U.S. patent application number 14/157951 was filed with the patent office on 2014-06-19 for mutant luciferase.
This patent application is currently assigned to Promega Corporation. The applicant listed for this patent is Promega Corporation. Invention is credited to Christopher R. Lowe, Melenie J. Murphy, James A. H. Murray, Rachel L. Price, David J. Squirrell, Laurence C. Tisi, Peter J. White.
Application Number | 20140170686 14/157951 |
Document ID | / |
Family ID | 10841350 |
Filed Date | 2014-06-19 |
United States Patent
Application |
20140170686 |
Kind Code |
A1 |
Squirrell; David J. ; et
al. |
June 19, 2014 |
MUTANT LUCIFERASE
Abstract
An isolated recombinant luciferase having luciferase activity.
The recombinant luciferase has an amino acid sequence which differs
from the wild-type luciferase from Phtotinus pyralis, Luciola
mingrelica, Luciola cruciata, Luciola lateralis, Hotaria parvula,
Pyrophorus plagiophthalamus, Lampyris noctiluca, Pyrocoelia miyako
or Photinus pennsylvanica. In the seguence of the recombinant
luciferase, the amino acid residue corresponding to phenylalanine
295 in Photinus pyralis wild-type luciferase or to leucine 297 in
Luciola mingrelica, Luciola cruciata or Luciola lateralis wild-type
luciferases, is mutated compared to the corresponding amino acid
which appears in the corresponding wild-type luciferase sequence.
The recombinant luciferase has increased thermostability compared
to the corresponding wild-type luciferase.
Inventors: |
Squirrell; David J.;
(Salisbury, GB) ; Murphy; Melenie J.; (Salisbury,
GB) ; Price; Rachel L.; (Salisbury, GB) ;
Lowe; Christopher R.; (Cambridge, GB) ; White; Peter
J.; (Cambridge, GB) ; Tisi; Laurence C.; (Ely,
GB) ; Murray; James A. H.; (Penarth, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Promega Corporation |
Madison |
WI |
US |
|
|
Assignee: |
Promega Corporation
Madison
WI
|
Family ID: |
10841350 |
Appl. No.: |
14/157951 |
Filed: |
January 17, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13023704 |
Feb 9, 2011 |
8652794 |
|
|
14157951 |
|
|
|
|
09763824 |
Feb 27, 2001 |
7906298 |
|
|
PCT/GB99/03538 |
Oct 26, 1999 |
|
|
|
13023704 |
|
|
|
|
Current U.S.
Class: |
435/8 ; 435/189;
435/252.33; 435/320.1; 536/23.2 |
Current CPC
Class: |
C12N 9/0069 20130101;
C12Q 1/66 20130101 |
Class at
Publication: |
435/8 ; 435/189;
536/23.2; 435/320.1; 435/252.33 |
International
Class: |
C12N 9/02 20060101
C12N009/02; C12Q 1/66 20060101 C12Q001/66 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 28, 1998 |
GB |
9823468.5 |
Claims
1. An isolated recombinant luciferase having luciferase activity
and comprising a variant of wild-type Photlnus pyralis luciferase
of SEQ ID NO: 37, wherein the amino acid sequence of said
recombinant luciferase has no more than 50 amino acid differences
as compared to the amino acid sequence of SEQ ID NO: 37, wherein,
the recombinant luciferase has an amino acid substitution at the
residue corresponding to position 295 of SEQ ID NO: 37, and wherein
the recombinant luciferase has increased thermostability as
compared to the wild-type Photlnus pyralis luciferase of SEQ ID NO:
37.
2. The recombinant luciferase of claim 1, further comprising an
amino acid other than phenylalanine at the amino acid residue
corresponding to position 14 of SEQ ID NO: 37.
3. The recombinant luciferase of claim 2, wherein the amino acid
residue corresponding to position 14 of SEQ ID NO: 37 is
alanine.
4. The recombinant luciferase of claim 1, further comprising an
amino acid other than leucine at the amino acid residue
corresponding to position 35 of SEQ ID NO: 37.
5. The recombinant luciferase of claim 4, wherein the amino acid
residue corresponding to position 35 of SEQ ID NO: 37 is
alanine.
6. The recombinant luciferase of claim 1, further comprising an
amino acid other than glutamic acid at the amino acid residue
corresponding to position 354 of SEQ ID NO: 37.
7. The recombinant luciferase of claim 6, wherein the amino acid
residue corresponding to position 354 of SEQ ID NO: 37 is
lysine.
8. The recombinant luciferase of claim 1, further comprising an
amino acid other than, alanine at the amino acid residue
corresponding to position 215 of SEQ ID NO: 37.
9. The recombinant luciferase of claim 8, wherein the amino acid
residue corresponding to position 215 of SEQ ID NO: 37 is
lysine.
10. The recombinant luciferase of claim 1, further comprising an
amino acid other than threonine at the amino acid residue
corresponding to position 214 of SEQ ID NO: 37, an amino acid other
than isoleucine at the amino acid residue corresponding to position
232 of SEQ ID NO: 37, and an amino acid other than glutamic acid at
the amino acid residue corresponding to position 354 of SEQ ID NO:
37.
11. The recombinant luciferase of claim 10, wherein the amino acid
corresponding to position 214 of SEQ ID NO: 37 is alanine, the
amino acid corresponding to position 232 of SEQ ID NO: 37 is
alanine and the amino acid corresponding to position 354 of SEQ ID
NO: 37 is lysine.
12. The recombinant luciferase of claim 11, further comprising an
amino acid other than phenylalanine at the amino acid residue
corresponding to position. 14 of SEQ ID NO: 37 and an amino acid
other than, leucine at the amino acid residue corresponding to
position 35 of SEQ ID NO: 37.
13. The recombinant luciferase of claim 12, wherein the amino acid,
corresponding to position 14 of SEQ ID NO: 37 is alanine and the
amino acid corresponding to position 35 of SEQ ID NO: 37 is
alanine,
14. The recombinant luciferase of claim 12, further comprising an
amino acid other than alanine at the amino acid residue
corresponding to position 215 of SEQ ID NO: 37.
15. The recombinant luciferase of claim 14, wherein the amino acid
corresponding to position 215 of SEQ ID NO: 37 is leucine.
16. An. isolated nucleic acid which encodes the recombinant
luciferase of claim 1.
17. A vector comprising the nucleic acid of claim 16.
18. An Isolated cell transformed with the vector of claim 17.
19. A bioluminescent assay comprising the steps of contacting the
recombinant luciferase of claim 1 with luciferin and detecting
bioluminescence.
20. A kit comprising the recombinant luciferase of claim 1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/023,704, filed Feb. 9, 2011, now U.S. Pat. No. ______, which
is a divisional of U.S. application Ser. No. 09/763,824, filed Feb.
27, 2001, now U.S. Pat. No. 7,906,298, which is a national stage
filing under 35 USC 371 of International Application No.
PCT/GB99/03538, filed Oct. 26, 1999, which claims priority benefits
to United Kingdom Patent Application No. 9823468,5, filed Oct. 28,
1998. These applications are incorporated herein by reference in
their entirety.
SUMMARY
[0002] The present invention relates to novel proteins, in
particular mutant luciferase enzymes having increased
thermostability as compared to the corresponding wild type enzyme,
to the use of these enzymes in assays and to test kits containing
them.
[0003] Firefly luciferase catalyses the oxidation of luciferin in
the presence of ATP, Mg.sup.2+ and molecular oxygen with the
resultant production of light. This reaction has a quantum yield of
about 0.88. The light emitting property has led to its use in a
wide variety of luminometric assays where ATP levels are being
measured. Examples of such assays include those which are based
upon the described in EP-B-680515 and WO 96/02665.
[0004] Luciferase is obtainable directly from the bodies of
insects, in particular beetles such as fireflies or glow-worms.
Particular species from which luciferases have been obtained
include the Japanese GENJI or KEIKE fireflies, Luciola cruciata and
Luciola lateralis, the East European firefly Luciola mingrelica,
the North American firefly Photinus pyralis and the glow-worm
Lampyris noctiluca. Other species from which luciferase can be
obtained are listed in Ye et al., Biochimica et Biophysica Acta,
1339 (1997) 39-52. Yet a further species is Phrixothrix
(railroad-worms), as described by Viviani et al., Biochemistry, 38,
(1999) 8271-8279.
