U.S. patent application number 14/092216 was filed with the patent office on 2014-06-12 for polysaccharide synthases (h).
This patent application is currently assigned to The University Of Melbourne. The applicant listed for this patent is Commonwealth Scientific And Industrial Research Organisation, Grains Research & Development Corporation, The University Of Adelaide, The University Of Melbourne. Invention is credited to Antony BACIC, Rachel Anita BURTON, Monika Susanne DOBLIN, Geoffrey Bruce FINCHER, Stephen Alan JOBLING, Filomena Angela PETTOLINO.
Application Number | 20140165231 14/092216 |
Document ID | / |
Family ID | 40800585 |
Filed Date | 2014-06-12 |
United States Patent
Application |
20140165231 |
Kind Code |
A1 |
DOBLIN; Monika Susanne ; et
al. |
June 12, 2014 |
POLYSACCHARIDE SYNTHASES (H)
Abstract
The present invention relates generally to polysaccharide
synthases. More particularly, the present invention relates to
(1,3;1,4)-.beta.-D-glucan synthases. The present invention
provides, among other things, methods for influencing the level of
(1,3;1,4)-.beta.-D-glucan produced by a cell and nucleic acid and
amino acid sequences which encode (1,3;1,4)-.beta.-D-glucan
synthases.
Inventors: |
DOBLIN; Monika Susanne;
(Victoria, AU) ; PETTOLINO; Filomena Angela;
(Victoria, AU) ; BACIC; Antony; (Victoria, AU)
; JOBLING; Stephen Alan; (Australian Capital Territory,
AU) ; FINCHER; Geoffrey Bruce; (South Australia,
AU) ; BURTON; Rachel Anita; (South Australia,
AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University Of Melbourne
Grains Research & Development Corporation
The University Of Adelaide
Commonwealth Scientific And Industrial Research
Organisation |
Victoria
Australian Capital Territory
South Australia
Australian Capital Territory |
|
AU
AU
AU
AU |
|
|
Assignee: |
The University Of Melbourne
Victoria
AU
Grains Research & Development Corporation
Australian Capital Territory
AU
The University Of Adelaide
South Australia
AU
Commonwealth Scientific And Industrial Research
Organisation
Australian Capital Territory
AU
|
Family ID: |
40800585 |
Appl. No.: |
14/092216 |
Filed: |
November 27, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12810227 |
Nov 29, 2010 |
8618356 |
|
|
PCT/AU2008/001906 |
Dec 24, 2008 |
|
|
|
14092216 |
|
|
|
|
Current U.S.
Class: |
800/298 ;
435/419; 435/468 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12N 15/8245 20130101; C12N 15/8261 20130101; C12N 9/1051 20130101;
C12N 15/8246 20130101 |
Class at
Publication: |
800/298 ;
435/468; 435/419 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 24, 2007 |
AU |
2007907071 |
Claims
1. A method for modulating the level of (1,3;1,4)-.beta.-D-glucan
produced by a plant or fungal cell, the method comprising
modulating the level and/or activity of a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in the cell, wherein the level
and/or activity of the a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase is modulated by modulating the expression of a CslH
nucleic acid in the cell, and wherein modulating the expression of
a CslH nucleic acid in the cell results in modulation of the level
of (1,3;1,4)-.beta.-D-glucan produced by the cell compared to a
wild-type cell of the same taxon, and wherein the CslH nucleic acid
comprises: (i) a nucleotide sequence set forth in SEQ ID NO: 72;
(ii) a nucleotide sequence encoding the amino acid sequence set
forth in SEQ ID NO: 75; or (iii) a nucleotide sequence encoding an
amino acid sequence which is at least 50% identical to the amino
acid sequence set forth in SEQ ID NO: 75.
2. The method of claim 1 wherein the cell is a plant cell.
3. The method of claim 2 wherein the cell is a monocot plant
cell.
4. The method of claim 2 wherein the cell is a cereal crop plant
cell.
5. A plant or fungal cell comprising any one or more of: a
modulated level and/or activity of CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase relative to a wild type cell of
the same taxon; and/or modulated expression of a CslH nucleic acid
relative to a wild type cell of the same taxon, wherein the cell
comprises a modulated level of (1,3;1,4)-.beta.-D-glucan relative
to a wild-type cell of the same taxon, wherein the CslH nucleic
acid comprises: (i) a nucleotide sequence set forth in SEQ ID NO:
72; (ii) a nucleotide sequence encoding the amino acid sequence set
forth in SEQ ID NO: 75; or (iii) a nucleotide sequence encoding an
amino acid sequence which is at least 50% identical to the amino
acid sequence set forth in SEQ ID NO: 75.
6. The cell of claim 5 wherein the cell is produced according to
the method of claim 1.
7. The cell of claim 5 wherein the cell is a plant cell.
8. The cell of claim 7 wherein the cell is a monocot plant
cell.
9. The cell of claim 7 wherein the cell is a cereal crop plant
cell.
10. A multicellular structure comprising one or more cells
according to claim 5.
11. The multicellular structure of claim 10 wherein the
multicellular structure is selected from the list consisting of a
whole plant, a plant tissue, a plant organ, a plant part, plant
reproductive material or cultured plant tissue.
12. The multicellular structure of claim 10 wherein the
multicellular structure comprises a cereal crop plant or a tissue,
organ or part thereof.
13. The multicellular structure of claim 12 wherein the
multicellular structure comprises a cereal grain.
14. The multicellular structure of claim 11 wherein the
multicellular structure comprises a cell having modulated dietary
fibre content relative to a wild type cell of the same taxon.
15. The multicellular structure of claim 14 wherein the
multicellular structure comprises a cell having an increased level
of (1,3;1,4)-.beta.-D-glucan relative to a wild type cell of the
same taxon and an increased dietary fibre content relative to a
wild type cell of the same taxon.
Description
PRIORITY CLAIM
[0001] The present invention claims priority to Australian
provisional patent application 2007907071 the content of which is
hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to polysaccharide
synthases. More particularly, the present invention relates to
(1,3;1,4)-.beta.-D-glucan synthases.
BACKGROUND OF THE INVENTION
[0003] The various tissues of cereal grains have diverse functions
during grain development, dormancy and after germination.
[0004] For example, the pericarp and seed coat tissues are
concerned with the protection of the seed during development and
during dormancy. However, by grain maturity, these outer grain
tissues have died and the tissue residues consist almost entirely
of cell wall residues. The nucellar tissue between the seed coat
and the aleurone surface is involved in transfer of nutrients to
the developing grain, however, at maturity this tissue has also
collapsed to leave cell wall remnants. The thin walled cells of the
starchy endosperm of mature grain are dead, but are packed with
starch and storage protein. In contrast, the thick-walled,
nucleated, aleurone cells are alive at grain maturity, and are
packed with protein bodies and lipid droplets. At the interface of
the starchy endosperm lies the scutellum, which functions in
delivering nutrients to the developing endosperm and, during
germination, transfers digestion products of the endosperm reserves
to the developing embryo.
[0005] The different structure and function of each tissue type in
the grain is determined, at least in part, by the cell wall
composition of each of these cell types.
[0006] Non-cellulosic polysaccharides are key components in the
cell walls of cereal grain tissues and include, for example,
(1,3;1,4)-.beta.-D-glucans, heteroxylans (mainly arabinoxylans),
glucomannans, xyloglucans, pectic polysaccharides and callose.
These non-cellulosic polysaccharides usually constitute less than
10% of the overall weight of the grain, but nevertheless are key
determinants of grain quality.
[0007] Although the precise physical relationships between
individual non-cellulosic polysaccharides and other wall components
have not been described, it is generally considered that in the
wall, microfibrils of cellulose are embedded in a matrix phase of
non-cellulosic polysaccharides and protein. Wall integrity is
maintained predominantly through extensive non-covalent
interactions, especially hydrogen bonding, between the matrix phase
and microfibrillar constituents. In the walls of some grain tissues
covalent associations between heteroxylans, lignin and proteins are
present. The extent of covalent associations between components
also varies with the wall type and genotype.
[0008] Non-cellulosic polysaccharides, especially heteroxylans and
(1,3;1,4)-.beta.-D-glucans, constitute a relatively high proportion
of the walls of the aleurone and starchy endosperm, and probably
also of the scutellum. In these tissues, cellulose contents are
correspondingly lower. The generally low cellulose content of these
walls, together with the fact that they contain no lignin, are
thought to be related to a limited requirement for structural
rigidity of walls in central regions of the grain, and to a
requirement to rapidly depolymerize wall components following
germination of the grain.
[0009] In contrast, in the cell walls of the pericarp-seed coat,
which provides a protective coat for the embryo and endosperm and
which is not mobilized during germination, cellulose and lignin
contents are much higher and the concentrations of non-cellulosic
polysaccharides are correspondingly lower.
[0010] (1,3;1,4)-.beta.-D-glucans, also referred to as
mixed-linkage or cereal .beta.-glucans, are non-cellulosic
polysaccharides which naturally occur in plants of the
monocotyledon family Poaceae, to which the cereals and grasses
belong, and in related families of the order Poales.
[0011] These non-cellulosic polysaccharides are important
constituents of the walls of the starchy endosperm and aleurone
cells of most cereal grains, where they can account for up to
70%-90% by weight of the cell walls.
[0012] Barley, oat and rye grains are rich sources of
(1,3;1,4)-.beta.-D-glucan, whereas wheat, rice and maize have lower
concentrations of this polysaccharide. The
(1,3;1,4)-.beta.-D-glucans are also relatively minor components of
walls in vegetative tissues of cereals and grasses. Although
present as a relatively minor component in vegetative tissues
(1,3;1,4)-.beta.-D-glucan) is still important in terms of, for
example, the digestibility of vegetative tissue by animals and in
the use of crop residues for bioethanol production.
[0013] (1,3;1,4)-.beta.-D-glucans are important in large-scale food
processing activities that include brewing and stockfeed
manufacture. Moreover, the non-starchy polysaccharides of cereals,
such as (1,3;1,4)-.beta.-D-glucans, have attracted renewed interest
in recent years because of their potentially beneficial effects in
human nutrition.
[0014] However, despite this interest, major gaps remain in our
knowledge of the genes and enzymes that control non-cellulosic
polysaccharide biosynthesis, including (1,3;1,4)-.beta.-D-glucan
biosynthesis, in cereal grain.
[0015] (1,3;1,4)-.beta.-D-glucan concentrations in grain are
thought to be influenced by both genotype and environment. For
example, the concentration of (1,3;1,4)-.beta.-D-glucan in cereal
grains depends on the genotype, the position of the grain on the
spike and environmental factors such as planting location, climatic
conditions during development and soil nitrogen.
[0016] Identification of the genes encoding
(1,3;1,4)-.beta.-D-glucan synthases would be desirable, as this
would facilitate modulation of the level of
(1,3;1,4)-.beta.-D-glucan produced by a cell, and therefore, allow
the qualities of grain or vegetative tissue to be altered.
Therefore, in order to enable the modulation of the level of
(1,3;1,4)-.beta.-D-glucan in a cell and associated changes in grain
or vegetative tissue quality, there is a clear need to identify
genes that encode (1,3;1,4)-.beta.-D-glucan synthases.
[0017] Reference to any prior art in this specification is not, and
should not be taken as, an acknowledgment or any form of suggestion
that this prior art forms part of the common general knowledge in
any country.
SUMMARY OF THE INVENTION
[0018] In accordance with the present invention, nucleotide
sequences and corresponding amino acid sequences that encode a
family of (1,3;1,4)-.beta.-D-glucan synthases are provided. In
accordance with the present invention, it has been revealed that
(1,3;1,4)-.beta.-D-glucan synthases are encoded by members of the
CslH gene family.
[0019] As a result of the identification of nucleotide sequences
and corresponding amino acid sequences that encode
(1,3;1,4)-.beta.-D-glucan synthases, the present invention
provides, inter alia, methods and compositions for modulating the
level and/or activity of (1,3;1,4)-.beta.-D-glucan synthase in a
cell and/or modulating the level of (1,3;1,4)-.beta.-D-glucan
produced by the cell.
[0020] Therefore, in a first aspect, the present invention provides
a method for modulating the level of (1,3;1,4)-.beta.-D-glucan
produced by a cell, the method comprising modulating the level
and/or activity of a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase in the cell.
[0021] In some embodiments, the level and/or activity of a
(1,3;1,4)-.beta.-D-glucan synthase is modulated by modulating the
expression of a CslH nucleic acid in the cell. Therefore, in a
second aspect, the present invention provides a method for
modulating the level and/or activity of a (1,3;1,4)-.beta.-D-glucan
synthase in a cell, the method comprising modulating the expression
of a CslH nucleic acid in the cell.
[0022] In some embodiments, the present invention contemplates
increasing the level of (1,3;1,4)-.beta.-D-glucan produced by a
cell, by expressing, overexpressing or introducing a CslH nucleic
acid into the cell. Alternatively, in further embodiments the
present invention also provides methods for down-regulating
expression of a CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase in
a cell by knockout or knockdown of a CslH nucleic acid in a
cell.
[0023] The present invention also facilitates the production of
(1,3;1,4)-.beta.-D-glucan in a recombinant expression system. For
example, (1,3;1,4)-.beta.-D-glucan may be recombinantly produced by
introducing a CslH nucleic acid under the control of a promoter,
into a cell, wherein the cell subsequently expresses a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase and produces
(1,3;1,4)-.beta.-D-glucan. Therefore, in a third aspect, the
present invention provides a method for producing
(1,3;1,4)-.beta.-D-glucan, the method comprising transforming a
cell with an isolated CslH nucleic acid and allowing the cell to
express the isolated CslH nucleic acid.
[0024] In a fourth aspect, the present invention also provides
(1,3;1,4)-.beta.-D-glucan produced according to the method of the
third aspect of the invention.
[0025] In a fifth aspect, the present invention also provides a
cell comprising: [0026] a modulated level and/or activity of
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase relative to a wild
type cell of the same taxon; and/or [0027] modulated expression of
a CslH nucleic acid relative to a wild type cell of the same
taxon.
[0028] In some embodiments, the cell further comprises a modulated
level of (1,3;1,4)-.beta.-D-glucan relative to a wild type cell of
the same taxon.
[0029] Furthermore, in a sixth aspect, the present invention
provides a multicellular structure comprising one or more cells
according to the fifth aspect of the invention.
[0030] The present invention also provides cereal grain comprising
one or more cells according to the fifth aspect of the invention.
Therefore, in a seventh aspect, the present invention provides a
cereal grain comprising a modulated level of
(1,3;1,4)-.beta.-D-glucan, wherein the grain comprises one or more
cells comprising a modulated level and/or activity of a
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase and/or modulated
expression of a CslH nucleic acid.
[0031] In an eighth aspect, the present invention also provides
flour comprising: [0032] flour produced by the milling of the grain
of the seventh aspect of the invention; and [0033] optionally,
flour produced by the milling of one or more other grains.
[0034] As set out above, the present invention is predicated, in
part, on the identification and isolation of CslH nucleotide
sequences and CslH amino acid sequences that encode
(1,3;1,4)-.beta.-D-glucan synthases.
[0035] Therefore, in a ninth aspect, the present invention provides
an isolated CslH nucleic acid or a complement, reverse complement
or fragment thereof.
[0036] In a tenth aspect, the present invention provides a genetic
construct or vector comprising an isolated nucleic acid molecule of
the ninth aspect of the invention.
[0037] In an eleventh aspect, the present invention provides a cell
comprising the isolated nucleic acid molecule of the ninth aspect
of the invention or genetic construct of the tenth aspect of the
invention.
[0038] In a twelfth aspect, the present invention provides a
multicellular structure comprising one or more of the cells of the
eleventh aspect of the invention.
[0039] As set out above, the present invention also provides amino
acid sequences for CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthases.
[0040] Accordingly, in a thirteenth aspect, the present invention
provides an isolated polypeptide comprising an amino acid sequence
defining a CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
polypeptide or a fragment thereof.
[0041] In a fourteenth aspect, the present invention provides an
antibody or an epitope binding fragment thereof, raised against an
isolated CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
polypeptide as hereinbefore defined or an epitope thereof.
[0042] Throughout this specification, unless the context requires
otherwise, the word "comprise", or variations such as "comprises"
or "comprising", will be understood to imply the inclusion of a
stated element or integer or group of elements or integers but not
the exclusion of any other element or integer or group of elements
or integers.
[0043] Nucleotide and amino acid sequences are referred to herein
by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs:
correspond numerically to the sequence identifiers <400>1
(SEQ ID NO: 1), <400>2 (SEQ ID NO: 2), etc. A summary of the
sequence identifiers is provided in Table 1. A sequence listing is
provided at the end of the specification.
TABLE-US-00001 TABLE 1 Summary of Sequence Identifiers Sequence
Identifier Sequence SEQ ID NO: 1 HvCslH1 coding region nucleotide
sequence SEQ ID NO: 2 HvCslH1 amino acid sequence SEQ ID NO: 3
OsCslH1 coding region nucleotide sequence SEQ ID NO: 4 OsCslH1
amino acid sequence SEQ ID NO: 5 OsCslH2 coding region nucleotide
sequence SEQ ID NO: 6 OsCslH2 amino acid sequence SEQ ID NO: 7
OsCslH3 coding region nucleotide sequence SEQ ID NO: 8 OsCslH3
amino acid sequence SEQ ID NO: 9 HvCslH1 genomic nucleotide
sequence SEQ ID NO: 10 OsCslH1 genomic nucleotide sequence SEQ ID
NO: 11 OsCslH2 genomic nucleotide sequence SEQ ID NO: 12 OsCslH3
genomic nucleotide sequence SEQ ID NO: 13 H1F1 primer nucleotide
sequence SEQ ID NO: 14 H1F2 primer nucleotide sequence SEQ ID NO:
15 HvCslH1cF1 primer nucleotide sequence SEQ ID NO: 16 HvH1TOPOf
primer nucleotide sequence SEQ ID NO: 17 H1R1 primer nucleotide
sequence SEQ ID NO: 18 H1R2 primer nucleotide sequence SEQ ID NO:
19 H1R5 primer nucleotide sequence SEQ ID NO: 20 H1R6 primer
nucleotide sequence SEQ ID NO: 21 H1R7 primer nucleotide sequence
SEQ ID NO: 22 H1R10 primer nucleotide sequence SEQ ID NO: 23
HvCslH1cR1 primer nucleotide sequence SEQ ID NO: 24 HvH1TOPOr
primer nucleotide sequence SEQ ID NO: 25 Adaptor 1 primer
nucleotide sequence SEQ ID NO: 26 Adaptor 2 primer nucleotide
sequence SEQ ID NO: 27 AP1 primer nucleotide sequence SEQ ID NO: 28
AP2 primer nucleotide sequence SEQ ID NO: 29 Hv18SRTr primer
nucleotide sequence SEQ ID NO: 30 Hv18Sf primer nucleotide sequence
SEQ ID NO: 31 Hv18Sr primer nucleotide sequence SEQ ID NO: 32 Hv
GAPDH Q-PCR forward primer nucleotide sequence SEQ ID NO: 33 Hv
GAPDH Q-PCR reverse primer nucleotide sequence SEQ ID NO: 34 Hv
Cyclophilin Q-PCR forward primer nucleotide sequence SEQ ID NO: 35
Hv Cyclophilin Q-PCR reverse primer nucleotide sequence SEQ ID NO:
36 Hv .alpha.-Tubulin Q-PCR forward primer nucleotide sequence SEQ
ID NO: 37 Hv .alpha.-Tubulin Q-PCR reverse primer nucleotide
sequence SEQ ID NO: 38 Hv HSP70 Q-PCR forward primer nucleotide
sequence SEQ ID NO: 39 Hv HSP70 Q-PCR reverse primer nucleotide
sequence SEQ ID NO: 40 Hv EL1a Q-PCR forward primer nucleotide
sequence SEQ ID NO: 41 Hv EL1a Q-PCR reverse primer nucleotide
sequence SEQ ID NO: 42 HvCslH1 Q-PCR forward primer nucleotide
sequence SEQ ID NO: 43 HvCslH1 Q-PCR reverse primer nucleotide
sequence SEQ ID NO: 44 SJ27 primer nucleotide sequence SEQ ID NO:
45 SJ28 primer nucleotide sequence SEQ ID NO: 46 SJ72 primer
nucleotide sequence SEQ ID NO: 47 SJ73 primer nucleotide sequence
SEQ ID NO: 48 SJ79 primer nucleotide sequence SEQ ID NO: 49 SJ75
primer nucleotide sequence SEQ ID NO: 50 SJ85 primer nucleotide
sequence SEQ ID NO: 51 SJ91 primer nucleotide sequence SEQ ID NO:
52 SJ163 primer nucleotide sequence SEQ ID NO: 53 SJ164 primer
nucleotide sequence SEQ ID NO: 54 SJ183 primer nucleotide sequence
SEQ ID NO: 55 SJ204 primer nucleotide sequence SEQ ID NO: 56 TUB
primer nucleotide sequence SEQ ID NO: 57 TUB2F primer nucleotide
sequence SEQ ID NO: 58 SJ107 primer nucleotide sequence SEQ ID NO:
59 SJ82 primer nucleotide sequence SEQ ID NO: 60 SJ94 primer
nucleotide sequence SEQ ID NO: 61 SJ95 primer nucleotide sequence
SEQ ID NO: 62 SJ97 primer nucleotide sequence SEQ ID NO: 63 SJ93
primer nucleotide sequence SEQ ID NO: 64 SJ44 primer nucleotide
sequence SEQ ID NO: 65 SJ38 primer nucleotide sequence SEQ ID NO:
66 SJ96 primer nucleotide sequence SEQ ID NO: 67 SJ37 primer
nucleotide sequence SEQ ID NO: 68 SJ244 primer nucleotide sequence
SEQ ID NO: 69 HvCslH1 (cv. Himalaya) coding region nucleotide
sequence SEQ ID NO: 70 HvCslH1 (cv. Himalaya) amino acid sequence
SEQ ID NO: 71 HvCslH1 (cv. Himalaya) genomic nucleotide sequence
SEQ ID NO: 72 TaCslH1-1 coding region nucleotide sequence SEQ ID
NO: 73 TaCslH1-2 coding region nucleotide sequence SEQ ID NO: 74
TaCslH1-3 coding region nucleotide sequence SEQ ID NO: 75 TaCslH1-1
amino acid sequence SEQ ID NO: 76 TaCslH1-2 amino acid sequence SEQ
ID NO: 77 TaCslH1-3 amino acid sequence SEQ ID NO: 78 TaCslH1-1
genomic nucleotide sequence SEQ ID NO: 79 TaCslH1-2 genomic
nucleotide sequence SEQ ID NO: 80 TaCslH1-3 genomic nucleotide
sequence
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0044] It is to be understood that following description is for the
purpose of describing particular embodiments only and is not
intended to be limiting with respect to the above description.
[0045] The present invention is predicated, in part, on the
identification of genes which encode biosynthetic enzymes for
(1,3;1,4)-.beta.-D-glucans.
[0046] "(1,3;1,4)-.beta.-D-glucans" should be understood to include
linear, unbranched polysaccharides in which .beta.-D-glucopyranosyl
monomers are polymerized through both (1.fwdarw.4)- and
(1.fwdarw.3)-linkages.
[0047] The ratio of (1.fwdarw.4)- to (1.fwdarw.3)-linkages in
naturally occurring (1,3;1,4)-.beta.-D-glucans is generally in the
range 2.2-2.6:1, although the ratio may also be outside of this
range. For example, in (1,3;1,4)-.beta.-D-glucan from sorghum
endosperm the ratio is 1.15:1. The two types of linkages are not
arranged in regular, repeating sequences. Single
(1.fwdarw.3)-linkages are separated by two or more
(1.fwdarw.4)-linkages. Regions of two or three adjacent
(1.fwdarw.4)-linkages predominate, but again there is no regularity
in the arrangement of these units. The linkage sequence does not
depend on preceding linkages further away than two glucose units
and follows a second order Markov chain distribution. Moreover, up
to 10% of the chain may consist of longer stretches of 5 to 20
adjacent (1.fwdarw.4)-linkages. Thus, cereal
(1,3;1,4)-.beta.-D-glucans may be considered as
(1.fwdarw.3)-.beta.-linked copolymers of cellotriosyl
(G4G4G.sub.Red), cellotetraosyl (G4G4G4G.sub.Red) units and longer
(1.fwdarw.4)-.beta.-D-oligoglucosyl units.
[0048] The ratio of tri- to tetra-saccharide units in endogenous
(1,3;1,4)-.beta.-D-glucans varies between cereal species. For
example, in wheat the ratio is 3.0-4.5:1, in barley 2.9-3.4:1, in
rye 2.7:1 and in oats 1.8-2.3:1. Furthermore, the observed ratios
may also vary according to the temperature and conditions of
(1,3;1,4)-.beta.-D-glucan extraction.
[0049] The average molecular masses reported for cereal
(1,3;1,4)-.beta.-D-glucans range from 48,000 (DP .about.300) to
3,000,000 (DP .about.1850), depending on the cereal species, cell
wall type, extraction procedure and the method used for molecular
mass determination. They are invariably polydisperse with respect
to molecular mass and this is illustrated by a weight average to
number average molecular mass ratio (M.sub.w/M.sub.n) of 1.18 for
barley (1,3;1,4)-.beta.-D-glucan. Certain barley
(1,3;1,4)-.beta.-D-glucans are also covalently-associated with
small amounts of protein and have estimated molecular masses of up
to 40,000,000.
[0050] The extractability of (1,3;1,4)-.beta.-D-glucans from walls
of cereal grains is a function of their degree of self-association
and their association with other wall polysaccharides and proteins.
In particular, extractability depends on the molecular mass and
linkage distribution in the (1,3;1,4)-.beta.-D-glucan chains.
Extensive association with other polymers and very high molecular
masses render the (1,3;1,4)-.beta.-D-glucans more difficult to
extract from grain.
[0051] For example, a portion of the (1,3;1,4)-.beta.-D-glucan from
barley, oat and rye flours may be extracted by water at pH 7.0 and
40.degree. C. Further fractions can be solubilised at higher
temperatures. The proportion of total (1,3;1,4)-.beta.-D-glucan
that is water-soluble at 40.degree. C. varies within and between
species. For example, waxy (high amylose) barleys have a higher
proportion of water-soluble (1,3;1,4)-.beta.-D-glucan than normal
barleys. (1,3;1,4)-.beta.-D-glucans extracted from barley at
40.degree. C. have a slightly lower tri-/tetrasaccharide ratio
(1.7:1) than those extracted at 65.degree. C. (2.0:1). Complete
extraction of cereal (1,3;1,4)-.beta.-D-glucans from grain requires
the use of alkaline extractants such as 4 M NaOH or aqueous
Ba(OH).sub.2, containing NaBH.sub.4 to prevent alkali-induced
degradation from the reducing terminus. Alkali-extracted barley
(1,3;1,4)-.beta.-D-glucan fractions have higher molecular masses,
higher ratios of (1.fwdarw.4):(1.fwdarw.3) linkages, more
contiguously linked (1.fwdarw.4)-linked segments and higher
tri-:tetra-saccharide ratios than their water-extractable
counterparts. Other extractants, such as dimethylsulphoxide, hot
perchloric acid, trichloroacetic acid, N-methylmorpholino-N-oxide
and dimethylacetamide-LiCl, may also be used to solubilise
(1,3;1,4)-.beta.-D-glucans, but these extractants may cause some
depolymerisation or degradation of the polymer. Once extracted with
hot water or alkali, the (1,3;1,4)-.beta.-D-glucans are often
soluble at neutral pH and room temperature. However, upon cooling,
(1,3;1,4)-.beta.-D-glucans can aggregate and precipitate.
[0052] As mentioned above, the present invention is predicated, in
part, on the identification of biosynthetic enzymes, and their
encoding genes, that catalyse the synthesis of
(1,3;1,4)-.beta.-D-glucan. Such enzymes are referred to herein as
"(1,3;1,4)-.beta.-D-glucan synthases".
[0053] The present invention arises, in part, from an analysis of
expressed sequence tag libraries and other sequence databases
including cellulose synthase (CesA) genes. More particularly, it
was noted in these analyses that the CesA genes were in fact
members of a much larger super-family of genes, which included both
the CesA genes and the cellulose synthase-like (Csl) gene
family.
[0054] The Csl gene families in most vascular plants are very large
and have been divided into several groups, designated CslA to CslH.
In Arabidopsis thaliana there are 29 known Csl genes and in rice
about 37. Overall, the Arabidopsis genome is believed to contain
more than 700 genes involved in cell wall metabolism. However, in
general, the specific functions of these genes are poorly
understood.
[0055] Furthermore, in contrast to the CesA genes, it has proved
difficult to define the functions of the Csl genes. In fact, of the
multiple Csl genes in higher plants, only the CslA and CslF groups
have been assigned a function.
[0056] In accordance with the present invention, it has been
revealed that members of the CslH gene family encode
(1,3;1,4)-.beta.-D-glucan synthases.
[0057] As a result of the identification of CslH nucleotide
sequences, and corresponding amino acid sequences that encode
(1,3;1,4)-.beta.-D-glucan synthases, the present invention
provides, inter alia, methods and compositions for modulating the
level and/or activity of (1,3;1,4)-.beta.-D-glucan synthase in a
cell and/or modulating the level of (1,3;1,4)-.beta.-D-glucan
produced by the cell.
[0058] Therefore, in a first aspect, the present invention provides
a method for modulating the level of (1,3;1,4)-.beta.-D-glucan
produced by a cell, the method comprising modulating the level
and/or activity of a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase in the cell.
[0059] The "cell" may be any suitable eukaryotic or prokaryotic
cell. As such, a "cell" as referred to herein may be a eukaryotic
cell including a fungal cell such as a yeast cell or mycelial
fungus cell; an animal cell such as a mammalian cell or an insect
cell; or a plant cell. Alternatively, the cell may also be a
prokaryotic cell such as a bacterial cell including an E. coli
cell, or an archaea cell.
[0060] In some embodiments, the cell is a plant cell, a vascular
plant cell, including a monocotyledonous or dicotyledonous
angiosperm plant cell, or a gymnosperm plant cell. In some
embodiments the plant is a monocotyledonous plant cell. In some
embodiments, the plant is a member of the order Poales. In some
embodiments, the monocotyledonous plant cell is a cereal crop plant
cell.
[0061] As used herein, the term "cereal crop plant" includes
members of the Poales (grass family) that produce edible grain for
human or animal food. Examples of Poales cereal crop plants which
in no way limit the present invention include wheat, rice, maize,
millet, sorghum, rye, triticale, oats, barley, teff, wild rice,
spelt and the like. However, the term cereal crop plant should also
be understood to include a number of non-Poales species that also
produce edible grain and are known as the pseudocereals, such as
amaranth, buckwheat and quinoa.
[0062] In other embodiments, the present invention also
contemplates the use of other monocotyledonous plants, such as
other non-cereal plants of the Poales, specifically including
pasture grasses such as Lolium spp.
[0063] As set out above, the present invention is predicated, in
part, on modulating the level and/or activity of a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in a cell.
[0064] A "CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase" should
be regarded as any CslH-encoded protein which catalyses the
synthesis of (1,3;1,4)-.beta.-D-glucan and, optionally, catalyses
the polymerisation of glucopyranosyl monomers.
[0065] In some embodiments, the CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase comprises the amino acid
sequence set forth in SEQ ID NO: 2 or an amino acid sequence which
is at least 50% identical thereto.
[0066] In some embodiments the CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase comprises at least 50%, at least
51%, at least 52%, at least 53%, at least 54%, at least 55%, at
least 56%, at least 57%, at least 58%, at least 59%, at least 60%,
at least 61%, at least 62%, at least 63%, at least 64%, at least
65%, at least 66%, at least 67%, at least 68%, at least 69%, at
least 70%, at least 71%, at least 72%, at least 73%, at least 74%,
at least 75%, at least 76%, at least 77%, at least 78%, at least
79%, at least 80%, at least 81%, at least 82%, at least 83%, at
least 84%, at least 85%, at least 86%, at least 87%, at least 88%,
at least 89%, at least 90%, at least 90.5%, at least 91%, at least
91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%,
at least 94%, at least 94.5%, at least 95%, at least 95.5%, at
least 96%, at least 96.5%, at least 97%, at least 97.5%, at least
98%, at least 98.5%, at least 99% at least 99.5% or 100% amino acid
sequence identity to SEQ ID NO: 2.
[0067] When comparing amino acid sequences, the compared sequences
should be compared over a comparison window of at least 100 amino
acid residues, at least 200 amino acid residues, at least 400 amino
acid residues, at least 800 amino acid residues or over the full
length of SEQ ID NO: 2. The comparison window may comprise
additions or deletions (i.e. gaps) of about 20% or less as compared
to the reference sequence (which does not comprise additions or
deletions) for optimal alignment of the two sequences. Optimal
alignment of sequences for aligning a comparison window may be
conducted by computerized implementations of algorithms such the
BLAST family of programs as, for example, disclosed by Altschul et
al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion
of sequence analysis can be found in Unit 19. 3 of Ausubel et al.
(Current Protocols in Molecular Biology, John Wiley & Sons Inc,
1994-1998, Chapter 15, 1998).
[0068] Examples of additional CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthases contemplated by the present
invention include CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
orthologs of SEQ ID NO: 2.
[0069] For example, barley (Hordeum vulgare) orthologs or allelic
variants of SEQ ID NO: 2 include, for example, polypeptides
comprising the amino acid sequence set forth in SEQ ID NO: 70. Rice
(Oryza sativa) orthologs of SEQ ID NO: 2 include, for example,
polypeptides comprising the amino acid sequences set forth in any
of SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8. Wheat (Triticum
aestivum) orthologs of SEQ ID NO: 2 include, for example,
polypeptides comprising the amino acid sequences set forth in SEQ
ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77.
[0070] As referred to herein, modulation of the "level" of the
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase should be
understood to include modulation of the level of CslH transcripts
and/or CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase polypeptides
in the cell. Modulation of the "activity" of the CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase should be understood to include
modulation of the total activity, specific activity, half-life
and/or stability of the CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase in the cell.
[0071] By "modulating" with regard to the level and/or activity of
the CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase is intended
decreasing or increasing the level and/or activity of CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in the cell. By "decreasing" is
intended, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%
reduction in the level or activity of CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in the cell. By "increasing" is
intended, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20 fold, 50-fold, 100-fold
increase in the level of activity of CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in the cell. "Modulating" also
includes introducing a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase into a cell which does not normally express the introduced
enzyme, or the substantially complete inhibition of CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase activity in a cell that normally
has such activity.
[0072] In some embodiments, the level of (1,3;1,4)-.beta.-D-glucan
produced by a cell is increased by increasing the level and/or
activity of CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase in the
cell. In another embodiment, the level of (1,3;1,4)-.beta.-D-glucan
produced by a cell is decreased by decreasing the level and/or
activity of CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase in the
cell.
[0073] The methods of the present invention contemplate any means
known in the art by which the level and/or activity of a
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase in a cell may be
modulated. This includes methods such as the application of agents
which modulate CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
activity in a cell, such as the application of a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase agonist or antagonist; the
application of agents which mimic CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase activity in a cell; modulating
the expression of a CslH nucleic acid which encodes CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in the cell; or effecting the
expression of an altered or mutated CslH nucleic acid in a cell
such that a (1,3;1,4)-.beta.-D-glucan synthase with increased or
decreased specific activity, half-life and/or stability is
expressed by the cell.
[0074] In some embodiments, the level and/or activity of a
(1,3;1,4)-.beta.-D-glucan synthase is modulated by modulating the
expression of a CslH nucleic acid in the cell.
[0075] Therefore, in a second aspect, the present invention
provides a method for modulating the level and/or activity of a
(1,3;1,4)-.beta.-D-glucan synthase in a cell, the method comprising
modulating the expression of a CslH nucleic acid in the cell.
[0076] As used herein, the term "CslH nucleic acid" should be
understood to include to a nucleic acid molecule which: [0077]
encodes a CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase as
defined herein; and/or [0078] comprises at least 50% nucleotide
sequence identity to the nucleotide sequence set forth in SEQ ID
NO: 1; and/or [0079] hybridises to a nucleic acid molecule
comprising one or more of the nucleotide sequence set forth in SEQ
ID NO: 1 under stringent conditions.
[0080] In some embodiments the CslH nucleic acid comprises at least
50%, at least 51%, at least 52%, at least 53%, at least 54%, at
least 55%, at least 56%, at least 57%, at least 58%, at least 59%,
at least 60%, at least 61%, at least 62%, at least 63%, at least
64%, at least 65%, at least 66%, at least 67%, at least 68%, at
least 69%, at least 70%, at least 71%, at least 72%, at least 73%,
at least 74%, at least 75%, at least 76%, at least 77%, at least
78%, at least 79%, at least 80%, at least 81%, at least 82%, at
least 83%, at least 84%, at least 85%, at least 86%, at least 87%,
at least 88%, at least 89%, at least 90%, at least 90.5%, at least
91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at
least 93.5%, at least 94%, at least 94.5%, at least 95%, at least
95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%,
at least 98%, at least 98.5%, at least 99% at least 99.5% or 100%
sequence identity to SEQ ID NO: 1.
[0081] When comparing nucleic acid sequences to SEQ ID NO: 1 to
calculate a percentage identity, the compared nucleotide sequences
should be compared over a comparison window of at least 300
nucleotide residues, at least 600 nucleotide residues, at least
1200 nucleotide residues, at least 2400 nucleotide residues or over
the full length of SEQ ID NO: 1. The comparison window may comprise
additions or deletions (ie. gaps) of about 20% or less as compared
to the reference sequence (which does not comprise additions or
deletions) for optimal alignment of the two sequences. Optimal
alignment of sequences for aligning a comparison window may be
conducted by computerized implementations of algorithms such the
BLAST family of programs as, for example, disclosed by Altschul et
al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion
of sequence analysis can be found in Unit 19. 3 of Ausubel et al.
("Current Protocols in Molecular Biology" John Wiley & Sons
Inc, 1994-1998, Chapter 15, 1998).
[0082] As set out above, the CslH nucleic acid may also comprise a
nucleic acid that hybridises to a nucleic acid molecule comprising
the nucleotide sequence set forth in SEQ ID NO: 1 under stringent
conditions. As used herein, "stringent" hybridisation conditions
will be those in which the salt concentration is less than about
1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration
(or other salts) at pH 7.0 to 8.3 and the temperature is at least
30.degree. C. Stringent conditions may also be achieved with the
addition of destabilizing agents such as formamide. Stringent
hybridisation conditions may be low stringency conditions, medium
stringency conditions or high stringency conditions. Exemplary low
stringency conditions include hybridisation with a buffer solution
of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate)
at 37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary medium stringency conditions include
hybridisation in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C. Exemplary high stringency conditions include
hybridisation in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C.,
and a wash in 0.1.times.SSC at 60 to 65.degree. C. Optionally, wash
buffers may comprise about 0.1% to about 1% SDS. Duration of
hybridization is generally less than about 24 hours, usually about
4 to about 12 hours.
[0083] Specificity of hybridisation is also a function of
post-hybridization washes, and is influenced by the ionic strength
and temperature of the final wash solution. For DNA-DNA hybrids,
the T.sub.m can be approximated from the equation of Meinkoth and
Wahl (Anal. Biochem. 138: 267-284, 1984), ie. T.sub.m=81.5.degree.
C.+16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the
molarity of monovalent cations, % GC is the percentage of guanosine
and cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization, and/or wash conditions can be adjusted to
hybridize to sequences of different degrees of complementarity. For
example, sequences with .gtoreq.90% identity can be hybridised by
decreasing the T.sub.m by about 10.degree. C. Generally, stringent
conditions are selected to be lower than the thermal melting point
(T.sub.m) for the specific sequence and its complement at a defined
ionic strength and pH. For example, high stringency conditions can
utilize a hybridization and/or wash at, for example, 1, 2, 3, 4 or
5.degree. C. lower than the thermal melting point (T.sub.m); medium
stringency conditions can utilize a hybridization and/or wash at,
for example, 6, 7, 8, 9, or 10.degree. C. lower than the thermal
melting point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at, for example, 11, 12, 13, 14, 15, or
20.degree. C. lower than the thermal melting point (T.sub.m). Using
the equation, hybridization and wash compositions, and desired
T.sub.m, those of ordinary skill will understand that variations in
the stringency of hybridization and/or wash solutions are
inherently described. If the desired degree of mismatching results
in a T.sub.m of less than 45.degree. C. (aqueous solution) or
32.degree. C. (formamide solution), the SSC concentration may be
increased so that a higher temperature can be used. An extensive
guide to the hybridization of nucleic acids is found in Tijssen
(Laboratory Techniques in Biochemistry and Molecular
Biology-Hybridization with Nucleic Acid Probes, Pt I, Chapter 2,
Elsevier, New York, 1993), Ausubel et al., eds. (Current Protocols
in Molecular Biology, Chapter 2, Greene Publishing and
Wiley-Interscience, New York, 1995) and Sambrook et al. (Molecular
Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y., 1989).
[0084] Examples of additional CslH nucleic acids contemplated by
the present invention include nucleic acids having coding regions
which are orthologs of SEQ ID NO: 1.
[0085] For example, barley (Hordeum vulgare) coding region
orthologs or allelic variants of SEQ ID NO: 1 include, for example,
nucleic acids comprising the nucleotide sequence set forth in SEQ
ID NO: 69. Rice (Oryza sativa) coding region orthologs of SEQ ID
NO: 1 include, for example, nucleic acids comprising the nucleotide
sequence set forth in any of SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID
NO: 7. Wheat (Triticum aestivum) coding region orthologs of SEQ ID
NO: 1 include, for example, nucleic acids comprising the nucleotide
sequence set forth in SEQ ID NO: 72, SEQ ID NO: 73 and SEQ ID NO:
74.
