U.S. patent application number 13/971507 was filed with the patent office on 2014-08-07 for extended dicer substrate agents and methods for the specific inhibition of gene expression.
This patent application is currently assigned to Dicerna Pharmaceuticals, Inc.. The applicant listed for this patent is Dicerna Pharmaceuticals, Inc.. Invention is credited to Bob Dale Brown.
Application Number | 20140221454 13/971507 |
Document ID | / |
Family ID | 42312114 |
Filed Date | 2014-08-07 |
United States Patent
Application |
20140221454 |
Kind Code |
A1 |
Brown; Bob Dale |
August 7, 2014 |
Extended Dicer Substrate Agents and Methods for the Specific
Inhibition of Gene Expression
Abstract
The invention provides compositions and methods for reducing
expression of a target gene in a cell, involving contacting a cell
with an isolated double stranded nucleic acid (dsNA) in an amount
effective to reduce expression of a target gene in a cell. The
dsNAs of the invention possess a pattern of deoxyribonucleotides
(in most embodiments, the pattern comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair) designed to
direct the site of Dicer enzyme cleavage within the dsNA molecule.
Deoxyribonucleotides of the dsNA molecules of the invention are
located within a region of the dsNA that can be excised via Dicer
cleavage to generate an active siRNA agent that no longer contains
the deoxyribonucleotide pattern (e.g.,
deoxyribonucleotide-deoxyribonucleotide base pairs). Such
DNA-extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to
be more effective RNA inhibitory agents than corresponding double
stranded RNA-extended DsiRNAs. DsiRNA agents were also found to
tolerate guide strand mismatches.
Inventors: |
Brown; Bob Dale;
(Millington, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dicerna Pharmaceuticals, Inc. |
Watertown |
MA |
US |
|
|
Assignee: |
Dicerna Pharmaceuticals,
Inc.
Watertown
MA
|
Family ID: |
42312114 |
Appl. No.: |
13/971507 |
Filed: |
August 20, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12642371 |
Dec 18, 2009 |
8513207 |
|
|
13971507 |
|
|
|
|
61138946 |
Dec 18, 2008 |
|
|
|
61166227 |
Apr 2, 2009 |
|
|
|
61173505 |
Apr 28, 2009 |
|
|
|
61173514 |
Apr 28, 2009 |
|
|
|
61173521 |
Apr 28, 2009 |
|
|
|
61173525 |
Apr 28, 2009 |
|
|
|
61173532 |
Apr 28, 2009 |
|
|
|
61173538 |
Apr 28, 2009 |
|
|
|
61173544 |
Apr 28, 2009 |
|
|
|
61173549 |
Apr 28, 2009 |
|
|
|
61173554 |
Apr 28, 2009 |
|
|
|
61173556 |
Apr 28, 2009 |
|
|
|
61173558 |
Apr 28, 2009 |
|
|
|
61173563 |
Apr 28, 2009 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 435/91.5; 536/24.5; 536/25.3 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 2310/321 20130101; C12N 2310/533 20130101; A61P 43/00
20180101; C12N 15/1135 20130101; A61K 31/713 20130101; C12N
2310/342 20130101; C12N 15/113 20130101; C12N 2310/322 20130101;
C12N 2320/52 20130101; C12N 2310/321 20130101; C12N 2310/322
20130101; C12N 15/111 20130101; C12N 2310/344 20130101; C12N
2310/3531 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/44.A ;
536/24.5; 435/375; 536/25.3; 435/91.5 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1-106. (canceled)
107. An isolated double stranded nucleic acid (dsNA) comprising a
first oligonucleotide strand having a 5' terminus and a 3' terminus
and a second oligonucleotide strand having a 5' terminus and a 3'
terminus, wherein: said first strand is 31 to 60 nucleotide
residues in length, said second strand is 31 to 60 nucleotide
residues in length; said second strand anneals to said first
strand, said second strand comprises a 3' overhang of unmodified
and modified nucleotides, said second strand is complementary to a
sequence of a target mRNA of a target gene; and said second strand
is sufficiently complementary to a target RNA to reduce target gene
expression when said double stranded nucleic acid is introduced
into a mammalian cell.
108. The isolated dsNA of claim 107, wherein the overhang of the
second strand is conjugated to a non-nucleic acid moiety.
109. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety is a peptide or an organic compound.
110. The isolated dsNA of claim 109, wherein the organic compound
is a dye.
111. The isolated dsNA of claim 110, wherein the organic compound
is cholesterol.
112. The isolated dsNA of claim 107, in combination with a
sugar
113. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety increases cellular uptake.
114. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety increase cellular targeting of the dsNA.
115. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety increases stability of the dsNA.
116. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety facilitates tracking of the dsNA.
117. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety increases the binding affinity of the dsNA.
118. The isolated dsNA of claim 108, wherein the non-nucleic acid
moiety decreases the immunogenicity of the dsNA.
119. The isolated dsNA of claim 107, wherein the modified
nucleotide is a phosphorothioate-modified nucleotide residue
(PS-NA).
120. The isolated dsNA of claim 107, wherein the modified
nucleotide is a peptide nucleic acid (PNA).
121. The isolated double stranded nucleic acid of claim 107,
wherein the modified nucleotide comprises a modified base and/or a
modified sugar moiety.
122. The isolated double stranded nucleic acid of claim 107,
wherein the modified nucleotide is selected from the group
consisting of: dideoxyribonucleotides, acyclonucleotides
3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxyinosine (ddI), 2',3'-dideoxy-3'-thiacytidine (3TC),
2',3'-didehydro-2',3'-dideoxythymidine (d4T), the monophosphate
nucleotides of 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T).
123. The isolated double stranded nucleic acid of claim 121,
wherein the modified sugar moiety is selected from the group
consisting of 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl,
2'-O[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge,
4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino and
2'-O--(N-methylcarbamate).
124. The isolated double stranded nucleic acid of claim 107,
wherein at least one internucleoside linkage is modified.
125. The isolated double stranded nucleic acid of claim 124,
wherein the internucleoside linkage modification is selected from
the group consisting of: methylphosphonate, phosphorothioate, and
phosphotriester modifications.
126. The isolated double stranded nucleic acid of claim 107,
further comprising a fluorescein.
127. The isolated double stranded nucleic acid of claim 107,
wherein the modified nucleotide comprises an LNA modification.
128. The isolated dsNA of claim 107, wherein the modified
nucleotide is selected from the group consisting of 2'-O-methyl,
2'-methoxyethoxy, 2'-fluoro, 2'-allyl,
2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge,
4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino and
2'-O--(N-methlycarbamate).
129. The isolated dsNA of claim 107, wherein the modified
nucleotide of said 3' overhang is a 2'-O-methyl ribonucleotide.
130. The isolated dsNA of claim 107, wherein all nucleotides of
said 3' overhang are modified nucleotides.
131. The isolated dsNA of claim 107, wherein one or both of said
first and second strands comprises a 5' phosphate.
132. The isolated dsNA of claim 107, wherein the 3' overhang is two
nucleotides in length and wherein said modified nucleotide of said
3' overhang is a 2'-O-methyl modified ribonucleotide.
133. The isolated dsNA of claim 107, wherein the first strand has a
nucleotide sequence that is at least 80%, 90%, 95% or 100%
complementary to the second strand nucleotide sequence.
134. The isolated dsNA of claim 107, wherein a nucleotide of said
second or first oligonucleotide strand is substituted with a
modified nucleotide that directs the orientation of Dicer
cleavage.
135. The isolated dsNA of claim 107, wherein the 3' terminus of
said first strand and the 5' terminus of said second strand are
joined by a chemical linker.
136. The isolated dsNA of claim 107, wherein the dsNA is a dicer
substrate.
137. The isolated dsNA of claim 107, wherein the dsNA is a Dicer
substrate that, upon endogenous Dicer processing, yields
double-stranded nucleic acids of 19-23 nucleotides in length
capable of reducing target gene expression in a mammalian cell.
138. The isolated dsNA of claim 107 comprising a phosphate backbone
modification selected from the group consisting of a phosphonate, a
phosphorothioate and a phosphotriester.
139. The isolated dsNA of claim 107, wherein the dsNA reduces
target gene expression in a mammalian cell in vitro by an amount
(expressed by %) selected from the group consisting of at least
10%, at least 50% and at least 80-90%.
140. The isolated dsNA of claim 107, wherein the dsNA, when
introduced into a mammalian cell, reduces target gene expression by
at least 70% when transfected into said cell at a concentration
selected from the group consisting of 1 nM or less, 200 pM or less,
100 pM or less, 50 pM or less, 20 pM or less and 10 pM or less.
141. The isolated dsNA of claim 107, wherein at least 50% of the
ribonucleotide residues of said dsNA are unmodified
ribonucleotides.
142. The isolated dsNA of claim 107, wherein at least 50% of the
ribonucleotide residues of said second strand are unmodified
ribonucleotides.
143. The isolated dsNA of claim 107, wherein the second
oligonucleotide strand, starting from the nucleotide residue of
said second strand that is complementary to the 5' terminal
nucleotide residue of said first oligonucleotide strand and toward
the 5' end of said second strand, comprises alternating modified
and unmodified nucleotide residues.
144. The isolated dsNA of claim 107, wherein the first strand is of
a length selected from the group consisting of: 33 to 49
nucleotides, 35 to 49 nucleotides and 37 to 49 nucleotides.
145. The isolated dsNA of claim 107, wherein the second strand
possesses a 3' overhang of 1-4 nucleotides in length.
146. The isolated dsNA of claim 145, wherein the 3' overhang is 1-3
nucleotides in length.
147. The isolated dsNA of claim 145, wherein the 3' overhang is 1-2
nucleotides in length.
148. A method for reducing expression of a target gene in a cell,
comprising: contacting a cell with an isolated double stranded NA
(dsNA) as claimed in claim 107 in an amount effective to reduce
expression of a target gene in a cell in comparison to a reference
dsRNA.
149. A method for reducing expression of a target gene in an
animal, comprising: treating an animal with an isolated double
stranded NA (dsNA) as claimed in claim 107 in an amount effective
to reduce expression of a target gene in a cell of the animal in
comparison to a reference dsRNA.
150. The method of claim 149, wherein the dsNA possesses enhanced
pharmacokinetics when compared to an appropriate control
DsiRNA.
151. The method of claim 149, wherein the dsNA possesses enhanced
pharmacodynamics when compared to an appropriate control
DsiRNA.
152. The method of claim 149, wherein the dsNA possesses reduced
toxicity when compared to an appropriate control DsiRNA.
153. The method of claim 149, wherein the dsNA possesses enhanced
intracellular uptake when compared to an appropriate control
DsiRNA.
154. A pharmaceutical composition for reducing expression of a
target gene in a cell of a subject comprising the isolated double
stranded NA (dsNA) of claim 107 in an amount effective to reduce
expression of a target gene in a cell in comparison to a reference
dsRNA and a pharmaceutically acceptable carrier.
155. A method of synthesizing the double stranded NA (dsNA) of
claim 107, comprising chemically or enzymatically synthesizing said
dsNA.
156. A kit comprising the dsNA of claim 107 and instructions for
its use.
157. An isolated double stranded nucleic acid (dsNA) comprising a
first oligonucleotide strand having a 5' terminus and a 3' terminus
and a second oligonucleotide strand having a 5' terminus and a 3'
terminus, wherein: the first strand is 31 to 60 nucleotide residues
in length, wherein starting from the first nucleotide (position 1)
at the 5' terminus of the first strand, positions 1 to 23 of said
first strand are ribonucleotides; said second strand is 31 to 60
nucleotide residues in length and comprises 23 consecutive
ribonucleotides that base pair with the ribonucleotides of
positions 1 to 23 of said first strand to form a duplex; the 5'
terminus of said first strand and the 3' terminus of said second
strand form a structure selected from the group consisting of a
blunt end and a 1-4 nucleotide 3' overhang; the 3' terminus of said
first strand and the 5' terminus of said second strand form a
duplexed blunt end; at least one of positions 24 to the 3' terminal
nucleotide residue of said first strand is a deoxyribonucleotide
that base pairs with a deoxyribonucleotide of said second strand;
and said second strand is sufficiently complementary to a target
RNA along at least 19 ribonucleotides of said second strand length
to reduce target gene expression when said double stranded nucleic
acid is introduced into a mammalian cell.
158. The isolated dsNA of claim 157, wherein two or more nucleotide
residues of positions 24 to the 3' terminal nucleotide residue of
said first strand are deoxyribonucleotides that base pair with
deoxyribonucleotides of said second strand.
159. The isolated dsNA of claim 157, wherein four or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
160. The isolated dsNA of claim 157, wherein six or more nucleotide
residues of positions 24 to the 3' terminal nucleotide residue of
said first strand are deoxyribonucleotides that base pair with
deoxyribonucleotides of said second strand.
161. The isolated dsNA of claim 157, wherein eight or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
162. The isolated dsNA of claim 157, wherein ten or more nucleotide
residues of positions 24 to the 3' terminal nucleotide residue of
said first strand are deoxyribonucleotides that base pair with
deoxyribonucleotides of said second strand.
163. The isolated dsNA of claim 157, wherein twelve or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
164. The isolated dsNA of claim 157, wherein fourteen or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
165. The isolated dsNA of claim 157, wherein sixteen or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
166. The isolated dsNA of claim 157, wherein eighteen or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
167. The isolated dsNA of claim 157, wherein twenty or more
nucleotide residues of positions 24 to the 3' terminal nucleotide
residue of said first strand are deoxyribonucleotides that base
pair with deoxyribonucleotides of said second strand.
168. The isolated dsNA of claim 158, wherein the
deoxyribonucleotides of said first strand that base pair with said
deoxyribonucleotides of said second strand are consecutive
deoxyribonucleotides.
169. The isolated dsNA of claim 157, wherein two or more
consecutive nucleotide residues of positions 24 to 27 of said first
strand are deoxyribonucleotides that base pair with
deoxyribonucleotides of said second strand.
170. The isolated dsNA of claim 157, wherein each of positions 24
and 25 of said first strand is a deoxyribonucleotide that base
pairs with a deoxyribonucleotide of said second strand.
171. The isolated dsNA of claim 157, wherein each nucleotide
residue of positions 24 to 27 of said first oligonucleotide strand
is a deoxyribonucleotide that base pairs with a deoxyribonucleotide
of said second strand.
172. The isolated dsNA of claim 157, wherein each nucleotide
residue of positions 24 to 29 of said first oligonucleotide strand
is a deoxyribonucleotide that base pairs with a deoxyribonucleotide
of said second strand.
173. The isolated dsNA of claim 157, wherein each nucleotide
residue of positions 24 to 31 of said first oligonucleotide strand
is a deoxyribonucleotide that base pairs with a deoxyribonucleotide
of said second strand.
174. The isolated dsNA of claim 157, wherein positions 24 to the 3'
terminal nucleotide residue of said first strand comprise between
one and 25 deoxyribonucleotide residues, wherein each of said
deoxyribonucleotide residues of said first strand base pairs with a
deoxyribonucleotide of said second strand.
175. The isolated dsNA of claim 157, wherein the
deoxyribonucleotides of said second strand that base pair with said
deoxyribonucleotides of said first strand are not complementary to
said target RNA.
176. The isolated dsNA of claim 157, wherein the second strand
possesses a 3' overhang of 1-4 nucleotides in length.
177. The isolated dsNA of claim 176, wherein the 3' overhang is 1-3
nucleotides in length.
178. The isolated dsNA of claim 176, wherein the 3' overhang is 1-2
nucleotides in length.
179. The isolated dsNA of claim 176, wherein the nucleotides of
said 3' overhang comprise a modified nucleotide.
180. The isolated dsNA of claim 179, wherein the modified
nucleotide residue is selected from the group consisting of
2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl,
2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge,
4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino and
2'-O--(N-methlycarbamate).
181. The isolated dsNA of claim 179, wherein the modified
nucleotide of said 3' overhang is a 2'-O-methyl ribonucleotide.
182. The isolated dsNA of claim 179, wherein all nucleotides of
said 3' overhang are modified nucleotides.
183. The isolated dsNA of claim 157, wherein one or both of said
first and second strands comprises a 5' phosphate.
184. The isolated dsNA of claim 179, wherein the 3' overhang is two
nucleotides in length and wherein said modified nucleotide of said
3' overhang is a 2'-O-methyl modified ribonucleotide.
185. The isolated dsNA of claim 176, wherein the second strand,
starting from the nucleotide residue of said second strand that is
complementary to the 5' terminal nucleotide residue of said first
oligonucleotide strand (position 1*), comprises unmodified
nucleotide residues at all positions from position 20* to the 5'
terminal residue of said second strand.
186. The isolated dsNA of claim 157, wherein starting from the
first nucleotide (position 1*) at the 3' terminus of said first
strand, position 1*, 2* and/or 3* is a deoxyribonucleotide.
187. The isolated dsNA of claim 186, wherein the first strand
comprises a deoxyribonucleotide at position 1* from the 3' terminus
of said first strand.
188. The isolated dsNA of claim 186, wherein the first strand
comprises deoxyribonucleotides at positions 1* and 2* from the 3'
terminus of said first strand.
189. The isolated dsNA of claim 157, wherein the ultimate and
penultimate residues of said 3' terminus of said first strand are
deoxyribonucleotides and the ultimate and penultimate residues of
said 5' terminus of said second strand are ribonucleotides.
190. The isolated dsNA of claim 157, wherein a nucleotide of said
second or first oligonucleotide strand is substituted with a
modified nucleotide that directs the orientation of Dicer
cleavage.
191. The isolated dsNA of claim 157, wherein starting from the
first nucleotide (position 1*) at the 3' terminus of said second
strand, positions 1*, 2*, and 3* from the 3' terminus of said
second strand are modified nucleotides.
192. The isolated dsNA of claim 157, wherein the first strand has a
nucleotide sequence that is at least 80%, 90%, 95% or 100%
complementary to the second strand nucleotide sequence.
193. The isolated dsNA of claim 157, wherein the 3' terminus of
said first strand and the 5' terminus of said second strand are
joined by a chemical linker.
194. The isolated dsNA of claim 157, wherein the dsNA is a Dicer
substrate.
195. The isolated dsNA of claim 157, wherein the dsNA is a Dicer
substrate that, upon endogenous Dicer processing, yields
double-stranded nucleic acids of 19-23 nucleotides in length
capable of reducing target gene expression in a mammalian cell.
196. The isolated dsNA of claim 157 comprising a phosphate backbone
modification selected from the group consisting of a phosphonate, a
phosphorothioate and a phosphotriester.
197. The isolated dsNA of claim 157, wherein the dsNA reduces
target gene expression in a mammalian cell in vitro by an amount
(expressed by %) selected from the group consisting of at least
10%, at least 50% and at least 80-90%.
198. The isolated dsNA of claim 157, wherein the dsNA, when
introduced into a mammalian cell, reduces target gene expression in
comparison to a reference dsRNA that does not possess a
deoxyribonucleotide-deoxyribonucleotide base pair.
199. The isolated dsNA of claim 157, wherein the dsNA, when
introduced into a mammalian cell, reduces target gene expression by
at least 70% when transfected into said cell at a concentration
selected from the group consisting of 1 nM or less, 200 pM or less,
100 pM or less, 50 pM or less, 20 pM or less and 10 pM or less.
200. The isolated dsNA of claim 157, wherein at least 50% of the
ribonucleotide residues of said dsNA are unmodified
ribonucleotides.
201. The isolated dsNA of claim 157, wherein at least 50% of the
ribonucleotide residues of said second strand are unmodified
ribonucleotides.
202. The isolated dsNA of claim 157, wherein the at least one of
positions 24 to the 3' terminal nucleotide residue of said first
strand that is a deoxyribonucleotide that base pairs with a
deoxyribonucleotide of said second strand is an unmodified
deoxyribonucleotide.
203. The isolated dsNA of claim 202, wherein both said at least one
of positions 24 to the 3' terminal nucleotide residue of said first
strand that is a deoxyribonucleotide that base pairs with a
deoxyribonucleotide of said second strand and said
deoxyribonucleotide of said second strand are unmodified
deoxyribonucleotides.
204. The isolated dsNA of claim 157, wherein at least 50% of all
deoxyribonucleotides of said dsNA are unmodified
deoxyribonucleotides.
205. The isolated dsNA of claim 157, wherein the second
oligonucleotide strand, starting from the nucleotide residue of
said second strand that is complementary to the 5' terminal
nucleotide residue of said first oligonucleotide strand and toward
the 5' end of said second strand, comprises alternating modified
and unmodified nucleotide residues.
206. The isolated dsNA of claim 157, wherein at least one of
positions 24 to the 3' terminal nucleotide residue of said first
strand is a phosphorothioate-modified nucleotide (PS-NA) That base
pairs with a deoxyribonucleotide of said second strand
207. The isolated dsNA of claim 157, wherein the target RNA is
KRAS.
208. A method for reducing expression of a target gene in a cell,
comprising: contacting a cell with an isolated double stranded NA
(dsNA) as claimed in claim 157 in an amount effective to reduce
expression of a target gene in a cell in comparison to a reference
dsRNA.
209. A method for reducing expression of a target gene in an
animal, comprising: treating an animal with an isolated double
stranded NA (dsNA) as claimed in claim 157 in an amount effective
to reduce expression of a target gene in a cell of the animal in
comparison to a reference dsRNA.
210. The method of claim 209, wherein the dsNA possesses enhanced
pharmacokinetics when compared to an appropriate control
DsiRNA.
211. The method of claim 209, wherein the dsNA possesses enhanced
pharmacodynamics when compared to an appropriate control
DsiRNA.
212. The method of claim 209, wherein the dsNA possesses reduced
toxicity when compared to an appropriate control DsiRNA.
213. The method of claim 209, wherein the dsNA possesses enhanced
intracellular uptake when compared to an appropriate control
DsiRNA.
214. A pharmaceutical composition for reducing expression of a
target gene in a cell of a subject comprising the isolated double
stranded NA (dsNA) of claim 157 in an amount effective to reduce
expression of a target gene in a cell in comparison to a reference
dsRNA and a pharmaceutically acceptable carrier.
215. A method of synthesizing the double stranded NA (dsNA) of
claim 157, comprising chemically or enzymatically synthesizing said
dsNA.
216. A kit comprising the dsNA of claim 157 and instructions for
its use.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a Continuation of application
Ser. No. 12/642,371 filed Dec. 18, 2009, which is related to and
claims priority under 35 U.S.C. .sctn.119(e) to the following
applications: U.S. provisional patent application No. 61/138,946,
filed Dec. 18, 2008; U.S. provisional patent application No.
61/166,227, filed Apr. 2, 2009; U.S. provisional patent application
No. 61/173,505, filed Apr. 28, 2009; U.S. provisional patent
application No. 61/173,514, filed Apr. 28, 2009; U.S. provisional
patent application No. 61/173,521, filed Apr. 28, 2009; U.S.
provisional patent application No. 61/173,525, filed Apr. 28, 2009;
U.S. provisional patent application No. 61/173,532, filed Apr. 28,
2009; U.S. provisional patent application No. 61/173,538, filed
Apr. 28, 2009; U.S. provisional patent application No. 61/173,544,
filed Apr. 28, 2009; U.S. provisional patent application No.
61/173,549, filed Apr. 28, 2009; U.S. provisional patent
application No. 61/173,554, filed Apr. 28, 2009; U.S. provisional
patent application No. 61/173,556, filed Apr. 28, 2009; U.S.
provisional patent application No. 61/173,558, filed Apr. 28, 2009;
and U.S. provisional patent application No. 61/173,563, filed Apr.
28, 2009. The entire teachings of the above applications are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Double-stranded RNA (dsRNA) agents possessing strand lengths
of 25 to 35 nucleotides have been described as effective inhibitors
of target gene expression in mammalian cells (Rossi et al., U.S.
Patent Publication Nos. 2005/0244858 and 2005/0277610). dsRNA
agents of such length are believed to be processed by the Dicer
enzyme of the RNA interference (RNAi) pathway, leading such agents
to be termed "Dicer substrate siRNA" ("DsiRNA") agents. Certain
modified structures of DsiRNA agents were previously described
(Rossi et al., U.S. Patent Publication No. 2007/0265220).
[0003] While robust, sequence-specific target gene silencing
efficacy has been identified for 25-35 nucleotide length dsRNA
agents, a need exists for improved design of such agents, including
design of DsiRNA agents possessing enhanced in vitro and in vivo
efficacy.
BRIEF SUMMARY OF THE INVENTION
[0004] The present invention is based, at least in part, upon the
surprising discovery that double stranded nucleic acid agents
having strand lengths in the range of 27-39 nucleotides in length
that possess base paired deoxyribonucleotides either at or near the
3' terminus of the sense strand/5' terminus of the antisense strand
or at or near the 5' terminus of the sense strand/3' terminus of
the antisense strand are effective RNA interference agents. Indeed,
the instant invention relates to the demonstration that inclusion
of base paired deoxyribonucleotides within a region of a Dicer
substrate siRNA ("DsiRNAs") that is excised from a resultant active
siRNA via Dicer enzyme cleavage, results in an effective inhibitory
agent. Inclusion of one or more base paired deoxyribonucleotides
within this region of a DsiRNA can impart certain advantages to
such a modified DsiRNA molecule, including, e.g., enhanced efficacy
(including enhanced potency and/or improved duration of effect),
display of a recognition domain for DNA-binding molecules, and
other attributes associated with a DNA:DNA duplex region. Indeed,
such double stranded DNA:DNA-extended DsiRNA agents were
demonstrated to possess enhanced efficacy, especially including
improved potency, relative to corresponding double stranded
RNA:DNA- or RNA:RNA-extended DsiRNA agents.
[0005] Among the advantages of the instant invention, the
surprising discovery that DNA-extended DsiRNA agents do not exhibit
decreased efficacy as duplex length increases allows for the
generation of DsiRNAs that remain effective RNA inhibitory agents
while providing greater spacing for, e.g., attachment of DsiRNAs to
additional functional groups, inclusion/patterning of stabilizing
modifications (e.g., PS-NA moieties) or other forms of
modifications capable of adding further functionality and/or
enhancing, e.g., pharmacokinetics, pharmacodynamics or
biodistribution of such agents, as compared to dsRNA agents of
corresponding length that do not contain such double stranded
DNA-extended domains. The effect of such dsDNA-extension regions
appears not to result from a stabilizing activity inherent in dsDNA
regions, but rather appears to be attributable to the ability of
specifically localized deoxyribonucleotide residues (either located
3' of the projected Dicer cleavage site of the first strand and
correspondingly 5' of the projected Dicer cleavage site of the
second strand or located 5' of the projected Dicer cleavage site of
the first strand and correspondingly 3' of the projected Dicer
cleavage site of the second strand) to direct Dicer cleavage such
that a preferred cleavage product and/or population of cleavage
products is generated and/or is made more prevalent.
[0006] Thus, in certain aspects, the instant invention allows for
design of RNA inhibitory agents possessing enhanced efficacies at
greater length (via more precise direction of the location of Dicer
cleavage events) than previously described RNA inhibitory agents,
thereby allowing for generation of dsRNA-containing agents
possessing enhanced efficacy, delivery, pharmacokinetic,
pharmacodynamic and biodistribution attributes, as well as improved
ability, e.g., to be successfully formulated, to be attached to an
active drug molecule and/or payload, to be attached to another
active nucleic acid molecule, to be attached to a detection
molecule, to possess (e.g., multiple) stabilizing modifications,
etc.
[0007] In one aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first and a second
oligonucleotide strand, where the first strand is 27 to 49
nucleotide residues in length, and starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides; where
the second strand is 27 to 53 nucleotide residues in length and
includes 23 consecutive ribonucleotides that base pair with the
ribonucleotides of positions 1 to 23 of the first strand to form a
duplex; the 5' terminus of the first strand and the 3' terminus of
the second strand form a blunt end or a 1-4 nucleotide 3' overhang;
the 3' terminus of the first strand and the 5' terminus of the
second strand form a blunt end; at least one of positions 24 to the
3' terminal nucleotide residue of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand; and the second strand is sufficiently
complementary to a target RNA along at least 19 ribonucleotides of
the second strand length to reduce target gene expression when the
dsNA is introduced into a mammalian cell.
[0008] In one embodiment, two or more nucleotide residues of
positions 24 to the 3' terminal nucleotide residue of the first
strand are deoxyribonucleotides that base pair with
deoxyribonucleotides of the second strand. In another embodiment,
four or more nucleotide residues of positions 24 to the 3' terminal
nucleotide residue of the first strand are deoxyribonucleotides
that base pair with deoxyribonucleotides of the second strand.
Optionally, six or more nucleotide residues, eight or more
nucleotide residues, ten or more nucleotide residues, twelve or
more nucleotide residues, fourteen or more nucleotide residues,
sixteen or more nucleotide residues, eighteen or more nucleotide
residues, or twenty or more nucleotide residues of positions 24 to
the 3' terminal nucleotide residue of the first strand are
deoxyribonucleotides that base pair with deoxyribonucleotides of
the second strand. In one embodiment, the deoxyribonucleotides of
the first strand that base pair with the deoxyribonucleotides of
the second strand are consecutive deoxyribonucleotides. In another
embodiment, two or more consecutive nucleotide residues of
positions 24 to 27 of the first strand are deoxyribonucleotides
that base pair with deoxyribonucleotides of the second strand.
Optionally, each of positions 24 and 25 of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand. In a related embodiment, each nucleotide residue
of positions 24 to 27 of the first oligonucleotide strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand.
[0009] In one embodiment, the first strand is 29 to 49 nucleotides
in length. In another embodiment, each nucleotide residue of
positions 24 to 29 of the first oligonucleotide strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand. In a further embodiment, the first strand is 31
to 49 nucleotides in length. Optionally, each nucleotide residue of
positions 24 to 31 of the first oligonucleotide strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand. In an additional embodiment, the first strand is
33 to 49 nucleotides in length. Optionally, each nucleotide residue
of positions 24 to 33 of the first oligonucleotide strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand. In another embodiment, the first strand is 35 to
49 nucleotides in length. Optionally, each nucleotide residue of
positions 24 to 35 of the first oligonucleotide strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand. In another embodiment, the first strand is 37 to
49 nucleotides in length. Optionally, each nucleotide residue of
positions 24 to 37 of the first oligonucleotide strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand.
[0010] In an additional embodiment, positions 24 to the 3' terminal
nucleotide residue of the first strand include between one and 25
deoxyribonucleotide residues, and each of the deoxyribonucleotide
residues of the first strand base pairs with a deoxyribonucleotide
of the second strand.
[0011] In one embodiment, the deoxyribonucleotides of the second
strand that base pair with the deoxyribonucleotides of the first
strand are not complementary to the target RNA.
[0012] In another embodiment, the second strand possesses a 3'
overhang of 1-4 nucleotides in length. Optionally, the 3' overhang
is 1-3 nucleotides in length, or, as a further option, 1-2
nucleotides in length. In one embodiment, the nucleotides of the 3'
overhang include a modified nucleotide. Optionally, the modified
nucleotide residue is 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro,
2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio,
4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino or
2'-O--(N-methlycarbamate). In one embodiment, the modified
nucleotide of the 3' overhang is a 2'-O-methyl ribonucleotide. In a
further embodiment, all nucleotides of the 3' overhang are modified
nucleotides. In a further embodiment, the 3' overhang is two
nucleotides in length and the modified nucleotide of the 3'
overhang is a 2'-O-methyl modified ribonucleotide. In another
embodiment, the second strand, starting from the nucleotide residue
of the second strand that is complementary to the 5' terminal
nucleotide residue of the first oligonucleotide strand, possesses
unmodified nucleotide residues at all positions from position 20 to
the 5' terminal residue of the second strand.
[0013] In another embodiment, one or both of the first and second
strands includes a 5' phosphate.
[0014] In one embodiment, starting from the first nucleotide
(position 1*) at the 3' terminus of the first strand, position 1*,
2* and/or 3* is a deoxyribonucleotide. In another embodiment, the
first strand has a deoxyribonucleotide at position 1* from the 3'
terminus of the first strand. In a related embodiment, the first
strand has deoxyribonucleotides at positions 1* and 2* from the 3'
terminus of the first strand.
[0015] In another embodiment, the ultimate and penultimate residues
of the 3' terminus of the first strand are deoxyribonucleotides and
the ultimate and penultimate residues of the 5' terminus of the
second strand are ribonucleotides.
[0016] In one embodiment, a nucleotide of the second or first
oligonucleotide strand is substituted with a modified nucleotide
that directs the orientation of Dicer cleavage. In an additional
embodiment, starting from the first nucleotide (position 1) at the
3' terminus of the second strand, positions 1, 2, and 3 from the 3'
terminus of the second strand are modified nucleotides.
[0017] In one embodiment, the first strand has a nucleotide
sequence that is at least 80%, 90%, 95% or 100% complementary to
the second strand nucleotide sequence.
[0018] In another embodiment, the 3' terminal nucleotide residue of
the first strand is attached to the 5' terminal nucleotide residue
of the second strand by a nucleotide sequence. In one embodiment,
the nucleotide sequence that attaches the 3' terminal nucleotide
residue of the first strand and the 5' terminal nucleotide residue
of the second strand includes a tetraloop. In another embodiment,
the nucleotide sequence that attaches the 3' terminal nucleotide
residue of the first strand and the 5' terminal nucleotide residue
of the second strand includes a hairpin.
[0019] In a further embodiment, the first and second strands are
joined by a chemical linker. In a related embodiment, the 3'
terminus of the first strand and the 5' terminus of the second
strand are joined by a chemical linker.
[0020] In one embodiment, the dsNA is cleaved endogenously in a
mammalian cell by Dicer. In another embodiment, the dsNA is cleaved
endogenously in a mammalian cell to produce a double-stranded
nucleic acid of 19-23 nucleotides in length that reduces target
gene expression.
[0021] In an additional embodiment, the dsNA has a phosphate
backbone modification that is a phosphonate, a phosphorothioate or
a phosphotriester.
[0022] In a further embodiment, the dsNAreduces target gene
expression in a mammalian cell in vitro by at least 10%, at least
50% or at least 80-90%.
[0023] In one embodiment, the dsNA, when introduced into a
mammalian cell, reduces target gene expression in comparison to a
reference dsRNA that does not possess a
deoxyribonucleotide-deoxyribonucleotide base pair.
[0024] In an additional embodiment, the dsNA, when introduced into
a mammalian cell, reduces target gene expression by at least 70%
when transfected into the cell at a concentration of 1 nM or less,
200 pM or less, 100 pM or less, 50 pM or less, 20 pM or less, or 10
pM or less.
[0025] In another embodiment, at least 50% of the ribonucleotide
residues of the dsNA are unmodified ribonucleotides. In an
additional embodiment, at least 50% of the ribonucleotide residues
of the second strand are unmodified ribonucleotides.
[0026] In one embodiment, at least one of positions 24 to the 3'
terminal nucleotide residue of the first strand that is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand is an unmodified deoxyribonucleotide. In a
related embodiment, both the at least one of positions 24 to the 3'
terminal nucleotide residue of the first strand that is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand and the deoxyribonucleotide of the second strand
are unmodified deoxyribonucleotides. In another embodiment, at
least 50% of all deoxyribonucleotides of the dsNA are unmodified
deoxyribonucleotides.
[0027] In one embodiment, the second oligonucleotide strand,
starting from the nucleotide residue of the second strand that is
complementary to the 5' terminal nucleotide residue of the first
oligonucleotide strand, includes alternating modified and
unmodified nucleotide residues.
[0028] In certain embodiments, the target RNA is KRAS.
[0029] In another aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first and a second
oligonucleotide strand, where the first strand: is 27 nucleotide
residues in length and the second strand is 27-31 nucleotide
residues in length; starting from the first nucleotide (position 1)
at the 5' terminus of the first strand, positions 1 to 23 of the
first strand are ribonucleotides that base pair with
ribonucleotides of the second strand to form a duplex; each of
positions 24 to 27 of the first strand is a deoxyribonucleotide
that base pairs with a deoxyribonucleotide of the second strand;
the 3' terminus of the first strand and the 5' terminus of the
second strand form a blunt end; and the second strand is
sufficiently complementary to a target RNA along at least 19
ribonucleotides of the second strand length to reduce target gene
expression when the double stranded nucleic acid is introduced into
a mammalian cell.
[0030] In an additional aspect, the invention provides an isolated
double stranded nucleic acid (dsNA) having a first oligonucleotide
strand and a second oligonucleotide strand, where the first strand
is 29 nucleotide residues in length and the second strand is 29-33
nucleotide residues in length, where starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides that base
pair with ribonucleotides of the second strand to form a duplex;
each of positions 24 to 29 of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand; the 3' terminus of the first strand and the 5'
terminus of the second strand form a blunt end; and the second
strand is sufficiently complementary to a target RNA along at least
19 ribonucleotides of the second strand length to reduce target
gene expression when the double stranded nucleic acid is introduced
into a mammalian cell.
[0031] In another aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first oligonucleotide strand
and a second oligonucleotide strand, where the first strand is 31
nucleotide residues in length and the second strand is 31-35
nucleotide residues in length, and starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides that base
pair with ribonucleotides of the second strand to form a duplex;
each of positions 24 to 31 of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand to form a duplex; the 3' terminus of the first
strand and the 5' terminus of the second strand form a blunt end;
and the second strand is sufficiently complementary to a target RNA
along at least 19 ribonucleotides of the second strand length to
reduce target gene expression when the double stranded nucleic acid
is introduced into a mammalian cell.
[0032] In one aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first oligonucleotide strand
and a second oligonucleotide strand, where the first strand is 33
nucleotide residues in length and the second strand is 33-37
nucleotide residues in length, where starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides that base
pair with ribonucleotides of the second strand to form a duplex;
each of positions 24 to 33 of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand to form a duplex; the 3' terminus of the first
strand and the 5' terminus of the second strand form a blunt end;
and the second strand is sufficiently complementary to a target RNA
along at least 19 ribonucleotides of the second strand length to
reduce target gene expression when the double stranded nucleic acid
is introduced into a mammalian cell.
[0033] In another aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first oligonucleotide strand
and a second oligonucleotide strand, where the first strand is 35
nucleotide residues in length and the second strand is 35-39
nucleotide residues in length, where starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides that base
pair with ribonucleotides of the second strand to form a duplex;
each of positions 24 to 35 of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand to form a duplex; the 3' terminus of the first
strand and the 5' terminus of the second strand form a blunt end;
and the second strand is sufficiently complementary to a target RNA
along at least 19 ribonucleotides of the second strand length to
reduce target gene expression when the double stranded nucleic acid
is introduced into a mammalian cell.
[0034] In a further aspect, the invention provides an isolated
double stranded nucleic acid (dsNA) having a first oligonucleotide
strand and a second oligonucleotide strand, where the first strand
is 37 nucleotide residues in length and the second strand is 37-41
nucleotide residues in length, where starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides that base
pair with ribonucleotides of the second strand to form a duplex;
each of positions 24 to 37 of the first strand is a
deoxyribonucleotide that base pairs with a deoxyribonucleotide of
the second strand to form a duplex; the 3' terminus of the first
strand and the 5' terminus of the second strand form a blunt end;
and the second strand is sufficiently complementary to a target RNA
along at least 19 ribonucleotides of the second strand length to
reduce target gene expression when the double stranded nucleic acid
is introduced into a mammalian cell.
[0035] In one embodiment, the deoxyribonucleotides of the second
strand that base pair with the deoxyribonucleotides of the first
strand are not complementary to the target RNA.
[0036] In one aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first and a second
oligonucleotide strand where the first strand: is 27 nucleotide
residues in length, and starting from the first nucleotide
(position 1) at the 5' terminus of the first strand, positions 1 to
23 of the first strand are ribonucleotides and positions 24 to 27
are deoxyribonucleotides; the second strand: is 29 nucleotide
residues in length, starting from the first nucleotide (position 1)
at the 5' terminus of the second strand, positions 1 to 4 of the
second strand are deoxyribonucleotides, and the second strand
includes 23 consecutive ribonucleotides that base pair with the
ribonucleotides of positions 1 to 23 of the first strand to form a
duplex; the 5' terminus of the first strand and the 3' terminus of
the second strand form a 2 nucleotide 3' overhang structure; the 3'
terminus of the first strand and the 5' terminus of the second
strand form a blunt end; and the second strand is sufficiently
complementary to a target RNA along at least 19 ribonucleotides of
the second strand length to reduce target gene expression when the
double stranded nucleic acid is introduced into a mammalian
cell.
[0037] In one embodiment, the nucleotides of the 3' overhang are
modified nucleotides. In another embodiment, starting from the
first nucleotide (position 1) at the 5' terminus of the second
strand, at least one of positions 13-27 is a modified
ribonucleotide. In a further embodiment, starting from the first
nucleotide (position 1) at the 5' terminus of the second strand,
positions 13, 15, 17, 19, 21, 23, 25 and 27 are modified
ribonucleotides.
[0038] In another aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first and a second
oligonucleotide strand, where the first strand is 27 to 49
nucleotide residues in length, and starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides; the
second strand is 27 to 53 nucleotide residues in length and
includes 23 consecutive ribonucleotides that base pair with the
ribonucleotides of positions 1 to 23 of the first strand to form a
duplex; the 5' terminus of the first strand and the 3' terminus of
the second strand form a blunt end or 1-4 nucleotide overhang
structure, the 3' terminus of the first strand and the 5' terminus
of the second strand form a blunt end, and at least one of
positions 24 to the 3' terminal nucleotide residue of the first
strand is a phosphorothioate-modified nucleotide (PS-NA) that base
pairs with a deoxyribonucleotide of the second strand, with the
second strand being sufficiently complementary to a target RNA
along at least 19 ribonucleotides of the second strand length to
reduce target gene expression when the double stranded nucleic acid
is introduced into a mammalian cell.
[0039] In one embodiment, two or more nucleotide residues of
positions 24 to the 3' terminal nucleotide residue of the first
strand are PS-NA residues that base pair with deoxyribonucleotides
of the second strand. Optionally, four or more, six or more, eight
or more, ten or more, twelve or more, or fifteen or more nucleotide
residues of positions 24 to the 3' terminal nucleotide residue of
the first strand are PS-NA residues that base pair with
deoxyribonucleotides of the second strand. In another embodiment,
the deoxyribonucleotide of the second strand that base pairs with
the PS-NA of the first strand is also a PS-NA.