[0005] However, since many of the genes encoding these enzymes have
been cloned and sequenced, they may also be produced using
recombinant DNA technology. Recombinant DNA sequences encoding the
enzymes are used to transform microorganisms such as E. coli which
then express the desired enzyme product.
[0006] The heat stability of wild and recombinant type luciferases
is such that they lose activity quite rapidly when exposed to
temperatures in excess of about 30.degree. C., particularly over
35.degree. C. This instability causes problems when the enzyme is
used or stored at high ambient temperature, or if the assay is
effected under high temperature reaction conditions, for example in
order to increase reaction rate.
[0007] Mutant luciferases having increased thermostability are
known from EP-A-524448 and WO95/25798 . The first of these
describes a mutant luciferase having a mutation at position 217 in
the Japanese firefly luciferase, in particular by replacing a
threonine residue with an isoleucine residue. The latter describes
mutant luciferases having over 60% similarity to luciferase from
Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola
lateralis but in which the amino acid residue corresponding to
residue 354 of Photinus pyralis or 356 of the Luciola species is
mutated such that it is other than glutamate.
[0008] The applicants have found yet further mutants which can
bring about increased thermostability and which may complement the
mutations already known in the art.
[0009] The present invention provides a protein having luciferase
activity and at least 60% similarity to luciferase from Photinus
pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis,
Hotaria paroula, Pyrophorus plagiophthalamus Lampyris noctiluca,
Pyrocoelia nayako, Photinus pennsylanvanica or Phrixothrix, wherein
in the sequence of the enzyme, at least one of
(a) the amino acid residue corresponding to residue 214 in Photinus
pyralis luciferase or to residue 216 of Luciola mingrelica, Luciola
cruciata or Luciola lateralis luciferase; (b) the amino acid
residue corresponding to residue 232 in Photinus pyralis luciferase
or to residue 234 of Luciola mingrelica, Luciola cruciata or
Luciola lateralis luciferase; (c) the amino acid residue
corresponding to residue 295 in Photinus pyralis luciferase or to
residue 297 of Luciola mingrelica, Luciola cruciata or Luciola
lateralis luciferase; (d) the amino acid residue corresponding to
amino acid 14 of the Photinus pyralis luciferase or to residue 16
of Luciola mingrelica, & residue 17 of Luciola cruciata or
Luciola lateralis; (e) the amino acid residue corresponding to
amino acid 35 of the Photinus pyralis luciferase or to residue 37
of Luciola mingrelica 38 of Luciola cruciata or Luciola lateralis;
(f) the amino acid residue corresponding to amino acid residue 105
of the Photinus pyralis luciferase or to residue 106 of Luciola
mingrelica, 107 of Luciola cruciata or Luciola lateralis or 108 of
Luciola lateralis gene; (g) the amino acid residue corresponding to
amino acid residue 234 of the Photinus pyralis luciferase or to
residue 236 of Luciola mingrelica, Luciola cruciata or Luciola
lateralis; (h) the amino acid residue corresponding to amino acid
residue 420 of the Photinus pyralis luciferase or to residue 422 of
Luciola mingrelica, Luciola cruciata or Luciola lateralis; (i) the
amino acid residue corresponding to amino acid residue 310 of the
Photinus pyralis luciferase or to residue 312 of Luciola
mingrelaca, Luciola cruciata or Luciola lateralis; is different to
the amino acid which appears in the corresponding wild type
sequence and wherein the luciferase enzyme possesses has increased
thermostability as compared to an enzyme having the amino acid of
the corresponding wild-type luciferase of a particular species at
this position.
[0010] Preferably, the protein has luciferase activity and at least
60% similarity to luciferase from Photinus pyralis, Luciola
mingrelica, Luciola cruciata or Luciola lateralis, Hotaria paroula,
Pyrophorus plagiophthalamus Lampyris noctiluca, Pyrocoelia nayako,
or Photinus pennsylanvanica.
[0011] In particular, the protein is a recombinant protein which
has luciferase activity and substantially the sequence of a
wild-type luciferase, for example of Photinus pyralis, Luciola
mingrelica, Luciola cruciata or Luciola lateralis, Hotaria parcula,
Pyrophorus plagiophthalamus (Green-Luc GR), Pyrophorus
plagiophthalamus (Yellow-Green Luc YG), Pyrophorus plagiophthalamus
(Yellow-Luc YE), Pyrophorus plagiophthalamus (Orange-Luc OR),
Lampyris noctiluca, Pyrocelia nayako Photinus pennsylanvanica LY,
Photinus pennsylanvanica KW, Photinus pennsylanvanica J19, or
Phrixothrix green (PV.sub.GR) or red (Ph.sub.RE) but which may
include one or more, for example up to 100 amino acid residues,
preferably no more than 50 amino acids and more preferably no more
than 30 amino acids, which have been engineered to be different to
that of the wild type enzyme.
[0012] In particular, bioluminescent enzymes from species that can
use the substrate D-luciferin
(4,5-dihydro-2-[6-hydroxy-2-benzothiazolyl]-4-thiazole carboxylic
acid) to produce light emission may form the basis of the mutant
enzymes of the invention.
[0013] By way of example, where the protein has substantially the
sequence of luciferase of Photinus pyralis, in accordance with the
invention, at least one of
(a) the amino acid residue corresponding to residue 214 in Photinus
pyralis luciferase has been changed to be other than threonine; (b)
the amino acid residue corresponding to residue 232 in Photinus
pyralis luciferase has been changed to be other than isoleucine;
(c) the amino acid residue corresponding to residue 295 in Photinus
pyralis luciferase has been changed to be other than phenylalanine;
(d) the amino acid residue corresponding to amino acid 14 of the
Photinus pyralis luciferase has been changed to be other than
phenylalanine; (e) the amino acid residue corresponding to amino
acid 35 of the Photinus pyralis luciferase has been changed to be
other than leucine; (f) the amino acid residue corresponding to
amino acid residue 105 of the Photinus pyralis luciferase has been
changed to be other than alanine; (g) the amino acid residue
corresponding to amino acid residue 234 of the Photinus pyralis
luciferase has been changed to be other than aspartic acid; (h) the
amino acid residue corresponding to amino acid residue 420 of the
Photinus pyralis luciferase has been changed to be other than
serine; (i) the amino acid residue corresponding to amino acid
residue 310 of the Photinus pyralis luciferase has been changed to
be other than histidine.
[0014] Where the protein has substantially the sequence of Luciola
mingrelica, Luciola cruciata or Luciola lateralis enzyme, in
accordance with the invention, at least one of
(a) the amino acid residue corresponding to residue 216 of Luciola
mingrelica, Luciola cruciata or Luciola lateralis luciferase is
other than glycine (for Luciola mingrelica based sequences) or
aparagine (for Luciola cruciata or Luciola lateralis) based
sequences; (b) the amino acid residue corresponding to residue 234
of Luciola mingrelica, Luciola cruciata or Luciola lateralis
luciferase is other than serine; (c) amino acid residue
corresponding to residue 297 of Luciola mingrelica, Luciola
cruciata or Luciola lateralis luciferase is other than leucine; (d)
amino acid residue corresponding to amino acid 16 of Luciola
mingrelica, or to amino acid 17 of Luciola cruciata or Luciola
lateralis is other than phenylalanine; (e) amino acid residue
corresponding to residue 37 of Luciola mingrelica, or 38 of Luciola
cruciata or Luciola lateralis is other than lysine; (f) amino acid
residue corresponding to amino acid residue 106 of Luciola
mingrelica, or to amino acid 107 of Luciola cruciata or Luciola
lateralis or to amino acid 108 of Luciola lateralis gene is other
than glycine; (g) amino acid residue corresponding to amino acid
residue 236 of Luciola mingrelica, Luciola cruciata or Luciola
lateralis is other than glycine; (h) amino acid residue
corresponding to residue 422 of Luciola mingrelica, Luciola
cruciata or Luciola lateralis is other than threonine; (i) amino
acid residue corresponding to amino acid residue 312 of Luciola
mingrelica, Luciola cruciata or Luciola lateralis is other than
threonine (for Luciola mingrelica based sequences) or valine (for
Luciola cruciata or Luciola lateralis) based sequences.
[0015] The particular substituted amino acids in any case which
give rise to enhanced thermostability can be determined by routine
methods as illustrated hereinafter. In each case, different
substitutions may result in enhanced thermostability. Substitution
may be effected by site-directed mutagenesis of DNA encoding native
or suitable mutant proteins as would be understood by the skilled
person. The invention in this case is associated with the
identification of the positions which are associated with
thermostability.