[0086] The CslH nucleic acids contemplated by the present invention
may also comprise one or more non-translated regions such as 3' and
5' untranslated regions and/or introns. For example, the CslH
nucleic acids contemplated by the present invention may comprise,
for example, mRNA sequences, cDNA sequences or genomic nucleotide
sequences
[0087] In some specific embodiments, the CslH nucleic acid may
comprise a genomic nucleotide sequence from an organism which may
include one or more non-protein-coding regions and/or one or more
introns. Genomic nucleotide sequences which comprise a CslH nucleic
acid include, for example: [0088] barley (Hordeum vulgare) CslH
genomic nucleotide sequences, for example, as set forth in SEQ ID
NO: 9 and/or SEQ ID NO: 71; [0089] rice (Oryza sativa) CslH genomic
nucleotide sequences, for example, as set forth in any one or more
of SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 12; and/or [0090]
wheat (Triticum aestivum) CslH genomic nucleotide sequences, for
example, as set forth in any one or more of SEQ ID NO: 78, SEQ ID
NO: 79 and/or SEQ ID NO: 80.
[0091] As mentioned above, the present invention provides methods
for modulating the expression of a CslH nucleic acid in a cell. The
present invention contemplates any method by which the expression
of a CslH nucleic acid in a cell may be modulated.
[0092] The term "modulating" with regard to the expression of the
CslH nucleic acid is generally intended to refer to decreasing or
increasing the transcription and/or translation of a CslH nucleic
acid. By "decreasing" is intended, for example, a 1%, 5%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, 100% reduction in the transcription and/or
translation of a CslH nucleic acid. By "increasing" is intended,
for example a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or
greater increase in the transcription and/or translation of a CslH
nucleic acid. Modulating also comprises introducing expression of a
CslH nucleic acid not normally found in a particular cell; or the
substantially complete inhibition (eg. knockout) of expression of a
CslH nucleic acid in a cell that normally has such activity.
[0093] Methods for modulating the expression of a particular
nucleic acid molecule in a cell are known in the art and the
present invention contemplates any such method. Exemplary methods
for modulating the expression of a CslH nucleic acid include:
genetic modification of the cell to upregulate or downregulate
endogenous CslH nucleic acid expression; genetic modification by
transformation with a CslH nucleic acid; administration of a
nucleic acid molecule to the cell which modulates expression of an
endogenous CslH nucleic acid in the cell; and the like.
[0094] In some embodiments, the expression of a CslH nucleic acid
is modulated by genetic modification of the cell. The term
"genetically modified", as used herein, should be understood to
include any genetic modification that effects an alteration in the
expression of a CslH nucleic acid in the genetically modified cell
relative to a non-genetically modified form of the cell. Exemplary
types of genetic modification contemplated herein include: random
mutagenesis such as transposon, chemical, UV or phage mutagenesis
together with selection of mutants which overexpress or
underexpress an endogenous CslH nucleic acid; transient or stable
introduction of one or more nucleic acid molecules into a cell
which direct the expression and/or overexpression of CslH nucleic
acid in the cell; site-directed mutagenesis of an endogenous CslH
nucleic acid; introduction of one or more nucleic acid molecules
which inhibit the expression of an endogenous CslH nucleic acid in
the cell, eg. a cosuppression construct or an RNAi construct; and
the like.
[0095] In one particular embodiment, the genetic modification
comprises the introduction of a nucleic acid into a cell of
interest.
[0096] The nucleic acid may be introduced using any method known in
the art which is suitable for the cell type being used, for
example, those described in Sambrook and Russell (Molecular
Cloning--A Laboratory Manual, 3.sup.rd Ed., Cold Spring Harbor
Laboratory Press, 2000).
[0097] In some embodiments of the invention wherein the cell is a
plant cell, suitable methods for introduction of a nucleic acid
molecule may include: Agrobacterium-mediated transformation,
microprojectile bombardment based transformation methods and direct
DNA uptake based methods. Roa-Rodriguez et al.
(Agrobacterium-mediated transformation of plants, 3.sup.rd Ed.
CAMBIA Intellectual Property Resource, Can berra, Australia, 2003)
review a wide array of suitable Agrobacterium-mediated plant
transformation methods for a wide range of plant species.
Microprojectile bombardment may also be used to transform plant
tissue and methods for the transformation of plants, particularly
cereal plants, and such methods are reviewed by Casas et al. (Plant
Breeding Rev. 13: 235-264, 1995). Direct DNA uptake transformation
protocols such as protoplast transformation and electroporation are
described in detail in Galbraith et al. (eds.), Methods in Cell
Biology Vol. 50, Academic Press, San Diego, 1995). In addition to
the methods mentioned above, a range of other transformation
protocols may also be used. These include infiltration,
electroporation of cells and tissues, electroporation of embryos,
microinjection, pollen-tube pathway, silicon carbide- and liposome
mediated transformation. Methods such as these are reviewed by
Rakoczy-Trojanowska (Cell. Mol. Biol. Lett. 7: 849-858, 2002). A
range of other plant transformation methods may also be evident to
those of skill in the art.
[0098] The introduced nucleic acid may be single stranded or double
stranded. The nucleic acid may be transcribed into mRNA and
translated into a CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
or another protein; may encode for a non-translated RNA such as an
RNAi construct, cosuppression construct, antisense RNA, tRNA,
miRNA, siRNA, ntRNA and the like; or may act directly in the cell.
The introduced nucleic acid may be an unmodified DNA or RNA or a
modified DNA or RNA which may include modifications to the
nucleotide bases, sugar or phosphate backbones but which retain
functional equivalency to a nucleic acid. The introduced nucleic
acid may optionally be replicated in the cell; integrated into a
chromosome or any extrachromosomal elements of the cell; and/or
transcribed by the cell. Also, the introduced nucleic acid may be
either homologous or heterologous with respect to the host cell.
That is, the introduced nucleic acid may be derived from a cell of
the same species as the genetically modified cell (ie. homologous)
or the introduced nucleic may be derived from a different species
(ie. heterologous). The transgene may also be a synthetic
transgene.
[0099] In one particular embodiment, the present invention
contemplates increasing the level of (1,3;1,4)-.beta.-D-glucan
produced by a cell, by expressing, overexpressing or introducing a
CslH nucleic acid into the cell.
[0100] By identifying CslH nucleotide sequences which encode
(1,3;1,4)-.beta.-D-glucan synthases, in further embodiments, the
present invention also provides methods for down-regulating
expression of a CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase in
a cell.
[0101] For example, the identification of CslH genes as encoding
(1,3;1,4)-.beta.-D-glucan synthases facilitates methods such as
knockout or knockdown of a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase in a cell using methods such as: [0102] insertional
mutagenesis of a CslH nucleic acid in a cell, including knockout or
knockdown of a CslH nucleic acid in a cell, by homologous
recombination with a knockout construct (for an example of targeted
gene disruption in plants see Terada et al., Nat. Biotechnol. 20:
1030-1034, 2002); [0103] post-transcriptional gene silencing (PTGS)
or RNAi of a CslH nucleic acid in a cell (for review of PTGS and
RNAi see Sharp, Genes Dev. 15(5): 485-490, 2001; and Hannon, Nature
418: 244-51, 2002); [0104] transformation of a cell with an
antisense construct directed against a CslH nucleic acid (for
examples of antisense suppression in plants see van der Krol et
al., Nature 333: 866-869; van der Krol et al., Bio Techniques 6:
958-967; and van der Krol et al., Gen. Genet. 220: 204-212); [0105]
transformation of a cell with a co-suppression construct directed
against a CslH nucleic acid (for an example of co-suppression in
plants see van der Krol et al., Plant Cell 2(4): 291-299); [0106]
transformation of a cell with a construct encoding a double
stranded RNA directed against a CslH nucleic acid (for an example
of dsRNA mediated gene silencing see Waterhouse et al., Proc. Natl.
Acad. Sci. USA 95: 13959-13964, 1998); [0107] transformation of a
cell with a construct encoding an siRNA or hairpin RNA directed
against a CslH nucleic acid (for an example of siRNA or hairpin RNA
mediated gene silencing in plants see Lu et al., Nucl. Acids Res.
32(21): e171; doi:10.1093/nar/gnh170, 2004); and/or [0108]
insertion of a miRNA target sequence such that it is in operable
connection with CslH nucleic acid (for an example of miRNA mediated
gene silencing see Brown et al., Blood 110(13): 4144-4152,
2007).
[0109] The present invention also facilitates the downregulation of
a CslH nucleic acid in a cell via the use of synthetic
oligonucleotides such as siRNAs or microRNAs directed against a
CslH nucleic acid which are administered to a cell (for examples of
synthetic siRNA mediated silencing see Caplen et al., Proc. Natl.
Acad. Sci. USA 98: 9742-9747, 2001; Elbashir et al., Genes Dev. 15:
188-200, 2001; Elbashir et al., Nature 411: 494-498, 2001; Elbashir
et al., EMBO J. 20: 6877-6888, 2001; and Elbashir et al., Methods
26: 199-213, 2002).
[0110] In addition to the examples above, the introduced nucleic
acid may also comprise a nucleotide sequence which is not directly
related to a CslH nucleic acid but, nonetheless, may directly or
indirectly modulate the expression of CslH nucleic acid in a cell.
Examples include nucleic acid molecules that encode transcription
factors or other proteins which promote or suppress the expression
of an endogenous CslH nucleic acid molecule in a cell; and other
non-translated RNAs which directly or indirectly promote or
suppress endogenous CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
expression and the like.
[0111] In order to effect expression of an introduced nucleic acid
in a genetically modified cell, where appropriate, the introduced
nucleic acid may be operably connected to one or more control
sequences. The term "control sequences" should be understood to
include any nucleotide sequences which are necessary or
advantageous for the transcription, translation and or
post-translational modification of the operably connected nucleic
acid or the transcript or protein encoded thereby. Each control
sequence may be native or foreign to the operably connected nucleic
acid. The control sequences may include, but are not limited to, a
leader, polyadenylation sequence, propeptide encoding sequence,
promoter, enhancer or upstream activating sequence, signal peptide
encoding sequence, and transcription terminator. Typically, a
control sequence at least includes a promoter.
[0112] The term "promoter" as used herein, describes any nucleic
acid which confers, activates or enhances expression of a nucleic
acid molecule in a cell. Promoters are generally positioned 5'
(upstream) to the genes that they control. In the construction of
heterologous promoter/gene combinations, it may be desirable to
position the promoter at a distance from the gene transcription
start site that is approximately the same as the distance between
that promoter and the gene it controls in its natural setting, ie.
the gene from which the promoter is derived. As is known in the
art, some variation in this distance can be accommodated without
loss of promoter function.
[0113] A promoter may regulate the expression of an operably
connected nucleotide sequence constitutively, or differentially
with respect to the cell, tissue, organ or developmental stage at
which expression occurs, in response to external stimuli such as
physiological stresses, pathogens, or metal ions, amongst others,
or in response to one or more transcriptional activators. As such,
the promoter used in accordance with the methods of the present
invention may include a constitutive promoter, an inducible
promoter, a tissue-specific promoter or an activatable
promoter.
[0114] The present invention contemplates the use of any promoter
which is active in a cell of interest. As such, a wide array of
promoters which are active in any of bacteria, fungi, animal cells
or plant cells would be readily ascertained by one of ordinary
skill in the art. However, in some embodiments, plant cells are
used. In these embodiments, plant-active constitutive, inducible,
tissue-specific or activatable promoters are typically used.
[0115] Plant constitutive promoters typically direct expression in
nearly all tissues of a plant and are largely independent of
environmental and developmental factors. Examples of constitutive
promoters that may be used in accordance with the present invention
include plant viral derived promoters such as the Cauliflower
Mosaic Virus 35S and 19S (CaMV 35S and CaMV 19S) promoters;
bacterial plant pathogen derived promoters such as opine promoters
derived from Agrobacterium spp., eg. the Agrobacterium-derived
nopaline synthase (nos) promoter; and plant-derived promoters such
as the rubisco small subunit gene (rbcS) promoter, the plant
ubiquitin promoter (Pubi), the rice actin promoter (Pact) and the
oat globulin promoter.
[0116] "Inducible" promoters include, but are not limited to,
chemically inducible promoters and physically inducible promoters.
Chemically inducible promoters include promoters which have
activity that is regulated by chemical compounds such as alcohols,
antibiotics, steroids, metal ions or other compounds. Examples of
chemically inducible promoters include: alcohol regulated promoters
(eg. see European Patent 637 339); tetracycline regulated promoters
(eg. see U.S. Pat. No. 5,851,796 and U.S. Pat. No. 5,464,758);
steroid responsive promoters such as glucocorticoid receptor
promoters (eg. see U.S. Pat. No. 5,512,483), estrogen receptor
promoters (eg. see European Patent Application 1 232 273), ecdysone
receptor promoters (eg. see U.S. Pat. No. 6,379,945) and the like;
metal-responsive promoters such as metallothionein promoters (eg.
see U.S. Pat. No. 4,940,661, U.S. Pat. No. 4,579,821 and U.S. Pat.
No. 4,601,978); and pathogenesis related promoters such as
chitinase or lysozyme promoters (eg. see U.S. Pat. No. 5,654,414)
or PR protein promoters (eg. see U.S. Pat. No. 5,689,044, U.S. Pat.
No. 5,789,214, Australian Patent 708850, U.S. Pat. No.
6,429,362).
[0117] The inducible promoter may also be a physically regulated
promoter which is regulated by non-chemical environmental factors
such as temperature (both heat and cold), light and the like.
Examples of physically regulated promoters include heat shock
promoters (eg. see U.S. Pat. No. 5,447,858, Australian Patent
732872, Canadian Patent Application 1324097); cold inducible
promoters (eg. see U.S. Pat. No. 6,479,260, U.S. Pat. No. 6,084,08,
U.S. Pat. No. 6,184,443 and U.S. Pat. No. 5,847,102); light
inducible promoters (eg. see U.S. Pat. No. 5,750,385 and Canadian
Patent 132 1563); light repressible promoters (eg. see New Zealand
Patent 508103 and U.S. Pat. No. 5,639,952).
[0118] "Tissue specific promoters" include promoters which are
preferentially or specifically expressed in one or more specific
cells, tissues or organs in an organism and/or one or more
developmental stages of the organism. It should be understood that
a tissue specific promoter may, in some cases, also be
inducible.
[0119] Examples of plant tissue specific promoters include: root
specific promoters such as those described in US Patent Application
2001047525; fruit specific promoters including ovary specific and
receptacle tissue specific promoters such as those described in
European Patent 316 441, U.S. Pat. No. 5,753,475 and European
Patent Application 973 922; and seed specific promoters such as
those described in Australian Patent 612326 and European Patent
application 0 781 849 and Australian Patent 746032.
[0120] In some embodiments, the tissue specific promoter is a seed
and/or grain specific promoter. Exemplary seed or grain specific
promoters include puroindoline-b gene promoters (for example see
Digeon et al., Plant Mol. Biol. 39: 1101-1112, 1999); Pbf gene
promoters (for example see Mena et al., Plant J. 16: 53-62, 1998);
GS.sub.1-2 gene promoters (for example see Muhitch et al., Plant
Sci. 163: 865-872, 2002); glutelin or Gt1 gene promoters (for
example see Okita et al., J. Biol. Chem. 264: 12573-12581, 1989;
Zheng et al., Plant J. 4: 357-366, 1993; Sindhu et al., Plant Sci.
130: 189-196, 1997; Nandi et al., Plant Sci. 163: 713-722, 2002);
Hor2-4 gene promoters (for example see Knudsen and Muller, Planta
195: 330-336, 1991; Patel et al., Mol. Breeding 6: 113-123, 2000;
Wong et al., Proc. Natl. Acad. Sci. USA 99: 16325-16330, 2002);
lipoxygenase 1 gene promoters (for example see Rouster et al.,
Plant J. 15: 435-440, 1998); Chi26 gene promoters (for example see
Leah et al., Plant J. 6: 579-589, 1994); Glu-D1-1 gene promoters
(for example see Lamacchia et al., J. Exp. Bot. 52: 243-250, 2001;
Zhang et al., Theor. Appl. Genet. 106: 1139-1146, 2003); Hor3-1
gene promoters (for example see Sorensen et al., Mol. Gen. Genet.
250: 750-760, 1996; Horvath et al., Proc. Natl. Acad. Sci. USA 97:
1914-1919, 2000) and Waxy (Wx) gene promoters (for example see Yao
et al., Acta Phytophysiol. Sin. 22: 431-436, 1996; Terada et al.,
Plant Cell Physiol. 41: 881-888, 2000; Liu et al., Transgenic Res.
12: 71-82, 2003). In one specific embodiment, the seed specific
promoter is an endosperm specific promoter.
[0121] The promoter may also be a promoter that is activatable by
one or more defined transcriptional activators, referred to herein
as an "activatable promoter". For example, the activatable promoter
may comprise a minimal promoter operably connected to an Upstream
Activating Sequence (UAS), which comprises, inter alia, a DNA
binding site for one or more transcriptional activators.
[0122] As referred to herein the term "minimal promoter" should be
understood to include any promoter that incorporates at least an
RNA polymerase binding site and, preferably a TATA box and
transcription initiation site and/or one or more CAAT boxes. When
the cell is a plant cell, the minimal promoter may be derived from,
for example, the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter.
The CaMV 35S derived minimal promoter may comprise, for example, a
sequence that corresponds to positions -90 to +1 (the transcription
initiation site) of the CaMV 35S promoter (also referred to as a
-90 CaMV 35S minimal promoter), -60 to +1 of the CaMV 35S promoter
(also referred to as a -60 CaMV 35S minimal promoter) or -45 to +1
of the CaMV 35S promoter (also referred to as a -45 CaMV 35S
minimal promoter).
[0123] As set out above, the activatable promoter may comprise a
minimal promoter fused to an Upstream Activating Sequence (UAS).
The UAS may be any sequence that can bind a transcriptional
activator to activate the minimal promoter. Exemplary
transcriptional activators include, for example: yeast derived
transcription activators such as Gal4, Pdr1, Gcn4 and Ace1; the
viral derived transcription activator, VP16; Hap1 (Hach et al., J
Biol Chem 278: 248-254, 2000); Gaf1 (Hoe et al., Gene 215(2):
319-328, 1998); E2F (Albani et al., J Biol Chem 275: 19258-19267,
2000); HAND2 (Dai and Cserjesi, J Biol Chem 277: 12604-12612,
2002); NRF-1 and EWG (Herzig et al., J Cell Sci 113: 4263-4273,
2000); P/CAF (Itoh et al., Nucl Acids Res 28: 4291-4298, 2000);
MafA (Kataoka et al., J Biol Chem 277: 49903-49910, 2002); human
activating transcription factor 4 (Liang and Hai, J Biol Chem 272:
24088-24095, 1997); Bcl10 (Liu et al., Biochem Biophys Res Comm
320(1): 1-6, 2004); CREB-H (Omori et al., Nucl Acids Res 29:
2154-2162, 2001); ARR1 and ARR2 (Sakai et al., Plant J 24(6):
703-711, 2000); Fos (Szuts and Bienz, Proc Natl Acad Sci USA 97:
5351-5356, 2000); HSF4 (Tanabe et al., J Biol Chem 274:
27845-27856, 1999); MAML1 (Wu et al., Nat Genet 26: 484-489,
2000).
[0124] In some embodiments, the UAS comprises a nucleotide sequence
that is able to bind to at least the DNA-binding domain of the GAL4
transcriptional activator. UAS sequences, which can bind
transcriptional activators that comprise at least the GAL4 DNA
binding domain, are referred to herein as UASc. In a particular
embodiment, the UASc comprises the sequence
5'-CGGAGTACTGTCCTCCGAG-3' or a functional homolog thereof.
[0125] As referred to herein, a "functional homolog" of the UASc
sequence should be understood to refer to any nucleotide sequence
which can bind at least the GAL4 DNA binding domain and which may
comprise a nucleotide sequence having at least 50% identity, at
least 65% identity, at least 80% identity or at least 90% identity
with the UASc nucleotide sequence.
[0126] The UAS sequence in the activatable promoter may comprise a
plurality of tandem repeats of a DNA binding domain target
sequence. For example, in its native state, UASc comprises four
tandem repeats of the DNA binding domain target sequence. As such,
the term "plurality" as used herein with regard to the number of
tandem repeats of a DNA binding domain target sequence should be
understood to include at least 2, at least 3 or at least 4 tandem
repeats.
[0127] As mentioned above, the control sequences may also include a
terminator. The term "terminator" refers to a DNA sequence at the
end of a transcriptional unit which signals termination of
transcription. Terminators are 3'-non-translated DNA sequences
generally containing a polyadenylation signal, which facilitates
the addition of polyadenylate sequences to the 3'-end of a primary
transcript. As with promoter sequences, the terminator may be any
terminator sequence which is operable in the cells, tissues or
organs in which it is intended to be used. Examples of suitable
terminator sequences which may be useful in plant cells include:
the nopaline synthase (nos) terminator, the CaMV 35S terminator,
the octopine synthase (ocs) terminator, potato proteinase inhibitor
gene (pin) terminators, such as the pinII and pinIII terminators
and the like.
[0128] Modulating the level of (1,3;1,4)-.beta.-D-glucan in a cell,
by modulating the level and/or activity of a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase in the cell, has several
industrial applications.
[0129] For example, (1,3;1,4)-.beta.-D-glucans are known to form
viscous solutions. The viscosity-generating properties of soluble
cereal (1,3;1,4)-.beta.-D-glucans are critical determinants in many
aspects of cereal processing. For example, incompletely degraded
(1,3;1,4)-.beta.-D-glucans from malted barley and cereal adjuncts
can contribute to wort and beer viscosity and are associated with
problems in wort separation and beer filtration (eg. see Bamforth,
Brew. Dig. 69 (5): 12-16, 1994) Therefore, for example, in some
embodiments, the present invention may be applied to reduce the
level of (1,3;1,4)-.beta.-D-glucan in barley grain, by reducing the
level and/or activity of a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase in one or more cells of the barley grain, to increase its
suitability for beer production.
[0130] Soluble cereal (1,3;1,4)-.beta.-D-glucans are also
considered to have antinutritive effects in monogastric animals
such as pigs and poultry. The "antinutritive" effects have been
attributed to the increased viscosity of gut contents, which slows
both the diffusion of digestive enzymes and the absorption of
degradative products of enzyme action. This, in turn, leads to
slower growth rates. Moreover, in dietary formulations for poultry,
high (1,3;1,4)-.beta.-D-glucan concentrations are associated with
`sticky` faeces, which are indicative of the poor digestibility of
the (1,3;1,4)-.beta.-D-glucans and which may present major handling
and hygiene problems for producers. Therefore, in another
embodiment, the present invention may be applied to reducing the
level of (1,3;1,4)-.beta.-D-glucan in one or more cells of a plant
used for animal feed, to improve the suitability of the plant as
animal feed.
[0131] However, cereal (1,3;1,4)-.beta.-D-glucans are important
components of dietary fibre in human and animal diets. As used
herein, the term "dietary fibre" should be understood to include
the edible parts of plants or analogous carbohydrates that are
resistant to digestion and absorption in the human small intestine
with complete or partial fermentation in the large intestine.
"Dietary fibre" includes polysaccharides (specifically including
(1,3;1,4)-.beta.-D-glucans), oligosaccharides, lignin and
associated plant substances. In at least human diets, dietary
fibres promote beneficial physiological effects including general
bowel health, laxation, blood cholesterol attenuation, and/or blood
glucose attenuation.
[0132] Humans and monogastric animals produce no enzymes that
degrade (1,3;1,4)-.beta.-D-glucans, although there are indications
that some depolymerization occurs in the stomach and small
intestine, presumably due to the activity of commensal
microorganisms. By comparison, the soluble
(1,3;1,4)-.beta.-D-glucans and other non-starchy polysaccharides
are readily fermented by colonic micro-organisms and make a small
contribution to digestible energy. In contrast to their
antinutritive effects in monogastric animals, oat and barley
(1,3;1,4)-.beta.-D-glucans at high concentrations in humans have
beneficial effects, especially for non-insulin-dependent diabetics,
by flattening glucose and insulin responses that follow a meal.
High concentrations of (1,3;1,4)-.beta.-D-glucans (eg. 20% w/v) in
food have also been implicated in the reduction of serum
cholesterol concentrations, by lowering the uptake of dietary
cholesterol or resorption of bile acids from the intestine.
[0133] Therefore, in another embodiment, the present invention may
be applied to increasing the dietary fibre content of an edible
plant or edible plant part, by increasing the level of
(1,3;1,4)-.beta.-D-glucan in the plant, or part thereof. In some
embodiments, the edible plant or edible part of a plant is a cereal
crop plant or part thereof.
[0134] (1,3;1,4)-.beta.-D-glucans, in common with a number of other
polysaccharides, in particular (1.fwdarw.3)-.beta.-D-glucans, are
also thought to modify immunological responses in humans by a
process that is mediated through binding to receptors on cells of
the reticuloendothelial system (leucocytes and macrophages). In
addition, they may have the capacity to activate the proteins of
the human complement pathway, a system that is invoked as a first
line of defense before circulating antibodies are produced.
[0135] The present invention also facilitates the production of
(1,3;1,4)-.beta.-D-glucan in a recombinant expression system. For
example, a (1,3;1,4)-.beta.-D-glucan may be recombinantly produced
by introducing a CslH nucleic acid under the control of a promoter,
into a cell, wherein the cell subsequently expresses a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase and produces
(1,3;1,4)-.beta.-D-glucan.
[0136] A vast array of recombinant expression systems that may be
used to express a CslH nucleic acid are known in the art. Exemplary
recombinant expression systems include: bacterial expression
systems such as E. coli expression systems (reviewed in Baneyx,
Curr. Opin. Biotechnol. 10: 411-421, 1999; eg. see also Gene
expression in recombinant microorganisms, Smith (Ed.), Marcel
Dekker, Inc. New York, 1994; and Protein Expression Technologies:
Current Status and Future Trends, Baneyx (Ed.), Chapters 2 and 3,
Horizon Bioscience, Norwich, UK, 2004), Bacillus spp. expression
systems (eg. see Protein Expression Technologies: Current Status
and Future Trends, supra, chapter 4) and Streptomyces spp.
expression systems (eg. see Practical Streptomyces Genetics, Kieser
et al., (Eds.), Chapter 17, John Innes Foundation, Norwich, UK,
2000); fungal expression systems including yeast expression systems
such as Saccharomyces spp., Schizosaccharomyces pombe, Hansenula
polymorpha and Pichia spp. expression systems and filamentous fungi
expression systems (eg. see Protein Expression Technologies:
Current Status and Future Trends, supra, chapters 5, 6 and 7;
Buckholz and Gleeson, Bio/Technology 9(11): 1067-1072, 1991; Cregg
et al., Mol. Biotechnol. 16(1): 23-52, 2000; Cereghino and Cregg,
FEMS Microbiology Reviews 24: 45-66, 2000; Cregg et al.,
Bio/Technology 11: 905-910, 1993); mammalian cell expression
systems including Chinese Hamster Ovary (CHO) cell based expression
systems (eg. see Protein Expression Technologies: Current Status
and Future Trends, supra, chapter 9); insect cell cultures
including baculovirus expression systems (eg. see Protein
Expression Technologies: Current Status and Future Trends, supra,
chapter 8; Kost and Condreay, Curr. Opin. Biotechnol. 10: 428-433,
1999; Baculovirus Expression Vectors: A Laboratory Manual WH
Freeman & Co., New York, 1992; and The Baculovirus Expression
System: A Laboratory Manual, Chapman & Hall, London, 1992);
Plant cell expression systems such as tobacco, soybean, rice and
tomato cell expression systems (eg. see review of Hellwig et al.,
Nat Biotechnol 22: 1415-1422, 2004); and the like.
[0137] Therefore, in a third aspect, the present invention provides
a method for producing (1,3;1,4)-.beta.-D-glucan, the method
comprising transforming a cell with an isolated CslH nucleic acid
and allowing the cell to express the isolated CslH nucleic
acid.
[0138] In some embodiments, the cell is a cell from a recombinant
expression system as hereinbefore defined.
[0139] In a fourth aspect, the present invention also provides
(1,3;1,4)-.beta.-D-glucan produced according to the method of the
third aspect of the invention.
[0140] In a fifth aspect, the present invention also provides a
cell comprising: [0141] a modulated level and/or activity of
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase relative to a wild
type cell of the same taxon; and/or [0142] modulated expression of
a CslH nucleic acid relative to a wild type cell of the same
taxon.
[0143] In some embodiments, the cell further comprises a modulated
level of (1,3;1,4)-.beta.-D-glucan relative to a wild type cell of
the same taxon.
[0144] In some embodiments, the cell of the fifth aspect of the
invention is produced according to the methods of the first or
second aspects of the present invention as described herein. In
further embodiments, the cell is a plant cell, a monocot plant
cell, a Poales plant cell and/or a cereal crop plant cell.
[0145] Furthermore, in a sixth aspect, the present invention
provides a multicellular structure comprising one or more cells
according to the fifth aspect of the invention.
[0146] As referred to herein, a "multicellular structure" includes
any aggregation of one or more cells. As such, the term
"multicellular structure" specifically encompasses tissues, organs,
whole organisms and parts thereof. Furthermore, a multicellular
structure should also be understood to encompass multicellular
aggregations of cultured cells such as colonies, plant calli,
suspension cultures and the like.
[0147] As mentioned above, in some embodiments of the invention,
the cell is a plant cell and as such, the present invention
includes a whole plant, plant tissue, plant organ, plant part,
plant reproductive material or cultured plant tissue, comprising
one or more plant cells according to the sixth aspect of the
invention.
[0148] In another embodiment, the present invention provides a
cereal crop plant comprising one or more cells according to the
fifth aspect of the invention.
[0149] In a particular embodiment, the present invention provides
cereal grain comprising one or more cells according to the fifth
aspect of the invention.
[0150] Therefore, in a seventh aspect, the present invention
provides a cereal grain comprising a modulated level of
(1,3;1,4)-.beta.-D-glucan, wherein the grain comprises one or more
cells comprising a modulated level and/or activity of a
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase and/or modulated
expression of a CslH nucleic acid.
[0151] In some embodiments, the grain may have an increased level
of (1,3;1,4)-.beta.-D-glucan compared to wild type grain from the
same species. In alternate embodiments, the grain may have a
decreased level of (1,3;1,4)-.beta.-D-glucan compared to wild type
grain from the same species.
[0152] In some embodiments wherein the grain is a wheat grain, the
wheat grain comprises level of (1,3;1,4)-.beta.-D-glucan of at
least 1%, at least 1.1%, at least 1.2%, at least 1.3%, at least
1.4%, at least 1.5%, at least 1.6%, at least 1.7%, at least 1.8% or
1.9% on a fresh weight basis of air dried whole grain.
[0153] In an eighth aspect, the present invention also provides
flour comprising: [0154] flour produced by the milling of the grain
of the seventh aspect of the invention; and [0155] optionally,
flour produced by the milling of one or more other grains.
[0156] As such, the flour produced by the milling of the grain of
the seventh aspect of the invention may comprise, for example
approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%
by weight of the flour of the ninth aspect of the invention.
[0157] As referred to herein "milling" contemplates any method
known in the art for milling grain, such as those described by
Brennan et al. (Manual of Flour and Husk Milling, Brennan et al.
(Eds.), AgriMedia, ISBN: 3-86037-277-7).
[0158] In some embodiments, the flour produced by the milling of
the grain of the seventh aspect of the invention used in the flour
comprises an increased level of (1,3;1,4)-.beta.-D-glucan compared
to wild type flour.
[0159] The "flour produced by the milling of one or more other
grains" may be flour produced by milling grain derived from any
cereal plant, as hereinbefore defined. This component of the flour
of the eighth aspect of the invention may, for example, comprise
0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% by weight.
[0160] In some embodiments, the flour produced by the milling of
one or more other grains is wheat flour and, therefore, the flour
of the eighth aspect of the invention may be particularly suitable
for producing bread, cakes, biscuits and the like.
[0161] As set out above, the present invention is predicated, in
part, on the identification and isolation of CslH nucleotide
sequences and CslH amino acid sequences that encode
(1,3;1,4)-.beta.-D-glucan synthases.
[0162] Therefore, in a ninth aspect, the present invention provides
an isolated CslH nucleic acid as hereinbefore defined, or a
complement, reverse complement or fragment thereof.
[0163] In the present invention, "isolated" refers to material
removed from its original environment (e.g., the natural
environment if it is naturally occurring), and thus is altered "by
the hand of man" from its natural state. For example, an isolated
polynucleotide could be part of a vector or a composition of
matter, or could be contained within a cell, and still be isolated
because that vector, composition of matter, or particular cell is
not the original environment of the polynucleotide. An "isolated"
nucleic acid molecule should also be understood to include a
synthetic nucleic acid molecule, including those produced by
chemical synthesis using known methods in the art or by in-vitro
amplification (eg. polymerase chain reaction and the like).
[0164] The isolated nucleic acid molecules of the present invention
may comprise any polyribonucleotide or polydeoxyribonucleotide,
which may be unmodified RNA or DNA or modified RNA or DNA. For
example, the isolated nucleic acid molecules of the invention may
comprise single- and double-stranded DNA, DNA that is a mixture of
single- and double-stranded regions, single- and double-stranded
RNA, and RNA that is mixture of single- and/or double-stranded
regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically, double-stranded or a mixture of
single- and double-stranded regions. In addition, the isolated
nucleic acid molecules may comprise of triple-stranded regions
comprising RNA or DNA or both RNA and DNA. The isolated nucleic
acid molecules may also contain one or more modified bases or DNA
or RNA backbones modified for stability or for other reasons.
"Modified" bases include, for example, tritylated bases and unusual
bases such as inosine. A variety of modifications can be made to
DNA and RNA; thus, "polynucleotide" embraces chemically,
enzymatically, or metabolically modified forms.
[0165] As set out above, the present invention also provides
fragments of a nucleotide sequence. "Fragments" of a nucleotide
sequence should be at least 15, 20, 30, 40, 50, 100, 150, 200, 250,
300, 325, 350, 375, 400, 450, 500, 550, or 600 nucleotides (nt) in
length. These fragments have numerous uses that include, but are
not limited to, diagnostic probes and primers. Of course, larger
fragments, such as those of 601-3000 nt in length are also useful
according to the present invention as are fragments corresponding
to most, if not all, of a CslH nucleic acid.
[0166] In some embodiments, the fragment may comprise a functional
fragment of a CslH nucleic acid. That is, the polynucleotide
fragments of the invention may encode a polypeptide having
(1,3;1,4)-.beta.-D-glucan synthase functional activity as defined
herein.
[0167] In a tenth aspect, the present invention provides a genetic
construct or vector comprising an isolated nucleic acid molecule of
the ninth aspect of the invention.
[0168] The vector or construct may further comprise one or more of:
an origin of replication for one or more hosts; a selectable marker
gene which is active in one or more hosts; or one or more control
sequences which enable transcription of the isolated nucleic acid
molecule in a cell.
[0169] "Selectable marker genes" include any nucleotide sequences
which, when expressed by a cell, confer a phenotype on the cell
that facilitates the identification and/or selection of these
transformed cells. A range of nucleotide sequences encoding
suitable selectable markers are known in the art. Exemplary
nucleotide sequences that encode selectable markers include:
antibiotic resistance genes such as ampicillin-resistance genes,
tetracycline-resistance genes, kanamycin-resistance genes, the
AURI-C gene which confers resistance to the antibiotic aureobasidin
A, neomycin phosphotransferase genes (eg. nptI and nptII) and
hygromycin phosphotransferase genes (eg. hpt); herbicide resistance
genes including glufosinate, phosphinothricin or bialaphos
resistance genes such as phosphinothricin acetyl transferase
encoding genes (eg. bar), glyphosate resistance genes including
3-enoyl pyruvyl shikimate 5-phosphate synthase encoding genes (eg.
aroA), bromyxnil resistance genes including bromyxnil nitrilase
encoding genes, sulfonamide resistance genes including
dihydropterate synthase encoding genes (eg. sul) and sulfonylurea
resistance genes including acetolactate synthase encoding genes;
enzyme-encoding reporter genes such as GUS and
chloramphenicolacetyltransferase (CAT) encoding genes; fluorescent
reporter genes such as the green fluorescent protein-encoding gene;
and luminescence-based reporter genes such as the luciferase gene,
amongst others.
[0170] Furthermore, it should be noted that the selectable marker
gene may be a distinct open reading frame in the construct or may
be expressed as a fusion protein with the CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase polypeptide.
[0171] The tenth aspect of the invention extends to all genetic
constructs essentially as described herein, which include further
nucleotide sequences intended for the maintenance and/or
replication of the genetic construct in prokaryotes or eukaryotes
and/or the integration of the genetic construct or a part thereof
into the genome of a eukaryotic or prokaryotic cell.
[0172] In some embodiments, the vector or construct is adapted to
be at least partially transferred into a plant cell via
Agrobacterium-mediated transformation. Accordingly, the vector or
construct may comprise left and/or right T-DNA border
sequences.
[0173] Suitable T-DNA border sequences would be readily ascertained
by one of skill in the art. However, the term "T-DNA border
sequences" may include substantially homologous and substantially
directly repeated nucleotide sequences that delimit a nucleic acid
molecule that is transferred from an Agrobacterium sp. cell into a
plant cell susceptible to Agrobacterium-mediated transformation. By
way of example, reference is made to the paper of Peralta and Ream
(Proc. Natl. Acad. Sci. USA, 82(15): 5112-5116, 1985) and the
review of Gelvin (Microbiology and Molecular Biology Reviews,
67(1): 16-37, 2003).
[0174] Although in some embodiments, the vector or construct is
adapted to be transferred into a plant via Agrobacterium-mediated
transformation, the present invention also contemplates any
suitable modifications to the genetic construct which facilitate
bacterial mediated insertion into a plant cell via bacteria other
than Agrobacterium sp., for example, as described in Broothaerts et
al. (Nature 433: 629-633, 2005).
[0175] Those skilled in the art will be aware of how to produce the
constructs described herein and of the requirements for obtaining
the expression thereof, when so desired, in a specific cell or
cell-type under the conditions desired. In particular, it will be
known to those skilled in the art that the genetic manipulations
required to perform the present invention may require the
propagation of a genetic construct described herein or a derivative
thereof in a prokaryotic cell such as an E. coli cell or a plant
cell or an animal cell. Exemplary methods for cloning nucleic acid
molecules are described in Sambrook et al. (2000, supra)
[0176] In an eleventh aspect, the present invention provides a cell
comprising the isolated nucleic acid molecule of the ninth aspect
of the invention or genetic construct of the tenth aspect of the
invention.
[0177] The isolated nucleic acid molecule of the tenth or eleventh
aspects of the invention or genetic construct of the twelfth aspect
of the invention may be introduced into a cell via any means known
in the art.
[0178] The isolated nucleic acid molecule or construct referred to
above may be maintained in the cell as a DNA molecule, as part of
an episome (eg. a plasmid, cosmid, artificial chromosome or the
like) or it may be integrated into the genomic DNA of the cell.
[0179] As used herein, the term "genomic DNA" should be understood
in its broadest context to include any and all DNA that makes up
the genetic complement of a cell. As such, the genomic DNA of a
cell should be understood to include chromosomes, mitochondrial
DNA, plastid DNA, chloroplast DNA, endogenous plasmid DNA and the
like. As such, the term "genomically integrated" contemplates
chromosomal integration, mitochondrial DNA integration, plastid DNA
integration, chloroplast DNA integration, endogenous plasmid
integration, and the like.
[0180] The isolated nucleic acid molecule may be operably connected
to, inter alia, a control sequence and/or a promoter such that the
cell may express the isolated nucleic acid molecule.
[0181] The cell may be any prokaryotic or eukaryotic cell. As such,
the cell may be a prokaryotic cell such as a bacterial cell
including an E. coli cell or an Agrobacterium spp. cell, or an
archaea cell. The cell may also be a eukaryotic cell including a
fungal cell such as a yeast cell or mycelial fungus cell; an animal
cell such as a mammalian cell or an insect cell; or a plant cell.
In a particular embodiment, the cell is a plant cell. In some
embodiments, the plant cell is a monocot plant cell, a Poales plant
cell, or a cereal crop plant cell.
[0182] In a twelfth aspect, the present invention provides a
multicellular structure, as hereinbefore defined, comprising one or
more of the cells of the eleventh aspect of the invention.
[0183] As mentioned above, in some embodiments, the cell is a plant
cell and as such, the present invention should be understood to
specifically include a whole plant, plant tissue, plant organ,
plant part, plant reproductive material, or cultured plant tissue,
comprising one or more cells of the eleventh aspect of the
invention.
[0184] In a further embodiment, the present invention provides a
monocot plant, a Poales plant or a cereal crop plant or part
thereof, comprising one or more cells of the eleventh aspect of the
invention.
[0185] In some embodiments, the present invention provides cereal
grain comprising one or more cells of the eleventh aspect of the
invention.
[0186] As set out above, the present invention also provides amino
acid sequences for CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthases. Accordingly, in a thirteenth aspect, the present
invention provides an isolated CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase as hereinbefore defined, or a
fragment thereof.
[0187] The isolated polypeptides may comprise of amino acids joined
to each other by peptide bonds or modified peptide bonds, ie.,
peptide isosteres, and may contain amino acids other than the 20
gene-encoded amino acids. The isolated polypeptides of the present
invention may be modified by either natural processes, such as
post-translational processing, or by chemical modification
techniques which are well known in the art.
[0188] Modifications can occur anywhere in the isolated
polypeptide, including the peptide backbone, the amino acid
side-chains and/or the termini. It will be appreciated that the
same type of modification may be present in the same or varying
degrees at several sites in a given isolated polypeptide. Also, an
isolated polypeptide of the present invention may contain many
types of modifications.
[0189] The polypeptides may be branched, for example, as a result
of ubiquitination, and/or they may be cyclic, with or without
branching. Cyclic, branched, and branched cyclic polypeptides may
result from post-translation natural processes or may be made by
synthetic methods.
