U.S. patent application number 13/956213 was filed with the patent office on 2014-07-03 for antisense oligonucleotide modulation of raf gene expression.
The applicant listed for this patent is Isis Pharmaceuticals, Inc.. Invention is credited to Brett P. Monia.
Application Number | 20140187601 13/956213 |
Document ID | / |
Family ID | 22949424 |
Filed Date | 2014-07-03 |
United States Patent
Application |
20140187601 |
Kind Code |
A1 |
Monia; Brett P. |
July 3, 2014 |
ANTISENSE OLIGONUCLEOTIDE MODULATION OF RAF GENE EXPRESSION
Abstract
Oligonucleotides are provided which are targeted to nucleic
acids encoding human raf and capable of inhibiting raf expression.
The oligonucleotides may have chemical modifications at one or more
positions and may be chimeric oligonucleotides. Methods of
inhibiting the expression of human raf using oligonucleotides of
the invention are also provided. The present invention further
comprises methods of inhibiting hyperproliferation of cells and
methods of treating or preventing conditions, including
hyperproliferative conditions, associated with raf expression.
Inventors: |
Monia; Brett P.; (Encinitas,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Isis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Family ID: |
22949424 |
Appl. No.: |
13/956213 |
Filed: |
July 31, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13678432 |
Nov 15, 2012 |
|
|
|
13956213 |
|
|
|
|
13185406 |
Jul 18, 2011 |
|
|
|
13678432 |
|
|
|
|
11364481 |
Feb 28, 2006 |
|
|
|
13185406 |
|
|
|
|
10173225 |
Jun 14, 2002 |
|
|
|
11364481 |
|
|
|
|
10057550 |
Jan 25, 2002 |
6806258 |
|
|
10173225 |
|
|
|
|
09506073 |
Feb 18, 2000 |
6410518 |
|
|
10057550 |
|
|
|
|
09143214 |
Aug 28, 1998 |
6090626 |
|
|
09506073 |
|
|
|
|
08756806 |
Nov 26, 1996 |
5952229 |
|
|
09143214 |
|
|
|
|
PCT/US95/07111 |
May 31, 1995 |
|
|
|
08756806 |
|
|
|
|
08250856 |
May 31, 1994 |
5563255 |
|
|
PCT/US95/07111 |
|
|
|
|
PCT/US98/13961 |
Jul 6, 1998 |
|
|
|
09506073 |
|
|
|
|
08888982 |
Jul 7, 1997 |
5981731 |
|
|
PCT/US98/13961 |
|
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
C07H 21/00 20130101;
A61K 38/00 20130101; C12N 2310/315 20130101; C12N 2310/321
20130101; C12N 2310/321 20130101; C12N 2310/3517 20130101; C12N
15/1135 20130101; A61P 35/00 20180101; C12N 2310/346 20130101; C12N
2310/341 20130101; C12N 2310/3341 20130101; C12N 2310/3521
20130101; C12N 2310/3527 20130101; C12N 2310/321 20130101; C12N
2310/3525 20130101; A61P 43/00 20180101; C12N 15/1137 20130101;
A61P 17/06 20180101; C12N 2310/321 20130101; A61P 35/04 20180101;
C12N 2310/322 20130101 |
Class at
Publication: |
514/44.A |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1-10. (canceled)
11. A method of preventing or treating an ocular condition in an
animal, said condition involving aberrant angiogenesis, comprising
administering to said animal an oligonucleotide of 8 to 50
nucleotides in length that is targeted to mRNA encoding c-raf (SEQ
ID NO:64).
12. The method of claim 11, wherein said ocular condition is
macular degeneration.
13. The method of claim 11, wherein said ocular condition is
diabetic retinopathy.
14. The method of claim 11, wherein said ocular condition is
retinopathy of prematurity.
15. The method of claim 11, wherein said administration comprises
ophthalmic administration.
16. The method of claim 15, wherein said ophthalmic administration
comprises topical administration.
17. The method of claim 15, wherein said ophthalmic administration
comprises intraocular injection administration.
18. The method of claim 11, wherein said oligonucleotide comprises
any one of SEQ ID NOs: 2, 6, 8, 12, 17, 20, 21, 22, 23, 24, 25, 26,
or 27.
19. The method of claim 11, wherein said oligonucleotide comprises
at least one phosphorothioate internucleoside linkage.
20. The method of either claim 11, wherein said oligonucleotide
comprises at least one nucleotide modified at the 2' position of
the sugar moiety.
21. The method of claim 20, wherein said modification comprises a
modification selected from the group consisting of OH, F, O-alkyl,
5-alkyl, N-alkyl, O-alkyl-O-alkyl, O-alkenyl, S-alkenyl, N-alkenyl,
O-alkynyl, S-alkynyl, and N-alkynyl.
22. The method of claim 20, wherein said 2' modification is an
O-alkyl-O-alkyl modification.
23. The method of claim 22, wherein said O-alkyl-O-alkyl
modification is a 2'-O--CH.sub.2CH.sub.2OCH.sub.3 modification.
24. The method of claim 11, wherein said oligonucleotide comprises
SEQ ID NO:8.
Description
[0001] This application is a continuation-in-part of Ser. No.
10/057,550, filed Jan. 25, 2002, which is a continuation of Ser.
No. 09/506,073, filed Feb. 18, 2000, which is a
continuation-in-part of Ser. No. 09/143,214 filed Aug. 28, 1998,
now issued as U.S. Pat. No. 6,090,626, which is a continuation of
Ser. No. 08/756,806 filed Nov. 26, 1996, now issued as U.S. Pat.
No. 5,952,229 which was a continuation of PCT/US95/07111 filed May
31, 1995 and Ser. No. 08/250,856 filed May 31, 1994, now issued as
U.S. Pat. No. 5,563,255. This application is also a
continuation-in-part of Ser. No. 08/888,982, filed Jul. 7, 1997,
now issued as U.S. Pat. No. 5,981,731, and corresponding PCT
application PCT/US98/13961, filed Jul. 6, 1998. Each of these
applications is assigned to the assignee of the present
invention.
INTRODUCTION
[0002] 1. Field of the Invention
[0003] This invention relates to compositions and methods for
modulating expression of the raf gene, a naturally present cellular
gene which has been implicated in abnormal cell proliferation and
tumor formation. This invention is also directed to methods for
inhibiting hyperproliferation of cells; these methods can be used
diagnostically or therapeutically. Furthermore, this invention is
directed to treatment of conditions associated with expression of
the raf gene and to prevention of tumor metastasis.
[0004] 2. Background of the Invention
[0005] Alterations in the cellular genes which directly or
indirectly control cell growth and differentiation are considered
to be the main cause of cancer. The raf gene family includes three
highly conserved genes termed A-, B- and c-raf (also called raf-1).
Raf genes encode protein kinases that are thought to play important
regulatory roles in signal transduction processes that regulate
cell proliferation. Expression of the c-raf protein is believed to
play a role in abnormal cell proliferation since it has been
reported that 60% of all lung carcinoma cell lines express
unusually high levels of c-raf mRNA and protein. Rapp et al., The
Oncogene Handbook, E. P. Reddy, A. M Skalka and T. Curran, eds.,
Elsevier Science Publishers, New York, 1988, pp. 213-253.
[0006] Oligonucleotides have been employed as therapeutic moieties
in the treatment of disease states in animals and man. For example,
workers in the field have now identified antisense, triplex and
other oligonucleotide compositions which are capable of modulating
expression of genes implicated in viral, fungal and metabolic
diseases. Antisense oligonucleotides have been safely administered
to humans and clinical trials of several antisense oligonucleotide
drugs, targeted both to viral and cellular gene products, are
presently underway. The phosphorothioate oligonucleotide drug,
Vitravene.TM. (ISIS 2922), has been approved by the FDA for
treatment of cytomegalovirus retinitis in AIDS patients. It is thus
established that oligonucleotides can be useful therapeutic
instrumentalities and can be configured to be useful in treatment
regimes for treatment of cells and animal subjects, especially
humans.
[0007] Antisense oligonucleotide inhibition of gene expression has
proven to be a useful tool in understanding the roles of raf genes.
An antisense oligonucleotide complementary to the first six codons
of human c-raf has been used to demonstrate that the mitogenic
response of T cells to interleukin-2 (IL-2) requires c-raf. Cells
treated with the oligonucleotide showed a near-total loss of c-raf
protein and a substantial reduction in proliferative response to
IL-2. Riedel et al., Eur. J. Immunol. 1993, 23, 3146-3150. Rapp et
al. have disclosed expression vectors containing a raf gene in an
antisense orientation downstream of a promoter, and methods of
inhibiting raf expression by expressing an antisense Raf gene or a
mutated Raf gene in a cell. WO application 93/04170. An antisense
oligodeoxyribonucleotide complementary to codons 1-6 of murine
c-Raf has been used to abolish insulin stimulation of DNA synthesis
in the rat hepatoma cell line H4IIE. Tornkvist et al., J. Biol.
Chem. 1994, 269, 13919-13921. WO Application 93/06248 discloses
methods for identifying an individual at increased risk of
developing cancer and for determining a prognosis and proper
treatment of patients afflicted with cancer comprising amplifying a
region of the c-raf gene and analyzing it for evidence of
mutation.
[0008] Denner et al. disclose antisense polynucleotides hybridizing
to the gene for raf, and processes using them. WO 94/15645.
Oligonucleotides hybridizing to human and rat raf sequences are
disclosed.
[0009] Iversen et al. disclose heterotypic antisense
oligonucleotides complementary to raf which are able to kill
ras-activated cancer cells, and methods of killing raf-activated
cancer cells. Numerous oligonucleotide sequences are disclosed,
none of which are actually antisense oligonucleotide sequences.
[0010] The liver is a major site of metastases for some of the most
common malignancies, carcinomas of the gastrointestinal tract and
colorectal carcinomas in particular. Liver metastases are
frequently inoperable and are associated with poor prognosis. New
approaches based on an understanding of the biology of liver
metastasis may provide alternative strategies for prevention and
treatment of hepatic metastases. The metastatic cascade involves a
sequence of steps including invasion of local host tissues, entry
into the circulation, arrest and adherence in the vascular bed and
extravasation into the target organ parenchyma. The evidence
suggests that attachment of circulating rumor cells to the vascular
endothelium or the target organ may be a key event in regulating
extravasation and implicates in this adhesion site-specific
microvascular endothelial cell surface molecules and cytokine
inducible receptors that are normally involved in
inflammation-induced leukocyte adhesion and transmigration. Among
the cytokine inducible receptors implicated in leukocyte
transmigration and tumor metastasis are the selectins, E-selectin
in particular.
[0011] E-selectin (CD62E) is a 115 kDa antigen first identified on
human umbilical vein endothelial cells stimulated by IL-1.
[0012] In vivo, its expression on vascular endothelial cells is
induced by proinflammatory cytokines such as IL-1 beta and
TNF-alpha. The endothelial cells express type 1 (TNFR60) and type 2
(TNFR80) TNF receptors, but the former is thought to be the major
form involved in soluble TNF-alpha-induced cellular responses.
Signaling through this receptor appears to involve activation of
the p42ERK, p38 MAPK and p54JNK (jun-nh2-terminal kinase) pathways,
as well as NF-kappa-B activation and may depend on cooperative
signaling between these pathways. Recent studies have implicated
the ras and raf kinases which act upstream of the MAPK pathway in
transcriptional activation of E-selectin, an activity which may be
secondary to a RNF-alpha-induced increase in ceramide
production.
[0013] The selectins generally bind to sialylated, glycosylated or
sulfated glycans on glycoproteins, glycolipids or proteoglycan. The
tetrasaccharides sialyl-Lewis.sup.x (sLew.sup.x) and
sialyl-Lewis.sup.a (s-Lew.sup.a) appear to be recognized by all
three selectins, namely L-, P- and E-selectin. Sialyl-Lewis.sup.x
and sialyl-Lewis.sup.a have been identified as markers of
progression in several types of carcinomas, particularly carcinomas
of the gastrointestinal tract which commonly metastasize to the
liver and their level of expression in carcinoma-derived cell lines
was shown to positively correlate with metastatic ability in nude
mice. In vitro adhesion studies have shown that human colorectal,
pancreatic and gastric carcinoma cells utilize sLex and related
carbohydrates to adhere to TNF-alpha inducible E-selectin on
cultured vascular endothelial cells. Moreover, anti-sLe.sup.x and
Sle.sup.a antibodies and a soluble E-selectin fusion protein
blocked metastases of human tumors in nude mice implicating
E-selectin in the metastatic process, particularly in metastasis of
human colorectal carcinoma cells.
[0014] Highly metastatic cells entering the liver can rapidly
induce a cytokine cascade involving Kupffer cell-derived TNA-alpha
which leads to upregulation of hepatic sinusoidal endothelial
E-selectin expression which is followed by upregulation of ICAM-1
and VCAM-1. Using an E-selectin specific monoclonal antibody, it
was demonstrated that E-selectin is involved in metastasis
formation in this organ.
[0015] There remains a long-felt need for improved compositions and
methods for inhibiting raf gene expression and for preventing tumor
metastasis. The present invention addresses this need.
SUMMARY OF THE INVENTION
[0016] The present invention provides oligonucleotides which are
targeted to nucleic acids encoding human raf and are capable of
inhibiting raf expression. The present invention also provides
chimeric oligonucleotides targeted to nucleic acids encoding human
raf. The oligonucleotides of the invention are believed to be
useful both diagnostically and therapeutically, and are believed to
be particularly useful in the methods of the present invention.
[0017] The present invention also comprises methods of inhibiting
the expression of human raf, particularly the abnormal expression
of raf. These methods are believed to be useful both
therapeutically and diagnostically as a consequence of the
association between raf expression and hyperproliferation. These
methods are also useful as tools, for example for detecting and
determining the role of raf expression in various cell functions
and physiological processes and conditions and for diagnosing
conditions associated with raf expression.
[0018] The present invention also comprises methods of inhibiting
hyperproliferation of cells using oligonucleotides of the
invention. These methods are believed to be useful, for example in
diagnosing raf-associated cell hyperproliferation. These methods
employ the oligonucleotides of the invention. These methods are
believed to be useful both therapeutically and as clinical research
and diagnostic tools.
DETAILED DESCRIPTION OF THE INVENTION
[0019] Malignant tumors develop through a series of stepwise,
progressive changes that lead to the loss of growth control
characteristic of cancer cells, i.e., continuous unregulated
proliferation, the ability to invade surrounding tissues, and the
ability to metastasize to different organ sites. Carefully
controlled in vitro studies have helped define the factors that
characterize the growth of normal and neoplastic cells and have led
to the identification of specific proteins that control cell growth
and differentiation. The raf genes are members of a gene family
which encode related proteins termed A-, B- and c-raf. Raf genes
code for highly conserved serine-threonine-specific protein
kinases. These enzymes are differentially expressed; c-raf, the
most thoroughly characterized, is expressed in all organs and in
all cell lines that have been examined. A- and B-raf are expressed
in urogenital and brain tissues, respectively. c-raf protein kinase
activity and subcellular distribution are regulated by mitogens via
phosphorylation. Various growth factors, including epidermal growth
factor, acidic fibroblast growth factor, platelet-derived growth
factor, insulin, granulocyte-macrophage colony-stimulating factor,
interleukin-2, interleukin-3 and erythropoietin, have been shown to
induce phosphorylation of c-raf. Thus, c-raf is believed to play a
fundamental role in the normal cellular signal transduction
pathway, coupling a multitude of growth factors to their net
effect, cellular proliferation.
