersham Biosciences, Sweden), 1.times. First strand buffer (50 mM
Tris-HCl, 75 mM KCl, 3 mM MgCl.sub.2, pH 8.3 at 20.degree. C.)
(Invitrogen, USA), 10 mM DTT (Invitrogen, USA), 1 mM of each of
dNTP (Applied Biosystems, USA), 10 U SUPERase-In (Ambion, USA), and
200 U Superscript II reverse transcriptase (Invitrogen, USA). The
Reference Total RNA template and the random hexamer were mixed and
heated 5 min at 70.degree. C. and quenched on ice. The temperature
profile on the thermocycler DYAD.TM. (MJ Research DNA engine, USA)
was 30 min at 37.degree. C., 90 min at 42.degree. C. and then on
hold at 4.degree. C. The first strand synthesis was purified on a
Microcon YM-30 Centrifugal Filter Unit (Millipore, USA) according
to the manufacture's instructions. The sample recovered after
centrifugation was diluted to five times the original RT starting
volume (100 .mu.L in total).
[0400] 2. U6 snRNA Real-Time PCR Assay Using a LNA-Modified
Detection Probe.
[0401] The reaction (50 .mu.L) was 1.times.PCR buffer [Tris-HCl,
KCl, (NH.sub.4).sub.2SO.sub.4, pH 8.7 at 20.degree. C.] (Qiagen,
Germany), MgCl.sub.2 to a final concentration of 4 mM, 200 nM of
each of dATP, dCTP, dGTP and 600 nM dUTP (Applied Biosystems, USA);
900 nM U6 snRNA forward primer (EQ17160, Table V), 900 nM U6 snRNA
RT primer (EQ17159, Table V), 250 nM LNA detection probe (EQ17167,
Table V), 0.1.times.ROX reference dye (Invitrogen, USA), 1 or 5
.mu.L of the first strand synthesis (RT) reaction (described above)
and 2.5 U HotStarTaq DNA polymerase (Qiagen, Germany). Cycling
procedure: 10 min at 95.degree. C., 40 cycles of 15 sec. at
95.degree. C., 1 min at 60.degree. C. in an Applied Biosystems 7500
Real Time PCR System (Applied Biosystems, USA).
[0402] The U6 snRNA (acc. no. X59362, GenBank) RT reactions were
subsequently detected using real-time PCR as described above, PCR
primers and LNA-modified dual-labelled detection probe for the
human U6 snRNA using a minus template as a negative control. The Ct
values using 1 or 5 .mu.L U6 snRNA cDNA template were 28.0 and 25.6
for the LNA-modified dual-labelled detection probe (EQ17167, Table
V), respectively (FIG. 25), whereas no Ct value was obtained for
the negative control experiment (no template).
Example 21
Real-Time RT-PCR for the Human miR-15a Using; MicroRNA-Primed
Extension Reaction on a 3'-Blocked and 5'-Biotin-Labelled
LNA-Modified Capture Probe, Immobilization of Extension Product in
a Streptavidin Tube, Reverse Transcriptase Reaction in Solution,
and Real-Time PCR Using a LNA-Modified Detection Probe
[0403] 1. The MicroRNA-Primed Extension Reaction on a 3'-Blocked,
5'-Biotin Labelled LNA-Modified Capture Probe
[0404] Hsa miR-15a RNA (1 fmol; EQ15885, Table I) was mixed with 1
.mu.g Torulla yeast RNA (Ambion, USA) and 100 fmol miR-15a capture
probe (EQ16879, Table VI) in a total volume of 6 .mu.L, heated for
5 min at 65.degree. C. and quenched on ice, 1 .mu.L
10.times.NE-Buffer 2 (New England Biolabs, USA), 1 .mu.L dNTP mix
(1 mM of each dNTP; Applied Biosystems, USA), 20 U SUPERase-In
(Ambion, USA) and 5 U Klenow exo- (New England Biolabs, USA) were
added. Incubations were continued for 30 min at 37.degree. C.
[0405] 2. The Immobilization in a Streptavidin Tube
[0406] One volume of 2.times. binding buffer (200 mM Tris-HCl pH
7.5 at 20.degree. C., 800 mM LiCl, 40 mM EDTA) was added to the
Klenow exo-reaction and the supernatant was transferred to a
streptavidin coated PCR tube (Roche, Germany). Incubation for 3 min
at 37.degree. C. allowed the biotin-streptavidin binding to be
formed. Unbound material was removed by washing three times in five
volumes of washing buffer (10 mM Tris-HCl pH 7.5 at 20.degree. C.,
20 mM LiCl.sub.3) at room temperature. "Proceed immediately with
the RT reaction".
[0407] 3. The RT Reaction in Solution
[0408] The RT-primer (100 fmol, EQ16994, Table VI) and 10 nmoles of
each of dNTP (Applied Biosystems, USA) were mixed in 12 .mu.L total
volume and added to the streptavidin PCR tube containing the
immobilized capture probe and the chimerical RNA-DNA strand. The
tube was heated 5 min at 70.degree. C. and the supernatant was
removed to a new tube on ice. 5.times. First strand buffer a (50 mM
Tris-HCl pH 8.3 at 20.degree. C., 75 mM KCl, 3 mM MgCl.sub.2;
Invitrogen, USA), 10.times.DTT (1.times.=10 mM, Invitrogen, USA),
20 U SUPERase-In (Ambion, USA), and 200 U Superscript II reverse
transcriptase (Invitrogen, USA) were added (in a volume of 8 .mu.L)
and the incubation was continued for 1 h at 42.degree. C. Heating
for 15 min at 70.degree. C. terminated the reaction.
[0409] 4. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0410] The reaction (50 .mu.L) was 1.times.PCR buffer (Qiagen,
Germany), MgCl.sub.2 to a final concentration of 4 mM, 0.2 mM of
each of dATP, dCTP, dGTP and 0.6 mM dUTP (Applied Biosystems, USA),
900 nM miR-15a forward primer (EQ16990, Table VI), 900 nM miR
reverse primer (EQ16989, Table VI), 250 nM miR-15a LNA detection
probe (EQ16992, Table VI), 0.1.times.ROX reference dye (Invitrogen,
USA), 1 .mu.L of the first strand synthesis (RT) reaction
(described above), 0.5 U Uracil DNA Glycosylase (Invitrogen, USA)
and 2.5 U HotStarTaq DNA polymerase (Qiagen, Germany). The
temperature cycling program was; 10 min at 37.degree. C., 10 min at
95.degree. C., 1 min at 45.degree. C., 1 min at 60.degree. C.,
followed by 40 cycles of 20 s at 95.degree. C. and 1 min at
60.degree. C. The real-time RT-PCR analysis was run on an ABI 7500
Real Time PCR System (Applied Biosystems, USA).
[0411] The result for the described reaction was a Ct value of
33.1. A reaction without Torulla yeast RNA gave a Ct of 33.3
whereas a reaction without SUPERase-In in step 1 gave a Ct of 32.1.
Negative control experiments without hsa miR-15a RNA (EQ15885,
Table I), or without miR-15a capture probe (EQ16879, Table VI), or
without Klenow exo-all gave no Ct values. Also a no template
control (NTC) qPCR gave no Ct value. End-point analysis by running
samples of the real-time RT-PCR reaction on an agarose gel
confirmed the results, i.e., no Ct values correspond to the absence
of the PCR amplicon on the gel.
TABLE-US-00007 TABLE VI Oligonucleotides used in Example 21 to 23
EQ No: Oligo Name: 5' Linker: Sequence (5'-3').sup.a 3' 16879 Hsa
miR-15a capture probe Bio HEG2 tactgagtaatcgatatcmCacAaamCca P (SEQ
ID NO: 48) 16989 miR rev PCR primer Caatttcacacaggatactgagt (SEQ ID
NO: 49) 16990 Hsa miR-15a PCR primer Agcggataactagcagcacata (SEQ ID
NO: 50) 16992 miR-15a qPCR probe 6-Fitc TTGTGGATAT#Q1z P (SEQ ID
NO: 51) 16994 miR RT primer caatttcacacaggatactgagtaatcg (SEQ ID
NO: 52) .sup.aLNA (uppercase), DNA (lowercase), Fluorescein (6-FITC
(Glenn Research, Prod. Id. No. 10-1964)), biotin (Bio (Glenn
Research)), two moieties of hexaethylene-glycol (HEG2 (Glenn
Research)), #Q1 (Prepared as described in Example 8a), z
(5-nitroindole (Glenn Research, Prod. Id. No. 10-1044)), Phosphate
(P).
Example 22
Real-Time RT-PCR for a Dilution Series of the Human miR-15a Using;
MicroRNA-Primed Extension Reaction on a 3'-Blocked and
5'-Biotin-Labelled LNA-Modified Capture Probe, Immobilization of
Extension Product in a Streptavidin Tube, Reverse Transcriptase
(RT) Reaction in Solution, and Real-Time PCR Using a LNA-Modified
Detection Probe
[0412] 1. The MicroRNA-Primed Extension Reaction on a 3'-Blocked,
5'-Biotin-Labelled LNA-Modified Capture Probe
[0413] Hsa miR-15a RNA (100 fmol, 10 fmol, 1 fmol, 100 amol, or 10
amol; EQ15885, Table I) was mixed with 1 .mu.g Torulla yeast RNA
(Ambion, USA) and 100 fmol miR-15a capture probe (EQ16879, Table
VI) in a total volume of 7 .mu.L, heated for 5 min at 65.degree. C.
and cooled on ice. 1 .mu.L 10.times.NE-Buffer 2 (New England
Biolabs, USA), 1 .mu.L dNTP mix (1 mM of each dNTP; Applied
Biosystems, USA), and 5 U Klenow exo- (New England Biolabs, USA)
were added. The incubation was continued for 30 min at 37.degree.
C.
