U.S. patent application number 14/065058 was filed with the patent office on 2014-05-22 for multiplexed identification of nucleic acid sequences.
This patent application is currently assigned to Stratos Genomics, Inc.. The applicant listed for this patent is Stratos Genomics, Inc.. Invention is credited to Mark Stamatios Kokoris, Robert N. McRuer.
Application Number | 20140141989 14/065058 |
Document ID | / |
Family ID | 44629089 |
Filed Date | 2014-05-22 |
United States Patent
Application |
20140141989 |
Kind Code |
A1 |
Kokoris; Mark Stamatios ; et
al. |
May 22, 2014 |
MULTIPLEXED IDENTIFICATION OF NUCLEIC ACID SEQUENCES
Abstract
A method for the rapid identification of a target nucleic acid
sequence is provided, as well as corresponding devices, products
and kits. Such methods are useful for the rapid detection,
identification and/or quantification of target nucleic acid
sequences associated with, for example, a pathogen.
Inventors: |
Kokoris; Mark Stamatios;
(Bothell, WA) ; McRuer; Robert N.; (Mercer Island,
WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Stratos Genomics, Inc. |
Seattle |
WA |
US |
|
|
Assignee: |
Stratos Genomics, Inc.
Seattle
WA
|
Family ID: |
44629089 |
Appl. No.: |
14/065058 |
Filed: |
October 28, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13174054 |
Jun 30, 2011 |
8586301 |
|
|
14065058 |
|
|
|
|
61360385 |
Jun 30, 2010 |
|
|
|
Current U.S.
Class: |
506/9 ;
435/6.11 |
Current CPC
Class: |
G01N 33/48721 20130101;
C12Q 1/6869 20130101; C12Q 1/6825 20130101; C12Q 1/6813 20130101;
C12Q 1/6869 20130101; C12Q 2531/113 20130101; C12Q 1/6832 20130101;
C12Q 2563/149 20130101; C12Q 2565/631 20130101; C12Q 2527/107
20130101; C12Q 2525/301 20130101; C12Q 2563/179 20130101; C12Q
2525/197 20130101; C12Q 2527/107 20130101; C12Q 2525/161 20130101;
C12Q 2565/549 20130101; C12Q 2565/549 20130101; C12Q 2565/631
20130101; C12Q 1/6825 20130101; C12Q 2533/107 20130101 |
Class at
Publication: |
506/9 ;
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for identifying a target nucleic acid sequence in a
sample, the method comprising: contacting the target nucleic acid
sequence with a capture probe under conditions that provide for
selective hybridization of the capture probe to a first portion of
the target nucleic acid sequence, wherein the capture probe
comprises a reporter tether and a probe complementary to the first
portion of the target nucleic acid sequence; ligating a terminal
probe to the capture probe under conditions that provide for
transient hydridization of the terminal probe to a second portion
of the target nucleic acid sequence adjacent to the first portion
of the target nucleic acid sequence to form a target identifier,
wherein the terminal probe comprises a reporter tether and a probe
complementary to the second portion of the target nucleic acid
sequence; and detecting the target identifier and thereby
identifying the target nucleic acid sequence in the sample.
2. The method of claim 1 wherein the probe of the capture probe
comprises from 10 to 100 nucleobases.
3. The method of claim 1 wherein the capture probe is tethered to a
solid support by a linker, or comprises a linker for tethering to a
solid support.
4. The method of claim 1 wherein the reporter tether of the capture
probe comprises a reporter code that, upon detection, parses the
genetic information of the first portion of the target nucleic acid
sequence to which the probe of the capture probe is
complementary.
5. The method of claim 1 wherein the probe of the terminal probe
comprises from 3 to 8 nucleobases.
6. The method of claim 1 wherein the terminal probe is tethered to
a solid support by a linker, or comprises a linker for tethering to
a solid support.
7. The method of claim 1 wherein the reporter tether of the
terminal probe comprises a reporter code that, upon detection,
parses the genetic information of the second portion of the target
nucleic acid sequence to which the probe of the terminal probe is
complementary.
8. The method of claim 1 wherein the target nucleic acid sequence
is contacted with a plurality of capture probes, wherein the probe
of each capture probe is complementary to a different target
nucleic acid sequence.
9. The method of claim 8, wherein the plurality of capture probes
is greater than 10, greater than 100, or greater than 1000.
10. The method of claim 1 wherein the step of ligating the terminal
probe to the capture probe comprises exposing the second portion of
the target nucleic acid sequence to a plurality of terminal probes
having probes with different combinations of nucleobases.
11. The method of claim 10 wherein the plurality of terminal probes
having probes with different combinations of nucleobases is greater
than 10, greater than 50, greater than 100, greater than 200, or
greater than 1000.
12. The method of claim 1, further comprising at least one step of
capturing, washing and concentrating the target identifier prior to
detection.
13. The method of claim 1 wherein the step of detecting is
accomplished by translocating the target identifier through a
nanopore.
14. The method of claim 1 wherein the target identifier is
amplified prior to detection.
15. The method of claim 14 wherein amplification of the target
identifier is by polymerase chain reaction.
16. The method of claim 14 wherein amplification of the target
identifier is by thermal cycling.
17. A method for identifying a target nucleic acid sequence in a
sample, the method comprising: contacting the target nucleic acid
sequence with a capture probe under conditions that provide for
selective hybridization of the capture probe to a first portion of
the target nucleic acid sequence, wherein the capture probe
comprises a probe complementary to the first portion of the target
nucleic acid sequence; ligating a first terminal probe to the
capture probe under conditions that provide for transient
hydridization of the first terminal probe to a second portion of
the target nucleic acid sequence adjacent to the first portion of
the target nucleic acid sequence, wherein the first terminal probe
comprises a reporter tether and a probe complementary to the second
portion of the target nucleic acid sequence; ligating a second
terminal probe to the capture probe under conditions that provide
for transient hydridization of the second terminal probe to a third
portion of the target nucleic acid sequence located adjacent to the
first portion of the target nucleic acid sequence, but at the
opposite end of the probe of the capture probe from the second
portion of target nucleic acid sequence, to form a target
identifier, wherein the second terminal probe comprises a reporter
tether and a probe complementary to the third portion of the target
nucleic acid sequence; and detecting the target identifier and
thereby identifying the target nucleic acid sequence in the
sample.
18. The method of claim 17 wherein the probe of the capture probe
comprises from 10 to 100 nucleobases.
19. The method of claim 17 wherein the capture probe is tethered to
a solid support by a linker, or comprises a linker for tethering to
a solid support.
20. The method of claim 17 wherein the probe of the first terminal
probe comprises from 3 to 8 nucleobases.
21. The method of claim 17 wherein the probe of the second terminal
probe comprises from 3 to 8 nucleobases.
22. The method of claim 17 wherein the first terminal probe is
tethered to a solid support by a linker, or comprises a linker for
tethering to a solid support.
23. The method of claim 17 wherein the second terminal probe is
tethered to a solid support by a linker, or comprises a linker for
tethering to a solid support.
24. The method of claim 17 wherein the reporter tether of the first
terminal probe comprises a reporter code that, upon detection,
parses the genetic information of the second portion of the target
nucleic acid sequence to which the probe of the first terminal
probe is complementary.
25. The method of claim 17 wherein the reporter tether of the
second terminal probe comprises a reporter code that, upon
detection, parses the genetic information of the third portion of
the target nucleic acid sequence to which the probe of the second
terminal probe is complementary.
26. The method of claim 17 wherein the target nucleic acid sequence
is contacted with a plurality of capture probes, wherein the probe
of each capture probe is complementary to a different target
nucleic acid sequence.
27. The method of claim 26, wherein the plurality of capture probes
is greater than 10, greater than 100, or greater than 1000.
28. The method of claim 17 wherein the step of ligating the first
and second terminal probes to the capture probe comprises exposing
the second and third portions of the target nucleic acid sequence
to a plurality of terminal probes having probes with different
combinations of nucleobases.
29. The method of claim 28 wherein the plurality of first and
second terminal probes having probes with different combinations of
nucleobases is greater than 10, greater than 50, greater than 100,
greater than 200, or greater than 1000.
30. The method of claim 17, further comprising at least one step of
capturing, washing and concentrating the target identifier prior to
detection.
31. The method of claim 17 wherein the step of detecting is
accomplished by translocating the target identifier through a
nanopore.
32. The method of claim 17 wherein the target identifier is
amplified prior to detection.
33. The method of claim 32 wherein amplification of the target
identifier is by polymerase chain reaction.
34. The method of claim 32 wherein amplification of the target
identifier is by thermal cycling.
35-69. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is a continuation of U.S.
application Ser. No. 13/174,054, filed Jun. 30, 2011 (now allowed);
which claims the benefit under 35 U.S.C. .sctn.119(e) of U.S.
Provisional Patent Application No. 61/360,385 filed on Jun. 30,
2010; both of these applications are incorporated herein by
reference in their entireties.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is
870225.sub.--406C1_SEQUENCE_LISTING.txt. The text file is 1 KB, was
created on Oct. 28, 2013, and is being submitted electronically via
EFS-Web.
BACKGROUND
[0003] 1. Technical Field
[0004] The present invention is generally related to detection of
nucleic acid sequences, as well as methods for rapid identification
of target sequences in mixed nucleic acid samples.
[0005] 2. Description of the Related Art
[0006] Rapid and accurate detection of nucleic acid sequence has
become increasingly important. For example, threats of biological
warfare and terrorism impose a need for rapid identification of
specific pathogens in samples found on the battlefield, at border
crossings, and in the work environment generally. In addition,
infectious disease accounts for approximately 7% of human mortality
in developed nations, and as much as 40% in the developing world.
Rapid and accurate identification of the causative pathogen could
result in increased survival of infected patients and enable better
containment of outbreaks. Unfortunately, traditional microbiology
techniques (e.g., cell culturing) for identifying biological agents
can take days or even weeks, often delaying a proper course of
action. Antibody based assays can be done quickly and easily, but
often lack sensitivity and/or specificity.
[0007] A desirable alternative to traditional approaches would have
one or more of the following characteristics: high specificity
(>99.9%) and sensitivity (<1000 copies); high-level
multiplexing (>100 targets); automated sample preparation; fully
integrated processes on disposable reagent cartridge;
sample-to-result in less than 15 minutes; rapid reconfiguration for
addition of new biomarkers; flexible targeting; and/or have an
associated compact, low-cost field deployable instrument.
Unfortunately, there are currently no technologies on the market
that satisfy these criteria.
[0008] Probe hybridization arrays can measure a broad spectrum of
nucleic acid targets (I. Biran, D. R. Walt, and J. R. Epstein,
"Fluorescence-based nucleic acid detection and microarrays,"
Analytica Chimica Acta, vol. 469, no. 1, pp. 3-36.1), but typically
have limited sensitivity of 10.sup.5 to 10.sup.6 target molecules
and are also limited by diffusion and nonspecific binding.
Bead-based methods of improving sensitivity to attomolar levels
have been devised (J. Nam, S. I. Stoeva, and C. A. Mirkin,
"Bio-Bar-Code-Based DNA Detection with PCR-like Sensitivity,"
Journal of the American Chemical Society, vol. 126, no. 19, pp.
5932-5933, May. 2004; S. I. Stoeva, J. Lee, J. E. Smith, S. T.
Rosen, and C. A. Mirkin, "Multiplexed Detection of Protein Cancer
Markers with Biobarcoded Nanoparticle Probes," Journal of the
American Chemical Society, vol. 128, no. 26, pp. 8378-8379, July
2006). Bead-based methods to reduce nonspecific signal have also
been devised (S. P. Mulvaney et al., "Rapid, femtomolar bioassays
in complex matrices combining microfluidics and
magnetoelectronics," Biosensors & Bioelectronics, vol. 23, no.
2, pp. 191-200, September 2007).
[0009] Specificity and sensitivity limitations of probe
hybridization methods have been improved by using two probes that
hybridize and ligate to produce a single product with unique
electrophoretic drag (U.S. Pat. No. 4,883,750). This approach has
provided two advantages: (i) the single product helps isolate its
signal from other background, and (ii) the specificity of the
ligase ensures high fidelity within five bases of the ligation
site. Further improvements have involved adding fluorescent
identifiers to probes (E. S. Winn-Deen and D. M. Iovannisci,
"Sensitive fluorescence method for detecting DNA-ligation
amplification products," Clinical Chemistry, vol. 37, no. 9, pp.
1522-1523, September 1991; U.S. Pat. No. 5,514,543). Higher
information identifiers have been proposed that require
amplification in order to obtain sufficient signal to identify the
target (PCT Publication WO 2010/115100; U.S. Pat. No.
7,320,865).
[0010] DNA sequencing can also be used for the identification of
pathogens. Because each pathogen's DNA sequence is unique,
sequencing allows for the identification of any number of different
pathogens. Currently, most diagnostic DNA sequencing is performed
using the chain termination method developed by Frederick Sanger.
