U.S. patent application number 14/169602 was filed with the patent office on 2014-05-22 for use of erbb4 as a prognostic and therapeutic marker for melanoma.
This patent application is currently assigned to The United States of America, as represented by The Secretary, Department of Health and Human Serv. The applicant listed for this patent is The United States of America, as represented by The Secretary, Department of Health and Human Serv, The United States of America, as represented by The Secretary, Department of Health and Human Serv. Invention is credited to Todd D. Prickett, Yardena R. Samuels.
Application Number | 20140141431 14/169602 |
Document ID | / |
Family ID | 41310089 |
Filed Date | 2014-05-22 |
United States Patent
Application |
20140141431 |
Kind Code |
A1 |
Samuels; Yardena R. ; et
al. |
May 22, 2014 |
USE OF ERBB4 AS A PROGNOSTIC AND THERAPEUTIC MARKER FOR
MELANOMA
Abstract
Members of the protein tyrosine kinase (PTK) family are highly
mutated in patients with melanoma. Described herein are novel
somatic mutations in the ERBB4 gene that result in increased kinase
activity, transformation ability and anchorage-independent growth.
These ERBB4 mutations contribute to the tumorogenicity of melanoma.
Provided is a method of predicting the prognosis of a patient with
melanoma by detecting the presence or absence of a mutation in the
ERBB4 gene. In some examples, the ERBB4 mutation is selected from
G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbering
based on SEQ ID NO: 1). Also provided are methods of selecting a
patient as a candidate for treatment with an ERBB4 and/or PI3K/AKT
pathway inhibitor, and a method of identifying a therapeutic agent
for the treatment of a subject diagnosed with melanoma.
Oligonucleotides that specifically hybridize with an ERBB4 nucleic
acid molecule comprising a novel mutation are also provided.
Inventors: |
Samuels; Yardena R.;
(Rehovot, IL) ; Prickett; Todd D.; (Sterling,
VA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by The Secretary,
Department of Health and Human Serv |
Bethesda |
MD |
US |
|
|
Assignee: |
The United States of America, as
represented by The Secretary, Department of Health and Human
Serv
Bethesda
MD
|
Family ID: |
41310089 |
Appl. No.: |
14/169602 |
Filed: |
January 31, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13128125 |
Jul 18, 2011 |
8652787 |
|
|
PCT/US2009/053005 |
Aug 6, 2009 |
|
|
|
14169602 |
|
|
|
|
61199156 |
Nov 12, 2008 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 2600/118 20130101;
C12Q 2600/136 20130101; C12Q 2600/112 20130101; C12Q 1/6886
20130101; A61P 35/00 20180101; C12Q 2600/106 20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of detecting a mutation in the ERBB4 gene that is
associated with a poor prognosis of a subject diagnosed with
melanoma, comprising detecting the presence of a mutation in the
ERBB4 gene in a melanoma sample from the subject, wherein the
mutation is selected from G949A, G1354A, G1624A, C1630T, G1687A,
G2506A and G2614A (numbered with reference to SEQ ID NO: 1).
2. The method of claim 1, wherein the poor prognosis is an increase
in the likelihood of death.
3. The method of claim 1, wherein the poor prognosis is an increase
in the likelihood of metastasis.
4. The method of claim 1, wherein the mutation in the ERBB4 gene
results in an increase in kinase activity of the ERBB4 protein.
5. The method of claim 1, further comprising obtaining the melanoma
sample from the subject.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a divisional of U.S. application Ser. No.
13/128,125, filed Jul. 18, 2011, which is the U.S. National Stage
of International Application No. PCT/US2009/053005, filed Aug. 6,
2009, published in English under PCT Article 21(2), which claims
the benefit of U.S. Provisional Application No. 61/199,156, filed
Nov. 12, 2008. The above-referenced applications are herein
incorporated by reference in their entirety.
FIELD
[0002] This disclosure concerns the identification of novel
mutations in members of the protein tyrosine (PTK) family,
including ERBB4, and methods of use.
BACKGROUND
[0003] The protein tyrosine kinases (PTKs) are a family of proteins
that catalyze phosphorylation of tyrosine residues in target
proteins; PTKs play important roles in cellular signaling. Within
this large family of proteins is the ERBB PTK family, which
consists of four receptor kinases, ERBB1 (EGFR1, HER1), ERBB2
(c-Neu, HER2), ERBB3 (HER3) and ERBB4 (HER4). The ERBB kinases
regulate a wide range of cellular responses, including cell
proliferation, survival, migration and differentiation. ERBB
signaling pathways are known to be altered in a wide variety of
cancers, which has led to the development of drugs to specifically
inhibit activity of members of this family (Junttila et al., Cancer
Res. 65(4):1384-1393, 2005).
[0004] ERBB4 is a protein of approximately 180 kD and is expressed
as four alternatively spliced isoforms. Previous studies of the
role of ERBB4 in cancer development and prognosis have produced
differing and sometimes contradictory results. For example,
clinical studies of breast cancer have linked ERBB4 expression to
either a favorable or adverse clinical outcome, and in vitro
studies have suggested that in breast cancer cells, ERBB4 mediates
either differentiation or tumorigenic growth (Junttila et al.,
Cancer Res. 65(4):1384-1393, 2005).
[0005] Cutaneous malignant melanoma is the most common fatal skin
cancer (Jermal et al., CA Cancer J. Clin. 156(2):106-130, 2006;
Tsao et al., N. Engl. J. of Med. 351:998-1012, 2004), and the
incidence of this disease increases each year. Patients diagnosed
with malignant melanoma have an average survival time of less than
10 months. PTKs are frequently mutated in cancer, and since they
are amenable to pharmacologic inhibition (Futreal et al., Nat. Rev.
Cancer 4:177-183, 2004; Sawyers, Nature 432:294-297, 2004), further
analysis of the PTK gene family is needed to provide insight into
melanoma pathogenesis and to identify new therapeutic strategies.
Given the known role of PTKs in human cancer, and the disparate
findings of studies of ERBB4 in cancer development, it is desirable
to further evaluate ERBB4 in patients with malignant melanoma.
SUMMARY
[0006] It is disclosed herein that members of the protein tyrosine
kinase family, including ERBB4, are highly mutated in melanoma
tumors. Analysis of several ERBB4 mutants revealed that the
mutations result in increased kinase activity of ERBB4 protein,
increased transformation ability and increased
anchorage-independent growth.
[0007] Thus, provided herein is a method of predicting the
prognosis of a subject diagnosed with melanoma, comprising
detecting the presence or absence of a mutation in the ERBB4 gene,
wherein the presence of the mutation in the ERBB4 gene predicts a
poor prognosis. In some embodiments, the ERBB4 mutation is selected
from one or more of G949A, G1354A, G1624A, C1630T, G1687A, G2506A
and G2614A (numbering based on SEQ ID NO: 1).
[0008] Also provided is a method of selecting a subject diagnosed
with melanoma as a candidate for treatment with an ERBB4 inhibitor,
a PI3K/AKT pathway inhibitor, or both, comprising detecting the
presence or absence of a mutation in the ERBB4 gene of the subject,
wherein the presence of a mutation in the ERBB4 gene indicates that
the subject is a candidate for treatment with an ERBB4 inhibitor, a
PI3K/AKT pathway inhibitor, or both. In some embodiments, the
method further includes administering to the subject an ERBB4
inhibitor, a PI3K/AKT pathway inhibitor, or both. Further provided
is a method of identifying a therapeutic agent for the treatment of
a subject diagnosed with melanoma, comprising screening candidate
agents to select an agent that decreases activity of ERBB4, or
decreases activity of the PI3K/AKT pathway, thereby identifying a
therapeutic agent for the treatment of a subject with melanoma. In
some embodiments of the methods, the ERBB4 mutation is selected
from G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A
(numbering based on SEQ ID NO: 1).
[0009] Further provided are oligonucleotides that specifically
hybridize with an ERBB4 nucleic acid molecule, wherein the ERBB4
nucleic acid molecule comprises at least one mutation selected from
G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbering
based on SEQ ID NO: 1). Also provided are arrays comprising one or
more of such ERBB4 mutant-specific oligonucleotides.
[0010] The foregoing and other features and advantages will become
more apparent from the following detailed description of several
embodiments, which proceeds with reference to the accompanying
figures.
BRIEF DESCRIPTION OF THE FIGURES
[0011] FIGS. 1A-1G: Distribution of mutations in ERBB4 and
increased basal activation of ERBB4 mutants. (FIG. 1A) Arrows
indicate the location of ERBB4 somatic mutations found in this
screen. Numbering of the ERBB4 amino acid residues is based on SEQ
ID NO: 2. Stars indicate ERBB4 mutants evaluated for increased
tyrosine kinase activity. Boxes represent functional domains (I,
extracellular domain subregion I; II, extracellular domain
subregion II; III, extracellular domain subregion III; IV,
extracellular domain subregion IV; PTK, tyrosine kinase domain).
(FIG. 1B) ERBB4 mutants have increased tyrosine phosphorylation.
HEK 293T cells were transiently transfected with the indicated
constructs. Twenty-four hours after transfection, cells were serum
starved and lysed. Shown are immunoblots of immunoprecipitated
ERBB4 probed with the indicated antibodies. Lysates were
immunoprobed with an anti .alpha.-tubulin antibody. (FIG. 1C and
FIG. 1D) ERBB4 mutants exhibit increased in vitro kinase activity.