[0414] 2. The Immobilization in a Streptavidin Tube
[0415] One volume of 2.times. binding buffer (200 mM Tris-HCl pH
7.5 at 20.degree. C., 800 mM LiCl, 40 mM EDTA) was added to the
Klenow exo-reaction and the supernatant was transferred to a
streptavidin coated PCR tube (Roche, Germany). Incubation for 3 min
at 37.degree. C. allowed the biotin-streptavidin binding to be
formed. Unbound material was removed by washing three times in five
volumes of washing buffer (10 mM Tris-HCl pH 7.5 at 20.degree. C.,
20 mM LiCl.sub.3) at room temperature.
[0416] 3. The RT Reaction in Solution
[0417] The RT-primer (100 fmol, EQ16994, Table VI) and 10 nmol of
each of dNTP (Applied Biosystems, USA) were mixed in 12 .mu.L total
volume and added to the streptavidin PCR tube containing the
immobilized capture probe and the chimerical RNA-DNA strand. The
tube was heated 5 min at 70.degree. C. and the supernatant was
transferred to a new tube on ice. 5.times. First strand buffer a
(50 mM Tris-HCl pH 8.3 at 20.degree. C., 75 mM KCl, 3 mM
MgCl.sub.2; Invitrogen, USA), 10.times.DTT (1.times.=10 mM,
Invitrogen, USA), 20 U SUPERase-In (Ambion, USA), and 200 U
Superscript II reverse transcriptase (Invitrogen, USA) was added
(in a volume of 8 .mu.L) and the incubation was continued for 1 h
at 42.degree. C. Heating for 15 min at 70.degree. C. terminated the
reaction.
[0418] 4. The Real-Time PCR Using an LNA-Modified Detection
Probe
[0419] The reaction (50 .mu.L) was 1.times.PCR buffer (Qiagen,
Germany), MgCl.sub.2 to a final concentration of 4 mM, 0.2 mM of
each of dATP, dCTP, dGTP and 0.6 mM dUTP (Applied Biosystems, USA),
900 nM miR-15a forward primer (EQ16990, Table VI), 900 nM miR
reverse primer (EQ16989, Table VI), 250 nM miR-15a LNA detection
probe (EQ16992, Table VI), 0.1.times.ROX reference dye (Invitrogen,
USA), 1 .mu.L of the first strand synthesis (RT) reaction
(described above), 0.5 U Uracil DNA Glycosylase (Invitrogen, USA)
and 2.5 U HotStarTaq DNA polymerase (Qiagen, Germany). The
temperature cycling program was 10 min at 37.degree. C., 10 min at
95.degree. C., 1 min at 45.degree. C., 1 min at 60.degree. C.,
followed by 40 cycles of 20 s at 95.degree. C. and 1 min at
60.degree. C. The real-time RT-PCR analysis was run on an ABI 7500
Real Time PCR System (Applied Biosystems, USA).
[0420] The result for the described reaction was Ct values of 24.0,
27.6, 31.1, 34.8, and 37.0 for 100 fmol, 10 fmol, 1 fmol, 100 amol,
and 10 amol hsa miR-15a RNA (EQ15885, Table I) input, respectively.
A negative control experiment without hsa miR-15a RNA (EQ15885,
Table I) gave no Ct value. Also a no template control (NTC) qPCR
gave no Ct value. The input of 10 amol hsa miR-15a RNA (EQ15885,
Table I) corresponded to a concentration of 10 fM or less in the 50
.mu.L real-time RT-PCR mixture. End-point analysis by running
samples of the real-time RT-PCR reaction on an agarose gel
confirmed the results, i.e., no Ct values correspond to absence of
PCR amplicons on the gel.
Example 23
Real-Time RT-PCR for the Human miR-15a Using MicroRNA-Primed
Extension Reaction on a 3'-Blocked and 5'-Biotin-Labelled
LNA-Modified Capture Probe, Immobilization of Extension Product on
Streptavidin Beads, Reverse Transcriptase (RT) Reaction in
Solution, and Real-Time PCR Using an LNA-Modified Detection
Probe
[0421] 1. The MicroRNA-Primed Extension Reactions on a 3'-Blocked,
5'-Biotin-Labelled LNA-Modified Capture Probe
[0422] Hsa miR-15a RNA (1 fmol; EQ15885, Table I) was mixed with 1
.mu.g Torulla yeast RNA (Ambion, USA) and 100 fmol miR-15a capture
probe (EQ16879, Table VI) in a total volume of 7 .mu.L, heated for
5 min at 65.degree. C. and cooled on ice. 1 .mu.L
10.times.NE-Buffer 2 (New England Biolabs, USA), 1 .mu.L dNTP mix
(1 mM of each; Applied Biosystems, USA), and 5 U Klenow exo- (New
England Biolabs, USA) were added. The incubation was continued for
30 min at 37.degree. C.
[0423] 2. The Immobilization onto Streptavidin Beads
[0424] One volume (10 .mu.L) of 2.times. binding buffer (10 mM
Tris-HCl pH 7.5 at 20.degree. C., 2 M NaCl, 1 mM EDTA) containing
10 .mu.g Dynabeads M-270 Streptavidin; (Dynal Biotech, Norway) was
added to the Klenow exo-reaction and incubated for 10 min at
20.degree. C. with rotation to allow the biotin-streptavidin
binding to be formed. The tube was placed in the magnetic particle
concentrator (Dynal MPC-9600; Dynal Biotech, Norway). The
supernatant was removed and the beads were washed three times in
100 .mu.L wash buffer (10 mM Tris-HCl pH 7.5 at 20.degree. C., 20
mM NaCl). "Proceed immediately with the RT reaction".
[0425] 3. The RT Reaction in Solution
[0426] The RT-primer (100 fmol, EQ16994, Table VI) and 10 nmol of
each of dNTP (Applied Biosystems, USA) were mixed in 12 .mu.L total
volume and added to the tubes containing the immobilized capture
probe and the chimerical RNA-DNA strand. The tube was heated 5 min
at 70.degree. C.; transferred to the magnetic particle concentrator
and the supernatant was transferred to a new tube on ice. 5.times.
First strand buffer a (50 mM Tris-HCl pH 8.3 at 20.degree. C., 75
mM KCl, 3 mM MgCl.sub.2; Invitrogen, USA), 10.times.DTT
(1.times.=10 mM, Invitrogen, USA), 20 U SUPERase-In (Ambion, USA),
and 200 U Superscript II reverse transcriptase (Invitrogen, USA)
were added (in a volume of 8 .mu.L) and the incubation was
continued for 1 h at 42.degree. C. Heating for 15 min at 70.degree.
C. terminated the reaction.
[0427] 4. Real-Time PCR Using a LNA-Modified Detection Probe
[0428] The reaction (50 .mu.L) was 1.times.PCR buffer (Qiagen,
Germany), MgCl.sub.2 to a final concentration of 4 mM, 0.2 mM of
each of dATP, dCTP, dGTP and 0.6 mM dUTP (Applied Biosystems, USA),
900 nM miR-15a forward primer (EQ16990, Table VI), 900 nM miR
reverse primer (EQ16989, Table VI), 250 nM miR-15a LNA detection
probe (EQ16992, Table VI), 0.1.times.ROX reference dye (Invitrogen,
USA), 5 .mu.L of the first strand synthesis (RT) reaction
(described above), 0.5 U Uracil DNA Glycosylase (Invitrogen, USA)
and 2.5 U HotStarTaq DNA polymerase (Qiagen, Germany). The
temperature cycling program was; 10 min at 37.degree. C., 10 min at
95.degree. C., 1 min at 45.degree. C., 1 min at 60.degree. C.,
followed by 40 cycles of 20 s at 95.degree. C. and 1 min at
60.degree. C. The real-time RT-PCR analysis was run on an ABI 7500
Real Time PCR System (Applied Biosystems, USA).
[0429] The result for the described reaction was a Ct value of
28.0. A no template control (NTC) qPCR gave no Ct value.
Example 24
Real-Time Quantitative PCR for the Human miR-7a Using Reverse
Transcription on Solid Support Primed by a LNA-Modified Capture
Probe Containing a 5'-Biotin Followed by Real-Time PCR Using a
LNA-Modified Detection Probe
[0430] 1. The MicroRNA-Primed Extension Reaction on a 5'-Biotin
Labelled LNA-Modified Capture Probe
[0431] In a total volume of 10 .mu.L the following was mixed: Hsa
miR-7a RNA (10 fmol; EQ16898, Table VII), 1 .mu.g Torulla yeast RNA
(Ambion, USA) and 100 fmol miR-7a capture probe (EQ 17367, Table
VII), 1 .mu.L 10.times.NE-Buffer 2 (New England Biolabs, USA), 1
.mu.L dNTP mix (1 mM of each dNTP; Applied Biosystems, USA), and 5
U Klenow exo- (New England Biolabs, USA). The mixture was incubated
for 30 min at 37.degree. C.
[0432] 2. The Immobilization in a Streptavidin Tube
[0433] 2.5 .mu.L 5.times. binding buffer (500 mM Tris-HCl pH 7.5 at
20.degree. C., 2 M LiCl, 100 mM EDTA) was added to the Klenow
exo-reaction and the supernatant was transferred to a streptavidin
coated PCR tube (Roche, Germany). Incubation for 3 min at
37.degree. C. allowed the biotin-streptavidin binding to be formed.
Unbound material was removed by washing five times in 100 .mu.L of
washing buffer (10 mM Tris-HCl pH 7.5 at 20.degree. C., 20 mM
LiCl.sub.3) at room temperature.
[0434] 3. The RT Reaction
[0435] 20 .mu.L of the following RT reaction mixture was added to
the streptavidin coated PCR tube containing the immobilized capture
probe and the chimerical RNA-DNA strand: 1.times. First strand
buffer (50 mM Tris-HCl pH 8.3 at 20.degree. C., 75 mM KCl, 3 mM
MgCl.sub.2; Invitrogen, USA), 10 mM DTT (Invitrogen, USA), 1.25 mM
of each dNTP (Applied Biosystems, USA), 20 U SUPERase-In (Ambion,
USA), and 200 U Superscript II reverse transcriptase (Invitrogen,
USA) was incubated for 1 h at 42.degree. C.
