MODULATION OF APOLIPOPROTEIN (a) EXPRESSION

Abstract

Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for diagnosis and treatment of disease associated with expression of apolipoprotein(a) are provided.

Description

RELATED APPLICATIONS

[0001] This application is a Continuation of U.S. patent application Ser. No. 12/726,286, filed Mar. 17, 2010, is a Continuation of U.S. patent application Ser. No. 10/559,647, filed Jul. 31, 2006, which is a US National Phase Application under 35 USC 371 of PCT/US2004/014540 filed on Jun. 2, 2004, which claims priority to U.S. provisional patent application No. 60/475,402, filed Jun. 2, 2003 and U.S. patent application Ser. No. 10/684,440, filed Oct. 15, 2003, each of which is incorporated by reference in its entirety.

SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled ISPH0595USC5_ST25.txt, created on Jan. 21, 2014 which is 168 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

[0003] The present invention provides compositions and methods for modulating the expression of apolipoprotein(a).

[0004] Lipoproteins are globular, micelle-like particles that consist of a non-polar core of acylglycerols and cholesteryl esters, surrounded by an amphiphilic coating consisting of protein, phospholipid and cholesterol. Lipoproteins have been classified into five broad categories on the basis of their functional and physical properties: chylomicrons (which transport dietary lipids from intestine to tissues), very low density lipoproteins (VLDL), intermediate density lipoproteins (IDL). Low density lipoproteins (LDL), (all of which transport triacylglycerols and cholesterol from the liver to tissues), and high density lipoproteins (HDL) (which transport endogenous cholesterol from tissues to the liver). Lipoprotein particles undergo continuous metabolic processing and have variable properties and compositions. Lipoprotein densities increase without decreasing particle diameter because the density of their outer coatings is less than that of the inner core. The protein components of lipoproteins are known as apolipoproteins. At least nine apolipoproteins are distributed in significant amounts among the various human lipoproteins.

[0005] Lipoprotein (a) (also known as Lp(a)) is a cholesterol rich particle of the proatherogenic LDL class. Since Lp(a) is found only in Old World primates and European hedgehogs, it has been suggested that it

does not play an essential role in lipid and lipoprotein metabolism. Most studies have shown that high concentrations of Lp(a) are strongly associated with increased risk of cardiovascular disease (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61). These observations have stimulated numerous studies in humans and other primates to investigate the factors that control Lp(a) concentrations and physiological properties (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61).

[0006] Lp(a) contains two disulfide-linked distinct proteins, apolipoprotein(a) (or ApoA) and apolipoprotein B (or ApoB) (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61). Apolipoprotein(a) is a unique apolipoprotein encoded by the LPA gene which has been shown to exclusively control the physiological concentrations of Lp(a) (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61). It varies in size due to interallelic differences in the number of tandemly repeated Kringle-4-encoding 5.5 kb sequences in the LPA gene (Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61).

[0007] Cloning of human apolipoprotein(a) in 1987 revealed homology to human plasminogen (McLean et al., Nature, 1987, 330, 132-137). The gene locus LPA encoding apolipoprotein(a) was localized to chromosome 6q26-27, in close proximity to the homologous gene for plasminogen (Frank et al., Hum. Genet., 1988, 79, 352-356).

[0008] Transgenic mice expressing human apolipoprotein(a) were found to be more susceptible than control mice to the development of lipid-staining lesions in the aorta. Consequently, apolipoprotein(a) is co-localized with lipid deposition in the artery walls (Lawn et al., Nature, 1992, 360, 670-672). As an extension of these studies, it was established that the major in vivo action of apolipoprotein(a) is inhibition of the conversion of plasminogen to plasmin which causes decreased activation of latent transforming growth factor-beta. Since transforming growth factor-beta is a negative regulator of smooth muscle cell migration and proliferation, inhibition of plasminogen activation indicates a possible mechanism for apolipoprotein(a) induction of atherosclerotic lesions (Grainger et al., Nature, 1994, 370, 460-462).

[0009] Elevated plasma levels of Lp(a), caused by increased expression of apolipoprotein(a), are associated with increased risk for atherosclerosis and its manifestations, which include hypercholesterolemia (Seed et al., N. Engl. J. Med., 1990, 322, 1494-1499), myocardial infarction (Sandkamp et al., Clin. Chem., 1990, 36, 20-23), and thrombosis (Nowak-Gottl et al., Pediatrics, 1997, 99, E11).

[0010] Moreover, the plasma concentration of Lp(a) is strongly influenced by heritable factors and is refractory to most drug and dietary manipulation (Katan and Beynen, Am. J. Epidemiol., 1987, 125, 387-399; Vessby et al., Atherosclerosis, 1982, 44, 61-71.). Pharmacologic therapy of elevated Lp(a) levels has been only moderately successful and apheresis remains the most effective therapeutic modality (Hajjar and Nachman, Annu. Rev. Med., 1996, 47, 423-442).

[0011] Morishita et al. reported the use of three ribozyme oligonucleotides against apolipoprotein(a) for inhibition of apolipoprotein(a) expression in HepG2 cells (Morishita et al., Circulation, 1998, 98, 1898-1904).

[0012] U.S. Pat. No. 5,721,138 refers to nucleotide sequences encoding the human apolipoprotein(a) gene 5'-regulatory region and isolated nucleotide sequences comprising at least thirty consecutive complementary nucleotides from human apolipoprotein(a) from nucleotide positions 208 to 1448 (Lawn, 1998).

[0013] To date, investigative and therapeutic strategies aimed at inhibiting apolipoprotein(a) function have involved the previously cited use of Lp(a) apheresis and ribozyme oligonucleotides. No existing drugs are available to specifically lower lipoprotein(a) levels in humans, and only limited models exist in which to perform drug discovery. Consequently, there remains a long-felt need for additional agents and methods capable of effectively modulating, e.g., inhibiting, apolipoprotein(a) function, and particularly a need for agents capable of safe and efficacious administration to lower alipoprotein(a) levels in patients at risk for the development of coronary artery disease.

SUMMARY OF THE INVENTION

[0014] The present invention provides compositions and methods for modulating the expression of apolipoprotein(a). Such novel compositions and methods enable research into the pathways of plasminogen and apolipoprotein(a), as well as other lipid metabolic processes. Such novel compositions and methods are useful in assessing the toxicity of chemical and pharmaceutical compounds on apolipoprotein(a) function, plasminogen or other lipid metabolic processes. Such novel compositions and methods are useful for drug discovery and for the treatment of cardiovascular conditions, including myocardial infarction and atherosclerosis, among others.

[0015] Antisense technology is emerging as an effective means for reducing the expression of specific gene products, and is uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of apolipoprotein(a) expression.

[0016] In particular, this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules or sequences encoding apolipoprotein(a). Such compounds are shown herein to modulate the expression of apolipoprotein(a). Additionally disclosed are embodiments of oligonucleotide compounds that hybridize with nucleic acid molecules encoding apolipoprotein(a) in preference to nucleic acid molecules or sequences encoding plasminogen.

[0017] The present invention is directed to compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding apolipoprotein(a), and which modulate the expression of apolipoprotein(a). Pharmaceutical and other compositions comprising the compounds of the invention are also provided.

[0018] Further provided are methods of screening for modulators of apolipoprotein(a) and methods of modulating the expression of apolipoprotein(a) in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. In these methods, the cells or tissues may be contacted in vivo. Alternatively, the cells or tissues may be contacted ex vivo.

[0019] Methods of treating an animal, particularly a human, having, suspected of having, or being prone to a disease or condition associated with expression of apolipoprotein(a) are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.

[0020] In one aspect, the invention provides the use of a compound or composition of the invention in the manufacture of a medicament for the treatment of any and all conditions disclosed herein.

DETAILED DESCRIPTION OF THE INVENTION

A. Overview of the Invention

[0021] The present invention employs compounds, preferably oligonucleotides and similar species, for use in modulating the function or effect of nucleic acid molecules encoding apolipoprotein(a). This is accomplished by providing oligonucleotides that specifically hybridize with one or more nucleic acid molecules encoding apolipoprotein(a). As used herein, the terms "target nucleic acid" and "nucleic acid molecule encoding apolipoprotein(a)" have been used for convenience to encompass DNA encoding apolipoprotein(a), RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as "antisense". Antisense technology is emerging as an effective means of reducing the expression of specific gene products and is uniquely useful in a number of therapeutic, diagnostic and research applications involving modulation of apolipoprotein(a) expression.

[0022] Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as "antisense inhibition." Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments, such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.

[0023] The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA, which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of apolipoprotein(a). In the context of the present invention, "modulation" and "modulation of expression" mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.

[0024] In the context of this invention, "hybridization" means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.

[0025] An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired. Such conditions include, e.g., physiological conditions in the case of in vivo assays or therapeutic treatment, and conditions in which assays are performed in the case of in vitro assays.

[0026] In the present invention the phrase "stringent hybridization conditions" or "stringent conditions" refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. In the context of this invention, "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.

[0027] "Complementary," as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound) is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases that can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.

[0028] The sequence of an antisense compound can be, but need not necessarily be, 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event. In one embodiment of this invention, the antisense compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85% sequence complementarity to a target region within the target nucleic acid. In other embodiments, the antisense compounds of the present invention comprise at least 90% sequence complementarity and even comprise at least 95% or at least 99% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases, and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0029] Percent homology, sequence identity, or complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some embodiments, homology, sequence identity, or complementarity between the oligomeric and target is between about 50% to about 60%. In some embodiments, homology, sequence identity, or complementarity is between about 60% to about 70%. In other embodiments, homology, sequence identity, or complementarity is between about 70% and about 80%. In still other embodiments, homology, sequence identity, or complementarity is between about 80% and about 90%. In yet other embodiments, homology, sequence identity, or complementarity is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%.

B. Compounds of the Invention

[0030] According to the present invention, "compounds" include antisense oligomeric compounds, antisense oligonucleotides, siRNAs, external guide sequence (EGS) oligonucleotides, alternate splicers, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, partially single-stranded, or circular oligomeric compounds. Specifically excluded from the definition of "compounds" herein are ribozymes that contain internal or external "bulges" that do not hybridize to the target sequence. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.

[0031] One non-limiting example of such an enzyme is RNase H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds that are "DNA-like" elicit RNase H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.

[0032] While one form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.

[0033] The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). The primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). Recently, the single-stranded RNA oligomers of antisense polarity of the dsRNAs have been reported to be the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697).

[0034] In the context of this invention, the term "oligomeric compound" refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars, and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid, and increased stability in the presence of nucleases.

[0035] The oligonucleotides of the present invention also include modified oligonucleotides in which a different base is present at one or more of the nucleotide positions in the oligonucleotide. For example, if the first nucleotide is an adenosine, modified oligonucleotides may be produced that contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide. These oligonucleotides are then tested using the methods described herein to determine their ability to inhibit expression of apolipoprotein(a) mRNA.

[0036] While oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to, oligonucleotide analogs and mimetics such as those described herein.

[0037] The compounds in accordance with this invention comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.

[0038] In one embodiment, the compounds of the invention are 12 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.

[0039] In another embodiment, the compounds of the invention are 15 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.

[0040] In another embodiment, compounds of this invention are oligonucleotides from about 12 to about 50 nucleobases. In another embodiment, compounds of this invention comprise from about 15 to about 30 nucleobases.

[0041] In another embodiment, the antisense compounds comprise at least 8 contiguous nucleobases of an antisense compound disclosed herein.

[0042] Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.

[0043] Exemplary compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5'-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5'-terminus of the antisense compound that is specifically hybridizable to the target nucleic acid, and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). Similarly, exemplary antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3'-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3'-terminus of the antisense compound that is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases).

[0044] Exemplary compounds of this invention may be found identified in the Examples and listed in Tables 1 and 7. In addition to oligonucleotide compounds that bind to target sequences of apolipoprotein(a) in general, there are also exemplified oligonucleotide compounds of this invention that bind to target nucleotide sequences of apolipoprotein(a), but do not bind to, or do not bind preferentially to, sequences of plasminogen due to lack of homology between the two nucleic acid molecules or a sufficient number of mismatches in the target sequences. These latter compounds are also useful in various therapeutic methods of this invention. Examples of antisense compounds to such `mismatched` target sequences as described above include SEQ ID NO: 12 and SEQ ID NO: 23 of Table 1 below. See, also, the discussion of target regions below.

[0045] One having skill in the art armed with the exemplary antisense compounds illustrated herein will be able, without undue experimentation, to identify further useful antisense compounds.

C. Targets of the Invention

[0046] "Targeting" an antisense compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes apolipoprotein(a).

[0047] The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term "region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. "Segments" are defined as smaller or sub-portions of regions within a target nucleic acid. "Sites," as used in the present invention, are defined as positions within a target nucleic acid.

[0048] Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon". A minority of genes having translation initiation codons with the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG; and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). Eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding apolipoprotein(a), regardless of the sequence(s) of such codons. A translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively).

[0049] The terms "start codon region" and "translation initiation codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "translation termination codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. Consequently, the "start codon region" (or "translation initiation codon region") and the "stop codon region" (or "translation termination codon region") are all regions that may be targeted effectively with the antisense compounds of the present invention.

[0050] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Within the context of the present invention, a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.

[0051] Another target region includes the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene). Still another target region includes the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. Another target region for this invention is the 5' cap region.

[0052] Accordingly, the present invention provides antisense compounds that target a portion of nucleotides 1-2480 as set forth in SEQ ID NO: 4. In another embodiment, the antisense compounds target at least an 8-nucleobase portion of nucleotides 1-45, comprising the 5'UTR as set forth in SEQ ID NO: 4. In another embodiment, the antisense compounds target at least an 8-nucleobase portion of nucleotides 13593-13938, comprising the 3'UTR as set forth in SEQ ID NO: 4. In another embodiment, the antisense compounds target at least an 8-nucleobase portion of nucleotides 46-13592, comprising the coding region as set forth in SEQ ID NO: 4. In still other embodiments, the antisense compounds target at least an 8-nucleobase portion of a "preferred target segment" (as defined herein) as set forth in Table 2.

[0053] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence, resulting in exon-exon junctions at the sites where exons are joined. Targeting exon-exon junctions can be useful in situations where the overproduction of a normal splice product is implicated in disease, or where the overproduction of an aberrant splice product is implicated in disease. In one embodiment, targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, is particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. An aberrant fusion junction due to rearrangement or deletion is another embodiment of a target site. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources known as "fusion transcripts" are also suitable target sites. Introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.

[0054] Alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants". More specifically, "pre-mRNA variants" are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.

[0055] Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants, and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants". If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.

[0056] Variants can be produced through the use of alternative signals to start or stop transcription. Pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as "alternative stop variants" of that pre-mRNA or mRNA. One specific type of alternative stop variant is the "polyA variant" in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites. Within the context of the invention, the types of variants described herein are also embodiments of target nucleic acids.

[0057] The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as "preferred target segments." As used herein the term "preferred target segment" is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid that are accessible for hybridization.

[0058] While the specific sequences of certain exemplary target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional target segments are readily identifiable by one having ordinary skill in the art in view of this disclosure.

[0059] Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.

[0060] Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5'-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5'-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). Similarly preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3'-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3'-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). One having skill in the art armed with the target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.

[0061] Once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.

[0062] In various embodiments of this invention, the oligomeric compounds are targeted to regions of a target apolipoprotein(a) nucleobase sequence, such as those disclosed herein. All regions of the target nucleobase sequence to which an oligomeric antisense compound can be targeted, wherein the regions are greater than or equal to 8 and less than or equal to 80 nucleobases, are described as follows:

[0063] Let R(m, n+m-1) be a region from a target nucleobase sequence, where "n" is the 5'-most nucleobase position of the region, where "n+m-1" is the 3'-most nucleobase position of the region and where "m" is the length of the region. A set "S(m)", of regions of length "m" is defined as the regions where n ranges from 1 to L-m+1, where L is the length of the target nucleobase sequence and L>m. A set, "A", of all regions can be constructed as a union of the sets of regions for each length from where m is greater than or equal to 8 and is less than or equal to 80.

[0064] This set of regions can be represented using the following mathematical notation:

A = m S ( m ) ##EQU00001## where m .di-elect cons. N | 8 .ltoreq. m .ltoreq. 80 ##EQU00001.2## and ##EQU00001.3## S ( m ) = { R n , n + m - 1 | n .di-elect cons. { 1 , 2 , 3 , , L - m + 1 } } ##EQU00001.4##

[0065] where the mathematical operator | indicates "such that",

[0066] where the mathematical operator .epsilon. indicates "a member of a set" (e.g. y.epsilon.Z indicates that element y is a member of set Z),

[0067] where x is a variable,

[0068] where N indicates all natural numbers, defined as positive integers,

[0069] and where the mathematical operator .orgate. indicates "the union of sets".

[0070] For example, the set of regions for m equal to 8, 9 and 80 can be constructed in the following manner. The set of regions, each 8 nucleobases in length, S(m=8), in a target nucleobase sequence 100 nucleobases in length (L=100), beginning at position 1 (n=1) of the target nucleobase sequence, can be created using the following expression:

S(8)={R.sub.1,8|n.epsilon.{1,2,3, . . . ,93}}

and describes the set of regions comprising nucleobases 1-8, 2-9, 3-10, 4-11, 5-12, 6-13, 7-14, 8-15, 9-16, 10-17, 11-18, 12-19, 13-20, 14-21, 15-22, 16-23, 17-24, 18-25, 19-26, 20-27, 21-28, 22-29, 23-30, 24-31, 25-32, 26-33, 27-34, 28-35, 29-36, 30-37, 31-38, 32-39, 33-40, 34-41, 35-42, 36-43, 37-44, 38-45, 39-46, 40-47, 41-48, 42-49, 43-50, 44-51, 45-52, 46-53, 47-54, 48-55, 49-56, 50-57, 51-58, 52-59, 53-60, 54-61, 55-62, 56-63, 57-64, 58-65, 59-66, 60-67, 61-68, 62-69, 63-70, 64-71, 65-72, 66-73, 67-74, 68-75, 69-76, 70-77, 71-78, 72-79, 73-80, 74-81, 75-82, 76-83, 77-84, 78-85, 79-86, 80-87, 81-88, 82-89, 83-90, 84-91, 85-92, 86-93, 87-94, 88-95, 89-96, 90-97, 91-98, 92-99, 93-100.

[0071] An additional set for regions 20 nucleobases in length, in a target sequence 100 nucleobases in length, beginning at position 1 of the target nucleobase sequence, can be described using the following expression:

S(20)={R.sub.1,20|n.epsilon.{1,2,3, . . . ,81}}

and describes the set of regions comprising nucleobases 1-20, 2-21, 3-22, 4-23, 5-24, 6-25, 7-26, 8-27, 9-28, 10-29, 11-30, 12-31, 13-32, 14-33, 15-34, 16-35, 17-36, 18-37, 19-38, 20-39, 21-40, 22-41, 23-42, 24-43, 25-44, 26-45, 27-46, 28-47, 29-48, 30-49, 31-50, 32-51, 33-52, 34-53, 35-54, 36-55, 37-56, 38-57, 39-58, 40-59, 41-60, 42-61, 43-62, 44-63, 45-64, 46-65, 47-66, 48-67, 49-68, 50-69, 51-70, 52-71, 53-72, 54-73, 55-74, 56-75, 57-76, 58-77, 59-78, 60-79, 61-80, 62-81, 63-82, 64-83, 65-84, 66-85, 67-86, 68-87, 69-88, 70-89, 71-90, 72-91, 73-92, 74-93, 75-94, 76-95, 77-96, 78-97, 79-98, 80-99, 81-100.

[0072] An additional set for regions 80 nucleobases in length, in a target sequence 100 nucleobases in length, beginning at position 1 of the target nucleobase sequence, can be described using the following expression:

S(80)={R.sub.1,80|n.epsilon.{1,2,3, . . . ,21}}

and describes the set of regions comprising nucleobases 1-80, 2-81, 3-82, 4-83, 5-84, 6-85, 7-86, 8-87, 9-88, 10-89, 11-90, 12-91, 13-92, 14-93, 15-94, 16-95, 17-96, 18-97, 19-98, 20-99, 21-100.

[0073] Thus, in this example, A would include regions 1-8, 2-9, 3-10-93-100, 1-20, 2-21, 3-22 . . . 81-100, 1-80, 2-81, 3-82 . . . 21-100.

[0074] The union of these aforementioned example sets and other sets for lengths from 10 to 19 and 21 to 79 can be described using the mathematical expression:

A = m S ( m ) ##EQU00002##

[0075] where .orgate. represents the union of the sets obtained by combining all members of all sets.

[0076] The mathematical expressions described herein define all possible target regions in a target nucleobase sequence of any length L, where the region is of length m, and where m is greater than or equal to 8 and less than or equal to 80 nucleobases, and where m is less than L, and where n is less than L-m+1.

[0077] In one embodiment, the oligonucleotide compounds of this invention are 100% complementary to these sequences or to small sequences found within each of the above listed sequences. In another embodiment the oligonucleotide compounds have from at least 3 or 5 mismatches per 20 consecutive nucleobases in individual nucleobase positions to these target regions. Still other compounds of the invention are targeted to overlapping regions of the above-identified portions of the apolipoprotein(a) sequence.

[0078] In still another embodiment, target regions include those portions of the apolipoprotion(a) sequence that do not overlap with plasminogen sequences. For example, among such apolipoprotein(a) target sequences are included those found within the following nucleobase sequences: 10624-10702, 10963-11036, 11325-11354, 11615-11716, 11985-12038, 12319-12379, 13487-13491, and 13833-13871. As a further example, target sequences of apolipoprotein(a) that have at least 6 mismatches with the sequence of plasminogen over at least 20 consecutive nucleotides are desirable targets for antisense compounds that bind preferentially to apolipoprotein(a) rather than to plasminogen. Such target sequences can readily be identified by a BLAST comparison of the two GENBANK.RTM. sequences of plasminogen (e.g., GENBANK.RTM. Accession No. NM.sub.--000301) and apolipoprotein(a) (e.g., GENBANK.RTM. Accession No. NM.sub.--005577.1).

[0079] In still another embodiment, the target regions include portions of the apolipoprotein (a) sequence that overlap with portions of the plasminogen or apolipoprotein B sequence, but to which antisense compounds bind to inhibit apolipoprotein (a) but do not inhibit, to any appreciable degree, plasminogen and/or apolipoprotein B. Such targets may be obtained from the target regions of SEQ ID NOs: 46, 54, 56, 57, 59, 60, 61, 62, 64, 67, 68 and 69 of Table 2. These target regions are bound by antisense oligonucleotides of SEQ ID Nos: 11, 23, 28, 30, 31, 33, 34, 35, 36, 39, 42, 43, and 45, for example, which inhibit apolipoprotein(a) but not a second protein, which is plasminogen (see Example 22) or apolipoprotein B (see Example 23).

D. Screening and Target Validation

[0080] In a further embodiment, the "preferred target segments" identified herein may be employed in a screen for additional compounds that modulate the expression of apolipoprotein(a). "Modulators" are those compounds that decrease or increase the expression of a nucleic acid molecule encoding apolipoprotein(a) and which comprise at least an 8-nucleobase portion that is complementary to a preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding apolipoprotein(a) with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding apolipoprotein(a). Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding apolipoprotein(a), the modulator may then be employed in further investigative studies of the function of apolipoprotein(a), or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.

[0081] The preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.

[0082] Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of the antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science, 2002, 295, 694-697).

[0083] The compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between apolipoprotein(a) and a disease state, phenotype, or condition. These methods include detecting or modulating apolipoprotein(a) comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of apolipoprotein(a) and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype.

E. Kits, Research Reagents, Diagnostics, and Therapeutics

[0084] The compounds of the present invention are utilized for diagnostics, therapeutics, and prophylaxis, and as research reagents and components of kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.

[0085] For use in kits and diagnostics and in various biological systems, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, are used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.

[0086] As used herein the term "biological system" or "system" is defined as any organism, cell, cell culture or tissue that expresses, or is made competent to express products of the LPA gene. These include, but are not limited to, humans, transgenic animals, cells, cell cultures, tissues, xenografts, transplants and combinations thereof.

[0087] As one nonlimiting example, expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds that affect expression patterns.

[0088] Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000 480, 17-24; Celis, et al., FEBS Lett., 2000 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).

[0089] The compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding apolipoprotein(a). Primers and probes disclosed herein are useful in methods requiring the specific detection of nucleic acid molecules encoding apolipoprotein(a) and in the amplification of said nucleic acid molecules for detection or for use in further studies of apolipoprotein(a). Hybridization of the primers and probes with a nucleic acid encoding apolipoprotein(a) can be detected by means known in the art. Such means may include conjugation of an enzyme to the primers and probes, radiolabelling of the primers and probes, or any other suitable detection means. Kits using such detection means for detecting the level of apolipoprotein(a) in a sample may also be prepared.

[0090] The invention further provides for the use of a compound or composition of the invention in the manufacture of a medicament for the treatment of any and all conditions disclosed herein.

[0091] The specificity and sensitivity of antisense are also harnessed by those of skill in the art for therapeutic uses. Antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs have been safely and effectively administered to humans and numerous clinical trials are underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.

[0092] For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of apolipoprotein(a) is treated by administering antisense compounds in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a apolipoprotein(a) inhibitor. The apolipoprotein(a) inhibitors of the present invention effectively inhibit the activity of the apolipoprotein(a) protein or inhibit the expression of the apolipoprotein(a) protein. In one embodiment, the activity or expression of apolipoprotein(a) in an animal is inhibited by about 10%. Preferably, the activity or expression of apolipoprotein(a) in an animal is inhibited by about 30%. More preferably, the activity or expression of apolipoprotein(a) in an animal is inhibited by 50% or more. Thus, the oligomeric compounds modulate expression of apolipoprotein(a) mRNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.

[0093] For example, the reduction of the expression of apolipoprotein(a) may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding apolipoprotein(a) protein and/or the apolipoprotein(a) protein itself. For example, apolipoprotein(a) is produced in the liver, and can be found in normal and atherosclerotic vessel walls.

[0094] The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.

F. Modifications

[0095] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

Modified Internucleoside Linkages (Backbones)

[0096] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

[0097] Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

[0098] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0099] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

[0100] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

Modified Sugar and Internucleoside Linkages--Mimetics

[0101] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e. the backbone) of the nucleotide units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate target nucleic acid. One such compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0102] Further embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH.sub.2--NH--O--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene (methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --O--N(CH.sub.3)--CH.sub.2--CH.sub.2-[wherein the native phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

Modified Sugars

[0103] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Particularly preferred are O[(CH.sub.2).sub.mO]CH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2'-.beta.-methoxyethyl (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-methoxyethoxy or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2, also described in examples herein below.

[0104] Other modifications include 2'-methoxy (2'-O--CH.sub.3), 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl (2'-O--CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl (2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The 2'-modification may be in the arabino (up) position or ribo (down) position. A preferred 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920; certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0105] A further modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (--CH.sub.2--).sub.n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in International Patent Publication Nos. WO 98/39352 and WO 99/14226.

Natural and Modified Nucleobases

[0106] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0107] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941; certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.

Conjugates

[0108] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosures of which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999), which is incorporated herein by reference in its entirety.

[0109] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928; and 5,688,941; certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.

[0110] Oligomeric compounds used in the compositions of the present invention can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of oligomeric compounds to enhance properties such as for example nuclease stability. Included in stabilizing groups are cap structures. By "cap structure or terminal cap moiety" is meant chemical modifications, which have been incorporated at either terminus of oligonucleotides (see for example Wincott et al., International Patent Publication No. WO 97/26270, incorporated by reference herein). These terminal modifications protect the oligomeric compounds having terminal nucleic acid molecules from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap) or at the 3'-terminus (3'-cap) or at both termini. In non-limiting examples, the 5'-cap includes inverted abasic residue (moiety), 4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety (for more details see Wincott et al., International Patent Publication No. WO 97/26270, incorporated by reference herein).