(FIG. 1C) HEK 293T cells were transiently transfected as in (FIG.
1B). Twenty-four hours after transfection, cells were either grown
in 10% serum or serum starved and then lysed. Protein lysates were
immunoprecipitated and used in a kinase assay. (FIG. 1D) The same
samples that were used in the kinase assay were immunoblotted with
ERBB4 antibody and lysates were blotted with .alpha.-tubulin
(ns=nonspecific; KD=kinase dead). (FIG. 1E) ERBB4 mutants exhibit
increased in vitro kinase activity. HEK 293T cells were transiently
transfected as in (FIG. 1B). Equivalent amounts of protein from
cell lysates were immunoprecipitated and used in a kinase assay to
measure receptor auto-phosphorylation. The same samples that were
used in the kinase assay were immunoblotted with ERBB4 antibody and
lysates were blotted with .alpha.-tubulin. KD=kinase dead. (FIG.
1F) Increased basal activation of endogenous mutant ERBB4. Melanoma
lines that harbor either WT or mutant ERBB4 were serum starved and
then lysed, immunoprecipitated for ERBB4, then immunoblotted with
.alpha.-PY20 or .alpha.-ERBB4. (FIG. 1G) Mutant ERBB4 has increased
basal activity. Melanoma lines harboring either WT or mutant ERBB4
were serum deprived, lysed, immunoprecipitated for ERBB4, and
analyzed by immunoblotting with .alpha.-P-ERBB4 (P--Y1162) or
.alpha.-ERBB4.
[0012] FIGS. 2A-2B: Mutant ERBB4 induces transformation and
anchorage independent growth in NIH 3T3 and SK-MeI-2 cells. (FIG.
2A) NIH 3T3 cells were transfected with the indicated ERBB4 mutant
or control constructs. The graph indicates the average number of
transformed foci after 10 days. (FIG. 2B) Growth in soft agar of
melanoma SK-MeI-2 cells stably expressing either vector, WT ERBB4
or various ERBB4 missense mutants. The graph indicates the number
of colonies after 14 days.
[0013] FIGS. 3A-3G: Expression of mutant ERBB4 provides an
essential cell survival signal in melanoma. (FIG. 3A) HEK 293 cells
were transiently co-transfected with either vector or WT ERBB4
together with either control vector or shRNAs that target ERBB4.
Cell lysates were analyzed by immunoblotting using .alpha.-ERBB4.
For normalization, lysates were analyzed in parallel by
.alpha.-tubulin immunoblotting. (FIG. 3B) Cells transduced with
shRNA targeting ERBB4 were lysed and immunoprecipitated using
.alpha.-ERBB4 beads. Immunoprecipitates were blotted with specific
antibodies, as indicated. (FIGS. 3C-3G) shRNA-mediated ERBB4
knockdown in melanoma lines containing ERBB4 mutations results in
reduced cell growth. Cells were seeded in 96-well plates and
incubated for 13-17 days. Plates were analyzed every other day for
cell proliferation, where the average cell number at each time
point was measured by determining DNA content using SYBR Green I.
Melanoma cells harboring ERBB4 mutations stably transduced with
shRNA constructs targeting ERBB4, but not those stably transduced
with the control vector only, showed decreased growth relative to
control. This did not occur in melanoma cells harboring WT
ERBB4.
[0014] FIGS. 4A-4B: Detection of mutations in ERBB4. Shown are
eight matched sets of two chromatograms each, illustrating somatic
mutations in the ERBB4 gene. In each case, the top sequence
chromatogram was obtained from normal tissue and the lower sequence
chromatogram from the indicated tumors. Arrows indicate the
location of missense mutations. The nucleotide and amino acid
alterations are indicated below the tumor chromatograms; numbering
of the mutation locations is based on SEQ ID NO: 1 (nucleotide) and
SEQ ID NO: 2 (amino acid).
[0015] FIG. 5: Distribution of mutations in ERBB4, FL T1, EphB2,
EphB6, PTK2B, and TIE1. Shown is a schematic of the domain
structure of select PTKs. Arrows indicate positions of
nonsynonymous mutations and boxes represent functional domains
(Rcpt L, receptor L; GFR, growth factor receptor; PTK, protein
tyrosine kinase; IG, immunoglobin; IGc2, immunoglobin C-2 Type; Eph
Rcpt, ephrin receptor; FNIII, fibronectin type III; SAM, sterile
alpha motif; FERM, protein 4.1, ezrin, radixin, moesin domain;
Focal AT, focal adhesion targeting region).
[0016] FIGS. 6A-6B: Mutation spectra of single base pair
substitutions. (FIG. 6A) Shown is a Kinome mutation spectrum. The
number of each of the six classes of base substitutions resulting
in nonsynonymous changes in the kinome screen is shown. (FIG. 6B)
Shown is a mutation spectrum of single base pair substitutions in
ERBB4. The number of each of the six classes of base substitutions
resulting in nonsynonymous changes in ERBB4 is shown.
[0017] FIG. 7: Specificity of phosphorylation site-specific
antibodies. Shown is a series of immunoblots to detect
phosphorylation status of ERBB4 mutants. HEK 293T cells were
transiently transfected with either vector or ERBB4 E452K missense
mutant. Cells were serum starved and then lysed. Shown are
immunoblots of immunoprecipitated ERBB4 probed with several
anti-phosphoERBB4 (Y1162; Y1284), or total ERBB4 antibodies in the
presence or absence of phosphorylated (pPep) or unphosphorylated
(Pep) competitive peptide.
[0018] FIG. 8: Increased basal activation of endogenous mutant
ERBB4. Shown is a set of two immunoblots demonstrating detection of
phosphorylated ERBB4 in melanoma cell lines expressing WT or mutant
ERBB4. MM lines that harbor either WT or mutant ERBB4 cells were
either grown in 10% serum or serum starved and then lysed. Shown
are immunoblots of immunoprecipitated ERBB4 probed with the
indicated antibodies.
[0019] FIGS. 9A-9C: Effect of ERBB4 mutations on cell growth in NIH
3T3 and SK-MeI-2 cells. (FIG. 9A) Growth in soft agar of NIH 3T3
cells expressing either vector, WT ERBB4 or various ERBB4 missense
mutants. The graph indicates the number of colonies after 14 days.
(FIG. 9B and FIG. 9C) Detection of ERBB4 protein expression in
stable transfectants of SK-MeI-2 melanoma cells by western blot
analysis. Lysates from the different clones stably transfected with
an empty vector, human ERBB4 or the indicated ERBB4 mutants were
immunoprecipitated and immunoblotted with ERBB4 antibody (FIG. 9B).
Anchorage independent proliferation of SK-MeI-2 cell clones
expressing the indicated constructs was assessed by measuring
colony growth in soft agar (FIG. 9C). The graph indicates the
number of colonies observed after 14 days of growth.
[0020] FIGS. 10A-10G: Melanoma lines expressing ERBB4 mutants
exhibit increased sensitivity to ERBB inhibition by lapatinib.
(FIG. 10A) Representative dose response curves showing lapatinib
efficacy against ERBB4 mutant cell lines compared to WT ERBB4 cell
lines. Cells were treated for 72 hours in the presence of
increasing concentrations (0.01-30 .mu.M) of lapatinib, and
relative cell number was estimated by methylene blue protein
staining and plotted as percent survival when compared to
vehicle-treated control versus Log(lapatinib) nM (where 1 is 10 nM
lapatinib). Fitted lines were generated using 4-parameter nonlinear
regression via GraphPad Prism. (FIG. 10B) ERBB4 mutant cells lines
have increased sensitivity to lapatinib compared to WT ERBB4 cell
lines. The IC.sub.50 values for inhibition of cell growth by 72
hour treatment with lapatinib of a larger panel of lines harboring
WT and mutant ERBB4 were analyzed using GraphPad Prism v.5 (n=3).
(FIG. 10C) Immunoprecipitation and western blot analysis of ERBB4
autophosphorylation in cells treated with lapatinib. Cells were
treated for 1 hour with lapatinib or vehicle alone as control.
Lysates were immunoprecipitated with .alpha.-ERBB4 followed by
western blot analysis with .alpha.-ERBB4 and .alpha.-P-ERBB4
(Y1162). (FIG. 10D) Melanoma lines expressing mutant ERBB4 exhibit
increased lapatinib sensitivity with respect to ERBB4 and AKT
phosphorylation. The activity of ERBB4, AKT and ERBB2 was
determined by immunoblotting with phospho-specific antibodies.
Cells were treated for 1 hour with 5 .mu.M lapatinib or vehicle
alone. Lysates were immunoprecipitated using .alpha.-ERBB2 or
.alpha.-ERBB4. Lysates and immunoprecipitates were analyzed by
western blotting using the indicated antibodies. Shown are
representative blots. (FIG. 10E) Quantitative assessment of data
from 2 cell lines harboring WT ERBB4 and 3 cell lines harboring
mutant ERBB4 that were performed similarly to (FIG. 10D). The ratio
of band intensities of (P--Y1162)-ERBB4/ERBB4, (P)-5473-AKT/AKT and
(P--Y1248)-ERBB2/ERBB2 for each cell line are shown. (FIG. 10F)
Mutant ERBB4 cells have increased sub-G1 population in the presence
of lapatinib compared to WT ERBB4 cells. Shown are representative
plots of FACS analysis of 31T (WT) and 12T (E563K) showing cell
cycle distribution (PI staining, x-axis) versus cell counts
(y-axis). (FIG. 10G) Quantitation of FACS-sorted lapatinib-treated
cells. The percent apoptotic cells were determined based on the
sub-G1 population for vehicle-treated cells or lapatinib-treated
cells.