[0436] 4. The Pre-PCR
[0437] The RT-mixture was removed and replaced with 20 .mu.L of the
PCR master mixture containing 1.times. Quantitect Probe PCR Master
Mix (Qiagen, USA) forward and reverse primer (EQ17372 &
EQ17374, Table VII) each at 0.4 .mu.M, 1 U Uracil-DNA Glycosylase
(UNG, Roche, Germany). The Pre-PCR was subjected to the flowing PCR
conditions: 95.degree. C. for 15 min, 30.degree. C. for 1 min,
40.degree. C. for 1 min, 60.degree. C. for 1 min, and 10 cycles of
94.degree. C. for 20 s and 60.degree. C. for 1 min. The reaction
was kept at 4.degree. C. until performance of real-time PCR.
Afterwards 80 .mu.L of DEPC-H.sub.2O was added to the pre-PCR
reaction before use in the real-time PCR.
[0438] 5. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0439] The 50 .mu.L real-time PCR mix contained 1.times. Quantitect
Probe PCR Master Mix (Qiagen) forward and reverse primer (EQ17372
& EQ17374, Table VII) each at 0.4 .mu.M, 0.2 .mu.M miR-7a LNA
detection probe (EQ17377, Table VII), 1 U UNG (Roche, Germany), and
5 .mu.L of the diluted first strand synthesis (RT)-pre-PCR reaction
(described above). The temperature cycling program was; 95.degree.
C. for 15 min, and 40 cycles of 94.degree. C. for 20 s &
60.degree. C. for 1 min. The real-time PCR was performed on an
Opticon real-time PCR instrument (MJ Research, USA).
[0440] Results.
[0441] The real-time PCR produced a sigmoid amplification plot with
ample amount of signal (FIG. 26) and a Ct value of 18.5. The
obtained Ct value is realistic for the amount of Hsa-miR-7a used in
the current experiment and indicates full functionality of the
assay.
TABLE-US-00008 TABLE VII Oligonucleotides used in Example 24 EQ No:
Oligo Name: 5' Sequence (5'-3').sup.a 3' 16898 hsa-let-7a
ugagguaguagguuguauaguu (SEQ ID NO: 53) 16899 hsa-let-7f
ugagguaguagauuguauaguu (SEQ ID NO: 54) 16917 hsa-let-7g
ugagguaguaguuuguacagu (SEQ ID NO: 55) 17367 cP5_hsa-let-7a capture
probe Bio gttgaggatggatggtaggatgagtaactAtAmCaA (SEQ ID NO: 56)
17372 hsa-let-7a_qPcR-F-primer3 agaatggatggatctgaggtagt (SEQ ID NO:
57) 17374 hsa-let-7a_qPcR-R-primer1 aggatggatggtaggatgagt (SEQ ID
NO: 58) 17375 hsa-let-7a qPcR-R-primer2 gttgaggatggatggtaggat (SEQ
ID NO: 59) 17377 hsa-let-7a_qPcR-Probe2 6-Fitc AcTATAmCAAmCmCT#Q1z
P (SEQ ID NO: 60) 18089 hsa-let-7a_qPcR-Probe2_Q2 6-Fitc
acTATAmCAAmCmCT#Q2z P (SEQ ID NO: 61) .sup.aLNA (uppercase), DNA
(lowercase), RNA (italic and lower cases), 5-methyl C (mC);
Fluorescein (6-FITC (Glenn Research, Prod. Id. No. 10-1964)),
biotin (Bio (Glenn Research)), #Q1 (Prepared as described in
Example 8a), #Q2 (Prepared as described in Example 8b), z
(5-nitroindole (Glenn Research, Prod. Id. No. 10-1044)), Phosphate
(P).
Example 25
Synthesis, Deprotection and Purification of Dual Labelled
Oligonucleotide Probes
[0442] The dual labelled oligonucleotide probes of Table I, II and
V to VII, i.e. EQ15866, EQ15867, EQ16580-16583, EQ16679, EQ17167,
EQ16879, EQ16992, EQ17367 and EQ17377 were prepared on an automated
DNA synthesizer (Expedite 8909 DNA synthesizer, PerSeptive
Biosystems, 0.2 mol scale) using the phosphoramidite approach
(Beaucage and Caruthers, Tetrahedron Lett. 22: 1859-1862, 1981)
with 2-cyanoethyl protected LNA and DNA phosphoramidites, (Sinha,
et al., Tetrahedron Lett. 24: 5843-5846, 1983).
[0443] The synthesis cycle was modified for LNA phosphoramidites
(250 s coupling time) compared to DNA phosphoramidites.
1H-tetrazole or 4,5-dicyanoimidazole (Proligo, Hamburg, Germany)
was used as activator in the coupling step.
[0444] The oligonucleotides were deprotected using 32% aqueous
ammonia (1 h at room temperature, then 2 hours at 60.degree. C.)
and purified by HPLC (Shimadzu-SpectraChrom series; Xterra.TM. RP18
column, 10 .mu.m 7.8.times.150 mm (Waters). Buffers: A: 0.05M
Triethylammonium acetate pH 7.4. B. 50% acetonitrile in water.
Eluent: 0-25 min: 10-80% B; 25-30 min: 80% B). The composition and
purity of the oligonucleotides were verified by MALDI-MS
(PerSeptive Biosystem, Voyager DE-PRO) analysis.
Example 26
Real-Time RT-PCR for the Human Hsa-Let-7a Using; MicroRNA-Primed
Extension Reaction on a 3'-Blocked and 5'-Biotin-Labelled
LNA-Modified Capture Probe, Immobilization of Extension Product in
a Streptavidin Tube, Reverse Transcriptase Reaction in Solution,
and Real-Time PCR Using a LNA-Modified Detection Probe with the
Quencher Q2
[0445] 1. The MicroRNA-Primed Extension Reaction on a 3'-Blocked,
5'-Biotin Labelled LNA-Modified Capture Probe.
[0446] Hsa Let-7a RNA (10 fmol; EQ16898, Table VII) was mixed with
1 .mu.g Torulla yeast RNA (Ambion, USA), 100 fmol cP5_hsa-let-7a
capture probe (EQ17367, Table VII), 1 .mu.L 10.times.NE-Buffer 2
(New England Biolabs, USA), 1 .mu.L dNTP mix (1 mM of each dNTP;
Applied Biosystems, USA), and 5 U Klenow exo- (New England Biolabs,
USA) in a total volume of 10 .mu.L. Incubation was performed for 30
min at 37.degree. C.
[0447] 2. The Immobilization in a Streptavidin Tube
[0448] A volume of 2.5 .mu.L 5.times. binding buffer (500 mM
Tris-HCl pH 7.5 at 20.degree. C., 2 M LiCl, 100 mM EDTA) was added
to the Klenow exo-reaction and the mixture was transferred to the
bottom of a streptavidin coated PCR tube (Roche, Germany).
Incubation was performed for 3 min at 37.degree. C. to allow the
biotin-streptavidin binding to occur. Unbound material was removed
by washing five times in 100 .mu.L of washing buffer (10 mM
Tris-HCl pH 7.5 at 20.degree. C., 20 mM LiCl.sub.3) at room
temperature. The washed tube was immediately subjected to the
reverse transcription reaction.
[0449] 3. The RT Reaction in Solution
[0450] The RT-primer (1 .mu.l 100 fmol/.mu.l, EQ17374, Table VII)
and 2.5 dNTP (10 mM of each dNTP, Applied Biosystems, USA) were
mixed in 12 .mu.L total volume and added to the streptavidin PCR
tube containing the immobilized capture probe and the chimerical
RNA-DNA strand. The tube was heated 5 min at 70.degree. C. and the
supernatant was removed to a new tube on ice. 4 .mu.l 5.times.
first strand buffer (250 mM Tris-HCl pH 8.3 at 20.degree. C., 375
mM KCl, 15 mM MgCl.sub.2; Invitrogen, USA), 2 .mu.l 100 mM DTT
(Invitrogen, USA), 1 .mu.l 20 U/.mu.l SUPERase-In (Ambion, USA),
and 1 .mu.l 200 U/.mu.l Superscript II reverse transcriptase
(Invitrogen, USA) were added and the incubation was continued for 1
h at 42.degree. C. Heating for 15 min at 70.degree. C. terminated
the reaction. The total volume was adjusted to 100 .mu.L by adding
80 .mu.L of DEPC H.sub.2O.
[0451] 4. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0452] The reaction (50 .mu.L) was 1.times. QuantiTect Probe PCR
Master Mix (Qiagen, Germany), 400 nM hsa-let-7a_qPcR-F-primer3
(EQ17372, Table VII), 400 nM hsa-let-7a qPcR-R-primer2 (EQ17375,
Table VII), 200 nM hsa-let-7a_qPcR-Probe2_Q2 detection probe
(EQ18089, Table VII), 5 .mu.L of the first strand synthesis (RT)
reaction (described above), and 0.5 U Uracil DNA Glycosylase
(Invitrogen, USA). The temperature cycling program was; 10 min at
37.degree. C., 15 min at 95.degree. C., 1 min at 30.degree. C., 1
min at 40.degree. C., 1 min at 60.degree. C., followed by 40 cycles
of 20 s at 94.degree. C. and 1 min at 60.degree. C. The real-time
RT-PCR analysis was performed on the Opticon real-time PCR
instrument (MJ Research, USA).
[0453] 5. Results.
[0454] The experiment was performed with a replica of 3, and the
average Ct value obtained was 19.0 with a CV of 0.01. Three
replicas of a reaction without addition of hsa Let-7a miRNA did not
produce signal and no Ct value was obtained.
Example 27
Preparation of Precursor Pre-miRNA Hsa Let-7a
[0455] 1. In Vitro Transcription
[0456] a. The T7 promoter/leader oligo (EQ18219, see Table VIII)
was mixed with the hsa-let-7a-1 precursor longmer DNA
oligonucleotide (EQ18213, see Table VIII) in a final concentration
of 20 .mu.M of each oligonucleotide.
[0457] b. The sample was heated 5 minutes at 95.degree. C. and the
solution was allowed to cool to room temperature on the bench.