This technique, termed "Sanger Sequencing," uses sequence specific
termination of DNA synthesis and fluorescently modified nucleotide
reporter substrates to derive sequence information. However, this
method comprises a modified polymerase chain reaction (PCR) which
makes this approach time consuming and expensive. Furthermore, PCR
cannot simultaneously amplify many pathogen probe targets in a
single reaction which requires samples to be split into many
parallel reaction paths, increasing complexity and cost while
reducing sensitivity. As a result, new sequencing methods, such as
products from Illumina (San Diego, Calif.) and Life technologies
(Carlsbad, Calif.), are displacing traditional methods. These
technologies, however, are still largely reliant on PCR and use
expensive and complex equipment that are not appropriate for rapid,
low cost on-site detection.
[0011] Accordingly, while significant advances have been made in
the field of nucleic acid detection generally, there is still a
need in this field for techniques and corresponding devices that
enhance or otherwise improve on the current state of the art,
particularly with regard to sensitivity, specificity, high
multiplexing, rapid result time, portability and/or cost. The
present invention fulfills some or all of these needs, and provides
further related advantages as evident upon review of the attached
drawings and following description.
BRIEF SUMMARY
[0012] In general terms, methods, corresponding devices, products
and kits are disclosed for rapidly and accurately identifying
target nucleic acid sequences in sample, such as a mixed nucleic
acid sample. Existing methods for pathogen detection are time
consuming, thus delaying the time before an appropriate course of
action or treatment regimen can begin. In contrast, the disclosed
methods, corresponding devices, products and kits methods are
sensitive and specific, and capable of rapid detection without the
need for PCR amplification.
[0013] The disclosed methods are particularly amenable to
incorporation in a portable, integrated system with a single
reaction and detection channel for rapid identification of a broad
spectrum of pathogens. The methods employ probe hybridization and
enzymatic ligation to produce single-molecule identifiers, referred
to herein as a target identifier, that select specifically for each
pathogen's genomic sequence. Each target identifier has a polymeric
string of high signal-to-noise reporters to encode one of thousands
of possible signatures that can be directly read with a solid-state
nanopore or other single molecule detection techniques. The
disclosed methods may employ a solution-based approach which
incorporates filtering techniques to isolate the target identifier.
In addition, the reactions that synthesize and isolate the target
identifiers can be completed in a matter of minutes, in preparation
for detection. Nanopore detection is a suitable detection
technology and is capable of readout rates >1,000 target
identifiers/minute, thus providing for rapid and timely detection
and identification.
[0014] In more specific embodiments, methods are disclosed for
identification of a target nucleic acid sequence in a sample, such
as a nucleic acid sequence derived from a pathogen. The sample is
contacted with a capture probe comprising a sequence of nucleobases
complementary to a portion of the target template, and a terminal
probe comprising a sequence of nucleobases complementary to a
portion of the target template, wherein the sample, the capture
probe and the terminal probe are admixed under conditions
sufficient to provide for hybridization of the capture probe.
Conditions are also provided such that the terminal probe, which is
perfectly complementary to template adjacent to the capture probe,
is preferentially ligated to the capture probe at temperatures that
are above the thermal melting temperatures of the transient probe
(typically 4 to 6 bases). This ligation reaction is referred to
herein as transient hybridization ligation (THL), and can proceed
in either the 5' or 3' direction, or in both the 5' and 3'
direction. The resulting ligation product is referred to as target
identifier.
[0015] In some embodiments, the capture probe comprises a reporter
tether. A reporter tether is sufficiently encoded to uniquely
identify the capture probe sequence. The reporter tether may
directly encode the genetic sequence data or it may encode an
identifier which is associated with the actual sequence (for
example, through a lookup table). The capture probe generally
comprises a sequence of 10-100, or more specifically 20-100 or
20-70, nucleobases complementary to a portion of the target
template.
[0016] In some embodiments, the terminal probe comprises a reporter
tether sufficiently encoded to uniquely identify the terminal probe
sequence. The terminal probe generally comprises a sequence of 3-8
nucleobases, or more specifically 4-6, complementary to a portion
of the target template.
[0017] In some embodiments, the capture probe has no reporter
tether and is extended by ligation in both directions with a
3'-extending terminal probe and a 5'-extending terminal probe, both
with reporter tethers. The resulting target identifier comprises
two reporter tethers, one from each terminal probe.
[0018] In some embodiments, a third type of probe, referred to as a
nested probe, is employed. It is typically 3-8, or more
specifically 4-6, nucleobases in length and extends by THL from the
capture probe. One or more nested probes may be further extended by
a terminal probe to form the target identifier. The nested probe
adds a further level of stringency to the reaction of forming the
target identifier, reducing the number of false positives. Such
additional THL extension provides increased specificity between the
resulting target identifier and the template. In some embodiments
the nested probe has no reporter tether and is a limited library of
base combinations intended to complement adjacent to capture probes
on templates of specific targets.
[0019] In other embodiments, the nested probe is what is referred
to as an Xprobe as described in published U.S. Patent Application
No. US2009/0035777 (incorporated herein by reference in its
entirety). After the target identifier is formed, an additional
cleavage step breaks a linkage that allows the reporter tether of
the Xprobe to linearize and be sequentially detected. In some
embodiments a single nested probe is employed, while in other
embodiments multiple nested probes are employed.
[0020] In other embodiments, the target identifier comprises a
reporter tether having a reporter code sufficient to parse the
genetic information of the entire target template. In other
embodiments, the capture probe, terminal probe, or both, are
adapted with linkers, also referred to herein as T-linkers.
T-linkers may be irreversible or reversible and they may be
selectively linkable or selectively cleavable. T-linkers may be
used to tether to solid support, such as magnetic beads, dielectric
beads, drag tags or other solid substrates to assist in
purification and/or concentration of the target identifier. In
these embodiments the target identifier may have one or more, such
as two, T-linkers.
[0021] In further embodiments, the method further comprises reading
the target identifier reporter code, parsing the genetic
information of the target template and using the genetic
information of the target template to identify the target nucleic
acid sequence, such as a biomarker. For example, in further
embodiments of the foregoing a detector construct is provided,
wherein the detector construct comprises a first and a second
reservoir comprising first and second electrodes, respectively,
wherein the first and second reservoirs are separated by a nanopore
substrate positioned between the first and second reservoirs, the
nanopore substrate comprising at least one nanopore channel, and
reading the target identifier reporter code comprises translocating
the target identifier from the first reservoir to the second
reservoir through the at least one nanopore channel. In more
particular embodiments, reading the target identifier reporter code
further comprises measuring the impedance change along or across
the nanopore channel as the target identifier translocates through
the nanopore channel. In still other embodiments, the target
identifier may be detected using a duplex interrupted method in a
biological nanopore (see, e.g., Gundlach et al., PNAS, 1001831107,
2010). In other embodiments, the target identifier may be detected
by an optical microscope that detects fluorophore reporters.
[0022] In other embodiments, the method further comprises
capturing, washing and/or concentrating the target identifier.
[0023] In other embodiments, a kit is provided that comprises a
plurality of probes for detecting any number of nucleic acid
biomarkers. For example, such a kit has a library of capture
probes, that may contain unique capture probes numbering, for
example, from 1 to 10, from 1 to 100 or, in some embodiments,
greater than 100, or in some embodiments greater than 1000 or
greater than 10000. The kit may also contain a library of terminal
probes with unique terminal probes numbering, for example, from 1
to 10, from 1 to 100 or, in some embodiments all possible base
combinations (e.g., 256 for 4-base terminal probes). The identity
of each probe type may be encoded in its reporter tether.
[0024] These and other aspects of the invention will be apparent
upon reference to the attached drawings and following detailed
description. To this end, various references are set forth herein
which describe in more detail certain procedures, compounds and/or
compositions, and are hereby incorporated by reference in their
entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In the figures, identical reference numbers identify similar
elements. The sizes and relative positions of elements in the
figures are not necessarily drawn to scale and some of these
elements are arbitrarily enlarged and positioned to improve figure
legibility. Further, the particular shapes of the elements as drawn
are not intended to convey any information regarding the actual
shape of the particular elements, and have been solely selected for
ease of recognition in the figures.
[0026] FIG. 1 is a schematic showing ligation of the capture probe
and the terminal probe in the presence of the target template to
form the target identifier.
[0027] FIG. 2 is a schematic showing various aspects of the
disclosed method; namely, (a) selective hybridization of the
capture probe, (b) transient hybridization and ligation of the
terminal probe, (c) extraction of the target identifier and
cleavage of the first bead, (d) capture of the target identifier by
a second bead, and (e) release and detection of the target
identifier.
[0028] FIG. 3 shows a representative nanopore detector response as
a target identifier translocates a solid-state nanopore.
[0029] FIG. 4 shows a low noise solid-state nanopore membrane with
a picoliter reservoir.
[0030] FIG. 5 shows a recorded trace of a 2-state reporter tether
translocated through a solid-state nanopore.
[0031] FIG. 6 is a gel from a competitive ligation assay that
demonstrates specificity.
[0032] FIG. 7 shows an embodiment with a bidirectional THL
extension of a capture probe.
[0033] FIG. 8 shows an embodiment with a nested probe between the
capture probe and the terminal probe.
[0034] FIG. 9 is a representation of an SBX Xprobe.
[0035] FIG. 10 is a schematic representation of a sequencing by
expansion process that uses Xprobes.
[0036] FIG. 11 shows an embodiment of a target identifier synthesis
where an Xprobe is ligated between the capture probe and the
terminal probe.
[0037] FIG. 12 shows an embodiment of a target identifier synthesis
where two Xprobes are ligated between two capture probes.
[0038] FIG. 13 is a schematic showing ligation of the capture probe
and the terminal probe, each with oligonucleotide T-linkers, in the
presence of the target template to form the target identifier.
[0039] FIG. 14 is a gel image that demonstrates the specificity of
transient hybridization ligation for Target Identifier synthesis
along with the efficiency of oligonucleotide T-linker purification
for one embodiment of the invention.
[0040] FIG. 15 is a schematic that describes a test case for
purification of fluorescently labeled ligation product using
oligonucleotide T-linkers.
[0041] FIG. 16 is a gel image that demonstrates high efficiency
purification of full-length ligation product using two distinct
oligonucleotide T-linker moieties, one on the 5' end and the other
on the 3' end of the construct.
[0042] FIG. 17 is a schematic showing various aspects of a method
for enhanced target sequence detection using thermal cycling;
namely, (a) admixture of a capture probe, a terminal probe, a
target nucleic acid and DNA ligase, (b) ligation of the terminal
probe to the template, and (c) release of the target
identifier.
[0043] FIG. 18 is a schematic showing aspects of a method for
target identifier amplification using polymerase; specifically, (a)
a target identifier, (b) hybridization of the target identifier to
a magnetic bead via a second T-linker, (c) an amplified reverse
complement of the target identifier, and (d) the free target
identifier complement.
[0044] FIG. 19 is a time trace of the current measurement
associated with a 2-peak, 2-state target identifier passing through
a solid-state nanopore.
DETAILED DESCRIPTION
[0045] In the following description, certain specific details are
set forth in order to provide a thorough understanding of various
embodiments. However, one skilled in the art will understand that
the invention may be practiced without these details. In other
instances, well-known structures have not been shown or described
in detail to avoid unnecessarily obscuring descriptions of the
embodiments. Unless the context requires otherwise, throughout the
specification and claims which follow, the word "comprise" and
variations thereof, such as, "comprises" and "comprising" are to be
construed in an open, inclusive sense, that is, as "including, but
not limited to." Further, headings provided herein are for
convenience only and do not interpret the scope or meaning of the
claimed invention.
[0046] Reference throughout this specification to "one embodiment"
or "an embodiment" means that a particular feature, structure or
characteristic described in connection with the embodiment is
included in at least one embodiment. Thus, the appearances of the
phrases "in one embodiment" or "in an embodiment" in various places
throughout this specification are not necessarily all referring to
the same embodiment. Furthermore, the particular features,
structures, or characteristics may be combined in any suitable
manner in one or more embodiments. Also, as used in this
specification and the appended claims, the singular forms "a,"
"an," and "the" include plural referents unless the content clearly
dictates otherwise. It should also be noted that the term "or" is
generally employed in its sense including "and/or" unless the
content clearly dictates otherwise.
DEFINITIONS
[0047] As used herein, and unless the context dictates otherwise,
the following terms have the meanings as specified below.