[0021] FIG. 11: Effects of ERBB4 mutation on AKT and ERK
phosphorylation. Melanoma cell lines containing either WT or mutant
ERBB4 were harvested and analyzed by immunoblot. Shown are
immunoblots of lysates probed with the indicated antibodies
(.alpha.-P-ERK1/2--recognizes phosphorylation of T202 and Y204 on
ERK1, and T185 and Y187 on ERK2).
[0022] FIG. 12: Knockdown of ERBB4 protein causes reduced
activation of the AKT pathway but not of the ERK pathway. Melanoma
cells lines containing either WT or mutant ERBB4 were harvested and
analyzed by western blot. Shown are immunoblots of lysates probed
with the indicated antibodies.
[0023] FIGS. 13A-13B: Rescue of oncogene dependence by exogenous
non-targetable ERBB4. (FIG. 13A) Melanoma cells harboring mutant
ERBB4 stably expressing control or ERBB4 shRNA #6 transduced with
either vector or non-targetable (NT) ERBB4 were analyzed by
immunoblotting with the indicated antibodies. As a loading control,
lysates were immunoblotted with .alpha.-tubulin. (FIG. 13B)
Melanoma cells expressing vector or the ERBB4 shRNA #6 transduced
with a vector or NT ERBB4 were evaluated for cell proliferation by
measuring the average cell number at each time point by determining
DNA content using SYBR Green I.
[0024] FIGS. 14A-14B: Effect of lapatinib in ERK1/2 signaling
pathways. (FIG. 14A) Melanoma lines expressing mutant ERBB4 exhibit
increased lapatinib sensitivity with respect to ERK1 and ERK2
phosphorylation. Cells were treated for 72 hours with 5 .mu.M
lapatinib or vehicle as control. The activity of ERK1 and ERK2 was
determined by immunoblotting with phospho-specific antibodies.
Total ERK protein was also determined by immunoblotting. Shown are
representative blots. (FIG. 14B) Quantitative assessment of data
from one melanoma cell line harboring mutant ERBB4. The ratio of
band intensities of P-ERK1/ERK1 or P-ERK2/ERK2 was analyzed for
each melanoma cell line.
SEQUENCE LISTING
[0025] The nucleic and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three letter code for amino
acids, as defined in 37 C.F.R. 1.822. Only one strand of each
nucleic acid sequence is shown, but the complementary strand is
understood as included by any reference to the displayed strand.
The Sequence Listing is submitted as an ASCII text file, created on
Jan. 19, 2014, 46.4 KB, which is incorporated by reference herein.
In the accompanying sequence listing:
[0026] SEQ ID NOs: 1 and 2 are the nucleotide and amino acid
sequences, respectively, of human ERBB4 (GenBank Accession No.
NM.sub.--005235.2, deposited Jul. 28, 2006). Seven mutations
identified in melanoma tumors are indicated (G949A, G1354A, G1624A,
C1630T, G1687A, G2506A and G2614A in the nucleotide sequence;
E317K, E452K, E542K, R544W, E563K, E836K and E872K in the amino
acid sequence).
[0027] SEQ ID NOs: 3-31 are the nucleotide sequences of forward
primers used to PCR amplify the coding region of human ERBB4.
[0028] SEQ ID NOs: 32-60 are the nucleotide sequences of reverse
primers used to PCR amplify the coding region of human ERBB4.
[0029] SEQ ID NO: 61 is the nucleotide sequences of the primer used
to sequence the coding region of human ERBB4.
[0030] SEQ ID NOs: 62 and 63 are the nucleotide sequences of
primers used to clone human ERBB4.
[0031] SEQ ID NOs: 64-70 are the nucleotide sequences of forward
primers used to PCR amplify the kinase domain of human ERBB4.
[0032] SEQ ID NOs: 71-77 are the nucleotide sequences of reverse
primers used to PCR amplify the kinase domain of human ERBB4.
[0033] SEQ ID NO: 78 is the nucleotide sequences of the forward
primer used to sequence the kinase domain of human ERBB4.
[0034] SEQ ID NO: 79 is the nucleotide sequences of the reverse
primer used to sequence the kinase domain of human ERBB4.
DETAILED DESCRIPTION
I. Introduction
[0035] PTK signaling pathways can be deregulated by a variety of
mechanisms in human tumors. Described herein is a comprehensive
mutational analysis of the PTK family, which revealed numerous
novel somatic mutations. Surprisingly, the analysis identified two
PTK genes that had mutations in over 10% of MM cases (FLT1 and
PTK2B) and one gene that had mutations in over 18% of MM cases
(ERBB4, a member of the EGFR family). The high frequency of
mutations identified in ERBB4, their co-localization, and the
identification of two identical missense mutations in multiple MM
cases, suggest that these mutations play a role in
tumorigenesis.
[0036] To evaluate the effect of mutations in ERBB4, seven
mutations that affect residues that are conserved in EGFR, and are
located at residues near EGFR mutations that have been described in
other tumor types, were cloned and their kinase activity was
examined. The results of this analysis showed that mutant ERBB4 has
increased autophosphorylation activity compared to wild type (WT)
ERBB4. Expression of mutant ERBB4 in NIH 3T3 cells and human
melanoma cells increased their growth on soft agar and colony
formation ability. Furthermore, immunoblots of melanoma cells
harboring ERBB4 mutations exhibited increased activity of the
PI3K/AKT pathway, as evidenced by an increase in phosphorylated
AKT. These functional assays indicated that the ERBB4 mutations
identified herein promote cellular phenotypes typical of neoplastic
cells, such as increased transformation ability and
anchorage-independent growth.
[0037] The combination of genetic, biochemical and cellular data
disclosed herein indicates that ERBB4 functions as an oncogene in
MM. This finding is consistent with previously reported alterations
of members of the EGFR family, which have been shown to be mutated
as well as amplified (Sharma et al., Nat. Rev. Cancer 7:169-181,
2007). In addition, ERBB4 has previously been shown to be involved
in enhanced proliferation of breast cancer cells (Junttila et al.,
Cancer Res. 65(4):1384-1393, 2005) and non-small cell lung cancer
cells (Starr et al., Int. J. Cancer 119:269-274, 2006).
Importantly, cells containing mutations in ERBB4 were associated
with enhanced and selective sensitivity to an FDA-approved ERBB4
inhibitor compared to WT cells. These results suggest that patients
with melanoma containing one or more ERBB4 mutations may benefit
from therapy directed at mutant ERBB4.
II. Abbreviations
[0038] ARAF v-raf murine sarcoma 3611 viral oncogene homolog [0039]
BRAF B-Raf proto-oncogene serine/threonine-protein kinase [0040]
CRAF v-raf-1 murine leukemia viral oncogene homolog 1 [0041] DMEM
Dulbecco's modified eagle medium [0042] DMSO Dimethyl sulfoxide
[0043] DNA Deoxyribonucleic acid [0044] EGFR Epidermal growth
factor receptor [0045] ELISA Enzyme-linked immunosorbent assay
[0046] FBS Fetal bovine serum [0047] GFR Growth factor receptor
[0048] HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog
[0049] IC.sub.50 Inhibitory concentration 50 [0050] IG
Immunoglobulin [0051] KD Kinase dead [0052] KO Knockout [0053] KRAS
v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog [0054] MM
Metastatic melanoma [0055] NRAS Neuroblastoma RAS viral oncogene
homolog [0056] NT Non-targetable [0057] PAGE Polyacrylamide-gel
electrophoresis [0058] PBS Phosphate buffered saline [0059] PCR
Polymerase chain reaction [0060] PI3K Phosphoinositide 3-kinase
[0061] RNA Ribonucleic acid [0062] RNAi RNA interference [0063] RT
Reverse transcriptase [0064] SAM Sterile alpha motif [0065] SDS
Sodium dodecyl sulfate [0066] shRNA Short hairpin RNA [0067] siRNA
Small interfering RNA [0068] SNP Single nucleotide polymorphism
[0069] TKI Tyrosine kinase inhibitor [0070] WT Wild type
III. Terms
[0071] Unless otherwise noted, technical terms are used according
to conventional usage. Definitions of common terms in molecular
biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al.