[0458] c. 8 .mu.L of the above solution was used as template in an
ordinary 20-.mu.L MegaScript reaction (Ambion, USA) containing ATP,
GTP, CTP, UTP, Reaction buffer, and enzyme mix.
[0459] d. The reaction was incubated over night at 37.degree.
C.
[0460] e. 1 .mu.L DNase was added and the reaction was incubated 15
min at 37.degree. C.
[0461] f. The in vitro transcribed precursor pre-miRNA was purified
on RNeasy MinElute Cleanup spin columns using a modified protocol
for miRNA cleanup.
TABLE-US-00009 TABLE VIII Oligonucleotides used in Example 27 EQ
No: Oligo Name? 5' Sequence (5'-3') 3' 18213 hsadet7a-1 precursor
longmer aagacagtagattgtatagttatctcccagtgg
tgggtgtgaccctaaaactatacaacctactac ctcatctccctatagtgagtcgtattaaatt
(SEQ ID NO: 62) 18219 T7 promotor/leader sequence
aatttaatacgactcactatagggaga (SEQ ID NO: 63)
[0462] 2: Modified Protocol for Precursor miRNA Cleanup
[0463] 1. Add 350 .mu.l Buffer RLT to the sample, and mix
thoroughly by vortexing.
[0464] 2. Add 1 volume of 80% ethanol (350 .mu.l), and mix
thoroughly by vortexing. Do not centrifuge. Proceed immediately to
step 3.
[0465] 3. Pipet the sample, including any precipitate that may have
formed, into an RNeasy Mini spin column placed in a 2 ml collection
tube. Close the lid gently, and centrifuge for 15 s at
8000.times.g.
[0466] 4. Discard the RNeasy Mini spin column.
[0467] 5. Pipet the flow-through from step 3 (which contains miRNA)
into a 2 ml reaction tube.
[0468] 6. Add 1.4 volumes of 100% ethanol (980 .mu.l), and mix
thoroughly by vortexing. Do not centrifuge. Proceed immediately to
step 7.
[0469] 7. Pipet 700 .mu.l of the sample into an RNeasy MinElute
spin column placed in a 2 ml collection tube. Close the lid gently,
and centrifuge for 15 s at 8000.times.g. Discard the flow-through.
Repeat step 7 until the whole sample has been pipetted into the
spin column. Discard the flow-through each time.
[0470] 8. Pipet 500 .mu.l Buffer RPE into the RNeasy MinElute spin
column. Close the lid gently, and centrifuge for 15 s at
8000.times.g. Discard the flow-through.
[0471] 9. Pipet 500 .mu.l of 80% ethanol into the RNeasy MinElute
spin column. Close the lid gently, and centrifuge for 15 s at
8000.times.g. Discard the flow-through and the collection tube.
[0472] 10. Place the RNeasy MinElute spin column into a new 2 ml
collection tube. Open the lid, and centrifuge for 1 min at
8000.times.g.
[0473] 11. Place the RNeasy MinElute spin column into a 1.5 ml
collection tube, and pipet 14 .mu.l RNase-free water onto the spin
column membrane. Close the lid gently, and centrifuge for 1 min at
8000.times.g to elute the miRNA.
[0474] The concentration of the miRNA eluate was measured at
OD.sub.260 followed by dilution in DEPC H.sub.2O to a final
concentration of 10 nM (10 fmol per .mu.L).
Example 28
Real-Time RT-PCR for Selective Detection of Mature Versus Precursor
of the Human Hsa-Let-7a Using; MicroRNA-Primed Extension Reaction
on a 3'-Blocked and 5'-Biotin-Labelled LNA-Modified Capture Probe,
Immobilization of Extension Product in a Streptavidin Tube, Reverse
Transcriptase Reaction in Solution, and Real-Time PCR Using a
LNA-Modified Detection Probe with Quencher Q2
[0475] 1. The MicroRNA-Primed Extension Reaction on a 3'-Blocked,
5'-Biotin Labelled LNA-Modified Capture Probe.
[0476] miRNA hsa Let-7a (10 fmol; EQ16898, Table VII) and/or
precursor pre-miRNA hsa Let-7a ((10 fmol; produced as outlined in
Example 27) was mixed with 1 .mu.g Torulla yeast RNA (Ambion, USA),
100 fmol cP5_hsa-let-7a capture probe (EQ17367, Table VII), 1 .mu.L
10.times.NE-Buffer 2 (New England Biolabs, USA), 1 .mu.L dNTP mix
(1 mM of each dNTP; Applied Biosystems, USA), and 5 U Klenow exo-
(New England Biolabs, USA) in a total volume of 10 .mu.L.
Incubation was performed for 30 min at 37.degree. C.
[0477] 2. The Immobilization in a Streptavidin Tube
[0478] A volume of 2.5 .mu.L 5.times. binding buffer (500 mM
Tris-HCl pH 7.5 at 20.degree. C., 2 M LiCl, 100 mM EDTA) was added
to the Klenow exo-reaction and the mixture was transferred to the
bottom of a streptavidin coated PCR tube (Roche, Germany).
Incubation was performed for 3 min at 37.degree. C. to allow the
biotin-streptavidin binding to occur. Unbound material was removed
by washing five times in 100 .mu.L of washing buffer (10 mM
Tris-HCl pH 7.5 at 20.degree. C., 20 mM LiCl,) at room temperature.
The washed tube was immediately subjected to the reverse
transcription reaction.
[0479] 3. The RT Reaction in Solution
[0480] The RT-primer (1 .mu.l 100 fmol/.mu.l, EQ17374, Table VII)
and 2.5 .mu.l dNTP (10 mM of each dNTP, Applied Biosystems, USA)
were mixed in 12 .mu.L total volume and added to the streptavidin
PCR tube containing the immobilized capture probe and the
chimerical RNA-DNA strand. The tube was heated 5 min at 70.degree.
C. and the supernatant was removed to a new tube on ice. 4 .mu.l
5.times. first strand buffer (250 mM Tris-HCl pH 8.3 at 20.degree.
C., 375 mM KCl, 15 mM MgCl.sub.2; Invitrogen, USA), 2 .mu.l 100 mM
DTT (Invitrogen, USA), 1 .mu.l 20 U/.mu.l SUPERase-In (Ambion,
USA), and 1 .mu.l 200 U/.mu.l Superscript II reverse transcriptase
(Invitrogen, USA) were added and the incubation was continued for 1
h at 42.degree. C. Heating for 15 min at 70.degree. C. terminated
the reaction. The total volume was adjusted to 100 .mu.L by adding
80 .mu.L of DEPC H.sub.2O.
[0481] 4. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0482] The reaction (50 .mu.L) was 1.times. QuantiTect Probe PCR
Master Mix (Qiagen, Germany), 400 nM hsa-let-7a_qPcR-F-primer3
(EQ17372, Table VII), 400 nM hsa-let-7a qPcR-R-primer2 (EQ17375,
Table VII), 200 nM hsa-let-7a_qPcR-Probe2_Q2 detection probe
(EQ18089, Table VII), 5 .mu.L of the first strand synthesis (RT)
reaction (described above), and 0.5 U Uracil DNA Glycosylase
(Invitrogen, USA). The temperature cycling program was; 10 min at
37.degree. C., 15 min at 95.degree. C., 1 min at 30.degree. C., 1
min at 40.degree. C., 1 min at 60.degree. C., followed by 40 cycles
of 20 s at 94.degree. C. and 1 min at 60.degree. C. The real-time
RT-PCR analysis was performed on the Opticon real-time PCR
instrument (MJ Research, USA).
[0483] 5. Results.
[0484] The following Ct values was obtained (Table IX) by
performing the assay outlined above on the mature miRNA hsa Let-7a
and/or pre-miRNA hsa Let-7a:
TABLE-US-00010 TABLE IX Input RNA Amount of input RNA Ct value
miRNA hsa Let-7a 10 fmol 17.0 pre-miRNA hsa Let-7a 10 fmol 28.9
miRNA hsa Let-7a & pre-miRNA 10 fmol each 17.7 hsa Let-7a No
miRNA or pre-miRNA -- none
[0485] There is a difference in Ct values of 11.8 (.DELTA.Ct)
between the mature and the precursor hsa-let-7a miRNA. A .DELTA.Ct
of 11.8 corresponds to a 1000-10,000 fold higher sensitivity of the
assay for the mature hsa-let-7a miRNA over the precursor, which
demonstrates the ability of the assay to discriminate between the
two miRNA species. Accordingly, very similar Ct values are obtained
when assaying the mature hsa-let-7a miRNA alone or the mature plus
precursor hsa-let-7a miRNA present in equimolar concentrations. No
signal and Ct value is obtained when the assay is performed without
addition of miRNA. Little or no signal was obtained in the qPCR
when no RT reaction was added or when the template consisted of the
oligo-template used for in vitro transcription of precursor
hsa-let-7a miRNA (result not shown). Likewise little or no signal
was obtained when the template added to the qPCR consisted of RT
performed as outlined above but using the precursor hsa-let-7a
miRNA as template i.e. omitting the microRNA-primed extension
reaction step (result not shown).
Example 29
Real-Time RT-PCR for Selective Detection of the Hsa-Let-7a Versus
Closely Related miRNAs Hsa-Let-7f and Hsa-Let-7g Using;
MicroRNA-Primed Extension Reaction on a 3'-Blocked and
5'-Biotin-Labelled LNA-Modified Capture Probe, Immobilization of
Extension Product in a Streptavidin Tube, Reverse Transcriptase
Reaction in Solution, and Real-Time PCR Using a LNA-Modified
Detection Probe with Quencher Q2
[0486] 1. The MicroRNA-Primed Extension Reaction on a 3'-Blocked,
5'-Biotin Labelled LNA-Modified Capture Probe.
[0487] 10 fmol hsa Let-7a miRNA, hsa Let-7f miRNA, or hsa Let-7g
miRNA (EQ16898, EQ16899 and EQ16917, respectively--Table VII) was
mixed with 1 .mu.g Torulla yeast RNA (Ambion, USA), 100 fmol
cP5_hsa-let-7a capture probe (EQ17367, Table VII), 1 .mu.L
10.times.NE-Buffer 2 (New England Biolabs, USA), 1 .mu.L dNTP mix
(1 mM of each dNTP; Applied Biosystems, USA), and 5 U Klenow exo-
(New England Biolabs, USA) in a total volume of 10 .mu.L.
