U.S. patent application number 14/156403 was filed with the patent office on 2014-07-17 for methods and compositions for monitoring and enhancing early embryo development.
The applicant listed for this patent is WISCONSIN ALUMNI RESEARCH FOUNDATION. Invention is credited to Hasan KHATIB.
Application Number | 20140200393 14/156403 |
Document ID | / |
Family ID | 51165637 |
Filed Date | 2014-07-17 |
United States Patent
Application |
20140200393 |
Kind Code |
A1 |
KHATIB; Hasan |
July 17, 2014 |
METHODS AND COMPOSITIONS FOR MONITORING AND ENHANCING EARLY EMBRYO
DEVELOPMENT
Abstract
Method for determining developmental fate of early embryos
comprises measuring the expression level of a gene selected from
the group consisting of CDKN1C, IGF2R, MAGEL2, MKRN3, NAP1L5, NDN,
PEG3, PHLDA2, TSSC4, and UBE3A genes. Also disclosed is a method
for improving pregnancy rate, wherein early embryos whose
expression level of the MKRN3, NDN, PEG3, PHLDA2, TSSC4, or UBE3A
gene is not increased, or the expression level of the CDKN1C,
IGF2R, MAGEL2, or NAP1L5 gene is not decreased, are selected for
planting into a suitable uterus for further development. Also
disclosed are methods for increasing the likelihood of an early
embryo to develop successfully into full-term pregnancy, wherein a
suitable amount of siRNA corresponding to the PHLDA2 gene is
injected into a fertilized egg which is in turn cultured further
and planted into a suitable uterus.
Inventors: |
KHATIB; Hasan; (Fitchburg,
WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
WISCONSIN ALUMNI RESEARCH FOUNDATION |
Madison |
WI |
US |
|
|
Family ID: |
51165637 |
Appl. No.: |
14/156403 |
Filed: |
January 15, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61752969 |
Jan 15, 2013 |
|
|
|
Current U.S.
Class: |
600/34 ; 435/375;
435/6.12; 600/33 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12Q 2600/124 20130101; C12Q 2600/158 20130101; C12N 15/1135
20130101; C12Q 1/6876 20130101 |
Class at
Publication: |
600/34 ;
435/6.12; 435/375; 600/33 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; A61D 19/00 20060101 A61D019/00; A61D 19/04 20060101
A61D019/04; C12N 15/113 20060101 C12N015/113 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with U.S. Government support under
12-CRHF-0-6055 awarded by the USDA/NIFA. The U.S. Government has
certain rights in the invention.
Claims
1. A method of selecting an embryo for planting into a uterus for
further development, the method comprising i) obtaining a supply of
embryos, and growing the embryos to a stage ready for planting into
a uterus; ii) obtaining a cell from a pre-planting embryo; iii)
determining the expression level in the cell of at least a gene
selected from the group consisting of CDKN1C, IGF2R, MAGEL2, MKRN3,
NAP1L5, NDN, PEG3, PHLDA2, TSSC4, and UBE3A, and iv) planting the
embryo into a suitable uterus if it does not show an increased
expression level of the MKRN3, NDN, PEG3, PHLDA2, TSSC4, or UBE3A
gene, or does not show a decreased expression level of the CDKN1C,
IGF2R, MAGEL2, or NAP1L5 gene.
2. The method according to claim 1, wherein the embryo is a bovine
embryo.
3. The method according to claim 2, wherein the embryo from which a
cell is extracted is not more than 8 days post fertilization.
4. The method according to claim 1, wherein the embryo is in an
embryonic developmental stage not later than a morula stage, or
before the blastocyst stage, wherein there is no differentiation
among the cells.
5. The method according to claim 3, wherein the embryo is in an
embryonic developmental stage before hatching and is ready for
planting.
6. The method according to claim 3, wherein the embryo has
developed to comprise not more than about 32 cells.
7. The method according to claim 6, wherein the embryo has
developed to comprise not more than about 150 cells.
8. The method according to claim 1, wherein the gene expression
level is determined by real time qRT-PCR.
9. The method according to claim 1, wherein the gene expression
level is determined by real time qRT-PCR on mRNA extracted from the
single cell.
10. An in vitro fertilization method for breeding animal, the
method comprising obtaining embryos via an in vitro fertilization
procedure, selecting a suitable embryo according to claim 1, and
planting into a suitable uterus to allow further development of
embryos that do not show an increased expression level of the
MKRN3, NDN, PEG3, PHLDA2, TSSC4, or UBE3A gene, or embryos that do
not show a decreased expression level of the CDKN1C, IGF2R, MAGEL2,
or NAP1L5 gene.
11. A method for selectively animal breeding using a multiple
ovulation and embryo transfer procedure (MOET), the method
comprising superovulating a female animal, collecting eggs from
said superovulated female, in vitro fertilizing said eggs and allow
the fertilized eggs to develop into INF embryos, selecting embryos
according to claim 1, and planting into a uterus only embryos that
do not show an increased expression level of the MKRN3, NDN, PEG3,
PHLDA2, TSSC4, or UBE3A gene, or embryos that do not show a
decreased expression level of the CDKN1C, IGF2R, MAGEL2, or NAP1L5
gene.
12. A method of improving the likelihood of a bovine embryo to
develop successfully, the method comprising i) obtaining a supply
of fertilized eggs, ii) micro-injecting a suitable dosage of siRNA
of corresponding to a PHLDA2 gene into the fertilized eggs, wherein
the PHLDA2 gene expression level is inhibited; and iii) continuing
to cultivate the fertilized eggs until they are ready for planting
into a uterus.
13. The method of claim 12, wherein the siRNA comprises a duplex of
PHLDA2 antisense [Phos]AGUAGCACCGGGCUAUAUCdTdT (SEQ ID No. 1), and
PHLDA2 Sense GAUAUAGCCCGGUGCUACUdTdT (SEQ ID No. 2).
14. The method of claim 13, wherein about 100 .mu.M of the siRNA is
injected per fertilized egg.
Description
PRIORITY INFORMATION
[0001] This application claims priority of pending U.S. App. Ser.
No. 61/752,969, filed Jan. 15, 2013, the contents of which are
incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to compositions and methods
for monitoring mammalian embryo development. Specifically, gene
expression levels are used as indicators of, and manipulated to
improve, early embryo development.
BACKGROUND OF THE INVENTION
[0004] In vitro fertilization (IVF) involves combining eggs and
sperm outside the body in a laboratory. Once an embryo forms, it is
planted in the uterus where it will develop further. Even though
IVF is a complex and expensive procedure, it has seen steadily
increasing use for the past three decades. In humans, since its
introduction in the U.S. in 1981, IVF and other similar techniques
have resulted in more than 200,000 babies. In other animals, IVF,
along with other assisted reproductive technology (ART) have been
instrumental in helping scientists address reproductive problems in
several endangered species, such as the Florida panthers, giant
pandas, black-footed ferrets, ocelots, clouded leopards,
chimpanzees, gorillas, South American bush dogs, Mexican wolves,
orangutans, and Mongolian wild horses. IVF has also been widely
used in animal breeding, for example in dairy cattle.
[0005] One challenge facing IVF techniques is low success rates of
early embryonic development and pregnancy. For example, only about
40% of fertilized bovine oocytes reach the blastocyst stage by day
8 of development and of these only 45% result in pregnancy [1]. As
such, there is a need to better understand the mechanisms affecting
proper embryo development, which will in turn allow the development
of tools for identifying embryos that will develop successfully for
implanting, and for increasing the rates of successful pregnancy
through intervention of the development process, especially in
cases of non-human animals. By selecting embryos that possess the
optimal genetic profile, the odds of successful in vitro
fertilization procedures improve. Considering the costs of IVF,
this could result in savings of thousands or tens of thousands of
dollars as the procedure may not need to be repeated as often
before resulting in a successful pregnancy.
[0006] To identify genetic factors affecting fertilization success
and embryo quality in dairy cattle, the present inventor has
established an IVF system and has been using it for genomic and
transcriptomic profiling of bovine embryos [see e.g. 2]. With this
controlled in vitro system, DNA variations and aberrant gene
expression have been discovered that are associated with
fertilization success and embryonic development [2-7]. These
findings provide valuable genetic and biological markers for
fertility of dairy cattle. Nevertheless, the genetic and molecular
mechanisms of differential gene expression are yet to be
revealed.
[0007] Imprinted genes are of particular interest due to their
reported roles in embryonic, placental, and neonatal growth [8].
Evidence for the importance of proper imprinted gene function can
be seen in animal model studies where disruption or knockouts of
particular imprinted genes have resulted in abnormal progeny or
lethality in utero [9, 10]. Imprinted genes have also been
implicated in livestock development, as differential expression of
these genes has been associated with aborted and abnormally
developed bovine clone fetuses [11, 12]. However, there is limited
information regarding the role of these genes during the early
developmental period.
[0008] In bovine, one such imprinted gene is PHLDA2 (pleckstrin
homology-like domain, family A, member 2). In a previous study that
used microarray expression analysis, the present inventor, by
comparing the transcriptomes of developed IVF blastocysts to
degenerate embryos, which do not properly complete the transition
from morula to blastocyst, has found that PHLDA2 was among a number
of genes and pathways that were altered in degenerate embryos [3].
PHLDA2 was significantly up-regulated by more than eight-fold
compared to blastocysts [3]. However, there was no definitive
evidence that this altered gene expression level was responsible
for the development fate of the early.
SUMMARY OF THE INVENTION
[0009] By demonstrating that the altered gene expression levels
were responsible for embryo degeneration, the present inventor has
surprisingly discovered that the altered expression levels of
several imprinted genes are useful markers for proper embryo
development. Specifically, it is revealed that the expression
levels of ten (10) imprinted genes differed between blastocysts
(successfully developing embryos) and degenerate embryos (or
"degenerates"). For example, PHLDA2 showed a higher expression
level in degenerates than in blastocysts, while CDKN1C
(p57.sup.KIP2, a member of the CIP/KIP family of cell-cycle
inhibitors that have unique roles in embryogenesis, see e.g. [41])
showed a higher expression level in blastocysts compared to
degenerates. Knockdown, using gene-specific siRNA injection into
one-cell zygotes, of PHLDA2 and CDKN1C--which are located in the
same gene cluster--resulted in significant changes in embryo
development.
[0010] Accordingly, in one embodiment, the present invention
provides a method of determining the likelihood of an embryo's
developmental fate, the method comprising i) obtaining a supply of
IVF embryos, and growing the embryos to a stage ready for planting
into a uterus; ii) obtaining a single cell from the pre-planting
embryos; iii) determining the expression level of at least a gene
selected from the group consisting of CDKN1C, IGF2R, MAGEL2, MKRN3,
NAP1L5, NDN, PEG3, PHLDA2, TSSC4, and UBE3A, and iv) planting into
a uterus only embryos that do not show an increased expression
level of the MKRN3, NDN, PEG3, PHLDA2, TSSC4, or UBE3A gene, or
embryos that do not show a decreased expression level of the
CDKN1C, IGF2R, MAGEL2, or NAP1L5 gene.
