U.S. patent application number 14/087299 was filed with the patent office on 2014-06-12 for method for predicting responsiveness to drugs.
This patent application is currently assigned to THE GENERAL HOSPITAL CORPORATION. The applicant listed for this patent is The General Hospital Corporation. Invention is credited to Daniel A. Haber, Gromoslaw A. Smolen.
Application Number | 20140162277 14/087299 |
Document ID | / |
Family ID | 36685627 |
Filed Date | 2014-06-12 |
United States Patent
Application |
20140162277 |
Kind Code |
A1 |
Haber; Daniel A. ; et
al. |
June 12, 2014 |
METHOD FOR PREDICTING RESPONSIVENESS TO DRUGS
Abstract
The present invention provides a novel method to determine the
likelihood of effectiveness of a treatment in an individual
affected with or at risk for developing cancer. The method involves
detecting the presence or absence of Met amplification in an
individual. The presence of Met amplification indicates that a Met
targeting treatment is likely to be effective. Preferably, the Met
targeting treatment is PHA-665752 or PF-02341066. In addition, the
present methods allow for the detection of cancer in an individual,
wherein the presence of Met amplification indicates that cancer is
present and further that it will be treatable, namely with a Met
targeting treatment.
Inventors: |
Haber; Daniel A.; (Chesnut
Hill, MA) ; Smolen; Gromoslaw A.; (Cambridge,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The General Hospital Corporation |
Boston |
MA |
US |
|
|
Assignee: |
THE GENERAL HOSPITAL
CORPORATION
Boston
MA
|
Family ID: |
36685627 |
Appl. No.: |
14/087299 |
Filed: |
November 22, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11887608 |
Nov 2, 2007 |
8652786 |
|
|
PCT/US2006/012678 |
Apr 5, 2006 |
|
|
|
14087299 |
|
|
|
|
60681601 |
May 17, 2005 |
|
|
|
60668419 |
Apr 5, 2005 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
G01N 33/57484 20130101;
C12Q 2600/106 20130101; C12Q 2600/158 20130101; C12Q 1/6886
20130101; C12Q 1/686 20130101 |
Class at
Publication: |
435/6.12 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support under Grant
No. PO1 95281 awarded by the National Institutes for Health (NIH).
The Government has certain rights in the invention thereto.
Claims
1. A method for identifying a cancer in an individual that is
susceptible to treatment comprising: a. isolating a biological
sample from an individual; and b. detecting the presence or absence
of amplification of the Met gene, wherein the presence of
amplification indicates that the cancer is susceptible to
treatment.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
Utility application Ser. No. 11/887,608, filed Nov. 2, 2007, which
is a 371 National Phase Entry Application of International
Application PCT/US2006/012678, filed Apr. 5, 2006, which designated
the U.S., which claims the benefit under 35 U.S.C. .sctn.119(e) of
U.S. Provisional Patent Application Ser. No. 60/668,419, filed Apr.
5, 2005, and 35 U.S.C. .sctn.119(e) of U.S. Provisional Patent
Application Ser. No. 60/681,601, filed May 17, 2005 the contents of
each of which are herein incorporated by reference in their
entirety.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 22, 2013, is named 32586761.txt and is 27,897 bytes in
size.
BACKGROUND
[0004] Cancers, for example, gastric cancer, prostate cancer,
breast cancer, colon cancer, lung cancer, pancreatic cancer,
ovarian cancer, cancer of the spleen, testicular cancer, cancer of
the thymus, etc., are diseases characterized by abnormal,
accelerated growth of epithelial cells. This accelerated growth
initially causes a tumor to form. Eventually, metastasis to
different organ sites can also occur. Although progress has been
made in the diagnosis and treatment of various cancers, these
diseases still result in significant mortality.
[0005] MET encodes a transmembrane tyrosine kinase receptor for
Hepatocyte Growth Factor (HGF, scatter factor), which transduces
signals implicated in proliferation, migration and morphogenesis
(6-8). Ectopic expression of MET, as well as HGF, confers a
tumorigenic and metastatic phenotype in cancer-derived cell lines
(9-11), and activating mutations have been reported in both
sporadic and inherited forms of renal papillary carcinomas (12).
Mutations in MET are rare in breast cancer (13, 14), but tumors
with high protein expression appear to have a worse clinical
prognosis (15, 16). Furthermore, increased HGF/MET signaling can
serve as an initiating event for tumorigenesis, as mice
overexpressing either HGF or mutant Met in mammary epithelium
develop breast tumors (17-19).
[0006] Genetic events that arise and are selected during tumor
progression may become essential for tumor survival, a phenomenon
generally described as "oncogene addiction" (1). For example,
homozygous inactivation of Brca1 alone leads to activation of DNA
damage signals and p53-mediated cell cycle arrest; however,
simultaneous suppression of p53 allows bypass of this DNA damage
checkpoint, and leads to accelerated tumor formation (2-4). The
identification of these secondary mutations is important in
designing effective treatment for cancers, as targeting one genetic
event may not suffice.
[0007] It must be remembered that overexpression and amplification
are not the same phenomenon. Overexpression can be obtained from a
single, unamplified gene, and an amplified gene does not always
lead to greater expression levels of mRNA and protein. Thus, it is
not possible to predict whether one phenomenon will result in, or
is related to, the other. However, in situations where both
amplification of a gene and overexpression of the gene product
occur in cells or tissues that are in a precancerous or cancerous
state, then that gene and its product present both a diagnostic
target and a therapeutic opportunity for intervention.
Amplification, without overexpression, and overexpression, without
amplification, also can be correlated with and indicative of
cancers and pre-cancers.
[0008] There is a significant need in the art for a satisfactory
treatment of cancer, and specifically cancers such as gastric,
lung, ovarian, breast, brain, colon and prostate cancers. While
tyrosine kinase therapy has proven to be beneficial in many cancer
types, its utility is currently limited by our understanding of the
individuals in which the therapy is most likely to be effective.
Thus, there is a need to identify patients who will most benefit
from particular therapies, so as, for example, to limit clinical
trial participation to only this subset of individuals and to
provide the most appropriate therapy to each individual person in
need.
SUMMARY
[0009] The inventors of the present invention have surprisingly
discovered that the presence of Met amplification predicts
responsiveness of an individual to Met targeted treatment. Thus,
the present invention provides a novel method to determine the
likelihood of effectiveness of a Met targeting treatment in an
individual affected with or at risk for developing cancer. The
method comprises detecting the presence or absence of Met
amplification of said individual. The presence of Met amplification
indicates that the Met targeting treatment is likely to be
effective. In addition, the present methods allow for the detection
of cancer in an individual, wherein the presence of Met
amplification indicates that cancer is present and further that it
will be treatable, namely with a Met targeting treatment.
[0010] In a preferred embodiment, the Met targeting treatment is a
tyrosine kinase inhibitor. In a preferred embodiment, the tyrosine
kinase inhibitor is a Met tyrosine kinase inhibitor. Preferably,
the Met tyrosine kinase inhibitor PHA-665752,
(3Z)-5-[(2,6-dichlorobenzyl)sulfonyl]-3-[(3,5-dimethyl-4-{[(2R)-2-(pyrrol-
idin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-1H-pyrrol-2-yl)methylene]-1,3-di-
hydro-2H-indol-2-one (Pfizer, Inc., La Jolla, Calif.).
Alternatively, the Met targeting treatment is PF-02341066 (Pfizer,
Inc.) or one or more of the c-Met inhibitors described in U.S.
Patent Application 20050107391. Also encompassed in the present
invention is XL880, an orally available Spectrum Selective Kinase
Inhibitor.TM. (SSKI) from Exelixis. Other Met targeting treatments
are known to those of skill in the art and are encompassed
herein.
[0011] Also encompassed in the present invention are methods of
treating an individual affected with or at risk for developing
cancer. In this embodiment, an individual is screened for the
presence or absence of Met amplification. Individuals identified
with Met amplification are therein administered a Met targeting
treatment. In one embodiment, the Met targeting treatment is a
tyrosine kinase inhibitor. In a preferred embodiment, the Met
targeting treatment is a Met inhibitor. The Met inhibitor may be
selected from the group consisting of a small molecule inhibitor, a
competitive inhibitor, a nucleic acid, an antibody, an antibody
fragment, or an aptamer.
[0012] Alternatively, the status of Met amplification in an
individual is known and a treatment plan is initiated based on this
known status. In this embodiment, the presence of Met amplification
indicates that a Met targeting treatment will be effective in the
treatment or prevention of a cancer. Thus, a Met targeting
treatment can be administered to such an individual. Thus, once a
patient has been identified as having Met amplification (e.g. the
test was done by another physician, at another clinic, or in
another country), a Met targeting treatment can be
administered.
[0013] In one embodiment, the Met amplification assay is performed
outside the country of treatment, e.g., the U.S., and the results
are provided to the physician, patient or clinic. The results can
be sent electronically or can be resident on a web site and
screened by the physician, clinic or patient.
[0014] The detection of the presence or absence of a Met
amplification is accomplished by determining the copy number of the
Met gene. In one embodiment the copy number is compared to a
positive and negative control sample. The copy number of Met gene
may be determined by PCR, qPCR, RT-PCR, Southern Blot, comparative
genomic hybridization, microarray based comparative genomic
hybridization, fluorescence in situ hybridization (FISH), ligase
chain reaction (LCR), transcription amplification, or
self-sustained sequence replication.
[0015] The cancer may be any cancer known to those of skill in the
art, including, but not limited to, gastrointestinal cancer,
prostate cancer, ovarian cancer, breast cancer, head and neck
cancer, lung cancer, non-small cell lung cancer, cancer of the
nervous system, kidney cancer, retina cancer, skin cancer, liver
cancer, pancreatic cancer, genital-urinary cancer and bladder
cancer. In a preferred embodiment, the cancer is non-small cell
lung cancer.
[0016] Also encompassed in the methods of the present invention is
a kit for detecting the presence or absence of Met
amplification.
DESCRIPTION OF THE FIGURES
[0017] FIG. 1A-1E: Recurrent amplification in primary mammary
tumors of Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre mice spanning
the Met oncogene locus. (FIG. 1A) Representative whole genome
profile of an individual tumor showing the ratio of tumor to normal
DNA from the same mouse. X-axis represents oligonucleotide probes
ordered by genomic map position, with the whole-genome filtered
median (three nearest neighbors) data set plotted on the Y axis.
(FIG. 1B) Schematic representation of the minimally amplified
region derived from the analysis of individual tumor data sets.
Only two complete genes are found in the minimal amplicon.
Horizontal bars represent the amplified region in individual tumor
samples (CX3-25); vertical lines demarcate the region shared by all
amplicons, which is expanded at the bottom of the panel. The
positions of oligonucleotide probe targets present on the
microarray are shown for those amplified in all 11/15 tumors (black
diamonds) and those found not to be amplified in at least one of
the 11 tumors (open diamonds). (FIG. 1C) Independent confirmation
of MET amplification using qPCR. Fold amplification represents the
ratio of Met signal (top of chromosome 6) to control, Edem1, a gene
that is genomically stable based on the microarray analysis of all
15 tumors (middle of chromosome 6). (FIG. 1D) Representative FISH
image of low-passage cells derived from a
Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre mammary tumor: Met
locus (top of chromosome 6) is shown in red and control probe
(bottom of chromosome 6) is shown in green. Arrows indicate
positions of individual loci. Amplified Met gene copies are carried
on characteristic "double minute" extrachromosomal elements. (FIG.
1E) Loss of unstable Met amplification in tumor-derived low passage
Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre cells as a function of
passage number in culture. Met gene copy number was quantified by
qPCR.
[0018] FIG. 2A-2B: MET genomic amplification in human gastric
cancer. (FIG. 2A) Human gastric cell lines screened for the
presence of MET amplification using qPCR. The relative MET copy
number is derived by comparison with an unrelated control locus,
TOP3A. The horizontal red line separates cells with >8-fold MET
amplification (Amp.sup.+) from cells with no or low level MET
amplification (Amp.sup.-). (FIG. 2B) Representative metaphase
(upper panel) and interphase (lower panel) FISH analysis of human
gastric cancer cell lines showing amplification of MET within
characteristic homogeneously staining regions (HSRs) in Amp.sup.+
cells. In SNU-5 cells (Amp.sup.+) with high level amplification,
the MET signal (red) is present in HSRs (red arrowhead) that are
distinct from the endogenous gene locus (7q31 region, red arrow).
Control probe on the opposite arm of chromosome 7 (7p21 region) is
shown in green (green arrow). In KATO III cells with <8-fold MET
amplification (Amp.sup.-), the increased gene copy number is
associated with individual chromosomal fragments (aneuploidy).
[0019] FIG. 3A-3C: Constitutive activation of MET and activation of
downstream signaling pathways in Amp.sup.+ cells. (FIG. 3A) MET is
constitutively activated in the Amp.sup.+ cells. Immunoblotting
analysis demonstrating high levels of MET protein expression in two
representative Amp.sup.+ cell lines, compared with two Amp.sup.-
cell lines. Immunoblotting using two phospho-specific MET
antibodies (against Y1234/1235 and against Y1349) shows strong
phosphorylation of the receptor only in Amp.sup.+ cells
(.beta.-actin loading control). (FIG. 3B) Effect of HGF on MET
activation in Amp.sup.+ and Amp.sup.- cells (representative
immunoblots). Cells were serum-starved for 24 h and treated with 40
ng/ml HGF for 10 minutes. Phosphorylation of MET (Y1234/1235) is
unaltered in Amp.sup.+ cells treated with HGF, but it is induced by
HGF in Amp.sup.- cells (total MET control). Phosphorylation of the
downstream effectors ERK1/2 (T202/Y204), and AKT (S473) is also
unaltered by HGF treatment in Amp.sup.+ cells, but strongly induced
in Amp.sup.- cells treated with HGF. (FIG. 3C) Inhibition by
PHA-665752 of MET autophosphorylation and activation of downstream
effectors ERK1/2, AKT, STAT3, and FAK in Amp.sup.+ cells, but not
in Amp.sup.- cells. Cells were treated with increasing
concentrations of PHA-665752 for 3 hours prior to analysis.
Inhibition of MET by PHA-665752 suppresses constitutive
phosphorylation of these effectors in Amp.sup.+ cells, but
Amp.sup.- cells are unaffected (representative blots shown).
[0020] FIG. 4A-4D: Gastric cancer cell lines with MET amplification
display selective killing following MET inhibition. (FIG. 4A)
Amp.sup.+ cells (red) show dramatically increased sensitivity to
PHA-665752, relative to Amp.sup.- cells (black). Cells were grown
for 96 hours in the presence of increasing PHA-665752 concentration
and their viability was assessed using MTT assays. Results are
plotted as a percentage of viability of untreated cells. (FIG. 4B)
Induction of apoptosis following treatment of Amp.sup.+ cells with
PHA-665752. Amp.sup.+ and Amp.sup.- cells were treated with
PHA-665752 for 72 hours, and induction of apoptosis was monitored
by immunofluorescent staining of fixed cells with an antibody
specific for cleaved caspase-3 (green). Cells were co-stained with
DAPI to show nuclei. (FIG. 4C) Selective killing of Amp.sup.+ cells
following siRNA-mediated knockdown of MET. Viability in Amp.sup.+
and Amp.sup.- cells was compared 96 hours after knockdown of MET or
of unrelated receptors (EGFR and ERBB2). Cell viability was
measured using the MTT assay and plotted as a percent of cells
treated with a nonspecific (control) siRNA duplex. (FIG. 4D)
Effective knockdown of targeted receptor tyrosine kinases using
siRNAs. Representative Amp.sup.+ and Amp.sup.- cells were treated
with indicated siRNAs and protein levels were monitored 48 h later
by immunoblotting (.beta.-actin loading control).