[0111] Particularly preferred 3'-cap structures of the present invention include, for example 4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety; 5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate; 5'-amino; bridging and/or non-bridging 5'-phosphoramidate, phosphorothioate and/or phosphorodithioate; bridging or non bridging methylphosphonate and 5'-mercapto moieties (for more details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925; incorporated by reference herein).

[0112] Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an oligomeric compound to impart nuclease stability include those disclosed in International Patent Publication No. WO 03/004602, published Jan. 16, 2003.

Chimeric Compounds

[0113] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.

[0114] The present invention also includes antisense compounds that are chimeric compounds. "Chimeric" antisense compounds, or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. The cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases such as RNaseL, which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0115] Preferred chimeric oligonucleotides are those disclosed in the Examples herein. Particularly preferred chimeric oligonucleotides are those referred to as ISIS 144367, ISIS 144368, ISIS 144379, ISIS 144381, and ISIS 144396.

[0116] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Chimeric antisense compounds can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap" segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers".

[0117] Such compounds have also been referred to in the art as hybrids. In a gapmer that is 20 nucleotides in length, a gap or wing can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 nucleotides in length. In one embodiment, a 20-nucleotide gapmer is comprised of a gap 8 nucleotides in length, flanked on both the 5' and 3' sides by wings 6 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 10 nucleotides in length, flanked on both the 5' and 3' sides by wings 5 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 12 nucleotides in length flanked on both the 5' and 3' sides by wings 4 nucleotides in length. In a further embodiment, a 20-nucleotide gapmer is comprised of a gap 14 nucleotides in length flanked on both the 5' and 3' sides by wings 3 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 16 nucleotides in length flanked on both the 5' and 3' sides by wings 2 nucleotides in length. In a further embodiment, a 20-nucleotide gapmer is comprised of a gap 18 nucleotides in length flanked on both the 5' and 3' ends by wings 1 nucleotide in length. Alternatively, the wings are of different lengths, for example, a 20-nucleotide gapmer may be comprised of a gap 10 nucleotides in length, flanked by a 6-nucleotide wing on one side (5' or 3') and a 4-nucleotide wing on the other side (5' or 3').

[0118] In a hemimer, an "open end" chimeric antisense compound, 20 nucleotides in length, a gap segment, located at either the 5' or 3' terminus of the oligomeric compound, can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides in length. For example, a 20-nucleotide hemimer can have a gap segment of 10 nucleotides at the 5' end and a second segment of 10 nucleotides at the 3' end. Alternatively, a 20-nucleotide hemimer can have a gap segment of 10 nucleotides at the 3' end and a second segment of 10 nucleotides at the 5' end.

[0119] Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922; certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

G. Formulations

[0120] The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756; each of which is herein incorporated by reference.

[0121] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.

[0122] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

[0123] The present invention also includes pharmaceutical compositions and formulations that include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

[0124] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0125] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0126] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.

[0127] Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 .mu.m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug that may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

[0128] Formulations of the present invention include liposomal formulations. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

[0129] Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

[0130] The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

[0131] In one embodiment, the present invention employs various penetration enhancers to affect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.

[0132] One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e., route of administration.

[0133] Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoyl-phosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoyl-phosphatidyl ethanolamine DOTMA).

[0134] For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298, filed May 20, 1999, which is incorporated herein by reference in its entirety.

[0135] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in U.S. Published Patent Application No. 2003/0040497 (Feb. 27, 2003) and its parent applications; U.S. Published Patent Application No. 2003/0027780 (Feb. 6, 2003) and its parent applications; and U.S. patent application Ser. No. 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.

[0136] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0137] Oligonucleotides may be formulated for delivery in vivo in an acceptable dosage form, e.g. as parenteral or non-parenteral formulations. Parenteral formulations include intravenous (IV), subcutaneous (SC), intraperitoneal (IP), intravitreal and intramuscular (IM) formulations, as well as formulations for delivery via pulmonary inhalation, intranasal administration, topical administration, etc. Non-parenteral formulations include formulations for delivery via the alimentary canal, e.g. oral administration, rectal administration, intrajejunal instillation, etc. Rectal administration includes administration as an enema or a suppository. Oral administration includes administration as a capsule, a gel capsule, a pill, an elixir, etc.

[0138] In some embodiments, an oligonucleotide may be administered to a subject via an oral route of administration. The subject may be an animal or a human (man). An animal subject may be a mammal, such as a mouse, rat, mouse, a rat, a dog, a guinea pig, a monkey, a non-human primate, a cat or a pig. Non-human primates include monkeys and chimpanzees. A suitable animal subject may be an experimental animal, such as a mouse, a rat, a dog, a monkey, a non-human primate, a cat or a pig.

[0139] In some embodiments, the subject may be a human. In certain embodiments, the subject may be a human patient in need of therapeutic treatment as discussed in more detail herein. In certain embodiments, the subject may be in need of modulation of expression of one or more genes as discussed in more detail herein. In some particular embodiments, the subject may be in need of inhibition of expression of one or more genes as discussed in more detail herein. In particular embodiments, the subject may be in need of modulation, i.e. inhibition or enhancement, of apolipoprotein(a) in order to obtain therapeutic indications discussed in more detail herein.

[0140] In some embodiments, non-parenteral (e.g. oral) oligonucleotide formulations according to the present invention result in enhanced bioavailability of the oligonucleotide. In this context, the term "bioavailability" refers to a measurement of that portion of an administered drug which reaches the circulatory system (e.g. blood, especially blood plasma) when a particular mode of administration is used to deliver the drug. Enhanced bioavailability refers to a particular mode of administration's ability to deliver oligonucleotide to the peripheral blood plasma of a subject relative to another mode of administration. For example, when a non-parenteral mode of administration (e.g. an oral mode) is used to introduce the drug into a subject, the bioavailability for that mode of administration may be compared to a different mode of administration, e.g. an IV mode of administration. In some embodiments, the area under a compound's blood plasma concentration curve (AUC.sub.0) after non-parenteral (e.g. oral, rectal, intrajejunal) administration may be divided by the area under the drug's plasma concentration curve after intravenous (i.v.) administration (AUC.sub.iv) to provide a dimensionless quotient (relative bioavailability, RB) that represents fraction of compound absorbed via the non-parenteral route as compared to the IV route. A composition's bioavailability is said to be enhanced in comparison to another composition's bioavailability when the first composition's relative bioavailability (RB.sub.1) is greater than the second composition's relative bioavailability (RB.sub.2).

[0141] In general, bioavailability correlates with therapeutic efficacy when a compound's therapeutic efficacy is related to the blood concentration achieved, even if the drug's ultimate site of action is intracellular (van Berge-Henegouwen et al., Gastroenterol., 1977, 73, 300). Bioavailability studies have been used to determine the degree of intestinal absorption of a drug by measuring the change in peripheral blood levels of the drug after an oral dose (DiSanto, Chapter 76 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 1451-1458).

[0142] In general, an oral composition's bioavailability is said to be "enhanced" when its relative bioavailability is greater than the bioavailability of a composition substantially consisting of pure oligonucleotide, i.e. oligonucleotide in the absence of a penetration enhancer.

[0143] Organ bioavailability refers to the concentration of compound in an organ. Organ bioavailability may be measured in test subjects by a number of means, such as by whole-body radiography. Organ bioavailability may be modified, e.g. enhanced, by one or more modifications to the oligonucleotide, by use of one or more carrier compounds or excipients, etc. as discussed in more detail herein. In general, an increase in bioavailability will result in an increase in organ bioavailability.

[0144] Oral oligonucleotide compositions according to the present invention may comprise one or more "mucosal penetration enhancers," also known as "absorption enhancers" or simply as "penetration enhancers." Accordingly, some embodiments of the invention comprise at least one oligonucleotide in combination with at least one penetration enhancer. In general, a penetration enhancer is a substance that facilitates the transport of a drug across mucous membrane(s) associated with the desired mode of administration, e.g. intestinal epithelial membranes. Accordingly, it is desirable to select one or more penetration enhancers that facilitate the uptake of an oligonucleotide, without interfering with the activity of the oligonucleotide, and in such a manner the oligonucleotide may be introduced into the body of an animal without unacceptable side-effects such as toxicity, irritation or allergic response.

[0145] Embodiments of the present invention provide compositions comprising one or more pharmaceutically acceptable penetration enhancers, and methods of using such compositions, which result in the improved bioavailability of oligonucleotides administered via non-parenteral modes of administration. Heretofore, certain penetration enhancers have been used to improve the bioavailability of certain drugs. See Muranishi, Crit. Rev. Ther. Drug Carrier Systems, 1990, 7, 1 and Lee et al., Crit. Rev. Ther. Drug Carrier Systems, 1991, 8, 91. It has been found that the uptake and delivery of oligonucleotides, relatively complex molecules which are known to be difficult to administer to animals and man, can be greatly improved even when administered by non-parenteral means through the use of a number of different classes of penetration enhancers.

[0146] In some embodiments, compositions for non-parenteral administration include one or more modifications from naturally-occurring oligonucleotides (i.e. full-phosphodiester deoxyribosyl or full-phosphodiester ribosyl oligonucleotides). Such modifications may increase binding affinity, nuclease stability, cell or tissue permeability, tissue distribution, or other biological or pharmacokinetic property. Modifications may be made to the base, the linker, or the sugar, in general, as discussed in more detail herein with regards to oligonucleotide chemistry. In some embodiments of the invention, compositions for administration to a subject, and in particular oral compositions for administration to an animal or human subject, will comprise modified oligonucleotides having one or more modifications for enhancing affinity, stability, tissue distribution, or another biological property.

[0147] Suitable modified linkers include phosphorothioate linkers. In some embodiments according to the invention, the oligonucleotide has at least one phosphorothioate linker. Phosphorothioate linkers provide nuclease stability as well as plasma protein binding characteristics to the oligonucleotide. Nuclease stability is useful for increasing the in vivo lifetime of oligonucleotides, while plasma protein binding decreases the rate of first pass clearance of oligonucleotide via renal excretion. In some embodiments according to the present invention, the oligonucleotide has at least two phosphorothioate linkers. In some embodiments, wherein the oligonucleotide has exactly n nucleosides, the oligonucleotide has from one to n-1 phosphorothioate linkages. In some embodiments, wherein the oligonucleotide has exactly n nucleosides, the oligonucleotide has n-1 phosphorothioate linkages. In other embodiments wherein the oligonucleotide has exactly n nucleoside, and n is even, the oligonucleotide has from 1 to n/2 phosphorothioate linkages, or, when n is odd, from 1 to (n-1)/2 phosphorothioate linkages. In some embodiments, the oligonucleotide has alternating phosphodiester (PO) and phosphorothioate (PS) linkages. In other embodiments, the oligonucleotide has at least one stretch of two or more consecutive PO linkages and at least one stretch of two or more PS linkages. In other embodiments, the oligonucleotide has at least two stretches of PO linkages interrupted by at least on PS linkage.

[0148] In some embodiments, at least one of the nucleosides is modified on the ribosyl sugar unit by a modification that imparts nuclease stability, binding affinity or some other beneficial biological property to the sugar. In some cases the sugar modification includes a 2'-modification, e.g. the 2'-OH of the ribosyl sugar is replaced or substituted. Suitable replacements for 2'-OH include 2'-F and 2'-arabino-F. Suitable substitutions for OH include 2'-O-alkyl, e.g. 2-O-methyl, and 2'-.beta.-substituted alkyl, e.g. 2'-O-methoxyethyl, 2'-.beta.-aminopropyl, etc. In some embodiments, the oligonucleotide contains at least one 2'-modification. In some embodiments, the oligonucleotide contains at least 2 2'-modifications. In some embodiments, the oligonucleotide has at least one 2'-modification at each of the termini (i.e. the 3'- and 5'-terminal nucleosides each have the same or different 2'-modifications). In some embodiments, the oligonucleotide has at least two sequential 2'-modifications at each end of the oligonucleotide. In some embodiments, oligonucleotides further comprise at least one deoxynucleoside. In particular embodiments, oligonucleotides comprise a stretch of deoxynucleosides such that the stretch is capable of activating RNase (e.g. RNase H) cleavage of an RNA to which the oligonucleotide is capable of hybridizing. In some embodiments, a stretch of deoxynucleosides capable of activating RNase-mediated cleavage of RNA comprises about 6 to about 16, e.g. about 8 to about 16 consecutive deoxynucleosides.

[0149] Oral compositions for administration of non-parenteral oligonucleotide compositions of the present invention may be formulated in various dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The term "alimentary delivery" encompasses e.g. oral, rectal, endoscopic and sublingual/buccal administration. A common requirement for these modes of administration is absorption over some portion or all of the alimentary tract and a need for efficient mucosal penetration of the nucleic acid(s) so administered.

[0150] Delivery of a drug via the oral mucosa, as in the case of buccal and sublingual administration, has several desirable features, including, in many instances, a more rapid rise in plasma concentration of the drug than via oral delivery (Harvey, Chapter 35 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, page 711).

[0151] Endoscopy may be used for drug delivery directly to an interior portion of the alimentary tract. For example, endoscopic retrograde cystopancreatography (ERCP) takes advantage of extended gastroscopy and permits selective access to the biliary tract and the pancreatic duct (Hirahata et al., Gan To Kagaku Ryoho, 1992, 19(10 Suppl.), 1591). Pharmaceutical compositions, including liposomal formulations, can be delivered directly into portions of the alimentary canal, such as, e.g., the duodenum (Somogyi et al., Pharm. Res., 1995, 12, 149) or the gastric submucosa (Akamo et al., Japanese J. Cancer Res., 1994, 85, 652) via endoscopic means. Gastric lavage devices (Inoue et al., Artif. Organs, 1997, 21, 28) and percutaneous endoscopic feeding devices (Pennington et al., Ailment Pharmacol. Ther., 1995, 9, 471) can also be used for direct alimentary delivery of pharmaceutical compositions.

[0152] In some embodiments, oligonucleotide formulations may be administered through the anus into the rectum or lower intestine. Rectal suppositories, retention enemas or rectal catheters can be used for this purpose and may be preferred when patient compliance might otherwise be difficult to achieve (e.g., in pediatric and geriatric applications, or when the patient is vomiting or unconscious). Rectal administration can result in more prompt and higher blood levels than the oral route. (Harvey, Chapter 35 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, page 711). Because about 50% of the drug that is absorbed from the rectum will bypass the liver, administration by this route significantly reduces the potential for first-pass metabolism (Benet et al., Chapter 1 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996).

[0153] One advantageous method of non-parenteral administration oligonucleotide compositions is oral delivery. Some embodiments employ various penetration enhancers in order to effect transport of oligonucleotides and other nucleic acids across mucosal and epithelial membranes. Penetration enhancers may be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Accordingly, some embodiments comprise oral oligonucleotide compositions comprising at least one member of the group consisting of surfactants, fatty acids, bile salts, chelating agents, and non-chelating surfactants. Further embodiments comprise oral oligonucleotide comprising at least one fatty acid, e.g. capric or lauric acid, or combinations or salts thereof. Other embodiments comprise methods of enhancing the oral bioavailability of an oligonucleotide, the method comprising co-administering the oligonucleotide and at least one penetration enhancer.

[0154] Other excipients that may be added to oral oligonucleotide compositions include surfactants (or "surface-active agents"), which are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the alimentary mucosa and other epithelial membranes is enhanced. In addition to bile salts and fatty acids, surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and perfluorohemical emulsions, such as FC-43 (Takahashi et al., J. Pharm. Phamacol., 1988, 40, 252).

[0155] Fatty acids and their derivatives which act as penetration enhancers and may be used in compositions of the present invention include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines and mono- and di-glycerides thereof and/or physiologically acceptable salts thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651).

[0156] In some embodiments, oligonucleotide compositions for oral delivery comprise at least two discrete phases, which phases may comprise particles, capsules, gel-capsules, microspheres, etc. Each phase may contain one or more oligonucleotides, penetration enhancers, surfactants, bioadhesives, effervescent agents, or other adjuvant, excipient or diluent. In some embodiments, one phase comprises at least one oligonucleotide and at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and substantially no oligonucleotide. In some embodiments, at least one phase is compounded with at least one degradation retardant, such as a coating or a matrix, which delays release of the contents of that phase. In some embodiments, a first phase comprises at least one oligonucleotide, and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and a release-retardant. In particular embodiments, an oral oligonucleotide comprises a first phase comprising particles containing an oligonucleotide and a penetration enhancer, and a second phase comprising particles coated with a release-retarding agent and containing penetration enhancer.

[0157] A variety of bile salts also function as penetration enhancers to facilitate the uptake and bioavailability of drugs. The physiological roles of bile include the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996, pages 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus, the term "bile salt" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (CDCA, sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579).

[0158] In some embodiments, penetration enhancers useful in some embodiments of present invention are mixtures of penetration enhancing compounds. One such penetration enhancer is a mixture of UDCA (and/or CDCA) with capric and/or lauric acids or salts thereof e.g. sodium. Such mixtures are useful for enhancing the delivery of biologically active substances across mucosal membranes, in particular intestinal mucosa. Other penetration enhancer mixtures comprise about 5-95% of bile acid or salt(s) UDCA and/or CDCA with 5-95% capric and/or lauric acid. Particular penetration enhancers are mixtures of the sodium salts of UDCA, capric acid and lauric acid in a ratio of about 1:2:2 respectively. Another such penetration enhancer is a mixture of capric and lauric acid (or salts thereof) in a 0.01:1 to 1:0.01 ratio (mole basis). In particular embodiments capric acid and lauric acid are present in molar ratios of e.g. about 0.1:1 to about 1:0.1, in particular about 0.5:1 to about 1:0.5.

[0159] Other excipients include chelating agents, i.e. compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the alimentary and other mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315). Chelating agents of the invention include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Buur et al., J. Control Rel., 1990, 14, 43).

[0160] As used herein, non-chelating non-surfactant penetration enhancers may be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary and other mucosal membranes (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1). This class of penetration enhancers includes, but is not limited to, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621).

[0161] Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), can be used.

[0162] Some oral oligonucleotide compositions also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which may be inert (i.e., does not possess biological activity per se) or may be necessary for transport, recognition or pathway activation or mediation, or is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4-tisothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177).

[0163] A "pharmaceutical carrier" or "excipient" may be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid, and is selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, EXPLOTAB.TM. disintegrating agent); and wetting agents (e.g., sodium lauryl sulphate, etc.).

[0164] Oral oligonucleotide compositions may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipuritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.

[0165] Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents that function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethyl-nitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclo-phosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

[0166] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. For example, the first target may be an apolipoprotein(a) target, and the second target may be a region from another nucleotide sequence. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same apolipoprotein(a) nucleic acid target. Numerous examples of antisense compounds are illustrated herein, and others may be selected from among suitable compounds known in the art. Two or more combined compounds may be used together or sequentially.

H. Dosing

[0167] The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC.sub.50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 .mu.g to 100 g per kg of body weight, from 0.1 .mu.g to 10 g per kg of body weight, from 1.0 .mu.g to 1 g per kg of body weight, from 10.0 .mu.g to 100 mg per kg of body weight, from 100 .mu.g to 10 mg per kg of body weight, or from 1 mg to 5 mg per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body weight, once or more daily, to once every 20 years.

[0168] The effects of treatments with therapeutic compositions can be assessed following collection of tissues or fluids from a patient or subject receiving said treatments. It is known in the art that a biopsy sample can be procured from certain tissues without resulting in detrimental effects to a patient or subject. In certain embodiments, a tissue and its constituent cells comprise, but are not limited to, blood (e.g., hematopoietic cells, such as human hematopoietic progenitor cells, human hematopoietic stem cells, CD34.sup.+ cells CD4.sup.+ cells), lymphocytes and other blood lineage cells, bone marrow, breast, cervix, colon, esophagus, lymph node, muscle, peripheral blood, oral mucosa and skin. In other embodiments, a fluid and its constituent cells comprise, but are not limited to, blood, urine, semen, synovial fluid, lymphatic fluid and cerebro-spinal fluid. Tissues or fluids procured from patients can be evaluated for expression levels of the target mRNA or protein. Additionally, the mRNA or protein expression levels of other genes known or suspected to be associated with the specific disease state, condition or phenotype can be assessed. mRNA levels can be measured or evaluated by real-time PCR, Northern blot, in situ hybridization or DNA array analysis. Protein levels can be measured or evaluated by ELISA, immunoblotting, quantitative protein assays, protein activity assays (for example, caspase activity assays) immunohistochemistry or immunocytochemistry. Furthermore, the effects of treatment can be assessed by measuring biomarkers associated with the disease or condition in the aforementioned tissues and fluids, collected from a patient or subject receiving treatment, by routine clinical methods known in the art. These biomarkers include but are not limited to: glucose, cholesterol, lipoproteins, triglycerides, free fatty acids and other markers of glucose and lipid metabolism; liver transaminases, bilirubin, albumin, blood urea nitrogen, creatine and other markers of kidney and liver function; interleukins, tumor necrosis factors, intracellular adhesion molecules, C-reactive protein and other markers of inflammation; testosterone, estrogen and other hormones; tumor markers; vitamins, minerals and electrolytes.

[0169] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. Each of the references, GENBANK.RTM. accession numbers, as well as each application from which the present application claims priority, and the like recited in the present application is incorporated herein by reference in its entirety.

EXAMPLES

Example 1

Synthesis of Nucleoside Phosphoramidites

[0170] The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and International Patent Publication No. WO 02/36743; 5'-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 51-O-Dimethoxytrityl-2'-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5'-O-Dimethoxytrityl-2'-deoxy-N4-benzoyl-5-methylcytidine penultimate intermediate for 5-methyl dC amidite, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-deoxy-N.sup.4-benzoyl-5-methylcy- tidin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (5-methyl dC amidite), 2'-Fluorodeoxyadenosine, 2'-Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-Fluorodeoxycytidine, 2'-O-(2-Methoxyethyl) modified amidites, 2'-O-(2-methoxyethyl)-5-methyluridine intermediate, 5'-O-DMT-2'-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-5-methyluridi- n-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T amidite), 5'-O-Dimethoxytrityl-2'-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5'-O-dimethoxytrityl-2'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methyl-cytid- ine penultimate intermediate, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.sup.4-benzo- yl-5-methylcytidin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE 5-Me-C amidite), [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.sup.6-benzo- yladenosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE A amdite), [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.su- p.4-isobutyrylguanosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidit- e (MOE G amidite), 2'-O-(Aminooxyethyl) nucleoside amidites and 2'-O-(dimethylaminooxyethyl) nucleoside amidites, 2'-(Dimethylaminooxyethoxy) nucleoside amidites, 5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine, 5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine, 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine, 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri- dine, 5'-O-tert-Butyldiphenylsilyl-2'-O--[N,N dimethylaminooxyethyl]-5-methyluridine, 2'-O-(dimethylaminooxyethyl)-5-methyluridine, 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine, 5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe- thyl)-N,N-diisopropylphosphoramidite], 2'-(Aminooxyethoxy) nucleoside amidites, N2-isobutyryl-6-.beta.-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5- '-O-(4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphos- phoramidite], 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites, 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.

Example 2

Oligonucleotide and Oligonucleoside Synthesis

[0171] The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.

[0172] Oligonucleotides: Unsubstituted and substituted phosphodiester (P.dbd.O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.

[0173] Phosphorothioates (P.dbd.S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1M NH.sub.4OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.

[0174] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.

[0175] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050, herein incorporated by reference.

[0176] Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or 5,366,878, herein incorporated by reference.

[0177] Alkylphosphonothioate oligonucleotides are prepared as described in International Patent Application Nos. PCT/US94/00902 and PCT/US93/06976 (published as International Patent Publication Nos. WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.

[0178] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.

[0179] Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.

[0180] Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.

[0181] Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P.dbd.O or P.dbd.S linkages are prepared as described in U.S. Pat. Nos. 5,378,825; 5,386,023; 5,489,677; 5,602,240; and 5,610,289; all of which are herein incorporated by reference.

[0182] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.

[0183] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.

Example 3

RNA Synthesis

[0184] In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5'-hydroxyl in combination with an acid-labile orthoester protecting group on the 2'-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2' hydroxyl.

[0185] Following this procedure for the sequential protection of the 5'-hydroxyl in combination with protection of the 2'-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized.

[0186] RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3'- to 5'-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3'-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5'-end of the first nucleoside. The support is washed and any unreacted 5'-hydroxyl groups are capped with acetic anhydride to yield 5'-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5'-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.

[0187] Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate (S.sub.2Na.sub.2) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55.degree. C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2'-groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage.

[0188] The 2'-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is one example of a useful orthoester protecting group that has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine, which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.

[0189] Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331).

[0190] RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 .mu.l of each of the complementary strands of RNA oligonucleotides (50 .mu.M RNA oligonucleotide solution) and 15 .mu.l of 5.times. annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90.degree. C., then 1 hour at 37.degree. C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid.

Example 4

Synthesis of Chimeric Oligonucleotides

[0191] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap" segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers".

[2'-O-Me]-[2'-deoxy]-[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides

[0192] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH.sub.4OH) for 12-16 hr at 55.degree. C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry).

[2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides

[0193] [2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites.

[2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy Phosphorothioate]-[2'-O-(2-Methoxyethyl) Phosphodiester] Chimeric Oligonucleotides

[0194] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy phosphorothioate]-[2'-O-(methoxyethyl)phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.

[0195] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/5 oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.

Example 5

Design and Screening of Duplexed Antisense Compounds Targeting Apolipoprotein(a)

[0196] In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target apolipoprotein(a). The nucleobase sequence of the antisense strand of the duplex comprises at least an 8-nucleobase portion of an oligonucleotide in Table 1. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini. The antisense and sense strands of the duplex comprise from about 17 to 25 nucleotides, or from about 19 to 23 nucleotides. Alternatively, the antisense and sense strands comprise 20, 21 or 22 nucleotides.

[0197] For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 97) and having a two-nucleobase overhang of deoxythymidine(dT) has the following structure (Antisense SEQ ID NO: 98, Complement SEQ ID NO: 99):

##STR00001##

[0198] Overhangs can range from 2 to 6 nucleobases and these nucleobases may or may not be complementary to the target nucleic acid. In another embodiment, the duplexes may have an overhang on only one terminus.

[0199] In another embodiment, a duplex comprising an antisense strand having the same sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 97) is prepared with blunt ends (no single stranded overhang) as shown (Antisense SEQ ID NO: 97, Complement SEQ ID NO: 100):

##STR00002##

[0200] The RNA duplex can be unimolecular or bimolecular; i.e., the two strands can be part of a single molecule or may be separate molecules.

[0201] RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 .mu.M. Once diluted, 30 .mu.L of each strand is combined with 15 .mu.L of a 5.times. solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 .mu.L. This solution is incubated for 1 minute at 90.degree. C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37.degree. C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 .mu.M. This solution can be stored frozen (-20.degree. C.) and freeze-thawed up to 5 times.

[0202] Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate apolipoprotein(a) expression.

[0203] When cells reached 80% confluency, they are treated with duplexed antisense compounds of the invention. For cells grown in 96-well plates, wells are washed once with 200 .mu.L OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM-1 containing 12 .mu.g/mL LIPOFECTIN.TM. reagent (Invitrogen Life Technologies, Carlsbad, Calif.) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.

Example 6

Oligonucleotide Isolation

[0204] After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55.degree. C. for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH.sub.4OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full-length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis were determined by the ratio of correct molecular weight relative to the -16 amu product (+/-32+/-48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.

Example 7

Oligonucleotide Synthesis--96 Well Plate Format

[0205] Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.

[0206] Oligonucleotides were cleaved from support and deprotected with concentrated NH.sub.4OH at elevated temperature (55-60.degree. C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.

Example 8

Oligonucleotide Analysis-96-Well Plate Format

[0207] The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE.TM. MDQ apparatus) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270 apparatus). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.

Example 9

Cell Culture and Oligonucleotide Treatment

[0208] The effects of antisense compounds on target nucleic acid expression are tested in any of a variety of cell types, provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR.