[0011] In one embodiment, the age of embryos from which cell can be
extracted in the case of bovine is not more than 8 days.
[0012] In one embodiment, the gene expression level is determined
by real time qRT-PCR on mRNA extracted from the single cell,
preferably using an internal or a priori standard.
[0013] In another embodiment, the present invention provides a
method of improving the likelihood of an embryo to develop
successfully, the method comprising i) obtaining a supply of
fertilized eggs, ii) micro-injecting siRNA of corresponding to the
target gene into the fertilized eggs; and iii) continuing to
cultivate the fertilized eggs until they are ready for planting
into a uterus.
[0014] The embryos suitable for the above method of the present
invention include those for the Florida panthers, giant pandas,
black-footed ferrets, ocelots, clouded leopards, chimpanzees,
gorillas, South American bush dogs, Mexican wolves, orangutans, and
Mongolian wild horses.
DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 shows the mean+S.E.M. for fold difference of
degenerative relative to blastocyst embryo pools. Each bar
represents the values across four sets of embryo pools (n=20
embryos per pool, two sires used). All samples were done in
quadruplicates and normalized to GAPDH tested in the same cDNA
samples. Expression calculations were done using the
2.sup.-.DELTA..DELTA.Ct method (59). Bars above the "0" represent
genes that were up-regulated in degenerative embryos while bars
below the "0" indicate down-regulated genes. * P<0.05.
[0016] FIG. 2 shows the differential expression of PHLDA2 in IVF
blastocysts and degenerate embryos. Data for PHLDA2 expression from
microarrays and mRNA was obtained from Huang et al. [5],
incorporated herein by reference in its entirety. Expression of
PHLDA2 was normalized to GAPDH and shown as fold change (.+-.SD) in
degenerate embryos.
[0017] FIG. 3 shows the DNA methylation of PHLDA2 in IVF embryos.
Exons of PHLDA2 are indicated by grey boxes and the direction of
transcription is indicated by arrowheads. Vertical bars below the
gene model represent CpG sites near and within PHLDA2. The CpG
island overlapping with PHLDA2 is shown as an open rectangular box.
For methylation analysis, each row of circles connected by a line
represents a single clone. Filled circles indicate methylated CpGs
while open circles represent unmethylated CpGs. Clones derived from
blastocysts and degenerate embryos are shown in red and black
respectively. CpG sites tested for differential methylation are
marked by arrows. Significant differential methylation of CpG sites
are indicated by p values.
[0018] FIG. 4 shows the qRT-PCR results for control and CDKN1C
siRNA injections. All samples were normalized to GAPDH using the
.DELTA..DELTA.Ct method [59].
[0019] FIG. 5 shows the morphological assessment of embryos.
Compacted morulas (A) that were cultured until day 8 of development
and either showed signs of blastocoele formation (B) or
degeneration (C).
[0020] FIG. 6 shows DNA methylation of PHLDA2 in bovine tissues.
Clones from allantois, heart, and spleen DNA are shown in red,
black, and blue, respectively.
[0021] FIG. 7 shows the morphological comparison of blastocysts on
day 8 of culture. Box A (left) shows a representative sample of
blastocysts that were injected with CDKN1C siRNA. Box B (right)
shows representative samples of control (non-injected)
blastocysts.
DETAILED DESCRIPTION OF THE INVENTION
[0022] The present invention in one embodiment provides a method of
selecting an IVF embryo for planting in a uterus, the method
comprising i) obtaining a supply of IVF embryos, and growing the
embryos to a stage ready for planting into a uterus, ii) obtaining
a cell from the pre-planting embryos; iii) determining the
expression level of at least a gene selected from the group
consisting of CDKN1C, IGF2R, MAGEL2, MKRN3, NAP1L5, NDN, PEG3,
PHLDA2, TSSC4, and UBE3A, and iv) planting into a uterus only
embryos that do not show an increased expression level of the
MKRN3, NDN, PEG3, PHLDA2, TSSC4, or UBE3A gene, or embryos that do
not show a decreased expression level of the CDKN1C, IGF2R, MAGEL2,
or NAP1L5 gene.
[0023] In one embodiment, the embryo is at an age before hatching
and is ready for planting. In one embodiment, the embryo is a
bovine embryo. In another embodiment, the bovine embryo is not more
than 8 days old, which has about 100-150 cells. In another
embodiment, the embryo is at the morula stage or a stage where
there is no differentiation; the morula stage bovine embryo
consists of about 32 cells. The morula stage precedes the
blastocyst stage. The blastocyst is a structure formed in the early
development of vertebrates, and possesses an inner cell mass (ICM),
or embryoblast, which subsequently forms the embryo, and an outer
layer of cells, or trophoblast, which later forms the placenta. The
trophoblast surrounds the inner cell mass and a fluid-filled
blastocyst cavity known as the blastocoele or the blastocystic
cavity. In humans the blastocyst consists of about 70-100
cells.
[0024] In one embodiment, the gene expression level is determined
by real time qRT-PCR on mRNA extracted from the single cell, and
using an internal standard, or a previously established standard.
Methods of real time quantification of mRNA level are well-known to
those ordinarily skilled in the art. See e.g. Galan A, Montaner D,
Poo M E, Valbuena D, Ruiz V, Aguilar C, Dopazo J, Simon C.
Functional genomics of 5- to 8-cell stage human embryos by
blastomere single-cell cDNA analysis. PLoS One. 2010 Oct. 26;
5(10):e13615; Wang D., Bodovitz S. Single cell analysis: the new
frontier in `omics`. Trends in Biotechnology; 2010. p. 281-90, both
of which are specifically incorporated herein by reference in their
entirety.
[0025] Many methods of determining gene expression levels are known
to persons ordinarily skilled in the art, e.g., as described in
Sambrook et al. (eds.) Cloning: A Laboratory Manual, 2nd ed., Cold
Spring Harbor Laboratory Press, 1989; Current Protocols in
Molecular Biology (Ausubel et al. (eds.) New York: John Wiley and
Sons, 1998). Examples of such methods include polymerase chain
reaction (including absolute quantitation by PCR, real time PCR
(RT-PCR) and qRT-PCR, multiplex or singleplex PCR), single cell
PCR, northern blot assays, nuclease protection assays, in situ
hybridization assays, immunohistochemistry assays,
immunocytochemistry assays, electrophoresis assays such as gel or
capillary, Western blot assays, ELISAs, immunoprecipitation assays,
chromatography based assays such as HPLC or gel chromotography,
mass spectrometry assays, RNase protection assays, flow cytometry
assays, DNA methylation assays, and histone modification analysis
assays.
[0026] In all methods of the invention, expression levels, at the
RNA or at the protein level, can be determined using any suitable
method. RNA levels may be determined by, e.g., quantitative RT-PCR
(e.g., TaqMann.TM. RT-PCR), or as described in the Examples.
Expression levels may be scaled and/or normalized per total amount
of RNA or protein in the sample and/or a control, which may
typically be a housekeeping gene such as the gene that encodes the
beta-actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or
18S ribosomal RNA). Normalization is typically done using a
standard curve to account for variability in the amount of protein,
DNA, or RNA input, or environmental factors that affect the gene
expression level.
[0027] In illustrative embodiments, the expression levels of the
genes of interest are determined using RT-PCR, either by a standard
curve for relative quantification. Absolute quantification of copy
numbers may also be determined by preparing a standard curve using
known amounts of the markers. The general methods for conducting
such assays are described, e.g., in Real-Time PCR Systems: Applied
Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time
PCR Systems, Chemistry Guide, Applied Biosystems, 2005, Part No.
4348358 Rev. E.
[0028] The present invention in one embodiment provides a method of
determining the likelihood of an embryo's developmental fate, the
method comprising i) obtaining a supply of IVF embryos, and growing
the embryos to a stage ready for planting into a uterus, ii)
obtaining a single cell from the pre-planting embryos; and iii)
determining the expression level of at least a gene selected from
the group consisting of CDKN1C, IGF2R, MAGEL2, MKRN3, NAP1L5, NDN,
PEG3, PHLDA2, TSSC4, and UBE3A, wherein embryos that do not show an
increased expression level of the MKRN3, NDN, PEG3, PHLDA2, TSSC4,
or UBE3A gene, or embryos that do not show a decreased expression
level of the CDKN1C, IGF2R, MAGEL2, or NAP1L5 gene, are determined
to be suitable for purposes of planting into a uterus for further
development into successful pregnancy. Suitable embryos are then
planted into uterus for further development.
[0029] In another embodiment, the present invention provides a
method of improving the likelihood of an embryo to develop
successfully, the method comprising i) obtaining a supply of
fertilized eggs, ii) micro-injecting a suitable dosage of siRNA
corresponding to the target gene into the fertilized eggs; and iii)
continuing to cultivate the fertilized eggs until they are ready
for planting into a uterus.
[0030] A small interfering RNA (siRNA) is a double-stranded RNA
molecule capable of inhibiting or reducing the expression of a gene
with which it shares homology. Each strand of the siRNA may be
about 10 to about 50 nucleotides, about 12 to about 45 nucleotides,
about 15 to about 40 nucleotides, about 20 to about 35 nucleotides,
about 20 to about 30 nucleotides, or about 20 to about 25
nucleotides in length. The double stranded siRNA may have about 10
to about 50 base pairs, about 12 to about 45 base pairs, about 15
to about 40 base pairs, about 20 to about 35 base pairs, about 20
to about 30 base pairs, or about 20 to about 25 base pairs. One
strand of the siRNA is called the target-complementary strand of an
siRNA duplex. By "siRNA corresponding to a target gene," it is
meant that the target-complementary strand of the siRNA is
complementary to at least 10 nucleotides of the mRNA transcript of
the target gene.
[0031] Alternatively, a single-stranded RNAi molecule may be
assembled from a single oligonucleotide, where the
self-complementary sense and antisense regions of the RNAi molecule
are linked by means of a nucleic acid-based or non-nucleic
acid-based linker(s). The RNAi molecule can be a polynucleotide
with a duplex, asymmetric duplex, hairpin or asymmetric hairpin
secondary structure. The RNAi can be a circular single-stranded
polynucleotide having two or more loop structures and a stem
comprising self-complementary sense and antisense regions. The
circular polynucleotide can be processed either in vivo or in vitro
to generate an active RNAi molecule.
[0032] Several methods have been used to deliver siRNAs to cells.
These methods include delivering synthetic siRNA molecules into
cells, such as the microinjection method described in the Examples,
and vector-based methods in which siRNA is transcribed in a target
cell by the vector. Certain vector-based siRNA delivery systems can
result in persistent and effective suppression of gene expression.