[0021] FIG. 5: Met protein is strongly expressed in the primary
Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre tumors bearing Met
amplification. Individual tumors (CX13 and CX25) were stained with
anti-Met antibody at 1:100 dilution. In slides labeled "negative
control" primary antibody against Met was not added during the
staining procedure. Diverse histological appearance of
Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre tumors has been
previously noted (2).
[0022] FIG. 6: Activation of MET receptor in Amp.sup.+ cells is
ligand-independent. Treatment of Amp.sup.+ cells with neutralizing
anti-HGF antibody (3-5) does not affect MET activation. Cells were
serum starved for 24 h and subsequently treated with 1 .mu.g/ml
anti-HGF antibody or goat IgG control in serum-free media for
another 24 h. Cells were harvested and MET phosphorylation status
was measured by immunoblotting (.beta.-actin loading control).
[0023] FIG. 7: Drug sensitivity profile of 40 human cancer cell
lines treated with gefitinib or PHA-665752. Cells were cultured and
analyzed in triplicate within microtiter plates. Cell numbers were
quantitated by DNA staining, 3 days after addition of various
concentrations of drugs and expressed as a fraction of matched
untreated cultures. For each drug concentration, cell lines with
relative drug sensitivity (<50% of untreated control growth) are
shown in darkest staining, intermediate sensitivity (50-75%) in
lightest shading, and drug insensitivity (>75%) in intermediate
shading. Arrowheads denote cell lines with unique drug sensitivity
to gefitinib (NCI-H1650) or to PHA-665752 (MKN45).
[0024] FIG. 8A-8B: MET genomic amplification in human gastric
cancer cell lines. (FIG. 8A) Human gastric cancer cell lines
screened for the presence of MET amplification by using qPCR. The
relative MET copy number is derived by comparison with an unrelated
control locus, TOP3A, at chromosome locus 17p11. Cell lines with
high-level MET amplification (Amp+) are shown in darkest shading,
whereas the cells with no or low-level copy number increase of MET
(Amp-) are shown in lighter shading. All Amp+ cells have
HSR-amplification of MET. (FIG. 8B) Representative metaphase
(Upper) and interphase (Lower) FISH analysis of human gastric
cancer cell lines, showing amplification of MET within
characteristic HSRs in Amp+ cells. In SNU-5 cells (Amp+) with
high-level amplification, the MET signal is present in HSRs (darker
arrowhead) that are distinct from the endogenous gene locus
(chromosome 7q31, darker arrow). Control probe on the opposite arm
of chromosome 7 (chromosome 7p21) is shown in green (lighter
arrow). In KATO III cells (Amp-), the low-level increased MET gene
copy number is associated with five individual copies of chromosome
7 (aneuploidy).
[0025] FIG. 9A-9D: Constitutive activation of MET in Amp+ cells.
(FIG. 9A) MET is constitutively activated in the Amp+ cells.
Immunoblotting analysis, demonstrating high levels of MET protein
expression in two representative Amp+ cell lines, compared with two
Amp- cell lines. Immunoblotting using two phospho-specific MET
antibodies (against Y1234/1235 and Y1349) shows strong baseline
phosphorylation of the receptor only in Amp+ cells (-actin loading
control). (FIG. 9B) Effect of HGF on MET activation in Amp+ and
Amp- cells. Representative immunoblotting analysis of cells
serum-starved for 24 h and treated with 40 ng/ml HGF for 10 min.
Phosphorylation of MET (Y1234/1235) is induced by HGF in Amp-
cells, but it is unaltered in Amp+ cells treated with HGF (total
MET expression in these cells is shown as control). Phosphorylation
of the downstream effectors ERK1/2 (T202/Y204) and AKT (S473) is
also strongly induced in Amp- cells treated with HGF but unaltered
by HGF treatment in Amp+ cells. Blots probed with phospho-specific
antibodies were exposed for a short time to illustrate signaling
differences and to avoid potential signal saturation associated
with longer exposure times. (FIG. 9C) Neutralizing HGF antibody
does not affect MET activation in Amp+ cells. Representative
Western blot, demonstrating unaltered baseline activation of MET in
Amp+ cells (MKN45) treated with neutralizing anti-HGF antibody.
Cells were serum starved for 24 h and subsequently treated with 5
.mu.g/ml anti-HGF antibody or goat IgG control in serum-free media
for another 24 h, by using standard conditions for neutralization
of HGF (30). (FIG. 9D) Neutralizing HGF antibody can functionally
inactivate HGF-mediated MET activation in Amp- cells. As control
for C, Amp- cells (AGS) were treated with HGF alone, with
neutralizing antibody to HGF, or goat IgG (control). Suppression of
HGF-induced MET activation in Amp- cells confirms effective HGF
neutralizing activity of this anti-HGF antibody.
[0026] FIG. 10A-10D: Selective killing of gastric cancer cell lines
with MET amplification after MET inhibition. (FIG. 10A) Sensitivity
of Amp+ cells and Amp- cells to increasing concentrations of
PHA-665752. Cells were grown for 96 h at various concentrations of
PHA-665752, and their viability was assessed by using MTT assays.
Results are plotted as percent viability of treated cells compared
with untreated matched controls. Experiments were performed in
triplicate, with standard deviations shown. (FIG. 10B) Growth curve
of representative Amp+ and Amp- cells treated with PHA-665752.
Cells were grown for up to 6 days in the presence or absence of
PHA-665752 (1 .mu.M), and relative cell numbers were measured by
using the fluorescent nucleic acid dye SYTO60 and expressed as a
fraction of the number of cells plated. Experiments were performed
in triplicate, with standard deviations shown. (FIG. 10C) Effective
knockdown of targeted receptor tyrosine kinases by using siRNAs.
Immunoblotting analysis of MET, EGFR, and ERBB2 protein levels
after treatment of Amp+ and Amp- cells with specific siRNAs for 48
h. The relative exposure time of MET signal in Amp- immunoblots was
increased to demonstrate effectiveness of siRNA knockdown (-actin
loading control). (FIG. 10D) Selective killing of Amp+ cells after
siRNA-mediated knockdown of MET. Viability in Amp+ and Amp- cells,
measured by using the MTT assay, was compared 96 h after knockdown
of MET or unrelated receptors (EGFR and ERBB2). Cell viability is
plotted as a percentage of cells treated with a nonspecific
(control) siRNA duplex. Experiments were performed in triplicate,
with standard deviations shown.
[0027] FIG. 11A-11C: Suppression of MET-dependent signals by
PHA-665752 in Amp+ cells and induction of apoptosis. (FIG. 11A)
Immunoblotting analysis, demonstrating inhibition of MET
autophosphorylation (Y1234/1235) by PHA-665752. Abrogation of
baseline phosphorylation of downstream effectors [ERK1/2
(T202/Y204), AKT (S473), STAT3 (Y727), and FAK (Y576/Y577)] is
evident after drug treatment in Amp+ cells but not in Amp- cells.
PHA-665752 was added for 3 h before protein extraction
(representative blots shown). (FIG. 11B) Induction of apoptosis in
Amp+ cells, but not in Amp- cells, 72 h after treatment with
PHA-665752 (1 .mu.M), measured by staining for cleaved caspase-3
(light staining) Cells are costained with DAPI to show nuclei.
(FIG. 11C) Immunoblotting analysis for PARP cleavage to demonstrate
induction of apoptosis in Amp+ cells, but not Amp- cells, after
treatment with PHA-665752 (500 nM for 72 h) (-actin loading
control).
DETAILED DESCRIPTION
[0028] The present invention provides a novel method to determine
the likelihood of effectiveness of an Met targeting treatment in an
individual affected with or at risk for developing cancer. The
method comprises detecting the presence or absence of Met
amplification of said individual. The presence of Met amplification
indicates that the Met targeting treatment is likely to be
effective. The individual with Met amplification can then be
treated with a Met targeting treatment.
[0029] In one embodiment of the present invention, the Met
targeting treatment is a tyrosine kinase inhibitor. In a preferred
embodiment, the tyrosine kinase inhibitor is a Met tyrosine kinase
inhibitor. Preferably, the Met tyrosine kinase inhibitor
PHA-665752,
(3Z)-5-[(2,6-dichlorobenzyl)sulfonyl]-3-[(3,5-dimethyl-4-{[(2R)-2-(pyrrol-
idin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-1H-pyrrol-2-yl)methylene]-1,3-di-
hydro-2H-indol-2-one (Pfizer, Inc., La Jolla, Calif.) or SU11274.
Alternatively, the Met targeting treatment is PF-02341066 (Pfizer,
Inc.) or one or more of the c-Met inhibitors described in U.S.
Patent Application 20050107391, incorporated by reference in its
entirety. In an alternative embodiment of the present invention,
the Met targeting treatment is an indirect modulator of Met, such
as, for example, SU5416, which targets vascular endothelial growth
factor (VEGF) and has been shown to display activity against
Met.
[0030] The methods of the present method allow for the screening of
individuals with or at risk for developing cancer, including, but
not limited to, solid tumor, solid tumor metastasis and the like.
Individuals who have already been diagnosed with cancer are
encompassed in the methods of the present invention. Cancers
include, but are not limited to, breast, lung, colorectal,
prostate, pancreatic, glioma, liver cancer, gastric cancer, head
and neck cancers, melanoma, renal cancer, leukemias, myeloma, and
sarcomas. Met has been directly implicated in cancers without a
successful treatment regimen such as pancreatic cancer, glioma, and
hepatocellular carcinoma. medulloblastoma, and mesothelioma. The
strong correlation of Met with the biology of metastasis and
invasion and disease pathogenesis comprises a novel mechanism for
determination of likelihood of drug responsiveness to metastatic
cancers.
[0031] Detection Methods
[0032] According to the methods of the present invention, detecting
the presence or absence of Met amplification in a patient with or
at risk for developing cancer can be performed in a variety of
ways. Such tests are commonly performed using DNA or RNA collected
from biological samples, e.g., tissue biopsies, urine, stool,
sputum, blood, cells, tissue scrapings, breast aspirates or other
cellular materials, and can be performed by a variety of
methods.
[0033] Gene amplification is a quantitative modification, whereby
the actual number of complete coding sequence, i.e. a gene,
increases, leading to an increased number of available templates
for transcription, an increased number of translatable transcripts,
and, ultimately, to an increased abundance of the protein encoded
by the amplified gene.
[0034] Gene amplification is most commonly encountered in the
development of resistance to cytotoxic drugs (antibiotics for
bacteria and chemotherapeutic agents for eukaryotic cells) and
neoplastic transformation. Transformation of a eukaryotic cell as a
spontaneous event or due to a viral or chemical/environmental
insult is typically associated with changes in the genetic material
of that cell.
[0035] The presence of a target gene that has undergone
amplification in tumors is evaluated by determining the copy number
of the target genes, i.e., the number of DNA sequences in a cell
encoding the target protein. Generally, a normal diploid cell has
two copies of a given autosomal gene. The copy number can be
increased, however, by gene amplification or duplication, for
example, in cancer cells, or reduced by deletion. Methods of
evaluating the copy number of a particular gene are well known in
the art, and include, hybridization and amplification based
assays.
[0036] Detection and measurement of amplification of the MET gene
in a test sample taken from a patient indicates that the patient
may have developed a tumor. According to the present invention, the
presence of Met amplification predicts the likelihood of
effectiveness of Met targeting therapy. Particularly, the presence
of amplified MET DNA leads to a diagnosis of cancer or precancerous
condition, for example, a gastric cancer, a breast cancer, a colon
cancer, a lung cancer, a brain cancer, or an ovarian cancer where
Met targeting therapy is likely to be effective.
[0037] The present invention therefore provides, in one aspect,
methods for detecting Met amplification. In one embodiment, Met
amplification is detected by measuring the levels of MET mRNA
expression in samples taken from the tissue of suspicion, and
determining whether MET is overexpressed in the tissue. The various
techniques, including hybridization based and amplification based
methods, for measuring and evaluating mRNA levels are provided
herein and are known to those of skill in the art.
[0038] The present invention also provides, in other aspects,
methods for detecting Met amplification in a mammalian tissue by
measuring the numbers of MET DNA copy in samples taken from the
tissue of suspicion, and determining whether the MET gene is
amplified in the tissue. The various techniques, including
hybridization based and amplification based methods, for measuring
and evaluating DNA copy numbers are provided herein and known to
those of skill in the art. The present invention thus provides
methods for detecting amplified genes at the DNA level and
increased expression at the RNA level, or increased protein
expression wherein the results are indicative of tumor
progression.
Detecting Gene Amplification
[0039] The present invention encompasses methods of gene
amplification known to those of skill in the art, see, for example,
Boxer, J. Clin. Pathol. 53: 19-21(2000). Such techniques include in
situ hybridization (Stoler, Clin. Lab. Med. 12:215-36 (1990), using
radioisotope or fluorophore-labeled probes; polymerase chain
reaction (PCR); quantitative Southern blotting, dot blotting and
other techniques for quantitating individual genes. Preferably,
probes or primers selected for gene amplification evaluation are
highly specific, to avoid detecting closely related homologous
genes. Alternatively, antibodies may be employed that can recognize
specific duplexes, including DNA duplexes, RNA duplexes, and
DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in
turn may be labeled and the assay may be carried out where the
duplex is bound to a surface, so that upon the formation of duplex
on the surface, the presence of antibody bound to the duplex can be
detected.
[0040] In one embodiment, the biological sample contains nucleic
acids from the test subject. The nucleic acids may be mRNA or
genomic DNA molecules from the test subject.
[0041] In another embodiment, the methods further involve obtaining
a control biological sample and detecting Met amplification in this
control sample, such that the presence or absence of Met
amplification in the control sample is determined. A negative
control sample is useful if there is an absence of Met
amplification, whereas a positive control sample is useful if there
is a presence of Met amplification. For the negative control, the
sample may be from the same individual as the test sample (i.e.
different location such as tumor versus non-tumor) or may be from a
different individual known to have an absence of Met
amplification.
[0042] In a preferred embodiment of the present invention, gene
amplification is detected by polymerase chain reaction (PCR)-based
assays. These assays utilize a very small amount of tumor DNA as
starting material, are exquisitely sensitive and provide DNA that
is amenable to further analysis, such as sequencing, and are
suitable for high-volume throughput analysis.
