U.S. patent application number 13/828901 was filed with the patent office on 2014-06-12 for novel read-through fusion polynucleotides and polypeptides and uses thereof.
The applicant listed for this patent is Donald J. Buchsbaum, Andres Forero-Torres, Jason Gertz, Albert F. LoBuglio, Richard M. Myers, Brian S. Roberts, Katherine E. Varley. Invention is credited to Donald J. Buchsbaum, Andres Forero-Torres, Jason Gertz, Albert F. LoBuglio, Richard M. Myers, Brian S. Roberts, Katherine E. Varley.
Application Number | 20140162296 13/828901 |
Document ID | / |
Family ID | 50881332 |
Filed Date | 2014-06-12 |
United States Patent
Application |
20140162296 |
Kind Code |
A1 |
Varley; Katherine E. ; et
al. |
June 12, 2014 |
Novel Read-Through Fusion Polynucleotides and Polypeptides and Uses
Thereof
Abstract
The present disclosure provides for and relates to novel fusion
proteins and polypeptides expressed by breast cancer and other
cancer cells, and to compositions, materials and methods for
detecting, characterizing and treating said breast and other
cancers. In one embodiment, the fusion polypeptides are
read-through fusion transcripts.
Inventors: |
Varley; Katherine E.;
(Huntsville, AL) ; Myers; Richard M.; (Huntsville,
AL) ; Roberts; Brian S.; (Huntsville, AL) ;
Gertz; Jason; (Huntsville, AL) ; Buchsbaum; Donald
J.; (Birmingham, AL) ; Forero-Torres; Andres;
(Birmingham, AL) ; LoBuglio; Albert F.;
(Birmingham, AL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Varley; Katherine E.
Myers; Richard M.
Roberts; Brian S.
Gertz; Jason
Buchsbaum; Donald J.
Forero-Torres; Andres
LoBuglio; Albert F. |
Huntsville
Huntsville
Huntsville
Huntsville
Birmingham
Birmingham
Birmingham |
AL
AL
AL
AL
AL
AL
AL |
US
US
US
US
US
US
US |
|
|
Family ID: |
50881332 |
Appl. No.: |
13/828901 |
Filed: |
March 14, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61713549 |
Oct 14, 2012 |
|
|
|
61714781 |
Oct 17, 2012 |
|
|
|
Current U.S.
Class: |
435/7.92 ;
435/252.33; 435/254.11; 435/254.2; 435/320.1; 435/346; 435/348;
435/353; 435/354; 435/358; 435/365; 435/366; 435/411; 435/414;
435/419; 435/69.7; 530/324; 530/326; 530/387.9; 536/23.4 |
Current CPC
Class: |
C07K 14/47 20130101;
C07K 14/4748 20130101; G01N 33/57415 20130101 |
Class at
Publication: |
435/7.92 ;
536/23.4; 435/320.1; 435/252.33; 435/69.7; 530/324; 530/326;
530/387.9; 435/254.2; 435/254.11; 435/419; 435/414; 435/411;
435/366; 435/365; 435/358; 435/353; 435/354; 435/348; 435/346 |
International
Class: |
C07K 14/47 20060101
C07K014/47; C07K 16/18 20060101 C07K016/18 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] The U.S. Government may have an interest in, or certain
rights to, the subject matter of this disclosure as provided for by
the terms of (i) U.S. Army Medical Research and Materiel Command
grant no. W81XWH1010790 and (ii) grant no. P50CA089019 awarded by
the National Institutes of Health, National Cancer Institute
Specialized Program of Research Excellence.
Claims
1. An isolated nucleic acid molecule comprising the nucleotide
sequence of SEQ ID. NO. 1, SEQ ID. NO. 2 or SEQ ID NO. 3 or of a
degenerate variant of any of the forgoing.
2. An isolated nucleic acid sequence comprising a sequence that
encodes a polypeptide of the amino acid sequence of SEQ ID. NO. 4,
SEQ ID. NO. 5, SEQ ID NO. 6 or SEQ ID NO: 7, or an immunogenic
fragment of any of the forgoing at least five (5) residues in
length.
3. An expression vector comprising the nucleic acid of claim 1 or 2
operably linked to an expression control sequence.
4. A cultured cell comprising the vector of claim 3.
5. A method of producing a protein, the method comprising culturing
the cell of claim 4 under conditions permitting the expression of
the protein.
6. A purified polypeptide, the sequence of which consists of SEQ
ID. NO. 4, SEQ ID. NO. 5, SEQ ID NO. 6, or SEQ ID NO: 7, or an
immunogenic fragment of any of the forgoing at least five (5)
residues in length.
7. A purified polypeptide comprising five (5) consecutive residues
of SEQ ID. NO. 4, SEQ ID. NO. 5 or SEQ ID NO. 6.
8. A purified antibody that binds specifically to the polypeptides
of SEQ ID. NO. 4, SEQ ID. NO. 5, SEQ ID NO. 6 or SEQ ID NO: 7.
9. A method of diagnosing breast cancer in an individual comprising
the steps of: a) obtaining a biological sample from the individual;
and b) detecting in the biological sample the presence of one or
more fusion proteins or polypeptides, wherein the presence of the
fusion proteins or polypeptides indicates breast cancer in the
individual.
10. A method of treating breast cancer in an individual comprising
the steps of: a) detecting the presence of a polypeptide of SEQ ID.
NO. 4, SEQ ID. NO. 5, SEQ ID NO. 6, or SEQ ID NO: 7.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S.
Provisional Application No. 61/713,549 filed Oct. 14, 2012 entitled
"Novel Read-through Fusion Proteins and Polypeptides" and
61/714,781 filed Oct. 17, 2012 entitled "Novel Read-through Fusion
Polypeptides, Proteins and Polypeptides".
FIELD OF THE DISCLOSURE
[0003] The present disclosure provides for and relates to novel
fusion proteins and polypeptides expressed by breast cancer and
other cancer cells, and to compositions, materials and methods for
detecting, characterizing and treating said breast and other
cancers. In one embodiment, the fusion polypeptides are
read-through fusion transcripts.
BACKGROUND
[0004] Fusion genes with oncogenic activity were first identified
in hematologic malignancies, where chromosomal translocations
frequently join two genes that result in an aberrant protein
product (1, 2). These fused genes have been valuable prognostic
markers and therapeutic targets (3). The therapeutic value of
identifying fusion genes is exemplified by the development of
selective inhibitors targeted to the ABL kinase involved in the
BCR-ABL fusion that is present in 95% of patients with chronic
myelogenous leukemia (1, 2, 4). Most recurrent fusion genes have
been identified in leukemias, lymphomas, and soft tissue sarcomas
where cytogenetic approaches to detect chromosomal aberrations
using spectral karyotyping, fluorescent in situ hybridization, and
flow cytometry have been developed (5). Cytogenetic approaches to
detect fusion genes in the more common forms of cancer, epithelial
tumors, are hampered by the poor chromosome morphology, complex
karyotypes, and cellular heterogeneity that typify these tumors,
although it has been posited that fusion genes are likely drivers
of oncogenesis in these tumors as well (3, 5, 6). Until recently,
the most prevalent recurrent fusion genes identified in breast
cancer were the ETV6-NTRK3 fusion in secretory breast carcinoma, a
rare subtype of infiltrating ductal carcinoma (7) and the MYB-NFIB
fusion in adenoid cystic carcinomas, another rare form of breast
cancer (8). Recently, genome-wide microarray profiling, whole
genome sequencing and whole transcriptome sequencing have made it
possible to systematically identify fusion genes in solid tumors.
With these methods, recurrent fusions that contribute to malignancy
have been identified in prostate cancer (e.g. TMPRSS2 fused to ETS
family transcription factors (9-11)), in lung cancer (EML4-ALK
(12)), and in breast cancer (MAST kinases fused to NOTCH family
genes (13)). New technologies and informatics approaches are
enabling the identification of recurrent fusion genes in more
common epithelial cancers that may serve as valuable biomarkers and
drug targets (13-19).
[0005] In addition to fusion genes created by genomic
rearrangements, fusion transcripts created by cis- and
trans-splicing of mRNA, in the absence of a DNA rearrangements,
have been detected by sequencing cDNA clone libraries and
performing RNA-seq (20). These chimeric RNAs have been detected at
low levels in expressed sequence tag (EST) libraries (21-23) and
low levels across benign and malignant samples (6, 20, 24). One
particularly prevalent class of chimeric RNAs involves adjacent
genes in the same coding orientation that are spliced together to
form an in-frame chimeric transcript that spans both genes. In
recent literature, these have been referred to as read-through gene
fusions, transcription-induced chimeras, co-transcription of
adjacent genes coupled with intergenic splicing (CoTIS), or
conjoined genes. Several of these read-through fusion transcripts
have been identified specifically in prostate cancer and are
associated with cellular proliferation and disease progression
(25-33). Recurrent read-through transcripts have not yet been
characterized in breast cancer.
[0006] In 2012, it is estimated that among U.S. women there will be
over 225,000 new cases of breast cancer with over 39,000 deaths due
to breast cancer. As such, there is a high unmet need for better
and more reliable methods of diagnosing and treating breast cancer
as well as other cancers. The present disclosure provides three
recurrent read-through fusion transcripts encoding various
polypeptides associated with breast cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1 shows eight (8) read-through fusion transcripts
detected in more than two (2) breast tissue samples using
paired-end RNA-seq. These read-through fusions were breast-tissue
specific, and not detected in other non-neoplastic human tissues
sequenced by the Illumina Human Body Map 2.0 project. The exon
structure of the 5' fusion partner is depicted on the left, and the
exon structure of the 3' fusion partner is depicted on the right.
The fusion transcripts use endogenous splice sites and black lines
indicate which exons flank the fusion junction to result in the
chimeric transcript. RNA-seq reads that span the fusion junction
are depicted above the gene models. The intergenic chromosomal
distance between the fusion partners is denoted in kilobase pairs
(kbp). The five (5) read-through fusion transcripts depicted in a,
b, c, d and e were detected in both breast cancer specimens and
non-cancer breast tissue. Three (3) read-through fusion transcripts
significantly associated with breast cancer are depicted in f, g
and h.
[0008] FIG. 2 shows the expression of fusion partners for breast
cancer associated read-through fusion transcripts. a) The fraction
of reads near the fusion junction that include sequence from the
fusion transcript rather than the un-fused canonical transcript was
computed. Mean and standard error of the mean are shown. Less than
20% of the 5' fusion partners' transcripts have the fusion
sequence, indicating that most of the transcripts from the 5'
fusion partners are not fused. A significantly larger fraction of
the 3' fusion partners' transcripts contain the fusion sequence.
Without being limited to this theory, Applicants believe this
indicates that the expression of the 3' fusion partner is composed
of a large fraction of fusion transcript driven by the 5' fusion
partner's promoter. b) There is no difference in the expression
levels (Fragments Per Kilobase of transcript Per Million reads;
FPKMs) of the 5' fusion partner between samples with or without the
read-through fusion transcript (labeled Fused and Not Fused,
respectively). Mean and standard error of the mean are depicted in
black. Without being limited to this theory, Applicants believe
this indicates that increased expression of the 5' fusion partner
is not sufficient to induce read-through fusion transcripts, and
that lower expression of the 5' partner is not associated with our
power to detect the read-through fusion transcripts.
[0009] FIG. 3 shows western blots of three breast cancer associated
fusion proteins. Western blots were performed using antibodies
raised to one of the fusion partner proteins for the three breast
cancer associated fusion transcripts. For each candidate fusion,
cell lysates from two cell lines were analyzed with RNA-seq reads
spanning the fusion junction and one cell line without RNA-seq
reads spanning the fusion junction. In each blot, the
canonical/native size of the targeted protein was detected in each
cell line, and a band at the predicted fusion protein size was
detected in the cell line with the most RNA-seq fusion-spanning
reads (IL17RC-CRELD1 in SUM-149, CTSD-IFITM10 in MCF7, and
SCNN1A-TNFRSF1A in HCC1954). A band corresponding to the size of
the predicted fusion protein was also detected in the cell line
with the second most RNA-seq fusion transcript reads for the
SCNN1A-TNFRSF1A (SUM-102). None of the cell lines without RNA-seq
evidence of the fusion transcript produced fusion protein-sized
bands.
[0010] FIG. 4 shows the results of investigating the CTSD-IFITM10
and SCNN1A-TNFRSF1A expression in vitro. a) For each fusion
transcript we designed qPCR primer to flank the fusion junctions
and we designed two custom siRNAs to target the fusion junction.
The sequence from the 5' gene is indicated in green and the
sequence from the 3' gene is indicated in red. b) The CTSD-IFITM10
fusion transcript was detected in RNA-seq data from the MCF7 breast
cancer cell line, and the SCNN1A-TNFRSF1A fusion transcript was
detected in RNA-seq data from the HCC1954 breast cancer cell line.
To confirm the presence of each fusion in these cell lines we
performed qPCR on cDNA and electrophoresed the products in a 4%
agarose gel. PCR products of the expected size were amplified from
cDNA using primers that flank the fusion junction between the two
genes, and there were no products generated in the PCR reaction
that did not contain cDNA, confirming the presence of these fusion
transcripts in each cell line. c) The MCF7 breast cancer cell line
was transfected with two siRNAs targeting the CTSD-IFITM10 fusion
junction. QPCR of the fusion transcript was performed 48 hours
after transfection. Both siRNAs significantly reduced the abundance
of the fusion transcript relative to the controls, which included a
non-targeting siRNA and a mock transfection that did not contain
any siRNA. d) The HC1954 breast cancer cell line was transfected
with two siRNAs targeting the SCNN1A-TNFRSF1A fusion junction. QPCR
of the fusion transcript was performed 48 hours after transfection.
One siRNA, represented by SEQ ID. NOS. 19 and 20, significantly
reduced the abundance of the fusion transcript relative to the
controls, which included a non-targeting siRNA and a mock
transfection that did not contain any siRNA. e) The MCF7 breast
cancer cell line was transfected with two siRNAs targeting the
CTSD-IFITM10 fusion junction. A quantitative cell proliferation
assay was performed 72 hours after transfection. Both siRNA
constructs, represented by SEQ ID NOS. 15 and 16, and 17 and 18,
respectively significantly reduced the number of live cells
relative to the controls, indicating that the CTSD-IFITM10 fusion
transcript is associated with proliferation in this breast cancer
cell line.
SUMMARY
[0011] The present disclosure provides novel fusion transcripts and
novel fusion polypeptides expressed therefrom. In one embodiment,
such fusion transcripts and fusion polypeptides are expressed in
breast cancer. In one embodiment, such fusion transcripts and
fusion polypeptides exhibit differentially increased expression in
breast cancer and as compared to normal breast cells and other
neoplastic tissue. In one embodiment, such fusion transcripts and
fusion polypeptides exhibit differentially increased expression in
human breast cancer as compared to normal human breast cells and
other human neoplastic tissue. In one embodiment, such fusion
transcripts and fusion polypeptides exhibit differentially
increased expression in estrogen receptor positive (ER+) breast
cancer primary tumors and triple negative breast cancer (TNBC)
primary tumors as compared to normal breast cells and other
neoplastic tissue. In one embodiment, such fusion transcripts are
significantly associated with human breast cancer.
[0012] The present disclosure also provides nucleic acids encoding
the novel polypeptides or fragments of the polypeptides. Also
provided are probes and primers used to amplify and detect nucleic
acids encoding the novel fusion junction polypeptides or fragments
of the polypeptides. The nucleic acids may be double stranded,
single stranded, RNA, DNA, variants or synthetic variants thereof.
In one embodiment, the nucleic acids encode the fusion junction
polypeptides generated by the read through transcripts of
IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10. In one embodiment,
the present disclosure provides a nucleic acid as in SEQ ID NO: 1
encoding the fusion polypeptide from a read through transcript of
IL17RC-CRELD1. In one embodiment, the present disclosure provides a
nucleic acid as in SEQ ID NO: 2 encoding a fusion polypeptide from
a read through transcript of SCNN1A-TNFRSF1A. In one embodiment,
the present disclosure provides a nucleic acid as in SEQ ID NO 3
encoding a fusion polypeptide from a read through transcript of
CTSD-IFITM10.
[0013] In one embodiment, the fusion transcripts are the result of
splicing of mRNA without DNA rearrangements and the fusion
polypeptides are expressed from such fusion transcripts. In one
embodiment the fusion transcripts are the result of fusion between
mRNA coding for the proteins IL17RC and CRELD1 polypeptides, the
SCNN1A and TNFRSF1A polypeptides and/or the CTSD and IFITM10
polypeptides resulting in the fusion of the proteins IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10. In one embodiment, the present
disclosure provides a fusion polypeptide from a read through
transcript of IL17RC-CRELD1 as in SEQ ID. NO: 4 or SEQ ID. NO. 5,
or fragments thereof. In one embodiment, the present disclosure
provides a fusion polypeptide from a read through transcript of
SCNN1A-TNFRSF1A as in SEQ ID. NO: 6, or a fragment thereof. In one
embodiment, the present disclosure provides a fusion polypeptide
from a read through transcript of CTSD-IFITM10 as in SEQ ID. NO: 7,
or a fragment thereof.
[0014] Also provided are vectors comprising the nucleic acids of
the present disclosure. In one embodiment, the vector is an
expression vector. In one embodiment, the expression vector
comprises the nucleic acid sequence of SEQ ID NO: 1 or a fragment
thereof. In another embodiment, the expression vector comprises the
nucleic acid sequence of SEQ ID NO: 2, or a fragment thereof. In
yet another embodiment, the expression vector comprises the nucleic
acid sequence of SEQ ID NO: 3, or a fragment thereof. Also provided
is a host cell comprising the vector or the expression vector.
[0015] Also provided are recombinant host cells that express the
fusion polypeptides of the present disclosure on the cell's surface
or that excrete the polypeptides to the exterior of the cell. In
one embodiment the recombinant host cell expresses or excretes the
polypeptide of SEQ ID NO: 4 or SEQ ID NO: 5, or variants or
fragments thereof. In one embodiment the recombinant host cell
expresses or excretes the polypeptide of SEQ ID NO: 6 or a variant
or a fragment thereof. In one embodiment the recombinant host cell
expresses or excretes the polypeptide of SEQ ID NO: 7 or a variant
or a fragment thereof.
[0016] In some embodiments the invention provides antigen-binding
agents including antibodies that specifically bind to the fusion
polypeptides and fusion proteins, the antigen binding agents
preferably having a greater affinity for the fusion polypeptides
and proteins than for either of the fusion partners that make up
the fusion protein. The antibodies of the invention may be
monoclonal or polyclonal antibodies. In some embodiments the
antibodies are chimeric, humanized, or human antibodies. In some
embodiments the antibodies are single chain antibodies or Fab
fragments.
[0017] In some aspects the invention provides an isolated antigen
binding agent that specifically binds to a IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide. In some
preferred embodiments the binding agent is a monoclonal antibody.
In some aspects the invention provides an isolated monoclonal
antibody or other antigen binding agent that specifically binds to
a IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion
polypeptide, wherein the antigen binding agent specifically binds
to a IL17RC-CRELD1 fusion polypeptide of SEQ ID NO: 4 or SEQ ID NO:
5, a SCNN1A-TNFRSF1A fusion polypeptide of SEQ ID NO: 6 or
CTSD-IFITM10 fusion polypeptide of SEQ ID NO: 7. In some aspects
the invention provides a monoclonal antibody wherein the antibody
binds a IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion
polypeptide protein with an affinity less than 1 nM.
[0018] In some embodiments the antibody or other binding agent
specifically binds to the IL17RC-CRELD1, SCNN1A-TNFRSF1A or
CTSD-IFITM10 fusion polypeptides, or to fragments thereof,
expressed on the surface of a recombinant cell.
[0019] Also provided is a hybridoma capable of producing the
antibodies of the present invention. Also provided is a method of
making the antibodies or other antigen binding agents comprising
culturing a host cell under conditions that allow the host cell to
express the antigen binding agent.
[0020] The invention provides methods of detecting nucleic acid
sequences that can be used for diagnosing, characterizing, and
treating tumors in an individual with IL17RC-CRELD1,
SCNN1A-1TNFRSF1A or CTSD-IFITM10 fusion transcript or in need of
treatment from a disease resulting, at least in part from, the
expression or the differentially increased expression of a
IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion
transcript."
[0021] The invention provides methods of making antibodies that can
be used for diagnosing, characterizing, and treating tumors in an
individual with IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10
fusion polypeptide or in need of treatment from a disease
resulting, at least in part from, the expression or the
differentially increased expression of a IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide.
[0022] The invention provides methods of making antibodies that can
be used for detecting, characterizing, and treating tumors
comprising screening a library of antibodies expressed on phage,
phagemids, ribosomes, or other particles with a IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide. In some
embodiments the polypeptide used to screen the library is expressed
on the surface of a recombinant cell. The resulting antibodies may
be isolated using standard methods known in the art. In some
embodiments the library is a library of human antibodies or
humanized antibodies.
[0023] Also provided are isolated nucleic acid molecules comprising
a polynucleotide sequence encoding the light chain variable domain,
the heavy chain variable domain, or both, of the antibodies or
other antigen binding agents of the invention. In one embodiment,
the polynucleotide comprises a light chain variable sequence, and a
heavy chain variable sequence.
[0024] In some aspects the invention provides bispecific antibodies
or other binding agents in which a first antigen-binding site binds
an epitope on a first fusion partners and a second antigen-binding
site binds an epitope on a second fusion partner. For example, a
bispecific antibody could comprise a first antigen-binding site
that binds CTSD and a second antigen-binding site that binds
IFITM10.
[0025] In some aspects the invention provides antibodies with
enhanced effector functions. In other aspects the invention
provides antibodies conjugated to a toxin or other therapeutic
agent. In some aspects of the invention the toxin or other
therapeutic agent is joined to the antibody by means of a cleavable
or non-cleavable linker.
[0026] In another aspect, the invention relates to the use of a
siRNA construct that is targeted to the IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide/nucleotide in
the treatment of cancer, such as breast cancer. The siRNA
constructs are set forth in SEQ ID NOS. 15-22 respectively and
variants thereof, including nucleic acid sequences 90, 91, 92, 93,
94, 95, 96, 97, 98 and 99% identical to one of SEQ ID. NOS 15-22,
should be considered with the scope of this disclosure. In one
embodiment the siRNA constructs silence or down regulate the
expression of the IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10
fusion polypeptide/nucleotide. According to still another aspect of
the present invention is a method for increasing the efficacy of
cancer therapy in a subject, the method comprising: administering
to a subject in need of an effective amount of an siRNA construct
directed to a IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion
polypeptide/nucleotide, wherein said subject is also being
administered a cancer therapy selected from the group consisting of
small-molecule drugs, angiogenesis inhibitors, tumor vaccine,
chemotherapy, immunotherapy, radiation therapy, gene therapy and
combinations thereof.
[0027] Also provided is a pharmaceutical composition comprising the
antibodies or other antigen binding proteins of the present
invention. In one embodiment the pharmaceutical composition
comprises a human or humanized antibody.
[0028] In some embodiments the invention provides methods useful to
detect and characterize breast cancer and other types of tumors.
Some aspects of the invention comprise detecting the expression or
the differentially increased expression of a fusion polypeptide
according to the invention in cells from the tumor. In some
embodiments the fusion protein detected is selected from: (a) SEQ
ID NO: 4 or SEQ ID NO: 5, or a fragment thereof, (b) SEQ ID NO: 6,
or a fragment thereof, or (c) SEQ ID NO: 7, or a fragment
thereof.