In many vector-based methods, the siRNA is generated by the
production of small hairpin RNA or short hairpin RNA (shRNA). shRNA
is a single-stranded RNA molecule comprising stem and hairpin
structures. In such a system, an RNA polymerase III promoter, such
as H1 promoter and U6 promoter, is used to drive transcription of
shRNA. The shRNA is processed in the cell into siRNA through the
action of the Dicer family of enzymes. Thus, the transcribed
products mimic the synthetic siRNA duplexes and are effective for
suppressing their corresponding target gene. U.S. Pat. No.
7,772,203; McIntyre G, Fanning G (2006), "Design and cloning
strategies for constructing shRNA expression vectors," BMC
Biotechnol. 6: 1; Paddison P, Caudy A, Bernstein E, Hannon G,
Conklin D (2002). "Short hairpin RNAs (shRNAs) induce
sequence-specific silencing in mammalian cells," Genes Dev. 16 (8):
948-58. shRNAs may be about 30 to about 80 (e.g., about 35, 40, 45,
50 or 55) nucleotides in length, specifically about 35 to about 70
nucleotides, about 35 to about 65 nucleotides, about 35 to about 60
nucleotides, about 35 to about 55 nucleotides, about 35 to about 50
nucleotides, or about 38 to about 44 (e.g., 38, 39, 40, 41, 42, 43
or 44) nucleotides in length. The double stranded region of the
shRNA may have about 10 to about 35 base pairs, specifically about
12 to about 30 base pairs about 14 to about 25 base pairs, or about
16 to about 22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base
pairs.
[0033] The embryos suitable for the above method of the present
invention may be that of any animal, especially those for which
artificial reproductive technologies are used due to low fertility,
such as endangered animal species including the Florida panthers,
giant pandas, black-footed ferrets, ocelots, clouded leopards,
chimpanzees, gorillas, South American bush dogs, Mexican wolves,
orangutans, and Mongolian wild horses.
[0034] The present invention further provides a method for
selectively breeding cattle using a multiple ovulation and embryo
transfer procedure (MOET), the method comprising superovulating a
female animal, collecting eggs from said superovulated female, in
vitro fertilizing said eggs and allow the fertilized eggs to
develop into INF embryos, selecting for planting into a uterus only
embryos that do not show an increased expression level of the
MKRN3, NDN, PEG3, PHLDA2, TSSC4, or UBE3A gene, or embryos that do
not show a decreased expression level of the CDKN1C, IGF2R, MAGEL2,
or NAP1L5 gene. The selected embryo is then planted into a suitable
uterus and allowed for further development.
[0035] The following examples are intended to illustrate preferred
embodiments of the invention and should not be interpreted to limit
the scope of the invention as defined in the claims.
EXAMPLES
[0036] Materials and Methods
[0037] In-Vitro Fertilization, Embryo Culture, and Morphological
Grading
[0038] Ovaries from cows were obtained from a local abattoir and
upon arrival underwent aspiration of antral follicles (2-6 mm).
Maturation of oocytes and fertilization were accomplished by
combining sperm, heparin, and PHE with the oocytes as described in
Khatib et al. [2]. At day 5 of development all embryos underwent
morphological assessment via light microscopy, where in
vitro-produced embryos should reach approximately 16-32 cells and
show evidence of cellular compaction and coalescence by this time.
Embryos failing to show both of these properties were deemed "early
degenerates" and removed from the study. Culturing and incubation
was then continued until day 8 of development when the second
morphological evaluation was performed. Embryos with a fluid filled
cavity (blastocoele) giving evidence of cellular differentiation
into the ICM and trophectoderm, were classified as "blastocysts"
(FIG. 5). Embryos that showed compaction at day 5 but failed to
form a blastocoele cavity were deemed as "late degenerates" (FIG.
5). These two populations of embryos were used for analysis and
collected into RNALater (Ambion, TX) solution to preserve RNA
integrity. For initial transcriptomic analysis, four randomly
sampled pools of embryos (two blastocyst and two degenerate pools)
were created (n=20 embryos/pool) using a single sire. A second set
of pools (two blastocyst and two degenerate) was created (n=20
embryos/pool) using a second sire.
[0039] RNA Extraction and Amplification
[0040] Total RNA was extracted from the embryo pools using
RNaqueous Micro (Ambion). Quality control of the RNA was performed
using the RNA6000 NanoChip (Agilent Technologies, CA) with the
Agilent 2100 Bioanalyzer to determine banding for 18S and 28S
ribosomal RNA. Due to limitations in the amount of RNA in embryos,
linear amplification was performed using the MessageAmp II aRNA
amplification kit (Ambion). DNase I treatment was then performed
using the RNaqueous Micro kit (Ambion) to ensure no genomic
contamination in the samples.
[0041] Quantitative Real-Time RT-PCR (qRT-PCR). The cDNA was
synthesized from the amplified RNA using the iScript cDNA synthesis
kit (Bio-Rad Laboratories, CA). Primers for qRT-PCR were designed
using Beacon Software (Premier Biosoft, CA) to span exons if
possible (Table 5). Six genes had only one exon (MAGEL2, MKRN3,
NDN, H19, NAP1L5, and MIM1), and as such, DNase treatment of the
RNA pools prior to cDNA synthesis was used to ensure no genomic
contamination. In addition, PCR reactions were performed with
DNase-treated RNA samples using primers designed in introns of the
gene 7-dehydrocholesterol reductase (DHCR7) to test for the
presence of genomic DNA in RNA samples. After two rounds of DNase
treatment, no product was observed deeming the samples free of DNA
contamination. An internal control gene for normalization was
chosen using the Vandesompele method [58]. All imprinted genes
underwent initial expression analysis to determine transcript
abundance and those showing expression were then subsequently
tested between morphological groups to quantify differential
expression. The relative gene expression values were calculated
using the 2.sup.-.DELTA..DELTA.Ct method [59]. Statistical analysis
was performed using R version 2.15.2 (www.r-project.org/). The
expression analysis for differentially expressed imprinted genes
was analyzed using analysis of variance (ANOVA) of .DELTA.Ct values
to determine possible sire and morphological effects.
[0042] Analysis of DNA Methylation of PHLDA2 by Bisulfite
Sequencing
[0043] To evaluate the methylation status of PHLDA2, genomic DNA
from embryo pools and tissues was treated with bisulfite and
purified using the Epitect Bisulfite Kit (Qiagen). We performed the
methylation analysis on pools of 20 blastocysts or degenerates. One
pool for each of the developmental statuses was evaluated.
Nonetheless, embryos were collected at multiple times to obtain the
sufficient number of embryos in the pools. Bisulfite-treated DNA
was first amplified by a PCR reaction for 40 cycles. The PCR
products were gel purified and amplified in a second PCR reaction
for 18 cycles using the same primers. The PCR products were gel
purified, ligated to the pGEM-T Vector (Promega, WI), and
transformed into JM101 competent cells (Promega) following the
manufacturer's instructions. Bacterial colonies were screened for
the presence of a single copy of insert fragment by PCR with
primers pairing with vector sequences flanking the TA cloning site.
Each embryo on average contained 100-150 cells. Thus there were a
total of approximately 4000-6000 chromosomes in the pool. We
sequenced .about.20 clones and selected only those with the highest
quality of sequence before looked at their actual sequences. The
PCR products were sequenced to obtain bisulfite-converted DNA
sequences. Association between DNA methylation at each CpG site
with developmental status or tissue was tested by Fisher's exact
test. Only CpG sites with a combined (two samples in comparison)
methylation level between 10% and 90% were tested, and statistical
significance was declared at a P<0.01.
[0044] siRNA Design and Synthesis
[0045] siRNA sequences were designed and synthesized by
Sigma-Aldrich (St. Louis, Mo.). A BLAST of siRNA sequences was done
against the bovine mRNA reference sequence to ensure that there
would be minimal off-target effects. Research has shown that
naturally produced siRNA have a 5'-phosphate on the antisense
strand that participates in activation of the RNA induced silencing
complex (RISC) [60]. Although most synthetically-produced siRNAs
have a 5'-OH (antisense), ATP-dependent phosphorylation occurs
shortly after introduction into the cell [60]. Given that we are
injecting siRNA into a newly developing embryo with limited stores
of ATP, a 5'-Phosphorylation modification was added to minimize
reduction of energy stores in the embryo. The siRNA duplex
sequences were PHLDA2 antisense [Phos]AGUAGCACCGGGCUAUAUCdTdT (SEQ
ID No. 1), PHLDA2 Sense GAUAUAGCCCGGUGCUACUdTdT (SEQ ID No. 2),
CDKN1C antisense [Phos]AAAUCCCUGAGUGCGGCGGdTdT (SEQ ID No. 3), and
CDKN1C sense CCGCCGCACUCAGGGAUUUdTdT (SEQ ID No. 4). For siRNA
injection three concentrations were assessed (100 uM, 150 uM, 200
uM).
[0046] Experimental Controls
[0047] Two control groups were designed to help infer effects of
single-gene knockdown. In the first control group (sham control),
embryos underwent mechanical puncturing by the microinjection
needle but no siRNA delivery in order to assure that potential
phenotypic observations are due to the siRNA, and not a result of
mechanical damage due to injection. The second group was a baseline
control that consisted of embryos produced by our conventional IVF
system.
[0048] Embryo Preparation and Microinjection of siRNA
[0049] In vitro maturation followed the protocol outlined in Khatib
et al. [2] except that putative zygotes were incubated for
18-hours. After this period, zygotes were removed from
fertilization media, denuded of cumulus-complexes, and then
prepared for microinjection. Microinjection of the zygotes was
performed using an inverted Nikon Diaphot microscope (200.times.
magnification) as described by Nganvongpanit et al. [15] with some
modifications. In summary, a group of 25-35 zygotes were placed in
a droplet of TALP-Hepes wash media with a mineral oil overlay. A
microinjection needle was used to pierce the zona pellucida and
deposit approximately .about.7-10 picoliters of siRNA into the
cytoplasm of the zygote using the MINJ-D pressurized microinjection
system (Tritech Research, CA). Zygotes were then washed twice in
TALP-HEPES wash media post-injection and placed in SOF culture
medium and incubated under the parameters mentioned above.
[0050] Morphological Grading
[0051] Cleavage rates were assessed as a marker of fertilization
for this study. In addition, embryos were assessed on day 8 of
culture for blastocyst development. Embryos at the blastocyst stage
were collected from each treatment group and underwent RNA
extraction, cDNA synthesis, and qRT-PCR as outlined in the previous
sections. Comparison of cleavage and blastocyst rates was completed
using a chi-squared test for contingency with statistical
significance deemed at P<0.05.
[0052] RNA-Seq Pathway Analysis of siRNA and Non-siRNA Injected
Embryos
[0053] Total RNA from control, sham-injected, and siRNA-injected
CDKN1C embryo pools underwent amplification using the MessageAmp II
aRNA Amplification Kit (Ambion). Libraries of amplified RNA for
each pool were prepared following the Illumina mRNA-Seq protocol.