Amplification-Based Assays
[0043] In one embodiment of the present invention,
amplification-based assays can be used to measure copy number of
the MET gene. In such amplification-based assays, the corresponding
MET nucleic acid sequence acts as a template in an amplification
reaction (for example, Polymerase Chain Reaction or PCR). In a
quantitative amplification, the amount of amplification product
will be proportional to the amount of template in the original
sample. Comparison to appropriate controls provides a measure of
the copy-number of the MET gene, corresponding to the specific
probe used. The presence of a higher level of amplification
product, as compared to a control, is indicative of amplified
Met.
[0044] Quantitative PCR
[0045] Methods of "quantitative" amplification are well known to
those of skill in the art. For example, quantitative PCR involves
simultaneously co-amplifying a known quantity of a control sequence
using the same primers. This provides an internal standard that may
be used to calibrate the PCR reaction. Detailed protocols for
quantitative PCR are provided, for example, in Innis et al. (1990)
PCR Protocols, A Guide to Methods and Applications, Academic Press,
Inc. N.Y. The known nucleic acid sequence for the Met (Accession
No.: NM.sub.--000245) is sufficient to enable one of skill to
routinely select primers to amplify any portion of the gene.
[0046] Real Time PCR
[0047] Real time PCR is another amplification technique that can be
used to determine gene copy levels or levels of mRNA expression.
(See, e.g., Gibson et al., Genome Research 6:995-1001, 1996; Heid
et al., Genome Research 6:986-994, 1996). Real-time PCR evaluates
the level of PCR product accumulation during amplification. This
technique permits quantitative evaluation of mRNA levels in
multiple samples. For gene copy levels, total genomic DNA is
isolated from a sample. For mRNA levels, mRNA is extracted from
tumor and normal tissue and cDNA is prepared using standard
techniques. Real-time PCR can be performed, for example, using a
Perkin Elmer/Applied Biosystems (Foster City, Calif.) 7700 Prism
instrument. Matching primers and fluorescent probes can be designed
for genes of interest using, for example, the primer express
program provided by Perkin Elmer/Applied Biosystems (Foster City,
Calif.). Optimal concentrations of primers and probes can be
initially determined by those of ordinary skill in the art, and
control (for example, beta-actin) primers and probes may be
obtained commercially from, for example, Perkin Elmer/Applied
Biosystems (Foster City, Calif.). To quantitate the amount of the
specific nucleic acid of interest in a sample, a standard curve is
generated using a control. Standard curves may be generated using
the Ct values determined in the real-time PCR, which are related to
the initial concentration of the nucleic acid of interest used in
the assay. Standard dilutions ranging from 10-10.sup.6 copies of
the gene of interest are generally sufficient. In addition, a
standard curve is generated for the control sequence. This permits
standardization of initial content of the nucleic acid of interest
in a tissue sample to the amount of control for comparison
purposes.
[0048] Methods of real-time quantitative PCR using TaqMan probes
are well known in the art. Detailed protocols for real-time
quantitative PCR are provided, for example, for RNA in: Gibson et
al., 1996, A novel method for real time quantitative RT-PCR. Genome
Res., 10:995-1001; and for DNA in: Heid et al., 1996, Real time
quantitative PCR. Genome Res., 10:986-994.
[0049] A TaqMan-based assay also can be used to quantify MET
polynucleotides. TaqMan based assays use a fluorogenic
oligonucleotide probe that contains a 5' fluorescent dye and a 3'
quenching agent. The probe hybridizes to a PCR product, but cannot
itself be extended due to a blocking agent at the 3' end. When the
PCR product is amplified in subsequent cycles, the 5' nuclease
activity of the polymerase, for example, AmpliTaq, results in the
cleavage of the TaqMan probe. This cleavage separates the 5'
fluorescent dye and the 3' quenching agent, thereby resulting in an
increase in fluorescence as a function of amplification.
[0050] Other Amplification Methods
[0051] Other suitable amplification methods include, but are not
limited to ligase chain reaction (LCR) (see Wu and Wallace (1989)
Genomics 4:560, Landegren et al. (1988) Science 241:1077, and
Barringer et al. (1990) Gene 89:117), transcription amplification
(Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173),
self-sustained sequence replication (Guatelli et al. (1990) Proc.
Nat. Acad. Sci. USA 87:1874), dot PCR, and linker adapter PCR,
etc.
Hybridization-Based Assays
[0052] Hybridization assays can be used to detect MET copy number.
Hybridization-based assays include, but are not limited to,
traditional "direct probe" methods such as Southern blots or in
situ hybridization (e.g., FISH), and "comparative probe" methods
such as comparative genomic hybridization (CGH). The methods can be
used in a wide variety of formats including, but not limited to
substrate--(e.g. membrane or glass) bound methods or array-based
approaches as described below.
[0053] Southern Blot
[0054] One method for evaluating the copy number of Met encoding
nucleic acid in a sample involves a Southern transfer. Methods for
doing Southern Blots are known to those of skill in the art (see
Current Protocols in Molecular Biology, Chapter 19, Ausubel, et
al., Eds., Greene Publishing and Wiley-Interscience, New York,
1995, or Sambrook et al., Molecular Cloning: A Laboratory Manual,
2d Ed. vol. 1-3, Cold Spring Harbor Press, NY, 1989). In such an
assay, the genomic DNA (typically fragmented and separated on an
electrophoretic gel) is hybridized to a probe specific for the
target region. Comparison of the intensity of the hybridization
signal from the probe for the target region with control probe
signal from analysis of normal genomic DNA (e.g., a non-amplified
portion of the same or related cell, tissue, organ, etc.) provides
an estimate of the relative copy number of the target nucleic acid.
An intensity level that is higher than the control is indicative of
amplified Met.
[0055] Fluorescence In Situ Hybridization (FISH)
[0056] In another embodiment, FISH is used to determine the copy
number of the MET gene in a sample. Fluorescence in situ
hybridization (FISH) is known to those of skill in the art (see
Angerer, 1987 Meth. Enzymol., 152: 649). Generally, in situ
hybridization comprises the following major steps: (1) fixation of
tissue or biological structure to be analyzed; (2) prehybridization
treatment of the biological structure to increase accessibility of
target DNA, and to reduce nonspecific binding; (3) hybridization of
the mixture of nucleic acids to the nucleic acid in the biological
structure or tissue; (4) post-hybridization washes to remove
nucleic acid fragments not bound in the hybridization, and (5)
detection of the hybridized nucleic acid fragments.
[0057] In a typical in situ hybridization assay, cells or tissue
sections are fixed to a solid support, typically a glass slide. If
a nucleic acid is to be probed, the cells are typically denatured
with heat or alkali. The cells are then contacted with a
hybridization solution at a moderate temperature to permit
annealing of labeled probes specific to the nucleic acid sequence
encoding the protein. The targets (e.g., cells) are then typically
washed at a predetermined stringency or at an increasing stringency
until an appropriate signal to noise ratio is obtained.
[0058] The probes used in such applications are typically labeled,
for example, with radioisotopes or fluorescent reporters. Preferred
probes are sufficiently long, for example, from about 50, 100, or
200 nucleotides to about 1000 or more nucleotides, to enable
specific hybridization with the target nucleic acid(s) under
stringent conditions.
[0059] In some applications it is necessary to block the
hybridization capacity of repetitive sequences. Thus, in some
embodiments, tRNA, human genomic DNA, or Cot-1 DNA is used to block
non-specific hybridization. Thus, in one embodiment of the present
invention, the presence or absence of Met amplification is
determined by FISH.
[0060] Comparative Genomic Hybridization (CGH)
[0061] In comparative genomic hybridization methods, a "test"
collection of nucleic acids (e.g. from a possible tumor) is labeled
with a first label, while a second collection (e.g. from a normal
cell or tissue) is labeled with a second label. The ratio of
hybridization of the nucleic acids is determined by the ratio of
the first and second labels binding to each fiber in an array.
Differences in the ratio of the signals from the two labels, for
example, due to gene amplification in the test collection, is
detected and the ratio provides a measure of the gene copy number,
corresponding to the specific probe used. A cytogenetic
representation of DNA copy-number variation can be generated by
CGH, which provides fluorescence ratios along the length of
chromosomes from differentially labeled test and reference genomic
DNAs. In another embodiment of the present invention, comparative
genomic hybridization may be used to detect the presence or absence
of Met amplification.
[0062] Microarray Based Comparative Genomic Hybridization
[0063] In an alternative embodiment of the present invention, DNA
copy numbers are analyzed via microarray-based platforms.
Microarray technology offers high resolution. For example, the
traditional CGH generally has a 20 Mb limited mapping resolution;
whereas in microarray-based CGH, the fluorescence ratios of the
differentially labeled test and reference genomic DNAs provide a
locus-by-locus measure of DNA copy-number variation, thereby
achieving increased mapping resolution. Details of various
microarray methods can be found in the literature. See, for
example, U.S. Pat. No. 6,232,068; Pollack et al., Nat. Genet.,
23(1):41-6, (1999), Pastinen (1997) Genome Res. 7: 606-614; Jackson
(1996) Nature Biotechnology 14:1685; Chee (1995) Science 274: 610;
WO 96/17958, Pinkel et al. (1998) Nature Genetics 20: 207-211 and
others.
[0064] The DNA used to prepare the arrays of the invention is not
critical. For example, the arrays can include genomic DNA, e.g.
overlapping clones that provide a high resolution scan of a portion
of the genome containing the desired gene, or of the gene itself.
Genomic nucleic acids can be obtained from, e.g., HACs, MACs, YACs,
BACs, PACs, P1s, cosmids, plasmids, inter-Alu PCR products of
genomic clones, restriction digests of genomic clones, cDNA clones,
amplification (e.g., PCR) products, and the like. Arrays can also
be produced using oligonucleotide synthesis technology. Thus, for
example, U.S. Pat. No. 5,143,854 and PCT Patent Publication Nos. WO
90/15070 and WO 92/10092 teach the use of light-directed
combinatorial synthesis of high density oligonucleotide arrays.
[0065] Hybridization protocols suitable for use with the methods of
the invention are described, e.g., in Albertson (1984) EMBO J. 3:
1227-1234; Pinkel (1988) Proc. Natl. Acad. Sci. USA 85: 9138-9142;
EPO Pub. No. 430,402; Methods in Molecular Biology, Vol. 33: In
Situ Hybridization Protocols, Choo, ed., Humana Press, Totowa, N.J.
(1994), Pinkel et al. (1998) Nature Genetics 20: 207-211, or of
Kallioniemi (1992) Proc. Natl Acad Sci USA 89:5321-5325 (1992),
etc.
[0066] The sensitivity of the hybridization assays may be enhanced
through use of a nucleic acid amplification system that multiplies
the target nucleic acid being detected. Examples of such systems
include the polymerase chain reaction (PCR) system and the ligase
chain reaction (LCR) system. Other methods recently described in
the art are the nucleic acid sequence based amplification (NASBAO,
Cangene, Mississauga, Ontario) and Q Beta Replicase systems.
Kits
[0067] In another embodiment of the present invention, kits useful
for the detection of Met amplification are disclosed. Such kits may
include any or all of the following: assay reagents, buffers,
specific nucleic acids or antibodies (e.g. full-size monoclonal or
polyclonal antibodies, single chain antibodies (e.g., scFv), or
other gene product binding molecules), and other hybridization
probes and/or primers, and/or substrates for polypeptide gene
products.
[0068] In addition, the kits may include instructional materials
containing directions (i.e., protocols) for the practice of the
methods of this invention. While the instructional materials
typically comprise written or printed materials they are not
limited to such. Any medium capable of storing such instructions
and communicating them to an end user is contemplated by this
invention. Such media include, but are not limited to electronic
storage media (e.g., magnetic discs, tapes, cartridges, chips),
optical media (e.g., CD ROM), and the like. Such media may include
addresses to internet sites that provide such instructional
materials.
Method of Treating a Patient
[0069] In one embodiment, the invention provides a method for
selecting a treatment for a patient affected by or at risk for
developing cancer by determining the presence or absence of
amplified Met.
[0070] In certain embodiments, the presence of amplified MET is
indicative that a Met targeting treatment will be effective or
otherwise beneficial (or more likely to be beneficial) in the
individual. Stating that the treatment will be effective means that
the probability of beneficial therapeutic effect is greater than in
a person not having the appropriate presence MET amplification.
[0071] In one embodiment, the treatment involves the administration
of a tyrosine kinase inhibitor. In particular, the tyrosine kinase
inhibitor is a MET tyrosine kinase inhibitor. The treatment may
involve a combination of treatments, including, but not limited to
a tyrosine kinase inhibitor in combination with other tyrosine
kinase inhibitors, chemotherapy, radiation, etc.
[0072] Thus, in connection with the administration of a tyrosine
kinase inhibitor, a drug which is "effective against" a cancer
indicates that administration in a clinically appropriate manner
results in a beneficial effect for at least a statistically
significant fraction of patients, such as a improvement of
symptoms, a cure, a reduction in disease load, reduction in tumor
mass or cell numbers, extension of life, improvement in quality of
life, or other effect generally recognized as positive by medical
doctors familiar with treating the particular type of disease or
condition.
Met Targeting Treatments
[0073] In one embodiment of the present invention, the Met
targeting treatment is a tyrosine kinase inhibitor. Alternatively
and preferably, the Met targeting treatment is specific for the
inhibition of Met. For example, a small molecule inhibitor, a
competitive inhibitor, an antibody, or a nucleic acid which
inhibits Met. In one embodiment of the present invention, the Met
targeting treatment is PHA-665752
[(3Z)-5-[(2,6-dichlorobenzyl)sulfonyl]-3-[(3,5-dimethyl-4-{[(2R)-2-(pyrro-
lidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-1H-pyrrol-2-yl)methylene]-1,3-d-
ihydro-2H-indol-2-one (Pfizer, Inc., La Jolla, Calif.); Christensen
et al., Cancer Research 63: 7345-7355, (2003)], SU11274 [Sattler et
al., Cancer Research 63: 5462-5469 (2003)], or SU5416 [Fong et al.,
Cancer Research 59:99-106 (1999); Wang et al., J Hepatol 41:
267-273 (2004)]. In a preferred embodiment, the Met targeting
treatment is PF-02341066 (Pfizer, Inc.).
[0074] Also encompassed in the present invention are c-Met
inhibitors described in U.S. patent application 20050107391,
incorporated herein by reference in its entirety.
[0075] The reversible phosphorylation of tyrosine residues on
proteins is an important mechanism of signal transduction. A large
variety of natural and synthetic compounds are known to be tyrosine
kinase inhibitors. Almost all of these inhibitors block protein
kinases by blocking the ATP pocket of the enzymes. Therefore, many
have a broad spectrum of activity not only against tyrosine kinases
but also against serine/threonine kinases and/or other ATP
utilizing proteins. In one embodiment of the present invention, the
Met targeting treatment is one such tyrosine kinase inhibitor and
may be selected from the following: a member of the geldanamycin
family of anisamycin antibiotics, which have been implicated in the
down-regulation of the MET at nanomolar concentrations. This class
of compounds are currently in clinical trials (NCI) as potential
anti-invasive, anti-metastatic agents and are encompassed in the
methods of the present invention.