[0029] In some aspects of the invention expression of the fusion
polypeptide is detected at the RNA level. In other aspects of the
invention expression of the fusion polypeptide is detected at the
level of protein synthesis. In some aspects of the invention
expression of the fusion polypeptide is detected through the use of
an antibody that specifically binds the polypeptide.
[0030] In some embodiments, antibodies or other antigen binding
agents of the invention are useful to treat breast and other
cancers or for preparing a pharmaceutical composition for use in
treating breast and other cancers. In one embodiment, the invention
includes a method of inhibiting proliferation of cells expressing a
IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide.
In one embodiment, the method comprises contacting the cells with a
composition comprising an antigen binding agent that specifically
binds to a IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion
polypeptide. In some aspects the antigen binding agent is an
antibody according to the invention. In another embodiment, the
invention provides a method of inhibiting the expression of a
IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide.
Some aspects of the invention are directed to a method of preparing
a pharmaceutical composition for use in treating a patient with
cancer, wherein the composition comprises an antigen binding agent
or bispecific antibody that specifically binds to a IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide. In some aspects
the antigen binding agent is an antibody according to the
invention.
[0031] In some aspects of the invention the patient is treated with
antibodies having enhanced effector functions. In some aspects of
the invention the patient is treated with antibodies conjugated to
a toxin or other therapeutic agent. In some aspects of the
invention the therapeutic agent is joined to the antibody by means
of a cleavable or non-cleavable linker. In some aspects of the
invention treatment is administered after detection of the
expression of an IL17RC-CRELD1, SCNN1A-TNFRSF1A or CTSD-IFITM10
fusion polypeptide in cells from the individual.
DETAILED DESCRIPTION
[0032] While the invention has been described with respect to a
limited number of embodiments, those skilled in the art, having
benefit of this disclosure, will appreciate that other embodiments
can be devised which do not depart from the scope of the invention
as disclosed here.
[0033] The present disclosure identifies and provides novel fusion
protein and polypeptides expressed by breast cancer cells and other
cancer cells. In another aspect, the present disclosure provides
novel nucleic acid molecules that encode the fusion polypeptides.
In yet another aspect, the present disclosure provides antigen
binding agents, including antibodies that specifically bind to the
fusion polypeptides. In another aspect, the present disclosure
provides methods of diagnosing and treating breast cancer or other
cancers by detecting the presence of the novel fusion polypeptides
in an individual. In yet another aspect, the present disclosure
provides for methods of treating breast cancers or other cancers in
an individual by inhibiting the expression of the fusion
polynucleotides and/or polypeptides by the breast cancer cells or
other cancer cells. In yet another aspect, the present disclosure
provides for methods of treating breast cancers or other cancers in
an individual by contacting a cell expressing the fusion
polypeptide with a composition comprising an antigen binding agent
that binds to the fusion polypeptide. In yet another aspect, the
present disclosure provides for methods of treating breast cancers
or other cancers in an individual by inhibiting the expression of
the fusion protein polypeptides by the breast cancer cells or other
cancer cells.
DEFINITIONS
[0034] Unless otherwise defined herein, scientific and technical
terms used in connection with the present invention shall have the
meanings that are commonly understood by those of ordinary skill in
the art. Further, unless otherwise required by context, singular
terms shall include pluralities and plural terms shall include the
singular. Generally, nomenclatures used in connection with, and
techniques of, cell and tissue culture, molecular biology,
immunology, microbiology, genetics and protein and nucleic acid
chemistry and hybridization described herein are those well known
and commonly used in the art. The methods and techniques of the
present invention are generally performed according to conventional
methods well known in the art and as described in various general
and more specific references that are cited and discussed
throughout the present specification unless otherwise indicated.
See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual,
2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (1989) and Ausubel et al, Current Protocols in Molecular
Biology, Greene Publishing Associates (1992), and Harlow and Lane
Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. (1990), which are incorporated
herein by reference. Enzymatic reactions and purification
techniques are performed according to manufacturer's
specifications, as commonly accomplished in the art or as described
herein. The terminology used in connection with, and the laboratory
procedures and techniques of, analytical chemistry, synthetic
organic chemistry, and medicinal and pharmaceutical chemistry
described herein are those well known and commonly used in the art.
Standard techniques can be used for chemical syntheses, chemical
analyses, pharmaceutical preparation, formulation, and delivery,
and treatment of patients.
[0035] The term "antibody" is used in the broadest sense and
includes, for example, an intact immunoglobulin or to an antigen
binding portion thereof that competes with the intact antibody for
specific binding, unless otherwise specified. Antigen binding
portions may be produced by recombinant DNA techniques or by
enzymatic or chemical cleavage of intact antibodies. Antigen
binding portions include Fab, Fab', F(ab').sub.2, Fd, Fv, and
domain antibodies (dAbs), and complementarity determining region
(CDR) fragments, single-chain antibodies (scFv), diabodies,
triabodies, tetrabodies, and polypeptides that contain at least a
portion of an immunoglobulin that is sufficient to confer specific
antigen binding to the polypeptide. Antibody includes a human
antibody, a humanized antibody, chimeric antibody, a monoclonal
antibody, a polyclonal antibody, a recombinant antibody, an
antigen-binding antibody fragment, a single chain antibody, a
maxibody (scFv fused by a linker or direct attachment to an Fc or
an Fc fragment), a diabody, a triabody, a tetrabody, a Fab
fragment, an F(fa')x fragment, a domain antibody, an IgD antibody,
an IgE antibody, and IgM antibody, and IgG1 antibody, and IgG2
antibody, and IgG3 antibody, and IgG4 antibody, and IgG4 antibody
having at least one mutation in the hinge region that alleviates a
tendency to for intra H-chain disulfide bonds.
[0036] The term "antigen binding agent" refers to a natural or
non-natural molecule, in one embodiment a proteinaceous molecule,
that specifically binds to a target, such as for example a fusion
polypeptide of the present disclosure. The term "specific binding"
or "specifically binds" refers to the ability of an antigen binding
agent to bind to a target with greater affinity (strength of
binding) than it binds to a non-target. In certain embodiments,
specific binding refers to binding to a target with an affinity
that is at least 10, 50, 100, 250, 500, or 1000 fold greater than
the affinity for a non-target. In certain embodiments, affinity is
determined by an affinity ELISA assay, by a BIAcore assay, by a
kinetic method, or by an equilibrium/solution method. Affinity can
be expressed in terms of the dissociation constant K.sub.d.
Examples of antigen binding agents includes, but are not limited to
proteins, peptides, nucleic acids, carbohydrates, lipids, and small
molecule compounds. In some embodiments the antigen binding agent
is an antigen binding protein; in some embodiments, the antigen
binding agent is an antibody.
[0037] The term "antigen binding protein" refers to a protein
comprising a portion that binds to an antigen and, optionally, a
scaffold or framework portion that allows the antigen binding
portion to adopt a conformation that promotes binding of the
antigen binding protein to the antigen. Examples of antigen binding
proteins include antibodies, antibody fragments (e.g., an antigen
binding portion of an antibody), antibody derivatives, and antibody
analogs. The antigen binding protein can comprise, for example, an
alternative protein scaffold or artificial scaffold with grafted
CDRs or CDR derivatives. Such scaffolds include, but are not
limited to, antibody-derived scaffolds comprising mutations
introduced to, for example, stabilize the three-dimensional
structure of the antigen binding protein as well as wholly
synthetic scaffolds comprising, for example, a biocompatible
polymer (see for example, Korndorfer et al, 2003, Proteins:
Structure, Function, and Bioinformatics, Volume 53, Issue 1:
121-129; Roque et al, 2004, Biotechnol. Prog. 20:639-654). In
addition, peptide antibody mimetics ("PAMs") can be used, as well
as scaffolds based on antibody mimetics utilizing fibronection
components as a scaffold. Antigen binding proteins further include
peptibodies. The term "peptibody" refers to a molecule comprising
an antibody Fc domain attached to at least one peptide. The
production of peptibodies is generally described in PCT publication
WO 00/24782. Antigen binding proteins further include
nonimmunoglobulin avidity multimers or "avimers," which are
multidomain proteins derived from the A-domains as found in various
cell surface receptors. Avimers can be generated by the sequential
selection of individual binding domains, each of which recognize a
different epitope, and can therefore bind multiple sites on a
target or even multiple targets. (see, for example, Silverman, J.
et al. Nat. Biotechnol. 23, 1556-1561, 2005).
[0038] The term "antigen binding site" refers to the portion of an
antigen binding agent that contains amino acid residues or other
moieties that interact with an antigen and contribute to the
antigen binding protein's specificity and affinity for the antigen.
For an antibody that specifically binds to its antigen, this will
include at least part of at least one of its CDR domains. An
antigen binding protein may have one or more binding sites. If
there is more than one binding site, the binding sites may be
identical to one another or may be different. For example, a
naturally occurring human immunoglobulin typically has two
identical binding sites, while a "bispecific" or "bifunctional"
antibody may have two different binding sites. An antigen binding
protein can have, for example, the structure of a naturally
occurring immunoglobulin. An "immunoglobulin" is a tetrameric
molecule. In a naturally occurring immunoglobulin, each tetramer is
composed of two identical pairs of polypeptide chains, each pair
having one "light" (about 25 kDa) and one "heavy" chain (about
50-70 kDa). The amino-terminal portion of each chain includes a
variable region of about 100 to 110 or more amino acids primarily
responsible for antigen recognition. The carboxy-terminal portion
of each chain defines a constant region primarily responsible for
effector function. Human light chains are classified as kappa and
lambda light chains. Heavy chains are classified as mu, delta,
gamma, alpha, or epsilon, and define the antibody's isotype as IgM,
IgD, IgG, IgA, and IgE, respectively. Within light and heavy
chains, the variable and constant regions are joined by a "J"
region of about 12 or more amino acids, with the heavy chain also
including a "D" region of about 10 more amino acids. The variable
regions of each light/heavy chain pair form the antibody binding
site such that an intact immunoglobulin has two binding sites.
Naturally occurring immunoglobulin chains exhibit the same general
structure of relatively conserved framework regions (FR) joined by
three hypervariable regions, also called complementarity
determining regions or CDRs. From N-terminus to C-terminus, both
light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2,
FR3, CDR3 and FR4. The assignment of amino acids to each domain is
in accordance with the definitions of Kabat et al. (Sequences of
Proteins of Immunological Interest, 5.sup.th Ed., US Dept. of
Health and Human Services, PHS, NIH, NIH Publication no. 91-3242,
1991). Intact antibodies include polyclonal, monoclonal, chimeric,
humanized or fully human antibodies having full length heavy and
light chains.
[0039] The term "chimeric antibody" refers to an antibody that
contains one or more regions from one antibody and one or more
regions from one or more other antibodies. A "CDR grafted antibody"
is an antibody comprising one or more CDRs derived from an antibody
of a particular species or isotype and the framework of another
antibody of the same or different species or isotype.
[0040] The term "down regulated," as it refers to genes inhibited
by the subject RNAi method, refers to a diminishment in the level
of expression of a gene(s) in the presence of one or more siRNA
construct(s) when compared to the level in the absence of such
siRNA construct(s). The term "down regulated" is used herein to
indicate that the target gene expression is lowered by 1-100%. For
example, the expression may be reduced by about 10, 20, 30, 40, 50,
60, 70, 80, 90, 95, or 99%.
[0041] The term "epitope" refers to that portion of the antigen
that an antigen binding agent recognizes. In the case of an
antibody that binds a protein target, an "epitope" is the antigenic
site on the protein that is recognized by the antibody, i.e., the
minimum molecular structure within the protein target to which the
antibody binds. Epitopes on proteins may be continuous (comprising
a segment of continuous amino acids from the primary amino acid
sequence) or non-continuous (comprising amino acids that are not
continuous in the primary protein sequence but which are in close
proximity in the three-dimensional folded protein).
[0042] The term "Fab fragment" refers to a monovalent fragment
having the V.sub.L, V.sub.H, C.sub.L and C.sub.HI domains; a
F(ab').sub.2 fragment is a bivalent fragment having two Fab
fragments linked by a disulfide bridge at the hinge region; a Fd
fragment has the V.sub.H and C.sub.H1 domains; an Fv fragment has
the V.sub.L and V.sub.H1 domains of a single arm of an antibody;
and a dAb fragment has a V.sub.H domain, a V.sub.L domain, or an
antigen-binding fragment of a V.sub.H or V.sub.L domain.
[0043] The term "gene silencing" refers to the suppression of gene
expression, e.g., transgene, heterologous gene and/or endogenous
gene expression. Gene silencing may be mediated through processes
that affect transcription and/or through processes that affect
post-transcriptional mechanisms. Gene silencing may occur when
siRNA initiates the degradation of the mRNA of a gene of interest
in a sequence-specific manner via RNA interference (for a review,
see Brantl, 2002, Biochim. Biophys. Acta, 1575(1-3): 15-25). Gene
silencing may be allele-specific wherein specific silencing of one
allele of a gene occurs.
[0044] The term "host cell" refers to a cell that can be used to
express a nucleic acid, e.g., a nucleic acid of the invention. A
host cell can be a prokaryote, for example, E. coli, or it can be a
eukaryote, for example, a single-celled eukaryote (e.g., a yeast or
other fungus), a plant cell (e.g., a tobacco or tomato plant cell),
an animal cell (e.g., a human cell, a monkey cell, a hamster cell,
a rat cell, a mouse cell, or an insect cell) or a hybridoma.
Examples of host cells include the COS-7 line of monkey kidney
cells (ATCC CRL 1651) (see Gluzman et al., 1981, Cell 23: 175), L
cells, CI 27 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary
(CHO) cells or their derivatives such as Veggie CHO and related
cell lines which grow in serum-free media (see Rasmussen et al.,
1998, Cytotechnology 28:31) or CHO strain DX-B11, which is
deficient in DHFR (see Urlaub et al., 1980, Proc. Natl. Acad. Sci.
USA 77:4216-20), HeLa cells, BIIK (ATCC CRL 10) cell lines, the
CV1/EBNA cell line derived from the African green monkey kidney
cell line CV1 (ATCC CCL 70) (see McMahan et al., 1991, EMBO J.
10:2821), human embryonic kidney cells such as 293, 293 EBNA or MSR
293, human epidermal A431 cells, human Colo205 cells, other
transformed primate cell lines, normal diploid cells, cell strains
derived from in vitro culture of primary tissue, primary explants,
HL-60, U937, HaK or Jurkat cells. Typically, a host cell is a
cultured cell that can be transformed or transfected with a
polypeptide-encoding nucleic acid, which can then be expressed in
the host cell. The phrase "recombinant host cell" can be used to
denote a host cell that has been transformed or transfected with a
nucleic acid to be expressed. A host cell also can be a cell that
comprises the nucleic acid but does not express it at a desired
level unless a regulatory sequence is introduced into the host cell
such that it becomes operably linked with the nucleic acid. It is
understood that the term host cell refers not only to the
particular subject cell but to the progeny or potential progeny of
such a cell. Because certain modifications may occur in succeeding
generations due to, e.g., mutation or environmental influence, such
progeny may not, in fact, be identical to the parent cell, but are
still included within the scope of the term as used herein.
[0045] The term "human antibody" includes all antibodies that have
one or more variable and constant regions derived from human
immunoglobulin sequences. In one embodiment, all of the variable
and constant domains are derived from human immunoglobulin
sequences (a fully human antibody). Human antibodies may be
prepared in a variety of ways, including immunization of a mouse
that is genetically modified to express human antibodies. One can
engineer mouse strains deficient in mouse antibody production with
large fragments of the human Ig loci in anticipation that such mice
would produce human antibodies in the absence of mouse antibodies.
Large human Ig fragments may preserve the large variable gene
diversity as well as the proper regulation of antibody production
and expression. By exploiting the mouse machinery for antibody
diversification and selection and the lack of immunological
tolerance to human proteins, the reproduced human antibody
repertoire in these mouse strains may yield high affinity fully
human antibodies against any antigen of interest, including human
antigens. Using the hybridoma technology, antigen-specific human
MAbs with the desired specificity may be produced and selected.
Certain exemplary methods are described in WO 98/24893, U.S. Pat.
No. 5,545,807, EP 546073B1, and EP 546073A1. Human antibodies can
also be prepared by panning human antibody libraries expressed on
phage, phagemids, ribosomes, or other particles.
[0046] The term "humanized antibody" refers to an antibody that has
a sequence that differs from the sequence of an antibody derived
from a non-human species by one or more amino acid substitutions,
deletions, and/or additions, such that the humanized antibody is
less likely to induce an immune response, and/or induces a less
severe immune response, as compared to the non-human species
antibody, when it is administered to a human subject. In one
embodiment, certain amino acids in the framework and constant
domains of the heavy and/or light chains of the non-human species
antibody are mutated to produce the humanized antibody. In another
embodiment, the constant domain(s) from a human antibody are fused
to the variable domain(s) of a non-human species. In another
embodiment, one or more amino acid residues in one or more CDR
sequences of a non-human antibody are changed to reduce the likely
immunogenicity of the non-human antibody when it is administered to
a human subject, wherein the changed amino acid residues either are
not critical for immunospecific binding of the antibody to its
antigen, or the changes to the amino acid sequence that are made
are conservative changes, such that the binding of the humanized
antibody to the antigen is not significantly worse than the binding
of the non-human antibody to the antigen. Examples of methods for
making humanized antibodies may be found in U.S. Pat. Nos.
6,054,297, 5,886,152 and 5,877,293.
[0047] The term "individual" or "patient" as used herein refers to
any animal, including mammals, such as, but not limited to, mice,
rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep,
horses, or primates, or humans. The term may specify male or female
or both, or exclude male or female.
[0048] The term "in need of prevention" as used herein refers to a
judgment made by a caregiver that a patient requires or will
benefit from prevention. This judgment is made based on a variety
of factors that are in the realm of a caregiver's expertise, and
may include the knowledge that the patient may become ill as the
result of a disease state that is treatable by a compound or
pharmaceutical composition of the disclosure.
[0049] The term "in need of treatment" as used herein refers to a
judgment made by a caregiver that a patient requires or will
benefit from treatment. This judgment is made based on a variety of
factors that are in the realm of a caregiver's expertise, and may
include the knowledge that the patient is ill as the result of a
disease state that is treatable by a compound or pharmaceutical
composition of the disclosure.
[0050] The term "isolated" or "purified" molecule (where the
molecule is, for example, a polypeptide, a polynucleotide, or an
antibody) is a molecule that by virtue of its origin or source of
derivation (1) is not associated with naturally associated
components that accompany it in its native state, (2) is
substantially free of other molecules from the same species (3) is
expressed by a cell from a different species, or (4) does not occur
in nature. Thus, a molecule that is chemically synthesized, or
expressed in a cellular system different from the cell from which
it naturally originates, will be "isolated" or "purified" from its
naturally associated components. A molecule also may be rendered
substantially free of naturally associated components by isolation,
using purification techniques well known in the art. Molecule
purity or homogeneity may be assayed by a number of means well
known in the art. For example, the purity of a polypeptide sample
may be assayed using polyacrylamide gel electrophoresis and
staining of the gel to visualize the polypeptide using techniques
well known in the art. For certain purposes, higher resolution may
be provided by using HPLC or other means well known in the art for
purification.
[0051] The term "monoclonal antibodies" refers to a collection of
antibodies encoded by the same nucleic acid molecule. In certain
embodiments, monoclonal antibodies are produced by a single
hybridoma or other cell line, or by a transgenic mammal. Monoclonal
antibodies typically recognize the same epitope. The term
"monoclonal" is not limited to any particular method for making an
antibody.
[0052] The term "multispecific antibody" refers to an antibody
wherein two or more variable regions bind to different epitopes.
The epitopes may be on the same or different targets. In certain
embodiments, a multispecific antibody is a "bispecific antibody,"
which recognizes two different epitopes on the same or different
antigens.
[0053] The terms "peptide," "polypeptide," and "protein" each refer
to a molecule comprising two or more amino acid residues joined to
each other by peptide bonds. These terms encompass, e.g., native
and artificial proteins, protein fragments and polypeptide analogs
such as muteins, variants, and fusion proteins of a protein
sequence as well as post-translationally, or otherwise covalently
or non-covalently, modified proteins.
[0054] The term "polyclonal antibody" refers to a heterogeneous
mixture of antibodies that bind to different epitopes of the same
antigen.
[0055] The terms "polynucleotide" and "nucleic acid" are used
interchangeably throughout and include DNA molecules (e.g., cDNA or
genomic DNA), RNA molecules (e.g., mRNA, siRNA), analogs of the DNA
or RNA generated using nucleotide analogs (e.g., peptide nucleic
acids and non-naturally occurring nucleotide analogs), and hybrids
thereof. The nucleic acid molecule can be single-stranded or
double-stranded. In one embodiment, the nucleic acid molecules of
the invention comprise a contiguous open reading frame encoding an
antibody, or a fragment, derivative, mutein, or variant thereof, of
the invention. The nucleic acids can be any length. They can be,
for example, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125,
150, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1,000, 1,500,
3,000, 5,000 or more nucleotides in length, and/or can comprise one
or more additional sequences, for example, regulatory sequences,
and/or be part of a larger nucleic acid, for example, a vector.
[0056] The terms "prevent", "preventing", "prevention" "suppress",
"suppressing" and suppression as used herein refer to administering
a compound either alone or as contained in a pharmaceutical
composition prior to the onset of clinical symptoms of a disease
state so as to prevent any symptom, aspect or characteristic of the
disease state. Such preventing and suppressing need not be absolute
to be useful.
[0057] The term "single-chain antibody" (scFv) refers to an
antibody in which a V.sub.L and a V.sub.11 region are joined via a
linker (e.g., a synthetic sequence of amino acid residues) to form
a continuous protein chain wherein the linker is long enough to
allow the protein chain to fold back on itself and form a
monovalent antigen binding site (see, e.g., Bird et al., 1988,
Science 242:423-26 and Huston et al, 1988, Proc. Natl. Acad. Sci.
USA 85:5879-83). Diabodies are bivalent antibodies comprising two
polypeptide chains, wherein each polypeptide chain comprises
V.sub.H and V.sub.L domains joined by a linker that is too short to
allow for pairing between two domains on the same chain, thus
allowing each domain to pair with a complementary domain on another
polypeptide chain (see, e.g., Holliger et al, 1993, Proc. Natl.
Acad. Sci. USA 90:6444-48, and Poljak et al, 1994, Structure 2:
1121-23). If the two polypeptide chains of a diabody are identical,
then a diabody resulting from their pairing will have two identical
antigen binding sites. Polypeptide chains having different
sequences can be used to make a diabody with two different antigen
binding sites. Similarly, tribodies and tetrabodies are antibodies
comprising three and four polypeptide chains, respectively, and
forming three and four antigen binding sites, respectively, which
can be the same or different.
[0058] The term "RNA interference (RNAi)" refers to the process of
sequence-specific, posttranscriptional gene silencing initiated by
siRNA. During RNAi, siRNA induces degradation of target mRNA with
consequent sequence-specific inhibition of gene expression.