Sequencing libraries were created from 50 ng samples and sequenced
with Illumina's HiSeq 2000 at the University of Wisconsin-Madison
Biotechnology Center. Mapping reads to the bovine reference genome,
assembly of transcripts and estimation of differential expression,
and Gene Ontology (GO) enrichment analysis was performed as
described in Driver et al. [61]. Sequencing reads were mapped to
the reference genome (bosTau7) using the software package Tophat
(v2.0.4) [62]. Cufflinks (v2.0.2) was used to assemble transcript
models from alignments and to estimate their abundance in the
transcriptome [63]. Abundances of transcripts were upper-quartile
normalized and also corrected for sequence bias in order to improve
expression estimates [64]. Differential expression of genes was
tested using Cuffdiff, a tool part of the Cufflinks package for
testing differential gene expression [63]. In addition, GO
enrichment analysis was performed using the GOseq (v1.8.0) package
[65] that is available in the R language/environment. Biological
pathways with a FDR<0.10 were considered significant.
[0054] Results
[0055] Association of Expression Levels of Imprinted Genes with
Pre-Implantation Bovine Embryo Development
[0056] In a previous study, we used microarrays to profile gene
expression of IVF embryos showing distinct developmental statuses.
Among the differentially expressed genes, PHLDA2 was found to be
significantly up-regulated in degenerate embryos as compared to
normally developed blastocysts in both microarray and qRT-PCR
experiments [3]. Given that PHLDA2 is imprinted and that imprinted
genes have key roles in embryo development, we sought to assess
whether other imprinted genes may show association with
developmental status of the embryo. Nine genes (CDKN1C, IGF2R,
MAGEL2, MKRN3, NAP1L5, NDN, PEG3, TSSC4, and UBE3A) were detected
in pools of blastocyst and degenerate embryo populations with
quantifiable differential expression. NDN, TSSC4, UBE3A, PEG3, and
MKRN3 were found to be up-regulated in degenerate embryos showing
average 1.5.+-.0.17-fold, 2.0.+-.0.22-fold, 2.0.+-.0.31-fold,
2.4.+-.0.30-fold, and 2.8.+-.0.26-fold differences between pools,
respectively (FIG. 1). The genes MAGEL2, NAP1L5, IGF2R, and CDKN1C
showed average 1.3.+-.0.04-fold, 1.5.+-.0.2-fold, 2.5.+-.0.57, and
5.4.+-.0.58-fold up-regulation in blastocysts, respectively (FIG.
1). Of those differentially expressed, MKRN3 (P=0.031) and CDKN1C
(P=0.035) showed statistically significant differences in
expression between blastocyst and degenerate embryos, and PEG3 had
differential expression that was close to a level of significance
(P=0.057). Four genes (USP29, NNAT, PEG10, and RTL1) had very low
expression in embryos making it impossible to quantify differences
accurately, while three genes (IGF2, H19, and MIM1) had
undetectable levels of expression in our embryo populations. To
reveal the mechanisms underlying the differential expression
observed in pre-implantation embryos, PHLDA2 and CDKN1C were
selected for further functional analysis.
[0057] DNA Methylation of PHLDA2 is Associated with Differential
Expression and Tissue Specificity
[0058] In this study, the up-regulation of PHLDA2 was reconfirmed
in three additional pairs of biological replicates, showing 15-fold
higher expression in degenerates compared to blastocysts (FIG. 2).
Although the magnitudes of difference varied between pairs of
embryos and between studies, PHLDA2 expression was consistently
higher in degenerate embryos than in blastocysts. These results
clearly suggest an association between aberrant PHLDA2 expression
and abnormal early embryonic development in IVF embryos.
TABLE-US-00001 TABLE 1 Development rates for PHILDA2 siRNA-
injected and control embryo groups Blasto- Cleavage Blasto- cyst
Treatment Total Cleaved Rate cysts Rate Control 279 208 74%.sup.a
54 26%.sup.a Sham 249 191 77%.sup.a 49 26%.sup.a 100 uM 138 89
64%.sup.a 33 37%.sup.a 150 uM 65 45 69%.sup.a 11 24%.sup.a 200 uM
145 98 68%.sup.a 10 10%.sup.b Differing superscripts within a
column denote statistically significance difference at P <
0.05.
[0059] Because of the importance of DNA methylation in regulating
transcription--particularly that of imprinted genes--we measured
the methylation of cytosines at CpG sites near or within the PHLDA2
gene by bisulfite sequencing. A CpG island highly enriched for CpG
sites was found to overlap with the first exon and first intron of
PHLDA2 as well as upstream of the start of the transcript. DNA
methylation analysis of blastocysts and degenerate embryos revealed
rare methylation of CpG cytosines (FIG. 3). However, one CpG site
upstream of the PHLDA2 transcription start site was highly
methylated in degenerate embryos relative to blastocysts (FIG. 3,
P=0.0004). To test whether DNA methylation was associated with the
tissue specificity of PHLDA2 expression and imprinting, we measured
methylation of DNA from heart, where PHLDA2 was not expressed; from
spleen, where PHLDA2 was lowly expressed and not imprinted; and
from allantois, where PHLDA2 was highly expressed and imprinted
(FIG. 6). Interestingly, DNA upstream of PHLDA2 was methylated at a
higher level in allantois than in heart and spleen (FIG. 6). In
particular, the same CpG dinucleotide (CG1 in FIG. 3) that was
associated with PHLDA2 expression in embryos was methylated at a
higher level in allantois than in heart and spleen (FIG. 6). A
similar methylation pattern was also observed for another CpG site
nearby (CG2; FIG. 6).
[0060] PHLDA2 has Dosage-Sensitive Effects on Bovine
Pre-Implantation Embryo
[0061] To test whether artificially suppressing expression of
PHLDA2 changes embryonic development, we injected fertilized
zygotes with siRNA oligos targeting PHLDA2 mRNA. Microinjection of
200 uM siRNA specific to PHLDA2 resulted in a 10% development rate
versus 26% for the control group (P=0.0004), whereas microinjection
of 150 uM siRNA resulted a development rate similar to the control
group (Table 1). In contrast, microinjection of 100 uM siRNA caused
an increase in blastocyst development (37%) relative to the control
group (26%) (Table 1). To test the effect of the 100 uM siRNA
injection on embryo development under different environmental
conditions, oocytes were collected from ovaries in mid-summer
during a period of heat stress where bovine embryo development
shows a marked decrease. After fertilization, microinjection and
subsequent culturing were performed. During the heat stress period,
the development rate of blastocysts in the control group was 5%
compared to 15% in the 100 uM-injected group (P=0.02) (Table 6). In
addition, there was a significant difference in cleavage rate for
the 150 uM group (P=0.047) compared to the control group. In a
subsequent microinjection experiment done at the end of the heat
stress season, the development rate of blastocysts was 25% in the
100 uM injected group compared to 20% and 18.35% in the control and
sham groups, respectively (Table 7).
[0062] Knockdown of CDKN1C using siRNA Affects Bovine
Pre-Implantation Embryonic Development
[0063] We also tested the effect of CDKN1C knockdown on
pre-implantation embryonic development. Initial siRNA experiments
with different concentrations showed that 200 uM of siRNA produced
.gtoreq.50% knockdown of CDKN1C gene expression in blastocysts
collected on day 8 of culture. As such, this concentration was
selected for further microinjection analysis. Injection of 200 uM
CDKN1C siRNA resulted in 45% decrease in blastocyst rate
(P<0.0006) by day 8 of development (Table 2). To determine the
amount of knockdown achieved by siRNA injection, qRT-PCR was
performed in the baseline control and the injected embryos. FIG. 4
shows 50% knockdown in gene expression. There was no significant
difference in cleavage rate and blastocyst rate for the sham, siRNA
injected, and control group in any of the IVF replications
(P=0.973). Furthermore, phenotypic observations showed no marked
difference between blastocysts produced from the baseline control
or from CDKN1C injections (FIG. 7).