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
[0072] In order to facilitate review of the various embodiments of
the disclosure, the following explanations of specific terms are
provided:
[0073] AKT: As used herein, the term "AKT" includes AKT1, AKT2 and
AKT3. The AKT1 gene encodes a serine-threonine protein kinase that
is catalytically inactive in serum-starved primary and immortalized
fibroblasts. AKT1 and the related AKT2 are activated by
platelet-derived growth factor. The activation, which occurs
through phosphatidylinositol 3-kinase, is rapid and specific, and
it is abrogated by mutations in the pleckstrin homology domain of
AKT1. AKT1 is also known as v-akt murine thymoma viral oncogene
homolog 1, PKB; RAC; PRKBA; MGC99656; PKB-ALPHA; and RAC-ALPHA. The
AKT2 gene is a putative oncogene encoding a protein belonging to a
subfamily of serine/threonine kinases containing SH2-like (Src
homology 2-like) domains. The Akt2 protein is a general protein
kinase capable of phosphorylating several known proteins. AKT2 is
also known as v-akt murine thymoma viral oncogene homolog 2; PKBB;
PRKBB; PKBBETA; and RAC-BETA. AKT3 is a member of the AKT (also
called PKB) serine/threonine protein kinase family. AKT kinases are
known to be regulators of cell signaling in response to insulin and
growth factors. They are involved in a wide variety of biological
processes including cell proliferation, differentiation, apoptosis,
tumorigenesis, as well as glycogen synthesis and glucose uptake.
The Akt3 protein kinase has been shown to be stimulated by
platelet-derived growth factor (PDGF), insulin, and insulin-like
growth factor 1 (IGF1). AKT3 is also known as v-akt murine thymoma
viral oncogene homolog 3; protein kinase B, gamma; PKBG; PRKBG;
STK-2; PKB-GAMMA; RAC-gamma; RAC-PK-gamma; and DKFZp434N0250.
Members of the AKT protein family are also called protein kinases B
(PKB) in the literature.
[0074] Antibody: A polypeptide ligand comprising at least a light
chain or heavy chain immunoglobulin variable region which
specifically recognizes and binds an epitope of an antigen.
Antibodies are composed of a heavy and a light chain, each of which
has a variable region, termed the variable heavy (V.sub.H) region
and the variable light (V.sub.L) region. Together, the V.sub.H
region and the V.sub.L region are responsible for binding the
antigen recognized by the antibody.
[0075] Antibodies include intact immunoglobulins and the variants
and portions of antibodies well known in the art, such as Fab
fragments, Fab' fragments, F(ab)'.sub.2 fragments, single chain Fv
proteins ("scFv"), and disulfide stabilized Fv proteins ("dsFv"). A
scFv protein is a fusion protein in which a light chain variable
region of an immunoglobulin and a heavy chain variable region of an
immunoglobulin are bound by a linker, while in dsFvs, the chains
have been mutated to introduce a disulfide bond to stabilize the
association of the chains. The term also includes genetically
engineered forms such as chimeric antibodies (for example,
humanized murine antibodies), heteroconjugate antibodies (such as,
bispecific antibodies). See also, Pierce Catalog and Handbook,
1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J.,
Immunology, 3.sup.rd Ed., W.H. Freeman & Co., New York,
1997.
[0076] Typically, a naturally occurring immunoglobulin has heavy
(H) chains and light (L) chains interconnected by disulfide bonds.
There are two types of light chain, lambda (.lamda.) and kappa (k).
There are five main heavy chain classes (or isotypes) which
determine the functional activity of an antibody molecule: IgM,
IgD, IgG, IgA and IgE.
[0077] Each heavy and light chain contains a constant region and a
variable region, (the regions are also known as "domains"). In
combination, the heavy and the light chain variable regions
specifically bind the antigen. Light and heavy chain variable
regions contain a "framework" region interrupted by three
hypervariable regions, also called "complementarity-determining
regions" or "CDRs." The extent of the framework region and CDRs
have been defined (see, Kabat et al., Sequences of Proteins of
Immunological Interest, U.S. Department of Health and Human
Services, 1991, which is hereby incorporated by reference). The
Kabat database is now maintained online. The sequences of the
framework regions of different light or heavy chains are relatively
conserved within a species, such as humans. The framework region of
an antibody, that is the combined framework regions of the
constituent light and heavy chains, serves to position and align
the CDRs in three-dimensional space.
[0078] The CDRs are primarily responsible for binding to an epitope
of an antigen. The CDRs of each chain are typically referred to as
CDR1, CDR2, and CDR3, numbered sequentially starting from the
N-terminus, and are also typically identified by the chain in which
the particular CDR is located. Thus, a V.sub.H CDR3 is located in
the variable domain of the heavy chain of the antibody in which it
is found, whereas a V.sub.L CDR1 is the CDR1 from the variable
domain of the light chain of the antibody in which it is found.
Antibodies with different specificities (i.e. different combining
sites for different antigens) have different CDRs. Although it is
the CDRs that vary from antibody to antibody, only a limited number
of amino acid positions within the CDRs are directly involved in
antigen binding. These positions within the CDRs are called
specificity determining residues (SDRs).
[0079] References to "V.sub.H" or "VH" refer to the variable region
of an immunoglobulin heavy chain, including that of an Fv, scFv,
dsFv or Fab. References to "V.sub.L" or "VL" refer to the variable
region of an immunoglobulin light chain, including that of an Fv,
scFv, dsFv or Fab.
[0080] A "monoclonal antibody" is an antibody produced by a single
clone of B lymphocytes or by a cell into which the light and heavy
chain genes of a single antibody have been transfected. Monoclonal
antibodies are produced by methods known to those of skill in the
art, for instance by making hybrid antibody-forming cells from a
fusion of myeloma cells with immune spleen cells. Monoclonal
antibodies include humanized monoclonal antibodies.
[0081] A "chimeric antibody" has framework residues from one
species, such as human, and CDRs (which generally confer antigen
binding) from another species, such as a murine antibody that
specifically binds a target antigen.
[0082] A "humanized" immunoglobulin is an immunoglobulin including
a human framework region and one or more CDRs from a non-human (for
example a mouse, rat, or synthetic) immunoglobulin. The non-human
immunoglobulin providing the CDRs is termed a "donor," and the
human immunoglobulin providing the framework is termed an
"acceptor." In one embodiment, all the CDRs are from the donor
immunoglobulin in a humanized immunoglobulin. Constant regions need
not be present, but if they are, they must be substantially
identical to human immunoglobulin constant regions, i.e., at least
about 85-90%, such as about 95% or more identical. Hence, all parts
of a humanized immunoglobulin, except possibly the CDRs, are
substantially identical to corresponding parts of natural human
immunoglobulin sequences. A "humanized antibody" is an antibody
comprising a humanized light chain and a humanized heavy chain
immunoglobulin. A humanized antibody binds to the same antigen as
the donor antibody that provides the CDRs. The acceptor framework
of a humanized immunoglobulin or antibody may have a limited number
of substitutions by amino acids taken from the donor framework.
Humanized or other monoclonal antibodies can have additional
conservative amino acid substitutions which have substantially no
effect on antigen binding or other immunoglobulin functions.
Humanized immunoglobulins can be constructed by means of genetic
engineering (see for example, U.S. Pat. No. 5,585,089).
[0083] A "human" antibody (also called a "fully human" antibody) is
an antibody that includes human framework regions and all of the
CDRs from a human immunoglobulin. In one example, the framework and
the CDRs are from the same originating human heavy and/or light
chain amino acid sequence. However, frameworks from one human
antibody can be engineered to include CDRs from a different human
antibody. All parts of a human immunoglobulin are substantially
identical to corresponding parts of natural human immunoglobulin
sequences.
[0084] Antisense compound: Refers to an oligomeric compound that is
at least partially complementary to the region of a target nucleic
acid molecule (such as a miR gene product) to which it hybridizes.
As used herein, an antisense compound that is "specific for" a
target nucleic acid molecule is one which specifically hybridizes
with and modulates expression of the target nucleic acid molecule.
As used herein, a "target" nucleic acid is a nucleic acid molecule
to which an antisense compound is designed to specifically
hybridize and modulate expression.
[0085] Nonlimiting examples of antisense compounds include primers,
probes, antisense oligonucleotides, siRNAs, miRNAs, shRNAs and
ribozymes. As such, these compounds can be introduced as
single-stranded, double-stranded, circular, branched or hairpin
compounds and can contain structural elements such as internal or
terminal bulges or loops. Double-stranded antisense compounds can
be two strands hybridized to form double-stranded compounds or a
single strand with sufficient self-complementarity to allow for
hybridization and formation of a fully or partially double-stranded
compound. In particular examples herein, the antisense compound is
an antisense oligonucleotide, siRNA or ribozyme.
[0086] Antisense oligonucleotide: As used herein, an "antisense
oligonucleotide" is a single-stranded antisense compound that is a
nucleic acid-based oligomer. An antisense oligonucleotide can
include one or more chemical modifications to the sugar, base,
and/or internucleoside linkages. Generally, antisense
oligonucleotides are "DNA-like" such that when the antisense
oligonucleotide hybridizes to a target RNA molecule, the duplex is
recognized by RNase H (an enzyme that recognizes DNA:RNA duplexes),
resulting in cleavage of the RNA.
[0087] Array: An arrangement of molecules, such as biological
macromolecules (such as peptides or nucleic acid molecules) or
biological samples (such as tissue sections), in addressable
locations on or in a substrate. A "microarray" is an array that is
miniaturized so as to require or be aided by microscopic
examination for evaluation or analysis. Arrays are sometimes called
DNA chips or biochips.
[0088] The array of molecules ("features") makes it possible to
carry out a very large number of analyses on a sample at one time.