Incubation was performed for 30 min at 37.degree. C.
[0488] 2. The Immobilization in a Streptavidin Tube
[0489] A volume of 2.5 .mu.L 5.times. binding buffer (500 mM
Tris-HCl pH 7.5 at 20.degree. C., 2 M LiCl, 100 mM EDTA) was added
to the Klenow exo-reaction and the mixture was transferred to the
bottom of a streptavidin coated PCR tube (Roche, Germany).
Incubation was performed for 3 min at 37.degree. C. to allow the
biotin-streptavidin binding to occur. Unbound material was removed
by washing five times in 100 .mu.L of washing buffer (10 mM
Tris-HCl pH 7.5 at 20.degree. C., 20 mM LiCl.sub.3) at room
temperature. The washed tube was immediately subjected to the
reverse transcription reaction.
[0490] 3. The RT Reaction in Solution
[0491] The RT-primer (1 .mu.l 100 fmol/.mu.l, EQ17374, Table VII)
and 2.5 .mu.l dNTP (10 mM of each dNTP, Applied Biosystems, USA)
were mixed in 12 .mu.L total volume and added to the streptavidin
PCR tube containing the immobilized capture probe and the
chimerical RNA-DNA strand. The tube was heated 5 min at 70.degree.
C. and the supernatant was removed to a new tube on ice. 4 .mu.l
5.times. first strand buffer (250 mM Tris-HCl pH 8.3 at 20.degree.
C., 375 mM KCl, 15 mM MgCl.sub.2; Invitrogen, USA), 2 .mu.l 100 mM
DTT (Invitrogen, USA), 1 .mu.l 20 U/.mu.l SUPERase-In (Ambion,
USA), and 1 .mu.l 200 U/.mu.l Superscript II reverse transcriptase
(Invitrogen, USA) were added and the incubation was continued for 1
h at 42.degree. C. Heating for 15 min at 70.degree. C. terminated
the reaction. The total volume was adjusted to 100 .mu.L by adding
80 .mu.L of DEPC H.sub.2O.
[0492] 4. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0493] The reaction (50 .mu.L) was 1.times. QuantiTect Probe PCR
Master Mix (Qiagen, Germany), 400 nM hsa-let-7a_qPcR-F-primer3
(EQ17372, Table VII), 400 nM hsa-let-7a qPcR-R-primer2 (EQ17375,
Table VII), 200 nM hsa-let-7a_qPcR-Probe2_Q2 detection probe
(EQ18089, Table VII), 5 .mu.L of the first strand synthesis (RT)
reaction (described above), and 0.5 U Uracil DNA Glycosylase
(Invitrogen, USA). The temperature cycling program was; 10 min at
37.degree. C., 15 min at 95.degree. C., 1 min at 30.degree. C., 1
min at 40.degree. C., 1 min at 60.degree. C., followed by 40 cycles
of 20 s at 94.degree. C. and 1 min at 60.degree. C. The real-time
RT-PCR analysis was performed on the Opticon real-time PCR
instrument (MJ Research, USA).
[0494] 5. Results.
[0495] A Ct value of 20.4 was obtained in the hsa Let-7a miRNA
assay using the hsa Let-7a miRNA as template. No signal was
generated and no Ct value was obtained in the assays where hsa
Let-7f miRNA and hsa Let-7g miRNA was used as template. Likewise no
signal and no Ct value was obtained from assays where no miRNA was
added or from qPCRs where no RT was added as template. This
indicate that the assay is discriminatively detecting the
hsa-let-7a miRNA and not the close miRNA homologues hsa Let-7f
miRNA and hsa Let-7g miRNA where the only difference between let-7a
and hsa Let-7f miRNAs is a single nucleotide change from G to
A.
Example 30
Real-Time RT-PCR Quantification of Hsa-Mir-143 Using Two Step
Extension of a Capture/RT-Probe Using as First Template the
Investigated MicroRNA and as Second Template an Artificial Helper
Oligonucleotide Followed by Real-Time PCR Quantification by
Amplification of the Fully Extended Capture/RT-Probe Using a LNA
Modified Dual-Labelled Detection Probe
[0496] When the miRNA is located on the lower strand of the
stem-loop molecule, processing by the Dicer enzyme results in a
unique 5'-end of the mature miR, whereas the 3'-end is identical
for the pre-miR and the mature miR.
[0497] The example follows the assay layout in FIG. 31.
[0498] The two capture/RT-probe extension reactions take place in
the same reaction mixture using a "One Step RT/PCR mix". The
reaction mixture thus contains micro-RNA, capture/RT-probe, reverse
transcriptase, 3'-phosphorylated and 5'-biotinylated artificial
helper template, and Taq-polymerase.
[0499] Subsequent to the 2-step capture/RT-probe extension an
aliquot of this reaction mixture is then used as input in a
real-time PCR quantification reaction.
[0500] 1. The 2-Step Capture/RT-Probe Extension Reaction
Mixture.
[0501] In a reaction mixture with a total volume of 25 .mu.L the
following was mixed: hsa-mir-143 microRNA (1 fmol; EQ16900, Table
X), 1 .mu.g Torulla yeast RNA (Ambion, USA), hsa-Rim-143_CP5_NoBio
(125 fmol; EQ18080, Table X), hsa-Rim-143_AT_Bio (6.25 .mu.mol;
EQ18079, Table X), dNTP mix (0.2 mM final conc. of each dNTP;
Applied Biosystems, USA), 1.times. Qiagen OneStep RT-PCR buffer
(Qiagen, Germany), 1.times. Qiagen OneStep RT-PCR Enzyme Mix and
DEPC treated water (Ambion, USA).
[0502] A "No-miR" control was performed in which the microRNA
(hsa-mir-143, Table X) was omitted.
[0503] The reaction mixtures were subjected to the following
temperature cycling program using a DNA Engine Dyad thermocycler
(MJ Research, USA):
[0504] Reverse Transcription: 60.degree. C. for 30 min
[0505] Activation of Tag: 95.degree. C. for 15 min
[0506] Capture probe extension: 10 cycles of (95.degree. C. for 20
sec+60.degree. C. for 30 sec)
[0507] Cooling: 4.degree. C.
[0508] The reaction mixtures were diluted with 75 .mu.L DEPC
treated water (Ambion, USA) immediately prior to further
processing.
[0509] 2. Removal of Artificial Helper Oligonucleotide from the
Reaction Mixture by Binding to Streptavidin.
[0510] An aliquot of 20 .mu.L of each of the reaction mixtures from
step 1 above was mixed with 1 .mu.L ImmunoPure.RTM. Immobilized
Streptavidin (Pierce), vortexed and incubated at 37.degree. C. for
5 min and spun through a spin-column (Harvard Apparatus).
[0511] 3. Real-Time PCR Quantification Using a LNA Modified
Dual-Labelled Detection Probe
[0512] In a reaction mixture with a total volume of 25 .mu.L the
following was mixed: hsa-Rim-143_Primer2 (0.5 .mu.M final conc.,
EQ17724, Table X), hsa-miR-143_Primer143_C2 (0.5 .mu.M final conc.,
EQ17574, Table X), hsa-Rim-143_P4 (0.25 .mu.M final conc., EQ18057,
Table X), 1.times. TaqMan.RTM. Universal PCR Master Mix (Applied
Biosystems, USA), 2.5 .mu.L of the diluted reaction mixture from
step 1 or step 2 above and DEPC treated water.
[0513] The reaction mixtures were subjected to the following
temperature cycling program using an ABI 7500 Real Time PCR System
(Applied Biosystems, USA):
[0514] Activation of Taq: 95.degree. C. for 15 min
[0515] PCR amplification: 40 cycles of (95.degree. C. for 20
sec+60.degree. C. for 30 sec)
[0516] The results for the described reactions was a Ct-value of 37
for the microRNA containing sample without purification in step 2
and a Ct-value of 36 for the corresponding sample including
purification in step 2. Neither of the two corresponding "No
miR"-controls gave any Ct-value within the 40 cycles. See FIG.
32.
TABLE-US-00011 TABLE X Oligonucleotides used in Example Rim EQ No:
Oligo Name: 5' Sequence (5'-3').sup.a 3' 16900 hsa-mir-143
ugagaugaagcacuguagcuca (SEQ ID NO: 64) 18080 hsa-Rim-
ctgatagagctttgcgtccactgattGag 143_CP5_NoBio mCtamCagt (SEQ ID NO:
65) 18079 hsa-Rim-143_AT_Bio Bio
tgaatccgaatctaacgttgcctaggctgagatga P agcact (SEQ ID NO: 66) 17724
hsa-Rim-143_Primer2 tgaatccgaatctaacgttgc (SEQ ID NO: 67) 17574
hsa-miR- ctgatagagctttgcgtcca (SEQ ID NO: 68) 143_Primer143_C2
18057 hsa-Rim-143_P4 6- aGmCTAmCAGT#Q2z P FITC .sup.aLNA
(uppercase), DNA (lowercase), Fluorescein (6-FITC (Glenn Research,
Prod. Id. No. 10-1964)), biotin (Bio (Glenn Research)), two
moieties of hexaethylene-glycol (HEG2 (Glenn Research)), #Q2
(Prepared as described in Example 8b), z (5-nitroindole (Glenn
Research, Prod. Id. No. 10-1044)), Phosphate (P).
Example 31
Real-Time RT-PCR for Selective Detection of the Hsa-Let-7a Versus
the Closely Related Hsa-Let-7g Using; Ligation of an RNA Adaptor to
Mature MicroRNA Followed by Reverse Transcription, and Real-Time
PCR Using a LNA-Modified Detection Probe with Quencher Q2
[0517] The method employed in this example is generally depicted in
FIG. 36.
[0518] 1. The Ligation of an RNA Adaptor to the Mature
MicroRNA.