[0040] In another aspect, the invention provides an isolated double
stranded nucleic acid (dsNA) having a first strand and a second
strand where the first strand is 27 to 49 nucleotide residues in
length and starting from the first nucleotide (position 1) at the
5' terminus of the first strand, positions 1 to 23 of the first
strand are ribonucleotides; the second strand is 27 to 53
nucleotide residues in length and includes 23 consecutive
ribonucleotides that base pair with the ribonucleotides of
positions 1 to 23 of the first strand to form a duplex; the 5'
terminus of the first strand and the 3' terminus of the second
strand form a structure that is either a blunt end or a 1-4
nucleotide 3' overhang; the 3' terminus of the first strand and the
5' terminus of the second strand form a blunt end; at least one
nucleotide of the second strand base pairs with a
deoxyribonucleotide of positions 24 to the 3' terminal nucleotide
residue of the first strand and is a phosphorothioate-modified
nucleotide (PS-NA); and the second strand is sufficiently
complementary to a target RNA along at least 19 ribonucleotides of
the second strand length to reduce target gene expression when the
double stranded nucleic acid is introduced into a mammalian
cell.
[0041] In one embodiment, two or more nucleotide residues of the
second strand base pair with deoxyribonucleotides of positions 24
to the 3' terminal nucleotide residue of the first strand and are
PS-NA residues. Optionally, four or more, six or more, eight or
more, ten or more, twelve or more, or fifteen or more nucleotide
residues of the second strand base pair with deoxyribonucleotides
of positions 24 to the 3' terminal nucleotide residue of the first
strand and are PS-NA residues. In another embodiment, the dsNA
includes two or more, three or more, four or more, five or more,
six or more, seven or more, eight or more, nine or more, ten or
more, eleven or more, twelve or more, thirteen or more, fourteen or
more, or fifteen or more total PS-NA residues.
[0042] In an additional aspect, the invention provides an isolated
double stranded nucleic acid (dsNA) having a first and a second
oligonucleotide strand, where the first strand is 27 to 49
nucleotide residues in length, and starting from the first
nucleotide (position 1) at the 5' terminus of the first strand,
positions 1 to 23 of the first strand are ribonucleotides; the
second strand is 27 to 53 nucleotide residues in length and
includes 23 consecutive ribonucleotides that base pair with the
ribonucleotides of positions 1 to 23 of the first strand to form a
duplex; the 5' terminus of the first strand and the 3' terminus of
the second strand form a blunt end or 1-4 nucleotide overhang
structure; the 3' terminus of the first strand and the 5' terminus
of the second strand form a blunt end; and at least one of
positions 24 to the 3' terminal nucleotide residue of the first
strand is a deoxyribonucleotide that base pairs with a
phosphorothioate-modified nucleotide (PS-NA) of the second strand,
with the second strand being sufficiently complementary to a target
RNA along at least 19 ribonucleotides of the second strand length
to reduce target gene expression when the double stranded nucleic
acid is introduced into a mammalian cell.
[0043] In one embodiment, two or more nucleotide residues of
positions 24 to the 3' terminal nucleotide residue of the first
strand are deoxyribonucleotides that base pair with PS-NA residues
of the second strand. Optionally, four or more, six or more, eight
or more, ten or more, twelve or more, or fifteen or more nucleotide
residues of positions 24 to the 3' terminal nucleotide residue of
the first strand are deoxyribonucleotides that base pair with PS-NA
residues of the second strand. In a further embodiment, the
deoxyribonucleotide of the first strand that base pairs with the
PS-NA of the second strand is also a PS-NA.
[0044] In another embodiment, the invention provides a method for
reducing expression of a target gene in a cell involving contacting
a cell with an isolated dsNA as described in an amount effective to
reduce expression of a target gene in a cell in comparison to a
reference dsRNA.
[0045] In an additional embodiment, the invention provides a method
for reducing expression of a target gene in an animal that includes
treating an animal with an isolated dsNA as described in an amount
effective to reduce expression of a target gene in a cell of the
animal in comparison to a reference dsRNA.
[0046] In one embodiment, the dsNA possesses enhanced
pharmacokinetics when compared to an appropriate control DsiRNA. In
another embodiment, the dsNA possesses enhanced pharmacodynamics
when compared to an appropriate control DsiRNA. In an additional
embodiment, the dsNA possesses reduced toxicity when compared to an
appropriate control DsiRNA. In a further embodiment, the dsNA
possesses enhanced intracellular uptake when compared to an
appropriate control DsiRNA.
[0047] In a further embodiment, the invention provides a
pharmaceutical composition that includes an isolated dsNA as
described in an amount effective to reduce expression of a target
gene in a cell in comparison to a reference dsRNA and a
pharmaceutically acceptable carrier, for reducing expression of a
target gene in a cell of a subject. In another embodiment, the
invention provides a method of synthesizing dsNA as described,
involving chemically or enzymatically synthesizing the dsNA. In an
additional embodiment, the invention provides a kit that includes a
dsNA as described, and instructions for its use.
[0048] In one aspect, the invention provides an isolated dsNA as
shown in FIG. 30.
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] FIG. 1A shows a schematic representation of the processing
of a Dicer substrate inhibitory RNA agent ("DsiRNA"). The protein
Dicer is represented by the large rectangle, with the PAZ
(Piwi/Argonaute/Zwille) domain of Dicer also indicated. The PAZ
domain binds the two-base overhang and the 3'-OH (hydroxyl group)
at the 3' end of the guide (antisense) strand, and each strand of
the dsRNA duplex is cleaved by separate RNase III domains (black
triangles). Substitution of 2 bases of DNA for RNA at the 3' end of
the passenger (sense) strand forms a two-base long RNA/DNA duplex
blunt end, which reduces or eliminates binding affinity for PAZ.
Cleavage of the DsiRNA typically yields a 19mer duplex with 2-base
overhangs at each end.
[0050] FIG. 1B shows that the addition of four bases of DNA duplex
to the DsiRNA had no apparent inhibitory effect upon Dicer
cleavage. The bases inserted into this example of an anti-HPRT
DsiRNA (heavy black bars and arrows) were not complementary to the
HPRT target sequence.
[0051] FIG. 2A presents histogram data showing the robust efficacy
of DsiRNA agents possessing base paired deoxyribonucleotides in a
duplexed region located 3' of the Dicer cleavage site of the sense
strand/5' of the Dicer cleavage site of the antisense strand
("Right-extended DsiRNA agents"). DsiRNA duplexes were transfected
into HeLa cells at a fixed concentration of 20 nM, and HPRT
expression levels were measured 24 hours later. Transfections were
performed in duplicate, and each duplicate was assayed in
triplicate for HPRT expression by qPCR. Error bars are the standard
error. Duplex 1 targeted HPRT and was a 25/27mer configuration
overhanging RNA/blunt two-DNA substitution as described in Rose et
al. NAR 2005. All other duplexes were longer than Duplex 1 due to
the insertion of bases that were not complementary to the HPRT
target region. The length of the inserted sequence ranged from two
bases (Duplex 2) to eight bases (Duplexes 6, 7, and 8).
[0052] FIG. 2B shows duplex numbers, sequences and chemical
modification patterns for agents for which data is presented in
FIG. 2A. UPPER case=unmodified RNA, Bold, underlined=2'-O-methyl
RNA, lower case=DNA, bold lower case=phosphorothioate-modified DNA
(PS-DNA). A general description of each duplex and the overall
configuration is shown at right.
[0053] FIGS. 3A and 3B show that DNA-extended DsiRNA agents were
more effective than corresponding RNA-extended DsiRNA agents at low
concentrations. An optimized 27/29mer DsiRNA duplex targeting HPRT
was compared to a modified duplex in a dose-response series at 10.0
nanomolar (nM), 1.0 nanomolar (nM) and 100 picomolar (100 pM or 0.1
nM), with efficacy of knockdown of HPRT mRNA levels assessed in
HeLa cells. Duplex concentrations shown represent the final
concentration of oligonucleotides in the transfection mixture and
culture medium as described in the Examples. Duplex identities are
indicated below the bars (1, 2, 3), with the "C" bar representing
baseline HPRT expression in untreated cells. FIG. 3B shows the
sequences and chemical modification patterns of those duplexes
depicted in FIG. 3A. UPPER case=unmodified RNA, Bold,
underlined=2'-O-methyl RNA, and lower case=DNA. DsiRNA 1 was a
derivative of a previously reported active 25/27mer DsiRNA duplex
(HPRT-1, Rose et al. NAR 2005, Collingwood et al. 2008, see also
FIG. 2A above), but contained an insertion of two bases in each
strand, which extended the oligonucleotide duplex to a 27/29mer
(heavy black bars denote inserted base pairs). Duplex 2 was
identical in sequence to duplex 1, but the two base pair insertion
(heavy black bars), including two additional nucleosides of both
passenger strand (sense sequence) and guide strand (antisense
sequence) were synthesized as DNA. Thus, duplex 2 terminated in 4
DNA bp (base pairs) at the 5' end of the guide strand, in contrast
to previously reported two base DNA substitutions at the 3' end of
the passenger (sense) strand (Rose et al, 2005). Duplex 3 (mismatch
(MM) control) was derived from the optimized HPRT-1 duplex, but
synthesized with mismatches indicated by arrows. The base
composition and chemical modification of each strand and the base
sequences and overhang or blunt structure at the ends of duplex 3
were held constant relative to the optimized HPRT-1 duplex in order
to control for non-targeted chemical effects (see FIG. 5
below).
[0054] FIGS. 4A-4D show that modified DsiRNA duplexes extended by
two to eight base paired deoxyribonucleosides were more effective
at reducing HPRT target mRNA levels than corresponding
ribonucleoside-extended DsiRNA agents. FIG. 4A shows HPRT target
gene mRNA levels for cells treated with 1 nM modified DsiRNA
agents. FIG. 4B shows HPRT target gene mRNA levels for cells
treated with 100 pM modified DsiRNA agents. FIG. 4C shows HPRT
target gene mRNA levels for cells treated with 10 pM modified
DsiRNA agents. FIG. 4D shows the sequences and chemical
modification patterns of those duplexes depicted in FIGS. 4A-4C.
Inserted sequences (heavy bars beneath the duplexes) did not match
the HPRT mRNA target region. UPPER case=unmodified RNA, Bold,
underlined=2'-O-methyl RNA, lower case=DNA. U=untreated cells.
[0055] FIG. 5A shows HPRT target mRNA inhibition results for a
series of modified duplexes of increasing length administered at a
fixed concentration of 100 pM. FIG. 5B shows duplex numbers,
sequences and chemical modification patterns for agents for which
data is presented in FIG. 5A. Duplex 1 was an optimized 25/27mer
DsiRNA containing chemical modifications, a two-base overhang at
the 3'-end of the guide (antisense) strand and two DNA
substitutions and a blunt end at the 3'-end of the passenger
(sense) strand (Collingwood et al. 2008). Bases non-complementary
to HPRT mRNA were inserted two bases at a time as either RNA
(duplexes 2 through 5) or DNA (duplexes 6 through 9), increasing
total duplex configurations from 27/29mers to 33/35mers. UPPER
case=unmodified RNA, Bold, underlined=2'-O-methyl RNA, lower
case=DNA. U=untreated cells. UPPER case=unmodified RNA, Bold,
underlined=2'-O-methyl RNA, lower case=DNA.
[0056] FIG. 6 shows the structure and predicted Dicer-mediated
processing of a "25/27mer DsiRNA" agent (top) and an exemplary
"Left-extended" DsiRNA agent (bottom) which contains a mismatch
residue (G:U) within the dsRNA duplex sequence. UPPER case=RNA
residues; lower case=DNA residues.
[0057] FIG. 7 shows the structures of a series of DNA-extended
duplexes, with pictured duplexes alternately right- or
left-extended with 5 base pair DNA sequences. Mismatches are
introduced within both forms of extended DsiRNA agents as
indicated, with numbering of such mismatches proceeding in the 3'
direction from position 1 of the second strand, which is the
predicted 5' terminal RNA residue of the second strand after Dicer
cleavage.
[0058] FIG. 8 depicts the results of an initial round of testing of
the inhibitory activity of right- and left-extended agents shown in
FIG. 7. For comparisons between right- versus left-extended parent
molecules, right- versus left-extended agents harboring a mismatch
at position 14, right-versus left-extended agents possessing a
mismatch at position 16, and right- versus left-extended agents
harboring a mismatch at both positions 14 and 18, left-extended
agents were surprisingly observed to be more effective at gene
silencing than corresponding right-extended agents. (100 pM of each
indicated duplex was transfected into HeLa cells for all such
experiments and % of KRAS target mRNA remaining was assessed at 24
hours.)
[0059] FIG. 9 depicts the result of a second round of experiments
performed with the agents shown in FIG. 7, showing that
left-extended agents were reproducibly more effective target mRNA
silencing agents than right-extended agents in three of the four
instances which were initially observed to show such a bias in
favor of left-extended agents. Inhibitory results for a
non-extended 25/27mer DsiRNA are also shown ("Opt" 25/27mer).
[0060] FIG. 10 shows the structure of a series of DsiRNA agents
designed to silence an HPRT target mRNA, and inhibitory efficacies
of such agents in cell culture. Capital letters indicate
ribonucleotides; lower case letters indicate deoxyribonucleotides;
bolded lower case letters indicate phosphorothioates (PS-NAs);
bolded and underlined uppercase letters indicate 2'-O-methyl
modified nucleotides; the bolded uppercase letter of agent
DP1065P/DP1067G indicates the site of a mismatched nucleotide (with
respect to the sense strand) within the "seed" region sequence of
the antisense strand of the DsiRNA agent.
[0061] FIG. 11 shows that phosphorothioate modified
"right-extended" DsiRNAs retain target HPRT1 gene inhibitory
efficacy, and also indicates that passenger strand extended
residues might tolerate phosphorothioate modification better than
guide strand extended residues while retaining target gene
inhibitory activity. In vitro Dicer cleavage assays (left
lane=untreated; right lane=Dicer enzyme treated) are also shown for
all extended DsiRNAs. Capital letters indicate ribonucleotides;
lower case letters indicate deoxyribonucleotides, while bolded
lower case letters indicate phosphorothioate-modified
deoxyribonucleotides.
[0062] FIG. 12 depicts the structures of control and
"right-extended" DsiRNAs of the invention targeting the "KRAS-200"
site within the KRAS transcript. Capital letters indicate
ribonucleotides; lower case letters indicate
deoxyribonucleotides.
[0063] FIG. 13 shows the KRAS inhibitory efficacies observed for
the DsiRNA structures of FIG. 12 in vitro.
[0064] FIG. 14 depicts the structures of control and
"right-extended" DsiRNAs of the invention targeting the "KRAS-909"
site within the KRAS transcript. Capital letters indicate
ribonucleotides; lower case letters indicate
deoxyribonucleotides.
[0065] FIG. 15 shows the KRAS inhibitory efficacies observed for
the DsiRNA structures of FIG. 14 in vitro.
[0066] FIG. 16 depicts the structures of control and
"right-extended" DsiRNAs of the invention targeting the "KRAS-249"
site within the KRAS transcript, including modification patterns of
such DsiRNAs. Capital letters indicate ribonucleotides; lower case
letters indicate deoxyribonucleotides, while bolded lower case
letters indicate phosphorothioate-modified deoxyribonucleotides.
Underlined capital letters indicate 2'-O-methyl-modified
ribonucleotides.
[0067] FIG. 17 depicts the structures of control and
"right-extended" DsiRNAs of the invention targeting the "KRAS-516"
site within the KRAS transcript, including modification patterns of
such DsiRNAs. Capital letters indicate ribonucleotides; lower case
letters indicate deoxyribonucleotides, while bolded lower case
letters indicate phosphorothioate-modified deoxyribonucleotides.
Underlined capital letters indicate 2'-O-methyl-modified
ribonucleotides.
[0068] FIG. 18 depicts the structures of control and
"right-extended" DsiRNAs of the invention targeting the "KRAS-909"
site within the KRAS transcript, including modification patterns of
such DsiRNAs. Capital letters indicate ribonucleotides; lower case
letters indicate deoxyribonucleotides, while bolded lower case
letters indicate phosphorothioate-modified deoxyribonucleotides.
Underlined capital letters indicate 2'-O-methyl-modified
ribonucleotides.
[0069] FIG. 19 shows in vitro KRAS inhibitory efficacy results
obtained for the "right-extended" DsiRNAs of FIGS. 16-18. Results
were obtained in HeLa cells contacted with the indicated DsiRNAs at
0.1 nM concentration, assayed at 24 hours post-RNAiMAX.TM.
treatment. Capital letters indicate ribonucleotides; lower case
letters indicate deoxyribonucleotides, while bolded lower case
letters indicate phosphorothioate-modified
deoxyribonucleotides.
[0070] FIG. 20 depicts the structures of 25/27mer "KRAS-249" site
targeting DsiRNAs which were assessed for mismatch residue
tolerance. Closed arrows indicate projected Dicer enzyme cleavage
sites, while open arrow indicates projected Ago2 cleavage site
within target strand sequence corresponding to passenger strand
DsiRNA sequence shown. Capital letters indicate ribonucleotides;
lower case letters indicate deoxyribonucleotides. Bolded capital
letters indicate sites of target-mismatched residues of guide
strand (and complementary residues of passenger strand, where
applicable), with such target-mismatched residues obtained by
"flipping" individual residues between guide and passenger strand
during DsiRNA design. Horizontal bracket within DP1301P/DP1302G
duplex indicates "seed region" of this duplex (with seed regions of
all other DsiRNA structures occurring in the same
vertically-aligned position).
[0071] FIG. 21 shows in vitro KRAS inhibitory efficacy results
obtained for the DsiRNAs of FIG. 20. Results were obtained in HeLa
cells contacted with the indicated DsiRNAs at 0.1 nM concentration,
assayed at 24 hours post-RNAiMAX.TM. treatment.
[0072] FIG. 22 shows single dose (10 mg/kg) in vivo KRAS inhibitory
efficacy results in liver tissue for an unmodified 25/27mer
"KRAS-249" site targeting DsiRNA ("K249"), a 2'-O-methyl-modified
form of this 25/27mer ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249DNA", shown in FIG. 16 as "K249D"; "5%
Glu"=5% glucose control).
[0073] FIG. 23 shows single dose (10 mg/kg) in vivo KRAS inhibitory
efficacy results in kidney tissue for an unmodified 25/27mer
"KRAS-249" site targeting DsiRNA ("K249"), a 2'-O-methyl-modified
form of this 25/27mer ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249DNA", shown in FIG. 16 as "K249D"; "5%
Glu"=5% glucose control).
[0074] FIG. 24 shows single dose (10 mg/kg) in vivo KRAS inhibitory
efficacy results in spleen tissue for an unmodified 25/27mer
"KRAS-249" site targeting DsiRNA ("K249"), a 2'-O-methyl-modified
form of this 25/27mer ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249DNA", shown in FIG. 16 as "K249D"; "5%
Glu"=5% glucose control).
[0075] FIG. 25 shows single dose (10 mg/kg) in vivo KRAS inhibitory
efficacy results in lymph node tissue for an unmodified 25/27mer
"KRAS-249" site targeting DsiRNA ("K249"), a 2'-O-methyl-modified
form of this 25/27mer ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249DNA", shown in FIG. 16 as "K249D"; "5%
Glu"=5% glucose control).
[0076] FIG. 26 shows multi-dose (2 mg/kg, administered a total of
four times, with each administration performed at three day
intervals) in vivo KRAS inhibitory efficacy results in liver tissue
for a 2'-O-methyl-modified form of a 25/27mer "KRAS-249" site
targeting DsiRNA ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249D", as shown in FIG. 16).
[0077] FIG. 27 shows multi-dose (2 mg/kg, administered a total of
four times, with each administration performed at three day
intervals) in vivo KRAS inhibitory efficacy results in lung tissue
for a 2'-O-methyl-modified form of a 25/27mer "KRAS-249" site
targeting DsiRNA ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249D", as shown in FIG. 16).
[0078] FIG. 28 shows multi-dose (2 mg/kg, administered a total of
four times, with each administration performed at three day
intervals) in vivo KRAS inhibitory efficacy results in spleen
tissue for a 2'-O-methyl-modified form of a 25/27mer "KRAS-249"
site targeting DsiRNA ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249D", as shown in FIG. 16).
[0079] FIG. 29 shows multi-dose (2 mg/kg, administered a total of
four times, with each administration performed at three day
intervals) in vivo KRAS inhibitory efficacy results in kidney
tissue for a 2'-O-methyl-modified form of a 25/27mer "KRAS-249"
site targeting DsiRNA ("KRAS-249M") and a DNA-extended form of this
modified DsiRNA ("K249D", as shown in FIG. 16).
[0080] FIG. 30 shows exemplary structures of "right extended"
DsiRNA agents that form a blunt end between the 3' terminus of the
first strand and 5' terminus of the second strand. Upper case
letters indicate ribonucleotides; lower case characters denote
deoxyribonucleotides; open triangle denotes a site within the
sequence of the first strand (here, the sense strand) corresponding
to the Ago2 cleavage site within the target RNA; filled triangles
indicate projected sites of Dicer cleavage; and [#] denotes a
duplex region of four to sixteen or more base pairs in length which
comprises at least one deoxyribonucleotide-deoxyribonucleotide base
pair. (In alternative embodiments, [#] indicates a duplex region of
four to sixteen or more base pairs in length which comprises at
least four deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Nucleotide
position numbering is also shown.
[0081] FIG. 31 shows an exemplary structure of a "right extended"
DsiRNA agent that possesses a 3'-terminal overhang of the first
strand relative to the 5' terminus of the second strand. Upper case
letters indicate ribonucleotides; lower case characters denote
deoxyribonucleotides; open triangle denotes a site within the
sequence of the first strand (here, the sense strand) corresponding
to the Ago2 cleavage site within the target RNA; filled triangles
indicate projected sites of Dicer cleavage; and [#] denotes a
duplex region of four to sixteen or more base pairs in length which
comprises at least one deoxyribonucleotide-deoxyribonucleotide base
pair. (In alternative embodiments, [#] indicates a duplex region of
four to sixteen or more base pairs in length which comprises at
least four deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Nucleotide
position numbering is also shown.
[0082] FIG. 32 shows an exemplary structure of a "right extended"
DsiRNA agent that forms a fray at the 3'-terminus of the first
strand and corresponding 5' terminus of the second strand. Upper
case letters indicate ribonucleotides; lower case characters denote
deoxyribonucleotides; open triangle denotes a site within the
sequence of the first strand (here, the sense strand) corresponding
to the Ago2 cleavage site within the target RNA; filled triangles
indicate projected sites of Dicer cleavage; and [#] denotes a
duplex region of four to sixteen or more base pairs in length which
comprises at least one deoxyribonucleotide-deoxyribonucleotide base
pair. (In alternative embodiments, [#] indicates a duplex region of
four to sixteen or more base pairs in length which comprises at
least four deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Nucleotide
position numbering is also shown.
[0083] FIG. 33 shows exemplary structures of "right extended"
DsiRNA agents that form a blunt end between the 3' terminus of the
first strand and 5' terminus of the second strand, and that also
possess mismatched residues within antisense strand sequences which
are projected to be retained within the interference agent
following Dicer cleavage. Upper case letters indicate
ribonucleotides; lower case characters denote deoxyribonucleotides;
open triangle denotes a site within the sequence of the first
strand (here, the sense strand) corresponding to the Ago2 cleavage
site within the target RNA; filled triangles indicate projected
sites of Dicer cleavage; and [#] denotes a duplex region of four to
sixteen or more base pairs in length which comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair. (In alternative
embodiments, [#] indicates a duplex region of four to sixteen or
more base pairs in length which comprises at least four
deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Seed and
mismatch regions of the antisense strand, as well as nucleotide
position numbering of each strand is also shown. The underlined
antisense residue of the bottom agent indicates a nucleotide which
base pairs with the sense strand of the DsiRNA agent, yet is
projected to form a mismatch with the target RNA.
[0084] FIG. 34 shows exemplary structures of "right extended"
DsiRNA agents that possess a 3'-terminal overhang of the first
strand relative to the 5' terminus of the second strand, and that
also possess mismatched residues within antisense strand sequences
which are projected to be retained within the interference agent
following Dicer cleavage. Upper case letters indicate
ribonucleotides; lower case characters denote deoxyribonucleotides;
open triangle denotes a site within the sequence of the first
strand (here, the sense strand) corresponding to the Ago2 cleavage
site within the target RNA; filled triangles indicate projected
sites of Dicer cleavage; and [#] denotes a duplex region of four to
sixteen or more base pairs in length which comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair. (In alternative
embodiments, [#] indicates a duplex region of four to sixteen or
more base pairs in length which comprises at least four
deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Seed and
mismatch regions of the antisense strand, as well as nucleotide
position numbering of each strand is also shown. The underlined
antisense residue of the bottom agent indicates a nucleotide which
base pairs with the sense strand of the DsiRNA agent, yet is
projected to form a mismatch with the target RNA.
[0085] FIG. 35 shows exemplary structures of "right extended"
DsiRNA agents that form a fray at the 3'-terminus of the first
strand and corresponding 5' terminus of the second strand, and that
also possess mismatched residues within antisense strand sequences
which are projected to be retained within the interference agent
following Dicer cleavage. Upper case letters indicate
ribonucleotides; lower case characters denote deoxyribonucleotides;
open triangle denotes a site within the sequence of the first
strand (here, the sense strand) corresponding to the Ago2 cleavage
site within the target RNA; filled triangles indicate projected
sites of Dicer cleavage; and [#] denotes a duplex region of four to
sixteen or more base pairs in length which comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair. (In alternative
embodiments, [#] indicates a duplex region of four to sixteen or
more base pairs in length which comprises at least four
deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Seed and
mismatch regions of the antisense strand, as well as nucleotide
position numbering of each strand is also shown. The underlined
antisense residue of the bottom agent indicates a nucleotide which
base pairs with the sense strand of the DsiRNA agent, yet is
projected to form a mismatch with the target RNA.
[0086] FIG. 36 shows exemplary structures of "left extended" DsiRNA
agents that form a blunt end between the 3' terminus of the first
strand and 5' terminus of the second strand. Upper case letters
indicate ribonucleotides; lower case characters denote
deoxyribonucleotides; open triangle denotes a site within the
sequence of the first strand (here, the sense strand) corresponding
to the Ago2 cleavage site within the target RNA; filled triangles
indicate projected sites of Dicer cleavage; and [#] denotes a
duplex region of four to sixteen or more base pairs in length which
comprises at least one deoxyribonucleotide-deoxyribonucleotide base
pair. (In alternative embodiments, [#] indicates a duplex region of
four to sixteen or more base pairs in length which comprises at
least four deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Nucleotide
position numbering is also shown.
[0087] FIG. 37 shows exemplary structures of "left extended" DsiRNA
agents that possess a 3'-terminal overhang of the first strand
relative to the 5' terminus of the second strand. Upper case
letters indicate ribonucleotides; lower case characters denote
deoxyribonucleotides; open triangle denotes a site within the
sequence of the first strand (here, the sense strand) corresponding
to the Ago2 cleavage site within the target RNA; filled triangles
indicate projected sites of Dicer cleavage; and [#] denotes a
duplex region of four to sixteen or more base pairs in length which
comprises at least one deoxyribonucleotide-deoxyribonucleotide base
pair. (In alternative embodiments, [#] indicates a duplex region of
four to sixteen or more base pairs in length which comprises at
least four deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Nucleotide
position numbering is also shown.
[0088] FIG. 38 shows an exemplary structure of a "left extended"
DsiRNA agent that forms a fray at the 3'-terminus of the first
strand and corresponding 5' terminus of the second strand. Upper
case letters indicate ribonucleotides; lower case characters denote
deoxyribonucleotides; open triangle denotes a site within the
sequence of the first strand (here, the sense strand) corresponding
to the Ago2 cleavage site within the target RNA; filled triangles
indicate projected sites of Dicer cleavage; and [#] denotes a
duplex region of four to sixteen or more base pairs in length which
comprises at least one deoxyribonucleotide-deoxyribonucleotide base
pair. (In alternative embodiments, [#] indicates a duplex region of
four to sixteen or more base pairs in length which comprises at
least four deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Nucleotide
position numbering is also shown.
[0089] FIG. 39 shows exemplary structures of "left extended" DsiRNA
agents that form a blunt end between the 3' terminus of the first
strand and 5' terminus of the second strand, and that also possess
mismatched residues within antisense strand sequences which are
projected to be retained within the interference agent following
Dicer cleavage. Upper case letters indicate ribonucleotides; lower
case characters denote deoxyribonucleotides; open triangle denotes
a site within the sequence of the first strand (here, the sense
strand) corresponding to the Ago2 cleavage site within the target
RNA; filled triangles indicate projected sites of Dicer cleavage;
and [#] denotes a duplex region of four to sixteen or more base
pairs in length which comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair. (In alternative
embodiments, [#] indicates a duplex region of four to sixteen or
more base pairs in length which comprises at least four
deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Seed and
mismatch regions of the antisense strand, as well as nucleotide
position numbering of each strand is also shown. The underlined
antisense residue of the lower two agents indicates a nucleotide
which base pairs with the sense strand of the DsiRNA agent, yet is
projected to form a mismatch with the target RNA.
[0090] FIG. 40 shows exemplary structures of "left extended" DsiRNA
agents that possess a 3'-terminal overhang of the first strand
relative to the 5' terminus of the second strand, and that also
possess mismatched residues within antisense strand sequences which
are projected to be retained within the interference agent
following Dicer cleavage. Upper case letters indicate
ribonucleotides; lower case characters denote deoxyribonucleotides;
open triangle denotes a site within the sequence of the first
strand (here, the sense strand) corresponding to the Ago2 cleavage
site within the target RNA; filled triangles indicate projected
sites of Dicer cleavage; and [#] denotes a duplex region of four to
sixteen or more base pairs in length which comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair. (In alternative
embodiments, [#] indicates a duplex region of four to sixteen or
more base pairs in length which comprises at least four
deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Seed and
mismatch regions of the antisense strand, as well as nucleotide
position numbering of each strand is also shown. The underlined
antisense residue of the middle agent indicates a nucleotide which
base pairs with the sense strand of the DsiRNA agent, yet is
projected to form a mismatch with the target RNA.
[0091] FIG. 41 shows exemplary structures of "left extended" DsiRNA
agents that form a fray at the 3'-terminus of the first strand and
corresponding 5' terminus of the second strand, and that also
possess mismatched residues within antisense strand sequences which
are projected to be retained within the interference agent
following Dicer cleavage. Upper case letters indicate
ribonucleotides; lower case characters denote deoxyribonucleotides;
open triangle denotes a site within the sequence of the first
strand (here, the sense strand) corresponding to the Ago2 cleavage
site within the target RNA; filled triangles indicate projected
sites of Dicer cleavage; and [#] denotes a duplex region of four to
sixteen or more base pairs in length which comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair. (In alternative
embodiments, [#] indicates a duplex region of four to sixteen or
more base pairs in length which comprises at least four
deoxyribonucleotides but is not required to possess a
deoxyribonucleotide-deoxyribonucleotide base pair.) Seed and
mismatch regions of the antisense strand, as well as nucleotide
position numbering of each strand is also shown. The underlined
antisense residue of the bottom agent indicates a nucleotide which
base pairs with the sense strand of the DsiRNA agent, yet is
projected to form a mismatch with the target RNA.
[0092] FIGS. 42A-42C show exemplary structures of "right extended"
DsiRNA agents. Upper case letters indicate ribonucleotides; lower
case characters denote deoxyribonucleotides; open triangle denotes
a site within the sequence of the top strand (here, the sense
strand) corresponding to the Ago2 cleavage site within the target
RNA; filled triangles indicate projected sites of Dicer cleavage;
and nucleotide position numbering is also shown.
[0093] FIGS. 43A-43C show exemplary structures of "left extended"
DsiRNA agents. Upper case letters indicate ribonucleotides; lower
case characters denote deoxyribonucleotides; open triangle denotes
a site within the sequence of the top strand (here, the sense
strand) corresponding to the Ago2 cleavage site within the target
RNA; filled triangles indicate projected sites of Dicer cleavage;
and nucleotide position numbering is also shown.
DETAILED DESCRIPTION
[0094] The invention provides compositions and methods for reducing
expression of a target gene in a cell, involving contacting a cell
with an isolated double stranded nucleic acid (dsNA) in an amount
effective to reduce expression of a target gene in a cell. The
dsNAs of the invention possess a pattern of deoxyribonucleotides
(in most embodiments, the pattern comprises at least one
deoxyribonucleotide-deoxyribonucleotide base pair) designed to
direct the site of Dicer enzyme cleavage within the dsNA molecule.
The deoxyribonucleotide pattern of the dsNA molecules of the
invention is located within a region of the dsNA that can be
excised via Dicer cleavage to generate an active siRNA agent that
no longer contains the deoxyribonucleotide pattern (e.g., in most
embodiments, the deoxyribonucleotide pattern comprises one or more
deoxyribonucleotide-deoxyribonucleotide base pairs). Surprisingly,
as demonstrated herein, DNA:DNA-extended Dicer-substrate siRNAs
(DsiRNAs) were more effective RNA inhibitory agents than
corresponding RNA:DNA- or RNA:RNA-extended DsiRNAs.
[0095] It was also surprising to discover that DsiRNAs comprising
DNA:DNA extensions which were positioned at the 5' end of the first
strand and corresponding 3' end of the second strand of a dsRNA
DsiRNA agent (where the second strand is complementary to a
sufficient region of target RNA sequence to serve as an effective
guide strand sequence of an RNAi agent (antisense to the target
RNA)) constituted effective--and in many instances
enhanced--inhibitory agents.
[0096] The surprising discovery that DNA-extended DsiRNA agents do
not exhibit decreases in efficacy as duplex length increases allows
for the generation of DsiRNAs that remain effective while providing
greater spacing for, e.g., attachment of DsiRNAs to additional
and/or distinct functional groups, inclusion/patterning of
stabilizing modifications (e.g., PS-NA moieties) or other forms of
modifications capable of adding further functionality and/or
enhancing, e.g., pharmacokinetics, pharmacodynamics or
biodistribution of such agents, as compared to dsRNA agents of
corresponding length that do not contain such double stranded
DNA-extended domains.
[0097] The advantage provided by the newfound ability to lengthen
DsiRNA-containing dsNA duplexes while retaining activity of a
post-Dicer-processed siRNA agent at levels greater than dsRNA
duplexes of similar length is emphasized by the results presented
herein, which show that complete phosphorothioate (PS) modification
of all nucleotides of a double-stranded DNA:DNA region of an
extended DsiRNA agent completely abolished silencing activity (see
duplex #8 of FIGS. 2A and 2B). The ability to extend DsiRNA agents
without observing a corresponding reduction in RNA silencing
activity can also allow for inclusion of, e.g., more modified
nucleotides within a single molecule that still retains RNA
silencing activity than could otherwise be achieved were such
modified nucleotides not allowed such spacing (in view of the
inhibitory effect associated with certain modifications when
present in a tandem series--e.g., tandem PS or 2'-O-methyl
modifications). Similarly, the ability to include longer duplex
extensions in such DsiRNA-containing agents while retaining RNA
inhibitory function can also allow for certain functional groups to
be attached to such agents that would otherwise not be possible,
because of the ability of such functional groups to interfere with
RNA silencing activity when present in tighter configurations.
DEFINITIONS
[0098] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by a person
skilled in the art to which this invention belongs. The following
references provide one of skill with a general definition of many
of the terms used in this invention: Singleton et al., Dictionary
of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge
Dictionary of Science and Technology (Walker ed., 1988); The
Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer
Verlag (1991); and Hale & Marham, The Harper Collins Dictionary
of Biology (1991). As used herein, the following terms have the
meanings ascribed to them below, unless specified otherwise.
[0099] As used herein, the term "nucleic acid" refers to
deoxyribonucleotides, ribonucleotides, or modified nucleotides, and
polymers thereof in single- or double-stranded form. The term
encompasses nucleic acids containing known nucleotide analogs or
modified backbone residues or linkages, which are synthetic,
naturally occurring, and non-naturally occurring, which have
similar binding properties as the reference nucleic acid, and which
are metabolized in a manner similar to the reference nucleotides.
Examples of such analogs include, without limitation,
phosphorothioates, phosphoramidates, methyl phosphonates,
chiral-methyl phosphonates, 2-O-methyl ribonucleotides,
peptide-nucleic acids (PNAs).
[0100] As used herein, "nucleotide" is used as recognized in the
art to include those with natural bases (standard), and modified
bases well known in the art. Such bases are generally located at
the 1' position of a nucleotide sugar moiety. Nucleotides generally
comprise a base, sugar and a phosphate group. The nucleotides can
be unmodified or modified at the sugar, phosphate and/or base
moiety, (also referred to interchangeably as nucleotide analogs,
modified nucleotides, non-natural nucleotides, non-standard
nucleotides and other; see, e.g., Usman and McSwiggen, supra;
Eckstein, et al., International PCT Publication No. WO 92/07065;
Usman et al, International PCT Publication No. WO 93/15187; Uhlman
& Peyman, supra, all are hereby incorporated by reference
herein). There are several examples of modified nucleic acid bases
known in the art as summarized by Limbach, et al, Nucleic Acids
Res. 22:2183, 1994. Some of the non-limiting examples of base
modifications that can be introduced into nucleic acid molecules
include, hypoxanthine, purine, pyridin-4-one, pyridin-2-one,
phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3-methyl uracil,
dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g.,
5-methylcytidine), 5-alkyluridines (e.g., ribothymidine),
5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or
6-alkylpyrimidines (e.g. 6-methyluridine), propyne, and others
(Burgin, et al., Biochemistry 35:14090, 1996; Uhlman & Peyman,
supra). By "modified bases" in this aspect is meant nucleotide
bases other than adenine, guanine, cytosine and uracil at 1'
position or their equivalents.
[0101] As used herein, a "double-stranded nucleic acid" or "dsNA"
is a molecule comprising two oligonucleotide strands which form a
duplex. A dsNA may contain ribonucleotides, deoxyribonucleotides,
modified nucleotides, and combinations thereof. The double-stranded
NAs of the instant invention are substrates for proteins and
protein complexes in the RNA interference pathway, e.g., Dicer and
RISC. An exemplary structure of one form of dsNA of the invention
is shown in FIG. 1A, and such structures characteristically
comprise an RNA duplex in a region that is capable of functioning
as a Dicer substrate siRNA (DsiRNA) and a DNA duplex comprising at
least one deoxyribonucleotide, which is located at a position 3' of
the projected Dicer cleavage site of the first strand of the
DsiRNA/DNA agent, and is base paired with a cognate
deoxyribonucleotide of the second strand, which is located at a
position 5' of the projected Dicer cleavage site of the second
strand of the DsiRNA/DNA agent. In alternative embodiments, the
instant invention provides a structure that characteristically
comprises an RNA duplex within a region that is capable of
functioning as a Dicer substrate siRNA (DsiRNA) and a DNA duplex
comprising at least one deoxyribonucleotide, which is located at a
position 5' of the projected Dicer cleavage site of the first
strand of the DsiRNA/DNA agent, and is base paired with a cognate
deoxyribonucleotide of the second strand, which is located at a
position 3' of the projected Dicer cleavage site of the second
strand of the DsiRNA/DNA agent (see, e.g., "Left-Extended" DsiRNA
agent of FIG. 6).
[0102] In certain embodiments, the DsiRNAs of the invention can
possess deoxyribonucleotide residues at sites immediately adjacent
to the projected Dicer enzyme cleavage site(s). For example, in the
second, fourth and sixth DsiRNAs shown in FIG. 12,
deoxyribonucleotides can be found (starting at the 5' terminal
residue of the first strand as position 1) at position 22 and sites
3' of position 22 (e.g., 23, 24, 25, etc.). Correspondingly,
deoxyribonucleotides can also be found on the second strand
commencing at the nucleotide that is complementary to position 20
of the first strand, and also at positions on the second strand
that are located in the 5' direction of this nucleotide. Thus,
certain effective DsiRNAs of the invention possess only 19 duplexed
ribonucleotides prior to commencement of introduction of
deoxyribonucleotides within the first strand, second strand, and/or
both strands of such DsiRNAs. While the preceding statements
regarding placement of deoxyribonucleotides immediately adjacent to
a projected Dicer enzyme cleavage site of the DsiRNAs of the
invention explicitly contemplates "right-extended" DsiRNAs of the
invention, parallel placement of deoxyribonucleotides can be
performed within "left-extended" DsiRNAs of the invention (e.g.,
deoxyribonucleotides can be placed immediately adjacent to the
projected Dicer enzyme cleavage site within "left-extended"
DsiRNAs--e.g., immediately 5' on the sense strand of the most 5'
projected Dicer cleavage site on the sense strand of such a
"left-extended" DsiRNA and/or immediately 3' on the antisense
strand of the most 3' projected Dicer cleavage site on the
antisense strand of such a "left-extended" DsiRNA).
[0103] As used herein, "duplex" refers to a double helical
structure formed by the interaction of two single stranded nucleic
acids. According to the present invention, a duplex may contain
first and second strands which are sense and antisense, or which
are target and antisense. A duplex is typically formed by the
pairwise hydrogen bonding of bases, i.e., "base pairing", between
two single stranded nucleic acids which are oriented antiparallel
with respect to each other. Base pairing in duplexes generally
occurs by Watson-Crick base pairing, e.g., guanine (G) forms a base
pair with cytosine (C) in DNA and RNA (thus, the cognate nucleotide
of a guanine deoxyribonucleotide is a cytosine deoxyribonucleotide,
and vice versa), adenine (A) forms a base pair with thymine (T) in
DNA, and adenine (A) forms a base pair with uracil (U) in RNA.
Conditions under which base pairs can form include physiological or
biologically relevant conditions (e.g., intracellular: pH 7.2, 140
mM potassium ion; extracellular pH 7.4, 145 mM sodium ion).
Furthermore, duplexes are stabilized by stacking interactions
between adjacent nucleotides. As used herein, a duplex may be
established or maintained by base pairing or by stacking
interactions. A duplex is formed by two complementary nucleic acid
strands, which may be substantially complementary or fully
complementary (see below).