[0190] Modifications include acetylation, acylation,
ADP-ribosylation, amidation, biotinylation, covalent attachment of
flavin, covalent attachment of a heme moiety, covalent attachment
of a nucleotide or nucleotide derivative, covalent attachment of a
lipid or lipid derivative, covalent attachment of
phosphatidylinositol, cross-linking, cyclization, disulfide bond
formation, demethylation, formation of covalent cross-links,
formation of cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
PEGylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, for instance, Proteins--Structure And
Molecular Properties 2.sup.nd Ed., Creighton (ed.), W. H. Freeman
and Company, New York, 1993); Posttranslational Covalent
Modification Of Proteins, Johnson (Ed.), Academic Press, New York,
1983; Seifter et al., Meth Enzymol 182: 626-646, 1990); Rattan et
al., Ann NY Acad Sci 663: 48-62, 1992).
[0191] As set out above, the present invention also provides
fragments of isolated polypeptides. Polypeptide fragments may be
"free-standing" or comprised within a larger polypeptide of which
the fragment forms a part or region.
[0192] The polypeptide fragments can be at least 3, 4, 5, 6, 8, 9,
10, 11, 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90,
100, 110, 120, 130, 140, or 150 amino acids in length.
[0193] In some embodiments, the fragment is a functional fragment
and thus comprises (1,3;1,4)-.beta.-D-glucan synthase functional
activity. However, even if the fragment does not retain one or more
biological functions of a CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase, other functional activities may still be retained. For
example, the fragments may lack CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase functional activity but retain
the ability to induce and/or bind to antibodies which recognize the
complete or mature forms of an isolated CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase polypeptide. A peptide,
polypeptide or protein fragment which has the ability to induce
and/or bind to antibodies which recognize the complete or mature
forms of the isolated CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase polypeptide is referred to herein as a "CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase epitope".
[0194] A CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase epitope
may comprise as few as three or four amino acid residues. In some
embodiments the epitope may comprise, for example, at least 5, at
least 10, at least 20, at least 50, at least 100 or at least 200
amino acid residues. Whether a particular epitope of an isolated
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase polypeptide retains
such immunologic activities can readily be determined by methods
known in the art. As such, one CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase polypeptide fragment is a
polypeptide comprising one or more CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase epitopes.
[0195] A polypeptide comprising one or more CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase epitopes may be produced by any
conventional means for making polypeptides including synthetic and
recombinant methods known in the art. In some embodiments,
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase epitope-bearing
polypeptides may be synthesized using known methods of chemical
synthesis. For instance, Houghten has described a simple method for
the synthesis of large numbers of peptides (Houghten, Proc. Natl.
Acad. Sci. USA 82: 5131-5135, 1985).
[0196] The isolated CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
polypeptides and CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
epitope-bearing polypeptides are useful, for example, in the
generation of antibodies that bind to the isolated CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase polypeptides of the
invention.
[0197] Such antibodies are useful, inter alia, in the detection and
localization of (1,3;1,4)-.beta.-D-glucan synthase polypeptides and
in affinity purification of (1,3;1,4)-.beta.-D-glucan synthase
polypeptides. The antibodies may also routinely be used in a
variety of qualitative or quantitative immunoassays using methods
known in the art. For example see Harlow et al., Antibodies: A
Laboratory Manual, (Cold Spring Harbor Laboratory Press 2.sup.nd
Ed., 1988).
[0198] Accordingly, in a fourteenth aspect, the present invention
provides an antibody or an epitope binding fragment thereof, raised
against an isolated CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase
polypeptide as hereinbefore defined or an epitope thereof.
[0199] The antibodies of the present invention include, but are not
limited to, polyclonal, monoclonal, multispecific, chimeric
antibodies, single chain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library and
epitope-binding fragments of any of the above.
[0200] The term "antibody", as used herein, refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an
antigen-binding site that immunospecifically binds an antigen. The
immunoglobulin molecules of the invention can be of any type (e.g.,
IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3,
IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
[0201] The antibodies of the present invention may be monospecific,
bispecific, trispecific, or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. For example, see PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt et al., J. Immunol. 147:
60-69, 1991; U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648;
5,573,920; 5,601,819; and Kostelny et al. J. Immunol. 148:
1547-1553, 1992).
[0202] In some embodiments, the antibodies of the present invention
may act as agonists or antagonists of CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase. In further embodiments, the
antibodies of the present invention may be used, for example, to
purify, detect, and target the polypeptides of the present
invention, including both in vitro and in vivo diagnostic and
therapeutic methods. For example, the antibodies have use in
immunoassays for qualitatively and quantitatively measuring levels
of CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase in biological
samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988).
[0203] The term "antibody", as used herein, should be understood to
encompass derivatives that are modified, eg. by the covalent
attachment of any type of molecule to the antibody such that
covalent attachment does not prevent the antibody from binding to a
CslH-encoded (1,3;1,4)-.beta.-D-glucan synthase or an epitope
thereof. For example, the antibody derivatives include antibodies
that have been modified, eg., by glycosylation, acetylation,
pegylation, phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a
cellular ligand or other protein, etc. Furthermore, any of numerous
chemical modifications may also be made using known techniques.
These include specific chemical cleavage, acetylation, formylation,
metabolic synthesis of tunicamycin, etc. Additionally, the
derivative may contain one or more non-classical amino acids.
[0204] Antibodies may be generated using methods known in the
art.
[0205] For example, if in vivo immunization is used, animals may be
immunized with free peptide; however, anti-peptide antibody titer
may be boosted by coupling of the peptide to a macromolecular
carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
For example, peptides containing cysteine residues may be coupled
to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carriers using a more general linking
agent such as glutaraldehyde.
[0206] Animals such as rabbits, rats and mice may be immunized with
either free or carrier-coupled peptides, for instance, by
intraperitoneal and/or intradermal injection of emulsions
containing about 100 micrograms of peptide or carrier protein and
Freund's adjuvant. Several booster injections may be needed, for
example, at intervals of about two weeks, to provide a useful titer
of anti-peptide antibody which can be detected, for example, by
ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0207] Polyclonal antibodies to a CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase polypeptide or a polypeptide
comprising one or more CslH-encoded (1,3;1,4)-.beta.-D-glucan
synthase epitopes can be produced by various procedures well known
in the art. For example, a polypeptide of the invention can be
administered to various host animals including, but not limited to,
rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various
adjuvants may be used to increase the immunological response,
depending on the host species, for example, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and Corynebacterium parvum. Such
adjuvants are also well known in the art.
[0208] As another example, monoclonal antibodies can be prepared
using a wide variety of techniques known in the art including the
use of hybridoma, recombinant, and phage display technologies, or a
combination thereof. For example, monoclonal antibodies can be
produced using hybridoma techniques including those known in the
art and taught, for example, in Harlow et al., Antibodies: A
Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed.,
1988) and Hammerling et al., in: Monoclonal Antibodies and T-Cell
Hybridomas (Elsevier, NY, 1981). The term "monoclonal antibody" as
used herein is not limited to antibodies produced through hybridoma
technology. The term "monoclonal antibody" refers to an antibody
that is derived from a single clone, including any eukaryotic,
prokaryotic, or phage clone, and not the method by which it is
produced.
[0209] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art.
For example, mice can be immunized with a polypeptide of the
invention or a cell expressing such peptide. Once an immune
response is detected, e.g., antibodies specific for the antigen are
detected in the mouse serum, the mouse spleen is harvested and
splenocytes isolated. The splenocytes are then fused by well-known
techniques to any suitable myeloma cells, for example cells from
cell line SP20 available from the ATCC. Hybridomas are selected and
cloned by limited dilution. The hybridoma clones are then assayed
by methods known in the art for cells that secrete antibodies
capable of binding a polypeptide of the invention. Ascites fluid,
which generally contains high levels of antibodies, can be
generated by immunizing mice with positive hybridoma clones.
[0210] Antibody fragments which recognize one or more CslH-encoded
(1,3;1,4)-.beta.-D-glucan synthase epitopes may also be generated
by known techniques. For example, Fab and F(ab')2 fragments may be
produced by proteolytic cleavage of immunoglobulin molecules, using
enzymes such as papain (to produce Fab fragments) or pepsin (to
produce F(ab')2 fragments). F(ab')2 fragments contain the variable
region, the light chain constant region and the CH1 domain of the
heavy chain.
[0211] The antibodies of the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles which carry the polynucleotide
sequences encoding them. In a particular embodiment, such phage can
be utilized to display antigen-binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labelled antigen or antigen bound or captured to a
solid surface or bead. Phages used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein.
[0212] Examples of phage display methods include those disclosed by
Brinkman et al. (J. Immunol. Methods 182: 41-50, 1995), Ames et al.
(J. Immunol. Methods 184: 177-186, 1995), Kettleborough et al.
(Eur. J. Immunol. 24: 952-958, 1994), Persic et al. (Gene 187:
9-18, 1997), Burton et al. (Advances in Immunology 57: 191-280,
1994); PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO
92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos.
5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753;
5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727;
5,733,743 and 5,969,108.
[0213] After phage selection, the antibody coding regions from the
phage can be isolated and used to generate whole antibodies or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria. For example, techniques to recombinantly
produce Fab, Fab' and F(ab')2 fragments can also be employed using
methods known in the art such as those disclosed in PCT publication
WO 92/22324; Mullinax et al. (BioTechniques 12(6): 864-869, 1992);
and Sawai et al. (AJRI 34:26-34, 1995); and Better et al. (Science
240: 1041-1043, 1988).
[0214] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al. (Methods in
Enzymology 203: 46-88, 1991); Shu et al. (Proc. Natl. Acad. Sci.
USA 90: 7995-7999, 1993); and Skerra et al. (Science 240:
1038-1040, 1988).
[0215] The present invention is further described by the following
non-limiting examples:
BRIEF DESCRIPTION OF THE DRAWINGS
[0216] FIG. 1 shows (A) a schematic of the T-DNA of the
HvCslH1::pGBW15 construct used in gain-of-function experiments in
Arabidopsis. After Gateway cloning, the 3.times.HA tag was attached
at the NH.sub.2-terminal end of the full-length HvCslH1 ORF. (B)
Transcript levels in the leaves of mature HvCslH1 transgenic T1
plants as determined by Northern blot analysis. Upper panel, X-ray
film exposure; lower panel, corresponding ethidium bromide-stained
gel. The observed 2.5 kb transcript size corresponds to the
expected size of the tagged HvCslH1 mRNA. (C) 3.times.HA-tagged
HvCslH1 protein levels in 3-week-old pooled HvCslH1 transgenic T2
lines as determined by Western blot analysis. Thirty micrograms of
mixed microsomal membrane protein was loaded per lane and blots
probed with the anti-HA antibody. B and C; Numbers refer to
transgenic lines, Col-0, wild-type untransformed line. Col-0, lines
8 and 14 from the same blot, all other lines are from different
blots.
[0217] FIG. 2 shows transmission electron micrographs showing
detection of .beta.-glucan in walls of HvCslH1-expressing lines
with a .beta.-glucan-specific monoclonal antibody (Meikle et al.,
Plant J 5: 1-9, 1994). (A-C) line 8, 16, 11; (D) wild-type Col-0
control; (E) line 6. A and D show cells of the vascular bundle; B
and C, mesophyll cells; E, epidermal cells. Scale bar=0.5 .mu.m
(A-C, E), 1 (D).
[0218] FIG. 3 shows HPAEC profiles of oligosaccharides released
upon (1,3;1,4)-.beta.-D-glucan endo-hydrolase digestion of alcohol
insoluble residue (AIR) prepared from 145 day-old Arabidopsis line
16-1 rosette leaf tissue (). 16-1 pre-enzyme treatment buffer wash
(). Barley mature leaf (entire sheath) AIR was used as the positive
control sample () G4G3G.sub.R (3-O-(3-cellobiosyl D-glucose, DP3)
and G4G4G3G.sub.R (3-O-.beta.-cellotriosyl D-glucose, DP4) peaks
are indicated.
[0219] FIG. 4 shows transmission electron micrographs showing the
detection of the 3.times.HA-tagged HvCslH1 protein by a
gold-labelled anti-HA antibody in sections of high pressure-frozen
leaves of Arabidopsis transgenic line 11. (A and B) mesophyll
cells. G, Golgi body, cw, cell wall, v, vacuole, er, endoplasmic
reticulum. Scale bar=0.5 .mu.m (A), 0.2 .mu.m (B). Arrows indicate
Golgi-associated vesicle labeling.
[0220] FIG. 5 shows HvCslH1 expression in barley as determined by
QPCR and in situ PCR analyses. (A) Normalised levels of HvCslH1
transcript (copies/microlitre cDNA) in a range of barley tissues.
Control genes for normalisation were GAPDH, cyclophilin and
.alpha.-tubulin. (B) Normalised levels of HvCslH1 transcript in
developing endosperm 0-24 days post-pollination. Control genes were
GAPDH, .alpha.-tubulin and elongation factor-1a. (C) Normalised
levels of HvCslH1 transcript in 10 day-old first leaf. Control
genes were GAPDH, cyclophilin and HSP70. Error bars on QPCR plots
indicate standard deviation. (D-F) In situ PCR images of the
maturing zone of a 7 day-old first leaf using probes for 18S RNA
(positive control, D), HvCslH1 (F) and a negative control (E).
Scale bar=100 .mu.m.
[0221] FIG. 6 shows structural features of HvCslH1. (A) Exon-intron
structure of HvCslH1. Black bars indicate exons, the thin black
line introns and 5' and 3' UTRs. Numbers above boxes show size of
exons, numbers below the line show intron size. Italicised numbers
refer to the size of 5' and 3' UTRs, bold-underline, the length of
known sequence upstream of the start codon. Numbers are in base
pairs. Thick black bars indicate the six consensus trans-membrane
domains as predicted by ARAMEMNON
(http://aramemnon.botanik.uni-koeln.de/). (B) Kyte-Doolittle
hydrophobicity plot (Kyte and Doolittle, J Mol Biol 157: 105-132,
1982) of HvCslH1. A 19 amino acid window with a +1.6 cutoff was
used. The six predicted transmembrane domains are indicated by
black bars. Numbers refer to amino acids. (C) Predicted membrane
topology of HvCslH1. NH.sub.2, amino terminal; COOH, carboxy
terminal; lumen, interior of ER, Golgi body or vesicle; cyt,
cytoplasm, mem, membrane, D,D,D,QXXRW, signature motif of CAZy GT2
family. Sequence of the QXXRW motif in HvCslH1 is QFKRW.
[0222] FIG. 7 shows a phylogenetic tree of full-length barley
(Hordeum vulgare) and rice (Oryza sativa) CSLH sequences. A.
thaliana and poplar (Populus trichocarpa) CSLB protein sequences
are included because the CSLB family is the most closely related of
the CSL families to the CSLH family. The alignment was generated
using ClustalX and the in-built distance algorithm with neighbour
joining used. The number of bootstrap replicates (from a total of
1,000) supporting each Glade is indicated below the internode for
that Glade. Accession numbers are: HvCslH1 (FJ459581), OsCSLH1
(Os10g20090, AC119148), OsCSLH2 (Os04g35020, AL606632), OsCSLH3
(Os04g35030, AL606632), PtCSLB1 (http://genome.jgi-psf.org/Poptr1
1/Poptr1 1.home.html; ID no. 572982), PtCSLB2 (ID no. 684214),
AtCSLB1 (At2G32610, NM.sub.--128820), AtCSLB2 (At2G32620,
NM.sub.--128821), AtCSLB3 (At2G32530, NM.sub.--179859), AtCSLB4
(At2G32540, NM.sub.--128813), AtCSLB5 (At4G15290, NM.sub.--117617,
AtCSLB6 (At4G15320, NM.sub.--117620).
[0223] FIG. 8 shows a partial genomic map of the short arm of
chromosome 2H where HvCslH1 is located. HvCslH1 and a cluster of
four HvCSLF genes were mapped to an interval corresponding to
69.2-71.5 Mb on the Steptoe.times.Morex bin map close to the
centromere (indicated by a black circle). HvCslH1 was placed in bin
8, co-segregating with the wg996 marker. On the Steptoe.times.Morex
reference map, wg996 co-segregates with abc162 and is 2.3 cM south
of abc468, the marker that co-segregates with the four HvCSLF genes
(Burton et al., Plant Physiol 146: 1821-1833, 2008). Key markers
are shown on the left, their distances from the top of the
chromosome in centimorgans (cM) and the LOD (logarithm of the odds
to the base 10) score in the malt .beta.-glucan QTL analysis of Han
et al. (Theor Appl Genet 91: 921-927, 1995) are indicated on the
right.
[0224] FIG. 9 shows (A) HPAEC profiles of oligosaccharides released
upon (1,3;1,4)-.beta.-D-glucan endo-hydrolase digestion of AIR
prepared from 145 day-old combined leaf and stem material from
Arabidopsis line 16-2 (). 16-2 pre-enzyme treatment buffer wash ().
Barley mature leaf (entire sheath) AIR was used as the positive
control sample (). Laminaribiose standard (). Retention times for
maltose (G.alpha.4G) and cellobiose (G.beta.4G) are also marked by
arrows. (B) MALDI-TOF MS chromatogram of enzyme-digested AIR of
sample in A. DP2 (laminaribiose), DP3 (3-O-.beta.-cellobiosyl
D-glucose) and DP4 (3-O-.beta.-cellotriosyl D-glucose) peaks are
indicated.
[0225] FIG. 10 shows the nucleotide sequence identity, protein
sequence identity and protein sequence similarity between CslH
sequences derived from Barley (Hordeum vulgare) and Rice (Oryza
sativa).
[0226] FIG. 11 shows a ClustalW multiple sequence alignment of CslH
amino acid sequences derived from Barley (Hordeum vulgare) and Rice
(Oryza sativa).
[0227] FIG. 12 is a phylogenetic tree showing the relationship of
complete CslB, F and H amino acid sequences derived from Barley
(Hordeum vulgare), Rice (Oryza sativa), Arabidopsis thaliana and
poplar (Populus trichocarpa).
[0228] FIG. 13 shows transmission electron micrographs illustrating
the detection of (1,3;1,4)-.beta.-D-glucan with a
(1,3;1,4)-.beta.-D-glucan-specific monoclonal antibody in epidermal
cell walls of four transgenic Arabidopsis plant lines used as
parents in OsCSLF2.times.HvCslH1 transgenic plant crosses. HvCslH1
line individuals 15-8-3 and 15-11-7 are shown in panels A and B,
respectively, and OsCSLF2 line individuals H37-5 and H17-4-4 in
panels C and D, respectively.
[0229] FIG. 14 shows transmission electron micrographs illustrating
the detection of (1,3;1,4)-.beta.-D-glucan with a
(1,3;1,4)-.beta.-D-glucan-specific monoclonal antibody in cell
walls of progeny resulting from OsCSLF2.times.HvCslH1 transgenic
plant crosses. An individual from a cross of 15-8-3.times.H37-5 is
shown in (A), a sib of 15-8-3.times.H37-5 (B), 15-8-3.times.H37-7
(C), a sib of 15-8-3.times.H37-7 (D), 15-8-15.times.H37-16 (E and
F), 15-11-13.times.H37-11 (G) and 15-11-7.times.H17-4 (H). Panels
A-E, G-H show epidermal cells, panel F, mesophyll cells.
[0230] FIG. 15 shows a vector map of the pGWB15 vector used to
express the CslH gene in Arabidopsis.
[0231] FIG. 16 shows the DNA sequence and translated amino acid
sequence of the CslH1 gene cDNA from barley cv. Himalaya. The DNA
sequence is shown numbered every ten bases and the translated amino
acid sequence of the single large open reading frame is shown
beneath in single letter form.
[0232] FIG. 17 shows a comparison of the barley CslH1 gene cDNA and
genomic sequences against the genomic sequences of the three wheat
CslH1 gene homeologs (TaCslH1-1, 1-2 and 1-3). The DNA sequences of
the barley cDNA (top, HvCslH1 from cv. Schooner (SEQ ID NO: 1) and
HvCslH1Him from cv. Himalaya, (SEQ ID NO: 69) and genomic clones
(HvCslH1g from cv. Morex (SEQ ID NO: 9) and HvCslH1gHim from cv.
Himalaya (SEQ ID NO: 71) were aligned with the three wheat
sequences (TaCslH1-1, 1-2 and 1-3, (SEQ ID NO: 78, 80 and 81,
respectively) in BioEdit using the Muscle comparison programme. The
alignment position is numbered above the sequences and dashes
indicate gaps introduced to optimise the alignment. Nucleotides
identical to the wheat genomic sequence (TaCslH1-1) are indicated
by dots. The exon/intron boundaries are shown in bold in the wheat
genomic sequence (TaCslH1-1). For reference, the ATG initiation
codon of the CslH coding region starts at alignment position 98 and
the stop codon TAA starts at position 3320, both are
underlined.
[0233] FIG. 18 shows a comparison of the amino acid sequences of
the barley cv. Himalaya and wheat CslH1 proteins. The translated
amino acid sequences of the barley gene (top, HvCslH1(Him) were
aligned with the three wheat sequences (indicated as TaCslH1-1pro,
1-2pro and 1-3pro) in BioEdit using the Muscle comparison
programme. The alignment position is numbered above the sequences
and there is a single dash (indicating a gap) in the barley
sequence introduced to optimise the alignment. Amino acids are
shown in their single letter form and those identical to the barley
sequence (HvCslH1(Him) are indicated by dots.
[0234] FIG. 19 shows the results of semi quantitative RT-PCR and
Q-PCR expression analysis of the barley cv. Himalaya CslH1 gene
during coleoptile development. Panel A shows semi quantitative
RT-PCR showing the expression pattern of the barley CslH1 gene
during growth of the coleoptile and in young leaf (L), root (R) and
mid stage endosperm (E). A constitutively expressed gene (alpha
tubulin) is shown as a control. Panel B shows normalized expression
levels (Q-PCR) for HvCslH1 in developing coleoptiles at various
times (days) after the initiation of germination.
[0235] FIG. 20 shows the results of semi quantitative RT-PCR
expression analysis of the barley CslF and CslH1 genes during leaf
development. Semi quantitative RT-PCR showing the expression
pattern of the barley CslH1 gene compared to other barley CslF
genes. A constitutively expressed gene (alpha tubulin) is shown as
a control.
[0236] FIG. 21 shows the results of semi quantitative RT-PCR
expression analysis of the barley cv. Himalaya and wheat CslH1
genes during endosperm development. Semi quantitative RT-PCR
showing the difference in expression pattern of the CslH1 gene in
the developing endosperm of barley cv. Himalaya gene (upper panel)
compared to wheat cv. Westonia (lower panel). DPA=days post
anthesis.
[0237] FIG. 22 shows the results of quantitative RT-PCR expression
analysis of the barley cv. Himalaya and wheat CslH1 genes during
endosperm development. Quantitative real time RT-PCR showing the
difference in expression pattern of the barley CslH1 gene compared
to wheat CslH1 gene in developing endosperm. The Ta0 dpa sample has
been set to one and the other expression levels are relative to
this.
[0238] FIG. 23 shows a plasmid map of the plant transformation
vector used to express the barley cv. Himalaya CslH1 genomic
sequence under control of the Bx17 promoter. A schematic
representation of the plant transformation vector designated
pZLBx17HvgH1. The boxes inside the circular plasmid represent
various genetic elements: Bx17prom=Bx17 promoter driving expression
of the barley HvCslH1 genomic sequence; Hvg9185.sub.--1=HvCslH1
genomic clone number 1 isolated with primer pair SJ91 and SJ85;
Nos3'=nopaline synthase polyadenylation sequence; NPTII=bacterial
kanamycin resistance gene. The position of selected restriction
sites is indicated outside of the plasmid map.
[0239] FIG. 24 shows a plasmid map of the plant selectable marker
plasmid conferring kanamycin resistance. A schematic representation
of the plant transformation vector designated pCMSTLSneo. The boxes
inside the circular plasmid represent various genetic elements:
35Sprom=CaMV 35S promoter driving expression of the plant
selectable marker gene; NPTII=plant kanamycin resistance gene; STLS
intron=Solanum tuberosum large subunit intron; 35S polyA=CaMV 35S
polyadenylation sequence; Amp res=bacterial ampicillin resistance
gene. The position of selected restriction sites is indicated
outside of the plasmid map.
[0240] FIG. 25 shows the beta glucan contents of single wheat
grains from T0 plant line 10 expressing the barley cv. Himalaya
CslH1 gene. Graph showing beta glucan content of individual wheat
grains from a T0 line number 10. Beta glucan is given as a
percentage of flour weight.
[0241] FIG. 26 shows a quantitative RT-PCR expression analysis of
CslH1 genes in empty vector control (208) and transgenic (236)
barley. Expression is shown in leaf and developing grain at 7 days
after pollination (7D) and 14 days after pollination (14D).
[0242] FIG. 27 shows a comparison of the DNA coding sequence and
amino acid sequence identity/similarity for barley and wheat CslH
sequences. HvCslH1=DNA coding sequence from barley cv. Schooner
(SEQ ID NO: 1) and corresponding amino acid sequence (SEQ ID NO:
2); HvCslH1 (Him) DNA coding sequence from barley cv. Himalaya (SEQ
ID NO: 69) and corresponding amino acid sequence (SEQ ID NO: 70);
TaCslH1-1=DNA coding sequence from wheat cv. Chinese Spring (SEQ ID
NO: 72) and corresponding amino acid sequence (SEQ ID NO: 75);
TaCslH1-2=DNA coding sequence from wheat cv. Chinese Spring (SEQ ID
NO: 73) and corresponding amino acid sequence (SEQ ID NO: 76);
TaCslH1-3=DNA coding sequence from wheat cv. Chinese Spring (SEQ ID
NO: 74) and corresponding amino acid sequence (SEQ ID NO: 77).
EXAMPLE 1
Barley has Only One CSLH Gene
[0243] Candidate CSLH genes in barley were initially identified by
querying online EST databases, such as the discontinued Stanford
cell wall website, NCBI, HarvEST, GrainGenes, Barley Gene Index and
BarleyBase, with rice CSLH sequences. All CSLH-related ESTs from
barley could be aligned into a single contiguous sequence of
.about.1,500 bp that included the entire 3' untranslated region
(UTR) and a region encoding the COOH-terminal 488 (of an expected
.about.750) amino acid residues of the protein (Table 2). This gene
was designated HvCslH1. Screening of a barley BAC library with
HvCslH1-derived probes identified several genomic clones all
containing HvCslH1, from which the missing 5' end was obtained
(data not shown). A 2,430 bp HvCslH1 cDNA fragment was
PCR-amplified, contains a single 2,256 bp ORF, and encodes a
protein with a predicted MW of 82.6 kDa and a pI of 7.0 (FIG. 6A).
Analysis of the conceptual translation of this sequence with
ARAMEMNON found between five and nine transmembrane domains (TMDs),
with the consensus among the different programs being two
NH.sub.2-terminal and four COOH-terminal TMDs (FIG. 6B) and both
termini of the mature protein predicted to be cytoplasmic. This
topology also places the large, central domain containing the
D,D,D,QFKRW motif within the cytoplasm (FIG. 6C). At the nucleotide
level, HvCslH1 shares 68-74% identity (62-69% amino acid identity)
(see Example 6) with the three rice CSLH genes (Hazen et al., Plant
Physiol 128: 336-340, 2002). A phylogenetic reconstruction shows
HvCslH1 to be the likely barley ortholog of OsCSLH1 (FIG. 7).
Genetic mapping of HvCslH1 using a Sloop.times.Halcyon doubled
haploid population (Read et al., Aust J Agr Res 54: 1145-1153,
2003) showed that HvCslH1 is on the short arm of chromosome 2H,
approximately 1.5 cM from a cluster of four HvCSLF genes (HvCSLF3,
4, 8, 10) that Burton et al. (Plant Physiol 146: 1821-1833, 2008)
reported was within a major QTL controlling .beta.-glucan content
in ungerminated barley grain (Han et al., Theor Appl Genet 91:
921-927, 1995; FIG. 8).
Supporting Information
[0244] A BAC library screening was employed to obtain a complete
set of full-length HvCslH family members. BAC filters containing
6.5 equivalents of the barley genome (cv. Morex) were screened and
three clearly positive clones identified (data not shown). When a
blot of BAC DNA from these clones digested with Hind III was
probed, the same three clones, 3-5-10, 3-7-3 and 3-7-8, were
verified as being positive. The digestion pattern of BACs 3-5-10
and 3-7-8 appeared identical and many bands were common to BAC
3-7-3, indicating that all 3 BACs cover identical or very similar
regions of the barley genome. When a genomic DNA blot was
hybridised with the same probe, single bands were observed in lanes
digested with Hind III, Eco RI or Eco RV, corroborating the BAC
digestion results. As all HvCslH ESTs are also derived from a
single gene (Table 2), these data strongly suggest that there is
only one CSLH gene in the barley genome.
[0245] An adaptor primer PCR method (Siebert et al., Nucl Acids Res
23: 1087-1088, 1995) was used to identify the 5' end of HvCslH1.
DNA was isolated from BACs 3-5-10 and 3-7-3, digested with a range
of restriction enzymes producing blunt-ended DNA fragments to which
adaptors were ligated. Nested PCR was then performed with adaptor-
and HvCslH1-specific primers (Table 3) in order to amplify
fragments containing the 5' end of the gene. Amplification of BAC
3-7-3 DNA digested with Nru I using primers AP2 and H1R6
successfully amplified a 1.3 kbp fragment that contained all but
.about.20 amino acids of the N-terminal sequence. Direct sequencing
of BAC 3-7-3 DNA with the H1R10 primer, an antisense primer
designed to anneal near the 5' end of the 1.3 kb fragment, enabled
the remainder of the open reading frame plus 748 bp of upstream
sequence to be identified. As predicted from earlier results, the
sequence obtained from BAC 3-5-10 was identical to BAC 3-7-3,
confirming that there is only one CSLH gene within the barley
genome.
TABLE-US-00002 TABLE 2 List of ESTs derived from HvCslH1. ESTs are
listed in order of alignment 5' to 3'. Accession no. (5' to 3')
Cultivar Source tissue CA013594 Barke early endosperm, 0-16 hours
after imbibition BJ470984 Haruna Nijo adult top three leaves at
heading stage BJ471865 Haruna Nijo adult top three leaves at
heading stage BJ473288 Haruna Nijo adult top three leaves at
heading stage BJ452043 Akashinriki vegetative stage leaves BJ471909
Haruna Nijo adult top three leaves at heading stage AV932844 Haruna
Nijo adult top three leaves at heading stage BJ469514 Haruna Nijo
adult top three leaves at heading stage AV933503 Haruna Nijo adult
top three leaves at heading stage AV933012 Haruna Nijo adult top
three leaves at heading stage AV932649 Haruna Nijo adult top three
leaves at heading stage AV932549 Haruna Nijo adult top three leaves
at heading stage BJ475824 Haruna Nijo adult top three leaves at
heading stage BJ476822 Haruna Nijo adult top three leaves at
heading stage AV934650 Haruna Nijo adult top three leaves at
heading stage BJ477472 Haruna Nijo adult top three leaves at
heading stage AV935479 Haruna Nijo adult top three leaves at
heading stage AV935951 Haruna Nijo adult top three leaves at
heading stage AV832539 Akashinriki vegetative stage leaves AV936586
Haruna Nijo adult top three leaves at heading stage CB881459 Barke
male inflorescences (approx. 2 mm in size), green anther stage
AV934667 Haruna Nijo adult top three leaves at heading stage
BJ475744 Haruna Nijo adult top three leaves at heading stage
BJ459600 Akashinriki vegetative stage leaves AV832391 Akashinriki
vegetative stage leaves
TABLE-US-00003 TABLE 3 Primers used in cloning and amplifying
HvCslH1 and in situ PCR analysis Gene Primer name Primer sequence
(5' to 3') Technique HvCslH1 H1F1 TTGACCGGACAACGGATCC DNA blot
analysis, (SEQ ID NO: 13) BAC screening, gene mapping, in situ PCR
HvCslH1 H1F2 CTGGAGATACTCATCAGC Northern blotting, (SEQ ID NO: 14)
transgenic plant genomic DNA PCR screening HvCslH1 HvCslH1cF1
TCGAGCGGTTGTTGCTTGTG HvCslH1 cDNA (SEQ ID NO: 15) amplification
HvCslH1 HvH1TOPOf CACCATGGCGGGCGGCAAGAAGCTG Binary vector (SEQ ID
NO: 16) construction HvCslH1 H1R1 CGTCACCGGGATGAAAAC DNA blot
analysis, (SEQ ID NO: 17) BAC screening, genome walking PCR, in
situ PCR HvCslH1 H1R2 TGACGCTCCACGGCATTC In situ PCR (priming (SEQ
ID NO: 18) cDNA synthesis) HvCslH1 H1R5 GGCTGGCCATCGAAATATTG BAC
screening, (SEQ ID NO: 19) genome walking PCR, gene mapping, in
situ PCR HvCslH1 H1R6 GAGCGTTGGTCATCACGG Genome walking (SEQ ID NO:
20) PCR HvCslH1 H1R7 CACATCGCGTGTAGGGC Genome walking (SEQ ID NO:
21) PCR HvCslH1 H1R10 CACTTGCCGTTCATGTTG Adaptor ligation (SEQ ID
NO: 22) PCR, BAC sequencing HvCslH1 HvCslH1cR1
CCTGCTTGAGTCTTCGTTACATGTTC HvCslH1 cDNA (SEQ ID NO: 23)
amplification HvCslH1 HvH1TOPOr CGCTTCCAATATTTCGATG Binary vector
(SEQ ID NO: 24) construction, Northern blotting, transgenic plant
genomic DNA PCR screening Generic Adaptor 1
CTAATACGACTCACTATAGGGCTCGAG Adaptor ligation PCR CGGCCGCCCGGGCAGGT
(SEQ ID NO: 25) Generic Adaptor 2 P-ACCTGCCC-NH.sub.2 Adaptor
ligation PCR (SEQ ID NO: 26) Generic AP1
GGATCCTAATACGACTCACTATAGGGC Adaptor ligation PCR (SEQ ID NO: 27)
Generic AP2 AATAGGGCTCGAGCGGC Adaptor ligation PCR (SEQ ID NO: 28)
18S rRNA Hv18SRTr GTTTCAGCCTTGCGACCATACT In situ PCR (priming (SEQ
ID NO: 29) cDNA synthesis) 18S rRNA Hv185f GGTAATTCCAGCTCCAAT In
situ PCR (SEQ ID NO: 30) 18S rRNA Hv185r GTTTATGGTTGAGACTAG In situ
PCR (SEQ ID NO: 31)
EXAMPLE 2
Expression of HvCslH1 in Arabidopsis Results in Deposition of
(1,3;1,4)-.beta.-D-Glucan
[0246] For heterologous expression in Arabidopsis, the HvCslH1 ORF
was cloned into the Gateway-enabled binary vector pGWB15 (Nakagawa
et al., J Biosci Bioeng 104: 34-41, 2007; FIG. 15), which placed
HvCslH1 under the control of the CaMV 35S promoter and added a
3.times.HA epitope tag to the encoded protein's NH.sub.2-terminal
end (FIG. 1A). Initial selection of transformed Arabidopsis seeds
identified a number of putative transgenic seedlings which PCR
confirmed contained HvCslH1. RNA blot analysis of these T.sub.1
plants showed that approximately 90% accumulated HvCslH1
transcripts in rosette leaves (FIG. 1B). Western blotting using an
anti-HA tag antibody was used to detect HvCslH1 protein in these
lines (FIG. 1C). A mixed microsomal membrane fraction
(50,000-100,000.times.g pellet) was prepared from pooled three-week
old kanamycin-resistant T2 seedlings. Western blotting with the
anti-HA antibody showed that only four of the 28 lines containing
HvCslH1 transcripts accumulated a polypeptide of the expected size
(.about.90 kDa) (FIG. 1C). Occasionally proteins of higher and
lower molecular mass were also detected (e.g. lane 11). The 90
kDa-protein was not observed in total protein extracts (data not
shown) or in mixed-membrane fractions prepared from untransformed
Arabidopsis plants (FIG. 1C, Col-0 lane). It is not known why
HA-tagged HvCslH1 accumulated in only some of the plant lines that
expressed HvCslH1 mRNA or why no correlation was apparent between
HvCslH1 protein levels and either HvCslH1 transcript levels
(compare FIGS. 1B and C) or with the number of HvCslH1 transgenes
present in a plant (data not shown), although this has been
previously observed (Burton et al., Science 311: 1940-1742, 2006)
Lines 8, 11, 16 and 24, which expressed the HA-tagged HvCslH1, and
line 6, which did not express detectable levels of the protein
(control), were selected for subsequent experimental work.
[0247] Immuno-EM was used to determine whether the walls of the
transgenic Arabidopsis plants accumulated detectable levels of
.beta.-glucan. Thin sections of mature leaf pieces from
self-pollinated progeny of lines 8, 11, 16, 24 and 6 (T2
generation) were probed with a monoclonal antibody specific for
.beta.-glucan (Meikle et al., Plant J 5: 1-9, 1994), followed by
detection using a secondary antibody conjugated to 18 nm gold
particles. Gold particles were clearly evident in walls of the
HA-tagged HvCslH1 positive lines 8, 11 and 16 (FIG. 2A, C, B,
respectively) but not in the walls of either line 24, which also
expressed HvCslH1 (data not shown), or line 6 (FIG. 2E) which had
no detectable HvCslH1 protein. Each positive transgenic line showed
a different pattern of tissue labeling. In line 8, patchy labeling
was observed in the walls of epidermal cells and occasionally in
xylem walls (FIG. 2A) whereas in line 11, epidermal and vascular
tissue walls were only lightly labelled, but heavier (albeit more
patchy) labeling was observed in mesophyll walls (FIG. 2C). Broadly
distributed, light labeling was present in all walls of the mature
leaf of line 16 (FIG. 2B). Irregular and inconsistent patterns of
ectopic polysaccharide production by transgenic Arabidopsis lines
expressing genes driven by the "constitutively"-expressed 35S
promoter have been observed previously (Burton et al., 2006,
supra). No labeling was seen in leaf sections of untransformed
Arabidopsis (FIG. 2D). Reduced levels of labeling were seen in leaf
sections of transgenic plants that had been pre-incubated with a
Bacillus subtilis endo-hydrolase which specifically hydrolyses this
.beta.-glucan (Burton et al., 2006, supra; data not shown).
[0248] To provide biochemical confirmation of the presence of
.beta.-glucan in transgenic Arabidopsis walls and to examine the
fine structure of the nascent .beta.-glucan, leaf and/or stem
material was pooled from the self-pollinated T3 and T4 progeny of
lines derived from plants 8, 11 and 16. These lines were homozygous
for the HvCslH1 transgene. Because .beta.-glucan was found to
accumulate with plant age, samples were taken when plants were in
senescence. Walls were prepared and digested with a
(1,3:1,4)-.beta.-glucan-specific endo-hydrolase and the released
oligosaccharides profiled by HPAEC and MALDI-TOF MS.
(1,3;1,4)-.beta.-D-Glucan endo-hydrolase specifically hydrolyses
(1,4)-.beta.-glucosidic linkages when these linkages are on the
reducing-end side of a (1,3)-.beta.-D-glucosyl residue. The action
of this enzyme yields a series of oligosaccharides with different
degrees of polymerization (DP). The diagnostic oligosaccharides in
this series are the trisaccharide G4G3G.sub.R and the
tetrasaccharide G4G4G3G.sub.R (where G is .beta.-D-glucopyranose, 3
and 4 indicate (1,3) and (1,4) linkages, respectively, and G.sub.R
refers to the reducing terminal residue). Variable quantities of
G4G3G.sub.R and G4G4G3G.sub.R were released when walls prepared
from leaf or leaf and stem from lines 8 and 11 and two independent
lines derived from plant 16 (lines 16-1 and 16-2) were treated with
(1,3;1,4)-.beta.-D-glucan endo-hydrolase (FIGS. 3, 9A). These
oligosaccharides were not detected in the no-enzyme treatment
control. The ratio of G4G3G.sub.R to G4G4G3G.sub.R (DP3:DP4) was
estimated to be 3.5 in line 16-1, which is similar to the DP3:DP4
ratio of 3.6 obtained for .beta.-glucan from the barley leaf
sample. A peak that co-eluted with laminaribiose, a
(1,3)-.beta.-linked disaccharide of glucose (G3G.sub.R), was also
observed in lines 8, 11 and 16-2 at varying levels across samples
(FIG. 9A, data not shown). This product was absent from the barley
and no-enzyme treatment control samples (FIG. 9A), verifying its
appearance is not due to a contaminating enzyme in the
(1,3;1,4)-.beta.-D-glucan endo-hydrolase preparation or to
endogenous disaccharide or enzyme activity within Arabidopsis. The
identities of oligosaccharides in this profile were further
confirmed by MALDI-TOF MS analysis, which showed the presence of
Hex.sub.2, Hex.sub.3 and Hex.sub.4 in ratios similar to those
observed in the HPAEC profile (FIG. 9B). The amounts of
.beta.-glucan in lines 16-1 and 16-2, as estimated from the areas
of the G4G3G.sub.R peaks, were 0.005% and 0.003% (w/w) of total
wall, respectively.
EXAMPLE 3
HvCslH1 is Located in ER- and Golgi-Associated Vesicles but not the
Plasma Membrane of Transgenic Arabidopsis Plants Expressing
HvCslH1
[0249] Sections of high pressure-frozen leaves from line 11 were
incubated with the gold-labelled anti-HA antibody to determine the
sub-cellular location of HvCslH1. Labelling was seen in the
endoplasmic reticulum and in Golgi-derived vesicles but not in the
plasma membrane (FIG. 4A, B). Similar results were observed in
labelled sections of roots and seedlings (data not shown).
EXAMPLE 4
HvCslH1 is Transcribed in Barley at Low Levels in Developing Grain,
Floral Tissues and Cells of the Leaf Undergoing Secondary Cell Wall
Thickening
[0250] The levels of HvCslH1 transcripts in various barley tissues
were determined using quantitative RT-PCR (QPCR). The gene-specific
primers are presented in Table 4.