[0519] Ten fmol hsa Let-7a miRNA or hsa Let-7g miRNA (EQ16898 and
EQ16917, respectively--Table VII) was mixed with 20 fmol RNA
Adaptor (EQ18557--Table XI) and 40 U of T4 RNA Ligase (New England
Biolabs, USA) in a total volume of 20 .mu.L consisting of
1.times.T4 RNA Ligase Buffer (50 mM Tris-HCl pH 7.8 at 25.degree.
C., 10 mM MgCl.sub.2, 1 mM ATP, and 10 mM dithiothreitol). Ligation
was performed by incubation for 15 min at 37.degree. C. Heating for
15 min at 65.degree. C. terminated the reaction.
[0520] 2. The RT Reaction
[0521] The reverse transcription reaction was performed in 50 .mu.L
consisting of 2 .mu.M RT-primer (EQ17374, Table VII) and 500 .mu.M
of each dNTP (Applied Biosystems, USA), 1.times. First strand
buffer (50 mM Tris-HCl pH 8.3 at 20.degree. C., 75 mM KCl, 3 mM
MgCl.sub.2; Invitrogen, USA), 10 mM DTT (Invitrogen, USA), 60 U
SUPERase-In (Ambion, USA), 500 U Superscript II reverse
transcriptase (Invitrogen, USA), and 20 .mu.L of the Ligation
mixture described above The reverse transcription reaction was
performed for 1 h at 42.degree. C. Heating for 15 min at 70.degree.
C. terminated the reaction.
[0522] 4. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0523] The reaction (50 .mu.L) was 1.times.PCR buffer (Qiagen,
Germany), MgCl.sub.2 to a final concentration of 4 mM, 0.2 mM of
each of dATP, dCTP, dGTP and 0.6 mM dUTP (Applied Biosystems, USA),
900 nM hsa-let-7a_qPcR-F-primer3 (EQ17372, Table VII), 900 nM
hsa-let-7a qPcR-R-primer2 (EQ17375, Table VII), 250 nM
hsa-let-7a_qPcR-Probe2_Q2 detection probe (EQ18089, Table VII),
0.1.times.ROX reference dye (Invitrogen, USA), 2.5 .mu.L of the
first strand synthesis (RT) reaction (described above), 0.5 U
Uracil DNA Glycosylase (Invitrogen, USA) and 2.5 U HotStarTaq DNA
polymerase (Qiagen, Germany). The temperature cy-cling program was;
10 min at 37.degree. C., 10 min at 95.degree. C., followed by 40
cycles of 20 s at 95.degree. C. and 1 min at 60.degree. C. The
real-time RT-PCR analysis was run on an ABI 7500 Real Time PCR
System (Applied Biosystems, USA).
[0524] 5. Results.
[0525] A Ct value of 27.1 was obtained in the hsa Let-7a miRNA
assay using the hsa Let-7a miRNA as template (FIG. 35). No signal
was generated and no Ct value was obtained in the assays where the
hsa Let-7g miRNA was used as template. Likewise no signal and no Ct
value was obtained from assays where no miRNA was added or from
qPCRs where no RT was added as template. Indicating that the assay
is discriminatively detecting the hsa-let-7a miRNA and not the
close miRNA homologue hsa Let-7g.
TABLE-US-00012 TABLE XI Oligonucleotide used in Ligation. EQ No:
Oligo Name: 5' Sequence (5'-3').sup.a 3' 18557 RNA Adaptor P
acucauccuaccauccauccu P (SEQ ID NO: 69) RNA (italic and lowercase)
and Phosphate (P).
Example 32
Real-Time RT-PCR for Selective Detection of the Hsa-Let-7a Versus
the Closely Related miRNA Hsa-Let-7g Using; Ligation of RNA Oligo
to Mature MicroRNA Using a "Bridging" Nucleic Acid Sequence
(Ligation Helper Oligo) Followed by Reverse Transcription, and
Real-Time PCR Using a LNA-Modified Detection Probe with Quencher
Q2
[0526] The following is an example of how the Ligation-Helper-Oligo
assisted ligation and subsequent reverse transcription and qPCR may
be performed to detect the mature microRNA hsa-let-7a.
[0527] 1. The Ligation of RNA Ligation Oligo to the Mature
MicroRNA.
[0528] Mix 10 fmol hsa Let-7a miRNA or hsa Let-7g miRNA (EQ16898
and EQ16917, respectively--Table VII) with, 100 fmol Ligation Oligo
and 100 fmol Ligation Helper Oligo (EQ18557 and EQ18565,
respectively--Table XII) and 400 U of T4 DNA Ligase (New England
Biolabs, USA) in a total volume of 20 .mu.L consisting of
1.times.T4 DNA Ligase Reaction Buffer (50 mM Tris-HCl pH 7.5 at
25.degree. C., 10 mM MgCl.sub.2, 1 mM ATP, 10 mM dithiothreitol, 25
.mu.g/ml BSA). Perform ligation by incubation for 30 min at room
temperature. Heat for 10 min at 65.degree. C. to terminate the
reaction.
[0529] 2. The RT Reaction
[0530] Add 1 .mu.L RT-primer (100 fmol/.mu.L, EQ17374, Table VII)
and 2 .mu.L dNTP (10 mM of each of dNTP--Applied Biosystems, USA)
together with 1 .mu.L 5.times. First strand buffer (250 mM Tris-HCl
pH 8.3 at 20.degree. C., 375 mM KCl, 15 mM MgCl.sub.2; Invitrogen,
USA), 1 .mu.L 20 U/.mu.L SUPERase-In (Ambion, USA), and 1 .mu.L 200
U/.mu.L Superscript II reverse transcriptase (Invitrogen, USA).
Perform the reverse transcription reaction for 1 h at 42.degree. C.
Heat for 15 min at 70.degree. C. to terminate the reaction. Adjust
the total volume to 100 .mu.L by adding 74 .mu.L of DEPC
H.sub.2O.
[0531] 3. The Real-Time PCR Using a LNA-Modified Detection
Probe
[0532] Set up a real time PCR reaction (50 .mu.L) with 1.times.
QuantiTect Probe PCR Master Mix (Qiagen, Germany), 400 nM
hsa-let-7a_qPcR-F-primer3 (EQ17372, Table VII), 400 nM hsa-let-7a
qPcR-R-primer2 (EQ17375, Table VII), 200 nM
hsa-let-7a_qPcR-Probe2_Q2 detection probe (EQ18089, Table VII), 5
.mu.L of the first strand synthesis (RT) reaction (described
above), and 0.5 U Uracil DNA Glycosylase (Invitrogen, USA). Use the
following temperature cycling program: 10 min at 37.degree. C., 15
min at 95.degree. C., 1 min at 30.degree. C., 1 min at 40.degree.
C., 1 min at 60.degree. C., followed by 40 cycles of 20 s at
94.degree. C. and 1 min at 60.degree. C. The real-time RT-PCR
analysis may be performed on the Opticon real-time PCR instrument
(MJ Research, USA).
TABLE-US-00013 TABLE XII Oligonucleotides used in Ligation. EQ No:
Oligo Name: 5' Sequence (5'-3').sup.a 3' 18557 hsa-let-7 Ligation P
acucauccuaccauccauccu P Oligo (SEQ ID NO: 70) 18565 hsa-let-7a
Liga- ggatgagtaactatac P tion-Helper (SEQ ID NO: 71)
EMBODIMENTS
[0533] The invention can also be defined by means of the following
embodiments, wherein the term "item" refers to a preceding item
with the specified number.
[0534] 1. A method of quantifying a target nucleotide sequence in a
nucleic acid sample comprising:
[0535] a) contacting the target nucleotide sequence with two
oligonucleotide tagging probes each consisting of an anchor
nucleotide sequence and a recognition nucleotide sequence, wherein
said recognition nucleotide sequence is complementary to the target
sequence, and wherein the recognition sequence of the first tagging
probe hybridizes to a first region of the target sequence and the
second recognition sequence of the second tagging probe hybridizes
to a second region of the target sequence adjacent to the first
region of the target sequence;
[0536] b) joining the two adjacent recognition sequences of the
hybridized tagging probes covalently by ligation to form a
contiguous nucleotide sequence, comprising a sequence complementary
to the target nucleotide sequence and the two anchor nucleotide
sequences; and
[0537] c) quantifying the ligated oligonucleotide molecules by
real-time PCR using primers corresponding to the anchor nucleotide
sequences and a labelled detection probe comprising a target
recognition sequence and a detection moiety.
[0538] 2. A method of item 1, wherein the recognition nucleotide
sequences in the tagging probes and the detection probe are
modified with high-affinity nucleotide analogues.
[0539] 3. A method of item 1 to 2, wherein the high-affinity
nucleotide analogue is LNA.
[0540] 4. A method of item 1 to 3, wherein the recognition
nucleotide sequence in the 5'-phosphorylated tagging probe is
modified with an LNA at every second, third or fourth position
starting with an LNA at the nucleotide position next to the 5'
nucleotide position, and wherein the recognition nucleotide
sequence in the second tagging probe is modified with an LNA at
every second, third or fourth position ending at the nucleotide
position prior to the 3' nucleotide position.
[0541] 5. A method of item 4, wherein the recognition nucleotide
sequence in the 5'-phosphorylated tagging probe is modified with an
LNA at every third position starting with an LNA at the nucleotide
position next to the 5' nucleotide position, and wherein the
recognition nucleotide sequence in the second tagging probe is
modified with an LNA at every third position ending at the
nucleotide position prior to the 3' nucleotide position.
[0542] 6. A method of item 1 to 5, wherein the anchor nucleotide
sequences in the tagging probes are DNA sequences.
[0543] 7. A method of item 1 to 5, wherein the anchor nucleotide
sequences in the tagging probes are modified with high-affinity
nucleotide analogues.
[0544] 8. A method of item 7, wherein the anchor nucleotide
sequences in the tagging probes are modified with LNA.
[0545] 9. A method of item 1 to 8, wherein the recognition
nucleotide sequences in the tagging probes are less than about 20
nucleotides in length and more preferably less than 15 nucleotides,
and most preferably between 10 and 14 nucleotides.