[0059] The term "small interfering" or "short interfering RNA" or
"siRNA" refers to a nucleic acid that forms a double stranded RNA,
which double stranded RNA has the ability to reduce or inhibit
expression of a gene or target gene when the siRNA is expressed in
the same cell as the gene or target gene. "siRNA" thus refers to
the double stranded RNA formed by the complementary strands. The
complementary portions of the siRNA that hybridize to form the
double stranded molecule typically have substantial or complete
identity. In one embodiment, an siRNA refers to a nucleic acid that
has substantial or complete identity to a target gene and forms a
double stranded siRNA. The sequence of the siRNA can correspond to
the full length target gene, or a subsequence thereof. siRNA is
"targeted" to a gene in that the nucleotide sequence of the duplex
portion of the siRNA is substantially complementary to a nucleotide
sequence of the targeted gene. The siRNA sequence duplex needs to
be of sufficient length to bring the siRNA and target RNA together
through complementary base-pairing interactions. The siRNA of the
invention may be of varying lengths. The length of the siRNA is
preferably greater than or equal to ten nucleotides and of
sufficient length to stably interact with the target RNA;
specifically 10-30 nucleotides; more specifically any integer
between 10 and 30 nucleotides, such as 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30. By
"sufficient length" is meant a nucleotide of greater than or equal
to 10 nucleotides that is of a length great enough to provide the
intended function under the expected condition. The term "stably
interact" refers to interaction of the small interfering RNA with
target nucleic acid (e.g., by forming hydrogen bonds with
complementary nucleotides in the target under physiological
conditions).
[0060] The term "therapeutically effective amount", in reference to
the treating, preventing or suppressing of a disease state, refers
to an amount of a compound either alone or as contained in a
pharmaceutical composition that is capable of having any
detectable, positive effect on any symptom, aspect, or
characteristics of the disease state/condition. Such effect need
not be absolute to be beneficial.
[0061] The terms "treat", "treating" and "treatment" as used herein
refers to administering a compound either alone or as contained in
a pharmaceutical composition after the onset of clinical symptoms
of a disease state so as to reduce or eliminate any symptom, aspect
or characteristic of the disease state. Such treating need not be
absolute to be useful.
[0062] The term "variant" of a molecule is a sequence that is
substantially similar to the sequence of the native molecule. For
nucleotide sequences, variants include those sequences that,
because of the degeneracy of the genetic code, encode the identical
amino acid sequence of the native protein. Naturally occurring
allelic variants such as these can be identified with the use of
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR) and hybridization techniques. Variant
nucleotide sequences also include synthetically derived nucleotide
sequences, such as those generated, for example, by using
site-directed mutagenesis, which encode the native protein, as well
as those that encode a polypeptide having amino acid substitutions.
Generally, nucleotide sequence variants of the invention will have
at least about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, to
99% sequence identity to the native (endogenous) nucleotide
sequence.
[0063] The term "vector" refers to a nucleic acid that can be used
to introduce another nucleic acid linked to it into a cell. One
type of vector is a "plasmid," which refers to a linear or circular
double stranded DNA molecule into which additional nucleic acid
segments can be ligated. Another type of vector is a viral vector
(e.g., replication defective retroviruses, adenoviruses and
adeno-associated viruses), wherein additional DNA segments can be
introduced into the viral genome. Certain vectors are capable of
autonomous replication in a host cell into which they are
introduced (e.g., bacterial vectors comprising a bacterial origin
of replication and episomal mammalian vectors). Other vectors
(e.g., non-episomal mammalian vectors) are integrated into the
genome of a host cell upon introduction into the host cell, and
thereby are replicated along with the host genome. An "expression
vector" is a type of vector that can direct the expression of a
chosen polynucleotide and may comprise an expression control
element which will control, at least in part, the expression of the
polynucleotide. Expression control elements are known in the art
and include various promoters.
Isolated Nucleic Acids and Purified Polypeptides
[0064] In one aspect, the present disclosure provides novel
isolated nucleic acids, including variants and fragments thereof.
In one embodiment, the isolated nucleic acids correspond to the
fusion transcripts of the present disclosure, or a fragment
thereof. In one embodiment, the fusion transcript is the
IL17RC-CRELD1 fusion transcript, the SCNN1A-TNFRSF1A fusion
transcript or the CTSD-IFITM10 fusion transcript. In one
embodiment, the nucleic acid coding for a fragment of the fusion
transcript of the present disclosure corresponds to a junction
region (a region containing sequence from both the 5' and 3' fusion
partners) of a fusion transcript of the present disclosure. In one
embodiment, the fusion junction is from the IL17RC-CRELD1 fusion
transcript, the SCNN1A-TNFRSF1A fusion transcript or the
CTSD-IFITM10 fusion transcript.
[0065] In another embodiment, the present disclosure provides novel
isolated nucleic acids coding for a fusion polypeptide of the
present disclosure or a fragment thereof. In one embodiment, the
fusion polypeptide is the IL17RC-CRELD1 fusion polypeptide, the
SCNN1A-TNFRSF1A fusion polypeptide or the CTSD-IFITM10 fusion
polypeptide. In one embodiment, the nucleic acid coding for a
fragment of the fusion polypeptide of the present disclosure is an
isolated nucleic acid molecule coding for a junction region (a
region containing sequence from both the 5' and 3' fusion partners)
of a fusion polypeptide of the present disclosure. In one
embodiment, the fusion junction is from the IL17RC-CRELD1 fusion
polypeptide, the SCNN1A-TNFRSF1A fusion polypeptide or the
CTSD-IFITM10 fusion polypeptide. Such an isolated nucleic acid
molecule may code for at least 3, at least 5 or at least 10 amino
acid residues of each partner of the fusion polypeptide. In yet
another aspect, the present disclosure provides methods for making
the isolated nucleic acids and purified polypeptides in an
expression system, such as a vector.
[0066] In one embodiment, the isolated nucleic acid comprises the
sequence of SEQ ID NO: 1, or a fragment thereof. SEQ ID NO: 1
provides the nucleic acid sequence corresponding to the junction
region of the IL17RC-CRELD1 fusion transcript. In one embodiment,
the isolated nucleic acid comprises the sequence of SEQ ID NO: 8,
or a fragment thereof. SEQ ID NO:8 provides the predicted cDNA
sequence corresponding to the full length IL17RC-CRELD1 fusion
transcript. In one embodiment, the fragment of SEQ ID NO: 8
corresponds to or comprises a junction region of the IL17RC-CRELD1
fusion transcript.
[0067] In another embodiment, the isolated nucleic acid comprises
the polynucleotide sequence of SEQ ID NO: 2, or a fragment thereof.
SEQ ID NO: 2 provides the nucleic acid sequence corresponding to
the junction region of the SCNN1A-TNFRSF1A fusion transcript. In
one embodiment, the isolated nucleic acid comprises the sequence of
SEQ ID NO: 10, or a fragment thereof. SEQ ID NO: 10 provides the
predicted cDNA sequence corresponding to the full length
SCNN1A-TNFRSF1A fusion transcript. In one embodiment, the fragment
of SEQ ID NO: 10 corresponds to or comprises a junction region of
the SCNN1A-TNFRSF1A fusion transcript.
[0068] In another embodiment, the isolated nucleic acid comprises
the polynucleotide sequence of SEQ ID NO: 3, or a fragment thereof.
SEQ ID NO: 3 provides the nucleic acid sequence corresponding to
the junction region of the CTSD-IFITM10 fusion transcript. In one
embodiment, the isolated nucleic acid comprises the sequence of SEQ
ID NO: 12, or a fragment thereof. SEQ ID NO: 12 provides the
predicted cDNA sequence corresponding to the full length
CTSD-IFITM10 fusion transcript. In one embodiment, the fragment of
SEQ ID NO: 12 corresponds to or comprises a junction region of the
CTSD-IFITM10 fusion transcript.
[0069] In another aspect, the present disclosure provides novel
isolated polypeptides. In one embodiment, the present disclosure
provides novel isolated fusion polypeptides, or a fragment thereof.
In one embodiment, the fusion polypeptide is the IL17RC-CRELD1
fusion polypeptide, the SCNN1A-TNFRSF1A fusion polypeptide or the
CTSD-IFITM10 fusion polypeptide. In one embodiment, the fragment of
the fusion polypeptide of the present disclosure is a fragment
containing a junction region (a region containing sequence from
both the 5' and 3' fusion partners) of a fusion polypeptide of the
present disclosure. In one embodiment, the fusion junction is from
the IL17RC-CRELD1 fusion polypeptide, the SCNN1A-TNFRSF1A fusion
polypeptide or the CTSD-IFITM10 fusion polypeptide. Such
polypeptide fragment may contain at least 3, at least 5 or at least
10 amino acid residues of each partner of the fusion
polypeptide.
[0070] In one embodiment, the isolated fusion polypeptide comprises
the amino acid sequence of SEQ ID NO: 4, or a fragment thereof. SEQ
ID NO: 4 provides the amino acid sequence corresponding to the
junction region of the IL17RC-CRELD1 fusion polypeptide. In another
embodiment, SEQ ID NO: 5 provides a different amino acid sequence
corresponding to the junction region of the IL17RC-CRELD1 fusion
polypeptide. In one embodiment, the isolated fusion polypeptide
comprises the amino acid of SEQ ID NO: 9, or a fragment thereof.
SEQ ID NO: 9 provides the predicted amino acid sequence
corresponding to the full length IL17RC-CRELD1 fusion transcript.
In one embodiment, the fragment of SEQ ID NO: 9 corresponds to or
comprises a junction region of the IL17RC-CRELD1 fusion transcript.
In one embodiment, the isolated fusion polypeptide comprises the
amino acid of SEQ ID NO: 13, or a fragment thereof. SEQ ID NO: 13
provides the predicted amino acid sequence corresponding to the
full length IL17RC-CRELD1 fusion transcript. In one embodiment, the
fragment of SEQ ID NO:13 corresponds to or comprises a junction
region of the IL17RC-CRELD1 fusion transcript.
[0071] In another embodiment, the isolated fusion polypeptide
comprises the amino acid sequence of SEQ ID NO: 6, or a fragment
thereof. SEQ ID NO: 6 provides the amino acid sequence
corresponding to the junction region of the SCNN1A-TNFRSF1A fusion
polypeptide. In one embodiment, the isolated fusion polypeptide
comprises the amino acid of SEQ ID NO: 11, or a fragment thereof.
SEQ ID NO: 11 provides the predicted amino acid sequence
corresponding to the full length SCNN1A-TNFRSF1A fusion transcript.
In one embodiment, the fragment of SEQ ID NO: 11 corresponds to or
comprises a junction region of the SCNN1A-TNFRSF1A fusion
transcript.
[0072] In another embodiment, the isolated fusion polypeptide
comprises the amino acid sequence of SEQ ID NO: 7, or a fragment
thereof. In one embodiment, the isolated fusion polypeptide
comprises the amino acid of SEQ ID NO: 14, or fragments thereof.
SEQ ID NO: 14 provides the predicted amino acid sequence
corresponding to the full length CTSD-IFITM10 fusion transcript
incorporating the junction region of SEQ ID NO: 7. In one
embodiment, the fragment of SEQ ID NO: 14 corresponds to or
comprises a junction region of the CTSD-IFITM10 fusion
transcript.
[0073] In yet another aspect, the present disclosure provides a
method of making the isolated polynucleotides or the purified
polypeptides. Any expression system known in the art can be used to
make the isolated polynucleotides or the purified polypeptides of
the invention. In general, host cells are transformed with a
recombinant expression vector that comprises DNA encoding a desired
polypeptide. Among the host cells that may be employed are
prokaryotes, yeast or higher eukaryotic cells. Prokaryotes include
gram negative or gram positive organisms, for example E. coli or
bacilli. Higher eukaryotic cells include insect cells and
established cell lines of mammalian origin. Examples of suitable
mammalian host cell lines include the COS-7 line of monkey kidney
cells (ATCC CRL 1651) (Gluzman et al, 1981, Cell 23:175), L cells,
293 cells, CI 27 cells, 3T3 cells (ATCC CCL 163), Chinese hamster
ovary (CHO) cells, HeLa cells, BHK (ATCC CRL 10) cell lines, and
the CV1/EBNA cell line derived from the African green monkey kidney
cell line CV1 (ATCC CCL 70) as described by McMahan et al, 1991,
EMBO J. 10: 2821. Appropriate cloning and expression vectors for
use with bacterial, fungal, yeast, and mammalian cellular hosts are
described by Pouwels et al. {Cloning Vectors: A Laboratory Manual,
Elsevier, New York, 1985).
[0074] The transformed cells can be cultured under conditions that
promote expression of the polypeptide, and the polypeptide
recovered by conventional protein purification procedures. One such
purification procedure includes the use of affinity chromatography.
Polypeptides contemplated for use herein include substantially
homogeneous recombinant mammalian antibody polypeptides
substantially free of contaminating endogenous materials.
Preparation of Antigen Binding Agents and Proteins
[0075] In another aspect, the resent disclosure provides for the
making of antigen binding agents and proteins prepared by any of a
number of conventional techniques. For example, they may be
purified from cells that naturally express them (e.g., an antibody
can be purified from a hybridoma that produces it), or produced in
recombinant expression systems, using any technique known in the
art. See, for example, Monoclonal Antibodies, Hybridomas: A New
Dimension in Biological Analyses, Kennet et al. (eds.), Plenum
Press, New York (1980); and Antibodies: A Laboratory Manual, Harlow
and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., (1988).
[0076] Antigen binding proteins may be prepared, and screened for
desired properties, by any of a number of known techniques. Certain
of the techniques involve isolating a nucleic acid encoding a
polypeptide chain (or portion thereof) of an antigen binding
protein of interest, and manipulating the nucleic acid through
recombinant DNA technology. The nucleic acid may be fused to
another nucleic acid of interest, or altered {e.g., by mutagenesis
or other conventional techniques) to add, delete, or substitute one
or more amino acid residues, for example.
[0077] Complementarity determining regions (CDRs) and framework
regions (FR) of a given antibody may be identified using the system
described by Kabat et al. in Sequences of Proteins of Immunological
Interest, 5.sup.th Ed., US Dept. of Health and Human Services, PHS,
NIH, NIH Publication no. 91-3242, 1991. One or more CDRs may be
incorporated into a molecule either covalently or noncovalently to
make it an antigen binding protein. An antigen binding protein may
incorporate the CDR(s) as part of a larger polypeptide chain, may
covalently link the CDR(s) to another polypeptide chain, or may
incorporate the CDR(s) noncovalently. The CDRs permit the antigen
binding protein to specifically bind to a particular antigen of
interest.
[0078] Fragments or analogs of antibodies can be readily prepared
by those of ordinary skill in the art following the teachings of
this specification and using techniques well-known in the art.
Preferred amino- and carboxy-termini of fragments or analogs occur
near boundaries of functional domains. Structural and functional
domains can be identified by comparison of the nucleotide and/or
amino acid sequence data to public or proprietary sequence
databases. Computerized comparison methods can be used to identify
sequence motifs or predicted protein conformation domains that
occur in other proteins of known structure and/or function. Methods
to identify protein sequences that fold into a known
three-dimensional structure are known. See, e.g., Bowie et al,
1991, Science 253: 164.
[0079] Numerous methods of preparing bispecific antibodies are
known in the art, and discussed in, e.g., U.S. patent application
Ser. No. 09/839,632, filed Apr. 20, 2001 (incorporated by reference
herein). Such methods include the use of hybrid-hybridomas as
described by Milstein et al, 1983, Nature 305:537, and others (U.S.
Pat. No. 4,474,893, U.S. Pat. No. 6,106,833), and chemical coupling
of antibody fragments (Brennan et al, 1985, Science 229:81; Glennie
et al., 1987, J. Immunol. 139:2367; U.S. Pat. No. 6,010,902).
Moreover, bispecific antibodies can be produced via recombinant
means, for example by using leucine zipper moieties (i.e., from the
Fos and Jun proteins, which preferentially form heterodimers;
Kostelny et al., 1992, J. Immunol. 148: 1547) or other lock and key
interactive domain structures as described in U.S. Pat. No.
5,582,996. Additional useful techniques include those described in
Kortt et al., 1997, supra; U.S. Pat. No. 5,959,083; and U.S. Pat.
No. 5,807,706.
[0080] Antibodies according to the invention will typically have a
K.sub.d in the range of 10.sup.-7 to 10.sup.-3 M; in some preferred
embodiments the antibodies have a K.sub.d of less than 10.sup.-9 M.
In one embodiment, the antibodies of the invention specifically
bind to the disclosed fusion proteins with higher affinity than
they bind to other targets, including to the individual fusion
partners IL17RC, CRELD1, SCNN1A, TNFRSF1A, CTSD and IFITM10. In
some preferred embodiments the antibodies bind the fusion
polypeptides with at least 10-fold higher affinity than they bind
any of the individual fusion partners; in some preferred
embodiments the antibodies bind the fusion polypeptides with at
least 100-fold higher affinity than they bind any of the fusion
partners.
[0081] In some embodiments of the invention a bispecific binding
agent, e.g., a bispecific antibody, recognizes the fusion proteins,
with one antigen-binding site recognizing SCNN1A and another
antigen-binding site recognizing TNFRSF1A. In some embodiments one
antigen-binding site recognizes the fusion protein and another
antigen-binding site recognizes another antigen such as, e.g., an
antigen expressed on a T-cell in order to leverage the cytotoxicity
of T cells. In some embodiments the bispecific antibodies have a
lower affinity, e.g., a K.sub.d of greater than 100 nM for each
arm, in order to take advantage of the avidity enhancement that can
result from bispecific binding.
Methods of Diagnosis
[0082] As illustrated in FIGS. 1-3, the fusion transcripts and the
resulting fusion polypeptides described herein are expressed in
certain tumors, including breast tumors. In one embodiment, such
fusion transcripts and fusion polypeptides are expressed in breast
cancer. In one embodiment, such fusion transcripts and fusion
polypeptides exhibit differentially increased expression in breast
cancer and as compared to normal breast cells and other neoplastic
tissue. In one embodiment, such fusion transcripts and fusion
polypeptides exhibit differentially increased expression in human
breast cancer as compared to normal human breast cells and other
human neoplastic tissue. In one embodiment, such fusion transcripts
and fusion polypeptides exhibit differentially increased expression
in estrogen receptor positive (ER+) breast cancer primary tumors
and triple negative breast cancer (TNBC) primary tunors as compared
to normal breast cells and other neoplastic tissue. In one
embodiment, such fusion transcripts are significantly associated
with human breast cancer; in one such embodiment, the human breast
cancer is ER+ breast cancer or TNBC.
[0083] RNA-seq (35) was performed on a total of 168 human samples,
including 28 breast cancer cell lines, 42 fresh frozen triple
negative breast cancer (TNBC) primary tumors, 42 fresh frozen
estrogen receptor positive (ER+) breast cancer primary tumors, 21
fresh frozen non-neoplastic breast tissue samples that were
adjacent to TNBC tumors, 30 fresh frozen non-neoplastic breast
tissue samples that were adjacent to ER+ breast tumors, and 5 fresh
frozen normal breast tissue samples that were collected from
cancer-free patients during reduction mammoplasty procedures.
RNA-seq data from 13 non-neoplastic human tissues collected by the
Illumina Body Map 2.0 project was obtained, which includes adipose,
brain, breast, colon, heart, kidney, liver ovary, prostate,
skeletal muscle, testes, thyroid and white blood cells (15). The
ChimeraScan software package was used to identify read-through
transcripts in the RNA-seq data (36).
[0084] With these methods, 17 candidate read-through fusion
transcripts were identified that were supported by at least 10
read-pairs that connect adjacent genes and at least one read that
spanned the fusion junction in more than two breast cancer samples.
Six fusion polypeptides were also detected in one or more
non-neoplastic tissues from the Illumina Human Body Map 2.0 project
and three transcripts were assigned to pairs of putative
transcripts whose boundaries are not well defined. The remaining
eight transcripts are breast tissue-specific read-through fusion
transcripts. Read-through fusion transcripts with fusion
junction-spanning reads are depicted in FIG. 1, and the number of
fusion junction-spanning reads in each sample is reported in
Supplemental Table 1.
[0085] For each of the eight fusion transcripts, it was determined
how many samples had at least one fusion junction-spanning read out
of a collection of breast cancer cell lines, TNBC primary tumors,
ER+ primary tumors, normal uninvolved tissue adjacent to each
primary tumor type, and cancer-free normal tissue from reduction
mammoplasty procedures (Table 1). Table 1 characterizes the
read-through fusion transcripts detected in breast cell line and
breast tissue samples. For each fusion transcript the number of
samples containing junction-spanning reads is listed. Read-through
fusion transcripts significantly associated with breast cancer are
IL17RC/CRELD1, SCNN1A/TNFRSF1A and CTSD/IFITM10 and p-values are
listed in the last column. * More prevalent in non-cancer
samples.
[0086] To determine which read-through fusion transcripts were
associated with breast cancer Fisher's Exact test was used to
identify fusions that were significantly overrepresented in the
breast cancer samples compared to the non-cancer breast samples
(Table 1). Five of the read-through fusion transcripts were found
at high frequency in normal breast tissue and were not
significantly associated with breast cancer (KLF6-REXO1,
VAX2-ATP6V1B1, LOC100132832-CCDC146, MFGE8-HAPLN3, and
CACNG4-CACNG1; Table 1).
TABLE-US-00001 Normal ER+ Normal Uninvolved Breast Breast
Uninvolved Tissue Cancer-Free Cancer TNBC Cancer Tissue Adjacent to
Reduction Cancer vs. Cell Primary Primary Adjacent to ER+ Breast
Mammoplasty Normal Lines Tumors Tumors TNBC Cancer Breast Tissue
Human Body Fisher's Exact Fusion Transcripts (N = 28) (N = 42) (N =
42) (N = 21) (N = 30) (N = 5) Map (N = 13) Test p-value KLF16-REXO1
7 (25%) 18 (43%) 16 (38%) 14 (67%) 15 (50%) 2 (40%) 0 (0%) 0.1699*
VAX2-ATP6V1B1 6 (21%) 8 (19%) 4 (10%) 4 (19%) 3 (10%) 2 (40%) 0
(0%) 0.3711 LOC100132832- 2 (7%) 11 (26%) 5 (12%) 5 (24%) 3 (10%) 1
(20%) 0 (0%) 0.3711 CCDC146 MFGE8-HAPLN3 4 (14%) 23 (55%) 4 (10%) 4
(19%) 7 (23%) 1 (20%) 0 (0%) 0.0794 CACNG4- 2 (7%) 2 (5%) 12 (29%)
1 (5%) 3 (10%) 0 (0%) 0 (0%) 0.0600 CACNG1 IL17RC-CRELD1 3 (11%) 11
(26%) 4 (10%) 3 (14%) 1 (3%) 0 (0%) 0 (0%) 0.0306 SCNN1A- 10 (36%)
3 (7%) 5 (12%) 1 (5%) 1 (3%) 0 (0%) 0 (0%) 0.0039 TNFRSF1A
CTSD-IFITM10 7 (25%) 9 (21%) 5 (12%) 0 (0%) 0 (0%) 0 (0%) 0 (0%)
<0.0001
[0087] Three read-through fusion transcripts were significantly
associated with breast cancer (IL7RC-CRELD1, SCNN1A-TNFRSF1A and
CTSD-IFITM10; Fisher's Exact Test p-values in Table 1). Two of
these breast-cancer associated fusion transcripts were detected
across breast tumors but were also detected at a lower frequency in
normal uninvolved tissue that was adjacent to the primary tumors
(IL17RC-CRELD1, and SCNN1A-TNFRSF1A) (Table 1). The breast tumors
underwent macro-dissection to enrich for tumor cells; however the
adjacent normal uninvolved tissue was not dissected. Pathologists
used a quality control section to diagnose the uninvolved tissue,
but the specimen could have had infiltrating tumor cells or tumor
exosomes containing mRNA deeper within the specimen. Neither of
these fusions was detected in the cancer-free normal breast tissues
from reduction mammoplasty procedures, suggesting that the low
frequency of these fusions in the normal uninvolved tissue adjacent
to tumors could be due to field defects. One fusion transcript,
CTSD-IFITM10, was identified exclusively in breast cancer samples.