TABLE-US-00002 TABLE 2 Development rates for CDKN1C siRNA-injected
embryos and control embryo groups Blasto- Cleavage Blasto- cyst
Treatment Total.sup.a Cleaved Rate cysts Rate Control 372 288
77%.sup.a 70 24%.sup.a Sham 327 251 77%.sup.a 59 24%.sup.a CDKN1C
354 272 77%.sup.a 34 13%.sup.b siRNA 200 uM .sup.aNumbers represent
average of six biological replicates; Differing superscripts within
a column denotes statistically significant differences (P <
0.05)
TABLE-US-00003 TABLE 3 Genes differentially expressed between sham
and injected embryos using RNA-Seq. log2 Over- Gene Locus(bosTau7)
(fold_change) fold_change expression qvalue qvalue IFI6 chr2:
131115858-131119447 -6.32041 79.92 I 2.04E-07 0.000 IFI27 chr21:
59014080-59022973 -6.16491 71.75 I 0.0285423 0.029 BID chr5:
115412156-115418905 5.43679 43.31 S 0.00611461 0.006 CCDC80 chr1:
58080017-58115541 -5.26498 38.45 I 0.00536579 0.005 ISG15 chr16:
48676752-48677780 -5.20855 36.98 I 0.0123406 0.012 LUM chr5:
23650318-23657534 -5.10874 34.51 I 6.68E-05 0.000 PHACTR3 chr13:
57213274-57279363 -5.00485 32.11 I 0.104192 0.104 LOC100335809
chr2: 6670518-6681740 -4.95429 31.00 I 7.00E-05 0.000 GJA1 chr9:
31507202-31520216 -4.88782 29.61 I 0.000315737 0.000 XCL1 chr16:
33520304-33523470 -4.82608 28.37 I 0.00112997 0.001 C27H8orf4
chr27: 37380049-37381351 -4.55854 23.56 I 0.000833725 0.001 AMY2B
chr3: 42379420-42402070 -4.54654 23.37 I 0.0519033 0.052 LOC510631
chr7: 41563878-41567475 -4.40798 21.23 I 6.68E-05 0.000 RARRES2
chr4: 116419569-116422625 -4.3782 20.80 I 0.000833725 0.001 PLOD2
chr1: 124617975-124739559 -3.91289 15.06 I 0.000151231 0.000 OLR1
chr5: 106703848-106715154 -3.7881 13.81 I 0.0667877 0.067 CSRP3
chr29: 26759118-26779797 -3.69731 12.97 I 0.104192 0.104 VIM chr13:
31432087-31440017 -3.66348 12.67 I 0.00611461 0.006 CDH2 chr24:
29398109-29646615 -3.55893 11.79 I 0.00611461 0.006 BMP2 chr13:
49207397-49218698 -3.36487 10.30 I 0.0857017 0.086 GATM chr10:
66442207-66458222 -3.25909 9.57 I 0.0015428 0.002 TST chr5:
80585175-80591756 3.19801 9.18 S 0.172886 0.173 RNASEH2A chr7:
10989463-10996393 3.17779 9.05 S 0.104192 0.104 LOC515823 chr10:
75128125-75129562 3.1723 9.01 S 0.11784 0.118 ETHE1 chr18:
51364563-51383878 3.12143 8.70 S 0.0133299 0.013 LOC100850219 chr5:
25327382-25336652 -2.94068 7.68 I 0.0159411 0.016 LOC788610 chr15:
47867002-47868681 2.90533 7.49 S 0.0667877 0.067 HBG chr15:
47852891-47854506 2.88532 7.39 S 0.0527532 0.053 --
chrUn_AAFC03100583: 2.85006 7.21 S 0.194133 0.194 48768-54903
LOC100849362 chrY: 3503924-3652372 2.83774 7.15 S 0.0298012 0.030
SLC7A4 chr17: 75507216-75510133 2.81633 7.04 S 0.129536 0.130 UCHL1
chr6: 62454747-62466453 -2.79919 6.96 I 0.162185 0.162 SLITRK2
chrX: 17410200-17413598 -2.74863 6.72 I 0.15962 0.160 LOC507211
chr9: 31659066-31826452 2.71243 6.55 S 0.11784 0.118 GLCCI1 chr4:
16107848-16217411 -2.70933 6.54 I 0.194133 0.194 BIRC3 chr15:
5391794-5422552 -2.70615 6.53 I 0.0667877 0.067 PLSCR1 chr1:
124197036-124224862 -2.67092 6.37 I 0.0519033 0.052 FAM110A chr13:
60912609-60926339 2.66448 6.34 S 0.129536 0.130 WBP1 chr11:
10572506-10574898 2.656 6.30 S 0.104192 0.104 KIF7 chr21:
20902079-20919879 -2.54852 5.85 I 0.0386798 0.039 SRM chr16:
39298009-39302069 2.40596 5.30 S 0.0800995 0.080 XIST chrX:
47265732-47302267 -2.34036 5.06 I 0.0671875 0.067 CIB1 chr21:
21450599-21453772 2.32354 5.01 S 0.0826982 0.083 TPRG1L chr16:
46723485-46726372 2.30358 4.94 S 0.118303 0.118 RNASE1 chr10:
25672191-25673775 2.29757 4.92 S 0.171802 0.172 CCNL1 chr1:
111988773-112002656 -2.2819 4.86 I 0.11784 0.118 NID2 chr10:
44859533-44958463 -2.23342 4.70 I 0.121965 0.122 AP2S1 chr18:
53642812-53652534 2.23307 4.70 S 0.171802 0.172 OGT chrX:
48728453-48754810 -2.13832 4.40 I 0.195152 0.195 FAT1 chr27:
17621364-17747563 -2.1212 4.35 I 0.15962 0.160 IFNT2 chr8:
23602560-23603873 -2.11584 4.33 I 0.15962 0.160 S--SHAM
I--INJECTED
[0064] Transcriptomic Response of Embryos upon CDKN1C Knockdown
[0065] To better understand the mechanisms by which CDKN1C affects
embryo survival, we analyzed the global RNA expression patterns in
control, sham, and injected embryos using RNA-Seq. Comparative
analysis of individual genes between sham- and siRNA-injected
embryos revealed 51 genes that were differentially expressed
between the two embryo groups (Table 3). GO analysis uncovered nine
pathways significantly enriched for differentially expressed genes
(FDR<0.10) between sham-injected and CDKN1C siRNA-injected
embryos (Table 4). Of these, there appears to be a preponderance of
perturbation to cellular signaling/communication (extracellular
region, regulation of cell communication), nucleic acid processing
(endonuclease activity, endoribonuclease activity, producing
3'-phosophomonoesters), and cellular metabolism (monosaccharide
catabolic process, alcohol catabolic process, and various
carbohydrate catabolic processes).
TABLE-US-00004 TABLE 4 Pathways significantly enriched for
differentially expressed genes Ontol- GO ID ogy Term 0005576 CC
Extracellular region 0016894 MF Endonuclease activity, active with
either ribo- or deoxyribonucleic acids and producing 3'-
phosphomonoesters 0046365 BP Monosaccharide catabolic process
0044421 CC Extracellular region part 0010646 BP Regulation of cell
communication 0046164 BP Alcohol catabolic process 0044275 BP
Cellular carbohydrate catabolic process 0016892 MF endoribonuclease
activity, producing 3'-phospho- monoesters 0016052 BP Carbohydrate
catabolic process Notes: Pathways significantly enriched (FDR <
0.10) for differentially expressed genes between sham and CDKN1C
siRNA-injected embryos. Pathways are ranked in order of decreasing
statistical significance BP: Biological process; CC: Cellular
component; MF: Molecular function
TABLE-US-00005 TABLE 5 Primer sequences for real-time PCR reactions
and product sizes Gene Primer Sequence (5'-3') Amplicon (bp) UBE3A
Forward GGGACTCTGTTGTGATTAGGG (SEQ ID No. 5) 171 Reverse
TAGGTAACCTTTCTGTGTCTGG (SEQ ID No. 6) NDN.sup.a Forward
AACGTGCTGCGCATCTTG (SEQ ID No. 7) 103 Reverse
TCAGGTAGTTCTGCTGGACGAA (SEQ ID No. 8) MAGEL2.sup.b Forward
CTGATGGTGGTTCTGAGCCT (SEQ ID No. 9) 257 Reverse
CAGGACAATCATCTTGCTGG (SEQ ID No. 10) MKRN3 Forward
CTGCAGACAGCGGCCCTAGC (SEQ ID No. 11) 222 Reverse
CCCGGTAGGGTTGCCCAGGA (SEQ ID No. 12) CDKN1C Forward
CAAGCGGCTGCGATGAGAG (SEQ ID No. 13) 67 Reverse TCCTGTCCACTGCCCAACG
(SEQ ID No. 14) IGF2R Forward CAGTCGCAAAGTCGGAACC (SEQ ID No. 15)
140 Reverse GGTCACAGTGGAAGAAGATGG (SEQ ID No. 16) PEG3.sup.c
Forward CGCCAAAGTCAGGGAGAG (SEQ ID No. 17) 150 Reverse
CTTAACTGCCAGGACACC (SEQ ID No. 18) NAPIL5 Forward
TCCTTTCGTCACAGTATCGC (SEQ ID No. 19) 118 Reverse TGAGTTCTGCTGCTGCTG
(SEQ ID No. 20) TSSC4 Forward TGCCACCAAGAACCTTCG (SEQ ID No. 21)
106 Reverse CCTCTGCCATGTGTCACC (SEQ ID No. 22) PEG10 Forward
CTTTCCAGCCTTCGCAGAG (SEQ ID No. 23) 126 Reverse
CTTCACTCCTGTGGCAATGG (SEQ ID No. 24) USP29 Forward
AGGAGGAAGTTCCCTTTGTTGC (SEQ ID No. 25) 143 Reverse
TCTCTGTGACGGCTGAAATAGC (SEQ ID No. 26) RTL1 Forward
CCCTCCTCTACCACCCCAAG (SEQ ID No. 27) 107 Reverse CTTGCCCGTCCGCTTGTC
(SEQ ID No. 28) NNAT Forward CACCCACCCACCAGTCTC (SEQ ID No. 29) 142
Reverse TTCTCGACACCGTGTATGC (SEQ ID No. 30) MIM1 Forward
ACTCGGTTGTCAGTCACAC (SEQ ID No. 31) 115 Reverse
GAATTTCCATCGTCTTATTAGC (SEQ ID No. 32) IGF2 Forward
TGCTGCTATGCTGCTTACC (SEQ ID No. 33) 151 Reverse AACACTCTTCCACGATGCC
(SEQ ID No. 34) H19 Forward CGTTCCTTTAGTCTCCTGAC (SEQ ID No. 35)
119 Reverse AGTCCGTGTTCCAAGTCC (SEQ ID No. 36) XIST Forward
CCACTGAGCAACAACTCTAGG (SEQ ID No. 37) 126 Reverse
GGCAAATATGAAGGGAACAACC (SEQ ID No. 38) P.O. Forward
GACAATGGCAGCATCTAC (SEQ ID No. 39) 198 Reverse GAAGGTGTAATCAGTCTCC
(SEQ ID No. 40) B-ACTIN Forward AGGCCAACCGTGAGAAGATGAC (SEQ ID No.
41) 100 Reverse CCAGAGGCATACAGGGACAGC (SEQ ID No. 42) GAPDH Forward
TGCCCAGAATATCATCCC (SEQ ID No. 43) 134 Reverse AGGTCAGATCCACAACAG
(SEQ ID No. 44) .sup.aNDN primers referenced from Wee et al. [66]
.sup.bMAGEL2 primers referenced from Tveden-Nyborg et al. [29]
.sup.cPEG3 primers referenced from Katz-Jaffee et al. (2008)
TABLE-US-00006 TABLE 6 Injection of 100 uM and 150 uM PHLDA2 siRNA
under heat stress Blasto- Cleavage Blasto- cyst Treatment Group
Total Cleaved Rate cysts Rate Control 166 123 68%.sup.a 6 5%.sup.a
PHLDA2 siRNA 100 uM 70 48 68%.sup.a 8 15%.sup.b PHLDA2 siRNA 150 uM
74 43 61%.sup.b 2 4%.sup.a Differing superscripts within a column
denote statistically significant differences (P < 0.05).
TABLE-US-00007 TABLE 7 Injection of 100 uM and 150 uM PHLDA2 siRNA
under presumptive post-heat stress Blasto- Cleavage Blasto- cyst
Treatment Group Total Cleaved Rate cysts Rate Control 105 70 66.7%
14 20% Sham 96 54 56.25% 10 18.25% PHLDA2 siRNA 100 uM 97 64
65.98%* 16 25% PHLDA2 siRNA 150 uM 125 91 72.8% 17 18.68% *denotes
P < 0.05
[0066] Discussion
[0067] Association of DNA Methylation with Expression of PHLDA2
[0068] The regulatory mechanisms of PHLDA2 expression and its
imprinting are not well understood in cattle. DNA methylation is
one of the most common mechanisms in regulating transcription. In
mammals, a general rule is that methylation in promoter regions of
genes represses transcription initiation whereas methylation in
gene bodies enhances transcription elongation [20]. In bovine IVF
embryos at the blastocyst stage, CpG sites within or near the
PHLDA2 gene were generally not methylated (FIG. 3). Nevertheless,
the methylation of a CpG site upstream of PHLDA2 was associated
with higher expression of the gene in degenerate embryos. This
particular CpG site was near the boundary of the CpG island
overlapping with PHLDA2. In fetal tissue DNA, PHLDA2 was methylated
at a higher level in heart, spleen, and allantois than in embryos,
particularly in the region outside the CpG island. Interestingly,
the same CpG site whose methylation correlated with expression in
embryos also showed differential methylation between heart, spleen,
and allantois DNA (FIG. 6). While this CpG site was highly
methylated in allantois, its methylation was lower in heart and
spleen. PHLDA2 expression in allantois was extremely high while it
was relatively lower in spleen and not detected in heart. The
differential methylation of the two CpG sites in these three
tissues suggests correspondence with PHLDA2 expression.