[0546] 10. A method of item 1 to 9, wherein the anchor nucleotide
sequences in the tagging probes are less than about 30 nucleotides
in length and more preferably less than 27 nucleotides, and most
preferably between 15 and 25 nucleotides.
[0547] 11. A method of item 1 to 10, wherein the recognition
sequence in the detection probe is modified with high-affinity
nucleotide analogues.
[0548] 12. A method of item 11, wherein the high-affinity
nucleotide analogue is LNA.
[0549] 13. A method of item 12, wherein the length of the detection
probe is less than about 20 nucleotides and more preferably less
than 15 nucleotides, and most preferably between 8 and 12
nucleotides.
[0550] 14. A method of item 13, wherein the detection probe
comprises an LNA sequence containing a DNA nucleotide at the 5'-end
and a phosphate group at the 3'-end.
[0551] 15. A method of item 14, wherein the detection probe is
substituted with at least one chemical moiety.
[0552] 16. A method of item 15, wherein the detection probe
contains a fluorophore-quencher pair.
[0553] 17. A method of item 1 to 16, wherein the detection probe is
detected using a dual label by the 5' nuclease assay principle.
[0554] 18. A method of item 1 to 16, wherein the detection probe is
detected by the molecular beacon principle.
[0555] 19. A method of anyone of items 1 to 18, wherein the tagging
probes are ligated using a T4 DNA ligase.
[0556] 20. A method of anyone of items 1 to 18, wherein the tagging
probes are ligated using a thermostable DNA ligase.
[0557] 21. A method of anyone of items 1 to 18, wherein the tagging
probes are ligated using a RNA ligase.
[0558] 22. A method of anyone of items 1 to 18, wherein the tagging
probes are ligated using a thermostable RNA ligase.
[0559] 23. A method of item 20 or 22, wherein the ligation reaction
is a repeated cycle between denaturation and tagging probe
annealing and joining, producing a plurality of ligated
oligonucleotide molecules.
[0560] 24. A method of anyone of items 1 to 23, wherein one of the
tagging probes is labelled with a ligand.
[0561] 25. A method of item 24, wherein the ligated molecules are
purified utilizing a ligand-capture molecule interaction.
[0562] 26. A method of item 24 to 25, wherein the ligand is biotin,
and wherein the ligand-capture molecule interaction is
biotin-avidin or biotin-streptavidin.
[0563] 27. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is a RNA sequence.
[0564] 28. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is a microRNA sequence.
[0565] 29. A method of item 28, wherein the target nucleotide
sequence is a mature microRNA sequence.
[0566] 30. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is a siRNA or a RNA-edited sequence.
[0567] 31. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is an alternative splice variant sequence.
[0568] 32. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is a non-coding or an antisense RNA sequence or
a RNA sequence containing a single nucleotide polymorphism or a
point mutation.
[0569] 33. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is a DNA sequence.
[0570] 34. A method of anyone of items 1 to 26, wherein the target
nucleotide sequence is a DNA sequence containing a single
nucleotide polymorphism or a point mutation.
[0571] 35. A method of items 1 to 34, wherein the target nucleotide
sequence is a human sequence.
[0572] 36. A method of item 35, wherein the target nucleotide
sequence is involved in a disease or useful for the diagnosis of a
disease, e.g. cancer.
[0573] 37. A library of tagging probes and detection probes of
anyone of items 1 to 36 for detection or quantification of
microRNAs.
[0574] 38. A library of probes of item 37 for detection and
quantification of plant or mammalian microRNAs.
[0575] 39. A library of probes of item 37 for detection and
quantification of human or animal microRNAs.
[0576] 40. A library of tagging probes and detection probes of
anyone of items 1 to 36 for detection or quantification of
antisense RNAs, non-coding RNAs or siRNAs.
[0577] 41. A library of tagging probes and detection probes of
anyone of items 1 to 36 for detection or quantification of
RNA-edited transcripts.
[0578] 42. A library of tagging probes and detection probes of
anyone of items 1 to 36 for detection or quantification of
alternative splice variants.
[0579] 43. A kit of anyone of items 37 to 42.
[0580] 44. A method of quantifying a target ribonucleic acid
sequence in a nucleic acid sample comprising:
[0581] a) contacting the target ribonucleic acid sequence with an
oligonucleotide tagging probe, consisting of an anchor nucleotide
sequence and a recognition nucleotide sequence, wherein said
recognition nucleotide sequence is complementary to a sequence in
the target ribonucleic acid sequence;
[0582] b) synthesis of a complementary strand to the target
ribonucleic acid by reverse transcription using a reverse
transcriptase enzyme and the oligonucleotide tagging probe as
primer;
[0583] c) replacing of the ribonucleic acid sequence in the
heteroduplex by synthesis of a second strand using a DNA polymerase
and a second tagging probe as primer, wherein said second tagging
probe consists of an anchor nucleotide sequence and a recognition
nucleotide sequence, wherein said recognition nucleotide sequence
is complementary to a sequence in the reverse
transcriptase-extended nucleic acid sequence; and
[0584] d) quantifying the resulting nucleic acids by real-time PCR
using primers corresponding to the anchor nucleotide sequences
attached to the oligonucleotide tagging probes and a labelled
detection probe comprising a target recognition sequence and a
detection moiety.
[0585] 45. A method of item 44, wherein the recognition nucleotide
sequences in the tagging probes and the detection probe are
modified with high-affinity nucleotide analogues.
[0586] 46. A method of item 44, wherein the recognition nucleotide
sequence complementary to a sequence in the target ribonucleic acid
in the first tagging probe and the detection probe are modified
with high-affinity nucleotide analogues, and the recognition
sequence in the second tagging probe is unmodified.
[0587] 47. A method of item 44, wherein the recognition sequences
in the tagging probes are unmodified and the detection probe is
modified with high-affinity nucleotide analogues.
[0588] 48. A method of item 44 to 47, wherein the high-affinity
nucleotide analogue is LNA.
[0589] 48. A method of item 44 to 48, wherein the recognition
sequences in the tagging probes are modified with an LNA at every
second, third or fourth position with at least one DNA nucleotide
in the 3' end of the recognition sequence.
[0590] 49. A method of item 48, wherein the recognition sequences
in the tagging probes are modified with an LNA at every third
position starting ending with at least one DNA nucleotide in the 3'
end of the recognition sequence.
[0591] 50. A method of item 44 to 49, wherein the anchor nucleotide
sequences in the tagging probes are DNA sequences.
[0592] 51. A method of item 44 to 50, wherein the anchor nucleotide
sequences in the tagging probes are modified with high-affinity
nucleotide analogues.
[0593] 52. A method of item 51, wherein the anchor nucleotide
sequences in the tagging probes are modified with LNA.
[0594] 53. A method of item 44 to 52, wherein the recognition
sequences in the tagging probes are less than about 20 nucleotides
in length and more preferably less than 15 nucleotides, and most
preferably between 6 and 14 nucleotides.
[0595] 54. A method of item 44 to 53, wherein the anchor nucleotide
sequences in the tagging probes are less than about 30 nucleotides
in length and more preferably less than 27 nucleotides, and most
preferably between 15 and 25 nucleotides.
[0596] 55. A method of item 44 to 54, wherein the recognition
sequence in the detection probe is modified with high-affinity
nucleotide analogues.
[0597] 56. A method of item 55, wherein the high-affinity
nucleotide analogue is LNA.
[0598] 57. A method of item 56, wherein the LNA is optionally
modified with SBC nucleobases, 2'-O-methyl, 2,6-diaminopurine,
2-thiouracil, 2-thiothymidine, 5-nitroindole, universal or
degenerate bases, intercalating nucleic acids or
minor-groove-binders.
[0599] 58. A method of item 57, wherein at least one of the LNA
adenosine monomers in the recognition sequence is substituted with
LNA 2,6-diaminopurine.
[0600] 59. A method of item 58, wherein at least one of the LNA
monomers are substituted with LNA 2-thiothymidine.
[0601] 60. A method of item 59, wherein the length of the detection
probe is less than about 20 nucleotides and more preferably less
than 15 nucleotides, and most preferably between 7 and 12
nucleotides.
[0602] 61. A method of item 59, wherein the detection probe
comprises an LNA sequence containing a DNA nucleotide at the 5'-end
and a phosphate group at the 3'-end.
[0603] 62. A method of item 61, wherein the detection probe is
substituted with at least one chemical moiety.
[0604] 63. A method of item 62, wherein the detection probe
contains a fluorophore-quencher pair.
[0605] 64. A method of item 44 to 63, wherein the detection probe
is detected using a dual label by the 5' nuclease assay
principle.
[0606] 65. A method of item 44 to 63, wherein the detection probe
is detected by the molecular beacon principle.
[0607] 66. A method of anyone of items 44 to 65, wherein the
complementary strand to the target ribonucleic acid is synthesized
using a thermostable reverse transcriptase.
[0608] 67. A method of anyone of items 44 to 66, wherein the second
strand replacing the target ribonucleic acid sequence in the
heteroduplex is synthesized using a thermostable DNA
polymerase.
[0609] 68. A method of anyone of items 44 to 67, wherein the second
strand tagging probe is labelled with a ligand.
[0610] 69. A method of item 68, wherein the second strand molecules
are purified utilizing a ligand-capture molecule interaction.
[0611] 70. A method of item 68 to 69, wherein the ligand is biotin,
and wherein the ligand-capture molecule interaction is
biotin-avidin or biotin-streptavidin.
[0612] 71. A method of anyone of items 44 to 70, wherein the target
ribonucleic acid sequence is a microRNA sequence.
[0613] 72. A method of item 71, wherein the target ribonucleic acid
sequence is a mature microRNA sequence.
[0614] 73. A method of item 72, wherein the recognition sequence of
the first tagging probe is complementary to the 3'-end of the
mature microRNA and the recognition sequence of the second tagging
probe is complementary to the 3'-end of the reverse
transcriptase-extended nucleotide sequence corresponding to the
5'-end of the mature microRNA.