All three of the breast cancer associated fusions were present in
both ER+ and TNBC, and while they are present in different
frequencies between the breast cancer subtypes, none are exclusive
to a particular subtype. One or more of the breast cancer
associated read-through fusion transcript were detected in 50%
(14/28) of the breast cancer cell lines, 43% (18/42) of the TNBC
primary tumors, and 24% (10/42) of the ER+ breast cancer primary
tumors demonstrating that these are frequent events in breast
cancer.
[0088] All three of the breast cancer associated read-through
fusion transcripts are spliced together using the last splice donor
from the 5' fusion partner and the first splice acceptor in the 3'
gene partner, skipping the last exon of the 5' fusion partner and
the first exon of the 3' gene partner (FIG. 1). For example, CTSD
has nine (9) exons and IFITM10 has three (3) exons, so the
CTSD/IFITM10 fusion protein is spliced at the eighth (8.sup.th)
exon of CTSD and the second (2.sup.nd) exon of IFITM10.
[0089] In each case, this results in splicing together nearly the
full-length transcripts for both genes. Normally the 5' fusion
partner's transcript should be terminated by cleavage of the
nascent transcript followed by polyadenylation (37). These
read-through fusion transcripts have not been cleaved at the 5'
partner gene's polyA signal and the 5' partner gene's terminal exon
splice acceptor site has been skipped to allow splicing between the
adjacent genes. It is increasingly evident that the processes of
transcription, splicing, 3' transcript cleavage, and
polyadenylation are coupled (38).
[0090] One possible explanation for the generation of read-through
fusion transcripts is that the 5' partner gene's terminal exon was
skipped because of a mutation at the splice acceptor site, which
could hinder formation of the 3'-terminal exon-definition complex
and subsequent cleavage/polyadenylation. If this were to occur,
then the next available splice acceptor site would be at the 3'
partner gene's 2.sup.nd exon, consistent with the observed splice
junctions. To test this possibility, 200 bp surrounding the 5'
fusion partner gene's skipped splice acceptor site were amplified
from DNA of cell lines with and without the fusion transcripts and
sequenced the amplicons on an Illumina MiSeq machine. No mutations
at or near the splice acceptor sites were found associated with the
presence of the fusion transcripts. Both alleles of heterozygous
SNPs occur at expected frequencies, so deletion of the splice sites
is also unlikely. Because the processes of transcription, splicing,
3' transcript cleavage, and polyadenylation can act both
synergistically and competitively (38), it is possible that the
kinetics of transcription at these loci is disrupted in breast
cancer cells in a way that allows the formation of read-through
fusion transcripts.
[0091] To determine if the expression level of each fusion partner
gene was correlated with the presence of the fusion, the sequencing
read depth for the canonical transcripts and fusion transcripts was
quantified. In each of the samples containing fusion
junction-spanning reads, the fraction of reads near the fusion
junction that include sequence from the fusion transcript rather
than the un-fused canonical transcripts was calculated (FIG. 2a).
In each case, the fraction of reads from the 3' fusion partner that
is involved in the fusion is significantly higher than the fraction
of reads from the 5' partner that is participating in the fusion
(Mann Whitney test: IL17RC vs CRELD1 p<0.0001, SCNN1A vs
TNFRSF1A p=0.0247, and CTSD vs IFITM10 p<0.0001). This indicates
that a larger proportion of the transcription of the 3' partner is
created from read-through transcripts, and the promoter of the 5'
fusion partner likely regulates this expression. The expression of
the 5' fusion partner in samples with and without evidence of the
fusion transcript was examined and it was discovered that there was
no difference in expression levels of IL17RC, SCNN1A or TNFRSF1A
between samples with and without the fusion, indicating that the
expression level of the 5' gene partner is not associated with the
presence of these fusions nor was the expression level of the 5'
gene partner associated with our power to detect the fusion (FIG.
2b). Because the presence of the fusion transcripts is independent
of the expression level of the partner genes, this suggests that
other factors are responsible for their creation and
regulation.
[0092] All three of the breast cancer-associated read-through
fusion transcripts we identified involved genes that encode
membrane proteins. These proteins' functions rely on their correct
placement in the membrane and correct participation in protein
complexes. IL17RC is a single-pass type I membrane protein that
binds the proinflammatory cytokines, IL-17A and IL-17F (39). It is
fused to CRELD1, a membrane protein that contains an epidermal
growth factor-like domain and is thought to function as a cell
adhesion molecule (40). SCNN1A is an alpha subunit of
nonvoltage-gated, amiloride-sensitive, sodium channels (41). It is
fused to TNFRSF1A, a tumor necrosis factor-alpha receptor that
activates NF-kappaB, mediates apoptosis, and regulates inflammatory
responses (42). CTSD is a lysosomal aspartyl protease that also
functions as a secreted protein that binds membrane receptors and
has previously been associated with breast cancer (43). It is fused
to IFITM10, a member of a family of membrane proteins that are
induced by interferon and are involved in cell proliferation and
cell adhesion (44). All of these read-through fusion transcripts
join genes that have disparate functions, suggesting that a fused
protein could impair normal function in breast cancer.
[0093] The length of the fusion protein based upon the location of
the inter-gene splicing, was predicted and Western blots were used
with an antibody raised against one of the native partner proteins
to determine whether a protein of the predicted fusion size could
be detected in cell lysates from cell lines with and without RNA
transcript evidence of the fusion. Specific Western blots of the
targeted protein at the expected canonical size and detected
protein at the predicted fusion size specifically in the cell lines
with the fusion transcripts were observed, and not in cell lines
without the fusions for all three of the breast cancer associated
read-through fusion transcripts (FIG. 3). The cell line with the
most fusion-spanning reads was positive for the fusion in all three
Western blots, and in the case of the SCNN1A-TNFRSF1A, the cell
line with the second highest number of fusion-spanning reads, was
also positive by Western blot. These results suggest that the
breast-cancer associated read-through fusion transcripts are
translated into fusion proteins.
[0094] Detecting expression and/or expression levels of the fusion
proteins in tissue samples can therefore be used to identify a
tumor, characterize a tumor, or to monitor the effects of treatment
on tumors that express the identified fusion proteins. In some
embodiments expression is detected at the RNA level, using methods
described herein and known in the art such as Quantitative PCR,
hybridization, in situ hybridization, nanostring technology (such
as that described in U.S. Pat. No. 7,473,767), and nucleic acid
sequencing. In some embodiments, expression is detected at the
protein level, using methods described herein and known in the art
such as immunoprecipitation, immunohistochemistry (IHC), Western
blot analysis, flow cytometry, ELISA, immunoassays with antibody
detection, and mass spectrometry.
Pharmaceutical Compositions, Modes of Administration and Methods of
Treatment
[0095] The present disclosure provides methods for the treatment
and/or prevention of a disease state that is characterized, at
least in part, by the expression of an IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion polypeptide. In one
embodiment, the disease state is characterized, at least in part,
by the differentially increased expression of an IL17RC-CRELD1,
SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion transcript or fusion
polypeptide. In one embodiment, such a fusion transcript has the
sequence of SEQ ID NOS: 1, 2, 3, 8, 11 or 12 or fragments or
variants thereof. In one embodiment, such a fusion transcript has
the sequence of SEQ ID NOS: 4, 5, 6, 7, 9, 11, 13 or 14 or
fragments or variants thereof.
[0096] In one embodiment, such fusion transcripts and fusion
polypeptides are expressed in a patient suffering from breast
cancer. In one embodiment, such fusion transcripts and fusion
polypeptides exhibit differentially increased expression in breast
cancer and as compared to normal breast cells and other neoplastic
tissue. In one embodiment, such fusion transcripts and fusion
polypeptides exhibit differentially increased expression in human
breast cancer as compared to normal human breast cells and other
human neoplastic tissue. In one embodiment, such fusion transcripts
and fusion polypeptides exhibit differentially increased expression
in estrogen receptor positive (ER+) breast cancer and/or triple
negative breast cancer (TNBC) as compared to normal breast cells
and other neoplastic tissue. In one embodiment, such fusion
transcripts are significantly associated with human breast cancer;
in one such embodiment, the human breast cancer is ER+ breast
cancer or TNBC. In one embodiment, the disease state is a cancer,
such as but not limited to breast cancer. In one embodiment, the
breast cancer ER+ breast cancer of TNBC.
[0097] The present disclosure provides for compounds that may be
used in the methods of treatment and prevention described herein.
The compound used in the treatment and/or prevention may be
provided alone or as a part of a pharmaceutical composition
comprising a pharmaceutically acceptable carrier and other
ingredients known in the art. The pharmaceutically acceptable
carriers described herein, include, but are not limited to,
vehicles, adjuvants, excipients, or diluents, are well-known to
those who are skilled in the art. Typically, the pharmaceutically
acceptable carrier is chemically inert to the active compounds and
has no detrimental side effects or toxicity under the conditions of
use. The pharmaceutically acceptable carriers can include polymers
and polymer matrices.
[0098] In one embodiment, the method of treatment and/or prevention
comprises contacting a cell of a subject with an antigen binding
agent of the present disclosure. In one embodiment, the method of
treatment and/or prevention comprises administering to a subject an
antigen binding agent of the present disclosure. In such
embodiments, the antigen binding agent is an antibody, such as, but
not limited to, a monoclonal antibody or a polyclonal antibody.
Bispecific antibodies are included therein. In such embodiment, the
antigen binding agent may be provided in a therapeutically
effective amount. In such embodiment, the methods may further
comprise identifying a subject in need of such treatment or
prevention. In one embodiment of the foregoing, such a subject may
be screened to determine the presence of a fusion transcript or
fusion polypeptide of the present disclosure. Further such subject
may be screened to determine if the subject has ER+ breast cancer
or TNBC.
[0099] The compounds and pharmaceutical compositions can be
administered by any conventional method available for use in
conjunction with pharmaceuticals, either individually or in
combination with additional therapeutic agents. In one embodiment,
the compounds and pharmaceutical compositions are administered in
therapeutically effective amount. The therapeutically effective
amount and the dosage of the compound or pharmaceutical composition
administered will, of course, vary depending upon known factors,
such as the pharmacodynamic characteristics; the mode and route of
administration; the age, health and weight of the subject; the
severity and stage of the disease state; the kind of concurrent
treatment; the frequency of treatment; and the effect desired. The
total amount of the compound (i.e. active ingredient) administered
will also be determined by the route, timing and frequency of
administration as well as the existence, nature, and extent of any
adverse side effects that might accompany the administration of the
compound and the desired physiological effect. It will be
appreciated by one skilled in the art that various conditions or
disease states, in particular chronic conditions or disease states,
may require prolonged treatment involving multiple
administrations.
[0100] A daily dosage of active ingredient can be expected to be
about 0.001 to 1000 milligrams (mg) per kilogram (kg) of body
weight. In one embodiment, the total amount is between about 0.1
mg/kg and about 1000 mg/kg of body weight; in an alternate
embodiment between about 1.1 mg/kg and about 100 mg/kg of body
weight; in yet another alternate embodiment between 0.1 mg/kg and
about 30 mg/kg of body weight. The above described amounts may be
administered as a series of smaller doses over a period of time if
desired. As would be obvious, the dosage of active ingredient may
be given other than daily if desired.
[0101] Dosage forms of the pharmaceutical compositions described
herein (forms of the pharmaceutical compositions suitable for
administration) may contain from about 0.1 mg to about 500 mg of
active ingredient per unit. In these pharmaceutical compositions,
the active ingredient will ordinarily be present in an amount of
about 0.5-95% weight based on the total weight of the composition.
Multiple dosage forms may be administered as part of a single
treatment.
[0102] The active ingredient can be administered orally in solid
dosage forms, such as capsules, tablets, and powders, or in liquid
dosage forms, such as elixirs, syrups and suspensions. It can also
be administered parenterally, in sterile liquid dosage forms. The
active ingredient can also be administered intranasally (nose
drops) or by inhalation via the pulmonary system, such as by
propellant based metered dose inhalers or dry powders inhalation
devices. Other dosage forms are potentially possible such as
administration transdermally, via patch mechanisms or ointment.
[0103] Formulations suitable for oral administration can consist of
(a) liquid solutions, such as a pharmaceutically effective amount
of the compound dissolved in diluents, such as water, saline, or
orange juice; (b) capsules, sachets, tablets, lozenges, and
troches, each containing a predetermined pharmaceutically effective
amount of the active ingredient, as solids or granules; (c)
powders; (d) suspensions in an appropriate liquid; and (e) suitable
emulsions. Liquid formulations may include diluents, such as water
and alcohols, for example, ethanol, benzyl alcohol, propylene
glycol, glycerin, and the polyethylene alcohols, either with or
without the addition of a pharmaceutically acceptable surfactant,
suspending agent, or emulsifying agent. Capsule forms can be of the
ordinary hard- or soft-shelled gelatin type containing, for
example, surfactants, lubricants, and inert fillers, such as
lactose, sucrose, calcium phosphate, and corn starch. Tablet forms
can include one or more of the following: lactose, sucrose,
mannitol, corn starch, potato starch, alginic acid,
microcrystalline cellulose, acacia, gelatin, guar gum, colloidal
silicon dioxide, croscarmellose sodium, talc, magnesium stearate,
calcium stearate, zinc stearate, stearic acid, and other
excipients, colorants, diluents, buffering agents, disintegrating
agents, moistening agents, preservatives, flavoring agents, and
pharmacologically compatible carriers. Lozenge forms can comprise
the active ingredient in a flavor, usually sucrose and acacia or
tragacanth, as well as pastilles comprising the active ingredient
in an inert base, such as gelatin and glycerin, or sucrose and
acadia, emulsions, and gels containing, in addition to the active
ingredient, such carriers as are known in the art.
[0104] Formulations suitable for parenteral administration include
aqueous and non-aqueous, isotonic sterile injection solutions,
which can contain anti-oxidants, buffers, bacteriostats, and
solutes that render the formulation isotonic with the blood of the
patient, and aqueous and non-aqueous sterile suspensions that can
include suspending agents, solubilizers, thickening agents,
stabilizers, and preservatives. The compound can be administered in
a physiologically acceptable diluent in a pharmaceutically
acceptable carrier, such as a sterile liquid or mixture of liquids,
including water, saline, aqueous dextrose and related sugar
solutions, an alcohol, such as ethanol, isopropanol, or hexadecyl
alcohol, glycols, such as propylene glycol or polyethylene glycol
such as poly(ethyleneglycol) 400, glycerol ketals, such as
2,2-dimethyl-1,3-dioxolane-4-methanol, ethers, an oil, a fatty
acid, a fatty acid ester or glyceride, or an acetylated fatty acid
glyceride with or without the addition of a pharmaceutically
acceptable surfactant, such as a soap or a detergent, suspending
agent, such as pectin, carbomers, methylcellulose,
hydroxypropylmethylcellulose, or carboxymethylcellulose, or
emulsifying agents and other pharmaceutical adjuvants.
[0105] Oils, which can be used in parenteral formulations, include
petroleum, animal, vegetable, or synthetic oils. Specific examples
of oils include peanut, soybean, sesame, cottonseed, corn, olive,
petrolatum, and mineral. Suitable fatty acids for use in parenteral
formulations include oleic acid, stearic acid, and isostearic acid.
Ethyl oleate and isopropyl myristate are examples of suitable fatty
acid esters. Suitable soaps for use in parenteral formulations
include fatty alkali metal, ammonium, and triethanolamine salts,
and suitable detergents include (a) cationic detergents such as,
for example, dimethyldialkylammonium halides, and alkylpyridinium
halides, (b) anionic detergents such as, for example, alkyl, aryl,
and olefin sulfonates, alkyl, olefin, ether, and monoglyceride
sulfates, and sulfosuccinates, (c) nonionic detergents such as, for
example, fatty amine oxides, fatty acid alkanolamides, and
polyoxyethylene polypropylene copolymers, (d) amphoteric detergents
such as, for example, alkyl .beta.-aminopropionates, and
2-alkylimidazoline quaternary ammonium salts, and (e) mixtures
thereof.
[0106] The parenteral formulations typically contain from about
0.5% to about 25% by weight of the active ingredient in solution.
Suitable preservatives and buffers can be used in such
formulations. In order to minimize or eliminate irritation at the
site of injection, such compositions may contain one or more
nonionic surfactants having a hydrophile-lipophile balance (HLB) of
from about 12 to about 17. The quantity of surfactant in such
formulations ranges from about 5% to about 15% by weight. Suitable
surfactants include polyethylene sorbitan fatty acid esters, such
as sorbitan monooleate and the high molecular weight adducts of
ethylene oxide with a hydrophobic base, formed by the condensation
of propylene oxide with propylene glycol.
[0107] Forms of systemic administration of the pharmaceutical
compositions include injection and infusion. Such injection and
infusion routes, include, but are not limited to, subcutaneous,
intramuscular, intracranial and intraperitoneal. Alternative means
for systemic administration include transmucosal and transdermal
administration using penetrants such as bile salts or fusidic acids
or other detergents.
[0108] Pharmaceutically acceptable excipients are also well-known
to those who are skilled in the art. The choice of excipient will
be determined in part by the particular compound, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of the
pharmaceutical composition of the present invention. The following
methods and excipients are merely exemplary and are in no way
limiting. The pharmaceutically acceptable excipients preferably do
not interfere with the action of the active ingredients and do not
cause adverse side-effects. Suitable carriers and excipients
include solvents such as water, alcohol, and propylene glycol,
solid absorbants and diluents, surface active agents, suspending
agent, tableting binders, lubricants, flavors, and coloring
agents.
[0109] The compounds of the present invention, alone or in
combination with other suitable components, can be made into
aerosol formulations to be administered via inhalation. These
aerosol formulations can be placed into pressurized acceptable
propellants, such as dichlorodifluoromethane, propane, and
nitrogen. Such aerosol formulations may be administered by metered
dose inhalers. They also may be formulated as pharmaceuticals for
non-pressured preparations, such as in a nebulizer or an
atomizer.
[0110] The formulations can be presented in unit-dose or multi-dose
sealed containers, such as ampules and vials, and can be stored in
a freeze-dried (lyophilized) condition requiring only the addition
of the sterile liquid excipient, for example, water, for
injections, immediately prior to use. Extemporaneous injection
solutions and suspensions can be prepared from sterile powders,
granules, and tablets. The requirements for effective
pharmaceutically acceptable carriers for injectable compositions
are well known to those of ordinary skill in the art. See
Pharmaceutics and Pharmacy Practice, J. B. Lippincott Co.,
Philadelphia, Pa., Banker and Chalmers, Eds., 238-250 (1982) and
ASHP Handbook on Injectable Drugs, Toissel, 4th ed., 622-630
(1986).
[0111] Formulations suitable for topical administration include
pastilles comprising the active ingredient in an inert base, such
as gelatin and glycerin, or sucrose and acacia, as well as creams,
emulsions, and gels containing, in addition to the active
ingredient, such carriers as are known in the art. Furthermore,
transdermal patches can be prepared using methods known in the
art.
[0112] Additionally, formulations suitable for rectal
administration may be presented as suppositories by mixing with a
variety of bases such as emulsifying bases or water-soluble bases.
Formulations suitable for vaginal administration may be presented
as pessaries, tampons, creams, gels, pastes, foams, or spray
formulas containing, in addition to the active ingredient, such
carriers as are known in the art to be appropriate.
[0113] One skilled in the art will appreciate that suitable methods
of administering a compound of the present invention to an patient
are available, and, although more than one route can be used to
administer a particular compound, a particular route can provide a
more immediate and more effective reaction than another route.
[0114] In one embodiment, the compound used in the treatment of the
disease state is an antibody or other antigen binding agent. The
antibodies or other antigen binding agents of the invention may be
used to inhibit proliferation of cells that exhibit differentially
increased expressions of the fusion proteins and polypeptides
disclosed herein.
[0115] In certain embodiments, the antibodies or other antigen
binding agents are administered alone. In certain embodiments, the
antibodies or other antigen binding agents are administered prior
to the administration of at least one other therapeutic agent. In
certain embodiments, the antibodies or other antigen binding agents
are administered concurrent with the administration of at least one
other therapeutic agent. In certain embodiments, the antibodies or
other antigen binding agents are administered subsequent to the
administration of at least one other therapeutic agent. Exemplary
therapeutic agents include, but are not limited to, radiation
therapy and chemotherapy. Such co-administration may improve the
effectiveness of the compounds and pharmaceutical compositions and
the methods of treatment and prevention disclosed herein.
Furthermore, such co-administration of the compounds and
pharmaceutical compositions disclosed herein may improve the
effectiveness of the known breast cancer therapies.
[0116] In some embodiments of the invention the antibodies or other
antigen binding agents are able to directly bind to a fusion
polypeptide of the present disclosure and/or modulate the function
of the fusion polypeptide of the present disclosure and therefore
selectively kill tumor cells expressing such fusion
polypeptides.
[0117] In some embodiments of the invention, the cell killing
ability of an antigen binding agent, such as, but not limited, an
antibody, is improved through conjugation to a cytotoxic agent or
by enhancing an antibody effector function. These embodiments are
particularly well-suited to killing cancer cells that express the
fusion polypeptides of the present disclosure. Antibodies with
improved cell-killing ability, such as antibodies conjugated to a
cytotoxic agent or antibodies with enhanced effector function, can
be used to kill tumor cells expressing the fusion polypeptides
whether or not those fusion polypeptides are functional and whether
or not the antibodies modulate that function. This is an important
therapeutic advantage in the treatment of tumors.
[0118] The invention therefore includes compositions and use of
antigen binding agent-drug conjugates, or "ADCs" (which are also
referred to immunoconjugates) comprising an antigen binding agents,
such as, but not limited to, an antibody, conjugated to a
cystostatic agent and/or a cytotoxic agent such as, but not limited
to, a chemotherapeutic agent, a growth inhibitory agent, a toxin
(e.g., an enzymatically active toxin of bacterial, fungal, plant,
or animal origin, or fragments thereof), or a radioactive isotope
(i.e., a radioconjugate). The use of immunoconjugates for the local
delivery of cytotoxic or cytostatic agents to kill or inhibit the
proliferation of tumor cells in the treatment of cancer (Lambert,
J., 2005, Curr. Opinion in Pharmacology 5:543-549; Wu et al, 2005,
Nature Biotechnology 23(9): 1 137-L146; Payne, G., 2003, Cancer
Cell 3:207-212; Syrigos and Epenetos, 1999, Anticancer Research
19:605-614; Nicutescu-Duvaz and Springer, 1997, Adv. Drug Del. Rev.
26: 151-172; U.S. Pat. No. 4,975,278) allows targeted delivery of
the such agents to tumors, and intracellular accumulation therein,
where systemic administration of these unconjugated agents may
result in unacceptable levels of toxicity to normal cells as well
as the tumor cells sought to be eliminated (Baldwin et al, 1986,
Lancet pp: 603-05; Thorpe, 1985 "Antibody Carriers Of Cytotoxic
Agents In Cancer Therapy: A Review," in Monoclonal Antibodies '84:
Biological And Clinical Applications, A. Pinchera et al (ed.s), pp.