[0048] "Analyte nucleic acid" means a nucleic acid which is the
subject of analysis and/or detection. Analyte nucleic acids include
pathogen nucleic acids as well as other nucleic acids. "Target
sequence" or "target template" means the portion of an analyte
nucleic acid which is being sequenced. A target template provides
unique genetic information such that the source of the analyte
nucleic acid can be identified. For example, a target template may
be unique to a particular pathogen, thus allowing detection of the
same. Selectively cleavable bond" or "selectively cleavable linker"
refers to a bond which can be broken under controlled conditions
such as, for example, conditions for selective cleavage of a
phosphorothiolate bond, a photocleavable bond, a phosphoramide
bond, a 3'-O--B-D-ribofuranosyl-2' bond, a thioether bond, a
selenoether bond, a sulfoxide bond, a disulfide bond,
deoxyribosyl-5'-3' phosphodiester bond, or a ribosyl-5'-3'
phosphodiester bond, as well as other cleavable bonds known in the
art. A selectively cleavable bond can be an intra-tether bond or
between or within a probe or a nucleobase residue or can be the
bond formed by hybridization between a probe and a template strand.
Selectively cleavable bonds are not limited to covalent bonds, and
can be non-covalent bonds or associations, such as those based on
hydrogen bonds, hydrophobic bonds, ionic bonds, pi-bond ring
stacking interactions, Van der Waals interactions, and the
like.
[0049] "Bio-threat agent" is a pathogen used as a weapon, for
example in warfare or terrorism. Examples of bio-threat agents
include anthrax, smallpox, plague and tularemia.
[0050] "Capture probe" refers to a probe which selectively
hybridizes to a target template to form a primer for extension
ligation. Capture probes are generally comprised a single-stranded
portion of 10-100 nucleobases that is complementary to the target
template of interest. In some embodiments, the capture probe
further comprises a reporter tether that is sufficiently encoded to
uniquely identify the capture probe sequence; namely, the capture
probe comprises a reporter tether having a reporter code
sufficient, upon detection, to parse the genetic information of all
or a portion of the target nucleic acid sequence to which the
capture probe is complementary. In some embodiments, the capture
probe is tethered to a solid support by a selectively cleavable
linker, or comprises a reversible linker for tethering to a solid
support, or more generally comprises a T-linker.
[0051] "Complementary" generally refers to specific nucleotide
duplexing to form canonical Watson-Crick base pairs, as is
understood by those skilled in the art. However, complementary as
referred to herein also includes base-pairing of nucleotide
analogs, which include, but are not limited to, 2'-deoxyinosine and
5-nitroindole-2'-deoxyriboside, which are capable of universal
base-pairing with A, T, G or C nucleotides and locked nucleic
acids, which enhance the thermal stability of duplexes. One skilled
in the art will recognize that hybridization stringency is a
determinant in the degree of match or mismatch in the duplex formed
by hybridization.
[0052] "Detector" is an apparatus used for detection of probes.
Detector constructs include any element necessary for detection of
the probes, and generally comprise at least one detector element.
The detector element is capable of detecting reporter elements.
Examples of detector elements include, but are not limited to, a
nanopore channel, fluorescence detectors, UV detectors, chemical
and electrochemical detectors, photoelectric detectors, and the
like. Detector constructs may have elements that function to
resolve reporter signals.
[0053] "Encode" is a verb referring to transferring from one format
to another and typically referring to transferring the genetic
information of oligomer probe base sequence into an arrangement of
reporters.
[0054] "Fluorophore" is a fluorescent molecule or a component of a
molecule that causes the molecule to be fluorescent. Fluorescein is
a non-limiting example of a fluorophore.
[0055] "Indicator" means a moiety, for example a chemical species,
which can be detected under the conditions of a particular assay.
Non-limiting examples of indicators and reporters moieties include:
fluorophores, chemiluminescent species, and any species capable of
inducing fluorescence or chemiluminescence in another species.
[0056] "Ligase" is an enzyme generally for joining 3'-OH
5'-monophosphate nucleotides, oligomers, and their analogs. Ligases
include, but are not limited to, NAD.sup.+-dependent ligases
including tRNA ligase, Taq DNA ligase, Thermus filiformis DNA
ligase, Escherichia coli DNA ligase, Tth DNA ligase, Thermus
scotoductus DNA ligase, thermostable ligase, Ampligase thermostable
DNA ligase, VanC-type ligase, 9.degree. N DNA Ligase, Tsp DNA
ligase, and novel ligases discovered by bioprospecting. Ligases
also include, but are not limited to, ATP-dependent ligases
including T4 RNA ligase, T4 DNA ligase, T7 DNA ligase, Pfu DNA
ligase, DNA ligase I, DNA ligase III, DNA ligase IV, and novel
ligases discovered by bioprospecting. These ligases include
wild-type, mutant isoforms, and genetically engineered
variants.
[0057] "Ligation" or "ligate" refers to joining 3'-OH
5'-monophosphate nucleotides, oligomers, and their analogs.
[0058] "Linker" is a molecule or moiety that joins two molecules or
moieties, and provides spacing between the two molecules or
moieties such that they are able to function in their intended
manner. For example, a linker can comprise a diamine hydrocarbon
chain that is covalently bound through a reactive group on one end
to an oligonucleotide analog molecule and through a reactive group
on another end to a solid support, such as, for example, a bead
surface. Coupling of linkers to nucleotides and substrate
constructs of interest can be accomplished through the use of
coupling reagents that are known in the art (see, e.g., Efimov et
al., Nucleic Acids Res. 27: 4416-4426, 1999). Methods of
derivatizing and coupling organic molecules are well known in the
arts of organic and bioorganic chemistry. A linker may also be
cleavable or reversible. Under some circumstances a hybridizable
oligomer can be considered a linker when it duplexes to its
complementary oligomer.
[0059] "Melting temperature" or "Tm" refers, in the case of DNA
molecules, to the temperature at which half of the DNA stands are
in the double-helical state and half are in the random coil states.
The melting temperature depends on both the length of the molecule,
and the specific nucleotide sequence composition of that molecule
(Proc. Natl. Acad. Sci. USA 95 (4): 1460-5).
[0060] "Moiety" is one of two or more parts into which something
may be divided, such as, for example, the various parts of a
tether, a molecule or a probe.
[0061] "Nested probe" refers to a probe which transiently
hybridizes to a target template and ligates to a capture probe or
the ligated extension of a capture probe. Nested probes generally
comprise from 3-8 nucleobases and may be ligated at both ends.
Nested probe may have no reporter tether (as in the case of a
simple probe), or may have a reporter tether (as in the case of an
Xprobe).
[0062] "Nucleic acid" is a polynucleotide or an oligonucleotide. A
nucleic acid molecule can be deoxyribonucleic acid (DNA),
ribonucleic acid (RNA), or a combination of both. Nucleic acids can
be mixtures or pools of molecules targeted for sequencing. Nucleic
acids are generally referred to as "target nucleic acids" or
"target sequences". A "target template" is the portion of a target
nucleic acid to which the Capture Probe and Terminal Probe
hybridize and provides unique genetic information such that the
source of the target nucleic acid can be identified. For example, a
target template may be unique to a particular pathogen thus
allowing detection of the same.
[0063] "Nucleobase" is a heterocyclic base such as adenine,
guanine, cytosine, thymine, uracil, inosine, xanthine,
hypoxanthine, or a heterocyclic derivative, analog, or tautomer
thereof. A nucleobase can be naturally occurring or synthetic.
Non-limiting examples of nucleobases are adenine, guanine, thymine,
cytosine, uracil, xanthine, hypoxanthine, 8-azapurine, purines
substituted at the 8 position with methyl or bromine,
9-oxo-N-6-methyladenine, 2-aminoadenine, 7-deazaxanthine,
7-deazaguanine, 7-deaza-adenine, N4-ethanocytosine,
2,6-diaminopurine, N6-ethano-2,6-diaminopurine, 5-methylcytosine,
5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil,
thiouracil, pseudoisocytosine,
2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine,
inosine, 7,8-dimethylalloxazine, 6-dihydrothymine,
5,6-dihydrouracil, 4-methyl-indole, ethenoadenine and the
non-naturally occurring nucleobases described in U.S. Pat. Nos.
5,432,272 and 6,150,510 and published PCT applications WO
92/002258, WO 93/10820, WO 94/22892 and WO 94/24144, and Fasman
("Practical Handbook of Biochemistry and Molecular Biology", pp.
385-394, 1989, CRC Press, Boca Raton, LO), all herein incorporated
by reference in their entireties.
[0064] "Nucleobase residue" includes nucleotides, nucleosides,
fragments thereof, and related molecules having the property of
binding to a complementary nucleotide. Deoxynucleotides and
ribonucleotides, and their various analogs, are contemplated within
the scope of this definition. Nucleobase residues may be members of
oligomers and probes. "Nucleobase" and "nucleobase residue" may be
used interchangeably herein and are generally synonymous unless
context dictates otherwise.
[0065] "Parse" or "Decode" are verbs referring to transferring from
one format to another, typically referring to transferring an
arrangement of reporters or the associated reporter code into a
probe identification number or into genetic information of probe
base sequence (or the nucleic acid to which it is
complementary).
[0066] "Pathogen" is a biological agent that can cause disease to
its host. Pathogens include, but are not limited to, viruses,
bacteria, fungi, parasites, prions and the like. Exemplary
pathogens include viruses from the families of: Adenoviridae,
Picornaviridae, Herpesviridae, Hepadnaviridae, Flaviviridae,
Retroviridae, Orthomyxoviridae, Paramyxoviridae, Papovaviridae,
Polyomavirus, Rhabdoviridae and Togaviridae. Exemplary bacteria
include Mycobacterium tuberculosis, Streptococcus, Pseudomonas,
Campylobacter, Salmonella, E. coli and the like.
[0067] "Polynucleotides", also called nucleic acids or nucleic acid
polymers, are covalently linked series of nucleotides. DNA
(deoxyribonucleic acid) and RNA (ribonucleic acid) are biologically
occurring polynucleotides in which the nucleotide residues are
linked in a specific sequence by phosphodiester linkages. As used
herein, the terms "polynucleotide" or "oligonucleotide" encompass
any polymer compound, having a linear backbone of nucleotides.
Oligonucleotides, also termed oligomers, are generally shorter
chained polynucleotides.
[0068] "Probe" is a short strand of nucleobase residues, referring
generally to two or more contiguous nucleobase residues which are
generally single-stranded and complementary to a target sequence of
a nucleic acid. Probes may be chimeric and may include DNAs, RNAs,
PNAs and LNAs. Probes may include modified nucleobase residues and
modified intra-nucleobase bonds in any combination. Backbones of
probes can be linked together by any of a number of types of
covalent bonds, including, but not limited to, ester,
phosphodiester, phosphoramide, phosphonate, phosphorothioate,
phosphorothiolate, amide bond and any combination thereof. The
probe may also have 5' and 3' end linkages that include, but are
not limited to, the following moieties: monophosphate,
triphosphate, hydroxyl, hydrogen, ester, ether, glycol, amine,
amide, and thioester.
[0069] "Reading", within the context of reading a reporter element
or reporter construct, means identifying the reporter element or
reporter construct. The identity of the reporter element or
reporter construct can then be used to decode the genetic
information of the target nucleic acid.
[0070] "Reporter" or "reporter element" is a signaling element,
molecular complex, compound, molecule or atom that is also
comprised of an associated "reporter detection characteristic".
Reporter elements include what are known as "tags" and "labels,"
and serve to parse the genetic information of the target nucleic
acid. Reporter elements include, but are not limited to, FRET
resonant donor or acceptor, dye, quantum dot, bead, dendrimer,
up-converting fluorophore, magnet particle, electron scatterer
(e.g., boron), mass, gold bead, magnetic resonance, ionizable
group, polar group, hydrophobic group. Still others are fluorescent
labels, such as but not limited to, ethidium bromide, SYBR Green,
Texas Red, acridine orange, pyrene, 4-nitro-1,8-naphthalimide,
TOTO-1, YOYO-1, cyanine 3 (Cy3), cyanine 5 (Cy5), phycoerythrin,
phycocyanin, allophycocyanin, FITC, rhodamine,
5(6)-carboxyfluorescein, fluorescent proteins, DOXYL
(N-oxyl-4,4-dimethyloxazolidine), PROXYL
(N-oxyl-2,2,5,5-tetramethylpyrrolidine),
TEMPO(N-oxyl-2,2,6,6-tetramethylpiperidine), dinitrophenyl,
acridines, coumarins, Cy3 and Cy5 (Biological Detection Systems,
Inc.), erytrosine, coumaric acid, umbelliferone, texas red
rhodaine, tetramethyl rhodamin, Rox, 7-nitrobenzo-1-oxa-1-diazole
(NBD), oxazole, thiazole, pyrene, fluorescein or lanthamides; also
radioisotopes (such as .sup.33P, .sup.3H, .sup.14C, .sup.35C,
.sup.125I, .sup.32P or .sup.131I), ethidium, Europium, Ruthenium,
and Samarium or other radioisotopes; or mass tags, such as, for
example, pyrimidines modified at the C5 position or purines
modified at the N7 position, wherein mass modifying groups can be,
for examples, halogen, ether or polyether, alkyl, ester or
polyester, or of the general type XR, wherein X is a linking group
and R is a mass-modifying group, chemiluminescent labels, spin
labels, enzymes (such as peroxidases, alkaline phosphatases,
beta-galactosidases, and oxidases), antibody fragments, and
affinity ligands (such as an oligomer, hapten, and aptamer).