[0104] By "complementary" or "complementarity" is meant that a
nucleic acid can form hydrogen bond(s) with another nucleic acid
sequence by either traditional Watson-Crick or Hoogsteen base
pairing. In reference to the nucleic acid molecules of the present
disclosure, the binding free energy for a nucleic acid molecule
with its complementary sequence is sufficient to allow the relevant
function of the nucleic acid to proceed, e.g., RNAi activity.
Determination of binding free energies for nucleic acid molecules
is well known in the art (see, e.g., Turner, et al., CSH Symp.
Quant. Biol. LII, pp. 123-133, 1987; Frier, et al., Proc. Nat.
Acad. Sci. USA 83:9373-9377, 1986; Turner, et al., J. Am. Chem.
Soc. 109:3783-3785, 1987). A percent complementarity indicates the
percentage of contiguous residues in a nucleic acid molecule that
can form hydrogen bonds (e.g., Watson-Crick base pairing) with a
second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10
nucleotides out of a total of 10 nucleotides in the first
oligonucleotide being based paired to a second nucleic acid
sequence having 10 nucleotides represents 50%, 60%, 70%, 80%, 90%,
and 100% complementary, respectively). To determine that a percent
complementarity is of at least a certain percentage, the percentage
of contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence is calculated and rounded to the nearest
whole number (e.g., 12, 13, 14, 15, 16, or 17 nucleotides out of a
total of 23 nucleotides in the first oligonucleotide being based
paired to a second nucleic acid sequence having 23 nucleotides
represents 52%, 57%, 61%, 65%, 70%, and 74%, respectively; and has
at least 50%, 50%, 60%, 60%, 70%, and 70% complementarity,
respectively). As used herein, "substantially complementary" refers
to complementarity between the strands such that they are capable
of hybridizing under biological conditions. Substantially
complementary sequences have 60%, 70%, 80%, 90%, 95%, or even 100%
complementarity. Additionally, techniques to determine if two
strands are capable of hybridizing under biological conditions by
examining their nucleotide sequences are well known in the art.
[0105] The first and second strands of the agents of the invention
(antisense and sense oligonucleotides) are not required to be
completely complementary. In one embodiment, the RNA sequence of
the antisense strand contains one or more mismatches or modified
nucleotides with base analogs. In an exemplary embodiment, such
mismatches occur within the 3' region of RNA sequence of the
antisense strand (e.g., within the RNA sequence of the antisense
strand that is complementary to the target RNA sequence that is
positioned 5' of the projected Argonaute 2 (Ago2) cut site within
the target RNA--see, e.g., FIG. 6 for illustration of exemplary
location of such a mismatch-containing region). In one aspect,
about two mismatches or modified nucleotides with base analogs are
incorporated within the RNA sequence of the antisense strand that
is 3' in the antisense strand of the projected Ago2 cleavage site
of the target RNA sequence when the target RNA sequence is
hybridized.
[0106] The use of mismatches or decreased thermodynamic stability
(specifically at or near the 3'-terminal residues of
sense/5'-terminal residues of the antisense region of siRNAs) has
been proposed to facilitate or favor entry of the antisense strand
into RISC (Schwarz et al., 2003; Khvorova et al., 2003), presumably
by affecting some rate-limiting unwinding steps that occur with
entry of the siRNA into RISC. Thus, terminal base composition has
been included in design algorithms for selecting active 21mer siRNA
duplexes (Ui-Tei et al., 2004; Reynolds et al., 2004).
[0107] In certain embodiments, mismatches (or modified nucleotides
with base analogs) can be positioned within a parent DsiRNA
(optionally a right- or left-extended DsiRNA agent) at or near the
predicted 3'-terminus of the sense strand of the siRNA projected to
be formed following Dicer cleavage. In such embodiments, the small
end-terminal sequence which contains the mismatch(es) will either
be left unpaired with the antisense strand (become part of a
3'-overhang) or be cleaved entirely off the final 21-mer siRNA. In
such embodiments, mismatches in the original (non-Dicer-processed)
agent do not persist as mismatches in the final RNA component of
RISC. It has been found that base mismatches or destabilization of
segments at the 3'-end of the sense strand of Dicer substrate
improved the potency of synthetic duplexes in RNAi, presumably by
facilitating processing by Dicer (Collingwood et al., 2008).
[0108] In some embodiments, one or more mismatches are positioned
within a DsiRNA agent of the invention (optionally a right- or
left-extended DsiRNA agent) at a location within the region of the
antisense strand of the DsiRNA agent that hybridizes with the
region of the target mRNA that is positioned 5' of the predicted
Ago2 cleavage site within the target mRNA (see, e.g., location(s)
of mismatches within the agents of FIG. 7). Optionally, two or more
mismatches are positioned within the right- or left-extended DsiRNA
agents of the instant invention within this relatively 3' region of
the antisense strand that hybridizes to a sequence of the target
RNA that is positioned 5' of the projected Ago2 cleavage site of
the target RNA (were target RNA cleavage to occur). Inclusion of
such mismatches within the DsiRNA agents of the instant invention
can allow such agents to exert inhibitory effects that resemble
those of naturally-occurring miRNAs, and optionally can be directed
against not only naturally-occurring miRNA target RNAs (e.g., 3'
UTR regions of target transcripts) but also against RNA sequences
for which no naturally-occurring antagonistic miRNA is known to
exist. For example, DsiRNAs of the invention possessing mismatched
base pairs which are designed to resemble and/or function as miRNAs
can be synthesized to target repetitive sequences within
genes/transcripts that might not be targeted by naturally-occurring
miRNAs (e.g., repeat sequences within the Notch protein can be
targeted, where individual repeats within Notch can differ from one
another (e.g., be degenerate) at the nucleic acid level, but which
can be effectively targeted via a miRNA mechanism that allows for
mismatch(es) yet also allows for a more promiscuous inhibitory
effect than a corresponding, perfect match siRNA agent). In such
embodiments, target RNA cleavage may or may not be necessary for
the mismatch-containing DsiRNA agent to exert an inhibitory
effect.
[0109] In one embodiment, a double stranded nucleic acid molecule
of the invention comprises or functions as a microRNA (miRNA). By
"microRNA" or "miRNA" is meant a small double stranded RNA that
regulates the expression of target messenger RNAs either by mRNA
cleavage, translational repression/inhibition or heterochromatic
silencing (see for example Ambros, 2004, Nature, 431, 350-355;
Bartel, 2004, Cell, 116, 281-297; Cullen, 2004, Virus Research.,
102, 3-9; He et al., 2004, Nat. Rev. Genet., 5, 522-531; and Ying
et al., 2004, Gene, 342, 25-28). In one embodiment, the microRNA of
the invention, has partial complementarity (i.e., less than 100%
complementarity) between the sense strand (e.g., first strand) or
sense region and the antisense strand (e.g., second strand) or
antisense region of the miRNA molecule or between the antisense
strand or antisense region of the miRNA and a corresponding target
nucleic acid molecule (e.g., target mRNA). For example, partial
complementarity can include various mismatches or non-base paired
nucleotides (e.g., 1, 2, 3, 4, 5 or more mismatches or non-based
paired nucleotides, such as nucleotide bulges) within the double
stranded nucleic acid molecule structure, which can result in
bulges, loops, or overhangs that result between the sense strand or
sense region and the antisense strand or antisense region of the
miRNA or between the antisense strand or antisense region of the
miRNA and a corresponding target nucleic acid molecule.
[0110] Single-stranded nucleic acids that base pair over a number
of bases are said to "hybridize." Hybridization is typically
determined under physiological or biologically relevant conditions
(e.g., intracellular: pH 7.2, 140 mM potassium ion; extracellular
pH 7.4, 145 mM sodium ion). Hybridization conditions generally
contain a monovalent cation and biologically acceptable buffer and
may or may not contain a divalent cation, complex anions, e.g.
gluconate from potassium gluconate, uncharged species such as
sucrose, and inert polymers to reduce the activity of water in the
sample, e.g. PEG. Such conditions include conditions under which
base pairs can form.
[0111] Hybridization is measured by the temperature required to
dissociate single stranded nucleic acids forming a duplex, i.e.,
(the melting temperature; Tm). Hybridization conditions are also
conditions under which base pairs can form. Various conditions of
stringency can be used to determine hybridization (see, e.g., Wahl,
G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A.
R. (1987) Methods Enzymol. 152:507). Stringent temperature
conditions will ordinarily include temperatures of at least about
30.degree. C., more preferably of at least about 37.degree. C., and
most preferably of at least about 42.degree. C. The hybridization
temperature for hybrids anticipated to be less than 50 base pairs
in length should be 5-10.degree. C. less than the melting
temperature (Tm) of the hybrid, where Tm is determined according to
the following equations. For hybrids less than 18 base pairs in
length, Tm(.degree. C.)=2(# of A+T bases)+4(# of G+C bases). For
hybrids between 18 and 49 base pairs in length, Tm(.degree.
C.)=81.5+16.6(log 10[Na+])+0.41 (% G+C)-(600/N), where N is the
number of bases in the hybrid, and [Na+] is the concentration of
sodium ions in the hybridization buffer ([Na+] for
1.times.SSC=0.165 M). For example, a hybridization determination
buffer is shown in Table 1.
TABLE-US-00001 TABLE 1 m.w./ To make 50 final conc. Vender Cat#
Lot# Stock mL solution NaCl 100 mM Sigma S-5150 41K8934 5M 1 mL KCl
80 mM Sigma P-9541 70K0002 74.55 0.298 g MgCl.sub.2 8 mM Sigma
M-1028 120K8933 1M 0.4 mL sucrose 2% w/v Fisher BP220-212 907105
342.3 1 g Tris-HCl 16 mM Fisher BP1757-500 12419 1M 0.8 mL
NaH.sub.2PO.sub.4 1 mM Sigma S-3193 52H-029515 120.0 0.006 g EDTA
0.02 mM Sigma E-7889 110K89271 0.5M 2 .mu.L H.sub.2O Sigma W-4502
51K2359 to 50 mL pH = 7.0 adjust with HCl at 20.degree. C.
[0112] Useful variations on hybridization conditions will be
readily apparent to those skilled in the art. Hybridization
techniques are well known to those skilled in the art and are
described, for example, in Benton and Davis (Science 196:180,
1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961,
1975); Ausubel et al. (Current Protocols in Molecular Biology,
Wiley Interscience, New York, 2001); Berger and Kimmel (Antisense
to Molecular Cloning Techniques, 1987, Academic Press, New York);
and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, New York.
[0113] As used herein, "oligonucleotide strand" is a single
stranded nucleic acid molecule. An oligonucleotide may comprise
ribonucleotides, deoxyribonucleotides, modified nucleotides (e.g.,
nucleotides with 2' modifications, synthetic base analogs, etc.) or
combinations thereof. Such modified oligonucleotides can be
preferred over native forms because of properties such as, for
example, enhanced cellular uptake and increased stability in the
presence of nucleases.
[0114] Certain dsNAs of this invention are chimeric dsNAs.
"Chimeric dsNAs" or "chimeras", in the context of this invention,
are dsNAs which contain two or more chemically distinct regions,
each made up of at least one nucleotide. These dsNAs typically
contain at least one region primarily comprising ribonucleotides
(optionally including modified ribonucleotides) that form a Dicer
substrate siRNA ("DsiRNA") molecule. This DsiRNA region is
covalently attached to a second region comprising base paired
deoxyribonucleotides (a "dsDNA region") which confers one or more
beneficial properties (such as, for example, increased efficacy,
e.g., increased potency and/or duration of DsiRNA activity,
function as a recognition domain or means of targeting a chimeric
dsNA to a specific location, for example, when administered to
cells in culture or to a subject, functioning as an extended region
for improved attachment of functional groups, payloads,
detection/detectable moieties, functioning as an extended region
that allows for more desirable modifications and/or improved
spacing of such modifications, etc.). This second region comprising
base paired deoxyribonucleotides may also include modified or
synthetic nucleotides and/or modified or synthetic
deoxyribonucleotides.
[0115] As used herein, the term "ribonucleotide" encompasses
natural and synthetic, unmodified and modified ribonucleotides.
Modifications include changes to the sugar moiety, to the base
moiety and/or to the linkages between ribonucleotides in the
oligonucleotide. As used herein, the term "ribonucleotide"
specifically excludes a deoxyribonucleotide, which is a nucleotide
possessing a single proton group at the 2' ribose ring
position.
[0116] As used herein, the term "deoxyribonucleotide" encompasses
natural and synthetic, unmodified and modified
deoxyribonucleotides. Modifications include changes to the sugar
moiety, to the base moiety and/or to the linkages between
deoxyribonucleotide in the oligonucleotide. As used herein, the
term "deoxyribonucleotide" also includes a modified ribonucleotide
that does not permit Dicer cleavage of a dsNA agent, e.g., a
2'-O-methyl ribonucleotide, a phosphorothioate-modified
ribonucleotide residue, etc., that does not permit Dicer cleavage
to occur at a bond of such a residue.
[0117] As used herein, the term "PS-NA" refers to a
phosphorothioate-modified nucleotide residue. The term "PS-NA"
therefore encompasses both phosphorothioate-modified
ribonucleotides ("PS-RNAs") and phosphorothioate-modified
deoxyribonucleotides ("PS-DNAs").
[0118] In certain embodiments, a chimeric DsiRNA/DNA agent of the
invention comprises at least one duplex region of at least 23
nucleotides in length, within which at least 50% of all nucleotides
are unmodified ribonucleotides. As used herein, the term
"unmodified ribonucleotide" refers to a ribonucleotide possessing a
hydroxyl (--OH) group at the 2' position of the ribose sugar.
[0119] In certain embodiments, a chimeric DsiRNA/DNA agent of the
invention comprises at least one region, located 3' of the
projected Dicer cleavage site on the first strand and 5' of the
projected Dicer cleavage site on the second strand, having a length
of at least 2 base paired nucleotides in length, wherein at least
50% of all nucleotides within this region of at least 2 base paired
nucleotides in length are unmodified deoxyribonucleotides. As used
herein, the term "unmodified deoxyribonucleotide" refers to a
ribonucleotide possessing a single proton at the 2' position of the
ribose sugar.
[0120] As used herein, "antisense strand" refers to a single
stranded nucleic acid molecule which has a sequence complementary
to that of a target RNA. When the antisense strand contains
modified nucleotides with base analogs, it is not necessarily
complementary over its entire length, but must at least hybridize
with a target RNA.
[0121] As used herein, "sense strand" refers to a single stranded
nucleic acid molecule which has a sequence complementary to that of
an antisense strand. When the antisense strand contains modified
nucleotides with base analogs, the sense strand need not be
complementary over the entire length of the antisense strand, but
must at least duplex with the antisense strand.
[0122] As used herein, "guide strand" refers to a single stranded
nucleic acid molecule of a dsRNA or dsRNA-containing molecule,
which has a sequence sufficiently complementary to that of a target
RNA to result in RNA interference. After cleavage of the dsRNA or
dsRNA-containing molecule by Dicer, a fragment of the guide strand
remains associated with RISC, binds a target RNA as a component of
the RISC complex, and promotes cleavage of a target RNA by RISC. As
used herein, the guide strand does not necessarily refer to a
continuous single stranded nucleic acid and may comprise a
discontinuity, preferably at a site that is cleaved by Dicer. A
guide strand is an antisense strand.
[0123] As used herein, "target RNA" refers to an RNA that would be
subject to modulation guided by the antisense strand, such as
targeted cleavage or steric blockage. The target RNA could be, for
example genomic viral RNA, mRNA, a pre-mRNA, or a non-coding RNA.
The preferred target is mRNA, such as the mRNA encoding a disease
associated protein, such as ApoB, Bcl2, Hif-1alpha, Survivin or a
p21 ras, such as Ha. ras, K-ras or N-ras.
[0124] As used herein, "passenger strand" refers to an
oligonucleotide strand of a dsRNA or dsRNA-containing molecule,
which has a sequence that is complementary to that of the guide
strand. As used herein, the passenger strand does not necessarily
refer to a continuous single stranded nucleic acid and may comprise
a discontinuity, preferably at a site that is cleaved by Dicer. A
passenger strand is a sense strand.
[0125] As used herein. "Dicer" refers to an endoribonuclease in the
RNase III family that cleaves a dsRNA or dsRNA-containing molecule,
e.g., double-stranded RNA (dsRNA) or pre-microRNA (miRNA), into
double-stranded nucleic acid fragments about 19-25 nucleotides
long, usually with a two-base overhang on the 3' end. With respect
to the dsNAs of the invention, the duplex formed by a dsRNA region
of a dsNA of the invention is recognized by Dicer and is a Dicer
substrate on at least one strand of the duplex. Dicer catalyzes the
first step in the RNA interference pathway, which consequently
results in the degradation of a target RNA. The protein sequence of
human Dicer is provided at the NCBI database under accession number
NP.sub.--085124, hereby incorporated by reference.
[0126] Dicer "cleavage" is determined as follows (e.g., see
Collingwood et al., Oligonucleotides 18:187-200 (2008)). In a Dicer
cleavage assay, RNA duplexes (100 pmol) are incubated in 20 .mu.L
of 20 mM Tris pH 8.0, 200 mM NaCl, 2.5 mM MgCl2 with or without 1
unit of recombinant human Dicer (Stratagene, La Jolla, Calif.) at
37.degree. C. for 18-24 hours. Samples are desalted using a
Performa SR 96-well plate (Edge Biosystems, Gaithersburg, Md.).
Electrospray-ionization liquid chromatography mass spectroscopy
(ESI-LCMS) of duplex RNAs pre- and post-treatment with Dicer is
done using an Oligo HTCS system (Novatia, Princeton, N.J.; Hail et
al., 2004), which consists of a ThermoFinnigan TSQ7000, Xcalibur
data system, ProMass data processing software and Paradigm MS4 HPLC
(Michrom BioResources, Auburn, Calif.). In this assay, Dicer
cleavage occurs where at least 5%, 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 95%, or even 100% of the Dicer substrate dsRNA,
(i.e., 25-35 bp dsRNA, preferably 26-30 bp dsRNA, optionally
extended as described herein) is cleaved to a shorter dsRNA (e.g.,
19-23 bp dsRNA, preferably, 21-23 bp dsRNA).
[0127] As used herein. "Dicer cleavage site" refers to the sites at
which Dicer cleaves a dsRNA (e.g., the dsRNA region of a dsNA of
the invention). Dicer contains two RNase III domains which
typically cleave both the sense and antisense strands of a dsRNA.
The average distance between the RNase III domains and the PAZ
domain determines the length of the short double-stranded nucleic
acid fragments it produces and this distance can vary (Macrae I, et
al. (2006). "Structural basis for double-stranded RNA processing by
Dicer". Science 311 (5758): 195-8.). As shown in FIG. 1A, Dicer is
projected to cleave certain double-stranded nucleic acids of the
instant invention that possess an antisense strand having a 2
nucleotide 3' overhang at a site between the 21.sup.st and
22.sup.nd nucleotides removed from the 3' terminus of the antisense
strand, and at a corresponding site between the 21.sup.st and
22.sup.nd nucleotides removed from the 5' terminus of the sense
strand. The projected and/or prevalent Dicer cleavage site(s) for
dsNA molecules distinct from those depicted in FIG. 1A may be
similarly identified via art-recognized methods, including those
described in Macrae et al. While the Dicer cleavage event depicted
in FIG. 1A generates a 21 nucleotide siRNA, it is noted that Dicer
cleavage of a dsNA (e.g., DsiRNA) can result in generation of
Dicer-processed siRNA lengths of 19 to 23 nucleotides in length.
Indeed, in one aspect of the invention that is described in greater
detail below, a double stranded DNA region is included within a
dsNA for purpose of directing prevalent Dicer excision of a
typically non-preferred 19mer siRNA.
[0128] As used herein, "overhang" refers to unpaired nucleotides,
in the context of a duplex having two or four free ends at either
the 5' terminus or 3' terminus of a dsNA. In certain embodiments,
the overhang is a 3' or 5' overhang on the antisense strand or
sense strand.
[0129] As used herein, "target" refers to any nucleic acid sequence
whose expression or activity is to be modulated. In particular
embodiments, the target refers to an RNA which duplexes to a single
stranded nucleic acid that is an antisense strand in a RISC
complex. Hybridization of the target RNA to the antisense strand
results in processing by the RISC complex. Consequently, expression
of the RNA or proteins encoded by the RNA, e.g., mRNA, is
reduced.
[0130] As used herein, the term "RNA processing" refers to
processing activities performed by components of the siRNA, miRNA
or RNase H pathways (e.g., Drosha, Dicer, Argonaute2 or other RISC
endoribonucleases, and RNaseH), which are described in greater
detail below (see "RNA Processing" section below). The term is
explicitly distinguished from the post-transcriptional processes of
5' capping of RNA and degradation of RNA via non-RISC- or non-RNase
H-mediated processes. Such "degradation" of an RNA can take several
forms, e.g. deadenylation (removal of a 3' poly(A) tail), and/or
nuclease digestion of part or all of the body of the RNA by any of
several endo- or exo-nucleases (e.g., RNase III, RNase P, RNase T1,
RNase A (1, 2, 3, 4/5), oligonucleotidase, etc.).
[0131] As used herein, "reference" is meant a standard or control.
As is apparent to one skilled in the art, an appropriate reference
is where only one element is changed in order to determine the
effect of the one element.
[0132] As used herein, "modified nucleotide" refers to a nucleotide
that has one or more modifications to the nucleoside, the
nucleobase, pentose ring, or phosphate group. For example, modified
nucleotides exclude ribonucleotides containing adenosine
monophosphate, guanosine monophosphate, uridine monophosphate, and
cytidine monophosphate and deoxyribonucleotides containing
deoxyadenosine monophosphate, deoxyguanosine monophosphate,
deoxythymidine monophosphate, and deoxycytidine monophosphate.
Modifications include those naturally occurring that result from
modification by enzymes that modify nucleotides, such as
methyltransferases. Modified nucleotides also include synthetic or
non-naturally occurring nucleotides. Synthetic or non-naturally
occurring modifications in nucleotides include those with 2'
modifications, e.g., 2'-methoxyethoxy, 2'-fluoro, 2'-allyl,
2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio,
4'-CH.sub.2-O-2'-bridge, 4'-(CH.sub.2).sub.2--O-2'-bridge, 2'-LNA,
and 2'-O--(N-methylcarbamate) or those comprising base analogs. In
connection with 2'-modified nucleotides as described for the
present disclosure, by "amino" is meant 2'-NH.sub.2 or
2'-O--NH.sub.2, which can be modified or unmodified. Such modified
groups are described, e.g., in Eckstein et al., U.S. Pat. No.
5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878.
[0133] The term "in vitro" has its art recognized meaning, e.g.,
involving purified reagents or extracts, e.g., cell extracts. The
term "in vivo" also has its art recognized meaning, e.g., involving
living cells, e.g., immortalized cells, primary cells, cell lines,
and/or cells in an organism.
[0134] In reference to the nucleic acid molecules of the present
disclosure, the modifications may exist in patterns on a strand of
the dsNA. As used herein, "alternating positions" refers to a
pattern where every other nucleotide is a modified nucleotide or
there is an unmodified nucleotide (e.g., an unmodified
ribonucleotide) between every modified nucleotide over a defined
length of a strand of the dsNA (e.g., 5'-MNMNMN-3'; 3'-MNMNMN-5';
where M is a modified nucleotide and N is an unmodified
nucleotide). The modification pattern starts from the first
nucleotide position at either the 5' or 3' terminus according to
any of the position numbering conventions described herein (in
certain embodiments, position 1 is designated in reference to the
terminal residue of a strand following a projected Dicer cleavage
event of a DsiRNA agent of the invention; thus, position 1 does not
always constitute a 3' terminal or 5' terminal residue of a
pre-processed agent of the invention). The pattern of modified
nucleotides at alternating positions may run the full length of the
strand, but in certain embodiments includes at least 4, 6, 8, 10,
12, 14 nucleotides containing at least 2, 3, 4, 5, 6 or 7 modified
nucleotides, respectively. As used herein, "alternating pairs of
positions" refers to a pattern where two consecutive modified
nucleotides are separated by two consecutive unmodified nucleotides
over a defined length of a strand of the dsNA (e.g.,
5'-MMNNMMNNMMNN-3'; 3'-MMNNMMNNMMNN-5'; where M is a modified
nucleotide and N is an unmodified nucleotide). The modification
pattern starts from the first nucleotide position at either the 5'
or 3' terminus according to any of the position numbering
conventions described herein. The pattern of modified nucleotides
at alternating positions may run the full length of the strand, but
preferably includes at least 8, 12, 16, 20, 24, 28 nucleotides
containing at least 4, 6, 8, 10, 12 or 14 modified nucleotides,
respectively. It is emphasized that the above modification patterns
are exemplary and are not intended as limitations on the scope of
the invention.
[0135] As used herein, "base analog" refers to a heterocyclic
moiety which is located at the 1' position of a nucleotide sugar
moiety in a modified nucleotide that can be incorporated into a
nucleic acid duplex (or the equivalent position in a nucleotide
sugar moiety substitution that can be incorporated into a nucleic
acid duplex). In the dsNAs of the invention, a base analog is
generally either a purine or pyrimidine base excluding the common
bases guanine (G), cytosine (C), adenine (A), thymine (T), and
uracil (U). Base analogs can duplex with other bases or base
analogs in dsRNAs. Base analogs include those useful in the
compounds and methods of the invention, e.g., those disclosed in
U.S. Pat. Nos. 5,432,272 and 6,001,983 to Benner and US Patent
Publication No. 20080213891 to Manoharan, which are herein
incorporated by reference. Non-limiting examples of bases include
hypoxanthine (I), xanthine (X),
3.beta.-D-ribofuranosyl-(2,6-diaminopyrimidine) (K),
3-.beta.-D-ribofuranosyl-(1-methyl-pyrazolo[4,3-d]pyrimidine-5,7(4H,6H)-d-
ione) (P), iso-cytosine (iso-C), iso-guanine (iso-G),
1-.beta.-D-ribofuranosyl-(5-nitroindole),
1-.beta.-D-ribofuranosyl-(3-nitropyrrole), 5-bromouracil,
2-aminopurine, 4-thio-dT, 7-(2-thienyl)-imidazo[4,5-b]pyridine (Ds)
and pyrrole-2-carbaldehyde (Pa), 2-amino-6-(2-thienyl)purine (S),
2-oxopyridine (Y), difluorotolyl, 4-fluoro-6-methylbenzimidazole,
4-methylbenzimidazole, 3-methyl isocarbostyrilyl, 5-methyl
isocarbostyrilyl, and 3-methyl-7-propynyl isocarbostyrilyl,
7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl,
9-methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl,
7-propynyl isocarbostyrilyl, propynyl-7-azaindolyl,
2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl,
phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl,
stilbenzyl, tetracenyl, pentacenyl, and structural derivates
thereof (Schweitzer et al., J. Org. Chem., 59:7238-7242 (1994);
Berger et al., Nucleic Acids Research, 28(15):2911-2914 (2000);
Moran et al., J. Am. Chem. Soc., 119:2056-2057 (1997); Morales et
al., J. Am. Chem. Soc., 121:2323-2324 (1999); Guckian et al., J.
Am. Chem. Soc., 118:8182-8183 (1996); Morales et al., J. Am. Chem.
Soc., 122(6):1001-1007 (2000); McMinn et al., J. Am. Chem. Soc.,
121:11585-11586 (1999); Guckian et al., J. Org. Chem., 63:9652-9656
(1998); Moran et al., Proc. Natl. Acad. Sci., 94:10506-10511
(1997); Das et al., J. Chem. Soc., Perkin Trans., 1:197-206 (2002);
Shibata et al., J. Chem. Soc., Perkin Trans., 1: 1605-1611 (2001);
Wu et al., J. Am. Chem. Soc., 122(32):7621-7632 (2000); O'Neill et
al., J. Org. Chem., 67:5869-5875 (2002); Chaudhuri et al., J. Am.
Chem. Soc., 117:10434-10442 (1995); and U.S. Pat. No. 6,218,108.).
Base analogs may also be a universal base.
[0136] As used herein, "universal base" refers to a heterocyclic
moiety located at the 1' position of a nucleotide sugar moiety in a
modified nucleotide, or the equivalent position in a nucleotide
sugar moiety substitution, that, when present in a nucleic acid
duplex, can be positioned opposite more than one type of base
without altering the double helical structure (e.g., the structure
of the phosphate backbone). Additionally, the universal base does
not destroy the ability of the single stranded nucleic acid in
which it resides to duplex to a target nucleic acid. The ability of
a single stranded nucleic acid containing a universal base to
duplex a target nucleic can be assayed by methods apparent to one
in the art (e.g., UV absorbance, circular dichroism, gel shift,
single stranded nuclease sensitivity, etc.). Additionally,
conditions under which duplex formation is observed may be varied
to determine duplex stability or formation, e.g., temperature, as
melting temperature (Tm) correlates with the stability of nucleic
acid duplexes. Compared to a reference single stranded nucleic acid
that is exactly complementary to a target nucleic acid, the single
stranded nucleic acid containing a universal base forms a duplex
with the target nucleic acid that has a lower Tm than a duplex
formed with the complementary nucleic acid. However, compared to a
reference single stranded nucleic acid in which the universal base
has been replaced with a base to generate a single mismatch, the
single stranded nucleic acid containing the universal base forms a
duplex with the target nucleic acid that has a higher Tm than a
duplex formed with the nucleic acid having the mismatched base.
[0137] Some universal bases are capable of base pairing by forming
hydrogen bonds between the universal base and all of the bases
guanine (G), cytosine (C), adenine (A), thymine (T), and uracil (U)
under base pair forming conditions. A universal base is not a base
that forms a base pair with only one single complementary base. In
a duplex, a universal base may form no hydrogen bonds, one hydrogen
bond, or more than one hydrogen bond with each of G, C, A, T, and U
opposite to it on the opposite strand of a duplex. Preferably, the
universal bases does not interact with the base opposite to it on
the opposite strand of a duplex. In a duplex, base pairing between
a universal base occurs without altering the double helical
structure of the phosphate backbone. A universal base may also
interact with bases in adjacent nucleotides on the same nucleic
acid strand by stacking interactions. Such stacking interactions
stabilize the duplex, especially in situations where the universal
base does not form any hydrogen bonds with the base positioned
opposite to it on the opposite strand of the duplex. Non-limiting
examples of universal-binding nucleotides include inosine,
1-.beta.-D-ribofuranosyl-5-nitroindole, and/or
1-.beta.-D-ribofuranosyl-3-nitropyrrole (US Pat. Appl. Publ. No.
20070254362 to Quay et al.; Van Aerschot et al., An acyclic
5-nitroindazole nucleoside analogue as ambiguous nucleoside.
Nucleic Acids Res. 1995 Nov. 11; 23(21):4363-70; Loakes et al.,
3-Nitropyrrole and 5-nitroindole as universal bases in primers for
DNA sequencing and PCR. Nucleic Acids Res. 1995 Jul. 11;
23(13):2361-6; Loakes and Brown, 5-Nitroindole as an universal base
analogue. Nucleic Acids Res. 1994 Oct. 11; 22(20):4039-43).
[0138] As used herein, "loop" refers to a structure formed by a
single strand of a nucleic acid, in which complementary regions
that flank a particular single stranded nucleotide region hybridize
in a way that the single stranded nucleotide region between the
complementary regions is excluded from duplex formation or
Watson-Crick base pairing. A loop is a single stranded nucleotide
region of any length. Examples of loops include the unpaired
nucleotides present in such structures as hairpins, stem loops, or
extended loops.
[0139] As used herein, "extended loop" in the context of a dsRNA
refers to a single stranded loop and in addition 1, 2, 3, 4, 5, 6
or up to 20 base pairs or duplexes flanking the loop. In an
extended loop, nucleotides that flank the loop on the 5' side form
a duplex with nucleotides that flank the loop on the 3' side. An
extended loop may form a hairpin or stem loop.
[0140] As used herein, "tetraloop" in the context of a dsRNA refers
to a loop (a single stranded region) consisting of four nucleotides
that forms a stable secondary structure that contributes to the
stability of an adjacent Watson-Crick hybridized nucleotides.
Without being limited to theory, a tetraloop may stabilize an
adjacent Watson-Crick base pair by stacking interactions. In
addition, interactions among the four nucleotides in a tetraloop
include but are not limited to non-Watson-Crick base pairing,
stacking interactions, hydrogen bonding, and contact interactions
(Cheong et al., Nature 1990 Aug. 16; 346(6285):680-2; Heus and
Pardi, Science 1991 Jul. 12; 253(5016):191-4). A tetraloop confers
an increase in the melting temperature (Tm) of an adjacent duplex
that is higher than expected from a simple model loop sequence
consisting of four random bases. For example, a tetraloop can
confer a melting temperature of at least 55.degree. C. in 10 mM
NaHPO.sub.4 to a hairpin comprising a duplex of at least 2 base
pairs in length. A tetraloop may contain ribonucleotides,
deoxyribonucleotides, modified nucleotides, and combinations
thereof. Examples of RNA tetraloops include the UNCG family of
tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g.,
GAAA), and the CUUG tetraloop. (Woese et al., Proc Natl Acad Sci
USA. 1990 November; 87(21):8467-71; Antao et al., Nucleic Acids
Res. 1991 Nov. 11; 19(21):5901-5). Examples of DNA tetraloops
include the d(GNNA) family of tetraloops (e.g., d(GTTA), the
d(GNRA)) family of tetraloops, the d(GNAB) family of tetraloops,
the d(CNNG) family of tetraloops, the d(TNCG) family of tetraloops
(e.g., d(TTCG)). (Nakano et al. Biochemistry, 41 (48), 14281-14292,
2002.; SHINJI et al. Nippon Kagakkai Koen Yokoshu VOL. 78th; NO. 2;
PAGE. 731 (2000).)
[0141] As used herein, "increase" or "enhance" is meant to alter
positively by at least 5% compared to a reference in an assay. An
alteration may be by 5%, 10%, 25%, 30%, 50%, 75%, or even by 100%
compared to a reference in an assay. By "enhance Dicer cleavage,"
it is meant that the processing of a quantity of a dsRNA or
dsRNA-containing molecule by Dicer results in more Dicer cleaved
dsRNA products, that Dicer cleavage reaction occurs more quickly
compared to the processing of the same quantity of a reference
dsRNA or dsRNA-containing molecule in an in vivo or in vitro assay
of this disclosure, or that Dicer cleavage is directed to cleave at
a specific, preferred site within a dsNA and/or generate higher
prevalence of a preferred population of cleavage products (e.g., by
inclusion of DNA residues as described herein). In one embodiment,
enhanced or increased Dicer cleavage of a dsNA molecule is above
the level of that observed with an appropriate reference dsNA
molecule. In another embodiment, enhanced or increased Dicer
cleavage of a dsNA molecule is above the level of that observed
with an inactive or attenuated molecule.
[0142] As used herein "reduce" is meant to alter negatively by at
least 5% compared to a reference in an assay. An alteration may be
by 5%, 10%, 25%, 30%, 50%, 75%, or even by 100% compared to a
reference in an assay. By "reduce expression," it is meant that the
expression of the gene, or level of RNA molecules or equivalent RNA
molecules encoding one or more proteins or protein subunits, or
level or activity of one or more proteins or protein subunits
encoded by a target gene, is reduced below that observed in the
absence of the nucleic acid molecules (e.g., dsRNA molecule or
dsRNA-containing molecule) in an in vivo or in vitro assay of this
disclosure. In one embodiment, inhibition, down-regulation or
reduction with a dsNA molecule is below that level observed in the
presence of an inactive or attenuated molecule. In another
embodiment, inhibition, down-regulation, or reduction with dsNA
molecules is below that level observed in the presence of, e.g., a
dsNA molecule with scrambled sequence or with mismatches. In
another embodiment, inhibition, down-regulation, or reduction of
gene expression with a nucleic acid molecule of the instant
disclosure is greater in the presence of the nucleic acid molecule
than in its absence.
[0143] As used herein, "cell" is meant to include both prokaryotic
(e.g., bacterial) and eukaryotic (e.g., mammalian or plant) cells.
Cells may be of somatic or germ line origin, may be totipotent or
pluripotent, and may be dividing or non-dividing. Cells can also be
derived from or can comprise a gamete or an embryo, a stem cell, or
a fully differentiated cell. Thus, the term "cell" is meant to
retain its usual biological meaning and can be present in any
organism such as, for example, a bird, a plant, and a mammal,
including, for example, a human, a cow, a sheep, an ape, a monkey,
a pig, a dog, and a cat. Within certain aspects, the term "cell"
refers specifically to mammalian cells, such as human cells, that
contain one or more isolated dsNA molecules of the present
disclosure. In particular aspects, a cell processes dsRNAs or
dsRNA-containing molecules resulting in RNA intereference of target
nucleic acids, and contains proteins and protein complexes required
for RNAi, e.g., Dicer and RISC.
[0144] As used herein, "animal" is meant a multicellular,
eukaryotic organism, including a mammal, particularly a human. The
methods of the invention in general comprise administration of an
effective amount of the agents herein, such as an agent of the
structures of formulae herein, to a subject (e.g., animal, human)
in need thereof, including a mammal, particularly a human. Such
treatment will be suitably administered to subjects, particularly
humans, suffering from, having, susceptible to, or at risk for a
disease, or a symptom thereof.
[0145] By "pharmaceutically acceptable carrier" is meant, a
composition or formulation that allows for the effective
distribution of the nucleic acid molecules of the instant
disclosure in the physical location most suitable for their desired
activity.
[0146] The present invention is directed to compositions that
comprise both a double stranded RNA ("dsRNA") duplex and
DNA-containing extended region--in most embodiments, a dsDNA
duplex--within the same agent, and methods for preparing them, that
are capable of reducing the expression of target genes in
eukaryotic cells. One of the strands of the dsRNA region contains a
region of nucleotide sequence that has a length that ranges from
about 15 to about 22 nucleotides that can direct the destruction of
the RNA transcribed from the target gene. The dsDNA duplex region
of such an agent is not necessarily complementary to the target
RNA, and, therefore, in such instances does not enhance target RNA
hybridization of the region of nucleotide sequence capable of
directing destruction of a target RNA. Double stranded NAs of the
invention can possess strands that are chemically linked, or can
also possess an extended loop, optionally comprising a tetraloop,
that links the first and second strands. In some embodiments, the
extended loop containing the tetraloop is at the 3' terminus of the
sense strand, at the 5' terminus of the antisense strand, or
both.
[0147] In one embodiment, the dsNA of the invention comprises a
double stranded RNA duplex region comprising 18-30 nts (for
example, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30 nts)
in length.
[0148] The DsiRNA/dsDNA agents of the instant invention can enhance
the following attributes of such agents relative to DsiRNAs lacking
such dsDNA regions: in vitro efficacy (e.g., potency and duration
of effect), in vivo efficacy (e.g., potency, duration of effect,
pharmacokinetics, pharmacodynamics, intracellular uptake, reduced
toxicity). In certain embodiments, the dsDNA region of the instant
invention can optionally provide an additional agent (or fragment
thereof), such as an aptamer or fragment thereof; a binding site
(e.g., a "decoy" binding site) for a native or exogenously
introduced moiety capable of binding to dsDNA in either a
non-sequence-selective or sequence-specific manner (e.g., the
dsDNA-extended region of an agent of the instant invention can be
designed to comprise one or more transcription factor recognition
sequences and/or the dsDNA-extended region can provide a
sequence-specific recognition domain for a probe, marker,
etc.).
[0149] As used herein, the term "pharmacokinetics" refers to the
process by which a drug is absorbed, distributed, metabolized, and
eliminated by the body. In certain embodiments of the instant
invention, enhanced pharmacokinetics of a DsiRNA/dsDNA agent
relative to an appropriate control DsiRNA refers to increased
absorption and/or distribution of such an agent, and/or slowed
metabolism and/or elimination of such a DsiRNA/dsDNA agent from a
subject administered such an agent.
[0150] As used herein, the term "pharmacodynamics" refers to the
action or effect of a drug on a living organism. In certain
embodiments of the instant invention, enhanced pharmacodynamics of
a DsiRNA/dsDNA agent relative to an appropriate control DsiRNA
refers to an increased (e.g., more potent or more prolonged) action
or effect of a DsiRNA/dsDNA agent upon a subject administered such
agent, relative to an appropriate control DsiRNA.
[0151] As used herein, the term "stabilization" refers to a state
of enhanced persistence of an agent in a selected environment
(e.g., in a cell or organism). In certain embodiments, the
DsiRNA/dsDNA chimeric agents of the instant invention exhibit
enhanced stability relative to appropriate control DsiRNAs. Such
enhanced stability can be achieved via enhanced resistance of such
agents to degrading enzymes (e.g., nucleases) or other agents.
DsiRNA Design/Synthesis
[0152] It was previously shown that longer dsRNA species of from 25
to about 30 nucleotides (DsiRNAs) yield unexpectedly effective RNA
inhibitory results in terms of potency and duration of action, as
compared to 19-23mer siRNA agents. Without wishing to be bound by
the underlying theory of the dsRNA processing mechanism, it is
thought that the longer dsRNA species serve as a substrate for the
Dicer enzyme in the cytoplasm of a cell. In addition to cleaving
the dsNA of the invention into shorter segments, Dicer is thought
to facilitate the incorporation of a single-stranded cleavage
product derived from the cleaved dsNA into the RISC complex that is
responsible for the destruction of the cytoplasmic RNA of or
derived from the target gene. Prior studies (Rossi et al., U.S.
Patent Application No. 2007/0265220) have shown that the
cleavability of a dsRNA species (specifically, a DsiRNA agent) by
Dicer corresponds with increased potency and duration of action of
the dsRNA species. The instant invention, at least in part,
provides for design of RNA inhibitory agents that direct the site
of Dicer cleavage, such that preferred species of Dicer cleavage
products are thereby generated.
[0153] A model of DsiRNA processing is presented in FIG. 1A.