[0069] Recent studies have clearly established that while a
negative correlation exists between DNA methylation in promoter
regions and gene expression, intragenic methylation is abundant and
that this methylation is positively correlated with gene expression
[21-23]. Thus, the increase in gene expression observed when CG1 in
degenerate embryos and CG1 and CG2 in allantois were methylated is
consistent with these studies.
[0070] Dosage Sensitivity of PHLDA2 in Bovine Pre-Implantation
Embryos
[0071] Injections of 100 uM siRNA increased development from 26 to
37%, while more concentrated knockdown using 200 uM siRNA caused
significant decrease in blastocyst rate (control 27% vs. 10%). This
dosage-sensitive effect of PHLDA2 was not only evident in our
standard IVF system, but also in the presence of relatively adverse
developmental conditions. Heat stress is a known condition that
negatively affects the reproductive function in dairy cattle, which
in turn leads to a decrease in embryonic development [24-27].
Production of IVF embryos during heat stress and in the end of heat
stress season resulted in low blastocyst rates in the control group
of non-injected embryos (Table 6 and Table 7). In contrast, embryos
that were injected with 100 uM PHLDA2 siRNA had an increased
blastocyst rate relative to controls. Thus, regardless of
environmental conditions, internal roles of PHLDA2 can improve or
adversely affect embryonic development during the pre-implantation
period. As such, this not only reflects that PHLDA2 has dosage
sensitive functions, but that it also may be a key gene controlling
early embryonic development in the bovine embryo.
[0072] Association of Expression Levels of Imprinted Genes with
Embryo Development
[0073] Genes showing higher expression in degenerate embryos appear
to have roles critical for cell division. MKRN3 putatively
functions as a ribonucleoprotein and been shown to be solely
expressed after the maternal embryonic transition in bovine
in-vitro embryos, where maternal stores of RNA are degraded and the
embryonic transcripts have gained control [28, 29]. For PEG3,
although its biological functions are still being determined,
studies suggest a Peg3/PAX-1 mediation of p53-mediated cell
apoptosis [30]. Our results may be indicative of increased cell
death and lack of RNA modification in the degenerate embryos and
may give rise to suggested roles in the embryo's developmental
potential. Furthermore, UBE3A encodes for the E6-associated
protein, which has a role as an ubiquitin ligase enzyme [31]. This
is of interest as over-expression of this gene in degenerate
embryos may result in an excess of polyubquitination and subsequent
degradation of critical proteins by the proteosomes.
[0074] Of those genes found to have higher expression in
blastocysts, reported functions are more limited. Studies suggest
that IGF2R should be maintained at sufficient levels for proper
development in utero [32]. In addition, low levels of IGF2R may
result in developmental abnormalities such as large offspring
syndrome [33]. Tssc4 has been mapped to a region on chromosome 7 in
the mouse that has association with early embryonic lethality
(http://www.mousebook.org/index.php), but there is little known
regarding its function in cattle.
[0075] Four genes (USP29, NNAT, PEG10, and RTL1) had very low
expression in embryos making it unable to quantify differences
accurately, while three genes (IGF2, H19, and MIM1) had
undetectable levels of expression in our embryo populations. This
may be due to expression levels being below detection limits or an
absence of transcripts due to no expression of these genes during
this developmental period. Although there is some evidence for
expression of H19 in mouse blastocysts [34], previous studies have
shown that neither H19 nor IGF2 is expressed in bovine [5, 35] or
ovine [36] blastocysts. One gene, XIST, was inconclusive in results
due to sex bias as relative abundance for this gene has been shown
to be higher in female blastocysts [37]. Thus, the use of pooling
does not allow us to quantify this gene further.
[0076] An increasing number of studies have shown the importance
and sensitivity of imprinted gene expression during the early
developmental stages. A study by Tunster et al. [38] showed that a
doubling of Phlda2 expression in mice resulted in a 25-35%
reduction in embryonic glycogen stores and a 13% decrease in
embryonic weight. Furthermore, another study revealed that
Mash2-deficient mouse embryos died due to placental failure by Day
10 postcoitum [39]. A prior study in mice revealed 26 imprinted
genes aberrantly expressed in abnormally developed placentas [40].
Interestingly, all of these genes showed a 3-fold or less change in
expression suggesting a heightened sensitivity of the organism to
deviations from normal imprinted gene expression. As such, the
relatively small fold changes found in this study could still hold
biological importance when it comes to the functions of imprinted
genes.
[0077] Knockdown of CDKN1C Causes Reduced Blastocyst
Development
[0078] CDKN1C (p57.sup.KIP2) is a member of the CIP/KIP family of
cell-cycle inhibitors that have unique roles in embryogenesis [41].
Although the primary role of CDKN1C is cell cycle regulation, it
has also been implicated to have roles that in apoptosis,
cytoskeletal dynamics, and differentiation [42]. Mice lacking
Cdkn1c have been found to have increased neonatal lethality and
those surviving showed numerous developmental abnormalities ranging
from cleft palates to abdominal defects [43]. Another study showed
that most mice devoid of Cdkn1c expression died after birth, and
tissues of these individuals had an increase in apoptotic cells and
signs of delayed differentiation [44]. In contrast, excess of this
gene has been shown to have association with increased embryonic
lethality, suggesting dosage sensitivity during early developmental
stages [45]. We hypothesized that by knocking down expression of
CDKN1C using siRNA, embryonic development would be negatively
affected, as the gene showed lower expression levels in degenerated
embryos compared to blastocysts.
[0079] Knockdown of CDKN1C in the bovine pre-implantation embryo
resulted in a 45% decrease in blastocyst rate by day 8 of culture.
Validation of knockdown was observed using qRT-PCR showing a 50%
reduction in CDKN1C levels in day 8 blastocysts in comparison to
sham and control groups. No significant effects were seen on
cleavage rates. Given that CDKN1C knockdown resulted in reduced
blastocyst formation suggests that this gene is a key factor
driving early development. Specifically, these results imply that
the differential expression that was observed between blastocyst
and degenerates was causative, in part, to the embryos'
degeneration.
[0080] Sensitivity of the Embryo to CDKN1C Dosage
[0081] Early embryonic development in mice has been shown to be
extremely sensitive to the levels of Cdkn1c [45]. One excess copy
caused growth retardation by E13.5 while loss of Cdkn1c resulted in
overgrowth phenotypes [45]. Prior to differentiation into a
blastocyst, individual blastomeres are totipotent; however, with
differentiation the ICM cells gain pluripotentcy [46]. A study by
Tury et al. [47] showed that Cdkn1c overexpression at E14.5-15.5 in
mice resulted in a transition from proliferation to differentiation
in neuronal tissues, whereas deficiency of this gene resulted in an
opposite effect. Thus, a particular level of CDKN1C is required for
proliferation to occur and then an increase in CDKN1C levels is
required for a transition from cell division to differentiation.
Indeed in our system there seems to be an apparent sensitivity to
CDKN1C levels. Although cleavage rates were unaffected by
knockdown, later development to the blastocyst stage was reduced
significantly. This suggests that even low levels of CDKN1C were
sufficient for early cell division but heightened levels may be
needed for the transition to differentiation.
[0082] Individual Genes and Pathways Perturbed by CDKN1C
Knockdown
[0083] A total of 51 genes showed significant differential
expression between sham- and siRNA-injected embryos. Notably,
functions of the 20 differentially-expressed genes with the
greatest differences (>10-fold expression difference between
embryo groups) included 10 genes involved in apoptosis (IFI6,
IFI27, CCDC80, LUM, PHACTR3, GJA1, OLR1, CSRP3, NIM, and BMP2). For
example, BMP2 can induce apoptosis by causing cell cycle arrest
[48] and LUM may influence apoptosis through pathways regulated by
Fas-Fas ligand interaction [49]. However, in addition to the
functions of IFI6 and IFI27 in apoptosis, roles in viral infections
have also been suggested [50]. Interestingly, the RNAi pathway in
the cell can be induced by viral infection. Therefore, these two
genes' expression levels may be increased in the siRNA-injected
group due to the CDKN1C siRNA introduction. All the apoptotic genes
were highly expressed in injected compared to non-injected embryos
probably as a result of the apoptotic activity in the injected
embryos. Other functions of the genes found to be altered as a
consequence of siRNA injection include lipid metabolism (OLR1 ,
FAT1, PLSCR1, and PARRES2), differentiation (CSRP3, CDH2, and
BMP2), and cell cycle regulation (C27H8orf4). Thus, knockdown of
CDKN1C identified many genes that are regulated by this gene with a
wide range of functions essential to the developing embryo.
[0084] Of the nine significant pathways found in the GO analysis,
the endonuclease activity pathway was enriched with genes that
showed higher expression in sham than in injected embryos.
Decreased endonuclease activity has been shown to associate with
increased DNA damage in neuronal development [51]. It has been
shown that ablation of certain genes involved in DNA damage repair
in murine embryos leads to embryonic lethality [52]. Decreased
ribonuclease activity in CDKN1C knockdown embryos may be causing
increased cellular damage and reduced development. Thus, p57 (the
protein product for CDKN1C) may be a responder for DNA damage in
the cell, and inadequate levels may prevent the embryo from
recovering from potentially fatal replication mistakes. In
addition, it appears that metabolic processes in the siRNA-injected
embryos are altered in comparison to shams.
[0085] Seven out of eight differentially expressed genes (ENO1,
ENO3, GPI, PFKL, TPI1, DHDH, GALE) for monosaccharide catabolic
process were found to be significantly higher in sham embryos.
Interestingly, ENO1 and ENO3 code for enolase, which is one of the
last steps in glycolysis [53]. Glycolysis, which is a redox
reaction, is a pathway that derives adenosine triphosphate (ATP), a
main source of energy in the cell. It has been suggested that
shifts in redox reactions can affect cell activities
post-compaction and at differentiation, which are two critical
processes in the bovine pre-implantation embryo [54]. In addition,
enolase may serve as a receptor for ligands on the surface of the
cell [55]. This is intriguing as the extracellular region pathway
was also enriched for differentially expressed genes in this study.
During the transition from morula to blastocyst, cells of the
pre-implantation embryo undergo numerous changes including
differentiation into specific cell types. Although there are
numerous hypotheses regarding the mechanism of cell fate and
differentiation during this time, cell signaling has been suggested
as a key component [56]. Early studies have suggested that CDK
inhibitors have functional roles in extracellular signaling and as
such, reduction of CDKN1C may be altering factors on the cellular
membrane responsible for cell signaling [57]. Thus, reducing the
level of CDKN1C and preventing protein production via RNAi leads to
global changes in the bovine pre-implantation embryo and uncovers
new genes and pathways regulated by this gene beyond its immediate
responsibilities in the cell cycle.
[0086] These are nothing more than speculations about the potential
functions of the genes affected by siRNA injection that inhibit the
expression of the two genes. Probably we should delete them or bury
them at the end of the examples.