T-24 Cells:

[0209] The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 .mu.g/mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872) at a density of 7000 cells/well for use in RT-PCR analysis.

[0210] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

A549 Cells:

[0211] The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 .mu.g/mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.

NHDF Cells:

[0212] Human neonatal dermal fibroblasts (NHDFs) were obtained from the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville, Md.) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.

HEK Cells:

[0213] Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville, Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, Md.) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.

Treatment with Antisense Compounds:

[0214] When cells reached 65-75% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 100 .mu.L OPTI-MEM.TM.-1 reduced-serum medium (Invitrogen Corporation, Carlsbad, Calif.) and then treated with 130 .mu.L of OPTI-MEM.TM.-1 medium containing 3.75 .mu.g/mL LIPOFECTIN.TM. reagent (Invitrogen Corporation, Carlsbad, Calif.) and the desired concentration of oligonucleotide. Cells are treated and data are obtained in triplicate. After 4-7 hours of treatment at 37.degree. C., the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.

[0215] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are 2'-O-methoxyethyl gapmers (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone. For mouse or rat cells the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 3, a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.

Example 10

Analysis of Oligonucleotide Inhibition of Apolipoprotein(a) Expression

[0216] Antisense modulation of apolipoprotein(a) expression can be assayed in a variety of ways known in the art. For example, apolipoprotein(a) mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. The preferred method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM.TM. 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

[0217] Protein levels of apolipoprotein(a) can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to apolipoprotein(a) can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.

Example 11

Design of Phenotypic Assays and In Vivo Studies for the Use of Apolipoprotein(a) Inhibitors

Phenotypic Assays

[0218] Once apolipoprotein(a) inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of apolipoprotein(a) in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).

[0219] In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with apolipoprotein(a) inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.

[0220] Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status, which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.

[0221] Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the apolipoprotein(a) inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.

[0222] The cells subjected to the phenotypic assays described herein derive from in vitro cultures or from tissues or fluids isolated from living organisms, both human and non-human. In certain embodiments, a tissue and its constituent cells comprise, but are not limited to, blood (e.g., hematopoietic cells, such as human hematopoietic progenitor cells, human hematopoietic stem cells, CD34.sup.+ cells CD4.sup.+ cells), lymphocytes and other blood lineage cells, bone marrow, brain, stem cells, blood vessel, liver, lung, bone, breast, cartilage, cervix, colon, cornea, embryonic, endometrium, endothelial, epithelial, esophagus, facia, fibroblast, follicular, ganglion cells, glial cells, goblet cells, kidney, lymph node, muscle, neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin, small intestine, spleen, stomach, testes and fetal tissue. In other embodiments, a fluid and its constituent cells comprise, but is not limited to, blood, urine, synovial fluid, lymphatic fluid and cerebro-spinal fluid. The phenotypic assays may also be performed on tissues treated with apolipoprotein(a) inhibitors ex vivo.

In Vivo Studies

[0223] The individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, including humans.

[0224] The clinical trial is subjected to rigorous controls to ensure that individuals are not unnecessarily put at risk and that they are fully informed about their role in the study.

[0225] To account for the psychological effects of receiving treatments, volunteers are randomly given placebo or apolipoprotein(a) inhibitor. Furthermore, to prevent the doctors from being biased in treatments, they are not informed as to whether the medication they are administering is a apolipoprotein(a) inhibitor or a placebo. Using this randomization approach, each volunteer has the same chance of being given either the new treatment or the placebo.

[0226] Volunteers receive either the apolipoprotein(a) inhibitor or placebo for eight week period with biological parameters associated with the indicated disease state or condition being measured at the beginning (baseline measurements before any treatment), end (after the final treatment), and at regular intervals during the study period. Such measurements include the levels of nucleic acid molecules encoding apolipoprotein(a) or apolipoprotein(a) protein levels in body fluids, tissues or organs compared to pre-treatment levels. Other measurements include, but are not limited to, indices of the disease state or condition being treated, body weight, blood pressure, serum titers of pharmacologic indicators of disease or toxicity as well as ADME (absorption, distribution, metabolism and excretion) measurements.

[0227] Information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes/no), motivation rating (some/moderate/great) and number and type of previous treatment regimens for the indicated disease or condition.

[0228] Volunteers taking part in this study are healthy adults (age 18 to 65 years) and roughly an equal number of males and females participate in the study. Volunteers with certain characteristics are equally distributed for placebo and apolipoprotein(a) inhibitor treatment. In general, the volunteers treated with placebo have little or no response to treatment, whereas the volunteers treated with the apolipoprotein(a) inhibitor show positive trends in their disease state or condition index at the conclusion of the study.

Example 12

RNA Isolation

[0229] Poly(A)+ mRNA Isolation

[0230] Poly(A)+ mRNA was isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 .mu.L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C., was added to each well, the plate was incubated on a 90.degree. C. hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.

[0231] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.

Total RNA Isolation

[0232] Total RNA was isolated using an RNEASY.TM. 96 kit and buffers purchased from Qiagen, Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 150 .mu.L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY.TM. 96 well plate attached to a QIAVAC.TM. manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 1 minute. 500 .mu.L of Buffer RW1 was added to each well of the RNEASY.TM. 96 plate and incubated for 15 minutes and the vacuum was again applied for 1 minute. An additional 500 .mu.L of Buffer RW1 was added to each well of the RNEASY.TM. 96 plate and the vacuum was applied for 2 minutes. 1 mL of Buffer RPE was then added to each well of the RNEASY.TM. 96 plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 3 minutes. The plate was then removed from the QIAVAC.TM. manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVAC.TM. manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 140 .mu.L of RNase free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.

[0233] The repetitive pipetting and elution steps may be automated using a QIAGEN.RTM. Bio-Robot.TM. 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.

Example 13

Real-Time Quantitative PCR Analysis of Apolipoprotein(a) mRNA Levels

[0234] Quantitation of apolipoprotein(a) mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM.TM. Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

[0235] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.

[0236] Prior to the real-time PCR, isolated RNA is subjected to a reverse transcriptase (RT) reaction, for the purpose of generating complementary DNA (cDNA), from which the real-time PCR product is amplified. Reverse transcriptase and PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT, real-time PCR reactions carried out by adding 20 .mu.L PCR cocktail (2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM MgCl.sub.2, 375 .mu.M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNase inhibitor, 1.25 Units PLATINUM.RTM. Taq polymerase, 5 Units MuLV reverse transcriptase, and 2.5.times.ROX dye) to 96-well plates containing 30 .mu.L total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48.degree. C. Following a 10 minute incubation at 95.degree. C. to activate the PLATINUM.RTM. Taq polymerase, 40 cycles of a two-step PCR protocol were carried out: 95.degree. C. for 15 seconds (denaturation) followed by 60.degree. C. for 1.5 minutes (annealing/extension). The method of obtaining gene target quantities by RT, real-time PCR is herein referred to as real-time PCR.

[0237] Gene target quantities obtained by RT, real-time PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RIBOGREEN.TM. reagent (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real-time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN.TM. RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN.TM. reagent are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).

[0238] In this assay, 170 .mu.L of RIBOGREEN.TM. working reagent (RIBOGREEN.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L purified, cellular RNA. The plate is read in a CytoFluor 4000 apparatus (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.

[0239] Probes and primers to human apolipoprotein(a) were designed to hybridize to a human apolipoprotein(a) sequence, using published sequence information (GENBANK.RTM. accession number NM.sub.--005577.1, incorporated herein as SEQ ID NO: 4). For human apolipoprotein(a) the PCR primers were:

forward primer: CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 5) reverse primer: TGCGTCTGAGCATTGCGT (SEQ ID NO: 6) and the PCR probe was: FAM-CCCGGTGTCAGGTGGGAGTACTGC-TAMRA (SEQ ID NO: 7) where FAM is the fluorescent dye and TAMRA is the quencher dye.

[0240] Gene target quantities in mouse cells are tissues are normalized using mouse GAPDH expression. For mouse GAPDH the PCR primers were:

forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 8) reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 9) and the PCR probe was: 5' JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3' (SEQ ID NO: 10) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.

Example 14

Northern Blot Analysis of Apolipoprotein(a) mRNA Levels

[0241] Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM. reagent (TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST "B" Inc., Friendswood, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER.TM. UV Crosslinker 2400 apparatus (Stratagene, Inc, La Jolla, Calif.) and then probed using QUICKHYB.TM. hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.

[0242] To detect human apolipoprotein(a), a human apolipoprotein(a) specific probe was prepared by PCR using the forward primer CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 5) and the reverse primer TGCGTCTGAGCATTGCGT (SEQ ID NO: 6). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).

[0243] Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER.TM. apparatus and IMAGEQUANT.TM. Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.

Example 15

Antisense Inhibition of Human Apolipoprotein(a) Expression by Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and a Deoxy Gap

[0244] In accordance with the present invention, a series of antisense compounds was designed to target different regions of the human apolipoprotein(a) RNA, using published sequences (GENBANK.RTM. accession number NM.sub.--005577.1, incorporated herein as SEQ ID NO: 4). The compounds are shown in Table 1. "Target site" indicates the first (5'-most) nucleotide number on the particular target sequence to which the compound binds. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-O-methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P.dbd.S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines.

[0245] Apolipoprotein(a) is found in humans, nonhuman primates and the European hedgehog, but not in common laboratory animals such as rats and mice. Transgenic mice which express human apolipoprotein(a) have been engineered (Chiesa et al., J. Biol. Chem., 1992, 267, 24369-24374). The use of primary hepatocytes prepared from human apolipoprotein(a) transgenic mice circumvents the issue of variability when testing antisense oligonucleotide activity in primary cells. Accordingly, primary mouse hepatocytes prepared from the human apolipoprotein(a) transgenic mice were used to investigate the effects of antisense oligonucleotides on human apolipoprotein(a) expression. The human apolipoprotein(a) transgenic mice were obtained from Dr. Robert Pitas and Dr. Matthias Schneider in the Gladstone Institute at the University of California, San Francisco. Primary hepatocytes were isolated from these mice and were cultured in DMEM, high glucose (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal bovine serum, (Invitrogen Corporation, Carlsbad, Calif.), 100 units per mL penicillin and 100 .mu.g/mL streptomycin (Invitrogen Corporation, Carlsbad, Calif.). For treatment with oligonucleotide, cells were washed once with serum-free DMEM and subsequently transfected with a dose of 150 nM of antisense oligonucleotide using LIPOFECTIN.TM. reagent (Invitrogen Corporation, Carlsbad, Calif.) as described in other examples herein. The compounds were analyzed for their effect on human apolipoprotein(a) mRNA levels by quantitative real-time PCR as described in other examples herein. Gene target quantities obtained by real time RT-PCR were normalized using mouse GAPDH.

[0246] Data are averages from three experiments in which primary transgenic mouse hepatocytes were treated with 150 nM of antisense oligonucleotides targeted to human apolipoprotein(a).

TABLE-US-00001 TABLE 1 Inhibition of human apolipoprotein(a) mRNA levels by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap TAR- GET SEQ TAR- SEQ ID GET % ID ISIS # REGION NO SITE SEQUENCE INHIB NO 144367 Coding 4 174 ggcaggtccttcctgtgaca 53 11 144368 Coding 4 352 tctgcgtctgagcattgcgt 87 12 144369 Coding 4 522 aagcttggcaggttcttcct 0 13 144370 Coding 4 1743 tcggaggcgcgacggcagtc 40 14 144371 Coding 4 2768 cggaggcgcgacggcagtcc 0 15 144372 Coding 4 2910 ggcaggttcttcctgtgaca 65 16 144373 Coding 4 3371 ataacaataaggagctgcca 50 17 144374 Coding 4 4972 gaccaagcttggcaggttct 62 18 144375 Coding 4 5080 taacaataaggagctgccac 36 19 144376 Coding 4 5315 tgaccaagcttggcaggttc 25 20 144377 Coding 4 5825 ttctgcgtctgagcattgcg 38 21 144378 Coding 4 6447 aacaataaggagctgccaca 29 22 144379 Coding 4 7155 acctgacaccgggatccctc 79 23 144380 Coding 4 7185 ctgagcattgcgtcaggttg 16 24 144381 Coding 4 8463 agtagttcatgatcaagcca 71 25 144382 Coding 4 8915 gacggcagtcccttctgcgt 34 26 144383 Coding 4 9066 ggcaggttcttccagtgaca 5 27 144384 Coding 4 10787 tgaccaagcttggcaagttc 31 28 144385 Coding 4 11238 tataacaccaaggactaatc 9 29 144386 Coding 4 11261 ccatctgacattgggatcca 66 30 144387 Coding 4 11461 tgtggtgtcatagaggacca 36 31 144388 Coding 4 11823 atgggatcctccgatgccaa 55 32 144389 Coding 4 11894 acaccaagggcgaatctcag 58 33 144390 Coding 4 11957 ttctgtcactggacatcgtg 59 34 144391 Coding 4 12255 cacacggatcggttgtgtaa 58 35 144392 Coding 4 12461 acatgtccttcctgtgacag 51 36 144393 Coding 4 12699 cagaaggaggccctaggctt 33 37 144394 Coding 4 13354 ctggcggtgaccatgtagtc 52 38 144395 3'UTR 4 13711 tctaagtaggttgatgcttc 68 39 144396 3'UTR 4 13731 tccttacccacgtttcagct 70 40 144397 3'UTR 4 13780 ggaacagtgtcttcgtttga 63 41 144398 3'UTR 4 13801 gtttggcatagctggtagct 44 42 144399 3'UTR 4 13841 accttaaaagcttatacaca 57 43 144400 3'UTR 4 13861 atacagaatttgtcagtcag 21 44 144401 3'UTR 4 13881 gtcatagctatgacacctta 46 45

[0247] As shown in Table 1, SEQ ID NOs 11, 12, 14, 16, 17, 18, 19, 21, 23, 25, 30, 31, 32, 33, 34, 35, 36, 38, 39, 40, 41, 42, 43 and 45 demonstrated at least 35% inhibition of human apolipoprotein(a) expression in this assay and are therefore preferred. More preferred are SEQ ID NOs 23, 12 and 40. The target regions to which these preferred sequences are complementary are herein referred to as "preferred target segments" and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 2. These sequences are shown to contain thymine (T) but one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 1. "Target site" indicates the first (5'-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 2 is the species in which each of the preferred target segments was found.

TABLE-US-00002 TABLE 2 Sequence and position of preferred target segments identified in apolipoprotein(a). TARGET REV SITE SEQ ID TARGET COMP OF SEQ ID ID NO SITE SEQUENCE SEQ ID ACTIVE IN NO 57364 4 174 tgtcacaggaaggacctgcc 11 H. sapiens 46 57365 4 352 acgcaatgctcagacgcaga 12 H. sapiens 47 57367 4 1743 gactgccgtcgcgcctccga 14 H. sapiens 48 57369 4 2910 tgtcacaggaagaacctgcc 16 H. sapiens 49 57370 4 3371 tggcagctccttattgttat 17 H. sapiens 50 57371 4 4972 agaacctgccaagcttggtc 18 H. sapiens 51 57372 4 5080 gtggcagctccttattgtta 19 H. sapiens 52 57374 4 5825 cgcaatgctcagacgcagaa 21 H. sapiens 53 57376 4 7155 gagggatcccggtgtcaggt 23 H. sapiens 54 57378 4 8463 tggcttgatcatgaactact 25 H. sapiens 55 57383 4 11261 tggatcccaatgtcagatgg 30 H. sapiens 56 57384 4 11461 tggtcctctatgacaccaca 31 H. sapiens 57 57385 4 11823 ttggcatcggaggatcccat 32 H. sapiens 58 57386 4 11894 ctgagattcgcccttggtgt 33 H. sapiens 59 57387 4 11957 cacgatgtccagtgacagaa 34 H. sapiens 60 57388 4 12255 ttacacaaccgatccgtgtg 35 H. sapiens 61 57389 4 12461 ctgtcacaggaaggacatgt 36 H. sapiens 62 57391 4 13354 gactacatggtcaccgccag 38 H. sapiens 63 57392 4 13711 gaagcatcaacctacttaga 39 H. sapiens 64 57393 4 13731 agctgaaacgtgggtaagga 40 H. sapiens 65 57394 4 13780 tcaaacgaagacactgttcc 41 H. sapiens 66 57395 4 13801 agctaccagctatgccaaac 42 H. sapiens 67 57396 4 13841 tgtgtataagcttttaaggt 43 H. sapiens 68 57398 4 13881 taaggtgtcatagctatgac 45 H. sapiens 69

[0248] As these "preferred target segments" have been found by experimentation to be open to, and accessible for, hybridization with the antisense compounds of the present invention, one of skill in the art will recognize or be able to ascertain, using no more than routine experimentation, further embodiments of the invention that encompass other compounds that specifically hybridize to these preferred target segments and consequently inhibit the expression of apolipoprotein(a).

[0249] According to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, siRNAs, external guide sequence (EGS) oligonucleotides, alternate splicers, and other short oligomeric compounds that hybridize to at least a portion of the target nucleic acid.

Example 16

Western Blot Analysis of Apolipoprotein(a) Protein Levels

[0250] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to apolipoprotein(a) is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER.TM. apparatus (Molecular Dynamics, Sunnyvale Calif.).

Example 17

Antisense Inhibition of Human Apolipoprotein(a) in Transgenic Primary Mouse Hepatocytes: Dose Response

[0251] In accordance with the present invention, antisense oligonucleotides identified as having good activity based on the results in Example 15 were further investigated in dose-response studies. Primary hepatocytes from human apolipoprotein(a) transgenic mice were treated with 10, 50, 150 or 300 nM of ISIS 144396 (SEQ ID NO: 40), ISIS 144368 (SEQ ID NO: 12), ISIS 144379 (SEQ ID NO: 23) or ISIS 113529 (CTCTTACTGTGCTGTGGACA, SEQ ID NO: 70). ISIS 113529, which does not target apolipoprotein(a), was used as a control oligonucleotide and is a chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-O-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P.dbd.S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines.

[0252] Following 24 hours of exposure to antisense oligonucleotides, target mRNA expression levels were evaluated by quantitative real-time PCR as described in other examples herein. The results are the average of 4 experiments for apolipoprotein(a) antisense oligonucleotides and the average of 12 experiments for the control oligonucleotide. The data are expressed as percent inhibition of apolipoprotein(a) expression relative to untreated controls and are shown in Table 3.

TABLE-US-00003 TABLE 3 Antisense inhibition of human apolipoprotein(a) in transgenic primary mouse hepatocytes: dose response % Inhibition of transgenic human lipoprotein(a) ISIS # Oligonucleotide dose 144396 144368 144379 113529 10 nM 0 11 55 N.D. 50 nM 0 26 73 N.D. 150 nM 0 58 85 N.D. 300 nM 9 62 89 0

[0253] These data demonstrate that ISIS 144368 and ISIS 144379 inhibited the expression of human apolipoprotein(a) in a dose-dependent fashion.

Example 18

Oil Red O Stain

[0254] Hepatic steatosis, or accumulation of lipids in the liver, is assessed by routine histological analysis of frozen liver tissue sections stained with oil red 0 stain, which is commonly used to visualize lipid deposits, and counterstained with hematoxylin and eosin, to visualize nuclei and cytoplasm, respectively. Tissue is preserved in 10% neutral-buffered formalin, embedded in paraffin, sectioned and stained.

Example 19

Animal Models

[0255] In addition to human systems, which express apolipoprotein(a), biological systems of other mammals are also available for studies of expression products of the LPA gene as well as for studies of the Lp(a) particles and their role in physiologic processes.

[0256] Transgenic mice which express human apolipoprotein(a) have been engineered (Chiesa et al., J. Biol. Chem., 1992, 267, 24369-24374) and are used as an animal model for the investigation of the in vivo activity of the oligonucleotides of this invention. Although transgenic mice expressing human apolipoprotein(a) exist, they fail to assemble Lp(a) particles because of the inability of human apolipoprotein(a) to associate with mouse apolipoprotein B. When mice expressing human apolipoprotein(a) are bred to mice expressing human apolipoprotein B, the Lp(a) particle is efficiently assembled (Callow et al., Proc. Natl. Acad. Sci. USA, 1994, 91, 2130-2134). Accordingly mice expressing both human apolipoprotein(a) and human apolipoprotein B transgenes are used for animal model studies in which the secretion of the Lp(a) particle is evaluated.

[0257] Where additional genetic alterations are necessary, mice with either a single human transgene (human apolipoprotein(a) or human apolipoprotein B) or both human transgenes (human apolipoprotein(a) and human apolipoprotein B) are bred to mice with a desired genetic mutation. The offspring with the desired combination of transgene(s) and genetic mutation(s) is selected for use as an animal model. In one nonlimiting example, mice expressing both human apolipoprotein(a) and human apolipoprotein B are bred to mice with a mutation in the leptin gene, yielding offspring producing human Lp(a) particles in an ob/ob model of obesity and diabetes.

ob/ob Mice

[0258] Leptin is a hormone produced by fat that regulates appetite. Deficiencies in this hormone in both humans and non-human animals leads to obesity. ob/ob mice have a mutation in the leptin gene which results in obesity and hyperglycemia. As such, these mice are a useful model for the investigation of obesity and treatments designed to reduce obesity.

[0259] Seven-week old male C57Bl/6J-Lep ob/ob mice (Jackson Laboratory, Bar Harbor, Me.) are fed a diet with a fat content of 10-15% and are subcutaneously injected with oligonucleotides of the present invention or a control oligonucleotide at a dose of 5, 10 or 25 mg/kg two times per week for 4 weeks. Saline-injected animals and leptin wildtype littermates (i.e. lean littermates) serve as controls. After the treatment period, mice are sacrificed and target levels are evaluated in liver, brown adipose tissue (BAT) and white adipose tissue (WAT). RNA isolation and target mRNA expression level quantitation are performed as described by other examples herein.

[0260] To assess the physiological effects resulting from antisense inhibition of target apolipoprotein(a) mRNA, the ob/ob mice that receive antisense oligonucleotide treatment are further evaluated at the end of the treatment period for serum lipids, serum apolipoproteins, serum free fatty acids, serum cholesterol (CHOL), liver triglycerides, and fat tissue triglycerides. Serum components are measured on routine clinical diagnostic instruments. Tissue triglycerides are extracted using an acetone extraction technique known in the art, and subsequently measured by ELISA. The presence of the Lp(a) particle in the serum is measured using a commercially available ELISA kit (ALerCHEK Inc., Portland, Me.). Hepatic steatosis, or accumulation of lipids in the liver, is assessed by measuring the liver triglyceride content. Hepatic steatosis is also assessed by routine histological analysis of frozen liver tissue sections stained with oil red O stain, which is commonly used to visualize lipid deposits, and counterstained with hematoxylin and eosin, to visualize nuclei and cytoplasm, respectively.

[0261] The effects of apolipoprotein(a) inhibition on glucose and insulin metabolism are also evaluated in the ob/ob mice treated with antisense oligonucleotides of this invention. Plasma glucose is measured at the start of the antisense oligonucleotide treatment and after 2 weeks and 4 weeks of treatment. Plasma insulin is similarly at the beginning to of the treatment, and following 2 weeks and 4 weeks of treatment. Glucose and insulin tolerance tests are also administered in fed and fasted mice. Mice receive intraperitoneal injections of either glucose or insulin, and the blood glucose and insulin levels are measured before the insulin or glucose challenge and at 15, 20 or 30 minute intervals for up to 3 hours.

[0262] To assess the metabolic rate of ob/ob mice treated with antisense oligonucleotides of this invention, the respiratory quotient and oxygen consumption of the mice are also measured.

[0263] The ob/ob mice that received antisense oligonucleotide treatment are further evaluated at the end of the treatment period for the effects of apolipoprotein(a) inhibition on the expression of genes that participate in lipid metabolism, cholesterol biosynthesis, fatty acid oxidation, fatty acid storage, gluconeogenesis and glucose metabolism. These genes include, but are not limited to, HMG-CoA reductase, acetyl-CoA carboxylase 1 and acetyl-CoA carboxylase 2, carnitine palmitoyltransferase I and glycogen phosphorylase, glucose-6-phosphatase and phosphoenolpyruvate carboxykinase 1, lipoprotein lipase and hormone sensitive lipase. mRNA levels in liver and white and brown adipose tissue are quantitated by real-time PCR as described in other examples herein, employing primer-probe sets that were generated using published sequences of each gene of interest.

db/db Mice

[0264] A deficiency in the leptin hormone receptor mouse also results in obesity and hyperglycemia. These mice are referred to as db/db mice and, like the ob/ob mice, are used as a mouse model of obesity.

[0265] Seven-week old male C57Bl/6J-Lepr db/db mice (Jackson Laboratory, Bar Harbor, Me.) are fed a diet with a fat content of 15-20% and are subcutaneously injected with oligonucleotides of this invention or a control oligonucleotide at a dose of 5, 10 or 25 mg/kg two times per week for 4 weeks. Saline-injected animals and leptin receptor wildtype littermates (i.e. lean littermates) serve as controls. After the treatment period, mice are sacrificed and apolipoprotein(a) levels are evaluated in liver, brown adipose tissue (BAT) and white adipose tissue (WAT). RNA isolation and apolipoprotein(a) mRNA expression level quantitation are performed as described by other examples herein.

[0266] After the treatment period, mice are sacrificed and apolipoprotein(a) levels are evaluated in liver, brown adipose tissue (BAT) and white adipose tissue (WAT). RNA isolation and apolipoprotein(a) mRNA expression level quantitation are performed as described by other examples herein.

[0267] To assess the physiological effects resulting from antisense inhibition of apolipoprotein(a) mRNA, the db/db mice that receive antisense oligonucleotide treatment are further evaluated at the end of the treatment period for serum lipids, serum apolipoproeins, serum free fatty acids, serum cholesterol (CHOL), liver triglycerides, and fat tissue triglycerides. Serum components are measured on routine clinical diagnostic instruments. Tissue triglycerides are extracted using an acetone extraction technique known in the art, and subsequently measured by ELISA. The presence of the Lp(a) particle in the serum is measured using a commercially available ELISA kit (ALerCHEK Inc., Portland, Me.). Hepatic steatosis, or accumulation of lipids in the liver, is assessed by measuring the liver triglyceride content. Hepatic steatosis is also assessed by routine histological analysis of frozen liver tissue sections stained with oil red O stain, which is commonly used to visualize lipid deposits, and counterstained with hematoxylin and eosin, to visualize nuclei and cytoplasm, respectively.

[0268] The effects of apolipoprotein(a) inhibition on glucose and insulin metabolism are also evaluated in the db/db mice treated with antisense oligonucleotides. Plasma glucose is measured at the start of the antisense oligonucleotide treatment and after 2 weeks and 4 weeks of treatment. Plasma insulin is similarly at the beginning to of the treatment, and following 2 weeks and 4 weeks of treatment. Glucose and insulin tolerance tests are also administered in fed and fasted mice. Mice receive intraperitoneal injections of either glucose or insulin, and the blood glucose levels are measured before the insulin or glucose challenge and 15, 30, 60, 90 and 120 minutes following the injection.

[0269] To assess the metabolic rates of db/db mice treated with antisense oligonucleotides, the respiratory quotients and oxygen consumptions of the mice are also measured.

[0270] The db/db mice that received antisense oligonucleotide treatment are further evaluated at the end of the treatment period for the effects of apolipoprotein(a) inhibition on the expression of genes that participate in lipid metabolism, cholesterol biosynthesis, fatty acid oxidation, fatty acid storage, gluconeogenesis and glucose metabolism. These genes include, but are not limited to, HMG-CoA reductase, acetyl-CoA carboxylase 1 and acetyl-CoA carboxylase 2, carnitine palmitoyltransferase I and glycogen phosphorylase, glucose-6-phosphatase and phosphoenolpyruvate carboxykinase 1, lipoprotein lipase and hormone sensitive lipase. mRNA levels in liver and white and brown adipose tissue are quantitated by real-time PCR as described in other examples herein, employing primer-probe sets that were generated using published sequences of each gene of interest.