[0020] Certain abnormal proliferative conditions are believed to be
associated with raf expression and are, therefore, believed to be
responsive to inhibition of raf expression. Abnormally high levels
of expression of the raf protein are also implicated in
transformation and abnormal cell proliferation. These abnormal
proliferative conditions are also believed to be responsive to
inhibition of raf expression. Examples of abnormal proliferative
conditions are hyperproliferative disorders such as cancers,
tumors, hyperplasias, pulmonary fibrosis, angiogenesis, psoriasis,
atherosclerosis and smooth muscle cell proliferation in the blood
vessels, such as stenosis or restenosis following angioplasty. The
cellular signaling pathway of which raf is a part has also been
implicated in inflammatory disorders characterized by T-cell
proliferation (T-cell activation and growth), such as tissue graft
rejection, endotoxin shock, and glomerular nephritis, for
example.
[0021] It has now been found that elimination or reduction of raf
gene expression may halt or reverse abnormal cell proliferation.
This has been found even in when levels of raf expression are not
abnormally high. There is a great desire to provide compositions of
matter which can modulate the expression of the raf gene. It is
greatly desired to provide methods of detection of the raf gene in
cells, tissues and animals. It is also desired to provide methods
of diagnosis and treatment of abnormal proliferative conditions
associated with abnormal raf gene expression. In addition, kits and
reagents for detection and study of the raf gene are desired.
"Abnormal" raf gene expression is defined herein as abnormally high
levels of expression of the raf protein, or any level of raf
expression in an abnormal proliferative condition or state.
[0022] The present invention employs oligonucleotides targeted to
nucleic acids encoding raf. This relationship between an
oligonucleotide and its complementary nucleic acid target to which
it hybridizes is commonly referred to as "antisense". "Targeting"
an oligonucleotide to a chosen nucleic acid target, in the context
of this invention, is a multistep process. The process usually
begins with identifying a nucleic acid sequence whose function is
to be modulated. This may be, as examples, a cellular gene (or mRNA
made from the gene) whose expression is associated with a
particular disease state, or a foreign nucleic acid from an
infectious agent. In the present invention, the target is a nucleic
acid encoding raf; in other words, the raf gene or mRNA expressed
from the raf gene. The targeting process also includes
determination of a site or sites within the nucleic acid sequence
for the oligonucleotide interaction to occur such that the desired
effect-modulation of gene expression-will result. Once the target
site or sites have been identified, oligonucleotides are chosen
which are sufficiently complementary to the target, i.e., hybridize
sufficiently well and with sufficient specificity, to give the
desired modulation.
[0023] In the context of this invention "modulation" means either
inhibition or stimulation. Inhibition of raf gene expression is
presently the preferred form of modulation. This modulation can be
measured in ways which are routine in the art, for example by
Northern blot assay of mRNA expression or Western blot assay of
protein expression as taught in the examples of the instant
application. Effects on cell proliferation or tumor cell growth can
also be measured, as taught in the examples of the instant
application. "Hybridization", in the context of this invention,
means hydrogen bonding, also known as Watson-Crick base pairing,
between complementary bases, usually on opposite nucleic acid
strands or two regions of a nucleic acid strand. Guanine and
cytosine are examples of complementary bases which are known to
form three hydrogen bonds between them. Adenine and thymine are
examples of complementary bases which form two hydrogen bonds
between them. "Specifically hybridizable" and "complementary" are
terms which are used to indicate a sufficient degree of
complementarity such that stable and specific binding occurs
between the DNA or RNA target and the oligonucleotide. It is
understood that an oligonucleotide need not be 100% complementary
to its target nucleic acid sequence to be specifically
hybridizable. An oligonucleotide is specifically hybridizable when
binding of the oligonucleotide to the target interferes with the
normal function of the target molecule to cause a loss of utility,
and there is a sufficient degree of complementarity to avoid
non-specific binding of the oligonucleotide to non-target sequences
under conditions in which specific binding is desired, i.e., under
physiological conditions in the case of in vivo assays or
therapeutic treatment or, in the case of in vitro assays, under
conditions in which the assays are conducted.
[0024] In preferred embodiments of this invention, oligonucleotides
are provided which are targeted to mRNA encoding c-raf, A-raf and
B-raf. In accordance with this invention, persons of ordinary skill
in the art will understand that mRNA includes not only the coding
region which carries the information to encode a protein using the
three letter genetic code, but also associated ribonucleotides
which form a region known to such persons as the 5'-untranslated
region, the 3'-untranslated region, the 5' cap region, intron
regions and intron/exon or splice junction ribonucleotides. Thus,
oligonucleotides may be formulated in accordance with this
invention which are targeted wholly or in part to these associated
ribonucleotides as well as to the coding ribonucleotides. In
preferred embodiments, the oligonucleotide is targeted to a
translation initiation site (AUG codon) or sequences in the 5'- or
3'-untranslated region of the human c-raf mRNA. The functions of
messenger RNA to be interfered with include all vital functions
such as translocation of the RNA to the site for protein
translation, actual translation of protein from the RNA, splicing
or maturation of the RNA and possibly even independent catalytic
activity which may be engaged in by the RNA. The overall effect of
such interference with the RNA function is to cause interference
with raf protein expression.
[0025] The present invention provides oligonucleotides for
modulation of raf gene expression. Such oligonucleotides are
targeted to nucleic acids encoding raf. Oligonucleotides and
methods for modulation of c-raf, A-raf and B-raf are presently
preferred; however, compositions and methods for modulating
expression of other forms of raf are also believed to have utility
and are comprehended by this invention. As hereinbefore defined,
"modulation" means either inhibition or stimulation. Inhibition of
raf gene expression is presently the preferred form of
modulation.
[0026] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of nucleotide or nucleoside
monomers consisting of naturally occurring bases, sugars and
intersugar (backbone) linkages. The term "oligonucleotide" also
includes oligomers comprising non-naturally occurring monomers, or
portions thereof, which function similarly. Such modified or
substituted oligonucleotides are often preferred over native forms
because of properties such as, for example, enhanced cellular
uptake and increased stability in the presence of nucleases.
[0027] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
Certain preferred oligonucleotides of this invention are chimeric
oligonucleotides. "Chimeric oligonucleotides" or "chimeras", in the
context of this invention, are oligonucleotides which contain two
or more chemically distinct regions, each made up of at least one
nucleotide. These oligonucleotides typically contain at least one
region of modified nucleotides that confers one or more beneficial
properties (such as, for example, increased nuclease resistance,
increased uptake into cells, increased binding affinity for the RNA
target) and a region that is a substrate for RNase H cleavage. In
one preferred embodiment, a chimeric oligonucleotide comprises at
least one region modified to increase target binding affinity, and,
usually, a region that acts as a substrate for RNAse H. Affinity of
an oligonucleotide for its target (in this case a nucleic acid
encoding raf) is routinely determined by measuring the Tm of an
oligonucleotide/target pair, which is the temperature at which the
oligonucleotide and target dissociate; dissociation is detected
spectrophotometrically. The higher the Tm, the greater the affinity
of the oligonucleotide for the target. In a more preferred
embodiment, the region of the oligonucleotide which is modified to
increase raf mRNA binding affinity comprises at least one
nucleotide modified at the 2' position of the sugar, most
preferably a 2'-O-alkyl, alkyl-O-alkyl or 2'-fluoro-modified
nucleotide. Such modifications are routinely incorporated into
oligonucleotides and these oligonucleotides have been shown to have
a higher Tm (i.e., higher target binding affinity) than
2'-deoxyoligonucleotides against a given target. The effect of such
increased affinity is to greatly enhance antisense oligonucleotide
inhibition of raf gene expression. RNAse H is a cellular
endonuclease that cleaves the RNA strand of RNA:DNA duplexes;
activation of this enzyme therefore results in cleavage of the RNA
target, and thus can greatly enhance the efficiency of antisense
inhibition. Cleavage of the RNA target can be routinely
demonstrated by gel electrophoresis. In another preferred
embodiment, the chimeric oligonucleotide is also modified to
enhance nuclease resistance. Cells contain a variety of exo- and
endo-nucleases which can degrade nucleic acids. A number of
nucleotide and nucleoside modifications have been shown to make the
oligonucleotide into which they are incorporated more resistant to
nuclease digestion than the native oligodeoxynucleotide. Nuclease
resistance is routinely measured by incubating oligonucleotides
with cellular extracts or isolated nuclease solutions and measuring
the extent of intact oligonucleotide remaining over time, usually
by gel electrophoresis. Oligonucleotides which have been modified
to enhance their nuclease resistance survive intact for a longer
time than unmodified oligonucleotides. A variety of oligonucleotide
modifications have been demonstrated to enhance or confer nuclease
resistance. Oligonucleotides which contain at least one
phosphorothioate modification are presently more preferred. In some
cases, oligonucleotide modifications which enhance target binding
affinity are also, independently, able to enhance nuclease
resistance.
[0028] The oligonucleotides in accordance with this invention
preferably are from about 8 to about 50 nucleotides in length. In
the context of this invention it is understood that this
encompasses non-naturally occurring oligomers as hereinbefore
described, having 8 to 50 monomers. Particularly preferred are
antisense oligonucleotides comprising from about 8 to about 30
nucleobases (i.e. from about 8 to about 30 linked nucleosides).
[0029] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0030] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0031] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotri-esters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thiono-alkylphosphonates, thionoalkylphosphotriesters, and
borano-phosphates having normal 3'-5' linkages, 2'-5' linked
analogs of these, and those having inverted polarity wherein the
adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are
also included.
[0032] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. No. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
[0033] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
O, S and CH.sub.2 component parts.
[0034] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439.
[0035] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Further
teaching of PNA compounds can be found in Nielsen et al. (Science,
1991, 254, 1497-1500).
[0036] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0037] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O-, S-, or N-alkyl,
O-alkyl-O-alkyl, O-, S-, or N-alkenyl, or O-, S- or N-alkynyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2)O].sub.nCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or
O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3,
SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3,
NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta
1995, 78, 486-504) i.e., an alkoxyalkoxy group. Further preferred
modifications include 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
and 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) as described in
examples hereinbelow.
[0038] Other preferred modifications include 2'-methoxy
(2'-.beta.-CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugars structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and
5,700,920.
[0039] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C or m5c), 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and
cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further
nucleobases include those disclosed in U.S. Pat. No. 3,687,808,
those disclosed in the Concise Encyclopedia Of Polymer Science And
Engineering 1990, pages 858-859, Kroschwitz, J. I., ed. John Wiley
& Sons, those disclosed by Englisch et al. (Angewandte Chemie,
International Edition 1991, 30, 613-722), and those disclosed by
Sanghvi, Y. S., Chapter 15, Antisense Research and Applications
1993, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press.
Certain of these nucleobases are particularly useful for increasing
the binding affinity of the oligomeric compounds of the invention.
These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and O-6 substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, X. S., Crooke, S. T. and
Lebleu, B., eds., Antisense Research and Applications 1993, CRC
Press, Boca Raton, pages 276-278) and are presently preferred base
substitutions, even more particularly when combined with
2'-O-methoxyethyl sugar modifications.
[0040] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941.
[0041] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. Such
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Lett. 1994, 4, 1053-1059), a thioether, e.g.,
hexyl-5-tritylthiol (Manoharan at al., Ann. N.Y. Acad. Sci. 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let. 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J. 1991, 10,
1111-1118; Kabanov et al., FEBS Lett. 1990, 259, 327-330;
Svinarchuk et al., Biochimie 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett. 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res. 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan at al., Nucleosides & Nucleotides 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett. 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0042] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941.
[0043] The oligonucleotides used in accordance with this invention
may be conveniently and routinely made through the well-known
technique of solid phase synthesis. Equipment for such synthesis is
sold by several vendors including Applied Biosystems. Any other
means for such synthesis may also be employed; the actual synthesis
of the oligonucleotides is well within the talents of the
routineer. It is also well known to use similar techniques to
prepare other oligonucleotides such as the phosphorothioates and
alkylated derivatives. It is also well known to use similar
techniques and commercially available modified amidites and
controlled-pore glass (CPG) products such as biotin, fluorescein,
acridine or psoralen-modified amidites and/or CPG (available from
Glen Research, Sterling Va.) to synthesize fluorescently labeled,
biotinylated or other modified oligonucleotides such as
cholesterol-modified oligonucleotides.
[0044] It has now been found that certain oligonucleotides targeted
to portions of the c-raf mRNA are particularly useful for
inhibiting raf expression and for interfering with cell
hyperproliferation. Methods for inhibiting c-raf expression using
antisense oligonucleotides are, likewise, useful for interfering
with cell hyperproliferation. In the methods of the invention,
tissues or cells are contacted with oligonucleotides. In the
context of this invention, to "contact" tissues or cells with an
oligonucleotide or oligonucleotides means to add the
oligonucleotide(s), usually in a liquid carrier, to a cell
suspension or tissue sample, either in vitro or ex vivo, or to
administer the oligonucleotide(s) to cells or tissues within an
animal.
[0045] For therapeutics, methods of inhibiting hyperproliferation
of cells and methods of treating abnormal proliferative conditions
are provided. The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill in the
art. In general, for therapeutics, a patient suspected of needing
such therapy is given an oligonucleotide in accordance with the
invention, commonly in a pharmaceutically acceptable carrier, in
amounts and for periods which will vary depending upon the nature
of the particular disease, its severity and the patient's overall
condition. The pharmaceutical compositions of this invention may be
administered in a number of ways depending upon whether local or
systemic treatment is desired, and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal), oral, or parenteral, for example by
intravenous drip, intravenous injection or subcutaneous,
intraperitoneal, intraocular, intravitreal or intramuscular
injection.
[0046] Formulations for topical administration may include
ointments, lotions, creams, gels, drops, suppositories, sprays,
liquids and powders. Conventional pharmaceutical carriers, aqueous,
powder or oily bases, thickeners and the like may be necessary or
desirable. Coated condoms, gloves and the like may also be
useful.
[0047] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets, or tablets. Thickeners, flavorings, diluents,
emulsifiers, dispersing aids or binders may be desirable.
[0048] Formulations for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives.
[0049] In addition to such pharmaceutical carriers, cationic lipids
may be included in the formulation to facilitate oligonucleotide
uptake. One such composition shown to facilitate uptake is
Lipofectin (BRL, Bethesda Md.). Compositions for parenteral
administration may include sterile aqueous solutions which may also
contain buffers, diluents and other suitable additives. In some
cases it may be more effective to treat a patient with an
oligonucleotide of the invention in conjunction with other
traditional therapeutic modalities in order to increase the
efficacy of a treatment regimen. In the context of the invention,
the term "treatment regimen" is meant to encompass therapeutic,
palliative and prophylactic modalities. For example, a patient may
be treated with conventional chemotherapeutic agents, particularly
those used for tumor and cancer treatment. Examples of such
chemotherapeutic agents include but are not limited to
daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin,
idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide,
cytosine arabinoside, bis-chloroethylnitrosurea, busulfan,
mitomycin C, actinomycin D, mithramycin, prednisone,
hydroxyprogesterone, testosterone, tamoxifen, dacarbazine,
procarbazine, hexamethylmelamine, pentamethylmelamine,
mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea,
nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea,
deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil
(5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX),
colchicine, taxol, vincristine, vinblastine, etoposide (VP-16),
trimetrexate, teniposide, cisplatin, carboplatin, topotecan,
irinotecan, gemcitabine and diethylstilbestrol (DES). See,
generally, The Merck Manual of Diagnosis and Therapy, 15th Ed.