TABLE-US-00004 TABLE 4 List of primers used in Q-PCR analysis. PCR
primers and PCR product sizes are given in base pairs, together
with optimal acquisition temperatures for genes analysed. Hv,
Hordeum vulgare. Forward Primer (5'-3') PCR product Acquisition
Gene Reverse Primer (5'-3') (bp) Temp. (.degree. C.) Hv GAPDH
GTGAGGCTGGTGCTGATTA 198 80 (SEQ ID NO: 32) CGTGGTGCAGCTAGCATTTGAGAC
(SEQ ID NO: 33) Hv Cyclophilin CCTGTCGTGTCGTCGGTCTAAA 122 79 (SEQ
ID NO: 34) ACGCAGATCCAGCAGCCTAAAG (SEQ ID NO: 35) Hv
.alpha.-Tubulin AGTGTCCTGTCCACCCACTC 248 80 (SEQ ID NO: 36)
AGCATGAAGTGGATCCTTGG (SEQ ID NO: 37) Hv HSP70 CGACCAGGGCAACCGCACCAC
108 83 (SEQ ID NO: 38) ACGGTGTTGATGGGGTTCATG (SEQ ID NO: 39) Hv
EL1a GGTACCTCCCAGGCTGACTGT 164 80 (SEQ ID NO: 40)
GTGGTGGCGTCCATCTTGTTA (SEQ ID NO: 41) HvCslH1 TGCTGTGGCTGGATGGTGTT
295 82 (SEQ ID NO: 42) GCTTTATTATTGAGAGAGATTGGGAGA (SEQ ID NO:
43)
[0251] FIG. 5 (A-C) shows that across a set of barley vegetative
and floral tissue cDNAs, HvCslH1 transcripts were accumulated to
levels that were routinely less than 1,000s copies/.mu.l cDNA. This
value is lower than some of the other barley CESAs and CSLs we have
studied where values are typically in the range of 10,000s and
100,000s copies/.mu.l cDNA. Levels of HvCslH1 transcripts were
relatively low in tissues comprising rapidly elongating cells,
including coleoptile and leaf base, which are those that are
actively synthesising .beta.-glucan.
[0252] The highest levels of HvCslH1 transcripts were in leaf tip,
where cells are no longer actively growing and less .beta.-glucan
accumulates (FIG. 5C; 2, 4). HvCslH1 transcription in leaf was
characterised further using RNAs isolated from six zones within the
.about.13 cm-long leaves of 10 day-old seedlings, starting from the
leaf tip. These zones comprises fully mature cells (zone A), to the
leaf base comprising dividing cells (zone F). In situ PCR (see
Example 5) was used to identify those cells in the leaf tip that
contained the HvCslH1 mRNA. In this technique, cells in which gene
transcripts are detected stain purple to dark brown (FIG. 5D, 18S
RNA positive control). Cells where no transcription is detected
stain light brown, as in the negative control (FIG. 5E). HvCslH1
was mostly transcribed in cells that are undergoing secondary wall
thickening, such as interfascicular sclerenchymal fibre and xylem
cells (FIG. 5F). Immuno-EM using sections taken from barley leaf
and probed with the .beta.-glucan antibody identified .beta.-glucan
in the walls of these cells.
[0253] HvCslH1 transcript levels were also investigated in more
detail in a 24-day developing endosperm series (FIG. 5B). HvCslH1
expression was low throughout the starchy endosperm during
development. Maximum transcript levels were reached at 4 DPA,
approximately 1 day before .beta.-glucan is first detected in
endosperm walls. This transcription pattern is similar to that of
several barley CSLF genes (HvCSLF3, 4, 7, 8 and 10) that are also
expressed in developing grain, although HvCSLF9 and 6 show much
higher transcript levels.
EXAMPLE 5
Discussion
[0254] The data presented here indicate that the product of
HvCslH1, a member of the grass-specific CSLH gene family, mediates
.beta.-glucan biosynthesis in Arabidopsis. Barley appears to have
only a single CSLH gene based on EST database analyses, genomic DNA
blot analysis and BAC library screening. EST analyses of other
grasses such as bread wheat, Lolium multiflorum, Festuca
arundinacae and Brachypodium distachon (all subfamily Pooideae)
have one identified CSLH gene, similar to barley, whereas maize,
sorghum and sugar cane (all subfamily Panicoideae), like rice
(subfamily Ehrhartoideae), appear to have multiple CSLH genes. When
an epitope-tagged version of the HvCslH1 cDNA was heterologously
expressed in Arabidopsis, three of four plant lines in which
protein was detected accumulated a polysaccharide in their walls
that was recognized by a .beta.-glucan-specific monoclonal
antibody. When isolated walls of the transgenic lines were digested
with a specific (1,3;1,4)-.beta.-D-glucan endo-hydrolase, the
characteristic trisaccharide (G4G3G.sub.R) and tetrasaccharide
(G4G4G3G.sub.R) were detected at ratios similar to those found in
.beta.-glucans from barley endosperm, demonstrating that the walls
from the transgenic Arabidopsis lines contained .beta.-glucan.
Furthermore, epitope-tagged HvCslH1 was found in the endoplasmic
reticulum and in Golgi-derived vesicles in cells of transgenic
plants. The morphological phenotype of the transgenic Arabidopsis
lines that expressed HvCslH1 appeared identical to wild-type
plants.
[0255] Although the overall proportion of (1,3)- and
(1,4)-.beta.-glucosyl linkages and the ratios of the G4G3G.sub.R
and G4G4G3G.sub.R products from (1,3;1,4)-.beta.-D-glucan
endo-hydrolase digestion of walls derived from plant line 16-1 was
similar to those observed in .beta.-glucans isolated from barley
tissues, one unusual feature that was observed was that the major
oligosaccharide released by (1,3;1,4)-.beta.-D-glucan
endo-hydrolase from the walls of line 16-2 was laminaribiose
(G3G.sub.R; FIG. 9A). The presence of G3G.sub.R in variable levels
was also associated with increased levels of trisaccharide relative
to the tetrasaccharide and, thus increased DP3:DP4 ratios. The
presence of G3G.sub.R in wall digests of the majority of plant
lines indicates a polysaccharide containing sections of alternating
(1,3)-.beta.- and (1,4)-.beta.-linked glucosyl residues
(-G3G4G3G4-). It is not known if these reside in a separate
polysaccharide or constitute a portion of a .beta.-glucan chain
that also has the usual fine structural features. Alternating
(1,3)-.beta.-D-glucosyl and (1,4 .beta.-D-glucosyl residues are not
common in barley and other cereal .beta.-glucans, but do represent
a significant component of the .beta.-glucan from the non-flowering
plant Equisetum and are also detected in .beta.-glucans from a
number of fungi, including basidiomycetes and ascomycetes. It is
possible that G3G.sub.R arises through misregulation of the
.beta.-glucan synthase in transgenic Arabidopsis, possibly because
its membrane micro-environment is different or because an unknown
factor that in barley suppresses (1,3)-.beta. glucosidic linkage
formation (or alternatively promotes (1,4)-.beta. glucosidic
linkage formation) is present at suboptimal levels in Arabidopsis.
Minor variations in the level of this factor among the lines
derived from plant 16 would account for the different structures
that were obtained. Another possible explanation for the structural
variability in the .beta.-glucan may relate to subtle differences
in post-assembly processing (see also Supporting Information
below).
[0256] In barley, HvCslH1 was most highly transcribed in leaf tips,
a tissue comprising fully mature cells. There is no evidence to
indicate coordinate transcription of HvCslH1 and any of the barley
CSLFs, suggesting that their encoded products are not components of
a protein complex. HvCslH1 transcription, for example, was not high
in elongating cells such as the coleoptile or developing endosperm,
which in barley are the tissues where .beta.-glucan is
characteristically accumulated. Although usually found in primary
cell walls of vegetative tissues where it is implicated in the
control of cell expansion and possibly as a temporary store of
glucose that can be mobilized as an energy source in the dark,
.beta.-glucan has also been found in the lignified cell walls of
xylem tracheary elements and sclerenchyma fibres, where immuno-EM
using the antibody to .beta.-glucan shows labeling in both the
middle lamella region (primary wall) and secondary wall of
sclerenchyma cells. Because in situ PCR showing transcription of
the HvCslH1 gene in the leaf was restricted to cells such as
interfascicular sclerenchymal fibre and xylem cells, we suggest
that a major role of this gene is in .beta.-glucan synthesis during
secondary wall development, although we cannot exclude a role in
primary wall .beta.-glucan synthesis elsewhere in the plant.
[0257] Regardless of how the fine structures of .beta.-glucans are
generated, it is clear that the CSLHs can mediate the synthesis of
.beta.-glucan in Arabidopsis, a finding that has implications for
our understanding of how this polysaccharide is synthesised. Any
mechanism(s) being considered for the assembly of .beta.-glucan
must account for the synthesis of the predominant cellotriosyl and
cellotetraosyl units, the random linking of these
(1,4)-.beta.-units together by single (1,3)-.beta.-linkages and the
means by which the molar ratio of tri- to tetra-saccharide units is
regulated. At least two glycosyltransferase activities might act in
concert: one that processively adds (1,4)-.beta.-linked glucose
residues to assemble the tri- and tetra-saccharides and the other
that adds single (1,3)-.beta.-linkages. Based on our current
knowledge of polysaccharide synthases several mechanisms are
hypothetically possible. The simplest explanation is that the one
polypeptide is responsible for the synthesis of both glucosidic
linkage types. Our transgenic experiments indicate that CSLH
proteins are independently able to make a .beta.-glucan and could
therefore conceivably make both types of .beta.-linkages. The CSLH
family is classified by the Carbohydrate Active Enzymes (CAZy)
database as members of glycosyltransferase family 2 (GT2)
(http://www.cazy.org; Coutinho et al., J Mol Biol 328: 307-317,
2003), a family that includes enzymes capable of independently
catalyzing the synthesis of either (1,3)-.beta.- or
(1,4)-.beta.-linkages but also examples of bifunctional enzymes,
i.e. enzymes that can synthesize two types of glycosidic linkages.
For example, hyaluronan synthases (HAS) synthesize a repeating
disaccharide of (1,4)-.beta.-glucuronic
acid-(1,3)-.beta.-N-acetylglucosamine units and both transferase
activities reside in the one polypeptide. In mouse HAS1, the region
that includes the D,D,D,QXXRW motif is responsible for both these
activities. The active site of the CSLHs, also containing the
D,D,D,QXXRW motif, might be similarly bifunctional. Another
possibility is that the CSLHs synthesise only one type of
glucosidic linkage with another glucosyltransferase, common to
monocots and dicots, responsible for synthesis of a second
linkage.
EXAMPLE 6
Materials and Methods
Binary Vector Construction and Plant Transformation
[0258] The HvCslH1 ORF was amplified from barley cv. Schooner
mature leaf tip cDNA with Herculase.RTM. (Stratagene) using primers
HvH1TOPOf and HvH1TOPOr (Table 3) and the PCR product cloned into
pENTR/D-TOPO (Invitrogen). Using the manufacturer's protocol
(Invitrogen), an LR reaction was used to clone the cDNA into the
destination vector pGWB15 containing an NH.sub.2-terminal
3.times.HA tag (Nakagawa et al., J Biosci Bioeng 104: 34-41, 2007)
and the predicted sequence confirmed by DNA sequencing. The
HvCslH1::pGBW15 construct was transferred from Escherichia coli
into Agrobacterium tumefaciens strain AGL1 via triparental mating
using the helper plasmid pRK2013. Arabidopsis thaliana Col-0 plants
were transformed using the floral dip method (Clough and Bent,
Plant J 16: 735-743, 1998).
RNA Blot Analysis
[0259] Samples of .about.10 .mu.g total RNA extracted from mature
rosette leaves of T1 plants using TRIzol.RTM. (Invitrogen) were
prepared and separated on a 1% w/v agarose-formaldehyde gel
(Farrell, RNA methodologies: A laboratory guide for isolation and
characterization, Academic Press, Inc., San Diego, 1993). RNA was
transferred to Hybond.TM. N.sup.+ membranes, pre-hybridised and
hybridised according to the method outlined in the Gene Images
CDP-Star detection module (Amersham-Biosciences). A HvCslH1
fragment amplified with primers H1F2 and HvH1TOPOr (Table 3) was
labeled using the Gene Images Random Prime labeling module
(Amersham) following the manufacturer's protocol and used as the
probe.
Quantitative PCR Analysis
[0260] RNA extractions, cDNA syntheses and QPCR were carried out as
described in Burton et al. (Science 311, 1940-1942, 2006; Plant
Physiol 134, 224-236, 2004) with the modifications listed in Burton
et al. (Plant Physiol 146, 1821-1833, 2008). The primer sequences
of the barley control genes are listed in Table 4.
In Situ PCR
[0261] In situ PCRs were conducted according to the method of
Koltai & Bird (Plant Physiol 123: 1203-1212, 2000) with the
following modifications. After tissue sectioning, genomic DNA was
removed by treatment for 6 h at 37.degree. C. in 1.times. DNase
buffer and 4 U RNase-free DNase (Promega). cDNA synthesis was
carried out using Thermoscript.TM. RT (Invitrogen) except that the
RNase H step was omitted and a gene-specific primer (1 .mu.g, Table
3) used for reverse transcription. PCRs were carried out in a final
volume of 50 .mu.L containing 1.times.PCR buffer, 200 .mu.m dNTPs
(Promega), 0.2 nmol digoxigenin-11-dUTP (Roche), 2 mM MgCl.sub.2,
200 ng of each primer and 2 U Taq DNA polymerase (Invitrogen).
Cycling parameters were as follows: initial denaturation at
96.degree. C. for 2 min, then 40 cycles of 94.degree. C. for 30
sec, 59.degree. C. for 30 sec, 72.degree. C. for 1 min. Sections
were then washed, incubated with 1.5 U alkaline
phosphatase-conjugated anti-digoxigenin Fab fragments (Roche) and
developed for 10-20 min as outlined by Koltai & Bird (2000,
supra). For negative control sections, reverse transcriptase was
omitted and all the Hv 18S rRNA primers included to check whether
there was any amplification from genomic DNA.
Preparation of Mixed Microsomal Membranes
[0262] T1 seed of HvCslH1 transgenic plants was collected and
.about.100 seeds sown onto 1.times.MS agar media containing 50 mg/L
kanamycin (Sigma). After 3 weeks, kanamycin-resistant seedlings
were pooled, frozen in liquid N.sub.2 and ground at 4.degree. C. in
a mortar and pestle containing homogenising buffer (50 mM
NaPO.sub.4 buffer, pH 7.5, 0.5 M sucrose, 20 mM KCl, 10 mM DTT, 0.2
mM PMSF, 83 .mu.L plant protease inhibitor cocktail (Sigma,
P9599)). Homogenate was filtered through a 50 .mu.M mesh and the
S/N centrifuged at 6,000.times.g for 10 min at 4.degree. C. The S/N
was decanted and centrifuged at 50,000.times.g for 30 min at
4.degree. C. in 4.5 ml ultracentrifuge tubes (Beckmann). The
50,000.times.g S/N was decanted and the pellet resuspended in 10 mM
Tris-MES buffer, pH 7.5 using a glass-teflon homogenizer. The
resuspended pellet was diluted to 4.5 mL with Tri-MES buffer and
centrifuged at 100,000.times.g for 1 h at 4.degree. C. The pellet
was resuspended in 0.25 M sucrose, 10 mM Tris-MES buffer, pH 7.5,
as outlined above. Protein concentration was measured using
Bradford assay reagent (BioRad) using bovine serum albumin as the
standard.
Western Blotting
[0263] Samples of membrane protein (30 .mu.g) were incubated at
60.degree. C. for 20-60 min in 200 mM dithiothreitol and sample
buffer (37.5 mM Tris-HCl, pH 7.0, 10% glycerol, 3% sodium
dodecylsulphate (SDS), 0.025% bromophenol blue) to give an
SDS:protein ratio of 1.5 mg SDS to 30 .mu.g protein before loading
onto an 8% SDS-PAGE gel. After electrophoresis, gels were blotted
onto nitrocellulose (OSMONIC.TM. Nitropure 22 .mu.m) in Towbin
buffer (25 mM Tris base, 192 mM glycine, 20% methanol) containing
0.05% SDS at 100 V for 90 min at 4.degree. C. Membranes were then
blocked overnight in Tris-buffered saline (TBS; 20 mM Tris base,
150 mM NaCl) containing 3% w/v milk powder before incubation for 1
h at RT in rat anti-HA polyclonal antibody (Roche) diluted 1:1000
in TBS containing 1% BSA. Membranes were washed 3.times. in TBS
containing 0.05% SDS (TBST), then incubated in anti-rat IgG
HRP-conjugated antibody (Dako) diluted 1:1000 in TBS containing 3%
w/v nonfat milk powder. Membranes were washed 3.times. in TBST
before signal was detected with the SuperSignal.RTM. West Pico
chemiluminescent substrate (Pierce).
Immuno-Electron Microscopy
[0264] Arabidopsis tissues were fixed and labeled with
anti-(1,3;1,4)-.beta.-D-glucan specific antibody (Meikle et al.,
Plant J 5: 1-9, 1994) according to Burton et al. (Science 311,
1940-1942, 2006). For labeling with anti-HA antibody, plant tissue
was placed between two copper planchets and rapidly frozen in a
Leica EM high pressure freezer (set at 2.7.times.10.sup.5 kPa and
at an approximate rate of -10,000.degree. C. s.sup.-1). The
planchets were transferred into 100% ethanol in a Leica automated
freeze-substitution unit set at -50.degree. C. for 72 h. Samples
were brought to room temperature (RT) overnight, removed and
infiltrated with LR White resin and embedded in gelatin capsules as
detailed in Burton et al. (2006, supra). Thin sections of embedded
leaf tissue were collected on formvar-coated gold grids and
incubated in a 1:200 dilution of the rat anti-HA polyclonal
antibody in phosphate buffered saline (PBS; 137 mM NaCl, 10 mM
NaPO.sub.4, 2.7 mM KCl, pH 7.4) containing 1% w/v BSA for 1 h at RT
and then overnight at 4.degree. C. Grids were washed several times
in PBS, then incubated in a 1:20 dilution of anti-rat secondary
antibody conjugated to 18 nm gold (Jackson ImmunoResearch) in PBS
containing 1% w/v BSA for 1 h at RT. The grids were then washed,
post stained and viewed under the TEM as described by Burton et al.
(2006, supra)
Preparation of Cell Wall Material
[0265] Alcohol insoluble residue (AIR) was prepared by grinding
plant material in liquid N.sub.2 using a mortar and pestle. Five
volumes of 80% ethanol was added to the homogenate prior to mixing
by rotation for 1 h at 4.degree. C. After centrifugation at
3,400.times.g for 5 min, the supernatant was removed and the
residue was refluxed twice at RT in 80% ethanol for 1 h, followed
by refluxing in 50% ethanol twice for 1 h. The ethanol-soluble
fraction was removed and the AIR was washed once in 100% ethanol
prior to drying at 40.degree. C. under vacuum.
(1,3;1,4)-.beta.-D-Glucan Specific Endo-Hydrolase Digestion
[0266] AIR (100 mg, prepared as described above) was incubated in 5
mL 20 mM NaPO.sub.4 buffer, pH 6.5 for 2 h at 50.degree. C. with
continuous mixing in an incubator with shaking at 200 rpm. After 2
h, the suspension was centrifuged (3,400.times.g, 5 min) and the
supernatant (S/N) removed. Another 5 mL of buffer was added and the
incubation and centrifugation repeated. The S/N from this second
incubation was used as the no enzyme negative control. The pelleted
AIR was resuspended in 5 mL NaPO.sub.4 buffer to which 100 .mu.l
(1,3;1,4)-.beta.-D-glucan endo-hydrolase (McCleary et al., J Inst
Brew 91: 285-295, 1985) was added. The mixture was incubated for 2
h at 50.degree. C. with continuous mixing after which the S/N was
collected as the (1,3;1,4)-.beta.-D-glucan endo-hydrolase-released
oligosaccharides. The negative control and
(1,3;1,4)-.beta.-D-glucan endo-hydrolase-treated S/Ns were desalted
on a graphitised carbon cartridge as described by Packer et al.
(Glycoconj J 15: 737-747, 1998) and dried.
HPAEC Analysis
[0267] The dried (1,3;1,4)-.beta.-D-glucan endo-hydrolase-released
oligosaccharides were dissolved in 100 .mu.L Milli H.sub.2O and 20
.mu.L injected onto a CarboPac PA1 column (Dionex) equilibrated
with 50 mM NaOAc in 0.2 M NaOH using a Dionex BioLC ICS 300 system
(Dionex) equipped with a pulsed amperometric detector (PAD) and
autosampler. Oligosaccharides were eluted at 1 mL/min with a linear
gradient of NaOAc from 50 mM in 0.2M NaOH to 350 mM in 0.2 M NaOH
over 15 min. Laminaribiose (Seigaku), maltose and cellobiose (both
from Sigma) were run as standards.
MALDI-TOF MS Analysis
[0268] Aliquots (30 .mu.L) of the remaining
(1,3;1,4)-.beta.-D-glucan endo-hydrolase-released oligosaccharides
were lyophilised, dissolved in DMSO and methylated using the NaOH
method (Ciucanu and Kerek, Carb Research 131: 209-217, 1984).
Methylated oligosaccharides were partitioned into dichloromethane
(DCM) and the DCM phase washed 3.times. with MilliQ water. The DCM
phase was dried under a N.sub.2 stream before re-dissolving in 10
.mu.L 50% acetonitrile. A 1 .mu.L aliquot was mixed with 1 .mu.L
2,5-dihydroxy benzoic acid matrix (10 mg/mL dissolved in 50%
acetonitrile) and 1 .mu.L of the mix was spotted onto a MALDI plate
for analysis in a MALDI TOF mass spectrometer (Voyager DSTR,
Applied Biosystems).
EST Analyses, Contig Assembly and Bioinformatics
[0269] CSLH ESTs were obtained by querying public databases
including the now discontinued Stanford Cell Wall website, NCBI
(http://www.ncbi.nlm.nih.gov/), HarvEST (http://harvest.ucr.edu/),
GrainGenes (http://wheat.pw.usda.gov/GG2/index.shtml), Barley Gene
Index (http://compbio.dfci.harvard.edu/tgi/plant.html) and
BarleyBase (www.barleybase.org) using the BLAST search tool
(Altschul et al., Nucl Acids Res 25: 3389-3402, 1997). Sequences
were assembled into contigs using either Sequencer.TM. 3.0
(GeneCodes) or ContigExpress, a module of Vector NTI.RTM. Advance
9.1.0 (Invitrogen). DNA or protein sequences were aligned using
ClustalX (Thompson et al., Nucl Acids Res 24: 4876-4882, 1997).
Phylogenetic analysis was carried out using the in-built neighbour
joining algorithm and tree robustness assessed using 1000
bootstrapped replicates. Sequence similarities were calculated
using MatGat 2.02 (http://bitincka.com/ledion/matgat/) (Campanella
et al., BMC Bioinformatics 4: 29, 2003). Transmembrane domains were
predicted using the suite of programs described in ARAMEMNON
(http://aramemnon.botanik.uni-koeln.de) (Schwacke et al., Plant
Physiol 131: 16-26, 2003). Motifs predicting post-translational
modifications were identified using the programs listed in ExPasy
under the Tools menu (http://www.expasy.org/tools/#pattern).
Protein parameters were calculated using ProtParam at ExPasy
(http://www.expasy.org/cgi-bin/protparam).
Barley BAC Screening
[0270] BAC filters containing 6.5 equivalents of the barley genome
from the non-Yd2 cv. Morex (Clemson University Genomics Institute,
CUGI) were blocked for 6 h at 65.degree. C. in prehybidisation
solution (0.53 M NaPO.sub.4 buffer pH 7.2, 7.5% w/v SDS, 1 mM EDTA,
11 .mu.g/ml salmon sperm DNA). The radiolabeled cDNA and gDNA
fragment amplified with primers H1F1 and H1R1 or H1R5 (Table 3) was
added and incubated for 24 h at 65.degree. C. Filters were washed
3.times. with 2.times.SSC, 0.1% SDS at RT. Final washes were done
with 1.times.SSC, 0.1% SDS. Filters were exposed to X-ray film for
2 d. Positive BAC clones were identified and ordered as directed on
the CUGI website (http://www.genome.clemson.edu). Clones were
streaked onto LB agar containing 25 .mu.g/ml chloramphenical and
grown overnight at 37.degree. C. Colonies for each clone were
picked, placed on gridded nylon membranes resting on LB agar
containing 25 .mu.g/ml chloramphenicol and incubated overnight at
37.degree. C. DNA was fixed to the membrane and denatured by
placing on filter paper soaked in 0.4 M NaOH for 20 min, then
neutralized by placing on filter paper soaked in neutralizing
solution (1.5 M NaCl, 0.5 M Tris-HCl pH 7.2, 1 mM EDTA). Membranes
were then washed 3.times. in 2.times.SSC, 0.1% SDS and hybridized
using standard conditions (Sambrook et al., Molecular cloning: a
laboratory manual, Cold Spring Harbour Laboratory Press, New York,
1989).
BAC DNA Isolation
[0271] Positive clones were cultured overnight in LB broth
containing 25 .mu.g/ml chloramphenicol at 37.degree. C. Cells were
pelleted by centrifugation (12,000.times.g, 3 min) and the pellet
resuspended in 90 .mu.L TES buffer (25 mM Tris-HCl pH 8.0, 10 mM
EDTA, 15% w/v sucrose). An aliquot (180 .mu.L) of lysis solution
(0.2 M NaOH, 1% SDS) was added and mixed gently, followed by 135
.mu.L 3 M NaOAc pH 4.6. The chromosomal DNA was pelleted by
centrifugation (12,000.times.g, 15 min). The S/N was collected and
2 .mu.L RNase A (10 mg/mL) added and incubated for 1 h at
37.degree. C. A 400 .mu.L aliquot of Tris-saturated
phenol-chloroform (1:1 ratio) was added and the samples centrifuged
again (12,000.times.g, 5 min). The S/N was collected and BAC DNA
precipitated using 2-3 volumes chilled 95% ethanol for 10 min at
RT. The BAC DNA was pelleted by centrifugation (15,000.times.g, 15
min), washed in 70% ethanol, resuspended in 20-50 .mu.L TE and
stored at 4.degree. C.
Genome Walking
[0272] The adaptor ligation method of Siebert et al. (Nucl Acids
Res 23: 1087-1088, 1995) was used to amplify fragments of genomic
DNA upstream of known CSLH EST sequence. Restriction enzymes used
to digest barley genomic DNA were Eco RV, Nru I, Pvu II, Sca I or
Ssp I. Primary PCR reactions were conducted in 25 .mu.L volumes
containing 2 .mu.L ligated DNA (1:10 dilution), 1.times.PCR buffer,
2 mM MgCl.sub.2, 100 ng each of adaptor primer AP1 and antisense
primer H1R7 (Table 3), 0.4 mM dNTPs and 1 unit Taq polymerase
(Invitrogen). Cycle parameters were as follows: 96.degree. C. for 2
min then 40 cycles of 94.degree. C. for 30 sec, 59.degree. C. for
30 sec, 72.degree. C. for 1 min, and a final step at 72.degree. C.
for 7 min. A secondary PCR reaction was conducted with 1 .mu.L of
the primary PCR using 100 ng each of adaptor primer AP2 and the
nested primer H1R6. Reaction composition and cycle parameters were
the same as above except that an annealing temperature of
61.degree. C. was used.
BAC Sequencing
[0273] For sequencing, between 0.5 and 1 .mu.g of isolated BAC DNA
was combined with 5 pmol primer and 1.times. Big Dye Terminator v
3.1 (BDT) mix (Applied Biosystems, USA) in a final volume of 20
.mu.L. Cycle parameters were as follows: 96.degree. C. for 15 min,
then 65 cycles of 96.degree. C. for 10 sec, 55.degree. C. for 10
sec and 60.degree. C. for 4 min. DNA was precipitated with 0.1 vol
3M NaOAc pH 5.2 and 2.5 vol 95% ethanol on ice for 10 min, then
pelleted by spinning at 12,000.times.g for 30 min. The pellet was
rinsed with 70% ethanol, dried and sent to AGRF (Brisbane,
Australia) for sequencing.
Mapping of HvCslH1
[0274] Genetic mapping was done using a Sloop.times.Halcyon doubled
haploid (DH) mapping population of 60 lines (Read et al., Aust J
Agric Res 54: 1145-1153, 2003). Using standard methods of DNA blot
hybridization (Sambrook et al., 1989, supra) a HvCslH1 probe
PCR-amplified using primers H.sub.1F.sub.1 and H1R5 (Table 3) was
hybridized to membranes containing parental line genomic DNA
digested with one of six restriction enzymes (Bam HI, Dra I, Eco
RI, Eco RV, Hind III, Xba I). The dihybrid population was then
digested with enzymes that gave a clear polymorphism (Dra I).
Polymorphisms were scored and HvCslH1 map location determined using
the `find best location` function of MapManager QT version 0.30
(Manly et al., Mamm Genome 12: 930-932, 2001). Map locations were
correlated with QTL data using resources available at
http://www.barleyworld.org/.
Arabidopsis Growth Conditions
[0275] Arabidopsis seeds were surface-sterilized in a sterilization
solution (sodium hypochlorite (2% available chlorine), drop of
Tween-20) for 15 min then rinsed 4.times. with sterile MilliQ
water.
Surface-sterilized seed was spread onto 85.times.25 mm Petri dishes
containing 50 mL of sterile 1.times.MS medium (4.33 g/L Murashige
and Skoog basal salts (Phytotechnology Laboratories), 2% w/v
sucrose, 1% w/v bactoagar). For selection of transformants, 50 mg/L
kanamycin (Sigma) was added to the medium. Plates were placed in a
cold room for 3-5 days at 4.degree. C. to synchronize germination.
Cold-stratified plates were then transferred into controlled
environment growth cabinets (Thermoline L+M model TPG 1260
TO-5.times.400, Smithfield, NSW, Australia) with day and night
temperatures of 23.degree. C. and 17.degree. C., respectively. The
average light intensity at rosette leaf level was .about.70 .mu.E
m.sup.-2 sec.sup.-1 supplied by 3-foot fluorescent tubes (Sylvania
Standard F30W/133-T8 Cool White) during a 16 h light cycle. After 3
weeks on MS plates, individual plantlets were transferred into
hydrated 42 mm diameter Jiffy pellets. Nine rows of six pellets
were arranged in trays with three trays being housed on each
2.times.3.5-foot wire rack shelf. Relative humidity was measured to
be between 60 and 70%. Plants were watered with tap water
supplemented with Peter's Professional.TM. General Purpose plant
fertilizer (Scotts Australia) by sub-irrigation every 2-3 days.
Genomic DNA Extraction and PCR Analysis of Arabidopsis
Transgenics
[0276] DNA was extracted from a single Arabidopsis leaf according
to the method described in Edwards et al. (Nucl Acids Res 19: 1349,
1991). A 1 .mu.L aliquot of genomic DNA was used as template in PCR
screens of transgenic plants using primers H.sub.1F.sub.2 and
HvCslH1TOPOr (Table 3) with the following cycling regime:
94.degree. C. for 2 min followed by 35 cycles of 94.degree. C. for
20 sec, 57.degree. C. for 30 sec, 72.degree. C. for 30 sec.
EXAMPLE 7
Alignment of CslH DNA and Amino Acid Sequences from Rice and
Barley
[0277] An alignment of the DNA and amino acid sequences for the
CslH sequences in both rice and barley was performed to calculate
the percent identity and similarity between the sequences, the
results of which are shown in FIG. 10. The DNA and protein
sequences were aligned and compared using the default parameters in
MatGAT version 2.02 downloaded from
http://bitincka.com/ledion/matgat/.
[0278] Multiple sequence alignments and phylogenetic tree
generation was performed using the ClustalX program as described by
Thompson et al. (Nucl Acids Res 25: 4876-4882, 1997). The protein
alignment and resultant phylogenetic tree are shown in FIGS. 11 and
12, respectively.
EXAMPLE 8
Cross of HvCslH1 and OsCSLF2 Transgenic Arabidopsis Lines
[0279] Two transgenic Arabidopsis lines, 15-8 and 15-11, in which
the tagged HvCslH1 protein was detected using an anti-HA antibody,
were chosen to genetically cross with two other transgenic
Arabidopsis lines containing OsCslF2, H37 and H17-4, as described
by Burton et al. (Science 311: 1940-1942, 2006). It was thought
that by expressing the HvCslH1 and OsCSLF2 proteins in the same
cell types, higher levels of (1,3;1,4)-.beta.-D-glucan above those
observed in single gene (CSLH or CSLF only) transgenic Arabidopsis
plants, could potentially be deposited into cell walls. In
addition, this would aid in detecting (1,3;1,4)-.beta.-D-glucan in
immuno-electron microscopy studies as well as in chemical cell wall
analyses.
[0280] All four of the parental lines were confirmed to contain
(1,3;1,4)-.beta.-D-glucan in their cell walls by immuno-electron
microscopy (FIG. 13). Individuals from each of the four populations
were used as male and female parents. Flowers of the female parent
(e.g. individual H37-5) were emasculated prior to anther dehiscence
and pollinated using dehisced anthers from the male parent (e.g.
individual 15-8-3). Each crossed flower was labelled and the
resulting seed pods collected upon dehydration.
[0281] The progeny of each cross were sown in soil and their
genotypes determined by PCR using leaf genomic DNA as template and
HvCslH1-specific primers and, in a separate reaction,
OsCslF2-specific primers. Mature leaves were fixed, embedded,
sectioned and labeled with (1,3;1,4)-.beta.-D-glucan monoclonal
antibody. A number of the progeny were found to have greater levels
of labelling than the parental lines, as observed in FIG. 14. For
example, the labelling in the epidermal cells of the individual
shown in Panel D is much heavier than compared to its
15-8-3.times.H37-7 parents (FIG. 13). A sib with the same genotype
(FIG. 14, panel C) showed consistent yet lower levels of epidermal
cell wall labeling.
EXAMPLE 9
Cloning of CslH cDNA and Genomic Sequences from Barley Cultivar
Himalaya and Wheat
[0282] A full length cDNA sequence of the CslH1 gene was isolated
from barley cultivar Himalaya using a combination of barley EST
sequences, PCR from cDNA using primers based on the rice CslH1 gene
sequence (LOC_Os10g20090) and 5'RACE.
[0283] The 2333 bp consensus sequence designated HvCslH1(Him) (SEQ
ID NO: 69) is shown in FIG. 16. There is a single long open reading
frame of 751 amino acids (SEQ ID NO: 70).
[0284] Oligonucleotide primers SJ91 and SJ85 were designed from the
5' and 3' ends of the consensus sequence and used to amplify a 3203
bp DNA fragment from genomic DNA designated HvCslH1gHim (SEQ ID NO:
71) in FIG. 17.
[0285] Alignment of the barley cDNA sequence and genomic sequences
indicated that the CslH gene has eight small (approximately 100 bp)
introns each flanked by the consensus GT . . . AG splice
donor/acceptor sites (FIG. 17).
[0286] A wheat homolog of CslH1 was identified in the TIGR database
as TC255929. Three classes of sequences made up this tentative
consensus as exemplified by ESTs CJ614392, CJ609729 and CJ721204.
PCR primers were designed from the barley sequence surrounding the
ATG initiation codon (SJ163) and from the consensus sequence of all
three EST types at the 3' end (SJ164) and used to amplify a full
length genomic fragment from wheat cultivar Chinese Spring. Two
sequence types were identified and designated TaCslH1-1 (SEQ ID NO:
78) and TaCslH1-2 (SEQ ID NO: 79). The third homeolog designated
TaCslH1-3 (SEQ ID NO: 80) was isolated using primers SJ204 and
SJ164 as described in more detail in materials and methods.
[0287] Comparison with the barley sequences indicated that the
intron-exon junctions were conserved in all three genes (FIG. 17).
The three wheat genes are 94.8-96.1% identical.
[0288] The predicted coding region sequences of the three wheat
CslH1 genes (SEQ ID NO: 72, SEQ ID NO: 73 and SEQ ID NO: 74) each
encode a polypeptide of 752 amino acids (SEQ ID NO: 75, SEQ ID NO:
76 and SEQ ID NO: 77).
[0289] The DNA coding sequences and amino acids sequences of the
barley and wheat CSLH1 genes were aligned using the muscle
alignment program and the percentage identity and similarity was
calculated using a PAM250 matrix. A table showing the percentage
identity and similarity is show in FIG. 27.
[0290] As shown in FIG. 27, the wheat proteins are about 94-95.0%
identical to each other and about 92.6-93.1% identical to the
barley proteins.
EXAMPLE 10
CslH Gene Expression in Barley and Wheat
[0291] Expression of the CslH1 gene was examined by semi
quantitative (RT-PCR and gel electrophoresis) and quantitative
(real time PCR) methods.
[0292] The coleoptile is a good tissue to examine expression of
genes related to beta glucan biosynthesis since the levels of beta
glucan increase as the coleoptile grows and then decline after
growth has stopped. The CslH1 gene shows maximum expression only
after growth has ceased and is high in the oldest tissues (6-8 days
old, as shown in FIG. 19A/B).
[0293] Other tissues were also examined. In developing leaf, the
CslH1 gene shows differential and maximum expression in the oldest
tissue at the tip of the leaf (FIG. 20). It appears from these
results that the CslH1 gene is preferentially (although not
exclusively) expressed in cells that have stopped dividing and
elongating and are thus differentiating. Cells in the maturing
endosperm would be in a similar phase of development, ie. cell
division would have stopped, cell enlargement would be slowing with
the cells differentiating into specialised starch storage
parenchyma.
[0294] In barley endosperm tissue, CslH1 gene expression peaked
around 4 days post anthesis and then increased during later stages
to reach a maximum at 28 days (FIG. 21).
[0295] There was a large difference in CslH1 gene expression in
wheat where expression peaked at 4 days post anthesis after which
expression was very low. These results were confirmed by real time
PCR which showed that at 28 days post anthesis, the CslH gene was
expressed about 10 fold higher levels in barley than in wheat (FIG.
22).
EXAMPLE 11
Overexpression of the Barley CslH Gene in Wheat Grain
[0296] Transgenic wheat plants were generated by biolistics
transformation with the full length genomic HvCslH1 (cv. Himalaya)
gene under control of the glutenin promoter such that expression
should only occur in endosperm tissues (FIG. 23). Lines were
screened for the presence or absence of the transgene by PCR of
young leaf material. Twelve PCR positive lines and three PCR
negative lines (H1-2, -7 and -11) were grown to maturity in the
glasshouse. RNA was isolated from developing grain at approximately
15 days post anthesis and cDNA was made using Superscript III.
Expression of the barley transgene was then analysed by real time
PCR. Table 5 shows the relative expression levels compared to the
endogenous wheat CslH gene as the primers used amplify both the
wheat and barley genes.
TABLE-US-00005 TABLE 5 Relative expression of CslH gene in wheat
endosperm Line Run 1 Run 2 Run 3 H1-1 468 225 H1-2 2 H1-3 206 H1-4
620 497 243 H1-5 299 411 H1-6 952 H1-7 63 H1-8 140 230 H1-9 1771
H1-10 4396 4052 H1-11 26 6 H1-12 10 1103 H1-14 1013 352 H1-15 10
H1-13 1 1
[0297] Most of the lines expressed the barley CslH gene at several
hundred fold higher levels than the controls with line 9, 10, 12
and 14 showing the highest expression (greater than one thousand
fold higher).
[0298] At maturity, single grains from were analysed for beta
glucan content and a summary of the results are shown in Table
6:
TABLE-US-00006 TABLE 6 Beta glucan content of transgenic wheat
flour Average Transgenic line Beta glucan std dev Max beta glucan
H1-1 0.81 0.08 .8 H1-2 0.68 0.02 .7 H1-3 0.89 0.05 .9 H1-4 0.82
0.05 .8 H1-5 0.83 0.21 1.1 H1-6 0.91 0.09 1.0 H1-7 0.65 0.05 .7
H1-8 0.87 0.15 1.1 H1-9 1.17 0.33 1.9 H1-10 1.12 0.39 1.9 H1-11
0.82 0.14 1.0 H1-12 1.23 0.26 1.7 H1-14 0.99 0.19 1.4 H1-15 0.60
0.26 .8 H1-16 1.00 0.11 1.2 PCR - (2, 7, 11) average 0.69 0.10 1.0
PCR + (rest) average 0.97 0.11 1.9
[0299] The PCR negative lines all had the lowest beta glucan
contents averaging 0.69% of grain weight, whereas grain from the
PCR positive lines had an increased average beta glucan content of
0.97%. The last column of Table 6 shows the maximum beta glucan
content of any single grain from a given line--the highest PCR
negative line was 1.0% (and most grains were much lower than this)
but several of the PCR positive lines had grains with significantly
increased beta glucan levels with line 9 and line 10 (the highest
expressers) having grains with up to 1.9% beta glucan. These levels
of beta glucan have never been seen before in wheat.
[0300] The heads from these T0 plants contain T1 seed which are
segregating for the transgene. If the DNA is inserted at a single
locus a ratio of three transgenic to one wild type seed should be
observed. FIG. 25 shows the beta glucan levels of individual T1
seeds from the H1 transgenic line 10 from which it can be seen that
approximately three quarters (47/61) have higher beta glucan levels
than the average of the PCR negative lines (0.7%). From the ratio
of the highest beta glucan level (1.9%) to the average PCR negative
level (0.7%) the increase in beta glucan content is 2.7 times that
normally seen in wild type wheat grains. A further significant
observation is that a high proportion of the grains have at least
1.4% beta glucan.
[0301] It is expected that further increases in beta glucan will be
seen in these grains when the lines are made homozygous and gene
dosage increases.
EXAMPLE 12
Materials and Methods for Examples 9 to 11
Plant Material
[0302] Barley (Hordeum vulgare) cultivar Himalaya and wheat
(Triticum aestivum) cultivar Chinese Spring, Westonia and Bob
White26, were grown under standard glasshouse conditions.