Lean Mice

[0271] C57Bl/6 mice are maintained on a standard rodent diet and are used as control (lean) animals. Seven-week old male C57Bl/6 mice are fed a diet with a fat content of 4% and are subcutaneously injected with oligonucleotides of this invention or control oligonucleotide at a dose of 5, 10 or 25 mg/kg two times per week for 4 weeks. Saline-injected animals serve as a control. After the treatment period, mice are sacrificed and apolipoprotein(a) levels are evaluated in liver, brown adipose tissue (BAT) and white adipose tissue (WAT). RNA isolation and apolipoprotein(a) mRNA expression level quantitation are performed as described by other examples herein.

[0272] To assess the physiological effects resulting from antisense inhibition of apolipoprotein(a) mRNA, the lean mice that receive antisense oligonucleotide treatment are further evaluated at the end of the treatment period for serum lipids, serum free fatty acids, serum cholesterol (CHOL), liver triglycerides, and fat tissue triglycerides. Serum components are measured on routine clinical diagnostic instruments. Tissue triglycerides are extracted using an acetone extraction technique known in the art, and subsequently measured by ELISA. The presence of the Lp(a) particle in the serum is measured using a commercially available ELISA kit (ALerCHEK Inc., Portland, Me.). Hepatic steatosis, i.e. accumulation of lipids in the liver, is assessed by measuring the liver triglyceride content. Hepatic steatosis is also assessed by routine histological analysis of frozen liver tissue sections stained with oil red O stain, which is commonly used to visualize lipid deposits, and counterstained with hematoxylin and eosin, to visualize nuclei and cytoplasm, respectively.

[0273] The effects of apolipoprotein(a) inhibition on glucose and insulin metabolism are also evaluated in the lean mice treated with antisense oligonucleotides of this invention. Plasma glucose is measured at the start of the antisense oligonucleotide treatment and after 2 weeks and 4 weeks of treatment. Plasma insulin is similarly at the beginning to of the treatment, and following 2 weeks and 4 weeks of treatment. Glucose and insulin tolerance tests are also administered in fed and fasted mice. Mice receive intraperitoneal injections of either glucose or insulin, and the blood glucose levels are measured before the insulin or glucose challenge and 15, 30, 60, 90 and 120 minutes following the injection.

[0274] To assess the metabolic rates of lean mice treated with antisense oligonucleotides of this invention, the respiratory quotients and oxygen consumptions of the mice can also be measured.

[0275] The lean mice that received antisense oligonucleotide treatment are further evaluated at the end of the treatment period for the effects of apolipoprotein(a) inhibition on the expression of genes that participate in lipid metabolism, cholesoterol biosynthesis, fatty acid oxidation, fatty acid storage, gluconeogenesis and glucose metabolism. These genes include, but are not limited to, HMG-CoA reductase, acetyl-CoA carboxylase 1 and acetyl-CoA carboxylase 2, carnitine palmitoyltransferase I and glycogen expressing both human apolipoprotein(a) and human apolipoprotein B are bred to mice with a mutation in the leptin gene, yielding offspring producing human Lp(a) particles in an ob/ob model of obesity and diabetes.

ob/ob Mice

[0276] Leptin is a hormone produced by fat that regulates appetite. Deficiencies in this hormone in both humans and non-human animals leads to obesity. ob/ob mice have a mutation in the leptin gene which results in obesity and hyperglycemia. As such, these mice are a useful model for the investigation of obesity and treatments designed to reduce obesity.

[0277] Seven-week old male C57Bl/6J-Lep ob/ob mice (Jackson Laboratory, Bar Harbor, Me.) are fed a diet with a fat content of 10-15% and are subcutaneously injected with oligonucleotides of the present invention or a control oligonucleotide at a dose of 5, 10 or 25 mg/kg two times per week for 4 weeks. Saline-injected animals and leptin wildtype littermates (i.e. lean littermates) serve as controls. After the treatment period, mice are sacrificed and target levels are evaluated in liver, brown adipose tissue (BAT) and white adipose tissue (WAT). RNA isolation and target mRNA expression level quantitation are performed as described by other examples herein.

[0278] To assess the physiological effects resulting from antisense inhibition of target apolipoprotein(a) mRNA, the ob/ob mice that receive antisense oligonucleotide treatment are further evaluated at the end of the treatment period for serum lipids, serum apolipoproteins, serum free fatty acids, serum cholesterol (CHOL), liver reverse primer: ACAGGGCTTTTCTCAGGTGGT (SEQ ID NO: 72) and the additional PCR probe was: FAM-CCAAGCACAGAGGCTCCTTCTGAACAAG-TAMRA (SEQ ID NO: 73). Gene target quantities were normalized using GAPDH expression levels. For human GAPDH the PCR primers were:

forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 74) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 75) and the PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 76) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.

[0279] Primary human hepatocytes were treated with 150 nM of the compounds shown in Table 4. Untreated cells served as the control to which all data were normalized. Following 24 hours of treatment, apolipoprotein(a) expression levels were measured by real-time PCR as described herein, using the primers and probe described by SEQ ID NOs 71, 72 and 73. The data, shown in Table 4, represent the average of three experiments and are normalized to untreated control cells.

TABLE-US-00004 TABLE 4 Antisense inhibition of human apolipoprotein(a) using chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap: primary human hepatocytes TARGET ISIS SEQ TARGET % SEQ # REGION ID NO SITE INHIB ID NO 144367 Coding 4 174 77 11 144368 Coding 4 352 59 12 144369 Coding 4 522 69 13 144370 Coding 4 1743 75 14 144371 Coding 4 2768 57 15 144372 Coding 4 2910 54 16 144373 Coding 4 3371 49 17 144374 Coding 4 4972 80 18 144375 Coding 4 5080 11 19 144376 Coding 4 5315 82 20 144377 Coding 4 5825 72 21 144378 Coding 4 6447 72 22 144379 Coding 4 7155 46 23 144380 Coding 4 7185 78 24 144381 Coding 4 8463 64 25 144382 Coding 4 8915 58 26 144383 Coding 4 9066 79 27 144384 Coding 4 10787 0 28 144385 Coding 4 11238 94 29 144386 Coding 4 11261 61 30 144387 Coding 4 11461 60 31 144388 Coding 4 11823 57 32 144389 Coding 4 11894 39 33 144390 Coding 4 11957 0 34 144391 Coding 4 12255 57 35 144392 Coding 4 12461 50 36 144393 Coding 4 12699 82 37 144394 Coding 4 13354 76 38 144395 3'UTR 4 13711 84 39 144396 3'UTR 4 13731 72 40 144397 3'UTR 4 13780 64 41 144398 3'UTR 4 13801 33 42 144399 3'UTR 4 13841 44 43 144400 3'UTR 4 13861 75 44 144401 3'UTR 4 13881 72 45

Example 21

Effects of Antisense Oligonucleotides Targeted to Human Apolipoprotein(a) on Human Plasminogen Expression

[0280] Human apolipoprotein(a) sequence shares a high degree of homology with the human plasminogen sequence. Thus it was of interest to determine if antisense oligonucleotides targeting apolipoprotein(a) would exhibit an inhibitory effect on human plasminogen.

[0281] In a further embodiment, compounds designed to target human apolipoprotein(a), shown in Table 1, were tested for their effects on human plasminogen mRNA expression. Pre-plated primary human hepatocytes were purchased from InVitro Technologies (Baltimore, Md.). Cells were cultured in high-glucose DMEM (Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine serum, 100 units per mL penicillin, and 100 .mu.g/mL streptomycin (all supplements from Invitrogen Life Technologies, Carlsbad, Calif.). Immediately upon receipt from the vendor, cells were transfected with a dose of 150 nM of antisense oligonucleotide as described in other examples herein.

[0282] Following 24 hours of exposure to antisense oligonucleotides, human plasminogen mRNA levels were measured by quantitative real-time PCR as described in other examples herein. Probes and primers to human plasminogen were designed to hybridize to a human plasminogen sequence, using published sequence information (GENBANK.RTM. accession number NM 000301.1, incorporated herein as SEQ ID NO: 77). For human plasminogen, the PCR primers were:

forward primer: CGCTGGGAACTTTGTGACATC (SEQ ID NO: 78) reverse primer: CCCGCTGCACAACACCTCCACC (SEQ ID NO: 79) and the PCR probe was: 5' JOE-CACTGGTAGGTGGGACCAGAA-TAMRA 3' (SEQ ID NO: 80) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye. Gene target quantities were normalized using GAPDH expression levels.

[0283] Data, shown in Table 5, are averages from three experiments in which primary human hepatocytes were treated with antisense oligonucleotides targeted to human apolipoprotein(a).

TABLE-US-00005 TABLE 5 Effects of chimeric phosphorothioate oligonucleotides targeted to human apolipoprotein (a) on human plamsinogen expression ISIS # % INHIB SEQ ID NO 144367 62 11 144368 49 12 144369 8 13 144370 44 14 144371 0 15 144372 11 16 144373 33 17 144374 60 18 144375 9 19 144376 32 20 144377 43 21 144378 8 22 144379 0 23 144380 31 24 144381 13 25 144382 45 26 144383 47 27 144384 0 28 144385 0 29 144386 0 30 144387 0 31 144388 36 32 144389 0 33 144390 0 34 144391 0 35 144392 0 36 144393 58 37 144394 24 38 144395 35 39 144396 62 40 144397 25 41 144398 0 42 144399 0 43 144400 60 44 144401 0 45

[0284] These data illustrate that ISIS 144371, 144379, 144384, 144385, 144386, 144387, 144389, 144390, 144391, 144392, 144398, 144399 and 144401 do not inhibit plasminogen expression. Thus, in this assay, these compounds selectively inhibit apolipoprotein(a) expression. ISIS 144369, 144378 and 144375 demonstrated less than 10% inhibition of plasminogen. The target sites in human apolipoprotein(a) to which ISIS 144379, ISIS 144368 and ISIS 144376 bind share 70%, 70% and 80% nucleotide identity with human plasminogen, respectively.

Example 22

Antisense Inhibition of Human Apolipoprotein(a) In Vivo: Transgenic Mouse Study

[0285] Apolipoprotein(a) is found in humans, nonhuman primates and the European hedgehog, but not in common laboratory animals such as rats and mice. Accordingly, mice harboring a human apolipoprotein(a) transgene are required to investigate the effects of antisense oligonucleotides on human apolipoprotein(a) expression.

[0286] In a further embodiment, antisense oligonucleotides targeted to human apolipoprotein(a) were tested for their effects in mice transgenic for both human apolipoprotein(a) and human apolipoprotein B, as well as in mice transgenic for human apolipoprotein B alone. The transgenic mice were provided by Dr. Robert Pitas and Dr. Matthias Schneider in the Gladstone Institute at the University of California, San Francisco.

[0287] Mice were treated with 25 mg/kg of ISIS 144379 (SEQ ID NO: 23), twice weekly, for a period of 4 weeks. A control group consisting of mice transgenic for both human genes was treated with saline. Each treatment group consisted of 4 animals. At the end of the 4 week treatment period, animals were sacrificed, and apolipoprotein(a) mRNA levels in liver tissue were measured by real-time PCR, as described herein. Apolipoprotein B mRNA was also measured by real-time PCR with probes and primers designed using published sequence information (GENBANK.RTM. accession number NM.sub.--000384.1, incorporated herein as SEQ ID NO: 81). For human apolipoprotein B the PCR primers were:

forward primer: TGCTAAAGGCACATATGGCCT (SEQ ID NO: 82) reverse primer: CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 83) and the PCR probe was: FAM-CTTGTCAGAGGGATCCTAACACTGGCCG-TAMRA (SEQ ID NO: 84) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. Gene target quantities were normalized using mouse GAPDH expression levels, as described herein.

[0288] The data, shown in Table 6, represent the average of all animals in each treatment group and are normalized to saline-treated control animals.

TABLE-US-00006 TABLE 6 Antisense inhibition of human apolipoprotein(a) in transgenic mice mRNA expression % control Transgene apoB apo(a) apolipoprotein B 101 0 apolipoprotein B 133 61 apolipoprotein(a)

[0289] These data illustrate that treatment of mice transgenic for human apolipoprotein(a) and human apolipoprotein B with ISIS 144379 resulted in a decrease in apolipoprotein(a), but not apolipoprotein B, mRNA expression.

Example 23

Antisense Oligonucleotides Targeted to Apolipoprotein(a) Having 2'-MOE Wings and Deoxy Gaps

[0290] In a further embodiment, and additional series of oligonucleotides was designed to target the human apolipoprotein(a) sequence, using public sequence information (GENBANK.RTM. accession #NM.sub.--005577.1, incorporated herein as SEQ ID NO: 4). The compounds are shown in Table 7. "Target site" indicates the first (5'-most) nucleotide number on the particular target sequence to which the compound binds. All compounds in Table 7 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-O-methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P.dbd.S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines.

TABLE-US-00007 TABLE 7 Antisense oligonucleotides targeted to apolipo- protein(a) having 2'-MOE wings and a deoxy gap TARGET SEQ SEQ ID TARGET ID ISIS # REGION NO SITE SEQUENCE NO 359474 5' UTR 4 11 cagtgtccagaaagtgtgtc 85 359475 Coding 4 12380 ggtttgctcagttggtgctg 86 359476 Coding 4 12409 ttaccatggtagcactgccg 87 359477 Coding 4 12419 actctggccattaccatggt 88 359478 Coding 4 12449 tgtgacagtggtggagaatg 89 359479 Coding 4 12669 tgacagtcggaggagcgacc 90 359480 Coding 4 12839 tgcccatttatttgtccctg 91 359481 Coding 4 12919 agttttcttggattcattgt 92 359482 Coding 4 12944 gagagggatatcacagtagt 93 359483 Coding 4 13359 cagtcctggcggtgaccatg 94 359484 Coding 4 13466 cttatagtgattgcacactt 95 359485 Coding 4 13493 tctggccaaatgctcagcac 96

Example 24

Antisense Inhibition of Apolipoprotein(a) in Human Primary Hepatocytes: Dose Response

[0291] In a further embodiment, antisense oligonucleotides targeted to human apolipoprotein(a) were selected for dose response studies. Human primary hepatocytes were treated with 25, 50, 150 and 300 nM of ISIS 144367, ISIS 144370, ISIS 144385, ISIS 144393 and ISIS 144395. ISIS 133529 was used as a control oligonucleotide. Untreated cells served as the control to which data were normalized. Following 24 hours of exposure to antisense oligonucleotides, target mRNA expression levels were measured by real-time PCR as described by other examples herein. The results, shown in Table 8, are the average of 3 experiments and are expressed as percent inhibition of apolipoprotein(a) expression relative to untreated control cells. "N.D." indicates not determined.

TABLE-US-00008 TABLE 8 Antisense inhibition of apolipoprotein(a) in human primary hepatocytes: dose response % Inhibition relative to untreated control cells Dose of oligonucleotide ISIS # 25 50 150 300 144367 57 76 88 87 144370 47 62 56 26 144385 33 36 59 39 144393 23 32 35 30 144395 34 35 35 35 113529 N.D. N.D. 8 21

[0292] These data demonstrate that ISIS 144367 inhibited apolipoprotein(a) in a dose-dependent manner. The other oligonucleotides tested were able to reduce apolipoprotein(a) expression.

Example 25

Effects of Antisense Inhibition of Apolipoprotein(a) on Plasminogen Expression: Dose Response in Primary Human Hepatocytes

[0293] In a further embodiment, antisense oligonucleotides targeted to human apolipoprotein(a) were tested for their ability to inhibit human plasminogen expression. Human primary hepatocytes were treated with 25, 50, 150 and 300 nM of ISIS 144367, ISIS 144370, ISIS 144385, ISIS 144393 and ISIS 144395. ISIS 113529 was used as a control oligonucleotide. Untreated cells served as the control to which data were normalized. Following 24 hours of exposure to antisense oligonucleotides, target mRNA expression levels were measured by real-time PCR as described by other examples herein. The results, shown in Table 9, are the average of 3 experiments and are expressed as percent inhibition of apolipoprotein(a) expression relative to untreated control cells. "N.D." indicates not determined.

TABLE-US-00009 TABLE 9 Effects of antisense inhibition, of apolipoprotein(a) on plasminogen expression in human primary hepatocytes: dose response % plasminogen expression relative to untreated control cells Dose of oligonucleotide (nM) ISIS # 25 50 150 300 144367 0 0 0 0 144370 0 6 9 0 144385 10 5 12 0 144393 10 39 2 0 144395 0 0 0 0 113529 N.D. N.D. 76 89

[0294] These data demonstrate that ISIS 144367 and ISIS 144395 did not inhibit the expression of plasminogen in this assay and are therefore apolipoprotein(a)-specific antisense oligonucleotides. ISIS 144370 and ISIS 144385 did not result in a considerable reduction in plasminogen expression.

Example 26

Effects of Antisense Inhibition of Apolipoprotein(a) in Cytokine-Induced Cells

[0295] Elevated plasma levels of Lp(a), caused by increased expression of apolipoprotein(a), is an independent risk factor for a variety of cardiovascular disorders, including atherosclerosis, hypercholesterolemia, myocardial infarction and thrombosis (Seed et al., N. Engl. J. Med., 1990, 322, 1494-1499; Sandkamp et al., Clin. Chem., 1990, 36, 20-23; Nowak-Gottl et al., Pediatrics, 1997, 99, E11). Furthermore, increases in plasma Lp(a) are associated with elevations in several acute-phase proteins, which participate in the acute-phase of the immune response and function to promote inflammation, activate the complement cascade, and stimulate chemotaxis of phagocytes. Thus, Lp(a) is proposed to be an acute-phase reactant and, consequently, responsive to cytokines. The apolipoprotein(a) promoter contains several functional cis-acting elements that are responsive to interleukin-6 (Wade et al., Proc. natl. Acad. Sci. USA, 1993, 90, 1369-1373), a major mediator of the acute phase response, further suggesting a link between Lp(a) and the acute phase response. An association between cytokines and Lp(a) was observed in primary monkey hepatocytes, where stimulation of the cells with interleukin-6 resulted in an increase in Lp(a) protein, as well as in apolipoprotein(a) mRNA (Ramharack et al., Arterioscler. Thromb. Vasc. Biol., 1998, 18, 984-990). To date, no direct association between cytokines and apolipoprotein(a) expression has been demonstrated in humans. Thus, it is of interest to determine whether the antisense inhibition of apolipoprotein(a) is affected by cytokine induction.

[0296] In a further embodiment, the ability of ISIS 144367 (SEQ ID NO: 11) to inhibit apolipoprotein(a) expression was investigated in primary human hepatocytes which were induced with cytokines. For a period of 24 hours, cells were induced using culture media supplemented with a final concentration of 1 .mu.M dexamethasone, 400 U/ml interleukin-1B and 200 U/ml interleukin-6. At the end of this induction period, cells were treated with oligonucleotide as described herein, for a period of 48 hours. One group of cells was cytokine-induced and treated with 12.5, 25, 50, 100 or 200 nM of ISIS 144367; data from these cells was normalized to data from cells receiving only cytokine treatment. A second group of cells received no cytokine induction and were treated with 12.5, 25, 50, 100 and 200 nM of ISIS 144367; data from these cells was normalized to cells that received neither cytokine nor oligonucleotide treatment. After the 48 oligonucleotide treatment period, cells were harvested and apolipoprotein(a) expression was measured by real-time PCR as described herein. The data, presented in Table 10, are the average of 3 experiments and are normalized to the respective controls as described. Results are shown as percent inhibition of apolipoprotein(a) expression.

TABLE-US-00010 TABLE 10 Antisense inhibition of apolipoprotein(a) in cytokine-induced primary human hepatocytes % Inhibition relative to control Dose of No Cytokine oligonucleotide (nM) induction induction 12.5 37 42 25 37 37 50 42 62 100 75 87 200 65 89

[0297] These data demonstrate a dose-dependent reduction in apolipoprotein(a) expression cytokine-induced cells following treatment with ISIS 144367. In cells receiving no oligonucleotide treatment, the expression of apolipoprotein(a) was similar in cytokine-induced cells relative to cells that were not exposed to cytokines. Furthermore, ISIS 144367 inhibited apolipoprotein(a) expression to a greater extent in cytokine-induced cells relative to cells not exposed to cytokines. Thus, ISIS 144367 is a more effective inhibitor of apolipoprotein(a) expression in cytokine-induced cells. These data demonstrate a link between cytokine stimulation of primary human hepatocytes and the antisense inhibition of apolipoprotein(a) expression.

[0298] The expression of plasminogen was also tested in cytokine-induced cells that received ISIS 144367 treatment. Cells were induced and treated as described for the apolipoprotein(a) mRNA expression experiment. Plasminogen mRNA was measured by real-time PCR as described herein. The data, averaged from 3 experiments and normalized to the appropriate controls, demonstrated that in this assay, in unstimulated cells as well as cytokine-induced cells, ISIS 144367 did not inhibit plasminogen. Thus, the effects of ISIS 144367 are specific to apolipoprotein(a) expression both in the presence and absence of cytokines.

Sequence CWU 1

1

100120DNAArtificial SequenceAntisense Oligonucleotide 1tccgtcatcg ctcctcaggg 20220DNAArtificial SequenceAntisense Oligonucleotide 2gtgcgcgcga gcccgaaatc 20320DNAArtificial SequenceAntisense Oligonucleotide 3atgcattctg cccccaagga 20413938DNAHomo sapiensCDS(46)..(13692) 4ctgggattgg gacacacttt ctggacactg ctggccagtc ccaaa atg gaa cat aag 57 Met Glu His Lys 1 gaa gtg gtt ctt cta ctt ctt tta ttt ctg aaa tca gca gca cct gag 105Glu Val Val Leu Leu Leu Leu Leu Phe Leu Lys Ser Ala Ala Pro Glu 5 10 15 20 caa agc cat gtg gtc cag gat tgc tac cat ggt gat gga cag agt tat 153Gln Ser His Val Val Gln Asp Cys Tyr His Gly Asp Gly Gln Ser Tyr 25 30 35 cga ggc acg tac tcc acc act gtc aca gga agg acc tgc caa gct tgg 201Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp 40 45 50 tca tct atg aca cca cat caa cat aat agg acc aca gaa aac tac cca 249Ser Ser Met Thr Pro His Gln His Asn Arg Thr Thr Glu Asn Tyr Pro 55 60 65 aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 297Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 70 75 80 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc 345Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 85 90 95 100 aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg 393Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro 105 110 115 act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg 441Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 120 125 130 act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag 489Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln 135 140 145 agt tat cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa 537Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 150 155 160 gct tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 585Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 165 170 175 180 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct 633Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala 185 190 195 gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag 681Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu 200 205 210 tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 729Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 215 220 225 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa 777Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln 230 235 240 gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat 825Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn 245 250 255 260 gga cag agt tat cga ggc aca tac tcc acc act gtc aca gga aga acc 873Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 265 270 275 tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg acc cca 921Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro 280 285 290 gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca 969Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro 295 300 305 gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg 1017Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 310 315 320 tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc 1065Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 325 330 335 340 gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc 1113Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser 345 350 355 gaa caa gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat 1161Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 360 365 370 ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc aca gga 1209Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly 375 380 385 aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg 1257Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg 390 395 400 acc cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 1305Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 405 410 415 420 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt 1353Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly 425 430 435 gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg 1401Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly 440 445 450 act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 1449Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 455 460 465 cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag tgc 1497Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys 470 475 480 tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc 1545Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val 485 490 495 500 aca gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 1593Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 505 510 515 agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg aac tac 1641Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 520 525 530 tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat 1689Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp 535 540 545 ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca 1737Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 550 555 560 gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta 1785Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu 565 570 575 580 gag gct cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag 1833Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln 585 590 595 gag tgc tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc 1881Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 600 605 610 act gtc aca gga aga acc tgc caa gct tgg tca tct atg aca cca cac 1929Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His 615 620 625 tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg 1977Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 630 635 640 aac tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg 2025Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 645 650 655 660 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca 2073Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser 665 670 675 gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca 2121Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro 680 685 690 agc cta gag gct cct tcc gaa caa gca ccg act gag caa agg cct ggg 2169Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 695 700 705 gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc aca tac 2217Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr 710 715 720 tcc acc act gtc aca gga aga acc tgc caa gct tgg tca tct atg aca 2265Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr 725 730 735 740 cca cac tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg 2313Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 745 750 755 atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct tat tgt 2361Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 760 765 770 tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa 2409Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 775 780 785 tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg 2457Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 790 795 800 gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag caa agg 2505Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg 805 810 815 820 cct ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc 2553Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly 825 830 835 aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg tca tct 2601Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 840 845 850 atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca aat gct 2649Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala 855 860 865 ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct 2697Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 870 875 880 tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 2745Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 885 890 895 900 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt 2793Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val 905 910 915 acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag 2841Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu 920 925 930 caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat 2889Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 935 940 945 cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg 2937Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp 950 955 960 tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca 2985Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro 965 970 975 980 aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 3033Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 985 990 995 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac 3078Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr 1000 1005 1010 tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 3123Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 1015 1020 1025 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa 3168Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu 1030 1035 1040 caa gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat 3213Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 1045 1050 1055 ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc aca 3258Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr 1060 1065 1070 gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 3303Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 1075 1080 1085 agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg aac 3348Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn 1090 1095 1100 tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg 3393Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 1105 1110 1115 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc 3438Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys 1120 1125 1130 tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg 3483Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 1135 1140 1145 gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag caa 3528Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln 1150 1155 1160 agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat 3573Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 1165 1170 1175 cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct 3618Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala 1180 1185 1190 tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 3663Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 1195 1200 1205 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat 3708Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp 1210 1215 1220 gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg 3753Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 1225 1230 1235 tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act 3798Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr 1240 1245 1250 gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 3843Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 1255 1260 1265 cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag 3888Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu

1270 1275 1280 tgc tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc 3933Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 1285 1290 1295 act gtc aca gga aga acc tgc caa gct tgg tca tct atg aca cca 3978Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro 1300 1305 1310 cac tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg 4023His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 1315 1320 1325 atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct tat 4068Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr 1330 1335 1340 tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 4113Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 1345 1350 1355 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act 4158Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr 1360 1365 1370 gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg 4203Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 1375 1380 1385 act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga 4248Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly 1390 1395 1400 cag agt tat cga ggc aca tac tcc acc act gtc aca gga aga acc 4293Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 1405 1410 1415 tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg acc 4338Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr 1420 1425 1430 cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 4383Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 1435 1440 1445 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc 4428Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro 1450 1455 1460 ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca 4473Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 1465 1470 1475 gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc 4518Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser 1480 1485 1490 cta gag gct cct tcc gaa caa gca ccg act gag caa agg cct ggg 4563Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 1495 1500 1505 gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc aca 4608Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr 1510 1515 1520 tac tcc acc act gtc aca gga aga acc tgc caa gct tgg tca tct 4653Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 1525 1530 1535 atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca aat 4698Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn 1540 1545 1550 gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 4743Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 1555 1560 1565 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac 4788Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr 1570 1575 1580 tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 4833Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 1585 1590 1595 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa 4878Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu 1600 1605 1610 caa gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat 4923Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 1615 1620 1625 ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc aca 4968Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr 1630 1635 1640 gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 5013Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 1645 1650 1655 agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg aac 5058Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn 1660 1665 1670 tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg 5103Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 1675 1680 1685 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc 5148Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys 1690 1695 1700 tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg 5193Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 1705 1710 1715 gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag caa 5238Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln 1720 1725 1730 agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat 5283Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 1735 1740 1745 cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct 5328Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala 1750 1755 1760 tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 5373Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 1765 1770 1775 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat 5418Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp 1780 1785 1790 gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg 5463Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 1795 1800 1805 tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act 5508Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr 1810 1815 1820 gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 5553Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 1825 1830 1835 cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag 5598Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu 1840 1845 1850 tgc tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc 5643Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 1855 1860 1865 act gtc aca gga aga acc tgc caa gct tgg tca tct atg aca cca 5688Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro 1870 1875 1880 cac tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg 5733His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 1885 1890 1895 atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct tat 5778Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr 1900 1905 1910 tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 5823Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 1915 1920 1925 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act 5868Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr 1930 1935 1940 gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg 5913Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 1945 1950 1955 act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga 5958Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly 1960 1965 1970 cag agt tat cga ggc aca tac tcc acc act gtc aca gga aga acc 6003Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 1975 1980 1985 tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg acc 6048Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr 1990 1995 2000 cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 6093Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 2005 2010 2015 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc 6138Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro 2020 2025 2030 ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca 6183Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 2035 2040 2045 gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc 6228Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser 2050 2055 2060 cta gag gct cct tcc gaa caa gca ccg act gag caa agg cct ggg 6273Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 2065 2070 2075 gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc aca 6318Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr 2080 2085 2090 tac tcc acc act gtc aca gga aga acc tgc caa gct tgg tca tct 6363Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 2095 2100 2105 atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca aat 6408Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn 2110 2115 2120 gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 6453Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 2125 2130 2135 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac 6498Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr 2140 2145 2150 tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 6543Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 2155 2160 2165 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa 6588Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu 2170 2175 2180 caa gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat 6633Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 2185 2190 2195 ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc aca 6678Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr 2200 2205 2210 gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 6723Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 2215 2220 2225 agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg aac 6768Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn 2230 2235 2240 tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg 6813Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 2245 2250 2255 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc 6858Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys 2260 2265 2270 tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg 6903Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 2275 2280 2285 gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag caa 6948Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln 2290 2295 2300 agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat 6993Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 2305 2310 2315 cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct 7038Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala 2320 2325 2330 tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 7083Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 2335 2340 2345 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat 7128Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp 2350 2355 2360 gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg 7173Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 2365 2370 2375 tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act 7218Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr 2380 2385 2390 gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 7263Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 2395 2400 2405 cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag 7308Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu 2410 2415 2420 tgc tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc 7353Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 2425 2430 2435 act gtc aca gga aga acc tgc caa gct tgg tca tct atg aca cca 7398Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro 2440 2445 2450 cac tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg 7443His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 2455 2460 2465 atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct tat 7488Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr 2470 2475 2480 tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 7533Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 2485 2490 2495 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act 7578Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr 2500 2505 2510 gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg 7623Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 2515 2520 2525 act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga

7668Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly 2530 2535 2540 cag agt tat cga ggc aca tac tcc acc act gtc aca gga aga acc 7713Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 2545 2550 2555 tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg acc 7758Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr 2560 2565 2570 cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 7803Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 2575 2580 2585 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc 7848Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro 2590 2595 2600 ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca 7893Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 2605 2610 2615 gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc 7938Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser 2620 2625 2630 cta gag gct cct tcc gaa caa gca ccg act gag cag agg cct ggg 7983Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 2635 2640 2645 gtg cag gag tgc tac cac ggt aat gga cag agt tat cga ggc aca 8028Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr 2650 2655 2660 tac tcc acc act gtc act gga aga acc tgc caa gct tgg tca tct 8073Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 2665 2670 2675 atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca aat 8118Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn 2680 2685 2690 gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 8163Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 2695 2700 2705 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac 8208Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr 2710 2715 2720 tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 8253Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 2725 2730 2735 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa 8298Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu 2740 2745 2750 caa gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat 8343Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 2755 2760 2765 ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc aca 8388Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr 2770 2775 2780 gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 8433Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 2785 2790 2795 agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg aac 8478Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn 2800 2805 2810 tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg 8523Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 2815 2820 2825 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc 8568Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys 2830 2835 2840 tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg 8613Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 2845 2850 2855 gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag caa 8658Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln 2860 2865 2870 agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat 8703Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 2875 2880 2885 cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct 8748Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala 2890 2895 2900 tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 8793Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 2905 2910 2915 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat 8838Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp 2920 2925 2930 gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg 8883Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 2935 2940 2945 tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act 8928Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr 2950 2955 2960 gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 8973Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 2965 2970 2975 cct tcc gaa caa gca ccg act gag cag agg cct ggg gtg cag gag 9018Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu 2980 2985 2990 tgc tac cac ggt aat gga cag agt tat cga ggc aca tac tcc acc 9063Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 2995 3000 3005 act gtc act gga aga acc tgc caa gct tgg tca tct atg aca cca 9108Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro 3010 3015 3020 cac tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg 9153His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 3025 3030 3035 atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct tat 9198Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr 3040 3045 3050 tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 9243Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 3055 3060 3065 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act 9288Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr 3070 3075 3080 gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg 9333Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 3085 3090 3095 act gag cag agg cct ggg gtg cag gag tgc tac cac ggt aat gga 9378Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly 3100 3105 3110 cag agt tat cga ggc aca tac tcc acc act gtc act gga aga acc 9423Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 3115 3120 3125 tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg acc 9468Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr 3130 3135 3140 cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 9513Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 3145 3150 3155 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc 9558Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro 3160 3165 3170 ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca 9603Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 3175 3180 3185 gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc 9648Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser 3190 3195 3200 cta gag gct cct tcc gaa caa gca ccg act gag cag agg cct ggg 9693Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 3205 3210 3215 gtg cag gag tgc tac cac ggt aat gga cag agt tat cga ggc aca 9738Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr 3220 3225 3230 tac tcc acc act gtc act gga aga acc tgc caa gct tgg tca tct 9783Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 3235 3240 3245 atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca aat 9828Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn 3250 3255 3260 gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 9873Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 3265 3270 3275 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac 9918Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr 3280 3285 3290 tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 9963Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 3295 3300 3305 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa 10008Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu 3310 3315 3320 caa gca ccg act gag cag agg cct ggg gtg cag gag tgc tac cac 10053Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 3325 3330 3335 ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc act 10098Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr 3340 3345 3350 gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 10143Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 3355 3360 3365 agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg aac 10188Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn 3370 3375 3380 tac tgc agg aat cca gat cct gtg gca gcc cct tat tgt tat acg 10233Tyr Cys Arg Asn Pro Asp Pro Val Ala Ala Pro Tyr Cys Tyr Thr 3385 3390 3395 agg gat ccc agt gtc agg tgg gag tac tgc aac ctg aca caa tgc 10278Arg Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys 3400 3405 3410 tca gac gca gaa ggg act gcc gtc gcg cct cca act att acc ccg 10323Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Ile Thr Pro 3415 3420 3425 att cca agc cta gag gct cct tct gaa caa gca cca act gag caa 10368Ile Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln 3430 3435 3440 agg cct ggg gtg cag gag tgc tac cac gga aat gga cag agt tat 10413Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 3445 3450 3455 caa ggc aca tac ttc att act gtc aca gga aga acc tgc caa gct 10458Gln Gly Thr Tyr Phe Ile Thr Val Thr Gly Arg Thr Cys Gln Ala 3460 3465 3470 tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gca tac 10503Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Ala Tyr 3475 3480 3485 tac cca aat gct ggc ttg atc aag aac tac tgc cga aat cca gat 10548Tyr Pro Asn Ala Gly Leu Ile Lys Asn Tyr Cys Arg Asn Pro Asp 3490 3495 3500 cct gtg gca gcc cct tgg tgt tat aca aca gat ccc agt gtc agg 10593Pro Val Ala Ala Pro Trp Cys Tyr Thr Thr Asp Pro Ser Val Arg 3505 3510 3515 tgg gag tac tgc aac ctg aca cga tgc tca gat gca gaa tgg act 10638Trp Glu Tyr Cys Asn Leu Thr Arg Cys Ser Asp Ala Glu Trp Thr 3520 3525 3530 gcc ttc gtc cct ccg aat gtt att ctg gct cca agc cta gag gct 10683Ala Phe Val Pro Pro Asn Val Ile Leu Ala Pro Ser Leu Glu Ala 3535 3540 3545 ttt ttt gaa caa gca ctg act gag gaa acc ccc ggg gta cag gac 10728Phe Phe Glu Gln Ala Leu Thr Glu Glu Thr Pro Gly Val Gln Asp 3550 3555 3560 tgc tac tac cat tat gga cag agt tac cga ggc aca tac tcc acc 10773Cys Tyr Tyr His Tyr Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 3565 3570 3575 act gtc aca gga aga act tgc caa gct tgg tca tct atg aca cca 10818Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro 3580 3585 3590 cac cag cat agt cgg acc cca gaa aac tac cca aat gct ggc ctg 10863His Gln His Ser Arg Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu 3595 3600 3605 acc agg aac tac tgc agg aat cca gat gct gag att cgc cct tgg 10908Thr Arg Asn Tyr Cys Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp 3610 3615 3620 tgt tac acc atg gat ccc agt gtc agg tgg gag tac tgc aac ctg 10953Cys Tyr Thr Met Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu 3625 3630 3635 aca caa tgc ctg gtg aca gaa tca agt gtc ctt gca act ctc acg 10998Thr Gln Cys Leu Val Thr Glu Ser Ser Val Leu Ala Thr Leu Thr 3640 3645 3650 gtg gtc cca gat cca agc aca gag gct tct tct gaa gaa gca cca 11043Val Val Pro Asp Pro Ser Thr Glu Ala Ser Ser Glu Glu Ala Pro 3655 3660 3665 acg gag caa agc ccc ggg gtc cag gat tgc tac cat ggt gat gga 11088Thr Glu Gln Ser Pro Gly Val Gln Asp Cys Tyr His Gly Asp Gly 3670 3675 3680 cag agt tat cga ggc tca ttc tct acc act gtc aca gga agg aca 11133Gln Ser Tyr Arg Gly Ser Phe Ser Thr Thr Val Thr Gly Arg Thr 3685 3690 3695 tgt cag tct tgg tcc tct atg aca cca cac tgg cat cag agg aca 11178Cys Gln Ser Trp Ser Ser Met Thr Pro His Trp His Gln Arg Thr 3700 3705 3710 aca gaa tat tat cca aat ggt ggc ctg acc agg aac tac tgc agg 11223Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg Asn Tyr Cys Arg 3715 3720 3725 aat cca gat gct gag att agt cct tgg tgt tat acc atg gat ccc 11268Asn Pro Asp Ala Glu Ile Ser Pro Trp Cys Tyr Thr Met Asp Pro 3730 3735 3740 aat gtc aga tgg gag tac tgc aac ctg aca caa tgt cca gtg aca 11313Asn Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Pro Val Thr 3745 3750 3755 gaa tca agt gtc ctt gcg acg tcc acg gct gtt tct gaa caa gca 11358Glu Ser Ser Val Leu Ala Thr Ser Thr Ala Val Ser Glu Gln Ala 3760 3765 3770 cca acg gag caa agc ccc aca gtc cag gac tgc tac cat ggt gat 11403Pro Thr Glu Gln Ser Pro Thr Val Gln Asp Cys Tyr His Gly Asp 3775 3780 3785

gga cag agt tat cga ggc tca ttc tcc acc act gtt aca gga agg 11448Gly Gln Ser Tyr Arg Gly Ser Phe Ser Thr Thr Val Thr Gly Arg 3790 3795 3800 aca tgt cag tct tgg tcc tct atg aca cca cac tgg cat cag aga 11493Thr Cys Gln Ser Trp Ser Ser Met Thr Pro His Trp His Gln Arg 3805 3810 3815 acc aca gaa tac tac cca aat ggt ggc ctg acc agg aac tac tgc 11538Thr Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg Asn Tyr Cys 3820 3825 3830 agg aat cca gat gct gag att cgc cct tgg tgt tat acc atg gat 11583Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp Cys Tyr Thr Met Asp 3835 3840 3845 ccc agt gtc aga tgg gag tac tgc aac ctg acg caa tgt cca gtg 11628Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Pro Val 3850 3855 3860 atg gaa tca act ctc ctc aca act ccc acg gtg gtc cca gtt cca 11673Met Glu Ser Thr Leu Leu Thr Thr Pro Thr Val Val Pro Val Pro 3865 3870 3875 agc aca gag ctt cct tct gaa gaa gca cca act gaa aac agc act 11718Ser Thr Glu Leu Pro Ser Glu Glu Ala Pro Thr Glu Asn Ser Thr 3880 3885 3890 ggg gtc cag gac tgc tac cga ggt gat gga cag agt tat cga ggc 11763Gly Val Gln Asp Cys Tyr Arg Gly Asp Gly Gln Ser Tyr Arg Gly 3895 3900 3905 aca ctc tcc acc act atc aca gga aga aca tgt cag tct tgg tcg 11808Thr Leu Ser Thr Thr Ile Thr Gly Arg Thr Cys Gln Ser Trp Ser 3910 3915 3920 tct atg aca cca cat tgg cat cgg agg atc cca tta tac tat cca 11853Ser Met Thr Pro His Trp His Arg Arg Ile Pro Leu Tyr Tyr Pro 3925 3930 3935 aat gct ggc ctg acc agg aac tac tgc agg aat cca gat gct gag 11898Asn Ala Gly Leu Thr Arg Asn Tyr Cys Arg Asn Pro Asp Ala Glu 3940 3945 3950 att cgc cct tgg tgt tac acc atg gat ccc agt gtc agg tgg gag 11943Ile Arg Pro Trp Cys Tyr Thr Met Asp Pro Ser Val Arg Trp Glu 3955 3960 3965 tac tgc aac ctg aca cga tgt cca gtg aca gaa tcg agt gtc ctc 11988Tyr Cys Asn Leu Thr Arg Cys Pro Val Thr Glu Ser Ser Val Leu 3970 3975 3980 aca act ccc aca gtg gcc ccg gtt cca agc aca gag gct cct tct 12033Thr Thr Pro Thr Val Ala Pro Val Pro Ser Thr Glu Ala Pro Ser 3985 3990 3995 gaa caa gca cca cct gag aaa agc cct gtg gtc cag gat tgc tac 12078Glu Gln Ala Pro Pro Glu Lys Ser Pro Val Val Gln Asp Cys Tyr 4000 4005 4010 cat ggt gat gga cgg agt tat cga ggc ata tcc tcc acc act gtc 12123His Gly Asp Gly Arg Ser Tyr Arg Gly Ile Ser Ser Thr Thr Val 4015 4020 4025 aca gga agg acc tgt caa tct tgg tca tct atg ata cca cac tgg 12168Thr Gly Arg Thr Cys Gln Ser Trp Ser Ser Met Ile Pro His Trp 4030 4035 4040 cat cag agg acc cca gaa aac tac cca aat gct ggc ctg acc gag 12213His Gln Arg Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu Thr Glu 4045 4050 4055 aac tac tgc agg aat cca gat tct ggg aaa caa ccc tgg tgt tac 12258Asn Tyr Cys Arg Asn Pro Asp Ser Gly Lys Gln Pro Trp Cys Tyr 4060 4065 4070 aca acc gat ccg tgt gtg agg tgg gag tac tgc aat ctg aca caa 12303Thr Thr Asp Pro Cys Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 4075 4080 4085 tgc tca gaa aca gaa tca ggt gtc cta gag act ccc act gtt gtt 12348Cys Ser Glu Thr Glu Ser Gly Val Leu Glu Thr Pro Thr Val Val 4090 4095 4100 cca gtt cca agc atg gag gct cat tct gaa gca gca cca act gag 12393Pro Val Pro Ser Met Glu Ala His Ser Glu Ala Ala Pro Thr Glu 4105 4110 4115 caa acc cct gtg gtc cgg cag tgc tac cat ggt aat ggc cag agt 12438Gln Thr Pro Val Val Arg Gln Cys Tyr His Gly Asn Gly Gln Ser 4120 4125 4130 tat cga ggc aca ttc tcc acc act gtc aca gga agg aca tgt caa 12483Tyr Arg Gly Thr Phe Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 4135 4140 4145 tct tgg tca tcc atg aca cca cac cgg cat cag agg acc cca gaa 12528Ser Trp Ser Ser Met Thr Pro His Arg His Gln Arg Thr Pro Glu 4150 4155 4160 aac tac cca aat gat ggc ctg aca atg aac tac tgc agg aat cca 12573Asn Tyr Pro Asn Asp Gly Leu Thr Met Asn Tyr Cys Arg Asn Pro 4165 4170 4175 gat gcc gat aca ggc cct tgg tgt ttt acc atg gac ccc agc atc 12618Asp Ala Asp Thr Gly Pro Trp Cys Phe Thr Met Asp Pro Ser Ile 4180 4185 4190 agg tgg gag tac tgc aac ctg acg cga tgc tca gac aca gaa ggg 12663Arg Trp Glu Tyr Cys Asn Leu Thr Arg Cys Ser Asp Thr Glu Gly 4195 4200 4205 act gtg gtc gct cct ccg act gtc atc cag gtt cca agc cta ggg 12708Thr Val Val Ala Pro Pro Thr Val Ile Gln Val Pro Ser Leu Gly 4210 4215 4220 cct cct tct gaa caa gac tgt atg ttt ggg aat ggg aaa gga tac 12753Pro Pro Ser Glu Gln Asp Cys Met Phe Gly Asn Gly Lys Gly Tyr 4225 4230 4235 cgg ggc aag aag gca acc act gtt act ggg acg cca tgc cag gaa 12798Arg Gly Lys Lys Ala Thr Thr Val Thr Gly Thr Pro Cys Gln Glu 4240 4245 4250 tgg gct gcc cag gag ccc cat aga cac agc acg ttc att cca ggg 12843Trp Ala Ala Gln Glu Pro His Arg His Ser Thr Phe Ile Pro Gly 4255 4260 4265 aca aat aaa tgg gca ggt ctg gaa aaa aat tac tgc cgt aac cct 12888Thr Asn Lys Trp Ala Gly Leu Glu Lys Asn Tyr Cys Arg Asn Pro 4270 4275 4280 gat ggt gac atc aat ggt ccc tgg tgc tac aca atg aat cca aga 12933Asp Gly Asp Ile Asn Gly Pro Trp Cys Tyr Thr Met Asn Pro Arg 4285 4290 4295 aaa ctt ttt gac tac tgt gat atc cct ctc tgt gca tcc tct tca 12978Lys Leu Phe Asp Tyr Cys Asp Ile Pro Leu Cys Ala Ser Ser Ser 4300 4305 4310 ttt gat tgt ggg aag cct caa gtg gag ccg aag aaa tgt cct gga 13023Phe Asp Cys Gly Lys Pro Gln Val Glu Pro Lys Lys Cys Pro Gly 4315 4320 4325 agc att gta ggg ggg tgt gtg gcc cac cca cat tcc tgg ccc tgg 13068Ser Ile Val Gly Gly Cys Val Ala His Pro His Ser Trp Pro Trp 4330 4335 4340 caa gtc agt ctc aga aca agg ttt gga aag cac ttc tgt gga ggc 13113Gln Val Ser Leu Arg Thr Arg Phe Gly Lys His Phe Cys Gly Gly 4345 4350 4355 acc tta ata tcc cca gag tgg gtg ctg act gct gct cac tgc ttg 13158Thr Leu Ile Ser Pro Glu Trp Val Leu Thr Ala Ala His Cys Leu 4360 4365 4370 aag aag tcc tca agg cct tca tcc tac aag gtc atc ctg ggt gca 13203Lys Lys Ser Ser Arg Pro Ser Ser Tyr Lys Val Ile Leu Gly Ala 4375 4380 4385 cac caa gaa gtg aac ctc gaa tct cat gtt cag gaa ata gaa gtg 13248His Gln Glu Val Asn Leu Glu Ser His Val Gln Glu Ile Glu Val 4390 4395 4400 tct agg ctg ttc ttg gag ccc aca caa gca gat att gcc ttg cta 13293Ser Arg Leu Phe Leu Glu Pro Thr Gln Ala Asp Ile Ala Leu Leu 4405 4410 4415 aag cta agc agg cct gcc gtc atc act gac aaa gta atg cca gct 13338Lys Leu Ser Arg Pro Ala Val Ile Thr Asp Lys Val Met Pro Ala 4420 4425 4430 tgt ctg cca tcc cca gac tac atg gtc acc gcc agg act gaa tgt 13383Cys Leu Pro Ser Pro Asp Tyr Met Val Thr Ala Arg Thr Glu Cys 4435 4440 4445 tac atc act ggc tgg gga gaa acc caa ggt acc ttt ggg act ggc 13428Tyr Ile Thr Gly Trp Gly Glu Thr Gln Gly Thr Phe Gly Thr Gly 4450 4455 4460 ctt ctc aag gaa gcc cag ctc ctt gtt att gag aat gaa gtg tgc 13473Leu Leu Lys Glu Ala Gln Leu Leu Val Ile Glu Asn Glu Val Cys 4465 4470 4475 aat cac tat aag tat att tgt gct gag cat ttg gcc aga ggc act 13518Asn His Tyr Lys Tyr Ile Cys Ala Glu His Leu Ala Arg Gly Thr 4480 4485 4490 gac agt tgc cag ggt gac agt gga ggg cct ctg gtt tgc ttc gag 13563Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Phe Glu 4495 4500 4505 aag gac aaa tac att tta caa gga gtc act tct tgg ggt ctt ggc 13608Lys Asp Lys Tyr Ile Leu Gln Gly Val Thr Ser Trp Gly Leu Gly 4510 4515 4520 tgt gca cgc ccc aat aag cct ggt gtc tat gct cgt gtt tca agg 13653Cys Ala Arg Pro Asn Lys Pro Gly Val Tyr Ala Arg Val Ser Arg 4525 4530 4535 ttt gtt act tgg att gag gga atg atg aga aat aat taa ttggacggga 13702Phe Val Thr Trp Ile Glu Gly Met Met Arg Asn Asn 4540 4545 gacagagtga agcatcaacc tacttagaag ctgaaacgtg ggtaaggatt tagcatgctg 13762gaaataatag acagcaatca aacgaagaca ctgttcccag ctaccagcta tgccaaacct 13822tggcattttt ggtatttttg tgtataagct tttaaggtct gactgacaaa ttctgtatta 13882aggtgtcata gctatgacat ttgttaaaaa taaactctgc acttattttg atttga 13938525DNAArtificial SequencePCR primer 5cagctcctta ttgttatacg aggga 25618DNAArtificial SequencePCR primer 6tgcgtctgag cattgcgt 18724DNAArtificial SequencePCR probe 7cccggtgtca ggtgggagta ctgc 24820DNAArtificial SequencePCR primer 8ggcaaattca acggcacagt 20920DNAArtificial SequencePCR primer 9gggtctcgct cctggaagat 201027DNAArtificial SequencePCR probe 10aaggccgaga atgggaagct tgtcatc 271120DNAArtificial SequenceAntisense Oligonucleotide 11ggcaggtcct tcctgtgaca 201220DNAArtificial SequenceAntisense Oligonucleotide 12tctgcgtctg agcattgcgt 201320DNAArtificial SequenceAntisense Oligonucleotide 13aagcttggca ggttcttcct 201420DNAArtificial SequenceAntisense Oligonucleotide 14tcggaggcgc gacggcagtc 201520DNAArtificial SequenceAntisense Oligonucleotide 15cggaggcgcg acggcagtcc 201620DNAArtificial SequenceAntisense Oligonucleotide 16ggcaggttct tcctgtgaca 201720DNAArtificial SequenceAntisense Oligonucleotide 17ataacaataa ggagctgcca 201820DNAArtificial SequenceAntisense Oligonucleotide 18gaccaagctt ggcaggttct 201920DNAArtificial SequenceAntisense Oligonucleotide 19taacaataag gagctgccac 202020DNAArtificial SequenceAntisense Oligonucleotide 20tgaccaagct tggcaggttc 202120DNAArtificial SequenceAntisense Oligonucleotide 21ttctgcgtct gagcattgcg 202220DNAArtificial SequenceAntisense Oligonucleotide 22aacaataagg agctgccaca 202320DNAArtificial SequenceAntisense Oligonucleotide 23acctgacacc gggatccctc 202420DNAArtificial SequenceAntisense Oligonucleotide 24ctgagcattg cgtcaggttg 202520DNAArtificial SequenceAntisense Oligonucleotide 25agtagttcat gatcaagcca 202620DNAArtificial SequenceAntisense Oligonucleotide 26gacggcagtc ccttctgcgt 202720DNAArtificial SequenceAntisense Oligonucleotide 27ggcaggttct tccagtgaca 202820DNAArtificial SequenceAntisense Oligonucleotide 28tgaccaagct tggcaagttc 202920DNAArtificial SequenceAntisense Oligonucleotide 29tataacacca aggactaatc 203020DNAArtificial SequenceAntisense Oligonucleotide 30ccatctgaca ttgggatcca 203120DNAArtificial SequenceAntisense Oligonucleotide 31tgtggtgtca tagaggacca 203220DNAArtificial SequenceAntisense Oligonucleotide 32atgggatcct ccgatgccaa 203320DNAArtificial SequenceAntisense Oligonucleotide 33acaccaaggg cgaatctcag 203420DNAArtificial SequenceAntisense Oligonucleotide 34ttctgtcact ggacatcgtg 203520DNAArtificial SequenceAntisense Oligonucleotide 35cacacggatc ggttgtgtaa 203620DNAArtificial SequenceAntisense Oligonucleotide 36acatgtcctt cctgtgacag 203720DNAArtificial SequenceAntisense Oligonucleotide 37cagaaggagg ccctaggctt 203820DNAArtificial SequenceAntisense Oligonucleotide 38ctggcggtga ccatgtagtc 203920DNAArtificial SequenceAntisense Oligonucleotide 39tctaagtagg ttgatgcttc 204020DNAArtificial SequenceAntisense Oligonucleotide 40tccttaccca cgtttcagct 204120DNAArtificial SequenceAntisense Oligonucleotide 41ggaacagtgt cttcgtttga 204220DNAArtificial SequenceAntisense Oligonucleotide 42gtttggcata gctggtagct 204320DNAArtificial SequenceAntisense Oligonucleotide 43accttaaaag cttatacaca 204420DNAArtificial SequenceAntisense Oligonucleotide 44atacagaatt tgtcagtcag 204520DNAArtificial SequenceAntisense Oligonucleotide 45gtcatagcta tgacacctta 204620DNAHomo sapiens 46tgtcacagga aggacctgcc 204720DNAHomo sapiens 47acgcaatgct cagacgcaga 204820DNAHomo sapiens 48gactgccgtc gcgcctccga 204920DNAHomo sapiens 49tgtcacagga agaacctgcc 205020DNAHomo sapiens 50tggcagctcc ttattgttat 205120DNAHomo sapiens 51agaacctgcc aagcttggtc 205220DNAHomo sapiens 52gtggcagctc cttattgtta 205320DNAHomo sapiens 53cgcaatgctc agacgcagaa 205420DNAHomo sapiens 54gagggatccc ggtgtcaggt 205520DNAHomo sapiens 55tggcttgatc atgaactact 205620DNAHomo sapiens 56tggatcccaa tgtcagatgg 205720DNAHomo sapiens 57tggtcctcta tgacaccaca