Briefly, Dicer enzyme binds to a DsiRNA agent, resulting in
cleavage of the DsiRNA at a position 19-23 nucleotides removed from
a Dicer PAZ domain-associated 3' overhang sequence of the antisense
strand of the DsiRNA agent. This Dicer cleavage event results in
excision of those duplexed nucleic acids previously located at the
3' end of the passenger (sense) strand and 5' end of the guide
(antisense) strand. (Cleavage of the DsiRNA shown in FIG. 1A
typically yields a 19mer duplex with 2-base overhangs at each end.)
As presently modeled in FIG. 1A, this Dicer cleavage event
generates a 21-23 nucleotide guide (antisense) strand capable of
directing sequence-specific inhibition of target mRNA as a RISC
component.
[0154] The first and second oligonucleotides of the DsiRNA agents
of the instant invention are not required to be completely
complementary. In fact, in one embodiment, the 3'-terminus of the
sense strand contains one or more mismatches. In one aspect, about
two mismatches are incorporated at the 3' terminus of the sense
strand. In another embodiment, the DsiRNA of the invention is a
double stranded RNA molecule containing two RNA oligonucleotides
each of which is an identical number of nucleotides in the range of
27-35 nucleotides in length and, when annealed to each other, have
blunt ends and a two nucleotide mismatch on the 3'-terminus of the
sense strand (the 5'-terminus of the antisense strand). The use of
mismatches or decreased thermodynamic stability (specifically at
the 3'-sense/5'-antisense position) has been proposed to facilitate
or favor entry of the antisense strand into RISC (Schwarz et al.,
2003; Khvorova et al., 2003), presumably by affecting some
rate-limiting unwinding steps that occur with entry of the siRNA
into RISC. Thus, terminal base composition has been included in
design algorithms for selecting active 21mer siRNA duplexes (Ui-Tei
et al., 2004; Reynolds et al., 2004). With Dicer cleavage of the
dsRNA region of this embodiment, the small end-terminal sequence
which contains the mismatches will either be left unpaired with the
antisense strand (become part of a 3'-overhang) or be cleaved
entirely off the final 21-mer siRNA. These specific forms of
"mismatches", therefore, do not persist as mismatches in the final
RNA component of RISC. The finding that base mismatches or
destabilization of segments at the 3'-end of the sense strand of
Dicer substrate improved the potency of synthetic duplexes in RNAi,
presumably by facilitating processing by Dicer, was a surprising
finding of past works describing the design and use of 25-30mer
dsRNAs (also termed "DsiRNAs" herein; Rossi et al., U.S. Patent
Application Nos. 2005/0277610, 2005/0244858 and 2007/0265220). It
is now equally surprising that DsiRNAs having base-paired
deoxyribonucleotides at either passenger (sense) or guide
(antisense) strand positions that are predicted to be 3' of the
most 3' Dicer cleavage site of the respective passenger or guide
strand are at least equally effective as RNA-RNA duplex-extended
DsiRNA agents. Such agents may also harbor mismatches, with such
mismatches being formed by the antisense strand either in reference
to (actual or projected hybridation with) the sequence of the sense
strand of the DsiRNA agent, or in reference to the target RNA
sequence. Exemplary mismatched or wobble base pairs of agents
possessing mismatches are G:A, C:A, C:U, G:G, A:A, C:C, U:U, I:A,
I:U and I:C. Base pair strength of such agents can also be lessened
via modification of the nucleotides of such agents, including,
e.g., 2-amino- or 2,6-diamino modifications of guanine and adenine
nucleotides.
Exemplary Structures of DsiRNA Agent Compositions
[0155] In one aspect, the present invention provides compositions
for RNA interference (RNAi) that possess one or more base paired
deoxyribonucleotides within a region of a double stranded nucleic
acid (dsNA) that is positioned 3' of a projected sense strand Dicer
cleavage site and correspondingly 5' of a projected antisense
strand Dicer cleavage site. The compositions of the invention
comprise a dsNA which is a precursor molecule, i.e., the dsNA of
the present invention is processed in vivo to produce an active
small interfering nucleic acid (siRNA). The dsNA is processed by
Dicer to an active siRNA which is incorporated into RISC.
[0156] In certain embodiments, the DsiRNA agents of the invention
can have any of the following exemplary structures:
[0157] In one such embodiment, the DsiRNA comprises:
TABLE-US-00002 5'-XXXXXXXXXXXXXXXXXXXXXXXX.sub.N*D.sub.NDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*D.sub.NXX-5'
wherein "X"=RNA, "Y" is an optional overhang domain comprised of
0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers--in
certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA
monomers that are optionally 2'-O-methyl RNA monomers, "D"=DNA, and
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In
one embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand.
[0158] In a related embodiment, the DsiRNA comprises:
TABLE-US-00003 5'-XXXXXX-XXXXXXX-XXXXXXX-X.sub.N*D.sub.NDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*D.sub.NDD-5'
wherein "X"=RNA, "Y" is an optional overhang domain comprised of
0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers--in
certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA
monomers that are optionally 2'-O-methyl RNA monomers, "D"=DNA, and
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In
one embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand.
[0159] In another such embodiment, the DsiRNA comprises:
TABLE-US-00004 5'-XXXXXX-XXXXXXX-XXXXXXXXX.sub.N*D.sub.NDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*D.sub.NZZ-5'
wherein "X"=RNA, "X"=2'-O-methyl RNA, "Y" is an optional overhang
domain comprised of 0-10 RNA monomers that are optionally
2'-O-methyl RNA monomers--in certain embodiments, "Y" is an
overhang domain comprised of 1-4 RNA monomers that are optionally
2'-O-methyl RNA monomers, "D"=DNA, "Z"=DNA or RNA, and "N"=1 to 50
or more, but is optionally 1-15 or, optionally, 1-8. "N*"=0 to 15
or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In one
embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand, with
2'-O-methyl RNA monomers located at alternating residues along the
top strand, rather than the bottom strand presently depicted in the
above schematic.
[0160] In another such embodiment, the DsiRNA comprises:
TABLE-US-00005 5'-XXXXXXXXXXXXXXXXXXXXXXXX.sub.N*D.sub.NDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*D.sub.NZZ-5'
wherein "X"=RNA, "X"=2'-O-methyl RNA, "Y" is an optional overhang
domain comprised of 0-10 RNA monomers that are optionally
2'-O-methyl RNA monomers--in certain embodiments, "Y" is an
overhang domain comprised of 1-4 RNA monomers that are optionally
2'-O-methyl RNA monomers, "D"=DNA, "Z"=DNA or RNA, and "N"=1 to 50
or more, but is optionally 1-15 or, optionally, 1-8. "N*"=0 to 15
or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In one
embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand, with
2'-O-methyl RNA monomers located at alternating residues along the
top strand, rather than the bottom strand presently depicted in the
above schematic.
[0161] In another embodiment, the DsiRNA comprises:
TABLE-US-00006 5'-XXXXXXXXXXXXXXXXXXXXXXXX.sub.N*[X1/D1].sub.NDD-3'
3'-YXX-XXXXXXX-XXXXXXX-XXX-X.sub.N*[X2/D2].sub.NZZ-5'
wherein "X"=RNA, "Y" is an optional overhang domain comprised of
0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers--in
certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA
monomers that are optionally 2'-O-methyl RNA monomers, "D"=DNA,
"Z"=DNA or RNA, and "N"=1 to 50 or more, but is optionally 1-15 or,
optionally, 1-8, where at least one D1.sub.N is present in the top
strand and is base paired with a corresponding D2.sub.N in the
bottom strand. Optionally, D1.sub.N and D1.sub.N+1 are base paired
with corresponding D2.sub.N and D2.sub.N+1; D1.sub.N, D1.sub.N+1
and D1.sub.N+2 are base paired with corresponding D2.sub.N,
D1.sub.N+1 and D1.sub.N+2, etc. "N*"=0 to 15 or more, but is
optionally 0, 1, 2, 3, 4, 5 or 6. In one embodiment, the top strand
is the sense strand, and the bottom strand is the antisense strand.
Alternatively, the bottom strand is the sense strand and the top
strand is the antisense strand, with 2'-O-methyl RNA monomers
located at alternating residues along the top strand, rather than
the bottom strand presently depicted in the above schematic.
[0162] In any of the above-depicted structures, the 5' end of
either the sense strand or antisense strand optionally comprises a
phosphate group.
[0163] In another embodiment, the DNA:DNA-extended DsiRNA comprises
strands having equal lengths possessing 1-3 mismatched residues
that serve to orient Dicer cleavage (specifically, one or more of
positions 1, 2 or 3 on the first strand of the DsiRNA, when
numbering from the 3'-terminal residue, are mismatched with
corresponding residues of the 5'-terminal region on the second
strand when first and second strands are annealed to one another).
An exemplary DNA:DNA-extended DsiRNA agent with two terminal
mismatched residues is shown:
##STR00001##
wherein "X"=RNA, "M"=Nucleic acid residues (RNA, DNA or non-natural
or modified nucleic acids) that do not base pair (hydrogen bond)
with corresponding "M" residues of otherwise complementary strand
when strands are annealed, "D"=DNA and "N"=1 to 50 or more, but is
optionally 1-15 or, optionally, 1-8. "N*"=0 to 15 or more, but is
optionally 0, 1, 2, 3, 4, 5 or 6. Any of the residues of such
agents can optionally be 2'-O-methyl RNA monomers--alternating
positioning of 2'-O-methyl RNA monomers that commences from the
3'-terminal residue of the bottom (second) strand, as shown for
above asymmetric agents, can also be used in the above "blunt/fray"
DsiRNA agent. In one embodiment, the top strand (first strand) is
the sense strand, and the bottom strand (second strand) is the
antisense strand. Alternatively, the bottom strand is the sense
strand and the top strand is the antisense strand. Modification and
DNA:DNA extension patterns paralleling those shown above for
asymmetric/overhang agents can also be incorporated into such
"blunt/frayed" agents.
[0164] In one embodiment, a length-extended DsiRNA agent is
provided that comprises deoxyribonucleotides positioned at sites
modeled to function via specific direction of Dicer cleavage, yet
which does not require the presence of a base-paired
deoxyribonucleotide in the dsNA structure. An exemplary structure
for such a molecule is shown:
TABLE-US-00007 5'-XXXXXXXXXXXXXXXXXXXDDXX-3'
3'-YXXXXXXXXXXXXXXXXXDDXXXX-5'
wherein "X"=RNA, "Y" is an optional overhang domain comprised of
0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers--in
certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA
monomers that are optionally 2'-O-methyl RNA monomers, and "D"=DNA.
In one embodiment, the top strand is the sense strand, and the
bottom strand is the antisense strand. Alternatively, the bottom
strand is the sense strand and the top strand is the antisense
strand. The above structure is modeled to force Dicer to cleave a
minimum of a 21mer duplex as its primary post-processing form. In
embodiments where the bottom strand of the above structure is the
antisense strand, the positioning of two deoxyribonucleotide
residues at the ultimate and penultimate residues of the 5' end of
the antisense strand is likely to reduce off-target effects (as
prior studies have shown a 2'-O-methyl modification of at least the
penultimate position from the 5' terminus of the antisense strand
to reduce off-target effects; see, e.g., US 2007/0223427).
[0165] In one embodiment, the DsiRNA comprises:
TABLE-US-00008 5'-D.sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*Y-3'
3'-D.sub.NXXXXXXXXXXXXXXXXXXXX.sub.N*-5'
wherein "X"=RNA, "Y" is an optional overhang domain comprised of
0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers--in
certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA
monomers that are optionally 2'-O-methyl RNA monomers, "D"=DNA, and
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In
one embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand.
[0166] In a related embodiment, the DsiRNA comprises:
TABLE-US-00009 5'-D.sub.NXXXX-XXXXXXX-XXXXXXXXXXX.sub.N*DD-3'
3'-D.sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*XX-5'
wherein "X"=RNA, optionally a 2'-O-methyl RNA monomers "D"=DNA,
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In
one embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand.
[0167] In another such embodiment, the DsiRNA comprises:
TABLE-US-00010 5'-D.sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*DD-3'
3'-D.sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*ZZ-5'
wherein "X"=RNA, optionally a 2'-O-methyl RNA monomers "D"=DNA,
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6.
"Z"=DNA or RNA. In one embodiment, the top strand is the sense
strand, and the bottom strand is the antisense strand.
Alternatively, the bottom strand is the sense strand and the top
strand is the antisense strand, with 2'-O-methyl RNA monomers
located at alternating residues along the top strand, rather than
the bottom strand presently depicted in the above schematic.
[0168] In another such embodiment, the DsiRNA comprises:
TABLE-US-00011 5'-D.sub.NZZXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*DD-3'
3'-D.sub.NXXXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*ZZ-5'
wherein "X"=RNA, "X"=2'-O-methyl RNA, "D"=DNA, "Z"=DNA or RNA, and
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In
one embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand, with
2'-O-methyl RNA monomers located at alternating residues along the
top strand, rather than the bottom strand presently depicted in the
above schematic.
[0169] In another such embodiment, the DsiRNA comprises:
TABLE-US-00012 5'-D.sub.NZZXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*Y-3'
3'-D.sub.NXXXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*-5'
wherein "X"=RNA, "X"=2'-O-methyl RNA, "D"=DNA, "Z"=DNA or RNA, and
"N"=1 to 50 or more, but is optionally 1-15 or, optionally, 1-8.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. "Y"
is an optional overhang domain comprised of 0-10 RNA monomers that
are optionally 2'-O-methyl RNA monomers--in certain embodiments,
"Y" is an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers. In one embodiment, the top
strand is the sense strand, and the bottom strand is the antisense
strand. Alternatively, the bottom strand is the sense strand and
the top strand is the antisense strand, with 2'-O-methyl RNA
monomers located at alternating residues along the top strand,
rather than the bottom strand presently depicted in the above
schematic.
[0170] In another embodiment, the DsiRNA comprises:
TABLE-US-00013 5'-[X1/D1].sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*DD-3'
3'-[X2/D2].sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*ZZ-5'
wherein "X"=RNA, "D"=DNA, "Z"=DNA or RNA, and "N"=1 to 50 or more,
but is optionally 1-15 or, optionally, 1-8, where at least one
D1.sub.N is present in the top strand and is base paired with a
corresponding D2.sub.N in the bottom strand. Optionally, D1.sub.N
and D1.sub.N+1 are base paired with corresponding D2.sub.N and
D2.sub.N+1; D1.sub.N, D1.sub.N+1 and D1.sub.N+2 are base paired
with corresponding D2.sub.N, D1.sub.N+1 and D1.sub.N+2, etc. "N*"=0
to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In one
embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand, with
2'-O-methyl RNA monomers located at alternating residues along the
top strand, rather than the bottom strand presently depicted in the
above schematic.
[0171] In a related embodiment, the DsiRNA comprises:
TABLE-US-00014 5'-[X1/D1].sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*Y-3'
3'-[X2/D2].sub.NXXXXXXXXXXXXXXXXXXXXXXXX.sub.N*-5'
wherein "X"=RNA, "D"=DNA, "Y" is an optional overhang domain
comprised of 0-10 RNA monomers that are optionally 2'-O-methyl RNA
monomers--in certain embodiments. "Y" is an overhang domain
comprised of 1-4 RNA monomers that are optionally 2'-O-methyl RNA
monomers, and "N"=1 to 50 or more, but is optionally 1-15 or,
optionally, 1-8, where at least one D1.sub.N is present in the top
strand and is base paired with a corresponding D2.sub.N in the
bottom strand. Optionally, D1.sub.N and D1.sub.N+1 are base paired
with corresponding D2.sub.N and D2.sub.N+1; D1.sub.N, D1.sub.N+1
and D1.sub.N+2 are base paired with corresponding D2.sub.N,
D1.sub.N+1 and D1.sub.N+2, etc. "N*"=0 to 15 or more, but is
optionally 0, 1, 2, 3, 4, 5 or 6. In one embodiment, the top strand
is the sense strand, and the bottom strand is the antisense strand.
Alternatively, the bottom strand is the sense strand and the top
strand is the antisense strand, with 2'-O-methyl RNA monomers
located at alternating residues along the top strand, rather than
the bottom strand presently depicted in the above schematic.
[0172] In any of the above-depicted structures, the 5' end of
either the sense strand or antisense strand optionally comprises a
phosphate group.
[0173] In another embodiment, the DNA:DNA-extended DsiRNA comprises
strands having equal lengths possessing 1-3 mismatched residues
that serve to orient Dicer cleavage (specifically, one or more of
positions 1, 2 or 3 on the first strand of the DsiRNA, when
numbering from the 3'-terminal residue, are mismatched with
corresponding residues of the 5'-terminal region on the second
strand when first and second strands are annealed to one another).
An exemplary DNA:DNA-extended DsiRNA agent with two terminal
mismatched residues is shown:
##STR00002##
wherein "X"=RNA, "M"=Nucleic acid residues (RNA, DNA or non-natural
or modified nucleic acids) that do not base pair (hydrogen bond)
with corresponding "M" residues of otherwise complementary strand
when strands are annealed, "D"=DNA and "N"=1 to 50 or more, but is
optionally 1-15 or, optionally, 1-8. "N*"=0 to 15 or more, but is
optionally 0, 1, 2, 3, 4, 5 or 6. Any of the residues of such
agents can optionally be 2'-O-methyl RNA monomers--alternating
positioning of 2'-O-methyl RNA monomers that commences from the
3'-terminal residue of the bottom (second) strand, as shown for
above asymmetric agents, can also be used in the above "blunt/fray"
DsiRNA agent. In one embodiment, the top strand (first strand) is
the sense strand, and the bottom strand (second strand) is the
antisense strand. Alternatively, the bottom strand is the sense
strand and the top strand is the antisense strand. Modification and
DNA:DNA extension patterns paralleling those shown above for
asymmetric/overhang agents can also be incorporated into such
"blunt/frayed" agents.
[0174] In another embodiment, a length-extended DsiRNA agent is
provided that comprises deoxyribonucleotides positioned at sites
modeled to function via specific direction of Dicer cleavage, yet
which does not require the presence of a base-paired
deoxyribonucleotide in the dsNA structure. Exemplary structures for
such a molecule are shown:
TABLE-US-00015 5'-XXDDXXXXXXXXXXXXXXXXXXXX.sub.N*Y-3'
3'-DDXXXXXXXXXXXXXXXXXXXXXX.sub.N*-5' or
5'-XDXDXXXXXXXXXXXXXXXXXXXX.sub.N*Y-3'
3'-DXDXXXXXXXXXXXXXXXXXXXXX.sub.N*-5'
wherein "X"=RNA, "Y" is an optional overhang domain comprised of
0-10 RNA monomers that are optionally 2'-O-methyl RNA monomers--in
certain embodiments, "Y" is an overhang domain comprised of 1-4 RNA
monomers that are optionally 2'-O-methyl RNA monomers, and "D"=DNA.
"N*"=0 to 15 or more, but is optionally 0, 1, 2, 3, 4, 5 or 6. In
one embodiment, the top strand is the sense strand, and the bottom
strand is the antisense strand. Alternatively, the bottom strand is
the sense strand and the top strand is the antisense strand. The
above structures are modeled to force Dicer to cleave a minimum of
a 21mer duplex as its primary post-processing form.
[0175] In any of the above embodiments where the bottom strand of
the above structure is the antisense strand, the positioning of two
deoxyribonucleotide residues at the ultimate and penultimate
residues of the 5' end of the antisense strand is likely to reduce
off-target effects (as prior studies have shown a 2'-O-methyl
modification of at least the penultimate position from the 5'
terminus of the antisense strand to reduce off-target effects; see,
e.g., US 2007/0223427).
[0176] The extended DsiRNAs of the invention can carry a broad
range of modification patterns (e.g., 2'-O-methyl RNA patterns
within extended DsiRNA agents). Certain preferred modification
patterns of the second strand of the extended DsiRNAs of the
invention are presented below--it is noted that while many of the
below structures depict modification of non-extended DsiRNAs, the
skilled artisan will recognize that the modification patterns shown
are also readily applied to the full range of extended DsiRNA
structures described elsewhere herein.
[0177] In one embodiment, the DsiRNA comprises:
TABLE-US-00016 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "Y" is an overhang domain
comprised of 1-4 RNA monomers that are optionally 2'-O-methyl RNA
monomers, and "D"=DNA. In one embodiment, the top strand is the
sense strand, and the bottom strand is the antisense strand.
Alternatively, the bottom strand is the sense strand and the top
strand is the antisense strand.
[0178] In another embodiment, the DsiRNA comprises:
TABLE-US-00017 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand.
[0179] In another embodiment, the DsiRNA comprises:
TABLE-US-00018 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand.
[0180] In further embodiments, the DsiRNA comprises:
TABLE-US-00019 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00020 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0181] In additional embodiments, the DsiRNA comprises:
TABLE-US-00021 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00022 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0182] In other embodiments, the DsiRNA comprises:
TABLE-US-00023 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00024 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0183] In further embodiments, the DsiRNA comprises:
TABLE-US-00025 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00026 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0184] In additional embodiments, the DsiRNA comprises:
TABLE-US-00027 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00028 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0185] In other embodiments, the DsiRNA comprises:
TABLE-US-00029 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00030 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0186] In certain additional embodiments, the DsiRNA comprises:
TABLE-US-00031 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00032 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0187] In additional embodiments, the DsiRNA comprises:
TABLE-US-00033 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00034 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0188] In further embodiments, the DsiRNA comprises:
TABLE-US-00035 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, "Y" is
an overhang domain comprised of 1-4 RNA monomers that are
optionally 2'-O-methyl RNA monomers, underlined residues are
2'-O-methyl RNA monomers, and "D"=DNA. The top strand is the sense
strand, and the bottom strand is the antisense strand. In one
embodiment, the DsiRNA comprises:
TABLE-US-00036 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'-O-methyl RNA, and
"D"=DNA. The top strand is the sense strand, and the bottom strand
is the antisense strand.
[0189] In another embodiment, the DsiRNA comprises strands having
equal lengths possessing 1-3 mismatched residues that serve to
orient Dicer cleavage (specifically, one or more of positions 1, 2
or 3 on the first strand of the DsiRNA, when numbering from the
3'-terminal residue, are mismatched with corresponding residues of
the 5'-terminal region on the second strand when first and second
strands are annealed to one another). An exemplary 27mer DsiRNA
agent with two terminal mismatched residues is shown:
##STR00003##
wherein "X"=RNA, "p"=a phosphate group, "M"=Nucleic acid residues
(RNA, DNA or non-natural or modified nucleic acids) that do not
base pair (hydrogen bond) with corresponding "M" residues of
otherwise complementary strand when strands are annealed. Any of
the residues of such agents can optionally be 2'-O-methyl RNA
monomers--alternating positioning of 2'-O-methyl RNA monomers that
commences from the 3'-terminal residue of the bottom (second)
strand, as shown for above asymmetric agents, can also be used in
the above "blunt/fray" DsiRNA agent. In one embodiment, the top
strand is the sense strand, and the bottom strand is the antisense
strand. Alternatively, the bottom strand is the sense strand and
the top strand is the antisense strand.
[0190] As used herein "DsiRNAmm" refers to a DisRNA having a
"mismatch tolerant region" containing one, two, three or four
mismatched base pairs of the duplex formed by the sense and
antisense strands of the DsiRNA, where such mismatches are
positioned within the DsiRNA at a location(s) lying between (and
thus not including) the two terminal base pairs of either end of
the DsiRNA. The mismatched base pairs are located within a
"mismatch-tolerant region" which is defined herein with respect to
the location of the projected Ago2 cut site of the corresponding
target nucleic acid. The mismatch tolerant region is located
"upstream of" the projected Ago2 cut site of the target strand.
"Upstream" in this context will be understood as the 5'-most
portion of the DsiRNAmm duplex, where 5' refers to the orientation
of the sense strand of the DsiRNA duplex. Therefore, the mismatch
tolerant region is upstream of the base on the sense (passenger)
strand that corresponds to the projected Ago2 cut site of the
target nucleic acid (see FIG. 14); alternatively, when referring to
the antisense (guide) strand of the DsiRNAmm, the mismatch tolerant
region can also be described as positioned downstream of the base
that is complementary to the projected Ago2 cut site of the target
nucleic acid, that is, the 3'-most portion of the antisense strand
of the DsiRNAmm (where position 1 of the antisense strand is the 5'
terminal nucleotide of the antisense strand, see FIG. 20).
[0191] In one embodiment, for example as depicted in FIG. 33, the
mismatch tolerant region is positioned between and including base
pairs 3-9 when numbered from the nucleotide starting at the 5' end
of the sense strand of the duplex. Therefore, a DsiRNAmm of the
invention possesses a single mismatched base pair at any one of
positions 3, 4, 5, 6, 7, 8 or 9 of the sense strand of a right-hand
extended DsiRNA (where position 1 is the 5' terminal nucleotide of
the sense strand and position 9 is the nucleotide residue of the
sense strand that is immediately 5' of the projected Ago2 cut site
of the target RNA sequence corresponding to the sense strand
sequence). In certain embodiments, for a DsiRNAmm that possesses a
mismatched base pair nucleotide at any of positions 3, 4, 5, 6, 7,
8 or 9 of the sense strand, the corresponding mismatched base pair
nucleotide of the antisense strand not only forms a mismatched base
pair with the DsiRNAmm sense strand sequence, but also forms a
mismatched base pair with a DsiRNAmm target RNA sequence (thus,
complementarity between the antisense strand sequence and the sense
strand sequence is disrupted at the mismatched base pair within the
DsiRNAmm, and complementarity is similarly disrupted between the
antisense strand sequence of the DsiRNAmm and the target RNA
sequence). In alternative embodiments, the mismatch base pair
nucleotide of the antisense strand of a DsiRNAmm only form a
mismatched base pair with a corresponding nucleotide of the sense
strand sequence of the DsiRNAmm, yet base pairs with its
corresponding target RNA sequence nucleotide (thus, complementarity
between the antisense strand sequence and the sense strand sequence
is disrupted at the mismatched base pair within the DsiRNAmm, yet
complementarity is maintained between the antisense strand sequence
of the DsiRNAmm and the target RNA sequence).
[0192] A DsiRNAmm of the invention that possesses a single
mismatched base pair within the mismatch-tolerant region (mismatch
region) as described above (e.g., a DsiRNAmm harboring a mismatched
nucleotide residue at any one of positions 3, 4, 5, 6, 7, 8 or 9 of
the sense strand) can further include one, two or even three
additional mismatched base pairs. In preferred embodiments, these
one, two or three additional mismatched base pairs of the DsiRNAmm
occur at position(s) 3, 4, 5, 6, 7, 8 and/or 9 of the sense strand
(and at corresponding residues of the antisense strand). In one
embodiment where one additional mismatched base pair is present
within a DsiRNAmm, the two mismatched base pairs of the sense
strand can occur, e.g., at nucleotides of both position 4 and
position 6 of the sense strand (with mismatch also occurring at
corresponding nucleotide residues of the antisense strand).
[0193] In DsiRNAmm agents possessing two mismatched base pairs,
mismatches can occur consecutively (e.g., at consecutive positions
along the sense strand nucleotide sequence). Alternatively,
nucleotides of the sense strand that form mismatched base pairs
with the antisense strand sequence can be interspersed by
nucleotides that base pair with the antisense strand sequence
(e.g., for a DsiRNAmm possessing mismatched nucleotides at
positions 3 and 6, but not at positions 4 and 5, the mismatched
residues of sense strand positions 3 and 6 are interspersed by two
nucleotides that form matched base pairs with corresponding
residues of the antisense strand). For example, two residues of the
sense strand (located within the mismatch-tolerant region of the
sense strand) that form mismatched base pairs with the
corresponding antisense strand sequence can occur with zero, one,
two, three, four or five matched base pairs located between these
mismatched base pairs.
[0194] For certain DsiRNAmm agents possessing three mismatched base
pairs, mismatches can occur consecutively (e.g., in a triplet along
the sense strand nucleotide sequence). Alternatively, nucleotides
of the sense strand that form mismatched base pairs with the
antisense strand sequence can be interspersed by nucleotides that
form matched base pairs with the antisense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 3, 4
and 8, but not at positions 5, 6 and 7, the mismatched residues of
sense strand positions 3 and 4 are adjacent to one another, while
the mismatched residues of sense strand positions 4 and 8 are
interspersed by three nucleotides that form matched base pairs with
corresponding residues of the antisense strand). For example, three
residues of the sense strand (located within the mismatch-tolerant
region of the sense strand) that form mismatched base pairs with
the corresponding antisense strand sequence can occur with zero,
one, two, three or four matched base pairs located between any two
of these mismatched base pairs.
[0195] For certain DsiRNAmm agents possessing four mismatched base
pairs, mismatches can occur consecutively (e.g., in a quadruplet
along the sense strand nucleotide sequence). Alternatively,
nucleotides of the sense strand that form mismatched base pairs
with the antisense strand sequence can be interspersed by
nucleotides that form matched base pairs with the antisense strand
sequence (e.g., for a DsiRNAmm possessing mismatched nucleotides at
positions 3, 5, 7 and 8, but not at positions 4 and 6, the
mismatched residues of sense strand positions 7 and 8 are adjacent
to one another, while the mismatched residues of sense strand
positions 3 and 5 are interspersed by one nucleotide that forms a
matched base pair with the corresponding residue of the antisense
strand--similarly, the mismatched residues of sense strand
positions 5 and 7 are also interspersed by one nucleotide that
forms a matched base pair with the corresponding residue of the
antisense strand). For example, four residues of the sense strand
(located within the mismatch-tolerant region of the sense strand)
that form mismatched base pairs with the corresponding antisense
strand sequence can occur with zero, one, two or three matched base
pairs located between any two of these mismatched base pairs.
[0196] In another embodiment, for example as depicted in FIG. 39, a
DsiRNAmm of the invention comprises a mismatch tolerant region
which possesses a single mismatched base pair nucleotide at any one
of positions 13, 14, 15, 16, 17, 18, 19, 20 or 21 of the antisense
strand of a left-hand extended DsiRNA (where position 1 is the 5'
terminal nucleotide of the antisense strand and position 13 is the
nucleotide residue of the antisense strand that is immediately 3'
(downstream) in the antisense strand of the projected Ago2 cut site
of the target RNA sequence sufficiently complementary to the
antisense strand sequence). In certain embodiments, for a DsiRNAmm
that possesses a mismatched base pair nucleotide at any of
positions 13, 14, 15, 16, 17, 18, 19, 20 or 21 of the antisense
strand with respect to the sense strand of the DsiRNAmm, the
mismatched base pair nucleotide of the antisense strand not only
forms a mismatched base pair with the DsiRNAmm sense strand
sequence, but also forms a mismatched base pair with a DsiRNAmm
target RNA sequence (thus, complementarity between the antisense
strand sequence and the sense strand sequence is disrupted at the
mismatched base pair within the DsiRNAmm, and complementarity is
similarly disrupted between the antisense strand sequence of the
DsiRNAmm and the target RNA sequence). In alternative embodiments,
the mismatch base pair nucleotide of the antisense strand of a
DsiRNAmm only forms a mismatched base pair with a corresponding
nucleotide of the sense strand sequence of the DsiRNAmm, yet base
pairs with its corresponding target RNA sequence nucleotide (thus,
complementarity between the antisense strand sequence and the sense
strand sequence is disrupted at the mismatched base pair within the
DsiRNAmm, yet complementarity is maintained between the antisense
strand sequence of the DsiRNAmm and the target RNA sequence).
[0197] A DsiRNAmm of the invention that possesses a single
mismatched base pair within the mismatch-tolerant region as
described above (e.g., a DsiRNAmm harboring a mismatched nucleotide
residue at positions 13, 14, 15, 16, 17, 18, 19, 20 or 21 of the
antisense strand) can further include one, two or even three
additional mismatched base pairs. In preferred embodiments, these
one, two or three additional mismatched base pairs of the DsiRNAmm
occur at position(s) 13, 14, 15, 16, 17, 18, 19, 20 and/or 21 of
the antisense strand (and at corresponding residues of the sense
strand). In one embodiment where one additional mismatched base
pair is present within a DsiRNAmm, the two mismatched base pairs of
the antisense strand can occur, e.g., at nucleotides of both
position 14 and position 18 of the antisense strand (with mismatch
also occurring at corresponding nucleotide residues of the sense
strand).
[0198] In DsiRNAmm agents possessing two mismatched base pairs,
mismatches can occur consecutively (e.g., at consecutive positions
along the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that base pair with the sense strand sequence (e.g., for a DsiRNAmm
possessing mismatched nucleotides at positions 13 and 16, but not
at positions 14 and 15, the mismatched residues of antisense strand
positions 13 and 16 are interspersed by two nucleotides that form
matched base pairs with corresponding residues of the sense
strand). For example, two residues of the antisense strand (located
within the mismatch-tolerant region of the sense strand) that form
mismatched base pairs with the corresponding sense strand sequence
can occur with zero, one, two, three, four, five, six or seven
matched base pairs located between these mismatched base pairs.
[0199] For certain DsiRNAmm agents possessing three mismatched base
pairs, mismatches can occur consecutively (e.g., in a triplet along
the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that form matched base pairs with the sense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 13,
14 and 18, but not at positions 15, 16 and 17, the mismatched
residues of antisense strand positions 13 and 14 are adjacent to
one another, while the mismatched residues of antisense strand
positions 14 and 18 are interspersed by three nucleotides that form
matched base pairs with corresponding residues of the sense
strand). For example, three residues of the antisense strand
(located within the mismatch-tolerant region of the antisense
strand) that form mismatched base pairs with the corresponding
sense strand sequence can occur with zero, one, two, three, four,
five or six matched base pairs located between any two of these
mismatched base pairs.
[0200] For certain DsiRNAmm agents possessing four mismatched base
pairs, mismatches can occur consecutively (e.g., in a quadruplet
along the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that form matched base pairs with the sense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 13,
15, 17 and 18, but not at positions 14 and 16, the mismatched
residues of antisense strand positions 17 and 18 are adjacent to
one another, while the mismatched residues of antisense strand
positions 13 and 15 are interspersed by one nucleotide that forms a
matched base pair with the corresponding residue of the sense
strand--similarly, the mismatched residues of antisense strand
positions 15 and 17 are also interspersed by one nucleotide that
forms a matched base pair with the corresponding residue of the
sense strand). For example, four residues of the antisense strand
(located within the mismatch-tolerant region of the antisense
strand) that form mismatched base pairs with the corresponding
sense strand sequence can occur with zero, one, two, three, four or
five matched base pairs located between any two of these mismatched
base pairs.
[0201] In a further embodiment, for example as depicted in FIG. 40,
a DsiRNAmm of the invention possesses a single mismatched base pair
nucleotide at any one of positions 11, 12, 13, 14, 15, 16, 17, 18
or 19 of the antisense strand of a left-hand extended DsiRNA (where
position 1 is the 5' terminal nucleotide of the antisense strand
and position 11 is the nucleotide residue of the antisense strand
that is immediately 3' (downstream) in the antisense strand of the
projected Ago2 cut site of the target RNA sequence sufficiently
complementary to the antisense strand sequence). In certain
embodiments, for a DsiRNAmm that possesses a mismatched base pair
nucleotide at any of positions 11, 12, 13, 14, 15, 16, 17, 18 or 19
of the antisense strand with respect to the sense strand of the
DsiRNAmm, the mismatched base pair nucleotide of the antisense
strand not only forms a mismatched base pair with the DsiRNAmm
sense strand sequence, but also forms a mismatched base pair with a
DsiRNAmm target RNA sequence (thus, complementarity between the
antisense strand sequence and the sense strand sequence is
disrupted at the mismatched base pair within the DsiRNAmm, and
complementarity is similarly disrupted between the antisense strand
sequence of the DsiRNAmm and the target RNA sequence). In
alternative embodiments, the mismatch base pair nucleotide of the
antisense strand of a DsiRNAmm only forms a mismatched base pair
with a corresponding nucleotide of the sense strand sequence of the
DsiRNAmm, yet this same antisense strand nucleotide base pairs with
its corresponding target RNA sequence nucleotide (thus,
complementarity between the antisense strand sequence and the sense
strand sequence is disrupted at the mismatched base pair within the
DsiRNAmm, yet complementarity is maintained between the antisense
strand sequence of the DsiRNAmm and the target RNA sequence).
[0202] A DsiRNAmm of the invention that possesses a single
mismatched base pair within the mismatch-tolerant region as
described above (e.g., a DsiRNAmm harboring a mismatched nucleotide
residue at positions 11, 12, 13, 14, 15, 16, 17, 18 or 19 of the
antisense strand) can further include one, two or even three
additional mismatched base pairs. In preferred embodiments, these
one, two or three additional mismatched base pairs of the DsiRNAmm
occur at position(s) 11, 12, 13, 14, 15, 16, 17, 18 and/or 19 of
the antisense strand (and at corresponding residues of the sense
strand). In one embodiment where one additional mismatched base
pair is present within a DsiRNAmm, the two mismatched base pairs of
the antisense strand can occur, e.g., at nucleotides of both
position 14 and position 18 of the antisense strand (with mismatch
also occurring at corresponding nucleotide residues of the sense
strand).
[0203] In DsiRNAmm agents possessing two mismatched base pairs,
mismatches can occur consecutively (e.g., at consecutive positions
along the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that base pair with the sense strand sequence (e.g., for a DsiRNAmm
possessing mismatched nucleotides at positions 12 and 15, but not
at positions 13 and 14, the mismatched residues of antisense strand
positions 12 and 15 are interspersed by two nucleotides that form
matched base pairs with corresponding residues of the sense
strand). For example, two residues of the antisense strand (located
within the mismatch-tolerant region of the sense strand) that form
mismatched base pairs with the corresponding sense strand sequence
can occur with zero, one, two, three, four, five, six or seven
matched base pairs located between these mismatched base pairs.
[0204] For certain DsiRNAmm agents possessing three mismatched base
pairs, mismatches can occur consecutively (e.g., in a triplet along
the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that form matched base pairs with the sense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 13,
14 and 18, but not at positions 15, 16 and 17, the mismatched
residues of antisense strand positions 13 and 14 are adjacent to
one another, while the mismatched residues of antisense strand
positions 14 and 18 are interspersed by three nucleotides that form
matched base pairs with corresponding residues of the sense
strand). For example, three residues of the antisense strand
(located within the mismatch-tolerant region of the antisense
strand) that form mismatched base pairs with the corresponding
sense strand sequence can occur with zero, one, two, three, four,
five or six matched base pairs located between any two of these
mismatched base pairs.
[0205] For certain DsiRNAmm agents possessing four mismatched base
pairs, mismatches can occur consecutively (e.g., in a quadruplet
along the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that form matched base pairs with the sense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 13,
15, 17 and 18, but not at positions 14 and 16, the mismatched
residues of antisense strand positions 17 and 18 are adjacent to
one another, while the mismatched residues of antisense strand
positions 13 and 15 are interspersed by one nucleotide that forms a
matched base pair with the corresponding residue of the sense
strand--similarly, the mismatched residues of antisense strand
positions 15 and 17 are also interspersed by one nucleotide that
forms a matched base pair with the corresponding residue of the
sense strand). For example, four residues of the antisense strand
(located within the mismatch-tolerant region of the antisense
strand) that form mismatched base pairs with the corresponding
sense strand sequence can occur with zero, one, two, three, four or
five matched base pairs located between any two of these mismatched
base pairs.
[0206] In an additional embodiment, for example as depicted in FIG.
41, a DsiRNAmm of the invention possesses a single mismatched base
pair nucleotide at any one of positions 15, 16, 17, 18, 19, 20, 21,
22 or 23 of the antisense strand of a left-hand extended DsiRNA
(where position 1 is the 5' terminal nucleotide of the antisense
strand and position 15 is the nucleotide residue of the antisense
strand that is immediately 3' (downstream) in the antisense strand
of the projected Ago2 cut site of the target RNA sequence
sufficiently complementary to the antisense strand sequence). In
certain embodiments, for a DsiRNAmm that possesses a mismatched
base pair nucleotide at any of positions 15, 16, 17, 18, 19, 20,
21, 22 or 23 of the antisense strand with respect to the sense
strand of the DsiRNAmm, the mismatched base pair nucleotide of the
antisense strand not only forms a mismatched base pair with the
DsiRNAmm sense strand sequence, but also forms a mismatched base
pair with a DsiRNAmm target RNA sequence (thus, complementarity
between the antisense strand sequence and the sense strand sequence
is disrupted at the mismatched base pair within the DsiRNAmm, and
complementarity is similarly disrupted between the antisense strand
sequence of the DsiRNAmm and the target RNA sequence). In
alternative embodiments, the mismatch base pair nucleotide of the
antisense strand of a DsiRNAmm only forms a mismatched base pair
with a corresponding nucleotide of the sense strand sequence of the
DsiRNAmm, yet this same antisense strand nucleotide base pairs with
its corresponding target RNA sequence nucleotide (thus,
complementarity between the antisense strand sequence and the sense
strand sequence is disrupted at the mismatched base pair within the
DsiRNAmm, yet complementarity is maintained between the antisense
strand sequence of the DsiRNAmm and the target RNA sequence).
[0207] A DsiRNAmm of the invention that possesses a single
mismatched base pair within the mismatch-tolerant region as
described above (e.g., a DsiRNAmm harboring a mismatched nucleotide
residue at positions 15, 16, 17, 18, 19, 20, 21, 22 or 23 of the
antisense strand) can further include one, two or even three
additional mismatched base pairs. In preferred embodiments, these
one, two or three additional mismatched base pairs of the DsiRNAmm
occur at position(s) 15, 16, 17, 18, 19, 20, 21, 22 and/or 23 of
the antisense strand (and at corresponding residues of the sense
strand). In one embodiment where one additional mismatched base
pair is present within a DsiRNAmm, the two mismatched base pairs of
the antisense strand can occur, e.g., at nucleotides of both
position 16 and position 20 of the antisense strand (with mismatch
also occurring at corresponding nucleotide residues of the sense
strand).
[0208] In DsiRNAmm agents possessing two mismatched base pairs,
mismatches can occur consecutively (e.g., at consecutive positions
along the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that base pair with the sense strand sequence (e.g., for a DsiRNAmm
possessing mismatched nucleotides at positions 16 and 20, but not
at positions 17, 18 and 19, the mismatched residues of antisense
strand positions 16 and 20 are interspersed by three nucleotides
that form matched base pairs with corresponding residues of the
sense strand). For example, two residues of the antisense strand
(located within the mismatch-tolerant region of the sense strand)
that form mismatched base pairs with the corresponding sense strand
sequence can occur with zero, one, two, three, four, five, six or
seven matched base pairs located between these mismatched base
pairs.