1987, pp. 1206-1228, Berkow et al., eds., Rahway, N.J. When used
with the compounds of the invention, such chemotherapeutic agents
may be used individually (e.g., 5-FU and oligonucleotide),
sequentially (e.g., 5-FU and oligonucleotide for a period of time
followed by MTX and oligonucleotide), or in combination with one or
more other such chemotherapeutic agents (e.g., 5-FU, MTX and
oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Other
drugs such as leucovorin, which is a form of folic acid used as a
"rescue" after high doses of methotrexate or other folic acid
agonists, may also be administered. In some embodiments, 5-FU and
leucovorin are given in combination as an IV bolus with the
compounds of the invention being provided as an IV infusion.
[0050] Dosing is dependent on severity and responsiveness of the
condition to be treated, with course of treatment lasting from
several days to several months or until a cure is effected or a
diminution of disease state is achieved. Optimal dosing schedules
can be calculated from measurements of drug accumulation in the
body. Persons of ordinary skill can easily determine optimum
dosages, dosing methodologies and repetition rates. Optimum dosages
may vary depending on the relative potency of individual
oligonucleotides, and can generally be calculated based on EC50's
in in vitro and in vivo animal studies. For example, given the
molecular weight of compound (derived from oligonucleotide sequence
and chemical structure) and an effective dose such as an IC50, for
example (derived experimentally), a dose in mg/kg is routinely
calculated.
[0051] The present invention is also suitable for diagnosing
abnormal proliferative states in tissue or other samples from
patients suspected of having a hyperproliferative disease such as
cancer, psoriasis or blood vessel restenosis or atherosclerosis.
The ability of the oligonucleotides of the present invention to
inhibit cell proliferation may be employed to diagnose such states.
A number of assays may be formulated employing the present
invention, which assays will commonly comprise contacting a tissue
sample with an oligonucleotide of the invention under conditions
selected to permit detection and, usually, quantitation of such
inhibition. Similarly, the present invention can be used to
distinguish raf-associated tumors from tumors having other
etiologies, in order that an efficacious treatment regime can be
designed.
[0052] The oligonucleotides of this invention may also be used for
research purposes. Thus, the specific hybridization exhibited by
the oligonucleotides may be used for assays, purifications,
cellular product preparations and in other methodologies which may
be appreciated by persons of ordinary skill in the art.
[0053] The oligonucleotides of the invention are also useful for
detection and diagnosis of raf expression. For example,
radiolabeled oligonucleotides can be prepared by .sup.32P labeling
at the 5' end with polynucleotide kinase. Sambrook et al.,
Molecular Cloning. A Laboratory Manual, Cold Spring Harbor
Laboratory Press, 1989, Volume 2, p. 10.59. Radiolabeled
oligonucleotides are then contacted with tissue or cell samples
suspected of raf expression and the sample is washed to remove
unbound oligonucleotide. Radioactivity remaining in the sample
indicates bound oligonucleotide (which in turn indicates the
presence of raf) and can be quantitated using a scintillation
counter or other routine means. Radiolabeled oligo can also be used
to perform autoradiography of tissues to determine the
localization, distribution and quantitation of raf expression for
research, diagnostic or therapeutic purposes. In such studies,
tissue sections are treated with radiolabeled oligonucleotide and
washed as described above, then exposed to photographic emulsion
according to routine autoradiography procedures. The emulsion, when
developed, yields an image of silver grains over the regions
expressing raf. Quantitation of the silver grains permits raf
expression to be detected.
[0054] Analogous assays for fluorescent detection of raf expression
can be developed using oligonucleotides of the invention which are
conjugated with fluorescein or other fluorescent tag instead of
radiolabeling. Such conjugations are routinely accomplished during
solid phase synthesis using fluorescently labeled amidites or CPG
(e.g., fluorescein-labeled amidites and CPG available from Glen
Research, Sterling Va. See 1993 Catalog of Products for DNA
Research, Glen Research, Sterling Va., p. 21).
[0055] Each of these assay formats is known in the art. One of
skill could easily adapt these known assays for detection of raf
expression in accordance with the teachings of the invention
providing a novel and useful means to detect raf expression.
Oligonucleotide Inhibition of c-Raf Expression
[0056] The oligonucleotides shown in Table 1 were designed using
the Genbank c-raf sequence HSRAFR (Genbank accession no. x03484;
SEQ ID NO: 64), synthesized and tested for inhibition of c-raf mRNA
expression in T24 bladder carcinoma cells using a Northern blot
assay. All are oligodeoxynucleotides with phosphorothioate
backbones.
TABLE-US-00001 TABLE 1 Human c-raf Kinase Antisense
Oligonucleotides SEQ ID Isis# Sequence (5'-3') Site NO: 5000
TGAAGGTGAGCTGGAGCCAT Coding 1 5074 GCTCCATTGATGCAGCTTAA AUG 2 5075
CCCTGTATGTGCTCCATTGA AUG 3 5076 GGTGCAAAGTCAACTAGAAG STOP 4 5097
ATTCTTAAACCTGAGGGAGC 5'UTR 5 5098 GATGCAGCTTAAACAATTCT 5'UTR 6 5131
CAGCACTGCAAATGGCTTCC 3'UTR 7 5132 TCCCGCCTGTGACATGCATT 3'UTR 8 5133
GCCGAGTGCCTTGCCTGGAA 3'UTR 9 5148 AGAGATGCAGCTGGAGCCAT Coding 10
5149 AGGTGAAGGCCTGGAGCCAT Coding 11 6721 GTCTGGCGCTGCACCACTCT 3'UTR
12 6722 CTGATTTCCAAAATCCCATG 3'UTR 13 6731 CTGGGCTGTTTGGTGCCTTA
3'UTR 14 6723 TCAGGGCTGGACTGCCTGCT 3'UTR 15 7825
GGTGAGGGAGCGGGAGGCGG 5'UTR 16 7826 CGCTCCTCCTCCCCGCGGCG 5'UTR 17
7827 TTCGGCGGCAGCTTCTCGCC 5'UTR 18 7828 GCCGCCCCAACGTCCTGTCG 5'UTR
19 7848 TCCTCCTCCCCGCGGCGGGT 5'UTR 20 7849 CTCGCCCGCTCCTCCTCCCC
5'UTR 21 7847 CTGGCTTCTCCTCCTCCCCT 3'UTR 22 8034
CGGGAGGCGGTCACATTCGG 5'UTR 23 8094 TCTGGCGCTGCACCACTCTC 3'UTR
24
[0057] In a first round screen of oligonucleotides at
concentrations of 100 nM or 200 nM, oligonucleotides 5074, 5075,
5132, 8034, 7826, 7827 and 7828 showed at least 50% inhibition of
c-raf mRNA and these oligonucleotides are therefore preferred.
Oligonucleotides 5132 and 7826 (SEQ ID NO: 8 and SEQ ID NO: 17)
showed greater than about 90% inhibition and are more preferred. In
additional assays, oligonucleotides 6721, 7848, 7847 and 8094
decreased c-raf mRNA levels by greater than 50%. These
oligonucleotides are 10'' also preferred. Of these, 7847 (SEQ ID
NO: 22) showed greater than about 90% inhibition of c-raf mRNA and
is more preferred.
Specificity of ISIS 5132 for Raf
[0058] Specificity of ISIS 5132 for raf mRNA was demonstrated by a
Northern blot assay in which this oligonucleotide was tested for
the ability to inhibit Ha-ras mRNA as well as c-raf mRNA in T24
cells. Ha-ras is a cellular oncogene which is implicated in
transformation and tumorigenesis. ISIS 5132 was shown to abolish
c-raf mRNA almost completely with no effect on Ha-ras mRNA
levels.
2'-Modified Oligonucleotides
[0059] Certain of these oligonucleotides were synthesized with
either phosphodiester (P.dbd.O) or phosphorothioate (P.dbd.S)
backbones and were also uniformly substituted at the 2' position of
the sugar with either a 2'-O-methyl, 2'-O-propyl, or 2'-fluoro
group. Oligonucleotides are shown in Table 2.
TABLE-US-00002 TABLE 2 Uniformly 2' Sugar-modified c-raf
Oligonucleotides SEQ ISIS ID # Sequence Site Modif NO. 6712
TCCCGCCTGTGACATGCATT 3'UTR OMe/P.dbd.S 8 8033 CGGGAGGCGGTCACATTCGG
5'UTR OMe/P.dbd.S 23 7829 GGTGAGGGAGCGGGAGGCGG 5'UTR OMe/P.dbd.S 16
7830 CGCTCCTCCTCCCCGCGGCG 5'UTR OMe/P.dbd.S 17 7831
TTCGGCGGCAGCTTCTCGCC 5'UTR OMe/P.dbd.S 18 7832 GCCGCCCCAACGTCCTGTCG
5'UTR OMe/P.dbd.S 19 7833 ATTCTTAAACCTGAGGGAGC 5'UTR OMe/P.dbd.S 5
7834 GATGCAGCTTAAACAATTCT 5'UTR OMe/P.dbd.S 6 7835
GCTCCATTGATGCAGCTTAA AUG OMe/P.dbd.S 2 7836 CCCTGTATGTGCTCCATTGA
AUG OMe/P.dbd.S 3 8035 CGGGAGGCGGTCACATTCGG 5'UTR OPr/P.dbd.O 23
7837 GGTGAGGGAGCGGGAGGCGG 5'UTR OPr/P.dbd.O 16 7838
CGCTCCTCCTCCCCGCGGCG 5'UTR OPr/P.dbd.O 17 7839 TTCGGCGGCAGCTTCTCGCC
5'UTR OPr/P.dbd.O 18 7840 GCCGCCCCAACGTCCTGTCG 5'UTR OPr/P.dbd.O 19
7841 ATTCTTAAACCTGAGGGAGC 5'UTR OPr/P.dbd.O 5 7842
GATGCAGCTTAAACAATTCT 5'UTR OPr/P.dbd.O 6 7843 GCTCCATTGATGCAGCTTAA
AUG OPr/P.dbd.O 2 7844 CCCTGTATGTGCTCCATTGA AUG OPr/P.dbd.O 3 9355
CGGGAGGCGGTCACATTCGG 5'UTR 2/F/P.dbd.S 23
[0060] Oligonucleotides from Table 2 having uniform 2'O-methyl
modifications and a phosphorothioate backbone were tested for
ability to inhibit c-raf protein expression in T24 cells as
determined by Western blot assay. Oligonucleotides 8033, 7834 and
7835 showed the greatest inhibition and are preferred. Of these,
8033 and 7834 are more preferred.
Chimeric Oligonucleotides
[0061] Chimeric oligonucleotides having SEQ ID NO: 8 were prepared.
These oligonucleotides had central "gap" regions of 6, 8, or 10
deoxynucleotides flanked by two regions of 2'-O-methyl modified
nucleotides. Backbones were uniformly phosphorothioate. In Northern
blot analysis, all three of these oligonucleotides (ISIS 6720,
6-deoxy gap; ISIS 6717, 8-deoxy gap; ISIS 6729, 10-deoxy gap)
showed greater than 70% inhibition of c-raf mRNA expression in T24
cells. These oligonucleotides are preferred. The 8-deoxy gap
compound (6717) showed greater than 90% inhibition and is more
preferred.
[0062] Additional chimeric oligonucleotides were synthesized having
one or more regions of 2'-O-methyl modification and uniform
phosphorothioate backbones. These are shown in Table 3. All are
phosphorothioates; bold regions indicate 2'-O-methyl modified
regions.
TABLE-US-00003 TABLE 3 Chimeric 2'-O-methyl P.dbd.S c-raf
oligonucleotides SEQ Isis Target ID # Sequence site NO: 7848
TCCTCCTCCCCGCGGCGGGT 5'UTR 20 7852 TCCTCCTCCCCGCGGCGGGT 5'UTR 20
7849 CTCGCCCGCTCCTCCTCCCC 5'UTR 21 7851 CTCGCCCGCTCCTCCTCCCC 5'UTR
21 7856 TTCTCGCCCGCTCCTCCTCC 5'UTR 25 7855 TTCTCGCCCGCTCCTCCTCC
5'UTR 25 7854 TTCTCCTCCTCCCCTGGCAG 3'UTR 26 7847
CTGGCTTCTCCTCCTCCCCT 3'UTR 22 7850 CTGGCTTCTCCTCCTCCCCT 3'UTR 22
7853 CCTGCTGGCTTCTCCTCCTC 3'UTR 27
[0063] When tested for their ability to inhibit c-raf mRNA by
Northern blot analysis, ISIS 7848, 7849, 7851, 7856, 7855, 7854,
7847, and 7853 gave better than 70% inhibition and are therefore
preferred. Of these, 7851, 7855, 7847 and 7853 gave greater than
90% inhibition and are more preferred.
[0064] Additional chimeric oligonucleotides with various 2'
modifications were prepared and tested. These are shown in Table 4.
All are phosphorothioates; bold regions indicate 2'-modified
regions.
TABLE-US-00004 TABLE 4 Chimeric 2'-modified P.dbd.S c-raf
oligonucleotides SEQ Isis Target Modifi- ID # Sequence site cation
NO: 6720 TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Me 8 6717
TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Me 8 6729 TCCCGCCTGTGACATGCATT
3'UTR 2'-O-Me 8 8097 TCTGGCGCTGCACCACTCTC 3'UTR 2'-O-Me 24 9270
TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Pro 8 9058 TCCCGCCTGTGACATGCATT
3'UTR 2'-F 8 9057 TCTGGCGCTGCACCACTCTC 3'UTR 2'-F 24
[0065] Of these, oligonucleotides 6720, 6717, 6729, 9720 and 9058
are preferred. Oligonucleotides 6717, 6729, 9720 and 9058 are more
preferred.
[0066] Two chimeric oligonucleotides with 2'-O-propyl sugar
modifications and chimeric P.dbd.O/P.dbd.S backbones were also
synthesized. These are shown in Table 5, in which italic regions
indicate regions which are both 2'-modified and have phosphodiester
backbones.
TABLE-US-00005 TABLE 5 Chimeric 2'-modified P.dbd.S/P.dbd.O c-raf
oligonucleotides SEQ Isis Target Modifi- ID # Sequence site cation
NO: 9271 TCCCGCCTGTGACATGCATT 3'UTR 2'-O-Pro 8 8096
TCTGGCGCTGCACCACTCTC 3'UTR 2'-O-Pro 24
Inhibition of Cancer Cell Proliferation
[0067] The phosphorothioate oligonucleotide ISIS 5132 was shown to
inhibit T24 bladder cancer cell proliferation. Cells were treated
with various concentrations of oligonucleotide in conjunction with
lipofectin (cationic lipid which increases uptake of
oligonucleotide). A dose-dependent inhibition of cell proliferation
was demonstrated, as indicated in Table 6, in which "None"
indicates untreated control (no oligonucleotide) and "Control"
indicates treatment with negative control oligonucleotide. Results
are shown as percent inhibition compared to untreated control.
TABLE-US-00006 TABLE 6 Inhibition of T24 Cell Proliferation by ISIS
5132 Oligo conc. None Control 5132 50 nM 0 +9% 23% 100 nM 0 +4% 24%
250 nM 0 10% 74% 500 nM 0 18% 82%
Effect of ISIS 5132 on T24 Human Bladder Carcinoma Tumors
[0068] Subcutaneous human T24 bladder carcinoma xenografts in nude
mice were established and treated with ISIS 5132 and an unrelated
control phosphorothioate oligonucleotide administered
intraperitoneally three times weekly at a dosage of 25 mg/kg. In
this preliminary study, ISIS 5132 inhibited tumor growth after
eleven days by 35% compared to controls. Oligonucleotide-treated
tumors remained smaller than control tumors throughout the course
of the study.