[0016] In general however, it may be desirable to consider
substituting an amino acid of different properties to the wild type
amino acid. Thus hydrophilic amino acid residues may, in some cases
be preferably substituted with hydrophobic amino acid residues and
vice versa. Similarly, acidic amino acid residues may be
substituted with basic residues.
[0017] For instance, the protein may comprise a protein having
luciferase activity and at least 60% similarity to luciferase from
Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola
lateralis enzyme wherein in the sequence of the enzyme, at least
one of
(a) the amino acid residue corresponding to residue 214 in Photinus
pyralis luciferase and to residue 216 of Luciola mingrelica,
Luciola cruciata or Luciola lateralis luciferase is mutated and is
other than threonine in the case of Photinus pyralis luciferase; or
(b) the amino acid residue corresponding to residue 232 in Photinus
pyralis luciferase and to residue 234 of Luciola mingrelica,
Luciola cruciate or Luciola lateralis luciferase is mutated and is
other than isoleucine in the case of Photinus pyralis luciferase;
or (c) amino acid residue corresponding to residue 295 in Photinus
pyralis luciferase and to residue 297 of Luciola mingrelica,
Luciola cruciata or Luciola lateralis luciferase is mutated and is
for example, other than phenylalanine in the case of Photinus
pyralis luciferase; and the luciferase enzyme has increased
thermostability as compared to the wild-type luciferase.
[0018] The sequences of all the various luciferases show that they
are highly conserved having a significant degree of similarity
between them. This means that corresponding regions among the
enzyme sequences are readily determinable by examination of the
sequences to detect the most similar regions, although if necessary
commercially available software (e.g. "Bestfit" from the University
of Wisconsin Genetics Computer Group; see Devereux et al (1984)
Nucleic Acid Research 12: 387-395) can be used in order to
determine corresponding regions or particular amino acids between
the various sequences. Alternatively or additionally, corresponding
acids can be determined by reference to L. Ye et al., Biochim.
Biophys Acta 1339 (1997) 39-52. The numbering system used in this
reference forms the basis of the numbering system used in the
present application.
[0019] Witch respect to the possible change of the amino acid
residue corresponding to residue 214 in Photinus pyralis
luciferase, the polar amino acid threonine is suitably replaced
with a non polar amino acid such as alanine, glycine, valine,
lecine, isoleucine, proline, phenylalanine, methionine, tryptophan
or cysteine. A particularly preferred substitution for the
threonine residue corresponding to residue 214 in Photinus pyralis
is alanine. A more preferred substitution is cysteine. However,
different polar residues such as asparagine at this position may
also enhance the thermostability of the corresponding enzyme having
threonine at this position.
[0020] Other amino acids which appear at this position in wild-type
luciferase enzymes include glycine (Luciola mingrelica, Hotaria
paroula), asparagine (Pyrophorus plagiophthalamus, GR, YC, YE and
OR, Luciola cruciata, Luciola lateralis, Lampyris nactiluca,
Pyrocelia nayako Photinus pennsylanvanica LY, KW, J19) and serine
(position 211 in Phrixothrix luciferase). These may advantageously
be substituted with non-polar or different non-polar side chains
such as alanine and cysteine.
[0021] As regards the possible change of the amino acid residue
corresponding to residue 232 in Photinus pyralis luciferase, the
nonpolar amino acid isoleucine is suitably replaced with a
different non polar amino acid such as alanine, glycine, valine,
leucine, proline, phenylalanine, methionine, tryptophan or
cysteine. Other amino acids appearing at this position in wild type
sequences include serine and asparagine (as well as valine or
alanine at corresponding position 229 in Phritothix green and red
respectively). Suitably, these polar residues are substituted by
non-polar residues such as those outlined above. A particularly
preferred substitution for the residue corresponding to residue 232
in Photinus pyralis luciferase and to residue 234 of Luciola
mingrelica, Luciola cruciata or Luciola lateralis luciferase is
alanine, where this represents a change of amino acid over the
wild-type sequence. Changes of the amino acid residue corresponding
to residue 295 in Photinus pyralis luciferase and to residue 297 of
Luciola mingrelica, Luciola cruciata or Luciola lateralis
luciferase, may also affect the thermostability of the protein.
(This corresponds to position 292 in Phrixothix luciferase.) In
general, the amino acid at this position is a non-polar amino acid
phenylalanine or leucine. These are suitably changed for different
non-polar amino acids. For example, in Photinus pyralis, the
non-polar amino acid phenylalanine is suitably replaced with a
different non polar amino acid, such as alanine, leucine, glycine,
valine, isoleucine, proline, methionine, tryptophan or cysteine. A
particularly preferred substitution for the phenylalanine residue
corresponding to residue 214 in Photinus pyralis luciferase is
leucine.
[0022] Mutation at the amino acid residue corresponding to amino
acid 14 of the Photinus pyralis luciferase or to amino acid 16 in
Luciola luciferase, (13 in Phrixothrix luciferase) is also
possible. This amino acid residue (which is usually phenylalanine,
but may also be leucine, serine, arginine or in some instances
tyrosine) is suitably changed to a different amino acid, in
particular to a different nonpolar amino acid such as alanine,
valine, leucine, isoleucine, proline, methionine or tryptophan,
preferably alanine.
[0023] Mutation at the amino acid residue corresponding to amino
acid 35 of the Photinus pyralis luciferase or to amino acid residue
37 in Luciola mingrelica luciferase (corresponding to amino acid 38
in other Luciola spp. And in Phrixothrix) may also be effective.
This amino acid varies amongst wild type enzymes, which may include
leucine (Photinus pyralis) but also lysine, histidine, glycine,
alanine, glutamine and aspartic acid at this position. Suitably the
amino residue at this position is substituted with a non-polar
amino acid residue or a different non-polar amino acid such as
such as alanine, valine, phenylalanine, isoleucine, proline,
methionine or tryptophan. A preferred amino acid at this position
is alanine, where this is different to the wild-type enzyme.
[0024] Mutations at the amino acid corresponding to position 14 of
the Photinus pyralis sequence and/or mutation at the amino acid
residue corresponding to amino acid 35 of the Photinus pyralis
luciferase are preferably not the only mutation in the enzyme.
[0025] They are suitably accompanied by others of the mutations
defined above, in particular those at positions corresponding to
positions 214, 395 or 232 of Photinus pyralis luciferase. Changes
of the amino acid residue corresponding to residue 105 in Photinus
pyralis luciferase and to residue 106 of Luciola mingrelica.
Luciola cruciata or Luciola lateralis luciferase, (102 in
Phrixothrix) may also affect the thermostability of the protein. In
general, the amino acid at this position is a non-polar amino acid
alanine or glycine, or serine in Phrixothrix. These are suitably
changed for different non-polar amino acids. For example, in
Photinus pyralis, the non-polar amino acid alanine is suitably
replaced with a different non polar amino acid, such as
phenylalanine, leucine, glycine, valine, isoleucine, proline,
methionine or tryptophan. A particularly preferred substitution for
the alanine residue corresponding to residue 105 in Photinus
pyralis luciferase is valine.
[0026] Changes of the amino acid residue corresponding to residue
234 in Photinus pyralis luciferase and to residue 236 of Luciola
mingrelica, Luciola cruciata or Luciola lateralis luciferase (231
in Phrixothrix), may also affect the thermostability of the
protein. In general, the amino acid at this position is aspartic
acid or glycine and in some cases, glutamine or threonine. These
are suitably changed for non-polar or different non-polar amino
acids as appropriate. For example, in Photinus pyralis, the amino
acid residue is aspartic acid is suitably replaced with a non polar
amino acid, such as alanine, leucine, glycine, valine, isoleucine,
proline, methionine or tryptophan. A particularly preferred
substitution for the phenylalanine residue corresponding to residue
234 in Photinus pyralis luciferase is glycine. Where a non-polar
amino acid residue such as glycine is present at this position (for
example in Luciola luciferase), this may be substituted with a
different non-polar amino acid.
[0027] Changes of the amino acid residue corresponding to residue
420 in Photinus pyralis luciferase and to residue 422 of Luciola
mingrelica, Luciola cruciata or Luciola lateralis luciferase (417
in Phrixothrix green and 418 in Phrixothrix red), may also affect
the thermostability of the protein. In general, the amino acid at
this position is an uncharged polar amino acid serine or threonine
or glycine. These are suitably changed for different uncharged
polar amino acids. For example, in Photinus pyralis, the serine may
be replaced with asparagine, glutamine, threonine or tyrosine, and
in particular threonine.