Association of the reporter element with the tether can be covalent
or non-covalent, and direct or indirect. Representative covalent
associations include linker and zero-linker bonds. Included are
bonds to the tether backbone or to a tether-bonded element such as
a dendrimer or sidechain. Representative non-covalent bonds include
hydrogen bonds, hydrophobic bonds, ionic bonds, pi-bond ring
stacking, Van der Waals interactions, and the like. Ligands, for
example, are associated by specific affinity binding with binding
sites on the reporter element.
[0071] "Reporter code" includes the genetic information from a
measured signal of a reporter tether. The reporter code is decoded
to provide sequence-specific genetic information data. It may also
include information to assist in error detection such as parity, or
information to determine code direction, or other functional
information to improve decoding performance.
[0072] "Reporter detection characteristic" referred to as the
"signal" describes all possible measurable or detectable elements,
properties or characteristics used to communicate the genetic
sequence information of a reporter directly or indirectly to a
measurement device. These include, but are not limited to,
fluorescence, multi-wavelength fluorescence, emission spectrum
fluorescence quenching, FRET, emission, absorbance, reflectance,
dye emission, quantum dot emission, bead image, molecular complex
image, magnetic susceptibility, electron scattering, ion mass,
magnetic resonance, molecular complex dimension, molecular complex
impedance, molecular charge, induced dipole, impedance, molecular
mass, quantum state, charge capacity, magnetic spin state,
inducible polarity, nuclear decay, resonance, or
complementarity.
[0073] "Reporter tether" or "reporter construct" is a tether
comprising one or more reporters that can produce a detectable
signal(s), wherein the detectable signal(s) generally contain
sequence information. This signal information is termed the
"reporter code" and is subsequently decoded into genetic sequence
data. A reporter tether may also comprise tether segments or other
architectural components including nucleic acids, polymers, graft
copolymers, block copolymers, affinity ligands, oligomers, haptens,
aptamers, dendrimers, linkage groups or affinity binding group
(e.g., biotin).
[0074] "Selective hybridization" refers to specific complementary
binding. Polynucleotides, oligonucleotides, probes, nucleobase
residues, and fragments thereof selectively hybridize to target
nucleic acid sequences, under hybridization and wash conditions
that minimize nonspecific binding. As known in the art, high
stringency conditions can be used to achieve selective
hybridization conditions favoring a perfect match. Conditions for
hybridization such as salt concentration, temperature, detergents,
PEG, and GC neutralizing agents such as betaine can be varied to
increase the stringency of hybridization, that is, the requirement
for exact matches of C to base pair with G, and A to base pair with
T or U, along a contiguous strand of a duplex nucleic acid.
Generally, decreasing the salt and increasing the temperature of a
hybridization reaction above the Tm of the perfectly matched
nucleic acid duplex increases the hybridization stringency and
therefore increases the selectivity of said duplex. Selective
hybridization generally occurs at or above the Tm. Selective
hybridization can be enhanced by capturing and washing said duplex
under conditions at which perfectly matched duplex will be stable
and mismatched duplexes will be unstable. This can generally be
achieved with wash conditions below the Tm of the perfectly matched
duplex.
[0075] "Solid support" or "solid substrate" is a solid material
having a surface for attachment of molecules, compounds, cells, or
other entities. The surface of a solid support can be flat or not
flat. A solid support can be porous or non-porous. A solid support
can be a chip or array that comprises a surface, and that may
comprise glass, silicon, nylon, polymers, plastics, ceramics, or
metals. A solid support can also be a membrane, such as a nylon,
nitrocellulose, or polymeric membrane, or a plate or dish and can
be comprised of glass, ceramics, metals, or plastics, such as, for
example, polystyrene, polypropylene, polycarbonate, or polyallomer.
A solid support can also be a bead, resin or particle of any shape.
Such particles or beads can be comprised of any suitable material,
such as glass or ceramics, and/or one or more polymers, such as,
for example, nylon, polytetrafluoroethylene, TEFLON.TM.,
polystyrene, polyacrylamide, sepaharose, agarose, cellulose,
cellulose derivatives, or dextran, and/or can comprise metals,
particularly paramagnetic metals, such as iron. Solid supports may
be flexible, for example, a polyethylene terephthalate (PET)
film.
[0076] "Target identifier" is a product resulting from the
contacting and ligation steps of the various methods disclosed
herein. Detection of the target identifier allows for
identification of the target nucleic acid sequence in the sample.
For example, a representative target identifier is formed by
ligating a capture probe with a terminal probe, each of which has a
reporter tether.
[0077] "Terminal probe" refers to a probe which transiently
hybridizes to a target template and ligates to a capture probe or
the ligated extension of a capture probe. The terminal probe is
perfectly complementary to template adjacent to the capture probe,
is preferentially ligated to the capture probe at temperatures that
are above the thermal melting temperatures of the terminal probe
(typically 4 to 6 bases or more generally 3 to 8 bases). In some
embodiments, the capture probe further comprises a reporter tether
that is sufficiently encoded to uniquely identify the terminal
probe sequence; namely, the terminal probe comprises a reporter
tether having a reporter code sufficient, upon detection, to parse
the genetic information of the portion of the target nucleic acid
sequence to which the terminal probe is complementary. In some
embodiments, the terminal probe is tethered to a solid support by a
selectively cleavable linker, or comprises a reversible linker for
tethering to a solid support, or more generally comprises a
T-linker.
[0078] "Tether" is a polymer having a generally linear dimension
with two terminal ends, where the ends form end-linkages for
concatenating the tether elements. Reporter Tethers provide a
scaffolding for reporter elements. Tethers can include, but are not
limited to: polyethylene glycols, polyglycols, polypyridines,
polyisocyan ides, polyisocyanates, poly(triarylmethyl)
methacrylates, polyaldehydes, polypyrrolinones, polyureas,
polyglycol phosphodiesters, polyacrylates, polymethacrylates,
polyacrylamides, polyvinyl esters, polystyrenes, polyamides,
polyurethanes, polycarbonates, polybutyrates, polybutadienes,
polybutyrolactones, polypyrrolidinones, polyvinylphosphonates,
polyacetamides, polysaccharides, polyhyaluranates, polyamides,
polyimides, polyesters, polyethylenes, polypropylenes,
polystyrenes, polycarbonates, polyterephthalates, polysilanes,
polyurethanes, polyethers, polyamino acids, polyglycines,
polyprolines, N-substituted polylysine, polypeptides, side-chain
N-substituted peptides, poly-N-substituted glycine, peptoids,
side-chain carboxyl-substituted peptides, homopeptides,
oligonucleotides, ribonucleic acid oligonucleotides, deoxynucleic
acid oligonucleotides, oligonucleotides modified to prevent
Watson-Crick base pairing, oligonucleotide analogs, polycytidylic
acid, polyadenylic acid, polyuridylic acid, polythymidine,
polyphosphate, polynucleotides, polyribonucleotides, polyethylene
glycol-phosphodiesters, peptide polynucleotide analogues,
threosyl-polynucleotide analogues, glycol-polynucleotide analogues,
morpholino-polynucleotide analogues, locked nucleotide oligomer
analogues, polypeptide analogues, branched polymers, comb polymers,
star polymers, dendritic polymers, random, gradient and block
copolymers, anionic polymers, cationic polymers, polymers forming
stem-loops, rigid segments and flexible segments.
[0079] "T-linker" is a linker that is used primarily to assist in
purification and/or concentration of analyte. T-linkers may be used
to tether to magnetic beads, dielectric beads, drag tags or other
solid substrates. Depending upon the process an analyte may have
more than one T-linker. T-linkers may be irreversible or reversible
linkers and they may be selectively linkable or selectively
cleavable.
[0080] "Transient hybridization" refers to an unstable duplexing of
nucleic acids that can be controlled by adjusting the stringency of
the hybridization environment. Increasing temperature and
decreasing the salt in a hybridization reaction generally increases
the stringency of the hybridization reaction. Short oligomer
nucleic acid probes hybridized to its reverse complement at a
temperature 5.degree. C. above the thermal melting temperature of
the duplex will have a much higher degree of transience than the
same hybridization reaction carried out at 5.degree. C. below the
melting temperature of the probe. Generally, the higher the
temperature is above the thermal melting temperature of the nucleic
acid duplex, the more unstable or transient the duplex is.
[0081] "Transient hybridization ligation" or "THL" is a ligation
process used to extend a stable duplex on a nucleic acid template
at temperatures that are above the thermal melting temperatures of
the extending probe. Template-dependant extension of the stable
duplex proceeds by ligating the transiently hybridized probe (e.g.,
a terminal probe or nested probe). Under these conditions,
promiscuous ligation side reactions between the extending probes
are suppressed, reducing background detection events and improving
assay performance. Generally, THL is performed at temperature
greater than the Tm of the hybridizing probe.
[0082] "Xpandomer" or "Xpandomer product" is a synthetic molecular
construct produced by expansion of a constrained Xpandomer (an
Xpandomer prior to cleavage of the selectively cleavable bond),
which is itself synthesized by template-directed assembly of
substrate constructs. The Xpandomer is elongated relative to the
target template it was produced from. It is composed of a
concatenation of subunits, each subunit a motif, each motif a
member of a library, comprising sequence information, a tether and
optionally, a portion, or all of the substrate, all of which are
derived from the formative substrate construct. The Xpandomer is
designed to expand to be longer than the target template thereby
lowering the linear density of the sequence information of the
target template along its length. Xpandomers comprise reporter
constructs which comprise all the sequence information of the
Xpandomer. In addition, the Xpandomer optionally provides a
platform for increasing the size and abundance of reporters which
in turn improves signal to noise for detection. Lower linear
information density and stronger signals increase the resolution
and reduce sensitivity requirements to detect and decode the
sequence of the template strand (U.S. Pat. No. 7,939,259).
[0083] "Xprobe" is an expandable oligomeric substrate construct.
Each Xprobe has a probe member and a tether member. The tether
member generally having one or more reporter constructs Xprobes
with 5'-monophosphate modifications are compatible with enzymatic
ligation-based methods for Xpandomer synthesis. Xprobes with 5' and
3' linker modifications are compatible with chemical ligation-based
methods for Xpandomer synthesis. Xprobes have a selectively
cleavable bond that enables expansion (U.S. Pat. No.
7,939,259).
[0084] In general terms, methods, corresponding devices and
products are disclosed for rapid and accurate identification of
target nucleic acid sequences within a sample mixture that may
include nucleic acids or other biomarkers of interest. For example,
in one embodiment the disclosed methods may be used for detection,
identification and quantification of bio-threat agents. In another
embodiment, the disclosed methods may be used for detection,
identification and quantification of an infective agent in a
patient sample. In another embodiment, the disclosed methods may be
used for diagnostic and therapeutic applications related to cancer,
autoimmune diseases, obesity and the like, including associated
drug efficacy and toxicity assessment.
[0085] Such rapid and accurate methods for detection of biomarkers
allow for treatment and/or corrective action on a timescale not
obtainable when more traditional means of identification are
employed. For example, the ligation approach disclosed herein
provides for high specificity, as well as run times of less than 15
minutes. In addition, the disclosed methods allow for single
molecule detection of less than 1000 target copies without the need
for PCR amplification. The sensitivity can be further enhanced by
using multiple probe targets for each genomic target and by making
multiple Target Identifiers from each target template with thermal
cycling (linear amplification). Additionally, the high multiplexing
capability of simultaneously interrogating a sample for thousands
of different possible pathogens decreases cost-per-pathogen tested
and reduces sampling requirements. Furthermore, the tests are
extendable by simply adding new probes to the libraries in an
ongoing basis as necessary or useful.
[0086] In addition to high sensitivity and speed, the methods are
extendable by integration of sequence by expansion methods (SBX)
(U.S. Pat. No. 7,939,259). Because the methods are solution-based
with total waste reagent of <1.0 ml/run they are amendable to
compact, portable (e.g., handheld) analysis. Furthermore,
hybridization and ligation methods are configurable to be highly
specific. Single molecule measurement can provide thousands of
biomarker identifiers/minute making the assays robust and
redundant. These and other related advantages are apparent in
reference to the following discussion.