In certain example arrays, one or more molecules (such as an
oligonucleotide probe) will occur on the array a plurality of times
(such as twice), for instance to provide internal controls. The
number of addressable locations on the array can vary, for example
from at least two, at least four, at least six, to at least 9, at
least 10, at least 14, at least 15, at least 20, at least 30, at
least 50, at least 75, at least 100, at least 150, at least 200, at
least 300, at least 500, least 550, at least 600, at least 800, at
least 1000, or more. In a particular example, an array includes
2-100 addressable locations, such as 4-20 addressable locations. In
particular examples, an array consists essentially of
oligonucleotide probes specific for ERBB4 nucleic acid molecules
comprising mutations selected from G949A, G1354A, G1624A, C1630T,
G1687A, G2506A and G2614A (numbered with reference to SEQ ID NO:
1).
[0089] In particular examples, an array includes nucleic acid
molecules, such as oligonucleotide sequences that are at least 15
nucleotides in length, such as about 15-40 nucleotides in
length.
[0090] Within an array, each arrayed sample is addressable, in that
its location can be reliably and consistently determined within at
least two dimensions of the array. The feature application location
on an array can assume different shapes. For example, the array can
be regular (such as arranged in uniform rows and columns) or
irregular. Thus, in ordered arrays the location of each sample is
assigned to the sample at the time when it is applied to the array,
and a key may be provided in order to correlate each location with
the appropriate target or feature position. Often, ordered arrays
are arranged in a symmetrical grid pattern, but samples could be
arranged in other patterns (such as in radially distributed lines,
spiral lines, or ordered clusters). Addressable arrays usually are
computer readable, in that a computer can be programmed to
correlate a particular address on the array with information about
the sample at that position (such as hybridization or binding data,
including for instance signal intensity). In some examples of
computer readable formats, the individual features in the array are
arranged regularly, for instance in a Cartesian grid pattern, which
can be correlated to address information by a computer.
[0091] Candidate: As used herein, a "candidate" for treatment with
an ERBB4 inhibitor is a melanoma patient that is likely to respond
favorably to treatment with the ERBB4 inhibitor. Candidates for
ERBB4 inhibitor therapy are melanoma patients that have a mutation
in the ERBB4 gene that results in an increase in ERBB4 expression,
or results in expression of an ERBB4 protein with increased kinase
activity. In some embodiments, the candidate is a melanoma patient
with an ERBB4 gene comprising a mutation selected from G949A,
G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbered with
reference to SEQ ID NO: 1). In some embodiment, the ERBB4 protein
comprises a mutation selected from E317K, E452K, E542K, R544W,
E563K, E836K and E872K (numbered with reference to SEQ ID NO:
2).
[0092] Clinical outcome: Refers to the health status of a patient
following treatment for a disease or disorder, or in the absence of
treatment. Clinical outcomes include, but are not limited to, an
increase in the length of time until death, a decrease in the
length of time until death, an increase in the chance of survival,
an increase in the risk of death, survival, disease-free survival,
chronic disease, metastasis, advanced or aggressive disease,
disease recurrence, death, and favorable or poor response to
therapy.
[0093] Decrease in survival: As used herein, "decrease in survival"
refers to a decrease in the length of time before death of a
patient, or an increase in the risk of death for the patient. A
decrease in survival also can refer to a decrease in the average
time to death in a group, such as a group of patients diagnosed
with melanoma.
[0094] Epidermal growth factor receptor (EGFR) family: A family of
protein tyrosine kinases (PTKs), also known as the ERBB family. The
ERBB PTK family includes four receptor kinases, ERBB1 (EGFR1,
HER1), ERBB2 (c-Neu, HER2), ERBB3 (HER3) and ERBB4 (HER4). The ERBB
kinases regulate a wide range of cellular responses, including cell
proliferation, survival, migration and differentiation. ERBB
signaling pathways are known to be altered in a wide variety of
cancers.
[0095] ERBB4: A member of the EGFR family that encodes a protein of
approximately 180 kD. ERBB4 encodes a single-pass type I membrane
protein with multiple cysteine rich domains, a transmembrane
domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase
binding site and a PDZ domain binding motif. ERBB4 is expressed as
four alternatively spliced isoforms. The protein binds to and is
activated by neuregulins and other factors and induces a variety of
cellular responses, including mitogenesis and differentiation.
Multiple proteolytic events allow for the release of a cytoplasmic
fragment and an extracellular fragment. Mutations in ERBB4 have
been associated with cancer.
[0096] ERBB4 inhibitor: An ERBB4 inhibitor refers to any compound
that inhibits expression or activity of ERBB4, such as kinase
activity of ERBB4. Inhibitor compounds include, but are not limited
to, small molecules, polypeptides and nucleic acid molecules (such
as antisense compounds). In some embodiments, an ERBB4 inhibitor is
a broad-spectrum inhibitor that inhibits activity of multiple
members of the EGFR family. EGFR family inhibitors are known in the
art (see, for example, PCT Publication Nos. WO 2008/005983, WO
03/012072 and WO 03/070912; and US Patent Application Publication
Nos. 2006/0233808 and 2006/0128636). In some embodiments, the ERBB4
inhibitor selectively inhibits expression or activity of ERBB4, and
not other EGFR family members (see, for example, U.S. Pat. No.
5,811,098). In some embodiments, the ERBB4 inhibitor is a kinase
inhibitor. Kinase inhibitors are well known in the art (see, for
example, US Patent Application Publication Nos. 2008/0031893;
2006/0148824; and 2002/0156083). In particular examples, the ERBB4
inhibitor is lapatinib (Burris et al., J. Clin. Oncol.
23(23):5305-5313, 2005).
[0097] Genomic DNA: The DNA found within the nucleus and containing
an organism's genome, which is passed on to its offspring as
information for continued replication and/or propagation and/or
survival of the organism. The term can be used to distinguish
between other types of DNA, such as DNA found within plasmids or
organelles.
[0098] Inhibitor: As used herein, the term "inhibitor" includes any
type of molecule that inhibits the expression or activity of a
target gene or protein. An inhibitor can be any type of compound,
such as a small molecule, antibody or antisense compound.
[0099] Kinase: An enzyme that catalyzes the transfer of a
phosphate, such as from ATP, to a substrate. As used herein, an
increase or decrease in "kinase activity" of a protein (e.g. ERBB4)
refers to an increase or decrease in the ability of the protein to
phosphorylate a substrate, such as a protein.
[0100] Label: An agent capable of detection, for example by ELISA,
spectrophotometry, flow cytometry, or microscopy. For example, a
label can be attached to a nucleic acid molecule or protein,
thereby permitting detection of the nucleic acid molecule or
protein. Examples of labels include, but are not limited to,
radioactive isotopes, enzyme substrates, co-factors, ligands,
chemiluminescent agents, fluorophores, haptens, enzymes, and
combinations thereof. Methods for labeling and guidance in the
choice of labels appropriate for various purposes are discussed for
example in Sambrook et al. (Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor, N.Y., 1989) and Ausubel et al. (In Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
1998).
[0101] In some embodiments, the label is a fluorophore
("fluorescent label"). Fluorophores are chemical compounds, which
when excited by exposure to a particular wavelength of light, emits
light (i.e., fluoresces), for example at a different wavelength.
Fluorophores can be described in terms of their emission profile,
or "color." Green fluorophores, for example Cy3, FITC, and Oregon
Green, are characterized by their emission at wavelengths generally
in the range of 515-540%. Red fluorophores, for example Texas Red,
Cy5 and tetramethylrhodamine, are characterized by their emission
at wavelengths generally in the range of 590-690%.
[0102] Examples of fluorophores that may be used are provided in
U.S. Pat. No. 5,866,366 to Nazarenko et al., and include for
instance: 4-acetamido-4'-isothiocyanatostilbene-2,2' disulfonic
acid, acridine and derivatives such as acridine and acridine
isothiocyanate, 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid
(EDANS), 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5
disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide,
anthranilamide, Brilliant Yellow, coumarin and derivatives such as
coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120),
7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanosine;
4',6-diaminidino-2-phenylindole (DAPI);
5',5''-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red);
7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin;
diethylenetriamine pentaacetate;
4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid;
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid;
5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl
chloride); 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL);
4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin
and derivatives such as eosin and eosin isothiocyanate; erythrosin
and derivatives such as erythrosin B and erythrosin isothiocyanate;
ethidium; fluorescein and derivatives such as 5-carboxyfluorescein
(FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF),
2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE),
fluorescein, fluorescein isothiocyanate (FITC), and QFITC(XRITC);
fluorescamine; IR144; IR1446; Malachite Green isothiocyanate;
4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine;
pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde;
pyrene and derivatives such as pyrene, pyrene butyrate and
succinimidyl 1-pyrene butyrate; Reactive Red 4 (Cibacron.RTM.
Brilliant Red 3B-A); rhodamine and derivatives such as
6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine
rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B,
rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B,
sulforhodamine 101 and sulfonyl chloride derivative of
sulforhodamine 101 (Texas Red);
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl
rhodamine; tetramethyl rhodamine isothiocyanate (TRITC);
riboflavin; rosolic acid and terbium chelate derivatives.