[0028] Changes of the amino acid residue corresponding to residue
310 in Photinus pyralis luciferase and to residue 312 of Luciola
mingrelica, Luciola cruciata or Luciola lateralis luciferase, may
also affect the thermostability of the protein. The amino acid
residue at this position varies amongst the known luciferase
oroteins, being histidine in Photinus pyralis, Pyrocelia nayako,
Lampyris noctiluca and some forms of Photinus pennsylanvanica
luciferase, threonine in Luciola mingrelica, Hotaria paroula and
Phrixothix (where it is amino acid 307) luciferase, valine in
Luciola cruciata and Luciola lateralis, and asparagine in some
Pyrophorus plagiophthalamus luciferase. Thus, in general, the amino
acid at this position is hydrophilic amino acid which may be
changed for a different amino acid residue which increases
thermostability of the enzyme. A particularly preferred
substitution for the histidine residue corresponding to residue 310
in Photinus pyralis luciferase is arginine.
[0029] Other mutations may also be present in the enzyme. For
example, in a preferred embodiment, the protein also has the amino
acid at position corresponding to amino acid 354 of the Photinus
pyralis luciferase (356 in Luciola luciferase and 351 in
Phrixothrix) changed from glutamate, in particular to an amino acid
other than glycine, proline or aspartic acid. Suitably, the amino
acid at this position is tryptophan, valine, leucine, isoleucine
are asparagine, but most preferably is lysine or arginine. This
mutation is described in WO 95/25798.
[0030] In an alternative preferred embodiment, the protein also has
the amino acid at the position corresponding to amino acid 217 in
Luciola luciferase (215 in Photinus pyralis) changed to a
hydrophobic amino acid in particular to isoleucine, leucine or
valine as described in EP-A-052448.
[0031] The proteins may contain further mutations in the sequence
provided the luciferase activity of the protein is not unduly
compromised. The mutations suitably enhance the properties of the
enzyme or better suit it for the intended purpose in some way. This
may mean that they result in enhanced thermostability and/or colour
shift properties, and/or the K.sub.m for ATP of the enzymes.
Examples of mutations which give rise to colour shifts are
described in WO95/18853. Mutations which affect K.sub.m values are
described for example in WO 96/22376 and International Patent
Application No. PCT/GB98/01026 which are incorporated herein by
reference.
[0032] Proteins of the invention suitably have more than one such
mutation, and preferably all three of the mutations described
above.
[0033] Proteins of the invention include both wild-type and
recombinant luciferase enzymes. They have at least 60% similarity
to the sequences of Photinus pyralis, Luciola mingrelica, Luciola
cruciata or Luciola lateralis or other luciferase enzymes as
discussed above in the sense that at least 60% of the amino acids
present in the wild-type enzymes are present in the proteins of the
invention. Such proteins can have a greater degree of similarity,
in particular at least 70%, more preferably at least 80% and most
preferably at least 90% to the wild-type enzymes listed above.
Similar proteins of this type include allelic variants, proteins
from other insect species as well as recombinantly produced
enzymes.
[0034] They may be identified for example, in that they are encoded
by nucleic acids which hybridise with sequences which encode
wild-type enzymes under stringent hybridisation conditions,
preferably high stringency conditions. Such conditions would be
well understood by the person skilled in the art, and are
exemplified for example in Sambrook et al. (1989) Molecular
Cloning, Cold Spring Harbor Laboratory Press). In general terms,
low stringency conditions can be defined as 3.times.SCC at about
ambient temperature to about 65.degree. C., and high stringency
conditions as 0.1.times.SSC at about 65.degree. C.. SSC is the name
of a buffer of 0.15 M NaCl, 0.015 M trisodium citrate. 3.times.SSC
is three times as strong as SSC and so on.
[0035] In particular, the similarity of a particular sequence to
the sequences of the invention may be assessed using the multiple
alignment method described by Lipman and Pearson, (Lipman, D. J.
& Pearson, W. R. (1985) Rapid and Sensitive Protein Similarity
Searches, Science, vol 227, pp 1435-1441). The "optimised"
percentage score should be calculated with the following parameters
for the Lipman-Pearson algorithm:ktup=1, gap penalty=4 and gap
penalty length=12. The sequence for which similarity is to be
assessed should be used as the "test sequence" which means that the
base sequence for the comparison, such as the sequence of Photinus
pyralis or any of the other sequences listed above,as recorded in
Ye et al., supra., or in the case of Phrixotrix, as described in
Biochemistry, 1999, 38, 8271-8279, should be entered first into the
algorithm. Generally, Photinus pyralis will be used as the
reference sequence.
[0036] Particular examples of proteins of the invention are
wild-type luciferase sequence with the mutations as outlined above.
The proteins have at least one and preferably more than one such
mutation.
[0037] The invention further provides nucleic acids which encode
the luciferases as described above. Suitably, the nucleic acids are
based upon wild-type sequences which are well known in the art.
Suitable mutation to effect the desired mutation in the amino acid
sequence would be readily apparent, based upon a knowledge of the
genetic code.
[0038] The nucleic acids of the invention are suitably incorporated
into an expression vector such as a plasmid under the control of
control elements such as promoters, enhancers, terminators etc.
These vectors can then be used to transform a host cell, for
example a prokaryotic or eukaryotic cell such as a plant or animal
cell, but in particular a prokaryotic cell such as E. coli so that
the cell expresses the desired luciferase enzyme. Culture of the
thus transformed cells using conditions which are well known in the
art will result in the production of the luciferase enzyme which
can then be separated from the culture medium. Where the cells are
plant or animal cells, plants or animals may be propagated from
said cells. The protein may then be extracted from the plants, or
in the case of transgenic animals, the proteins may be recovered
from milk. Vectors, transformed cells, transgenic plants and
animals and methods of producing enzyme by culturing these cells
all form further aspects of the invention.
[0039] The Photinus pyralis T214A mutant luciferase was created by
random mutagenesis as described hereinafter. It was found that the
T214A single point mutation has greater thermostability than wild
type luciferase.
[0040] Two new triple mutant luciferases: E354K/T214A/A215L and
E354K/T214A/I232A were also prepared and these also have exhibited
greater thermostability.
[0041] Particular examples of mutant enzymes of Photinus pyralis
which fall within the scope of the invention include the following:
[0042] I232A/E354K [0043] T214A/I232A/E354K [0044]
A215L/I232A/E354K [0045] T214A/I232A/E354K/A215L [0046]
I232A/E354K/T214A/F295L [0047] I232A/E354K/T214A F295L/F14A/L35A
[0048] I232A/E354K/T214A/F295L/F14A/L35A/A215L [0049] A105V [0050]
T214A [0051] T214C [0052] T214N [0053] T295L [0054] I232A [0055]
F14A [0056] L35A [0057] D234G [0058] S420T [0059] H310R or
equivalents of any of these when derived from the luciferases of
other species.
[0060] The mutations for the creation of the triple mutant were
introduced to the luciferase gene on plasmid pET23 by site-directed
mutagenesis, (PCR). The oligonucleotides added to the PCR reaction
in order to effect the relevant mutations are given in the Examples
below.
[0061] It has been reported previously that the effect of point
mutations at the 354 and 215 positions are additive. This invention
provides the possibility of combining three or more such mutations
to provide still greater thermostability.
[0062] Thermostable luciferase of the invention will advantageously
be employed in any bioluminescent assay which utilises the
luciferase/luciferin reaction as a signalling means. There are many
such assays known in the literature. The proteins may therefore be
included in kits prepared with a view to performing such assays,
optionally with luciferin and any other reagents required to
perform the particular assay.
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] The invention will now be particularly described by way of
example with reference to the accompanying diagrammatic drawings in
which:
[0064] FIG. 1 illustrates the plasmids used in the production of
mutants in accordance with the invention;
[0065] FIG. 2 shows the results of heat inactivation studies on
luciferases including luciferases of the invention;
[0066] FIG. 3 shows the results of thermostability experiments on
various luciferase mutants;
[0067] FIG. 4 shows the results of thermostability experiments on
other luciferase mutants; and
[0068] FIG. 5 shows oligonucleotides (SEQ ID NOs: 1-10, 11/36 and
12-33) used in the preparation of mutant enzymes of the
invention.