[0087] In one embodiment, a method for identifying a target nucleic
acid sequence in a sample is disclosed. The method comprises
contacting the sample with a capture probe and a first terminal
probe under conditions that provide for selective hybridization of
the capture probe to a first portion of the target nucleic acid
sequence, and transient hybridization of the first terminal probe
to a second portion of the target nucleic acid sequence adjacent to
the first portion of the target nucleic acid sequence; ligating the
capture probe and the first terminal probe to form a target
identifier; and detecting the target identifier and thereby
identifying the target nucleic acid sequence in the sample. The
target nucleic acid sequence may be derived from a pathogen, and
detecting the target identifier identifies the pathogen.
[0088] In another embodiment, the method comprises identifying a
target nucleic acid sequence in a sample by contacting the target
nucleic acid sequence with a capture probe under conditions that
provide for selective hybridization of the capture probe to a first
portion of the target nucleic acid sequence, wherein the capture
probe comprises a reporter tether and a probe complementary to the
first portion of the target nucleic acid sequence; ligating a
terminal probe to the capture probe under conditions that provide
for transient hydridization of the terminal probe to a second
portion of the target nucleic acid sequence adjacent to the first
portion of the target nucleic acid sequence to form a target
identifier, wherein the terminal probe comprises a reporter tether
and a probe complementary to the second portion of the target
nucleic acid sequence; and detecting the target identifier and
thereby identifying the target nucleic acid sequence in the
sample.
[0089] The probe of the capture probe may comprise from 10 to 100
nucleobases. The capture probe may be tethered to a solid support
by a linker (e.g., selectively cleavable linker), or comprises a
linker (e.g., reversible linker) for tethering to a solid support.
The reporter tether of the capture probe may comprise a reporter
code that, upon detection, parses the genetic information of the
first portion of the target nucleic acid sequence to which the
probe of the capture probe is complementary.
[0090] The probe of the terminal probe may comprise from 3 to 8
nucleobases. The terminal probe may be tethered to a solid support
by a linker (e.g., selectively cleavable linker), or comprises a
linker (e.g., reversible linker) for tethering to a solid support.
The reporter tether of the terminal probe may comprise a reporter
code that, upon detection, parses the genetic information of the
second portion of the target nucleic acid sequence to which the
probe of the terminal probe is complementary.
[0091] The target nucleic acid sequence may be contacted with a
plurality of capture probes, wherein the probe of each capture
probe is complementary to a different target nucleic acid sequence.
The plurality of capture probes may be greater than 10, greater
than 100, or greater than 1000.
[0092] The step of ligating the terminal probe to the capture probe
may comprise exposing the second portion of the target nucleic acid
sequence to a plurality of terminal probes having probes with
different combinations of nucleobases. The plurality of terminal
probes having probes with different combinations of nucleobases may
be greater than 10, greater than 50, greater than 100, greater than
200, or greater than 1000.
[0093] The method may further comprise at least one step of
capturing, washing and concentrating the target identifier prior to
detection. The step of detecting may be accomplished by
translocating the target identifier through a nanopore. The target
identifier may be amplified prior to detection by, for example,
polymerase chain reaction (PCR) or by thermal cycling.
[0094] FIGS. 1 and 2 depict one embodiment of the disclosed methods
and related products. In this embodiment, the method employs two
labeled oligonucleotide probes, the capture probe (110) and the
terminal probe (120), to produce a single-molecule identifier
specific to a target template (115) called the target identifier
(130). In the presence of a target nucleic acid having a unique
target template (e.g., a virulence factor of a target pathogen),
probe (126) of capture probe (110) selectively hybridizes on the
target template (115) to form a stable duplex (referred to herein
as selective hybridization). Next, probe (127) of terminal probe
(120) transiently hybridizes to the template adjacent to the
capture probe and is enzymatically ligated via ligase (160) to form
a measurable product called a target identifier (130). Only if a
target template is present in the test sample will the capture
probe and terminal probe form a target identifier, thus confirming
the presence of the target nucleic acid.
[0095] As illustrated in FIGS. 1 and 2, both the capture probe
(110) and the terminal probe (120) have reporters, depicted as
discrete units (111). The reporters encode reporter codes along
their respective reporter tethers (131, 121) (i.e., a capture probe
reporter code and a terminal probe reporter code). When the capture
probe and terminal probe are ligated their respective reporter
codes combine to comprise the target identifier reporter code which
uniquely identifies the targeted template. In this embodiment, the
capture probe is tethered to a magnetic bead (180) by a cleavable
linker (182). This is used to wash and purify the target
identifier. Next the beads, which may have multiple capture probes
linked thereto, are cleaved and the purification product is
purified a second time using the reversible linker (184), such as a
T-linker, with a second magnetic bead (186) (shown in FIG. 2)
having the appropriate linker receptor (187). In this second
purification only the target identifier will link to the bead and
be selected. This double purification strategy helps reduce
detector background events and to concentrate the target
identifiers. The final step in this embodiment, depicted in FIG. 2,
shows a target identifier passing through a Coulter-like nanopore
detector (190). Impedance-based reporters positioned serially along
the target identifier are identified as they pass through the
nanopore. This series of identities is the target identifier
reporter code and is used to identify the target template.
[0096] In some embodiments, each capture probe comprises an
oligomer probe (10 to 100 bases), a reporter tether and a T-linker,
and each terminal probe comprises an oligomer probe (3 to 8 bases),
a reporter tether and a second T-linker. The reporter tethers are
attached distal to the ligating end of the capture probe and
terminal probe (via a base modification) and comprise a serial
string of reporters, each of which is designed for measurement in
the detector construct. The T-linkers are designed to provide
attachments for a first and a second serial purification, each
purification selecting for product that is comprised of one of the
T-linkers. After both purifications only the product that comprises
both T-linkers is recovered (i.e., the process selects for only
target identifiers).
[0097] The oligomer portion of the terminal probe is shorter than
that of the capture probe and has a thermal melt temperature (Tm)
below the temperature (T) at which the ligation is performed. This
T-Tm differential suppresses promiscuous priming by the terminal
probe and preferentially ligates to the hybridized capture probe is
the dominant ligation product (target identifier). This type of
ligation is called Transient Hybridization Ligation (THL). Under
THL conditions, a terminal probe that is complementary to the
template will not form a stable duplex, but will hybridize
transiently and (with ligase) will selectively ligate to extend the
stable duplex. THL suppresses promiscuous ligation side reactions
that lead to undesirable background, but also promotes higher
fidelity ligation. THL may be performed where T-Tm is >1.degree.
C. or >5.degree. C. or >20.degree. C.
[0098] In some embodiments, the reporter tether for the terminal
probe can be a simple label to identify the target identifier as
ligated, or it can carry additional sequence information to provide
variant information. For example, in some further embodiments, a
single capture probe can be ligated to two terminal probes (and
thus two different reporter codes) in a target dependant manner. As
such the target identifier product informs on the identity of two
distinct loci. Alternatively, in another embodiment all 256
tetramer terminal probes (with all possible 4-base combinations)
are used with each capture probe to identify all possible 4-mer
variants in the ligated portion of the target identifier.
[0099] In some other embodiments, each reporter has a minimum of
two states for encoding the base sequence information or an
identification number. For example, three 4-state reporters encode
for a three-base probe sequence. In still another example, six
4-state reporters encode for 4096 identification numbers. Parity or
error correction information may also be encoded in the reporters.
For example, in one specific embodiment, 9 binary-state reporters
encode a 4 base sequence (2 bits/base) of the associated probe and
use the last reporter to encode parity of the previous 8 bits to
improve detection read fidelity. In other embodiments, the code
directionality is indicated to eliminate the read direction
ambiguity. For example, probe reporter codes can be designed so
when they combine to form the target identifier reporter code,
there is always a low state at the start of the code and a high
state at the end of the code, thus providing the correct direction
to read.
[0100] In an N-multiplexed assay, there are N biomarker targets
that are simultaneously detected for by detecting for N unique
target identifiers. The target identifier reporter code is
generally comprised of at least 2 or more reporter code portions
that are contributed by the constituent probes. In some embodiments
of an N-multiplexed assay, each of the N target identifiers is
formed by ligating one of N unique capture probes and one of N
unique terminal probes. The reporter codes associated with each
probe can be selected to get an unambiguous detection, but may
provide different levels of functionality. For example, a robust
approach may use N capture probe reporter codes and N terminal
probe reporter codes. These produce N.sup.2 possible combinations
for the target identifier reporter codes of which only N are used.
This provides additional stringency for reducing false positives.
Alternatively N capture probe reporter codes may be used with a
single reporter code associated with all N terminal probes to
indicate a successful ligation occurred. In still other examples a
combinatorial approach may be used whereby the same reporter code
may be associated with different capture probes (or different
terminal probes). In this case, multiple possible ligation products
may have the same code. In other embodiments, multiple target
identifiers may share the same capture probe or the same terminal
probe and thus portions of their reporter codes are the same
[0101] For multiplexed assays, probe libraries can be constructed
that will ligate to form any of N unique target identifiers in the
presence of any of N nucleic acid targets (or any combination
thereof). Capture probe libraries may have >10 unique probes, or
may have >100 unique probes, or even >1000 unique probes.
Terminal probe libraries may have >10 unique probes, or may have
>50 unique probes or may have >100 unique probes, or even
>250 unique probes. These target identifiers are purified
(optional) and detected to identify and quantify these targets. In
some embodiments, multiplexed assays will target N>10 nucleic
acid biomarkers. In some embodiments, multiplexed assays will
target N>100 nucleic acid biomarkers. In some embodiments,
multiplexed assays will target N>1,000 nucleic acid biomarkers.
In other embodiments, multiplexed assays will target N>10,000
nucleic acid biomarkers.
[0102] One exemplary method for detection of the target identifier
reporter code is the Coulter-like nanopore process illustrated in
FIG. 3. Reporters (311) of sufficient size are readily detected and
discriminated in solid-state nanopore (330). The nanopore connects
two reservoirs that are filled with an aqueous electrolyte
solution, typically 1 molar KCl (not shown). A potential is applied
between Ag/AgCl electrodes located in each reservoir and a current
flows through the nanopore. Typically, the target identifier probe
has a negative charge density along its length, and is drawn into
and pulled through (translocated) the nanopore by electrophoretic
forces. The nanopore current is modulated by whatever portion of
the target identifier probe that lies within the nanopore channel.
Each reporter type has a unique molecular structure based upon size
and/or charge distribution. As each reporter passes through the
nanopore, its molecular characteristics alter the current amplitude
so the associated reporter identity can be determined. For example,
the reporters depicted in FIG. 3 produce 3 of 4 possible
current-blocking amplitude levels, each one identifying a different
base (313). By capturing this current signal, the sequence
information encoded in the Target Identifier reporter code is
decoded. Other methods for single-molecule detection and
presentation of probes and reporters are disclosed in WO
2008/157696, WO 2009/055617 and PCT/US10/22654 which are hereby
incorporated in their entireties.
[0103] Accordingly, after purification, target identifiers may be
translocated through a nanopore detector which simultaneously
quantifies and identifies the spectrum of nucleic acid targets
present in a sample based upon a large library of possible targets.
In this manner, the reporter code is determined and the genetic
sequence of the target template identified. The nanopore detector
is capable of single molecule detection of target identifier
molecules at rates in excess of 1,000 identifiers/min. Thus, with
suitable sample input volume, the detection method identifies low
copy number nucleic acid biomarkers without the use of PCR.
[0104] Nanopore reporters are molecular constructs designed to
create high signal-to-noise current blockages as they translocate
through a nanopore. In general, the type (e.g. level of impedance)
and positioning (sequential order) of the reporters on the reporter
tether determines the identity (i.e., sequence) of the associated
probe. In one embodiment, a string of twenty, 2-level reporters
provides 20-bits of information and can be used to encode >1
million unique identifiers. In other embodiments, encoding
techniques of the telecommunications industry such as matched
filters, parity, and CRC codes are used for robust, low-error
decryption.
[0105] The nanopore detector depicted in FIG. 4 is capable of
single-molecule detection and has no fundamental sensitivity
limitation. Practically, it is limited by efficiency of guiding the
target identifiers into the nanopore. However, in some embodiments,
the target identifier is concentrated appropriately such that the
nanopore can detect <1000 copies of a target with no PCR
pre-amplification. To achieve this level of sensitivity the target
identifier sample is confined to a small volume in the nanopore
sample input reservoir. For example, in a further embodiment
picoliter input reservoirs integrated within each nanopore chip are
employed.
[0106] Another method of increasing sensitivity and mitigating
losses of the target identifiers, such as nonspecific absorption,
is to use molecular amplification. Direct PCR amplification of the
target sample is limited by the level of multiplexing that can be
used due to the amplification bias that skews product populations.
However, single molecule detection can eliminate the need for
amplification or, in some embodiments, reduce amplification
requirements by orders of magnitude, making amplification methods
practical. Also important, amplification techniques disclosed here
are amenable to high multiplexing.