[0209] For certain DsiRNAmm agents possessing three mismatched base
pairs, mismatches can occur consecutively (e.g., in a triplet along
the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that form matched base pairs with the sense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 16,
17 and 21, but not at positions 18, 19 and 20, the mismatched
residues of antisense strand positions 16 and 17 are adjacent to
one another, while the mismatched residues of antisense strand
positions 17 and 21 are interspersed by three nucleotides that form
matched base pairs with corresponding residues of the sense
strand). For example, three residues of the antisense strand
(located within the mismatch-tolerant region of the antisense
strand) that form mismatched base pairs with the corresponding
sense strand sequence can occur with zero, one, two, three, four,
five or six matched base pairs located between any two of these
mismatched base pairs.
[0210] For certain DsiRNAmm agents possessing four mismatched base
pairs, mismatches can occur consecutively (e.g., in a quadruplet
along the antisense strand nucleotide sequence). Alternatively,
nucleotides of the antisense strand that form mismatched base pairs
with the sense strand sequence can be interspersed by nucleotides
that form matched base pairs with the sense strand sequence (e.g.,
for a DsiRNAmm possessing mismatched nucleotides at positions 17,
19, 21 and 22, but not at positions 18 and 20, the mismatched
residues of antisense strand positions 21 and 22 are adjacent to
one another, while the mismatched residues of antisense strand
positions 17 and 19 are interspersed by one nucleotide that forms a
matched base pair with the corresponding residue of the sense
strand--similarly, the mismatched residues of antisense strand
positions 19 and 21 are also interspersed by one nucleotide that
forms a matched base pair with the corresponding residue of the
sense strand). For example, four residues of the antisense strand
(located within the mismatch-tolerant region of the antisense
strand) that form mismatched base pairs with the corresponding
sense strand sequence can occur with zero, one, two, three, four or
five matched base pairs located between any two of these mismatched
base pairs.
[0211] For reasons of clarity, the location(s) of mismatched
nucleotide residues within the above DsiRNAmm agents are numbered
in reference to the 5' terminal residue of either sense or
antisense strands of the DsiRNAmm. As noted for the different
left-extended DsiRNAmm agents exemplified in FIGS. 20, 21 and 22,
the numbering of positions located within the mismatch-tolerant
region (mismatch region) of the antisense strand can shift with
variations in the proximity of the 5' terminus of the antisense
strand to the projected Ago2 cleavage site. Thus, the location(s)
of preferred mismatch sites within either antisense strand or sense
strand can also be identified as the permissible proximity of such
mismatches to the projected Ago2 cut site. Accordingly, in one
preferred embodiment, the position of a mismatch nucleotide of the
sense strand of a DsiRNAmm is the nucleotide residue of the sense
strand that is located immediately 5' (upstream) of the projected
Ago2 cleavage site of the corresponding target RNA sequence. In
other preferred embodiments, a mismatch nucleotide of the sense
strand of a DsiRNAmm is positioned at the nucleotide residue of the
sense strand that is located two nucleotides 5' (upstream) of the
projected Ago2 cleavage site, three nucleotides 5' (upstream) of
the projected Ago2 cleavage site, four nucleotides 5' (upstream) of
the projected Ago2 cleavage site, five nucleotides 5' (upstream) of
the projected Ago2 cleavage site, six nucleotides 5' (upstream) of
the projected Ago2 cleavage site, seven nucleotides 5' (upstream)
of the projected Ago2 cleavage site, eight nucleotides 5'
(upstream) of the projected Ago2 cleavage site, or nine nucleotides
5' (upstream) of the projected Ago2 cleavage site.
[0212] Exemplary single mismatch-containing 25/27mer DsiRNAs
(DsiRNAmm) include the following structures (such
mismatch-containing structures may also be incorporated into other
exemplary DsiRNA structures shown herein).
TABLE-US-00037 5'-pXX.sup.MXXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXX.sub.MXXXXXXXXXXXXXXXXXXXXXXp-5'
5'-pXXX.sup.MXXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXX.sub.MXXXXXXXXXXXXXXXXXXXXXp-5'
5'-pXXXX.sup.MXXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXX.sub.MXXXXXXXXXXXXXXXXXXXXp-5'
5'-pXXXXX.sup.MXXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXX.sub.MXXXXXXXXXXXXXXXXXXXp-5'
5'-pXXXXXX.sup.MXXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXX.sub.MXXXXXXXXXXXXXXXXXXp-5'
5'-pXXXXXXX.sup.MXXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXX.sub.MXXXXXXXXXXXXXXXXXp-5'
5'-pXXXXXXXX.sup.MXXXXXXXXXXXXXXDD-3'
3'-XXXXXXXXXX.sub.MXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "D"=DNA, "p"=a phosphate group. "M"=Nucleic acid
residues (RNA, DNA or non-natural or modified nucleic acids) that
do not base pair (hydrogen bond) with corresponding "M" residues of
otherwise complementary strand when strands are annealed. Any of
the residues of such agents can optionally be 2'-O-methyl RNA
monomers--alternating positioning of 2'-O-methyl RNA monomers that
commences from the 3'-terminal residue of the bottom (second)
strand, as shown above, can also be used in the above DsiRNAmm
agents. For the above mismatch structures, the top strand is the
sense strand, and the bottom strand is the antisense strand.
[0213] In certain embodiments, a DsiRNA of the invention can
contain mismatches that exist in reference to the target RNA
sequence yet do not necessarily exist as mismatched base pairs
within the two strands of the DsiRNA--thus, a DsiRNA can possess
perfect complementarity between first and second strands of a
DsiRNA, yet still possess mismatched residues in reference to a
target RNA (which, in certain embodiments, may be advantageous in
promoting efficacy and/or potency and/or duration of effect). In
certain embodiments, where mismatches occur between antisense
strand and target RNA sequence, the position of a mismatch is
located within the antisense strand at a position(s) that
corresponds to a sequence of the sense strand located 5' of the
projected Ago2 cut site of the target region--e.g., antisense
strand residue(s) positioned within the antisense strand to the 3'
of the antisense residue which is complementary to the projected
Ago2 cut site of the target sequence (such region is indicated
within, e.g., FIG. 33 as a "mismatch region", which is distinct
from the projected "seed region" of such DsiRNAs).
[0214] Exemplary 25/27mer DsiRNAs that harbor a single mismatched
residue in reference to target sequences include the following
preferred structures.
TABLE-US-00038 Target RNA Sequence: 5'- . . . AXXXXXXXXXXXXXXXXXXXX
. . . -3' DsiRNAmm Sense Strand: 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
DsiRNAmm Antisense Strand: 3'-EXXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
Target RNA Sequence: 5'- . . . XAXXXXXXXXXXXXXXXXXXX . . . -3'
DsiRNAmm Sense Strand: 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3' DsiRNAmm
Antisense Strand: 3'-XEXXXXXXXXXXXXXXXXXXXXXXXXXp-5' Target RNA
Sequence: 5'- . . . AXXXXXXXXXXXXXXXXXX . . . -3' DsiRNAmm Sense
Strand: 5'-pBXXXXXXXXXXXXXXXXXXXXXXD-3' DsiRNAmm Antisense Strand:
3'-XXEXXXXXXXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XAXXXXXXXXXXXXXXXXX . . . -3' DsiRNAmm Sense Strand:
5'-pXBXXXXXXXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXEXXXXXXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XXAXXXXXXXXXXXXXXXX . . .-3' DsiRNAmm Sense Strand:
5'-pXXBXXXXXXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXEXXXXXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XXXAXXXXXXXXXXXXXXX . . . -3' DsiRNAmm Sense Strand:
5'-pXXXBXXXXXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXXEXXXXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5- . . .
XXXXAXXXXXXXXXXXXXX . . . -3' DsiRNAmm Sense Strand:
5'-pXXXXBXXXXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXXXEXXXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XXXXXAXXXXXXXXXXXXX . . . -3' DsiRNAmm Sense Strand:
5'-pXXXXXBXXXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXXXXEXXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XXXXXXAXXXXXXXXXXXX . . . -3' DsiRNAmm Sense Strand:
5'-pXXXXXXBXXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXXXXXEXXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XXXXXXXAXXXXXXXXXXX . . .-3' DsiRNAmm Sense Strand:
5-pXXXXXXXBXXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXXXXXXEXXXXXXXXXXXXXXXXXp-5' Target RNA Sequence: 5'- . . .
XXXXXXXXAXXXXXXXXXX . . . -3' DsiRNAmm Sense Strand:
5'-pXXXXXXXXBXXXXXXXXXXXXXXDD-3' DsiRNAmm Antisense Strand:
3'-XXXXXXXXXXEXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "D"=DNA, "p"=a phosphate group, "E"=Nucleic acid
residues (RNA, DNA or non-natural or modified nucleic acids) that
do not base pair (hydrogen bond) with corresponding "A" RNA
residues of otherwise complementary (target) strand when strands
are annealed, yet optionally do base pair with corresponding "B"
residues ("B" residues are also RNA, DNA or non-natural or modified
nucleic acids). Any of the residues of such agents can optionally
be 2'-O-methyl RNA monomers--e.g., alternating positioning of
2'-O-methyl RNA monomers that commences from the 3'-terminal
residue of the bottom (second) strand, as shown above, or other
patterns of 2'-O-methyl and/or other modifications as described
herein can also be used in the above DsiRNA agents.
[0215] In addition to the above-exemplified structures, DsiRNAs of
the invention can also possess one, two or three additional
residues that form further mismatches with the target RNA sequence.
Such mismatches can be consecutive, or can be interspersed by
nucleotides that form matched base pairs with the target RNA
sequence. Where interspersed by nucleotides that form matched base
pairs, mismatched residues can be spaced apart from each other
within a single strand at an interval of one, two, three, four,
five, six, seven or even eight base paired nucleotides between such
mismatch-forming residues.
[0216] As for the above-described DsiRNAmm agents, a preferred
location within DsiRNAs for antisense strand nucleotides that form
mismatched base pairs with target RNA sequence (yet may or may not
form mismatches with corresponding sense strand nucleotides) is
within the antisense strand region that is located 3' (downstream)
of the antisense strand sequence which is complementary to the
projected Ago2 cut site of the DsiRNA (e.g., in FIG. 39, the region
of the antisense strand which is labeled as the "mismatch region"
is preferred for mismatch-forming residues and happens to be
located at positions 13-21 of the antisense strand for the agents
shown in FIG. 39). Thus, in one preferred embodiment, the position
of a mismatch nucleotide (in relation to the target RNA sequence)
of the antisense strand of a DsiRNAmm is the nucleotide residue of
the antisense strand that is located immediately 3' (downstream)
within the antisense strand sequence of the projected Ago2 cleavage
site of the corresponding target RNA sequence. In other preferred
embodiments, a mismatch nucleotide of the antisense strand of a
DsiRNAmm (in relation to the target RNA sequence) is positioned at
the nucleotide residue of the antisense strand that is located two
nucleotides 3' (downstream) of the corresponding projected Ago2
cleavage site, three nucleotides 3' (downstream) of the
corresponding projected Ago2 cleavage site, four nucleotides 3'
(downstream) of the corresponding projected Ago2 cleavage site,
five nucleotides 3' (downstream) of the corresponding projected
Ago2 cleavage site, six nucleotides 3' (downstream) of the
projected Ago2 cleavage site, seven nucleotides 3' (downstream) of
the projected Ago2 cleavage site, eight nucleotides 3' (downstream)
of the projected Ago2 cleavage site, or nine nucleotides 3'
(downstream) of the projected Ago2 cleavage site.
[0217] In DsiRNA agents possessing two mismatch-forming nucleotides
of the antisense strand (where mismatch-forming nucleotides are
mismatch forming in relation to target RNA sequence), mismatches
can occur consecutively (e.g. at consecutive positions along the
antisense strand nucleotide sequence). Alternatively, nucleotides
of the antisense strand that form mismatched base pairs with the
target RNA sequence can be interspersed by nucleotides that base
pair with the target RNA sequence (e.g., for a DsiRNA possessing
mismatch-forming nucleotides at positions 13 and 16 (starting from
the 5' terminus (position 1) of the antisense strand of the
structure shown in FIG. 39), but not at positions 14 and 15, the
mismatched residues of sense strand positions 13 and 16 are
interspersed by two nucleotides that form matched base pairs with
corresponding residues of the target RNA sequence). For example,
two residues of the antisense strand (located within the
mismatch-tolerant region of the antisense strand) that form
mismatched base pairs with the corresponding target RNA sequence
can occur with zero, one, two, three, four or five matched base
pairs (with respect to target RNA sequence) located between these
mismatch-forming base pairs.
[0218] For certain DsiRNAs possessing three mismatch-forming base
pairs (mismatch-forming with respect to target RNA sequence),
mismatch-forming nucleotides can occur consecutively (e.g., in a
triplet along the antisense strand nucleotide sequence).
Alternatively, nucleotides of the antisense strand that form
mismatched base pairs with the target RNA sequence can be
interspersed by nucleotides that form matched base pairs with the
target RNA sequence (e.g., for a DsiRNA possessing mismatched
nucleotides at positions 13, 14 and 18, but not at positions 15, 16
and 17, the mismatch-forming residues of antisense strand positions
13 and 14 are adjacent to one another, while the mismatch-forming
residues of antisense strand positions 14 and 18 are interspersed
by three nucleotides that form matched base pairs with
corresponding residues of the target RNA). For example, three
residues of the antisense strand (located within the
mismatch-tolerant region of the antisense strand) that form
mismatched base pairs with the corresponding target RNA sequence
can occur with zero, one, two, three or four matched base pairs
located between any two of these mismatch-forming base pairs.
[0219] For certain DsiRNAs possessing four mismatch-forming base
pairs (mismatch-forming with respect to target RNA sequence),
mismatch-forming nucleotides can occur consecutively (e.g., in a
quadruplet along the sense strand nucleotide sequence).
Alternatively, nucleotides of the antisense strand that form
mismatched base pairs with the target RNA sequence can be
interspersed by nucleotides that form matched base pairs with the
target RNA sequence (e.g., for a DsiRNA possessing mismatch-forming
nucleotides at positions 13, 15, 17 and 18, but not at positions 14
and 16, the mismatch-forming residues of antisense strand positions
17 and 18 are adjacent to one another, while the mismatch-forming
residues of antisense strand positions 13 and 15 are interspersed
by one nucleotide that forms a matched base pair with the
corresponding residue of the target RNA sequence--similarly, the
mismatch-forming residues of antisense strand positions 15 and 17
are also interspersed by one nucleotide that forms a matched base
pair with the corresponding residue of the target RNA sequence).
For example, four residues of the antisense strand (located within
the mismatch-tolerant region of the antisense strand) that form
mismatched base pairs with the corresponding target RNA sequence
can occur with zero, one, two or three matched base pairs located
between any two of these mismatch-forming base pairs.
[0220] The above DsiRNAmm and other DsiRNA structures are described
in order to exemplify certain structures of DsiRNAmm and DsiRNA
agents. Design of the above DsiRNAmm and DsiRNA structures can be
adapted to generate, e.g., DsiRNAmm forms of a DNA-extended ("DNA
handle") DsiRNA agent shown infra (including, e.g., design of
mismatch-containing DsiRNAmm agents as shown in FIGS. 14-16 and
20-22). As exemplified above, DsiRNAs can also be designed that
possess single mismatches (or two, three or four mismatches)
between the antisense strand of the DsiRNA and a target sequence,
yet optionally can retain perfect complementarity between sense and
antisense strand sequences of a DsiRNA.
[0221] It is further noted that the DsiRNA agents exemplified infra
can also possess insertion/deletion (in/del) structures within
their double-stranded and/or target RNA-aligned structures.
Accordingly, the DsiRNAs of the invention can be designed to
possess in/del variations in, e.g., antisense strand sequence as
compared to target RNA sequence and/or antisense strand sequence as
compared to sense strand sequence, with preferred location(s) for
placement of such in/del nucleotides corresponding to those
locations described above for positioning of mismatched and/or
mismatch-forming base pairs.
[0222] In certain embodiments, the "D" residues of any of the above
structures include at least one PS-DNA or PS-RNA. Optionally, the
"D" residues of any of the above structures include at least one
modified nucleotide that inhibits Dicer cleavage.
[0223] While the above-described "DNA-extended" DsiRNA agents can
be categorized as either "left extended" or "right extended",
DsiRNA agents comprising both left- and right-extended
DNA-containing sequences within a single agent (e.g., both flanks
surrounding a core dsRNA structure are dsDNA extensions) can also
be generated and used in similar manner to those described herein
for "right-extended" and "left-extended" agents.
[0224] In some embodiments, the DsiRNA of the instant invention
further comprises a linking moiety or domain that joins the sense
and antisense strands of a DNA:DNA-extended DsiRNA agent.
Optionally, such a linking moiety domain joins the 3' end of the
sense strand and the 5' end of the antisense strand. The linking
moiety may be a chemical (non-nucleotide) linker, such as an
oligomethylenediol linker, oligoethylene glycol linker, or other
art-recognized linker moiety. Alternatively, the linker can be a
nucleotide linker, optionally including an extended loop and/or
tetraloop.
[0225] In one embodiment, the DsiRNA agent has an asymmetric
structure, with the sense strand having a 27-base pair length, the
antisense strand having a 29-nucleotide length with a 2 base
3'-overhang (and, therefore, the DsiRNA agent possesses a blunt end
at the 3' end of the sense strand/5' end of the antisense strand),
and with deoxyribonucleotides located at positions 24 and 25 of the
sense strand (numbering from position 1 at the 5' of the sense
strand) and each base paired with a cognate deoxyribonucleotide of
the antisense strand. In another embodiment, this DsiRNA agent has
an asymmetric structure further containing 2 deoxyribonucleotides
at the 3' end of the sense strand.
[0226] In another embodiment, the DsiRNA agent has an asymmetric
structure, with the sense strand having a 30-nucleotide length, the
antisense strand having a 28-nucleotide length, with a 2 nucleotide
3' overhang positioned at the 3' end of the sense strand. The 3'
end of the antisense strand and 5' end of the sense strand of this
DsiRNA agent form a blunt end, and starting from position 1 at the
5' terminus of the sense strand, positions 1-5 are
deoxyribonucleotides that hybridize to form a duplex with cognate
deoxyribonucleotides of the 3' end region of the antisense strand.
Optionally, starting from position 1 at the 5' end of the antisense
strand, positions 11-21 of the antisense strand (in certain
embodiments, positions 13-21) harbor one or more nucleotides that
either form a mismatch base pairing with the corresponding
nucleotide of the sense strand, or with the corresponding
nucleotide of the target RNA sequence when the antisense strand and
the target RNA sequence hybridize to form a duplex, or with both
sense strand and target RNA sequence. Optionally, the ultimate and
penultimate nucleotides of the 5' terminus of the sense strand and
the ultimate and penultimate nucleotides of the 3' end of the
antisense strand comprise one or more phosphorothioates
(optionally, the two antisense strand deoxyribonucleotides, the two
sense strand deoxyribonucleotides, or all 4 deoxyribonucleotides
constituting the ultimate and penultimate residues of both the 5'
end of the sense strand and the 3' end of the antisense strand
possess phosphorothioates).
Modification of DsiRNAs
[0227] One major factor that inhibits the effect of double stranded
RNAs ("dsRNAs") is the degradation of dsRNAs (e.g., siRNAs and
DsiRNAs) by nucleases. A 3'-exonuclease is the primary nuclease
activity present in serum and modification of the 3'-ends of
antisense DNA oligonucleotides is crucial to prevent degradation
(Eder et al., 1991). An RNase-T family nuclease has been identified
called ERI-1 which has 3' to 5' exonuclease activity that is
involved in regulation and degradation of siRNAs (Kennedy et al.,
2004; Hong et al., 2005). This gene is also known as Thex1
(NM.sub.--02067) in mice or THEX1 (NM.sub.--153332) in humans and
is involved in degradation of histone mRNA; it also mediates
degradation of 3'-overhangs in siRNAs, but does not degrade duplex
RNA (Yang et al., 2006). It is therefore reasonable to expect that
3'-end-stabilization of dsRNAs, including the DsiRNAs of the
instant invention, will improve stability.
[0228] XRN1 (NM.sub.--019001) is a 5' to 3' exonuclease that
resides in P-bodies and has been implicated in degradation of mRNA
targeted by miRNA (Rehwinkel et al., 2005) and may also be
responsible for completing degradation initiated by internal
cleavage as directed by a siRNA. XRN2 (NM.sub.--012255) is a
distinct 5' to 3' exonuclease that is involved in nuclear RNA
processing. Although not currently implicated in degradation or
processing of siRNAs and miRNAs, these both are known nucleases
that can degrade RNAs and may also be important to consider.
[0229] RNase A is a major endonuclease activity in mammals that
degrades RNAs. It is specific for ssRNA and cleaves at the 3'-end
of pyrimidine bases. SiRNA degradation products consistent with
RNase A cleavage can be detected by mass spectrometry after
incubation in serum (Turner et al., 2007). The 3'-overhangs enhance
the susceptibility of siRNAs to RNase degradation. Depletion of
RNase A from serum reduces degradation of siRNAs; this degradation
does show some sequence preference and is worse for sequences
having poly A/U sequence on the ends (Haupenthal et al., 2006).
This suggests the possibility that lower stability regions of the
duplex may "breathe" and offer transient single-stranded species
available for degradation by RNase A. RNase A inhibitors can be
added to serum and improve siRNA longevity and potency (Haupenthal
et al., 2007).
[0230] In 21mers, phosphorothioate or boranophosphate modifications
directly stabilize the internucleoside phosphate linkage.
Boranophosphate modified RNAs are highly nuclease resistant, potent
as silencing agents, and are relatively non-toxic. Boranophosphate
modified RNAs cannot be manufactured using standard chemical
synthesis methods and instead are made by in vitro transcription
(IVT) (Hall et al., 2004 and Hall et al., 2006). Phosphorothioate
(PS) modifications can be readily placed in an RNA duplex at any
desired position and can be made using standard chemical synthesis
methods, though the ability to use such modifications within an RNA
duplex that retains RNA silencing activity can be limited. As shown
herein in FIG. 2 (duplex #8), inclusion of a multiple PS-modified
deoxyribonucleotide residues in a tandem series configuration that
base paired with a cognate tandem series of PS-modified
deoxyribonucleotide residues abolished RNA silencing activity of an
agent that was otherwise active with only unmodified
deoxyribonucleotides present at these residues. Because PS moieties
are likely to require greater spacing when included within an RNA
duplex-containing agent in order to retain RNA inhibitory activity,
extended DsiRNAs such as those described herein can provide a means
of including more PS modifications (either PS-DNA or PS-RNA) within
a single DsiRNA agent than would otherwise be available were no
such extension used. It is noted, however, that the PS modification
shows dose-dependent toxicity, so most investigators have
recommended limited incorporation in siRNAs, historically favoring
the 3'-ends where protection from nucleases is most important
(Harborth et al., 2003; Chiu and Rana, 2003; Braasch et al., 2003;
Amarzguioui et al., 2003). More extensive PS modification can be
compatible with potent RNAi activity; however, use of sugar
modifications (such as 2'-O-methyl RNA) may be superior (Choung et
al., 2006).
[0231] A variety of substitutions can be placed at the 2'-position
of the ribose which generally increases duplex stability (T.sub.m)
and can greatly improve nuclease resistance. 2'-O-methyl RNA is a
naturally occurring modification found in mammalian ribosomal RNAs
and transfer RNAs. 2'-O-methyl modification in siRNAs is known, but
the precise position of modified bases within the duplex is
important to retain potency and complete substitution of
2'-O-methyl RNA for RNA will inactivate the siRNA. For example, a
pattern that employs alternating 2'-O-methyl bases can have potency
equivalent to unmodified RNA and is quite stable in serum (Choung
et al., 2006; Czauderna et al., 2003).
[0232] The 2'-fluoro (2'-F) modification is also compatible with
dsRNA (e.g., siRNA and DsiRNA) function; it is most commonly placed
at pyrimidine sites (due to reagent cost and availability) and can
be combined with 2'-O-methyl modification at purine positions; 2'-F
purines are available and can also be used. Heavily modified
duplexes of this kind can be potent triggers of RNAi in vitro
(Allerson et al., 2005; Prakash et al., 2005; Kraynack and Baker,
2006) and can improve performance and extend duration of action
when used in vivo (Morrissey et al., 2005a; Morrissey et al.,
2005b). A highly potent, nuclease stable, blunt 19mer duplex
containing alternative 2'-F and 2'-O-Me bases is taught by
Allerson. In this design, alternating 2'-O-Me residues are
positioned in an identical pattern to that employed by Czauderna,
however the remaining RNA residues are converted to 2'-F modified
bases. A highly potent, nuclease resistant siRNA employed by
Morrissey employed a highly potent, nuclease resistant siRNA in
vivo. In addition to 2'-O-Me RNA and 2'-F RNA, this duplex includes
DNA, RNA, inverted abasic residues, and a 3'-terminal PS
internucleoside linkage. While extensive modification has certain
benefits, more limited modification of the duplex can also improve
in vivo performance and is both simpler and less costly to
manufacture. Soutschek et al. (2004) employed a duplex in vivo and
was mostly RNA with two 2'-O-Me RNA bases and limited 3'-terminal
PS internucleoside linkages.
[0233] Locked nucleic acids (LNAs) are a different class of
2'-modification that can be used to stabilize dsRNA (e.g., siRNA
and DsiRNA). Patterns of LNA incorporation that retain potency are
more restricted than 2'-O-methyl or 2'-F bases, so limited
modification is preferred (Braasch et al., 2003; Grunweller et al.,
2003; Elmen et al., 2005). Even with limited incorporation, the use
of LNA modifications can improve dsRNA performance in vivo and may
also alter or improve off target effect profiles (Mook et al.,
2007).
[0234] Synthetic nucleic acids introduced into cells or live
animals can be recognized as "foreign" and trigger an immune
response. Immune stimulation constitutes a major class of
off-target effects which can dramatically change experimental
results and even lead to cell death. The innate immune system
includes a collection of receptor molecules that specifically
interact with DNA and RNA that mediate these responses, some of
which are located in the cytoplasm and some of which reside in
endosomes (Marques and Williams, 2005; Schlee et al., 2006).
Delivery of siRNAs by cationic lipids or liposomes exposes the
siRNA to both cytoplasmic and endosomal compartments, maximizing
the risk for triggering a type 1 interferon (IFN) response both in
vitro and in vivo (Morrissey et al., 2005b; Sioud and Sorensen,
2003; Sioud, 2005; Ma et al., 2005). RNAs transcribed within the
cell are less immunogenic (Robbins et al., 2006) and synthetic RNAs
that are immunogenic when delivered using lipid-based methods can
evade immune stimulation when introduced unto cells by mechanical
means, even in vivo (Heidel et al., 2004). However, lipid based
delivery methods are convenient, effective, and widely used. Some
general strategy to prevent immune responses is needed, especially
for in vivo application where all cell types are present and the
risk of generating an immune response is highest. Use of chemically
modified RNAs may solve most or even all of these problems.
[0235] Although certain sequence motifs are clearly more
immunogenic than others, it appears that the receptors of the
innate immune system in general distinguish the presence or absence
of certain base modifications which are more commonly found in
mammalian RNAs than in prokaryotic RNAs. For example,
pseudouridine, N6-methyl-A, and 2'-O-methyl modified bases are
recognized as "self" and inclusion of these residues in a synthetic
RNA can help evade immune detection (Kariko et al., 2005).
Extensive 2'-modification of a sequence that is strongly
immunostimulatory as unmodified RNA can block an immune response
when administered to mice intravenously (Morrissey et al., 2005b).
However, extensive modification is not needed to escape immune
detection and substitution of as few as two 2'-O-methyl bases in a
single strand of a siRNA duplex can be sufficient to block a type 1
IFN response both in vitro and in vivo; modified U and G bases are
most effective (Judge et al., 2006). As an added benefit, selective
incorporation of 2'-O-methyl bases can reduce the magnitude of
off-target effects (Jackson et al., 2006). Use of 2'-O-methyl bases
should therefore be considered for all dsRNAs intended for in vivo
applications as a means of blocking immune responses and has the
added benefit of improving nuclease stability and reducing the
likelihood of off-target effects.
[0236] Although cell death can result from immune stimulation,
assessing cell viability is not an adequate method to monitor
induction of IFN responses. IFN responses can be present without
cell death, and cell death can result from target knockdown in the
absence of IFN triggering (for example, if the targeted gene is
essential for cell viability). Relevant cytokines can be directly
measured in culture medium and a variety of commercial kits exist
which make performing such assays routine. While a large number of
different immune effector molecules can be measured, testing levels
of IFN-.alpha., TNF-.alpha., and IL-6 at 4 and 24 hours post
transfection is usually sufficient for screening purposes. It is
important to include a "transfection reagent only control" as
cationic lipids can trigger immune responses in certain cells in
the absence of any nucleic acid cargo. Including controls for IFN
pathway induction should be considered for cell culture work. It is
essential to test for immune stimulation whenever administering
nucleic acids in vivo, where the risk of triggering IFN responses
is highest.
[0237] Modifications can be included in the DsiRNA agents of the
present invention so long as the modification does not prevent the
DsiRNA agent from serving as a substrate for Dicer. Indeed, one
surprising finding of the instant invention is that base paired
deoxyribonucleotides can be attached to previously described DsiRNA
molecules, resulting in enhanced RNAi efficacy and duration,
provided that such extension is performed in a region of the
extended molecule that does not interfere with Dicer processing
(e.g., 3' of the Dicer cleavage site of the sense strand/5' of the
Dicer cleavage site of the antisense strand). In one embodiment,
one or more modifications are made that enhance Dicer processing of
the DsiRNA agent. In a second embodiment, one or more modifications
are made that result in more effective RNAi generation. In a third
embodiment, one or more modifications are made that support a
greater RNAi effect. In a fourth embodiment, one or more
modifications are made that result in greater potency per each
DsiRNA agent molecule to be delivered to the cell. Modifications
can be incorporated in the 3'-terminal region, the 5'-terminal
region, in both the 3'-terminal and 5'-terminal region or in some
instances in various positions within the sequence. With the
restrictions noted above in mind, any number and combination of
modifications can be incorporated into the DsiRNA agent. Where
multiple modifications are present, they may be the same or
different. Modifications to bases, sugar moieties, the phosphate
backbone, and their combinations are contemplated. Either
5'-terminus can be phosphorylated.
[0238] Examples of modifications contemplated for the phosphate
backbone include phosphonates, including methylphosphonate,
phosphorothioate, and phosphotriester modifications such as
alkylphosphotriesters, and the like. Examples of modifications
contemplated for the sugar moiety include 2'-alkyl pyrimidine, such
as 2'-O-methyl, 2'-fluoro, amino, and deoxy modifications and the
like (see, e.g., Amarzguioui et al., 2003). Examples of
modifications contemplated for the base groups include abasic
sugars, 2-O-alkyl modified pyrimidines, 4-thiouracil,
5-bromouracil, 5-iodouracil, and 5-(3-aminoallyl)-uracil and the
like. Locked nucleic acids, or LNA's, could also be incorporated.
Many other modifications are known and can be used so long as the
above criteria are satisfied. Examples of modifications are also
disclosed in U.S. Pat. Nos. 5,684,143, 5,858,988 and 6,291,438 and
in U.S. published patent application No. 2004/0203145 A1. Other
modifications are disclosed in Herdewijn (2000), Eckstein (2000),
Rusckowski et al. (2000), Stein et al. (2001); Vorobjev et al.
(2001).
[0239] One or more modifications contemplated can be incorporated
into either strand. The placement of the modifications in the
DsiRNA agent can greatly affect the characteristics of the DsiRNA
agent, including conferring greater potency and stability, reducing
toxicity, enhance Dicer processing, and minimizing an immune
response. In one embodiment, the antisense strand or the sense
strand or both strands have one or more 2'-O-methyl modified
nucleotides. In another embodiment, the antisense strand contains
2'-O-methyl modified nucleotides. In another embodiment, the
antisense stand contains a 3' overhang that is comprised of
2'-O-methyl modified nucleotides. The antisense strand could also
include additional 2'-O-methyl modified nucleotides.
[0240] In certain embodiments of the present invention, the DsiRNA
agent has one or more properties which enhance its processing by
Dicer. According to these embodiments, the DsiRNA agent has a
length sufficient such that it is processed by Dicer to produce an
active siRNA and at least one of the following properties: (i) the
DsiRNA agent is asymmetric, e.g., has a 3' overhang on the
antisense strand and (ii) the DsiRNA agent has a modified 3' end on
the sense strand to direct orientation of Dicer binding and
processing of the dsRNA region to an active siRNA. In certain such
embodiments, the presence of one or more base paired
deoxyribonucleotides in a region of the sense strand that is 3' to
the projected site of Dicer enzyme cleavage and corresponding
region of the antisense strand that is 5' of the projected site of
Dicer enzyme cleavage can also serve to orient such a molecule for
appropriate directionality of Dicer enzyme cleavage.
[0241] In certain embodiments, the length of the dsDNA region (or
length of the region comprising DNA:DNA base pairs) is 1-50 base
pairs, optionally 2-30 base pairs, preferably 2-20 base pairs, and
more preferably 2-15 base pairs. Thus, a DNA:DNA-extended DsiRNA of
the instant invention may possess a dsDNA region that is 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more (e.g., 51,
52, 53, 54, 55, 56, 57, 58, 59, 60 or more) base pairs in
length.
[0242] In some embodiments, the longest strand in the dsNA
comprises 29-43 nucleotides. In one embodiment, the DsiRNA agent is
asymmetric such that the 3' end of the sense strand and 5' end of
the antisense strand form a blunt end, and the 3' end of the
antisense strand overhangs the 5' end of the sense strand. In
certain embodiments, the 3' overhang of the antisense strand is
1-10 nucleotides, and optionally is 1-4 nucleotides, for example 2
nucleotides. Both the sense and the antisense strand may also have
a 5' phosphate.
[0243] In certain embodiments, the sense strand of a DsiRNA of the
invention that comprises base paired deoxyribonucleotide residues
has a total length of between 26 nucleotides and 39 or more
nucleotides (e.g., the sense strand possesses a length of 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50 or more (e.g., 51, 52, 53, 54, 55, 56, 57,
58, 59, 60 or more) nucleotides). In certain embodiments, the
length of the sense strand is between 26 nucleotides and 39
nucleotides, optionally between 27 and 35 nucleotides, or,
optionally, between 27 and 33 nucleotides in length. In related
embodiments, the antisense strand has a length of between 27 and 43
or more nucleotides (e.g., the sense strand possesses a length of
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50 or more (e.g., 51, 52, 53, 54, 55,
56, 57, 58, 59, 60 or more) nucleotides). In certain such
embodiments, the antisense strand has a length of between 27 and 43
nucleotides in length, or between 27 and 39 nucleotides in length,
or between 27 and 35 nucleotides in length, or between 28 and 37
nucleotides in length, or, optionally, between 29 and 35
nucleotides in length.
[0244] In certain embodiments, the presence of one or more base
paired deoxyribonucleotides in a region of the sense strand that is
3' of the projected site of Dicer enzyme cleavage and corresponding
region of the antisense strand that is 5' of the projected site of
Dicer enzyme cleavage can serve to direct Dicer enzyme cleavage of
such a molecule. While certain exemplified agents of the invention
possess a sense strand deoxyribonucleotide that is located at
position 24 or more 3' when counting from position 1 at the 5' end
of the sense strand, and having this position 24 or more 3'
deoxyribonucleotide of the sense strand base pairing with a cognate
deoxyribonucleotide of the antisense strand, in some embodiments,
it is also possible to direct Dicer to cleave a shorter product,
e.g., a 19mer or a 20mer via inclusion of deoxyribonucleotide
residues at, e.g., position 20 of the sense strand. Such a position
20 deoxyribonucleotide base pairs with a corresponding
deoxyribonucleotide of the antisense strand, thereby directing
Dicer-mediated excision of a 19mer as the most prevalent Dicer
product (it is noted that the antisense strand can also comprise
one or two deoxyribonucleotide residues immediately 3' of the
antisense residue that base pairs with the position 20
deoxyribonucleotide residue of the sense strand in such
embodiments, to further direct Dicer cleavage of the antisense
strand). In such embodiments, the double-stranded DNA region (which
is inclusive of modified nucleic acids that block Dicer cleavage)
will generally possess a length of greater than 1 or 2 base pairs
(e.g., 3 to 5 base pairs or more), in order to direct Dicer
cleavage to generate what is normally a non-preferred length of
Dicer cleavage product. A parallel approach can also be taken to
direct Dicer excision of 20mer siRNAs, with the positioning of the
first deoxyribonucleotide residue of the sense strand (when
surveying the sense strand from position 1 at the 5' terminus of
the sense strand) occurring at position 21.
[0245] In certain embodiments, the sense strand of the DsiRNA agent
is modified for Dicer processing by suitable modifiers located at
the 3' end of the sense strand, i.e., the DsiRNA agent is designed
to direct orientation of Dicer binding and processing via sense
strand modification. Suitable modifiers include nucleotides such as
deoxyribonucleotides, dideoxyribonucleotides, acyclonucleotides and
the like and sterically hindered molecules, such as fluorescent
molecules and the like. Acyclonucleotides substitute a
2-hydroxyethoxymethyl group for the 2'-deoxyribofuranosyl sugar
normally present in dNMPs. Other nucleotide modifiers could include
3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxyinosine (ddI), 2',3'-dideoxy-3'-thiacytidine (3TC),
2',3'-didehydro-2',3'-dideoxythymidine (d4T) and the monophosphate
nucleotides of 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T). In one embodiment,
deoxyribonucleotides are used as the modifiers. When nucleotide
modifiers are utilized, 1-3 nucleotide modifiers, or 2 nucleotide
modifiers are substituted for the ribonucleotides on the 3' end of
the sense strand. When sterically hindered molecules are utilized,
they are attached to the ribonucleotide at the 3' end of the
antisense strand. Thus, the length of the strand does not change
with the incorporation of the modifiers. In another embodiment, the
invention contemplates substituting two DNA bases in the DsiRNA
agent to direct the orientation of Dicer processing of the
antisense strand. In a further embodiment of the present invention,
two terminal DNA bases are substituted for two ribonucleotides on
the 3'-end of the sense strand forming a blunt end of the duplex on
the 3' end of the sense strand and the 5' end of the antisense
strand, and a two-nucleotide RNA overhang is located on the 3'-end
of the antisense strand. This is an asymmetric composition with DNA
on the blunt end and RNA bases on the overhanging end. In certain
embodiments of the instant invention, the modified nucleotides
(e.g., deoxyribonucleotides) of the penultimate and ultimate
positions of the 3' terminus of the sense strand base pair with
corresponding modified nucleotides (e.g., deoxyribonucleotides) of
the antisense strand (optionally, the penultimate and ultimate
residues of the 5' end of the antisense strand in those DsiRNA
agents of the instant invention possessing a blunt end at the 3'
terminus of the sense strand/5' terminus of the antisense
strand).
[0246] The sense and antisense strands of a DsiRNA agent of the
instant invention anneal under biological conditions, such as the
conditions found in the cytoplasm of a cell. In addition, a region
of one of the sequences, particularly of the antisense strand, of
the DsiRNA agent has a sequence length of at least 19 nucleotides,
wherein these nucleotides are in the 21-nucleotide region adjacent
to the 3' end of the antisense strand and are sufficiently
complementary to a nucleotide sequence of the RNA produced from the
target gene to anneal with and/or decrease levels of such a target
RNA.
[0247] The DsiRNA agent of the instant invention may possess one or
more deoxyribonucleotide base pairs located at any positions of
sense and antisense strands that are located 3' of the projected
Dicer cleavage site of the sense strand and 5' of the projected
Dicer cleavage site of the antisense strand. In certain
embodiments, one, two, three or all four of positions 24-27 of the
sense strand (starting from position 1 at the 5' terminus of the
sense strand) are deoxyribonucleotides, each deoxyribonucleotide of
which base pairs with a corresponding deoxyribonucleotide of the
antisense strand. In certain embodiments, the deoxyribonucleotides
of the 5' region of the antisense strand (e.g., the region of the
antisense strand located 5' of the projected Dicer cleavage site
for a given DsiRNA molecule) are not complementary to the target
RNA to which the DsiRNA agent is directed. In related embodiments,
the entire region of the antisense strand located 5' of the
projected Dicer cleavage site of a DsiRNA agent is not
complementary to the target RNA to which the DsiRNA agent is
directed. In certain embodiments, the deoxyribonucleotides of the
antisense strand or the entire region of the antisense strand that
is located 5' of the projected Dicer cleavage site of the DsiRNA
agent is not sufficiently complementary to the target RNA to
enhance annealing of the antisense strand of the DsiRNA to the
target RNA when the antisense strand is annealed to the target RNA
under conditions sufficient to allow for annealing between the
antisense strand and the target RNA (e.g., a "core" antisense
strand sequence lacking the DNA-extended region anneals equally
well to the target RNA as the same "core" antisense strand sequence
also extended with sequence of the DNA-extended region).
[0248] The DsiRNA agent may also have one or more of the following
additional properties: (a) the antisense strand has a right or left
shift from the typical 21mer, (b) the strands may not be completely
complementary, i.e., the strands may contain simple mismatch
pairings and (c) base modifications such as locked nucleic acid(s)
may be included in the 5' end of the sense strand. A "typical"
21mer siRNA is designed using conventional techniques. In one
technique, a variety of sites are commonly tested in parallel or
pools containing several distinct siRNA duplexes specific to the
same target with the hope that one of the reagents will be
effective (Ji et al., 2003). Other techniques use design rules and
algorithms to increase the likelihood of obtaining active RNAi
effector molecules (Schwarz et al., 2003; Khvorova et al., 2003;
Ui-Tei et al., 2004; Reynolds et al., 2004; Krol et al., 2004; Yuan
et al., 2004; Boese et al., 2005). High throughput selection of
siRNA has also been developed (U.S. published patent application
No. 2005/0042641 A1). Potential target sites can also be analyzed
by secondary structure predictions (Heale et al., 2005). This 21mer
is then used to design a right shift to include 3-9 additional
nucleotides on the 5' end of the 21mer. The sequence of these
additional nucleotides may have any sequence. In one embodiment,
the added ribonucleotides are based on the sequence of the target
gene. Even in this embodiment, full complementarity between the
target sequence and the antisense siRNA is not required.