[0103] Other contemplated fluorophores include GFP (green
fluorescent protein), Lissamine.TM., diethylaminocoumarin,
fluorescein chlorotriazinyl, naphthofluorescein,
4,7-dichlororhodamine and xanthene and derivatives thereof. Other
fluorophores known to those skilled in the art may also be
used.
[0104] LY294002: A selective small molecule inhibitor of PI3K.
LY294002 is also known as
2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (Vlahos et al., J
Biol Chem 269:5241-5248, 1994). The molecular formula of LY294002
is C.sub.19H.sub.17NO.sub.3.
[0105] Melanoma: A form of cancer that originates in melanocytes
(cells that make the pigment melanin). Melanocytes are found
primarily in the skin, but are also present in the bowel and
eye.
[0106] Metastasis: Refers to the spread of cancer cells from the
original tumor to other sites in the body.
[0107] Mutation: Any change of the DNA sequence within a gene or
chromosome. In some instances, a mutation will alter a
characteristic or trait (phenotype), but this is not always the
case. Types of mutations include base substitution point mutations
(e.g., transitions or transversions), deletions, and insertions.
Missense mutations are those that introduce a different amino acid
into the sequence of the encoded protein; nonsense mutations are
those that introduce a new stop codon. In the case of insertions or
deletions, mutations can be in-frame (not changing the frame of the
overall sequence) or frame shift mutations, which may result in the
misreading of a large number of codons (and often leads to abnormal
termination of the encoded product due to the presence of a stop
codon in the alternative frame).
[0108] This term specifically encompasses variations that arise
through somatic mutation, for instance those that are found only in
disease cells, but not constitutionally, in a given individual.
Examples of such somatically-acquired variations include the point
mutations that frequently result in altered function of various
genes that are involved in development of cancers. This term also
encompasses DNA alterations that are present constitutionally, that
alter the function of the encoded protein in a readily demonstrable
manner, and that can be inherited by the children of an affected
individual. In this respect, the term overlaps with "polymorphism,"
as discussed below, but generally refers to the subset of
constitutional alterations that have arisen within the past few
generations in a kindred and that are not widely disseminated in a
population group.
[0109] In some embodiments, a mutation in ERBB4 refers to a
nucleotide substitution in the ERBB4 gene or cDNA, or an amino acid
substitution in the ERBB4 protein.
[0110] Oligonucleotide: A linear polynucleotide sequence of up to
about 100 nucleotide bases in length.
[0111] Patient or subject: As used herein, the term "patient"
includes human and non-human animals. The preferred patient for
treatment is a human. "Patient" and "subject" are used
interchangeably herein.
[0112] Pharmaceutically acceptable vehicles: The pharmaceutically
acceptable carriers (vehicles) useful in this disclosure are
conventional. Remington's Pharmaceutical Sciences, by E. W. Martin,
Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of one or more therapeutic compounds, molecules or agents.
[0113] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations usually comprise injectable fluids that
include pharmaceutically and physiologically acceptable fluids such
as water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(for example, powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
[0114] Phosphoinositide-3 kinase (PI3K): A family of related
enzymes that are capable of phosphorylating the 3 position hydroxyl
group of the inositol ring of phosphatidylinositol. PI3Ks are also
known as phosphatidylinositol-3-kinases. Class I PI3K are
heterodimeric molecules composed of a regulatory subunit and a
catalytic subunit. Class II and Class III PI3K are differentiated
from Class I by their structure and function. Class II PI3K are
composed of one of three catalytic isoforms (C2.alpha., C2.beta.,
and C2.gamma.), but have no regulatory proteins. Class III PI3K
exist as a heterodimers of a catalytic subunit (Vps34) and a
regulatory (p150) subunit. Genes encoding PIK3 subunits include,
for example, PIK3C2A, PIK3C2B, PIK3C2G, PIK3C3, PIK3CA, PIK3CB,
PIK3CG, PIK3CD, PIK3R1, PIK3R2, PIK3R3, PIK3R4, PIK3R4, PIK3R5 and
PIK3R6.
[0115] PI3K/Akt pathway: A signaling pathway involved in a number
of cellular processes, such as cell growth, proliferation,
differentiation, motility, survival, intracellular trafficking,
metabolism and angiogenesis.
[0116] PI3K/Akt pathway inhibitor: Any compound that inhibits
expression or activity of a member of the PI3K pathway, such as,
but not limited to PI3K or AKT. For example, the inhibitor can be a
small molecule, antibody, antisense compound or polypeptide. In
some examples, the antibody is a chimeric antibody, a humanized
antibody or a human antibody. In some examples, the antisense
compound is an antisense oligonucleotide, siRNA or ribozyme.
Antibodies, antisense compounds and other inhibitors specific for
members of the PI3K/Akt pathway are known in the art and are
commercially available. Exemplary inhibitors of the PI3K/Akt
pathway are described herein, but are not intended to be limiting.
In some examples, the small molecule inhibitor of PI3K is LY294002
(also known as 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one;
molecular formula C.sub.19H.sub.17NO.sub.3) or wortmannin
(molecular formula C.sub.23H.sub.24O.sub.8). In some examples, the
small molecule inhibitor of Akt is UCN-01 (also known as
7-hydroxystaurosporine and
8,12-epoxy-1H,8H-2,7b,12a-triazadibenzo[a,g]cyclonona[cde]trinden-1-one,
2,3,9,10,11,12-hexahydro-3-hydroxy-9-methoxy-8-methyl-10-(methylamino)).
UCN-01 is a synthetic derivative of staurosporine with
antineoplastic activity. Antisense compounds specific for members
for the PI3K/Akt pathway have been previously described. For
example, U.S. Patent Application Publication Nos. 2005/02772682 and
2004/0077580 disclose siRNAs and antisense oligonucleotides
specific for PI3K. In addition, U.S. Patent Application Publication
Nos. 2008/0161547, 2004/0265999 and 2003/0148974 describe antisense
oligonucleotide and siRNA compounds that target AKT. Antibodies
specific for members of the PI3K/Akt pathway have been described in
the art and are commercially available from a variety of sources.
For example, PI3K antibodies are disclosed in U.S. Patent
Application Publication No. 2008/0014598.
[0117] Polymorphism: Variant in a sequence of a gene, or any
genomic sequence, usually carried from one generation to another in
a population. Polymorphisms can be those variations (nucleotide
sequence differences) that, while having a different nucleotide
sequence, produce functionally equivalent gene products, such as
those variations generally found between individuals, different
ethnic groups, and geographic locations. The term polymorphism also
encompasses variations that produce gene products with altered
function, i.e., variants in the gene sequence that lead to gene
products that are not functionally equivalent. This term also
encompasses variations that produce no gene product, an inactive
gene product, a truncated gene product, or increased or increased
activity gene product.
[0118] Polymorphisms can be referred to, for instance, by the
nucleotide position at which the variation exists, by the change in
amino acid sequence caused by the nucleotide variation, or by a
change in some other characteristic of the nucleic acid molecule or
protein that is linked to the variation (e.g., an alteration of a
secondary structure such as a stem-loop, or an alteration of the
binding affinity of the nucleic acid for associated molecules, such
as polymerases, RNAses, a change in the availability of a site for
cleavage by a restriction endonuclease, either the formation of a
new site, or lose of a site, and so forth).
[0119] Polypeptide: A polymer in which the monomers are amino acid
residues which are joined together through amide bonds. When the
amino acids are alpha-amino acids, either the L-optical isomer or
the D-optical isomer can be used. The terms "polypeptide" or
"protein" as used herein are intended to encompass any amino acid
sequence and include modified sequences such as glycoproteins. The
term "polypeptide" is specifically intended to cover naturally
occurring proteins, as well as those which are recombinantly or
synthetically produced.
[0120] The term "residue" or "amino acid residue" includes
reference to an amino acid that is incorporated into a protein,
polypeptide, or peptide.
[0121] Conservative amino acid substitutions are those
substitutions that, when made, least interfere with the properties
of the original protein, that is, the structure and especially the
function of the protein is conserved and not significantly changed
by such substitutions. Examples of conservative substitutions are
shown in the following table:
TABLE-US-00001 Original Residue Conservative Substitutions Ala Ser
Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp His Asn; Gln
Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile Phe Met;
Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu
[0122] Conservative substitutions generally maintain (a) the
structure of the polypeptide backbone in the area of the
substitution, for example, as a sheet or helical conformation, (b)
the charge or hydrophobicity of the molecule at the target site, or
(c) the bulk of the side chain.
[0123] The substitutions which in general are expected to produce
the greatest changes in protein properties will be
non-conservative, for instance changes in which (a) a hydrophilic
residue, for example, seryl or threonyl, is substituted for (or by)
a hydrophobic residue, for example, leucyl, isoleucyl,
phenylalanyl, valyl or alanyl; (b) a cysteine or proline is
substituted for (or by) any other residue; (c) a residue having an
electropositive side chain, for example, lysyl, arginyl, or
histadyl, is substituted for (or by) an electronegative residue,
for example, glutamyl or aspartyl; or (d) a residue having a bulky
side chain, for example, phenylalanine, is substituted for (or by)
one not having a side chain, for example, glycine.
[0124] Preventing, treating or ameliorating a disease: "Preventing"
a disease (such as metastatic melanoma) refers to inhibiting the
full development of a disease. "Treating" refers to a therapeutic
intervention that ameliorates a sign or symptom of a disease or
pathological condition after it has begun to develop.