Antisense Oligonucleotides Targeted to a-Raf
[0069] It is believed that certain oligonucleotides targeted to
portions of the A-raf mRNA and which inhibit A-raf expression will,
be useful for interfering with cell hyperproliferation. Methods for
inhibiting A-raf expression using such antisense oligonucleotides
are, likewise, believed to be useful for interfering with cell
hyperproliferation.
[0070] The phosphorothioate deoxyoligonucleotides shown in Table 7
were designed and synthesized using the Genbank A-raf sequence
HUMARAFIR (Genbank listing x04790; SEQ ID NO: 65).
TABLE-US-00007 TABLE 7 Oligonucleotides Targeted to Human A-raf SEQ
Isis Target ID # Sequence site NO: 9060 GTC AAG ATG GGC TGA GGT GG
5' UTR 28 9061 CCA TCC CGG ACA GTC ACC AC Coding 29 9062 ATG AGC
TCC TCG CCA TCC AG Coding 30 9063 AAT GCT GGT GGA ACT TGT AG Coding
31 9064 CCG GTA CCC CAG GTT CTT CA Coding 32 9065 CTG GGC AGT CTG
CCG GGC CA Coding 33 9066 CAC CTC AGC TGC CAT CCA CA Coding 34 9067
GAG ATT TTG CTG AGG TCC GG Coding 35 9068 GCA CTC CGC TCA ATC TTG
GG Coding 36 9069 CTA AGG CAC AAG GCG GGC TG Stop 37 9070 ACG AAC
ATT GAT TGG CTG GT 3' UTR 38 9071 GTA TCC CCA AAG CCA AGA GG 3' UTR
39 10228 CAT CAG GGC AGA GAC GAA CA 3' UTR 40
Oligonucleotides ISIS 9061, ISIS 9069 and ISIS 10228 were evaluated
by Northern blot analysis for their effects on A-raf mRNA levels in
A549, T24 and NHDF cells. All three oligonucleotides decreased
A-raf RNA levels in a dose-dependent manner in all three cell
types, with inhibition of greater than 50% at a 500 nM dose in all
cell types. The greatest inhibition (88%) was achieved with ISIS
9061 and 9069 in T24 cells. These three oligonucleotides (ISIS
9061, 9069 and 10228) are preferred, with ISIS 9069 and 9061 being
more preferred. Identification of Oligonucleotides Targeted to Rat
and Mouse c-Raf
[0071] Many conditions which are believed to be mediated by raf
kinase are not amenable to study in humans. For example, tissue
graft rejection is a condition which is likely to be ameliorated by
interference with raf expression; but, clearly, this must be
evaluated in animals rather than human transplant patients. Another
such example is restenosis. These conditions can be tested in
animal models, however, such as the rat and mouse models used
here.
[0072] Oligonucleotide sequences for inhibiting c-raf expression in
rat and mouse cells were identified. Rat and mouse c-raf genes have
regions of high homology; a series of oligonucleotides which target
both rat and mouse c-raf mRNA sequence were designed and
synthesized, using information gained from evaluation of
oligonucleotides targeted to human c-raf. These oligonucleotides
were screened for activity in mouse bEND cells and rat A-10 cells
using Northern blot assays. The oligonucleotides (all
phosphorothioates) are shown in Table 8.
TABLE-US-00008 TABLE 8 Oligonucleotides targeted to mouse and rat
c-raf SEQ ISIS Target ID # site Sequence NO: 10705 Coding
GGAACATCTGGAATTTGGTC 41 10706 Coding GATTCACTGTGACTTCGAAT 42 10707
3'UTR GCTTCCATTTCCAGGGCAGG 43 10708 3'UTR AAGAAGGCAATATGAAGTTA 44
10709 3'UTR GTGGTGCCTGCTGACTCTTC 45 10710 3'UTR
CTGGTGGCCTAAGAACAGCT 46 10711 AUG GTATGTGCTCCATTGATGCA 47 10712 AUG
TCCCTGTATGTGCTCCATTG 48 11060 5'UTR ATACTTATACCTGAGGGAGC 49 11061
5'UTR ATGCATTCTGCCCCCAAGGA 50 11062 3'UTR GACTTGTATACCTCTGGAGC 51
11063 3'UTR ACTGGCACTGCACCACTGTC 52 11064 3'UTR
AAGTTCTGTAGTACCAAAGC 53 11065 3'UTR CTCCTGGAAGACAGATTCAG 54
Oligonucleotides ISIS 11061 and 10707 were found to inhibit c-raf
RNA levels by greater than 90% in mouse bEND cells at a dose of 400
nM. These two oligonucleotides inhibited raf RNA levels virtually
entirely in rat A-10 cells at a concentration of 200 nM. The IC50
for ISIS 10707 was found to be 170 nM in mouse bEND cells and 85 nM
in rat A-10 cells. The IC50 for ISIS 11061 was determined to be 85
nM in mouse bEND cells and 30 nM in rat A-10 cells. Effect of
ISIS-11061 on Endogenous c-Raf mRNA Expression in Mice
[0073] Mice were injected intraperitoneally with ISIS 11061 (50
mg/kg) or control oligonucleotide or saline control once daily for
three days. Animals were sacrificed and organs were analyzed for
c-raf mRNA expression by Northern blot analysis. ISIS 11061 was
found to decrease levels of c-raf mRNA in liver by approximately
70%. Control oligonucleotides had no effects on c-raf expression.
The effect of ISIS 11061 was specific for c-raf; A-raf and G3PDH
RNA levels were unaffected by oligonucleotide treatment.
Antisense Oligonucleotide to c-Raf Increases Survival in Murine
Heart Allograft Model
[0074] To determine the therapeutic effects of the c-raf antisense
oligonucleotide ISIS 11061 in preventing allograft rejection, this
oligonucleotide was tested for activity in a murine vascularized
heterotopic heart transplant model. Hearts from C57BI10 mice were
transplanted into the abdominal cavity of C3H mice as primary
vascularized grafts essentially as described by Isobe et al.,
Circulation 1991, 84, 1246-1255. Oligonucleotides were administered
by continuous intravenous administration via a 7-day Alzet pump.
The mean allograft survival time for untreated mice was
7.83.+-.0.75 days (7, 7, 8, 8, 8, 9 days). Allografts in mice
treated for 7 days with 20 mg/kg or 40 mg/kg ISIS 11061 all
survived at least 11 days (11, 11, 12 days for 20 mg/kg dose and
>11, >11, >11 days for the 40 mg/kg dose).
[0075] In a pilot study conducted in rats, hearts from Lewis rats
were transplanted into the abdominal cavity of ACI rats. Rats were
dosed with ISIS 11061 at 20 mg/kg for 7 days via Alzet pump. The
mean allograft survival time for untreated rats was 8.86.+-.0.69
days (8, 8, 9, 9, 9, 9, 10 days). In rats treated with
oligonucleotide, the allograft survival time was 15.3.+-.1.15 days
(14, 16, 16 days).
Effects of Antisense Oligonucleotide Targeted to c-Raf on Smooth
Muscle Cell Proliferation
[0076] Smooth muscle cell proliferation is a cause of blood vessel
stenosis, for example in atherosclerosis and restenosis after
angioplasty. Experiments were performed to determine the effect of
ISIS 11061 on proliferation of A-10 rat smooth muscle cells. Cells
in culture were grown with and without ISIS 11061 (plus lipofectin)
and cell proliferation was measured 24 and 48 hours after
stimulation with fetal calf serum. ISIS 11061 (500 nM) was found to
inhibit serum-stimulated cell growth in a dose-dependent manner
with a maximal inhibition of 46% and 75% at 24 hours and 48 hours,
respectively. An IC50 value of 200 nM was obtained for this
compound. An unrelated control oligonucleotide had no effect at
doses up to 500 nM.
Effects of Antisense Oligonucleotides Targeted to c-Raf on
Restenosis in Rats
[0077] A rat carotid artery injury model of angioplasty restenosis
has been developed and has been used to evaluate the effects on
restenosis of antisense oligonucleotides targeted to the c-myc
oncogene. Bennett et al., J. Clin. Invest. 1994, 93, 820-828. This
model will be used to evaluate the effects of antisense
oligonucleotides targeted to rat c-raf, particularly ISIS 11061, on
restenosis. Following carotid artery injury with a balloon
catheter, oligonucleotides are administered either by intravenous
injection, continuous intravenous administration via Alzet pump, or
direct administration to the carotid artery in a pluronic gel
matrix as described by Bennett et al. After recovery, rats are
sacrificed, carotid arteries are examined by microscopy and effects
of treatment on luminal cross-sections are determined.
Effects of ISIS 5132 (Antisense Oligodeoxynucleotide Targeted To
Human c-Raf on Tumor Growth in Human Patients
[0078] Two clinical trials were undertaken to test ISIS 5132 on a
variety of human tumors. In one study the compound was administered
by intravenous infusion over 2 hours. In the other trial the drug
was administered by intravenous infusion over 21 days using a
continuous pump.
Two patients, both of whom had demonstrated tumor progression with
previous cytotoxic chemotherapy, exhibited long-term stable disease
in response to ISIS 5132 treatment in the 2-hour infusion study (29
patients evaluated). In these responding patients levels of c-raf
expression in peripheral blood cells paralleled clinical response.
Six patients showed stabilization of disease of two months or
greater in response to ISIS 5132 treatment in the 21-day continuous
infusion study (34 patients evaluated). These results are discussed
hereinbelow in Examples 13-15.
[0079] The invention is further illustrated by the following
examples which are illustrations only and are not intended to limit
the present invention to specific embodiments.
EXAMPLES
Example 1
Synthesis and Characterization of Oligonucleotides
[0080] Unmodified DNA oligonucleotides were synthesized on an
automated DNA synthesizer (Applied Biosystems model 380B) using
standard phosphoramidite chemistry with oxidation by iodine.
.beta.-cyanoethyldiisopropyl phosphoramidites were purchased from
Applied Biosystems (Foster City, Calif.). For phosphorothioate
oligonucleotides, the standard oxidation bottle was replaced by a
0.2 M solution of H-1,2-benzodithiole-3-one 1,1-dioxide in
acetonitrile for the stepwise thiation of the phosphite linkages.
The thiation cycle wait step was increased to 68 seconds and was
followed by the capping step. 2'-O-methyl phosphorothioate
oligonucleotides were synthesized using 2'-O-methyl
.beta.-cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham
Mass.) and the standard cycle for unmodified oligonucleotides,
except the wait step after pulse delivery of tetrazole and base was
increased to 360 seconds. The 3'-base used to start the synthesis
was a 2'-deoxyribonucleotide. 2'-O-propyl oligonucleotides were
prepared by a slight modification of this procedure.
[0081] 2'-fluoro phosphorothioate oligonucleotides were synthesized
using 5'-dimethoxytrityl-3'-phosphoramidites and prepared as
disclosed in U.S. patent application Ser. No. 463,358, filed Jan.
11, 1990, and 566,977, filed Aug. 13, 1990, which are assigned to
the same assignee as the instant application and which are
incorporated by reference herein. The 2'-fluoro oligonucleotides
were prepared using phosphoramidite chemistry and a slight
modification of the standard DNA synthesis protocol: deprotection
was effected using methanolic ammonia at room temperature.
[0082] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides were
purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes
ethanol. Analytical gel electrophoresis was accomplished in 20%
acrylamide, 8 M urea, 45 mM Tris-borate buffer, pH 7.0.
Oligodeoxynucleotides and their phosphorothioate analogs were
judged from electrophoresis to be greater than 80% full length
material.
Example 2
Northern Blot Analysis of Inhibition of c-Raf mRNA Expression
[0083] The human urinary bladder cancer cell line T24 was obtained
from the American Type Culture Collection (Rockville Md.). Cells
were grown in McCoy's 5A medium with L-glutamine (Gibco BR1.,
Gaithersburg Md.), supplemented with 10% heat-inactivated fetal
calf serum and 50 U/ml each of penicillin and streptomycin. Cells
were seeded on 100 mm plates. When they reached 70% confluency,
they were treated with oligonucleotide. Plates were washed with 10
ml prewarmed PBS and 5 ml of Opti-MEM reduced-serum medium
containing 2.5 .mu.l DOTMA. Oligonucleotide with lipofectin was
then added to the desired concentration. After 4 hours of
treatment, the medium was replaced with McCoy's medium. Cells were
harvested 24 to 72 hours after oligonucleotide treatment and RNA
was isolated using a standard CsCl purification method. Kingston,
R. E., in Current Protocols in Molecular Biology, (F. M. Ausubel,
R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman
and K. Strahl, eds.), John Wiley and Sons, NY. Total RNA was
isolated by centrifugation of cell lysates over a CsCl cushion. RNA
samples were electrophoresed through 1.2% agarose-formaldehyde gels
and transferred to hybridization membranes by capillary diffusion
over a 12-14 hour period. The RNA was cross-linked to the membrane
by exposure to UV light in a Stratalinker (Stratagene, La Jolla,
Calif.) and hybridized to random-primed .sup.32P-labeled c-raf cDNA
probe (obtained from ATCC) or G3PDH probe as a control. RNA was
quantitated using a Phosphorimager (Molecular Dynamics, Sunnyvale,
Calif.).
Example 3
Specific Inhibition of c-Raf Kinase Protein Expression in T24
Cells
[0084] T24 cells were treated with oligonucleotide (200 nM) and
lipofectin at T=0 and T=24 hours. Protein extracts were prepared at
T=48 hours, electrophoresed on acrylamide gels and analyzed by
Western blot using polyclonal antibodies against c-raf (UBI, Lake
Placid, N.Y.) or A-raf (Transduction Laboratories, Knoxyille,
Tenn.). Radiolabeled secondary antibodies were used and raf protein
was quantitated using a Phosphorimager (Molecular Dynamics,
Sunnyvale Calif.).
Example 4
Antisense Inhibition of Cell Proliferation
[0085] T24 cells were treated on day 0 for two hours with various
concentrations of oligonucleotide and lipofectin (50 nM
oligonucleotide in the presence of 2 .mu.g/ml lipofectin; 100 nM
oligonucleotide and 2 .mu.g/ml lipofectin; 250 nM oligonucleotide
and 6 .mu.g/ml lipofectin or 500 nM oligonucleotide and 10 .mu.g/ml
lipofectin). On day 1, cells were treated for a second time at
desired oligonucleotide concentration for two hours. On day 2,
cells were counted.
Example 5
Effect of ISIS 5132 on T24 Human Bladder Carcinoma Tumor Xenografts
in Nude Mice
[0086] 5.times.10.sup.6 T24 cells were implanted subcutaneously in
the right inner thigh of nude mice. Oligonucleotides (ISIS 5132 and
an unrelated control phosphorothioate oligonucleotide suspended in
saline) were administered three times weekly beginning on day 4
after tumor cell inoculation. A saline-only control was also given.
Oligonucleotides were given by intraperitoneal injection.
Oligonucleotide dosage was 25 mg/kg. Tumor size was measured and
tumor volume was calculated on the eleventh, fifteenth and
eighteenth treatment days.