Primer Sequences
[0303] The primer sequences referred to in Examples 9 to 11 and
this example are shown below in Table 7:
TABLE-US-00007 TABLE 7 Primer sequences for Examples 9 to 12 Primer
Target gene Sequence (5'-3') Sequence Identifier SJ27 CslH1
AGGCGTGGTTCGCGTTCG SEQ ID NO: 44 SJ28 CslH1 CAGCGCGTAGTACGTCAC SEQ
ID NO: 45 SJ72 CslH1 CAGCCGTGATGACCAACG SEQ ID NO: 46 SJ73 CslH1
GTTGCCAAAGGGATCGTC SEQ ID NO: 47 SJ79 CslH1 GCGGTCGTGACGAACATGTCCAC
SEQ ID NO: 48 SJ75 CslH1 GACGCTCCACGGGATTC SEQ ID NO: 49 SJ85 CslH1
GGTTAGTTCCTTGTGCAGAGGT SEQ ID NO: 50 SJ91 CslH1
GAGCTGTGTTCGTGGAGCTTAG SEQ ID NO: 51 SJ163 CslH1
CTGCTCTCGGCCACGGCCAT SEQ ID NO: 52 SJ164 CslH1
CCGCCGGTTAGTTCCTTGTGCAGA SEQ ID NO: 53 SJ183 CslH1
GGAGAGTTCGTGTGCTGTGG SEQ ID NO: 54 SJ204 CslH1
CACCATGAGCCCCGTCCGGTTCGACA SEQ ID NO: 55 TUB Alpha tubulin
CAAACCTCAGGGAAGCAGTCA SEQ ID NO: 56 TUB2F Alpha tubulin
AGTGTCCTGTCCACCCACTC SEQ ID NO: 57 SJ107 CslF6 GCATCGTACTGGTGCTGCT
SEQ ID NO: 58 SJ82 CslF6 GCGCTTCTCACGGGACACGTACA SEQ ID NO: 59 SJ94
CslF4 GATGCGTACAACTCGAGCAA SEQ ID NO: 60 SJ95 CslF4
CGTTGCTGAAGTCAAGTGGA SEQ ID NO: 61 SJ97 CslF9 CGCTGCAAACGAGAAAGAAGG
SEQ ID NO: 62 SJ93 CslF9 GGCGCTGAAATCCAGAGG SEQ ID NO: 63 SJ44
CslF3 CGGAAATCCATAGGAAAGG SEQ ID NO: 64 SJ38 CslF3 CGGCGGAACATGCAAC
SEQ ID NO: 65 SJ96 CslF8 GGATTGACCCAGCTGAAAAC SEQ ID NO: 66 SJ37
CslF8 GAGTTGTTGACGTAGTGGTC SEQ ID NO: 67 SJ244 Bx17 prom
CGAGCACCCCAATCTACAGA SEQ ID NO: 68
DNA, RNA Isolation and cDNA Synthesis
[0304] Plant DNA was isolated from fully expanded leaf tissue using
a CTAB based method (Murray and Thompson, Nucleic Acids Res. 8:
4321-4325, 1980). Total RNA was isolated from leaf and coleoptile
tissues using an RNAeasy kit from Qiagen. RNA was isolated from
developing endosperm using a phenol SDS method and LiCl
precipitation (Clarke et al., Functional and Integrative Genomics
8, 211-221, 2007). RNA was treated with DNAse using a "DNA-free"
kit from Ambion and then cDNA was synthesised using SuperscriptIII
reverse transcriptase according to the manufacturer's instructions
(Clontech).
Cloning of CslH Genes
[0305] The methods for cloning CslH genes were similar to those
described in the cloning and characterisation of CslF genes (Burton
et al., Plant Physiol 146: 1821-1833, 2008). A 1.8 kb tentative
consensus sequence (TC140327) of a barley homolog of the rice
Cellulose synthase like H1 gene (LOC_Os10g20090) was identified in
the TIGR database. PCR primer pairs (SJ27-SJ73 and SJ72-SJ75) were
designed based on the rice CslH1 sequence and used to amplify
sequences from cDNA. The 5' end of the gene was then amplified by
5'RACE using a SMART cDNA library and nested CslH1 primers SJ28 and
SJ79 according to the manufacturer's instructions (Clontech).
[0306] A full length genomic clone was isolated by amplification
with primers SJ91 and SJ85 and Phusion Taq polymerase (Finnzymes)
according to the manufacturers recommend cycling conditions
(denature 30 sec at 98.degree. C. followed by 35 cycles of
98.degree. C. for 5 sec, 63.degree. C. for 7 sec and 72.degree. C.
for 3 min) and cloned into the pCRBluntII TOPO cloning vector
(Invitrogen).
[0307] Wheat CslH genomic clones were isolated by PCR with Phusion
polymerase from the cultivar Chinese Spring using primers SJ163 and
SJ164 and an annealing temperature of 70.degree. C. A genome
walking kit was used according to the manufacturers instructions
(Clontech) to obtain sequences extending upstream of the coding
region of all three wheat CslH homeologs from the variety Bob White
(data not shown). A primer (SJ204) was designed that was specific
to the third homeolog and used with SJ164 to isolate the third full
length genomic clone. It was confirmed that the predicted
exon/intron boundaries could be spliced correctly by sequencing
cDNA fragments (data not shown).
Expression Analysis of CslH Gene in Wheat and Barley by RT-PCR
Total RNA was isolated from sections of the first leaf of a 7 day
old plant, from dark grown coleoptiles of different ages, and from
developing grain collected at 4 day intervals post anthesis (DPA),
DNAse treated and reverse transcribed with Superscript III
according to the manufacturer's instructions (Invitrogen). PCR
reactions were performed using HotStarTaq (Qiagen). The cDNA was
diluted and used in PCR reactions at a level equivalent to 1 ng of
original RNA per microlitre. For semi-quantitative RT-PCR, CslH1
primers SJ72 and SJ74, for the CslF genes, primer pairs were as
follows; (CslF6; SJ107-SJ82), (CslF4; SJ94-SJ95), (CslF9;
SJ97-SJ93), (CslF3; SJ44-SJ38), (CslF8; SJ96-SJ37). An annealing
temperature of 59.degree. C. was used. Test amplifications were
performed to ensure that the amplification was not saturated
(approx 32-35 cycles except tubulin 24 cycles) and the products
were analysed by ethidium bromide staining after agarose gel
electrophoresis. Real time PCR was performed on triplicate samples
on a Rotorgene 6000 machine (Corbett Life Sciences, AU) using
HotStarTaq (Qiagen), SybrGreen and primers SJ183 and SJ164 and an
annealing temperature of 60.degree. C. Relative expression levels
were calculated using the machine software with wheat 0 dpa samples
as the comparator (set to one). The Ct value of this sample was
25.5 cycles. For analysis of transgenic grain at 15 dpa, the
relative expression values were normalised against tubulin and
compared to the lowest expression line (H1-13).
Expression Analysis of CslH Gene in Barley by Q-PCR
[0308] HvCslH1 transcript was measured in developing coleoptile 0.5
to 7 days post germination. HvCslH1 transcript was shown to
accumulate only after the completion of the elongation phase and
the emergence of the leaf. Highest levels of expression were seen
at 7 days when the coleoptile is senescing (twisting and shrinking)
(Gibeaut et al., Planta 221:729-738, 2005).
Production of Transgenic Wheat Plants Overexpressing the Barley
CslH Gene in Endosperm
[0309] The full length barley cv. Himalaya genomic CslH sequence
(SEQ ID NO: 71) was amplified using primers SJ91 and SJ85, was
inserted as an EcoRI fragment between a 1.9 kb fragment of the high
molecular weight glutenin Bx17 promoter and the nopaline synthase
terminator (FIG. 23). The Bx17 promoter confers high level
expression in developing endosperm (Reddy and Appels, Theor Appl
Genet 85: 616-624, 1993).
[0310] Bob White 26 wheat plants were transformed using the
biolistics method (Pellegrineschi et al., Genome 45: 421-430, 2002)
with 50 mg/L G418 as the selection agent. The HvCslH expression
vector (pZLBx17HvgH1 and a second plasmid with the CaMV 35S
promoter driving expression of the NPTII selectable marker
(pCMSTLSneo, FIG. 24) were mixed in equimolar amounts and co
bombarded into immature embryos.
[0311] Transgenic plants were screened for the presence of the
transgene using young leaf tissue and the RedExtractnAmp.TM. kit
from Sigma with primers SJ244 and SJ79.
[0312] At anthesis (emergence of the anthers and shedding of
pollen) heads were tagged to enable grain to be sampled at
approximately 15 dpa. Three grains from a head were pooled, RNA
extracted and reverse transcribed and levels of transgene
expression were analysed by real time PCR using primers SJ183 and
SJ85. Expression levels were normalised against alpha tubulin
(primers TUB and TUB2F) and finally expressed as a ratio compared
to the lowest expresser.
[0313] Flour from mature single grains was analysed for beta glucan
content using a scaled down version of the lichenase enzymatic
method (AACC Method 32-33, Megazyme assay kit, McCleary and
Glennie-Holmes, J. Inst Brewing 91: 285-295, 1985). Beta glucan
contents are expressed as a percentage (w/w) of the milled whole
grain flour.
EXAMPLE 13
Overexpression of the Barley CslH Gene in Barley Cv. Golden
Promise
[0314] The full-length coding region of the barley CslH cDNA (SEQ
ID NO: 1) was transferred into two Gateway-enabled barley
transformation vectors. The vector pRB474 contains the oat globulin
promoter (Vickers et al., Plant Mol Biol 62: 195-214, 2006) which
provides endosperm specific expression and the vector pMDC32
(Curtis and Grossniklaus, Plant Physiol. 133: 462-9, 2003) contains
a double 35S promoter which drives constitutive expression in all
plant tissues.
Barley Transformation
[0315] The vectors were transferred into Agrobacterium tumefaciens
and immature scutella of the barley cultivar Golden Promise were
transformed using established protocols to produce two populations
of transgenic plants. Insertion of the transgene was confirmed by
Southern blotting. Plants 236-1 to 236-18 contain the barley CslH
gene driven by the oat globulin promoter. Plants 237-1 and -2
contain the barley CslH gene driven by the 35S promoter. Plants
208-2, -3, -5 and -7 are control plants and are transgenic for the
empty vector pRB474 carrying the oat globulin promoter only.
Transcript Analysis
[0316] Leaf and developing grain samples, from 7 and 14 days after
pollination (DAP) were collected from the 236 plants. Total RNA was
extracted using TRIzol reagent (Invitrogen) following a standard
protocol and cDNA was synthesized according to Burton et al.,
(Plant Physiol 146: 1821-1833, 2008). Quantitative real-time PCR
(QPCR) was carried out according to Burton et al. (2008, supra).
The transcript levels of the CslH gene were compared in the
endosperm of the transgenic grain to wild type endosperm levels
which are generally very low.
[0317] As shown in FIG. 26, the empty vector control lines (208)
have typical wild type levels of CslH transcript. The transgenic
lines (236) show significantly increased HvCslH1 mRNA levels at 7
days (7 D) and further increases at 14 days (14 D) after
pollination.
Beta-Glucan Analysis
[0318] The T1 seed from the transgenic plants were collected. A
sample of the bulked T1 grain from each individual plant was ground
to flour and the amount of beta-glucan present was assayed using
Megazyme method (described supra). The data from each plant are
presented as the mean value of two replicates and the amount of
beta-glucan as a percentage of grain weight is shown in Table 8,
below:
TABLE-US-00008 TABLE 8 (1,3;1,4)-.beta.-D-glucan content of bulked
transgenic barley flour ##STR00001##
[0319] The empty vector control lines (208) have a
(1,3;1,4)-.beta.-D-glucan content around 4% which is typical for
wild type Golden Promise grain. Even though the T1 grain is bulked
(and therefore contains null-segregant grains) a significant number
of the transgenic lines (shaded) show an overall
(1,3;1,4)-.beta.-D-glucan content greater than the control, with
the highest value at 5.9%.
[0320] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. It is to be understood
that the invention includes all such variations and modifications.
The invention also includes all of the steps, features,
compositions and compounds referred to, or indicated in this
specification, individually or collectively, and any and all
combinations of any two or more of the steps or features.
[0321] Also, it must be noted that, as used herein, the singular
forms "a", "an" and "the" include plural aspects unless the context
already dictates otherwise. Thus, for example, reference to "a
transgene" includes a single transgene as well as two or more
transgenes; "a plant cell" includes a single cell as well as two or
more cells; and so forth.
Sequence CWU 1
1
8012256DNAHordeum vulgare 1atggcgggcg gcaagaagct gcaggagagg
gtcgccctgg cgagaaccgc gtggatgctg 60gccgacttcg cgatcctctt cctcctcctc
gccatcgtgg cccgccgcgc cgcctcgctc 120cgggagcgcg gcgggacgtg
gttggcggcg ctcgtctgcg aggcgtggtt cgccttcgtg 180tggatcctca
acatgaacgg caagtggagc cccgtccggt tcgacaccta ccccgacaac
240ctcgccaaca ggatggagga gctcccggcg gtggacatgt tcgtcacgac
cgcggacccg 300gcgctggagc ctccgttgat cacggtgaac acggtgctct
cgctgctcgc cctggactac 360ccggacgtcg gcaagctggc gtgctacgtc
tctgacgacg gctgctcccc ggtgacgtgc 420tacgcgctgc gtgaggccgc
caagttcgcc ggcctctggg tccctttctg caagaggcac 480gacgttgctg
tgagggcccc attcatgtac ttctcttcca cgccggaggt tggcacaggc
540acagccgacc acgagttcct ggaaagctgg gcgctcatga agagcgaata
tgagagacta 600gccagccgaa tcgagaacgc cgatgagggc tccattatgc
gtgacagcgg cgacgagttc 660gccgagttca tcgacgccga gcgcgggaac
catcctacca tcgttaaggt tctgtgggat 720aacagcaaga gcaaagtggg
ggaaggattc ccacatctgg tgtacctctc tcgagagaaa 780agccccagac
atcgccacaa cttccaggct ggtgccatga atgttctgac aagggtgtca
840gccgtgatga ccaacgctcc catcatgctg aatgtggact gcgacatgtt
cgccaacaat 900ccgcaggtcg ccctacacgc gatgtgcctc ctattggggt
tcgacgacga gatccacagc 960gggttcgtcc aagtgccaca gaagttctac
ggtggcctca aggacgatcc ctttggcaac 1020cagatgcagg ttataaccaa
gaaaattgga ggtggaatcg ccgggatcca aggcatgttc 1080tacggcggca
cgggctgttt tcaccgcagg aaagtcattt acggcatgcc gccacctgac
1140accgtcaaac acgagacaag aggttcacca tcttacaagg agctgcaagt
caggtttggg 1200agctcaaagg tgttgatcga atcatctagg aacatcatct
caggagacct gctcgctaga 1260ccaaccgttg atgtatcgag tcgcatcgaa
atggcaaaac aagtcggcga ttgcaactat 1320gaggctggca cgtgttgggg
caaggagatt ggttgggtct atggatcaat gacagaagac 1380attttgaccg
gacaacggat ccatgcggcg ggttggaaat cggccttgtt ggacaccaac
1440ccaccggcat tcttgggatg tgctccgacc gggggaccgg ccagcttgac
ccagttcaag 1500agatgggcaa caggggttct ggagatactc atcagccgga
acagccctat cctcggcacc 1560atcttccaac gcctccaact ccggcaatgc
cttggctatc tcatcgtcga ggcgtggccc 1620gtgagggcgc ctttcgagct
gtgctatgca ctattgggac ctttctgcct tctcacaaac 1680cagtccttct
tgccaacggc atcggatgaa ggttttcgca tcccagtagc tctattcttg
1740agttaccaca tataccactt gatggagtac aaggagtgcg ggctctctgc
ccgcgcctgg 1800tggaacaacc acaggatgca acgcatcacc tcggcctccg
cctggctcct cgccttcctc 1860accgtgatcc tcaagacact agggctctct
gagaccgtgt tcgaggtcac ccgcaaggaa 1920agcagcacgt ccgatggcgg
cgccggcacc gacgaggccg atccaggact gttcacattc 1980gactcggcgc
ccgttttcat cccggtgacg gcgctctcag tgttgaacat tgtggccctc
2040gccgtcgggg catggcgcgc cgtcatcggg actgcggcgg tcgttcatgg
tggcccgggc 2100atcggagagt tcgtgtgctg tggctggatg gtgttgtgct
tctggccgtt cgtgagaggg 2160cttgtcagca ggggaaagca tggaatcccg
tggagcgtca aggtgaaggc tggtttgatt 2220gtggctgcgt tcgtgcacct
ctgcacaagg aactaa 22562751PRTHordeum vulgare 2Met Ala Gly Gly Lys
Lys Leu Gln Glu Arg Val Ala Leu Ala Arg Thr 1 5 10 15 Ala Trp Met
Leu Ala Asp Phe Ala Ile Leu Phe Leu Leu Leu Ala Ile 20 25 30 Val
Ala Arg Arg Ala Ala Ser Leu Arg Glu Arg Gly Gly Thr Trp Leu 35 40
45 Ala Ala Leu Val Cys Glu Ala Trp Phe Ala Phe Val Trp Ile Leu Asn
50 55 60 Met Asn Gly Lys Trp Ser Pro Val Arg Phe Asp Thr Tyr Pro
Asp Asn 65 70 75 80 Leu Ala Asn Arg Met Glu Glu Leu Pro Ala Val Asp
Met Phe Val Thr 85 90 95 Thr Ala Asp Pro Ala Leu Glu Pro Pro Leu
Ile Thr Val Asn Thr Val 100 105 110 Leu Ser Leu Leu Ala Leu Asp Tyr
Pro Asp Val Gly Lys Leu Ala Cys 115 120 125 Tyr Val Ser Asp Asp Gly
Cys Ser Pro Val Thr Cys Tyr Ala Leu Arg 130 135 140 Glu Ala Ala Lys
Phe Ala Gly Leu Trp Val Pro Phe Cys Lys Arg His 145 150 155 160 Asp
Val Ala Val Arg Ala Pro Phe Met Tyr Phe Ser Ser Thr Pro Glu 165 170
175 Val Gly Thr Gly Thr Ala Asp His Glu Phe Leu Glu Ser Trp Ala Leu
180 185 190 Met Lys Ser Glu Tyr Glu Arg Leu Ala Ser Arg Ile Glu Asn
Ala Asp 195 200 205 Glu Gly Ser Ile Met Arg Asp Ser Gly Asp Glu Phe
Ala Glu Phe Ile 210 215 220 Asp Ala Glu Arg Gly Asn His Pro Thr Ile
Val Lys Val Leu Trp Asp 225 230 235 240 Asn Ser Lys Ser Lys Val Gly
Glu Gly Phe Pro His Leu Val Tyr Leu 245 250 255 Ser Arg Glu Lys Ser
Pro Arg His Arg His Asn Phe Gln Ala Gly Ala 260 265 270 Met Asn Val
Leu Thr Arg Val Ser Ala Val Met Thr Asn Ala Pro Ile 275 280 285 Met
Leu Asn Val Asp Cys Asp Met Phe Ala Asn Asn Pro Gln Val Ala 290 295
300 Leu His Ala Met Cys Leu Leu Leu Gly Phe Asp Asp Glu Ile His Ser
305 310 315 320 Gly Phe Val Gln Val Pro Gln Lys Phe Tyr Gly Gly Leu
Lys Asp Asp 325 330 335 Pro Phe Gly Asn Gln Met Gln Val Ile Thr Lys
Lys Ile Gly Gly Gly 340 345 350 Ile Ala Gly Ile Gln Gly Met Phe Tyr
Gly Gly Thr Gly Cys Phe His 355 360 365 Arg Arg Lys Val Ile Tyr Gly
Met Pro Pro Pro Asp Thr Val Lys His 370 375 380 Glu Thr Arg Gly Ser
Pro Ser Tyr Lys Glu Leu Gln Val Arg Phe Gly 385 390 395 400 Ser Ser
Lys Val Leu Ile Glu Ser Ser Arg Asn Ile Ile Ser Gly Asp 405 410 415
Leu Leu Ala Arg Pro Thr Val Asp Val Ser Ser Arg Ile Glu Met Ala 420
425 430 Lys Gln Val Gly Asp Cys Asn Tyr Glu Ala Gly Thr Cys Trp Gly
Lys 435 440 445 Glu Ile Gly Trp Val Tyr Gly Ser Met Thr Glu Asp Ile
Leu Thr Gly 450 455 460 Gln Arg Ile His Ala Ala Gly Trp Lys Ser Ala
Leu Leu Asp Thr Asn 465 470 475 480 Pro Pro Ala Phe Leu Gly Cys Ala
Pro Thr Gly Gly Pro Ala Ser Leu 485 490 495 Thr Gln Phe Lys Arg Trp
Ala Thr Gly Val Leu Glu Ile Leu Ile Ser 500 505 510 Arg Asn Ser Pro
Ile Leu Gly Thr Ile Phe Gln Arg Leu Gln Leu Arg 515 520 525 Gln Cys
Leu Gly Tyr Leu Ile Val Glu Ala Trp Pro Val Arg Ala Pro 530 535 540
Phe Glu Leu Cys Tyr Ala Leu Leu Gly Pro Phe Cys Leu Leu Thr Asn 545
550 555 560 Gln Ser Phe Leu Pro Thr Ala Ser Asp Glu Gly Phe Arg Ile
Pro Val 565 570 575 Ala Leu Phe Leu Ser Tyr His Ile Tyr His Leu Met
Glu Tyr Lys Glu 580 585 590 Cys Gly Leu Ser Ala Arg Ala Trp Trp Asn
Asn His Arg Met Gln Arg 595 600 605 Ile Thr Ser Ala Ser Ala Trp Leu
Leu Ala Phe Leu Thr Val Ile Leu 610 615 620 Lys Thr Leu Gly Leu Ser
Glu Thr Val Phe Glu Val Thr Arg Lys Glu 625 630 635 640 Ser Ser Thr
Ser Asp Gly Gly Ala Gly Thr Asp Glu Ala Asp Pro Gly 645 650 655 Leu
Phe Thr Phe Asp Ser Ala Pro Val Phe Ile Pro Val Thr Ala Leu 660 665
670 Ser Val Leu Asn Ile Val Ala Leu Ala Val Gly Ala Trp Arg Ala Val
675 680 685 Ile Gly Thr Ala Ala Val Val His Gly Gly Pro Gly Ile Gly
Glu Phe 690 695 700 Val Cys Cys Gly Trp Met Val Leu Cys Phe Trp Pro
Phe Val Arg Gly 705 710 715 720 Leu Val Ser Arg Gly Lys His Gly Ile
Pro Trp Ser Val Lys Val Lys 725 730 735 Ala Gly Leu Ile Val Ala Ala
Phe Val His Leu Cys Thr Arg Asn 740 745 750 32253DNAOryza sativa
3atggaggcgg cggctagagg caacaagaag ctgcaggaga gggtgcccat ccggcgcacc
60gcgtggaggc tcgccgacct cgccatcctc ttcctcctcc tcgccctcct cctccaccgc
120gtcctccacg acagcggcgc gccatggcgg cgcgccgcgc tcgcctgcga
ggcgtggttc 180accttcatgt ggctgctcaa cgtgaacgcc aagtggagcc
ccgtccgttt cgacacgttc 240ccggagaacc tcgccgaaag gatcgacgag
ctcccggcgg tggacatgtt cgtgacgacg 300gcggacccgg tgctggagcc
gccgctggtg accgtgaaca cggtgctgtc gctgctcgcc 360ctcgactacc
cggccgccgg cgagaagctg gcgtgctacg tctccgacga cgggtgctcg
420ccgctgacgt gctacgcgct gcgggaggcc gcccggttcg ccaggacgtg
ggtgcccttc 480tgccggcggc acggcgtcgc cgtcagggcg cccttccggt
acttctcctc cacgccggag 540ttcggcccgg cggatggcaa gttcttggag
gactggacat tcatgaagag cgagtatgag 600aagttggtcc accggatcga
ggacgccgat gagccttccc ttctgcggca cggcggtggt 660gagttcgcag
agtttctgga tgttgagagg gggaaccacc ctactatcat aaaggttctg
720tgggataaca acaggagcag gacaggagat ggcttccctc gtctgatata
cgtctcaagg 780gagaagagcc ccaacctaca ccatcactac aaggctggcg
ccatgaatgc cctgacaagg 840gtgtcagcac tgatgaccaa cgccccattc
atgctaaacc tagactgcga catgtttgta 900aacaaccccc gggtcgtcct
ccatgccatg tgccttctgt taggttttga cgatgagatc 960agctgcgcgt
ttgttcagac gccgcagaaa ttctacggtg ccttgaagga tgatcctttc
1020gggaaccagc tggaagttag tttgatgaaa gttggacgtg ggattgcagg
gcttcagggc 1080atattttatt gtggaacagg ctgctttcac cgcagaaaag
tcatttacgg catgaggaca 1140gggcgagaag gcaccacagg ttattcatct
aacaaggagc tccatagtaa attcggaagt 1200tcaaataatt ttaaggaatc
agccagggat gtcatttatg ggaacttgtc aacagagcca 1260atagtagata
tatcaagttg cgttgatgtt gccaaagaag tagctgcctg caactacgag
1320attggcacat gttggggtca ggaggttggt tgggtctatg gatcactgac
agaagacgtg 1380ttgaccggac aacggatcca tgcagcgggt tggagatcca
cgctgatgga aatcgaacca 1440ccagcattca tgggttgtgc accaaatgga
gggcccgcct gcctaaccca gttgaagaga 1500tgggcatcag gttttttaga
aatactcatc agtcggaata acccaatcct cacaaccaca 1560tttaagagtc
tccaattccg acaatgcctt gcatacctgc acagctatgt gtggcctgtg
1620agggcacctt tcgaattgtg ctatgcattg ttggggcctt attgcttact
atcaaaccaa 1680tccttcttgc caaagacatc agaagacggt ttctacatcg
cattagctct attcattgcc 1740tataacacat acatgttcat ggagttcata
gagtgtgggc agtctgcacg tgcatgttgg 1800aacaaccaca ggatgcaacg
gatcacctca gcttctgctt ggctactggc atttcttacc 1860gtcatcctca
agaccttagg cttctccgag actgtgttcg aggtcacccg caaagacaag
1920agcacatcag atggtgattc caacaccgat gagcctgagc cagggaggtt
caccttcgac 1980gaatcgacgg tgttcattcc cgtgacagca cttgcaatgt
taagtgtcat tgcaatcgct 2040gtaggagcat ggagggtggt tttggtgaca
acggaaggct tgcccggtgg ccctggtatc 2100agtgaattca tctcctgtgg
gtggctggtg ctgtgcttca tgccattgct gagaggtcta 2160gtgggaagtg
gtcgatatgg cattccttgg agtatcaaga tgaaggcctg cttgcttgtt
2220gctatattct tgctcttctg caaaagaaat taa 22534750PRTOryza sativa
4Met Glu Ala Ala Ala Arg Gly Asn Lys Lys Leu Gln Glu Arg Val Pro 1
5 10 15 Ile Arg Arg Thr Ala Trp Arg Leu Ala Asp Leu Ala Ile Leu Phe
Leu 20 25 30 Leu Leu Ala Leu Leu Leu His Arg Val Leu His Asp Ser
Gly Ala Pro 35 40 45 Trp Arg Arg Ala Ala Leu Ala Cys Glu Ala Trp
Phe Thr Phe Met Trp 50 55 60 Leu Leu Asn Val Asn Ala Lys Trp Ser
Pro Val Arg Phe Asp Thr Phe 65 70 75 80 Pro Glu Asn Leu Ala Glu Arg
Ile Asp Glu Leu Pro Ala Val Asp Met 85 90 95 Phe Val Thr Thr Ala
Asp Pro Val Leu Glu Pro Pro Leu Val Thr Val 100 105 110 Asn Thr Val
Leu Ser Leu Leu Ala Leu Asp Tyr Pro Ala Ala Gly Glu 115 120 125 Lys
Leu Ala Cys Tyr Val Ser Asp Asp Gly Cys Ser Pro Leu Thr Cys 130 135
140 Tyr Ala Leu Arg Glu Ala Ala Arg Phe Ala Arg Thr Trp Val Pro Phe
145 150 155 160 Cys Arg Arg His Gly Val Ala Val Arg Ala Pro Phe Arg
Tyr Phe Ser 165 170 175 Ser Thr Pro Glu Phe Gly Pro Ala Asp Gly Lys
Phe Leu Glu Asp Trp 180 185 190 Thr Phe Met Lys Ser Glu Tyr Glu Lys
Leu Val His Arg Ile Glu Asp 195 200 205 Ala Asp Glu Pro Ser Leu Leu
Arg His Gly Gly Gly Glu Phe Ala Glu 210 215 220 Phe Leu Asp Val Glu
Arg Gly Asn His Pro Thr Ile Ile Lys Val Leu 225 230 235 240 Trp Asp
Asn Asn Arg Ser Arg Thr Gly Asp Gly Phe Pro Arg Leu Ile 245 250 255
Tyr Val Ser Arg Glu Lys Ser Pro Asn Leu His His His Tyr Lys Ala 260
265 270 Gly Ala Met Asn Ala Leu Thr Arg Val Ser Ala Leu Met Thr Asn
Ala 275 280 285 Pro Phe Met Leu Asn Leu Asp Cys Asp Met Phe Val Asn
Asn Pro Arg 290 295 300 Val Val Leu His Ala Met Cys Leu Leu Leu Gly
Phe Asp Asp Glu Ile 305 310 315 320 Ser Cys Ala Phe Val Gln Thr Pro
Gln Lys Phe Tyr Gly Ala Leu Lys 325 330 335 Asp Asp Pro Phe Gly Asn
Gln Leu Glu Val Ser Leu Met Lys Val Gly 340 345 350 Arg Gly Ile Ala
Gly Leu Gln Gly Ile Phe Tyr Cys Gly Thr Gly Cys 355 360 365 Phe His
Arg Arg Lys Val Ile Tyr Gly Met Arg Thr Gly Arg Glu Gly 370 375 380
Thr Thr Gly Tyr Ser Ser Asn Lys Glu Leu His Ser Lys Phe Gly Ser 385
390 395 400 Ser Asn Asn Phe Lys Glu Ser Ala Arg Asp Val Ile Tyr Gly
Asn Leu 405 410 415 Ser Thr Glu Pro Ile Val Asp Ile Ser Ser Cys Val
Asp Val Ala Lys 420 425 430 Glu Val Ala Ala Cys Asn Tyr Glu Ile Gly
Thr Cys Trp Gly Gln Glu 435 440 445 Val Gly Trp Val Tyr Gly Ser Leu
Thr Glu Asp Val Leu Thr Gly Gln 450 455 460 Arg Ile His Ala Ala Gly
Trp Arg Ser Thr Leu Met Glu Ile Glu Pro 465 470 475 480 Pro Ala Phe
Met Gly Cys Ala Pro Asn Gly Gly Pro Ala Cys Leu Thr 485 490 495 Gln
Leu Lys Arg Trp Ala Ser Gly Phe Leu Glu Ile Leu Ile Ser Arg 500 505
510 Asn Asn Pro Ile Leu Thr Thr Thr Phe Lys Ser Leu Gln Phe Arg Gln
515 520 525 Cys Leu Ala Tyr Leu His Ser Tyr Val Trp Pro Val Arg Ala
Pro Phe 530 535 540 Glu Leu Cys Tyr Ala Leu Leu Gly Pro Tyr Cys Leu
Leu Ser Asn Gln 545 550 555 560 Ser Phe Leu Pro Lys Thr Ser Glu Asp
Gly Phe Tyr Ile Ala Leu Ala 565 570 575 Leu Phe Ile Ala Tyr Asn Thr
Tyr Met Phe Met Glu Phe Ile Glu Cys 580 585 590 Gly Gln Ser Ala Arg
Ala Cys Trp Asn Asn His Arg Met Gln Arg Ile 595 600 605 Thr Ser Ala
Ser Ala Trp Leu Leu Ala Phe Leu Thr Val Ile Leu Lys 610 615 620 Thr
Leu Gly Phe Ser Glu Thr Val Phe Glu Val Thr Arg Lys Asp Lys 625 630
635 640 Ser Thr Ser Asp Gly Asp Ser Asn Thr Asp Glu Pro Glu Pro Gly
Arg 645 650 655 Phe Thr Phe Asp Glu Ser Thr Val Phe Ile Pro Val Thr
Ala Leu Ala 660 665 670 Met Leu Ser Val Ile Ala Ile Ala Val Gly Ala
Trp Arg Val Val Leu 675 680 685 Val Thr Thr Glu Gly Leu Pro Gly Gly
Pro Gly Ile Ser Glu Phe Ile 690 695 700 Ser Cys Gly Trp Leu Val Leu
Cys Phe Met Pro Leu Leu Arg Gly Leu 705 710 715 720 Val Gly Ser Gly
Arg Tyr Gly Ile Pro Trp Ser Ile Lys Met Lys Ala 725 730 735 Cys Leu
Leu Val Ala Ile Phe Leu Leu Phe Cys Lys Arg Asn 740 745 750
52289DNAOryza sativa 5atggcggtgg tggcggcggc ggcggccacc ggttccacca
ccagatcagg cggcggcggc 60ggcgagggga cgaggtccgg gaggaagaag ccgccgccgc
cgccgctgca ggagagggtg 120cccctcgggc ggcgcgcggc gtgggcgtgg
cggctggccg gcctcgccgt cctcctcctc 180ctcctcgccc tcctcgccct
ccggctgctt cgccaccacg gcggcgccgg gggcgacggc 240ggcgtgtggc
gcgtggcgct cgtgtgcgag gcgtggttcg cggcgctgtg cgcgctcaac
300gtgagcgcca agtggagccc cgtccggttc gtcacgcggc cggagaacct
cgtggcggag 360ggcaggacgc cgtcgacgac ggcggcggag tacggcgagc
tgccggcggt ggacatgctg 420gtgacgacgg cggacccggc gctggagccg
ccgctggtga cggtgaacac ggtgctctcg 480ctgctcgccc tcgactaccc
gcgcgccggc gagcggctgg cctgctacgt ctccgacgac 540gggtgctcgc
cgctgacgtg ccacgcgctg cgggaggccg ccgggttcgc cgccgcgtgg
600gtgcccttct gccgccggta cggcgtcgcc gtcagggccc cgttccggta
cttctcctcc 660tcctcctcgc cggagtccgg cggcccggcc gatcgcaagt
tcttggacga ctggacattc 720atgaaggatg agtatgacaa gttagtgcgg
cgcatcaaga acaccgacga gcgctccctc 780ctccggcacg gcggcggcga
gttcttcgcc gagttcttga acgtcgagag gaggaatcac 840cccaccatcg
tcaagacgag ggtgtcagct gtgatgacca acgcaccgat catgctgaac
900atggactgcg acatgtttgt gaacaatccc caggccgtcc tccatgcgat
gtgcctgctg 960ctggggttcg acgacgaggc cagcagcggg ttcgtccagg
cgccgcagag attctacgac 1020gccctcaagg acgatccatt tgggaaccag
atggagtgtt ttttcaagag atttatcagt 1080ggggttcaag gagttcaggg
tgccttttat gctggaaccg gctgctttca ccgtaggaaa 1140gcagtttatg
gcgtgccacc gaacttcaat ggagccgaga gagaagatac cataggttca
1200tcgtcttata aggagcttca taccaggttt ggaaactcag aggaattgaa
cgaatcagca 1260agaaacatca tttgggatct gtcctctaag ccaatggttg
atatatcaag tcgcattgaa 1320gtggcaaaag cagtttcagc ttgcaactat
gatattggca catgttgggg acaggaggtt 1380ggttgggtct atggatcact
aacagaagac atattgaccg gacagcggat acacgcgatg 1440ggttggagat
ccgtattgat ggtaaccgaa ccacccgcat tcatgggctc cgcgccgatt
1500ggaggaccag cctgcctaac tcagttcaag agatgggcaa ctggccaatc
tgagataatc 1560atcagccgga acaacccaat tctcgcaacc atgttcaagc
gcctcaaatt ccggcaatgt 1620cttgcctacc tgatcgtcct tgggtggcct
ctgagagcgc cttttgagct atgctatgga 1680ttgttgggac cttattgcat
actcacaaac caatccttct tgccaaaggc atcagaagat 1740ggtttcagcg
tcccgttagc cctattcata tcctataaca catacaactt catggagtac
1800atggcgtgcg ggctctccgc ccgtgcatgg tggaacaatc ataggatgca
acggatcatc 1860tcggtctctg cctggacact agcatttctt accgtgctcc
tcaagtcctt aggcctctcc 1920gaaactgttt ttgaggtcac cggcaaggac
aaaagcatgt ctgatgacga tgacaacacc 1980gatggtgctg accctgggag
gttcaccttc gactcattgc cggtgttcat ccccgtgacg 2040gcacttgcga
tgttaaacat cgttgcggtc actgtcggag catgtagggt agctttcggg
2100acagcggaag gtgtgccctg tgccccgggt atcggcgaat tcatgtgttg
tgggtggctg 2160gtgctgtgct tcttcccgtt tgtaagaggg atagtgtggg
gcaagggaag ctatgggatc 2220ccttggagtg tcaagctgaa ggctagctta
cttgtggcta tgtttgttac cttctgcaaa 2280agaaactaa 22896762PRTOryza
sativa 6Met Ala Val Val Ala Ala Ala Ala Ala Thr Gly Ser Thr Thr Arg
Ser 1 5 10 15 Gly Gly Gly Gly Gly Glu Gly Thr Arg Ser Gly Arg Lys
Lys Pro Pro 20 25 30 Pro Pro Pro Leu Gln Glu Arg Val Pro Leu Gly
Arg Arg Ala Ala Trp 35 40 45 Ala Trp Arg Leu Ala Gly Leu Ala Val
Leu Leu Leu Leu Leu Ala Leu 50 55 60 Leu Ala Leu Arg Leu Leu Arg
His His Gly Gly Ala Gly Gly Asp Ala 65 70 75 80 Gly Val Trp Arg Val
Ala Leu Val Cys Glu Ala Trp Phe Ala Ala Leu 85 90 95 Cys Ala Leu