Example 1
Identification of Thermostable Mutant Luciferase
[0069] The error-prone PCR was based on the protocol devised by
Fromant et al., Analytical Biochemistry, 224, 347-353 (1995).
[0070] The dNTP mix in this reaction was: [0071] 35 mM dTTP [0072]
12.5 mM dGTP [0073] 22.5 mM dCTP [0074] 14 mM dATP
[0075] The PCR conditions were: [0076] 0.5 .mu.l (50 ng) plasmid
pPW601 J54* [0077] 5.0 .mu.l 10.times. KCl reaction buffer [0078] 1
.mu.l each of W56 and W57* (60 pmoles of each primer) [0079] 1
.mu.l Biotaq.TM. polymerase (5 U) [0080] 2 .mu.l dNTPs (see above)
[0081] 1.76 .mu.l MgCl.sub.2 (50 mM stock) [0082] 1 .mu.l
mNCl.sub.2 (25 mM stock) [final concentration in reaction=3.26 mM]
[0083] 36.7 .mu.l dH.sub.2O * Plasmid pPW60laJ54 is a mutated
version of pPW601a (WO 95/25798) where an NdeI site has been
created within the 3 bases prior to the ATG start codon. This
allows for easy cloning from pPW601a into the pET23 vector.
+Primer Sequences:
TABLE-US-00001 [0084] W56: (SEQ ID NO: 34)
5'-AAACAGGGACCCATATGGAAGACGC-3' W57: (SEQ ID NO: 35)
5'-AATTAACTCGAGGAATTTCGTCATCGCTGAATACAG-3')
Cycling Parameters Were:
94.degree. C.--5 min
[0085] Then 12.times. cycles of: [0086] 94.degree. C.--30 s [0087]
55.degree. C.--30 s [0088] 72.degree. C.--5 min
72.degree. C.--10 min
[0089] The PCR products were purified from the reaction mix using a
Clontech Advantage.TM. PCR-pure kit. An aliquot of the purified
products was then digested with the restriction enzymes NdeI and
XhoI. The digested PCR products were then "cleaned up" with the
Advantage kit and ligated into the vector pET23a which had been
digested with the same enzymes.
[0090] Ligation Conditions: [0091] 4 .mu.l pET23a (56 ng) [0092] 5
.mu.l PCR products (200 ng) [0093] 3 .mu.l 5.times. Gibco BRL
ligase reaction buffer [0094] 1 .mu.l Gibco BRL ligase (10 U)
[0095] 2 .mu.l dH.sub.2O
[0096] The ligation was carried out overnight at 16.degree. C.
[0097] The ligated DNAs were then purified using the Advantage.TM.
kit and then electroporated into electrocompetent E. coli HB101
cells (1 mm cuvettes, 1.8 Kv).
[0098] Eleven electroporations were performed and the cells were
then added to 40 ml of TY broth containing 50 .mu.g/ml ampicillin.
The cells were then grown overnight at 37.degree. C. The entire 50
ml of culture grown overnight was used to purify plasmid DNA. This
is the library.
Screening the Library
[0099] An aliquot of the plasmid library was used to electroporate
E. coli BL21 DE3 cells. These cells were then plated onto LB agar
containing 50 .mu.g/ml ampicillin and grown overnight at 37.degree.
C.
[0100] The next day, colonies were picked and patched onto nylon
filters on LB agar+amp plates and growth continued overnight at
37.degree. C.. The next day, filters were overlaid with a solution
of luciferin--500 .mu.M in 100 mM sodium citrate pH5.0. The patches
were then viewed in a darkroom. One colony/patch was picked from
200 for further analysis.
Characterisation of the Thermostable Mutant
[0101] The E. coli clone harbouring the mutant plasmid was
isolated. Plasmid DNA was prepared for ABI sequencing. The entire
open reading frame encoding luciferase was sequenced using 4
different oligonucleotide primers. Sequencing revealed a single
point mutation at nt 640 (A.fwdarw.G). Giving a codon change of ACT
(T) to GCT (A) at amino acid position 214.
Example 2
Preparation of Triple Mutant Enzyme
[0102] A mutagenic oligonucleotide was then used to create this
same mutation in pMOD1 (A215L/E354K) to create a triple mutant
pMOD2 (A215L/E354K/T214A). This mutation also creates a unique
SacI/SstI site in pMOD1.
Example 3
Preparation of Further Triple Mutant Enzyme
[0103] The following primers were used to create the triple mutant
T214A/I232A/E354K using a standard PCR reaction and with the pET23
plasmid with the T214A mutation as template:
TABLE-US-00002 E354K-sense (SEQ ID NO: 26) CTGATTACACCCAAGGGGGATG
E354K-antisense (SEQ ID NO: 27) CATCCCCCTTGGGTGTAATCAG I232A-sense
(SEQ ID NO: 30) GCAATCAAATCGCTCCGGATACTGC I232A-antisense (SEQ ID
NO: 31) GCAGTATCCGGAGCGATTTGATTGC
Example 4
Identification of Thermostable 295 Mutant
[0104] The F295 mutant was created using the error-prone PCR method
described by Fromant et al., Analytical Biochemistry, vol 224,
347-353 (1995). The PCR conditions used were as follows: [0105] 0.5
.mu.l (50 ng) plasmid pET23 [0106] 5.0 .mu.l 10.times. KCI reaction
buffer [0107] 1 .mu.l primer 1--60 pmoles of each primer [0108] 1
.mu.l primer 2 [0109] 1 .mu.l Biotaq.TM. polymerase (5 U) [0110] 2
.mu.l dNTPs, in mixture 35 mM dTTP, 12.5 mM dGTP, 22.5 mM dCTP, 14
mM dATP [0111] 1.76 .mu.l MgCl.sub.2 (50 mM stock) [0112] 1 .mu.l
MnCl.sub.2 (25 mM stock) [final concentration in reaction=3.26 mM]
[0113] 36.7 .mu.l dH.sub.2O
TABLE-US-00003 [0113] Primer 1 = (SEQ ID NO: 34)
5'-AAACAGGGACCCATATGGAAGACGC-3' Primer 2 = (SEQ ID NO: 35)
5'-AATTAACTCGAGGAATTTCGTCATCGCTGAATACAG-3'
[0114] The Cycling Parameters Were:
[0115] 94.degree. C. for 5 min
[0116] 15 cycles of: [0117] 30 s@94.degree. C. [0118] 30
s@55.degree. C. [0119] 5 min@72.degree. C.
[0120] then 10 min at 72.degree. C.
[0121] The PCR products were purified from the reaction mix using a
Clontech Advantage.TM. PCR-Pure kit. An aliquot of the purified
products was then digested with the restriction enzymes Ndel and
Xhol. The digested PCR products were then "cleaned up" with the
Advantage.TM. kit and ligated into the vector pET23a, which had
been digested with the same enzymes.
[0122] The ligation conditions were as follows: [0123] 56 ng pET23a
[0124] 200 ng PCR products [0125] 3 .mu.l 5.times. Gibco BRL ligase
reaction buffer [0126] 1 .mu.l Gibco BRL ligase (10 U) [0127]
volume made up to 10 .mu.l with dH.sub.2O
[0128] The ligation was carried out overnight at 16.degree. C.
[0129] The ligated DNAs were then purified using the Advantage.TM.
kit and then electroporated into electrocompetent Escherichia coli
DH5.alpha. cells (1 mm cuvettes, 1.8 kV). 1 ml of SOC broth was
added to each electroporation and the cells allowed to recover and
express antibiotic resistance genes encoded by the plasmid.
Aliquots of the library were inoculated onto LB agar containing 50
.mu.g/ml ampicillin and the bacteria were grown overnight at
37.degree. C. Nylon filter discs were then overlaid onto the agar
plates and the colonies transferred to fresh plates. The original
plates were left at room temperature for the colonies to re-grow.
The plates with the nylon filters were incubated at 42.degree. C.
for 2 h before plates were sprayed with 500 .mu.M luciferin in 100
mM citrate buffer pH5.0 and viewed in a darkroom.
[0130] Three thermostable colonies were selected on the basis that
they still glowed after 2 h at 42.degree. C. Plasmid DNA was
isolated from these clones and sequenced, and this revealed the
F295L mutation in each case.