[0249] The first and second oligonucleotides of a DsiRNA agent of
the instant invention are not required to be completely
complementary. They only need to be substantially complementary to
anneal under biological conditions and to provide a substrate for
Dicer that produces a siRNA sufficiently complementary to the
target sequence. Locked nucleic acids, or LNA's, are well known to
a skilled artisan (Elman et al., 2005; Kurreck et al., 2002;
Crinelli et al., 2002; Braasch and Corey, 2001; Bondensgaard et
al., 2000; Wahlestedt et al., 2000). In one embodiment, an LNA is
incorporated at the 5' terminus of the sense strand. In another
embodiment, an LNA is incorporated at the 5' terminus of the sense
strand in duplexes designed to include a 3' overhang on the
antisense strand.
[0250] In certain embodiments, the DsiRNA agent of the instant
invention has an asymmetric structure, with the sense strand having
a 27-base pair length, and the antisense strand having a 29-base
pair length with a 2 base 3'-overhang. Such agents optionally may
possess between one and four deoxyribonucleotides of the 3'
terminal region (specifically, the region 3' of the projected Dicer
cleavage site) of the sense strand, at least one of which base
pairs with a cognate deoxyribonucleotide of the 5' terminal region
(specifically, the region 5' of the projected Dicer cleavage site)
of the antisense strand. In other embodiments, the sense strand has
a 28-base pair length, and the antisense strand has a 30-base pair
length with a 2 base 3'-overhang. Such agents optionally may
possess between one and five deoxyribonucleotides of the 3'
terminal region (specifically, the region 3' of the projected Dicer
cleavage site) of the sense strand, at least one of which base
pairs with a cognate deoxyribonucleotide of the 5' terminal region
(specifically, the region 5' of the projected Dicer cleavage site)
of the antisense strand. In additional embodiments, the sense
strand has a 29-base pair length, and the antisense strand has a
31-base pair length with a 2 base 3'-overhang. Such agents
optionally possess between one and six deoxyribonucleotides of the
3' terminal region (specifically, the region 3' of the projected
Dicer cleavage site) of the sense strand, at least one of which
base pairs with a cognate deoxyribonucleotide of the 5' terminal
region (specifically, the region 5' of the projected Dicer cleavage
site) of the antisense strand. In further embodiments, the sense
strand has a 30-base pair length, and the antisense strand has a
32-base pair length with a 2 base 3'-overhang. Such agents
optionally possess between one and seven deoxyribonucleotides of
the 3' terminal region (specifically, the region 3' of the
projected Dicer cleavage site) of the sense strand, at least one of
which base pairs with a cognate deoxyribonucleotide of the 5'
terminal region (specifically, the region 5' of the projected Dicer
cleavage site) of the antisense strand. In other embodiments, the
sense strand has a 31-base pair length, and the antisense strand
has a 33-base pair length with a 2 base 3'-overhang. Such agents
optionally possess between one and eight deoxyribonucleotides of
the 3' terminal region (specifically, the region 3' of the
projected Dicer cleavage site) of the sense strand, at least one of
which base pairs with a cognate deoxyribonucleotide of the 5'
terminal region (specifically, the region 5' of the projected Dicer
cleavage site) of the antisense strand. In additional embodiments,
the sense strand has a 32-base pair length, and the antisense
strand has a 34-base pair length with a 2 base 3'-overhang. Such
agents optionally possess between one and nine deoxyribonucleotides
of the 3' terminal region (specifically, the region 3' of the
projected Dicer cleavage site) of the sense strand, at least one of
which base pairs with a cognate deoxyribonucleotide of the 5'
terminal region (specifically, the region 5' of the projected Dicer
cleavage site) of the antisense strand. In certain further
embodiments, the sense strand has a 33-base pair length, and the
antisense strand has a 35-base pair length with a 2 base
3'-overhang. Such agents optionally possess between one and ten
deoxyribonucleotides of the 3' terminal region (specifically, the
region 3' of the projected Dicer cleavage site) of the sense
strand, at least one of which base pairs with a cognate
deoxyribonucleotide of the 5' terminal region (specifically, the
region 5' of the projected Dicer cleavage site) of the antisense
strand. In still other embodiments, any of these DsiRNA agents have
an asymmetric structure that further contains 2
deoxyribonucleotides at the 3' end of the sense strand in place of
two of the ribonucleotides; optionally, these 2
deoxyribonucleotides base pair with cognate deoxyribonucleotides of
the antisense strand.
[0251] Certain DsiRNA agent compositions containing two separate
oligonucleotides can be linked by a third structure. The third
structure will not block Dicer activity on the DsiRNA agent and
will not interfere with the directed destruction of the RNA
transcribed from the target gene. In one embodiment, the third
structure may be a chemical linking group. Many suitable chemical
linking groups are known in the art and can be used. Alternatively,
the third structure may be an oligonucleotide that links the two
oligonucleotides of the DsiRNA agent in a manner such that a
hairpin structure is produced upon annealing of the two
oligonucleotides making up the dsNA composition. The hairpin
structure will not block Dicer activity on the DsiRNA agent and
will not interfere with the directed destruction of the target
RNA.
[0252] In certain embodiments, the DsiRNA agent of the invention
has several properties which enhance its processing by Dicer.
According to such embodiments, the DsiRNA agent has a length
sufficient such that it is processed by Dicer to produce an siRNA
and at least one of the following properties: (i) the DsiRNA agent
is asymmetric, e.g., has a 3' overhang on the sense strand and (ii)
the DsiRNA agent has a modified 3' end on the antisense strand to
direct orientation of Dicer binding and processing of the dsRNA
region to an active siRNA. According to these embodiments, the
longest strand in the DsiRNA agent comprises 25-43 nucleotides. In
one embodiment, the sense strand comprises 25-39 nucleotides and
the antisense strand comprises 26-43 nucleotides. The resulting
dsNA can have an overhang on the 3' end of the sense strand. The
overhang is 1-4 nucleotides, such as 2 nucleotides. The antisense
or sense strand may also have a 5' phosphate.
[0253] In certain embodiments, the sense strand of a DsiRNA agent
is modified for Dicer processing by suitable modifiers located at
the 3' end of the sense strand, i.e., the DsiRNA agent is designed
to direct orientation of Dicer binding and processing. Suitable
modifiers include nucleotides such as deoxyribonucleotides,
dideoxyribonucleotides, acyclonucleotides and the like and
sterically hindered molecules, such as fluorescent molecules and
the like. Acyclonucleotides substitute a 2-hydroxyethoxymethyl
group for the 2'-deoxyribofuranosyl sugar normally present in
dNMPs. Other nucleotide modifiers could include 3'-deoxyadenosine
(cordycepin), 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxyinosine (ddI), 2',3'-dideoxy-3'-thiacytidine (3TC),
2',3'-didehydro-2',3'-dideoxythymidine (d4T) and the monophosphate
nucleotides of 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T). In one embodiment,
deoxyribonucleotides are used as the modifiers. When nucleotide
modifiers are utilized, 1-3 nucleotide modifiers, or 2 nucleotide
modifiers are substituted for the ribonucleotides on the 3' end of
the sense strand. When sterically hindered molecules are utilized,
they are attached to the ribonucleotide at the 3' end of the
antisense strand. Thus, the length of the strand does not change
with the incorporation of the modifiers. In another embodiment, the
invention contemplates substituting two DNA bases in the dsNA to
direct the orientation of Dicer processing. In a further
embodiment, two terminal DNA bases are located on the 3' end of the
sense strand in place of two ribonucleotides forming a blunt end of
the duplex on the 5' end of the antisense strand and the 3' end of
the sense strand, and a two-nucleotide RNA overhang is located on
the 3'-end of the antisense strand. This is an asymmetric
composition with DNA on the blunt end and RNA bases on the
overhanging end.
[0254] In certain other embodiments, the antisense strand of a
DsiRNA agent is modified for Dicer processing by suitable modifiers
located at the 3' end of the antisense strand, i.e., the DsiRNA
agent is designed to direct orientation of Dicer binding and
processing. Suitable modifiers include nucleotides such as
deoxyribonucleotides, dideoxyribonucleotides, acyclonucleotides and
the like and sterically hindered molecules, such as fluorescent
molecules and the like. Acyclonucleotides substitute a
2-hydroxyethoxymethyl group for the 2'-deoxyribofuranosyl sugar
normally present in dNMPs. Other nucleotide modifiers could include
3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxyinosine (ddI), 2',3'-dideoxy-3'-thiacytidine (3TC),
2',3'-didehydro-2',3'-dideoxythymidine (d4T) and the monophosphate
nucleotides of 3'-azido-3'-deoxythymidine (AZT),
2',3'-dideoxy-3'-thiacytidine (3TC) and
2',3'-didehydro-2',3'-dideoxythymidine (d4T). In one embodiment,
deoxyribonucleotides are used as the modifiers. When nucleotide
modifiers are utilized, 1-3 nucleotide modifiers, or 2 nucleotide
modifiers are substituted for the ribonucleotides on the 3' end of
the antisense strand. When sterically hindered molecules are
utilized, they are attached to the ribonucleotide at the 3' end of
the antisense strand. Thus, the length of the strand does not
change with the incorporation of the modifiers. In another
embodiment, the invention contemplates substituting two DNA bases
in the dsNA to direct the orientation of Dicer processing. In a
further invention, two terminal DNA bases are located on the 3' end
of the antisense strand in place of two ribonucleotides forming a
blunt end of the duplex on the 5' end of the sense strand and the
3' end of the antisense strand, and a two-nucleotide RNA overhang
is located on the 3'-end of the sense strand. This is also an
asymmetric composition with DNA on the blunt end and RNA bases on
the overhanging end.
[0255] The sense and antisense strands anneal under biological
conditions, such as the conditions found in the cytoplasm of a
cell. In addition, a region of one of the sequences, particularly
of the antisense strand, of the dsNA has a sequence length of at
least 19 nucleotides, wherein these nucleotides are adjacent to the
3' end of antisense strand and are sufficiently complementary to a
nucleotide sequence of the target RNA to direct RNA
interference.
[0256] Additionally, the DsiRNA agent structure can be optimized to
ensure that the oligonucleotide segment generated from Dicer's
cleavage will be the portion of the oligonucleotide that is most
effective in inhibiting gene expression. For example, in one
embodiment of the invention, a 27-35-bp oligonucleotide of the
DsiRNA agent structure is synthesized wherein the anticipated 21 to
22-bp segment that will inhibit gene expression is located on the
3'-end of the antisense strand. The remaining bases located on the
5'-end of the antisense strand will be cleaved by Dicer and will be
discarded. This cleaved portion can be homologous (i.e., based on
the sequence of the target sequence) or non-homologous and added to
extend the nucleic acid strand. As surprisingly identified in the
instant invention, such extension can be performed with base paired
DNA residues (double stranded DNA:DNA extensions), resulting in
extended DsiRNA agents having improved efficacy or duration of
effect than corresponding double stranded RNA:RNA-extended DsiRNA
agents.
[0257] US 2007/0265220 discloses that 27mer DsiRNAs show improved
stability in serum over comparable 21mer siRNA compositions, even
absent chemical modification. Modifications of DsiRNA agents, such
as inclusion of 2'-O-methyl RNA in the antisense strand, in
patterns such as detailed in US 2007/0265220 and in the instant
Examples, when coupled with addition of a 5' Phosphate, can improve
stability of DsiRNA agents. Addition of 5'-phosphate to all strands
in synthetic RNA duplexes may be an inexpensive and physiological
method to confer some limited degree of nuclease stability.
[0258] The chemical modification patterns of the DsiRNA agents of
the instant invention are designed to enhance the efficacy of such
agents. Accordingly, such modifications are designed to avoid
reducing potency of DsiRNA agents; to avoid interfering with Dicer
processing of DsiRNA agents; to improve stability in biological
fluids (reduce nuclease sensitivity) of DsiRNA agents; or to block
or evade detection by the innate immune system. Such modifications
are also designed to avoid being toxic and to avoid increasing the
cost or impact the ease of manufacturing the instant DsiRNA agents
of the invention.
RNA Processing
[0259] siRNA
[0260] The process of siRNA-mediated RNAi is triggered by the
presence of long, dsRNA molecules in a cell. During the initiation
step of RNAi, these dsRNA molecules are cleaved into 21-23
nucleotide (nt) small-interfering RNA duplexes (siRNAs) by Dicer, a
conserved family of enzymes containing two RNase III-like domains
(Bernstein et al. 2001; Elbashir et al. 2001). The siRNAs are
characterized by a 19-21 base pair duplex region and 2 nucleotide
3' overhangs on each strand. During the effector step of RNAi, the
siRNAs become incorporated into a multimeric protein complex called
RNA-induced silencing complex (RISC), where they serve as guides to
select fully complementary mRNA substrates for degradation.
Degradation is initiated by endonucleolytic cleavage of the mRNA
within the region complementary to the siRNA. More precisely, the
mRNA is cleaved at a position 10 nucleotides from the 5' end of the
guiding siRNA (Elbashir et al. 2001 Genes & Dev. 15: 188-200;
Nykanen et al. 2001 Cell 107: 309-321; Martinez et al. 2002 Cell
110: 563-574). An endonuclease responsible for this cleavage was
identified as Argonaute2 (Ago2; Liu et al. Science, 305:
1437-41).
miRNA
[0261] The majority of human miRNAs (70%)--and presumably the
majority of miRNAs of other mammals--are transcribed from introns
and/or exons, and approximately 30% are located in intergenic
regions (Rodriguez et al., Genome Res. 2004, 14(10A), 1902-1910).
In human and animal, miRNAs are usually transcribed by RNA
polymerase II (Farh et al. Science 2005, 310(5755), 1817-1821), and
in some cases by pol III (Borchert et al. Nat. Struct. Mol. Biol.
2006, 13(12), 1097-1101). Certain viral encoded miRNAs are
transcribed by RNA polymerase III (Pfeffer et al. Nat. Methods
2005, 2(4), 269-276; Andersson et al. J. Virol. 2005, 79(15),
9556-9565), and some are located in the open reading frame of viral
gene (Pfeffer et al. Nat. Methods 2005, 2(4), 269-276; Samols et
al. J. Virol. 2005, 79(14), 9301-9305). miRNA transcription results
in the production of large monocistronic, bicistronic or
polycistronic primary transcripts (pri-miRNAs). A single pri-miRNA
may range from approximately 200 nucleotides (nt) to several
kilobases (kb) in length and have both a 5' 7-methylguanosine (m7)
caps and a 3' poly (A) tail. Characteristically, the mature miRNA
sequences are localized to regions of imperfect stem-loop sequences
within the pri-miRNAs (Cullen. Mol. Cell 2004, 16(6), 861-865).
[0262] The first step of miRNA maturation in the nucleus is the
recognition and cleavage of the pri-miRNAs by the RNase III
Drosha-DGCR8 nuclear microprocessor complex, which releases a
.about.70 nt hairpin-containing precursor molecule called
pre-miRNAs, with a monophosphate at the 5' terminus and a 2-nt
overhang with a hydroxyl group at the 3' terminus (Cai et al. RNA
2004, 10(12), 1957-1966; Lee et al. Nature 2003, 425(6956),
415-419; Kim Nat. Rev. Mol. Cell. Biol. 2005, 6(5), 376-385). The
next step is the nuclear transport of the pre-miRNAs out of the
nucleus into the cytoplasm by Exportin-5, a carrier protein (Yi et
al. Genes. Dev. 2003, 17(24), 3011-3016, Bohnsack et al. RNA 2004,
10(2), 185-191). Exportin-5 and the GTP-bound form of its cofactor
Ran together recognize and bind the 2 nucleotide 3' overhang and
the adjacent stem that are characteristics of pre-miRNA (Basyuk et
al. Nucl. Acids Res. 2003, 31(22), 6593-6597, Zamore Mol. Cell.
2001, 8(6), 1158-1160). In the cytoplasm, GTP hydrolysis results in
release of the pre-miRNA, which is then processed by a cellular
endonuclease III enzyme Dicer (Bohnsack et al.). Dicer was first
recognized for its role in generating siRNAs that mediate RNA
interference (RNAi). Dicer acts in concert with its cofactors TRBP
(Transactivating region binding protein; Chendrimata et al. Nature
2005, 436(7051), 740-744) and PACT (interferon-inducible double
strand-RNA-dependant protein kinase activator, Lee et al. EMBO J.
2006, 25(3), 522-532). These enzymes bind at the 3' 2 nucleotide
overhang at the base of the pre-miRNA hairpin and remove the
terminal loop, yielding an approximately 21-nt miRNA duplex
intermediate with both termini having 5' monophosphates, 3' 2
nucleotide overhangs and 3' hydroxyl groups. The miRNA guide
strand, the 5' terminus of which is energetically less stable, is
then selected for incorporation into the RISC(RNA-induced silencing
complex), while the `passenger` strand is released and degraded
(Maniataki et al. Genes. Dev. 2005, 19(24), 2979-2990; Hammond et
al. Nature 2000, 404(6775), 293-296). The composition of RISC
remains incompletely defined, but a key component is a member of
the Argonaute (Ago) protein family (Maniataki et al.; Meister et
al. Mol. Cell. 2004, 15(2), 185-197).
[0263] The mature miRNA then directs RISC to complementary mRNA
species. If the target mRNA has perfect complementarity to the
miRNA-armed RISC, the mRNA will be cleaved and degraded (Zeng et
al. Proc. Natl. Acad. Sci. USA 2003, 100(17), 9779-9784; Hutvagner
et al. Science 2002, 297(55 89), 2056-2060). But as the most common
situation in mammalian cells, the miRNAs targets mRNAs with
imperfect complementarity and suppress their translation, resulting
in reduced expression of the corresponding proteins (Yekta et al.
Science 2004, 304(5670), 594-596; Olsen et al. Dev. Biol. 1999,
216(2), 671-680). The 5' region of the miRNA, especially the match
between miRNA and target sequence at nucleotides 2-7 or 8 of miRNA
(starting from position 1 at the 5' terminus), which is called the
seed region, is essentially important for miRNA targeting, and this
seed match has also become a key principle widely used in computer
prediction of the miRNA targeting (Lewis et al. Cell 2005, 120(1),
15-20; Brennecke et al. PLoS Biol. 2005, 3(3), e85). miRNA
regulation of the miRNA-mRNA duplexes is mediated mainly through
multiple complementary sites in the 3' UTRs, but there are many
exceptions. miRNAs may also bind the 5' UTR and/or the coding
region of mRNAs, resulting in a similar outcome (Lytle et al. Proc.
Natl. Acad. Sci. USA 2007, 104(23), 9667-9672).
RNase H
[0264] RNase H is a ribonuclease that cleaves the 3'-O--P bond of
RNA in a DNA/RNA duplex to produce 3'-hydroxyl and 5'-phosphate
terminated products. RNase H is a non-specific endonuclease and
catalyzes cleavage of RNA via a hydrolytic mechanism, aided by an
enzyme-bound divalent metal ion. Members of the RNase H family are
found in nearly all organisms, from archaea and prokaryotes to
eukaryotes. During DNA replication, RNase H is believed to cut the
RNA primers responsible for priming generation of Okazaki
fragments; however, the RNase H enzyme may be more generally
employed to cleave any DNA:RNA hybrid sequence of sufficient length
(e.g., typically DNA:RNA hybrid sequences of 4 or more base pairs
in length in mammals).
MicroRNA and MicroRNA-Like Therapeutics
[0265] MicroRNAs (miRNAs) have been described to act by binding to
the 3' UTR of a template transcript, thereby inhibiting expression
of a protein encoded by the template transcript by a mechanism
related to but distinct from classic RNA interference.
Specifically, miRNAs are believed to act by reducing translation of
the target transcript, rather than by decreasing its stability.
Naturally-occurring miRNAs are typically approximately 22 nt in
length. It is believed that they are derived from larger precursors
known as small temporal RNAs (stRNAs) approximately 70 nt long.
[0266] Interference agents such as siRNAs, and more specifically
such as miRNAs, that bind within the 3' UTR (or elsewhere in a
target transcript, e.g., in repeated elements of, e.g., Notch
and/or transcripts of the Notch family) and inhibit translation may
tolerate a larger number of mismatches in the siRNA/template
(miRNA/template) duplex, and particularly may tolerate mismatches
within the central region of the duplex. In fact, there is evidence
that some mismatches may be desirable or required, as naturally
occurring stRNAs frequently exhibit such mismatches, as do miRNAs
that have been shown to inhibit translation in vitro (Zeng et al.,
Molecular Cell, 9: 1-20). For example, when hybridized with the
target transcript, such miRNAs frequently include two stretches of
perfect complementarity separated by a region of mismatch. Such a
hybridized complex commonly includes two regions of perfect
complementarily (duplex portions) comprising nucleotide pairs, and
at least a single mismatched base pair, which may be, e.g., G:A,
G:U, G:G, A:A, A:C, U:U, U:C, C:C, G:-, A:-, U:-, C:-, etc. Such
mismatched nucleotides, especially if present in tandem (e.g., a
two, three or four nucleotide area of mismatch) can form a bulge
that separates duplex portions which are located on either flank of
such a bulge. A variety of structures are possible. For example,
the miRNA may include multiple areas of nonidentity (mismatch). The
areas of nonidentity (mismatch) need not be symmetrical in the
sense that both the target and the miRNA include nonpaired
nucleotides. For example, structures have been described in which
only one strand includes nonpaired nucleotides (Zeng et al., FIG.
33). Typically the stretches of perfect complementarily within a
miRNA agent are at least 5 nucleotides in length, e.g., 6, 7, or
more nucleotides in length, while the regions of mismatch may be,
for example, 1, 2, 3, or 4 nucleotides in length.
[0267] In general, any particular siRNA could function to inhibit
gene expression both via (i) the "classical" siRNA pathway, in
which stability of a target transcript is reduced and in which
perfect complementarily between the siRNA and the target is
frequently preferred, and also by (ii) the "alternative" pathway
(generally characterized as the miRNA pathway in animals), in which
translation of a target transcript is inhibited. Generally, the
transcripts targeted by a particular siRNA via mechanism (i) would
be distinct from the transcript targeted via mechanism (ii),
although it is possible that a single transcript could contain
regions that could serve as targets for both the classical and
alternative pathways. (Note that the terms "classical" and
"alternative" are used merely for convenience and generally are
believed to reflect historical timing of discovery of such
mechanisms in animal cells, but do not reflect the importance,
effectiveness, or other features of either mechanism.) One common
goal of siRNA design has been to target a single transcript with
great specificity, via mechanism (i), while minimizing off-target
effects, including those effects potentially elicited via mechanism
(ii). However, it is among the goals of the instant invention to
provide RNA interference agents that possess mismatch residues by
design, either for purpose of mimicking the activities of
naturally-occurring miRNAs, or to create agents directed against
target RNAs for which no corresponding miRNA is presently known,
with the inhibitory and/or therapeutic efficacies/potencies of such
mismatch-containing DsiRNA agents (e.g., DsiRNAmm agents) tolerant
of, and indeed possibly enhanced by, such mismatches.
[0268] The tolerance of miRNA agents for mismatched nucleotides
(and, indeed the existence and natural use of mechanism (ii) above
in the cell) suggests the use of miRNAs in manners that are
advantageous to and/or expand upon the "classical" use of perfectly
complementary siRNAs that act via mechanism (i). Because miRNAs are
naturally occurring molecules, there are likely to be distinct
advantages in applying miRNAs as therapeutic agents. miRNAs benefit
from hundreds of millions of years of evolutionary "fine tuning" of
their function. Thus, sequence-specific "off target" effects should
not be an issue with naturally occurring miRNAs, nor, by extension,
with certain synthetic DsiRNAs of the invention (e.g., DsiRNAmm
agents) designed to mimic naturally occurring miRNAs. In addition,
miRNAs have evolved to modulate the expression of groups of genes,
driving both up and down regulation (in certain instances,
performing both functions concurrently within a cell with a single
miRNA acting promiscuously upon multiple target RNAs), with the
result that complex cell functions can be precisely modulated. Such
replacement of naturally occurring miRNAs can involve introducing
synthetic miRNAs or miRNA mimetics (e.g., certain DsiRNAmms) into
diseased tissues in an effort to restore normal proliferation,
apoptosis, cell cycle, and other cellular functions that have been
affected by down-regulation of one or more miRNAs. In certain
instances, reactivation of these miRNA-regulated pathways has
produced a significant therapeutic response (e.g., In one study on
cardiac hypertrophy, overexpression of miR-133 by
adenovirus-mediated delivery of a miRNA expression cassette
protected animals from agonist-induced cardiac hypertrophy, whereas
reciprocally reduction of miR-133 in wild-type mice by antagomirs
caused an increase in hypertrophic markers (Care et al. Nat. Med.
13: 613-618)).
[0269] To date, more than 600 miRNAs have been identified as
encoded within the human genome, with such miRNAs expressed and
processed by a combination of proteins in the nucleus and
cytoplasm. miRNAs are highly conserved among vertebrates and
comprise approximately 2% of all mammalian genes. Since each miRNA
appears to regulate the expression of multiple, e.g., two, three,
four, five, six, seven, eight, nine or even tens to hundreds of
different genes, miRNAs can function as "master-switches",
efficiently regulating and coordinating multiple cellular pathways
and processes. By coordinating the expression of multiple genes,
miRNAs play key roles in embryonic development, immunity,
inflammation, as well as cellular growth and proliferation.
[0270] Expression and functional studies suggest that the altered
expression of specific miRNAs is critical to a variety of human
diseases. Mounting evidence indicates that the introduction of
specific miRNAs into disease cells and tissues can induce favorable
therapeutic responses (Pappas et al. Expert Opin Ther Targets. 12:
115-27). The promise of miRNA therapy is perhaps greatest in cancer
due to the apparent role of certain miRNAs as tumor suppressors.
The rationale for miRNA-based therapeutics for, e.g., cancer is
supported, at least in part, by the following observations: [0271]
(1) miRNAs are frequently mis-regulated and expressed at altered
levels in diseased tissues when compared to normal tissues. A
number of studies have shown altered levels of miRNAs in cancerous
tissues relative to their corresponding normal tissues. Often,
altered expression is the consequence of genetic mutations that
lead to increased or reduced expression of particular miRNAs.
Diseases that possess unique miRNA expression signatures can be
exploited as diagnostic and prognostic markers, and can be targeted
with the DsiRNA (e.g., DsiRNAmm) agents of the invention. [0272]
(2) Mis-regulated miRNAs contribute to cancer development by
functioning as oncogenes or tumor suppressors. Oncogenes are
defined as genes whose over-expression or inappropriate activation
leads to oncogenesis. Tumor suppressors are genes that are required
to keep cells from being cancerous; the down-regulation or
inactivation of tumor suppressors is a common inducer of cancer.
Both types of genes represent preferred drug targets, as such
targeting can specifically act upon the molecular basis for a
particular cancer. Examples of oncogenic miRNAs are miR-155 and
miR-17-92: let-7 is an example of a tumor suppressive miRNA. [0273]
(3) Administration of miRNA induces a therapeutic response by
blocking or reducing tumor growth in pre-clinical animal studies.
The scientific literature provides proof-of-concept studies
demonstrating that restoring miRNA function can prevent or reduce
the growth of cancer cells in vitro and also in animal models. A
well-characterized example is the anti-tumor activity of let-7 in
models for breast and lung cancer. DsiRNAs (e.g., DsiRNAmms) of the
invention which are designed to mimic let-7 can be used to target
such cancers, and it is also possible to use the DsiRNA design
parameters described herein to generate new DsiRNA (e.g., DsiRNAmm)
agents directed against target RNAs for which no counterpart
naturally occurring miRNA is known (e.g., repeats within Notch or
other transcripts), to screen for therapeutic lead compounds, e.g.
agents that are capable of reducing tumor burden in pre-clinical
animal models. [0274] (4) A given miRNA controls multiple cellular
pathways and therefore may have superior therapeutic activity.
Based on their biology, miRNAs can function as "master switches" of
the genome, regulating multiple gene products and coordinating
multiple pathways. Genes regulated by miRNAs include genes that
encode conventional oncogenes and tumor suppressors, many of which
are individually pursued as drug targets by the pharmaceutical
industry. Thus, miRNA therapeutics could possess activity superior
to siRNAs and other forms of lead compounds by targeting multiple
disease and/or cancer-associated genes. Given the observation that
mis-regulation of miRNAs is frequently an early event in the
process of tumorigenesis, miRNA therapeutics, which replace missing
miRNAs, may be the most appropriate therapy. [0275] (5) miRNAs are
natural molecules and are therefore less prone to induce
non-specific side-effects. Millions of years of evolution helped to
develop the regulatory network of miRNAs, fine-tuning the
interaction of miRNA with target messenger RNAs. Therefore, miRNAs
and miRNA derivatives (e.g., DsiRNAs designed to mimic naturally
occurring miRNAs) will have few if any sequence-specific
"off-target" effects when applied in the proper context.
[0276] The physical characteristics of siRNAs and miRNAs are
similar. Accordingly, technologies that are effective in delivering
siRNAs (e.g., DsiRNAs of the invention) are likewise effective in
delivering synthetic miRNAs (e.g., certain DsiRNAmms of the
invention).
Conjugation and Delivery of DsiRNA Agents
[0277] In certain embodiments, the present invention relates to a
method for treating a subject having or at risk of developing a
disease or disorder. In such embodiments, the DsiRNA can act as a
novel therapeutic agent for controlling the disease or disorder.
The method comprises administering a pharmaceutical composition of
the invention to the patient (e.g., human), such that the
expression, level and/or activity a target RNA is reduced. The
expression, level and/or activity of a polypeptide encoded by the
target RNA might also be reduced by a DsiRNA of the instant
invention.
[0278] In the treatment of a disease or disorder, the DsiRNA can be
brought into contact with the cells or tissue exhibiting or
associated with a disease or disorder. For example, DsiRNA
substantially identical to all or part of a target RNA sequence,
may be brought into contact with or introduced into a diseased,
disease-associated or infected cell, either in vivo or in vitro.
Similarly, DsiRNA substantially identical to all or part of a
target RNA sequence may administered directly to a subject having
or at risk of developing a disease or disorder.
[0279] Therapeutic use of the DsiRNA agents of the instant
invention can involve use of formulations of DsiRNA agents
comprising multiple different DsiRNA agent sequences. For example,
two or more, three or more, four or more, five or more, etc. of the
presently described agents can be combined to produce a formulation
that, e.g., targets multiple different regions of one or more
target RNA(s). A DsiRNA agent of the instant invention may also be
constructed such that either strand of the DsiRNA agent
independently targets two or more regions of a target RNA. Use of
multifunctional DsiRNA molecules that target more then one region
of a target nucleic acid molecule is expected to provide potent
inhibition of RNA levels and expression. For example, a single
multifunctional DsiRNA construct of the invention can target both
conserved and variable regions of a target nucleic acid molecule,
thereby allowing down regulation or inhibition of, e.g., different
strain variants of a virus, or splice variants encoded by a single
target gene.
[0280] A DsiRNA agent of the invention can be conjugated (e.g., at
its 5' or 3' terminus of its sense or antisense strand) or
unconjugated to another moiety (e.g. a non-nucleic acid moiety such
as a peptide), an organic compound (e.g., a dye, cholesterol, or
the like). Modifying DsiRNA agents in this way may improve cellular
uptake or enhance cellular targeting activities of the resulting
DsiRNA agent derivative as compared to the corresponding
unconjugated DsiRNA agent, are useful for tracing the DsiRNA agent
derivative in the cell, or improve the stability of the DsiRNA
agent derivative compared to the corresponding unconjugated DsiRNA
agent.
RNAi In Vitro Assay to Assess DsiRNA Activity
[0281] An in vitro assay that recapitulates RNAi in a cell-free
system can optionally be used to evaluate DsiRNA constructs. For
example, such an assay comprises a system described by Tuschl et
al., 1999, Genes and Development, 13, 3191-3197 and Zamore et al.,
2000, Cell, 101, 25-33, adapted for use with DsiRNA agents directed
against target RNA. A Drosophila extract derived from syncytial
blastoderm is used to reconstitute RNAi activity in vitro. Target
RNA is generated via in vitro transcription from an appropriate
plasmid using T7 RNA polymerase or via chemical synthesis. Sense
and antisense DsiRNA strands (for example 20 uM each) are annealed
by incubation in buffer (such as 100 mM potassium acetate, 30 mM
HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at
90.degree. C. followed by 1 hour at 37.degree. C., then diluted in
lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH
at pH 7.4, 2 mM magnesium acetate). Annealing can be monitored by
gel electrophoresis on an agarose gel in TBE buffer and stained
with ethidium bromide. The Drosophila lysate is prepared using zero
to two-hour-old embryos from Oregon R flies collected on yeasted
molasses agar that are dechorionated and lysed. The lysate is
centrifuged and the supernatant isolated. The assay comprises a
reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM
final concentration), and 10% [vol/vol] lysis buffer containing
DsiRNA (10 nM final concentration). The reaction mixture also
contains 10 mM creatine phosphate, 10 ug/ml creatine phosphokinase,
100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL
RNasin (Promega), and 100 uM of each amino acid. The final
concentration of potassium acetate is adjusted to 100 mM. The
reactions are pre-assembled on ice and preincubated at 25.degree.
C. for 10 minutes before adding RNA, then incubated at 25.degree.
C. for an additional 60 minutes. Reactions are quenched with 4
volumes of 1.25.times. Passive Lysis Buffer (Promega). Target RNA
cleavage is assayed by RT-PCR analysis or other methods known in
the art and are compared to control reactions in which DsiRNA is
omitted from the reaction.
[0282] Alternately, internally-labeled target RNA for the assay is
prepared by in vitro transcription in the presence of [alpha-32P]
CTP, passed over a G50 Sephadex column by spin chromatography and
used as target RNA without further purification. Optionally, target
RNA is 5'-32P-end labeled using T4 polynucleotide kinase enzyme.
Assays are performed as described above and target RNA and the
specific RNA cleavage products generated by RNAi are visualized on
an autoradiograph of a gel. The percentage of cleavage is
determined by PHOSPHOR IMAGER.RTM. (autoradiography) quantitation
of bands representing intact control RNA or RNA from control
reactions without DsiRNA and the cleavage products generated by the
assay.
Methods of Introducing Nucleic Acids, Vectors, and Host Cells
[0283] DsiRNA agents of the invention may be directly introduced
into a cell (i.e., intracellularly); or introduced extracellularly
into a cavity, interstitial space, into the circulation of an
organism, introduced orally, or may be introduced by bathing a cell
or organism in a solution containing the nucleic acid. Vascular or
extravascular circulation, the blood or lymph system, and the
cerebrospinal fluid are sites where the nucleic acid may be
introduced.
[0284] The DsiRNA agents of the invention can be introduced using
nucleic acid delivery methods known in art including injection of a
solution containing the nucleic acid, bombardment by particles
covered by the nucleic acid, soaking the cell or organism in a
solution of the nucleic acid, or electroporation of cell membranes
in the presence of the nucleic acid. Other methods known in the art
for introducing nucleic acids to cells may be used, such as
lipid-mediated carrier transport, chemical-mediated transport, and
cationic liposome transfection such as calcium phosphate, and the
like. The nucleic acid may be introduced along with other
components that perform one or more of the following activities:
enhance nucleic acid uptake by the cell or otherwise increase
inhibition of the target RNA.
[0285] A cell having a target RNA may be from the germ line or
somatic, totipotent or pluripotent, dividing or non-dividing,
parenchyma or epithelium, immortalized or transformed, or the like.
The cell may be a stem cell or a differentiated cell. Cell types
that are differentiated include adipocytes, fibroblasts, myocytes,
cardiomyocytes, endothelium, neurons, glia, blood cells,
megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils,
basophils, mast cells, leukocytes, granulocytes, keratinocytes,
chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of
the endocrine or exocrine glands.
[0286] Depending on the particular target RNA sequence and the dose
of DsiRNA agent material delivered, this process may provide
partial or complete loss of function for the target RNA. A
reduction or loss of RNA levels or expression (either RNA
expression or encoded polypeptide expression) in at least 50%, 60%,
70%, 80%, 90%, 95% or 99% or more of targeted cells is exemplary.
Inhibition of target RNA levels or expression refers to the absence
(or observable decrease) in the level of RNA or RNA-encoded
protein. Specificity refers to the ability to inhibit the target
RNA without manifest effects on other genes of the cell. The
consequences of inhibition can be confirmed by examination of the
outward properties of the cell or organism (as presented below in
the examples) or by biochemical techniques such as RNA solution
hybridization, nuclease protection, Northern hybridization, reverse
transcription, gene expression monitoring with a microarray,
antibody binding, enzyme linked immunosorbent assay (ELISA),
Western blotting, radioimmunoassay (RIA), other immunoassays, and
fluorescence activated cell analysis (FACS). Inhibition of target
RNA sequence(s) by the DsiRNA agents of the invention also can be
measured based upon the effect of administration of such DsiRNA
agents upon measurable phenotypes such as tumor size for cancer
treatment, viral load/titer for viral infectious diseases, etc.
either in vivo or in vitro. For viral infectious diseases,
reductions in viral load or titer can include reductions of, e.g.,
50%, 60%, 70%, 80%, 90%, 95% or 99% or more, and are often measured
in logarithmic terms, e.g., 10-fold, 100-fold, 1000-fold,
10.sup.5-fold, 10.sup.6-fold, 10.sup.7-fold reduction in viral load
or titer can be achieved via administration of the DsiRNA agents of
the invention to cells, a tissue, or a subject.
[0287] For RNA-mediated inhibition in a cell line or whole
organism, expression a reporter or drug resistance gene whose
protein product is easily assayed can be measured. Such reporter
genes include acetohydroxyacid synthase (AHAS), alkaline
phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase
(GUS), chloramphenicol acetyltransferase (CAT), green fluorescent
protein (GFP), horseradish peroxidase (HRP), luciferase (Luc),
nopaline synthase (NOS), octopine synthase (OCS), and derivatives
thereof. Multiple selectable markers are available that confer
resistance to ampicillin, bleomycin, chloramphenicol, gentarnycin,
hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin,
puromycin, and tetracyclin. Depending on the assay, quantitation of
the amount of gene expression allows one to determine a degree of
inhibition which is greater than 10%, 33%, 50%, 90%, 95% or 99% as
compared to a cell not treated according to the present
invention.
[0288] Lower doses of injected material and longer times after
administration of RNA silencing agent may result in inhibition in a
smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%,
or 95% of targeted cells). Quantitation of gene expression in a
cell may show similar amounts of inhibition at the level of
accumulation of target RNA or translation of target protein. As an
example, the efficiency of inhibition may be determined by
assessing the amount of gene product in the cell; RNA may be
detected with a hybridization probe having a nucleotide sequence
outside the region used for the inhibitory DsiRNA, or translated
polypeptide may be detected with an antibody raised against the
polypeptide sequence of that region.
[0289] The DsiRNA agent may be introduced in an amount which allows
delivery of at least one copy per cell. Higher doses (e.g., at
least 5, 10, 100, 500 or 1000 copies per cell) of material may
yield more effective inhibition; lower doses may also be useful for
specific applications.
RNA Interference Based Therapy
[0290] As is known, RNAi methods are applicable to a wide variety
of genes in a wide variety of organisms and the disclosed
compositions and methods can be utilized in each of these contexts.
Examples of genes which can be targeted by the disclosed
compositions and methods include endogenous genes which are genes
that are native to the cell or to genes that are not normally
native to the cell. Without limitation, these genes include
oncogenes, cytokine genes, idiotype (Id) protein genes, prion
genes, genes that expresses molecules that induce angiogenesis,
genes for adhesion molecules, cell surface receptors, proteins
involved in metastasis, proteases, apoptosis genes, cell cycle
control genes, genes that express EGF and the EGF receptor,
multi-drug resistance genes, such as the MDR1 gene.
[0291] More specifically, a target mRNA of the invention can
specify the amino acid sequence of a cellular protein (e.g., a
nuclear, cytoplasmic, transmembrane, or membrane-associated
protein). In another embodiment, the target mRNA of the invention
can specify the amino acid sequence of an extracellular protein
(e.g., an extracellular matrix protein or secreted protein). As
used herein, the phrase "specifies the amino acid sequence" of a
protein means that the mRNA sequence is translated into the amino
acid sequence according to the rules of the genetic code. The
following classes of proteins are listed for illustrative purposes:
developmental proteins (e.g., adhesion molecules, cyclin kinase
inhibitors, Wnt family members, Pax family members, Winged helix
family members, Hox family members, cytokines/lymphokines and their
receptors, growth/differentiation factors and their receptors,
neurotransmitters and their receptors); oncogene-encoded proteins
(e.g., ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB,
EBRB2, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK,
LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM I, PML, RET, SRC,
TALI, TCL3, and YES); tumor suppressor proteins (e.g., APC, BRCA1,
BRCA2, MADH4, MCC, NF I, NF2, RB I, TP53, and WTI); and enzymes
(e.g., ACC synthases and oxidases, ACP desaturases and
hydroxylases, ADP-glucose pyrophorylases, ATPases, alcohol
dehydrogenases, amylases, amyloglucosidases, catalases, cellulases,
chalcone synthases, chitinases, cyclooxygenases, decarboxylases,
dextriinases, DNA and RNA polymerases, galactosidases, glucanases,
glucose oxidases, granule-bound starch synthases, GTPases,
helicases, hernicellulases, integrases, inulinases, invertases,
isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes,
nopaline synthases, octopine synthases, pectinesterases,
peroxidases, phosphatases, phospholipases, phosphorylases,
phytases, plant growth regulator synthases, polygalacturonases,
proteinases and peptidases, pullanases, recombinases, reverse
transcriptases, RUBISCOs, topoisomerases, and xylanases).