Asn Val Ser Ala Lys Trp Ser Pro Val Arg Phe Val Thr 100 105 110 Arg
Pro Glu Asn Leu Val Ala Glu Gly Arg Thr Pro Ser Thr Thr Ala 115 120
125 Ala Glu Tyr Gly Glu Leu Pro Ala Val Asp Met Leu Val Thr Thr Ala
130 135 140 Asp Pro Ala Leu Glu Pro Pro Leu Val Thr Val Asn Thr Val
Leu Ser 145 150 155 160 Leu Leu Ala Leu Asp Tyr Pro Arg Ala Gly Glu
Arg Leu Ala Cys Tyr 165 170 175 Val Ser Asp Asp Gly Cys Ser Pro Leu
Thr Cys His Ala Leu Arg Glu 180 185 190 Ala Ala Gly Phe Ala Ala Ala
Trp Val Pro Phe Cys Arg Arg Tyr Gly 195 200 205 Val Ala Val Arg Ala
Pro Phe Arg Tyr Phe Ser Ser Ser Ser Ser Pro 210 215 220 Glu Ser Gly
Gly Pro Ala Asp Arg Lys Phe Leu Asp Asp Trp Thr Phe 225 230 235 240
Met Lys Asp Glu Tyr Asp Lys Leu Val Arg Arg Ile Lys Asn Thr Asp 245
250 255 Glu Arg Ser Leu Leu Arg His Gly Gly Gly Glu Phe Phe Ala Glu
Phe 260 265 270 Leu Asn Val Glu Arg Arg Asn His Pro Thr Ile Val Lys
Thr Arg Val 275 280 285 Ser Ala Val Met Thr Asn Ala Pro Ile Met Leu
Asn Met Asp Cys Asp 290 295 300 Met Phe Val Asn Asn Pro Gln Ala Val
Leu His Ala Met Cys Leu Leu 305 310 315 320 Leu Gly Phe Asp Asp Glu
Ala Ser Ser Gly Phe Val Gln Ala Pro Gln 325 330 335 Arg Phe Tyr Asp
Ala Leu Lys Asp Asp Pro Phe Gly Asn Gln Met Glu 340 345 350 Cys Phe
Phe Lys Arg Phe Ile Ser Gly Val Gln Gly Val Gln Gly Ala 355 360 365
Phe Tyr Ala Gly Thr Gly Cys Phe His Arg Arg Lys Ala Val Tyr Gly 370
375 380 Val Pro Pro Asn Phe Asn Gly Ala Glu Arg Glu Asp Thr Ile Gly
Ser 385 390 395 400 Ser Ser Tyr Lys Glu Leu His Thr Arg Phe Gly Asn
Ser Glu Glu Leu 405 410 415 Asn Glu Ser Ala Arg Asn Ile Ile Trp Asp
Leu Ser Ser Lys Pro Met 420 425 430 Val Asp Ile Ser Ser Arg Ile Glu
Val Ala Lys Ala Val Ser Ala Cys 435 440 445 Asn Tyr Asp Ile Gly Thr
Cys Trp Gly Gln Glu Val Gly Trp Val Tyr 450 455 460 Gly Ser Leu Thr
Glu Asp Ile Leu Thr Gly Gln Arg Ile His Ala Met 465 470 475 480 Gly
Trp Arg Ser Val Leu Met Val Thr Glu Pro Pro Ala Phe Met Gly 485 490
495 Ser Ala Pro Ile Gly Gly Pro Ala Cys Leu Thr Gln Phe Lys Arg Trp
500 505 510 Ala Thr Gly Gln Ser Glu Ile Ile Ile Ser Arg Asn Asn Pro
Ile Leu 515 520 525 Ala Thr Met Phe Lys Arg Leu Lys Phe Arg Gln Cys
Leu Ala Tyr Leu 530 535 540 Ile Val Leu Gly Trp Pro Leu Arg Ala Pro
Phe Glu Leu Cys Tyr Gly 545 550 555 560 Leu Leu Gly Pro Tyr Cys Ile
Leu Thr Asn Gln Ser Phe Leu Pro Lys 565 570 575 Ala Ser Glu Asp Gly
Phe Ser Val Pro Leu Ala Leu Phe Ile Ser Tyr 580 585 590 Asn Thr Tyr
Asn Phe Met Glu Tyr Met Ala Cys Gly Leu Ser Ala Arg 595 600 605 Ala
Trp Trp Asn Asn His Arg Met Gln Arg Ile Ile Ser Val Ser Ala 610 615
620 Trp Thr Leu Ala Phe Leu Thr Val Leu Leu Lys Ser Leu Gly Leu Ser
625 630 635 640 Glu Thr Val Phe Glu Val Thr Gly Lys Asp Lys Ser Met
Ser Asp Asp 645 650 655 Asp Asp Asn Thr Asp Gly Ala Asp Pro Gly Arg
Phe Thr Phe Asp Ser 660 665 670 Leu Pro Val Phe Ile Pro Val Thr Ala
Leu Ala Met Leu Asn Ile Val 675 680 685 Ala Val Thr Val Gly Ala Cys
Arg Val Ala Phe Gly Thr Ala Glu Gly 690 695 700 Val Pro Cys Ala Pro
Gly Ile Gly Glu Phe Met Cys Cys Gly Trp Leu 705 710 715 720 Val Leu
Cys Phe Phe Pro Phe Val Arg Gly Ile Val Trp Gly Lys Gly 725 730 735
Ser Tyr Gly Ile Pro Trp Ser Val Lys Leu Lys Ala Ser Leu Leu Val 740
745 750 Ala Met Phe Val Thr Phe Cys Lys Arg Asn 755 760
72379DNAOryza sativa 7atggcggcgg cgagcggcga gaaggaggag gaggagaaga
agctgcagga gagggcgccg 60atccggcgca cggcgtggat gctggccaat ttcgtcgtac
tcttcctcct cctcgccctc 120ctcgtccgcc gcgccaccgc cgccgacgcc
gaggagcgcg gcgtcggcgg cgcggcgtgg 180cgcgtggcgt tcgcctgcga
ggcgtggttc gcgttcgtgt ggctgctcaa catgaacgcc 240aagtggagcc
ccgcccggtt cgacacctac ccggagaacc tcgccggaag gtgtggcgcc
300gcccatcgtc ctagaaagtc gtcgtgcatc tccggccatc tcgatctcat
gcggagacag 360tgtgctttga tgcaggatcg acgagctgcc ggcggtcgac
atgttcgtga cgacggcgga 420cccggcgctc gagccgccgg tggtgacggt
gaacaaggtg ctctcgctgc tcgccgtcga 480ctactacccg ggcggcggcg
gcgccggcgg cggcgaaggc tggcctgcta cgtctctgac 540gacgggtgct
cgccggtgac gtactacgcg ctgcgggagg ccgccgggtt cgcgaggacg
600tgggtgccct tctgccggcg gcacggcgtc gccgtcaggg cccccttccg
gtacttcgcc 660tccgcgccgg agttcggccc ggccgaccgg aagttcttag
acgattggac attcatgaag 720agtgagtacg acaagctagt ccgtcggatc
gaggacgccg acgagaccac ccttctgcgg 780caaggcggcg gcgagttcgc
cgagttcatg gacgccaaga ggacgaacca ccgcgccatt 840gtcaaggtta
tatgggataa taacagcaag aacaggatag gcgaagaagg agggttcccg
900catctcatat acgtctcaag ggagaagagc cccggacacc accatcacta
caaggccggc 960gccatgaacg ccctgacgag ggtgtcagcc gtgatgacca
acgcaccgat catgctgaac 1020gtggactgcg acatgttcgc gaacgatccc
caggtcgtcc tccacgcgat gtgcctgctg 1080ctggggttcg acgacgagat
ctccagcggg ttcgttcagg tgccgcagag tttctacggc 1140gacctcaagg
acgatccttt cgggaacaag ctggaggtta tttacaaggg cttattttat
1200ggtggaacgg gttgcttcca ctgtagaaaa gccatttacg gcatcgaacc
agactccatt 1260gtggtaggaa gagagggcgc cgcaggttcg ccatcttaca
aggagcttca gttcaagttt 1320gaaagttcag aggagttgaa ggaatcagct
cggtacatca tttctgggga tatgtccggt 1380gagccaatag tagatatatc
aagtcacatt gaggttgcaa aagaagtttc ttcctgcaac 1440tatgagagtg
gcacacattg gggtctggag gttggttggg cctatggatc aatgaccgaa
1500gacattttga ctgggcagcg gatccatgca gcaggttgga gatctgcaaa
gttggaaacc 1560gaaccaccag cattcttggg ctgcgcacca acgggtggac
cagcttgcct aacccagttc 1620aagagatggg caacgggttt gtttgagata
ctcataagcc agaataaccc actccttctg 1680agcatattca agcatctcca
attccgacaa tgccttgcgt acctgactct ttatgtgtgg 1740gctgtgaggg
gatttgttga gctatgctat gaattgttgg ttccttattg cctactcaca
1800aatcaatcct tcttgtcaaa ggcatcagaa aattgtttca acatcacatt
agcactattc 1860ttgacctata atacatacaa cttcgtggag tacatggaat
gtgggctctc tgtacgtgcc 1920tggtggaaca accacagaat gcaacggatc
atttcagcct ctgcatggct actagcattt 1980tttactgtgc tcctcaagac
cataggcctc tccgagactg tgttcgaggt cacccgtaag 2040gagaagagca
catcggatgg caatggccaa aacgatgagg ttgacccgga gagattcacc
2100tttgacgcat caccagtgtt catccccgtt acggcgctga caatgttgaa
cattgttgca 2160atcacaattg gtacatggag ggcagttttt gggacaacag
aagacgtgcc tggtggtccg 2220ggtataagtg aattcatgtc ttgtggatgg
ctgctactgt gcttattgcc atttgtgaga 2280gggctagtgg gcaagggaag
ctatggtatc ccatggagtg tcaagctgaa ggctagtttg 2340ctggtggcct
tgttcctgtt ctgctccaat agaaattag 23798792PRTOryza sativa 8Met Ala
Ala Ala Ser Gly Glu Lys Glu Glu Glu Glu Lys Lys Leu Gln 1 5 10 15
Glu Arg Ala Pro Ile Arg Arg Thr Ala Trp Met Leu Ala Asn Phe Val 20
25 30 Val Leu Phe Leu Leu Leu Ala Leu Leu Val Arg Arg Ala Thr Ala
Ala 35 40 45 Asp Ala Glu Glu Arg Gly Val Gly Gly Ala Ala Trp Arg
Val Ala Phe 50 55 60 Ala Cys Glu Ala Trp Phe Ala Phe Val Trp Leu
Leu Asn Met Asn Ala 65 70 75 80 Lys Trp Ser Pro Ala Arg Phe Asp Thr
Tyr Pro Glu Asn Leu Ala Gly 85 90 95 Arg Cys Gly Ala Ala His Arg
Pro Arg Lys Ser Ser Cys Ile Ser Gly 100 105 110 His Leu Asp Leu Met
Arg Arg Gln Cys Ala Leu Met Gln Asp Arg Arg 115 120 125 Ala Ala Gly
Gly Arg His Val Arg Asp Asp Gly Gly Pro Gly Ala Arg 130 135 140 Ala
Ala Gly Gly Asp Gly Glu Gln Gly Ala Leu Ala Ala Arg Arg Arg 145 150
155 160 Leu Leu Pro Gly Arg Arg Arg Arg Arg Arg Arg Arg Arg Leu Ala
Cys 165 170 175 Tyr Val Ser Asp Asp Gly Cys Ser Pro Val Thr Tyr Tyr
Ala Leu Arg 180 185 190 Glu Ala Ala Gly Phe Ala Arg Thr Trp Val Pro
Phe Cys Arg Arg His 195 200 205 Gly Val Ala Val Arg Ala Pro Phe Arg
Tyr Phe Ala Ser Ala Pro Glu 210 215 220 Phe Gly Pro Ala Asp Arg Lys
Phe Leu Asp Asp Trp Thr Phe Met Lys 225 230 235 240 Ser Glu Tyr Asp
Lys Leu Val Arg Arg Ile Glu Asp Ala Asp Glu Thr 245 250 255 Thr Leu
Leu Arg Gln Gly Gly Gly Glu Phe Ala Glu Phe Met Asp Ala 260 265 270
Lys Arg Thr Asn His Arg Ala Ile Val Lys Val Ile Trp Asp Asn Asn 275
280 285 Ser Lys Asn Arg Ile Gly Glu Glu Gly Gly Phe Pro His Leu Ile
Tyr 290 295 300 Val Ser Arg Glu Lys Ser Pro Gly His His His His Tyr
Lys Ala Gly 305 310 315 320 Ala Met Asn Ala Leu Thr Arg Val Ser Ala
Val Met Thr Asn Ala Pro 325 330 335 Ile Met Leu Asn Val Asp Cys Asp
Met Phe Ala Asn Asp Pro Gln Val 340 345 350 Val Leu His Ala Met Cys
Leu Leu Leu Gly Phe Asp Asp Glu Ile Ser 355 360 365 Ser Gly Phe Val
Gln Val Pro Gln Ser Phe Tyr Gly Asp Leu Lys Asp 370 375 380 Asp Pro
Phe Gly Asn Lys Leu Glu Val Ile Tyr Lys Gly Leu Phe Tyr 385 390 395
400 Gly Gly Thr Gly Cys Phe His Cys Arg Lys Ala Ile Tyr Gly Ile Glu
405 410 415 Pro Asp Ser Ile Val Val Gly Arg Glu Gly Ala Ala Gly Ser
Pro Ser 420 425 430 Tyr Lys Glu Leu Gln Phe Lys Phe Glu Ser Ser Glu
Glu Leu Lys Glu 435 440 445 Ser Ala Arg Tyr Ile Ile Ser Gly Asp Met
Ser Gly Glu Pro Ile Val 450 455 460 Asp Ile Ser Ser His Ile Glu Val
Ala Lys Glu Val Ser Ser Cys Asn 465 470 475 480 Tyr Glu Ser Gly Thr
His Trp Gly Leu Glu Val Gly Trp Ala Tyr Gly 485 490 495 Ser Met Thr
Glu Asp Ile Leu Thr Gly Gln Arg Ile His Ala Ala Gly 500 505 510 Trp
Arg Ser Ala Lys Leu Glu Thr Glu Pro Pro Ala Phe Leu Gly Cys 515 520
525 Ala Pro Thr Gly Gly Pro Ala Cys Leu Thr Gln Phe Lys Arg Trp Ala
530 535 540 Thr Gly Leu Phe Glu Ile Leu Ile Ser Gln Asn Asn Pro Leu
Leu Leu 545 550 555 560 Ser Ile Phe Lys His Leu Gln Phe Arg Gln Cys
Leu Ala Tyr Leu Thr 565 570 575 Leu Tyr Val Trp Ala Val Arg Gly Phe
Val Glu Leu Cys Tyr Glu Leu 580 585 590 Leu Val Pro Tyr Cys Leu Leu
Thr Asn Gln Ser Phe Leu Ser Lys Ala 595 600 605 Ser Glu Asn Cys Phe
Asn Ile Thr Leu Ala Leu Phe Leu Thr Tyr Asn 610 615 620 Thr Tyr Asn
Phe Val Glu Tyr Met Glu Cys Gly Leu Ser Val Arg Ala 625 630 635 640
Trp Trp Asn Asn His Arg Met Gln Arg Ile Ile Ser Ala Ser Ala Trp 645
650 655 Leu Leu Ala Phe Phe Thr Val Leu Leu Lys Thr Ile Gly Leu Ser
Glu 660 665 670 Thr Val Phe Glu Val Thr Arg Lys Glu Lys Ser Thr Ser
Asp Gly Asn 675 680 685 Gly Gln Asn Asp Glu Val Asp Pro Glu Arg Phe
Thr Phe Asp Ala Ser 690 695 700 Pro Val Phe Ile Pro Val Thr Ala Leu
Thr Met Leu Asn Ile Val Ala 705 710 715 720 Ile Thr Ile Gly Thr Trp
Arg Ala Val Phe Gly Thr Thr Glu Asp Val 725 730 735 Pro Gly Gly Pro
Gly Ile Ser Glu Phe Met Ser Cys Gly Trp Leu Leu 740 745 750 Leu Cys
Leu Leu Pro Phe Val Arg Gly Leu Val Gly Lys Gly Ser Tyr 755 760 765
Gly Ile Pro Trp Ser Val Lys Leu Lys Ala Ser Leu Leu Val Ala Leu 770
775 780 Phe Leu Phe Cys Ser Asn Arg Asn 785 790 93927DNAHordeum
vulgare 9ggtcaattcc tgtctaaaga gtagcagacc tagcaggtta tcccagtcag
gattgtagta 60ttgccagaat tcgggtgggc caaacgggtc tagggttcaa aatagaccgg
gattacaaat 120tcagagtgcc aatttcaggg attcaaagtt caggatttga
tttagctttc gtctataact 180ttagggtttg ttttgaactt ttttcgtgca
gtggacggct cgcataacgt tgtgccgagc 240gtttgtgtaa caaaaacagt
cgctggcgac ttggcgagct cgttaggcgt gacgtgcatg 300ggtccaataa
tttaccgtgc gtacgtgagt gatatcgtca aggataacgg atccaaactg
360gagtcctatt ctccacacgc catggttttg catggatccg gctgggtggc
acgctggacc 420aagtgagcag cgagcacaca cttccgtagc aaagagacaa
gagcaccatc cctgtcccaa 480agattatcat acggtggcag tggtacatgg
cagaaccaag taaagataac tttctcctgt 540cctcccaccc tccgagaccc
catcacaagt catagtctag ttttgttttt gtcctgatcg 600gaaatgcgcc
gaggagagga gaggatagtt ttatctggtc catataaatg cactcgagcg
660gttgttgctt gtggagctgt gttcgtggag cttagctagt
ctgctactgc tactgctggc 720tagtggctac ctgctctcgg ccacggccat
ggcgggcggc aagaagctgc aggagagggt 780cgccctggcg agaaccgcgt
ggatgctggc cgacttcgcg atcctcttcc tcctcctcgc 840catcgtggcc
cgccgcgccg cctcgctccg ggagcgcggc gggacgtggt tggcggcgct
900cgtctgcgag gcgtggttcg ccttcgtgtg gatcctcaac atgaacggca
agtggagccc 960cgtccggttc gacacctacc ccgacaacct cgccaacagg
tactctacgt acgtacccac 1020ggcgacaaga cccaccatgc tgacccctac
aacttcctca aattttgatc tagctagtgt 1080ctgtgataat tttgctagga
tggaggagct cccggcggtg gacatgttcg tcacgaccgc 1140ggacccggcg
ctggagcctc cgttgatcac ggtgaacacg gtgctctcgc tgctcgccct
1200ggactacccg gacgtcggca agctggcgtg ctacgtctct gacgacggct
gctccccggt 1260gacgtgctac gcgctgcgtg aggccgccaa gttcgccggc
ctctgggtcc ctttctgcaa 1320gaggcacgac gttgctgtga gggccccatt
catgtacttc tcttccacgc cggaggttgg 1380cacaggcaca gccgaccacg
agttcctgga aagctgggcg ctcatgaagg ttaggcgcca 1440atggtgacca
tgtcagttta caaaataatg tttggtcgtc catcatcgcc atggccattc
1500atcttcctcg tgtacgtgtg actttcagag cgaatatgag agactagcca
gccgaatcga 1560gaacgccgat gagggctcca ttatgcgtga cagcggcgac
gagttcgccg agttcatcga 1620cgccgagcgc gggaaccatc ctaccatcgt
taaggtcgcc gcactgacca tgtccatgca 1680tgtgtccatg aacatcgtgt
catgacaaac gcatagcaaa tccgtgtctc gtgctaatat 1740cgtcacggtt
aatttgggcc gagttcaggt tctgtgggat aacagcaaga gcaaagtggg
1800ggaaggattc ccacatctgg tgtacctctc tcgagagaaa agccccagac
atcgccacaa 1860cttccaggct ggtgccatga atgttctggt gagcactctc
tttcgctcaa cacagtgttg 1920cactgctaat cagtgtcaca caagcagcac
accacatttt atactaatta agctgatcat 1980ttcgtggtgc agacaagggt
gtcagccgtg atgaccaacg ctcccatcat gctgaatgtg 2040gactgcgaca
tgttcgccaa caatccgcag gtcgccctac acgcgatgtg cctcctattg
2100gggttcgacg acgagatcca cagcgggttc gtccaagtgc cacagaagtt
ctacggtggc 2160ctcaaggacg atccctttgg caaccagatg caggttataa
ccaaggtact acatatgcat 2220gtgcacaagt gctcttgtcg tcgtgctgtg
caccactagg tagtgttaca gttgtactgg 2280tttttgtggc atgttcagaa
aattggaggt ggaatcgccg ggatccaagg catgttctac 2340ggcggcacgg
gctgttttca ccgcaggaaa gtcatttacg gcatgccgcc acctgacacc
2400ctcaaacacg agacaagagg tgaaactggg cacacaacag atgtgatcat
caggcgtaaa 2460ttggagtatg catttcagtt cgactagggc atttcaaatg
gctaagtgtt cttaatttgc 2520caggttcacc atcttacaag gagctgcaag
tcaggtttgg gagctcaaag gtgttgatcg 2580aatcatctag gaacatcatc
tcaggagacc tgctcgctag accaaccgtt gatgtatcga 2640gtcgcatcga
aatggcaaaa caagtcggcg attgcaacta tgaggctggc acgtgttggg
2700gcaaggagat tggttgggtc tatggatcaa tgacagagga cattttgacc
ggacaacgga 2760tccatgcggc gggttggaaa tcggccttgt tggacaccaa
cccaccggca ttcttgggat 2820gtgctccgac cgggggaccg gccagcttga
cccagttcaa gagatgggca acaggggttc 2880tggagatact catcagccgg
aacagcccta tcctcggcac catcttccaa cgcctccaac 2940tccggcaatg
ccttggctat ctcatcgtcg aggcgtggcc cgtgagggcg cctttcgagc
3000tgtgctatgc actattggga cctttctgcc ttctcacaaa ccagtccttc
ttgccaacgg 3060tacatacact ttcgcggttc gccaagatac attatgcagc
taaacaaaaa tgctgtgtga 3120tttgtttgat aatgaagcag gacctagttg
gctaatatgt atgtaaattc agatattttt 3180tttatgattg gtacatttgt
tgttttgcag gcatcggatg aaggttttcg catcccagta 3240gctctattct
tgagttacca catataccac ttgatggagt acaaggagtg cgggctctct
3300gcccgcgcct ggtggaacaa ccacaggatg caacgcatca cctcggcctc
cgcctggctc 3360ctcgccttcc tcaccgtgat cctcaagaca ctagggctct
ctgagaccgt gttcgaggtc 3420acccgcaagg aaagcagcac gtccgatggc
ggcgccggca ccgacgaggc cgatccagga 3480ctgttcacat tcgactcggc
gcccgttttc atcccggtga cggcgctctc agtgttgaac 3540attgtggccc
tcgccgtcgg ggcatggcgc gccgtcatcg ggactgcggc ggtcgttcat
3600ggtggcccgg gcatcggaga gttcgtgtgc tgtggctgga tggtgttgtg
cttctggccg 3660ttcgtgagag ggcttgtcag caggggaaag catggaatcc
cgtggagcgt caaagtgaag 3720gctggtttga ttgtggctgc gttcgtgcac
ctctgcacaa ggaactaacc ggccgggctg 3780gccatcgaaa tattggaagc
gtaattttag ttctaccatt ggaacatgta acgaagactc 3840aagcaggaat
taaagcgtgt tattaaagga agtttgaccc aatgtatcta tctatctctc
3900ccaatctctc tcaataataa agcaaat 3927108900DNAOryza sativa
10atgacttagt gacgatatga tcggtcgatc tggtgttatg cgttagtggg gaagagagtg
60gaaggaagaa aacatgaaga aggttaacat catagcatca gaattctttg tgtaatctgg
120tctatctaaa agtgacttaa atgtgtgaat aattttacat tcgctccctt
tgtcgtagaa 180aaaaaaatca tatcccaata aaaagacagg gagaaggaca
taagactaaa atatccctca 240ttactactac tttggtccct aaaacaaata
atcttttact ggtaggtact aagcggcatt 300aaatagatta aatttctttg
atttgtacaa caaaaacagc tataggaggg taggaattaa 360tatatttttt
tagataaagt ttttatcttt ggaagttata atttattttg ggatggggag
420ggagacaact acagtgtttc gtttggatcg ttctgtctgt tatgcccgtg
atcttttcag 480ttcagaactt cagagagcga taaaactgtg ggggcaagtg
ctctggcgcc ggcaataatg 540gaggcggcgg ctagaggcaa caagaagctg
caggagaggg tgcccatccg gcgcaccgcg 600tggaggctcg ccgacctcgc
catcctcttc ctcctcctcg ccctcctcct ccaccgcgtc 660ctccacgaca
gcggcgcgcc atggcggcgc gccgcgctcg cctgcgaggc gtggttcacc
720ttcatgtggc tgctcaacgt gaacgccaag tggagccccg tccgtttcga
cacgttcccg 780gagaacctcg ccgaaaggta aggtgcccaa gaattaatca
ggaatgattc aagccaacat 840ccagaaaaaa gaagatgatt ctgacgagct
ggttggtttt gcatctcttt cttgttgtta 900ggatcgacga gctcccggcg
gtggacatgt tcgtgacgac ggcggacccg gtgctggagc 960cgccgctggt
gaccgtgaac acggtgctgt cgctgctcgc cctcgactac ccggccgccg
1020gcgagaagct ggcgtgctac gtctccgacg acgggtgctc gccgctgacg
tgctacgcgc 1080tgcgggaggc cgcccggttc gccaggacgt gggtgccctt
ctgccggcgg cacggcgtcg 1140ccgtcagggc gcccttccgg tacttctcct
ccacgccgga gttcggcccg gcggatggca 1200agttcttgga ggactggaca
ttcatgaagg ttagctatgg caaccgcaac acctctcagt 1260ttctttctct
ctcttttttt tttccatttt ggaagtacta acgaatttaa aaatataagg
1320aaacatgata accacaacac gtctcagttt ctttctcttt ttttaatcca
ttttggaagt 1380actaacaaat ttaaaaatat aaggaaaaca tgataaccac
agcacgtctc agtttctttc 1440cttttttttt tccaatttgg aagtactaac
aaatttaaaa atataaggaa acatgatttg 1500actcgtgctc taaattaaaa
tcgattagat gaaatccggg ataccgatat ttaagtcagt 1560cttataaaag
aagcgtcgaa tgggtaggat accgtcaagt gattaatcct aatatggatt
1620attagtcaga attatacgga atttcaacgt tcataaaaca aataaatata
tttgcttggc 1680cgtccacctt gggtgatatt taagcacatt agtaccctta
agtactttaa aatatttaat 1740ttaaagtttc taaaacaaca tgtacagatt
tattttacaa agtgtaaaaa tgtatttatt 1800tattatatat tataataaaa
ataattaaat atatattttt gagatcgttc gtaacttcaa 1860taattatgta
accgggaggg agtacgtaaa ccggtcatat tgccagagtt aaatcgtcga
1920ttgatctaga attgaatgcc attgccatat atgctcagtg taacgagctt
tagttcggct 1980gctgctggag tcaattagta gatcggacga ttagtcgcga
atcagcctga ttaattgggc 2040cagcccggcc attttggcgt ccacgtcgcc
acaactcgtc acgaatggca gagtcgtatc 2100ggtttgtctt ccgtgtacca
ctgtaccagt acagttggcc ttataatcga ttggaacggc 2160cgtcattttc
cacacttttt cgtaagcaga aatgcagcgt ttcgatatgt cttctttagc
2220tattctgtga gcttccttgt ttagccaaac cagtgttaac cacccttgcc
tctgaggagg 2280agtttagtat cttttagctg ctgctcctta aatacacata
tctcgttgct agtagggatt 2340aatttattaa tgttccactg caaaatttcc
aaaatttccg aaattccagg tctactggtc 2400cctgatagaa tattatgttg
gcaaaagaaa tagtttttta attacacata tcttatttaa 2460gtttaatcaa
aatttgttca aatttcaact tatttcggtc tgaaattttg acaatttcct
2520gaaatttgtt tctatcggtt ccccggtaga aatatatgca aaccggtatg
tagaaccgtg 2580gttacaggat gcacgctttt atcttggagt ccaaaacagc
acaagcgaaa ggaagggcct 2640attcagattg atggcatttt caactatacc
gttatttggt aaaatgtata attatgtggc 2700tacgtttagt ttgtaaccaa
atattggcaa tgtgtataga attttggcaa tactattaag 2760ccaatcctac
caaaattttg gcaacgttgc caatttatca aaattttagc attgccaaat
2820tttgataagg tttattttgg catcaatctg aatggacccg aagttatcat
tgagtagtca 2880tggttcctga tcttaattcg ttcatggcca tcttgtttat
gtgcaaacat ttcagagcga 2940gtatgagaag ttggtccacc ggatcgagga
cgccgatgag ccttcccttc tgcggcacgg 3000cggtggtgag ttcgcagagt
ttctggatgt tgagaggggg aaccacccta ctatcataaa 3060ggtatcgatc
cccacctgac tatataaaaa ctttcaaata tggattctgg tccctccaac
3120tccaaagtgt gtcccttgca cagagtttct caactcattt ctcaccatga
ccctgaactt 3180ctgtgcttaa cttggtttgg ttctctgctg gatgatttag
gttctgtggg ataacaacag 3240gagcaggaca ggagatggct tccctcgtct
gatatacgtc tcaagggaga agagccccaa 3300cctacaccat cactacaagg
ctggcgccat gaatgccctg gtcagtgcta catagctctt 3360tttgttacta
gagaaatttt acggttattg agagagtata tgtagatacc gaaattttgc
3420aacacaaatt ttaatacatc gaggtactaa gttttacacc agaaaatatg
gtacctctcg 3480gtacactatt tgttactaaa caacatggaa agttcagaca
atgtttgtta ctcaccaaca 3540cggcaagttc agacactgtt tgtgttactc
atgattgggg aagttcagat atttgattgt 3600tcttaccatg attttttgtc
agacaagggt gtcagcactg atgaccaacg ccccattcat 3660gctaaaccta
gactgcgaca tgtttgtaaa caacccccgg gtcgtcctcc atgccatgtg
3720ccttctgtta ggttttgacg atgagatcag ctgcgcgttt gttcagacgc
cgcagaaatt 3780ctacggtgcc ttgaaggatg atcctttcgg gaaccagctg
gaagttagtt tgatggtaca 3840caactagctc ttgcttgtac gataatttat
ttaatttagt tgatgatcca actaaactag 3900gttgatgatc ttgtgtgatt
ttcagaaagt tggacgtggg attgcagggc ttcagggcat 3960attttattgt
ggaacaggct gctttcaccg cagaaaagtc atttacggca tgaggacagg
4020gcgagaaggc accacaggtg aaattgggca aacactgatg tgattgtcat
acattagggc 4080tccatttggt attgcggtag atcataataa tcacgtttgc
tgcaaatgtt ttttgacgtt 4140tggcagttgg ccaaccgctt ttctttttaa
ttatctacgt tagaaatgat aataattata 4200attatctaat cataatttgg
tatgtaaaca caaacaacaa caattattag tattagtttt 4260catgtcagcc
taaactagta agagaattca aatttaattc ttcaggttat tcatctaaca
4320aggagctcca tagtaaattc ggaagttcaa ataattttaa ggaatcagcc
agggatgtca 4380tttatgggaa cttgtcaaca gagccaatag tagatatatc
aagttgcgtt gatgttgcca 4440aagaagtagc tgcctgcaac tacgagattg
gcacatgttg gggtcaggag gtacagccat 4500tgccacatgt ctataggatg
ttactatgca gtttaattta ctattctata tgtttcataa 4560atgtcattcc
atatattcac aggttggttg ggtctatgga tcactgacag aagacgtgtt
4620gaccggacaa cggatccatg cagcgggttg gagatccacg ctgatggaaa
tcgaaccacc 4680agcattcatg ggttgtgcac caaatggagg gcccgcctgc
ctaacccagt tgaagagatg 4740ggcatcaggt tttttagaaa tactcatcag
tcggaataac ccaatcctca caaccacatt 4800taagagtctc caattccgac
aatgccttgc atacctgcac agctatgtgt ggcctgtgag 4860ggcacctttc
gaattgtgct atgcattgtt ggggccttat tgcttactat caaaccaatc
4920cttcttgcca aaggtactac tgcatcacta accaatgcat cggttataat
cttctgtact 4980ctccttgcct tcttaacaca gtgttgcacc tcatttgcat
attcaaagat aaaaaaatct 5040ttccaattga atggctagag agtgaggtat
atatgaacta ttaactctac tattgcagac 5100atcagaagac ggtttctaca
tcgcattagc tctattcatt gcctataaca catacatgtt 5160catggagttc
atagagtgtg ggcagtctgc acgtgcatgt tggaacaacc acaggatgca
5220acggatcacc tcagcttctg cttggctact ggcatttctt accgtcatcc
tcaagacctt 5280aggcttctcc gagactgtgt tcgaggtcac ccgcaaagac
aagagcacat cagatggtga 5340ttccaacacc gatgagcctg agccagggag
gttcaccttc gacgaatcga cggtgttcat 5400tcccgtgaca gcacttgcaa
tgttaagtgt cattgcaatc gctgtaggag catggagggt 5460ggttttggtg
acaacggaag gcttgcccgg tggccctggt atcagtgaat tcatctcctg
5520tgggtggctg gtgctgtgct tcatgccatt gctgagaggt ctagtgggaa
gtggtcgata 5580tggcattcct tggagtatca agatgaaggc ctgcttgctt
gttgctatat tcttgctctt 5640ctgcaaaaga aattaattgc agctggtgtg
cagcaacaat tagtccatac tattatttga 5700gcatgcaaac actaggtttc
atcttcatat tattatgtcc gcaaacgttg actaagctct 5760agaaaaggga
acaattcaat cactaattcg aagcaaaaac tggttgttta ctgtaagaga
5820gaatctactc gtccatggca agttgtccca ccggtgcaaa cttgatctta
gtggcatata 5880tatagtagat ttcctcttat tgtacggcct gtatgcatgc
atgaatcctt caaagtagaa 5940gcattggagc ggtcccgtgc aaatttattt
tcttggatgg atctactatt ataaaaattg 6000aagatgtttt tgctgatact
ttgatacgtc atccgtgttt gaatcggttg taattttatg 6060ttttattttt
aatctctatc tctacctaaa aagaacaaga aatttccata atcggtaaaa
6120aggaaaaaaa gtccgactaa aaaggtaaaa aaagggaaaa aaaagtccga
ctcaaaaacc 6180gataaaaaaa acttctgtcg tgaaaaaaat tgtccgactc
aggtaaaaaa aggtctcgcc 6240agtaaaaaaa gacaaagaaa agtccctttt
tttttcatcg gtgacttttt tcacgcgaaa 6300tagttttacc gtacgcacgc
gctattggtt ttttcgtctg gttttttaaa tccgatctgt 6360tcaccacgca
tctccctggt gcttttggtt ttttcatcaa tttttttatc accgggtttt
6420tatcccatgc gtttttggtt tttcttgtac gattttttaa tccgatttat
tcgtggcacg 6480tctaccgagt tgaaccttgg cgtcacgctg gcgccatatt
aatcgtgcgt ttttacttca 6540atttgattgc aaaaagaaat cgattcccac
tcatccctcg tcattttctc catgattttc 6600tgggctttat ttcgccggat
ttaatctaat ggttgccgat gatgacagcg atcttcccca 6660attgttttta
tcctgagttt tacgctctga ttttgggtaa aacaaccaat tttgggtgat
6720taagaaagat tcgaccggat ttgatgggtc gaacgaaaca tgccaaatga
gggaggtagc 6780ggaccagcct agggctgaaa actgcttcac tcgtggctgg
gtggaaacaa gaaggccaaa 6840cggagggagg tagcgaactg gcataggatt
gaaatgtaag gaaggctttt ggcccaaaac 6900tcaagaaaga ttttgggaag
gaatcgggcg gcgccgggca aaggagggag ggaaggggag 6960cttcacgggg
tggcggtgga ttgggaaggc cggcgcggcg gtgtggagaa gaggaggccg
7020gcggcggtgg ggatagagag gatggccagc gaaggtgggg atggagagga
tggaccggcg 7080tggtggggaa gggcgacacg aggagaggct gccgcgggcg
acgccggcgc agccgtgctc 7140ggctgagcgt cggccgactc cgcgtggcgg
taggaatgga gaggagggga aaggttcgac 7200acggtgggga gctcaatccg
gggacgccgg catgctgcga tggacaggag tcggtggaga 7260ggggatagag
actcgctcgc ctgccggctg ccacttgccc cgctccatcg gtcggggaga
7320gagaggggat agagagaaga ggggagaaag agaggaggaa gaagaggagg
gtgagatgga 7380tgacatatgg ggcccacgtg ggtcccacca tttttttatt
attttctgtg tgagactaac 7440ttgtggggcc catgtgggtc ccaccacttt
tttattattt tttgtgtgag attgatatgt 7500gggtcccgca gattttatta
tttttccagc tcgaattacc acgtaagtgc cacgtcaatg 7560ccacgttaga
tgaagaccga gtcaaattag ccacgttggc gccacgtcag tcaaaaccgc
7620cctcaaaacc gtcgagggac ctaatctgca ccggttttga tagttgaggg
acccgttgtg 7680tctggttttc cggttgaggg atgaaatcgg atttgttgac
aagttaaggg acctcagatg 7740aacttattcc tctgggtagc gacgcagggg
acttgggaga ggcccacgag ccagccacat 7800cggaacaagc aggggacacc
gtagcacctg agcccagcga agaggtctcc acctctgtcg 7860gctgggagag
aaataagttc actttaggtc ccttaattta tcgtcgagtt tgaaattcat
7920ccctaaacca aaatacgata taactcatcc cccaatttat aataacgtat
caactttgat 7980cctggcggta tagcggccgc ttttggctga tatggtgagt
gggacctacc tgggctccac 8040atgtcagcgg acggagttag gggcggtgct
tgtcttcctc ttctctagcg cggtggacgg 8100cggggcaggg acggcgctcg
gccttcctct tctctagcag cgaacggcgg gggtagggtg 8160gactgtggcg
gatgttgcac gatcttctct atatcaccag cccatcccgc gactccgcct
8220tcgaggcttc aacttgtccg acaacaacgt agttaaattc atcctcacca
cgtggttccc 8280cttcggcgcc agcagcaatg cgtcgcagcc ggtgacgcag
tccgtggtgt ggttcgcgaa 8340gcagtcgttg tccggcgaga caaccgttgg
cactatgcat tccgtgctca gcgtcacggt 8400agacggccag ctcgcgctca
ccgaagtaga tggccgcatg ctatggcggg caccggtctc 8460ccggctgatg
cgcggctcca tcctcgtgct ccgtgactct gatagcctcc ggccggttcg
8520tcggtgacgc cagctgaagg atcgaacaac aagaactaag ccaaccaaat
gggggtgaat 8580ggttgtagta tacatacata ttatacatac atcctagtta
tattattact taactaatac 8640cctctttccg atgccctcct ggtgcttcga
gaagccaccc ttgattgccg agttccttac 8700aacaatccgt catgaccatc
caactgtggc taaatacgga ggagtacccg ccccaggaaa 8760ttaacttagt
actatataca cgcgcggagg aatacccgta ctgagccatc accatcagcg
8820gcccacctcg cttctgcagc atataacctc aaataatgat atgtagtaat
ctaaacacca 8880tgcttaaatt accaaatgct 8900114620DNAOryza sativa
11ggcttccgtc attcataggc atccgatgga ttgggctaac tgagccaccg aggaactttc
60ggaatttttt tagaattttg acggaaatta ccatacaaat acggttaccg acaaaacatt
120cggaaaaacc tccatcccat ttccggaaga tattaccgtt tctatttcca
ccaccgtcga 180ttatcgttac tgactaaaac ggtcggtgca aaccggaaac
agtagctgga aatctcaaca 240aacaaagtta aggaccgacg acacacttta
ctggtgatag aataaacaca tgcatgttgg 300aaaatagaag tgttgaagaa
aacgatactc tcgtcgtgcc cccgcgatgc gtgcgtggag 360tgaggagaag
acaatgattt tttttcgttt ttaatactat agtagataat aatgggagaa
420accaagaaac gtactcgctc gctagctacg cctacgcgcg cgccgcggcg
tgggcgcgcg 480tgtgcggttg ccgcgtgcgt tgctcgctcg acgcatggct
cgatcgcttc gtcgctcgat 540cgatccgtca atggcggtgg tggcggcggc
ggcggccacc ggttccacca ccagatcagg 600cggcggcggc ggcgagggga
cgaggtccgg gaggaagaag ccgccgccgc cgccgctgca 660ggagagggtg
cccctcgggc ggcgcgcggc gtgggcgtgg cggctggccg gcctcgccgt
720cctcctcctc ctcctcgccc tcctcgccct ccggctgctt cgccaccacg
gcggcgccgg 780gggcgacggc ggcgtgtggc gcgtggcgct cgtgtgcgag
gcgtggttcg cggcgctgtg 840cgcgctcaac gtgagcgcca agtggagccc
cgtccggttc gtcacgcggc cggagaacct 900cgtggcggag ggcaggacgc
cgtcgacgac ggcggcggag tacggcgagc tgccggcggt 960ggacatgctg
gtgacgacgg cggacccggc gctggagccg ccgctggtga cggtgaacac
1020ggtgctctcg ctgctcgccc tcgactaccc gcgcgccggc gagcggctgg
cctgctacgt 1080ctccgacgac gggtgctcgc cgctgacgtg ccacgcgctg
cgggaggccg ccgggttcgc 1140cgccgcgtgg gtgcccttct gccgccggta
cggcgtcgcc gtcagggccc cgttccggta 1200cttctcctcc tcctcctcgc
cggagtccgg cggcccggcc gatcgcaagt tcttggacga 1260ctggacattc
atgaaggtca atcaactata cttggaaaag tcaatattct cgagtttctt
1320acatgtcatc taaataatcc ggaacacagc gtcatgttcc gatgatctta
tgtttatggc 1380cattttcttg tttgatcaat ttcatatata ggatgagtat
gacaagttag tgcggcgcat 1440caagaacacc gacgagcgct ccctcctccg
gcacggcggc ggcgagttct tcgccgagtt 1500cttgaacgtc gagaggagga
atcaccccac catcgtcaag gtcgatggca atagctagct 1560cttcggcatt
tttttacctc atcgtgatac atgaacttct ctgctcacta agccccgttc
1620gaaattattg aagatgaaga ttaagtatga acatgcgaaa tgagaaagtt
attactacat 1680tgttaattga gttttaaata ttttaaactt aaaaaataga
tttatctgat attttaaagc 1740aatttcgata tagaaagttt tccagtttta
aaaacatgct atatgggcat gtaaaacgag 1800aaactcatta ctacattatt
aattgagttt taattatttt aaacttaaaa aatggactta 1860cctgatattt
tagagcaatt ctgatataga aagttttcgc atgaaacaca ccgtttagcc