Example 6
Diagnostic Assay for Raf-Associated Tumors Using Xenografts in Nude
Mice
[0087] Tumors arising from raf expression are diagnosed and
distinguished from other tumors using this assay. A biopsy sample
of the tumor is treated, e.g., with collagenase or trypsin or other
standard methods, to dissociate the tumor mass. 5.times.10.sup.6
tumor cells are implanted subcutaneously in the inner thighs of two
or more nude mice. Antisense oligonucleotide (e.g., ISIS 5132)
suspended in saline is administered to one or more mice by
intraperitoneal injection three times weekly beginning on day 4
after tumor cell inoculation. Saline only is given to a control
mouse. Oligonucleotide dosage is 25 mg/kg. Tumor size is measured
and tumor volume is calculated on the eleventh treatment day. Tumor
volume of the oligonucleotide-treated mice is compared to that of
the control mouse. The volume of raf-associated tumors in the
treated mice are measurably smaller than tumors in the control
mouse. Tumors arising from causes other than raf expression are not
expected to respond to the oligonucleotides targeted to raf and,
therefore, the tumor volumes of oligonucleotide-treated and control
mice are equivalent.
Example 7
Detection of Raf Expression
[0088] Oligonucleotides are radiolabeled after synthesis by
.sup.32P labeling at the 5' end with polynucleotide kinase.
Sambrook et al., Molecular Cloning. A Laboratory Manual, Cold
Spring Harbor Laboratory Press, 1989, Volume 2, pg. 11.31-11.32.
Radiolabeled oligonucleotides are contacted with tissue or cell
samples suspected of raf expression, such as tumor biopsy samples
or skin samples where psoriasis is suspected, under conditions in
which specific hybridization can occur, and the sample is washed to
remove unbound oligonucleotide. Radioactivity remaining in the
sample indicates bound oligonucleotide and is quantitated using a
scintillation counter or other routine means.
[0089] Radiolabeled oligonucleotides of the invention are also used
in autoradiography. Tissue sections are treated with radiolabeled
oligonucleotide and washed as described above, then exposed to
photographic emulsion according to standard autoradiography
procedures. The emulsion, when developed, yields an image of silver
grains over the regions expressing raf. The extent of raf
expression is determined by quantitation of the silver grains.
[0090] Analogous assays for fluorescent detection of raf expression
use oligonucleotides of the invention which are labeled with
fluorescein or other fluorescent tags. Labeled DNA oligonucleotides
are synthesized on an automated DNA synthesizer (Applied Biosystems
model 380B) using standard phosphoramidite chemistry with oxidation
by iodine. Th-cyanoethyldiisopropyl phosphoramidites are purchased
from Applied Biosystems (Foster City, Calif.). Fluorescein-labeled
amidites are purchased from Glen Research (Sterling Va.).
Incubation of oligonucleotide and biological sample is carried out
as described for radiolabeled oligonucleotides except that instead
of a scintillation counter, a fluorimeter or fluorescence
microscope is used to detect the fluorescence which indicates raf
expression.
Example 8
Effect of Oligonucleotide on Endogenous c-Raf Expression
[0091] Mice were treated by intraperitoneal injection at an
oligonucleotide dose of 50 mg/kg on days 1, 2 and 3. On day 4
animals were sacrificed and organs removed for c-raf mRNA assay by
Northern blot analysis. Four groups of animals were employed: 1) no
oligonucleotide treatment (saline); 2) negative control
oligonucleotide ISIS 1082 (targeted to herpes simplex virus; 3)
negative control oligonucleotide 4189 (targeted to mouse protein
kinase C-.alpha.; 4) ISIS 11061 targeted to rodent c-raf.
Example 9
Cardiac Allograft Rejection Model
[0092] Hearts were transplanted into the abdominal cavity of rats
or mice (of a different strain from the donor) as primary
vascularized grafts essentially as described by Isobe et al.,
Circulation 1991, 84, 1246-1255. Oligonucleotides were administered
by continuous intravenous administration via a 7-day Alzet pump.
Cardiac allograft survival was monitored by listening for the
presence of a second heartbeat in the abdominal cavity.
Example 10
Proliferation Assay Using Rat A-10 Smooth Muscle Cells
[0093] A10 cells were plated into 96-well plates in Dulbecco's
modified Eagle medium (DMEM)+10% fetal calf serum and allowed to
attach for 24 hours. Cells were made quiescent by the addition of
DMEM+0.2% dialyzed fetal calf serum for an additional 24 hours.
During the last 4 hours of quiescence, cells were treated with ISIS
11061+lipofectin (Gibco-BRL, Bethesda Md.) in serum-free medium.
Medium was then removed, replaced with fresh medium and the cells
were stimulated with 10% fetal calf serum. The plates were the
placed into the incubator and cell growth was evaluated by MTS
conversion to formozan (Promega cell proliferation kit) at 24 and
48 hours after serum stimulation. A control oligonucleotide, ISIS
1082 (an unrelated oligonucleotide targeted to herpes simplex
virus), was also tested.
Example 11
Rat Carotid Artery Restenosis Model
[0094] This model has been described by Bennett et al., J. Clin.
Invest. 1994, 93, 820-828. Intimal hyperplasia is induced by
balloon catheter dilatation of the carotid artery of the rat. Rats
are anesthetized and common carotid artery injury is induced by
passage of a balloon embolectomy catheter distended with 20 ml of
saline. Oligonucleotides are applied to the adventitial surface of
the arterial wall in a pluronic gel solution. Oligonucleotides are
dissolved in a 0.25% pluronic gel solution at 4.degree. C. (F127,
BASF Corp.) at the desired dose. 100 .mu.l of the gel solution is
applied to the distal third of the common carotid artery
immediately after injury. Control rats are treated similarly with
gel containing control oligonucleotide or no oligonucleotide. The
neck wounds are closed and the animals allowed to recover. 14 days
later, rats are sacrificed, exsanguinated and the carotid arteries
fixed in situ by perfusion with paraformaldehyde and
glutaraldehyde, excised and processed for microscopy.
Cross-sections of the arteries are calculated.
[0095] In an alternative to the pluronic gel administration
procedure, rats are treated by intravenous injection or continuous
intravenous infusion (via Alzet pump) of oligonucleotide.
Example 12
Additional Oligonucleotides Targeted to Human c-Raf Kinase
[0096] The oligonucleotides shown in Table 9 were designed using
the Genbank c-raf sequence HSRAFR (Genbank accession no. x03484;
SEQ ID NO: 64), synthesized and tested for inhibition of c-raf mRNA
expression as described in Examples 1 and 2. All are
oligodeoxynucleotides with phosphorothioate backbones and all are
targeted to the 3' UTR of human c-raf.
TABLE-US-00009 TABLE 9 Human c-raf Kinase Antisense
Oligonucleotides Isis SEQ ID # Sequence (5'-3') NO 11459
TTGAGCATGGGGAATGTGGG 55 11457 AACATCAACATCCACTTGCG 56 11455
TGTAGCCAACAGCTGGGGCT 57 11453 CTGAGAGGGCTGAGATGCGG 58 11451
GCTCCTGGAAGACAAAATTC 59 11449 TGTGACTAGAGAAACAAGGC 60 11447
CAAGAAAACCTGTATTCCTG 61 11445 TTGTCAGGTGCAATAAAAAC 62 11443
TTAAAATAACATAATTGAGG 63
Of these, ISIS 11459 and 11449 gave 38% and 31% inhibition of c-raf
mRNA levels in this assay and are, therefore, preferred. ISIS
11451, 11445 and 11443 gave 18%, 11% and 7% inhibition of c-raf
expression, respectively.
Example 13
Effect of Antisense Oligonucleotide Targeted to c-Raf on Patients
with Cancer-2 Hour Infusion
[0097] Twenty-nine fully evaluable patients with a range of cancer
types received ISIS 5132 as a two-hour infusion three times weekly
for three weeks. Following a one-week treatment-free interval,
treatment was resumed, and maintained as long as the patient
remained free of tumor progression or significant toxicity. Doses
were escalated from 0.5 to 6.0 mg/kg in cohorts of three patients.
The drug was well-tolerated and no patient required dose
reduction.
[0098] Patients with refractory malignancies received ISIS 5132 at
2-hour intravenous infusion three times weekly for 3 consecutive
weeks at one of nine dose levels ranging from 0.5 mg/kg to 6.0
mg/kg. Eligibility required adequate bone marrow function
(neutrophils.gtoreq.1,5000/mm.sup.3, hemoglobin.gtoreq.9.0 g/dL,
and platelets.gtoreq.1000,000/mm.sup.3), serum creatine<2.0
mg/dL, total bilirubin<2.0 mg/dL, aspartate
aminotransferase<2 times upper normal limit (<5 times upper
normal limit in the presence of liver metastases), and no
prolongation of the prothrombin time (PT) or activated partial
thromboplastin time (aPTT). Blood counts and biochemical profiles
were performed twice weekly during the first week and once a week
thereafter. ISIS 5132 was supplied as a sterile solution in vials
containing 1.1 mL or 10.5 mL of phosphate-buffered saline at a
concentration of 10 mg/mL. Prior to administration, ISIS 5132 was
diluted in normal saline to a total volume of 50 mL and the infused
intravenously over two hours. Following a one-week treatment-free
interval, dosing was resumed and maintained as long as the patient
remained free of tumor progression or significant toxicity.
Example 14
Reduction of c-Raf Expression in Peripheral Blood Mononuclear Cells
of Cancer Patients after Treatment with Antisense
Oligonucleotide
[0099] Peripheral-blood mononuclear cells (PBMCs) for c-raf mRNA
analysis were collected at baseline and on days 3, 5, 8, and 15 of
cycle 1 and on day 1 of each cycle thereafter. PBMCs were isolated
by Ficoll-Hypaque density centrifugation and stored at -70.degree.
C. Total RNA was isolated using Trizol reagent (Gibco BRL,
Rockville, Md.) according to the manufacturer's directions. Because
of the low abundance of the c-raf message in PBMCs, mRNA
quantitation was performed using a reverse-transcriptase polymerase
chain reaction (RT-PCR) assay. 100 ng total RNA was used for each
cDNA reaction. C-raf expression was normalized to that of the
endogenous standard .beta.-actin by calculating the ration of the
radiolabeled PCR products. PCR reactions (25 .mu.l total volume,
containing 0.1-10 .mu.l cDNA, 12.5 pmol of each of the c-raf or
.beta.-actin primers, and 1 .mu.Ci .alpha.-.sup.32P dCTP) were
heated to 95.degree. C. for 5 minutes then amplified for 28-36
cycles at 95.degree. C. for 1 minute, 55.degree. C. for 1 minute
and 72.degree. C. for 2 minutes. The products were loaded on 8%
urea polyacrylamide gels which were then dried at 80.degree. C. for
1 hour under vacuum and exposed to film for several hours at
-80.degree. C. Reductions in c-raf expression were identified in 13
of 14 patients within 48 hours of initial ISIS 5132 dosing. The
median reduction was to 42% (mean 53%) of initial values (p=0.002).
Compared to baseline values, median reduction in expression on day
5 was 26% (mean 71%; p=0.017), on day 8 32% (mean 81%; p=0.03), and
on day 15 35% (mean 74%; p=0.017).
Clinical Responses in Cancer Patients--2 Hr Infusion:
[0100] Two patients, both of whom had demonstrated tumor
progression with previous cytotoxic chemotherapy, exhibited
long-term stable disease in response to ISIS 5132 treatment. One
was a 68-year old man with colorectal cancer metastatic to liver
who had progressed two years after adjuvant therapy with
5-fluorouracil/leucovorin, and had evinced further tumor growth
during therapy with a 17-1A monoclonal antibody and irinotecan.
Following treatment with 3 mg/kg of ISIS 5132, minor (20%)
shrinkage in a liver metastasis was accompanied by a progressive
decline in choreoembryonic antigen (CEA, a marker for colon cancer)
from 895 ng/mL to 618 ng/mL. During this time, c-raf mRNA values
declined to below 10% of the initial value. After seven cycles of
treatment, both the plasma CEA values and the PBMC c-raf mRNA began
to increase, and one month later a CT scan revealed progression of
the hepatic metastases.
[0101] A 46-year old woman with renal cell cancer metastatic to
lung and lymph nodes failed to respond to interleukin-2,
.alpha.-interferon and 5-fluorouracil in combination, and began
treatment with ISIS 5132 at 5 mg/kg. She had immediate symptomatic
improvement, but the size of the tumor was unchanged on CT scans.
After ten cycles of treatment, she began to have recurrent pain,
and progression was identified radiologically. In this patient the
nadir PBMC c-raf mRNA was 9%, and values remained low until the
beginning of the ninth cycle, when a return above baseline was
observed, again followed shortly thereafter by progressive
disease.
Example 15
Effect of Antisense Oligonucleotide Targeted to c-Raf on Patients
with Cancer--21 Day Continuous Infusion
[0102] A continuous intravenous infusion of ISIS 5132 was
administered for 21 days every 4 weeks to 34 patients with a
variety of solid tumors refractory to standard therapy. The dose of
ISIS 5132 was increased in sequential cohorts of patients, as
toxicity allowed, until a final dose of 5.0 mg/kg of body weight
was reached.
[0103] Eligible patients had histologically-documented solid
malignancies of measurable or evaluable status refractory to
standard therapy or for whom no effective therapy existed. Patients
were prescreened in regard to their medical history as described
above with the addition of the measurement of complement split
products prior to the first infusion of ISIS 5132, 4 and 24 hours
after starting the infusion and, repeated on days 7, 14 and 21.
Patients received sequential, ascending, multiple doses of ISIS
5132 administered as a continuous IV infusion for 21 consecutive
days at a pump rate of 1.5 mL/hour followed by one week of rest
(one cycle). The initial dose of ISIS 5231 was 0.5 mg/kg of body
weight. Subsequent doses were 1.0, 1.5, 2.0, 3.0, 4.0, and 5.0
mg/kg. The total dose was added to 250 mL of normal saline and
infused as described above.
Clinical Responses in Cancer Patients-22-Day Infusion:
[0104] Six patients showed stabilization of disease of two months
or greater. Of these two patients had prolonged stabilization: one
patient (treated at 1.5 mg/kg/day) with renal cell carcinoma
remained stable for 9 months, and the other (treated at 4.0
mg/kg/day) with pancreatic cancer remained stable for 10 months.
The most significant response occurred in a 57-year old female with
ovarian cancer, treated at 3.0 mg/kg/day. Her CA-125 level (a
marker for ovarian cancer) at the time of initial surgical
resection was 3300 u/mL. Following resection and a brief course of
taxol and platinum, her CA-125 level was reportedly normal, but
began to markedly increase again within 8 months. She was then
treated with a succession of systemic therapies, most of which
achieved only a short term, modest decrease in CA-125 levels. At
the time of initiation of ISIS 5132 infusions, her CA-125 level was
1490 u/mL. She was treated with 10 cycles of ISIS 5132 and achieved
a 97% reduction in tumor marker levels.
Example 16
[0105] Effect of antisense oligonucleotide targeted to c-raf (21
day infusion) in combination with other chemotherapeutic agents in
cancer patients
[0106] Fourteen patients with refractory cancers were given ISIS
5132 at doses of 1.0-3.0 mg/kg/day as a 21 day IV infusion in
combination with 5-fluorouracil (425 mg/m.sup.2) and Leucovorin (20
mg/m.sup.2) as an IV bolus given on days 1-5 every 4 weeks. In this
ongoing study, 8 patients have been treated at the 2.0 mg/kg/day
dose level. Toxicities that occurred were not dose-limiting.