Example 5
[0131] Other mutants of the invention were produced by PCR using
appropriate combinations of the oligonucleotides listed above as
well as the following:
TABLE-US-00004 F14A-sense (SEQ ID NO: 5)
GAAAGGCCCGGCACCAGCCTATCCTCTAGAGG F14A-antisense (SEQ ID NO: 6)
CCTCTAGCGGATAGGCTGCTGCCGGGCCTTTC L35A-sense (SEQ ID NO: 9)
GAGATACGCCGCGGTTCCTGG L35A-antisense (SEQ ID NO: 10)
CCAGGAACCGCGGCGTATCTC
Example 6
Purification of Luciferase and Heat Inactivation Studies
[0132] Cells expressing the recombinant mutant luciferases were
cultured, disrupted and extracted as described in WO 95/25798 to
yield cell free extracts of luciferase.
[0133] Eppendorf tubes containing the cell free extracts were
incubated generally at 40.degree. C. unless otherwise stated.
Purified preparations of wild type luciferases (for comparative
purposes were incubated in thermostability buffer comprising 50 mM
potassium phosphate buffer pH7.8 containing 10% saturated ammonium
sulphate, 1 mM dithiothreitol and 0.2% bovine serum albumin (BSA).
At set times a tube was removed and cooled in an ice/water bath
prior to assay with remaining assayed activity being calculated as
a percentage of the initial activity or relative bioluminesce.
[0134] The results are illustrated in FIGS. 2 and 3 hereinafter. It
can be seen from FIG. 2 that luciferase mutants of the invention
have improved thermostability compared with the previously known
mutants.
[0135] The dramatic increase in stability over wild-type luciferase
(RWT) is clear from FIG. 3.
Example 7
Investigations into the Activity of 214 Mutants
[0136] A library of 214 mutants was prepared using site-directed
mutagenesis using cassette oligos (FIG. 5) and thermostable mutants
selected and tested as described in Example 1. Three particularly
thermostable mutants were characterised by sequencing as described
in Example 1 as T214A, T214C and T214N.
[0137] O/N cultures of E. coli XL1-Blue harbouring plasmids
encoding T214, T214A, T214C and T214N were lysed using the Promega
lysis buffer. 50 .mu.l of liquid extracts were then heat
inactivated at 37.degree. C. and 40.degree. C. over various time
points. Aliquots 10 .mu.l of heated extract were then tested in the
Promega live assay buffer (100 .mu.l).
[0138] The results are shown in the following Tables
TABLE-US-00005 0 4 min 8 min 22 min (37.degree. C.) rwt T214 11074
5561 2555 343 RLU T214C 106449 92471 90515 78816 RLU T214A 63829
52017 45864 35889 RLU T214N 60679 49144 41736 29488 RLU
TABLE-US-00006 % remaining activity 37.degree. C. rwt T214 100 50.2
23.1 3.1 T214C 100 86.9 85.0 74.0 T214A 100 81.5 71.8 56.2 T214N
100 81.0 68.8 48.6
[0139] The experiment was repeated at 40.degree. C. with the 3
mutants
TABLE-US-00007 0 4 min 8 min 16 min T214C 104830 79365 72088 56863
RLU T214A 64187 43521 28691 14547 RLU T214N 60938 38359 25100 12835
RLU
TABLE-US-00008 % remaining activity 40.degree. C. 0 4 min 8 min 16
min T214C 100 73.7 68.8 54.2 T214A 100 67.8 44.7 22.7 T214N 100
63.0 41.2 21.1
[0140] These results indicate that T214C is significantly more
thermostable than either r-wt or T214A or N. This change in
properties is unexpected as it is usually expected that the more
cysteine residues that are present, the worse the
thermostability.
Example 8
Investigation of Other Point Mutations
[0141] A series of other Photinus pyralis mutants with single point
mutations were prepared using random error-prone PCR (FIG. 5).
Following, screening and sequencing of the mutants generated, the
sequencing was checked using site-directed mutagenesis followed by
further sequencing. These were D234G, A105V and F295L. The
thermostability of these mutants as well as recombinant wild-type
Photinus pyralis luciferase was tested. Protein samples in Promega
lysis buffer were incubated at 37.degree. C. for 10 minutes and
their activity assayed after 2, 5 and 10 minutes. The results,
showing that each mutation produced enhanced thermostability over
wild type, is shown in FIG. 4.
Sequence CWU 1
1
42123DNAArtificial SequenceDescription of Artificial Sequence
Primer 1cgccggtgag ctccccgccg ccg 23223DNAArtificial
SequenceDescription of Artificial Sequence Primer 2cggcggcggg
gagctcaccg gcg 23351DNAArtificial SequenceDescription of Artificial
Sequence Primer 3cgaacacttc ttcatcgttg accgccttaa gtctttaatt
aaatacaaag g 51451DNAArtificial SequenceDescription of Artificial
Sequence Primer 4cctttgtatt taattaaaga cttaaggcgg tcaactatga
agaagtgttc g 51532DNAArtificial SequenceDescription of Artificial
Sequence Primer 5gaaaggcccg gcaccagcct atcctctaga gg
32632DNAArtificial SequenceDescription of Artificial Sequence
Primer 6cctctagcgg ataggctggt gccgggcctt tc 32736DNAArtificial
SequenceDescription of Artificial Sequence Primer 7ccataaattt
accgaattcg tcgacttcga tcgagg 36818DNAArtificial SequenceDescription
of Artificial Sequence Primer 8gtgtggaatt gtgagcgg
18921DNAArtificial SequenceDescription of Artificial Sequence
Primer 9gagatacgcc gcggttcctg g 211021DNAArtificial
SequenceDescription of Artificial Sequence Primer 10ccaggaaccg
cggcgtatct c 211130DNAArtificial SequenceDescription of Artificial
Sequence Primer 11ccctattttc attcctggcc aaaagcactc
301230DNAArtificial SequenceDescription of Artificial Sequence
Primer 12gagtgctttt ggccaggaat gaaaataggg 301327DNAArtificial
SequenceDescription of Artificial Sequence Primer 13ccgcatagag
ctctctgcgt cagattc 271427DNAArtificial SequenceDescription of
Artificial Sequence Primer 14gaatctgacg cagagagctc tatgcgg
271530DNAArtificial SequenceDescription of Artificial Sequence
Primer 15gttgaccgct tgggatcctt aattaaatac 301622DNAArtificial
SequenceDescription of Artificial Sequence Primer 16gtatagattt
gaaaaagagc tg 221722DNAArtificial SequenceDescription of Artificial
Sequence Primer 17cagctctttt tcaaatctat ac 221822DNAArtificial
SequenceDescription of Artificial Sequence Primer 18ggctacatac
tggagacata gc 221922DNAArtificial SequenceDescription of Artificial
Sequence Primer 19gctatgtctc cagtatgtag cc 222021DNAArtificial
SequenceDescription of Artificial Sequence Primer 20gcagttgcgc
ccgtgaacga c 212121DNAArtificial SequenceDescription of Artificial
Sequence Primer 21gtcgttcacg ggcgcaactg c 212229DNAArtificial
SequenceDescription of Artificial Sequence Primer 22caaatcattc
cgggtactgc gattttaag 292329DNAArtificial SequenceDescription of
Artificial Sequence Primer 23cttaaaatcg cagtacccgg aatgatttg
292427DNAArtificial SequenceDescription of Artificial Sequence
Primer 24ccgcatagaa ctctctgcgt cagattc 272527DNAArtificial
SequenceDescription of Artificial Sequence Primer 25gaatctgacg
cagagagttc tatgcgc 272622DNAArtificial SequenceDescription of
Artificial Sequence Primer 26ctgattacac ccaaggggga tg
222722DNAArtificial SequenceDescription of Artificial Sequence
Primer 27catccccctt gggtgtaatc ag 222829DNAArtificial
SequenceDescription of Artificial Sequence Primer 28cccttccgca
tagannngcc tgcgtcagt 292929DNAArtificial SequenceDescription of
Artificial Sequence Primer 29actgacgcag gcnnntctat gcggaaggg
293025DNAArtificial SequenceDescription of Artificial Sequence
Primer 30gcaatcaaat cgctccggat actgc 253125DNAArtificial
SequenceDescription of Artificial Sequence Primer 31gcagtatccg
gagcgatttg attgc 253220DNAArtificial SequenceDescription of
Artificial Sequence Primer 32ccattccatc aaggttttgg
203320DNAArtificial SequenceDescription of Artificial Sequence
Primer 33ccaaaacctt gatggaatgg 203425DNAArtificial
SequenceDescription of Artificial Sequence Primer 34aaacagggac
ccatatggaa gacgc 253536DNAArtificial SequenceDescription of
Artificial Sequence Primer 35aattaactcg aggaatttcg tcatcgctga
atacag 363630DNAArtificial SequenceDescription of Artificial
Sequence Primer 36ccctattttc attcctggcc aaaagcactg
3037550PRTPhotinus pyralis 37Met Glu Asp Ala Lys Asn Ile Lys Lys
Gly Pro Ala Pro Phe Tyr Pro1 5 10 15Leu Glu Asp Gly Thr Ala Gly Glu
Gln Leu His Lys Ala Met Lys Arg 20 25 30Tyr Ala Leu Val Pro Gly Thr
Ile Ala Phe Thr Asp Ala His Ile Glu 35 40 45Val Asn Ile Thr Tyr Ala
Glu Tyr Phe Glu Met Ser Val Arg Leu Ala 50 55 60 Glu Ala Met Lys
Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val65 70 75 80Cys Ser
Glu Asn Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu 85 90 95Phe
Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg 100 105
110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr Val Val Phe Val
115 120 125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys
Leu Pro 130 135 140Ile Ile Gln Lys Ile Ile Ile Met Asp Ser Lys Thr
Asp Tyr Gln Gly145 150 155 160Phe Gln Ser Met Tyr Thr Phe Val Thr
Ser His Leu Pro Pro Gly Phe 165 170 175Asn Glu Tyr Asp Phe Val Pro
Glu Ser Phe Asp Arg Asp Lys Thr Ile 180 185 190Ala Leu Ile Met Asn
Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195 200 205Ala Leu Pro
His Arg Thr Ala Cys Val Arg Phe Ser His Ala Arg Asp 210 215 220Pro
Ile Phe Gly Asn Gln Ile Ile Pro Asp Thr Ala Ile Leu Ser Val225 230
235 240Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr
Leu 245 250 255Ile Cys Gly Phe Arg Val Val Leu Met Tyr Arg Phe Glu
Glu Glu Leu 260 265 270Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln
Ser Ala Leu Leu Val 275 280 285Pro Thr Leu Phe Ser Phe Phe Ala Lys
Ser Thr Leu Ile Asp Lys Tyr 290 295 300Asp Leu Ser Asn Leu His Glu
Ile Ala Ser Gly Gly Ala Pro Leu Ser305 310 315 320Lys Glu Val Gly
Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile 325 330 335Arg Gln
Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr 340 345
350Pro Glu Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe
355 360 365Phe Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu
Gly Val 370 375 380Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met
Ile Met Ser Gly385 390 395 400Tyr Val Asn Asn Pro Glu Ala Thr Asn
Ala Leu Ile Asp Lys Asp Gly 405 410 415Trp Leu His Ser Gly Asp Ile
Ala Tyr Trp Asp Glu Asp Glu His Phe 420 425 430Phe Ile Val Asp Arg
Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln 435 440 445Val Ala Pro
Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile 450 455 460Phe
Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu465 470
475 480Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr Met Thr Glu
Lys 485 490 495Glu Ile Val Asp Tyr Val Ala Ser Gln Val Thr Thr Ala
Lys Lys Leu 500 505 510Arg Gly Gly Val Val Phe Val Asp Glu Val Pro
Lys Gly Leu Thr Gly 515 520 525Lys Leu Asp Ala Arg Lys Ile Arg Glu
Ile Leu Ile Lys Ala Lys Lys 530 535 540Gly Gly Lys Ser Lys Leu545
55038550PRTPhotinus pyralisVARIANT(214)xaa=an amino acid other than
Thr 38Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr
Pro1 5 10 15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met
Lys Arg 20 25 30Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala
His Ile Glu 35 40 45Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser
Val Arg Leu Ala 50 55 60Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn
His Arg Ile Val Val65 70 75 80Cys Ser Glu Asn Ser Leu Gln Phe Phe
Met Pro Val Leu Gly Ala Leu 85 90 95Phe Ile Gly Val Ala Val Ala Pro
Ala Asn Asp Ile Tyr Asn Glu Arg 100 105 110Glu Leu Leu Asn Ser Met
Asn Ile Ser Gln Pro Thr Val Val Phe Val 115 120 125Ser Lys Lys Gly
Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro 130 135 140Ile Ile
Gln Lys Ile Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly145 150 155
160Phe Gln Ser Met Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe
165 170 175Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg Asp Lys
Thr Ile 180 185 190Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu
Pro Lys Gly Val 195 200 205Ala Leu Pro His Arg Xaa Ala Cys Val Arg
Phe Ser His Ala Arg Asp 210 215 220Pro Ile Phe Gly Asn Gln Ile Ile
Pro Asp Thr Ala Ile Leu Ser Val225 230 235 240Val Pro Phe His His
Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu 245 250 255Ile Cys Gly
Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu 260 265 270Phe
Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val 275 280
285Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr
290 295 300Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro
Leu Ser305 310 315 320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe
His Leu Pro Gly Ile 325 330 335Arg Gln Gly Tyr Gly Leu Thr Glu Thr
Thr Ser Ala Ile Leu Ile Thr 340 345 350Pro Glu Gly Asp Asp Lys Pro
Gly Ala Val Gly Lys Val Val Pro Phe 355 360 365Phe Glu Ala Lys Val
Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val 370 375 380Asn Gln Arg
Gly Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly385 390 395
400Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly
405 410 415Trp Leu His Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu
His Phe 420 425 430Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr
Lys Gly Tyr Gln 435 440 445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu
Leu Gln His Pro Asn Ile 450 455 460Phe Asp Ala Gly Val Ala Gly Leu
Pro Asp Asp Asp Ala Gly Glu Leu465 470 475 480Pro Ala Ala Val Val
Val Leu Glu His Gly Lys Thr Met Thr Glu Lys 485 490 495Glu Ile Val
Asp Tyr Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu 500 505 510Arg
Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly 515 520
525Lys Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys
530 535 540Gly Gly Lys Ser Lys Leu545 55039550PRTPhotinus
pyralisVARIANT(214)Xaa=Cys, Ala or Asn 39Met Glu Asp Ala Lys Asn
Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro1 5 10 15Leu Glu Asp Gly Thr
Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg 20 25 30Tyr Ala Leu Val
Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu 35 40 45Val Asn Ile
Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu Ala 50 55 60Glu Ala
Met Lys Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val65 70 75
80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu
85 90 95Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu
Arg 100 105 110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr Val
Val Phe Val 115 120 125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val
Gln Lys Lys Leu Pro 130 135 140Ile Ile Gln Lys Ile Ile Ile Met Asp
Ser Lys Thr Asp Tyr Gln Gly145 150 155 160Phe Gln Ser Met Tyr Thr
Phe Val Thr Ser His Leu Pro Pro Gly Phe 165 170 175Asn Glu Tyr Asp
Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile 180 185 190Ala Leu
Ile Met Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195 200
205Ala Leu Pro His Arg Xaa Ala Cys Val Arg Phe Ser His Ala Arg Asp
210 215 220Pro Ile Phe Gly Asn Gln Ile Ile Pro Asp Thr Ala Ile Leu
Ser Val225 230 235 240Val Pro Phe His His Gly Phe Gly Met Phe Thr
Thr Leu Gly Tyr Leu 245 250 255Ile Cys Gly Phe Arg Val Val Leu Met
Tyr Arg Phe Glu Glu Glu Leu 260 265 270Phe Leu Arg Ser Leu Gln Asp
Tyr Lys Ile Gln Ser Ala Leu Leu Val 275 280 285Pro Thr Leu Phe Ser
Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr 290 295 300Asp Leu Ser
Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser305 310 315
320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile
325 330 335Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu
Ile Thr 340 345 350Pro Glu Gly Asp Asp Lys Pro Gly Ala Val Gly Lys
Val Val Pro Phe 355 360 365Phe Glu Ala Lys Val Val Asp Leu Asp Thr
Gly Lys Thr Leu Gly Val 370 375 380Asn Gln Arg Gly Glu Leu Cys Val
Arg Gly Pro Met Ile Met Ser Gly385 390 395 400Tyr Val Asn Asn Pro
Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly 405 410 415Trp Leu His
Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe 420 425 430Phe
Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln 435 440
445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile
450 455 460Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly
Glu Leu465 470 475 480Pro Ala Ala Val Val Val Leu Glu His Gly Lys
Thr Met Thr Glu Lys 485 490 495Glu Ile Val Asp Tyr Val Ala Ser Gln
Val Thr Thr Ala Lys Lys Leu 500 505 510Arg Gly Gly Val Val Phe Val
Asp Glu Val Pro Lys Gly Leu Thr Gly 515 520 525Lys Leu Asp Ala Arg
Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys 530 535 540Gly Gly Lys
Ser Lys Leu545 55040550PRTPhotinus pyralisVARIANT(214)Xaa=Ala 40Met
Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro1 5 10
15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg
20 25 30Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile
Glu 35 40 45Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg
Leu Ala 50 55 60Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His Arg
Ile Val Val65 70 75 80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro
Val Leu Gly Ala Leu 85
90 95Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu
Arg 100 105 110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr Val
Val Phe Val 115 120 125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val
Gln Lys Lys Leu Pro 130 135 140Ile Ile Gln Lys Ile Ile Ile Met Asp
Ser Lys Thr Asp Tyr Gln Gly145 150 155 160Phe Gln Ser Met Tyr Thr
Phe Val Thr Ser His Leu Pro Pro Gly Phe 165 170 175Asn Glu Tyr Asp
Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile 180 185 190Ala Leu
Ile Met Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195 200
205Ala Leu Pro His Arg Xaa Ala Cys Val Arg Phe Ser His Ala Arg Asp
210 215 220Pro Ile Phe Gly Asn Gln Ile Ile Pro Asp Thr Ala Ile Leu
Ser Val225 230 235 240Val Pro Phe His His Gly Phe Gly Met Phe Thr
Thr Leu Gly Tyr Leu 245 250 255Ile Cys Gly Phe Arg Val Val Leu Met
Tyr Arg Phe Glu Glu Glu Leu 260 265 270Phe Leu Arg Ser Leu Gln Asp
Tyr Lys Ile Gln Ser Ala Leu Leu Val 275 280 285Pro Thr Leu Phe Ser
Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr 290 295 300Asp Leu Ser
Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser305 310 315
320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile
325 330 335Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu
Ile Thr 340 345 350Pro Xaa Gly Asp Asp Lys Pro Gly Ala Val Gly Lys
Val Val Pro Phe 355 360 365Phe Glu Ala Lys Val Val Asp Leu Asp Thr
Gly Lys Thr Leu Gly Val 370 375 380Asn Gln Arg Gly Glu Leu Cys Val
Arg Gly Pro Met Ile Met Ser Gly385 390 395 400Tyr Val Asn Asn Pro
Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly 405 410 415Trp Leu His
Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe 420 425 430Phe
Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln 435 440
445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile
450 455 460Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly
Glu Leu465 470 475 480Pro Ala Ala Val Val Val Leu Glu His Gly Lys
Thr Met Thr Glu Lys 485 490 495Glu Ile Val Asp Tyr Val Ala Ser Gln
Val Thr Thr Ala Lys Lys Leu 500 505 510Arg Gly Gly Val Val Phe Val
Asp Glu Val Pro Lys Gly Leu Thr Gly 515 520 525Lys Leu Asp Ala Arg
Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys 530 535 540Gly Gly Lys
Ser Lys Leu545 55041550PRTPhotinus pyralisVARIANT(214)Xaa=Ala 41Met
Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro1 5 10
15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg
20 25 30Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile
Glu 35 40 45 Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val
Arg Leu Ala 50 55 60Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His
Arg Ile Val Val65 70 75 80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met
Pro Val Leu Gly Ala Leu 85 90 95Phe Ile Gly Val Ala Val Ala Pro Ala
Asn Asp Ile Tyr Asn Glu Arg 100 105 110Glu Leu Leu Asn Ser Met Asn
Ile Ser Gln Pro Thr Val Val Phe Val 115 120 125Ser Lys Lys Gly Leu
Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro 130 135 140Ile Ile Gln
Lys Ile Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly145 150 155
160Phe Gln Ser Met Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe
165 170 175Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg Asp Lys
Thr Ile 180 185 190Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu
Pro Lys Gly Val 195 200 205Ala Leu Pro His Arg Xaa Ala Cys Val Arg
Phe Ser His Ala Arg Asp 210 215 220Pro Ile Phe Gly Asn Gln Ile Xaa
Pro Asp Thr Ala Ile Leu Ser Val225 230 235 240Val Pro Phe His His
Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu 245 250 255Ile Cys Gly
Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu 260 265 270Phe
Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val 275 280
285Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr
290 295 300Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro
Leu Ser305 310 315 320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe
His Leu Pro Gly Ile 325 330 335Arg Gln Gly Tyr Gly Leu Thr Glu Thr
Thr Ser Ala Ile Leu Ile Thr 340 345 350Pro Xaa Gly Asp Asp Lys Pro
Gly Ala Val Gly Lys Val Val Pro Phe 355 360 365Phe Glu Ala Lys Val
Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val 370 375 380Asn Gln Arg
Gly Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly385 390 395
400Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly
405 410 415Trp Leu His Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu
His Phe 420 425 430Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr
Lys Gly Tyr Gln 435 440 445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu
Leu Gln His Pro Asn Ile 450 455 460Phe Asp Ala Gly Val Ala Gly Leu
Pro Asp Asp Asp Ala Gly Glu Leu465 470 475 480Pro Ala Ala Val Val
Val Leu Glu His Gly Lys Thr Met Thr Glu Lys 485 490 495Glu Ile Val
Asp Tyr Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu 500 505 510Arg
Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly 515 520
525Lys Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys
530 535 540Gly Gly Lys Ser Lys Leu545 55042550PRTPhotinus
pyralisVARIANT(214)Xaa=Ala 42Met Glu Asp Ala Lys Asn Ile Lys Lys
Gly Pro Ala Pro Phe Tyr Pro1 5 10 15Leu Glu Asp Gly Thr Ala Gly Glu
Gln Leu His Lys Ala Met Lys Arg 20 25 30Tyr Ala Leu Val Pro Gly Thr
Ile Ala Phe Thr Asp Ala His Ile Glu 35 40 45Val Asn Ile Thr Tyr Ala
Glu Tyr Phe Glu Met Ser Val Arg Leu Ala 50 55 60Glu Ala Met Lys Arg
Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val65 70 75 80Cys Ser Glu
Asn Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu 85 90 95Phe Ile
Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg 100 105
110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr Val Val Phe Val
115 120 125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys
Leu Pro 130 135 140Ile Ile Gln Lys Ile Ile Ile Met Asp Ser Lys Thr
Asp Tyr Gln Gly145 150 155 160Phe Gln Ser Met Tyr Thr Phe Val Thr
Ser His Leu Pro Pro Gly Phe 165 170 175Asn Glu Tyr Asp Phe Val Pro
Glu Ser Phe Asp Arg Asp Lys Thr Ile 180 185 190Ala Leu Ile Met Asn
Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195 200 205Ala Leu Pro
His Arg Xaa Xaa Cys Val Arg Phe Ser His Ala Arg Asp 210 215 220Pro
Ile Phe Gly Asn Gln Ile Xaa Pro Asp Thr Ala Ile Leu Ser Val225 230
235 240Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr
Leu 245 250 255Ile Cys Gly Phe Arg Val Val Leu Met Tyr Arg Phe Glu
Glu Glu Leu 260 265 270Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln
Ser Ala Leu Leu Val 275 280 285Pro Thr Leu Phe Ser Phe Phe Ala Lys
Ser Thr Leu Ile Asp Lys Tyr 290 295 300Asp Leu Ser Asn Leu His Glu
Ile Ala Ser Gly Gly Ala Pro Leu Ser305 310 315 320Lys Glu Val Gly
Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile 325 330 335Arg Gln
Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr 340 345
350Pro Xaa Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe
355 360 365Phe Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu
Gly Val 370 375 380Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met
Ile Met Ser Gly385 390 395 400Tyr Val Asn Asn Pro Glu Ala Thr Asn
Ala Leu Ile Asp Lys Asp Gly 405 410 415Trp Leu His Ser Gly Asp Ile
Ala Tyr Trp Asp Glu Asp Glu His Phe 420 425 430Phe Ile Val Asp Arg
Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln 435 440 445Val Ala Pro
Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile 450 455 460Phe
Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu465 470
475 480Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr Met Thr Glu
Lys 485 490 495Glu Ile Val Asp Tyr Val Ala Ser Gln Val Thr Thr Ala
Lys Lys Leu 500 505 510Arg Gly Gly Val Val Phe Val Asp Glu Val Pro
Lys Gly Leu Thr Gly 515 520 525Lys Leu Asp Ala Arg Lys Ile Arg Glu
Ile Leu Ile Lys Ala Lys Lys 530 535 540Gly Gly Lys Ser Lys Leu545
550
* * * * *