1920gttttaaaaa atatgctaat gaaaaccgaa gtagaatctg cagtgacaaa
gcattttttt 1980ctctctctct ctgtgcagac gagggtgtca gctgtgatga
ccaacgcacc gatcatgctg 2040aacatggact gcgacatgtt tgtgaacaat
ccccaggccg tcctccatgc gatgtgcctg 2100ctgctggggt tcgacgacga
ggccagcagc gggttcgtcc aggcgccgca gagattctac 2160gacgccctca
aggacgatcc atttgggaac cagatggagt gttttttcaa ggtacatagc
2220tagtgtactg atgatcaatg ctagtagcta gtatttctgc cttcatctgt
atgttggagt 2280attaatctat cgatggttaa tgttctgatt gtttgaaatc
aaccttttaa aataaacgtc 2340aagaattata gaaccggagg gagtagctgt
cgtgcttggc tgtacatttg cttatatatg 2400gaaaatgagt tgtctgatca
aatctgaatt tactatgcac aaaatgtttc ttcattaatc 2460cgtatcccgt
tctatgctgc ttattaaccc cactaatatt ccaaataagt taaactgatc
2520ttgtgtcatg tttagagatt tatcagtggg gttcaaggag ttcagggtgc
cttttatgct 2580ggaaccggct gctttcaccg taggaaagca gtttatggcg
tgccaccgaa cttcaatgga 2640gccgagagag aagataccat aggtgaaatt
gggcatacac tgatgtgatt gttaggagta 2700catcaatcat gccatctcac
acccttaaat tgagagacct ggcataattc ttcaggttca 2760tcgtcttata
aggagcttca taccaggttt ggaaactcag aggaattgaa cgaatcagca
2820agaaacatca tttgggatct gtcctctaag ccaatggttg atatatcaag
tcgcattgaa 2880gtggcaaaag cagtttcagc ttgcaactat gatattggca
catgttgggg acaggaggta 2940aagacaactt ccattgccat atttttgtag
gttatgctac agtgcagtac acttttctgc 3000aagtctcata caattcatcc
ctcatattct aatcaggttg gttgggtcta tggatcacta 3060acagaagaca
tattgaccgg acagcggata cacgcgatgg gttggagatc cgtattgatg
3120gtaaccgaac cacccgcatt catgggctcc gcgccgattg gaggaccagc
ctgcctaact 3180cagttcaaga gatgggcaac tggccaatct gagataatca
tcagccggaa caacccaatt 3240ctcgcaacca tgttcaagcg cctcaaattc
cggcaatgtc ttgcctacct gatcgtcctt 3300gggtggcctc tgagagcgcc
ttttgagcta tgctatggat tgttgggacc ttattgcata 3360ctcacaaacc
aatccttctt gccaaaggta atcatttgca tgccactcat taatacattc
3420cttatatttt tcaagtactt ttcaattggt tggctagaga gtgatatgga
tgaactatta 3480tactcttggt atcctgtagg catcagaaga tggtttcagc
gtcccgttag ccctattcat 3540atcctataac acatacaact tcatggagta
catggcgtgc gggctctccg cccgtgcatg 3600gtggaacaat cataggatgc
aacggatcat ctcggtctct gcctggacac tagcatttct 3660taccgtgctc
ctcaagtcct taggcctctc cgaaactgtt tttgaggtca ccggcaagga
3720caaaagcatg tctgatgacg atgacaacac cgatggtgct gaccctggga
ggttcacctt 3780cgactcattg ccggtgttca tccccgtgac ggcacttgcg
atgttaaaca tcgttgcggt 3840cactgtcgga gcatgtaggg tagctttcgg
gacagcggaa ggtgtgccct gtgccccggg 3900tatcggcgaa ttcatgtgtt
gtgggtggct ggtgctgtgc ttcttcccgt ttgtaagagg 3960gatagtgtgg
ggcaagggaa gctatgggat cccttggagt gtcaagctga aggctagctt
4020acttgtggct atgtttgtta ccttctgcaa aagaaactaa tttcaacatc
taaccataga 4080caagtaaatt ttacccccag ctcaatggta tgataggagc
atgtatcata tgtatcaaga 4140aacacctcat cattttccat cgctcccatc
cgcgtcgctc ccgtcccagg ggcggcacgg 4200acggcgcctc atcctcctcc
gccgcctcct cccttctcct cccctttgcc tcgccaccgc 4260ccgagcggcg
cgtcggcaaa gccgaccggc cacaaggacg gcggtggcgg ggccctctcc
4320cctcctcgag gaagccagcg gcggggacac cggggctgct cgggagcggc
ggtccgcggc 4380gcgggaggcg gcgccggggg gttggcgtgg cggatccggc
cacgccggag gcggatccgt 4440ctcccccggc agcggatctg gcccctccgt
gtccagggcc gagcaacagc gagcggcggt 4500cagcggcgcg ggaggcggcg
ccgaggggtc gtcgcggcga atccggccac gccggaggtg 4560gatccgcctc
ccctggcggc ggatccggcc tccccgcatc caggggccaa gcgacggcga
4620126540DNAOryza sativa 12tctttttatt gttattaggt gataaaccat
gaatattatt tatgtgtgac ttgtttttct 60aaatctttta ataaattttt taaataagac
gaacaattat acaatggaca tagaaagtcg 120tcagaacata acttaaaata
tgacggagga agggagtaag agataagggg atgtcgcagc 180taatccatct
ccctcagtaa ttactgctcg ttttctggtc atcggatcgc tacgttttag
240agctaggcca gacgatgtga cgccatgcat gcaggccgtg cagatcgccc
caagagaaat 300taattattac tcgacatcga tgattgatct cggccggccg
gccgttctct ctcgacgcga 360cgtcgtcacg cggcggttca tcgacggcgc
ccgtggagac gcgacaaacg ccagcgatcg 420agcaagagca accagagaaa
cccatggctg ccattgatat ttgattgaag gtgctagcta 480cgccggtata
aatatggaga ggagagacgt gcagctctgc ttctagctcg acttctcgag
540tggtgacgaa gctagttagc agtaacaatg gcggcggcga gcggcgagaa
ggaggaggag 600gagaagaagc tgcaggagag ggcgccgatc cggcgcacgg
cgtggatgct ggccaatttc 660gtcgtactct tcctcctcct cgccctcctc
gtccgccgcg ccaccgccgc cgacgccgag 720gagcgcggcg tcggcggcgc
ggcgtggcgc gtggcgttcg cctgcgaggc gtggttcgcg 780ttcgtgtggc
tgctcaacat gaacgccaag tggagccccg cccggttcga cacctacccg
840gagaacctcg ccggaaggtg tggcgccgcc catcgtccta gaaagtcgtc
gtgcatctcc 900ggccatctcg atctcatgcg gagacagtgt gctttgatgc
aggatcgacg agctgccggc 960ggtcgacatg ttcgtgacga cggcggaccc
ggcgctcgag ccgccggtgg tgacggtgaa 1020caaggtgctc tcgctgctcg
ccgtcgacta ctacccgggc ggcggcggcg ccggcggcgg 1080cgaaggctgg
cctgctacgt ctctgacgac gggtgctcgc cggtgacgta ctacgcgctg
1140cgggaggccg ccgggttcgc gaggacgtgg gtgcccttct gccggcggca
cggcgtcgcc 1200gtcagggccc ccttccggta cttcgcctcc gcgccggagt
tcggcccggc cgaccggaag 1260ttcttagacg attggacatt catgaaggta
aggctttatg ctatccctgg ataagtaaat 1320actccccaaa gtttttaggt
tacaagacgt tttaacttta gttaaaatta aattgcttta 1380agtttgacca
agtttgttga aaaaaaaaat agtaagagca agtataataa tgagctataa
1440gtctactata agcttacgtg gaggagagag gtaacaaaaa aaaaatcaag
agtattgatt 1500ctaatacaag agctagctta acacaagttt caagataaat
acattaaata tataagtgag 1560agatagatag aggagaagaa aattataact
aatcttatag ctaatctatt atatatatta 1620gctttaagat ggactaatag
tagaaagtga gctatactat tatccttgct ctaacatttt 1680caacccaaaa
caaatttatt aagaaaatat attcaattat tgatttgatt aaactaattt
1740agtattataa atattgttat atttgtctat aaacttagtt aagcttgaaa
tactttgact 1800ttgaccaaag tcaagacgta ttataacctg aaatagaggg
aaataaattt cacagaatcg 1860aaggttatgg ggcatcctta atgcaaaacc
cgggttttac aatttgtttc atgaaacctc 1920aagttttagg ggcaaagtgt
ttcatgaaac tcagctacaa gcttatatcg tctatccgac 1980taatatattt
atctatatta attgtataaa aatgtttgag atctttttta aaatacatat
2040atatacacgt tatctgcttt atcatttatt attatcggtt atgattatgg
tgagttttgt 2100atgcggtgaa aagttgaaaa aacaattaaa ctagataaga
gaaatgtgta ttttgagcca 2160acaatgtgaa tttattaaaa aaacaataat
gtaataatga aatatgagta tttacataaa 2220tataggtttt tttttgaaat
atcttactct aaaatatgag atttcttaaa acaaatcaca 2280ataactgaag
ttaatagata ccccaataac gtggggttct gtgaaattta ttctaaataa
2340atttaggggc ggatcaggtt taattgagct agcccataac attatgggtc
aagaatagag 2400ctacgcgagg ccccaaggtc cagattcgtc cctgttggta
tgctaggtgc acaactgtgc 2460taactatttt tttagcgtat cacaacgtga
tgtgctaaac aacgacatag tcactgggac 2520actagtttga ctattaatta
tcagttacta ttactaagta taaaacttat aaaagataca 2580tacaagttaa
tataacattt tgaaactttt attcaggaca aatctaatta accatacaac
2640attcaaaagt agaaccgaaa cgttcaaata gaatttgacg gtcaaagttt
aaacatatat 2700tactacacga attcgaaaac aacacatatt atgaccagag
tgagaacatg ctaacatcca 2760aaatgacaaa ggagaaaaag aaataaccac
agcttacaca gagaaatttt ataatttaac 2820acttctttcg tttcccaatt
attttaattg atacttgtga gaataacatg tggggccatc 2880tgagtaaatg
aaaatgtcca aaatgttaaa taatcaaaac acattttaaa acgtgttaaa
2940ttatcgaatc tctttagcac tttaatcttt aacggcatat tgattgtgta
taattctaga 3000gtgagtacga caagctagtc cgtcggatcg aggacgccga
cgagaccacc cttctgcggc 3060aaggcggcgg cgagttcgcc gagttcatgg
acgccaagag gacgaaccac cgcgccattg 3120tcaaggtcga ttccccacat
ggctagcttt caaactgatc atgtcagaac tacatcaaat 3180ctttcttgtc
tctcatgaca tgaacttctc atatcgggga gatcatcatc aggttatatg
3240ggataataac agcaagaaca ggataggcga agaaggaggg ttcccgcatc
tcatatacgt 3300ctcaagggag aagagccccg gacaccacca tcactacaag
gccggcgcca tgaacgccct 3360ggtactagct cgatcagtgc actgatatct
actgttagct cgatcgacat gtaatgggag 3420tcagattcag atcgagccca
gagatgtgcg ttagtactga aaacatgtgt acatttctct 3480ctcttgtgtg
tgcagacgag ggtgtcagcc gtgatgacca acgcaccgat catgctgaac
3540gtggactgcg acatgttcgc gaacgatccc caggtcgtcc tccacgcgat
gtgcctgctg 3600ctggggttcg acgacgagat ctccagcggg ttcgttcagg
tgccgcagag tttctacggc 3660gacctcaagg acgatccttt cgggaacaag
ctggaggtta tttacaaggt acgtgcgtac 3720acaagtggtt gtccgttata
atacatctac cagtgtattc ctccctccgt ttcatattat 3780aaactgcttt
gatttttttt cctcatcaat cttctttagt tttgaccaaa tttatagcta
3840gaaaaaaaat taacaatatc tataacatca aattacacta aattcatttc
attatatata 3900acattgaata tattttacaa atatgtttgt ttgccttaaa
aagtattact atattttttc 3960tataaatttg attaaactta aaaatatttt
actaaaaaag tcaaagcgac ttgtcatatg 4020aaacatatga agtacttcct
ccgtttcaca atgtaagtca ttttagcatt ttccacattc 4080atattgatgt
ttaatgaatc tagatagata tatatgtcta gattcattaa cataaatatg
4140aatgtggaaa atgctagaat gacttacatt gtgaataaac ggagggagta
ctaattaatg 4200ataacactta tccattctta tagtgaaagt ttgaaagtac
atctttgtgt aacccaattg 4260aaagtaacaa ttaaaactac actatatatc
cacttctgaa tatagatgct agatttctat 4320ctatagaaaa aaaactagac
taattttgca gtacgtgtgt tcagaaactt ctaggcgggg 4380ttgcagggat
ttagggctta ttttatggtg gaacgggttg cttccactgt agaaaagcca
4440tttacggcat cgaaccagac tccattgtgg taggaagaga gggcgccgca
ggtgaagttg 4500gagcatacac agtgatgtga tggttatcac ttatcaggag
aacattagtc ttatcattct 4560agtagaacta aatcgcgaga cttttcaatt
tgcttctcta ggttcgccat cttacaagga 4620gcttcagttc aagtttgaaa
gttcagagga gttgaaggaa tcagctcggt acatcatttc 4680tggggatatg
tccggtgagc caatagtaga tatatcaagt cacattgagg ttgcaaaaga
4740agtttcttcc tgcaactatg agagtggcac acattggggt ctggaggtat
agacaacttt 4800catttgtcat atttttgtag gttatgctac aatgcactac
acttttaaac aagcttcata 4860gcaagtcatt ccatatatct acaggttggt
tgggcctatg gatcaatgac cgaagacatt 4920ttgactgggc agcggatcca
tgcagcaggt tggagatctg caaagttgga aaccgaacca 4980ccagcattct
tgggctgcgc accaacgggt ggaccagctt gcctaaccca gttcaagaga
5040tgggcaacgg gtttgtttga gatactcata agccagaata acccactcct
tctgagcata 5100ttcaagcatc tccaattccg acaatgcctt gcgtacctga
ctctttatgt gtgggctgtg 5160aggggatttg ttgagctatg ctatgaattg
ttggttcctt attgcctact cacaaatcaa 5220tccttcttgt caaaggtact
ctctccatac ttatctttac attgcttata taattgtaag 5280tattaattag
tttttgtagt acaaatattt gtagaacttt tacatattca tgaacaattc
5340ttttagtact tccaattggt tgggagcaga gaagtgatgc agtaatatct
tgttcctata 5400ggcatcagaa aattgtttca acatcacatt agcactattc
ttgacctata atacatacaa 5460cttcgtggag tacatggaat gtgggctctc
tgtacgtgcc tggtggaaca accacagaat 5520gcaacggatc atttcagcct
ctgcatggct actagcattt tttactgtgc tcctcaagac 5580cataggcctc
tccgagactg tgttcgaggt cacccgtaag gagaagagca catcggatgg
5640caatggccaa aacgatgagg ttgacccgga gagattcacc tttgacgcat
caccagtgtt 5700catccccgtt acggcgctga caatgttgaa cattgttgca
atcacaattg gtacatggag 5760ggcagttttt gggacaacag aagacgtgcc
tggtggtccg ggtataagtg aattcatgtc 5820ttgtggatgg ctgctactgt
gcttattgcc atttgtgaga gggctagtgg gcaagggaag 5880ctatggtatc
ccatggagtg tcaagctgaa ggctagtttg ctggtggcct tgttcctgtt
5940ctgctccaat agaaattagt ttcagcatgt aagcatagtc agcttaacat
gtttcatgta 6000tgtattattt gagcaatatg tttgtaattc catttagcaa
atgacgacaa ctataaacat 6060atggagtatt tcactttcag ctggtggtgt
tgttggtaaa cataactgag ttctataaga 6120tagcagttca accactaaga
gcgtcatcgg ttggttaaga gctgattata tactaaaaca 6180acttattaga
gattaaaata taatttatag gtaaaagctt tcatatgtgt catttgcgac
6240ttaaaagcca atgctgaaaa caactatatt gaaaataccc taaaatgaac
cccacaatta 6300attttcaaaa tttaaatttt ggtaacaact aattctttct
agggcaaacg atgagaccct 6360aagttccaaa caaagagtaa ttctttattc
cgaataccta caagtacatt attataaaaa 6420tacgagtgct tttccattct
taagaacgta ccaccaggta tcaggtatca atctaaataa 6480cttttggtta
catatgggta cgattgggct aaccaattgc tagatagaat acatcaatcc
65401319DNAArtificialprimer 13ttgaccggac aacggatcc
191418DNAArtificialprimer 14ctggagatac tcatcagc
181520DNAArtificialprimer 15tcgagcggtt gttgcttgtg
201625DNAArtificialprimer 16caccatggcg ggcggcaaga agctg
251718DNAArtificialprimer 17cgtcaccggg atgaaaac
181818DNAArtificialprimer 18tgacgctcca cggcattc
181920DNAArtificialprimer 19ggctggccat cgaaatattg
202018DNAArtificialprimer 20gagcgttggt catcacgg
182117DNAArtificialprimer 21cacatcgcgt gtagggc
172226DNAArtificialprimer 22cctgcttgag tcttcgttac atgttc
262326DNAArtificialprimer 23cctgcttgag tcttcgttac atgttc
262419DNAArtificialprimer 24cgcttccaat atttcgatg
192544DNAArtificialprimer 25ctaatacgac tcactatagg gctcgagcgg
ccgcccgggc aggt 44268DNAArtificialprimer 26acctgccc
82727DNAArtificialprimer 27ggatcctaat acgactcact atagggc
272817DNAArtificialprimer 28aatagggctc gagcggc
172922DNAArtificialprimer 29gtttcagcct tgcgaccata ct
223018DNAArtificialprimer 30ggtaattcca gctccaat
183118DNAArtificialprimer 31gtttatggtt gagactag
183219DNAArtificialprimer 32gtgaggctgg tgctgatta
193324DNAArtificialprimer 33cgtggtgcag ctagcatttg agac
243422DNAArtificialprimer 34cctgtcgtgt cgtcggtcta aa
223522DNAArtificialprimer 35acgcagatcc agcagcctaa ag
223620DNAArtificialprimer 36agtgtcctgt ccacccactc
203720DNAArtificialprimer 37agcatgaagt ggatccttgg
203821DNAArtificialprimer 38cgaccagggc aaccgcacca c
213921DNAArtificialprimer 39acggtgttga tggggttcat g
214021DNAArtificialprimer 40ggtacctccc aggctgactg t
214121DNAArtificialprimer 41gtggtggcgt ccatcttgtt a
214220DNAArtificialprimer 42tgctgtggct ggatggtgtt
204327DNAArtificialprimer 43gctttattat tgagagagat tgggaga
274418DNAArtificialprimer 44aggcgtggtt cgcgttcg
184518DNAArtificialprimer 45cagcgcgtag tacgtcac
184618DNAArtificialprimer 46cagccgtgat gaccaacg
184718DNAArtificialprimer 47gttgccaaag ggatcgtc
184823DNAArtificialprimer 48gcggtcgtga cgaacatgtc cac
234917DNAArtificialprimer 49gacgctccac gggattc
175022DNAArtificialprimer 50ggttagttcc ttgtgcagag gt
225122DNAArtificialprimer 51gagctgtgtt cgtggagctt ag
225220DNAArtificialprimer 52ctgctctcgg ccacggccat
205324DNAArtificialprimer 53ccgccggtta gttccttgtg caga
245420DNAArtificialprimer 54ggagagttcg tgtgctgtgg
205526DNAArtificialprimer 55caccatgagc cccgtccggt tcgaca
265621DNAArtificialprimer 56caaacctcag ggaagcagtc a
215720DNAArtificialprimer 57agtgtcctgt ccacccactc
205819DNAArtificialprimer 58gcatcgtact ggtgctgct
195923DNAArtificialprimer 59gcgcttctca cgggacacgt aca
236020DNAArtificialprimer 60gatgcgtaca actcgagcaa
206120DNAArtificialprimer 61cgttgctgaa gtcaagtgga
206221DNAArtificialprimer 62cgctgcaaac gagaaagaag g
216318DNAArtificialprimer 63ggcgctgaaa tccagagg
186419DNAArtificialprimer 64cggaaatcca taggaaagg
196516DNAArtificialprimer 65cggcggaaca tgcaac
166620DNAArtificialprimer 66ggattgaccc agctgaaaac
206720DNAArtificialprimer 67gagttgttga cgtagtggtc
206820DNAArtificialprimer 68cgagcacccc aatctacaga
20692333DNAHordeum vulgare cv. Himalaya 69gagctgtgtt cgtggagctt
agctagtctg ctactgctac tgctggctag tggctacctg 60ctctcggcca cggccatggc
gggcggcaag aagctgcagg agagggtcgc cctggcgaga 120accgcgtgga
tgctggccga cttcgcgatc ctcttcctcc tcctcgccat cgtggcccgc
180cgcgccgcct cgctccggga gcgcggcggg acgtggttgg cggcgctcgt
ctgcgaggcg 240tggttcgcct tcgtgtggat cctcaacatg aacggcaagt
ggagccccgt ccggttcgac 300acctaccccg acaacctcgc caacaggatg
gaggagctcc cggcggtgga catgttcgtc 360acgaccgcgg acccggcgct
ggagcctccg ttgatcacgg tgaacacggt gctctcgctg 420ctcgccctgg
actacccgga cgtcggcaag ctggcgtgct acgtctctga cgacggctgc
480tccccggtga cgtgctacgc gctgcgtgag gccgccaagt tcgccggcct
ctgggtccct 540ttctgcaaga ggcacgacgt tgctgtgagg gccccattca
tgtacttctc ttccacgccg 600gaggttggca caggcacagc cgaccacgag
ttcctggaaa gctgggcgct catgaagagc 660gaatatgaga gactagccag
ccgaatcgag aacgccgatg agggctccat tatgcgtgac 720agcggcgacg
agttcgccga gttcatcgac gccgagcgcg ggaaccatcc taccatcgtt
780aaggttctgt gggataacag caagagcaaa gtgggggaag gattcccaca
tctggtgtac 840ctctctcgag agaaaagccc cagacatcgc cacaacttca
aggctggtgc catgaatgtt 900ctgacaaggg tgtcagccgt gatgaccaac
gctcccatca tgctgaatgt ggactgcgac 960atgttcgcca acaatccgca
ggtcgcccta cacgcgatgt gcctcctatt ggggttcgac 1020gacgagatcc
acagcgggtt cgtccaagtg ccacagaagt tctacggtgg cctcaaggac
1080gatccctttg gcaaccagat gcaggttata accaagaaaa ttggaggtgg
aatcgccggg 1140atccaaggca tgttctacgg cggcacgggc tgttttcacc
gcaggaaagt catttacggc 1200atgccgccac ctgacaccgt caaacacgag
acaagaggtt caccatctta caaggagctg 1260caagtcaggt ttgggagctc
aaaggtgttg atcgaatcat ctaggaacat catctcagga 1320gacctgctcg
ctagaccaac cgttgatgta tcgagtcgca tcgaaatggc aaaacaagtc
1380ggcgattgca actatgaggc tggcacgtgt tggggcaagg agattggttg
ggtctatgga 1440tcaatgacag aagacatttt gaccggacaa cggatccatg
cggcgggttg gaaatcggcc 1500ttgttggaca ccaacccacc ggcattcttg
ggatgtgctc cgaccggggg accggccagc 1560ttgacccagt tcaagagatg
ggcaacaggg gttctggaga tactcatcag ccggaacagc 1620cctatcctcg
gcaccatctt ccaacgcctc caactccggc aatgccttgg ctatctcatc
1680gtcgaggcgt ggcccgtgag ggcgcctttc gagctgtgct atgcactatt
gggacctttc 1740tgccttctca caaaccagtc cttcttgcca acggcatcgg
atgaaggttt tcgcatccca 1800gtagctctat tcttgagtta ccacatatac
cacttgatgg agtacaagga gtgcgggctc 1860tctgcccgcg cctggtggaa
caaccacagg atgcaacgca tcacctcggc ctccgcctgg 1920ctcctcgcct
tcctcaccgt gatcctcaag acactagggc tctctgagac cgtgttcgag
1980gtcacccgca aggaaagcag cacgtccgat ggcggcgccg gcaccgacga
ggccgatcca 2040ggactgttca cattcgactc ggcgcccgtt ttcatcccgg
tgacggcgct ctcagtgttg 2100aacattgtgg ccctcgccgt cggggcatgg
cgcgccgtca tcgggactgc ggcggtcgtt
2160catggtggcc cgggcatcgg agagttcgtg tgctgtggct ggatggtgtt
gtgcttctgg 2220ccgttcgtga gagggcttgt cagcagggga aagcatggaa
tcccgtggag cgtcaaggtg 2280aaggctggtt tgattgtggc tgcgttcgtg
cacctctgca caaggaacta acc 233370751PRTHordeum vulgare cv. Himalaya
70Met Ala Gly Gly Lys Lys Leu Gln Glu Arg Val Ala Leu Ala Arg Thr 1
5 10 15 Ala Trp Met Leu Ala Asp Phe Ala Ile Leu Phe Leu Leu Leu Ala
Ile 20 25 30 Val Ala Arg Arg Ala Ala Ser Leu Arg Glu Arg Gly Gly
Thr Trp Leu 35 40 45 Ala Ala Leu Val Cys Glu Ala Trp Phe Ala Phe
Val Trp Ile Leu Asn 50 55 60 Met Asn Gly Lys Trp Ser Pro Val Arg
Phe Asp Thr Tyr Pro Asp Asn 65 70 75 80 Leu Ala Asn Arg Met Glu Glu
Leu Pro Ala Val Asp Met Phe Val Thr 85 90 95 Thr Ala Asp Pro Ala
Leu Glu Pro Pro Leu Ile Thr Val Asn Thr Val 100 105 110 Leu Ser Leu
Leu Ala Leu Asp Tyr Pro Asp Val Gly Lys Leu Ala Cys 115 120 125 Tyr
Val Ser Asp Asp Gly Cys Ser Pro Val Thr Cys Tyr Ala Leu Arg 130 135
140 Glu Ala Ala Lys Phe Ala Gly Leu Trp Val Pro Phe Cys Lys Arg His
145 150 155 160 Asp Val Ala Val Arg Ala Pro Phe Met Tyr Phe Ser Ser
Thr Pro Glu 165 170 175 Val Gly Thr Gly Thr Ala Asp His Glu Phe Leu
Glu Ser Trp Ala Leu 180 185 190 Met Lys Ser Glu Tyr Glu Arg Leu Ala
Ser Arg Ile Glu Asn Ala Asp 195 200 205 Glu Gly Ser Ile Met Arg Asp
Ser Gly Asp Glu Phe Ala Glu Phe Ile 210 215 220 Asp Ala Glu Arg Gly
Asn His Pro Thr Ile Val Lys Val Leu Trp Asp 225 230 235 240 Asn Ser
Lys Ser Lys Val Gly Glu Gly Phe Pro His Leu Val Tyr Leu 245 250 255
Ser Arg Glu Lys Ser Pro Arg His Arg His Asn Phe Lys Ala Gly Ala 260
265 270 Met Asn Val Leu Thr Arg Val Ser Ala Val Met Thr Asn Ala Pro
Ile 275 280 285 Met Leu Asn Val Asp Cys Asp Met Phe Ala Asn Asn Pro
Gln Val Ala 290 295 300 Leu His Ala Met Cys Leu Leu Leu Gly Phe Asp
Asp Glu Ile His Ser 305 310 315 320 Gly Phe Val Gln Val Pro Gln Lys
Phe Tyr Gly Gly Leu Lys Asp Asp 325 330 335 Pro Phe Gly Asn Gln Met
Gln Val Ile Thr Lys Lys Ile Gly Gly Gly 340 345 350 Ile Ala Gly Ile
Gln Gly Met Phe Tyr Gly Gly Thr Gly Cys Phe His 355 360 365 Arg Arg
Lys Val Ile Tyr Gly Met Pro Pro Pro Asp Thr Val Lys His 370 375 380
Glu Thr Arg Gly Ser Pro Ser Tyr Lys Glu Leu Gln Val Arg Phe Gly 385
390 395 400 Ser Ser Lys Val Leu Ile Glu Ser Ser Arg Asn Ile Ile Ser
Gly Asp 405 410 415 Leu Leu Ala Arg Pro Thr Val Asp Val Ser Ser Arg
Ile Glu Met Ala 420 425 430 Lys Gln Val Gly Asp Cys Asn Tyr Glu Ala
Gly Thr Cys Trp Gly Lys 435 440 445 Glu Ile Gly Trp Val Tyr Gly Ser
Met Thr Glu Asp Ile Leu Thr Gly 450 455 460 Gln Arg Ile His Ala Ala
Gly Trp Lys Ser Ala Leu Leu Asp Thr Asn 465 470 475 480 Pro Pro Ala
Phe Leu Gly Cys Ala Pro Thr Gly Gly Pro Ala Ser Leu 485 490 495 Thr
Gln Phe Lys Arg Trp Ala Thr Gly Val Leu Glu Ile Leu Ile Ser 500 505
510 Arg Asn Ser Pro Ile Leu Gly Thr Ile Phe Gln Arg Leu Gln Leu Arg
515 520 525 Gln Cys Leu Gly Tyr Leu Ile Val Glu Ala Trp Pro Val Arg
Ala Pro 530 535 540 Phe Glu Leu Cys Tyr Ala Leu Leu Gly Pro Phe Cys
Leu Leu Thr Asn 545 550 555 560 Gln Ser Phe Leu Pro Thr Ala Ser Asp
Glu Gly Phe Arg Ile Pro Val 565 570 575 Ala Leu Phe Leu Ser Tyr His
Ile Tyr His Leu Met Glu Tyr Lys Glu 580 585 590 Cys Gly Leu Ser Ala
Arg Ala Trp Trp Asn Asn His Arg Met Gln Arg 595 600 605 Ile Thr Ser
Ala Ser Ala Trp Leu Leu Ala Phe Leu Thr Val Ile Leu 610 615 620 Lys
Thr Leu Gly Leu Ser Glu Thr Val Phe Glu Val Thr Arg Lys Glu 625 630
635 640 Ser Ser Thr Ser Asp Gly Gly Ala Gly Thr Asp Glu Ala Asp Pro
Gly 645 650 655 Leu Phe Thr Phe Asp Ser Ala Pro Val Phe Ile Pro Val
Thr Ala Leu 660 665 670 Ser Val Leu Asn Ile Val Ala Leu Ala Val Gly
Ala Trp Arg Ala Val 675 680 685 Ile Gly Thr Ala Ala Val Val His Gly
Gly Pro Gly Ile Gly Glu Phe 690 695 700 Val Cys Cys Gly Trp Met Val
Leu Cys Phe Trp Pro Phe Val Arg Gly 705 710 715 720 Leu Val Ser Arg
Gly Lys His Gly Ile Pro Trp Ser Val Lys Val Lys 725 730 735 Ala Gly
Leu Ile Val Ala Ala Phe Val His Leu Cys Thr Arg Asn 740 745 750
713203DNAHordeum vulgare cv. Himalaya 71gagctgtgtt cgtggagctt
agctagtctg ctactgctac tgctggctag tggctacctg 60ctctcggcca cggccatggc
gggcggcaag aagctgcagg agagggtcgc cctggcgaga 120accgcgtgga
tgctggccga cttcgcgatc ctcttcctcc tcctcgccat cgtggcccgc
180cgcgccgcct cgctccggga gcgcggcggg acgtggttgg cggcgctcgt
ctgcgaggcg 240tggttcgcct tcgtgtggat cctcaacatg aacggcaagt
ggagccccgt ccggttcgac 300acctaccccg acaacctcgc caacaggtac
tctacgtacg tacccacggc gacaagaccc 360accatgctga cccctacaac
ttcctcaaat tttgatctag ctagtgtctg tgataatttt 420gctaggatgg
aggagctccc ggcggtggac atgttcgtca cgaccgcgga cccggcgctg
480gagcctccgt tgatcacggt gaacacggtg ctctcgctgc tcgccctgga
ctacccggac 540gtcggcaagc tggcgtgcta cgtctctgac gacggctgct
ccccggtgac gtgctacgcg 600ctgcgtgagg ccgccaagtt cgccggcctc
tgggtccctt tctgcaagag gcacgacgtt 660gctgtgaggg ccccattcat
gtacttctct tccacgccgg aggttggcac aggcacagcc 720gaccacgagt
tcctggaaag ctgggcgctc atgaaggtta ggcgccaatg gtgaccatgt
780cagtttacaa aataatgttt ggtcgtccat catcgccatg gccattcatc
ttcctcgtgt 840acgtgtgact ttcagagcga atatgagaga ctagccagcc
gaatcgagaa cgccgatgag 900ggctccatta tgcgtgacag cggcgacgag
ttcgccgagt tcatcgacgc cgagcgcggg 960aaccatccta ccatcgttaa
ggtcgccgca ctgaccatgt ccatgcatgt gtccatgaac 1020atcgtgtcat
gacaaacgca tagcaaatcc gtgtctcgtg ctaatatcgt cacggttaat
1080ttgggccgag ttcaggttct gtgggataac agcaagagca aagtggggga
aggattccca 1140catctggtgt acctctctcg agagaaaagc cccagacatc
gccacaactt caaggctggt 1200gccatgaatg ttctggtgag cactctcttt
cgctcaacac agtgttgcac tgctaatcag 1260tgtcacacaa gcagcacacc
acattttata ctaattaagc tgatcatttc gtggtgcaga 1320caagggtgtc
agccgtgatg accaacgctc ccatcatgct gaatgtggac tgcgacatgt
1380tcgccaacaa tccgcaggtc gccctacacg cgatgtgcct cctattgggg
ttcgacgacg 1440agatccacag cgggttcgtc caagtgccac agaagttcta
cggtggcctc aaggacgatc 1500cctttggcaa ccagatgcag gttataacca
aggtactaca tatgcatgtg cacaagtgct 1560cttgtcgtcg tgctgtgcac
cactaggtag tgttacagtt gtactggttt ttgtggcatg 1620ttcagaaaat
tggaggtgga atcgccggga tccaaggcat gttctacggc ggcacgggct
1680gttttcaccg caggaaagtc atttacggca tgccgccacc tgacaccgtc
aaacacgaga 1740caagaggtga aactgggcac acaacagatg tgatcatcag
gcgtaaattg gagtatgcat 1800ttcagttcga ctagggcatt tcaaatggct
aagtgttctt aatttgccag gttcaccatc 1860ttacaaggag ctgcaagtca
ggtttgggag ctcaaaggtg ttgatcgaat catctaggaa 1920catcatctca
ggagacctgc tcgctagacc aaccgttgat gtatcgagtc gcatcgaaat
1980ggcaaaacaa gtcggcgatt gcaactatga ggctggcacg tgttggggca
aggaggtatg 2040cttagctacc tgttgccgta tttttgcagg tttcgctaca
gtacatctac aatcttttgc 2100agtttttctc tagttacagt ttcttccatg
tatttttgca gattggttgg gtctatggat 2160caatgacaga agacattttg
accggacaac ggatccatgc ggcgggttgg aaatcggcct 2220tgttggacac
caacccaccg gcattcttgg gatgtgctcc gaccggggga ccggccagct
2280tgacccagtt caagagatgg gcaacagggg ttctggagat actcatcagc
cggaacagcc 2340ctatcctcgg caccatcttc caacgcctcc aactccggca
atgccttggc tatctcatcg 2400tcgaggcgtg gcccgtgagg gcgcctttcg
agctgtgcta tgcactattg ggacctttct 2460gccttctcac aaaccagtcc
ttcttgccaa cggtacatac actttcgcgg ttcgccaaga 2520tacattatgc
agctaaacaa aaatgctgtg tgatttgttt gataatgaag caggacctag
2580ttggctaata tgtatgtaaa ttcagatatt ttttttatga ttggtacatt
tgttgttttg 2640caggcatcgg atgaaggttt tcgcatccca gtagctctat
tcttgagtta ccacatatac 2700cacttgatgg agtacaagga gtgcgggctc
tctgcccgcg cctggtggaa caaccacagg 2760atgcaacgca tcacctcggc
ctccgcctgg ctcctcgcct tcctcaccgt gatcctcaag 2820acactagggc
tctctgagac cgtgttcgag gtcacccgca aggaaagcag cacgtccgat
2880ggcggcgccg gcaccgacga ggccgatcca ggactgttca cattcgactc
ggcgcccgtt 2940ttcatcccgg tgacggcgct ctcagtgttg aacattgtgg
ccctcgccgt cggggcatgg 3000cgcgccgtca tcgggactgc ggcggtcgtt
catggtggcc cgggcatcgg agagttcgtg 3060tgctgtggct ggatggtgtt
gtgcttctgg ccgttcgtga gagggcttgt cagcagggga 3120aagcatggaa
tcccgtggag cgtcaaggtg aaggctggtt tgattgtggc tgcgttcgtg
3180cacctctgca caaggaacta acc 3203722284DNATriticum aestivum
72ctgctctcgg ccgcggccat ggcgggcggc aagaagctgc acgagagggt cgccctgggg
60agaactgcgt ggatgctggc cgacttcgtg atcctcctcc tcctcctcgc cctcgtggcc
120cgccgcgccg cgtcgctcgg ggagcgcggc gggacgtggc tggcggcgct
cgtctgcgag 180gcgtggttcg ccttcgtctg gatcctcaac atgaacggca
agtggagccc cgtccggttc 240gacacctacc ccgagaacct ctcccacagg
ctggaggagc tcccggcggt ggacatgttc 300gtcacgacgg cggacccggc
gctggagccg ccgttgatca cggtgaacac ggtgctctcg 360ctgctcgccc
tggactaccc ggacgtcggc aagctggcgt gctacgtctc cgacgacggc
420tgctccccgg tgacgtgcta cgcgctgcgc gaggccgcca agttcgccag
cctctggatt 480cccttctgca agaggtatga cgttggtgtg agggcccctt
tcatgtactt ctcttccgcg 540ccggaggttg gcaccggtac agccgaccac
gagttcctgg aaagctgggc actcatgaag 600accgaatatg agaagctggc
cagccggatc gagaacgccg acgaggtctc cattctgcgt 660gacggcggcg
aagagttcgc cgagttcatc gacgccgagc gcgggaacca tcctaccatc
720gttaaggttc tctgggataa cagcaagagc aaagcagggg aaggattccc
acatctggtg 780tacctctctc gagagaaaag ccccagacat cgccacaact
tcaaggccgg tgccatgaat 840gttctgacaa gggtgtcggc cgtgatgacc
aacgctccaa tcatgctgaa tgtggactgc 900gacatgttcg ccaacaaccc
gcaggtcgcc ctgcacgcga tgtgcctcct gttggggttc 960gacgacgaga
tccacagcgg gttcgtccag gcgccacaga agttctacgg tggcctcaag
1020gatgacccct ttggcaacca gatgcaggtt ataaccaaga aaattggagg
tgggctcgcc 1080gggatccaag gcaccttcta cggcggcacg ggctgttttc
accgcaggaa ggtcatctac 1140ggcatgccgc ctccggacac cgtcaagcac
gagacaagag gttcaccatc ttacaaggag 1200ctgcaagcca agtttgggag
ctcaaaggag ttgatcgaat catctaggaa catcatctca 1260ggggacctgc
tcgctagacc aaccgtagat atatcgagtc gtgtcgaaat ggcaaaacaa
1320gtaggcgact gcaactatga ggctggcaca tgttggggcc aagagattgg
gtgggtctat 1380ggatcaatga cagaggacat tttgaccggt caacggatcc
aggcggcggg ttgggaatcg 1440gccttgttgg acaccgaccc accggcattc
ctgggatgtg ctccgaccgg tggaccagcc 1500agcttgaccc agttcaagag
atgggcaaca gggcttctgg agatactcat cagccggaac 1560agccccatcc
tcggcaccat cttcaagggc ctccaactcc ggcaatgcct tggctatctc
1620atcgtagacg cgtggcccgt gagggcgcct ttcgagctgt gctatgcgct
cttgggacct 1680ttctgccttc tcacaaacca atccttctta ccaacggcat
cagatgaagg ttttcacatc 1740ccagcggctc tatttttgac ttacaacata
taccacctga tggagtacaa ggagtgcggg 1800ctctcggtcc gcgcctggtg
gaacaaccat aggatgcaac gcatcacctc ggcctccgcc 1860tggctcctcg
ccttcctcac cgtcatcctc aagacgctag ggctctccga gaccgtgttc
1920gaggtcaccc gcaaggagag cagcacgtca tccgatggcg gcgcgggcac
cgacgatgcc 1980gatcctgggt tgttcacctt tgactcggcg cccgttttca
tcccagtgac ggcgctctca 2040gtgttgaaca ttgtcgccct caccgtcgcg
gcatggcgcg ccgtcgtcgg gacggtggcg 2100ggcgttcatg gtggcccggg
cgtcggagag ttcgtgtgct gtggctggat ggtgttgtgc 2160ttctggccat
tcgtgagagg gcttgtcagt agtggaaagt atgggatccc gtggagtgtc
2220agggtgaagg ctgggttgat tgtggctgcg ttcgtgcacc tctgcacaag
gaactaaccg 2280gccg 2284732284DNATriticum aestivum 73ctgctctcgg
ccacggccat ggcgggcggc aagaagctgc aggagagggt cgccctgggc 60aggagtgcgt
ggatgctggc cgacttcgtg atcctcttcc tcctcctcgc cctcgtggcc
120cgccgcgccg cgtcgctcgg ggagcgcggc gggacgtggc tggcagcgct
cgtctgcgag 180gcgtggttcg ccttcgtgtg gatcctcaac atgaacggca
agtggagccc cgtccggttc 240gacacctacc ccgacaacct ctcccacagg
atggaggagc tcccagcggt ggacatgttc 300gtcacgacgg cggacccggc
gctggagccg ccgttgatca cggtgaacac ggtgctctcg 360ctgctcgccc
tggactaccc gcacgtcggc aagctggcgt gctacgtctc cgacgacggc