[0615] 74. A method of anyone of items 44 to 70, wherein the target
ribonucleic acid sequence is a siRNA or a RNA-edited sequence.
[0616] 75. A method of anyone of items 44 to 70, wherein the target
ribonucleic acid sequence is an alternative splice variant
sequence.
[0617] 76. A method of anyone of items 44 to 70, wherein the target
ribonucleic acid sequence is a non-coding or an antisense RNA
sequence or a RNA sequence containing a single nucleotide
polymorphism or a point mutation.
[0618] 77. A method of anyone of items 74 to 76, wherein the
recognition sequence of the first tagging probe is complementary to
the 3'-end of the mature siRNA or to a sequence located 3' to the
RNA edited nucleotide, splice junction, single nucleotide
polymorphism or point mutation, and the recognition sequence of the
second tagging probe is complementary to the reverse
transcriptase-extended nucleotide sequence corresponding to the
5'-end of the siRNA or located 5' to the RNA edited nucleotide,
splice junction, single nucleotide polymorphism or point mutation
in the ribonucleic acid target sequence.
[0619] 78. A method of items 44 to 77, wherein the target
ribonucleic acid sequence is a human sequence.
[0620] 79. A method of item 78, wherein the target ribonucleic acid
sequence is involved in a disease or useful for the diagnosis of a
disease, e.g. cancer.
[0621] 80. A library of tagging probes and detection probes of
anyone of items 44 to 79 for detection or quantification of
microRNAs.
[0622] 81. A library of probes of item 80 for detection and
quantification of plant or mammalian microRNAs.
[0623] 82. A library of probes of item 80 for detection and
quantification of human or animal microRNAs.
[0624] 83. A library of tagging probes and detection probes of
anyone of items 44 to 79 for detection or quantification of
antisense RNAs, non-coding RNAs, siRNAs, RNA-edited transcripts or
alternative splice variants.
[0625] 84. A kit of anyone of items 80 to 83.
Sequence CWU 1
1
79117DNAartificial sequenceSynthetic sequence 1gtaaaacgac ggccagt
17217DNAartificial sequenceSynthetic sequence 2gaaacagcta tgacatg
17328DNAartificial sequenceSynthetic sequence 3atgtgctgct
aactggccgt cgttttac 28428DNAartificial sequenceSynthetic sequence
4gaaacagcta tgacatgcac aaancatt 28522DNAartificial
sequenceSynthetic sequence 5tagcagcaca taatggtttg tg
22622DNAartificial sequenceSynthetic sequence 6tagcagcacg
taaatattgg cg 22722RNAartificial sequenceSynthetic sequence
7uagcagcaca uaaugguuug ug 22822RNAartificial sequenceSynthetic
sequence 8uagcagcacg uaaauauugg cg 22918DNAartificial
sequenceSynthetic sequence 9cgtaaaacga cggccagt 181025DNAartificial
sequenceSynthetic sequence 10caagtcttga aacagctatg acatg
251120DNAartificial sequenceSynthetic sequence 11gtaaaacgac
ggccagttag 201220DNAartificial sequenceSynthetic sequence
12ccgaaacagc tatgacatgc 201328DNAartificial sequenceSynthetic
sequence 13atgtgctgct aactggccgt cgttttac 281428DNAartificial
sequenceSynthetic sequence 14gaaacagcta tgacatgcac aaaccatt
281528DNAartificial sequenceSynthetic sequence 15gaaacagcta
tgacatgnan aaaccatt 281628DNAartificial sequenceSynthetic sequence
16gaaacagcta tgacatgcac aaaccatt 281728DNAartificial
sequenceSynthetic sequence 17atgtgntgct aactggccgt cgttttac
281828DNAartificial sequenceSynthetic sequence 18gaaacagcta
tgacatgcac aaaccatt 281910DNAartificial sequenceSynthetic sequence
19agnanataat 102010DNAartificial sequenceSynthetic sequence
20agnanntaat 102110DNAartificial sequenceSynthetic sequence
21agnnnntaat 102210DNAartificial sequenceSynthetic sequence
22agnnnntnat 102328DNAartificial sequenceSynthetic sequence
23gtaaaacgac ggccagttag cagcanat 282428DNAartificial
sequenceSynthetic sequence 24gtaaaacgac ggccagttag cagcacat
282525DNAartificial sequenceSynthetic sequence 25gaaacagcta
tgacatgcac aaacc 252625DNAartificial sequenceSynthetic sequence
26gaaacagcta tgacatgnac aaanc 252727DNAartificial sequenceSynthetic
sequence 27gtaaaacgac ggccagttag cagcaca 272827DNAartificial
sequenceSynthetic sequence 28gtaaaacgac ggccagttag nagnaca
272925DNAartificial sequenceSynthetic sequence 29gaaacagcta
tgacatgnac aaanc 253024DNAartificial sequenceSynthetic sequence
30gaaacagcta tgacatgnac aaan 243124DNAartificial sequenceSynthetic
sequence 31gaaacagcta tgacatgnac aaan 243224DNAartificial
sequenceSynthetic sequence 32gaaacagcta tgacatgnac aaan
243324DNAartificial sequenceSynthetic sequence 33gaaacagcta
tgacatgnac aaan 243425DNAartificial sequenceSynthetic sequence
34gaaacagcta tgacatgnac aaanc 253524DNAartificial sequenceSynthetic
sequence 35gaaacagcta tgacatgnac aaan 243624DNAartificial
sequenceSynthetic sequence 36gaaacagcta tgacatgnac aaan
243724DNAartificial sequenceSynthetic sequence 37gaaacagcta
tgacatgnac aaan 243824DNAartificial sequenceSynthetic sequence
38gaaacagcta tgacatgnac aaan 243924DNAartificial sequenceSynthetic
sequence 39gaaacagcta tgacatgnac aaan 244023DNAartificial
sequenceSynthetic sequence 40gaaacagcta tgacatgnan aaa
234122DNAartificial sequenceSynthetic sequence 41gaaacagcta
tgacatgnan aa 224228DNAartificial sequenceSynthetic sequence
42gaaacagcta tgacatgnan aaannatt 284327DNAartificial
sequenceSynthetic sequence 43gaaacagcta tgacatgnan aaannat
274426DNAartificial sequenceSynthetic sequence 44gaaacagcta
tgacatgnan aaanna 264525DNAartificial sequenceSynthetic sequence
45gaaacagcta tgacatgnan aaann 254624DNAartificial sequenceSynthetic
sequence 46tatggaacgc ttcacgaatt tgcg 244720DNAartificial
sequenceSynthetic sequence 47cgcttcggca gcacatatac
204827DNAartificial sequenceSynthetic sequence 48tactgagtaa
tcgatatcna caaanca 274923DNAartificial sequenceSynthetic sequence
49caatttcaca caggatactg agt 235022DNAartificial sequenceSynthetic
sequence 50agcggataac tagcagcaca ta 225110DNAartificial
sequenceSynthetic sequence 51ttgtggatat 105228DNAartificial
sequenceSynthetic sequence 52caatttcaca caggatactg agtaatcg
285322RNAartificial sequenceSynthetic sequence 53ugagguagua
gguuguauag uu 225422RNAartificial sequenceSynthetic sequence
54ugagguagua gauuguauag uu 225521RNAartificial sequenceSynthetic
sequence 55ugagguagua guuuguacag u 215635DNAartificial
sequenceSynthetic sequence 56gttgaggatg gatggtagga tgagtaacta tanaa
355723DNAartificial sequenceSynthetic sequence 57agaatggatg
gatctgaggt agt 235821DNAartificial sequenceSynthetic sequence
58aggatggatg gtaggatgag t 215921DNAartificial sequenceSynthetic
sequence 59gttgaggatg gatggtagga t 216012DNAartificial
sequenceSynthetic sequence 60actatanaan nt 126112DNAartificial
sequenceSynthetic sequence 61actatanaan nt 126297DNAartificial
sequenceSynthetic sequence 62aagacagtag attgtatagt tatctcccag
tggtgggtgt gaccctaaaa ctatacaacc 60tactacctca tctccctata gtgagtcgta
ttaaatt 976327DNAartificial sequenceSynthetic sequence 63aatttaatac
gactcactat agggaga 276422RNAartificial sequenceSynthetic sequence
64ugagaugaag cacuguagcu ca 226536DNAartificial sequenceSynthetic
sequence 65ctgatagagc tttgcgtcca ctgattgagn tanagt
366641DNAartificial sequenceSynthetic sequence 66tgaatccgaa
tctaacgttg cctaggctga gatgaagcac t 416721DNAartificial
sequenceSynthetic sequence 67tgaatccgaa tctaacgttg c
216820DNAartificial sequenceSynthetic sequence 68ctgatagagc
tttgcgtcca 206921RNAartificial sequenceSynthetic sequence
69acucauccua ccauccaucc u 217020RNAartificial sequenceSynthetic
sequence 70acucauccua ccauccaucc 207116DNAartificial
sequenceSynthetic sequence 71ggatgagtaa ctatac 167283RNAHomo
sapiens 72ccuuggagua aaguagcagc acauaauggu uuguggauuu ugaaaaggug
caggccauau 60ugugcugccu caaaaauaca agg 837322RNAHomo sapiens
73uagcagcaca uaaugguuug ug 2274106RNAHomo sapiens 74gcgcagcgcc
cugucuccca gccugaggug cagcgcugca ucucugguca guugggaguc 60ugagaugaag
cacuguagcu caggaagaga gaaguuguuc ugcagc 1067522RNAHomo sapiens
75ugagaugaag cacuguagcu ca 2276106RNAHomo sapiens 76gcgcagcgcc
cugucuccca gccugaggug cagugcugca ucucugguca guugggaguc 60ugagaugaag
cacuguagcu caggaagaga gaaguuguuc ugcagc 1067722RNAHomo sapiens
77ugagaugaag cacuguagcu ca 227812DNAartificial sequenceSynthetic
sequence 78aaaaaaaaaa aa 127912DNAartificial sequenceSynthetic
sequence 79tttttttttt tt 12
* * * * *
References