[0107] In some embodiments, the target identifiers are linearly
amplified by thermal cycling the ligation reaction between the THL
temperature and the melting temperature of the target Identifier to
denature it from its template complement. This process is a linear
amplification of target identifier provided the ligation products
are at low concentration relative to the probe reactants and do not
significantly interfere with the ongoing ligation.
[0108] In other embodiments, PCR amplification is performed after
the target identifier has been produced and purified. In this case,
the target identifiers are designed to be contiguous,
single-stranded nucleic acid, thus enabling amplification with
polymerase. Since the amplicons are nucleic acids, reporters that
utilize this amplification strategy are typically encoded using
specific nucleotide sequences. The sequences may themselves be the
reporter and thus require no further modification prior to
measurement or they may be duplexed with complementary probes that
are functionalized with sequence specific reporters. The PCR
reaction may be either a linear amplification (using a primer
specific to only one end of the target identifier) or an
exponential amplification (using primers specific to both ends of
the target identifier). Amplification of the purified target
identifier products can be multiplexed to a very high degree with
no significant bias because the reporters and primers are universal
structures that comprise most of the amplicon. In some embodiments
multiplex amplification of >100 unique target identifiers is
provided. In some embodiments multiplex amplification of >1,000
unique target identifiers is provided. In some embodiments
multiplex amplification of >10,000 unique target identifiers is
provided.
[0109] FIG. 5 is a time trace that records the current measurement
caused by a synthetic 13-peak, 2-state reporter tether passing
through a solid-state nanopore. This was recorded with a 100 kHz
bandwidth filter on an Axopatch 200B amplifier, and demonstrates
reporter resolution <25 .mu.s/reporter. The tether has a ds-DNA
backbone with reporters spaced at 600 base intervals. Within each
interval, 210 bases have short side-chain oligomers attached at
every 10 bases. Alternating reporters have side-chain lengths of 10
and 20 bases that result in two peak heights. Note that using
thirteen 2-state reporters provides for >8000 (2.sup.13)
possible identification codes.
[0110] In some embodiments the target identifier has two reversibly
and selectively linkable T-linkers and is purified with the
following method. In a first purification the first T-linker of the
target identifier is linked to a magnetic bead or other solid
substrate and the beads are washed to remove unbound products.
These products, including the target identifiers, are then
released. In a second purification the second T-linker of the
target identifier is linked to a second magnetic bead type or a
second other solid substrate and a second wash step is applied.
This purified product is then released for detection. Only products
that comprise both the first and second T-linkers are selected. By
design this selects for only the target identifiers.
[0111] In some embodiments, post-ligation purification of the
target identifier is simplified by tethering the distal end of the
capture probe to a magnetic bead via a selectively cleavable linker
(e.g., T-linker), such as an acid labile phosphoramidate or a
photolabile nitrobenzyl. In other embodiments, the distal end of
the capture probe is tethered to a solid support via a selectively
cleavable linker. Capture and washing of magnetic beads is
performed post ligation to remove unligated terminal probe (as well
as all other reaction components).
[0112] In some other embodiments, the reversible linker of the
terminal probe is used as a second purification step to select the
ligated target identifier from the unligated capture probe after
cleaving from the magnetic beads. One example of a reversible
linker is a polydeoxyAdenosine oligonucleotide of >20 bases.
Using a second set of magnetic beads functionalized with
polydeoxyThymidine oligonucleotides of >20 bases), the target
identifiers are selectively captured, washed, and eluted into the
electrolyte detection buffer as a highly purified and concentrated
sample.
[0113] An important criterion of nucleic acid target identification
is to minimize false positive readings. Ideally, a unique target
template will produce target identifiers that form fully
complementary basepairs with the target nucleic acid. By reducing
the probability of mismatched basepairs and increasing the number
of basepairs that are matched, the number of false positive
measurements is reduced. Methods are used to promote such high
fidelity detection. Capture probes are duplexed to the target
templates below but near their thermal melt temperatures so as to
destabilize duplexes with any mismatches. Ligase suppresses
ligation of any oligomers having base mismatches with the template
near the ligated nick (generally within 5 bases biased to the 3'
side of the nick). Ligation under THL conditions increases this
stringency, thus reducing ligation to probes with basepair
mismatches. By using more than one ligation event to form the
target identifier further increases the fidelity of the duplex
matching by effectively increasing the number of basepairs that are
positioned near a ligation. Using a full library of terminal probes
(e.g., 256 4-base probes), or Xprobes as described below, reduces
mismatches because when a correct match is preferentially ligated,
it eliminates the opportunity for a mismatched probe to ligate.
This is a competitive ligation which preferentially selects for the
complementary probe. FIG. 6 shows high specificity when ligating
base-modified probes using transient ligation in a competitive
ligation with a library of sixteen base-modified ti-mer probes.
[0114] In particular, FIG. 6 is a gel electrophoresis image showing
the results of 16 competitive THL reactions using a 96-base
template. The template provides a single specific hybridization
point for each of 16 different hexamer probes. Specificity of one
of these constituent hexamers was tested in each of 16 THL
reactions. For each reaction, 15 phosphorylated hexamer probes are
used along with one non-phosphorylated hexamer probe. If ligated,
the non-phosphorylated probe will terminate any further ligation.
Thus, only non-specific ligation (of phosphorylated probes) will
produce longer ligation products (than the terminated ligation
product). In each of the 16 reaction lanes shown in FIG. 6, no
measurable longer products were observed. This established a
specificity bound >99% for this experimental setup.
[0115] Ligation blocking methods, such as unphosphorylated 5' probe
termini demonstrated in the FIG. 6 reactions, are employed to
reduce undersired side reaction products and to increase efficacy.
3' probe termini may also be blocked by conjugating it to a
non-ligatable group (e.g., PEG or amine).
[0116] In general, the probe portions of both the capture probe and
the terminal probe are blocked on the ends distal to the ligation
site. During sample preparation, template termini may be blocked as
well as any other 3' or 5' nucleic acid termini that are not
participating in the preferred ligations.
[0117] The statistics of single molecule measurements provides a
further technique in reducing false positives. Each target
identifier measurement is independent and the identification of
pathogens is through assessment of hundreds or thousands of
measured target identifiers that provide a statistical basis for
ignoring outliers and quantifying highly repeated reaction
products.
[0118] In another embodiment, the method comprises identifying a
target nucleic acid sequence in a sample by contacting the target
nucleic acid sequence with a capture probe under conditions that
provide for selective hybridization of the capture probe to a first
portion of the target nucleic acid sequence, wherein the capture
probe comprises a probe complementary to the first portion of the
target nucleic acid sequence; ligating a first terminal probe to
the capture probe under conditions that provide for transient
hydridization of the first terminal probe to a second portion of
the target nucleic acid sequence adjacent to the first portion of
the target nucleic acid sequence, wherein the first terminal probe
comprises a reporter tether and a probe complementary to the second
portion of the target nucleic acid sequence; ligating a second
terminal probe to the capture probe under conditions that provide
for transient hydridization of the second terminal probe to a third
portion of the target nucleic acid sequence located adjacent to the
first portion of the target nucleic acid sequence, but at the
opposite end of the probe of the capture probe from the second
portion of target nucleic acid sequence, to form a target
identifier, wherein the second terminal probe comprises a reporter
tether and a probe complementary to the third portion of the target
nucleic acid sequence; and detecting the target identifier and
thereby identifying the target nucleic acid sequence in the
sample.
[0119] The probe of the capture probe may comprise from 10 to 100
nucleobases. The capture probe may be tethered to a solid support
by a linker (e.g., selectively cleavable linker), or comprises a
linker (e.g., reversible linker) for tethering to a solid
support.
[0120] The probe of the first and second terminal probes may
comprise from 3 to 8 nucleobases. The first and second terminal
probes may be tethered to a solid support by a linker (e.g.,
selectively cleavable linker), or comprises a linker (e.g.,
reversible linker) for tethering to a solid support. The reporter
tether of the first and second terminal probes may comprise a
reporter code that, upon detection, parses the genetic information
of the second and third portion, respectively, of the target
nucleic acid sequence to which the probe of the first and second
terminal probes are complementary.
[0121] The target nucleic acid sequence may contact with a
plurality of capture probes, wherein the probe of each capture
probe is complementary to a different target nucleic acid sequence.
The plurality of capture probes may be greater than 10, greater
than 100, or greater than 1000.
[0122] The step of ligating the first and second terminal probes to
the capture probe may comprise exposing the second and third
portions of the target nucleic acid sequence to a plurality of
terminal probes having probes with different combinations of
nucleobases. The plurality of first and second terminal probes
having probes with different combinations of nucleobases may be
greater than 10, greater than 50, greater than 100, greater than
200, or greater than 1000.
[0123] The method may further comprise at least one step of
capturing, washing and concentrating the target identifier prior to
detection. The step of detecting may be accomplished by
translocating the target identifier through a nanopore. The target
identifier may be amplified prior to detection by, for example,
polymerase chain reaction (PCR) or by thermal cycling.
[0124] FIG. 7 shows a single capture probe (710), having no
reporter tether, hybridized to the target template (705). Each end
of the capture probe is extended by THL utilizing ligase (700),
with a 3' extending terminal probe (720) and a 5' extending
terminal probe (730) to form a target identifier (750). The
reporter code of the target identifier product is a concatenation
of the two terminal probe reporter codes.
[0125] In some embodiments the capture probe is blocked on one end
of the probe to limit ligation to a preferred direction. For
example, the capture probe may have the phosphate removed on the 5'
end to allow ligation only from its 3' terminus.
[0126] In another embodiment, the method comprises identifying a
target nucleic acid sequence in a sample by contacting the target
nucleic acid sequence with a capture probe under conditions that
provide for selective hybridization of the capture probe to a first
portion of the target nucleic acid sequence, wherein the capture
probe comprises a reporter tether and a probe complementary to the
first portion of the target nucleic acid sequence; ligating one or
more nested probes to the capture probe under conditions that
provide for transient hydridization of the one or more nested
probes to a second portion of the target nucleic acid sequence
adjacent to the first portion of the target nucleic acid sequence,
wherein the one or more nested probes comprise probes complementary
to the second portion of the target nucleic acid sequence, and
wherein the one or more nested probes optionally comprise a
reporter tether; ligating a terminal probe to the one or more
nested probes under conditions that provide for transient
hydridization of the terminal probe to a third portion of the
target nucleic acid sequence adjacent to the second portion of the
target nucleic acid sequence to form a target identifier, wherein
the terminal probe comprises a reporter tether and a probe
complementary to the third portion of the target nucleic acid
sequence; and detecting the target identifier and thereby
identifying the target nucleic acid sequence in the sample.
[0127] The probe of the capture probe may comprise from 10 to 100
nucleobases. The capture probe may be tethered to a solid support
by a linker (e.g., selectively cleavable linker), or comprises a
linker (e.g., reversible linker) for tethering to a solid support.
The reporter tether of the capture probe comprises a reporter code
that, upon detection, parses the genetic information of the first
portion of the target nucleic acid sequence to which the probe of
the capture probe is complementary.
[0128] The probes of the one or more nested probes may comprise
from 3 to 8 nucleobases. The one ore more nested probes may
comprise a reporter tether. The reporter tether of the one or more
nested probes may comprise a reporter code that, upon detection,
parses the genetic information of the second portion of the target
nucleic acid sequence to which the probes of the one or more nested
probes are complementary. The reporter tether of the one or more
nested probes may be in the form of a loop, and the method further
comprises the step of opening the loop, prior to detection, to
yield the reporter tether in linear form.
[0129] The probe of the terminal probe may comprise from 3 to 8
nucleobases. The terminal probe may be tethered to a solid support
by a linker (e.g., selectively cleavable linker), or comprises a
linker (e.g., reversible linker) for tethering to a solid support.
The reporter tether of the terminal probe may comprise a reporter
code that, upon detection, parses the genetic information of the
third portion of the target nucleic acid sequence to which the
probe of the terminal probe is complementary.
[0130] The target nucleic acid sequence may be contacted with a
plurality of capture probes, wherein the probe of each capture
probe is complementary to a different target nucleic acid sequence.
The plurality of capture probes may be greater than 10, greater
than 100, or greater than 1000.
[0131] The step of ligating the terminal probe to the one or more
nested probes may comprise exposing the third portion of the target
nucleic acid sequence to a plurality of terminal probes having
probes with different combinations of nucleobases. The plurality of
terminal probes having probes with different combinations of
nucleobases may be greater than 10, greater than 50, greater than
100, greater than 200, or greater than 1000.
[0132] The method may further comprise at least one step of
capturing, washing and concentrating the target identifier prior to
detection. The step of detecting may be accomplished by
translocating the target identifier through a nanopore. The target
identifier may be amplified prior to detection by, for example,
polymerase chain reaction (PCR) or by thermal cycling.