[0087] Conclusions
[0088] Ten imprinted genes were found to be differentially
expressed between blastocyst and degenerate embryos, among which
PHLDA2 showed a higher expression level in degenerates than
blastocysts and CDKN1C showed a higher expression level in
blastocysts compared to degenerates. Knockdown of PHLDA2 and
CDKN1C--which are located in the same gene cluster--resulted in
significant changes in embryo development using gene-specific siRNA
injection into one-cell zygotes. RNA-Seq transcriptomic analysis of
CDKN1C-siRNA injected vs. non-injected embryos revealed many genes
and pathways that may be regulated by CDKN1C with functions
critical to developing embryo. This suggests that CDKN1C and PHLDA2
are major contributors to bovine embryo development.
REFERENCES
[0089] 1. Farin P W, Piedrahita J A, Farin C E: Errors in
development of fetuses and placentas from in vitro-produced bovine
embryos. Theriogenology 2006, 65(1):178-191. [0090] 2. Khatib H,
Monson R L, Schutzkus V, Kohl D M, Rosa G J M, Rutledge J J:
Mutations in the STAT5A gene are associated with embryonic survival
and milk composition in cattle. Journal of Dairy Science 2008,
91(2):784-793. [0091] 3. Huang W, Khatib H: Comparison of
transcriptomic landscapes of bovine embryos using RNA-Seq. Bmc
Genomics 2010, 11:711. [0092] 4. Huang W, Kirkpatrick B W, Rosa G J
M, Khatib H: A genome-wide association study using selective DNA
pooling identifies candidate markers for fertility in Holstein
cattle. Animal Genetics 2010, 41(6):570-578. [0093] 5. Huang W,
Yandell B S, Khatib H: Transcriptomic profiling of bovine IVF
embryos revealed candidate genes and pathways involved in early
embryonic development. Bmc Genomics 2010, 11. [0094] 6. Khatib H,
Huang W, Wang X, Tran A H, Bindrim A B, Schutzkus V, Monson R L,
Yandell B S: Single gene and gene interaction effects on
fertilization and embryonic survival rates in cattle. Journal of
Dairy Science 2009, 92(5):2238-2247. [0095] 7. Driver A M, Huang W,
Gajic S, Monson R L, Rosa G J M, Khatib H: Short communication:
Effects of the progesterone receptor variants on fertility traits
in cattle. Journal of Dairy Science 2009, 92(8):4082-4085. [0096]
8. Bressan F F, De Bem T H C, Perecin F, Lopes F L, Ambrosio C E,
Meirelles F V, Miglino M A: Unearthing the Roles of Imprinted Genes
in the Placenta. Placenta 2009, 30(10):823-834. [0097] 9. Lefebvre
L, Viville S, Barton S C, Ishino F, Keverne E B, Surani M A:
Abnormal maternal behaviour and growth retardation associated with
loss of the imprinted gene Mest. Nature Genetics 1998,
20(2):163-169. [0098] 10. Ono R, Nakamura K, Inoue K, Naruse M,
Usami T, Wakisaka-Saito N, Hino T, Suzuki-Migishima R, Ogonuki N,
Miki H et al: Deletion of Peg10, an imprinted gene acquired from a
retrotransposon, causes early embryonic lethality. Nature Genetics
2006, 38(1):101-106. [0099] 11. Yang L, Chavatte-Palmer P, Kubota
C, O'Neill M, Hoagland T, Renard J P, Taneja M, Yang X Z, Tian X C:
Expression of imprinted genes is aberrant in deceased newborn
cloned calves and relatively normal in surviving adult clones.
Molecular Reproduction and Development 2005, 71(4):431-438. [0100]
12. Liu J H, Yin S, Xiong B, Hou Y, Chen D Y, Sun Q Y: Aberrant DNA
methylation imprints in aborted bovine clones. Molecular
Reproduction and Development 2008, 75(4):598-607. [0101] 13. Fire
A, Xu S Q, Montgomery M K, Kostas S A, Driver S E, Mello C C:
Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature 1998, 391(6669):806-811. [0102] 14.
Manrique C, Compan V, Rosselet C, Duflo S G D: Specific knock-down
of GAD67 in the striatum using naked small interfering RNAs.
Journal of Biotechnology 2009, 142(3-4):185-192. [0103] 15.
Nganvongpanit K, Muller H, Rings F, Hoelker M, Jennen D, Tholen E,
Havlicek V, Besenfelder U, Schellander K, Tesfaye D: Selective
degradation of maternal and embryonic transcripts in in vitro
produced bovine oocytes and embryos using sequence specific
double-stranded RNA. Reproduction 2006, 131(5):861-874. [0104] 16.
Lee K B, Bettegowda A, Wee G, Ireland J J, Smith G W: Molecular
Determinants of Oocyte Competence: Potential Functional Role for
Maternal (Oocyte-Derived) Follistatin in Promoting Bovine Early
Embryogenesis. Endocrinology 2009, 150(5):2463-2471 [0105] 17.
Tesfaye D, Regassa A, Rings F, Ghanem N, Phatsara C, Tholen E,
Herwig R, Un C, Schellander K, Hoelker M: Suppression of the
transcription factor MSX1 gene delays bovine preimplantation embryo
development in vitro. Reproduction 2010, 139(5):857-870. [0106] 18.
Tripurani S K, Lee K B, Wang L, Wee G, Smith G W, Lee Y S, Latham K
E, Yao J B: A Novel Functional Role for the Oocyte-Specific
Transcription Factor Newborn Ovary Homeobox (NOBOX) during Early
Embryonic Development in Cattle. Endocrinology 2011,
152(3):1013-1023. [0107] 19. O'Meara C M, Murray J D, Mamo S,
Gallagher E, Roche J, Lonergan P: Gene silencing in bovine zygotes:
siRNA transfection versus microinjection. Reproduction Fertility
and Development 2011, 23(4):534-543. [0108] 20. Jones P A, Takai D:
The role of DNA methylation in mammalian epigenetics. Science 2001,
293(5532):1068-1070. [0109] 21. Hellman A, Chess A: Gene
body-specific methylation on the active X chromosome. Science 2007,
315(5815):1141-1143. [0110] 22. Ball M P, Li J B, Gao Y, Lee J H,
LeProust E M, Park I H, Xie B, Daley G Q, Church GM: Targeted and
genome-scale strategies reveal gene-body methylation signatures in
human cells. Nature Biotechnology 2009, 27(4):361-368. [0111] 23.
Jjingo D, Conley A B, Yi S V, Lunyak V V, Jordan I K: On the
presence and role of human gene-body DNA methylation. Oncotarget
2012, 3(4):462-474. [0112] 24. Sartori R, Sartor-Bergfelt R,
Mertens S A, Guenther J N, Parrish J J, Wiltbank M C: Fertilization
and early embryonic development in heifers and lactating cows in
summer and lactating and dry cows in winter. Journal of Dairy
Science 2002, 85(11):2803-2812. [0113] 25. Schrock G E, Saxton A M,
Schrick F N, Edwards J L: Early in vitro fertilization improves
development of bovine ova heat stressed during in vitro maturation.
Journal of Dairy Science 2007, 90(9):4297-4303. [0114] 26. Hansen P
J: Exploitation of genetic and physiological determinants of
embryonic resistance to elevated temperature to improve embryonic
survival in dairy cattle during heat stress. Theriogenology 2007,
68:S242-S249. [0115] 27. Roth Z, Hansen P J: Involvement of
apoptosis in disruption of developmental competence of bovine
oocytes by heat shock during maturation. Biology of Reproduction
2004, 71(6):1898-1906. [0116] 28. Jong M T C, Gray T A, Ji Y G,
Glenn C C, Saitoh S, Driscoll D J, Nicholls R D: A novel imprinted
gene, encoding a RING zinc-finger protein, and overlapping
antisense transcript in the Prader-Willi syndrome critical region.
Human Molecular Genetics 1999, 8(5):783-793. [0117] 29.
Tveden-Nyborg P Y, Alexopoulos N I, Cooney M A, French A J,
Tecirlioglu R T, Holland M K, Thomsen P D, D'Cruz N T: Analysis of
the expression of putatively imprinted genes in bovine
peri-implantation embryos. Theriogenology 2008, 70(7):1119-1128.
[0118] 30. Deng Y B, Wu X W: Peg3/Pw1 promotes p53-mediated
apoptosis by inducing Bax translocation from cytosol to
mitochondria. Proceedings of the National Academy of Sciences of
the United States of America 2000, 97(22):12050-12055. [0119] 31.
Williams C A: Neurological aspects of the Angelman syndrome. Brain
& Development 2005, 27(2):88-94. [0120] 32. Gicquel C, Le Bouc
Y: Hormonal regulation of fetal growth. Hormone Research 2006,
65:28-33. [0121] 33. Suteevun-Phermthai T, Curchoe C L, Evans A C,
Boland E, Rizos D, Fair T, Duffy P, Sung L Y, Du F, Chaubal S et
al: Allelic switching of the imprinted IGF2R gene in cloned bovine
fetuses and calves. Animal Reproduction Science 2009,
116(1-2):19-27. [0122] 34. Fauque P, Jouannet P, Lesaffre C,
Ripoche M A, Dandolo L, Vaiman D, Jammes H: Assisted reproductive
technology affects developmental kinetics, H19 imprinting control
region methylation and H19 gene expression in individual mouse. Bmc
Developmental Biology 2007, 7. [0123] 35. Kues W A, Sudheer S,
Herrmann D, Carnwath J W, Havlicek V, Besenfelder U, Lehrach H,
Adjaye J, Niemann H: Genome-wide expression profiling reveals
distinct clusters of transcriptional regulation during bovine
preimplantation development in vivo (vol 105, pg 19768, 2008).
Proceedings of the National Academy of Sciences of the United
States of America 2009, 106(5):1679-1679. [0124] 36. Thurston A,
Taylor J, Gardner J, Sinclair K D, Young L E: Monoallelic
expression of nine imprinted genes in the sheep embryo occurs after
the blastocyst stage. Reproduction 2008, 135(1):29-40. [0125] 37.
Morton K M, Herrmann D, Sieg B, Struckmann C, Maxwell W M C, Rath
D, Evans G, Lucas-Hahn A, Niemann H, Wrenzycki C: Altered mRNA
expression patterns in bovine blastocysts after fertilisation in
vitro using flow-cytometrically sex-sorted sperm. Molecular
Reproduction and Development 2007, 74(8):931-940. [0126] 38.