475-506). Efforts to improve the therapeutic index (i.e. maximal
efficacy and minimal toxicity of Immunoconjugates) have focused on
the selectivity of polyclonal (Rowland et al, 1986, Cancer Immunol.
Immunother., 21:183-87) and monoclonal antibodies (mAbs) as well as
drug-linking and drug-releasing properties (Lambert, J., 2005,
Curr. Opinion in Pharmacology 5:543-549). Agents used in such
immunoconjugates conjugates include bacterial protein toxins, such
as, but not limited to, diphtheria toxin, plant protein toxins such
as, but not limited to, ricin and saporin, small molecules, such
as, but not limited to, auristatins, geldanamycin (Mandler et al.,
2000, J. of the Nat. Cancer Inst. 92(19): 1573-1581; Mandler et
al., 2000, Bioorganic & amp; Med. Chem. Letters 10: 1025-1028;
Mandler et al., 2002, Bioconjugate Chem. 13:786-791), maytansinoids
(EP 1391213; Liu et al., 1996, Proc. Natl. Acad. Sci. USA
93:8618-8623), calicheamicin (Lode et al., 1998, Cancer Res.
58:2928; Hinman et al., 1993, Cancer Res. 53:3336-3342),
daunomycin, doxorubicin, methotrexate, and vindesine.
[0119] In some embodiments of the invention the antigen binding
agents, such as, but not limited to, antibodies, have an enhanced
effector function. An "effector function" refers to those
biological activities attributable to the Fc region of an antibody,
including complement-dependent cytotoxicity (CDC) and
antibody-dependent cell-mediated cytotoxicity (ADCC). ADCC is a
cell-mediated reaction in which nonspecific cytotoxic cells that
express Fc receptors recognize bound antibody on a target cell and
subsequently cause lysis of the target cell. In some embodiments,
the ADCC activity has been enhanced through methods known in the
art such as modification of the Fc sequence or modification of the
carbohydrate structure, e.g., reducing fucose in the Fc-linked
oligosaccharide structure of the antibodies to create "afucosylated
antibodies."
[0120] In one embodiment, the composition administered to a patient
is a siRNA construct as discussed below.
RNAi
[0121] RNAi is the process of sequence-specific post
transcriptional gene silencing mediated by siRNA. Long double
stranded RNA (dsRNA) in cells stimulates the activity of a
ribonuclease III enzyme referred to as dicer. Dicer is involved in
the processing of the long dsRNA into short pieces of siRNA. siRNAs
derived from dicer activity are typically about 21-23 nucleotides
in length and include duplexes of about 19 base pairs.
[0122] The RNAi response also features an endonuclease complex
containing a siRNA, commonly referred to as an RNA-induced
silencing complex (RISC), which mediates cleavage of single
stranded RNA having sequence complementary to the antisense strand
of the siRNA duplex. Cleavage of the target RNA takes place in the
middle of the region complementary to the antisense strand of the
siRNA duplex. siRNA mediated RNAi has been studied in a variety of
systems. Recent work in Drosophila embryonic lysates has revealed
certain requirements for siRNA length, structure, chemical
composition, and sequence that are essential to mediate efficient
RNAi activity. RNAi technology has been used in mammalian cell
culture, where a siRNA-mediated reduction in gene expression has
been accomplished by transfecting cells with synthetic RNA
oligonucleotides. The ability to use siRNA-mediated gene silencing
in mammalian cells combined with the high degree of sequence
specificity allows RNAi technology to be used to selectively
silence expression of mutant alleles or toxic gene products in
dominantly inherited diseases, including neurodegenerative
diseases. Several neurodegenerative diseases, such as Parkinson's
disease, Alzheimer's disease, Huntington's disease, Spinocerebellar
Ataxia Type 1, Type 2, and Type 3, and dentatorubral pallidoluysian
atrophy (DRLPA), have proteins identified that are involved in the
overall pathogenic progression of the disease.
[0123] In one embodiment, the present invention relates to the use
of a siRNA construct to silence the expression of, or down regulate
the expression of, a IL17RC-CRELD1, SCNN1A-TNFRSF1A and
CTSD-IFITM10 fusion polypeptide or a gene expressing the
IL17RC-CRELD1, SCNN1A-TNFRSF1A and CTSD-IFITM10 fusion polypeptide.
In another aspect, the invention relates to the use of a siRNA
construct that is targeted to the IL17RC-CRELD1, SCNN1A-TNFRSF1A or
CTSD-IFITM10 fusion polypeptide/nucleotide in the treatment of
cancer, such as breast cancer. According to still another aspect of
the present invention is a method for increasing the efficacy of
cancer therapy in a subject, the method comprising: administering
to a subject in need of an effective amount of an siRNA construct
directed to the IL17RC-CRELD1, SCNN1A-TNFRSF1A and CTSD-IFITM10
fusion polypeptide, wherein said subject is also being administered
a cancer therapy selected from the group consisting of
small-molecule drugs, angiogenesis inhibitors, tumor vaccine,
chemotherapy, immunotherapy, radiation therapy, gene therapy and
combinations thereof. As shown in FIG. 4, the siRNA constructs
disclosed herein effectively silence, or downregulate, the
expression of the SCNN1A-TNFRSF1A or CTSD-IFITM10 fusion
polypeptides.
[0124] The CTSD-IFITM10 fusion transcript was detected in RNA-seq
data from the MCF7 breast cancer cell line and the SCNN1A-TNFRSF1A
fusion transcript was detected in RNA-seq data from the HCC1954
breast cancer cell line, which makes them amenable to further
investigation in vitro. qPCR primers were designed flanking the
fusion junction for each transcript (FIG. 4a). We prepared cDNA
from each of the cell lines and performed qPCR using the junction
flanking primers. The qPCR successfully amplified a product from
cDNA from each cell line, and the product was the expected size
when electrophoresed on a 4% agarose gel (FIG. 4b). The negative
control, which contained all reaction components except cDNA, did
not produce a qPCR product (FIG. 4b). Together these results
confirm the presence of the fusion transcript detected by RNA-seq
in each cell line. The qPCR primers identified herein (SEQ ID NOS.:
23-26) are capable of identifying the fusion transcripts.
[0125] Two siRNA duplexes to target the fusion junction of each
fusion transcript were designed as shown in FIG. 4a, wherein
CTSD-IFITM10 siRNA #1 corresponds to SEQ ID NOS.: 15 (sense) and 16
(anti-sense), CTSD-IFITM10 siRNA #2 corresponds to SEQ ID NOS.:
17(sense) and 18 (anti-sense). Further, in FIG. 4a, SCNN1A-TNFRSF1A
siRNA #1 corresponds to SEQ ID NOS.: 19(sense) and 20(anti-sense)
SCNN1A-TNFRSF1A siRNA #2 corresponds to SEQ ID NOS.:
21(sense)-22(anti-sense). We transfected the cell lines with the
siRNA duplexes targeting the fusion transcript and measured the
abundance of fusion transcript 48 hours after transfection using
the qPCR primers flanking the fusion junction. In FIG. 4a, the
CTSD-IFITM10 qPCR forward primer corresponds to SEQ ID. NO. 23 and
the CTSD-IFITM10 qPCR reverse primer corresponds to SEQ ID. NO. 24.
Further, the SCNN1A-TNFRSF1A qPCR forward primer corresponds to SEQ
ID. NO. 25 and the SCNN1A-TNFRSF1A qPCR reverse primer corresponds
to SEQ ID. NO. 26. We measured the fusion transcript abundance in
three control samples transfected with a non-targeting siRNA and in
three experiment samples transfected with each of the siRNAs
targeted to the fusion junction.
[0126] Both siRNA constructs (SEQ ID NOS. 15-18) targeting the
fusion junction of the CTSD-IFITM10 fusion transcript produced
knockdown of the fusion transcript in the MCF7 cell line resulting
in only 42% to 51% of the transcript remaining relative to the
cells treated with the non-targeting siRNA, which indicates that
the fusion transcript abundance can be reduced with these siRNAs
(FIG. 4c). One siRNA construct (SEQ ID NOS. 19 and 20) targeting
the fusion junction of the SCNN1A-TNFRSF1A fusion transcript
produced knockdown of the fusion transcript in HCC1954 resulting in
only 42% to 45% of the transcript remaining relative to the cells
treated with the non-targeting siRNA, which indicates that this
siRNA can be used to reduce the abundance of the SCNN1A-TNFRSF1A
fusion transcript (FIG. 4d).
[0127] To determine if knockdown of the fusion transcripts affects
cell proliferation we measured the number of live cells 72 hours
after transfection with each siRNA targeting the fusion junction.
We compared the number of live cells between samples transfected
with non-targeting siRNA and those transfected with each of the
siRNAs targeting the fusion junctions. We found that the two siRNAs
targeting the CTSD-IFITM10 fusion transcript resulted in a
significant decrease in the number of live MCF7 cells after 72
hours (p<0.03) resulting in 10% to 17% reduction in live cell
numbers, indicating that the abundance of this fusion transcript is
associated with cell proliferation (FIG. 4e). While this decrease
is modest, it is important to note that this cell viability effect
is evident even when 45% of the fusion transcript is remaining
after knockdown, and could exhibit a more profound effect on
proliferation with greater knockdown. The two siRNAs targeting the
SCNN1A-TNFRSF1A fusion transcript were not associated with
difference in the number of live HCC1954 cells, indicating that the
55-58% knockdown of the fusion transcript was not associated with a
cell proliferation differences, but we cannot rule out the
possibility that a more dramatic difference in the amount of
transcript could reveal an association with cell proliferation. The
significant association between the CTSD-IFITM10 fusion transcript
abundance and MCF7 cell proliferation indicates that this novel
fusion transcript may play a role in breast cancer cell
proliferation.
[0128] The siRNA of the present invention may be expressed from a
recombinant plasmid either as two separate, complementary RNA
molecules, or as a single RNA molecule with two complementary
regions. Selection of vectors suitable for expressing siRNA of the
invention, methods for inserting nucleic acid sequences for
expressing the siRNA into the plasmid, and methods of delivering
the recombinant plasmid to the cells of interest are within the
skill in the art. Methods for constructing recombinant DNA vectors
and the production of DNA may be found in Sambrook et al., infra,
for example.
[0129] The siRNA of the present invention may be a polynucleotide
sequence cloned into a plasmid vector and expressed using any
suitable promoter. Suitable promoters for expressing siRNA of the
invention from a plasmid include, but are not limited to, the H1
and U6 RNA pol III promoter sequences and viral promoters including
the viral LTR, adenovirus, SV40, and CMV promoters. Additional
promoters known to one of skill in the art may also be used,
including tissue specific, inducible or regulatable promoters for
expression of the siRNA in a particular tissue or in a particular
intracellular environment. The vector may also include additional
regulatory or structural elements, including, but not limited to
introns, enhancers, and polyadenylation sequences. These elements
may be included in the DNA as desired to obtain optimal performance
of the siRNA in the cell and may or may not be necessary for the
function of the DNA. Optionally, a selectable marker gene or a
reporter gene may be included either with the siRNA encoding
polynucleotide or as a separate plasmid for delivery to the target
cells. Additional elements known to one of skill in the art may
also be included.
[0130] The siRNA may also be expressed from a polynucleotide
sequence cloned into a viral vector that may include the elements
described above. Suitable viral vectors for gene delivery to a cell
include, but are not limited to, replication-deficient viruses that
are capable of directing synthesis of all virion proteins, but are
incapable of making infections particles. Exemplary viruses
include, but are not limited to lentiviruses, adenoviruses,
adeno-associated viruses, retroviruses, and alphaviruses.
[0131] Adenovirus, AAV, and lentiviral vectors may be used for gene
delivery to the nervous system, including the central nervous
system and the peripheral nervous system, where cell division is
limited, to infect terminally differentiated cells without the need
for cell division. (Davidson et al., Nat. Genet. 3:219-223, 1993;
Mastrangeli et al., Clin. Res. 41:223 A (Abstract), 1993; Ghadge et
al., Gene Ther. 2:132-137, 1995; Xiao et al., Exp. Neurol.
144:113-124, 1997; McCown et al., Brain Res. 713:99-107, 1996;
Davidson and Bohn, Exp. Neurol. 144(1):125-30, 1997; Choi-Lundberg,
D. L. and Bohn, M. C, Stem Cell Biology and Gene Therapy,
Quesenberry, P. J., Stein, G. S., Forget, B. and Weissman, S.
(Eds), J. Wiley & Sons, New York, pp. 503-553, 1998; Chamberlin
et al., Brain Res. 793:169-175, 1998; Blomer et al., J. Virol.
71:6641-6649, 1997; Zufferey et al., Nat. Biotechnol. 15:871-875,
1997; Kordower et al., Exp. Neurol. 160:1-16, 1999). The
recombinant lentivirus vectors remain capable of infecting
non-dividing cells when deleted of accessory proteins (Johnston et
al., J. Virol. 73:4991-5000, 1999, Naldini, Throm. Haemat.
82:552-554, 1999).
[0132] The recombinant DNA can be readily introduced into the host
cells, e.g., mammalian, bacterial, yeast or insect cells by
transfection with an expression vector composed of DNA encoding the
siRNA by any procedure useful for the introduction into a
particular cell, e.g., physical or biological methods, to yield a
cell having the recombinant DNA stably integrated into its genome
or existing as a episomal element, so that the DNA molecules, or
sequences of the present invention are expressed by the host cell.
Preferably, the DNA is introduced into host cells via a vector. The
host cell is preferably of eukaryotic origin, e.g., plant,
mammalian, insect, yeast or fungal sources, but host cells of
non-eukaryotic origin may also be employed.
[0133] Physical methods to introduce a preselected DNA or RNA
duplex into a host cell include, but are not limited to, calcium
phosphate precipitation, lipofection, DEAE-dextran, particle
bombardment, microinjection, electroporation, immunoliposomes,
lipids, cationic lipids, phospholipids, or liposomes and the like.
One skilled in the art will understand that any method may be used
to deliver the DNA or RNA duplex into the cell.
[0134] One mode of administration to the CNS uses a
convection-enhanced delivery (CED) system. This method includes: a)
creating a pressure gradient during interstitial infusion into
white matter to generate increased flow through the brain
interstitium (convection-supplementing simple diffusion); b)
maintaining the pressure gradient over a lengthy period of time (24
hours to 48 hours) to allow radial penetration of the migrating
compounds (such as: neurotrophic factors, antibodies, growth
factors, genetic vectors, enzymes, etc.) into the gray matter; and
c) increasing drug concentrations by orders of magnitude over
systemic levels. Using a CED system, DNA, RNA duplexes or viruses
can be delivered to many cells over large areas of the brain. Any
CED device may be appropriate for delivery of DNA, RNA or viruses.
In some embodiments, the device is an osmotic pump or an infusion
pump. Both osmotic and infusion pumps are commercially available
from a variety of suppliers, for example Alzet Corporation,
Hamilton Corporation, Alza, Inc., Palo Alto, Calif.
[0135] Biological methods to introduce the nucleotide of interest
into a host cell include the use of DNA and RNA viral vectors. For
mammalian gene therapy, it is desirable to use an efficient means
of inserting a copy gene into the host genome. Viral vectors have
become the most widely used method for inserting genes into
mammalian, e.g., human cells.
[0136] Delivery of the recombinant nucleotides to the host cell may
be confirmed by a variety of assays known to one of skill in the
art. Assays include Southern and Northern blotting, RT-PCR, PCR,
ELISA, and Western blotting, by way of example.
[0137] Infective virus particles will be produced from the viral
vectors of the present invention using standard methodology, known
to one of skill in the art. The methods generally involve
introducing the viral vector containing the siRNA encoding
polynucleotide into a producer cell. By way of example, the
producer cell for a lentiviral vector generally includes gag/pol
and env coding sequences. AAV virus production also includes
introducing a helper construct into the producer cell, where the
helper construct includes coding regions capable of being expressed
in the producer cell to complement helper functions missing from
the replication deficient viral vector. For AAV vectors helper
functions include, but are not limited to, ORFs, namely the rep and
cap coding regions, or functional homologues thereof; and helper
functions from herpes virus or adenovirus, such as E1A, E2, E3 and
E4. The production of virus particles also includes culturing the
producer cell to produce virions. The siRNA expression vector, and
if necessary, helper construct(s) for AAV can be introduced into
the producer cell, either simultaneously or serially, using
standard transfection techniques known to one of skill in the art
(Zoltukhin et al., Gene Therapy, 6:973-985, 1999).
[0138] The virions are then harvested from the supernatant of
transfected cells, isolated by freeze/thaw cycles and
centrifugation. The virions may be purified by binding to a
heparin-agarose column, cluted, and concentrated. For in vivo
delivery, siRNA virions may be purified by fast performance liquid
chromatography (FPLC).
[0139] The siRNA virions formed from the siRNA vectors may be
delivered to target cells of the central or peripheral nervous
system, or both, or any target cell from which the therapeutic
protein can have an effect on a nervous system disorder or any
target cell affected by a synucleinopathy. Preferably, the siRNA
virions are added to the cells at the appropriate multiplicity of
infection according to standard transduction methods appropriate
for the particular target cells. Titers of siRNA virions to
administer can vary, depending upon the target cell type and the
particular viral vector, and may be determined by those of skill in
the art without undue experimentation. siRNA virions are preferably
administered to the cell in a therapeutically-effective amount.
siRNA virions may be administered in a physiologically acceptable
carrier. In general, a "physiologically acceptable carrier" is one
that is not toxic or unduly detrimental to cells. Exemplary
physiologically acceptable carriers include sterile, pyrogen-free,
phosphate buffered saline. Physiologically-acceptable carriers
include pharmaceutically-acceptable carriers.
[0140] The siRNA virions may be delivered to a target cell by any
method known to one of skill in the art, including, but not limited
to injection into the delivery site tissue. By way of example, for
delivery to a specific region of the central nervous system, the
siRNA virions may be administered by microinjection, infusion,
convection enhanced delivery (CED), electroporation or other means
suitable to directly deliver the composition directly into the
delivery site tissue through a surgical incision. The delivery is
generally accomplished slowly, such as at a rate of about 0.2-1
.mu.l per minute. Pursuant to the invention, administration of
siRNA virions into selected regions of a subject's brain may be
made by drilling a hole and piercing the dura to permit the needle
of a microsyringe or micropipette to be inserted. A stereotaxic
apparatus may be used to assist in delivering the virions to the
specific target cells. Alternatively, siRNA virions may be
delivered by lumbar puncture, for example, to the cerebral spinal
fluid or delivered intraventricularly. The siRNA virions can be
injected intrathecally into a spinal cord region. In another
example, virions may be delivered to muscle in order to deliver
siRNA to the terminals of motor neurons or sensory neurons. As will
be understood by one of skill in the art, virions may be delivered
to any cell by any means.
Materials and Methods
Cell Lines and Tissues:
[0141] The 28 breast cancer cell lines were cultured as described
previously (45). De-identified fresh frozen breast cancer
specimens, fresh frozen breast tissue adjacent to tumors, and fresh
frozen breast tissue specimens from reduction mammoplasty
procedures were obtained from the University of Alabama at
Birmingham's Comprehensive Cancer Center Tissue Procurement Shared
Facility. The specific aliquots of specimens provided for research
were chosen based on their quality control by board certified
pathologists. After identification by quality control, the normal
uninvolved breast tissue aliquots were not further macro-dissected.
The breast tumor specimens were macro-dissected by the pathologists
at the Tissue Procurement Shared Facility to enrich for tumor cell
content and remove adjacent normal tissue. The frozen breast tissue
specimens were weighed, transferred to a 15 mL conical tube
containing ceramic beads, and RLT Buffer (Qiagen) plus 1% BME was
added so that the tube contained 35 uL of buffer for each milligram
of tissue. The conical tubes containing tissue, ceramic beads and
buffer were then shaken in a MP Biomedicals FastPrep machine until
the tissue was visibly homogenized (90 seconds at 6.5 meters per
second). The homogenized tissue was stored at -80.degree. C.
RNA-seq:
[0142] Total RNA was extracted from 5 million cultured cells or 350
uL of tissue homogenate (equivalent to 10 mg of tissue) using the
Norgen Animal Tissue RNA Purification Kit (Norgen Biotek
Corporation). Cell lysate was treated with Proteinase K before it
was applied to the column and on-column DNAse treatment was
performed according to the manufacturer's instructions. Total RNA
was eluted from the columns and quantified using the Qubit RNA
Assay Kit and the Qubit 2.0 fluorometer (Invitrogen). RNA-seq
libraries for each sample were constructed from 250 ng total RNA
using the polyA selection and transposase-based non-stranded
library construction (Tn-RNA-seq) described previously (35).
RNA-seq libraries were barcoded during PCR using Nextera barcoded
primers according to the manufacturer (Epicentre). The RNA-seq
libraries were quantified using the Qubit dsDNA HS Assay Kit and
the Qubit 2.0 fluorometer (Invitrogen) and three barcoded libraries
were pooled in equimolar quantities for sequencing. The pooled
libraries were sequenced on an Illumina HiSeq 2000 sequencing
machine using paired-end 50 bp reads and a 6 bp index read, and we
obtained at least 50 million read pairs from each library.
ChimeraScan 0.4.5a was used to align and identify fusion
transcripts in each of the sequencing libraries using default
parameters (36). To quantify the expression of each fusion partner,
we used TopHat v1.4.1 (46) with the options -r 100-mate-std-dev 75
to align 50 million RNA-seq read pairs, and used GENCODE version 9
(47) as a transcript reference. Gene expression values (Fragments
Per Kilobase of transcript Per Million reads, FPKMs) were
calculated for each GENCODE transcript using Cufflinks 1.3.0 with
the -u option (48).
Splice Junction DNA Sequencing:
[0143] Genomic DNA was isolated from 12 breast cancer cell lines
using 5 million cultured cells per cell line and the Qiagen DNeasy
Kit. PCR amplification of 200 bp surrounding the terminal exon
splice acceptor site that is skipped in the formation of the
read-through fusion transcripts were performed in 50 uL reactions
containing 5 ng genomic DNA, 0.5 uM Forward PCR primer, 0.5 uM
Reverse PCR primer, 5 units Platinum Taq DNA Polymerase
(Invitrogen), 1.times.PCR Buffer with 2 mM MgCl.sub.2, 0.5 mM each
dNTP, and 0.5 M Betaine. These reactions were denatured at
98.degree. C. for 1 minute then thermocycled (30 cycles of
95.degree. C. for 30 seconds and 62.degree. C. for 3 minutes) and
held at 4.degree. C. The PCR products were purified using Agencourt
AMPure XP beads (Beckman Coulter). The PCR products were quantified
using the Qubit dsDNA HS Assay Kit and the Qubit 2.0 fluorometer
(Invitrogen). Equimolar quantities of each of the eight PCR
products were pooled into 12 pools, one for each cell line.
Illumina sequencing libraries were prepared for each of the 12
pools of PCR products using Nextera according to the manufacturer's
instructions (Epicentre). The 12 libraries were quantified using
the Qubit dsDNA HIS Assay Kit and the Qubit 2.0 fluorometer
(Invitrogen). Equimolar quantities of each library were pooled and
diluted to 10 nM and sequenced using single-end 50 bp reads and a 6
base index read on the Illumina MiSeq sequencer. We obtained 6
million sequencing reads in total covering all 8 amplicons in each
of the 12 breast cancer cell lines. Variants were identified by the
GATK software on BaseSpace (Illumina) and BAM files were downloaded
and inspected manually using IGV 2.0 (49).