"Ameliorating" refers to the reduction in the number or severity of
signs or symptoms of a disease.
[0125] Probes and primers: A probe comprises an isolated nucleic
acid capable of hybridizing to a target nucleic acid. A detectable
label or reporter molecule can be attached to a probe or primer.
Typical labels include radioactive isotopes, enzyme substrates,
co-factors, ligands, chemiluminescent or fluorescent agents,
haptens, and enzymes. Methods for labeling and guidance in the
choice of labels appropriate for various purposes are discussed,
for example in Sambrook et al. (In Molecular Cloning: A Laboratory
Manual, CSHL, New York, 1989) and Ausubel et al. (In Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
1998). In some embodiments, an "oligonucleotide" is a probe or
primer.
[0126] In a particular example, a probe includes at least one
fluorophore, such as an acceptor fluorophore or donor fluorophore.
For example, a fluorophore can be attached at the 5'- or 3'-end of
the probe. In specific examples, the fluorophore is attached to the
base at the 5'-end of the probe, the base at its 3'-end, the
phosphate group at its 5'-end or a modified base, such as a T
internal to the probe.
[0127] Probes are generally at least 15 nucleotides in length, such
as at least 15, at least 16, at least 17, at least 18, at least 19,
least 20, at least 21, at least 22, at least 23, at least 24, at
least 25, at least 26, at least 27, at least 28, at least 29, at
least 30, at least 31, at least 32, at least 33, at least 34, at
least 35, at least 36, at least 37, at least 38, at least 39, at
least 40, at least 41, at least 42, at least 43, at least 44, at
least 45, at least 46, at least 47, at least 48, at least 49, at
least 50 at least 51, at least 52, at least 53, at least 54, at
least 55, at least 56, at least 57, at least 58, at least 59, at
least 60, at least 61, at least 62, at least 63, at least 64, at
least 65, at least 66, at least 67, at least 68, at least 69, at
least 70, or more contiguous nucleotides complementary to the
target nucleic acid molecule, such as 15-70 nucleotides, 15-60
nucleotides, 15-50 nucleotides, 15-40 nucleotides, or 15-30
nucleotides.
[0128] Primers are short nucleic acid molecules, for instance DNA
oligonucleotides 10 nucleotides or more in length, which can be
annealed to a complementary target nucleic acid molecule by nucleic
acid hybridization to form a hybrid between the primer and the
target nucleic acid strand. A primer can be extended along the
target nucleic acid molecule by a polymerase enzyme. Therefore,
primers can be used to amplify a target nucleic acid molecule.
[0129] The specificity of a primer increases with its length. Thus,
for example, a primer that includes 30 consecutive nucleotides will
anneal to a target sequence with a higher specificity than a
corresponding primer of only 15 nucleotides. Thus, to obtain
greater specificity, probes and primers can be selected that
include at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or
more consecutive nucleotides. In particular examples, a primer is
at least 15 nucleotides in length, such as at least 15 contiguous
nucleotides complementary to a target nucleic acid molecule.
Particular lengths of primers that can be used to practice the
methods of the present disclosure include primers having at least
15, at least 16, at least 17, at least 18, at least 19, at least
20, at least 21, at least 22, at least 23, at least 24, at least
25, at least 26, at least 27, at least 28, at least 29, at least
30, at least 31, at least 32, at least 33, at least 34, at least
35, at least 36, at least 37, at least 38, at least 39, at least
40, at least 45, at least 50, at least 55, at least 60, at least
65, at least 70, or more contiguous nucleotides complementary to
the target nucleic acid molecule to be amplified, such as a primer
of 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-40
nucleotides or 15-30 nucleotides.
[0130] Primer pairs can be used for amplification of a nucleic acid
sequence, for example, by PCR, real-time PCR, or other nucleic-acid
amplification methods known in the art. An "upstream" or "forward"
primer is a primer 5' to a reference point on a nucleic acid
sequence. A "downstream" or "reverse" primer is a primer 3' to a
reference point on a nucleic acid sequence. In general, at least
one forward and one reverse primer are included in an amplification
reaction.
[0131] Nucleic acid probes and primers can be readily prepared
based on the nucleic acid molecules provided herein. It is also
appropriate to generate probes and primers based on fragments or
portions of these disclosed nucleic acid molecules, for instance
regions that encompass the identified polymorphisms of interest.
PCR primer pairs can be derived from a known sequence by using
computer programs intended for that purpose such as Primer (Version
0.5, .COPYRGT. 1991, Whitehead Institute for Biomedical Research,
Cambridge, Mass.) or PRIMER EXPRESS.RTM. Software (Applied
Biosystems, AB, Foster City, Calif.).
[0132] Prognosis: The likelihood of the clinical outcome for a
subject afflicted with a specific disease or disorder. With regard
to cancer, the prognosis is a representation of the likelihood
(probability) that the subject will survive (such as for one, two,
three, four or five years) and/or the likelihood (probability) that
the tumor will metastasize. A "poor prognosis" indicates a greater
than 50% chance that the subject will not survive to a specified
time point (such as one, two, three, four or five years), and/or a
greater than 50% chance that the tumor will metastasize. In several
examples, a poor prognosis indicates that there is a greater than
60%, 70%, 80%, or 90% chance that the subject will not survive
and/or a greater than 60%, 70%, 80% or 90% chance that the tumor
will metastasize. Conversely, a "good prognosis" indicates a
greater than 50% chance that the subject will survive to a
specified time point (such as one, two, three, for or five years),
and/or a greater than 50% chance that the tumor will not
metastasize. In several examples, a good prognosis indicates that
there is a greater than 60%, 70%, 80%, or 90% chance that the
subject will survive and/or a greater than 60%, 70%, 80% or 90%
chance that the tumor will not metastasize.
[0133] Protein tyrosine kinase (PTK): A family of proteins that
catalyze phosphorylation of tyrosine residues in target proteins.
PTKs play important roles in cellular signaling.
[0134] Ribozyme: A catalytic RNA molecule. In some cases, ribozymes
can bind to specific sites on other RNA molecules and catalyze the
hydrolysis of phosphodiester bonds in the RNA molecules.
[0135] RNA interference (RNAi): Refers to a cellular process that
inhibits expression of genes, including cellular and viral genes.
RNAi is a form of antisense-mediated gene silencing involving the
introduction of double stranded RNA-like oligonucleotides leading
to the sequence-specific reduction of RNA transcripts.
Double-stranded RNA molecules that inhibit gene expression through
the RNAi pathway include siRNAs, miRNAs, and shRNAs.
[0136] Sample: A biological specimen containing genomic DNA, RNA,
protein, or combinations thereof, obtained from a subject. Examples
include, but are not limited to, peripheral blood, urine, saliva,
tissue biopsy (such as skin tissue), surgical specimen, and autopsy
material. In one example, a sample includes a biopsy of a melanoma
tumor or a sample of normal tissue (from a subject not afflicted
with a known disease or disorder, such as a cancer-free
subject).
[0137] Screening: As used herein, "screening" refers to the process
used to evaluate and identify candidate agents that decrease kinase
activity of ERBB4 protein. In some cases, screening involves
contacting a candidate agent (such as a small molecule, peptide or
nucleic acid molecule) with cells expressing ERBB4 and testing the
effect of the agent on kinase activity of ERBB4. In some
embodiments, the cells express WT ERBB4. In other embodiments, the
cells express mutant ERBB4, such as an ERBB4 protein comprising a
mutation selected from E317K, E452K, E542K, R544W, E563K, E836K and
E872K (numbered with reference to SEQ ID NO: 2).
[0138] Short hairpin RNA (shRNA): A sequence of RNA that makes a
tight hairpin turn and can be used to silence gene expression via
the RNAi pathway. The shRNA hairpin structure is cleaved by the
cellular machinery into siRNA.
[0139] Small interfering RNA (siRNA): A double-stranded nucleic
acid molecule that modulates gene expression through the RNAi
pathway. siRNA molecules are generally 20-25 nucleotides in length
with 2-nucleotide overhangs on each 3' end. However, siRNAs can
also be blunt ended. Generally, one strand of a siRNA molecule is
at least partially complementary to a target nucleic acid, such as
a target mRNA. siRNAs are also referred to as "small inhibitory
RNAs."
[0140] Small molecule: A molecule, typically with a molecular
weight less than about 1000 Daltons, or in some embodiments, less
than about 500 Daltons, wherein the molecule is capable of
modulating, to some measurable extent, an activity of a target
molecule.
[0141] Specific hybridization: Specific hybridization refers to the
binding, duplexing, or hybridizing of a molecule only or
substantially only to a particular nucleotide sequence when that
sequence is present in a complex mixture (e.g. total cellular DNA
or RNA). Specific hybridization may also occur under conditions of
varying stringency.
[0142] Hybridization conditions resulting in particular degrees of
stringency will vary depending upon the nature of the hybridization
method of choice and the composition and length of the hybridizing
DNA used. Generally, the temperature of hybridization and the ionic
strength (especially the Na.sup.+ concentration) of the
hybridization buffer will determine the stringency of
hybridization. Calculations regarding hybridization conditions
required for attaining particular degrees of stringency are
discussed by Sambrook et al. (In: Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor, N.Y., 1989 ch. 9 and 11). By way of
illustration only, a hybridization experiment may be performed by
hybridization of a DNA molecule to a target DNA molecule which has
been electrophoresed in an agarose gel and transferred to a
nitrocellulose membrane by Southern blotting (Southern, J. Mol.