[0076] In addition, other examples of Met targeting treatments
encompassed in the methods of the present invention are tyrosine
kinase inhibitors such as, but not limited to, indrocarbazoles,
such as K252a, which is known to inhibit Met mediated signals at
nanomolar concentrations, The compound inhibits Met
autophosphorylation and prevents activation of its downstream
effectors MAPKinase and Akt. It prevents HGF-mediated scattering in
MLP-29 cells, reduces Met-driven proliferation in GTL-16 gastric
carcinoma cells, and reverses Met mediated transformation of NIH3T3
fibroblasts. K252a and related compounds are promising leads of
drugs that may be used against Trk and Met driven cancers [Morotti
et al., Oncogene 21:4885-4893, (2002)]. Conceivably, K252a may
serve as a lead in the development of Met specific inhibitors.
[0077] Also encompassed in the methods of the present invention are
inhibitors with selectivity for protein tyrosine kinases. Several
classes of compounds are known protein tyrosine kinase inhibitors
and my be used in the methods of the present invention. For
example, genistein, lavendustin A, tyrphostin 47, herbimycin,
staurosporin and radicicol. Herbimycin A is a benzoquinoid
ansamycin antibiotic that inhibits a broad spectrum of protein
tyrosine kinases by covalently interacting with their kinase
domains. Staurosporin is an indole carbazole antibiotic which
inhibits a broad spectrum of kinases including scr family members,
and serine/threonine kinases. More recently a large number of
protein tyrosine kinase inhibitors have been described, all of
which are encompassed in the methods of the present invention; 1)
bis monocyclic, bicyclic or heterocyclic aryl compounds (WO
92/20642); 2) vinylene-azaindole derivatives (WO 94/14808); 3)
1-cycloprpyl-4-pyridyl-quinolones (U.S. Pat. No. 5,330,992); 4)
styryl compounds (U.S. Pat. No. 5,217,999); 2) styryl-substituted
pridyl compounds (U.S. Pat. No. 5,302,606); 5) quinazoline
derivatives (EP Application No. 0 566 266A1 and U.S. Pat. No.
6,103,728); 6) selenoindoles and selenides (WO 94/03427); 7)
tricyclic polyhydroxylic compounds (PCT WO 92/21660); 8)
benzylphosphonic acid compounds (PCT WO 91/15495); 9) tyrphostin
like compounds (U.S. Pat. No. 6,225,346B1); 10) thienyl compounds
(U.S. Pat. No. 5,886,195); and 11) bezodiazepine based compounds
(U.S. Pat. No. 6,100,254).
[0078] Other tyrosine kinase inhibitors encompassed in the present
invention include, but are not limited to the pyrazole pyrimidine
PP1, STI-571 (GLEEVEC.TM.), ZD1839, OSI-774, SU101, Aryl and
heteroaryl quinazoline compounds, SU 5416, Bis mono- and bicyclic
aryl and hetero aryl compounds show selectivity for EGFR and PDGFR
(U.S. Pat. No. 5,409,930), Piceatannol
(3,4,3,5V-tetrahydroxy-trans-stilbene), and benzodiazepines. Other
useful inhibitors include RNA ligands (Jellinek, et al.,
Biochemistry 33:10450-56; Takano, et al., 1993, Mol. Bio. Cell
4:358A; Kinsella, et al. 1992, Exp. Cell Res. 199:56-62; Wright, et
al., 1992, J. Cellular Phys. 152:448-57) and various other tyrosine
kinase inhibitors as disclosed in WO 94/03427; WO 92/21660; WO
91/15495; WO 94/14808; U.S. Pat. No. 5,330,992; and Mariani, et
al., 1994, Proc. Am. Assoc. Cancer Res. 35:2268.
[0079] Also encompassed in the methods of the present invention are
methods for the identification of Met tyrosine kinase inhibitors.
Methods include, but are not limited to, the use of mutant ligands
(U.S. Pat. No. 4,966,849) and soluble receptors and antibodies
(Application No. WO 94/10202; Kendall & Thomas, 1994, Proc.
Natl. Acad. Sci 90:10705-09; Kim et al., 1993, Nature
362:841-844).
[0080] In another embodiment of the present invention, the Met
targeting treatment is a small molecule inhibitor. For example, bis
monocyclic, bicyclic or heterocyclic aryl compounds (WO 92/20642)
and vinylene-azaindole derivatives (WO 94/14808) have been
described generally as tyrosine kinase inhibitors. Styryl compounds
(U.S. Pat. No. 5,217,999), styryl-substituted pyridyl compounds
(U.S. Pat. No. 5,302,606), certain quinazoline derivatives (EP
Application No. 0 566 266 A1; Expert Opin. Ther. Pat. (1998), 8(4):
475-478), selenoindoles and selenides (WO 94/03427), tricyclic
polyhydroxylic compounds (WO 92/21660) and benzylphosphonic acid
compounds (WO 91/15495) have been described as compounds for use as
tyrosine kinase inhibitors for use in the treatment of cancer.
Anilinocinnolines (WO 97/34876) and quinazoline derivative
compounds (WO 97/22596; WO 97/42187) have been described as
inhibitors of angiogenesis and vascular permeability.
[0081] Other Met targeting treatments useful in the methods of the
present invention include nucleic acid ligands to HGF and MET, such
as those described in PCT International Publication No. WO
01/09159. Also encompassed in the present invention are MET
antagonists described in U.S. Pat. Nos. 5,686,292 and 6,099,841,
U.S. Pat. No. 6,174,889, PCT International Publication Nos. WO
00/43373, WO 98/07695 and WO 99/15550.
[0082] Particularly useful in the methods of the present invention
are compounds which inhibit Met specifically. Inhibitors which
modulate MET have been reported and include, but are not limited to
the following: indolinone hydrazides (WO05/005378), tetracyclic
compounds (WO05/004808; U.S. published patent application No.
2005/0014755), arylmethyl triazolo and imidazopyrazines
(WO05/004607), triazolotriazine compounds (WO05/010005), pyrrole
compositions (WO05/016920), aminoheteroaryl compounds (WO04/076412;
U.S. published patent application No. 2005/0009840),
4,6-diaminosubstituted-2-[oxy or aminoxy]-[1,3,5]triazines
(WO04/031184), triarylimidazoles (U.S. published patent application
No. 2005/0085473), 2-(2,6-dichlorophenyl)-diarylimidazoles (U.S.
published patent application No. 2004/0214874; U.S. published
patent application No. 2003/0199691), nucleic acids (U.S. published
patent application No. 2003/0049644; U.S. Pat. No. 6,344,321; U.S.
Pat. No. 5,646,036; WO01/09159), antibodies (U.S. Pat. No.
5,686,292; U.S. Pat. No. 5,646,036; U.S. published patent
application No. 2004/0166544; U.S. published patent application No.
2005/0054019; WO05/016382; WO04/072117), peptide and polypeptides
(U.S. Pat. No. 6,214,344; U.S. published patent application No.
2003/0118587; U.S. published patent application No. 2002/0136721
WO04/078778; WO05/030140) and others described in U.S. published
patent application No. 2004/0210041; U.S. published patent
application No. 2003/0118585; U.S. published patent application No.
2003/0045559; U.S. published patent application No.
2004/0185050.
[0083] Other MET inhibitors which can be used in the methods of the
invention include but are not limited to the following: substituted
2,3-dihydro-1 h-isoindol-1-one derivatives (U.S. published patent
application No. 2005/0054670); Geometrically restricted
3-cyclopentylidene-1,3-dihydroindol-2-ones (U.S. published patent
application No. 2005/0038066), Substituted quinolinone derivatives
(U.S. published patent application No. 2005/0049253),
5-sulfonamido-substituted indolinone compounds (U.S. published
patent application No. 2004/0204407), Cyclic substituted fused
pyrrolocarbazoles and isoindolones (U.S. published patent
application No. 2004/0186157), Heterocyclic compounds (U.S.
published patent application No. 2004/0209892), Indazolinone
compositions (U.S. published patent application No. 2004/0167121),
Heterocyclic substituted pyrazolones (U.S. published patent
application No. 2003/0162775), Benzothiazole derivatives (U.S.
published patent application No. 2003/0153568), Pyrazolopyrimidines
(U.S. published patent application No. 2002/0156081) and others
(U.S. published patent application No. 2004/0116388; U.S. published
patent application No. 2004/0019067; U.S. published patent
application No. 2003/0004174; U.S. published patent application No.
2003/0199534; U.S. published patent application No. 2002/0052386;
U.S. published patent application No. 2003/0069430; U.S. published
patent application No. 2004/0198750; U.S. published patent
application No. 2004/0127453)
[0084] In another aspect, the invention concerns an article of
manufacture or package, comprising a container, a composition
within the container comprising a MET antagonist, e.g., an anti-MET
antibody (or other anti-tumor-specific antigen antibody),
optionally a label on or associated with the container that
indicates that the composition can be used for treating a condition
characterized by overexpression of MET, and a package insert
containing instructions to administer the antagonist to patients
who have been found to have an amplified MET gene. A therapeutic
product may include sterile saline or another pharmaceutically
acceptable emulsion and suspension base.
[0085] Once identified, such compounds are administered to patients
in need of Met targeted treatment, for example, patients affected
with or at risk for developing cancer or cancer metastasis.
[0086] The route of administration may be intravenous (I.V.),
intramuscular (I.M.), subcutaneous (S.C.), intradermal (I.D.),
intraperitoneal (I.P.), intrathecal (I.T.), intrapleural,
intrauterine, rectal, vaginal, topical, intratumor and the like.
The compounds of the invention can be administered parenterally by
injection or by gradual infusion over time and can be delivered by
peristaltic means.
[0087] Administration may be by transmucosal or transdermal means.
For transmucosal or transdermal administration, penetrants
appropriate to the barrier to be permeated are used in the
formulation. Such penetrants are generally known in the art, and
include, for example, for transmucosal administration bile salts
and fusidic acid derivatives. In addition, detergents may be used
to facilitate permeation. Transmucosal administration may be
through nasal sprays, for example, or using suppositories. For oral
administration, the compounds of the invention are formulated into
conventional oral administration forms such as capsules, tablets
and tonics.
[0088] For topical administration, the pharmaceutical composition
(inhibitor of kinase activity) is formulated into ointments,
salves, gels, or creams, as is generally known in the art.
[0089] The therapeutic compositions of this invention are
conventionally administered intravenously, as by injection of a
unit dose, for example. The term "unit dose" when used in reference
to a therapeutic composition of the present invention refers to
physically discrete units suitable as unitary dosage for the
subject, each unit containing a predetermined quantity of active
material calculated to produce the desired therapeutic effect in
association with the required diluent; i.e., carrier, or
vehicle.
[0090] The compositions are administered in a manner compatible
with the dosage formulation, and in a therapeutically effective
amount. The quantity to be administered and timing depends on the
subject to be treated, capacity of the subject's system to utilize
the active ingredient, and degree of therapeutic effect desired.
Precise amounts of active ingredient required to be administered
depend on the judgment of the practitioner and are peculiar to each
individual.
[0091] The tyrosine kinase inhibitors useful for practicing the
methods of the present invention are described herein. Any
formulation or drug delivery system containing the active
ingredients, which is suitable for the intended use, as are
generally known to those of skill in the art, can be used. Suitable
pharmaceutically acceptable carriers for oral, rectal, topical or
parenteral (including inhaled, subcutaneous, intraperitoneal,
intramuscular and intravenous) administration are known to those of
skill in the art. The carrier must be pharmaceutically acceptable
in the sense of being compatible with the other ingredients of the
formulation and not deleterious to the recipient thereof.
[0092] As used herein, the terms "pharmaceutically acceptable",
"physiologically tolerable" and grammatical variations thereof, as
they refer to compositions, carriers, diluents and reagents, are
used interchangeably and represent that the materials are capable
of administration to or upon a mammal without the production of
undesirable physiological effects.
DEFINITIONS
[0093] The term "drug" or "compound" as used herein refers to a
chemical entity or biological product, or combination of chemical
entities or biological products, administered to a person to treat
or prevent or control a disease or condition. The chemical entity
or biological product is preferably, but not necessarily a low
molecular weight compound, but may also be a larger compound, for
example, an oligomer of nucleic acids, amino acids, or
carbohydrates including without limitation proteins,
oligonucleotides, ribozymes, DNAzymes, glycoproteins, siRNAs,
lipoproteins, aptamers, and modifications and combinations
thereof.
[0094] The term "genotype" in the context of this invention refers
to the particular allelic form of a gene, which can be defined by
the particular nucleotide(s) present in a nucleic acid sequence at
a particular site(s).
[0095] As used herein, the terms "effective" and "effectiveness"
includes both pharmacological effectiveness and physiological
safety. Pharmacological effectiveness refers to the ability of the
treatment to result in a desired biological effect in the patient.
Physiological safety refers to the level of toxicity, or other
adverse physiological effects at the cellular, organ and/or
organism level (often referred to as side-effects) resulting from
administration of the treatment. "Less effective" means that the
treatment results in a therapeutically significant lower level of
pharmacological effectiveness and/or a therapeutically greater
level of adverse physiological effects.
[0096] The term "antibody" is meant to be an immunoglobulin protein
that is capable of binding an antigen. Antibody as used herein is
meant to include antibody fragments, e.g. F(ab')2, Fab', Fab,
capable of binding the antigen or antigenic fragment of interest.
Preferably, the binding of the antibody to the antigen inhibits the
activity of a variant form of EGFR.
[0097] The term "humanized antibody" is used herein to describe
complete antibody molecules, i.e. composed of two complete light
chains and two complete heavy chains, as well as antibodies
consisting only of antibody fragments, e.g. Fab, Fab', F (ab') 2,
and Fv, wherein the CDRs are derived from a non-human source and
the remaining portion of the Ig molecule or fragment thereof is
derived from a human antibody, preferably produced from a nucleic
acid sequence encoding a human antibody.
[0098] The terms "human antibody" and "humanized antibody" are used
herein to describe an antibody of which all portions of the
antibody molecule are derived from a nucleic acid sequence encoding
a human antibody. Such human antibodies are most desirable for use
in antibody therapies, as such antibodies would elicit little or no
immune response in the human patient.
[0099] The term "chimeric antibody" is used herein to describe an
antibody molecule as well as antibody fragments, as described above
in the definition of the term "humanized antibody." The term
"chimeric antibody" encompasses humanized antibodies. Chimeric
antibodies have at least one portion of a heavy or light chain
amino acid sequence derived from a first mammalian species and
another portion of the heavy or light chain amino acid sequence
derived from a second, different mammalian species.
[0100] Preferably, the variable region is derived from a non-human
mammalian species and the constant region is derived from a human
species. Specifically, the chimeric antibody is preferably produced
from a 9 nucleotide sequence from a non-human mammal encoding a
variable region and a nucleotide sequence from a human encoding a
constant region of an antibody.
[0101] Nucleic acid molecules can be isolated from a particular
biological sample using any of a number of procedures, which are
well-known in the art, the particular isolation procedure chosen
being appropriate for the particular biological sample. For
example, freeze-thaw and alkaline lysis procedures can be useful
for obtaining nucleic acid molecules from solid materials; heat and
alkaline lysis procedures can be useful for obtaining nucleic acid
molecules from urine; and proteinase K extraction can be used to
obtain nucleic acid from blood (Rolff, A et al. PCR: Clinical
Diagnostics and Research, Springer (1994).