Western Blots:
[0144] Breast cancer cell pellets containing 2.5 million cells were
lysed by adding 100 uL RIPA Buffer (1.times.PBS, 1% NP-40, 0.5%
sodium deoxycholate, 0.1% SDS and Roche protease inhibitor
cocktail) and passing the solution through a 21-gauge needle. The
lysed cells were then centrifuged at 16,000 rcf for 15 minutes at
4.degree. C., and the supernatant was collected and protein was
quantified using the Qubit Protein Assay Kit and the Qubit 2.0
fluorometer (Invitrogen). Twenty micrograms of protein extract was
loaded into a BioRad 12% SDS-polyacrylamide gel in
1.times.Tris/Glycine Buffer (BioRad). Magic Marker (Invitrogen) was
used as a protein standard. The gel electrophoresis rig was
partially immersed in an ice bath while it ran for 1.5 hours at 125
V. Proteins were transferred to a nitrocellulose membrane using the
iBlot system (Invitrogen) for 7 minutes at 20 V. The membranes were
washed (1.times.PBS with 0.05% Tween 20) and incubated in blocking
buffer for 60 minutes (1.times.PBS with 0.05% Tween 20 and 5% w/v
Instant Nonfat Dry Milk). The membranes were then incubated with
primary antibody overnight at 4.degree. C. (1.times.PBS with 0.05%
Tween 20, 1% w/v Instant Nonfat Dry Milk, and 500 ng/mL primary
antibody) followed by three 10 minute washes (1.times.PBS with
0.05% Tween 20). The following primary antibodies from Santa Cruz
Biotechnology were used: CRELD1 sc-99364, CTSD sc-37438, and
TNFRSF1A sc-8436. The membrane was then incubated with secondary
antibody (1.times.PBS, 0.05% Tween 20, 1% Instant Nonfat Dry Milk,
and a 1:4,000 dilution of horseradish peroxidase (HRP) conjugated
goat anti-mouse secondary antibody (Thermo Scientific)). The
membrane was then washed (1.times.PBS with 0.05% Tween 20) and
incubated for 5 minutes in a substrate solution of equal parts
stable peroxide and luminol/enhancer (SuperSignal West Femto
Chemiluminescent Substrate, Thermo Scientific). The membranes were
then imaged for chemiluminescence.
qPCR and RNAi
[0145] Four ON-TARGETplus custom siRNA duplex reagents from Thermo
Scientific were ordered configured to target the fusion junctions
of the read-through fusion transcript and ON-TARGETplus
Non-targeting siRNA #1 was also purchases (Thermo Scientific
catalog ##D-001810-01-05), to serve as a control in experiments. To
design the custom siRNAs, entered the fusion junction nucleotide
sequences into the siDESIGN Center on the Thermo Scientific
website. The software successfully designed a siRNA corresponding
to SEQ ID. NOS. 15 and 16 for the CTSD-IFITM100 fusion and a siRNA
corresponding to SEQ ID. NOs. 19 and 20 for SCNN1A-TNFRSF1A fusion.
The software did not report any other siRNAs to these targets. The
fusion junction sequence for CTSD-IFITM10 siRNA #2 and
SCNN1A-TNFRSF1A siRNA #2 were then entered and the software design
a siRNA corresponding to SEQ ID. NOs. 17 and 18 for the
CTSD-IFITM100 fusion and a siRNA corresponding to SEQ ID NOs. 12
and 22 for the SCNN1A-TNFRSF1A fusion, so that we would have a
second siRNA targeting each fusion junction sequence with a more
even representation of bases on each side of the junction. The
siRNA duplex sequences are as follows:
TABLE-US-00002 Sequence Sense/Anti-sense Target Polypeptide SEQ ID
NO ACUACACGCUCAAGGCCCAUU Sense CTSD-IFITM10 15
UGGGCCUUGAGCGUGUAGUUU Anti-sense CTSD-IFITM10 16
ACGCUCAAGGCCCAGGGCCUU Sense CTSD-IFITM10 17 PGGCCUGGGCCUUGAGCGUUU
Anti-sense CTSD-IFITM10 18 CUGUCACGGUGCUCCUGGAUU Sense
SCNN1A-TNFRSF1A 19 PUCCAGGAGCACCGUGACAGUU Anti-sense
SCNN1A-TNFRSF1A 20 CUCUGUCACGGUGCUCCUGUU Sense SCNN1A-TNFRSF1A 21
PCAGGAGCACCGUGACAGAGUU Anti-sense SCNN1A-TNFRSF1A 22
[0146] The MCF7 and HCC1954 cell lines were purchased from ATCC
(www.atcc.org). Both cell lines were cultured in the conditions
recommended by ATCC; MCF7 was grown in Eagle's Minimum Essential
Medium, supplemented with 0.01 mg/ml bovine insulin and 10% fetal
bovine serum; HCC1954 was grown in RPMI-1640 Medium supplemented
with 10% fetal bovine serum. The cells were grown in black Costar
96-Well clear-bottom plates (Fisher Scientific catalog
#07-200-565). MCF7 was seeded at 15,000 cells per well, and HCC1954
was seeded at 10,000 cells per well.
[0147] The siRNA transfection experiments were performed in 96-well
plates in triplicate, and included a mock transfection control with
no siRNA, a non-targeting siRNA control, and the two custom siRNAs
targeting each fusion junction. The Lipofectamine RNAiMAX
Transfection Reagent and siRNA were prepared according the
manufacturers instruction (Invitrogen). Briefly, 1.5 uL of the
transfection reagent was diluted in 25 uL of Opti-MEM I Reduced
Serum Medium (Invitrogen) and separately 15 pmol of siRNA stored at
10 uM stock concentration was diluted in 25 uL Opti-MEM I Reduced
Serum Medium (Invitrogen). These two dilutions were mixed and
incubated at room temperature for 5 minutes. We added 10 uL of the
siRNA-transfection reagent mix to each well in the 96-well plate
containing cells, which results in 3 pmol of siRNA in 0.3 uL of
Lipofectamine RNAiMAX reagent per well.
[0148] We ordered PCR primers flanking the fusion junctions of each
read-through fusion transcript, as well as primers to the CTCF
gene, which were used as a positive control. The primer
oligonucleotide sequences are as follows:
TABLE-US-00003 Sequence Forward/Reverse Target Polypeptide SEQ ID
NO. CTACAAGCTGTCCCCAGAGG Forward CTSD-IFITM10 23 CCGTCCGTGGTGCTG
Reverse CTSD-IFITM10 24 GGCCAAAGTCAACATCTTCTT Forward
SCNN1A-TNFRSF1A 25 GGCCAAAGTCAACATCTTCTT Reverse SCNN1A-TNFRSF1A 26
ACCTGTTCCTGTGACTGTACC Forward CTCF 27 ATGGGTTCACTTTCCGCAAGG Reverse
CTCF 28
[0149] We performed the qPCR assay 48 hours after transfection. We
prepared cDNA using the Power SYBR Green Cells-to-CT Kit
(Invitrogen) according to the manufacturer's instructions,
including the option of using 22.5 uL of cell lysate in the reverse
transcription reaction. The qPCR experiments were run in duplicate
in 10 uL reactions with 4 uL of cDNA, 5 uL Power SYBR Green PCR
Master Mix and PCR primers added to a final concentration of 200
nM. For each cDNA sample we also performed control qPCR experiments
using 400 nM of each primer designed to CTCF, a housekeeping gene
locus that we used to ensure that the quantity and quality of cDNA
was equivalent across experiments. The reactions were run on an ABI
7900HT with the following thermal cycling conditions: 50.degree. C.
for 2 minutes, 95.degree. C. for 10 minutes, 40 cycles of
95.degree. C. for 15 seconds and 60.degree. C. for 1 min. A
dissociation curve analysis was run using the standard protocol on
the instrument. Transcript abundance was calculated using automatic
baseline and threshold settings using the instrument's software. To
calculate the percentage of transcript remaining after siRNA
knockdown we normalized the transcript abundance measured in wells
treated with siRNAs targeting the fusion junction to the transcript
abundance measured in wells treated with the non-targeting siRNA.
As a control, we also performed this normalization on the mock
transfection with no siRNA to ensure that the presence of the
non-targeting siRNA did not affect the abundance of the fusion
transcript.
[0150] We performed cell proliferation assays 72 hours after
transfection using the CyQUANT Cell Proliferation Assay Kit for
Cells in Culture (Invitrogen) according to the manufacturers
instruction. Our protocol included using 1.5.times.CyQUANT GR dye,
which was recommended to obtain adequate dynamic range in wells
with 75,000 cells, which we observed in our untreated controls. The
fluorescence from each well of the 96-well plate was measured using
the Molecular Devices SpectraMax M5e plate reader. To calculate the
percentage of live cells remaining after siRNA knockdown we
normalized the fluorescence intensity in wells treated with siRNAs
targeting the fusion junction to the fluorescence measured in wells
treated with the non-targeting siRNA. As a control, we also
performed this normalization on the mock transfection with no siRNA
to ensure that the presence of the non-targeting siRNA did not
affect the fluorescence or quantity of live of the cells.
REFERENCES
[0151] 1. Nowell P C. The minute chromosome (Phl) in chronic
granulocytic leukemia. Blut. 1962 April; 8:65-6. [0152] 2. Rowley J
D. Letter: A new consistent chromosomal abnormality in chronic
myelogenous leukaemia identified by quinacrine fluorescence and
Giemsa staining. Nature. 1973 Jun. 1; 243(5405):290-3. [0153] 3.
Rowley J D. Chromosomal translocations: revisited yet again. Blood.
2008 Sep. 15; 112(6):2183-9. [0154] 4. Druker B J, Tamura S,
Buchdunger E, Ohno S, Segal G M, Fanning S, et al. Effects of a
selective inhibitor of the Abl tyrosine kinase on the growth of
Bcr-Abl positive cells. Nat Med. 1996 May; 2(5):561-6. [0155] 5.
Mitelman F, Johansson B, Mertens F. Fusion genes and rearranged
genes as a linear function of chromosome aberrations in cancer. Nat
Genet. 2004 April; 36(4):331-4. [0156] 6. Maher C A, Palanisamy N,
Brenner J C, Cao X, Kalyana-Sundaram S, Luo S, et al. Chimeric
transcript discovery by paired-end transcriptome sequencing. Proc
Natl Acad Sci USA. 2009 Jul. 28; 106(30):12353-8. [0157] 7. Tognon
C, Knezevich S R, Huntsman D, Roskelley C D, Melnyk N, Mathers J A,
et al. Expression of the ETV6-NTRK3 gene fusion as a primary event
in human secretory breast carcinoma. Cancer Cell. 2002 November;
2(5):367-76. [0158] 8. Persson M, Andren Y, Mark J, Horlings H M,
Persson F, Stenman G. Recurrent fusion of MYB and NFIB
transcription factor genes in carcinomas of the breast and head and
neck. Proc Natl Acad Sci USA. 2009 Nov. 3; 106(44):18740-4. [0159]
9. Tomlins S A, Laxman B, Dhanasekaran S M, Helgeson B E, Cao X,
Morris D S, et al. Distinct classes of chromosomal rearrangements
create oncogenic ETS gene fusions in prostate cancer. Nature. 2007
Aug. 2; 448(7153):595-9. [0160] 10. Tomlins S A, Rhodes D R, Perner
S, Dhanasekaran S M, Mehra R, Sun X W, et al. Recurrent fusion of
TMPRSS2 and ETS transcription factor genes in prostate cancer.
Science. 2005 Oct. 28; 310(5748):644-8. [0161] 11. Kumar-Sinha C,
Tomlins S A, Chinnaiyan A M. Recurrent gene fusions in prostate
cancer. Nat Rev Cancer. 2008 July; 8(7):497-511. [0162] 12. Soda M,
Choi Y L, Enomoto M, Takada S, Yamashita Y, Ishikawa S, et al.
Identification of the transforming EML4-ALK fusion gene in
non-small-cell lung cancer. Nature. 2007 Aug. 2; 448(7153):561-6.
[0163] 13. Robinson D R, Kalyana-Sundaram S, Wu Y M, Shankar S, Cao
X, Ateeq B, et al. Functionally recurrent rearrangements of the
MAST kinase and Notch gene families in breast cancer. Nat Med. 2011
December; 17(12):1646-51. [0164] 14. Asmann Y W, Hossain A, Necela
B M, Middha S, Kalari K R, Sun Z, et al. A novel bioinformatics
pipeline for identification and characterization of fusion
transcripts in breast cancer and normal cell lines. Nucleic Acids
Res. 2011 August; 39(15):e100. [0165] 15. Asmann Y W, Necela B M,
Kalari K R, Hossain A, Baker T R, Carr J M, et al. Detection of
redundant fusion transcripts as biomarkers or disease-specific
therapeutic targets in breast cancer. Cancer Res. 2012 Apr. 15;
72(8):1921-8. [0166] 16. Edgren H, Murumagi A, Kangaspeska S,
Nicorici D, Hongisto V, Kleivi K, et al. Identification of fusion
genes in breast cancer by paired-end RNA-sequencing. Genome Biol.
2011; 12(1):R6. [0167] 17. Ha K C, Lalonde E, Li L, Cavallone L,
Natrajan R, Lambros M B, et al. Identification of gene fusion
transcripts by transcriptome sequencing in BRCA1-mutated breast
cancers and cell lines. BMC Med Genomics. 2011; 4:75. [0168] 18.
Zhao Q, Caballero O L, Levy S, Stevenson B J, Iseli C, de Souza S
J, et al. Transcriptome-guided characterization of genomic
rearrangements in a breast cancer cell line. Proc Natl Acad Sci
USA. 2009 Feb. 10; 106(6):1886-91. [0169] 19. Kim D, Salzberg S L.
TopHat-Fusion: an algorithm for discovery of novel fusion
transcripts. Genome Biol. 2011; 12(8):R72. [0170] 20.
Frenkel-Morgenstern M, Lacroix V, Ezkurdia I, Levin Y, Gabashvili
A, Prilusky J, et al. Chimeras taking shape: potential functions of
proteins encoded by chimeric RNA transcripts. Genome Res. 2012
July; 22(7):1231-42. [0171] 21. Li X, Zhao L, Jiang H, Wang W.
Short homologous sequences are strongly associated with the
generation of chimeric RNAs in eukaryotes. J Mol. Evol. 2009
January; 68(1):56-65. [0172] 22. Akiva P, Toporik A, Edelheit S,
Peretz Y, Diber A, Shemesh R, et al. Transcription-mediated gene
fusion in the human genome. Genome Res. 2006 January; 16(1):30-6.
[0173] 23. Parra G, Reymond A, Dabbouseh N, Dermitzakis E T,
Castelo R, Thomson T M, et al. Tandem chimerism as a means to
increase protein complexity in the human genome. Genome Res. 2006
January; 16(1):37-44. [0174] 24. Li H, Wang J, Ma X, Sklar J. Gene
fusions and RNA trans-splicing in normal and neoplastic human
cells. Cell Cycle. 2009 Jan. 15; 8(2):218-22. [0175] 25. Rickman D
S, Pflueger D, Moss B, VanDoren V E, Chen C X, de la Taille A, et
al. SLC45A3-ELK4 is a novel and frequent erythroblast
transformation-specific fusion transcript in prostate cancer.
Cancer Res. 2009 Apr. 1; 69(7):2734-8. [0176] 26. Kim R N, Kim A,
Choi S H, Kim D S, Nam S H, Kim D W, et al. Novel mechanism of
conjoined gene formation in the human genome. Funct Integr
Genomics. 2012 March; 12(1):45-61. [0177] 27. Prakash T, Sharma V
K, Adati N, Ozawa R, Kumar N, Nishida Y, et al. Expression of
conjoined genes: another mechanism for gene regulation in
eukaryotes. PLoS One. 2010; 5(10):e13284. [0178] 28. Kumar-Sinha C,
Kalyana-Sundaram S, Chinnaiyan A M. SLC45A3-ELK4 Chimera in
Prostate Cancer Spotlight on cis-Splicing. Cancer Discov. 2012
July; 2(7):582-5. [0179] 29. Nacu S, Yuan W, Kan Z, Bhatt D, Rivers
C S, Stinson J, et al. Deep RNA sequencing analysis of readthrough
gene fusions in human prostate adenocarcinoma and reference
samples. BMC Med Genomics. 2011; 4:11. [0180] 30. Maher C A,
Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing X, et al.
Transcriptome sequencing to detect gene fusions in cancer. Nature.
2009 Mar. 5; 458(7234):97-101. [0181] 31. Zhang Y, Gong M, Yuan H,
Park H G, Frierson H F, Li H. Chimeric Transcript Generated by
cis-Splicing of Adjacent Genes Regulates Prostate Cancer Cell
Proliferation. Cancer Discov. 2012 July; 2(7):598-607. [0182] 32.
Kannan K, Wang L, Wang J, Ittmann M M, Li W, Yen L. Recurrent
chimeric RNAs enriched in human prostate cancer identified by deep
sequencing. Proc Natl Acad Sci USA. 2011 May 31; 108(22):9172-7.
[0183] 33. Zhou J, Liao J, Zheng X, Shen H. Chimeric RNAs as
potential biomarkers for tumor diagnosis. BMB Rep. 2012 March;
45(3):133-40. [0184] 34. Stephens P J, McBride D J, Lin M L, Varela
I, Pleasance E D, Simpson J T, et al. Complex landscapes of somatic
rearrangement in human breast cancer genomes. Nature. 2009 Dec. 24;
462(7276):1005-10. [0185] 35. Gertz J, Varley K E, Davis N S, Baas
B J, Goryshin I Y, Vaidyanathan R, et al. Transposase mediated
construction of RNA-seq libraries. Genome Res. 2012 January;
22(1):134-41. [0186] 36. Iyer M K, Chinnaiyan A M, Maher C A.
ChimeraScan: a tool for identifying chimeric transcription in
sequencing data. Bioinformatics. 2011 Oct. 15; 27(20):2903-4.
[0187] 37. Wahle E, Ruegsegger U. 3'-End processing of pre-mRNA in
eukaryotes. FEMS Microbiol Rev. 1999 June; 23(3):277-95. [0188] 38.
Martinson H G. An active role for splicing in 3'-end formation.
Wiley Interdiscip Rev RNA. 2011 July-August; 2(4):459-70. [0189]
39. Kuestner R E, Taft D W, Haran A, Brandt C S, Brender T, Lum K,
et al. Identification of the IL-17 receptor related molecule
IL-17RC as the receptor for IL-17F. J. Immunol. 2007 Oct. 15;
179(8):5462-73. [0190] 40. Rupp P A, Fouad G T, Egelston C A,
Reifsteck C A, Olson S B, Knosp W M, et al. Identification, genomic
organization and mRNA expression of CRELD1, the founding member of
a unique family of matricellular proteins. Gene. 2002 Jun. 26;
293(1-2):47-57. [0191] 41. Hummler E, Beermann F. Scnn1 sodium
channel gene family in genetically engineered mice. J Am Soc
Nephrol. 2000 November; 11 Suppl 16:S129-34. [0192] 42. Chen G,
Goeddel DV. TNF-R1 signaling: a beautiful pathway. Science. 2002
May 31; 296(5573):1634-5. [0193] 43. Nicotra G, Castino R, Follo C,
Peracchio C, Valente G, Isidoro C. The dilemma: does tissue
expression of cathepsin D reflect tumor malignancy? The question:
does the assay truly mirror cathepsin D mis-function in the tumor?
Cancer Biomark. 2010; 7(1):47-64. [0194] 44. Hickford D,
Frankenberg S, Shaw G, Renfree M B. Evolution of vertebrate
interferon inducible transmembrane proteins. BMC Genomics. 2012;
13:155. [0195] 45. Oliver P G, LoBuglio A F, Zhou T, Forero A, Kim
H, Zinn K R, et al. Effect of anti-DR5 and chemotherapy on
basal-like breast cancer. Breast Cancer Res Treat. 2012 June;
133(2):417-26. [0196] 46. Trapnell C, Pachter L, Salzberg S L.
TopHat: discovering splice junctions with RNA-Seq. Bioinformatics.
2009 May 1; 25(9):1105-11. [0197] 47. Hlarrow J, Denoeud F,
Frankish A, Reymond A, Chen C K, Chrast J, et al. GENCODE:
producing a reference annotation for ENCODE. Genome Biol. 2006; 7
Suppl 1:S4 1-9. [0198] 48. Trapnell C, Williams B A, Pertea G,
Mortazavi A, Kwan G, van Baren M J, et al. Transcript assembly and
quantification by RNA-Seq reveals unannotated transcripts and
isoform switching during cell differentiation. Nat Biotechnol. 2010
May; 28(5):511-5. [0199] 49. Robinson J T, Thorvaldsdottir H,
Winckler W, Guttman M, Lander E S, Getz G, et al. Integrative
genomics viewer. Nat Biotechnol. 2011 January; 29(1):24-6.