[0292] In one aspect, the target mRNA molecule of the invention
specifies the amino acid sequence of a protein associated with a
pathological condition. For example, the protein may be a
pathogen-associated protein (e.g., a viral protein involved in
immunosuppression of the host, replication of the pathogen,
transmission of the pathogen, or maintenance of the infection), or
a host protein which facilitates entry of the pathogen into the
host, drug metabolism by the pathogen or host, replication or
integration of the pathogen's genome, establishment or spread of
infection in the host, or assembly of the next generation of
pathogen. Pathogens include RNA viruses such as flaviviruses,
picornaviruses, rhabdoviruses, filoviruses, retroviruses, including
lentiviruses, or DNA viruses such as adenoviruses, poxviruses,
herpes viruses, cytomegaloviruses, hepadnaviruses or others.
Additional pathogens include bacteria, fungi, helminths,
schistosomes and trypanosomes. Other kinds of pathogens can include
mammalian transposable elements. Alternatively, the protein may be
a tumor-associated protein or an autoimmune disease-associated
protein.
[0293] The target gene may be derived from or contained in any
organism. The organism may be a plant, animal, protozoa, bacterium,
virus or fungus. See e.g., U.S. Pat. No. 6,506,559, incorporated
herein by reference.
Pharmaceutical Compositions
[0294] In certain embodiments, the present invention provides for a
pharmaceutical composition comprising the DsiRNA agent of the
present invention. The DsiRNA agent sample can be suitably
formulated and introduced into the environment of the cell by any
means that allows for a sufficient portion of the sample to enter
the cell to induce gene silencing, if it is to occur. Many
formulations for dsNA are known in the art and can be used so long
as the dsNA gains entry to the target cells so that it can act.
See, e.g., U.S. published patent application Nos. 2004/0203145 A1
and 2005/0054598 A1. For example, the DsiRNA agent of the instant
invention can be formulated in buffer solutions such as phosphate
buffered saline solutions, liposomes, micellar structures, and
capsids. Formulations of DsiRNA agent with cationic lipids can be
used to facilitate transfection of the DsiRNA agent into cells. For
example, cationic lipids, such as lipofectin (U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (published PCT International
Application WO 97/30731), can be used. Suitable lipids include
Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme
Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche) all of
which can be used according to the manufacturer's instructions.
[0295] Such compositions typically include the nucleic acid
molecule and a pharmaceutically acceptable carrier. As used herein
the language "pharmaceutically acceptable carrier" includes saline,
solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic and absorption delaying agents, and the like,
compatible with pharmaceutical administration. Supplementary active
compounds can also be incorporated into the compositions.
[0296] A pharmaceutical composition is formulated to be compatible
with its intended route of administration. Examples of routes of
administration include parenteral, e.g., intravenous, intradermal,
subcutaneous, oral (e.g., inhalation), transdermal (topical),
transmucosal, and rectal administration. Solutions or suspensions
used for parenteral, intradermal, or subcutaneous application can
include the following components: a sterile diluent such as water
for injection, saline solution, fixed oils, polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as ascorbic acid or sodium bisulfite; chelating
agents such as ethylenediaminetetraacetic acid; buffers such as
acetates, citrates or phosphates and agents for the adjustment of
tonicity such as sodium chloride or dextrose. pH can be adjusted
with acids or bases, such as hydrochloric acid or sodium hydroxide.
The parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic.
[0297] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It should be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0298] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle, which contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, the preferred methods of preparation
are vacuum drying and freeze-drying which yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0299] Oral compositions generally include an inert diluent or an
edible carrier. For the purpose of oral therapeutic administration,
the active compound can be incorporated with excipients and used in
the form of tablets, troches, or capsules, e.g., gelatin capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash. Pharmaceutically compatible binding agents,
and/or adjuvant materials can be included as part of the
composition. The tablets, pills, capsules, troches and the like can
contain any of the following ingredients, or compounds of a similar
nature: a binder such as microcrystalline cellulose, gum tragacanth
or gelatin; an excipient such as starch or lactose, a
disintegrating agent such as alginic acid, Primogel, or corn
starch; a lubricant such as magnesium stearate or Sterotes; a
glidant such as colloidal silicon dioxide; a sweetening agent such
as sucrose or saccharin; or a flavoring agent such as peppermint,
methyl salicylate, or orange flavoring.
[0300] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer. Such methods include those
described in U.S. Pat. No. 6,468,798.
[0301] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0302] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0303] The compounds can also be administered by transfection or
infection using methods known in the art, including but not limited
to the methods described in McCaffrey et al. (2002), Nature,
418(6893), 38-9 (hydrodynamic transfection); Xia et al. (2002),
Nature Biotechnol., 20(10), 1006-10 (viral-mediated delivery); or
Putnam (1996), Am. J. Health Syst. Pharm. 53(2), 151-160, erratum
at Am. J. Health Syst. Pharm. 53(3), 325 (1996).
[0304] The compounds can also be administered by any method
suitable for administration of nucleic acid agents, such as a DNA
vaccine. These methods include gene guns, bio injectors, and skin
patches as well as needle-free methods such as the micro-particle
DNA vaccine technology disclosed in U.S. Pat. No. 6,194,389, and
the mammalian transdermal needle-free vaccination with powder-form
vaccine as disclosed in U.S. Pat. No. 6,168,587. Additionally,
intranasal delivery is possible, as described in, inter alia,
Hamajima et al. (1998), Clin. Immunol. Immunopathol., 88(2),
205-10. Liposomes (e.g., as described in U.S. Pat. No. 6,472,375)
and microencapsulation can also be used. Biodegradable targetable
microparticle delivery systems can also be used (e.g., as described
in U.S. Pat. No. 6,471,996).
[0305] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Such formulations can be prepared using standard
techniques. The materials can also be obtained commercially from
Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal
suspensions (including liposomes targeted to infected cells with
monoclonal antibodies to viral antigens) can also be used as
pharmaceutically acceptable carriers. These can be prepared
according to methods known to those skilled in the art, for
example, as described in U.S. Pat. No. 4,522,811.
[0306] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD.sub.50 (the
dose lethal to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds
which exhibit high therapeutic indices are preferred. While
compounds that exhibit toxic side effects may be used, care should
be taken to design a delivery system that targets such compounds to
the site of affected tissue in order to minimize potential damage
to uninfected cells and, thereby, reduce side effects.
[0307] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED.sub.50 with
little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any compound used in the method of the
invention, the therapeutically effective dose can be estimated
initially from cell culture assays. A dose may be formulated in
animal models to achieve a circulating plasma concentration range
that includes the IC.sub.50 (i.e., the concentration of the test
compound which achieves a half-maximal inhibition of symptoms) as
determined in cell culture. Such information can be used to more
accurately determine useful doses in humans. Levels in plasma may
be measured, for example, by high performance liquid
chromatography.
[0308] As defined herein, a therapeutically effective amount of a
nucleic acid molecule (i.e., an effective dosage) depends on the
nucleic acid selected. For instance, if a plasmid encoding a DsiRNA
agent is selected, single dose amounts in the range of
approximately 1 pg to 1000 mg may be administered; in some
embodiments, 10, 30, 100, or 1000 pg, or 10, 30, 100, or 1000 ng,
or 10, 30, 100, or 1000 .mu.g, or 10, 30, 100, or 1000 mg may be
administered. In some embodiments, 1-5 g of the compositions can be
administered. The compositions can be administered from one or more
times per day to one or more times per week; including once every
other day. The skilled artisan will appreciate that certain factors
may influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the disease
or disorder, previous treatments, the general health and/or age of
the subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of a protein,
polypeptide, or antibody can include a single treatment or,
preferably, can include a series of treatments.
[0309] It can be appreciated that the method of introducing DsiRNA
agents into the environment of the cell will depend on the type of
cell and the make up of its environment. For example, when the
cells are found within a liquid, one preferable formulation is with
a lipid formulation such as in lipofectamine and the DsiRNA agents
can be added directly to the liquid environment of the cells. Lipid
formulations can also be administered to animals such as by
intravenous, intramuscular, or intraperitoneal injection, or orally
or by inhalation or other methods as are known in the art. When the
formulation is suitable for administration into animals such as
mammals and more specifically humans, the formulation is also
pharmaceutically acceptable. Pharmaceutically acceptable
formulations for administering oligonucleotides are known and can
be used. In some instances, it may be preferable to formulate
DsiRNA agents in a buffer or saline solution and directly inject
the formulated DsiRNA agents into cells, as in studies with
oocytes. The direct injection of DsiRNA agents duplexes may also be
done. For suitable methods of introducing dsNA (e.g., DsiRNA
agents), see U.S. published patent application No. 2004/0203145
A1.
[0310] Suitable amounts of a DsiRNA agent must be introduced and
these amounts can be empirically determined using standard methods.
Typically, effective concentrations of individual DsiRNA agent
species in the environment of a cell will be about 50 nanomolar or
less, 10 nanomolar or less, or compositions in which concentrations
of about 1 nanomolar or less can be used. In another embodiment,
methods utilizing a concentration of about 200 picomolar or less,
and even a concentration of about 50 picomolar or less, about 20
picomolar or less, about 10 picomolar or less, or about 5 picomolar
or less can be used in many circumstances.
[0311] The method can be carried out by addition of the DsiRNA
agent compositions to any extracellular matrix in which cells can
live provided that the DsiRNA agent composition is formulated so
that a sufficient amount of the DsiRNA agent can enter the cell to
exert its effect. For example, the method is amenable for use with
cells present in a liquid such as a liquid culture or cell growth
media, in tissue explants, or in whole organisms, including
animals, such as mammals and especially humans.
[0312] The level or activity of a target RNA can be determined by
any suitable method now known in the art or that is later
developed. It can be appreciated that the method used to measure a
target RNA and/or the expression of a target RNA can depend upon
the nature of the target RNA. For example, if the target RNA
encodes a protein, the term "expression" can refer to a protein or
the RNA/transcript derived from the target RNA. In such instances,
the expression of a target RNA can be determined by measuring the
amount of RNA corresponding to the target RNA or by measuring the
amount of that protein. Protein can be measured in protein assays
such as by staining or immunoblotting or, if the protein catalyzes
a reaction that can be measured, by measuring reaction rates. All
such methods are known in the art and can be used. Where target RNA
levels are to be measured, any art-recognized methods for detecting
RNA levels can be used (e.g., RT-PCR, Northern Blotting, etc.). In
targeting viral RNAs with the DsiRNA agents of the instant
invention, it is also anticipated that measurement of the efficacy
of a DsiRNA agent in reducing levels of a target virus in a
subject, tissue, in cells, either in vitro or in vivo, or in cell
extracts can also be used to determine the extent of reduction of
target viral RNA level(s). Any of the above measurements can be
made on cells, cell extracts, tissues, tissue extracts or any other
suitable source material.
[0313] The determination of whether the expression of a target RNA
has been reduced can be by any suitable method that can reliably
detect changes in RNA levels. Typically, the determination is made
by introducing into the environment of a cell undigested DsiRNA
such that at least a portion of that DsiRNA agent enters the
cytoplasm, and then measuring the level of the target RNA. The same
measurement is made on identical untreated cells and the results
obtained from each measurement are compared.
[0314] The DsiRNA agent can be formulated as a pharmaceutical
composition which comprises a pharmacologically effective amount of
a DsiRNA agent and pharmaceutically acceptable carrier. A
pharmacologically or therapeutically effective amount refers to
that amount of a DsiRNA agent effective to produce the intended
pharmacological, therapeutic or preventive result. The phrases
"pharmacologically effective amount" and "therapeutically effective
amount" or simply "effective amount" refer to that amount of an RNA
effective to produce the intended pharmacological, therapeutic or
preventive result. For example, if a given clinical treatment is
considered effective when there is at least a 20% reduction in a
measurable parameter associated with a disease or disorder, a
therapeutically effective amount of a drug for the treatment of
that disease or disorder is the amount necessary to effect at least
a 20% reduction in that parameter.
[0315] Suitably formulated pharmaceutical compositions of this
invention can be administered by any means known in the art such as
by parenteral routes, including intravenous, intramuscular,
intraperitoneal, subcutaneous, transdermal, airway (aerosol),
rectal, vaginal and topical (including buccal and sublingual)
administration. In some embodiments, the pharmaceutical
compositions are administered by intravenous or intraparenteral
infusion or injection.
[0316] In general, a suitable dosage unit of dsNA will be in the
range of 0.001 to 0.25 milligrams per kilogram body weight of the
recipient per day, or in the range of 0.01 to 20 micrograms per
kilogram body weight per day, or in the range of 0.01 to 10
micrograms per kilogram body weight per day, or in the range of
0.10 to 5 micrograms per kilogram body weight per day, or in the
range of 0.1 to 2.5 micrograms per kilogram body weight per day.
Pharmaceutical composition comprising the dsNA can be administered
once daily. However, the therapeutic agent may also be dosed in
dosage units containing two, three, four, five, six or more
sub-doses administered at appropriate intervals throughout the day.
In that case, the dsNA contained in each sub-dose must be
correspondingly smaller in order to achieve the total daily dosage
unit. The dosage unit can also be compounded for a single dose over
several days, e.g., using a conventional sustained release
formulation which provides sustained and consistent release of the
dsNA over a several day period. Sustained release formulations are
well known in the art. In this embodiment, the dosage unit contains
a corresponding multiple of the daily dose. Regardless of the
formulation, the pharmaceutical composition must contain dsNA in a
quantity sufficient to inhibit expression of the target gene in the
animal or human being treated. The composition can be compounded in
such a way that the sum of the multiple units of dsNA together
contain a sufficient dose.
[0317] Data can be obtained from cell culture assays and animal
studies to formulate a suitable dosage range for humans. The dosage
of compositions of the invention lies within a range of circulating
concentrations that include the ED.sub.50 (as determined by known
methods) with little or no toxicity. The dosage may vary within
this range depending upon the dosage form employed and the route of
administration utilized. For any compound used in the method of the
invention, the therapeutically effective dose can be estimated
initially from cell culture assays. A dose may be formulated in
animal models to achieve a circulating plasma concentration range
of the compound that includes the IC.sub.50 (i.e., the
concentration of the test compound which achieves a half-maximal
inhibition of symptoms) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels of dsNA in plasma may be measured by standard
methods, for example, by high performance liquid
chromatography.
[0318] The pharmaceutical compositions can be included in a kit,
container, pack, or dispenser together with instructions for
administration.
Methods of Treatment
[0319] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disease or disorder caused, in whole or in part,
by the expression of a target RNA and/or the presence of such
target RNA (e.g., in the context of a viral infection, the presence
of a target RNA of the viral genome, capsid, host cell component,
etc.).
[0320] "Treatment", or "treating" as used herein, is defined as the
application or administration of a therapeutic agent (e.g., a
DsiRNA agent or vector or transgene encoding same) to a patient, or
application or administration of a therapeutic agent to an isolated
tissue or cell line from a patient, who has the disease or
disorder, a symptom of disease or disorder or a predisposition
toward a disease or disorder, with the purpose to cure, heal,
alleviate, relieve, alter, remedy, ameliorate, improve or affect
the disease or disorder, the symptoms of the disease or disorder,
or the predisposition toward disease.
[0321] In one aspect, the invention provides a method for
preventing in a subject, a disease or disorder as described above,
by administering to the subject a therapeutic agent (e.g., a DsiRNA
agent or vector or transgene encoding same). Subjects at risk for
the disease can be identified by, for example, any or a combination
of diagnostic or prognostic assays as described herein.
Administration of a prophylactic agent can occur prior to the
detection of, e.g., viral particles in a subject, or the
manifestation of symptoms characteristic of the disease or
disorder, such that the disease or disorder is prevented or,
alternatively, delayed in its progression.
[0322] Another aspect of the invention pertains to methods of
treating subjects therapeutically, i.e., alter onset of symptoms of
the disease or disorder. These methods can be performed in vitro
(e.g., by culturing the cell with the DsiRNA agent) or,
alternatively, in vivo (e.g., by administering the DsiRNA agent to
a subject).
[0323] With regards to both prophylactic and therapeutic methods of
treatment, such treatments may be specifically tailored or
modified, based on knowledge obtained from the field of
pharmacogenomics. "Pharmacogenomics", as used herein, refers to the
application of genomics technologies such as gene sequencing,
statistical genetics, and gene expression analysis to drugs in
clinical development and on the market. More specifically, the term
refers the study of how a patient's genes determine his or her
response to a drug (e.g., a patient's "drug response phenotype", or
"drug response genotype"). Thus, another aspect of the invention
provides methods for tailoring an individual's prophylactic or
therapeutic treatment with either the target RNA molecules of the
present invention or target RNA modulators according to that
individual's drug response genotype. Pharmacogenomics allows a
clinician or physician to target prophylactic or therapeutic
treatments to patients who will most benefit from the treatment and
to avoid treatment of patients who will experience toxic
drug-related side effects.
[0324] Therapeutic agents can be tested in an appropriate animal
model. For example, a DsiRNA agent (or expression vector or
transgene encoding same) as described herein can be used in an
animal model to determine the efficacy, toxicity, or side effects
of treatment with said agent. Alternatively, a therapeutic agent
can be used in an animal model to determine the mechanism of action
of such an agent. For example, an agent can be used in an animal
model to determine the efficacy, toxicity, or side effects of
treatment with such an agent. Alternatively, an agent can be used
in an animal model to determine the mechanism of action of such an
agent.
[0325] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA, genetics,
immunology, cell biology, cell culture and transgenic biology,
which are within the skill of the art. See, e.g., Maniatis et al.,
1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd
Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel
et al., 1992), Current Protocols in Molecular Biology (John Wiley
& Sons, including periodic updates); Glover, 1985, DNA Cloning
(IRL Press, Oxford); Anand, 1992; Guthrie and Fink, 1991; Harlow
and Lane, 1988, Antibodies. (Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.); Jakoby and Pastan, 1979; Nucleic Acid
Hybridization (B. D. Hames & S. J. Higgins eds. 1984);
Transcription And Translation (B. D. Hames & S. J. Higgins eds.
1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc.,
1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal,
A Practical Guide To Molecular Cloning (1984); the treatise,
Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer
Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds.,
1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols.
154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And
Molecular Biology (Mayer and Walker, eds., Academic Press, London,
1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M.
Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology,
6th Edition, Blackwell Scientific Publications, Oxford, 1988; Hogan
et al., Manipulating the Mouse Embryo, (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1986); Westerfield, M.,
The zebrafish book. A guide for the laboratory use of zebrafish
(Danio rerio), (4th Ed., Univ. of Oregon Press, Eugene, 2000).
[0326] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. All
publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety.
In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and not intended to be limiting.
EXAMPLES
[0327] The present invention is described by reference to the
following Examples, which are offered by way of illustration and
are not intended to limit the invention in any manner. Standard
techniques well known in the art or the techniques specifically
described below were utilized.
Example 1
Methods
Oligonucleotide Synthesis, In Vitro Use
[0328] Individual RNA strands were synthesized and HPLC purified
according to standard methods (Integrated DNA Technologies,
Coralville, Iowa). All oligonucleotides were quality control
released on the basis of chemical purity by HPLC analysis and full
length strand purity by mass spectrometry analysis. Duplex RNA
DsiRNAs were prepared before use by mixing equal quantities of each
strand, briefly heating to 100.degree. C. in RNA buffer (IDT) and
then allowing the mixtures to cool to room temperature.
Oligonucleotide Synthesis, In Vivo Use
[0329] Individual RNA strands were synthesized and HPLC purified
according to standard methods (OligoFactory, Holliston, Mass.). All
oligonucleotides were quality control released on the basis of
chemical purity by HPLC analysis and full length strand purity by
mass spectrometry analysis. Duplex RNA DsiRNAs were prepared before
use by mixing equimolar quantities of each strand, briefly heating
to 100.degree. C. in RNA buffer (IDT) and then allowing the
mixtures to cool to room temperature.
Cell Culture and RNA Transfection
[0330] HeLa cells were obtained from ATCC and maintained in
Dulbecco's modified Eagle medium (HyClone) supplemented with 10%
fetal bovine serum (HyClone) at 37.degree. C. under 5% CO.sub.2.
For RNA transfections of FIG. 2, HeLa cells were seeded overnight
in 6-well plates at a density of 4.times.10.sup.5 cells/well in a
final volume of 2 mL. 24 hours later, cells were transfected with
the DsiRNA duplexes as specified at a final concentration of 20 nM
using Oligofectamine.TM. (Invitrogen) and following the
manufacturer's instructions. Briefly, 8 .mu.L of a 5 .mu.M stock
solution of each DsiRNA was mixed with 200 .mu.L of Opti-MEM.RTM. I
(Invitrogen). In a separate tube, 12 .mu.L of Oligofectamine.TM.
was mixed with 48 .mu.L of Opti-MEM.RTM. I. After a 5 minute
incubation at room temperature (RT) the DsiRNA and
Oligofectamine.TM. aliquots were combined, gently vortexed, and
further incubated for 20 minutes at RT to allow
DsiRNA:Oligofectamine.TM. complexes (transfection mixes) to form.
Finally, culture medium was added to bring each transfection mix to
a final volume of 2 mL. After a 6 hour incubation, the
transfection/culture medium in each well was replaced with fresh
culture medium and cells were incubated for an additional 18
hours.
[0331] For RNA transfections of FIGS. 3-5, HeLa cells were
transfected with DsiRNAs as indicated at a final concentration of
0.1 nM using Lipofectamine.TM. RNAiMAX (Invitrogen) and following
manufacturer's instructions. Briefly, 2.5 .mu.L of a 0.02 .mu.M
stock solution of each DsiRNA were mix with 46.5 .mu.L of Opti-MEM
I (Invitrogen) and 1 .mu.L of Lipofectamine.TM. RNAiMAX. The
resulting 50 .mu.L mix was added into individual wells of 12 well
plates and incubated for 20 min at RT to allow
DsiRNA:Lipofectamine.TM. RNAiMAX complexes to form. Meanwhile, HeLa
cells were trypsinized and resuspended in medium at a final
concentration of 367 cells/.mu.L. Finally, 450 .mu.L of the cell
suspension were added to each well (final volume 500 .mu.L) and
plates were placed into the incubator for 24 hours.
RNA Isolation and Analysis, In Vitro Examples
[0332] Cells were washed once with 2 mL of PBS, and total RNA was
extracted using RNeasy Mini Kit.TM. (Qiagen) and eluted in a final
volume of 30 .mu.L. 1 .mu.g of total RNA was reverse-transcribed
using Transcriptor 1.sup.st Strand cDNA Kit.TM. (Roche) and random
hexamers following manufacturer's instructions. One-thirtieth (0.66
.mu.L) of the resulting cDNA was mixed with 5 .mu.L of iQ.TM.
Multiplex Powermix (Bio-Rad) together with 3.33 .mu.L of H.sub.2O
and 1 .mu.L of a 3 .mu.M mix containing 2 sets of primers and
probes specific for human genes HPRT-1 (accession number
NM.sub.--000194) and SFRS9 (accession number NM.sub.--003769)
genes:
TABLE-US-00039 Hu HPRT forward primer F517 GACTTTGCTTTCCTTGGTCAG Hu
HPRT reverse primer R591 GGCTTATATCCAACACTTCGTGGG Hu HPRT probe
P554 Cy5-ATGGTCAAGGTCGCAAGCTTGCTGGT-IBFQ Hu SFRS9 forward primer
F569 TGTGCAGAAGGATGGAGT Hu SFRS9 reverse primer R712
CTGGTGCTTCTCTCAGGATA Hu SFRS9 probe P644
HEX-TGGAATATGCCCTGCGTAAACTGGA-IBFQ
In Vivo Sample Preparation and Injection
[0333] DsiRNA was formulated in Invivofectamine.TM. according to
manufacturer's protocol (Invitrogen, Carlsbad, Calif.). Briefly,
the N/group of mice and body weight of the mice used were
determined, then amount of DsiRNA needed for each group of mice
treated was calculated. One ml IVF-oligo was enough for 4 mice of
25 g/mouse at 10 mg/kg dosage. One mg DsiRNA was added to one ml
Invivofectamine.TM., and mixed at RT for 30 min on a rotator. 14 ml
of 5% glucose was used to dilute formulated IVF-DsiRNA and applied
to 50 kDa molecular weight cutoff spin concentrators (Amicon). The
spin concentrators were spun at 4000 rpm for .about.2 hours at 4 C
until the volume of IVF-DsiRNA was brought down to less than 1 ml.
Recovered IVF-DsiRNA was diluted to one ml with 5% glucose and
readied for animal injection.
Animal Injection and Tissue Harvesting
[0334] Animals were subjected to surgical anesthesia by i.p.
injection with Ketamine/Xylazine. Each mouse was weighed before
injection. Formulated IVF-DsiRNA was injected i.v. at 100 ul/10 g
of body weight. After 24 hours, mice were sacrificed by CO.sub.2
inhalation. Tissues for analysis were collected and placed in tubes
containing 2 ml RNAlater.TM. (Qiagen) and rotated at RT for 30 min
before incubation at 4.degree. C. overnight. The tissues were
stored subsequently at -80.degree. C. until use.
Tissue RNA Preparation and Quantitation
[0335] About 50-100 mg of tissue pieces were homogenized in 1 ml
QIAzol.TM. (Qiagen) on Tissue Lyser.TM. (Qiagen). Then total RNA
were isolated according to the manufacturer's protocol. Briefly,
0.2 ml Chloroform (Sigma-Aldrich) was added to the QIAzol.TM.
lysates and mixed vigorously by vortexing. After spinning at 14,000
rpm for 15 min at 4.degree. C., aqueous phase was collected and
mixed with 0.5 ml of isopropanol. After another centrifugation at
14,000 rpm for 10 min, the RNA pellet was washed once with 75%
ethanol and briefly dried. The isolated RNA was resuspended in 100
ul RNase-Free water, and subjected to clean up with RNeasy.TM.
total RNA preparation kit (Qiagen) or SV 96 total RNA Isolation
System (Promega) according to manufacturer's protocol.
First Strand cDNA Synthesis, In Vivo Examples
[0336] 1 .mu.g of total RNA was reverse-transcribed using
Transcriptor 1.sup.st Strand cDNA Kit.TM. (Roche) and oligo-dT
following manufacturer's instructions. One-fortieth (0.66 .mu.L) of
the resulting cDNA was mixed with 5 .mu.L of IQ Multiplex Powermix
(Bio-Rad) together with 3.33 .mu.L of H.sub.2O and 1 .mu.L of a 3
.mu.M mix containing 2 sets of primers and probes specific for
mouse genes HPRT-1 (accession number NM.sub.--013556) and KRAS
(accession number NM.sub.--021284) genes:
TABLE-US-00040 Mm HPRT forward primer F576 CAAACTTTGCTTTCCCTGGT Mm
HPRT reverse primer R664 CAACAAAGTCTGGCCTGTATC Mm HPRT probe P616
Cy5-TGGTTAAGGTTGCAAGCTTGCTGGTG-IBFQ Mm KRAS forward primer F275
CTTTGTGGATGAGTACGACC Mm KRAS reverse primer R390
CACTGTACTCCTCTTGACCT Mm KRAS probe P297
FAM-ACGATAGAGGACTCCTACAGGAAACAAGT-IBFQ
Quantitative RT-PCR
[0337] A CFX96 Real-time System with a C1000 Thermal cycler
(Bio-Rad) was used for the amplification reactions. PCR conditions
were: 95.degree. C. for 3 min; and then cycling at 95.degree. C.,
10 sec; 55.degree. C., 1 min for 40 cycles. Each sample was tested
in triplicate. For HPRT Examples, relative HPRT mRNA levels were
normalized to SFRS9 mRNA levels and compared with mRNA levels
obtained in control samples treated with the transfection reagent
plus a control mismatch duplex, or untreated. For KRAS examples,
relative KRAS mRNA levels were normalized to HPRT-1 mRNA levels and
compared with mRNA levels obtained in control samples from mice
treated with 5% glucose. Data were analyzed using Bio-Rad CFX
Manager version 1.0 (in vitro Examples) or 1.5 (in vivo Example)
software.
Example 2
Efficacy of DsiRNA Agents Possessing DNA Duplex Extensions
[0338] DsiRNA agents possessing DNA duplex extensions were examined
for efficacy of sequence-specific target mRNA inhibition.
Specifically, HPRT-targeting DsiRNA duplexes possessing
RNA-extended, DNA-extended or mixed DNA- and RNA-extended
structures were transfected into HeLa cells at a fixed
concentration of 20 nM and HPRT expression levels were measured 24
hours later (FIGS. 2A and 2B). Transfections were performed in
duplicate, and each duplicate was assayed in triplicate for HPRT
expression by qPCR. Under these conditions (20 nM duplexes,
Oligofectamine transfection), HPRT gene expression was reduced by
30-50% by duplexes 1 through 6. Duplex 6 contained DNA
substitutions which formed a 10 bp (base pair) region starting at
the 5' end of the guide (antisense) strand and gave a final length
configuration of 33/35mer. Duplex 7 was identical in length and
sequence to duplex 6, but contained only 4 DNA nucleoside
modifications in the positions indicated in FIG. 2B. Surprisingly,
duplex 7 reduced HPRT expression significantly less than duplex 6,
suggesting that Dicer recognizes the extended RNA region between
the DNA bases and cleaves the duplex into alternate species of
siRNAs. It was also observed that phosphorothioate modification of
DNA:DNA-extended regions of DsiRNA (duplex 8) was capable of
abolishing the RNA inhibitory activity of DNA-extended DsiRNA
agents. It is likely that activity of the duplex 8 agent can be
restored by sufficient substitution of PS-DNA moieties with
unmodified DNA moieties. Indeed, such "add-back" of unmodified DNA
residues to such a duplex underscores an advantage of the
invention--the agents of the invention can be made to carry more
modifications than non-extended agents while still retaining RNA
inhibitory activity, which is an important development in view of
the issues that presence of tandem and/or tightly-spaced modified
residues can cause (here, complete abolishment of RNA inhibitory
activity when tandem, base paired PS-DNAs are present in duplex
8).
Example 3
Dose-Response Comparison of 27/29Mer Duplexes
[0339] To test the efficacy of a DNA duplex-extended DsiRNA at
reduced concentrations, a modified duplex targeting HPRT was
compared to an optimized 27/29mer duplex in a dose response series
of experiments at 10.0 nanomolar (nM), 1.0 nanomolar (nM) and 100
picomolar (100 pM or 0.1 nM) concentrations for knockdown of HPRT
mRNA levels in HeLa cells. Duplex DsiRNA 1 was a derivative of a
25/27mer DsiRNA duplex previously reported as active (HPRT-1, Rose
et al. NAR 2005, Collingwood et al. 2008); however, the present
duplex (#1) contained an insertion of two bases in each strand that
extended the oligonucleotide duplex to a 27/29mer. Duplex 2 was
identical in sequence to duplex 1, but the two base pair insertion
and two additional nucleosides of the guide strand (antisense
sequence) were synthesized as DNA. Thus, duplex 2 terminated in 4
DNA bp (base pairs) at the 5' end of the guide strand, in contrast
to previously reported two base DNA substitutions at the 3' end of
the passenger (sense) strand (Rose et al, 2005). Duplex 3 (MM
control) was derived from the optimized HPRT-1 duplex, but
synthesized with mismatches in relation to the target RNA sequence.
The base composition and chemical modification of each strand and
the base sequences and overhang or blunt structure at the ends of
duplex 3 were held constant relative to the optimized HPRT-1 duplex
in order to control for non-targeted chemical effects (see FIG. 5).
Baseline HPRT expression in untreated cells was also measured ("C"
of FIG. 3A).
[0340] Putative Dicer processing products of duplexes 1 and 2 were
identical (see FIG. 1A) to one another, and to the Dicer processing
products of duplexes shown in FIG. 2B. At 10 nM and 1 nM
transfection concentrations, both duplexes 1 and 2 reduced HPRT RNA
levels by at least 95%, suggesting that the addition of the
double-stranded DNA at the end of Duplex 2 did not interfere with
Dicer binding and processing of the duplex into a structure
competent to load and direct RISC activity against HPRT mRNA. At
100 pM, duplex 2 reduced HPRT expression by 90% and appeared more
than 2-fold more active than duplex 1, which reduced HPRT by
approximately 75%.
Example 4
Comparison of Duplexes Extended by Two, Six and Eight DNA Base
Pairs
[0341] To investigate the length of double stranded DNA extension
that might be introduced into a DsiRNA agent while still enhancing
efficacy and/or duration of effect of such a DNA duplex-extended
DsiRNA in comparison to a DsiRNA agent having a corresponding
length of extended double stranded RNA, a series of double stranded
nucleic acids were generated and tested with two base pair, six
base pair and eight base pair extensions (the nominal length of
such extensions also includes penultimate and ultimate
deoxyribonucleotide residues of the 3' terminus of the sense strand
that base pair with cognate deoxyribonucleotide residues of the 5'
terminus of the antisense strand, resulting in the "DNA 4 bp"
duplex #4, the "DNA 8 bp" duplex #5 and the "DNA 10 bp" duplex #6
of FIGS. 4A-4D). Inhibition of gene expression by duplex 3, a
33/35mer comprising an extension comprising a two base pair DNA:RNA
double stranded region and a six base pair RNA:RNA double stranded
region (see FIGS. 4A-4D) was reduced relative to duplex 1 (a
27/29mer having a two base pair RNA:RNA double stranded extension)
and duplex 2 (a 31/33mer having a six base pair RNA:RNA double
stranded extension), consistent with previous reports that
increasing RNA duplex length lowered RNAi activity. Notably,
RNA:RNA-extended duplexes 1, 2 and 3 all showed reduced activity
relative to corresponding duplexes 4, 5, and 6, which possessed
double stranded DNA:DNA extensions. The greatest difference in
activity between the RNA insert/DNA series and the DNA series was
observed at 100 pM, but was still detectable at 10 pM (FIGS. 4B and
4C).
[0342] The duplexes compared in FIG. 4 were designed to 1) enhance
negative effects of promiscuous processing of Dicer-substrate
duplexes, if it occurred, and 2) to eliminate the possibility of
RNase H-mediated cleavage of the HPRT mRNA. Duplexes processed in a
way that did not yield a canonical 19-23 base long RNA strand,
beginning with the 3'-end of the guide (antisense) strands shown in
FIG. 4B, would be less likely to direct RISC-mediated reduction in
HPRT target mRNA levels. Promiscuous processing of long RNA
duplexes (e.g., duplex 3 of FIG. 4D) would yield guide strands that
contained mismatches in the seed region, thus reducing RISC
activity against the target. Promiscuous processing could also
yield RISC loaded with passenger (sense) oligonucleotides. Duplex 3
was significantly less active than shorter RNA species at lower
concentrations, and was likely processed into less active siRNA
species.
[0343] If long duplexes containing DNA (e.g., duplex 6 of FIG. 4D)
were differentially degraded and/or incorrectly processed, single
stranded oligonucleotides containing up to ten bases of antisense
DNA could result. In theory, this DNA portion could activate RNase
H to cleave a complementary target mRNA. The DNA portions of
duplexes 4, 5, and 6 did not match HPRT mRNA, and thus could not be
responsible for the observed reduction in HPRT mRNA. Differential
degradation of duplexes prior to cellular uptake, processing by
Dicer, or before loading into RISC could also have caused an
observed difference in HPRT reduction. Duplex 3 contained an
internal substitution of two DNA nucleosides to control for this
effect (bases 9 and 10, counting from the 3' end of the passenger
strand). If DNA substitutions increased duplex activity by simply
stabilizing the duplex against nuclease degradation, duplex 3
should have been more stable than duplexes 1 or 2, and potentially
as stable as duplex 4. Instead, duplex 3 reduced HPRT target mRNA
levels less effectively than duplexes 1, 2, and 4, indicating that
the enhancing effect seen when double stranded DNA:DNA regions were
introduced was not simply attributable to enhanced resistance to
nuclease degradation. By similar rationale, if DNA base pairs had
caused a significant stabilization of the tested duplexes, then
increased DNA base pair length should have resulted in
progressively enhanced activity across duplexes 4 through 6.
However, such progressively increasing DNA lengths did not increase
duplex activity.
[0344] In view of the above results, it was concluded that DsiRNA
agents possessing double stranded DNA:DNA extended regions of two
to ten base pairs (where such extensions were located in the region
of the sense strand that was 3' of the projected Dicer cleavage
site and corresponding region of the antisense strand that was 5'
of the projected Dicer cleavage site) constituted effective, and in
certain cases, enhanced, RNA inhibitory agents.
Example 5
Enhanced Efficacy of Double Stranded DNA:DNA-Extended Duplexes at
Low Concentration
[0345] A series of modified duplexes of increasing length was
evaluated for reduction of HPRT mRNA expression at a fixed
concentration of 100 pM. Duplex 1 of FIGS. 5A and 5B was an
optimized 25/27mer Dicer-substrate containing chemical
modifications, a two-base overhang at the 3'-end of the guide
(antisense) strand and two DNA substitutions and a blunt end at the
3'-end of the passenger (sense) strand (Collingwood et al. 2008).
Bases non-complementary to HPRT mRNA were inserted two bases at a
time as either RNA (duplexes 2 through 5) or DNA (duplexes 6
through 9; see FIGS. 5A and 5B), increasing total duplex
configurations from 27/29mers to 33/35mers.
[0346] Duplex 1 was more effective at reducing HPRT mRNA levels
than any other "optimized" duplex extended by the addition of RNA
base pairs (duplexes 2 through 5; FIG. 5A), supporting the concept
that longer duplexes were likely processed into one or more less
active guide species. All duplexes extended by the addition of DNA
base pairs (duplexes 6 though 9; FIG. 5A) were significantly more
active than duplexes 2 though 5, and approximately equal in
activity to duplex 1.
[0347] Duplexes 6 through 9 were indistinguishable in their degree
of HPRT mRNA reduction. Thus, the DNA base pair regions were not
exerting a nuclease-resistance property that increased RNAi
activity (compare duplexes 2 through 5 to each other and to duplex
1). Surprisingly, increasing the length of the DNA portion also did
not negatively impact HPRT reduction. All DNA duplexes had
equivalent activity and had greater activity than comparable
RNA-based duplexes. These results indicated that the DNA insertions
of duplexes 2 through 5 limited Dicer activity to production of the
canonical guide strand processed out of optimized duplex 1.
Example 6
Efficacy of Left-Extended DsiRNA Agents, Including DsiRNA Agents
Harboring Mismatches ("DsiRNAmms")
[0348] To examine whether effective DsiRNA agents can also possess
DNA:DNA extensions in the reverse ("flipped") orientation as the
above-described "right extended" DsiRNA agents, "left extended"
DsiRNA agents were synthesized and tested for inhibitory efficacy
via methods as described above. Such "left extended" DsiRNA agents
(in the instant case, 30/28mer agents possessing a 5 base pair
DNA:DNA extension formed between the 5' terminal region of the
sense strand and 3' terminal region of the antisense strand, as
shown in FIG. 7) were tested for target RNA inhibitory efficacy in
direct comparison with corresponding 28/30mer "right extended"
DsiRNA agents. Surprisingly, "left extended" agents were observed
to be more potent than "right extended" agents in their inhibition
of KRAS target mRNA levels. Also surprising was the fact that
mismatch residues could be introduced into both "left extended" and
"right extended" DNA:DNA extended DsiRNA agents at certain
positions but not others, while retaining inhibition efficacy of
such agents. Specifically, DNA:DNA extended "DsiRNAmm" agents (as
used herein, the term "DsiRNAmm agent" indicates a DsiRNA agent
comprising one or more mismatched base pairs that are positioned at
a location other than the two terminal nucleotide residues of
either end of either strand) were synthesized to possess mismatched
base pairs at the following positions: 12 alone, 14 alone, 16
alone, 14 and 18 together and 12 and 16 together (starting from
position 1 as the 5' terminal antisense residue of the projected
post-Dicer cleaved DsiRNAmm agent). As shown in FIGS. 8 and 9,
DsiRNAmm agents possessing mismatched residues at position 14
alone, position 16 alone and at both positions 14 and 18, were all
effective inhibitory agents. Surprisingly, left-extended forms of
both "parent" DsiRNAs and DsiRNAmms were initially identified to
possess greater inhibition efficacy (at 100 pM transfection levels
in HeLa cells) than right extended forms for parent DsiRNA agents
and for DsiRNAmm agents having mismatched residues at position 14
alone, position 16 alone and at both positions 14 and 18 of the
antisense strand (when positions are numbered in the 3' direction
(meaning from 5' to 3') starting from position 1 at the 5' terminal
antisense residue of the predicted post-Dicer cleaved DsiRNA or
DsiRNAmm agent; see FIG. 8). With the exception of the DsiRNAmm
agent possessing mismatched residues at both positions 14 and 18 of
the antisense strand, the greater efficacy at 100 pM which was
initially observed for left-extended as compared to right-extended
DsiRNA or DsiRNAmm agents was reproducible (FIG. 9).
Example 7
Location of Phosphorothioate Modifications and DNA Residues within
Effective DsiRNA Agents
[0349] To test whether DNA:DNA extended sequences of the invention
provide extra residues within a DsiRNA agent upon which
advantageous modifications might be placed while retaining
inhibitory efficacy of the DsiRNA agent, the robustness of DsiRNA
agents harboring multiple phosphorothioate-modified bases was
examined. Prior studies of phosphorothioate modified siRNA agents
have revealed that such agents can be cytotoxic to cells when
multiple phosphorothioates are present (Amarzguioui et al. Nucleic
Acids Research. 31: 589-595), and some siRNA agents possessing
phosphorothioate modifications at or near the 5' end of the
antisense strand have been observed to have reduced inhibitory
activity. As shown in FIG. 10, the DsiRNA agents "DNA 6 bp(2PS)"
and "DNA 6 bp(4PS)" exhibited similar target mRNA (HPRT) inhibitory
efficacies, demonstrating that the DNA-extended duplex regions of
these molecules can be extensively modified without detrimental
impact upon these molecules' target RNA inhibitory efficacy.
[0350] The patterning of deoxyribonucleotides at or near the
projected 5' Dicer cleavage site of the antisense strand within
"right-extended" DsiRNA agents of the invention was also examined.