205820DNAHomo sapiens 58ttggcatcgg aggatcccat 205920DNAHomo sapiens 59ctgagattcg cccttggtgt 206020DNAHomo sapiens 60cacgatgtcc agtgacagaa 206120DNAHomo sapiens 61ttacacaacc gatccgtgtg 206220DNAHomo sapiens 62ctgtcacagg aaggacatgt 206320DNAHomo sapiens 63gactacatgg tcaccgccag 206420DNAHomo sapiens 64gaagcatcaa cctacttaga 206520DNAHomo sapiens 65agctgaaacg tgggtaagga 206620DNAHomo sapiens 66tcaaacgaag acactgttcc 206720DNAHomo sapiens 67agctaccagc tatgccaaac 206820DNAHomo sapiens 68tgtgtataag cttttaaggt 206920DNAHomo sapiens 69taaggtgtca tagctatgac 207020DNAArtificial SequenceAntisense Oligonucleotide 70ctcttactgt gctgtggaca 207116DNAArtificial SequencePCR primer 71ccacagtggc cccggt 167221DNAArtificial SequencePCR primer 72acagggcttt tctcaggtgg t 217328DNAArtificial SequencePCR probe 73ccaagcacag aggctccttc tgaacaag 287419DNAArtificial SequencePCR primer 74gaaggtgaag gtcggagtc 197520DNAArtificial SequencePCR primer 75gaagatggtg atgggatttc 207620DNAArtificial SequencePCR probe 76caagcttccc gttctcagcc 20772732DNAH. sapiensCDS(55)..(2487) 77aacaacatcc tgggattggg acccactttc tgggcactgc tggccagtcc caaa atg 57 Met 1 gaa cat aag gaa gtg gtt ctt cta ctt ctt tta ttt ctg aaa tca ggt 105Glu His Lys Glu Val Val Leu Leu Leu Leu Leu Phe Leu Lys Ser Gly 5 10 15 caa gga gag cct ctg gat gac tat gtg aat acc cag ggg gct tca ctg 153Gln Gly Glu Pro Leu Asp Asp Tyr Val Asn Thr Gln Gly Ala Ser Leu 20 25 30 ttc agt gtc act aag aag cag ctg gga gca gga agt ata gaa gaa tgt 201Phe Ser Val Thr Lys Lys Gln Leu Gly Ala Gly Ser Ile Glu Glu Cys 35 40 45 gca gca aaa tgt gag gag gac gaa gaa ttc acc tgc agg gca ttc caa 249Ala Ala Lys Cys Glu Glu Asp Glu Glu Phe Thr Cys Arg Ala Phe Gln 50 55 60 65 tat cac agt aaa gag caa caa tgt gtg ata atg gct gaa aac agg aag 297Tyr His Ser Lys Glu Gln Gln Cys Val Ile Met Ala Glu Asn Arg Lys 70 75 80 tcc tcc ata atc att agg atg aga gat gta gtt tta ttt gaa aag aaa 345Ser Ser Ile Ile Ile Arg Met Arg Asp Val Val Leu Phe Glu Lys Lys 85 90 95 gtg tat ctc tca gag tgc aag act ggg aat gga aag aac tac aga ggg 393Val Tyr Leu Ser Glu Cys Lys Thr Gly Asn Gly Lys Asn Tyr Arg Gly 100 105 110 acg atg tcc aaa aca aaa aat ggc atc acc tgt caa aaa tgg agt tcc 441Thr Met Ser Lys Thr Lys Asn Gly Ile Thr Cys Gln Lys Trp Ser Ser 115 120 125 act tct ccc cac aga cct aga ttc tca cct gct aca cac ccc tca gag 489Thr Ser Pro His Arg Pro Arg Phe Ser Pro Ala Thr His Pro Ser Glu 130 135 140 145 gga ctg gag gag aac tac tgc agg aat cca gac aac gat ccg cag ggg 537Gly Leu Glu Glu Asn Tyr Cys Arg Asn Pro Asp Asn Asp Pro Gln Gly 150 155 160 ccc tgg tgc tat act act gat cca gaa aag aga tat gac tac tgc gac 585Pro Trp Cys Tyr Thr Thr Asp Pro Glu Lys Arg Tyr Asp Tyr Cys Asp 165 170 175 att ctt gag tgt gaa gag gaa tgt atg cat tgc agt gga gaa aac tat 633Ile Leu Glu Cys Glu Glu Glu Cys Met His Cys Ser Gly Glu Asn Tyr 180 185 190 gac ggc aaa att tcc aag acc atg tct gga ctg gaa tgc cag gcc tgg 681Asp Gly Lys Ile Ser Lys Thr Met Ser Gly Leu Glu Cys Gln Ala Trp 195 200 205 gac tct cag agc cca cac gct cat gga tac att cct tcc aaa ttt cca 729Asp Ser Gln Ser Pro His Ala His Gly Tyr Ile Pro Ser Lys Phe Pro 210 215 220 225 aac aag aac ctg aag aag aat tac tgt cgt aac ccc gat agg gag ctg 777Asn Lys Asn Leu Lys Lys Asn Tyr Cys Arg Asn Pro Asp Arg Glu Leu 230 235 240 cgg cct tgg tgt ttc acc acc gac ccc aac aag cgc tgg gaa ctt tgc 825Arg Pro Trp Cys Phe Thr Thr Asp Pro Asn Lys Arg Trp Glu Leu Cys 245 250 255 gac atc ccc cgc tgc aca aca cct cca cca tct tct ggt ccc acc tac 873Asp Ile Pro Arg Cys Thr Thr Pro Pro Pro Ser Ser Gly Pro Thr Tyr 260 265 270 cag tgt ctg aag gga aca ggt gaa aac tat cgc ggg aat gtg gct gtt 921Gln Cys Leu Lys Gly Thr Gly Glu Asn Tyr Arg Gly Asn Val Ala Val 275 280 285 acc gtt tcc ggg cac acc tgt cag cac tgg agt gca cag acc cct cac 969Thr Val Ser Gly His Thr Cys Gln His Trp Ser Ala Gln Thr Pro His 290 295 300 305 aca cat aac agg aca cca gaa aac ttc ccc tgc aaa aat ttg gat gaa 1017Thr His Asn Arg Thr Pro Glu Asn Phe Pro Cys Lys Asn Leu Asp Glu 310 315 320 aac tac tgc cgc aat cct gac gga aaa agg gcc cca tgg tgc cat aca 1065Asn Tyr Cys Arg Asn Pro Asp Gly Lys Arg Ala Pro Trp Cys His Thr 325 330 335 acc aac agc caa gtg cgg tgg gag tac tgt aag ata ccg tcc tgt gac 1113Thr Asn Ser Gln Val Arg Trp Glu Tyr Cys Lys Ile Pro Ser Cys Asp 340 345 350 tcc tcc cca gta tcc acg gaa caa ttg gct ccc aca gca cca cct gag 1161Ser Ser Pro Val Ser Thr Glu Gln Leu Ala Pro Thr Ala Pro Pro Glu 355 360 365 cta acc cct gtg gtc cag gac tgc tac cat ggt gat gga cag agc tac 1209Leu Thr Pro Val Val Gln Asp Cys Tyr His Gly Asp Gly Gln Ser Tyr 370 375 380 385 cga ggc aca tcc tcc acc acc acc aca gga aag aag tgt cag tct tgg 1257Arg Gly Thr Ser Ser Thr Thr Thr Thr Gly Lys Lys Cys Gln Ser Trp 390 395 400 tca tct atg aca cca cac cgg cac cag aag acc cca gaa aac tac cca 1305Ser Ser Met Thr Pro His Arg His Gln Lys Thr Pro Glu Asn Tyr Pro 405 410 415 aat gct ggc ctg aca atg aac tac tgc agg aat cca gat gcc gat aaa 1353Asn Ala Gly Leu Thr Met Asn Tyr Cys Arg Asn Pro Asp Ala Asp Lys 420 425 430 ggc ccc tgg tgt ttt acc aca gac ccc agc gtc agg tgg gag tac tgc 1401Gly Pro Trp Cys Phe Thr Thr Asp Pro Ser Val Arg Trp Glu Tyr Cys 435 440 445 aac ctg aaa aaa tgc tca gga aca gaa gcg agt gtt gta gca cct ccg 1449Asn Leu Lys Lys Cys Ser Gly Thr Glu Ala Ser Val Val Ala Pro Pro 450 455 460 465 cct gtt gtc ctg ctt cca gat gta gag act cct tcc gaa gaa gac tgt 1497Pro Val Val Leu Leu Pro Asp Val Glu Thr Pro Ser Glu Glu Asp Cys 470 475 480 atg ttt ggg aat ggg aaa gga tac cga ggc aag agg gcg acc act gtt 1545Met Phe Gly Asn Gly Lys Gly Tyr Arg Gly Lys Arg Ala Thr Thr Val 485 490 495 act ggg acg cca tgc cag gac tgg gct gcc cag gag ccc cat aga cac 1593Thr Gly Thr Pro Cys Gln Asp Trp Ala Ala Gln Glu Pro His Arg His 500 505 510 agc att ttc act cca gag aca aat cca cgg gcg ggt ctg gaa aaa aat 1641Ser Ile Phe Thr Pro Glu Thr Asn Pro Arg Ala Gly Leu Glu Lys Asn 515 520 525 tac tgc cgt aac cct gat ggt gat gta ggt ggt ccc tgg tgc tac acg 1689Tyr Cys Arg Asn Pro Asp Gly Asp Val Gly Gly Pro Trp Cys Tyr Thr 530 535 540 545 aca aat cca aga aaa ctt tac gac tac tgt gat gtc cct cag tgt gcg 1737Thr Asn Pro Arg Lys Leu Tyr Asp Tyr Cys Asp Val Pro Gln Cys Ala 550 555 560 gcc cct tca ttt gat tgt ggg aag cct caa gtg gag ccg aag aaa tgt 1785Ala Pro Ser Phe Asp Cys Gly Lys Pro Gln Val Glu Pro Lys Lys Cys 565 570 575 cct gga agg gtt gtg ggg ggg tgt gtg gcc cac cca cat tcc tgg ccc 1833Pro Gly Arg Val Val Gly Gly Cys Val Ala His Pro His Ser Trp Pro 580 585 590 tgg caa gtc agt ctt aga aca agg ttt gga atg cac ttc tgt gga ggc 1881Trp Gln Val Ser Leu Arg Thr Arg Phe Gly Met His Phe Cys Gly Gly 595 600 605 acc ttg ata tcc cca gag tgg gtg ttg act gct gcc cac tgc ttg gag 1929Thr Leu Ile Ser Pro Glu Trp Val Leu Thr Ala Ala His Cys Leu Glu 610 615 620 625 aag tcc cca agg cct tca tcc tac aag gtc atc ctg ggt gca cac caa 1977Lys Ser Pro Arg Pro Ser Ser Tyr Lys Val Ile Leu Gly Ala His Gln 630 635 640 gaa gtg aat ctc gaa ccg cat gtt cag gaa ata gaa gtg tct agg ctg 2025Glu Val Asn Leu Glu Pro His Val Gln Glu Ile Glu Val Ser Arg Leu 645 650 655 ttc ttg gag ccc aca cga aaa gat att gcc ttg cta aag cta agc agt 2073Phe Leu Glu Pro Thr Arg Lys Asp Ile Ala Leu Leu Lys Leu Ser Ser 660 665 670 cct gcc gtc atc act gac aaa gta atc cca gct tgt ctg cca tcc cca 2121Pro Ala Val Ile Thr Asp Lys Val Ile Pro Ala Cys Leu Pro Ser Pro 675 680 685 aat tat gtg gtc gct gac cgg acc gaa tgt ttc atc act ggc tgg gga 2169Asn Tyr Val Val Ala Asp Arg Thr Glu Cys Phe Ile Thr Gly Trp Gly 690 695 700 705 gaa acc caa ggt act ttt gga gct ggc ctt ctc aag gaa gcc cag ctc 2217Glu Thr Gln Gly Thr Phe Gly Ala Gly Leu Leu Lys Glu Ala Gln Leu 710 715 720 cct gtg att gag aat aaa gtg tgc aat cgc tat gag ttt ctg aat gga 2265Pro Val Ile Glu Asn Lys Val Cys Asn Arg Tyr Glu Phe Leu Asn Gly 725 730 735 aga gtc caa tcc acc gaa ctc tgt gct ggg cat ttg gcc gga ggc act 2313Arg Val Gln Ser Thr Glu Leu Cys Ala Gly His Leu Ala Gly Gly Thr 740 745 750 gac agt tgc cag ggt gac agt gga ggt cct ctg gtt tgc ttc gag aag 2361Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Phe Glu Lys 755 760 765 gac aaa tac att tta caa gga gtc act tct tgg ggt ctt ggc tgt gca 2409Asp Lys Tyr Ile Leu Gln Gly Val Thr Ser Trp Gly Leu Gly Cys Ala 770 775 780 785 cgc ccc aat aag cct ggt gtc tat gtt cgt gtt tca agg ttt gtt act 2457Arg Pro Asn Lys Pro Gly Val Tyr Val Arg Val Ser Arg Phe Val Thr 790 795 800 tgg att gag gga gtg atg aga aat aat taa ttggacggga gacagagtga 2507Trp Ile Glu Gly Val Met Arg Asn Asn 805 810 cgcactgact cacctagagg ctgggacgtg ggtagggatt tagcatgctg gaaataactg 2567gcagtaatca aacgaagaca ctgtccccag ctaccagcta cgccaaacct cggcattttt 2627tgtgttattt tctgactgct ggattctgta gtaaggtgac atagctatga catttgttaa 2687aaataaactc tgtacttaac tttgatttga gtaaattttg gtttt 27327821DNAArtificial SequencePCR primer 78cgctgggaac tttgtgacat c 217922DNAArtificial SequencePCR primer 79cccgctgcac aacacctcca cc 228021DNAArtificial SequencePCR probe 80cactggtagg tgggaccaga a 218114121DNAH. sapiensCDS(129)..(13820) 81attcccaccg ggacctgcgg ggctgagtgc ccttctcggt tgctgccgct gaggagcccg 60cccagccagc cagggccgcg aggccgaggc caggccgcag cccaggagcc gccccaccgc 120agctggcg atg gac ccg ccg agg ccc gcg ctg ctg gcg ctg ctg gcg ctg 170 Met Asp Pro Pro Arg Pro Ala Leu Leu Ala Leu Leu Ala Leu 1 5 10 cct gcg ctg ctg ctg ctg ctg ctg gcg ggc gcc agg gcc gaa gag gaa 218Pro Ala Leu Leu Leu Leu Leu Leu Ala Gly Ala Arg Ala Glu Glu Glu 15 20 25 30 atg ctg gaa aat gtc agc ctg gtc tgt cca aaa gat gcg acc cga ttc 266Met Leu Glu Asn Val Ser Leu Val Cys Pro Lys Asp Ala Thr Arg Phe 35 40 45 aag cac ctc cgg aag tac aca tac aac tat gag gct gag agt tcc agt 314Lys His Leu Arg Lys Tyr Thr Tyr Asn Tyr Glu Ala Glu Ser Ser Ser 50 55 60 gga gtc cct ggg act gct gat tca aga agt gcc acc agg atc aac tgc 362Gly Val Pro Gly Thr Ala Asp Ser Arg Ser Ala Thr Arg Ile Asn Cys 65 70 75 aag gtt gag ctg gag gtt ccc cag ctc tgc agc ttc atc ctg aag acc 410Lys Val Glu Leu Glu Val Pro Gln Leu Cys Ser Phe Ile Leu Lys Thr 80 85 90 agc cag tgc acc ctg aaa gag gtg tat ggc ttc aac cct gag ggc aaa 458Ser Gln Cys Thr Leu Lys Glu Val Tyr Gly Phe Asn Pro Glu Gly Lys 95 100 105 110 gcc ttg ctg aag aaa acc aag aac tct gag gag ttt gct gca gcc atg 506Ala Leu Leu Lys Lys Thr Lys Asn Ser Glu Glu Phe Ala Ala Ala Met 115 120 125 tcc agg tat gag ctc aag ctg gcc att cca gaa ggg aag cag gtt ttc 554Ser Arg Tyr Glu Leu Lys Leu Ala Ile Pro Glu Gly Lys Gln Val Phe 130 135 140 ctt tac ccg gag aaa gat gaa cct act tac atc ctg aac atc aag agg 602Leu Tyr Pro Glu Lys Asp Glu Pro Thr Tyr Ile Leu Asn Ile Lys Arg 145 150 155 ggc atc att tct gcc ctc ctg gtt ccc cca gag aca gaa gaa gcc aag 650Gly Ile Ile Ser Ala Leu Leu Val Pro Pro Glu Thr Glu Glu Ala Lys 160 165 170 caa gtg ttg ttt ctg gat acc gtg tat gga aac tgc tcc act cac ttt 698Gln Val Leu Phe Leu Asp Thr Val Tyr Gly Asn Cys Ser Thr His Phe 175 180 185 190 acc gtc aag acg agg aag ggc aat gtg gca aca gaa ata tcc act gaa 746Thr Val Lys Thr Arg Lys Gly Asn Val Ala Thr Glu Ile Ser Thr Glu 195 200 205 aga gac ctg ggg cag tgt gat cgc ttc aag ccc atc cgc aca ggc atc 794Arg Asp Leu Gly Gln Cys Asp Arg Phe Lys Pro Ile Arg Thr Gly Ile 210 215 220 agc cca ctt gct ctc atc aaa ggc atg acc cgc ccc ttg tca act ctg 842Ser Pro Leu Ala Leu Ile Lys Gly Met Thr Arg Pro Leu Ser Thr Leu 225 230 235 atc agc agc agc cag tcc tgt cag tac aca ctg gac gct aag agg aag 890Ile Ser Ser Ser Gln Ser Cys Gln Tyr Thr Leu Asp Ala Lys Arg Lys 240 245 250 cat gtg gca gaa gcc atc tgc aag gag caa cac ctc ttc ctg cct ttc 938His Val Ala Glu Ala Ile Cys Lys Glu Gln His Leu Phe Leu Pro Phe 255 260 265 270 tcc tac aac aat aag tat ggg atg gta gca caa gtg aca cag act ttg 986Ser Tyr Asn Asn Lys Tyr Gly Met Val Ala Gln Val Thr Gln Thr Leu 275 280 285 aaa ctt gaa gac aca cca aag atc aac agc cgc ttc ttt ggt gaa ggt 1034Lys Leu Glu Asp Thr Pro Lys Ile Asn Ser Arg Phe Phe Gly Glu Gly

290 295 300 act aag aag atg ggc ctc gca ttt gag agc acc aaa tcc aca tca cct 1082Thr Lys Lys Met Gly Leu Ala Phe Glu Ser Thr Lys Ser Thr Ser Pro 305 310 315 cca aag cag gcc gaa gct gtt ttg aag act ctc cag gaa ctg aaa aaa 1130Pro Lys Gln Ala Glu Ala Val Leu Lys Thr Leu Gln Glu Leu Lys Lys 320 325 330 cta acc atc tct gag caa aat atc cag aga gct aat ctc ttc aat aag 1178Leu Thr Ile Ser Glu Gln Asn Ile Gln Arg Ala Asn Leu Phe Asn Lys 335 340 345 350 ctg gtt act gag ctg aga ggc ctc agt gat gaa gca gtc aca tct ctc 1226Leu Val Thr Glu Leu Arg Gly Leu Ser Asp Glu Ala Val Thr Ser Leu 355 360 365 ttg cca cag ctg att gag gtg tcc agc ccc atc act tta caa gcc ttg 1274Leu Pro Gln Leu Ile Glu Val Ser Ser Pro Ile Thr Leu Gln Ala Leu 370 375 380 gtt cag tgt gga cag cct cag tgc tcc act cac atc ctc cag tgg ctg 1322Val Gln Cys Gly Gln Pro Gln Cys Ser Thr His Ile Leu Gln Trp Leu 385 390 395 aaa cgt gtg cat gcc aac ccc ctt ctg ata gat gtg gtc acc tac ctg 1370Lys Arg Val His Ala Asn Pro Leu Leu Ile Asp Val Val Thr Tyr Leu 400 405 410 gtg gcc ctg atc ccc gag ccc tca gca cag cag ctg cga gag atc ttc 1418Val Ala Leu Ile Pro Glu Pro Ser Ala Gln Gln Leu Arg Glu Ile Phe 415 420 425 430 aac atg gcg agg gat cag cgc agc cga gcc acc ttg tat gcg ctg agc 1466Asn Met Ala Arg Asp Gln Arg Ser Arg Ala Thr Leu Tyr Ala Leu Ser 435 440 445 cac gcg gtc aac aac tat cat aag aca aac cct aca ggg acc cag gag 1514His Ala Val Asn Asn Tyr His Lys Thr Asn Pro Thr Gly Thr Gln Glu 450 455 460 ctg ctg gac att gct aat tac ctg atg gaa cag att caa gat gac tgc 1562Leu Leu Asp Ile Ala Asn Tyr Leu Met Glu Gln Ile Gln Asp Asp Cys 465 470 475 act ggg gat gaa gat tac acc tat ttg att ctg cgg gtc att gga aat 1610Thr Gly Asp Glu Asp Tyr Thr Tyr Leu Ile Leu Arg Val Ile Gly Asn 480 485 490 atg ggc caa acc atg gag cag tta act cca gaa ctc aag tct tca atc 1658Met Gly Gln Thr Met Glu Gln Leu Thr Pro Glu Leu Lys Ser Ser Ile 495 500 505 510 ctc aaa tgt gtc caa agt aca aag cca tca ctg atg atc cag aaa gct 1706Leu Lys Cys Val Gln Ser Thr Lys Pro Ser Leu Met Ile Gln Lys Ala 515 520 525 gcc atc cag gct ctg cgg aaa atg gag cct aaa gac aag gac cag gag 1754Ala Ile Gln Ala Leu Arg Lys Met Glu Pro Lys Asp Lys Asp Gln Glu 530 535 540 gtt ctt ctt cag act ttc ctt gat gat gct tct ccg gga gat aag cga 1802Val Leu Leu Gln Thr Phe Leu Asp Asp Ala Ser Pro Gly Asp Lys Arg 545 550 555 ctg gct gcc tat ctt atg ttg atg agg agt cct tca cag gca gat att 1850Leu Ala Ala Tyr Leu Met Leu Met Arg Ser Pro Ser Gln Ala Asp Ile 560 565 570 aac aaa att gtc caa att cta cca tgg gaa cag aat gag caa gtg aag 1898Asn Lys Ile Val Gln Ile Leu Pro Trp Glu Gln Asn Glu Gln Val Lys 575 580 585 590 aac ttt gtg gct tcc cat att gcc aat atc ttg aac tca gaa gaa ttg 1946Asn Phe Val Ala Ser His Ile Ala Asn Ile Leu Asn Ser Glu Glu Leu 595 600 605 gat atc caa gat ctg aaa aag tta gtg aaa gaa gct ctg aaa gaa tct 1994Asp Ile Gln Asp Leu Lys Lys Leu Val Lys Glu Ala Leu Lys Glu Ser 610 615 620 caa ctt cca act gtc atg gac ttc aga aaa ttc tct cgg aac tat caa 2042Gln Leu Pro Thr Val Met Asp Phe Arg Lys Phe Ser Arg Asn Tyr Gln 625 630 635 ctc tac aaa tct gtt tct ctt cca tca ctt gac cca gcc tca gcc aaa 2090Leu Tyr Lys Ser Val Ser Leu Pro Ser Leu Asp Pro Ala Ser Ala Lys 640 645 650 ata gaa ggg aat ctt ata ttt gat cca aat aac tac ctt cct aaa gaa 2138Ile Glu Gly Asn Leu Ile Phe Asp Pro Asn Asn Tyr Leu Pro Lys Glu 655 660 665 670 agc atg ctg aaa act acc ctc act gcc ttt gga ttt gct tca gct gac 2186Ser Met Leu Lys Thr Thr Leu Thr Ala Phe Gly Phe Ala Ser Ala Asp 675 680 685 ctc atc gag att ggc ttg gaa gga aaa ggc ttt gag cca aca ttg gaa 2234Leu Ile Glu Ile Gly Leu Glu Gly Lys Gly Phe Glu Pro Thr Leu Glu 690 695 700 gct ctt ttt ggg aag caa gga ttt ttc cca gac agt gtc aac aaa gct 2282Ala Leu Phe Gly Lys Gln Gly Phe Phe Pro Asp Ser Val Asn Lys Ala 705 710 715 ttg tac tgg gtt aat ggt caa gtt cct gat ggt gtc tct aag gtc tta 2330Leu Tyr Trp Val Asn Gly Gln Val Pro Asp Gly Val Ser Lys Val Leu 720 725 730 gtg gac cac ttt ggc tat acc aaa gat gat aaa cat gag cag gat atg 2378Val Asp His Phe Gly Tyr Thr Lys Asp Asp Lys His Glu Gln Asp Met 735 740 745 750 gta aat gga ata atg ctc agt gtt gag aag ctg att aaa gat ttg aaa 2426Val Asn Gly Ile Met Leu Ser Val Glu Lys Leu Ile Lys Asp Leu Lys 755 760 765 tcc aaa gaa gtc ccg gaa gcc aga gcc tac ctc cgc atc ttg gga gag 2474Ser Lys Glu Val Pro Glu Ala Arg Ala Tyr Leu Arg Ile Leu Gly Glu 770 775 780 gag ctt ggt ttt gcc agt ctc cat gac ctc cag ctc ctg gga aag ctg 2522Glu Leu Gly Phe Ala Ser Leu His Asp Leu Gln Leu Leu Gly Lys Leu 785 790 795 ctt ctg atg ggt gcc cgc act ctg cag ggg atc ccc cag atg att gga 2570Leu Leu Met Gly Ala Arg Thr Leu Gln Gly Ile Pro Gln Met Ile Gly 800 805 810 gag gtc atc agg aag ggc tca aag aat gac ttt ttt ctt cac tac atc 2618Glu Val Ile Arg Lys Gly Ser Lys Asn Asp Phe Phe Leu His Tyr Ile 815 820 825 830 ttc atg gag aat gcc ttt gaa ctc ccc act gga gct gga tta cag ttg 2666Phe Met Glu Asn Ala Phe Glu Leu Pro Thr Gly Ala Gly Leu Gln Leu 835 840 845 caa ata tct tca tct gga gtc att gct ccc gga gcc aag gct gga gta 2714Gln Ile Ser Ser Ser Gly Val Ile Ala Pro Gly Ala Lys Ala Gly Val 850 855 860 aaa ctg gaa gta gcc aac atg cag gct gaa ctg gtg gca aaa ccc tcc 2762Lys Leu Glu Val Ala Asn Met Gln Ala Glu Leu Val Ala Lys Pro Ser 865 870 875 gtg tct gtg gag ttt gtg aca aat atg ggc atc atc att ccg gac ttc 2810Val Ser Val Glu Phe Val Thr Asn Met Gly Ile Ile Ile Pro Asp Phe 880 885 890 gct agg agt ggg gtc cag atg aac acc aac ttc ttc cac gag tcg ggt 2858Ala Arg Ser Gly Val Gln Met Asn Thr Asn Phe Phe His Glu Ser Gly 895 900 905 910 ctg gag gct cat gtt gcc cta aaa gct ggg aag ctg aag ttt atc att 2906Leu Glu Ala His Val Ala Leu Lys Ala Gly Lys Leu Lys Phe Ile Ile 915 920 925 cct tcc cca aag aga cca gtc aag ctg ctc agt gga ggc aac aca tta 2954Pro Ser Pro Lys Arg Pro Val Lys Leu Leu Ser Gly Gly Asn Thr Leu 930 935 940 cat ttg gtc tct acc acc aaa acg gag gtg atc cca cct ctc att gag 3002His Leu Val Ser Thr Thr Lys Thr Glu Val Ile Pro Pro Leu Ile Glu 945 950 955 aac agg cag tcc tgg tca gtt tgc aag caa gtc ttt cct ggc ctg aat 3050Asn Arg Gln Ser Trp Ser Val Cys Lys Gln Val Phe Pro Gly Leu Asn 960 965 970 tac tgc acc tca ggc gct tac tcc aac gcc agc tcc aca gac tcc gcc 3098Tyr Cys Thr Ser Gly Ala Tyr Ser Asn Ala Ser Ser Thr Asp Ser Ala 975 980 985 990 tcc tac tat ccg ctg acc ggg gac acc aga tta gag ctg gaa ctg agg 3146Ser Tyr Tyr Pro Leu Thr Gly Asp Thr Arg Leu Glu Leu Glu Leu Arg 995 1000 1005 cct aca gga gag att gag cag tat tct gtc agc gca acc tat gag 3191Pro Thr Gly Glu Ile Glu Gln Tyr Ser Val Ser Ala Thr Tyr Glu 1010 1015 1020 ctc cag aga gag gac aga gcc ttg gtg gat acc ctg aag ttt gta 3236Leu Gln Arg Glu Asp Arg Ala Leu Val Asp Thr Leu Lys Phe Val 1025 1030 1035 act caa gca gaa ggt gcg aag cag act gag gct acc atg aca ttc 3281Thr Gln Ala Glu Gly Ala Lys Gln Thr Glu Ala Thr Met Thr Phe 1040 1045 1050 aaa tat aat cgg cag agt atg acc ttg tcc agt gaa gtc caa att 3326Lys Tyr Asn Arg Gln Ser Met Thr Leu Ser Ser Glu Val Gln Ile 1055 1060 1065 ccg gat ttt gat gtt gac ctc gga aca atc ctc aga gtt aat gat 3371Pro Asp Phe Asp Val Asp Leu Gly Thr Ile Leu Arg Val Asn Asp 1070 1075 1080 gaa tct act gag ggc aaa acg tct tac aga ctc acc ctg gac att 3416Glu Ser Thr Glu Gly Lys Thr Ser Tyr Arg Leu Thr Leu Asp Ile 1085 1090 1095 cag aac aag aaa att act gag gtc gcc ctc atg ggc cac cta agt 3461Gln Asn Lys Lys Ile Thr Glu Val Ala Leu Met Gly His Leu Ser 1100 1105 1110 tgt gac aca aag gaa gaa aga aaa atc aag ggt gtt att tcc ata 3506Cys Asp Thr Lys Glu Glu Arg Lys Ile Lys Gly Val Ile Ser Ile 1115 1120 1125 ccc cgt ttg caa gca gaa gcc aga agt gag atc ctc gcc cac tgg 3551Pro Arg Leu Gln Ala Glu Ala Arg Ser Glu Ile Leu Ala His Trp 1130 1135 1140 tcg cct gcc aaa ctg ctt ctc caa atg gac tca tct gct aca gct 3596Ser Pro Ala Lys Leu Leu Leu Gln Met Asp Ser Ser Ala Thr Ala 1145 1150 1155 tat ggc tcc aca gtt tcc aag agg gtg gca tgg cat tat gat gaa 3641Tyr Gly Ser Thr Val Ser Lys Arg Val Ala Trp His Tyr Asp Glu 1160 1165 1170 gag aag att gaa ttt gaa tgg aac aca ggc acc aat gta gat acc 3686Glu Lys Ile Glu Phe Glu Trp Asn Thr Gly Thr Asn Val Asp Thr 1175 1180 1185 aaa aaa atg act tcc aat ttc cct gtg gat ctc tcc gat tat cct 3731Lys Lys Met Thr Ser Asn Phe Pro Val Asp Leu Ser Asp Tyr Pro 1190 1195 1200 aag agc ttg cat atg tat gct aat aga ctc ctg gat cac aga gtc 3776Lys Ser Leu His Met Tyr Ala Asn Arg Leu Leu Asp His Arg Val 1205 1210 1215 cct gaa aca gac atg act ttc cgg cac gtg ggt tcc aaa tta ata 3821Pro Glu Thr Asp Met Thr Phe Arg His Val Gly Ser Lys Leu Ile 1220 1225 1230 gtt gca atg agc tca tgg ctt cag aag gca tct ggg agt ctt cct 3866Val Ala Met Ser Ser Trp Leu Gln Lys Ala Ser Gly Ser Leu Pro 1235 1240 1245 tat acc cag act ttg caa gac cac ctc aat agc ctg aag gag ttc 3911Tyr Thr Gln Thr Leu Gln Asp His Leu Asn Ser Leu Lys Glu Phe 1250 1255 1260 aac ctc cag aac atg gga ttg cca gac ttc cac atc cca gaa aac 3956Asn Leu Gln Asn Met Gly Leu Pro Asp Phe His Ile Pro Glu Asn 1265 1270 1275 ctc ttc tta aaa agc gat ggc cgg gtc aaa tat acc ttg aac aag 4001Leu Phe Leu Lys Ser Asp Gly Arg Val Lys Tyr Thr Leu Asn Lys 1280 1285 1290 aac agt ttg aaa att gag att cct ttg cct ttt ggt ggc aaa tcc 4046Asn Ser Leu Lys Ile Glu Ile Pro Leu Pro Phe Gly Gly Lys Ser 1295 1300 1305 tcc aga gat cta aag atg tta gag act gtt agg aca cca gcc ctc 4091Ser Arg Asp Leu Lys Met Leu Glu Thr Val Arg Thr Pro Ala Leu 1310 1315 1320 cac ttc aag tct gtg gga ttc cat ctg cca tct cga gag ttc caa 4136His Phe Lys Ser Val Gly Phe His Leu Pro Ser Arg Glu Phe Gln 1325 1330 1335 gtc cct act ttt acc att ccc aag ttg tat caa ctg caa gtg cct 4181Val Pro Thr Phe Thr Ile Pro Lys Leu Tyr Gln Leu Gln Val Pro 1340 1345 1350 ctc ctg ggt gtt cta gac ctc tcc acg aat gtc tac agc aac ttg 4226Leu Leu Gly Val Leu Asp Leu Ser Thr Asn Val Tyr Ser Asn Leu 1355 1360 1365 tac aac tgg tcc gcc tcc tac agt ggt ggc aac acc agc aca gac 4271Tyr Asn Trp Ser Ala Ser Tyr Ser Gly Gly Asn Thr Ser Thr Asp 1370 1375 1380 cat ttc agc ctt cgg gct cgt tac cac atg aag gct gac tct gtg 4316His Phe Ser Leu Arg Ala Arg Tyr His Met Lys Ala Asp Ser Val 1385 1390 1395 gtt gac ctg ctt tcc tac aat gtg caa gga tct gga gaa aca aca 4361Val Asp Leu Leu Ser Tyr Asn Val Gln Gly Ser Gly Glu Thr Thr 1400 1405 1410 tat gac cac aag aat acg ttc aca cta tca tgt gat ggg tct cta 4406Tyr Asp His Lys Asn Thr Phe Thr Leu Ser Cys Asp Gly Ser Leu 1415 1420 1425 cgc cac aaa ttt cta gat tcg aat atc aaa ttc agt cat gta gaa 4451Arg His Lys Phe Leu Asp Ser Asn Ile Lys Phe Ser His Val Glu 1430 1435 1440 aaa ctt gga aac aac cca gtc tca aaa ggt tta cta ata ttc gat 4496Lys Leu Gly Asn Asn Pro Val Ser Lys Gly Leu Leu Ile Phe Asp 1445 1450 1455 gca tct agt tcc tgg gga cca cag atg tct gct tca gtt cat ttg 4541Ala Ser Ser Ser Trp Gly Pro Gln Met Ser Ala Ser Val His Leu 1460 1465 1470 gac tcc aaa aag aaa cag cat ttg ttt gtc aaa gaa gtc aag att 4586Asp Ser Lys Lys Lys Gln His Leu Phe Val Lys Glu Val Lys Ile 1475 1480 1485 gat ggg cag ttc aga gtc tct tcg ttc tat gct aaa ggc aca tat 4631Asp Gly Gln Phe Arg Val Ser Ser Phe Tyr Ala Lys Gly Thr Tyr 1490 1495 1500 ggc ctg tct tgt cag agg gat cct aac act ggc cgg ctc aat gga 4676Gly Leu Ser Cys Gln Arg Asp Pro Asn Thr Gly Arg Leu Asn Gly 1505 1510 1515 gag tcc aac ctg agg ttt aac tcc tcc tac ctc caa ggc acc aac 4721Glu Ser Asn Leu Arg Phe Asn Ser Ser Tyr Leu Gln Gly Thr Asn 1520 1525 1530 cag ata aca gga aga tat gaa gat gga acc ctc tcc ctc acc tcc 4766Gln Ile Thr Gly Arg Tyr Glu Asp Gly Thr Leu Ser Leu Thr Ser 1535 1540 1545 acc tct gat ctg caa agt ggc atc att aaa aat act gct tcc cta 4811Thr Ser Asp Leu Gln Ser Gly Ile Ile Lys Asn Thr Ala Ser Leu 1550 1555 1560 aag tat gag aac tac gag ctg act tta aaa tct gac acc aat ggg 4856Lys Tyr Glu Asn Tyr Glu Leu Thr Leu Lys Ser Asp Thr Asn Gly 1565 1570 1575 aag tat aag aac ttt gcc act tct aac aag atg gat atg acc ttc 4901Lys Tyr Lys Asn Phe Ala Thr Ser Asn Lys Met Asp Met Thr Phe 1580 1585 1590 tct aag caa aat gca ctg ctg cgt tct gaa tat cag gct gat tac