[0102] The phrases "gene amplification" and "gene duplication" are
used interchangeably and refer to a process by which multiple
copies of a gene or gene fragment are formed in a particular cell
or cell line. The duplicated region (a stretch of amplified DNA) is
often referred to as "amplicon." Usually, the amount of the
messenger RNA (mRNA) produced, i.e., the level of gene expression,
also increases in the proportion of the number of copies made of
the particular gene expressed.
[0103] The "copy number of a gene" refers to the number of DNA
sequences in a cell encoding a particular gene product. Generally,
for a given gene, an animal has two copies of each gene. The copy
number can be increased, however, by gene amplification or
duplication, or reduced by deletion.
[0104] A "cancer" in an animal refers to the presence of cells
possessing characteristics typical of cancer-causing cells, such as
uncontrolled proliferation, immortality, metastatic potential,
rapid growth and proliferation rate, and certain characteristic
morphological features. Often, cancer cells will be in the form of
a tumor, but such cells may exist alone within an animal, or may be
a non-tumorigenic cancer cell, such as a leukemia cell. In some
circumstances, cancer cells will be in the form of a tumor; such
cells may exist locally within an animal, or circulate in the blood
stream as independent cells, for example, leukemic cells. Examples
of cancer include but are not limited to breast cancer, a melanoma,
adrenal gland cancer, biliary tract cancer, bladder cancer, brain
or central nervous system cancer, bronchus cancer, blastoma,
carcinoma, a chondrosarcoma, cancer of the oral cavity or pharynx,
cervical cancer, colon cancer, colorectal cancer, esophageal
cancer, gastrointestinal cancer, glioblastoma, hepatic carcinoma,
hepatoma, kidney cancer, leukemia, liver cancer, lung cancer,
lymphoma, non-small cell lung cancer, osteosarcoma, ovarian cancer,
pancreas cancer, peripheral nervous system cancer, prostate cancer,
sarcoma, salivary gland cancer, small bowel or appendix cancer,
small-cell lung cancer, squamous cell cancer, stomach cancer,
testis cancer, thyroid cancer, urinary bladder cancer, uterine or
endometrial cancer, and vulval cancer.
[0105] To "compare" levels of gene expression means to detect gene
expression levels in two samples and to determine whether the
levels are equal or if one or the other is greater. A comparison
can be done between quantified levels, allowing statistical
comparison between the two values, or in the absence of
quantification, for example using qualitative methods of detection
such as visual assessment by a human.
[0106] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes a biological activity of MET or the transcription or
translation thereof. Suitable antagonist molecules specifically
include antagonist antibodies or antibody fragments, fragments,
peptides, small organic molecules, anti-sense nucleic acids,
etc.
[0107] "Reducing the level of gene activity" refers to inhibiting
the gene product activity in the cell, or lowering the copy number
of the gene, or decreasing the level of the gene's transcribed mRNA
or translated protein in the cell. Preferably, the level of the
particular gene activity is lowered to the level typical of a
normal, cancer-free cell, but the level may be reduced to any level
that is sufficient to decrease the proliferation of the cell,
including to levels below those typical of normal cells.
[0108] An "inhibitor of gene activity" is a molecule that acts to
reduce or prevent the production and/or accumulation of gene
product activity in a cell. The molecule can prevent the
accumulation at any step of the pathway from the gene to enzyme
activity, e.g. preventing transcription, reducing mRNA levels,
preventing translation, or inhibiting the enzyme itself. Such
inhibitors can include antisense molecules or ribozymes, repressors
of gene transcription, or competitive or non-competitive molecular
inhibitors of the gene product.
[0109] The phrase "repressor of transcription" refers to a molecule
that can prevent the production of mRNA from a particular gene.
Preferably, the molecule binds directly or indirectly to a
regulatory element of the gene, thereby preventing the
transcription of the gene.
[0110] The terms "HGF receptor" and "c-Met" and "Met" when used
herein refer to a cellular receptor for HGF, which typically
includes extracellular domain, a transmembrane domain and an
intracellular domain, as well as variants and fragments thereof
which retain the ability to bind HGF. The terms "HGF receptor" and
"c-Met" and "Met" include the polypeptide molecule that comprises
the full-length, native amino acid sequence encoded by the gene
variously known as p190.sup.MET. The present definition
specifically encompasses soluble forms of HGF receptor, and HGF
receptor from natural sources, synthetically produced in vitro or
obtained by genetic manipulation including methods of recombinant
DNA technology. The HGF receptor variants or fragments preferably
share at least about 65% sequence identity, and more preferably at
least about 75% sequence identity with any domain of the human
c-Met amino acid sequence published in Rodrigues et al., Mol. Cell.
Biol. 11:2962-2970 (1991); Park et al., Proc. Natl. Acad. Sci.,
14:6379-6383 (1987); or Ponzetto et al., Oncogene 6:553-559 (1991).
The nucleic acid sequence of the polynucleotide encoding the
full-length protein of MET was published by Park et al. (Proc.
Natl. Acad. Sci. USA 84: 6379-83 (1987)) and submitted to GenBank
under the accession number NM.sub.--000245.
EXAMPLES
Example 1
[0111] Mouse mammary tumors derived from a heterozygous Trp53
deletion with a tissue-specific deletion of Brca1
(Brca1.sup.11/coTrp53.sup.+/-MMTV-Cre) (2) were subjected to a
whole-genome survey using long oligonucleotide microarrays
(Agilent). The use of coding sequence markers for genomic copy
number analysis has proven highly effective in identifying
gene-centered amplifications and deletions (5). Remarkably, a
single recurrent abnormality was evident in 11 of 15 (73%) tumors,
namely high level amplification of a locus on chromosome 6 (FIG.
1A). The minimal amplicon contained only two full-length
genes--Capza2, encoding the F-actin capping protein alpha-2 subunit
involved in cytoskeleton remodeling, and the oncogene Met (FIG.
1B).
[0112] 10-50 fold amplification of Met was confirmed using
quantitative real-time PCR (qPCR) (FIG. 1C). MET encodes a
transmembrane tyrosine kinase receptor for Hepatocyte Growth Factor
(HGF, scatter factor), which transduces signals implicated in
proliferation, migration and morphogenesis (6-8). Ectopic
expression of MET, as well as HGF, confers a tumorigenic and
metastatic phenotype in cancer-derived cell lines (9-11), and
activating mutations have been reported in both sporadic and
inherited forms of renal papillary carcinomas (12). Mutations in
MET are rare in breast cancer (13, 14), but tumors with high
protein expression appear to have a worse clinical prognosis (15,
16). Furthermore, increased HGF/MET signaling can serve as an
initiating event for tumorigenesis, as mice overexpressing either
HGF or mutant Met in mammary epithelium develop breast tumors
(17-19).
[0113] No mutations were present in the coding sequence of
amplified Met from any of the mammary tumors of
Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre mice, suggesting that
overexpression of the wild type receptor is sufficient to confer a
selective advantage in tumor cells with this genetic background.
Consistent with the presence of DNA amplification, the primary
tumors expressed high levels of Met protein (FIG. 5). Fluorescent
In Situ Hybridization (FISH) analysis of early passage cell lines
derived from these tumors showed that the amplified Met genes are
carried on "double minute" extrachromosomal elements (FIG. 1D).
While amplification of Met appears to be common in this mouse model
of Brca1/p53-driven mammary tumorigenesis, the amplified gene
copies are rapidly lost upon establishment of cell lines,
presumably reflecting the absence of selection pressure under in
vitro culture conditions (FIG. 1E).
[0114] Amplification of Met was not observed in other common mouse
models of mammary carcinogenesis, including MMTV-driven Erbb2 and
c-Myc (data not shown), suggesting that the initiating Brca1/p53
lesion in our mouse tumor model may dictate subsequent secondary
genetic lesions. In humans, overexpression of the receptor has been
reported in many epithelial cancers, but gene amplification in
breast cancer has not been systematically analyzed. To extend our
findings from the mouse model, we tested a panel of 100 primary
human breast cancers. While about 10% of cases had increased MET
gene copy number (3-6 copies), no high level Met amplification was
found (data not shown). Similarly, no cases of BRCA1- or
BRCA2-linked breast tumors (0/9) or breast cancers from patients
with TP53-mutant Li-Fraumeni syndrome (0/13) displayed elevated MET
gene copy numbers (data not shown). MET amplification therefore is
not a common characteristic of human breast cancer.
[0115] In contrast, MET amplification has been reported in 10-20%
of all primary gastric cancers, including up to 40% in the
scirrhous histological subtype (20, 21). Indeed, we found increased
MET gene copy numbers in 5/17 (29%) gastric cell lines tested (FIG.
2A). In all these cell lines, the amplified gene copies were stably
integrated within a characteristic homogeneously staining region
(HSR) of chromosomes (FIG. 2B). No mutations were present in the
coding sequence of MET in any of the gastric cancer cell lines,
making it possible to test the contribution of wild type MET
amplification to cellular proliferation and survival.
[0116] Five gastric cancer cell lines with >8-fold MET
amplification (Amp.sup.+) were compared with 12 cell lines without
amplification (Amp.sup.-). As expected, Amp.sup.+ cells had a
dramatic elevation in MET protein expression. Remarkably, these
cells also displayed constitutive MET phosphorylation (FIG. 3A),
which was not further enhanced by treatment with its ligand HGF
(FIG. 3B). In contrast, Amp.sup.- cells had low or undetectable
levels of MET phosphorylation under standard culture conditions,
but demonstrated phosphorylation of the receptor following
treatment with HGF. Consistent with the ligand-independence of MET
activation in Amp.sup.+ cells, no HGF mRNA expression was
detectable by quantitative RT-PCR in 4/5 cell lines (Table 3) and
treatment with neutralizing anti-HGF antibody did not affect the
levels of MET phosphorylation (FIG. 4). Constitutive activation of
the receptor may therefore result from the very high level of
protein expressed, an effect that has been reported for MET (22)
and other receptor tyrosine kinases (23).
[0117] To test the potential therapeutic relevance of these
observations, we made use of a highly specific MET kinase
inhibitor, PHA-665752 (24) (Pfizer). This drug effectively
suppressed the constitutive MET autophosphorylation in Amp.sup.+
cells. Furthermore, treatment with PHA-665752 also abrogated the
baseline phosphorylation of downstream effectors of growth factor
receptors, ERK1/2, AKT, STAT3, and FAK in these cells (FIG. 3B).
Thus, constitutive activation of these proliferative and survival
pathways in Amp.sup.+ cells appears to be dependent upon MET
signaling.
[0118] In contrast, in Amp.sup.- cells where MET is not
constitutively autophosphorylated, PHA-665752 had no effect on
baseline phosphorylation of ERK1/2, AKT, STAT3 or FAK, indicating
that these effectors are likely to be activated through alternative
growth factor receptors. In 5/5 Amp.sup.+ cells, continued
treatment with PHA-665752 led to a dramatic decrease in the number
of viable cells (FIG. 4A, Table 4), accompanied by the induction of
apoptosis (FIG. 4B). In contrast, 12/12 Amp.sup.- cells were
resistant to the MET kinase inhibitor, showing no change in their
proliferation rate following drug treatment (p=0.00016, Fisher's
Exact Test, two-sided).
[0119] To confirm that the differential effects of PHA-665752 are
truly attributable to its effect on MET, we treated cells with
siRNA targeting the MET receptor. Consistent with the drug studies,
a marked reduction in cell viability was evident in Amp.sup.+ cells
following MET knockdown, whereas no such effect was observed in
Amp.sup.- cells (FIG. 4C, 4D). Amp.sup.+ cells were not affected by
knockdown of other receptors, such as epidermal growth factor
receptor (EGFR) or ERBB2. Thus, a subset of gastric cancer cell
lines defined by >8-fold MET amplification appears to be
dependent upon constitutive activation of this growth factor
receptor for their survival and show exquisite sensitivity to the
tyrosine kinase inhibitor PHA-665752.
[0120] Analysis of the role of MET in malignancy has largely
focused on its effect in promoting cell motility, invasion and
metastasis, rather than its primary transforming potential.
However, the ability of MET itself to drive malignant proliferation
is evident from its central role in initiating human papillary
renal carcinoma (12), and in a number of mouse models with ectopic
expression of the activated receptor (17-19). Our observations
suggest that even in human cancers where MET alteration may or may
not be the initiating genetic event, amplification of the receptor
leads to a dependence on its transduced signals (i.e. oncogene
addiction (1), thereby identifying a marker of drug response.
[0121] As such, MET amplification in gastric and other types of
cancers may constitute a molecular marker for targeted therapy,
analogous to the BCR-ABL translocation in chronic myeloid leukemia
(CML) (27, 28), and activating kinase mutations within c-KIT in
gastrointestinal stromal tumors (GIST) (29, 30) and within the
epidermal growth factor receptor (EGFR) in non-small cell lung
cancer (NSCLC) (31, 32). While our studies focused on cell lines
with stable MET amplification on HSRs, tumors with unstable
amplification subject to in vivo selection pressures may also prove
responsive to MET inhibition. As MET inhibitors enter clinical
trials in the near future, our observations highlight an approach
in which preclinical studies defining molecular markers of drug
susceptibility may help select subsets of cancers most likely to
demonstrate a clinical response to such targeted inhibitors.
Materials and Methods:
[0122] Microarray Screening
[0123] Tumors derived from the
Brca1.sup..DELTA.11/coTrp53.sup.+/-MMTV-Cre animals were
histologically analyzed to be over 90% pure. DNA from was extracted
from matching pairs of tumor and liver (normal control) of the same
animal and processed for microarray analysis as described before
(33).
[0124] Quantitative Real-Time PCR
[0125] The sequences of the PCR primer pairs and fluorogenic MGB
probes (all listed from 5' to 3') used for DNA copy number
analyses:
TABLE-US-00001 (SEQ ID NO 1) Hs.MET_F, TGTTGCCAAGCTGTATTCTGTTTAC
(SEQ ID NO 2) Hs.MET_R, TCTCTGAATTAGAGCGATGTTGACA (SEQ ID NO 3)
Hs.MET_probe, VIC-TGGATAATTGTGTCTTTCTCTAG-MGBNFQ (SEQ ID NO 4)
Hs.TOP3A_F, CCACTGCGAACTTAAGAAAACTTTG (SEQ ID NO 5) Hs.TOP3A_R,
TTCTCTATCACAGTCAGTCCAGATCA (SEQ ID NO 6) Hs.TOP3A_probe,
VIC-AACGAGAGACTCGCCAGT-MGBNFQ (SEQ ID NO 7) Mm.Met_F,
TTCCAACCCTCTTTGATTGCA (SEQ ID NO 8) Mm.Met_R,
GCTACTTGAAGGCCAAATCCTATAA (SEQ ID NO 9) Mm.Met_probe,
VIC-AATCCAACTGTGAAAGAT-MGBNFQ (SEQ ID NO 10) Mm.Edem_F,
GTTTCCACACCACCTTTGATTCT (SEQ ID NO 11) Mm.Edem_R,
GTCAGGAGGAACACCTGTCTTCA (SEQ ID NO 12) Mm.Edem_probe,
VIC-CCCACTGCAGGTGAA-MGBNFQ
[0126] All samples were done in triplicates and the relative MET
copy number was derived by standardizing the input DNA to the
control signal (TOP3A for the human samples and Edem1 for the mouse
samples).