Disease stabilization lasting at least 4 cycles occurred in 4
patients (2 renal cell, 1 colon, 1 pancreatic). Thus ISIS 5132 at a
dose of 2 mg/kg/day is active and well tolerated in combination
with 5-FU/LV on this schedule.
Example 17
Effect of Antisense Oligonucleotide Targeted to c-Raf in Pig Branch
Retinal Vein Occlusion Model of Ocular Neovascularization
[0107] Angiogenesis, or neovascularization, is the formation of new
capillaries from existing blood vessels. In adult organisms this
process is typically controlled and short-lived, for example in
wound repair and regeneration. Gaiso, M. L., 1999, Medscape
Oncology 2(1), Medscape Inc. However, aberrant capillary growth can
occur and this uncontrolled growth plays a causal and/or supportive
role in many pathologic conditions such as tumor growth and
metastasis. In the context of this invention "aberrant
angiogenesis" refers to unwanted or uncontrolled angiogenesis.
Angiogenesis inhibitors are being evaluated for use as antitumor
drugs. Other diseases and conditions associated with angiogenesis
include arthritis, cardiovascular diseases, skin conditions, and
aberrant wound healing. Aberrant angiogenesis can also occur in the
eye, causing loss of vision. Examples of ocular conditions
involving aberrant angiogenesis include macular degeneration,
diabetic retinopathy and retinopathy of prematurity. A pig model of
ocular neovascularization, the branch retinal vein occlusion (BVO)
model, is used to study ocular neovascularization. An antisense
oligonucleotide targeted to pig c-raf, ISIS 107189
(CCACACCACTCATCTCATCT; SEQ ID NO: 66) was tested in this model.
[0108] Male farm pigs (8-10 kg) were subjected to branch retinal
vein occlusions (BVO) by laser treatment in both eyes. The extent
of BVO was determined by indirect opthalmoscopy after a 2 week
period. Intravitreous injections (10 .mu.M) of ISIS 107189 were
started on the day of BVO induction and were repeated at weeks 2,
6, and 10 after BVO (Right eye--vehicle, Left eye--antisense
molecule). Stereo fundus photography and fluorescein angiography
were performed at baseline BVO and at weeks 1, 6 and 12 following
intravitreous injections. In addition capillary gel electrophoresis
analysis of the eye sections containing sclera, choroid, and the
retina were performed to determine antisense concentrations, and
gross and microscopic evaluations were performed to determine eye
histopathology.
[0109] The antisense oligonucleotide targeted to c-raf
significantly inhibited the neovascularization response compared to
vehicle-only injections (p=0.05).
Example 18
Oligonucleotide Inhibition of B-Raf Expression
[0110] The oligonucleotides shown in Table 10 were designed using
the Genbank B-raf sequence HUMBRAF (Genbank listings M95712;
M95720; x54072), provided herein as SEQ ID NO: 67, synthesized and
tested for inhibition of B-raf mRNA expression in T24 bladder
carcinoma cells or A549 lung carcinoma cells using a Northern blot
assay.
[0111] The human urinary bladder cancer cell line T24 and the human
lung tumor cell line A549 were obtained from the American Type
Culture Collection (Rockville Md.). T24 cells were grown in McCoy's
5A medium with L-glutamine and A549 cells were grown in DMEM low
glucose medium (Gibco BRL, Gaithersburg Md.), supplemented with 10%
heat-inactivated fetal calf serum and 50 U/ml each of penicillin
and streptomycin. Cells were seeded on 100 mm plates. When they
reached 70% confluency, they were treated with oligonucleotide.
Plates were washed with 10 ml prewarmed PBS and 5 ml of Opti-MEM
reduced-serum medium containing 2.5 .mu.l DOTMA per 100 nM
oligonucleotide. Oligonucleotide with lipofectin was then added to
the desired concentration. After 4 hours of treatment, the medium
was replaced with appropriate medium (McCoy's or DMEM low glucose).
Cells were harvested 24 to 72 hours after oligonucleotide treatment
and RNA was isolated using a standard CsCl purification method.
Kingston, R. E., in Current Protocols in Molecular Biology. (F. M.
Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G.
Seidman and K. Strahl, eds.), John Wiley and Sons, NY. Total RNA
was isolated by centrifugation of cell lysates over a CsCl cushion.
RNA samples were electrophoresed through 1.2% agarose-formaldehyde
gels and transferred to hybridization membranes by capillary
diffusion over a 12-14 hour period. The RNA was cross-linked to the
membrane by exposure to UV light in a Stratalinker (Stratagene, La
Jolla, Calif.) and hybridized to a .sup.32P-labeled B-raf cDNA
probe or G3PDH probe as a control. The human B-raf cDNA probe was
cloned by PCR using complementary oligonucleotide primers after
reverse transcription of total RNA. Identity of the B-raf cDNA was
confirmed by restriction digestion and direct DNA sequencing. NA
was quantitated using a Phosphorimager (Molecular Dynamics,
Sunnyvale, Calif.).
TABLE-US-00010 TABLE 10 Human B-raf Kinase Antisense
Oligonucleotides (All are phos- phorothioate oligodeoxynucleotides)
SEQ Isis ID # Sequence (5'-3') Site NO: 13720 ATTTTGAAGGAGACGGACTG
coding 68 13721 TGGATTTTGAAGGAGACGGA coding 69 13722
CGTTAGTTAGTGAGCCAGGT coding 70 13723 ATTTCTGTAAGGCTTTCACG coding 71
13724 CCCGTCTACCAAGTGTTTTC coding 72 13725 AATCTCCCAATCATCACTCG
coding 73 13726 TGCTGAGGTGTAGGTGCTGT coding 74 13727
TGTAACTGCTGAGGTGTAGG coding 75 13728 TGTCGTGTTTTCCTGAGTAC coding 76
13729 AGTTGTGGCTTTGTGGAATA coding 77 13730 ATGGAGATGGTGATACAAGC
coding 78 13731 GGATGATTGACTTGGCGTGT coding 79 13732
AGGTCTCTGTGGATGATTGA coding 80 13733 ATTCTGATGACTTCTGGTGC coding 81
13734 GCTGTATGGATTTTTATCTT coding 82 13735 TACAGAACAATCCCAAATGC
coding 83 13736 ATCCTCGTCCCACCATAAAA coding 84 13737
CTCTCATCTCTTTTCTTTTT coding 85 13738 GTCTCTCATCTCTTTTCTTT coding 86
13739 CCGATTCAAGGAGGGTTCTG coding 87 13740 TGGATGGGTGTTTTTGGAGA
coding 88 13741 CTGCCTGGATGGGTGTTTTT coding 89 14144
GGACAGGAAACGCACCATAT coding 90 14143 CTCATTTGTTTCAGTGGACA stop
codon 91 14142 TCTCTCACTCATTTGTTTCA stop codon 92 14141
ACTCTCTCACTCATTTGTTT stop codon 93 14140 GAACTCTCTCACTCATTTGT
coding 94 14139 TCCTGAACTCTCTCACTCAT coding 95 14138
TTGCTACTCTCCTGAACTCT coding 96 14137 TTTGTTGCTACTCTCCTGAG coding 97
14136 CTTTTGTTGCTACTCTCCTG coding 98 13742 GCTACTCTCCTGAACTCTCT
coding 99 14135 TTCCTTTTGTTGCTACTCTC coding 100 14134
ATTTATTTTCCTTTTGTTGC coding 101 14133 ATATGTTCATTTATTTTCCT coding
102 13743 TTTATTTTCCTTTTGTTGCT coding 103 13744
TGTTCATTTATTTTCCTTTT coding 104 14132 ATTTAACATATAAGCAAACA coding
105 14529 CTGCCTGGTACCCTGTTTTT 5 mismatch 106 14530
CTGCCTGGAAGGGTGTTTTT 1 mismatch 107 14531 CTGCCTGGTACGGTGTTTTT 3
mismatch 108
[0112] There are multiple B-raf transcripts. The two most prevalent
transcripts were quantitated after oligonucleotide treatment. These
transcripts run at approximately 8.5 kb (upper transcript) and 4.7
kb (lower transcript) under the gel conditions used. Both
transcripts are translated into B-raf protein in cells. In the
initial screen, A549 cells were treated with oligonucleotides at a
concentration of 200 nM oligonucleotide for four hours in the
presence of lipofectin. Results were normalized and expressed as a
percent of control. In this initial screen, oligonucleotides giving
a reduction of either B-raf mRNA transcript of approximately 30% or
greater were considered active. According to this criterion,
oligonucleotides 13722, 13724, 13726, 13727, 13728, 13730, 13732,
13733, 13736, 13739, 13740, 13741, 13742, 13743, 14135, 14136,
14138 and 14144 were found to be active. These sequences are
therefore preferred. Of these, oligonucleotides 13727, 13730,
13740, 13741, 13743 and 14144 showed 40-50% inhibition of one or
both B-raf transcripts in at least one assay. These sequences are
therefore more preferred. In one of the two assays, ISIS 14144 (SEQ
ID NO: 23) reduced levels of both transcripts by 50-60% and ISIS
13741 (SEQ ID NO: 22) reduced both transcripts by 65-70%. These two
sequences are therefore highly preferred.
[0113] Dose response experiments were done in both T24 cells and
A549 cells for the two most active oligonucleotides, ISIS 13741 and
ISIS 14144 (SEQ ID NO: 89 and 90), along with mismatch control
sequences having 1, 3 or 5 mismatches of the ISIS 13741 sequence.
ISIS 13741 and 14144 had almost identical activity in this assay
when the upper B-raf transcript was measured, with IC50s between
250 and 300 nM. The mismatch controls had no activity (ISIS 14531)
or slight activity, with a maximum inhibition of less than 20% at
the 400 nM dose (ISIS 14530, ISIS 14529). Against the lower B-raf
transcript, ISIS 13741 and ISIS 14144 had IC50s of approximately
350 and 275 nM, respectively in this assay, with the mismatch
controls never achieving 50% inhibition at concentrations up to 400
nM. Therefore, ISIS 13741 and 14144 are preferred.
[0114] Reduction of B-raf mRNA levels was measured in T24 cells by
these oligonucleotides (all are phosphorothioate
oligodeoxynucleotides) after a 4-hour treatment in the presence of
lipofectin. Results are normalized to G3PDH and expressed as a
percent of control. Against the upper transcript, ISIS 13741 and
14144 were again most active, with IC50s of approximately 100 nM
and 275 nM, respectively, in this assay. The mismatch controls
14529 and 14531 had no activity, and the mismatch control 14530
achieved a maximum reduction of raf mRNA of approximately 20% at a
400 nM dose. Against the lower transcript, ISIS 13741 had an IC50
of approximately 100-125 nM and ISIS 14144 had an IC50 of
approximately 250 nM in this assay, with the mismatch controls
completely inactive. Therefore ISIS 13741 and 14144 are
preferred.
2'-Methoxyethoxy (2'-MOB) Oligonucleotides Targeted to B-Raf:
[0115] The oligonucleotides shown in Table. 11 were synthesized.
Nucleotides shown in bold are 2'-MOE. 2'-MOE cytosines are all
5-methylcytosines. For backbone linkage, "s" indicates
phosphorothioate (P.dbd.S) and "o" indicates phosphodiester
(P.dbd.O).
TABLE-US-00011 TABLE 11 2'-MOE oligonucleotides targeted to human
B-raf (bold = 2'-MOE) SEQ ID ISIS# Sequence/modification NO: 13741
CsTsGsCsCsTsGsGsAsTsGsGsGsTsGsTsTsTsTsT 89 15339
CsTsGsCsCsTsGsGsAsTsGsGsGsTsGsTsTsTsTsT 89 15340
CoToGoCoCoToGoGoAoToGsGsGsTsGsTsTsTsTsT 89 15341
CsTsGsCsCsTsGsGsAsTsGsGsGsTsGsTsTsTsTsT 89 15342
CoToGoCoCsTsGsGsAsTsGsGsGsTsGoToToToToT 89 15343
CsTsGsCsCsTsGsGsAsToGoGoGoToGoToToToToT 89 15344
CsTsGsCsCsTsGsGsAsTsGsGsGsTsGsTsTsTsTsT 89
These oligonucleotides were tested for their ability to reduce
B-raf mRNA levels in T24 cells. Against the lower transcript, ISIS
13741 (P.dbd.S deoxy) and ISIS 15344 (P.dbd.S deoxy/MOE) had IC50s
of approximately 250 nM. The other two compounds tested, ISIS 15341
and 15342, did not achieve 50% inhibition at doses up to 400 nM.
Against the upper transcript, ISIS 13741 and 15344 demonstrated
IC50s of approximately 150 nM, ISIS 15341 demonstrated an IC50 of
approximately 200 nM and ISIS 15342 did not achieve 50% reduction
at doses up to 400 nM. Based on these results, ISIS 15341, 13741
and 15344 are preferred.
Example 19
CX-1 Cell Adhesion to TNF-Alpha-Activated Hepatic Sinusoidal
Endothelial Cells is Blocked by PretreatMent with Murine C-Raf
Antisense Oligodeoxynucleotide
[0116] CX-1 cells are a highly metastatic, poorly differentiated
colorectal carcinoma cell line which produce CEA (what is this?).
CX-1 cells can adhere to TNF.sub.a-activated murine hepatic
sinusoidal endothelial cells in an E-selectin is dependent manner.
To determine whether pre-treatment of hepatic endothelial cells
with c-raf antisense oligodeoxynucleotide (ODN) could inhibit
TNF-.alpha. dependent CX-1 cell adhesion, hepatic endothelial cells
were treated with different concentrations of c-raf ODN for 4 h,
cultured for an additional 48 h, then stimulated or not with 50
ng/ml TNF-alpha for an additional 2 h (for RNA analysis) or 5 h
(for adhesion assay). The ODN had the following sequence:
5'-ATGCATTCTGCCCCCAAGGA-3' (SEQ ID NO: 109), in which the first
five and last five nucleotides have 2'-O-methoxyethyl modifications
and the internucleoside linkages are all phosphorothioates.
[0117] Liver sinusoidal endothelial cells (LSEC) were obtained by
perfusion of normal mouse livers with pronase and collagenase,
followed by separation of parenchymal and non-parenchymal cells on
metrimazide density gradients. The cells were cultured in 24-well
plates which were pre-coated with rat tail (type I) collagen for
5-7 days prior to their use in the adhesion assay. Tumor cell
adhesion to the endothelial cells was measured as previously
described (Brodt et al., Int. J. Cancer 71:612-619, 1997). Briefly,
tumor cells were radiolabeled with Na.sup.51Cr and 10.sup.5 cells
were added per well of endothelial cells which had been
pre-activated (or not) with 50 ng/ml TNF-.alpha. for 5-6 hr. The
plates were centrifuged for 10 min at 400 rpm, then incubated at
37.degree. C. for 1 h. Unattached cells were removed by repeated
washing, the monolayers lysed with 1N NaOH and readioactivity in
the lysates measured using a gamma counter. The total number of
endothelial cells per well at the time of the assay was about
2.5.times.10.sup.5.
[0118] To test the effect of c-raf antisense ODN on tumor cell
adhesion to the endothelial cells, the cells were cultured for 5
days, the medium removed and replaced with Opti-MEM medium
containing 3 .mu.l lipofectamine (both from Life Technologies,
Burlington, Ontario, Canada) with or without different
concentrations of the CON. Incubation with the ODN was for 5 h at
37.degree. C. at which time the medium was aspirated, replaced with
RPMI containing 10% fetal calf serum (FCS) and the cells incubated
at 37.degree. C. for 48 h prior to the adhesion assay.