[0133] One or more nested probes can be used to increase the
specificity of the target identifier to improve nucleic acid target
identification. In the embodiment shown in FIG. 8, the nested probe
is a short probe with no reporter tether. The nested probe (801) is
ligated via ligase (805) to a capture probe (830) having reporter
tether (831), followed by ligation of the nested probe (801) to a
terminal probe (840) having reporter tether (841). In some
embodiments the nested probe may be .about.3 to 8 bases long. By
limiting the libraries of these simple nested probes and the
corresponding terminal probes, only certain combinations of probes
will be complementary to the target and extend the capture probes
to produce the desired target identifier.
[0134] In another embodiment, the nested probes are Xprobes.
Xprobes are used for nucleic acid sequencing methods collectively
called sequencing by expansion (SBX) and disclosed in WO
2008/157696, WO 2009/055617 and PCT/US10/22654. In these
embodiments, one or more Xprobes are sequentially ligated by THL to
extend the capture probe. In some embodiments this capture probe
extension may be ligated (by THL) to a terminal probe. A brief
description of the Xprobe and its use in template dependant THL for
SBX follows for clarity.
[0135] One method of SBX uses building blocks called Xprobes (shown
in FIG. 9), to specifically assemble, through enzymatic ligation, a
spatially expanded representation of a target DNA sequence. This
construct, called an Xpandomer, encodes sequences with high
signal-to-noise reporters to enable high-throughput single-molecule
DNA sequencing with multiple detection technologies (e.g.,
Coulter-based nanopore detection). An Xprobe has four structural
elements; an oligomer probe, a looped tether, reporters on the
tether that encode for the probe sequence, and a cleavable linker
that is located between two probe-tether attachment points. If the
linker is cleaved, the probe separates into two portions held
together by a reporter tether.
[0136] FIG. 10 shows how Xprobes are used in a solution-based,
template-dependant ligation process to serially link Xprobes into a
product called an Xpandomer. The target identifier has similar
characteristics to that of the expanded Xpandomer product. Before
step I, DNA is fragmented and ligated with end adaptors to anneal
to a sequencing primer and the primed template strand is contacted
with a library of Xprobes and ligase (L). In Step I, conditions are
adjusted to favor hybridization followed by ligation at a free
3'-OH of the primer template duplex. This is typically a THL
reaction. In Steps II and III, the process of hybridization and
ligation (typically THL) results in extension by cumulative
addition of Xprobes extending from the primer end. These reactions
occur in free solution and proceed until a sufficient amount of
product has been synthesized. In Step IV, formation of a completed
Xpandomer intermediate is shown. In Step V, the duplex is denatured
and the Xpandomer is released. In the final step, the selectively
cleavable links on the backbone are cleaved and allow the tether
loops to "open up", forming the linearly elongated Xpandomer
product.
[0137] To read Xpandomers in a nanopore detector, they are mixed
with electrolyte and added to the nanopore input reservoir. The
Xpandomers are electrophoretically drawn into the pore. As the
reporters sequentially pass through the pore, they block the
current by an amount corresponding to the reporter type. The
sequence of blockages is then translated into sequence information.
Thus by incorporating the SBX approach into the disclosed methods
for identifying a target template, a target identifier having
enriched information content can be obtained.
[0138] FIG. 11 depicts an embodiment where a capture probe (1101)
is extended in either the 5' or 3' direction by THL utilizing
ligase (1180) of a single Xprobe (1120) and a terminal probe
(1130). The resulting product (1150) requires an additional
cleavage step that opens the looped reporter tether to produce a
target identifier having a linearized backbone (1160) so the
reporters can be detected serially. A preferred embodiment uses
full libraries of tetramer Xprobes and tetramer terminal probes
that comprise all probe base combinations (256 combinations for
each). Target identifier products have a capture probe at one end
and a terminal probe at the other, but will have a variable number
of Xprobes ligated between them. The number of nested Xprobes is a
Poisson distribution that depends upon the relative concentrations
of Xprobes to terminal probes. The lower the probability of
incorporating a terminal probe with each extension ligation the
more Xprobes are likely to be nested.
[0139] In another embodiment, the method comprises identifying a
target nucleic acid sequence in a sample by contacting the target
nucleic acid sequence with a first capture probe and a second
capture probe under conditions that provide for selective
hybridization of the first capture probe and the second capture
probe to a first portion and a second portion, respectively, of the
target nucleic acid sequence, wherein the first capture probe and
the second capture probe comprise a reporter tether and a probe
complementary to the first portion and the second portion,
respectively, of the target nucleic acid sequence; ligating one or
more nested probes to the first capture probe and the second
capture probe under conditions that provide for transient
hydridization of the one or more nested probes to a portion of the
target nucleic acid sequence located between the first and second
portions of the target nucleic acid sequence to form a target
identifier, wherein the one or more nested probes comprise probes
complementary to the nucleic acid sequence located between the
first and second portions of the target nucleic acid sequence, and
wherein the one or more nested probes optionally comprise a
reporter tether; and detecting the target identifier and thereby
identifying the target nucleic acid sequence in the sample.
[0140] The probes of the first capture probe and second capture
probe may comprise from 10 to 100 nucleobases. The first capture
probe and second capture probe may be tethered to a solid support
by a linker (e.g., selectively cleavable linker), or comprises a
linker (e.g., reversible linker) for tethering to a solid support.
The reporter tether of the first capture probe and second capture
probe may comprise a reporter code that, upon detection, parses the
genetic information of the first portion and the second portion,
respectively, of the target nucleic acid sequence to which the
probe of the first capture probe and probe of the second capture
probe are complementary.
[0141] The probes of the one or more nested probes may comprise
from 3 to 8 nucleobases. The one or more nested probes may comprise
a reporter tether. The reporter tether of the one or more nested
probes may comprise a reporter code that, upon detection, parses
the genetic information of the portion of the target nucleic acid
sequence located between the first and second portions of the
target nucleic acid sequence to which the probes of the one or more
nested probes are complementary. The reporter tether of the one or
more nested probes may be in the form of a loop, and the method
further comprises the step of opening the loop, prior to detection,
to yield the reporter tether in linear form.
[0142] The target nucleic acid sequence may be contacted with a
plurality of the first and second capture probes, wherein the probe
of each of the plurality of first and second capture probe is
complementary to a different target nucleic acid sequence. The
plurality of the first and second capture probes may be greater
than 10, greater than 100, or greater than 1000.
[0143] FIG. 12 depicts an embodiment that uses two capture probes
that have tethers with T-linkers, but no reporters (1210, 1220). In
this embodiment, the capture probes are hybridized to two
complementary portions of the target template between which an
8-base gap forms. Two 4-base Xprobes (1230, 1240) transiently
hybridize in the gap and link to the capture probes and to each
other by THL with ligase (1225) to form a target identifier (1280)
specific to the target template. As with other embodiments with
Xprobes, a cleavage step is then employed to open the two looped
reporter tethers and produce a target identifier sequence of
reporters along a linearized backbone (1290). In other embodiments,
target identifiers can be formed with >2 Xprobes by filling gaps
with corresponding number of bases. One embodiment uses a full
Xprobe library of 256 tetramer probe base combinations.
[0144] Tethers are generally resistant to entanglement or are
folded so as to be compact. Polyethylene glycol (PEG), polyethylene
oxide (PEO), methoxypolyethylene glycol (mPEG), and a wide variety
of similarly constructed PEG derivatives (PEGs) are broadly
available polymers that can be utilized in the practice of this
invention. Modified PEGs are available with a variety of
bifunctional and heterobifunctional end crosslinkers and are
synthesized in a broad range of lengths. PEGs are generally soluble
in water, methanol, benzene, dichloromethane, and many common
organic solvents. PEGs are generally flexible polymers that
typically do not non-specifically interact with biological
chemicals.
[0145] Other polymers that may be employed as tethers, and provide
"scaffolding" for reporters, include, for example, poly-glycine,
poly-proline, poly-hydroxyproline, poly-cysteine, poly-serine,
poly-aspartic acid, poly-glutamic acid, and the like. Side chain
functionalities can be used to build functional group-rich
scaffolds for added signal capacity or complexity.
[0146] T-linkers are typically on the distal end of the reporter
tethers of capture probes and terminal probes. A T-linker is
generally coupled with a T-linker receptor to complete the linkage
to the solid substrate (e.g. bead). In some cases the T-linker is
cleaved (to uncouple from the solid substrate) leaving T-linker
residues on the product ends. A T-linker is used for purifying and
concentrating target identifiers and includes selectively cleavable
linkers and selectively linkable linkers. Selectively cleavable
linkers are described below. Selectively linkable linkers include a
variety of covalent chemical linkers, biological linker pairs and
combinations thereof. A preferred T-linker is an oligomer (10 to 50
bases) that will selectively hybridize (couple) to its
complementary oligomer (T-linker receptor).
[0147] In some embodiments, the selectively cleavable linker may be
a covalent bond. A broad range of suitable commercially available
chemistries (Pierce, Thermo Fisher Scientific, USA) can be adapted
for preparation of the probes comprising selectively cleavable
linker bonds. Common linker chemistries include, for example,
NHS-esters with amines, maleimides with sulfhydryls, imidoesters
with amines, EDC with carboxyls for reactions with amines, pyridyl
disulfides with sulfhydryls, and the like. Other embodiments
involve the use of functional groups like hydrazide (HZ) and
4-formylbenzoate (4FB) which can then be further reacted to form
linkages. More specifically, a wide range of crosslinkers (hetero-
and homo-bifunctional) are broadly available (Pierce) which
include, but are not limited to, Sulfo-SMCC (Sulfosuccinimidyl
4-[N-maleimidomethyl]cyclohexane-1-carboxylate), SIA
(N-Succinimidyl iodoacetate), Sulfo-EMCS
([N-e-Maleimidocaproyloxy]sulfosuccinimide ester), Sulfo-GMBS
(N-[g-Maleimido butyryloxy]sulfosuccinimide ester), AMAS
N-(a-Maleimidoacetoxy) succinimide ester), BMPS (N EMCA
(N-e-Maleimidocaproic acid)-[.beta.-Maleimidopropyloxy]succinimide
ester), EDC (1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide
Hydrochloride), SANPAH
(N-Succinimidyl-6-[4'-azido-2'-nitrophenylamino]hexanoate), SADP
(N-Succinimidyl(4-azidophenyl)-1,3''-dithiopropionate), PMPI
(N-[p-Maleimidophenyl]isocy, BMPH (N-[.beta.-Maleimidopropionic
acid]hydrazide, trifluoroacetic acid salt)anate), EMCH
([N-e-Maleimidocaproic acid]hydrazide, trifluoroacetic acid salt),
SANH (succinimidyl 4-hydrazinonicotinate acetone hydrazone), SHTH
(succinimidyl 4-hydrazidoterephthalate hydrochloride), and C6-SFB
(C6-succinimidyl 4-formylbenzoate). Also, the method disclosed by
Letsinger et al. ("Phosphorothioate oligonucleotides having
modified internucleoside linkages", U.S. Pat. No. 6,242,589) can be
adapted to form phosphorothiolate linkages.
[0148] Further, well-established protection/deprotection
chemistries are broadly available for common linker moieties
(Benoiton, "Chemistry of Peptide Synthesis", CRC Press, 2005).
Amino protection include, but are not limited to, 9-Fluorenylmethyl
carbamate (Fmoc-NRR'), t-Butyl carbamate (Boc-NRR'), Benzyl
carbamate (Z-NRR', Cbz-NRR'), Acetamide Trifluoroacetamide,
Phthalimide, Benzylamine (Bn-NRR'), Triphenylmethylamine (Tr-NRR'),
and Benzylideneamine p-Toluenesulfonamide (Ts-NRR'). Carboxyl
protection include, but are not limited to, Methyl ester, t-Butyl
ester, Benzyl ester, S-t-Butyl ester, and 2-Alkyl-1,3-oxazoline.
Carbonyl include, but are not limited to, Dimethyl acetal
1,3-Dioxane, and 1,3-Dithiane N,N-Dimethylhydrazone. Hydroxyl
protection include, but are not limited to, Methoxymethyl ether
(MOM-OR), Tetrahydropyranyl ether (THP-OR), t-Butyl ether, Allyl
ether, Benzyl ether (Bn-OR), t-Butyldimethylsilyl ether (TBDMS-OR),
t-Butyldiphenylsilyl ether (TBDPS-OR), Acetic acid ester, Pivalic
acid ester, and Benzoic acid ester.
EXAMPLES
Example 1
Identification of a Target Sequence within a Mixed Nucleic Acid
Sample
[0149] Oligonucleotide sequences complementary to the capture probe
and terminal probe portions of a target template are prepared by
automated DNA synthesis. A reporter tether linked via a selectively
cleavable bond to a magnetic bead is linked to the oligonucleotide
complementary to the capture probe portion of the target template.