420tgctccccct tgacgtgcta cggtctgcac gaggccgcca agttcgccag
cctctgggtt 480cccttctgca agaggcacga cgttggtgtg agggcccctt
tcatgtactt ctcttccgcg 540ccggaggttg acaccggtac agtcgaccac
gagttcctgg aaagctgggc actcatgaag 600agcgaatatg agaagctggc
cagccggatc gagaacgccg acgaggtctc cattctgcgt 660gacggcggcg
acgagttcgc cgagttcatc gacgccgagc gcgggaacca tcctaccatc
720gttaaggttc tctgggataa cagcaagaac aaaacaggtg aaggattccc
acatctggtg 780tacctctcga gagagaaaag ccccagacat cgtcacaact
ttaaggccgg tgccatgaat 840gttctgacaa gggtgtcggc cgtgatgacc
aacgctccga tcatgctgaa tgtggactgc 900gacatgtttg ccaacaaccc
gcaggtcgcc ctacacgcga tgtgcctcct gttggggttc 960gacgacgaga
tccacagcgg gttcgtccag gcgccacaga agttctacgg tggcctcaag
1020gatgacccct ttggcaacca gatgcaggtt ataaccaaga aaattggagg
tgggctcgcc 1080gggatccaag gcacgttcta cggcggcacg ggctgttttc
accgcaggaa ggtcatttac 1140ggcatgccgc ctccggacac cgtcaagcac
gagacaagag gttcaccatc ttacaaggag 1200ctgcaagcca agtttgggag
ctcaaaggag ttgatcgaat catctaggaa catcatctca 1260ggagacctgc
tcgctagacc aaccgtagat atatcaagtc gggtcgaaat ggcaaaacaa
1320gtaggcgact gcaactatga ggctggcaca tattggggcc aagagattgg
gtgggtctat 1380ggatcaatga cagaggacat tttgaccggg caacggatcc
aagcggcggg ttggaaatcg 1440gccttgttgg acaccgaccc accggcattc
ttgggatgtg ctccgacagg ggggccggct 1500agcttgaccc agttcaagag
atgggcaaca gggcttctgg agatactcat cagccggaac 1560agccccatcc
tcggcaccat cttcaggcgc ctccaactcc ggcaatgcct tgcctatctc
1620atcgtcaacg cgtggcccat gagggcacct ttcgagatgt gttacgcgct
attgggacct 1680ttctgccttc tcacaaacca gtccttcttg ccaacgacat
ctaatgaagg ttttcgcatc 1740ccagcggctc tattcttgag ttaccacgta
taccacctga tggagtacaa ggagtgcggg 1800ctctcggtcc gcgcctggtg
gaacaaccac aggatgcaac gcatcacctc ggcctccgcc 1860tggctcctcg
ccttcctcac cgtcatcctc aagacgctag ggctctccga gaccgtgttc
1920gaggtcaccc gcaaggagag cagcacgtcc tccgatggtg gcgcgggcac
cgacgaggcc 1980gatactgggc tgttcacctt cgactcggcg cccgttttca
tcccggtgac ggcgctctca 2040atgctgaaca ttgtcgccct cgccgtcgcg
gcatggcgcg ccgttgtcgg gacggcggcg 2100ggcgttcatg gtggcccggg
agtcggagag ttcgtgtgct gtggctggat ggtgctgtgc 2160ttctggccgt
tcatgagagg gcttgtcagc agtggaaagt atgggatccc gtggagtgtc
2220agggtgaagg ctgggttgat tgtggctgcg ttcgtgcacc tctgcacaag
gaactaaccg 2280gcgg 2284742363DNATriticum aestivum 74ggaaatgcac
cgagcagagg ttagtttatc cggtctttat aaatgcactc tgtggtgttg 60tgctagctag
ctagtctgct acctctcggc cgcggccatg gcgggcggca agaagctgca
120ggagagggtc gccctgggga gaactgcgtg gatgctggcc gacttcgtga
tcctcctcct 180cctcctcgcc ctcgtggccc gccgcgccgc gtcgctcggg
gagcgcggcg ggacgtggct 240ggcggcgctc gtctgcgagg cgtggttcgc
cttcgtctgg atcctcaaca tgaacggcaa 300gtggagcccc gtccggttcg
acacctaccc cgacaacctc tcccacagga tggaggagct 360cccggcggtg
gacatgttcg tcacgacggc agacccggcg ctggagccgc cgttgatcac
420ggtgaacacg gtgctctcgc tgctcgccct ggactacccg gacgtcggca
ggctggcgtg 480ctacgtctcc gacgacggct gctcccccgt gacgtgctac
gcgctgcgcg aggccgccaa 540gttcgccggc ctctgggttc ccttttgcaa
gaggcacgac gttggtgtga gggccccttt 600catgtacttc tcttccgcgc
cggaggttgg caacggaaca gtcgaccacg agttcctgga 660aagctgggca
ctcatgaaga gccaatatga gaagctggcc cgccggatcg agaacgccga
720cgagggcaca attatgcgtg acggcggcga cgagttcgcc gagttcatcg
acgccgagcg 780cgggaaccat cctaccatcg ttaaggttct ctgggacaac
agcaagagca aagcagggga 840agaattccca catctggtgt acctctctcg
agagaaaagc cccagacatc gtcacaactt 900caaggccggt gccatgaatg
ttctgacaag ggtgtcggcc gtgatgacca acgctccgat 960catgctgaat
gtggactgcg acatgttcgc caacaacccg caggtcgccc tacacgcgat
1020gtgcctcctg ttggggttcg acgacgagat ccacagcggg ttcgtccagg
cgccacagaa 1080gttctacggc ggcctcaagg atgacccctt tggcaaccag
atgcaggtta taaccaagaa 1140aatcggaggt gggctcgccg ggatccaagg
catgttctac ggcgggacag gctgttttca 1200caggaggaaa gtcatttacg
gcgtgccgcc accagacacc gtcaaacacg agatgaaagg 1260ttcaccatct
tacaaggagc tgcaggccaa gtttgggagc tcaaaggagt tgatcgaatc
1320atctaggaac atcatctcag gagacctgct cgctagacca accgtagatt
tatcgagtcg 1380cgtcgaaatg gcaaaacaag taggcgactg caactatgag
gctggcacat gttggggcca 1440ggagattggc tgggtctatg gatcaatgac
agaggacatc ttgaccgggc tgcggatcca 1500tgcggcgggt tgggaatcgg
ccttattgga caccgagcca ccggcattcc tgggatgtgc 1560tccgaccggt
ggaccggcca gcttgaccca gttcaagaga tgggcaacag ggcttctgga
1620gatactcatc agccagaaca gcccgatcct cggcaccatc ttccgacgcc
tccaactccg 1680gcaatgcctt gcctatctca tcgtagaagc gtggcccgtg
cgggcgcctt tcgagctgtg 1740ctatgcgcta ctgggacctt tctgccttct
cacaaaccag tccttcttgc caacggcatc 1800ggatgaaggt ttccgcatcc
cagcggctct attcttgacc tgccacatat accacctgat 1860ggagtacaag
gagtgcgggc tctcggtccg
cgcctggtgg aacaaccaca ggatgcaacg 1920catcacctcg gcctccgcct
ggctcctcgc cttcctcacc gtcattctca agacgctagg 1980gctctccgag
accgtgttcg aggtcacccg caaggaaagc agcacgtcct ccgatggcgg
2040cgcgggcacc gacgaggccg atcctgggct cttcaccttc gactcggcgc
ccgttttcat 2100cccggtgacg gtgctctcaa tgctgaacat tgtcgccctc
gccgtcgcgg catggcgtgc 2160tgttgtcggg gcggcggcgg gcgttcatgg
tggcccgggc atcggggagt tcgtgtgctg 2220tggctggatc gtgctgtgct
tctggccgtt cgtgagaggg cttgtcagca ggggaaagta 2280tggaatcccg
tggagtgtca gggtgaaggc tggtttgatt gtggctgcgt tcgtgcacat
2340ctgcacaagg aactaaccgg cgg 236375752PRTTriticum aestivum 75Met
Ala Gly Gly Lys Lys Leu His Glu Arg Val Ala Leu Gly Arg Thr 1 5 10
15 Ala Trp Met Leu Ala Asp Phe Val Ile Leu Leu Leu Leu Leu Ala Leu
20 25 30 Val Ala Arg Arg Ala Ala Ser Leu Gly Glu Arg Gly Gly Thr
Trp Leu 35 40 45 Ala Ala Leu Val Cys Glu Ala Trp Phe Ala Phe Val
Trp Ile Leu Asn 50 55 60 Met Asn Gly Lys Trp Ser Pro Val Arg Phe
Asp Thr Tyr Pro Glu Asn 65 70 75 80 Leu Ser His Arg Leu Glu Glu Leu
Pro Ala Val Asp Met Phe Val Thr 85 90 95 Thr Ala Asp Pro Ala Leu
Glu Pro Pro Leu Ile Thr Val Asn Thr Val 100 105 110 Leu Ser Leu Leu
Ala Leu Asp Tyr Pro Asp Val Gly Lys Leu Ala Cys 115 120 125 Tyr Val
Ser Asp Asp Gly Cys Ser Pro Val Thr Cys Tyr Ala Leu Arg 130 135 140
Glu Ala Ala Lys Phe Ala Ser Leu Trp Ile Pro Phe Cys Lys Arg Tyr 145
150 155 160 Asp Val Gly Val Arg Ala Pro Phe Met Tyr Phe Ser Ser Ala
Pro Glu 165 170 175 Val Gly Thr Gly Thr Ala Asp His Glu Phe Leu Glu
Ser Trp Ala Leu 180 185 190 Met Lys Thr Glu Tyr Glu Lys Leu Ala Ser
Arg Ile Glu Asn Ala Asp 195 200 205 Glu Val Ser Ile Leu Arg Asp Gly
Gly Glu Glu Phe Ala Glu Phe Ile 210 215 220 Asp Ala Glu Arg Gly Asn
His Pro Thr Ile Val Lys Val Leu Trp Asp 225 230 235 240 Asn Ser Lys
Ser Lys Ala Gly Glu Gly Phe Pro His Leu Val Tyr Leu 245 250 255 Ser
Arg Glu Lys Ser Pro Arg His Arg His Asn Phe Lys Ala Gly Ala 260 265
270 Met Asn Val Leu Thr Arg Val Ser Ala Val Met Thr Asn Ala Pro Ile
275 280 285 Met Leu Asn Val Asp Cys Asp Met Phe Ala Asn Asn Pro Gln
Val Ala 290 295 300 Leu His Ala Met Cys Leu Leu Leu Gly Phe Asp Asp
Glu Ile His Ser 305 310 315 320 Gly Phe Val Gln Ala Pro Gln Lys Phe
Tyr Gly Gly Leu Lys Asp Asp 325 330 335 Pro Phe Gly Asn Gln Met Gln
Val Ile Thr Lys Lys Ile Gly Gly Gly 340 345 350 Leu Ala Gly Ile Gln
Gly Thr Phe Tyr Gly Gly Thr Gly Cys Phe His 355 360 365 Arg Arg Lys
Val Ile Tyr Gly Met Pro Pro Pro Asp Thr Val Lys His 370 375 380 Glu
Thr Arg Gly Ser Pro Ser Tyr Lys Glu Leu Gln Ala Lys Phe Gly 385 390
395 400 Ser Ser Lys Glu Leu Ile Glu Ser Ser Arg Asn Ile Ile Ser Gly
Asp 405 410 415 Leu Leu Ala Arg Pro Thr Val Asp Ile Ser Ser Arg Val
Glu Met Ala 420 425 430 Lys Gln Val Gly Asp Cys Asn Tyr Glu Ala Gly
Thr Cys Trp Gly Gln 435 440 445 Glu Ile Gly Trp Val Tyr Gly Ser Met
Thr Glu Asp Ile Leu Thr Gly 450 455 460 Gln Arg Ile Gln Ala Ala Gly
Trp Glu Ser Ala Leu Leu Asp Thr Asp 465 470 475 480 Pro Pro Ala Phe
Leu Gly Cys Ala Pro Thr Gly Gly Pro Ala Ser Leu 485 490 495 Thr Gln
Phe Lys Arg Trp Ala Thr Gly Leu Leu Glu Ile Leu Ile Ser 500 505 510
Arg Asn Ser Pro Ile Leu Gly Thr Ile Phe Lys Gly Leu Gln Leu Arg 515
520 525 Gln Cys Leu Gly Tyr Leu Ile Val Asp Ala Trp Pro Val Arg Ala
Pro 530 535 540 Phe Glu Leu Cys Tyr Ala Leu Leu Gly Pro Phe Cys Leu
Leu Thr Asn 545 550 555 560 Gln Ser Phe Leu Pro Thr Ala Ser Asp Glu
Gly Phe His Ile Pro Ala 565 570 575 Ala Leu Phe Leu Thr Tyr Asn Ile
Tyr His Leu Met Glu Tyr Lys Glu 580 585 590 Cys Gly Leu Ser Val Arg
Ala Trp Trp Asn Asn His Arg Met Gln Arg 595 600 605 Ile Thr Ser Ala
Ser Ala Trp Leu Leu Ala Phe Leu Thr Val Ile Leu 610 615 620 Lys Thr
Leu Gly Leu Ser Glu Thr Val Phe Glu Val Thr Arg Lys Glu 625 630 635
640 Ser Ser Thr Ser Ser Asp Gly Gly Ala Gly Thr Asp Asp Ala Asp Pro
645 650 655 Gly Leu Phe Thr Phe Asp Ser Ala Pro Val Phe Ile Pro Val
Thr Ala 660 665 670 Leu Ser Val Leu Asn Ile Val Ala Leu Thr Val Ala
Ala Trp Arg Ala 675 680 685 Val Val Gly Thr Val Ala Gly Val His Gly
Gly Pro Gly Val Gly Glu 690 695 700 Phe Val Cys Cys Gly Trp Met Val
Leu Cys Phe Trp Pro Phe Val Arg 705 710 715 720 Gly Leu Val Ser Ser
Gly Lys Tyr Gly Ile Pro Trp Ser Val Arg Val 725 730 735 Lys Ala Gly
Leu Ile Val Ala Ala Phe Val His Leu Cys Thr Arg Asn 740 745 750
76752PRTTriticum aestivum 76Met Ala Gly Gly Lys Lys Leu Gln Glu Arg
Val Ala Leu Gly Arg Ser 1 5 10 15 Ala Trp Met Leu Ala Asp Phe Val
Ile Leu Phe Leu Leu Leu Ala Leu 20 25 30 Val Ala Arg Arg Ala Ala
Ser Leu Gly Glu Arg Gly Gly Thr Trp Leu 35 40 45 Ala Ala Leu Val
Cys Glu Ala Trp Phe Ala Phe Val Trp Ile Leu Asn 50 55 60 Met Asn
Gly Lys Trp Ser Pro Val Arg Phe Asp Thr Tyr Pro Asp Asn 65 70 75 80
Leu Ser His Arg Met Glu Glu Leu Pro Ala Val Asp Met Phe Val Thr 85
90 95 Thr Ala Asp Pro Ala Leu Glu Pro Pro Leu Ile Thr Val Asn Thr
Val 100 105 110 Leu Ser Leu Leu Ala Leu Asp Tyr Pro His Val Gly Lys
Leu Ala Cys 115 120 125 Tyr Val Ser Asp Asp Gly Cys Ser Pro Leu Thr
Cys Tyr Gly Leu His 130 135 140 Glu Ala Ala Lys Phe Ala Ser Leu Trp
Val Pro Phe Cys Lys Arg His 145 150 155 160 Asp Val Gly Val Arg Ala
Pro Phe Met Tyr Phe Ser Ser Ala Pro Glu 165 170 175 Val Asp Thr Gly
Thr Val Asp His Glu Phe Leu Glu Ser Trp Ala Leu 180 185 190 Met Lys
Ser Glu Tyr Glu Lys Leu Ala Ser Arg Ile Glu Asn Ala Asp 195 200 205
Glu Val Ser Ile Leu Arg Asp Gly Gly Asp Glu Phe Ala Glu Phe Ile 210
215 220 Asp Ala Glu Arg Gly Asn His Pro Thr Ile Val Lys Val Leu Trp
Asp 225 230 235 240 Asn Ser Lys Asn Lys Thr Gly Glu Gly Phe Pro His
Leu Val Tyr Leu 245 250 255 Ser Arg Glu Lys Ser Pro Arg His Arg His
Asn Phe Lys Ala Gly Ala 260 265 270 Met Asn Val Leu Thr Arg Val Ser
Ala Val Met Thr Asn Ala Pro Ile 275 280 285 Met Leu Asn Val Asp Cys
Asp Met Phe Ala Asn Asn Pro Gln Val Ala 290 295 300 Leu His Ala Met
Cys Leu Leu Leu Gly Phe Asp Asp Glu Ile His Ser 305 310 315 320 Gly
Phe Val Gln Ala Pro Gln Lys Phe Tyr Gly Gly Leu Lys Asp Asp 325 330
335 Pro Phe Gly Asn Gln Met Gln Val Ile Thr Lys Lys Ile Gly Gly Gly
340 345 350 Leu Ala Gly Ile Gln Gly Thr Phe Tyr Gly Gly Thr Gly Cys
Phe His 355 360 365 Arg Arg Lys Val Ile Tyr Gly Met Pro Pro Pro Asp
Thr Val Lys His 370 375 380 Glu Thr Arg Gly Ser Pro Ser Tyr Lys Glu
Leu Gln Ala Lys Phe Gly 385 390 395 400 Ser Ser Lys Glu Leu Ile Glu
Ser Ser Arg Asn Ile Ile Ser Gly Asp 405 410 415 Leu Leu Ala Arg Pro
Thr Val Asp Ile Ser Ser Arg Val Glu Met Ala 420 425 430 Lys Gln Val
Gly Asp Cys Asn Tyr Glu Ala Gly Thr Tyr Trp Gly Gln 435 440 445 Glu
Ile Gly Trp Val Tyr Gly Ser Met Thr Glu Asp Ile Leu Thr Gly 450 455
460 Gln Arg Ile Gln Ala Ala Gly Trp Lys Ser Ala Leu Leu Asp Thr Asp
465 470 475 480 Pro Pro Ala Phe Leu Gly Cys Ala Pro Thr Gly Gly Pro
Ala Ser Leu 485 490 495 Thr Gln Phe Lys Arg Trp Ala Thr Gly Leu Leu
Glu Ile Leu Ile Ser 500 505 510 Arg Asn Ser Pro Ile Leu Gly Thr Ile
Phe Arg Arg Leu Gln Leu Arg 515 520 525 Gln Cys Leu Ala Tyr Leu Ile
Val Asn Ala Trp Pro Met Arg Ala Pro 530 535 540 Phe Glu Met Cys Tyr
Ala Leu Leu Gly Pro Phe Cys Leu Leu Thr Asn 545 550 555 560 Gln Ser
Phe Leu Pro Thr Thr Ser Asn Glu Gly Phe Arg Ile Pro Ala 565 570 575
Ala Leu Phe Leu Ser Tyr His Val Tyr His Leu Met Glu Tyr Lys Glu 580
585 590 Cys Gly Leu Ser Val Arg Ala Trp Trp Asn Asn His Arg Met Gln
Arg 595 600 605 Ile Thr Ser Ala Ser Ala Trp Leu Leu Ala Phe Leu Thr
Val Ile Leu 610 615 620 Lys Thr Leu Gly Leu Ser Glu Thr Val Phe Glu
Val Thr Arg Lys Glu 625 630 635 640 Ser Ser Thr Ser Ser Asp Gly Gly
Ala Gly Thr Asp Glu Ala Asp Thr 645 650 655 Gly Leu Phe Thr Phe Asp
Ser Ala Pro Val Phe Ile Pro Val Thr Ala 660 665 670 Leu Ser Met Leu
Asn Ile Val Ala Leu Ala Val Ala Ala Trp Arg Ala 675 680 685 Val Val
Gly Thr Ala Ala Gly Val His Gly Gly Pro Gly Val Gly Glu 690 695 700
Phe Val Cys Cys Gly Trp Met Val Leu Cys Phe Trp Pro Phe Met Arg 705
710 715 720 Gly Leu Val Ser Ser Gly Lys Tyr Gly Ile Pro Trp Ser Val
Arg Val 725 730 735 Lys Ala Gly Leu Ile Val Ala Ala Phe Val His Leu
Cys Thr Arg Asn 740 745 750 77752PRTTriticum aestivum 77Met Ala Gly
Gly Lys Lys Leu Gln Glu Arg Val Ala Leu Gly Arg Thr 1 5 10 15 Ala
Trp Met Leu Ala Asp Phe Val Ile Leu Leu Leu Leu Leu Ala Leu 20 25
30 Val Ala Arg Arg Ala Ala Ser Leu Gly Glu Arg Gly Gly Thr Trp Leu
35 40 45 Ala Ala Leu Val Cys Glu Ala Trp Phe Ala Phe Val Trp Ile
Leu Asn 50 55 60 Met Asn Gly Lys Trp Ser Pro Val Arg Phe Asp Thr
Tyr Pro Asp Asn 65 70 75 80 Leu Ser His Arg Met Glu Glu Leu Pro Ala
Val Asp Met Phe Val Thr 85 90 95 Thr Ala Asp Pro Ala Leu Glu Pro
Pro Leu Ile Thr Val Asn Thr Val 100 105 110 Leu Ser Leu Leu Ala Leu
Asp Tyr Pro Asp Val Gly Arg Leu Ala Cys 115 120 125 Tyr Val Ser Asp
Asp Gly Cys Ser Pro Val Thr Cys Tyr Ala Leu Arg 130 135 140 Glu Ala
Ala Lys Phe Ala Gly Leu Trp Val Pro Phe Cys Lys Arg His 145 150 155
160 Asp Val Gly Val Arg Ala Pro Phe Met Tyr Phe Ser Ser Ala Pro Glu
165 170 175 Val Gly Asn Gly Thr Val Asp His Glu Phe Leu Glu Ser Trp
Ala Leu 180 185 190 Met Lys Ser Gln Tyr Glu Lys Leu Ala Arg Arg Ile
Glu Asn Ala Asp 195 200 205 Glu Gly Thr Ile Met Arg Asp Gly Gly Asp
Glu Phe Ala Glu Phe Ile 210 215 220 Asp Ala Glu Arg Gly Asn His Pro
Thr Ile Val Lys Val Leu Trp Asp 225 230 235 240 Asn Ser Lys Ser Lys
Ala Gly Glu Glu Phe Pro His Leu Val Tyr Leu 245 250 255 Ser Arg Glu
Lys Ser Pro Arg His Arg His Asn Phe Lys Ala Gly Ala 260 265 270 Met
Asn Val Leu Thr Arg Val Ser Ala Val Met Thr Asn Ala Pro Ile 275 280
285 Met Leu Asn Val Asp Cys Asp Met Phe Ala Asn Asn Pro Gln Val Ala
290 295 300 Leu His Ala Met Cys Leu Leu Leu Gly Phe Asp Asp Glu Ile
His Ser 305 310 315 320 Gly Phe Val Gln Ala Pro Gln Lys Phe Tyr Gly
Gly Leu Lys Asp Asp 325 330 335 Pro Phe Gly Asn Gln Met Gln Val Ile
Thr Lys Lys Ile Gly Gly Gly 340 345 350 Leu Ala Gly Ile Gln Gly Met
Phe Tyr Gly Gly Thr Gly Cys Phe His 355 360 365 Arg Arg Lys Val Ile
Tyr Gly Val Pro Pro Pro Asp Thr Val Lys His 370 375 380 Glu Met Lys
Gly Ser Pro Ser Tyr Lys Glu Leu Gln Ala Lys Phe Gly 385 390 395 400
Ser Ser Lys Glu Leu Ile Glu Ser Ser Arg Asn Ile Ile Ser Gly Asp 405
410 415 Leu Leu Ala Arg Pro Thr Val Asp Leu Ser Ser Arg Val Glu Met
Ala 420 425 430 Lys Gln Val Gly Asp Cys Asn Tyr Glu Ala Gly Thr Cys
Trp Gly Gln 435 440 445 Glu Ile Gly Trp Val Tyr Gly Ser Met Thr Glu
Asp Ile Leu Thr Gly 450 455 460 Leu Arg Ile His Ala Ala Gly Trp Glu
Ser Ala Leu Leu Asp Thr Glu 465 470 475 480 Pro Pro Ala Phe Leu Gly
Cys Ala Pro Thr Gly Gly Pro Ala Ser Leu 485 490 495 Thr Gln Phe Lys
Arg Trp Ala Thr Gly Leu Leu Glu Ile Leu Ile Ser 500 505 510 Gln Asn
Ser Pro Ile Leu Gly Thr Ile Phe Arg Arg Leu Gln Leu Arg 515 520 525
Gln Cys Leu Ala Tyr Leu Ile Val Glu Ala Trp Pro Val Arg Ala Pro 530
535 540 Phe Glu Leu Cys Tyr Ala Leu Leu Gly Pro Phe Cys Leu Leu Thr
Asn 545 550 555 560 Gln Ser Phe Leu Pro Thr Ala Ser Asp Glu Gly Phe
Arg Ile Pro Ala 565 570 575 Ala Leu Phe Leu Thr Cys His Ile Tyr His
Leu Met Glu Tyr Lys Glu 580 585 590 Cys Gly Leu Ser Val Arg Ala Trp
Trp Asn Asn His Arg Met Gln Arg 595 600 605 Ile Thr Ser Ala Ser Ala
Trp Leu Leu Ala Phe Leu Thr Val Ile Leu 610 615 620 Lys Thr Leu Gly
Leu Ser Glu Thr Val Phe Glu Val Thr Arg Lys Glu 625 630 635 640 Ser
Ser Thr Ser Ser Asp Gly Gly Ala Gly Thr Asp Glu Ala Asp Pro 645 650
655 Gly Leu Phe Thr Phe Asp Ser Ala Pro Val Phe Ile Pro Val Thr Val
660 665 670 Leu Ser Met Leu Asn Ile Val Ala Leu Ala Val Ala Ala Trp
Arg Ala 675 680 685 Val Val Gly Ala Ala Ala Gly Val His Gly Gly Pro
Gly Ile Gly Glu 690 695 700 Phe Val Cys Cys Gly Trp Ile Val Leu Cys
Phe Trp Pro Phe Val Arg 705
710 715 720 Gly Leu Val Ser Arg Gly Lys Tyr Gly Ile Pro Trp Ser Val
Arg Val 725 730 735 Lys Ala Gly Leu Ile Val Ala Ala Phe Val His Ile
Cys Thr Arg Asn 740 745 750 783114DNATriticum aestivum 78ctgctctcgg
ccgcggccat ggcgggcggc aagaagctgc acgagagggt cgccctgggg 60agaactgcgt
ggatgctggc cgacttcgtg atcctcctcc tcctcctcgc cctcgtggcc
120cgccgcgccg cgtcgctcgg ggagcgcggc gggacgtggc tggcggcgct
cgtctgcgag 180gcgtggttcg ccttcgtctg gatcctcaac atgaacggca
agtggagccc cgtccggttc 240gacacctacc ccgagaacct ctcccacagg
tacgtacgtt cttgtgcaca ctaactgcaa 300aataatgttg acctacagct
tcgtgcagct tcttccttaa actgtgtcgt gtctgtgatg 360attttgctag
gctggaggag ctcccggcgg tggacatgtt cgtcacgacg gcggacccgg
420cgctggagcc gccgttgatc acggtgaaca cggtgctctc gctgctcgcc
ctggactacc 480cggacgtcgg caagctggcg tgctacgtct ccgacgacgg
ctgctccccg gtgacgtgct 540acgcgctgcg cgaggccgcc aagttcgcca
gcctctggat tcccttctgc aagaggtatg 600acgttggtgt gagggcccct
ttcatgtact tctcttccgc gccggaggtt ggcaccggta 660cagccgacca
cgagttcctg gaaagctggg cactcatgaa ggttaggcgc catggtgacc
720atttcagttt ccataatgtt tggtcgtcca tcgtcgccat gaccatgcat
cttcctcgtg 780tacgtgtgac tttcagaccg aatatgagaa gctggccagc
cggatcgaga acgccgacga 840ggtctccatt ctgcgtgacg gcggcgaaga
gttcgccgag ttcatcgacg ccgagcgcgg 900gaaccatcct accatcgtta
aggtcgccgc actgaccatg tccatgtaca tcgtgtcatg 960ccaaacgcgt
agcaaatccg tctcgtgcta atatcgtcac ggttaacctg tgtgagttca
1020ggttctctgg gataacagca agagcaaagc aggggaagga ttcccacatc
tggtgtacct 1080ctctcgagag aaaagcccca gacatcgcca caacttcaag
gccggtgcca tgaatgttct 1140ggtgagcact ctcttgtaca caacagtgtt
tcactggtaa tcagtgtgtc acacaaacag 1200cacaataagt ggcagttgaa
agttcagaca tgtgtacaat gcgcttgata atttgcaagc 1260aaataattaa
gctgagcgtt tcgtggtgca gacaagggtg tcggccgtga tgaccaacgc
1320tccaatcatg ctgaatgtgg actgcgacat gttcgccaac aacccgcagg
tcgccctgca 1380cgcgatgtgc ctcctgttgg ggttcgacga cgagatccac
agcgggttcg tccaggcgcc 1440acagaagttc tacggtggcc tcaaggatga
cccctttggc aaccagatgc aggttataac 1500caaggtacta catatgcatg
tgcacaagtg ctgttgtggt agtgcaccac tagggtagtg 1560ttacagttgc
actggttttt ctggcatgtt cagaaaattg gaggtgggct cgccgggatc
1620caaggcacct tctacggcgg cacgggctgt tttcaccgca ggaaggtcat
ctacggcatg 1680ccgcctccgg acaccgtcaa gcacgagaca agaggtaata
aaactgggca cgcacaagat 1740gagatcatcc gacgtaaatt gaagtatttg
gtcagtgcat ttcagttcga ctagggcata 1800tcaaatggct gttctgaatt
tgccaggttc accatcttac aaggagctgc aagccaagtt 1860tgggagctca
aaggagttga tcgaatcatc taggaacatc atctcagggg acctgctcgc
1920tagaccaacc gtagatatat cgagtcgtgt cgaaatggca aaacaagtag
gcgactgcaa 1980ctatgaggct ggcacatgtt ggggccaaga ggtgtgctta
gcttcgttgc cgtatttttg 2040caggttttgc tacagtacgg ccacatctac
acaccttctg cagtttctct ctattacagt 2100ttcttccatg tatttttgca
gattgggtgg gtctatggat caatgacaga ggacattttg 2160accggtcaac
ggatccaggc ggcgggttgg gaatcggcct tgttggacac cgacccaccg
2220gcattcctgg gatgtgctcc gaccggtgga ccagccagct tgacccagtt
caagagatgg 2280gcaacagggc ttctggagat actcatcagc cggaacagcc
ccatcctcgg caccatcttc 2340aagggcctcc aactccggca atgccttggc
tatctcatcg tagacgcgtg gcccgtgagg 2400gcgcctttcg agctgtgcta
tgcgctcttg ggacctttct gccttctcac aaaccaatcc 2460ttcttaccaa
cggtacacac atttttgcca tgacccatta ctacattgct catagctgaa
2520attttagtgc atttgccgtt ttgcaggcat cagatgaagg ttttcacatc
ccagcggctc 2580tatttttgac ttacaacata taccacctga tggagtacaa
ggagtgcggg ctctcggtcc 2640gcgcctggtg gaacaaccat aggatgcaac
gcatcacctc ggcctccgcc tggctcctcg 2700ccttcctcac cgtcatcctc
aagacgctag ggctctccga gaccgtgttc gaggtcaccc 2760gcaaggagag
cagcacgtca tccgatggcg gcgcgggcac cgacgatgcc gatcctgggt
2820tgttcacctt tgactcggcg cccgttttca tcccagtgac ggcgctctca
gtgttgaaca 2880ttgtcgccct caccgtcgcg gcatggcgcg ccgtcgtcgg
gacggtggcg ggcgttcatg 2940gtggcccggg cgtcggagag ttcgtgtgct
gtggctggat ggtgttgtgc ttctggccat 3000tcgtgagagg gcttgtcagt
agtggaaagt atgggatccc gtggagtgtc agggtgaagg 3060ctgggttgat
tgtggctgcg ttcgtgcacc tctgcacaag gaactaaccg gccg
3114793178DNATriticum aestivum 79ctgctctcgg ccacggccat ggcgggcggc
aagaagctgc aggagagggt cgccctgggc 60aggagcgcgt ggatgctggc cgacttcgtg
atcctcttcc tcgtcctcgc cctcgtggcc 120cgccgcgccg cgtcgctcgg
ggagcgcggc gggacgtggc tggcagcgct cgtctgcgag 180gcgtggttcg
ccttcgtgtg gatcctcaac atgaacggca agtggagccc cgtccggttc
240gacacctacc ccgagaacct ctcccacagg tacgtacgtt cttgtgcaca
ctaactgcaa 300aataatgttg acctacagct tcgtgcaact tcttccttaa
gctgtgtcgt gtctgtgatg 360attttgctag gatggaagag ctcccggcgg
tggacatgtt cgtcacgacg gcggacccgg 420cgctggagcc gccgttgatc
acggtgaaca cggtgctctc gctgctcgcc ctggactacc 480cgcacgtcgg
caagctggcg tgctacgtct ccgacgacgg ctgctccccc ttgacgtgct
540actctctgcg cgaggccgcc aagttcgcca gcctctgggt tcccttctgc
aagaggcacg 600acgttggtgt gagggcccct ttcatgtact tctcttccgc
gccggaggtt gacaccggta 660cagtcgacca cgagttcctg gaaagctggg
cactcatgaa ggtcagccga tgatgatgat 720gtcagtttcc ataatgtttg
gtcgtccatc atcgccatga ccatgcatct tccttgtgta 780cgtgtgactt
tcagagcgaa tatgagaagc tggccagccg gatcgagacg cgacgaggtc
840tcattctgcg tgacggcggc gacgagttcg ccgagttcat cgacgccgag
cgcgggaacc 900atcctaccat cgttaaggtc gctgcactga ccatatccac
gtgtccatgt acatcgtgtc 960gtgccaaacg catagcgaat ccgtctcgtg
ctaatatcgt cacggttaac ctgtctgagt 1020tcaggttctc tgggataaca
gcaagaacaa aacaggtgaa ggattcccac atctggtgta 1080cctctcgaga
gagaaaagcc ccagacatcg tcacaacttt aaggccggtg ccatgaatgt
1140tctggtgagc actctcttct actcaataca gtgttgcact actaatcagt
gtgtcacaca 1200aacagcaaaa agtggcagat aaaagctcag acggttgcac
gacacatttg atactaatta 1260agctgagcat ttcgtggtgc agacaagggt
gtcggccgtg atgaccaacg ctccgatcat 1320gctgaatgtg gactgcgaca
tgtttgccaa caacccgcag gtcgccctac acgcgatgtg 1380cctcctgttg
gggttcgacg acgagatcca cagcgggttc gtccaggcgc cacagaagtt
1440ctacggtggc ctcaaggatg acccctttgg caaccagatg caggttataa
ccaaggtact 1500acatatgcat gtgcacaagt gctgttgtgg tagtgcacca
ctagggtagt gttacagttg 1560cactggtttt tctggcatgt tcagaaaatt
ggaggtgggc tcgccgggat ccaaggcacg 1620ttctacggcg gcacgggctg
ttttcaccgc aggaaggtca tttacggcat gccgcctccg 1680gacaccgtca
agcacgagac aagaggtaat aaaactgggc acacaaaaga tgaggcatcc
1740ggcgtaaatt ggagtatttg gccagtgcat ttcagttcga ctagggcata
tcaaatggct 1800ttctgaattt gccaggttca ccatcttaca aggagctgca
agccaagttt gggagctcaa 1860aggagttgat cgaatcatct aggaacatca
tctcaggaga cctgctcgct agaccaaccg 1920tagatatatc aagtcgggtc
gaaatggcaa aacaagtagg cgactgcaac tatgaggctg 1980gcacatgttg
gggccaagag gtgtgcttag cttcgttgcc gtatttttgc aggttttgct
2040acagtacggc cacatctaca aaccttctgc agtttctctc tattacagtt
tcttccatct 2100atttttgcag attgggtggg tctatggatc aatgacagag
gacattttga ccgggcaacg 2160gatccaagcg gcgggttgga aatcggcctt
gttggacacc gacccaccgg cattcttggg 2220atgtgctccg acaggggggc
cggctagctt gacccagttc aagagatggg caacagggct 2280tctggagata
ctcatcagcc ggaacagccc catcctcggc accatcttca ggcgcctcca
2340actccggcaa tgccttgcct atctcatcgt caacgcgtgg cccatgaggg
cacctttcga 2400gatgtgttac gcgctattgg gacctttctg ccttctcaca
aaccagtcct tcttgccaac 2460ggtacacaca tttttgccat gaccctttac
tacattgctc atagctgaaa tttcagtaca 2520cgtggtgatg tggaaacaca
agtctatgca actaaacaaa aatgtttgtg taatttgttt 2580gataagattt
gtgcatttgc tgttttgcag acatctaatg aaggttttcg catcccagcg
2640gctctattct tgagttacca cgtataccac ctgatggagt acaaggagtg
cgggctctcg 2700gtccgcgcct ggtggaacaa ccacaggatg caacgcatca
cctcggcctc cgcctggctc 2760ctcgccttcc tcaccgtcat cctcaagacg
ctagggctct ccgagaccgt gttcgaggtc 2820acccgcaagg agagcagcac
gtcctccgat ggtggcgcgg gcaccgacga ggccgatact 2880gggctgttca
ccttcgactc ggcgcccgtt ttcatcccgg tgacggcgct ctcaatgctg
2940aacattgtcg ccctcgccgt cgcggcatgg cgcgccgttg tcgggacggc
ggcgggcgtt 3000catggtggcc cgggagtcgg agagttcgtg tgctgtggct
ggatggtgct gtgcttctgg 3060ccgttcatga gagggcttgt cagcagtgga
aagtatggga tcccgtggag tgtcagggtg 3120aaggctgggt tgattgtggc
tgcgttcgtg cacctctgca caaggaacta accggcgg 3178803261DNATriticum
aestivum 80ggaaatgcac cgagcagagg ttagtttatc cggtctttat aaatgcactc
tgtggtgttg 60tgctagctag ctagtctgct acctctcggc cgcggccatg gcgggcggca
agaagctgca 120ggagagggtc gccctgggga gaactgcgtg gatgctggcc
gacttcgtga tcctcctcct 180cctcctcgcc ctcgtggccc gccgcgccgc
gtcgctcggg gagcgcggcg ggacgtggct 240ggcggcgctc gtctgcgagg
cgtggttcgc cttcgtctgg atcctcaaca tgaacggcaa 300gtggagcccc
gtccggttcg acacctaccc cgacaacctc tcccacaggt acgtacgttc
360ttgtgcacac taactgcaaa ataatgttga cctacagcta cgtgcagctt
cttccttaaa 420ctgtgtcgtg tctgtgatga ttttgctagg atggaggagc
tcccggcggt ggacatgttc 480gtcacgacgg cagacccggc gctggagccg
ccgttgatca cggtgaacac ggtgctctcg 540ctgctcgccc tggactaccc
ggacgtcggc aggctggcgt gctacgtctc cgacgacggc 600tgctcccccg
tgacgtgcta cgcgctgcgc gaggccgcca agttcgccgg cctctgggtt
660cccttttgca agaggcacga cgttggtgtg agggcccctt tcatgtactt
ctcttccgcg 720ccggaggttg gcaacggaac agtcgaccac gagttcctgg
aaagctgggc actcatgaag 780gttagtcgcc atggtgatca tgccggttta
tgtttggtcg tccatcatcg ccatgaccat 840gcatcttcct cgtgtacgtg
tgacttcaga gccaatatga gaagctggcc cgccggatcg 900agaacgccga
cgagggcaca attatgcgtg acggcggcga cgagttcgcc gagttcatcg
960acgccgagcg cgggaaccat cctaccatcg ttaaggtcgg tgcactgacc
atgttcattt 1020gtccatgtac atcgtgtcgt gccaaacgca tagcaaatcc
gtctcgtgct aatatcgtca 1080cggttaatct gtctgagttc aggttctctg
ggacaacagc aagagcaaag caggggaaga 1140attcccacat ctggtgtacc
tctctcgaga gaaaagcccc agacatcgtc acaacttcaa 1200ggccggtgcc
atgaatgttc tggtgagcac tctcttctac tcaatacaat gttgcactac
1260taatcagtgt gtcacacaaa cagcaaaaag tggaagataa aagttcagac
ggcatgacac 1320ttttgatact aattaagctg agcatttcgt ggtgcagaca
agggtgtcgg ccgtgatgac 1380caacgctccg atcatgctga atgtggactg
cgacatgttc gccaacaacc cgcaggtcgc 1440cctacacgcg atgtgcctcc
tgttggggtt cgacgacgag atccacagcg ggttcgtcca 1500ggcgccacag
aagttctacg gcggcctcaa ggatgacccc tttggcaacc agatgcaggt
1560tataaccaag gtacacaagt gctgctgtgg ttgtactgtt acagtttttt
ttttgagcga 1620tgggtagtgt tacagttgta ctggtttttc tggcatgttc
agaaaatcgg aggtgggctc 1680gccgggatcc aaggcatgtt ctacggcggg
acaggctgtt ttcacaggag gaaagtcatt 1740tacggcgtgc cgccaccaga
caccgtcaaa cacgagatga aaggtaataa aactgggcac 1800acaaaagatg
agatcatccg gcgtaaattg gagtatttgg tcagtgcatt tcggttcgac
1860tagggcaaca tcaaatggct gttccgaatt tgccaggttc accatcttac
aaggagctgc 1920aggccaagtt tgggagctca aaggagttga tcgaatcatc
taggaacatc atctcaggag 1980acctgctcgc tagaccaacc gtagatttat
cgagtcgcgt cgaaatggca aaacaagtag 2040gcgactgcaa ctatgaggct
ggcacatgtt ggggccagga ggtatgctta gcttccgttg 2100ccgtattttt
gcaggttttg ctacagtaca tctacaacta caaaccttct gcagtttctc
2160tctagttaca gtttcttcca tatatatatt tttgcagatt ggctgggtct
atggatcaat 2220gacagaggac atcttgaccg ggctgcggat ccatgcggcg
ggttgggaat cggccttatt 2280ggacaccgag ccaccggcat tcctgggatg
tgctccgacc ggtggaccgg ccagcttgac 2340ccagttcaag agatgggcaa
cagggcttct ggagatactc atcagccaga acagcccgat 2400cctcggcacc
atcttccgac gcctccaact ccggcaatgc cttgcctatc tcatcgtaga
2460agcgtggccc gtgcgggcgc ctttcgagct gtgctatgcg ctactgggac
ctttctgcct 2520tctcacaaac cagtccttct tgccaacggt acatacactt
ttgccatgac ccattactac 2580attatatgca actaaacaaa aatgttgtgt
gatttgtttg ataatgaagc gcgacctagt 2640tggttaatgt gtaaatatat
attttcatga tttttacatt tgctgttttg caggcatcgg 2700atgaaggttt
ccgcatccca gcggctctat tcttgacctg ccacatatac cacctgatgg
2760agtacaagga gtgcgggctc tcggtccgcg cctggtggaa caaccacagg
atgcaacgca 2820tcacctcggc ctccgcctgg ctcctcgcct tcctcaccgt
cattctcaag acgctagggc 2880tctccgagac cgtgttcgag gtcacccgca
aggaaagcag cacgtcctcc gatggcggcg 2940cgggcaccga cgaggccgat
cctgggctct tcaccttcga ctcggcgccc gttttcatcc 3000cggtgacggt
gctctcaatg ctgaacattg tcgccctcgc cgtcgcggca tggcgtgctg
3060ttgtcggggc ggcggcgggc gttcatggtg gcccgggcat cggggagttc
gtgtgctgtg 3120gctggatcgt gctgtgcttc tggccgttcg tgagagggct
tgtcagcagg ggaaagtatg 3180gaatcccgtg gagtgtcagg gtgaaggctg
gtttgattgt ggctgcgttc gtgcacatct 3240gcacaaggaa ctaaccggcg g
3261
* * * * *
References