Sequence CWU 1
1
28178DNAHomo sapiens 1ctttccctca tcctccttct caaaaaggat cacgcgaaag
gtccccagcc tgggtaaaga 60tggccccatg gcccccga 78288DNAHomo sapiens
2gagctgaact acaaaaccaa ttctgagtct ccctctgtca cggtgctcct ggagctgttg
60gtgggaatat acccctcagg ggttattg 88365DNAHomo sapiens 3ctgtccccag
aggactacac gctcaaggcc cagggccccg gccagtgccc agccccgctg 60ggaga
65418PRTHomo sapiens 4Leu Ser Leu Ile Leu Leu Leu Lys Lys Asp His
Ala Lys Gly Pro Gln 1 5 10 15 Pro Gly 526PRTHomo sapiens 5Leu Ser
Leu Ile Leu Leu Leu Lys Lys Asp His Ala Lys Ser Pro Ala 1 5 10 15
Trp Val Lys Met Ala Pro Trp Pro Pro Lys 20 25 630PRTHomo sapiens
6Glu Leu Asn Tyr Lys Thr Asn Ser Glu Ser Pro Ser Val Thr Val Leu 1
5 10 15 Leu Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly 20
25 30 722PRTHomo sapiens 7Leu Ser Pro Glu Asp Tyr Thr Leu Lys Ala
Gln Gly Pro Gly Gln Cys 1 5 10 15 Pro Ala Pro Leu Gly Asp 20
84051DNAHomo sapiens 8acagccagca gcctgccggg agccaaaacg aaagcactcc
gtgctggaag taggaggaga 60gtcaggactc ccaggacaga gagtgcacaa actacccagc
acagccccct ccgccccctc 120tggaggctga agagggattc cagcccctgc
cacccacaga cacgggctga ctggggtgtc 180tgcccccctt gggggggggc
agcacagggc ctcaggcctg ggtgccacct ggcacctaga 240agatgcctgt
gccctggttc ttgctgtcct tggcactggg ccgaagccca gtggtccttt
300ctctggagag gcttgtgggg cctcaggacg ctacccactg ctctccgggc
ctctcctgcc 360gcctctggga cagtgacata ctctgcctgc ctggggacat
cgtgcctgct ccgggccccg 420tgctggcgcc tacgcacctg cagacagagc
tggtgctgag gtgccagaag gagaccgact 480gtgacctctg tctgcgtgtg
gctgtccact tggccgtgca tgggcactgg gaagagcctg 540aagatgagga
aaagtttgga ggagcagctg actcaggggt ggaggagcct aggaatgcct
600ctctccaggc ccaagtcgtg ctctccttcc aggcctaccc tactgcccgc
tgcgtcctgc 660tggaggtgca agtgcctgct gcccttgtgc agtttggtca
gtctgtgggc tctgtggtat 720atgactgctt cgaggctgcc ctagggagtg
aggtacgaat ctggtcctat actcagccca 780ggtacgagaa ggaactcaac
cacacacagc agctgcctga ctgcaggggg ctcgaagtct 840ggaacagcat
cccgagctgc tgggccctgc cctggctcaa cgtgtcagca gatggtgaca
900acgtgcatct ggttctgaat gtctctgagg agcagcactt cggcctctcc
ctgtactgga 960atcaggtcca gggcccccca aaaccccggt ggcacaaaaa
cctgactgga ccgcagatca 1020ttaccttgaa ccacacagac ctggttccct
gcctctgtat tcaggtgtgg cctctggaac 1080ctgactccgt taggacgaac
atctgcccct tcagggagga cccccgcgca caccagaacc 1140tctggcaagc
cgcccgactg cgactgctga ccctgcagag ctggctgctg gacgcaccgt
1200gctcgctgcc cgcagaagcg gcactgtgct ggcgggctcc gggtggggac
ccctgccagc 1260cactggtccc accgctttcc tgggagaacg tcactgtgga
caaggttctc gagttcccat 1320tgctgaaagg ccaccctaac ctctgtgttc
aggtgaacag ctcggagaag ctgcagctgc 1380aggagtgctt gtgggctgac
tccctggggc ctctcaaaga cgatgtgcta ctgttggaga 1440cacgaggccc
ccaggacaac agatccctct gtgccttgga acccagtggc tgtacttcac
1500tacccagcaa agcctccacg agggcagctc gccttggaga gtacttacta
caagacctgc 1560agtcaggcca gtgtctgcag ctatgggacg atgacttggg
agcgctatgg gcctgcccca 1620tggacaaata catccacaag cgctgggccc
tcgtgtggct ggcctgccta ctctttgccg 1680ctgcgctttc cctcatcctc
cttctcaaaa aggatcacgc gaaaggtccc cagcctgggt 1740aaagatggcc
ccatggcccc cgaagggcct agtcccagct gtgctctggg gcctcagcct
1800cttcctcaac ctcccaggac ctatctggct ccagccctct ccacctcccc
agtcttctcc 1860cccgcctcag ccccatccgt gtcatacctg ccggggactg
gttgacagct ttaacaaggg 1920cctggagaga accatccggg acaactttgg
aggtggaaac actgcctggg aggaagagaa 1980tttgtccaaa tacaaagaca
gtgagacccg cctggtagag gtgctggagg gtgtgtgcag 2040caagtcagac
ttcgagtgcc accgcctgct ggagctgagt gaggagctgg tggagagctg
2100gtggtttcac aagcagcagg aggccccgga cctcttccag tggctgtgct
cagattccct 2160gaagctctgc tgccccgcag gcaccttcgg gccctcctgc
cttccctgtc ctgggggaac 2220agagaggccc tgcggtggct acgggcagtg
tgaaggagaa gggacacgag ggggcagcgg 2280gcactgtgac tgccaagccg
gctacggggg tgaggcctgt ggccagtgtg gccttggcta 2340ctttgaggca
gaacgcaacg ccagccatct ggtatgttcg gcttgttttg gcccctgtgc
2400ccgatgctca ggacctgagg aatcaaactg tttgcaatgc aagaagggct
gggccctgca 2460tcacctcaag tgtgtagaca ttgatgagtg tggcacagag
ggagccaact gtggagctga 2520ccaattctgc gtgaacactg agggctccta
tgagtgccga gactgtgcca aggcctgcct 2580aggctgcatg ggggcagggc
caggtcgctg taagaagtgt agccctggct atcagcaggt 2640gggctccaag
tgtctcgatg tggatgagtg tgagacagag gtgtgtccgg gagagaacaa
2700gcagtgtgaa aacaccgagg gcggttatcg ctgcatctgt gccgagggct
acaagcagat 2760ggaaggcatc tgtgtgaagg agcagatccc aggtgcattc
cccatcttaa ctgatttaac 2820ccctgaaaca acccgacgct ggaagttggg
ttctcatccc cactctacat atgtaaaaat 2880gaagatgcag agagatgaag
ctactttccc agggctatat ggcaagcaag tcgcaaagct 2940gggatcccaa
tccagacagt ctgaccgtgg aacgagactc atacacagtc agcaggcttc
3000ttctcagaga tgacagaaga cgagttggtg gtgctgcagc agatgttctt
tggcatcatc 3060atctgtgcac tggccacgct ggctgctaag ggcgacttgg
tgttcaccgc catcttcatt 3120ggggctgtgg cggccatgac tggctactgg
ttgtcagagc gcagtgaccg tgtgctggag 3180ggcttcatca agggcagata
atcgcggcca ccacctgtag gacctcctcc cacccacgct 3240gcccccagag
cttgggctgc cctcctgctg gacactcagg acagcttggt ttatttttga
3300gagtggggta agcaccccta cctgccttac agagcagccc aggtacccag
gcccgggcag 3360acaaggcccc tggggtaaaa agtagccctg aaggtggata
ccatgagctc ttcacctggc 3420ggggactggc aggcttcaca atgtgtgaat
ttcaaaagtt tttccttaat ggtggctgct 3480agagctttgg cccctgctta
ggattaggtg gtcctcacag gggtggggcc atcacagctc 3540cctcctgcca
gctgcatgct gccagttcct gttctgtgtt caccacatcc ccacacccca
3600ttgccactta tttattcatc tcaggaaata aagaaaggtc ttggaaagtt
aaaaggcatc 3660agtcttacta cctgtcccac cacccccacc ttagggaaat
gtcctagaat cctgggaaat 3720tgagggcttc tttgatggtg agtggagaaa
agatagagga gaaggttgcc cctgaagtgc 3780tgttaggaga aggaggatag
aggaatcagc cttaggaggg ttccatgcca gctgtcattt 3840ggcaaaggac
cctggacaga tgacttttgc ctctgaactt cactcttctc tttcctcaaa
3900tgggcttcat aatgctttcc actcaggctt aacatgagaa ttaaatgagg
tgacaaatgt 3960gaagacctgg acagtacaca acagatattc aataaaagtg
tggtcgccat tatgaccaga 4020gcctccaagc ctcaaaaaaa aaaaaaaaaa a
40519922PRTHomo sapiens 9Met Pro Val Pro Trp Phe Leu Leu Ser Leu
Ala Leu Gly Arg Ser Pro 1 5 10 15 Val Val Leu Ser Leu Glu Arg Leu
Val Gly Pro Gln Asp Ala Thr His 20 25 30 Cys Ser Pro Gly Leu Ser
Cys Arg Leu Trp Asp Ser Asp Ile Leu Cys 35 40 45 Leu Pro Gly Asp
Ile Val Pro Ala Pro Gly Pro Val Leu Ala Pro Thr 50 55 60 His Leu
Gln Thr Glu Leu Val Leu Arg Cys Gln Lys Glu Thr Asp Cys 65 70 75 80
Asp Leu Cys Leu Arg Val Ala Val His Leu Ala Val His Gly His Trp 85
90 95 Glu Glu Pro Glu Asp Glu Glu Lys Phe Gly Gly Ala Ala Asp Ser
Gly 100 105 110 Val Glu Glu Pro Arg Asn Ala Ser Leu Gln Ala Gln Val
Val Leu Ser 115 120 125 Phe Gln Ala Tyr Pro Thr Ala Arg Cys Val Leu
Leu Glu Val Gln Val 130 135 140 Pro Ala Ala Leu Val Gln Phe Gly Gln
Ser Val Gly Ser Val Val Tyr 145 150 155 160 Asp Cys Phe Glu Ala Ala
Leu Gly Ser Glu Val Arg Ile Trp Ser Tyr 165 170 175 Thr Gln Pro Arg
Tyr Glu Lys Glu Leu Asn His Thr Gln Gln Leu Pro 180 185 190 Asp Cys
Arg Gly Leu Glu Val Trp Asn Ser Ile Pro Ser Cys Trp Ala 195 200 205
Leu Pro Trp Leu Asn Val Ser Ala Asp Gly Asp Asn Val His Leu Val 210
215 220 Leu Asn Val Ser Glu Glu Gln His Phe Gly Leu Ser Leu Tyr Trp
Asn 225 230 235 240 Gln Val Gln Gly Pro Pro Lys Pro Arg Trp His Lys
Asn Leu Thr Gly 245 250 255 Pro Gln Ile Ile Thr Leu Asn His Thr Asp
Leu Val Pro Cys Leu Cys 260 265 270 Ile Gln Val Trp Pro Leu Glu Pro
Asp Ser Val Arg Thr Asn Ile Cys 275 280 285 Pro Phe Arg Glu Asp Pro
Arg Ala His Gln Asn Leu Trp Gln Ala Ala 290 295 300 Arg Leu Arg Leu
Leu Thr Leu Gln Ser Trp Leu Leu Asp Ala Pro Cys 305 310 315 320 Ser
Leu Pro Ala Glu Ala Ala Leu Cys Trp Arg Ala Pro Gly Gly Asp 325 330
335 Pro Cys Gln Pro Leu Val Pro Pro Leu Ser Trp Glu Asn Val Thr Val
340 345 350 Asp Lys Val Leu Glu Phe Pro Leu Leu Lys Gly His Pro Asn
Leu Cys 355 360 365 Val Gln Val Asn Ser Ser Glu Lys Leu Gln Leu Gln
Glu Cys Leu Trp 370 375 380 Ala Asp Ser Leu Gly Pro Leu Lys Asp Asp
Val Leu Leu Leu Glu Thr 385 390 395 400 Arg Gly Pro Gln Asp Asn Arg
Ser Leu Cys Ala Leu Glu Pro Ser Gly 405 410 415 Cys Thr Ser Leu Pro
Ser Lys Ala Ser Thr Arg Ala Ala Arg Leu Gly 420 425 430 Glu Tyr Leu
Leu Gln Asp Leu Gln Ser Gly Gln Cys Leu Gln Leu Trp 435 440 445 Asp
Asp Asp Leu Gly Ala Leu Trp Ala Cys Pro Met Asp Lys Tyr Ile 450 455
460 His Lys Arg Trp Ala Leu Val Trp Leu Ala Cys Leu Leu Phe Ala Ala
465 470 475 480 Ala Leu Ser Leu Ile Leu Leu Leu Lys Lys Asp His Ala
Lys Ser Pro 485 490 495 Ala Trp Val Lys Met Ala Pro Trp Pro Pro Lys
Gly Leu Val Pro Ala 500 505 510 Val Leu Trp Gly Leu Ser Leu Phe Leu
Asn Leu Pro Gly Pro Ile Trp 515 520 525 Leu Gln Pro Ser Pro Pro Pro
Gln Ser Ser Pro Pro Pro Gln Pro His 530 535 540 Pro Cys His Thr Cys
Arg Gly Leu Val Asp Ser Phe Asn Lys Gly Leu 545 550 555 560 Glu Arg
Thr Ile Arg Asp Asn Phe Gly Gly Gly Asn Thr Ala Trp Glu 565 570 575
Glu Glu Asn Leu Ser Lys Tyr Lys Asp Ser Glu Thr Arg Leu Val Glu 580
585 590 Val Leu Glu Gly Val Cys Ser Lys Ser Asp Phe Glu Cys His Arg
Leu 595 600 605 Leu Glu Leu Ser Glu Glu Leu Val Glu Ser Trp Trp Phe
His Lys Gln 610 615 620 Gln Glu Ala Pro Asp Leu Phe Gln Trp Leu Cys
Ser Asp Ser Leu Lys 625 630 635 640 Leu Cys Cys Pro Ala Gly Thr Phe
Gly Pro Ser Cys Leu Pro Cys Pro 645 650 655 Gly Gly Thr Glu Arg Pro
Cys Gly Gly Tyr Gly Gln Cys Glu Gly Glu 660 665 670 Gly Thr Arg Gly
Gly Ser Gly His Cys Asp Cys Gln Ala Gly Tyr Gly 675 680 685 Gly Glu
Ala Cys Gly Gln Cys Gly Leu Gly Tyr Phe Glu Ala Glu Arg 690 695 700
Asn Ala Ser His Leu Val Cys Ser Ala Cys Phe Gly Pro Cys Ala Arg 705
710 715 720 Cys Ser Gly Pro Glu Glu Ser Asn Cys Leu Gln Cys Lys Lys
Gly Trp 725 730 735 Ala Leu His His Leu Lys Cys Val Asp Ile Asp Glu
Cys Gly Thr Glu 740 745 750 Gly Ala Asn Cys Gly Ala Asp Gln Phe Cys
Val Asn Thr Glu Gly Ser 755 760 765 Tyr Glu Cys Arg Asp Cys Ala Lys
Ala Cys Leu Gly Cys Met Gly Ala 770 775 780 Gly Pro Gly Arg Cys Lys
Lys Cys Ser Pro Gly Tyr Gln Gln Val Gly 785 790 795 800 Ser Lys Cys
Leu Asp Val Asp Glu Cys Glu Thr Glu Val Cys Pro Gly 805 810 815 Glu
Asn Lys Gln Cys Glu Asn Thr Glu Gly Gly Tyr Arg Cys Ile Cys 820 825
830 Ala Glu Gly Tyr Lys Gln Met Glu Gly Ile Cys Val Lys Glu Gln Ile
835 840 845 Pro Gly Ala Phe Pro Ile Leu Thr Asp Leu Thr Pro Glu Thr
Thr Arg 850 855 860 Arg Trp Lys Leu Gly Ser His Pro His Ser Thr Tyr
Val Lys Met Lys 865 870 875 880 Met Gln Arg Asp Glu Ala Thr Phe Pro
Gly Leu Tyr Gly Lys Gln Val 885 890 895 Ala Lys Leu Gly Ser Gln Ser
Arg Gln Ser Asp Arg Gly Thr Arg Leu 900 905 910 Ile His Ser Gln Gln
Ala Ser Ser Gln Arg 915 920 103834DNAHomo sapiens 10cttgcctgtc
tgcgtctaaa gcccctgccc agagtccgcc ttctcaggtc cagtactccc 60agttcacctg
ccctcgggag ccctccttcc ttcggaaaac tcccggctct gactcctcct
120cagcccctcc ccccgccctg ctcaccttta attgagatgc taatgagatt
cctgtcgctt 180ccatccctgg ccggccagcg ggcgggctcc ccagccaggc
cgctgcacct gtcaggggaa 240caagctggag gagcaggacc ctagacctct
gcagcccata ccaggtctca tggaggggaa 300caagctggag gagcaggact
ctagccctcc acagtccact ccagggctca tgaaggggaa 360caagcgtgag
gagcaggggc tgggccccga acctgcggcg ccccagcagc ccacggcgga
420ggaggaggcc ctgatcgagt tccaccgctc ctaccgagag ctcttcgagt
tcttctgcaa 480caacaccacc atccacggcg ccatccgcct ggtgtgctcc
cagcacaacc gcatgaagac 540ggccttctgg gcagtgctgt ggctctgcac
ctttggcatg atgtactggc aattcggcct 600gcttttcgga gagtacttca
gctaccccgt cagcctcaac atcaacctca actcggacaa 660gctcgtcttc
cccgcagtga ccatctgcac cctcaatccc tacaggtacc cggaaattaa
720agaggagctg gaggagctgg accgcatcac agagcagacg ctctttgacc
tgtacaaata 780cagctccttc accactctcg tggccggctc ccgcagccgt
cgcgacctgc gggggactct 840gccgcacccc ttgcagcgcc tgagggtccc
gcccccgcct cacggggccc gtcgagcccg 900tagcgtggcc tccagcttgc
gggacaacaa cccccaggtg gactggaagg actggaagat 960cggcttccag
ctgtgcaacc agaacaaatc ggactgcttc taccagacat actcatcagg
1020ggtggatgcg gtgagggagt ggtaccgctt ccactacatc aacatcctgt
cgaggctgcc 1080agagactctg ccatccctgg aggaggacac gctgggcaac
ttcatcttcg cctgccgctt 1140caaccaggtc tcctgcaacc aggcgaatta
ctctcacttc caccacccga tgtatggaaa 1200ctgctatact ttcaatgaca
agaacaactc caacctctgg atgtcttcca tgcctggaat 1260caacaacggt
ctgtccctga tgctgcgcgc agagcagaat gacttcattc ccctgctgtc
1320cacagtgact ggggcccggg taatggtgca cgggcaggat gaacctgcct
ttatggatga 1380tggtggcttt aacttgcggc ctggcgtgga gacctccatc
agcatgagga aggaaaccct 1440ggacagactt gggggcgatt atggcgactg
caccaagaat ggcagtgatg ttcctgttga 1500gaacctttac ccttcaaagt
acacacagca ggtgtgtatt cactcctgct tccaggagag 1560catgatcaag
gagtgtggct gtgcctacat cttctatccg cggccccaga acgtggagta
1620ctgtgactac agaaagcaca gttcctgggg gtactgctac tataagctcc
aggttgactt 1680ctcctcagac cacctgggct gtttcaccaa gtgccggaag
ccatgcagcg tgaccagcta 1740ccagctctct gctggttact cacgatggcc
ctcggtgaca tcccaggaat gggtcttcca 1800gatgctatcg cgacagaaca
attacaccgt caacaacaag agaaatggag tggccaaagt 1860caacatcttc
ttcaaggagc tgaactacaa aaccaattct gagtctccct ctgtcacggt
1920gctcctggag ctgttggtgg gaatataccc ctcaggggtt attggactgg
tccctcacct 1980aggggacagg gagaagagag atagtgtgtg tccccaagga
aaatatatcc accctcaaaa 2040taattcgatt tgctgtacca agtgccacaa
aggaacctac ttgtacaatg actgtccagg 2100cccggggcag gatacggact
gcagggagtg tgagagcggc tccttcaccg cttcagaaaa 2160ccacctcaga
cactgcctca gctgctccaa atgccgaaag gaaatgggtc aggtggagat
2220ctcttcttgc acagtggacc gggacaccgt gtgtggctgc aggaagaacc
agtaccggca 2280ttattggagt gaaaaccttt tccagtgctt caattgcagc
ctctgcctca atgggaccgt 2340gcacctctcc tgccaggaga aacagaacac
cgtgtgcacc tgccatgcag gtttctttct 2400aagagaaaac gagtgtgtct
cctgtagtaa ctgtaagaaa agcctggagt gcacgaagtt 2460gtgcctaccc
cagattgaga atgttaaggg cactgaggac tcaggcacca cagtgctgtt
2520gcccctggtc attttctttg gtctttgcct tttatccctc ctcttcattg
gtttaatgta 2580tcgctaccaa cggtggaagt ccaagctcta ctccattgtt
tgtgggaaat cgacacctga 2640aaaagagggg gagcttgaag gaactactac
taagcccctg gccccaaacc caagcttcag 2700tcccactcca ggcttcaccc
ccaccctggg cttcagtccc gtgcccagtt ccaccttcac 2760ctccagctcc
acctataccc ccggtgactg tcccaacttt gcggctcccc gcagagaggt
2820ggcaccaccc tatcaggggg ctgaccccat ccttgcgaca gccctcgcct
ccgaccccat 2880ccccaacccc cttcagaagt gggaggacag cgcccacaag
ccacagagcc tagacactga 2940tgaccccgcg acgctgtacg ccgtggtgga
gaacgtgccc ccgttgcgct ggaaggaatt 3000cgtgcggcgc ctagggctga
gcgaccacga gatcgatcgg ctggagctgc agaacgggcg 3060ctgcctgcgc
gaggcgcaat acagcatgct ggcgacctgg aggcggcgca cgccgcggcg
3120cgaggccacg ctggagctgc tgggacgcgt gctccgcgac atggacctgc
tgggctgcct 3180ggaggacatc gaggaggcgc tttgcggccc cgccgccctc
ccgcccgcgc ccagtcttct 3240cagatgaggc tgcgcccctg cgggcagctc
taaggaccgt cctgcgagat cgccttccaa 3300ccccactttt ttctggaaag
gaggggtcct gcaggggcaa gcaggagcta gcagccgcct 3360acttggtgct
aacccctcga tgtacatagc ttttctcagc tgcctgcgcg ccgccgacag
3420tcagcgctgt gcgcgcggag agaggtgcgc cgtgggctca agagcctgag
tgggtggttt 3480gcgaggatga gggacgctat gcctcatgcc cgttttgggt
gtcctcacca gcaaggctgc 3540tcgggggccc ctggttcgtc cctgagcctt
tttcacagtg cataagcagt tttttttgtt 3600tttgttttgt tttgttttgt
ttttaaatca atcatgttac actaatagaa acttggcact 3660cctgtgccct
ctgcctggac aagcacatag caagctgaac tgtcctaagg caggggcgag
3720cacggaacaa tggggccttc agctggagct gtggactttt gtacatacac
taaaattctg 3780aagttaaagc tctgctcttg
gaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaa 383411985PRTHomo sapiens
11Met Glu Gly Asn Lys Leu Glu Glu Gln Asp Ser Ser Pro Pro Gln Ser 1
5 10 15 Thr Pro Gly Leu Met Lys Gly Asn Lys Arg Glu Glu Gln Gly Leu
Gly 20 25 30 Pro Glu Pro Ala Ala Pro Gln Gln Pro Thr Ala Glu Glu
Glu Ala Leu 35 40 45 Ile Glu Phe His Arg Ser Tyr Arg Glu Leu Phe
Glu Phe Phe Cys Asn 50 55 60 Asn Thr Thr Ile His Gly Ala Ile Arg
Leu Val Cys Ser Gln His Asn 65 70 75 80 Arg Met Lys Thr Ala Phe Trp
Ala Val Leu Trp Leu Cys Thr Phe Gly 85 90 95 Met Met Tyr Trp Gln
Phe Gly Leu Leu Phe Gly Glu Tyr Phe Ser Tyr 100 105 110 Pro Val Ser
Leu Asn Ile Asn Leu Asn Ser Asp Lys Leu Val Phe Pro 115 120 125 Ala
Val Thr Ile Cys Thr Leu Asn Pro Tyr Arg Tyr Pro Glu Ile Lys 130 135
140 Glu Glu Leu Glu Glu Leu Asp Arg Ile Thr Glu Gln Thr Leu Phe Asp