As shown in FIG. 10, DsiRNA agents possessing antisense strand
deoxyribonucleotides extending from the 5' terminus of the
antisense strand all the way to the location adjacent to the 5'
terminal nucleotide of the post-Dicer cleaved antisense strand (see
agents DP1055P/DP1057G and DP1058P/DP1060G) were effective RNA
interference agents. Results for the DP1055P/DP1057G and
DP1058P/DP1060G DsiRNA agents were unexpected, as it was previously
thought that termination of deoxyribonucleotide inclusion within
the 5' end region of the antisense strand should occur at a
location 5' within the antisense strand of the most 3' Dicer
cleavage site within the sense strand (see agents DP1055P/DP1056G
and DP1058P/DP1059G). As also shown in FIG. 10, a left-extended
DsiRNA agent was observed to be an effective inhibitory agent,
while inclusion of a U:G mismatch within the "seed" region of the
antisense strand of this DsiRNA agent was observed to cause a
modestly diminished level of inhibitory activity.
[0351] The effect of strand-weighted patterns of phosphorothioate
modification of "right-extended" DsiRNA agents of the invention was
also examined. The phosphorothioate-modified oligonucleotide
strands of "right-extended" DsiRNA agents "DNA 6 bp(2PS)" and "DNA
6 bp(4PS)" were reassembled to create the DP1061P/DP1064G and
DP1062G/DP1063P DsiRNA agents shown in FIG. 11. Surprisingly, the
DP1062G/DP1063P duplex, which presents four phosphorothioate
modified deoxyribonucleotides on the passenger strand and only two
phosphorothioate modified deoxyribonucleotides on corresponding
guide strand residues, performed as well as or better than the "DNA
6 bp(2PS)" agent, whereas the DP1061P/DP1064G duplex, which harbors
four phosphorothioate modified deoxyribonucleotides on the guide
strand and only two phosphorothioate modified deoxyribonucleotides
on corresponding passenger strand residues, was not as effective an
inhibitory molecule. Such results suggest that for the extended
regions of DsiRNAs of the invention, phosphorothioate modification
patterns that weight such modifications on the passenger strand
relative to the guide strand might retain greatest efficacy
relative to oppositely weighted patterns.
Example 8
Comparison of Duplexes Extended by Five, Ten and Twelve DNA or RNA
Base Pairs
[0352] To investigate further the impact of structural extensions
of DsiRNAs, several series of "right-extended" DsiRNAs targeting
the KRAS transcript were generated and assessed for target
knockdown efficacy in vitro. FIG. 12 depicts the structures of a
series of "right-extended" DsiRNAs targeting the "KRAS-200" site
within the KRAS transcript. The first duplex of FIG. 12
("DP1174P/DP1175G" or duplex "01" of corresponding data FIG. 13) is
a 25/27mer DsiRNA possessing deoxyribonucleotides at only the
ultimate and penultimate 3'-terminal residues of the passenger
strand. The second duplex of FIG. 12 ("DP1200P/DP1201G" or duplex
"02" of corresponding data FIG. 13) is a 25/27mer DsiRNA possessing
deoxyribonucleotides at all passenger strand residues located 3' of
the passenger strand projected Dicer cleavage site and at all guide
strand residues located 5' of the guide strand projected Dicer
cleavage site shown. The third duplex of FIG. 12 ("DP1202P/DP1203G"
or duplex "03" of corresponding data FIG. 13) is a 30/32mer DsiRNA
possessing a five base pair ribonucleotide sequence insertion
relative to the "DP1174P/DP1175G" duplex, as shown (boxed region of
the third duplex of FIG. 12). The fourth duplex of FIG. 12
("DP1204P/DP1205G" or duplex "04" of corresponding data FIG. 13) is
a 30/32mer DsiRNA possessing a five base pair deoxyribonucleotide
sequence insertion relative to the "DP1200P/DP201G" duplex, as
shown (boxed region of the fourth duplex of FIG. 12). The fifth
duplex of FIG. 12 ("DP1206P/DP1207G" or duplex "05" of
corresponding data FIG. 13) is a 35/37mer DsiRNA possessing a ten
base pair ribonucleotide sequence insertion relative to the
"DP1174P/DP1175G" duplex, as shown (boxed region of the fifth
duplex of FIG. 12). The sixth duplex of FIG. 12 ("DP1208P/DP1209G"
or duplex "06" of corresponding data FIG. 13) is a 35/37mer DsiRNA
possessing a ten base pair deoxyribonucleotide sequence insertion
relative to the "DP1200P/DP1201G" duplex, as shown (boxed region of
the sixth duplex of FIG. 12).
[0353] FIG. 13 shows KRAS target gene inhibitory efficacy results
for the KRAS-200 site targeting DsiRNAs presented in FIG. 12. As
shown in FIG. 13, DsiRNAs possessing RNA duplex or DNA duplex
extensions of five or even ten base pairs in length retained robust
inhibitory efficacy in vitro (the experiments of FIG. 13 were
performed in HeLa cells and involved treatment with 0.1 nM DsiRNA
for 24 hours, in duplicate, using RNAiMAX; "13" and "14" correspond
to results obtained using RNAiMAX alone and obtained for untreated
cells, respectively; multiplex experiments were performed to assess
both KRAS and HPRT1 levels).
[0354] FIG. 14 depicts the structures of a series of
"right-extended" DsiRNAs targeting the "KRAS-909" site within the
KRAS transcript. The first duplex of FIG. 14 ("DP1188P/DP1189G") is
a 25/27mer DsiRNA possessing deoxyribonucleotides at only the
ultimate and penultimate 3'-terminal residues of the passenger
strand. The second duplex of FIG. 14 ("DP1210P/DP1211G") is a
25/27mer DsiRNA possessing deoxyribonucleotides at all passenger
strand residues located 3' of the passenger strand projected Dicer
cleavage site and at all guide strand residues located 5' of the
guide strand projected Dicer cleavage site shown. The third duplex
of FIG. 14 ("DP1212P/DP1213G") is a 30/32mer DsiRNA possessing a
five base pair ribonucleotide sequence insertion relative to the
"DP1188P/DP1189G" duplex, as shown (boxed region of the third
duplex of FIG. 14). The fourth duplex of FIG. 14
("DP1214P/DP1215G") is a 30/32mer DsiRNA possessing a five base
pair deoxyribonucleotide sequence insertion relative to the
"DP1210P/DP1211G" duplex, as shown (boxed region of the fourth
duplex of FIG. 14). The fifth duplex of FIG. 14 ("DP1216P/DP1217G")
is a 35/37mer DsiRNA possessing a ten base pair ribonucleotide
sequence insertion relative to the "DP1188P/DP1189G" duplex, as
shown (boxed region of the fifth duplex of FIG. 14). The sixth
duplex of FIG. 14 ("DP1218P/DP1219G") is a 35/37mer DsiRNA
possessing a ten base pair deoxyribonucleotide sequence insertion
relative to the "DP1210P/DP1211G" duplex, as shown (boxed region of
the sixth duplex of FIG. 14).
[0355] FIG. 15 shows KRAS target gene inhibitory efficacy results
for the KRAS-909 site targeting DsiRNAs presented in FIG. 14. As
shown in FIG. 15, while 25/27mer DsiRNAs "1188P/1189G" and 30/32mer
"1212P/1213G" showed slightly greater target RNA inhibitory
efficacies than other DsiRNAs examined, DsiRNAs possessing RNA
duplex or DNA duplex extensions of five or even ten base pairs in
length exhibited robust inhibitory efficacies in vitro. (the
experiments of FIG. 15 were performed in HeLa cells and involved
treatment with 0.1 nM DsiRNA for 24 hours, in duplicate, using
RNAiMAX; multiplex experiments were performed to assess both KRAS
and HPRT1 levels).
Example 9
Effect of Numerous Phosphorothioate Modifications within "Extended"
DsiRNAs
[0356] FIG. 10 demonstrates that deoxyribonucleotide extension of
DsiRNA molecules can provide a surface upon which phosphorothioate
modification can be performed with little, if any, impact upon
target transcript inhibitory efficacy of the
phosphorothioate-modified DsiRNA. FIGS. 16-18 depict DsiRNA
molecules synthesized for purpose of testing whether even more
extensive levels of phosphorothioate modification can be tolerated
within extended (here, "right-extended") DsiRNAs. Specifically,
FIG. 16 shows a series of "KRAS-249" site-targeting DsiRNAs,
wherein: [0357] the first duplex ("K249M") is a 25/27mer possessing
deoxyribonucleotides at only the penultimate and ultimate residues
at the 3'-terminus of the passenger strand, has no phosphorothioate
modifications and has a pattern of 2'-O-Methyl modification as
shown (underlined residues indicate 2-O-Methyl modified residues).
[0358] the second duplex ("K249D") is a 31/33mer possessing a total
of eight deoxyribonucleotide base pairs positioned at the
3'-terminus of the passenger strand/5'-terminus of the guide
strand, having no phosphorothioate modifications and having a
pattern of 2'-O-Methyl modification as shown. [0359] the third and
fourth duplexes ("K249DNA8" and "K249DNA8p") are 33/35mers
possessing exclusively deoxyribonucleotides at all passenger strand
residues positioned 3' of the projected Dicer cleavage site shown
and at all residues of the guide strand located 5' of the projected
Dicer cleavage site shown. 2'-O-Methyl modification patterns were
the same as used for the "K249D" DsiRNA described above. The fourth
duplex ("K249DNA8p") possesses phosphorothioate modifications at
all nucleotides of the eight base pairs comprising the 3' terminus
of the passenger strand/5' terminus of the guide strand. [0360] the
fifth and sixth duplexes ("K249DNA12" and "K249DNA 12p") are
37/39mers possessing exclusively deoxyribonucleotides at all
passenger strand residues positioned 3' of the projected Dicer
cleavage site shown and at all residues of the guide strand located
5' of the projected Dicer cleavage site shown. 2'-O-Methyl
modification patterns were the same as used for the "K249D" DsiRNA
described above. The sixth duplex ("K249DNA12p") possesses
phosphorothioate modifications at all nucleotides of the twelve
base pairs comprising the 3' terminus of the passenger strand/5'
terminus of the guide strand.
[0361] FIG. 17 shows a series of "KRAS-516" site-targeting DsiRNAs,
wherein: [0362] the first and second duplexes ("K516DNA8" and
"K516DNA8p") are 33/35mers possessing exclusively
deoxyribonucleotides at all passenger strand residues positioned 3'
of the projected Dicer cleavage site shown and at all residues of
the guide strand located 5' of the projected Dicer cleavage site
shown. 2'-O-Methyl modified nucleotides are shown as underlined
residues. The second duplex ("K516DNA8p") possesses
phosphorothioate modifications at all nucleotides of the eight base
pairs comprising the 3' terminus of the passenger strand/5'
terminus of the guide strand. Notably, a four base pair
deoxyribonucleotide sequence of K249 was introduced into these
extended DsiRNAs (see boxed region labeled as "K249"). [0363] the
third and fourth duplexes ("K516DNA12" and "K516DNA12p") are
37/39mers possessing exclusively deoxyribonucleotides at all
passenger strand residues positioned 3' of the projected Dicer
cleavage site shown and at all residues of the guide strand located
5' of the projected Dicer cleavage site shown. 2'-O-Methyl
modification patterns were the same as used for the "K516DNA8" and
"K516DNA8p" DsiRNAs described above. The fourth duplex ("K516DNA
12p") possesses phosphorothioate modifications at all nucleotides
of the twelve base pairs comprising the 3' terminus of the
passenger strand/5' terminus of the guide strand. As for "K516DNA8"
and "K516DNA8p" DsiRNAs, a four base pair deoxyribonucleotide
sequence of K249 was used introduced into these extended DsiRNAs
(see boxed region labeled as "K249").
[0364] FIG. 18 shows a series of "KRAS-909" site-targeting DsiRNAs,
wherein: [0365] the first and second duplexes ("K909DNA8" and
"K909DNA8p") are 33/35mers possessing exclusively
deoxyribonucleotides at all passenger strand residues positioned 3'
of the projected Dicer cleavage site shown and at all residues of
the guide strand located 5' of the projected Dicer cleavage site
shown. 2'-O-Methyl modified nucleotides are shown as underlined
residues. The second duplex ("K909DNA8p") possesses
phosphorothioate modifications at all nucleotides of the eight base
pairs comprising the 3' terminus of the passenger strand/5'
terminus of the guide strand. A four base pair deoxyribonucleotide
sequence of K249 was also introduced into these extended DsiRNAs
(see boxed region labeled as "K249"). [0366] the third and fourth
duplexes ("K909DNA12" and "K909DNA12p") are 37/39mers possessing
exclusively deoxyribonucleotides at all passenger strand residues
positioned 3' of the projected Dicer cleavage site shown and at all
residues of the guide strand located 5' of the projected Dicer
cleavage site shown. 2'-O-Methyl modification patterns were the
same as used for the "K909DNA8" and "K909DNA8p" DsiRNAs described
above. The fourth duplex ("K909DNA 12p") possesses phosphorothioate
modifications at all nucleotides of the twelve base pairs
comprising the 3' terminus of the passenger strand/5' terminus of
the guide strand. As for "K909DNA8" and "K909DNA8p" DsiRNAs, a four
base pair deoxyribonucleotide sequence of K249 was used introduced
into these extended DsiRNAs (see boxed region labeled as
"K249").
[0367] The extended DsiRNAs shown in FIGS. 16-18 were tested for
KRAS target transcript inhibitory efficacy in vitro. Data from such
experiments is shown in FIG. 19. Surprisingly, both 33/35mer and
37/39mer DNA-extended DsiRNAs exhibited significant inhibitory
efficacies (refer to "DNA8" and "DNA 12" results for each of
KRAS-249, 516 and 909 target sites in FIG. 19); however, extensive
phosphorothioate modification of the DNA-extended region of these
DsiRNAs--positioned on both strands of the extended region--reduced
inhibitory efficacies (see "DNA8p" and "DNA12p" results for each of
KRAS-249, 516 and 909 target sites). Thus, even though a pattern of
two or even four successive DNA base pairs harboring
phosphorothioate modifications of both strands was observed to show
little or no impact upon the efficacy of a DNA-extended DsiRNA (see
FIG. 10), FIG. 19 shows that insertion of eight or twelve
successive phosphorothioate-modified deoxyribonucleotide base pairs
(phosphorothioate modified on both strands) within the "extended"
DsiRNAs of the invention can reduce the inhibitory efficacy of such
"extended" DsiRNAs.
[0368] In spite of the above results, it is noted that positioning
of phosphorothioate modifications on only one strand of the
double-stranded extended regions of the extended DsiRNAs of the
instant invention has been shown to allow for introduction of
longer runs of phosphorothioate modification with no significant
loss of efficacy. For example, inclusion of as many as 15
consecutive phosphorothioate modifications upon only one strand of
the extended region of an extended DsiRNA has been shown to be
tolerated without significant loss of efficacy of such a modified
extended DsiRNA (data not shown). Thus, even though the results of
FIG. 19 show the impact of including long tracts of
phosphorothioate modification upon both strands of the extended
DsiRNAs of the invention, on the whole, the DNA-containing extended
region(s) of the DsiRNAs of the instant invention have been
demonstrated to provide a structure upon which extensive
advantageous modifications (e.g., phosphorothioate, 2'-O-Methyl or
other modification(s) capable of enhancing stability, delivery,
efficacy and/or potency of the extended DsiRNAs of the invention)
can be introduced without negatively impacting, e.g., the
inhibitory efficacy of the extended DsiRNAs of the invention.
Example 10
Relative Effect of Position and Number of Mismatches Within
Non-Seed Regions of DsiRNAs
[0369] In above Example 6, it was demonstrated that introduction of
mismatches within the extended DsiRNAs of the invention could
create extended "DsiRNAmm" agents that possess inhibitory
efficacies similar to those of DsiRNAs possessing sequences that
are perfectly complementary to target sequence. Notably, it was
observed in FIGS. 7-9 that, of the non-seed region mismatch
positions examined, the mismatch position ("position 12") that
impacted efficacy the most was also the position located in closest
proximity to the projected Ago2 cleavage site of the target strand
sequence. Further to these results, the effect of introducing
sequence mismatches within 25/27mer DsiRNA nucleotides at non-seed
region positions substantially removed from the projected Ago2
cleavage site was examined. FIG. 20 shows the structures of a
series of 25/27mer DsiRNAs that were synthesized to assess the
impact of introducing one or more mismatch residues (noting that
for the DsiRNAmm molecules of FIG. 20, mismatches were relative to
target sequence only, and not with respect to corresponding DsiRNA
passenger strand sequence residues; it is further noted that a
"target-mismatched" nucleotide or residue is defined for purpose of
the invention as a guide strand nucleotide that forms a mismatch
relative to target nucleotide sequence, but that is not necessarily
mismatched relative to a corresponding DsiRNA passenger strand
sequence nucleotide), with such mismatches starting from either the
3' terminus of the guide strand, or starting from the guide strand
position that is complementary to the 5' terminal residue of the
passenger strand. As shown in FIG. 21, the 3' terminal region of
the guide strand of the tested 25/27mer DsiRNA surprisingly
tolerated introduction of one or more target-mismatched
nucleotides. Indeed, introduction of between one and three
target-mismatched nucleotides commencing from the 3' terminus of
the guide strand of the tested DsiRNA elicited no statistically
significant impact upon target inhibition efficacy (see duplexes
DP1301P/DP1303G, DP1301P/DP1304G and DP1305P/DP1306G), while
introduction of four, five or even six target-mismatched
nucleotides commencing from the 3' terminus of the guide strand of
the tested DsiRNA still resulted in a DsiRNA that retained
significant inhibitory activity (see duplexes DP1307P/DP1308G,
DP1309P/DP1310G and DP1311P/DP1312G). Introduction of
target-mismatched residues within the guide strand that commenced
from the guide strand position that is complementary to the 5'
terminal residue of the DsiRNA passenger strand yielded results
consistent with those observed for introduction of
target-mismatched nucleotides commencing from the 3' terminus of
the guide strand. Specifically, introduction of between one and
four target-mismatched nucleotides commencing from the guide strand
position that is complementary to the 5' terminal residue of the
DsiRNA passenger strand impacted DsiRNA inhibitory efficacy to
approximately the same extent as observed for introduction of
between three and six target-mismatched nucleotides commencing from
the 3' terminus of the guide strand (consistent with the observed
tolerance for the ultimate and penultimate nucleotides of the
3'-terminal guide strand sequence--as well as the guide strand
position complementary to the 5' terminal residue of the DsiRNA
passenger strand--to target-mismatched nucleotides).
Example 11
In Vivo Efficacy of DsiRNA Agents, Single Dose Results
[0370] DsiRNA agents possessing DNA duplex extensions were examined
for in vivo efficacy of sequence-specific target mRNA inhibition.
Specifically, unmodified KRAS-targeting DsiRNA "K249" of FIG. 20
("DP1301P/DP1302G" duplex), 2'-O-Methyl-modified KRAS-targeting
DsiRNA "K249M" (first duplex of FIG. 16) and 2'-O-Methyl-modified
"right extended" KRAS-targeting DsiRNA "K249D" (second duplex of
FIG. 16; denoted as "K249DNA" in FIGS. 22-25) were formulated in
Invivofectamine.TM. and injected i.v. into CD1 mice at 10 mg/kg.
Expression of KRAS in liver, kidney, spleen and lymph node tissues
was measured 24 hours post-injection (FIGS. 22-25, respectively;
each bar presents results obtained for four mice per treatment
group), with real-time PCR (RT-PCR) performed in triplicate to
assess KRAS expression. Under these conditions, "right extended"
DsiRNA "K249DNA" exhibited statistically significant levels of KRAS
target gene inhibition in all tissues examined. Specific KRAS
percent inhibition levels observed in such "K249DNA"-treated
tissues and p-values associated with these observations were: liver
(55%-87%, mean 71%, p=0.010), spleen (92%-98%, mean 94%,
P<0.001), kidney (19%-53%, mean 35%. P=0.009) and lymph nodes
(47%-81%, mean 59%, P=0.001). Thus, the in vivo efficacy of the
extended DsiRNAs of the instant invention were demonstrated across
many tissue types.
Example 12
In Vivo Efficacy of DsiRNA Agents, Multiple Dose Results
[0371] DsiRNA agents possessing DNA duplex extensions were examined
for in vivo efficacy of sequence-specific target mRNA inhibition in
a repeated dose protocol at a lower dosage than that of Example 11.
Specifically, 2'-O-Methyl-modified KRAS-targeting DsiRNA "K249M"
(first duplex of FIG. 16) and 2'-O-Methyl-modified "right extended"
KRAS-targeting DsiRNA "K249D" (second duplex of FIG. 16) were
formulated in Invivofectamine.TM. and injected i.v. in CD1 mice at
2 mg/kg every 3 days until a total of four doses were administered
to each mouse. Expression of KRAS in liver, lung, spleen and kidney
tissues was measured 24 hours after the final injection was
administered (FIGS. 26-29, respectively; each bar presents results
obtained for four mice per treatment group), with real-time PCR
(RT-PCR) performed in triplicate to assess KRAS expression. Under
these conditions, statistically significant reductions in KRAS
levels were observed in liver and spleen tissues of mice
administered the "right-extended" DsiRNA "K249D". Specific KRAS
percent inhibition levels observed in such "K249DNA"-treated
tissues and p-values associated with these observations were: liver
(46%-90%, mean 78%, p=0.002), spleen (36%-80%, mean 62%, P=0.004),
kidney (0%, mean 0%, P=0.814**) and lung (17%-38%, mean 26%,
P=0.065**). Thus, the in vivo efficacy of the extended DsiRNAs of
the instant invention in a multi-dose (low dose) regimen was
demonstrated in liver and spleen tissues.
Example 13
Further Assessment of In Vivo Efficacy of DsiRNA Agents
[0372] Further demonstration of the capability of the extended
Dicer substrate agents of the invention to reduce gene expression
of specific target genes in vivo is performed via administration of
the DsiRNAs of the invention to mice or other mammalian subjects,
either systemically (e.g., by i.v. or i.p. injection) or via direct
injection of a tissue (e.g., injection of the eye, spinal
cord/brain/CNS, etc.). Measurement of additional target RNA levels
are performed upon target cells (e.g., RNA levels in liver and/or
kidney cells are assayed following injection of mice; eye cells are
assayed following ophthalmic injection of subjects; or spinal
cord/brain/CNS cells are assayed following direct injection of same
of subjects) by standard methods (e.g., Trizol.TM. preparation
(guanidinium thiocyanate-phenol-chloroform) followed by
qRT-PCR).
[0373] In any such further in vivo experiments, an extended Dicer
substrate agent of the invention (e.g., a left-extended or
right-extended DsiRNA) can be deemed to be an effective in vivo
agent if a statistically significant reduction in RNA levels is
observed when administering an extended Dicer substrate agent of
the invention, as compared to an appropriate control (e.g., a
vehicle alone control, a randomized duplex control, a duplex
directed to a different target RNA control, etc.). Generally, if
the p-value (e.g., generated via 1 tailed, unpaired T-test)
assigned to such comparison is less than 0.05, an extended Dicer
substrate agent (e.g., left-extended or right-extended DsiRNA
agent) of the invention is deemed to be an effective RNA
interference agent. Alternatively, the p-value threshold below
which to classify an extended Dicer substrate agent of the
invention as an effective RNA interference agent can be set, e.g.
at 0.01, 0.001, etc., in order to provide more stringent filtering,
identify more robust differences, and/or adjust for multiple
hypothesis testing, etc. Absolute activity level limits can also be
set to distinguish between effective and non-effective extended
Dicer substrate agents. For example, in certain embodiments, an
effective extended Dicer substrate agent of the invention is one
that not only shows a statistically significant reduction of target
RNA levels in vivo but also exerts, e.g., at least an approximately
10% reduction, approximately 15% reduction, at least approximately
20% reduction, approximately 25% reduction, approximately 30%
reduction, etc. in target RNA levels in the tissue or cell that is
examined, as compared to an appropriate control. Further in vivo
efficacy testing of the extended Dicer substrate agents (e.g.,
left-extended and right-extended DsiRNA agents) of the invention is
thereby performed.
[0374] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains. All references cited in this
disclosure are incorporated by reference to the same extent as if
each reference had been incorporated by reference in its entirety
individually.
[0375] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The methods and compositions described herein as presently
representative of preferred embodiments are exemplary and are not
intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art,
which are encompassed within the spirit of the invention, are
defined by the scope of the claims.
[0376] It will be readily apparent to one skilled in the art that
varying substitutions and modifications can be made to the
invention disclosed herein without departing from the scope and
spirit of the invention. Thus, such additional embodiments are
within the scope of the present invention and the following claims.
The present invention teaches one skilled in the art to test
various combinations and/or substitutions of chemical modifications
described herein toward generating nucleic acid constructs with
improved activity for mediating RNAi activity. Such improved
activity can comprise improved stability, improved bioavailability,
and/or improved activation of cellular responses mediating RNAi.
Therefore, the specific embodiments described herein are not
limiting and one skilled in the art can readily appreciate that
specific combinations of the modifications described herein can be
tested without undue experimentation toward identifying DsiRNA
molecules with improved RNAi activity.
[0377] The invention illustratively described herein suitably can
be practiced in the absence of any element or elements, limitation
or limitations that are not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of", and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed. Thus, it should be understood that although the
present invention has been specifically disclosed by preferred
embodiments, optional features, modification and variation of the
concepts herein disclosed may be resorted to by those skilled in
the art, and that such modifications and variations are considered
to be within the scope of this invention as defined by the
description and the appended claims.
[0378] In addition, where features or aspects of the invention are
described in terms of Markush groups or other grouping of
alternatives, those skilled in the art will recognize that the
invention is also thereby described in terms of any individual
member or subgroup of members of the Markush group or other
group.
[0379] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
Embodiments of this invention are described herein, including the
best mode known to the inventors for carrying out the invention.
Variations of those embodiments may become apparent to those of
ordinary skill in the art upon reading the foregoing description.
The inventors expect skilled artisans to employ such variations as
appropriate, and the inventors intend for the invention to be
practiced otherwise than as specifically described herein.
Accordingly, this invention includes all modifications and
equivalents of the subject matter recited in the claims appended
hereto as permitted by applicable law. Moreover, any combination of
the above-described elements in all possible variations thereof is
encompassed by the invention unless otherwise indicated herein or
otherwise clearly contradicted by context.
Sequence CWU 1
1
219121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1gactttgctt tccttggtca g 21224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2ggcttatatc caacacttcg tggg 24326DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 3atggtcaagg tcgcaagctt
gctggt 26418DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 4tgtgcagaag gatggagt 18520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5ctggtgcttc tctcaggata 20625DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 6tggaatatgc cctgcgtaaa ctgga
25720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7caaactttgc tttccctggt 20821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8caacaaagtc tggcctgtat c 21926DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 9tggttaaggt tgcaagcttg ctggtg
261020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10ctttgtggat gagtacgacc 201120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11cactgtactc ctcttgacct 201229DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 12acgatagagg actcctacag
gaaacaagt 291327DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 13gccagacuuu guuggauuug aaacctt
271429RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14aagguuuca aauccaacaa agucuggcuu
291521RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 15gccagacuuu guuggauuug a
211621RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16aaauccaaca aagucuggcu u
211725DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 17gccagacuuu guuggauuug aaatt
251827RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 18aauuucaaau ccaacaaagu cuggcuu
271929RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19aagguuucaa auccaacaaa gucuggcuu
292031DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20gccagacuuu guuggauuug aaaccaacat t
312133RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 21aauguugguu ucaaauccaa caaagucugg cuu
332227DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22gccagacuuu guuggauuug aaacctt
272329DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 23aagguuucaa auccaacaaa gucuggcuu
292431DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 24gccagacuuu guuggauuug aaaccaacat t
312533DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25aatgttgguu ucaaauccaa caaagucugg cuu
332633DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 26gccagacuuu guuggauuug aaaccaacag ctt
332735DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 27aagctgttgg uuucaaaucc aacaaagucu ggcuu
352833DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 28gccagacuuu guuggauuug aaaccaacag ctt
332935DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 29aagcuguugg uuucaaaucc aacaaagucu ggcuu
353025DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 30gcuagguugu uucagacuug aaatt
253127RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 31aauuucaagu cugaaacaac cuagcuu
273232DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 32agccagacuu uguuggauuu gaaaccaaca tt
323329DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 33gccagacuuu guuggauuug aaaccaatt
293431RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 34aauugguuuc aaauccaaca aagucuggcu u
313533DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 35gccagacuuu guuggauuug aaaccaacag ctt
333629DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 36gccagacuuu guuggauuug aaaccaatt
293731DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 37aattgguuuc aaauccaaca aagucuggcu u
313825DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 38ggagggcuuu cuuuguguau uugcc
253927RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 39ggcaaauaca caaagaaagc ccucccc
274030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 40ggaccuuggg gagggcuuuc uuuguguacc
304128DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 41uacacaaaga aaguccuccc caaggtcc
284228DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 42ggagggcuuu cuuuguguac caaggtcc
284330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 43ggaccuuggu acacaaagaa agcccucccc
304428DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 44uacacaaaga aagcccuccc caaggtcc
284530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45ggaccuuggu acacaaagaa ggcccucccc
304628DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46uacacaaaga aggcccuccc caaggtcc
284730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 47ggaccuuggu acacaaagaa aguccucccc
304830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 48ggaccuuggu acacaaagaa agccuucccc
304928DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 49uacacaaaga aagccuuccc caaggtcc
285030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50ggaccuuggu acacaaagaa aguccuuccc
305128DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 51uacacaaaga aaguccuucc caaggtcc
285230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 52ggaccuuggu acacaaagaa ggccuucccc
305328DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 53uacacaaaga aggccuuccc caaggtcc
285425DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 54gccagacuuu guuggauuug aaatt
255527DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55aattucaaau ccaacaaagu cuggcuu
275627DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 56aatttcaaau ccaacaaagu cuggcuu
275727DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 57gccagacuuu guuggauuug aaacctt
275829DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 58aaggttucaa auccaacaaa gucuggcuu
295929DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 59aaggtttcaa auccaacaaa gucuggcuu
296033DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 60aggcaggtuu aagccagacu uuguuggauu uga
336131DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 61aaauccaaca aagucuggcu uaaacctgcc t
316231DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 62aaauucaaca aagucuggcu uaaacctgcc t
316325DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 63caggucaaga ggaguacagu gcaat
256427RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 64auugcacugu acuccucuug accugcu
276525DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 65caggucaaga ggaguacagu gcaat
256627DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 66attgcacugu acuccucuug accugcu
276730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 67caggucaaga ggaguacagu gcagauacat
306832RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 68auguaucugc acuguacucc ucuugaccug cu
326930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 69caggucaaga ggaguacagu gcagatacat
307032DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 70atgtatctgc acuguacucc ucuugaccug cu
327135DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 71caggucaaga ggaguacagu gcacaaugga uacat
357237RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 72auguauccau ugugcacugu acuccucuug
accugcu 377335DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 73caggucaaga ggaguacagu
gcacaatgga tacat 357437DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 74atgtatccat
tgtgcacugu acuccucuug accugcu 377525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75ggugugaaac aaauuaauga agctt 257627RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76aagcuucauu aauuuguuuc acaccaa 277725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77ggugugaaac aaauuaauga agctt 257827DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78aagcttcauu aauuuguuuc acaccaa 277930DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 79ggugugaaac aaauuaauga agcgauactt
308032RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 80aaguaucgcu ucauuaauuu guuucacacc aa
328130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 81ggugugaaac aaauuaauga agcgatactt
308232DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 82aagtatcgct tcauuaauuu guuucacacc aa
328335DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 83ggugugaaac aaauuaauga agccaaugga uactt
358437RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 84aaguauccau uggcuucauu aauuuguuuc
acaccaa 378535DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 85ggugugaaac aaauuaauga
agccaatgga tactt 358637DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 86aagtatccat
tggcttcauu aauuuguuuc acaccaa 378712DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87gaagcgauac tt 128812RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88aaguaucgcu uc 128912DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89gaagcgatac tt 129012DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90aagtatcgct tc 129117DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 91gaagccaaug gauactt 179217DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92aaguauccau uggcuuc 179317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 93gaagccaatg gatactt 179417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 94aagtatccat tggcttc 179531DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 95ggagggcuuu cuuuguguau uugccaacct t
319633DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 96aaggttggca aauacacaaa gaaagcccuc ccc
339733DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 97ggagggcuuu cuuuguguau utgccaacct tgg
339835DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 98ccaaggttgg caaauacaca aagaaagccc ucccc
359937DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 99ggagggcuuu cuuuguguau utgccaacct
tggaacc 3710039DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 100ggttccaagg ttggcaaaua
cacaaagaaa gcccucccc 3910133DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 101aaaacauaaa
gaaaagauga gtgccaacct tgg 3310235DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 102ccaaggttgg
cactcaucuu uucuuuaugu uuucg 3510337DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 103aaaacauaaa gaaaagauga gtgccaacct tggaacc
3710439DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 104ggttccaagg ttggcactca ucuuuucuuu
auguuuucg 3910533DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 105ggugugaaac aaauuaauga
atgccaacct tgg 3310635DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 106ccaaggttgg
cattcauuaa uuuguuucac accaa 3510737DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 107ggugugaaac aaauuaauga atgccaacct tggaacc
3710839DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 108ggttccaagg ttggcattca uuaauuuguu
ucacaccaa
3910910DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 109ugccaacctt 1011010DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 110aaggttggca 1011112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 111tgccaacctt gg 1211212DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 112ccaaggttgg ca 1211316DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 113tgccaacctt ggaacc 1611416DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 114ggttccaagg ttggca 1611527RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 115ggcaaauaca caaagaaagc ccucccg
2711627RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116ggcaaauaca caaagaaagc ccuccag
2711725DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 117cgagggcuuu cuuuguguau uugcc
2511827RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 118ggcaaauaca caaagaaagc ccucgag
2711925DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 119ccagggcuuu cuuuguguau uugcc
2512027RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 120ggcaaauaca caaagaaagc ccuggag
2712125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 121ccugggcuuu cuuuguguau uugcc
2512227RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 122ggcaaauaca caaagaaagc ccaggag
2712325DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 123ccucggcuuu cuuuguguau uugcc
2512427RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124ggcaaauaca caaagaaagc cgaggag
2712527RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125ggcaaauaca caaagaaagc ccucgcc
2712627RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126ggcaaauaca caaagaaagc ccuggcc
2712727RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127ggcaaauaca caaagaaagc ccaggcc
2712827RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128ggcaaauaca caaagaaagc cgaggcc
2712939DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129gccagacuuu guuggauuug aaannnnnnn
nnnnnnnnn 3913043DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 130nnnnnnnnnn nnnnnnuuuc
aaauccaaca aagucuggcu uuu 4313141DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 131gccagacuuu
guuggauuug aaannnnnnn nnnnnnnnnc c 4113245DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 132ggnnnnnnnn nnnnnnnnuu ucaaauccaa caaagucugg
cuuuu 4513343DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 133gccagacuuu guuggauuug
aaannnnnnn nnnnnnnnnu uuu 4313441DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 134gccagacuuu
guuggauuug aaannnnnnn nnnnnnnnng u 4113545DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 135gunnnnnnnn nnnnnnnnuu ucaaauccaa caaagucugg
cuuuu 4513639DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 136ggagggcuuu cuuuguguac
caannnnnnn nnnnnnnnn 3913743DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 137nnnnnnnnnn
nnnnnnuugg uacacaaaga aaguccuccc ccc 4313841DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 138ggagggcuuu cuuuguguac caannnnnnn nnnnnnnnnc c
4113945DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 139ggnnnnnnnn nnnnnnnnuu gguacacaaa
gaaaguccuc ccccc 4514039DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 140ggaggacuuu
cuuuguguac caannnnnnn nnnnnnnnn 3914143DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 141ggagggcuuu cuuuguguac caannnnnnn nnnnnnnnnu uuu
4314243DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 142ggaggacuuu cuuuguguac caannnnnnn
nnnnnnnnnu uuu 4314341DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 143ggagggcuuu
cuuuguguac caannnnnnn nnnnnnnnng u 4114445DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 144gunnnnnnnn nnnnnnnnuu gguacacaaa gaaaguccuc
ccccc 4514541DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 145ggaggacuuu cuuuguguac
caannnnnnn nnnnnnnnng u 4114641DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 146nnnnnnnnnn
nnnnnnuuaa gccagacuuu guuggauuug a 4114741DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 147tcaaauccaa caaagucugg cuuaannnnn nnnnnnnnnn n
4114839DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 148aaauccaaca aagucuggcu uaannnnnnn
nnnnnnnnn 3914943DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 149nnnnnnnnnn nnnnnnuuaa
gccagacuuu guuggauuuu uuu 4315041DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 150guaaauccaa
caaagucugg cuuaannnnn nnnnnnnnnn n 4115141DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 151nnnnnnnnnn nnnnnnuuaa gccagucuuu guuggauuug a
4115241DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 152tcaaauccaa caaaggcugg cuuaannnnn
nnnnnnnnnn n 4115341DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 153nnnnnnnnnn nnnnnnuuaa
gccugacuuu guuggauuug a 4115441DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 154tcaaauccaa
caaagucggg cuuaannnnn nnnnnnnnnn n 4115541DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 155nnnnnnnnnn nnnnnnuuaa gccagccuuu guuggauuug a
4115641DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156nnnnnnnnnn nnnnnnuuaa gcccgacuuu
guuggauuug a 4115743DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 157nnnnnnnnnn nnnnnnuuaa
gccagucuuu guuggauuuu uuu 4315839DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 158aaauccaaca
aaggcuggcu uaannnnnnn nnnnnnnnn 3915943DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 159nnnnnnnnnn nnnnnnuuaa gccagccuuu guuggauuuu uuu
4316041DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 160guaaauccaa caaagucggg cuuaannnnn
nnnnnnnnnn n 4116128DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 161gccagacuuu guuggauuug
aaaccatt 2816230DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 162aatgguuuca aauccaacaa
agucuggcuu 3016330DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 163gccagacuuu guuggauuug
aaaccaactt 3016432DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 164aagttgguuu caaauccaac
aaagucuggc uu 3216532DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 165gccagacuuu
guuggauuug aaaccaacag tt 3216634DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 166aactgttggu
uucaaaucca acaaagucug gcuu 3416734DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 167gccagacuuu
guuggauuug aaaccaacag cctt 3416836DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 168aaggctgttg
guuucaaauc caacaaaguc uggcuu 3616935DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 169gccagacuuu guuggauuug aaaccaacag ccatt
3517037DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170aatggctgtt gguuucaaau ccaacaaagu
cuggcuu 3717136DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 171gccagacuuu guuggauuug
aaaccaacag ccagtt 3617238DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 172aactggctgt
tgguuucaaa uccaacaaag ucuggcuu 3817337DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 173gccagacuuu guuggauuug aaaccaacag ccagctt
3717439DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 174aagctggctg ttgguuucaa auccaacaaa
gucuggcuu 3917538DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 175gccagacuuu guuggauuug
aaaccaacag ccagcatt 3817640DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 176aatgctggct
gttgguuuca aauccaacaa agucuggcuu 4017739DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 177gccagacuuu guuggauuug aaaccaacag ccagcactt
3917841DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 178aagtgctggc tgttgguuuc aaauccaaca
aagucuggcu u 4117929DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 179gccagacuuu guuggauuug
aaaccaatt 2918031DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 180aauugguuuc aaauccaaca
aagucuggcu u 3118131DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 181aattgguuuc aaauccaaca
aagucuggcu u 3118229DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 182gccagacuuu guuggauuug
aaaccaatt 2918329DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 183gccagacuuu guuggauuug
aaaccaauu 2918429DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 184gccagacuuu guuggauuug
aaaccaagu 2918529DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 185guttgguuuc aaauccaaca
aagucuggc 2918629DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 186aagggccaga cuuuguugga
uuugaaacc 2918727DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 187uuucaaaucc aacaaagucu guucctt
2718830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188aacgggccag acuuuguugg auuugaaacc
3018928DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 189uuucaaaucc aacaaagucu guuccgtt
2819031DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 190aaacgggcca gacuuuguug gauuugaaac c
3119129DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 191uuucaaaucc aacaaagucu guuccgttt
2919232DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 192aagacgggcc agacuuuguu ggauuugaaa cc
3219330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 193uuucaaaucc aacaaagucu guuccgtctt
3019433DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 194aagcacgggc cagacuuugu uggauuugaa acc
3319531DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 195uuucaaaucc aacaaagucu guuccgtgct t
3119634DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 196aagccacggg ccagacuuug uuggauuuga aacc
3419732DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 197uuucaaaucc aacaaagucu guuccgtggc tt
3219835DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 198aagcctacgg gccagacuuu guuggauuug aaacc
3519933DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 199uuucaaaucc aacaaagucu guuccgtagg ctt
3320036DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 200aagtcctacg ggccagacuu uguuggauuu
gaaacc 3620134DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 201uuucaaaucc aacaaagucu
guuccgtagg actt 3420237DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 202aagtgcctac
gggccagacu uuguuggauu ugaaacc 3720335DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 203uuucaaaucc aacaaagucu guuccgtagg cactt
3520438DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 204aagctgccta cgggccagac uuuguuggau
uugaaacc 3820536DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 205uuucaaaucc aacaaagucu
guuccgtagg cagctt 3620639DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 206aacgctgcct
acgggccaga cuuuguugga uuugaaacc 3920737DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 207uuucaaaucc aacaaagucu guuccgtagg cagcgtt
3720840DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 208aatcgctgcc tacgggccag acuuuguugg
auuugaaacc 4020938DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 209uuucaaaucc
aacaaagucu guuccgtagg cagcgatt 3821041DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 210aagtcgctgc ctacgggcca gacuuuguug gauuugaaac c
4121139DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 211uuucaaaucc aacaaagucu guuccgtagg
cagcgactt 3921231DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 212aaacgggcca gacuuuguug
gauuugaaac c 3121329DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 213uuucaaaucc aacaaagucu
guuccgutt 2921431DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 214aaacgggcca gacuuuguug
gauuugaaac c 3121529DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 215uuucaaaucc aacaaagucu
guuccgutt 2921631DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 216aaacgggcca gacuuuguug
gauuugaaac c 3121729DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 217uuucaaaucc aacaaagucu
guuccgttt 2921833DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 218ugaaacgggc cagacuuugu
uggauuugaa acc 3321931DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 219uuucaaaucc
aacaaagucu guuccgtttu g 31
* * * * *