4946Ser Lys Gln Asn Ala Leu Leu Arg Ser Glu Tyr Gln Ala Asp Tyr 1595 1600 1605 gag tca ttg agg ttc ttc agc ctg ctt tct gga tca cta aat tcc 4991Glu Ser Leu Arg Phe Phe Ser Leu Leu Ser Gly Ser Leu Asn Ser 1610 1615 1620 cat ggt ctt gag tta aat gct gac atc tta ggc act gac aaa att 5036His Gly Leu Glu Leu Asn Ala Asp Ile Leu Gly Thr Asp Lys Ile 1625 1630 1635 aat agt ggt gct cac aag gcg aca cta agg att ggc caa gat gga 5081Asn Ser Gly Ala His Lys Ala Thr Leu Arg Ile Gly Gln Asp Gly 1640 1645 1650 ata tct acc agt gca acg acc aac ttg aag tgt agt ctc ctg gtg 5126Ile Ser Thr Ser Ala Thr Thr Asn Leu Lys Cys Ser Leu Leu Val 1655 1660 1665 ctg gag aat gag ctg aat gca gag ctt ggc ctc tct ggg gca tct 5171Leu Glu Asn Glu Leu Asn Ala Glu Leu Gly Leu Ser Gly Ala Ser 1670 1675 1680 atg aaa tta aca aca aat ggc cgc ttc agg gaa cac aat gca aaa 5216Met Lys Leu Thr Thr Asn Gly Arg Phe Arg Glu His Asn Ala Lys 1685 1690 1695 ttc agt ctg gat ggg aaa gcc gcc ctc aca gag cta tca ctg gga 5261Phe Ser Leu Asp Gly Lys Ala Ala Leu Thr Glu Leu Ser Leu Gly 1700 1705 1710 agt gct tat cag gcc atg att ctg ggt gtc gac agc aaa aac att 5306Ser Ala Tyr Gln Ala Met Ile Leu Gly Val Asp Ser Lys Asn Ile 1715 1720 1725 ttc aac ttc aag gtc agt caa gaa gga ctt aag ctc tca aat gac 5351Phe Asn Phe Lys Val Ser Gln Glu Gly Leu Lys Leu Ser Asn Asp 1730 1735 1740 atg atg ggc tca tat gct gaa atg aaa ttt gac cac aca aac agt 5396Met Met Gly Ser Tyr Ala Glu Met Lys Phe Asp His Thr Asn Ser 1745 1750 1755 ctg aac att gca ggc tta tca ctg gac ttc tct tca aaa ctt gac 5441Leu Asn Ile Ala Gly Leu Ser Leu Asp Phe Ser Ser Lys Leu Asp 1760 1765 1770 aac att tac agc tct gac aag ttt tat aag caa act gtt aat tta 5486Asn Ile Tyr Ser Ser Asp Lys Phe Tyr Lys Gln Thr Val Asn Leu 1775 1780 1785 cag cta cag ccc tat tct ctg gta act act tta aac agt gac ctg 5531Gln Leu Gln Pro Tyr Ser Leu Val Thr Thr Leu Asn Ser Asp Leu 1790 1795 1800 aaa tac aat gct ctg gat ctc acc aac aat ggg aaa cta cgg cta 5576Lys Tyr Asn Ala Leu Asp Leu Thr Asn Asn Gly Lys Leu Arg Leu 1805 1810 1815 gaa ccc ctg aag ctg cat gtg gct ggt aac cta aaa gga gcc tac 5621Glu Pro Leu Lys Leu His Val Ala Gly Asn Leu Lys Gly Ala Tyr 1820 1825 1830 caa aat aat gaa ata aaa cac atc tat gcc atc tct tct gct gcc 5666Gln Asn Asn Glu Ile Lys His Ile Tyr Ala Ile Ser Ser Ala Ala 1835 1840 1845 tta tca gca agc tat aaa gca gac act gtt gct aag gtt cag ggt 5711Leu Ser Ala Ser Tyr Lys Ala Asp Thr Val Ala Lys Val Gln Gly 1850 1855 1860 gtg gag ttt agc cat cgg ctc aac aca gac atc gct ggg ctg gct 5756Val Glu Phe Ser His Arg Leu Asn Thr Asp Ile Ala Gly Leu Ala 1865 1870 1875 tca gcc att gac atg agc aca aac tat aat tca gac tca ctg cat 5801Ser Ala Ile Asp Met Ser Thr Asn Tyr Asn Ser Asp Ser Leu His 1880 1885 1890 ttc agc aat gtc ttc cgt tct gta atg gcc ccg ttt acc atg acc 5846Phe Ser Asn Val Phe Arg Ser Val Met Ala Pro Phe Thr Met Thr 1895 1900 1905 atc gat gca cat aca aat ggc aat ggg aaa ctc gct ctc tgg gga 5891Ile Asp Ala His Thr Asn Gly Asn Gly Lys Leu Ala Leu Trp Gly 1910 1915 1920 gaa cat act ggg cag ctg tat agc aaa ttc ctg ttg aaa gca gaa 5936Glu His Thr Gly Gln Leu Tyr Ser Lys Phe Leu Leu Lys Ala Glu 1925 1930 1935 cct ctg gca ttt act ttc tct cat gat tac aaa ggc tcc aca agt 5981Pro Leu Ala Phe Thr Phe Ser His Asp Tyr Lys Gly Ser Thr Ser 1940 1945 1950 cat cat ctc gtg tct agg aaa agc atc agt gca gct ctt gaa cac 6026His His Leu Val Ser Arg Lys Ser Ile Ser Ala Ala Leu Glu His 1955 1960 1965 aaa gtc agt gcc ctg ctt act cca gct gag cag aca ggc acc tgg 6071Lys Val Ser Ala Leu Leu Thr Pro Ala Glu Gln Thr Gly Thr Trp 1970 1975 1980 aaa ctc aag acc caa ttt aac aac aat gaa tac agc cag gac ttg 6116Lys Leu Lys Thr Gln Phe Asn Asn Asn Glu Tyr Ser Gln Asp Leu 1985 1990 1995 gat gct tac aac act aaa gat aaa att ggc gtg gag ctt act gga 6161Asp Ala Tyr Asn Thr Lys Asp Lys Ile Gly Val Glu Leu Thr Gly 2000 2005 2010 cga act ctg gct gac cta act cta cta gac tcc cca att aaa gtg 6206Arg Thr Leu Ala Asp Leu Thr Leu Leu Asp Ser Pro Ile Lys Val 2015 2020 2025 cca ctt tta ctc agt gag ccc atc aat atc att gat gct tta gag 6251Pro Leu Leu Leu Ser Glu Pro Ile Asn Ile Ile Asp Ala Leu Glu 2030 2035 2040 atg aga gat gcc gtt gag aag ccc caa gaa ttt aca att gtt gct 6296Met Arg Asp Ala Val Glu Lys Pro Gln Glu Phe Thr Ile Val Ala 2045 2050 2055 ttt gta aag tat gat aaa aac caa gat gtt cac tcc att aac ctc 6341Phe Val Lys Tyr Asp Lys Asn Gln Asp Val His Ser Ile Asn Leu 2060 2065 2070 cca ttt ttt gag acc ttg caa gaa tat ttt gag agg aat cga caa 6386Pro Phe Phe Glu Thr Leu Gln Glu Tyr Phe Glu Arg Asn Arg Gln 2075 2080 2085 acc att ata gtt gta gtg gaa aac gta cag aga aac ctg aag cac 6431Thr Ile Ile Val Val Val Glu Asn Val Gln Arg Asn Leu Lys His 2090 2095 2100 atc aat att gat caa ttt gta aga aaa tac aga gca gcc ctg gga 6476Ile Asn Ile Asp Gln Phe Val Arg Lys Tyr Arg Ala Ala Leu Gly 2105 2110 2115 aaa ctc cca cag caa gct aat gat tat ctg aat tca ttc aat tgg 6521Lys Leu Pro Gln Gln Ala Asn Asp Tyr Leu Asn Ser Phe Asn Trp 2120 2125 2130 gag aga caa gtt tca cat gcc aag gag aaa ctg act gct ctc aca 6566Glu Arg Gln Val Ser His Ala Lys Glu Lys Leu Thr Ala Leu Thr 2135 2140 2145 aaa aag tat aga att aca gaa aat gat ata caa att gca tta gat 6611Lys Lys Tyr Arg Ile Thr Glu Asn Asp Ile Gln Ile Ala Leu Asp 2150 2155 2160 gat gcc aaa atc aac ttt aat gaa aaa cta tct caa ctg cag aca 6656Asp Ala Lys Ile Asn Phe Asn Glu Lys Leu Ser Gln Leu Gln Thr 2165 2170 2175 tat atg ata caa ttt gat cag tat att aaa gat agt tat gat tta 6701Tyr Met Ile Gln Phe Asp Gln Tyr Ile Lys Asp Ser Tyr Asp Leu 2180 2185 2190 cat gat ttg aaa ata gct att gct aat att att gat gaa atc att 6746His Asp Leu Lys Ile Ala Ile Ala Asn Ile Ile Asp Glu Ile Ile 2195 2200 2205 gaa aaa tta aaa agt ctt gat gag cac tat cat atc cgt gta aat 6791Glu Lys Leu Lys Ser Leu Asp Glu His Tyr His Ile Arg Val Asn 2210 2215 2220 tta gta aaa aca atc cat gat cta cat ttg ttt att gaa aat att 6836Leu Val Lys Thr Ile His Asp Leu His Leu Phe Ile Glu Asn Ile 2225 2230 2235 gat ttt aac aaa agt gga agt agt act gca tcc tgg att caa aat 6881Asp Phe Asn Lys Ser Gly Ser Ser Thr Ala Ser Trp Ile Gln Asn 2240 2245 2250 gtg gat act aag tac caa atc aga atc cag ata caa gaa aaa ctg 6926Val Asp Thr Lys Tyr Gln Ile Arg Ile Gln Ile Gln Glu Lys Leu 2255 2260 2265 cag cag ctt aag aga cac ata cag aat ata gac atc cag cac cta 6971Gln Gln Leu Lys Arg His Ile Gln Asn Ile Asp Ile Gln His Leu 2270 2275 2280 gct gga aag tta aaa caa cac att gag gct att gat gtt aga gtg 7016Ala Gly Lys Leu Lys Gln His Ile Glu Ala Ile Asp Val Arg Val 2285 2290 2295 ctt tta gat caa ttg gga act aca att tca ttt gaa aga ata aat 7061Leu Leu Asp Gln Leu Gly Thr Thr Ile Ser Phe Glu Arg Ile Asn 2300 2305 2310 gat gtt ctt gag cat gtc aaa cac ttt gtt ata aat ctt att ggg 7106Asp Val Leu Glu His Val Lys His Phe Val Ile Asn Leu Ile Gly 2315 2320 2325 gat ttt gaa gta gct gag aaa atc aat gcc ttc aga gcc aaa gtc 7151Asp Phe Glu Val Ala Glu Lys Ile Asn Ala Phe Arg Ala Lys Val 2330 2335 2340 cat gag tta atc gag agg tat gaa gta gac caa caa atc cag gtt 7196His Glu Leu Ile Glu Arg Tyr Glu Val Asp Gln Gln Ile Gln Val 2345 2350 2355 tta atg gat aaa tta gta gag ttg acc cac caa tac aag ttg aag 7241Leu Met Asp Lys Leu Val Glu Leu Thr His Gln Tyr Lys Leu Lys 2360 2365 2370 gag act att cag aag cta agc aat gtc cta caa caa gtt aag ata 7286Glu Thr Ile Gln Lys Leu Ser Asn Val Leu Gln Gln Val Lys Ile 2375 2380 2385 aaa gat tac ttt gag aaa ttg gtt gga ttt att gat gat gct gtg 7331Lys Asp Tyr Phe Glu Lys Leu Val Gly Phe Ile Asp Asp Ala Val 2390 2395 2400 aag aag ctt aat gaa tta tct ttt aaa aca ttc att gaa gat gtt 7376Lys Lys Leu Asn Glu Leu Ser Phe Lys Thr Phe Ile Glu Asp Val 2405 2410 2415 aac aaa ttc ctt gac atg ttg ata aag aaa tta aag tca ttt gat 7421Asn Lys Phe Leu Asp Met Leu Ile Lys Lys Leu Lys Ser Phe Asp 2420 2425 2430 tac cac cag ttt gta gat gaa acc aat gac aaa atc cgt gag gtg 7466Tyr His Gln Phe Val Asp Glu Thr Asn Asp Lys Ile Arg Glu Val 2435 2440 2445 act cag aga ctc aat ggt gaa att cag gct ctg gaa cta cca caa 7511Thr Gln Arg Leu Asn Gly Glu Ile Gln Ala Leu Glu Leu Pro Gln 2450 2455 2460 aaa gct gaa gca tta aaa ctg ttt tta gag gaa acc aag gcc aca 7556Lys Ala Glu Ala Leu Lys Leu Phe Leu Glu Glu Thr Lys Ala Thr 2465 2470 2475 gtt gca gtg tat ctg gaa agc cta cag gac acc aaa ata acc tta 7601Val Ala Val Tyr Leu Glu Ser Leu Gln Asp Thr Lys Ile Thr Leu 2480 2485 2490 atc atc aat tgg tta cag gag gct tta agt tca gca tct ttg gct 7646Ile Ile Asn Trp Leu Gln Glu Ala Leu Ser Ser Ala Ser Leu Ala 2495 2500 2505 cac atg aag gcc aaa ttc cga gag act cta gaa gat aca cga gac 7691His Met Lys Ala Lys Phe Arg Glu Thr Leu Glu Asp Thr Arg Asp 2510 2515 2520 cga atg tat caa atg gac att cag cag gaa ctt caa cga tac ctg 7736Arg Met Tyr Gln Met Asp Ile Gln Gln Glu Leu Gln Arg Tyr Leu 2525 2530 2535 tct ctg gta ggc cag gtt tat agc aca ctt gtc acc tac att tct 7781Ser Leu Val Gly Gln Val Tyr Ser Thr Leu Val Thr Tyr Ile Ser 2540 2545 2550 gat tgg tgg act ctt gct gct aag aac ctt act gac ttt gca gag 7826Asp Trp Trp Thr Leu Ala Ala Lys Asn Leu Thr Asp Phe Ala Glu 2555 2560 2565 caa tat tct atc caa gat tgg gct aaa cgt atg aaa gca ttg gta 7871Gln Tyr Ser Ile Gln Asp Trp Ala Lys Arg Met Lys Ala Leu Val 2570 2575 2580 gag caa ggg ttc act gtt cct gaa atc aag acc atc ctt ggg acc 7916Glu Gln Gly Phe Thr Val Pro Glu Ile Lys Thr Ile Leu Gly Thr 2585 2590 2595 atg cct gcc ttt gaa gtc agt ctt cag gct ctt cag aaa gct acc 7961Met Pro Ala Phe Glu Val Ser Leu Gln Ala Leu Gln Lys Ala Thr 2600 2605 2610 ttc cag aca cct gat ttt ata gtc ccc cta aca gat ttg agg att 8006Phe Gln Thr Pro Asp Phe Ile Val Pro Leu Thr Asp Leu Arg Ile 2615 2620 2625 cca tca gtt cag ata aac ttc aaa gac tta aaa aat ata aaa atc 8051Pro Ser Val Gln Ile Asn Phe Lys Asp Leu Lys Asn Ile Lys Ile 2630 2635 2640 cca tcc agg ttt tcc aca cca gaa ttt acc atc ctt aac acc ttc 8096Pro Ser Arg Phe Ser Thr Pro Glu Phe Thr Ile Leu Asn Thr Phe 2645 2650 2655 cac att cct tcc ttt aca att gac ttt gtc gaa atg aaa gta aag 8141His Ile Pro Ser Phe Thr Ile Asp Phe Val Glu Met Lys Val Lys 2660 2665 2670 atc atc aga acc att gac cag atg cag aac agt gag ctg cag tgg 8186Ile Ile Arg Thr Ile Asp Gln Met Gln Asn Ser Glu Leu Gln Trp 2675 2680 2685 ccc gtt cca gat ata tat ctc agg gat ctg aag gtg gag gac att 8231Pro Val Pro Asp Ile Tyr Leu Arg Asp Leu Lys Val Glu Asp Ile 2690 2695 2700 cct cta gcg aga atc acc ctg cca gac ttc cgt tta cca gaa atc 8276Pro Leu Ala Arg Ile Thr Leu Pro Asp Phe Arg Leu Pro Glu Ile 2705 2710 2715 gca att cca gaa ttc ata atc cca act ctc aac ctt aat gat ttt 8321Ala Ile Pro Glu Phe Ile Ile Pro Thr Leu Asn Leu Asn Asp Phe 2720 2725 2730 caa gtt cct gac ctt cac ata cca gaa ttc cag ctt ccc cac atc 8366Gln Val Pro Asp Leu His Ile Pro Glu Phe Gln Leu Pro His Ile 2735 2740 2745 tca cac aca att gaa gta cct act ttt ggc aag cta tac agt att 8411Ser His Thr Ile Glu Val Pro Thr Phe Gly Lys Leu Tyr Ser Ile 2750 2755 2760 ctg aaa atc caa tct cct ctt ttc aca tta gat gca aat gct gac 8456Leu Lys Ile Gln Ser Pro Leu Phe Thr Leu Asp Ala Asn Ala Asp 2765 2770 2775 ata ggg aat gga acc acc tca gca aac gaa gca ggt atc gca gct 8501Ile Gly Asn Gly Thr Thr Ser Ala Asn Glu Ala Gly Ile Ala Ala 2780 2785 2790 tcc atc act gcc aaa gga gag tcc aaa tta gaa gtt ctc aat ttt 8546Ser Ile Thr Ala Lys Gly Glu Ser Lys Leu Glu Val Leu Asn Phe 2795 2800 2805 gat ttt caa gca aat gca caa ctc tca aac cct aag att aat ccg 8591Asp Phe Gln Ala Asn Ala Gln Leu Ser Asn Pro Lys Ile Asn Pro 2810 2815 2820 ctg gct ctg aag gag tca gtg aag ttc tcc agc aag tac ctg aga 8636Leu Ala Leu Lys Glu Ser Val Lys Phe Ser Ser Lys Tyr Leu Arg 2825 2830 2835 acg gag cat ggg agt gaa atg ctg ttt ttt gga aat gct att gag 8681Thr Glu His Gly Ser Glu Met Leu Phe Phe Gly Asn Ala Ile Glu 2840 2845 2850