Similarly a terminal probe is prepared by linking a reporter tether
comprising the terminal probe reporter code and a
polydeoxyAdenosine moiety to the oligonucleotide complementary to
the terminal probe portion of the target template.
[0150] The capture probe and terminal probe are admixed with a
sample comprising ligase enzyme and a target nucleic acid having a
target template. After sufficient time for ligation, the magnetic
beads are isolated and washed. The selectively cleavable linker is
then cleaved and the magnetic beads removed by filtration. To the
filtrate is added a polydeoxyThymidine moiety which is chemically
linked to a magnetic bead. After sufficient time for hybridization
of the polydeoxyAdenosine moiety with the polydeoxyThymidine
moiety, the mixture is filtered and the magnetic beads isolated.
The purified target identifier is then isolated by denaturing the
polydeoxyAdenosine/polydeoxyThymidine duplex and filtering off the
magnetic beads.
[0151] The isolated target identifier is presented to the nanopore
detector as a concentrated solution. The reporter code is parsed
and the genetic sequence of the target template is determined. The
source of the target nucleic acid (e.g., a pathogen) is then
determined from the genetic sequence of the target template.
Example 2
Synthesis and Purification of Target Identifier
[0152] Referring to FIG. 13, to demonstrate the specificity and
efficiency of transient hybridization ligation for one embodiment,
capture probe (1310) and terminal probe (1320) specific to template
(1350) were ligated with ligase (1330) using an on-bead assay to
produce a target identifier. Capture probe (1310) and terminal
probe (1320) have reporter tethers (1315,1325, respectively), with
the reporter tethers having reporters (1370) and T-linker (1390).
Efficient purification of the target identifier was demonstrated
using magnetic beads functionalized with oligonucleotides that are
complementary to T-Linker affinity handles.
[0153] Target identifier and unligated probes were analyzed by
agarose gel electrophoresis (E-gel, 1.2% with SYBR Safe; Invitrogen
Corporation; Carlsbad, Calif.). The 11-lane gel image is shown in
FIG. 14. The capture probe (lane 2), which has a 25-base 5'
phosphorylated overhang and a 3' oligonucleotide deoxyadenosine
affinity handle distal to the ligation overhang, was simultaneously
hybridized to oligonucleotide deoxythymidine (25-mer)
functionalized magnetic beads (Dynabeads Oligo (dT)25; Invitrogen
Corporation; Carlsbad, Calif.) and each of four templates: (1)
Template.sub.--0.sub.--0 (lanes 4 and 8) was fully complementary to
both the capture probe and terminal probe overhangs; (2)
Template.sub.--0.sub.--1 (lanes 5 and 9) had a single mismatch
(A-A) at the final nucleotide of the terminal probe 3' overhang;
(3) Template.sub.--1.sub.--0 (lanes 6 and 10) had a single mismatch
(G-G) at the final nucleotide of the capture probe 5' overhang; and
(4) Template.sub.--1.sub.--1 (lanes 7 and 11) had a single mismatch
at the final nucleotide of both the terminal probe 3' overhang
(A-A) and the capture probe 5' overhang (G-G).
[0154] Capture probe, target template, and Oligo-dT magnetic beads
were admixed in 1.times. T4 DNA Ligase Buffer (Epicentre
Biotechnologies, Madison, Wis.) and allowed to hybridize. Mixture
was cooled slowly to 23.degree. C. and magnetic beads were captured
and washed to remove excess template. Beads with capture
probe/target template duplex were resuspended in ligation reaction
mix and spiked with terminal probe comprising a 5-base, 3'
overhang, a reporter tether, and a T-linker affinity handle distal
to the ligation overhang. Terminal probe size reference is run in
lane 3 (FIG. 14). Reaction mixes were heated to 37.degree. C.,
spiked with T4 DNA ligase (T4 DNA Ligase (Rapid); Enzymatics;
Beverly, Mass.) and incubated 60 minutes at 37.degree. C. Sample
included salts, buffer, and ATP as appropriate to support ligation.
Magnetic beads were washed three times with 6 to 7 volumes of a
bead binding solution of 500 mM NaCl, 10 mM Tris Buffer, 20 mM EDTA
and 1% N-lauroylsarcosine, and two times with 7 volumes of a wash
solution of 500 mM NaCl, 10 mM Tris Buffer and 20 mM EDTA, to
remove excess terminal prove and ligation reaction mix. Beads were
resuspended with water and product was eluted from the Oligo-dT
beads (lanes 4-7) by heating to 50.degree. C.
[0155] Following this purification, and as shown in FIG. 14, the
fully matched template (lane 4) facilitated .gtoreq.90%
dimerization, while all three mismatched templates (lanes 5-7)
allowed for very little ligation. These results demonstrate high
specificity at a temperature significantly higher than the melting
temperature of the terminal probe overhang.
[0156] Reactions were subsequently purified using magnetic beads
functionalized with a capture oligonucleotide (5'
AACGCACTCAATCCATCTTCAGGT 3'; 3' bead linkage) complementary to the
affinity handle on the terminal probe T-linker (5'
ACCTGAAGATGGATTGAGTGCGTT 3') to remove unligated capture probe
(lanes 8-11). Following this purification, the mismatched template
reactions (lanes 9-11) have almost no remaining monomer or dimer,
while the fully matched template reaction (lane 8) is almost
entirely in dimer form, confirming that the ligation was complete
and the dimer can be double bead-purified using T-linker affinity
handles. Lane 1 is a molecular ladder that provides size reference
confirmation of probes and ligation products, and the full-length
product is shown by arrows.
Example 3
Purification Using Oligonucleotide T-Linkers
[0157] To demonstrate the utility of T-linkers for target
identifier purification, full-length ligation products were
synthesized containing two distinct oligonucleotide T-linker
moieties, one on the 5' end and the other on the 3' end of the
construct as illustrated in FIG. 15. In particular, capture probes
(1510,1520) were selectively hybridized to template (1530). Capture
probes (1510,1520) contained a reporter tether (1550,1560), the
terminal portion of which (distal to the ligation end) were
fluorescently labeled with a fluorophore (1580,1581)
(NHS-Rhodamine; Thermo Scientific; Rockford, Ill.) to permit
detection. The gap between the two capture probes was filled using
template-dependent ligation (T4 DNA Ligase, Enzymatics Inc.,
Beverly, Mass.) to insert six basic hexamer probes (1590).
[0158] In addition to the full-length ligation product with
T-linker affinity handles on each end, a range of fluorescently
labeled truncation products were produced during the ligation
synthesis reaction. Since none of the truncation products contain
both T-linker handles, sequential purification of this test sample
using magnetic beads (functionalized with oligonucleotides
complementary to the T-linkers) should yield only the full-length
ligation product.
[0159] Oligonucleotide deoxythymidine (25-mer) functionalized
magnetic beads (1540) (Dynabeads Oligo (dT)25; Invitrogen
Corporation; Carlsbad, Calif.) were used for the first bead
purification step to specifically capture the oligonucleotide
deoxyAdenosine affinity handle on the first T-linker. Briefly, the
sample was heated to 95.degree. C. for 20 seconds in the presence
of magnetic beads (1540) and 1 volume of a bead binding solution
(BBTS) of 500 mM NaCl, 20 mM Tris Buffer, 10 mM EDTA, 1%
N-lauroylsarcosine, and 1% Tween 20. Sample was continually mixed
while cooling to room temperature, allowing the Poly A tail (1561)
of the first T-linker to specifically hybridize to the Oligo(dT)25
tethered to the magnetic beads (1564). The sample was then washed
with BBTS solution to remove non-specifically bound ligation
product. Purified sample is recovered by heat denaturation (of the
Poly dA/dT duplex), bead capture, and removal of the aqueous
fraction. The second bead purification protocol follows the same
basic process, but using magnetic beads (1542) functionalized with
a capture oligonucleotide (5' AACGCACTCAATCCATCTTCAGGT 3'; 3' bead
linkage) (1570) complementary to the affinity handle on the second
T-linker (5' ACCTGAAGATGGATTGAGTGCGTT 3') (1571).
[0160] FIG. 16 shows the gel electrophoresis image with 3 lanes:
Lane 1 shows the reaction products prior to purification; Lane 2
shows the reaction products after the 1.sup.st purification (using
the 1.sup.st T-linker); and Lane 3 shows the reaction products
after the 2.sup.nd purification (using the 2.sup.nd T-linker)
wherein all truncated ligation products were eliminated leaving
only a single band of the targeted double T-linker ligation
product. The full-length product is shown in FIG. 16 by the
arrow.
Example 4
Enhanced Target Sequence Detection Using Thermal Cycling
[0161] Referring to FIG. 17A, capture probe (1710) and terminal
probe (1720) are admixed with a sample comprising thermostable DNA
ligase enzyme (1730) and a target nucleic acid having a target
template (1740). Sample includes salts, buffer, and cofactors such
as ATP or NAD as appropriate to support ligation. Both probes are
synthesized with multiple 4-state reporters (1725) along their
reporter tethers (1760) to provide unique reporter codes. Each
probe type has a distinct oligonucleotide T-linker (1762). Capture
probe (1710) is depicted as a 15-base probe moiety, while the
terminal probe (1720) is depicted as a hexamer probe moiety.
[0162] In FIG. 17A, capture probe (1710) is shown hybridizing to
template (1740), while FIG. 17B depicts the THL of terminal probe
(1720) to template (1740), both steps being performed at 37.degree.
C. As shown in FIG. 17C, the temperature is raised and the
resulting target identifier (1780) is released from template
(1740), beginning a new cycle at depicted in Figure A. This thermal
cycling is repeated, thus amplifying the number of target
identifiers produced in the ligation reaction.
Example 5
Amplification of Target Identifier Using Polymerase
[0163] Referring to FIG. 18A, target identifier (1810) has a
contiguous single-stranded nucleic acid which include first and
second T-linkers (1832,1834), coded reporter tethers (1842,1844),
and target specific probes (1850) derived from both the capture
probe and terminal probe. As shown in FIG. 18B, target identifier
(1810) is hybridized to magnetic bead (1870) via the second
T-linker (1834). The receptor (1836) for the second T-linker (1834)
is an oligonucleotide that duplexes with the 3' terminus of the
target identifier such that the 3' end of the receptor is
extendable by polymerase (1858). The second T-linker also comprises
a selectively cleavable photolabile linker (1888). After washing
beads to remove any remaining truncated product, sample is
resuspended with a reaction mix that includes salts, buffer, and
dNTP's to support polymerase extension. Pfu high fidelity DNA
polymerase (Promega, Madison, Wis.) is added and the sample is
thermal cycled between 95.degree. C., 50.degree. C., and 72.degree.
C. to enable repeated denaturation, annealing, and polymerase
extension (represented by the circular arrows of FIG. 18), thus
providing an amplified reverse complement (1812) of target
identifier (1810) as shown in FIG. 18C. Following linear
amplification, beads are thoroughly washed to eliminate all but the
bead-bound target identifier complement. Beads are exposed to 365
nm UV source (1890) to selectively cleave photolabile linker
(1888), yielding the free target identifier complement (1812) as
shown in FIG. 18D.
Example 6
Detection of Target Identifier in a Solid-State Nanopore
[0164] FIG. 19 is a time trace that records the current measurement
caused by a 2-peak, 2-state target identifier passing through a
solid-state nanopore. This was recorded with a 100 kHz bandwidth
filter on an Axopatch 200B amplifier, and demonstrates reporter
resolution <25us/reporter. The target identifier was assembled
via THL in the manner described in Example 2 above. The tethers of
the capture and terminal probes each had a ds-DNA backbone with a
single reporter of 210 bases that have short side-chain oligomers
attached at every 10 bases. For both the capture and terminal
probes, the reporter moiety was positioned 200 bases from the
ligation site and 200 bases from the T-linker. The capture probe
and terminal probe reporters had side-chain lengths of 10 and 20
bases, respectively, that result in the two peak heights as shown
in FIG. 19.
[0165] The various embodiments described above can be combined to
provide further embodiments. All of the U.S. patents, U.S. patent
application publications, U.S. patent applications, foreign
patents, foreign patent applications and non-patent publications
referred to in this specification and/or listed in the Application
Data Sheet are incorporated herein by reference, in their entirety.
Aspects of the embodiments can be modified, if necessary to employ
concepts of the various patents, applications and publications to
provide yet further embodiments.
Sequence CWU 1
1
4124DNAArtificialCapture oligonucleotide 1aacgcactca atccatcttc
aggt 24224DNAArtificialTerminal probe T-linker oligonucleotide
2acctgaagat ggattgagtg cgtt 24324DNAArtificialCapture
Oligonucleotide 3aacgcactca atccatcttc aggt
24424DNAArtificialTerminal probe T-linker Oligonucleotide
4acctgaagat ggattgagtg cgtt 24
* * * * *