[0119] In response to TNF-.alpha., E-selectin mRNA expression in
the endothelial cells was significantly higher than in untreated
cells. Pretreatment of these cells with c-raf ODN, but not with
control ODN, significantly reduced c-raf expression and abolished
E-selectin induction in a dose-dependent manner. When adhesion of
CX-1 cells to the endothelial cells was subsequently measured, the
incremental increase in adhesion due to TNF-.alpha. activated
E-selectin was reduced in an ODN dose-dependent manner and
abolished at a concentration of 100 nM antisense ODN (FIG. 1).
Control ODN had no effect on E-selectin expression or tumor
adhesion.
Example 20
CX-1 but not MIP-101 Cells Induce Cytokine and E-Selectin
Expression Upon Entry into the Hepatic Circulation
[0120] Highly metastatic murine carcinoma H-59 cells rapidly induce
cytokine and E-selectin expression upon intrasplenic/portal
injection in syngeneic mice. The following study tested whether
colorectal carcinoma cells that are highly metastatic to the liver
could induce a similar host cytokine response when xenotransplanted
into nude mice.
[0121] Experimental liver metastases were generated by
intrasplenic/portal injection of tumor cells as previously
described (Long et al., Exp. Cell Res. 238: 116-121, 1998). The
mice were anesthetized with an intramuscular injection of 2.2 mg/kg
Anased (Novopharm, Toronto, ON), followed by 11 mg/kg Ketalan
(Bimeda-MTC, Cambridge, ON). They were then inoculated
intrasplenically with 1-2.times.10.sup.6 CX-1 cells and
splenectomized 1 min later. The mice were sacrificed 4-6 wk later
and the liver metastates enumerated immediately, without prior
fixation.
[0122] Mice received one tail vein injection of 25 mg/kg c-raf
antisense or control ODN at 24 h, and a second injection of 6 mg/kg
ODN 4 h, prior to the intrasplenic/portal injection of 10.sup.6
CX-1 cells. Following tumor cell injection, the animals received 1
injection of 6 mg/kg ODN at 4 h and thereafter 1 weekly injection
of 25 mg/kg ODN from day 3 onward until the end of the experiment.
A second, control group was injected with vehicle (saline) only at
the time of ODN injection.
[0123] Following the intrasplenic/portal injection of CX-1 cells,
there was a rapid increase in hepatic TNF-.alpha. (FIG. 2A) and
IL-1.beta. mRNA expression. This increase was first detectable at
30 min, reached 10-fold relative to control levels at 4 h and
remained high for up to 48 h post tumor inoculation. The increase
in cytokine expression was followed by an increase in E-selectin
mRNA expression which was measurable at 1 h, reached maximal levels
at 4 h and remained high for 48 h post tumor inoculation. The
injection of the non-metastatic colorectal carcinoma MIP-101 failed
to trigger a cytokine response or E-selectin expression for up to
48 h following tumor cell injection (FIG. 2A-C). A similar
E-selectin induction by CX-1 cells was also subsequently confirmed
in athymic nude mice (FIG. 2D).
Example 21
Reduction in Tumor-Induced Hepatic E-Selectin Expression Following
Treatment with c-Raf Antisense ODN
[0124] To determine whether a reduction in c-raf levels can inhibit
tumor-induced hepatic E-selectin expression, CX-1 cells were
injected into nude mice pretreated with c-raf ODN, 24 and 4 h prior
to tumor cell inoculation. Livers were harvested 4 h post tumor
cell inoculation and c-raf and E-selectin mRNA levels were analyzed
using RT-PCR and Northern blotting. Injection of c-raf antisense,
but not control ODN, significantly reduced hepatic c-raf and
essentially abrogated tumor-induced E-selectin expression.
[0125] In brief, total RNA was extracted using the Trizol reagent
(Life Technologies, Inc.) and reverse-transcribed in a 20 .mu.l
reaction mixture containing 50 mM Tris-HCl, pH 8.3, 30 mM KCl, 8 mM
MgCl.sub.2, 1 mM dNTPs and 0.2 units of avian myeloblastosis virus
(AMV) reverse transcriptase. In each case, the 3'-antisense
oligonucleotide (2 .mu.M) was used to initiate reverse
transcription. The mixture was incubated sequentially for 10 min at
25.degree. C., 60 min at 37.degree. C. and 5 min at 95.degree. C.
cDNAs were amplified by PCR using the TNF-.alpha., IL-10 or
E-selectin specific oligonucleotides described (Khatib et al.,
Cancer Res. 59:1356-161, 1999). For amplification, a total of 25
PCR cycles were performed each consisting of 30 sec at 94.degree.
C., 30 sec at 56.degree. C. and 30 sec at 72.degree. C. using a
PerkinElmer Life Sciences thermocycler. Amplified PCR products were
analyzed on a 1.5% agarose gel. To determine the effect of ODN
treatment on tumor-induced E-selectin expression, nu/nu or C57Bl6
mice were injected i.v. with 25 mg/kg ODN 24 and 4 h prior to the
intrasplenic/portal injection of 2.times.10.sup.6 CX-1 cells. The
livers were removed 4 h following tumor cell injection and the RNA
extracted as described. To test the effect of c-raf treatment on
TNF-.alpha. induced E-selectin expression, the endothelial cells
were incubated with 200 nM ODN in Optimem medium for 4 h, the ODN
removed, the cells washed and maintained in RPMI medium
supplemented with 10% serum for 48 h. Two hours prior to RNA
extraction, 50 ng/ml TNF-.alpha. were added to the endothelial cell
cultures for E-selectin mRNA induction.
Example 22
Treatment with c-Raf Antisense ODN Inhibits Experimental Liver
Metastasis of CX-1 Cells
[0126] To investigate whether reduced E-selectin expression in
c-raf antisense ODN treated mice altered the course of experimental
liver metastasis, nude mice were tail vein inoculated with c-raf
antisense or control ODN 24 and 4 h prior to, as well as 4 h
following, the intrasplenic/portal injection of 2.times.10.sup.6
CX-1 cells. Maintenance ODN injections were administered once
weekly from day 3 onward until the end of the experiment, 4-5 weeks
later. In three in vivo experiments performed, the number of
metastases in c-raf antisense ODN-treated mice was significantly
reduced relative to vehicle or control ODN-treated animals, while
no significant difference was observed between the number of
metastases in the two control groups. Results of a representative
experiment are shown in FIG. 3. The median number of metastases
based on pooled data from all three experiments in vehicle treated
mice was 24 (range 3-100, n=11), in control ODN treated mice, it
was 44 (range 14-100, n=13) and in c-raf antisense ODN treated mice
it was 6 (range 2-21, n=20), representing an 86% reduction in the
number of metastases relative to control ODN treated mice. Previous
experiments have shown that the rodent-specific c-raf antisense ODN
does not affect c-raf expression in human cells since the murine
c-far ODN sequence used in these studies has no homology to the
human sequence.
[0127] c-raf antisense ODN had no direct deleterious effect on CX-1
cell growth at concentrations used to block E-selectin expression
in endothelial cells as measured by MTT [3-(4,5-dimethylthiazol
2-yl)-2,5-diphenyltetrazolium bromide] assay (LOng et al., Exp Cell
Res. 238:116-121, 1998) (FIG. 4). In the MTT assay, Cells were
seeded in 24 well plates at a density of 5.times.10.sup.4
cells/well and cultured overnight in RPMI containing 110% serum.
Different concentrations of c-raf or control ODN were then added
and cell viability measured daily for 3 days.
[0128] The antisense ODN sequence had no detectable deleterious
effect on the human carcinoma CX-1 cell growth in vitro when tested
at concentrations which were effective in blocking endothelial
E-selectin induction in mouse endothelial cells. Inhibition of the
host tumor-induced activation of E-selectin resulted in a marked
reduction in the number of experimental liver metastasis. The use
of human raf ODNs (A-raf, B-raf or C-raf), particularly ISIS 5142,
for prevention and treatment of any type of metastases is within
the scope of the present invention.
Sequence CWU 1
1
109120DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 1tgaaggtgag ctggagccat 20220DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 2gctccattga
tgcagcttaa 20320DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 3ccctgtatgt gctccattga 20420DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 4ggtgcaaagt
caactagaag 20520DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 5attcttaaac ctgagggagc 20620DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 6gatgcagctt
aaacaattct 20720DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 7cagcactgca aatggcttcc 20820DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 8tcccgcctgt
gacatgcatt 20920DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 9gccgagtgcc ttgcctggaa 201020DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 10agagatgcag
ctggagccat 201120DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 11aggtgaaggc ctggagccat 201220DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 12gtctggcgct
gcaccactct 201320DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 13ctgatttcca aaatcccatg 201420DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 14ctgggctgtt
tggtgcctta 201520DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 15tcagggctgg actgcctgct 201620DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 16ggtgagggag
cgggaggcgg 201720DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 17cgctcctcct ccccgcggcg 201820DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 18ttcggcggca
gcttctcgcc 201920DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 19gccgccccaa cgtcctgtcg 202020DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 20tcctcctccc
cgcggcgggt 202120DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 21ctcgcccgct cctcctcccc 202220DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 22ctggcttctc
ctcctcccct 202320DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotides 23cgggaggcgg tcacattcgg 202420DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotides 24tctggcgctg
caccactctc 202520DNAArtificial SequenceChimeric 2-'o-methyl P=S
c-raf antisense oligonucleotide 25ttctcgcccg ctcctcctcc
202620DNAArtificial SequenceChimeric 2-'o-methyl P=S c-raf
antisense oligonucleotide 26ttctcctcct cccctggcag
202720DNAArtificial SequenceChimeric 2-'o-methyl P=S c-raf
antisense oligonucleotide 27cctgctggct tctcctcctc
202820DNAArtificial SequenceOligonucleotide targeted to human A-raf
28gtcaagatgg gctgaggtgg 202920DNAArtificial SequenceOligonucleotide
targeted to human A-raf 29ccatcccgga cagtcaccac 203020DNAArtificial
SequenceOligonucleotide targeted to human A-raf 30atgagctcct
cgccatccag 203120DNAArtificial SequenceOligonucleotide targeted to
human A-raf 31aatgctggtg gaacttgtag 203220DNAArtificial
SequenceOligonucleotide targeted to human A-raf 32ccggtacccc
aggttcttca 203320DNAArtificial SequenceOligonucleotide targeted to
human A-raf 33ctgggcagtc tgccgggcca 203420DNAArtificial
SequenceOligonucleotide targeted to human A-raf 34cacctcagct
gccatccaca 203520DNAArtificial SequenceOligonucleotide targeted to
human A-raf 35gagattttgc tgaggtccgg 203620DNAArtificial
SequenceOligonucleotide targeted to human A-raf 36gcactccgct
caatcttggg 203720DNAArtificial SequenceOligonucleotide targeted to
human A-raf 37ctaaggcaca aggcgggctg 203820DNAArtificial
SequenceOligonucleotide targeted to human A-raf 38acgaacattg
attggctggt 203920DNAArtificial SequenceOligonucleotide targeted to
human A-raf 39gtatccccaa agccaagagg 204020DNAArtificial
SequenceOligonucleotide targeted to human A-raf 40catcagggca
gagacgaaca 204120DNAArtificial SequenceOligonucleotide targeted to
mouse and rat c-raf 41ggaacatctg gaatttggtc 204220DNAArtificial
SequenceOligonucleotide targeted to mouse and rat c-raf
42gattcactgt gacttcgaat 204320DNAArtificial SequenceOligonucleotide
targeted to mouse and rat c-raf 43gcttccattt ccagggcagg
204420DNAArtificial SequenceOligonucleotide targeted to mouse and
rat c-raf 44aagaaggcaa tatgaagtta 204520DNAArtificial
SequenceOligonucleotide targeted to mouse and rat c-raf
45gtggtgcctg ctgactcttc 204620DNAArtificial SequenceOligonucleotide
targeted to mouse and rat c-raf 46ctggtggcct aagaacagct
204720DNAArtificial SequenceOligonucleotide targeted to mouse and
rat c-raf 47gtatgtgctc cattgatgca 204820DNAArtificial
SequenceOligonucleotide targeted to mouse and rat c-raf
48tccctgtatg tgctccattg 204920DNAArtificial SequenceOligonucleotide
targeted to mouse and rat c-raf 49atacttatac ctgagggagc
205020DNAArtificial SequenceOligonucleotide targeted to mouse and
rat c-raf 50atgcattctg cccccaagga 205120DNAArtificial
SequenceOligonucleotide targeted to mouse and rat c-raf
51gacttgtata cctctggagc 205220DNAArtificial SequenceOligonucleotide
targeted to mouse and rat c-raf 52actggcactg caccactgtc
205320DNAArtificial SequenceOligonucleotide targeted to mouse and
rat c-raf 53aagttctgta gtaccaaagc 205420DNAArtificial
SequenceOligonucleotide targeted to mouse and rat c-raf
54ctcctggaag acagattcag 205520DNAArtificial SequenceHuman c-raf
kinase antisense oligonucleotide 55ttgagcatgg ggaatgtggg
205620DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotide 56aacatcaaca tccacttgcg 205720DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotide 57tgtagccaac
agctggggct 205820DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotide 58ctgagagggc tgagatgcgg 205920DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotide 59gctcctggaa
gacaaaattc 206020DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotide 60tgtgactaga gaaacaaggc 206120DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotide 61caagaaaacc