145 150 155 160 Leu Tyr Lys Tyr Ser Ser Phe Thr Thr Leu Val Ala Gly
Ser Arg Ser 165 170 175 Arg Arg Asp Leu Arg Gly Thr Leu Pro His Pro
Leu Gln Arg Leu Arg 180 185 190 Val Pro Pro Pro Pro His Gly Ala Arg
Arg Ala Arg Ser Val Ala Ser 195 200 205 Ser Leu Arg Asp Asn Asn Pro
Gln Val Asp Trp Lys Asp Trp Lys Ile 210 215 220 Gly Phe Gln Leu Cys
Asn Gln Asn Lys Ser Asp Cys Phe Tyr Gln Thr 225 230 235 240 Tyr Ser
Ser Gly Val Asp Ala Val Arg Glu Trp Tyr Arg Phe His Tyr 245 250 255
Ile Asn Ile Leu Ser Arg Leu Pro Glu Thr Leu Pro Ser Leu Glu Glu 260
265 270 Asp Thr Leu Gly Asn Phe Ile Phe Ala Cys Arg Phe Asn Gln Val
Ser 275 280 285 Cys Asn Gln Ala Asn Tyr Ser His Phe His His Pro Met
Tyr Gly Asn 290 295 300 Cys Tyr Thr Phe Asn Asp Lys Asn Asn Ser Asn
Leu Trp Met Ser Ser 305 310 315 320 Met Pro Gly Ile Asn Asn Gly Leu
Ser Leu Met Leu Arg Ala Glu Gln 325 330 335 Asn Asp Phe Ile Pro Leu
Leu Ser Thr Val Thr Gly Ala Arg Val Met 340 345 350 Val His Gly Gln
Asp Glu Pro Ala Phe Met Asp Asp Gly Gly Phe Asn 355 360 365 Leu Arg
Pro Gly Val Glu Thr Ser Ile Ser Met Arg Lys Glu Thr Leu 370 375 380
Asp Arg Leu Gly Gly Asp Tyr Gly Asp Cys Thr Lys Asn Gly Ser Asp 385
390 395 400 Val Pro Val Glu Asn Leu Tyr Pro Ser Lys Tyr Thr Gln Gln
Val Cys 405 410 415 Ile His Ser Cys Phe Gln Glu Ser Met Ile Lys Glu
Cys Gly Cys Ala 420 425 430 Tyr Ile Phe Tyr Pro Arg Pro Gln Asn Val
Glu Tyr Cys Asp Tyr Arg 435 440 445 Lys His Ser Ser Trp Gly Tyr Cys
Tyr Tyr Lys Leu Gln Val Asp Phe 450 455 460 Ser Ser Asp His Leu Gly
Cys Phe Thr Lys Cys Arg Lys Pro Cys Ser 465 470 475 480 Val Thr Ser
Tyr Gln Leu Ser Ala Gly Tyr Ser Arg Trp Pro Ser Val 485 490 495 Thr
Ser Gln Glu Trp Val Phe Gln Met Leu Ser Arg Gln Asn Asn Tyr 500 505
510 Thr Val Asn Asn Lys Arg Asn Gly Val Ala Lys Val Asn Ile Phe Phe
515 520 525 Lys Glu Leu Asn Tyr Lys Thr Asn Ser Glu Ser Pro Ser Val
Thr Val 530 535 540 Leu Leu Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly
Val Ile Gly Leu 545 550 555 560 Val Pro His Leu Gly Asp Arg Glu Lys
Arg Asp Ser Val Cys Pro Gln 565 570 575 Gly Lys Tyr Ile His Pro Gln
Asn Asn Ser Ile Cys Cys Thr Lys Cys 580 585 590 His Lys Gly Thr Tyr
Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp 595 600 605 Thr Asp Cys
Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn 610 615 620 His
Leu Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly 625 630
635 640 Gln Val Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys
Gly 645 650 655 Cys Arg Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn
Leu Phe Gln 660 665 670 Cys Phe Asn Cys Ser Leu Cys Leu Asn Gly Thr
Val His Leu Ser Cys 675 680 685 Gln Glu Lys Gln Asn Thr Val Cys Thr
Cys His Ala Gly Phe Phe Leu 690 695 700 Arg Glu Asn Glu Cys Val Ser
Cys Ser Asn Cys Lys Lys Ser Leu Glu 705 710 715 720 Cys Thr Lys Leu
Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu 725 730 735 Asp Ser
Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu 740 745 750
Cys Leu Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg 755
760 765 Trp Lys Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro
Glu 770 775 780 Lys Glu Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu
Ala Pro Asn 785 790 795 800 Pro Ser Phe Ser Pro Thr Pro Gly Phe Thr
Pro Thr Leu Gly Phe Ser 805 810 815 Pro Val Pro Ser Ser Thr Phe Thr
Ser Ser Ser Thr Tyr Thr Pro Gly 820 825 830 Asp Cys Pro Asn Phe Ala
Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr 835 840 845 Gln Gly Ala Asp
Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile 850 855 860 Pro Asn
Pro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser 865 870 875
880 Leu Asp Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val
885 890 895 Pro Pro Leu Arg Trp Lys Glu Phe Val Arg Arg Leu Gly Leu
Ser Asp 900 905 910 His Glu Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg
Cys Leu Arg Glu 915 920 925 Ala Gln Tyr Ser Met Leu Ala Thr Trp Arg
Arg Arg Thr Pro Arg Arg 930 935 940 Glu Ala Thr Leu Glu Leu Leu Gly
Arg Val Leu Arg Asp Met Asp Leu 945 950 955 960 Leu Gly Cys Leu Glu
Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala Ala 965 970 975 Leu Pro Pro
Ala Pro Ser Leu Leu Arg 980 985 124689DNAHomo sapiens 12gcgcacgccg
gccgcgccca cgtgaccggt ccgggtgcaa acacgcgggt cagctgatcc 60ggcccaactg
cggcgtcatc ccggctataa gcgcacggcc tcggcgaccc tctccgaccc
120ggccgccgcc gccatgcagc cctccagcct tctgccgctc gccctctgcc
tgctggctgc 180acccgcctcc gcgctcgtca ggatcccgct gcacaagttc
acgtccatcc gccggaccat 240gtcggaggtt gggggctctg tggaggacct
gattgccaaa ggccccgtct caaagtactc 300ccaggcggtg ccagccgtga
ccgaggggcc cattcccgag gtgctcaaga actacatgga 360cgcccagtac
tacggggaga ttggcatcgg gacgcccccc cagtgcttca cagtcgtctt
420cgacacgggc tcctccaacc tgtgggtccc ctccatccac tgcaaactgc
tggacatcgc 480ttgctggatc caccacaagt acaacagcga caagtccagc
acctacgtga agaatggtac 540ctcgtttgac atccactatg gctcgggcag
cctctccggg tacctgagcc aggacactgt 600gtcggtgccc tgccagtcag
cgtcgtcagc ctctgccctg ggcggtgtca aagtggagag 660gcaggtcttt
ggggaggcca ccaagcagcc aggcatcacc ttcatcgcag ccaagttcga
720tggcatcctg ggcatggcct acccccgcat ctccgtcaac aacgtgctgc
ccgtcttcga 780caacctgatg cagcagaagc tggtggacca gaacatcttc
tccttctacc tgagcaggga 840cccagatgcg cagcctgggg gtgagctgat
gctgggtggc acagactcca agtattacaa 900gggttctctg tcctacctga
atgtcacccg caaggcctac tggcaggtcc acctggacca 960ggtggaggtg
gccagcgggc tgaccctgtg caaggagggc tgtgaggcca ttgtggacac
1020aggcacttcc ctcatggtgg gcccggtgga tgaggtgcgc gagctgcaga
aggccatcgg 1080ggccgtgccg ctgattcagg gcgagtacat gatcccctgt
gagaaggtgt ccaccctgcc 1140cgcgatcaca ctgaagctgg gaggcaaagg
ctacaagctg tccccagagg actacacgct 1200caaggcccag ggccccggcc
agtgcccagc cccgctggga gacccggcca gcaccacgga 1260cggcgcccag
gaagcccgag tccccctgga cggggccttc tggattccga ggcccccggc
1320aggttcgccc aagggctgct tcgcttgcgt gtccaagccc cctgccctgc
aggctccggc 1380ggcccctgcc cctgagccct cggcctctcc cccgatggcg
cccacactgt tccccatgga 1440gtccaagagc agcaagaccg acagcgtgcg
ggctgccggc gcgccccctg cctgcaagca 1500cctagccgag aagaagacga
tgaccaaccc cacgaccgtc atcgaggtct acccggacac 1560caccgaggtg
aacgactatt acctgtggtc catcttcaac ttcgtctacc tcaacttctg
1620ctgcctgggc ttcatcgcct tggcctactc cctcaaagtg cgagacaaga
agcttctcaa 1680tgacctgaat ggagccgtgg aggatgcaaa gacggcccgg
ctgttcaaca tcaccagttc 1740tgccctggca gcctcctgca tcatcctcgt
cttcatcttc ctgcggtacc ccctcaccga 1800ctactaaggc ccgccaggca
cggctgctgg cggagacaag cactgagaca tgtttattct 1860catggtccct
gaaacgcagg atcccatgag gttggggcag ggcagggctt cttgtcctgg
1920ggcccccttg agctgtgaac tgggcagcaa ggccatcaga agctgagtac
agcaaggggg 1980cagtgagctt ggccctcagt ccaccccctc cgcctcctgg
cctccaccct gcctgtgtct 2040ggggcctggg ggcttctccc ctcgctgctg
caccctggct tccagcgtct gtgtccctgc 2100cctcacgtgc cccttcccag
gctcctgggg ccccttggac ctgacaccta gcaggaaggg 2160cttatgcaaa
attgtcccag gttgggagga ctcactctgt gctccccgac cctgcctcct
2220ccacgatgtg accccgctca gagcccttgt gtctgtgaac tttcaatgaa
atacccatgc 2280agctccagcc cagccttcta ctttgtgtcc ctggcagggc
ctggagaagt ctggaggctt 2340tgcaatcctc cctcaggaac tgcctggcgg
tcagggcccc gggtgctgtg tcccaacaga 2400ctgcagggga cggtctgctc
catcacagct gtgccagaca gtgaatggga agggggggca 2460tttggtggag
gtaccccaaa ctcgagtcac ttagagggtc aggcagcctc ctggggggac
2520ggaagggggt ggggcacagc ctcagctgcc tgcattggcc aaatcagagc
aaaggaaacc 2580acaaattcac tcggaaggaa gcagcaggca gagacgatag
acgcctggct aacccctgtc 2640cctcctggag ggctctggga cctggacagg
cccctttacc tctctcgtgc ccatctcctt 2700agctgtaaaa taggaaaatg
gcctttcact tctataatca ctgtgaaaat gaacggaaga 2760tgcctttcaa
aggccgaggc cagcgccctg acggcccatg gcatgtgcag tccacaatgt
2820gggaggcagg atgcagggat gggctctgtc cccttggaac tcaggcacag
tcatgggggt 2880gccggtcagc cctgaagaca agctgatgag ggtgcactag
gaaaagtgca gggcatcggc 2940gaggcacacg aaggaggtgg ggaggtgaag
atggagaaga agccgaggca gtggccatgg 3000gtgtggagct tcgcgctgtg
ggtgcccagc tggtctggga aaccgcagga aatcccgcag 3060ctcaggtgcg
cagtgggaag gacttgctat tccgtgggaa ggcaggcaaa ccttcccagg
3120gaaggggcat ggccgtgcgc ctcatgtttt gggaagctcg tgccctctgg
ggtagcgagg 3180ccagcttgga ggggagtcca gtggacagag gtggatgcaa
gtggagggag ctgagcctgg 3240gctggggctg gcagcagagg gctggacagc
agggcgcctg cgtggcagct gtgcagtcag 3300tggggttgac tggtttggaa
ggtaaggtgg gggagaagcc cggaggattc ctgtcccttg 3360acttggacag
cccagtggag agggctgtgt accaagggca ggaaaccagg gagaagaaga
3420tgttgacttt aagataccaa gcagagaagg gaagagcctt ctgggctgga
gacgtggggt 3480gcctcagaag ggaggacctt gagctagcag cagatgggac
aaacgcaggg gacagggcac 3540agccgtggca ggagtgcagc gagcaagatt
ctggtcacag tcctgaccca gaaacctgca 3600gaggaaggga gggtggccag
cacctgcccg tgggcctggg gtgcagccca ggcagaggtg 3660gatggagggg
gtgctcaggg aagaggggag gggagtgtgt gacctcaaaa tgggagggct
3720tgggggtcag agtcgagaga ggggacaggg tggggaccat gtgggactct
tgagcactga 3780cccttgaacc caggcagtgg tgggatggga gggcaggagg
cggcgggctg cgaggctgat 3840gcggggctgc acggagctgt cattgagcct
cttggaggat ggtgggagaa gtgccagggg 3900cggctgaaag ccttgccgag
actgtgggca gcctggttgt gggcacttcg gatgcttgca 3960ccattagacc
cagaggcttc ctggacaagc ctgggctgga agaggatggc agaggctgct
4020gggccttgga agagagaggg tcctggcttc tagttcctgg ggcagctaag
gccaacccca 4080gtgtccaggt gtcttccatg ttatgcctgg gagggaagaa
agtagagggg caaatgcttt 4140ctttgcctat tttccttaaa catttggtgg
cagtgctggt ggctgcctgg gacaggggcc 4200aggaggaaac acccctgcat
tagggaagcc ctcagccagc ttttccctgg gatgttcctg 4260cgcctggctg
aagctttctg agttcatgtt ggggaaatgg aacggtcacc ttccagccag
4320taaaggcacc cctagctctt gggatgtttg tatccaactc cgggcaatgt
ggggctacaa 4380aggcccctgg cttccatacc ctggggaccg ggggagggct
ggtgctcccg cggtgggtgt 4440ccacggtgag gtcaggcccc cacagcaggt
gcattctcgc cctcagcagg caggcaagca 4500ggcatcagct ccggcgctgg
tctctggctt cgaagtctgt gtctttgcct gtctgtactc 4560atgcctgacc
tgctggcgct ccctgtccac tgcactcctc ccacctcatt tttatgtgat
4620tttgcacagt gcctggcaga catttgacat tcaataaaca ttgtacgaac
gaaagaaaaa 4680aaaaaaaaa 468913557PRTHomo sapiens 13Met Gln Pro Ser
Ser Leu Leu Pro Leu Ala Leu Cys Leu Leu Ala Ala 1 5 10 15 Pro Ala
Ser Ala Leu Val Arg Ile Pro Leu His Lys Phe Thr Ser Ile 20 25 30
Arg Arg Thr Met Ser Glu Val Gly Gly Ser Val Glu Asp Leu Ile Ala 35
40 45 Lys Gly Pro Val Ser Lys Tyr Ser Gln Ala Val Pro Ala Val Thr
Glu 50 55 60 Gly Pro Ile Pro Glu Val Leu Lys Asn Tyr Met Asp Ala
Gln Tyr Tyr 65 70 75 80 Gly Glu Ile Gly Ile Gly Thr Pro Pro Gln Cys
Phe Thr Val Val Phe 85 90 95 Asp Thr Gly Ser Ser Asn Leu Trp Val
Pro Ser Ile His Cys Lys Leu 100 105 110 Leu Asp Ile Ala Cys Trp Ile
His His Lys Tyr Asn Ser Asp Lys Ser 115 120 125 Ser Thr Tyr Val Lys
Asn Gly Thr Ser Phe Asp Ile His Tyr Gly Ser 130 135 140 Gly Ser Leu
Ser Gly Tyr Leu Ser Gln Asp Thr Val Ser Val Pro Cys 145 150 155 160
Gln Ser Ala Ser Ser Ala Ser Ala Leu Gly Gly Val Lys Val Glu Arg 165
170 175 Gln Val Phe Gly Glu Ala Thr Lys Gln Pro Gly Ile Thr Phe Ile
Ala 180 185 190 Ala Lys Phe Asp Gly Ile Leu Gly Met Ala Tyr Pro Arg
Ile Ser Val 195 200 205 Asn Asn Val Leu Pro Val Phe Asp Asn Leu Met
Gln Gln Lys Leu Val 210 215 220 Asp Gln Asn Ile Phe Ser Phe Tyr Leu
Ser Arg Asp Pro Asp Ala Gln 225 230 235 240 Pro Gly Gly Glu Leu Met
Leu Gly Gly Thr Asp Ser Lys Tyr Tyr Lys 245 250 255 Gly Ser Leu Ser
Tyr Leu Asn Val Thr Arg Lys Ala Tyr Trp Gln Val 260 265 270 His Leu
Asp Gln Val Glu Val Ala Ser Gly Leu Thr Leu Cys Lys Glu 275 280 285
Gly Cys Glu Ala Ile Val Asp Thr Gly Thr Ser Leu Met Val Gly Pro 290
295 300 Val Asp Glu Val Arg Glu Leu Gln Lys Ala Ile Gly Ala Val Pro
Leu 305 310 315 320 Ile Gln Gly Glu Tyr Met Ile Pro Cys Glu Lys Val
Ser Thr Leu Pro 325 330 335 Ala Ile Thr Leu Lys Leu Gly Gly Lys Gly
Tyr Lys Leu Ser Pro Glu 340 345 350 Asp Tyr Thr Leu Lys Ala Gln Gly
Pro Gly Gln Cys Pro Ala Pro Leu 355 360 365 Gly Asp Pro Ala Ser Thr
Thr Asp Gly Ala Gln Glu Ala Arg Val Pro 370 375 380 Leu Asp Gly Ala
Phe Trp Ile Pro Arg Pro Pro Ala Gly Ser Pro Lys 385 390 395 400 Gly
Cys Phe Ala Cys Val Ser Lys Pro Pro Ala Leu Gln Ala Pro Ala 405 410
415 Ala Pro Ala Pro Glu Pro Ser Ala Ser Pro Pro Met Ala Pro Thr Leu
420 425 430 Phe Pro Met Glu Ser Lys Ser Ser Lys Thr Asp Ser Val Arg
Ala Ala 435 440 445 Gly Ala Pro Pro Ala Cys Lys His Leu Ala Glu Lys
Lys Thr Met Thr 450 455 460 Asn Pro Thr Thr Val Ile Glu Val Tyr Pro
Asp Thr Thr Glu Val Asn 465 470 475 480 Asp Tyr Tyr Leu Trp Ser Ile
Phe Asn Phe Val Tyr Leu Asn Phe Cys 485 490 495 Cys Leu Gly Phe Ile
Ala Leu Ala Tyr Ser Leu Lys Val Arg Asp Lys 500 505 510 Lys Leu Leu
Asn Asp Leu Asn Gly Ala Val Glu Asp Ala Lys Thr Ala 515 520 525 Arg
Leu Phe Asn Ile Thr Ser Ser Ala Leu Ala Ala Ser Cys Ile Ile 530 535
540 Leu Val Phe Ile Phe Leu Arg Tyr Pro Leu Thr Asp Tyr 545 550 555
14499PRTHomo sapiens 14Met Pro Val Pro Trp Phe Leu Leu Ser Leu Ala
Leu Gly Arg Ser Pro 1 5 10 15 Val Val Leu Ser Leu Glu Arg Leu
Val
Gly Pro Gln Asp Ala Thr His 20 25 30 Cys Ser Pro Gly Leu Ser Cys
Arg Leu Trp Asp Ser Asp Ile Leu Cys 35 40 45 Leu Pro Gly Asp Ile
Val Pro Ala Pro Gly Pro Val Leu Ala Pro Thr 50 55 60 His Leu Gln
Thr Glu Leu Val Leu Arg Cys Gln Lys Glu Thr Asp Cys 65 70 75 80 Asp
Leu Cys Leu Arg Val Ala Val His Leu Ala Val His Gly His Trp 85 90
95 Glu Glu Pro Glu Asp Glu Glu Lys Phe Gly Gly Ala Ala Asp Ser Gly
100 105 110 Val Glu Glu Pro Arg Asn Ala Ser Leu Gln Ala Gln Val Val
Leu Ser 115 120 125 Phe Gln Ala Tyr Pro Thr Ala Arg Cys Val Leu Leu
Glu Val Gln Val 130 135 140 Pro Ala Ala Leu Val Gln Phe Gly Gln Ser
Val Gly Ser Val Val Tyr 145 150 155 160 Asp Cys Phe Glu Ala Ala Leu
Gly Ser Glu Val Arg Ile Trp Ser Tyr 165 170 175 Thr Gln Pro Arg Tyr
Glu Lys Glu Leu Asn His Thr Gln Gln Leu Pro 180 185 190 Asp Cys Arg
Gly Leu Glu Val Trp Asn Ser Ile Pro Ser Cys Trp Ala 195 200 205 Leu
Pro Trp Leu Asn Val Ser Ala Asp Gly Asp Asn Val His Leu Val 210 215
220 Leu Asn Val Ser Glu Glu Gln His Phe Gly Leu Ser Leu Tyr Trp Asn
225 230 235 240 Gln Val Gln Gly Pro Pro Lys Pro Arg Trp His Lys Asn
Leu Thr Gly 245 250 255 Pro Gln Ile Ile Thr Leu Asn His Thr Asp Leu
Val Pro Cys Leu Cys 260 265 270 Ile Gln Val Trp Pro Leu Glu Pro Asp
Ser Val Arg Thr Asn Ile Cys 275 280 285 Pro Phe Arg Glu Asp Pro Arg
Ala His Gln Asn Leu Trp Gln Ala Ala 290 295 300 Arg Leu Arg Leu Leu
Thr Leu Gln Ser Trp Leu Leu Asp Ala Pro Cys 305 310 315 320 Ser Leu
Pro Ala Glu Ala Ala Leu Cys Trp Arg Ala Pro Gly Gly Asp 325 330 335
Pro Cys Gln Pro Leu Val Pro Pro Leu Ser Trp Glu Asn Val Thr Val 340
345 350 Asp Lys Val Leu Glu Phe Pro Leu Leu Lys Gly His Pro Asn Leu
Cys 355 360 365 Val Gln Val Asn Ser Ser Glu Lys Leu Gln Leu Gln Glu
Cys Leu Trp 370 375 380 Ala Asp Ser Leu Gly Pro Leu Lys Asp Asp Val
Leu Leu Leu Glu Thr 385 390 395 400 Arg Gly Pro Gln Asp Asn Arg Ser
Leu Cys Ala Leu Glu Pro Ser Gly 405 410 415 Cys Thr Ser Leu Pro Ser
Lys Ala Ser Thr Arg Ala Ala Arg Leu Gly 420 425 430 Glu Tyr Leu Leu
Gln Asp Leu Gln Ser Gly Gln Cys Leu Gln Leu Trp 435 440 445 Asp Asp
Asp Leu Gly Ala Leu Trp Ala Cys Pro Met Asp Lys Tyr Ile 450 455 460
His Lys Arg Trp Ala Leu Val Trp Leu Ala Cys Leu Leu Phe Ala Ala 465
470 475 480 Ala Leu Ser Leu Ile Leu Leu Leu Lys Lys Asp His Ala Lys
Gly Pro 485 490 495 Gln Pro Gly 1521RNAHomo sapiens 15acuacacgcu
caaggcccau u 211621RNAHomo sapiens 16ugggccuuga gcguguaguu u
211721RNAHomo sapiens 17acgcucaagg cccagggccu u 211821RNAHomo
sapiens 18ggcccugggc cuugagcguu u 211921RNAHomo sapiens
19cugucacggu gcuccuggau u 212021RNAHomo sapiens 20uccaggagca
ccgugacagu u 212121RNAHomo sapiens 21cucugucacg gugcuccugu u
212221RNAHomo sapiens 22caggagcacc gugacagagu u 212320DNAHomo
sapiens 23ctacaagctg tccccagagg 202415DNAHomo sapiens 24ccgtccgtgg
tgctg 152521DNAHomo sapiens 25ggccaaagtc aacatcttct t 212620DNAHomo
sapiens 26ggggtatatt cccaccaaca 202721DNAHomo sapiens 27acctgttcct
gtgactgtac c 212821DNAHomo sapiens 28atgggttcac tttccgcaag g 21
* * * * *