[0127] The sequences of the PCR primer pairs and fluorogenic MGB
probes (all listed from 5' to 3') used for quantitating relative
HGF expression levels are:
TABLE-US-00002 (SEQ ID NO 13) Hs.HGF_F, CGCTACGAAGTCTGTGACATTCC
(SEQ ID NO 14) Hs.HGF_R, CCCATTGCAGGTCATGCAT (SEQ ID NO 15)
Hs.HGF_probe, VIC-CAGTGTTCAGAAGTTG-MGBNFQ (SEQ ID NO 16)
Hs.GAPDH_F, GGTGGTCTCCTCTGACTTCAACA (SEQ ID NO 17) Hs.GAPDH_R,
GTGGTCGTTGAGGGCAATG (SEQ ID NO 18) Hs.GAPDH_probe,
VIC-AACCACTCCTCCACCTTTGACGCTG- TAMRA
[0128] All samples were done in triplicates and the relative HGF
expression levels was derived by dividing the HGF signal by the
GAPDH signal. All values are relative to the lowest expressing cell
line, which was assigned an arbitrary expression value of 1.
[0129] Mutational Screening
[0130] DNA isolated from fresh frozen tissue or cultured cell lines
was amplified by direct PCR amplification or nested PCR
amplification. Genomic was amplified in a 25 ul reaction consisting
of 1.times. buffer, 50 uM dNTP, 200 nM sense primer, 200 nM
antisense primer and 0.8 U Expand Taq (Roche Diagnostics, Germany).
Primer sequences and annealing temperatures are provided in the
table below. PCR amplicons were purified using exonuclease I
(United States Biochemical, Cleveland, Ohio) and shrimp alkaline
phosphatase (United States Biochemical, Cleveland, Ohio) and
diluted in water prior to sequencing. Bidirectional capillary
sequencing was performed using BigDye Terminator v1.1 chemistry
(Applied Biosystems, Foster City, Calif.) in combination with an
ABI3100 instrument. Internal sequencing primers for exons 4 and 5
of human MET were (exon 4: CCACAAGCCCTGCTAATCTGTTATT (SEQ ID NO 19)
and CTTTCTTGGAGAACAAATTAACTAG (SEQ ID NO 20)) and (exon 5:
CACCGTTATGACAGGATTTGCACAC (SEQ ID NO 21) and
GCTGATGACTCACAGCTAAATGAG (SEQ ID NO 22)). Electropherograms were
aligned and reviewed using Sequence Navigator software in
combination with Factura.
TABLE-US-00003 TABLE 1 primers and annealing temperatures used for
human MET sequencing. Primary PRIMER SEQUENCE PRIMER SEQUENCE
Annealing Primer (Sense) (Anti-Sense) temp. .degree. C. Exon 2A
GTCATGTCCAACCGCACAATGCATC CCAGTCTTGTACTCAGCAACCTTC 52 (SEQ ID NO
23) (SEQ ID NO 24) Exon 2B GTCATTCTACATGAGCATCACATT
CTGATATCGAATGCAATGGATGATC 50 (SEQ ID NO 25) (SEQ ID NO 26) Exon 2C
CAGTGTCCTGACTGTGTGGTGAGCG GCTTGCTGACATACGCAGCCTGAAG 58 (SEQ ID NO
27) (SEQ ID NO 28) Exon 2D GGAAATGCCTCTGGAGTGTATTCTC
GGTGTAAATGAAGATTCAATTCCTC 52 (SEQ ID NO 29) (SEQ ID NO 30) Exon 3
CCTTGCCATTATCCTCCAGGCTCTG CAGAAAGTAGACCAGGCTTCATTG 58 (SEQ ID NO
31) (SEQ ID NO 32) Exon 4&5 CCACAAGCCCTGCTAATCTGTTATT
GCTGATGACTCACAGCTAAATGAG 58 (SEQ ID NO 33) (SEQ ID NO 34) Exon 6
CTTGTTTCATTAACATGTCATGTAG TTCAAGAGATGAGCTTCTTGAGCAA 58 (SEQ ID NO
35) (SEQ ID NO 36) Exon 7&8 GTCAGCTCACCATTTAGAGTTAATG
GGTACAGATATTAATTCAAATTGAC 58 (SEQ ID NO 37) (SEQ ID NO 38) Exon 9
GATCCAGTCAGATTAAACAGCCTAC CAACATAACAGCATCAAAGCCAGAG 58 (SEQ ID NO
39) (SEQ ID NO 40) Exon 10 AAGTTGTTTCCAAAGAACAGTTACC
CTACACTGCAAGGAAATTAACTAGC 58 (SEQ ID NO 41) (SEQ ID NO 42) Exon 11
TGTGTAGTCTAACATTAGGAAGTTA GTATAAGATACAATGGCCAAGTAC 52 (SEQ ID NO
43) (SEQ ID NO 44) Exon 12 GTATCATAGAATCGTGTGCCTTGGC
CTAGGAATGCAGGCTGAGTTGATG 58 (SEQ ID NO 45) (SEQ ID NO 46) Exon 13
GAAGGCAGTTATGCCATTTGTAGAA CATCGTAGCGAACTAATTCACTG 58 (SEQ ID NO 47)
(SEQ ID NO 48) Exon 14 CCTTAAGAACACAGTCATTACAG
GTGTCAAATACTTACTTGGCAGAGG 58 (SEQ ID NO 49) (SEQ ID NO 50) Exon 15
GCTTTCAAAATTAATACTTAGTCTAC CTTGTTATCACTGCTCTGTCAGTTG 58 (SEQ ID NO
51) (SEQ ID NO 52) Exon 16 GTACTCTTTTGCTGTATAGAAAG
CCACAAGGGGAAAGTGTAAATCAAC 58 (SEQ ID NO 53) (SEQ ID NO 54) Exon 17
CAAGATGCTAACTGTGTGGTTTACC GAGGTGCATTTGAATGATGCTAAC 58 (SEQ ID NO
55) (SEQ ID NO 56) Exon 18 GACCAAACTAATTTTTGAGACAAG
CACATCGATTTAAGATTGTAACAG 58 (SEQ ID NO 57) (SEQ ID NO 58) Exon 19
CTTCCTTCAGAAGTTATGGATTTC GAAGAAAACTGGAATTGGTGGTGTTG 58 (SEQ ID NO
59) (SEQ ID NO 60) Exon 20 CAGAAACCGTATTGAGTATGTAAAGC
GCATTTTAGCATTACTTCATATCTG 58 (SEQ ID NO 61) (SEQ ID NO 62) Exon 21
GAAGACTCCTACAACCCGAATACTG CAAGTCCTATAATAGTGCAATTTTG 58 (SEQ ID NO
63) (SEQ ID NO 64) Annealing Secondary temperature Primer PRIMER
SEQUENCE (Sense) PRIMER SEQUENCE (Anti-Sense) .degree. C. Exon 14
GAACACAGTCATTACAGTTTAAG CTTACTTGGCAGAGGTAAATACTTCC 58 (SEQ ID NO
65) (SEQ ID NO 66) Exon 15 CTTAGTCTACTTAAATGAAAATCTG
CTGCTCTGTCAGTTGCTTTCACC 58 (SEQ ID NO 67) (SEQ ID NO 68) Exon 16
GCTGTATAGAAAGAAGAAAG CAGTGGTAGCTGATTTTTCCACAAGG 58 (SEQ ID NO 69)
(SEQ ID NO 70) Exon 17 CTGTGTGGTTTACCATTTCATTGC
GACTCAGAGCAGGCCTATTTTG 58 (SEQ ID NO 71) (SEQ ID NO 72) Exon 18
GACCAAACTAATTTTTGAGACAAG GAAATAAAGGACTTTTGCATAAG 58 (SEQ ID NO 73)
(SEQ ID NO 74) Exon 19 GTTATGGATTTCAAATACTGAAGC
GTCCATTTTTACATATGAAGAAAAC 58 (SEQ ID NO 75) (SEQ ID NO 76) Exon 20
GAGTATGTAAAGCCAAGTTTAG CATTACTTCATATCTGTTCCAAAAAG 58 (SEQ ID NO 77)
(SEQ ID NO 78) Exon 21 CTGCCCAGACCCCTTGTAAGTAGTC
GTGCAATTTTGGCAAGAGCAAAG 58 (SEQ ID NO 79) (SEQ ID NO 80)
TABLE-US-00004 TABLE 2 Table of primers and annealing temperatures
used for mouse Met sequencing. Primary PRIMER SEQUENCE PRIMER
SEQUENCE Annealing Primer (Sense) (Anti-Sense) temperature .degree.
C. Exon 1A GATATCGAAGCTGGAGGAGTCATGC CATAGTATGTGTCAACAAGCAGAG 58
(SEQ ID NO 81) (SEQ ID NO 82) Exon 1B GTTGGAACACCCAGATTGTTTACC
CGAAGGCATGTATGTACTTTATGG 58 (SEQ ID NO 83) (SEQ ID NO 84) Exon 1C
CGGCTGAAGGAAACCCAAGATGG GACAGACGTTTATTCTGCTTCATAC 58 (SEQ ID NO 85)
(SEQ ID NO 86) Exon 2 CATGTGACTATCCTTGATATTCTG
GTTACCCCTTTGGGTTCTGTCTCTAG 58 (SEQ ID NO 87) (SEQ ID NO 88) Exon 3
CTAACAGGATGCACTGTGGGTCTTC GGAGGCATGAGTCTAAGTCTCAG 58 (SEQ ID NO 89)
(SEQ ID NO 90) Exon 4 GATGCTACTCAATTAGATGCCGTG
GATGTCCCCCACGTAGATGAATAC 58 (SEQ ID NO 91) (SEQ ID NO 92) Exon 5
CACACACAGGAACACACGCATGTG CCTGGATGAGCATGTTGAACAATTG 58 (SEQ ID NO
93) (SEQ ID NO 94) Exons 6 CTCACAATTTGGGGTTTAATATCC
GAATCATTAGTGGGAGAGAATCACG 58 & 7 (SEQ ID NO 95) (SEQ ID NO 96)
Exon 8 CTTACAGATGTAATTTTGGAATATG CACAGCAGCGTTTAAATAAATGAGG 58 (SEQ
ID NO 97) (SEQ ID NO 98) Exon 9 GCGAGTCCTCTAACATCATAAGAG
GTACCATTTGACCTCTGCTGCAGG 58 (SEQ ID NO 99) (SEQ ID NO 100) Exon 10
GTGTAACAACTGATGTGTTTTGAG GTAGAATAGGATACACTGAGCAC 58 (SEQ ID NO 101)
(SEQ ID NO 102) Exon 11 CAGCGTCTGCATTTGTTGTATTCTTG
GCTAGAGCCAACATACAGATGAGC 58 (SEQ ID NO 103) (SEQ ID NO 104) Exon 12
CCACCAGGGTGCTAATTGGAATCC CTTTTATGAATGCTTATTAGACAAC 58 (SEQ ID NO
105) (SEQ ID NO 106) Exon 13 GTTGTCTAATAAGCATTCATAAAAG
CAGGACAAAAAGCAAAAAGCAAG 58 (SEQ ID NO 107) (SEQ ID NO 108) Exon 14
GAGTGTTCCCAGCCTAGCATTTCG CTCGTTATCAGGCTCTGTCAGGAG 60 (SEQ ID NO
109) (SEQ ID NO 110) Exon 15 GCATGGAGAGAAGTGTAATGCATC
CCACAAGGGAAAGTGCAAATGAACAC 60 (SEQ ID NO 111) (SEQ ID NO 112) Exon
16 TCTCTTGCTACCTAAATTTGAAAAAG CCTTGTTAAGGGCATTTGCTACTC 52 (SEQ ID
NO 113) (SEQ ID NO 114) Exon 17 CCACAGGGCATGAGTTATTATTTG
CTTCGAAGAGAAGAGAGAAAATGTC 60 (SEQ ID NO 115) (SEQ ID NO 116) Exon
18 CAATAGGCCAGAGGAAATTATGG GTTACCATACAACTACGGAGAG 60 (SEQ ID NO
117) (SEQ ID NO 118) Exon 19 GTGAAGTGTGTCAAGCAAGGATG
CCAGCATTTTAGCATCACTTCGTAC 58 (SEQ ID NO 119) (SEQ ID NO 120) Exon
20 CCTTGTAAGTAAGAGTTTGCTGG GTTAAGTGACCTTCCAAAGGCCAG 58 (SEQ ID NO
121) (SEQ ID NO 122)
[0131] FISH
[0132] Cell lines were grown in the appropriate medium until 70%
confluent. Cells were trypsinized, washed in 1.times.PBS, treated
with 0.56% KCl and fixed with 3:1 methanol:acetic acid. Cells were
dropped on clean glass slides for interphase and/or metaphase
spreads. For FISH in human cells BAC clone CTD-1013N12 containing
the full-length MET gene was used. BAC RP11-340A14, mapping to
7q11.2, was used as a control probe. For FISH in mouse cells BAC
RP23-173p9 containing the full-length Met gene (6A2 region) was
used. BAC RP23-137A12, mapping to 6G3 region, was used as a control
probe. All clones were confirmed by PCR using gene-specific or STS
markers. Human BAC clones were mapped to normal metaphase spreads
to confirm their map positions. BAC DNAs were labeled with Cy3- and
FITC-dUTP by nick translation. Metaphase spreads were hybridized
with 200 ng of each probe along with 10 ug of Cot-1 DNA in a
hybridization buffer containing 50% formamide, 10% dextran sulfate
and 2.times.SSC at 37.degree. C. in a humid chamber for 18-20
hours. Following hybridization slides were washed in 50%
formamide/2.times.SSC pH7.0, and 0.1.times.SSC solutions at
50.degree. C. Slides were then counterstained with DAPI in antifade
solution. Image analysis was performed using the Magnafire
software.
[0133] Cell Lines
[0134] Human gastric cell lines were either purchased from ATCC or
were generously donated by Dr. Kay Huebner and Dr. Reuben Lotan.
All lines were propagated in RPMI1640 medium supplemented with 10%
fetal bovine serum, 2 mM L-glutamine, 50 U/ml
penicillin/streptomycin and maintained at 5% CO.sub.2 at 37.degree.
C.
[0135] Immunoblotting
[0136] Cells were either directly lysated in 2.times. sample buffer
or in RIPA buffer (150 mM NaCl, 50 mM Tris pH 8.0, 1% NP40, 0.5%
DOC, 0.1% SDS, 1 mM EDTA, 10 mM NaF, 1 mM Na-orthovanadate,
1.times. protease inhibitor cocktail (Roche; Indianapolis, Ind.)).