tgtattcctg 206220DNAArtificial SequenceHuman c-raf kinase antisense
oligonucleotide 62ttgtcaggtg caataaaaac 206320DNAArtificial
SequenceHuman c-raf kinase antisense oligonucleotide 63ttaaaataac
ataattgagg 20642977DNAHomo sapiens 64ccgaatgtga ccgcctcccg
ctccctcacc cgccgcgggg aggaggagcg ggcgagaagc 60tgccgccgaa cgacaggacg
ttggggcggc ctggctccct caggtttaag aattgtttaa 120gctgcatcaa
tggagcacat acagggagct tggaagacga tcagcaatgg ttttggattc
180aaagatgccg tgtttgatgg ctccagctgc atctctccta caatagttca
gcagtttggc 240tatcagcgcc gggcatcaga tgatggcaaa ctcacagatc
cttctaagac aagcaacact 300atccgtgttt tcttgccgaa caagcaaaga
acagtggtca atgtgcgaaa tggaatgagc 360ttgcatgact gccttatgaa
agcactcaag gtgaggggcc tgcaaccaga gtgctgtgca 420gtgttcagac
ttctccacga acacaaaggt aaaaaagcac gcttagattg gaatactgat
480gctgcgtctt tgattggaga agaacttcaa gtagatttcc tggatcatgt
tcccctcaca 540acacacaact ttgctcggaa gacgttcctg aagcttgcct
tctgtgacat ctgtcagaaa 600ttcctgctca atggatttcg atgtcagact
tgtggctaca aatttcatga gcactgtagc 660accaaagtac ctactatgtg
tgtggactgg agtaacatca gacaactctt attgtttcca 720aattccacta
ttggtgatag tggagtccca gcactacctt ctttgactat gcgtcgtatg
780cgagagtctg tttccaggat gcctgttagt tctcagcaca gatattctac
acctcacgcc 840ttcaccttta acacctccag tccctcatct gaaggttccc
tctcccagag gcagaggtcg 900acatccacac ctaatgtcca catggtcagc
accacgctgc ctgtggacag caggatgatt 960gaggatgcaa ttcgaagtca
cagcgaatca gcctcacctt cagccctgtc cagtagcccc 1020aacaatctga
gcccaacagg ctggtcacag ccgaaaaccc ccgtgccagc acaaagagag
1080cgggcaccag tatctgggac ccaggagaaa aacaaaatta ggcctcgtgg
acagagagat 1140tcaagctatt attgggaaat agaagccagt gaagtgatgc
tgtccactcg gattgggtca 1200ggctcttttg gaactgttta taagggtaaa
tggcacggag atgttgcagt aaagatccta 1260aaggttgtcg acccaacccc
agagcaattc caggccttca ggaatgaggt ggctgttctg 1320cgcaaaacac
ggcatgtgaa cattctgctt ttcatggggt acatgacaaa ggacaacctg
1380gcaattgtga cccagtggtg cgagggcagc agcctctaca aacacctgca
tgtccaggag 1440accaagtttc agatgttcca gctaattgac attgcccggc
agacggctca gggaatggac 1500tatttgcatg caaagaacat catccataga
gacatgaaat ccaacaatat atttctccat 1560gaaggcttaa cagtgaaaat
tggagatttt ggtttggcaa cagtaaagtc acgctggagt 1620ggttctcagc
aggttgaaca acctactggc tctgtcctct ggatggcccc agaggtgatc
1680cgaatgcagg ataacaaccc attcagtttc cagtcggatg tctactccta
tggcatcgta 1740ttgtatgaac tgatgacggg ggagcttcct tattctcaca
tcaacaaccg agatcagatc 1800atcttcatgg tgggccgagg atatgcctcc
ccagatctta gtaagctata taagaactgc 1860cccaaagcaa tgaagaggct
ggtagctgac tgtgtgaaga aagtaaagga agagaggcct 1920ctttttcccc
agatcctgtc ttccattgag ctgctccaac actctctacc gaagatcaac
1980cggagcgctt ccgagccatc cttgcatcgg gcagcccaca ctgaggatat
caatgcttgc 2040acgctgacca cgtccccgag gctgcctgtc ttctagttga
ctttgcacct gtcttcaggc 2100tgccagggga ggaggagaag ccagcaggca
ccacttttct gctccctttc tccagaggca 2160gaacacatgt tttcagagaa
gctctgctaa ggaccttcta gactgctcac agggccttaa 2220cttcatgttg
ccttcttttc tatccctttg ggccctggga gaaggaagcc atttgcagtg
2280ctggtgtgtc ctgctccctc cccacattcc ccatgctcaa ggcccagcct
tctgtagatg 2340cgcaagtgga tgttgatggt agtacaaaaa gcaggggccc
agccccagct gttggctaca 2400tgagtattta gaggaagtaa ggtagcaggc
agtccagccc tgatgtggag acacatggga 2460ttttggaaat cagcttctgg
aggaatgcat gtcacaggcg ggactttctt cagagagtgg 2520tgcagcgcca
gacattttgc acataaggca ccaaacagcc caggactgcc gagactctgg
2580ccgcccgaag gagcctgctt tggtactatg gaacttttct taggggacac
gtcctccttt 2640cacagcttct aaggtgtcca gtgcattggg atggttttcc
aggcaaggca ctcggccaat 2700ccgcatctca gccctctcag gagcagtctt
ccatcatgct gaattttgtc ttccaggagc 2760tgcccctatg gggcgggccg
cagggccagc ctgtttctct aacaaacaaa caaacaaaca 2820gccttgtttc
tctagtcaca tcatgtgtat acaaggaagc caggaataca ggttttcttg
2880atgatttggg ttttaatttt gtttttattg cacctgacaa aatacagtta
tctgatggtc 2940cctcaattat gttattttaa taaaataaat taaattt
2977652458DNAHomo sapiensmisc_feature(1088)..(1088)n = A,T,C or G
65tgacccaata agggtggaag gctgagtccc gcagagccaa taacgagagt ccgagaggcg
60acggaggcgg actctgtgag gaaacaagaa gagaggccca agatggagac ggcggcggct
120gtagcggcgt gacaggagcc ccatggcacc tgcccagccc cacctcagcc
catcttgaca 180aaatctaagg ctccatggag ccaccacggg gcccccctgc
caatggggcc gagccatccc 240gggcagtggg caccgtcaaa gtatacctgc
ccaacaagca acgcacggtg gtgactgtcc 300gggatggcat gagtgtctac
gactctctag acaaggccct gaaggtgcgg ggtctaaatc 360aggactgctg
tgtggtctac cgactcatca agggacgaaa gacggtcact gcctgggaca
420cagccattgc tcccctggat ggcgaggagc tcattgtcga ggtccttgaa
gatgtcccgc 480tgaccatgca caattttgta cggaagacct tcttcagcct
ggcgttctgt gacttctgcc 540ttaagtttct gttccatggc ttccgttgcc
aaacctgtgg ctacaagttc caccagcatt 600gttcctccaa ggtccccaca
gtctgtgttg acatgagtac caaccgccaa cagttctacc 660acagtgtcca
ggatttgtcc ggaggctcca gacagcatga ggctccctcg aaccgccccc
720tgaatgagtt gctaaccccc cagggtccca gcccccgcac ccagcactgt
gacccggagc 780acttcccctt ccctgcccca gccaatgccc ccctacagcg
catccgctcc acgtccactc 840ccaacgtcca tatggtcagc accacggccc
ccatggactc caacctcatc cagctcactg 900gccagagttt cagcactgat
gctgccggta gtagaggagg tagtgatgga accccccggg 960ggagccccag
cccagccagc gtgtcctcgg ggaggaagtc cccacattcc aagtcaccag
1020cagagcagcg cgagcggaag tccttggccg atgacaagaa gaaagtgaag
aacctggggt 1080accgggantc aggctattac tgggaggtac cacccagtga
ggtgcagctg ctgaagagga 1140tcgggacggg ctcgtttggc accgtgtttc
gagggcggtg gcatggcgat gtggccgtga 1200aggtgctcaa ggtgtcccag
cccacagctg agcaggccca ggctttcaag aatgagatgc 1260aggtgctcag
gaagacgcga catgtcaaca tcttgctgtt tatgggcttc atgacccggc
1320cgggatttgc catcatcaca cagtggtgtg agggctccag cctctaccat
cacctgcatg 1380tggccgacac acgcttcgac atggtccagc tcatcgacgt
ggcccggcag actgcccagg 1440gcatggacta cctccatgcc aagaacatca
tccaccgaga tctcaagtct aacaacatct 1500tcctacatga ggggctcacg
gtgaagatcg gtgactttgg cttggccaca gtgaagactc 1560gatggagcgg
ggcccagccc ttggagcagc cctcaggatc tgtgctgtgg atggcagctg
1620aggtgatccg tatgcaggac ccgaacccct acagcttcca gtcagacgtc
tatgcctacg 1680gggttgtgct ctacgagctt atgactggct cactgcctta
cagccacatt ggctgccgtg 1740accagattat ctttatggtg ggccgtggct
atctgtcccc ggacctcagc aaaatctcca 1800gcaactgccc caaggccatg
cggcgcctgc tgtctgactg cctcaagttc cagcgggagg 1860agcggcccct
cttcccccag atcctggcca caattgagct gctgcaacgg tcactcccca
1920agattgagcg gagtgcctcg gaaccctcct tgcaccgcac ccaggccgat
gagttgcctg 1980cctgcctact cagcgcagcc cgccttgtgc cttaggcccc
gcccaagcca ccagggagcc 2040aatctcagcc ctccacgcca aggagccttg
cccaccagcc aatcaatgtt cgtctctgcc 2100ctgatgctgc ctcaggatcc
cccattcccc accctgggag atgagggggt ccccatgtgc 2160ttttccagtt
cttctggaat tgggggaccc ccgccaaaga ctgagccccc tgtctcctcc
2220atcatttggt ttcctcttgg ctttggggat acttctaaat tttgggagct
cctccatctc 2280caatggctgg gatttgtggc agggattcca ctcagaacct
ctctggaatt tgtgcctgat 2340gtgccttcca ctggattttg gggttcccag
caccccatgt ggattttggg gggtcccttt 2400tgtgtctccc ccgccattca
aggactcctc tctttcttca ccaagaagca cagaattc 24586620DNAArtificial
SequenceAntisense oligonucleotide targeted to pig c-raf
66ccacaccact catctcatct 20672510DNAHomo sapiens 67cgcctcccgg
ccccctcccc gcccgacagc ggccgctcgg gccccggctc tcggttataa 60gatggcggcg
ctgagcggtg gcggtggtgg cggcgcggag ccgggccagg ctctgttcaa
120cggggacatg gagcccgagg ccggcgccgg ccggcccgcg gcctcttcgg
ctgcggaccc 180tgccattccg gaggaggtgt ggaatatcaa acaaatgatt
aagttgacac aggaacatat 240agaggcccta ttggacaaat ttggtgggga
gcataatcca ccatcaatat atctggaggc 300ctatgaagaa tacaccagca
agctagatgc actccaacaa agagaacaac agttattgga 360atctctgggg
aacggaactg atttttctgt ttctagctct gcatcaatgg ataccgttac
420atcttcttcc tcttctagcc tttcagtgct accttcatct ctttcagttt
ttcaaaatcc 480cacagatgtg gcacggagca accccaagtc accacaaaaa
cctatcgtta gagtcttcct 540gcccaacaaa cagaggacag tggtacctgc
aaggtgtgga gttacagtcc gagacagtct 600aaagaaagca ctgatgatga
gaggtctaat cccagagtgc tgtgctgttt acagaattca 660ggatggagag
aagaaaccaa ttggttggga cactgatatt tcctggctta ctggagaaga
720attgcatgtg gaagtgttgg agaatgttcc acttacaaca cacaactttg
tacgaaaaac 780gtttttcacc ttagcatttt gtgacttttg tcgaaagctg
cttttccagg gtttccgctg 840tcaaacatgt ggttataaat ttcaccagcg
ttgtagtaca gaagttccac tgatgtgtgt 900taattatgac caacttgatt
tgctgtttgt ctccaagttc tttgaacacc acccaatacc 960acaggaagag
gcgtccttag cagagactgc cctaacatct ggatcatccc cttccgcacc
1020cgcctcggac tctattgggc cccaaattct caccagtccg tctccttcaa
aatccattcc 1080aattccacag cccttccgac cagcagatga agatcatcga
aatcaatttg ggcaacgaga 1140ccgatcctca tcagctccca atgtgcatat
aaacacaata gaacctgtca atattgatga 1200cttgattaga gaccaaggat
ttcgtggtga tggaggatca accacaggtt tgtctgctac 1260cccccctgcc
tcattacctg gctcactaac taacgtgaaa gccttacaga aatctccagg
1320acctcagcga gaaaggaagt catcttcatc ctcagaagac aggaatcgaa
tgaaaacact 1380tggtagacgg gactcgagtg atgattggga gattcctgat
gggcagatta cagtgggaca 1440aagaattgga tctggatcat ttggaacagt
ctacaaggga aagtggcatg gtgatgtggc 1500agtgaaaatg ttgaatgtga
cagcacctac acctcagcag ttacaagcct tcaaaaatga 1560agtaggagta
ctcaggaaaa cacgacatgt gaatatccta ctcttcatgg gctattccac
1620aaagccacaa ctggctattg ttacccagtg gtgtgagggc tccagcttgt
atcaccatct 1680ccatatcatt gagaccaaat ttgagatgat caaacttata
gatattgcac gacagactgc 1740acagggcatg gattacttac acgccaagtc
aatcatccac agagacctca agagtaataa 1800tatatttctt catgaagacc
tcacagtaaa aataggtgat tttggtctag ctacagtgaa 1860atctcgatgg
agtgggtccc atcagtttga acagttgtct ggatccattt tgtggatggc
1920accagaagtc atcagaatgc aagataaaaa tccatacagc tttcagtcag
atgtatatgc 1980atttgggatt gttctgtatg aattgatgac tggacagtta
ccttattcaa acatcaacaa 2040cagggaccag ataattttta tggtgggacg
aggatacctg tctccagatc tcagtaaggt 2100acggagtaac tgtccaaaag
ccatgaagag attaatggca gagtgcctca aaaagaaaag 2160agatgagaga
ccactctttc cccaaattct cgcctctatt gagctgctgg cccgctcatt
2220gccaaaaatt caccgcagtg catcagaacc ctccttgaat cgggctggtt
tccaaacaga 2280ggattttagt ctatatgctt gtgcttctcc aaaaacaccc
atccaggcag ggggatatgg 2340tgcgtttcct gtccactgaa acaaatgagt
gagagagttc aggagagtag caacaaaagg 2400aaaataaatg aacatatgtt
tgcttatatg ttaaattgaa taaaatactc tctttttttt 2460taaggtggaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaccc 25106820DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 68attttgaagg
agacggactg 206920DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 69tggattttga aggagacgga 207020DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 70cgttagttag
tgagccaggt 207120DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 71atttctgtaa ggctttcacg 207220DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 72cccgtctacc
aagtgttttc 207320DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 73aatctcccaa tcatcactcg 207420DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 74tgctgaggtg
taggtgctgt 207520DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 75tgtaactgct gaggtgtagg 207620DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 76tgtcgtgttt
tcctgagtac 207720DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 77agttgtggct ttgtggaata 207820DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 78atggagatgg
tgatacaagc 207920DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 79ggatgattga cttggcgtgt 208020DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 80aggtctctgt
ggatgattga 208120DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 81attctgatga cttctggtgc 208220DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 82gctgtatgga
tttttatctt 208320DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 83tacagaacaa tcccaaatgc 208420DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 84atcctcgtcc
caccataaaa 208520DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 85ctctcatctc ttttcttttt 208620DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 86gtctctcatc
tcttttcttt 208720DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 87ccgattcaag gagggttctg 208820DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 88tggatgggtg
tttttggaga 208920DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 89ctgcctggat gggtgttttt 209020DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 90ggacaggaaa
cgcaccatat 209120DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 91ctcatttgtt tcagtggaca 209220DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 92tctctcactc
atttgtttca 209320DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 93actctctcac tcatttgttt 209420DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 94gaactctctc
actcatttgt 209520DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 95tcctgaactc tctcactcat 209620DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 96ttgctactct
cctgaactct 209720DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 97tttgttgcta ctctcctgag 209820DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 98cttttgttgc
tactctcctg 209920DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 99gctactctcc tgaactctct 2010020DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 100ttccttttgt
tgctactctc 2010120DNAArtificial SequenceHuman B-raf kinase
antisense oligonucleotide 101atttattttc cttttgttgc
2010220DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 102atatgttcat ttattttcct 2010320DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 103tttattttcc
ttttgttgct 2010420DNAArtificial SequenceHuman B-raf kinase
antisense oligonucleotide 104tgttcattta ttttcctttt
2010520DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 105atttaacata taagcaaaca 2010620DNAArtificial
SequenceHuman B-raf kinase antisense oligonucleotide 106ctgcctggta
ccctgttttt 2010720DNAArtificial SequenceHuman B-raf kinase
antisense oligonucleotide 107ctgcctggaa gggtgttttt
2010820DNAArtificial SequenceHuman B-raf kinase antisense
oligonucleotide 108ctgcctggta cggtgttttt 2010920DNAArtificial
Sequencec-raf antisense oligodeoxynucleotide 109atgcattctg
cccccaagga 20
* * * * *