Tunster S J, Tycko B, John R M: The Imprinted Phlda2 Gene Regulates
Extraembryonic Energy Stores. Molecular and Cellular Biology 2010,
30(1):295-306. [0127] 39. Guillemot F, Caspary T, Tilghman S M,
Copeland N G, Gilbert D J, Jenkins N A, Anderson D J, Joyner A L,
Rossant J, Nagy A: GENOMIC IMPRINTING OF MASH2, A MOUSE GENE
REQUIRED FOR TROPHOBLAST DEVELOPMENT. Nature Genetics 1995,
9(3):235-242. [0128] 40. Bobetsis Y A, Barros S P, Lin D M, Arce R
M, Offenbacher S: Altered gene expression in murine placentas in an
infection-induced intrauterine growth restriction model: a
microarray analysis. Journal of Reproductive Immunology 2010,
85(2):140-148. [0129] 41. Pateras I S, Apostolopoulou K, Niforou K,
Kotsinas A, Gorgoulis V G: p57(KIP2): "Kip"ing the Cell under
Control. Molecular Cancer Research 2009, 7(12):1902-1919. [0130]
42. Besson A, Dowdy S F, Roberts J M: CDK inhibitors: Cell cycle
regulators and beyond. Developmental Cell 2008, 14(2):159-169.
[0131] 43. Zhang P M, Liegeois N J, Wong C, Finegold M, Hou H,
Thompson J C, Silverman A, Harper J W, DePinho R A, Elledge S J:
Altered cell differentiation and proliferation in mice lacking
p57(KIP2) indicates a role in Beckwith-Wiedemann syndrome. Nature
1997, 387(6629):151-158. [0132] 44. Yan Y M, Lee M H, Massague J,
Barbacid M: Ablation of the CDK inhibitor p57(Kip2) results in
increased apoptosis and delayed differentiation during mouse
development. Genes & Development 1997, 11(8):973-983. [0133]
45. Andrews S C, Wood M D, Tunster S J, Barton S C, Surani M A,
John R M: Cdkn1c (p57(Kip2)) is the major regulator of embryonic
growth within its imprinted domain on mouse distal chromosome 7.
Bmc Developmental Biology 2007, 7. [0134] 46. Sudheer S, Adjaye J:
Functional genomics of human pre-implantation development.
Briefings in functional genomics & proteomics 2007,
6(2):120-132. [0135] 47. Tury A, Mairet-Coello G, DiCicco-Bloom E:
The Cyclin-Dependent Kinase Inhibitor p57(Kip2) Regulates Cell
Cycle Exit, Differentiation, and Migration of Embryonic Cerebral
Cortical Precursors. Cerebral Cortex 2011, 21(8):1840-1856. [0136]
48. Kawamura C, Kizaki M, Ikeda Y: Bone morphogenetic protein
(BMP)-2 induces apoptosis in human myeloma cells. Leukemia &
Lymphoma 2002, 43(3):635-639. [0137] 49. Vij N, Roberts L, Joyce S,
Chakravarti S: Lumican suppresses cell proliferation and aids
Fas-Fas ligand mediated apoptosis: implications in the cornea.
Experimental Eye Research 2004, 78(5):957-971. [0138] 50. Cheriyath
V, Leaman D W, Borden E C: Emerging Roles of FAM14 Family Members
(G1P3/ISG 6-16 and ISG12/IFI27) in Innate Immunity and Cancer.
Journal of Interferon and Cytokine Research 2011, 31(1):173-181.
[0139] 51. Huang E, Qu D, Zhang Y, Venderova K, Hague M E,
Rousseaux M W C, Slack R S, Woulfe J M, Park D S: The role of
Cdk5-mediated apurinic/apyrimidinic endonuclease 1 phosphorylation
in neuronal death. Nature Cell Biology 2010, 12(6):563-U100. [0140]
52. Chen C-H, Chu P-C, Lee L, Lien H-W, Lin T-L, Fan C-C, Chi P,
Huang C-J, Chang M-S: Disruption of Murine mp29/Syf2/Ntc31 Gene
Results in Embryonic Lethality with Aberrant Checkpoint Response.
Plos One 2012, 7(3). [0141] 53. Stein M, Gabdoulline R R, Wade R C:
Cross-species analysis of the glycolytic pathway by comparison of
molecular interaction fields. Molecular bioSystems 2010,
6(1):152-164. [0142] 54. Harvey A J, Kind K L, Thompson J G: REDOX
regulation of early embryo development. Reproduction 2002,
123(4):479-486. [0143] 55. Seweryn E, Pietkiewicz J, Szamborska A,
Gamian A: Enolase on the surface of prockaryotic and eukaryotic
cells is a receptor for human plasminogen. Post py higieny i
medycyny doswiadczalnej (Online) 2007, 61:672-682. [0144] 56.
Sasaki H: Mechanisms of trophectoderm fate specification in
preimplantation mouse development. Development Growth &
Differentiation 2010, 52(3):263-273. [0145] 57. Polyak K, Lee M H,
Erdjumentbromage H, Koff A, Roberts J M, Tempst P, Massague J:
CLONING OF P27(KIP1), A CYCLIN-DEPENDENT KINASE INHIBITOR AND A
POTENTIAL MEDIATOR OF EXTRACELLULAR ANTIMITOGENIC SIGNALS. Cell
1994, 78(1):59-66. [0146] 58. Vandesompele J, De Preter K, Pattyn
F, Poppe B, Van Roy N, De Paepe A, Speleman F: Accurate
normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome biology 2002,
3(7):RESEARCH0034-RESEARCH0034. [0147] 59. Livak K J, Schmittgen T
D: Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001,
25(4):402-408. [0148] 60. Nykanen A, Haley B, Zamore P D: ATP
requirements and small interfering RNA structure in the RNA
interference pathway. Cell 2001, 107(3):309-321. [0149] 61. Driver
A M, Penagaricano F, Huang W, Ahmad K R, Hackbart K S, Wiltbank M
C, Khatib H: RNA-Seq analysis uncovers transcriptomic variations
between morphologically similar in vivo- and in vitro-derived
bovine blastocysts. Bmc Genomics 2012, 13. [0150] 62. Trapnell C,
Pachter L, Salzberg S L: TopHat: discovering splice junctions with
RNA-Seq. Bioinformatics 2009, 25(9):1105-1111. [0151] 63. Trapnell
C, Williams B A, Pertea G, Mortazavi A, Kwan G, van Baren M J,
Salzberg S L, Wold B J, Pachter L: Transcript assembly and
quantification by RNA-Seq reveals unannotated transcripts and
isoform switching during cell differentiation. Nature Biotechnology
2010, 28(5):511-U174. [0152] 64. Roberts A, Trapnell C, Donaghey J,
Rinn J L, Pachter L: Improving RNA-Seq expression estimates by
correcting for fragment bias. Genome biology 2011, 12(3). [0153]
65. Young M D, Wakefield M J, Smyth G K, Oshlack A: Gene ontology
analysis for RNA-seq: accounting for selection bias. Genome biology
2010, 11(2). [0154] 66. Wee G, Koo D B, Song B S, Kim J S, Kang M
J, Moon S J, Kang Y K, Lee K K, Han Y M: Inheritable histone H4
acetylation of somatic chromatins in cloned embryos. Journal of
Biological Chemistry 2006, 281(9):6048-6057.
Sequence CWU 1
1
44123DNAArtificial SequencePHLDA2 antisense 1aguagcaccg ggcuauaucd
tdt 23223DNAArtificial SequencePHLDA2 Sense 2gauauagccc ggugcuacud
tdt 23323DNAArtificial SequenceCDKN1C antisense 3aaaucccuga
gugcggcggd tdt 23423DNAArtificial SequenceCDKN1C sense 4ccgccgcacu
cagggauuud tdt 23521DNAArtificial SequenceUBE3A-F 5gggactctgt
tgtgattagg g 21622DNAArtificial SequenceUBE3A-R 6taggtaacct
ttctgtgtct gg 22718DNAArtificial SequenceNDNa-F 7aacgtgctgc
gcatcttg 18822DNAArtificial SequenceNDNa-R 8tcaggtagtt ctgctggacg
aa 22920DNAArtificial SequenceMAGEL2b-F 9ctgatggtgg ttctgagcct
201020DNAArtificial SequenceMAGEL2b-R 10caggacaatc atcttgctgg
201120DNAArtificial SequenceMKRN3-F 11ctgcagacag cggccctagc
201220DNAArtificial SequenceMKRN3-R 12cccggtaggg ttgcccagga
201319DNAArtificial SequenceCDKN1C-F 13caagcggctg cgatgagag
191419DNAArtificial SequenceCDKN1C-R 14tcctgtccac tgcccaacg
191519DNAArtificial SequenceIGF2R-F 15cagtcgcaaa gtcggaacc
191621DNAArtificial SequenceIGF2R-R 16ggtcacagtg gaagaagatg g
211718DNAArtificial SequencePEG3c-F 17cgccaaagtc agggagag
181818DNAArtificial SequencePEG3c-R 18cttaactgcc aggacacc
181920DNAArtificial SequenceNAP1L5-F 19tcctttcgtc acagtatcgc
202018DNAArtificial SequenceNAP1L5-R 20tgagttctgc tgctgctg
182118DNAArtificial SequenceTSSC4-F 21tgccaccaag aaccttcg
182218DNAArtificial SequenceTSSC4-R 22cctctgccat gtgtcacc
182319DNAArtificial SequencePEG10-F 23ctttccagcc ttcgcagag
192420DNAArtificial SequencePEG10-R 24cttcactcct gtggcaatgg
202522DNAArtificial SequenceUSP29-F 25aggaggaagt tccctttgtt gc
222622DNAArtificial SequenceUSP29-R 26tctctgtgac ggctgaaata gc
222720DNAArtificial SequenceRTL1-F 27ccctcctcta ccaccccaag
202818DNAArtificial SequenceRTL1-R 28cttgcccgtc cgcttgtc
182918DNAArtificial SequenceNNAT-F 29cacccaccca ccagtctc
183019DNAArtificial SequenceNNAT-R 30ttctcgacac cgtgtatgc
193119DNAArtificial SequenceMIM1-F 31actcggttgt cagtcacac
193222DNAArtificial SequenceMIM1-R 32gaatttccat cgtcttatta gc
223319DNAArtificial SequenceIGF2-F 33tgctgctatg ctgcttacc
193419DNAArtificial SequenceIGF2-R 34aacactcttc cacgatgcc
193520DNAArtificial SequenceH19-F 35cgttccttta gtctcctgac
203618DNAArtificial SequenceH19-R 36agtccgtgtt ccaagtcc
183721DNAArtificial SequenceXIST-F 37ccactgagca acaactctag g
213822DNAArtificial SequenceXIST-R 38ggcaaatatg aagggaacaa cc
223921DNAArtificial SequenceP.O.-F 39ccactgagca acaactctag g
214022DNAArtificial SequenceP.O.-R 40ggcaaatatg aagggaacaa cc
224122DNAArtificial SequenceB-ACTIN-F 41aggccaaccg tgagaagatg ac
224221DNAArtificial SequenceB-ACTIN-R 42ccagaggcat acagggacag c
214318DNAArtificial SequenceGAPDH-F 43tgcccagaat atcatccc
184418DNAArtificial SequenceGAPDH-R 44aggtcagatc cacaacag 18
* * * * *
References