Cell lysates were sonicated for 10 sec and cleared by
centrifugation at 14,000 rpm for 10 min at 4.degree. C. Cleared
lysates were boiled in sample buffer and loaded onto 10% SDS-PAGE
gel. For immunoblotting analysis, proteins were transferred onto
Immobilon PVDF membrane (Millipore; Bedford, Mass.) and visualized
with Western Lightning Plus chemiluminescence kit (Perkin Elmer;
Boston, Mass.).
[0137] Antibodies
[0138] The phospho-MET (Y1234/Y1235), phospho-AKT (S473),
phospho-ERK1/2(T202/Y204), phospho-FAK (Y576/Y577), phospho-STAT3
(Y747), AKT, ERK1/2, STAT3, ERBB2, EGFR, and cleaved caspase-3
antibodies were from Cell Signaling (Beverly, Mass.). The
phospho-MET (Y1349) antibody was from Biosource (Camarillo,
Calif.). The human MET antibody (C-12) and mouse Met antibody
(SP260) were from Santa Cruz Biotechnology (Santa Cruz, Calif.).
The .beta.-actin antibody was from Abcam (Cambridge, Mass.). The
neutralizing HGF antibody was from R&D Systems (Minneapolis,
Minn.). All immunoblots were done with 1:1000 antibody dilution,
except for the .beta.-actin antibody, which was used at 1:10000
dilution.
[0139] Apoptosis Induction Assay
[0140] Cells were plated on coverslips in 12-well dishes and grown
to approximately 75% confluency in 10% serum. Subsequently, media
was changed to 2% serum and 1 .mu.M PHA-665752. After 72 h the
cells were fixed with 4% paraformaldehyde for 20 minutes.
Permeabilization with 1% NP40 for 5 minutes was followed by
blocking with 3% BSA for 30 minutes. The coverslips were then
incubated overnight at 4.degree. C. with cleaved caspase-3 antibody
at 1:200 dilution. The next day, the coverslips were washed 3 times
with PBS and incubated with a secondary antibody (goat anti-rabbit
FITC-conjugated) for 1 h at 1:250 dilution. Following 5 washes with
PBS, coverslips were mounted in Vectashield mounting medium
containing DAPI (Vector Laboratories; Burlingame, Calif.).
[0141] Viability Assays
[0142] Cells were plated in 96-well plate in medium containing 4%
fetal bovine serum at approximately 4000 cells/well. The next day
the cells were treated with increasing concentrations of
PHA-665752. Cell viability was measured 96 h later using the MTT
assay. Briefly, 10 ul of 5 mg/ml MTT (Thiazolyl blue) solution was
added to each well and incubated for about 2 hours at 37.degree. C.
For adherent cell lines, the media was removed from each well and
the resultant MTT formazan was solubilized in 100 ul of DMSO. For
suspension cell lines, the MMT formazan was solubilized by direct
addition of 100 ul of acidic isopropanol (0.1N HCl) to each well.
The results were quantitated spectrophotometrically using a test
wavelength of 570 nm and a reference wavelength of 630 nm.
[0143] RNA
[0144] RNA was extracted from cultured cells using RNeasy kit from
Qiagen (Valencia, Calif.). c-DNA synthesis was performed using
SuperScript II Reverse Transcriptase from Invitrogen (Carlsbad,
Calif.).
[0145] siRNA-Mediated "Knockdown" of Met Expression
[0146] The duplexes targeting MET, EGFR, and ERBB2 were custom
SMARTpool mixtures from Dharmacon (Lafayette, Colo.). siRNA
duplexes were transfected using X-treme Gene transfection reagent
from Roche or Lipofectamine 2000 from Invitrogen.
[0147] Immunohistochemistry
[0148] Immunohistochemistry was performed using Vectastain ABC Kit
from Vector Laboratories (Burlingame, Calif.). Mouse Met antibody
was used at a 1:100 dilution.
TABLE-US-00005 TABLE 3 Relative expression levels of HGF mRNA in
the gastric cancer cell lines. Cell lines Relative HGF expression
Amp.sup.+ cells MKN45 nd SNU-5 nd GTL16 nd KATO II nd Hs746T 8.80
.+-. 2.29 Amp.sup.- cells MKN74 nd SNU-16 nd HSC39 27.35 .+-. 5.35
AGS nd KATO III 1.67 .+-. 0.50 SNU-1 nd N87 1.00 .+-. 0.27 MKN1
2.22 .+-. 1.56 MKN28 nd TMK-1 26.45 .+-. 2.31 Hs738T 4710.45 .+-.
121.48 MKN7 nd nd - denotes "not detectable".
TABLE-US-00006 TABLE 4 Percent viability after 96 h treatment with
500 nM PHA-665752. Cell lines % viability Amp.sup.+ cells MKN45 5.8
.+-. 0.5 SNU-5 4.0 .+-. 0.2 GTL16 12.8 .+-. 1.2 KATO II 3.2 .+-.
0.3 Hs746T 38.4 .+-. 1.2 Amp.sup.- cells MKN74 89.6 .+-. 2.6 SNU-16
99.9 .+-. 1.5 HSC39 92.8 .+-. 2.1 AGS 99.8 .+-. 1.9 KATO III 105.2
.+-. 9.5 SNU-1 100.9 .+-. 3.2 N87 86.0 .+-. 7.4 MKN1 87.5 .+-. 4.0
MKN28 103.8 .+-. 4.2 TMK-1 91.3 .+-. 2.1 Hs738T 100.2 .+-. 12.3
MKN7 117.9 .+-. 21.1
Example 2
Screening of Cancer Cell Lines for Sensitivity to a MET Tyrosine
Kinase Inhibitor
[0149] The genetic heterogeneity underlying differential
responsiveness of lung cancers to the EGFR tyrosine kinase
inhibitors gefitinib and erlotinib is recapitulated in
lung-cancer-derived cell lines. Whereas most NSCLC cell lines have
an IC50 for gefitinib of 10 .mu.M, rare cell lines harboring
activating mutations in EGFR typically demonstrate a 50- to
100-fold enhancement in sensitivity, as measured by cell killing
(32, 38-40). To test the predictive value of such an in vitro
drug-sensitivity screen, we treated 40 cell lines representing
diverse tumor types with gefitinib at concentrations ranging from
100 nM to 10 .mu.M. Extreme sensitivity (100 nM) was observed with
NCI-H1650, the only NSCLC cell line in our panel with the del
E746-A750 activating mutation in EGFR (FIG. 7) (39). Variable
degrees of sensitivity were evident in other cell lines tested, but
none had a degree of cell killing comparable to <1 .mu.M
gefitinib. The NCI-H1975 NSCLC cell line harbors both a
L858R-sensitizing mutation in EGFR and the T790M drug-resistance
mutation, and, hence, it scored as relatively resistant in the
assay. Consistent with the lower gefitinib sensitivity of the
remaining cell lines, they did not harbor activating EGFR
mutations. To extend this analysis to other tyrosine kinase
inhibitors, we screened the same cancer cell line panel for
sensitivity to a specific MET tyrosine kinase inhibitor PHA-665752
(24) (Pfizer). Extreme sensitivity (100 nM) to this drug was
observed for one gastric cancer cell line MKN45. As with gefitinib,
other cell lines demonstrated variable degrees of cell killing, but
none had a similar response <1 .mu.M of PHA-665752 (FIG. 7). The
MKN45 cell line is known to have amplification of MET (41),
pointing to a potential genetic mechanism underlying its
extraordinary drug sensitivity. None of the other 39 cell lines had
MET gene amplification, as determined by quantitative PCR (qPCR)
analysis (data not shown).
[0150] MET Amplification and Constitutive Activation in Human
Gastric Cancer Cells.
[0151] Overexpression of MET has been reported in many epithelial
cancers, but gene amplification is most common in gastric cancer,
where 10-20% of all primary tumors and up to 40% of the scirrhous
histological subtype have increased MET gene copy numbers (21,
42-43). Analysis of a panel of gastric cancer cell lines by using
qPCR identified increased MET gene copy number in 5 of 17 (29%)
cases (FIG. 8A). In all 5 cell lines, FISH analysis showed the
amplified gene copies to be integrated within a chromosomal locus,
consistent with so-called homogeneously staining regions (HSRs)
(FIG. 8B). HSR-amplification is characteristically stable in the
absence of selection, indicating that the increased MET gene copy
number represents targeted amplification of this locus rather than
reflecting general aneuploidy. FISH and qPCR analyses were
consistent in identifying the subset of cell lines with MET
amplification, with higher fold amplification apparent by FISH
(FIGS. 8 A and B), presumably reflecting the effect of low-level
copy-number variability in the control locus used in qPCR analysis,
resulting in underestimation of the true extent of MET
amplification. A cutoff of 8-fold gene amplification, as measured
by qPCR, provided a clear distinction between gastric cancer cells
with low-level aneuploidy (Amp-) versus those with high-level
specific HSR-amplification of MET (Amp+).
[0152] As expected, all 5 Amp+ cells displayed dramatic elevation
in MET protein expression, compared with the 12 Amp- cells (FIG.
9A). Remarkably, Amp+ cells also displayed high levels of baseline
MET activation, as measured by phosphorylation of tyrosine residues
1,234/1,235 and 1,349 (FIG. 9A). MET phosphorylation was not due to
the presence of activating mutations, as determined by nucleotide
sequencing of the entire coding sequence in all 17 gastric cancer
cell lines (data not shown). MET activation in Amp+ cells also
appeared to be independent of its ligand, hepatocyte growth factor
(HGF)/scatter factor, based on three observations. First, whereas
Amp- cells had low levels of MET phosphorylation under standard
culture conditions but demonstrated HGF-induced receptor
autophosphorylation accompanied by phosphorylation of downstream
effectors ERK1/2 and AKT, no such increase in baseline MET
phosphorylation or activation of downstream signaling was evident
in Amp+ cells treated with HGF (FIG. 9B). Second, no HGF mRNA
expression was detectable by quantitative RT-PCR in 4 of 5 Amp+
cell lines, arguing against an autocrine signaling loop. Finally,
treatment of Amp+ cells with neutralizing anti-HGF antibody did not
affect the levels of MET phosphorylation (FIG. 9C), whereas it
effectively suppressed HGF-induced MET activation in Amp- cells
(FIG. 9D). Thus, Amp+ cells appear to exhibit constitutive
ligand-independent MET activation, which may result from receptor
dimerization associated with the very high levels of protein
expressed on the cell surface, an effect that has been reported for
MET (22) and other receptor tyrosine kinases (23).
[0153] MET Amplification As Molecular Marker of Susceptibility to a
Tyrosine Kinase Inhibitor. To test the potential therapeutic
relevance of these observations, we treated gastric cancer cell
lines with the specific MET kinase inhibitor PHA-665752. This
small-molecule inhibitor has an IC50 against MET of 9 nM, compared
with an IC50 of 3.8 .mu.M and >10 .mu.M for EGFR and
platelet-derived growth factor receptor, respectively (24). In 5 of
5 Amp+ cells, treatment with PHA-665752 for 96 h resulted in a
dramatic reduction in cell numbers, whereas treatment had no effect
in any of the 12 Amp- cells (P=0.00016, Fisher's exact test,
two-sided) (FIG. 10A). Cell viability for these experiments was
assessed by vital dye staining and expressed as a fraction of
viable cells in matched untreated cultures. To determine whether
this effect represented cell death or growth arrest, we compared
the effect of PHA-665752 on the proliferation of Amp+ and Amp-
cells as a function of time. Amp+ cells underwent an initial arrest
in proliferation, followed by cell death (FIG. 10B). In contrast,
the proliferation rate of Amp- cells was unaffected by the presence
or absence of PHA-665752 (FIG. 10B).
[0154] To confirm that the differential effects of PHA-665752 are
truly attributable to its effect on MET, we transfected cells with
small interfering (si)RNA targeting the MET receptor transcript.
Effective and specific knockdown of MET protein expression was
demonstrated by immunoblotting analysis (FIG. 10C). As control for
nonspecific effects on growth factor signaling, we also tested
siRNA targeting EGFR and ERBB2. Consistent with the effect of
PHA-665752, a marked reduction in cell viability was evident in
Amp+ cells after MET knockdown, whereas no such effect was observed
in Amp- cells (FIG. 10D). Amp+ cells were not affected by knockdown
of other receptors, such as EGFR or ERBB2.
[0155] To address the mechanism by which PHA-665752 triggers cell
death in Amp+ cells, we first tested the effect of drug treatment
on MET-dependent signaling. PHA-665752 (50 nM) effectively
suppressed the constitutive MET autophosphorylation in Amp+ cells
(FIG. 11A). Most significantly, treatment with this concentration
of PHA-665752 also effectively abrogated the baseline
phosphorylation of downstream effectors of growth factor receptors,
such as ERK1/2, AKT, STAT3, and FAK. Thus, constitutive activation
of these proliferative and survival pathways in Amp+ cells appears
to depend specifically on baseline MET signaling. In contrast, in
Amp- cells, where MET is not constitutively autophosphorylated,
PHA-665752 had no effect on baseline phosphorylation of ERK1/2,
AKT, STAT3, or FAK, indicating that these effectors are likely to
be activated through alternative growth factor receptors (FIG.
11A).
[0156] Suppression of essential growth-factor-mediated survival
pathways has been linked to the induction of apoptosis. Consistent
with this model, both cleaved caspase-3-staining and PARP-cleavage
assays demonstrated apoptosis in Amp+ cells treated with PHA-665752
but not in Amp- cells under identical conditions (FIGS. 11B and C).
The early induction of apoptosis by PHA-665752 in SNU-5 cells is
accompanied by a prominent PARP-cleavage signal at 72 h, compared
with a more delayed but prolonged cell death in MKN45 cells (FIG.
9B). Thus, a subset of gastric cancer cell lines defined by
targeted MET amplification appears to depend on constitutive
activation of this growth factor receptor for their survival and
show exquisite sensitivity to cell killing by the tyrosine kinase
inhibitor PHA-665752.
[0157] Cellular Proliferation and Viability Assays. Cells were
plated in 96-well plates in medium containing 4% FBS at 4,000 cells
per well and, after 24 h, treated with various concentrations of
either gefitinib or PHA-665752. For quantitation of cellular
proliferation, cells were fixed at appropriate time points in 4%
paraformaldehyde, and all plates were stained simultaneously by
using the fluorescent nucleic acid stain SYTO60 (Molecular Probes)
at 1:8,000 dilution in PBS. Quantitation was done by measuring the
absorption at 700 nm by using the Odyssey Imaging System (LI-COR,
Lincoln, Nebr.). The relative cell number was obtained by
normalizing treated samples to matched untreated specimens. For
quantitation of cell viability, cultures were stained after 4 days
by using the MTT assay. Briefly, 10 ul of 5 mg/ml MTT (Thiazolyl
blue) solution was added to each well and incubated for 2 h at
37.degree. C. For adherent cell lines, the media was removed from
each well, and the resultant MTT formazan was solubilized in 100
.mu.l of DMSO. For nonadherent cell lines, the MTT formazan was
solubilized by direct addition of 100 .mu.l of acidic isopropanol
(0.1 N HCl) to each well. The results were quantitated
spectrophotometrically by using a test wavelength of 570 nm and a
reference wavelength of 630 nm.