gga aaa tca aac aca gtg gca agt tta cac aca gaa aaa aat aca 8726Gly Lys Ser Asn Thr Val Ala Ser Leu His Thr Glu Lys Asn Thr 2855 2860 2865 ctg gag ctt agt aat gga gtg att gtc aag ata aac aat cag ctt 8771Leu Glu Leu Ser Asn Gly Val Ile Val Lys Ile Asn Asn Gln Leu 2870 2875 2880 acc ctg gat agc aac act aaa tac ttc cac aaa ttg aac atc ccc 8816Thr Leu Asp Ser Asn Thr Lys Tyr Phe His Lys Leu Asn Ile Pro 2885 2890 2895 aaa ctg gac ttc tct agt cag gct gac ctg cgc aac gag atc aag 8861Lys Leu Asp Phe Ser Ser Gln Ala Asp Leu Arg Asn Glu Ile Lys 2900 2905 2910 aca ctg ttg aaa gct ggc cac ata gca tgg act tct tct gga aaa 8906Thr Leu Leu Lys Ala Gly His Ile Ala Trp Thr Ser Ser Gly Lys 2915 2920 2925 ggg tca tgg aaa tgg gcc tgc ccc aga ttc tca gat gag gga aca 8951Gly Ser Trp Lys Trp Ala Cys Pro Arg Phe Ser Asp Glu Gly Thr 2930 2935 2940 cat gaa tca caa att agt ttc acc ata gaa gga ccc ctc act tcc 8996His Glu Ser Gln Ile Ser Phe Thr Ile Glu Gly Pro Leu Thr Ser 2945 2950 2955 ttt gga ctg tcc aat aag atc aat agc aaa cac cta aga gta aac 9041Phe Gly Leu Ser Asn Lys Ile Asn Ser Lys His Leu Arg Val Asn 2960 2965 2970 caa aac ttg gtt tat gaa tct ggc tcc ctc aac ttt tct aaa ctt 9086Gln Asn Leu Val Tyr Glu Ser Gly Ser Leu Asn Phe Ser Lys Leu 2975 2980 2985 gaa att caa tca caa gtc gat tcc cag cat gtg ggc cac agt gtt 9131Glu Ile Gln Ser Gln Val Asp Ser Gln His Val Gly His Ser Val 2990 2995 3000 cta act gct aaa ggc atg gca ctg ttt gga gaa ggg aag gca gag 9176Leu Thr Ala Lys Gly Met Ala Leu Phe Gly Glu Gly Lys Ala Glu 3005 3010 3015 ttt act ggg agg cat gat gct cat tta aat gga aag gtt att gga 9221Phe Thr Gly Arg His Asp Ala His Leu Asn Gly Lys Val Ile Gly 3020 3025 3030 act ttg aaa aat tct ctt ttc ttt tca gcc cag cca ttt gag atc 9266Thr Leu Lys Asn Ser Leu Phe Phe Ser Ala Gln Pro Phe Glu Ile 3035 3040 3045 acg gca tcc aca aac aat gaa ggg aat ttg aaa gtt cgt ttt cca 9311Thr Ala Ser Thr Asn Asn Glu Gly Asn Leu Lys Val Arg Phe Pro 3050 3055 3060 tta agg tta aca ggg aag ata gac ttc ctg aat aac tat gca ctg 9356Leu Arg Leu Thr Gly Lys Ile Asp Phe Leu Asn Asn Tyr Ala Leu 3065 3070 3075 ttt ctg agt ccc agt gcc cag caa gca agt tgg caa gta agt gct 9401Phe Leu Ser Pro Ser Ala Gln Gln Ala Ser Trp Gln Val Ser Ala 3080 3085 3090 agg ttc aat cag tat aag tac aac caa aat ttc tct gct gga aac 9446Arg Phe Asn Gln Tyr Lys Tyr Asn Gln Asn Phe Ser Ala Gly Asn 3095 3100 3105 aac gag aac att atg gag gcc cat gta gga ata aat gga gaa gca 9491Asn Glu Asn Ile Met Glu Ala His Val Gly Ile Asn Gly Glu Ala 3110 3115 3120 aat ctg gat ttc tta aac att cct tta aca att cct gaa atg cgt 9536Asn Leu Asp Phe Leu Asn Ile Pro Leu Thr Ile Pro Glu Met Arg 3125 3130 3135 cta cct tac aca ata atc aca act cct cca ctg aaa gat ttc tct 9581Leu Pro Tyr Thr Ile Ile Thr Thr Pro Pro Leu Lys Asp Phe Ser 3140 3145 3150 cta tgg gaa aaa aca ggc ttg aag gaa ttc ttg aaa acg aca aag 9626Leu Trp Glu Lys Thr Gly Leu Lys Glu Phe Leu Lys Thr Thr Lys 3155 3160 3165 caa tca ttt gat tta agt gta aaa gct cag tat aag aaa aac aaa 9671Gln Ser Phe Asp Leu Ser Val Lys Ala Gln Tyr Lys Lys Asn Lys 3170 3175 3180 cac agg cat tcc atc aca aat cct ttg gct gtg ctt tgt gag ttt 9716His Arg His Ser Ile Thr Asn Pro Leu Ala Val Leu Cys Glu Phe 3185 3190 3195 atc agt cag agc atc aaa tcc ttt gac agg cat ttt gaa aaa aac 9761Ile Ser Gln Ser Ile Lys Ser Phe Asp Arg His Phe Glu Lys Asn 3200 3205 3210 aga aac aat gca tta gat ttt gtc acc aaa tcc tat aat gaa aca 9806Arg Asn Asn Ala Leu Asp Phe Val Thr Lys Ser Tyr Asn Glu Thr 3215 3220 3225 aaa att aag ttt gat aag tac aaa gct gaa aaa tct cac gac gag 9851Lys Ile Lys Phe Asp Lys Tyr Lys Ala Glu Lys Ser His Asp Glu 3230 3235 3240 ctc ccc agg acc ttt caa att cct gga tac act gtt cca gtt gtc 9896Leu Pro Arg Thr Phe Gln Ile Pro Gly Tyr Thr Val Pro Val Val 3245 3250 3255 aat gtt gaa gtg tct cca ttc acc ata gag atg tcg gca ttc ggc 9941Asn Val Glu Val Ser Pro Phe Thr Ile Glu Met Ser Ala Phe Gly 3260 3265 3270 tat gtg ttc cca aaa gca gtc agc atg cct agt ttc tcc atc cta 9986Tyr Val Phe Pro Lys Ala Val Ser Met Pro Ser Phe Ser Ile Leu 3275 3280 3285 ggt tct gac gtc cgt gtg cct tca tac aca tta atc ctg cca tca 10031Gly Ser Asp Val Arg Val Pro Ser Tyr Thr Leu Ile Leu Pro Ser 3290 3295 3300 tta gag ctg cca gtc ctt cat gtc cct aga aat ctc aag ctt tct 10076Leu Glu Leu Pro Val Leu His Val Pro Arg Asn Leu Lys Leu Ser 3305 3310 3315 ctt cca cat ttc aag gaa ttg tgt acc ata agc cat att ttt att 10121Leu Pro His Phe Lys Glu Leu Cys Thr Ile Ser His Ile Phe Ile 3320 3325 3330 cct gcc atg ggc aat att acc tat gat ttc tcc ttt aaa tca agt 10166Pro Ala Met Gly Asn Ile Thr Tyr Asp Phe Ser Phe Lys Ser Ser 3335 3340 3345 gtc atc aca ctg aat acc aat gct gaa ctt ttt aac cag tca gat 10211Val Ile Thr Leu Asn Thr Asn Ala Glu Leu Phe Asn Gln Ser Asp 3350 3355 3360 att gtt gct cat ctc ctt tct tca tct tca tct gtc att gat gca 10256Ile Val Ala His Leu Leu Ser Ser Ser Ser Ser Val Ile Asp Ala 3365 3370 3375 ctg cag tac aaa tta gag ggc acc aca aga ttg aca aga aaa agg 10301Leu Gln Tyr Lys Leu Glu Gly Thr Thr Arg Leu Thr Arg Lys Arg 3380 3385 3390 gga ttg aag tta gcc aca gct ctg tct ctg agc aac aaa ttt gtg 10346Gly Leu Lys Leu Ala Thr Ala Leu Ser Leu Ser Asn Lys Phe Val 3395 3400 3405 gag ggt agt cat aac agt act gtg agc tta acc acg aaa aat atg 10391Glu Gly Ser His Asn Ser Thr Val Ser Leu Thr Thr Lys Asn Met 3410 3415 3420 gaa gtg tca gtg gca aaa acc aca aaa gcc gaa att cca att ttg 10436Glu Val Ser Val Ala Lys Thr Thr Lys Ala Glu Ile Pro Ile Leu 3425 3430 3435 aga atg aat ttc aag caa gaa ctt aat gga aat acc aag tca aaa 10481Arg Met Asn Phe Lys Gln Glu Leu Asn Gly Asn Thr Lys Ser Lys 3440 3445 3450 cct act gtc tct tcc tcc atg gaa ttt aag tat gat ttc aat tct 10526Pro Thr Val Ser Ser Ser Met Glu Phe Lys Tyr Asp Phe Asn Ser 3455 3460 3465 tca atg ctg tac tct acc gct aaa gga gca gtt gac cac aag ctt 10571Ser Met Leu Tyr Ser Thr Ala Lys Gly Ala Val Asp His Lys Leu 3470 3475 3480 agc ttg gaa agc ctc acc tct tac ttt tcc att gag tca tct acc 10616Ser Leu Glu Ser Leu Thr Ser Tyr Phe Ser Ile Glu Ser Ser Thr 3485 3490 3495 aaa gga gat gtc aag ggt tcg gtt ctt tct cgg gaa tat tca gga 10661Lys Gly Asp Val Lys Gly Ser Val Leu Ser Arg Glu Tyr Ser Gly 3500 3505 3510 act att gct agt gag gcc aac act tac ttg aat tcc aag agc aca 10706Thr Ile Ala Ser Glu Ala Asn Thr Tyr Leu Asn Ser Lys Ser Thr 3515 3520 3525 cgg tct tca gtg aag ctg cag ggc act tcc aaa att gat gat atc 10751Arg Ser Ser Val Lys Leu Gln Gly Thr Ser Lys Ile Asp Asp Ile 3530 3535 3540 tgg aac ctt gaa gta aaa gaa aat ttt gct gga gaa gcc aca ctc 10796Trp Asn Leu Glu Val Lys Glu Asn Phe Ala Gly Glu Ala Thr Leu 3545 3550 3555 caa cgc ata tat tcc ctc tgg gag cac agt acg aaa aac cac tta 10841Gln Arg Ile Tyr Ser Leu Trp Glu His Ser Thr Lys Asn His Leu 3560 3565 3570 cag cta gag ggc ctc ttt ttc acc aac gga gaa cat aca agc aaa 10886Gln Leu Glu Gly Leu Phe Phe Thr Asn Gly Glu His Thr Ser Lys 3575 3580 3585 gcc acc ctg gaa ctc tct cca tgg caa atg tca gct ctt gtt cag 10931Ala Thr Leu Glu Leu Ser Pro Trp Gln Met Ser Ala Leu Val Gln 3590 3595 3600 gtc cat gca agt cag ccc agt tcc ttc cat gat ttc cct gac ctt 10976Val His Ala Ser Gln Pro Ser Ser Phe His Asp Phe Pro Asp Leu 3605 3610 3615 ggc cag gaa gtg gcc ctg aat gct aac act aag aac cag aag atc 11021Gly Gln Glu Val Ala Leu Asn Ala Asn Thr Lys Asn Gln Lys Ile 3620 3625 3630 aga tgg aaa aat gaa gtc cgg att cat tct ggg tct ttc cag agc 11066Arg Trp Lys Asn Glu Val Arg Ile His Ser Gly Ser Phe Gln Ser 3635 3640 3645 cag gtc gag ctt tcc aat gac caa gaa aag gca cac ctt gac att 11111Gln Val Glu Leu Ser Asn Asp Gln Glu Lys Ala His Leu Asp Ile 3650 3655 3660 gca gga tcc tta gaa gga cac cta agg ttc ctc aaa aat atc atc 11156Ala Gly Ser Leu Glu Gly His Leu Arg Phe Leu Lys Asn Ile Ile 3665 3670 3675 cta cca gtc tat gac aag agc tta tgg gat ttc cta aag ctg gat 11201Leu Pro Val Tyr Asp Lys Ser Leu Trp Asp Phe Leu Lys Leu Asp 3680 3685 3690 gta acc acc agc att ggt agg aga cag cat ctt cgt gtt tca act 11246Val Thr Thr Ser Ile Gly Arg Arg Gln His Leu Arg Val Ser Thr 3695 3700 3705 gcc ttt gtg tac acc aaa aac ccc aat ggc tat tca ttc tcc atc 11291Ala Phe Val Tyr Thr Lys Asn Pro Asn Gly Tyr Ser Phe Ser Ile 3710 3715 3720 cct gta aaa gtt ttg gct gat aaa ttc att act cct ggg ctg aaa 11336Pro Val Lys Val Leu Ala Asp Lys Phe Ile Thr Pro Gly Leu Lys 3725 3730 3735 cta aat gat cta aat tca gtt ctt gtc atg cct acg ttc cat gtc 11381Leu Asn Asp Leu Asn Ser Val Leu Val Met Pro Thr Phe His Val 3740 3745 3750 cca ttt aca gat ctt cag gtt cca tcg tgc aaa ctt gac ttc aga 11426Pro Phe Thr Asp Leu Gln Val Pro Ser Cys Lys Leu Asp Phe Arg 3755 3760 3765 gaa ata caa atc tat aag aag ctg aga act tca tca ttt gcc ctc 11471Glu Ile Gln Ile Tyr Lys Lys Leu Arg Thr Ser Ser Phe Ala Leu 3770 3775 3780 aac cta cca aca ctc ccc gag gta aaa ttc cct gaa gtt gat gtg 11516Asn Leu Pro Thr Leu Pro Glu Val Lys Phe Pro Glu Val Asp Val 3785 3790 3795 tta aca aaa tat tct caa cca gaa gac tcc ttg att ccc ttt ttt 11561Leu Thr Lys Tyr Ser Gln Pro Glu Asp Ser Leu Ile Pro Phe Phe 3800 3805 3810 gag ata acc gtg cct gaa tct cag tta act gtg tcc cag ttc acg 11606Glu Ile Thr Val Pro Glu Ser Gln Leu Thr Val Ser Gln Phe Thr 3815 3820 3825 ctt cca aaa agt gtt tca gat ggc att gct gct ttg gat cta aat 11651Leu Pro Lys Ser Val Ser Asp Gly Ile Ala Ala Leu Asp Leu Asn 3830 3835 3840 gca gta gcc aac aag atc gca gac ttt gag ttg ccc acc atc atc 11696Ala Val Ala Asn Lys Ile Ala Asp Phe Glu Leu Pro Thr Ile Ile 3845 3850 3855 gtg cct gag cag acc att gag att ccc tcc att aag ttc tct gta 11741Val Pro Glu Gln Thr Ile Glu Ile Pro Ser Ile Lys Phe Ser Val 3860 3865 3870 cct gct gga att gtc att cct tcc ttt caa gca ctg act gca cgc 11786Pro Ala Gly Ile Val Ile Pro Ser Phe Gln Ala Leu Thr Ala Arg 3875 3880 3885 ttt gag gta gac tct ccc gtg tat aat gcc act tgg agt gcc agt 11831Phe Glu Val Asp Ser Pro Val Tyr Asn Ala Thr Trp Ser Ala Ser 3890 3895 3900 ttg aaa aac aaa gca gat tat gtt gaa aca gtc ctg gat tcc aca 11876Leu Lys Asn Lys Ala Asp Tyr Val Glu Thr Val Leu Asp Ser Thr 3905 3910 3915 tgc agc tca acc gta cag ttc cta gaa tat gaa cta aat gtt ttg 11921Cys Ser Ser Thr Val Gln Phe Leu Glu Tyr Glu Leu Asn Val Leu 3920 3925 3930 gga aca cac aaa atc gaa gat ggt acg tta gcc tct aag act aaa 11966Gly Thr His Lys Ile Glu Asp Gly Thr Leu Ala Ser Lys Thr Lys 3935 3940 3945 gga aca ctt gca cac cgt gac ttc agt gca gaa tat gaa gaa gat 12011Gly Thr Leu Ala His Arg Asp Phe Ser Ala Glu Tyr Glu Glu Asp 3950 3955 3960 ggc aaa ttt gaa gga ctt cag gaa tgg gaa gga aaa gcg cac ctc 12056Gly Lys Phe Glu Gly Leu Gln Glu Trp Glu Gly Lys Ala His Leu 3965 3970 3975 aat atc aaa agc cca gcg ttc acc gat ctc cat ctg cgc tac cag 12101Asn Ile Lys Ser Pro Ala Phe Thr Asp Leu His Leu Arg Tyr Gln 3980 3985 3990 aaa gac aag aaa ggc atc tcc acc tca gca gcc tcc cca gcc gta 12146Lys Asp Lys Lys Gly Ile Ser Thr Ser Ala Ala Ser Pro Ala Val 3995 4000 4005 ggc acc gtg ggc atg gat atg gat gaa gat gac gac ttt tct aaa 12191Gly Thr Val Gly Met Asp Met Asp Glu Asp Asp Asp Phe Ser Lys 4010 4015 4020 tgg aac ttc tac tac agc cct cag tcc tct cca gat aaa aaa ctc 12236Trp Asn Phe Tyr Tyr Ser Pro Gln Ser Ser Pro Asp Lys Lys Leu 4025 4030 4035 acc ata ttc aaa act gag ttg agg gtc cgg gaa tct gat gag gaa 12281Thr Ile Phe Lys Thr Glu Leu Arg Val Arg Glu Ser Asp Glu Glu 4040 4045 4050 act cag atc aaa gtt aat tgg gaa gaa gag gca gct tct ggc ttg 12326Thr Gln Ile Lys Val Asn Trp Glu Glu Glu Ala Ala Ser Gly Leu 4055 4060 4065 cta acc tct ctg aaa gac aac gtg ccc aag gcc aca ggg gtc ctt 12371Leu Thr Ser Leu Lys Asp Asn Val Pro Lys Ala Thr Gly Val Leu 4070 4075 4080 tat gat tat gtc aac aag tac cac tgg gaa cac aca ggg ctc acc 12416Tyr Asp Tyr Val Asn Lys Tyr His Trp Glu His Thr Gly Leu Thr 4085 4090 4095 ctg aga gaa gtg tct tca aag ctg aga aga aat ctg cag aac aat 12461Leu Arg Glu Val Ser Ser Lys Leu Arg Arg Asn Leu Gln Asn Asn

4100 4105 4110 gct gag tgg gtt tat caa ggg gcc att agg caa att gat gat atc 12506Ala Glu Trp Val Tyr Gln Gly Ala Ile Arg Gln Ile Asp Asp Ile 4115 4120 4125 gac gtg agg ttc cag aaa gca gcc agt ggc acc act ggg acc tac 12551Asp Val Arg Phe Gln Lys Ala Ala Ser Gly Thr Thr Gly Thr Tyr 4130 4135 4140 caa gag tgg aag gac aag gcc cag aat ctg tac cag gaa ctg ttg 12596Gln Glu Trp Lys Asp Lys Ala Gln Asn Leu Tyr Gln Glu Leu Leu 4145 4150 4155 act cag gaa ggc caa gcc agt ttc cag gga ctc aag gat aac gtg 12641Thr Gln Glu Gly Gln Ala Ser Phe Gln Gly Leu Lys Asp Asn Val 4160 4165 4170 ttt gat ggc ttg gta cga gtt act caa aaa ttc cat atg aaa gtc 12686Phe Asp Gly Leu Val Arg Val Thr Gln Lys Phe His Met Lys Val 4175 4180 4185 aag cat ctg att gac tca ctc att gat ttt ctg aac ttc ccc aga 12731Lys His Leu Ile Asp Ser Leu Ile Asp Phe Leu Asn Phe Pro Arg 4190 4195 4200 ttc cag ttt ccg ggg aaa cct ggg ata tac act agg gag gaa ctt 12776Phe Gln Phe Pro Gly Lys Pro Gly Ile Tyr Thr Arg Glu Glu Leu 4205 4210 4215 tgc act atg ttc ata agg gag gta ggg acg gta ctg tcc cag gta 12821Cys Thr Met Phe Ile Arg Glu Val Gly Thr Val Leu Ser Gln Val 4220 4225 4230 tat tcg aaa gtc cat aat ggt tca gaa ata ctg ttt tcc tat ttc 12866Tyr Ser Lys Val His Asn Gly Ser Glu Ile Leu Phe Ser Tyr Phe 4235 4240 4245 caa gac cta gtg att aca ctt cct ttc gag tta agg aaa cat aaa 12911Gln Asp Leu Val Ile Thr Leu Pro Phe Glu Leu Arg Lys His Lys 4250 4255 4260 cta ata gat gta atc tcg atg tat agg gaa ctg ttg aaa gat tta 12956Leu Ile Asp Val Ile Ser Met Tyr Arg Glu Leu Leu Lys Asp Leu 4265 4270 4275 tca aaa gaa gcc caa gag gta ttt aaa gcc att cag tct ctc aag 13001Ser Lys Glu Ala Gln Glu Val Phe Lys Ala Ile Gln Ser Leu Lys 4280 4285 4290 acc aca gag gtg cta cgt aat ctt cag gac ctt tta caa ttc att 13046Thr Thr Glu Val Leu Arg Asn Leu Gln Asp Leu Leu Gln Phe Ile 4295 4300 4305 ttc caa cta ata gaa gat aac att aaa cag ctg aaa gag atg aaa 13091Phe Gln Leu Ile Glu Asp Asn Ile Lys Gln Leu Lys Glu Met Lys 4310 4315 4320 ttt act tat ctt att aat tat atc caa gat gag atc aac aca atc 13136Phe Thr Tyr Leu Ile Asn Tyr Ile Gln Asp Glu Ile Asn Thr Ile 4325 4330 4335 ttc aat gat tat atc cca tat gtt ttt aaa ttg ttg aaa gaa aac 13181Phe Asn Asp Tyr Ile Pro Tyr Val Phe Lys Leu Leu Lys Glu Asn 4340 4345 4350 cta tgc ctt aat ctt cat aag ttc aat gaa ttt att caa aac gag 13226Leu Cys Leu Asn Leu His Lys Phe Asn Glu Phe Ile Gln Asn Glu 4355 4360 4365 ctt cag gaa gct tct caa gag tta cag cag atc cat caa tac att 13271Leu Gln Glu Ala Ser Gln Glu Leu Gln Gln Ile His Gln Tyr Ile 4370 4375 4380 atg gcc ctt cgt gaa gaa tat ttt gat cca agt ata gtt ggc tgg 13316Met Ala Leu Arg Glu Glu Tyr Phe Asp Pro Ser Ile Val Gly Trp 4385 4390 4395 aca gtg aaa tat tat gaa ctt gaa gaa aag ata gtc agt ctg atc 13361Thr Val Lys Tyr Tyr Glu Leu Glu Glu Lys Ile Val Ser Leu Ile 4400 4405 4410 aag aac ctg tta gtt gct ctt aag gac ttc cat tct gaa tat att 13406Lys Asn Leu Leu Val Ala Leu Lys Asp Phe His Ser Glu Tyr Ile 4415 4420 4425 gtc agt gcc tct aac ttt act tcc caa ctc tca agt caa gtt gag 13451Val Ser Ala Ser Asn Phe Thr Ser Gln Leu Ser Ser Gln Val Glu 4430 4435 4440 caa ttt ctg cac aga aat att cag gaa tat ctt agc atc ctt acc 13496Gln Phe Leu His Arg Asn Ile Gln Glu Tyr Leu Ser Ile Leu Thr 4445 4450 4455 gat cca gat gga aaa ggg aaa gag aag att gca gag ctt tct gcc 13541Asp Pro Asp Gly Lys Gly Lys Glu Lys Ile Ala Glu Leu Ser Ala 4460 4465 4470 act gct cag gaa ata att aaa agc cag gcc att gcg acg aag aaa 13586Thr Ala Gln Glu Ile Ile Lys Ser Gln Ala Ile Ala Thr Lys Lys 4475 4480 4485 ata att tct gat tac cac cag cag ttt aga tat aaa ctg caa gat 13631Ile Ile Ser Asp Tyr His Gln Gln Phe Arg Tyr Lys Leu Gln Asp 4490 4495 4500 ttt tca gac caa ctc tct gat tac tat gaa aaa ttt att gct gaa 13676Phe Ser Asp Gln Leu Ser Asp Tyr Tyr Glu Lys Phe Ile Ala Glu 4505 4510 4515 tcc aaa aga ttg att gac ctg tcc att caa aac tac cac aca ttt 13721Ser Lys Arg Leu Ile Asp Leu Ser Ile Gln Asn Tyr His Thr Phe 4520 4525 4530 ctg ata tac atc acg gag tta ctg aaa aag ctg caa tca acc aca 13766Leu Ile Tyr Ile Thr Glu Leu Leu Lys Lys Leu Gln Ser Thr Thr 4535 4540 4545 gtc atg aac ccc tac atg aag ctt gct cca gga gaa ctt act atc 13811Val Met Asn Pro Tyr Met Lys Leu Ala Pro Gly Glu Leu Thr Ile 4550 4555 4560 atc ctc taa ttttttaaaa gaaatcttca tttattcttc ttttccaatt 13860Ile Leu gaactttcac atagcacaga aaaaattcaa actgcctata ttgataaaac catacagtga 13920gccagccttg cagtaggcag tagactataa gcagaagcac atatgaactg gacctgcacc 13980aaagctggca ccagggctcg gaaggtctct gaactcagaa ggatggcatt ttttgcaagt 14040taaagaaaat caggatctga gttattttgc taaacttggg ggaggaggaa caaataaatg 14100gagtctttat tgtgtatcat a 141218221DNAArtificial SequencePCR primer 82tgctaaaggc acatatggcc t 218323DNAArtificial SequencePCR primer 83ctcaggttgg actctccatt gag 238428DNAArtificial SequencePCR probe 84cttgtcagag ggatcctaac actggccg 288520DNAArtificial SequenceAntisense Oligonucleotide 85cagtgtccag aaagtgtgtc 208620DNAArtificial SequenceAntisense Oligonucleotide 86ggtttgctca gttggtgctg 208720DNAArtificial SequenceAntisense Oligonucleotide 87ttaccatggt agcactgccg 208820DNAArtificial SequenceAntisense Oligonucleotide 88actctggcca ttaccatggt 208920DNAArtificial SequenceAntisense Oligonucleotide 89tgtgacagtg gtggagaatg 209020DNAArtificial SequenceAntisense Oligonucleotide 90tgacagtcgg aggagcgacc 209120DNAArtificial SequenceAntisense Oligonucleotide 91tgcccattta tttgtccctg 209220DNAArtificial SequenceAntisense Oligonucleotide 92agttttcttg gattcattgt 209320DNAArtificial SequenceAntisense Oligonucleotide 93gagagggata tcacagtagt 209420DNAArtificial SequenceAntisense Oligonucleotide 94cagtcctggc ggtgaccatg 209520DNAArtificial SequenceAntisense Oligonucleotide 95cttatagtga ttgcacactt 209620DNAArtificial SequenceAntisense Oligonucleotide 96tctggccaaa tgctcagcac 209719DNAArtificial SequenceAntisense Oligonucleotide 97cgagaggcgg acgggaccg 199821DNAArtificial SequenceAntisense Oligonucleotide 98cgagaggcgg acgggaccgt t 219921DNAArtificial SequenceAntisense Oligonucleotide 99ttgctctccg cctgccctgg c 2110019DNAArtificial SequenceAntisense Oligonucleotide 100gctctccgcc tgccctggc 19

Claims

1. A compound comprising a modified oligonucleotide 12 to 30 linked nucleobases in length targeted to a nucleic acid molecule encoding apolipoprotein (a), wherein the compound comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 85, 89-93, 95-96 and is at least 80% complementary to SEQ ID NO: 4.

2. The compound of claim 1, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 1.

3. The compound of claim 1, wherein the modified oligonucleotide is single-stranded.

4. The compound of claim 1, wherein at least one internucleoside linkage is a modified internucleoside linkage.

5. The compound of claim 4, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

6. The compound of claim 1, wherein the modified oligonucleotide comprises at least one modified sugar.

7. The compound of claim 6, wherein at least one modified sugar is a bicyclic sugar.

8. The compound of claim 6, wherein at least one modified sugar comprises a 2'-.beta.-methoxyethyl, or a 4'-CH.sub.2--O-2'.

9. The compound of claim 1, wherein at least one nucleoside comprises a modified nucleobase.

10. The compound of claim 9, wherein the modified nucleobase is a 5-methylcytosine.

11. The compound of claim 1, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; a 3' wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

12. The compound of claim 11, wherein the modified oligonucleotide consists of 20 linked nucleosides and comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.

13. The compound of claim 11, wherein the modified oligonucleotide consists of 20 linked nucleosides.

14. A composition comprising the compound of claim 1, or a salt thereof, and a pharmaceutically acceptable carrier or diluent.

15. A composition comprising the compound of claim 1, for use in therapy.

16. The compound of claim 15, for use in treating, preventing, or slowing progression of a disease related to elevated apo(a) and/or elevated Lp(a).

17. The compound of claim 16, wherein the disease is an inflammatory, cardiovascular or metabolic disease, disorder or condition.