[0158] FISH and Mutational Analysis. Bacterial artificial
chromosome clone CTD-1013N12, containing the full-length MET gene,
was used for FISH. PAC RP4-620P6, mapping to 7p21, was used as a
control probe. FISH was performed as described in ref 44. For
mutational analysis, genomic DNA was amplified by PCR and sequenced
bidirectionally by using BigDye Terminator v1.1 chemistry (Applied
Biosystems). Primer sequences and annealing temperatures are
provided herein.
[0159] siRNA-Mediated "Knockdown" of MET Expression and
Immunoblotting Analysis. The duplexes targeting MET, EGFR, and
ERBB2 transcripts were custom SMARTpool mixtures from Dharmacon
(Lafayette, Colo.). siRNA duplexes were transfected by using
Lipofectamine 2000 from Invitrogen following the manufacturer's
instructions. Briefly, cells were plated in 4% serum and
transfected the next day with siRNAs at a final concentration of 40
nM for 5 h, followed by change of culture medium. The transfection
was repeated on day 2 under the same conditions. Cell viability was
assayed 4 days from the time of the first transfection, by using
the MTT assay.
[0160] Antibodies. The phospho-MET (Y1234/Y1235), phospho-AKT
(S473), phopho-ERK1/2(T202/Y204), phospho-FAK (Y576/Y577),
phospho-STAT3 (Y727), AKT, ERK1/2, STAT3, ERBB2, EGFR, cleaved
PARP, and cleaved caspase-3 antibodies were from Cell Signaling
Technology (Beverly, Mass.). The phospho-MET (Y1349) antibody was
from BioSource International (Camarillo, Calif.). The total MET
antibody (C-12) was from Santa Cruz Biotechnology. The -actin
antibody was from Abcam (Cambridge, Mass.). The neutralizing HGF
goat antibody was from R & D Systems, and the matched goat IgG
control antibody was from Sigma. All immunoblots were done with
1:1,000 antibody dilution, except for the -actin antibody, which
was used at 1:10,000 dilution.
[0161] Apoptosis Induction Assay. Cells were plated on coverslips
in 12-well dishes and grown to 75% confluency in 10% serum,
followed by incubation in 4% serum and PHA-665752. After 72 h,
cells were fixed with 4% paraformaldehyde for 20 min, permeabilized
by using 1% Nonidet P-40 for 5 min, and blocked with 3% BSA for 30
min. The coverslips were then incubated overnight at 4.degree. C.
with cleaved caspase-3 antibody at 1:200 dilution. The next day,
the coverslips were washed three times with PBS and incubated with
a secondary antibody (goat anti-rabbit FITC-conjugated) for 1 h at
1:250 dilution. After five washes with PBS, coverslips were mounted
in Vectashield mounting medium containing DAPI (Vector
Laboratories), and staining was visualized by fluorescent
microscopy.
REFERENCES
[0162] 1. I. B. Weinstein, Science 297, 63 (2002). [0163] 2. S. G.
Brodie et al., Oncogene 20, 7514 (2001). [0164] 3. X. Xu et al.,
Nat. Genet. 22, 37 (1999). [0165] 4. X. Xu, et al., Nat. Genet. 28,
266 (2001). [0166] 5. C. Brennan et al., Cancer Res. 64, 4744
(2004). [0167] 6. A. Bertotti, P. M. Comoglio, Trends Biochem. Sci.
28, 527 (2003). [0168] 7. C. Birchmeier, W. Birchmeier, E.
Gherardi, G. F. Vande Woude, Nat. Rev. Mol. Cell. Biol. 4, 915
(2003). [0169] 8. P. C. Ma, G. Maulik, J. Christensen, R. Salgia,
Cancer Metastasis Rev. 22, 309 (2003). [0170] 9. S. Rong et al.,
Mol. Cell. Biol. 12, 5152 (1992). [0171] 10. S. Rong, S. Segal, M.
Anver, J. H. Resau, G. F. Vande Woude, Proc. Natl. Acad. Sci.
U.S.A. 91, 4731 (1994). [0172] 11. R. Abounader et al., Faseb J.
16, 108 (2002). [0173] 12. L. Schmidt et al., Nat. Genet. 16, 68
(1997). [0174] 13. J. H. Lee et al., Oncogene 19, 4947 (2000).
[0175] 14. I. Bieche, M. H. Champeme, R. Lidereau, Int. J. Cancer
82, 908 (1999). [0176] 15. E. Lengyel et al., Int. J. Cancer 113,
678 (2005). [0177] 16. J. Y. Kang et al., Cancer Res. 63, 1101
(2003). [0178] 17. M. I. Gallego, B. Bierie, L. Hennighausen,
Oncogene 22, 8498 (2003). [0179] 18. M. Jeffers et al., Proc. Natl.
Acad. Sci. U.S.A. 95, 14417 (1998). [0180] 19. H. Takayama et al.,
Proc. Natl. Acad. Sci. U.S.A. 94, 701 (1997). [0181] 20. M.
Nakajima et al., Cancer 85, 1894 (1999). [0182] 21. H. Kuniyasu et
al., Biochem. Biophys. Res. Commun. 189, 227 (1992). [0183] 22. J.
D. Bergstrom, A. Hermansson, T. Diaz de Stahl, N. E. Heldin, Br. J.
Cancer 80, 650 (1999). [0184] 23. P. J. Brennan, T. Kumagai, A.
Berezov, R. Murali, M. I. Greene, Oncogene 19, 6093 (2000). [0185]
24. J. G. Christensen et al., Cancer Res. 63, 7345 (2003). [0186]
25. C. Ponzetto et al., Oncogene 6, 553 (1991). [0187] 26. A.
Hellman et al., Cancer Cell 1, 89 (2002). [0188] 27. B. J. Druker
et al., N. Engl. J. Med. 344, 1038 (2001). [0189] 28. B. J. Druker
et al., N. Engl. J. Med. 344, 1031 (2001). [0190] 29. D. A. Tuveson
et al., Oncogene 20, 5054 (2001). [0191] 30. S. Hirota et al.,
Science 279, 577 (1998). [0192] 31. T. J. Lynch et al., N. Engl. J.
Med. 350, 2129 (2004). [0193] 32. J. G. Paez et al., Science 304,
1497 (2004). [0194] 33. C. Brennan et al., Cancer Res. 64, 4744
(2004). [0195] 34. S. G. Brodie et al., Oncogene 20, 7514 (2001).
[0196] 35. A. S. Wong et al., Oncogene 20, 1318 (2001). [0197] 36.
R. Warn et al., Exp. Cell Res. 267, 258 (2001). [0198] 37. N.
Chattopadhyay, R. J. MacLeod, J. Tfelt-Hansen, E. M. Brown, Am. J.
Physiol. Endocrinol. Metab. 284, E219 (2003). [0199] 38. Koizumi,
F., Shimoyama, T., Taguchi, F., Saijo, N. & Nishio, K. (2005)
Int. J. Cancer 116, 36-44. [0200] 39. Sordella, R., Bell, D. W.,
Haber, D. A. & Settleman, J. (2004) Science 305, 1163-1167.
[0201] 40. Tracy, S., Mukohara, T., Hansen, M., Meyerson, M.,
Johnson, B. E. & Janne, P. A. (2004) Cancer Res 64, 7241-7244.
[0202] 41. Rege-Cambrin, G., Scaravaglio, P., Carozzi, F.,
Giordano, S., Ponzetto, C., Comoglio, P. M. & Saglio, G. (1992)
Cancer Genet. Cytogenet 64, 170-173. [0203] 42. Nessling, M.,
Solinas-Toldo, S., Wilgenbus, K. K., Borchard, F. & Lichter, P.
(1998) Genes Chromosomes Cancer 23, 307-316. [0204] 43. Sakakura,
C., Mori, T., Sakabe, T., Ariyama, Y., Shinomiya, T., Date, K.,
Hagiwara, A., Yamaguchi, T., Takahashi, T. & Nakamura, Y., et
al. (1999) Genes Chromosomes Cancer 24, 299-305. [0205] 44.
Mohapatra, G., Moore, D. H., Kim, D. H., Grewal, L., Hyun, W. C.,
Waldman, F. M., Pinkel, D. & Feuerstein, B. G. (1997) Genes.
Chromosomes Cancer 20, 311-319.
[0206] The references cited throughout the application are
incorporated herein by reference in their entirety.
Sequence CWU 1
1
122125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1tgttgccaag ctgtattctg tttac 25225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2tctctgaatt agagcgatgt tgaca 25323DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 3tggataattg tgtctttctc tag
23425DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4ccactgcgaa cttaagaaaa ctttg 25526DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5ttctctatca cagtcagtcc agatca 26618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
6aacgagagac tcgccagt 18721DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 7ttccaaccct ctttgattgc a
21825DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8gctacttgaa ggccaaatcc tataa 25918DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
9aatccaactg tgaaagat 181023DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 10gtttccacac cacctttgat tct
231123DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11gtcaggagga acacctgtct tca 231215DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
12cccactgcag gtgaa 151323DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 13cgctacgaag tctgtgacat tcc
231419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14cccattgcag gtcatgcat 191516DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
15cagtgttcag aagttg 161623DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 16ggtggtctcc tctgacttca aca
231719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17gtggtcgttg agggcaatg 191825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
18aaccactcct ccacctttga cgctg 251925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
19ccacaagccc tgctaatctg ttatt 252025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20ctttcttgga gaacaaatta actag 252125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21caccgttatg acaggatttg cacac 252224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22gctgatgact cacagctaaa tgag 242325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23gtcatgtcca accgcacaat gcatc 252424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24ccagtcttgt actcagcaac cttc 242524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25gtcattctac atgagcatca catt 242625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
26ctgatatcga atgcaatgga tgatc 252725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27cagtgtcctg actgtgtggt gagcg 252825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28gcttgctgac atacgcagcc tgaag 252925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29ggaaatgcct ctggagtgta ttctc 253025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30ggtgtaaatg aagattcaat tcctc 253125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31ccttgccatt atcctccagg ctctg 253224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32cagaaagtag accaggcttc attg 243325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33ccacaagccc tgctaatctg ttatt 253424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34gctgatgact cacagctaaa tgag 243525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
35cttgtttcat taacatgtca tgtag 253625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36ttcaagagat gagcttcttg agcaa 253725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37gtcagctcac catttagagt taatg 253825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
38ggtacagata ttaattcaaa ttgac 253925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39gatccagtca gattaaacag cctac 254025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40caacataaca gcatcaaagc cagag 254125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
41aagttgtttc caaagaacag ttacc 254225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
42ctacactgca aggaaattaa ctagc 254325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43tgtgtagtct aacattagga agtta 254424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
44gtataagata caatggccaa gtac 244525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
45gtatcataga atcgtgtgcc ttggc 254624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46ctaggaatgc aggctgagtt gatg 244725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47gaaggcagtt atgccatttg tagaa 254823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
48catcgtagcg aactaattca ctg 234923DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 49ccttaagaac acagtcatta cag
235025DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 50gtgtcaaata cttacttggc agagg 255126DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51gctttcaaaa ttaatactta gtctac 265225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52cttgttatca ctgctctgtc agttg 255323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53gtactctttt gctgtataga aag 235425DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 54ccacaagggg aaagtgtaaa
tcaac 255525DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 55caagatgcta actgtgtggt ttacc
255624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 56gaggtgcatt tgaatgatgc taac 245724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
57gaccaaacta atttttgaga caag 245824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
58cacatcgatt taagattgta acag 245924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
59cttccttcag aagttatgga tttc 246026DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
60gaagaaaact ggaattggtg gtgttg 266126DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
61cagaaaccgt attgagtatg taaagc 266225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
62gcattttagc attacttcat atctg 256325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
63gaagactcct acaacccgaa tactg 256425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
64caagtcctat aatagtgcaa ttttg 256523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
65gaacacagtc attacagttt aag 236626DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 66cttacttggc agaggtaaat
acttcc 266725DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 67cttagtctac ttaaatgaaa atctg
256823DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 68ctgctctgtc agttgctttc acc 236920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
69gctgtataga aagaagaaag 207026DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 70cagtggtagc tgatttttcc acaagg
267124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 71ctgtgtggtt taccatttca ttgc 247222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
72gactcagagc aggcctattt tg 227324DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 73gaccaaacta atttttgaga
caag 247423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 74gaaataaagg acttttgcat aag 237524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
75gttatggatt tcaaatactg aagc 247625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
76gtccattttt acatatgaag aaaac 257722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
77gagtatgtaa agccaagttt ag 227826DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 78cattacttca tatctgttcc
aaaaag 267925DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 79ctgcccagac cccttgtaag tagtc
258023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 80gtgcaatttt ggcaagagca aag 238125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
81gatatcgaag ctggaggagt catgc 258224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
82catagtatgt gtcaacaagc agag 248324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
83gttggaacac ccagattgtt tacc 248424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
84cgaaggcatg tatgtacttt atgg 248523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
85cggctgaagg aaacccaaga tgg 238625DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 86gacagacgtt tattctgctt
catac 258724DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 87catgtgacta tccttgatat tctg
248826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 88gttacccctt tgggttctgt ctctag 268925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
89ctaacaggat gcactgtggg tcttc 259023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
90ggaggcatga gtctaagtct cag 239124DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 91gatgctactc aattagatgc
cgtg 249224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 92gatgtccccc acgtagatga atac 249324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
93cacacacagg aacacacgca tgtg 249425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
94cctggatgag catgttgaac aattg 259524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
95ctcacaattt ggggtttaat atcc 249625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
96gaatcattag tgggagagaa tcacg 259725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
97cttacagatg taattttgga atatg 259825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
98cacagcagcg tttaaataaa tgagg 259924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
99gcgagtcctc taacatcata agag 2410024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
100gtaccatttg acctctgctg cagg 2410124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
101gtgtaacaac tgatgtgttt tgag 2410223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
102gtagaatagg atacactgag cac 2310326DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
103cagcgtctgc atttgttgta ttcttg 2610424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
104gctagagcca acatacagat gagc 2410524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
105ccaccagggt gctaattgga atcc 2410625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
106cttttatgaa tgcttattag acaac 2510725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
107gttgtctaat aagcattcat aaaag 2510823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
108caggacaaaa agcaaaaagc aag 2310924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
109gagtgttccc agcctagcat ttcg 2411024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
110ctcgttatca ggctctgtca ggag 2411124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
111gcatggagag aagtgtaatg catc 2411226DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
112ccacaaggga aagtgcaaat gaacac 2611326DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
113tctcttgcta cctaaatttg aaaaag 2611424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
114ccttgttaag ggcatttgct actc
2411524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 115ccacagggca tgagttatta tttg 2411625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
116cttcgaagag aagagagaaa atgtc 2511723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
117caataggcca gaggaaatta tgg 2311822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
118gttaccatac aactacggag ag 2211923DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
119gtgaagtgtg tcaagcaagg atg 2312025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
120ccagcatttt agcatcactt cgtac 2512123DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
121ccttgtaagt aagagtttgc tgg 2312224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
122gttaagtgac cttccaaagg ccag 24
* * * * *