Biol. 98:503, 1975), a technique well known in the art and
described in Sambrook et al. (Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor, N.Y., 1989).
[0143] Traditional hybridization with a target nucleic acid
molecule labeled with [.sup.32P]-dCTP is generally carried out in a
solution of high ionic strength such as 6.times.SSC at a
temperature that is 20-25.degree. C. below the melting temperature,
T.sub.m, described below. For Southern hybridization experiments
where the target DNA molecule on the Southern blot contains 10 ng
of DNA or more, hybridization is typically carried out for 6-8
hours using 1-2 ng/ml radiolabeled probe (of specific activity
equal to 10.sup.9 CPM/.mu.g or greater). Following hybridization,
the nitrocellulose filter is washed to remove background
hybridization. The washing conditions should be as stringent as
possible to remove background hybridization but to retain a
specific hybridization signal.
[0144] The term T.sub.m represents the temperature (under defined
ionic strength, pH and nucleic acid concentration) at which 50% of
the probes complementary to the target sequence hybridize to the
target sequence at equilibrium. Because the target sequences are
generally present in excess, at T.sub.m 50% of the probes are
occupied at equilibrium. The T.sub.m of such a hybrid molecule may
be estimated from the following equation (Bolton and McCarthy,
Proc. Natl. Acad. Sci. USA 48:1390, 1962):
T.sub.m=81.5.degree. C.-16.6(log.sub.10[Na.sup.+])+0.41(%
G+C)-0.63(% formamide)-(600/l)
[0145] where l=the length of the hybrid in base pairs.
[0146] This equation is valid for concentrations of Na.sup.+ in the
range of 0.01 M to 0.4 M, and it is less accurate for calculations
of Tm in solutions of higher [Na.sup.+]. The equation is also
primarily valid for DNAs whose G+C content is in the range of 30%
to 75%, and it applies to hybrids greater than 100 nucleotides in
length (the behavior of oligonucleotide probes is described in
detail in Ch. 11 of Sambrook et al. (Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor, N.Y., 1989).
[0147] Thus, by way of example, for a 150 base pair DNA probe
derived from a cDNA (with a hypothetical % GC of 45%), a
calculation of hybridization conditions required to give particular
stringencies may be made as follows: For this example, it is
assumed that the filter will be washed in 0.3.times.SSC solution
following hybridization, thereby: [Na.sup.+]=0.045 M; % GC=45%;
Formamide concentration=0; l=150 base pairs;
T.sub.m=81.5-16.6(log.sub.10[Na.sup.+])+(0.41.times.45)-(600/150);
and so T.sub.m=74.4.degree. C.
[0148] The T.sub.m of double-stranded DNA decreases by
1-1.5.degree. C. with every 1% decrease in homology (Bonner et al.,
J. Mol. Biol. 81:123, 1973). Therefore, for this given example,
washing the filter in 0.3.times.SSC at 59.4-64.4.degree. C. will
produce a stringency of hybridization equivalent to 90%; that is,
DNA molecules with more than 10% sequence variation relative to the
target cDNA will not hybridize. Alternatively, washing the
hybridized filter in 0.3.times.SSC at a temperature of
65.4-68.4.degree. C. will yield a hybridization stringency of 94%;
that is, DNA molecules with more than 6% sequence variation
relative to the target cDNA molecule will not hybridize. The above
example is given entirely by way of theoretical illustration. It
will be appreciated that other hybridization techniques may be
utilized and that variations in experimental conditions will
necessitate alternative calculations for stringency.
[0149] Stringent conditions may be defined as those under which DNA
molecules with more than 25%, 15%, 10%, 6% or 2% sequence variation
(also termed "mismatch") will not hybridize. Stringent conditions
are sequence dependent and are different in different
circumstances. Longer sequences hybridize specifically at higher
temperatures. Generally, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point T.sub.m for
the specific sequence at a defined ionic strength and pH. An
example of stringent conditions is a salt concentration of at least
about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0
to 8.3 and a temperature of at least about 30.degree. C. for short
probes (e.g. 10 to 50 nucleotides). Stringent conditions can also
be achieved with the addition of destabilizing agents such as
formamide. For example, conditions of 5.times.SSPE (750 mM NaCl, 50
mM Na Phosphate, 5 mM EDTA, pH 7.4) and a temperature of
25-30.degree. C. are suitable for allele-specific probe
hybridizations.
[0150] The following is an exemplary set of hybridization
conditions and is not meant to be limiting:
TABLE-US-00002 Very High Stringency (detects sequences that share
at least 90% identity) Hybridization: 5x SSC at 65.degree. C. for
16 hours Wash twice: 2x SSC at room temperature (RT) for 15 minutes
each Wash twice: 0.5x SSC at 65.degree. C. for 20 minutes each
TABLE-US-00003 High Stringency (detects sequences that share 80%
identity or greater) Hybridization: 5x-6x SSC at 65.degree.
C.-70.degree. C. for 16-20 hours Wash twice: 2x SSC at RT for 5-20
minutes each Wash twice: 1x SSC at 55.degree. C.-70.degree. C. for
30 minutes each
TABLE-US-00004 Low Stringency (detects sequences that share greater
than 50% identity) Hybridization: 6x SSC at RT to 55.degree. C. for
16-20 hours Wash at least twice: 2x-3x SSC at RT to 55.degree. C.
for 20-30 minutes each.
[0151] A perfectly matched probe has a sequence perfectly
complementary to a particular target sequence. The test probe is
typically perfectly complementary to a portion (subsequence) of the
target sequence. The term "mismatch probe" refers to probes whose
sequence is deliberately selected not to be perfectly complementary
to a particular target sequence.
[0152] Therapeutic: A generic term that includes both diagnosis and
treatment.
[0153] Therapeutic agent: A chemical compound, small molecule, or
other composition, such as an antisense compound, antibody,
peptide, nucleic acid molecule, protease inhibitor, hormone,
chemokine or cytokine, capable of inducing a desired therapeutic or
prophylactic effect when properly administered to a subject. For
example, therapeutic agents for melanoma include agents that
prevent or inhibit development or metastasis of melanoma. As used
herein, a "candidate agent" is a compound selected for screening to
determine if it can function as a therapeutic agent for melanoma.
In some embodiments, a "candidate agent" is an agent screened to
determine if is capable of increasing kinase activity of ERBB4.
"Incubating" includes a sufficient amount of time for an agent to
interact with a cell or tissue. "Contacting" includes incubating an
agent in solid or in liquid form with a cell or tissue. "Treating,"
when used to refer to the treatment of a cell or tissue with a
therapeutic agent, includes contacting or incubating an agent with
the cell or tissue.
[0154] Transformation: Refers to the transition of a normal cell to
a malignant cell.
[0155] Tumor, neoplasia, malignancy or cancer: A neoplasm is an
abnormal growth of tissue or cells that results from excessive cell
division. Neoplastic growth can produce a tumor. The amount of a
tumor in an individual is the "tumor burden" which can be measured
as the number, volume, or weight of the tumor. A tumor that does
not metastasize is referred to as "benign." A tumor that invades
the surrounding tissue and/or can metastasize is referred to as
"malignant." A "non-cancerous tissue" is a tissue from the same
organ wherein the malignant neoplasm formed, but does not have the
characteristic pathology of the neoplasm. Generally, noncancerous
tissue appears histologically normal. A "normal tissue" is tissue
from an organ, wherein the organ is not affected by cancer or
another disease or disorder of that organ. A "cancer-free" subject
has not been diagnosed with a cancer of that organ and does not
have detectable cancer.
[0156] UCN-01 (7-hydroxystaurosporine): A synthetic derivative of
staurosporine with antineoplastic activity. UCN-01 inhibits many
phosphokinases, including AKT, calcium-dependent protein kinase C,
and cyclin-dependent kinases. The chemical structure name of UCN-01
is 8,12-epoxy-1H,8H-2,7b,12a-triazadibenzo[a,
g]cyclonona[cde]trinden-1-one,
2,3,9,10,11,12-hexahydro-3-hydroxy-9-methoxy-8-methyl-10-(methylamino).
[0157] Wortmannin: A furanosteroid metabolite of the fungi
Penicillium funiculosum, Talaromyces (Penicillium) wortmannii, is a
specific, covalent inhibitor of PI3K. The molecular formula of
wortmannin is C.sub.23H.sub.24O.sub.8.
[0158] Unless otherwise explained, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this disclosure belongs.
The singular terms "a," "an," and "the" include plural referents
unless context clearly indicates otherwise. Similarly, the word
"or" is intended to include "and" unless the context clearly
indicates otherwise. Hence "comprising A or B" means including A,
or B, or A and B. It is further to be understood that all base
sizes or amino acid sizes, and all molecular weight or molecular
mass values, given for nucleic acids or polypeptides are
approximate, and are provided for description. Although methods and
materials similar or equivalent to those described herein can be
used in the practice or testing of the present disclosure, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including explanations of terms, will
control. In addition, the materials, methods, and examples are
illustrative only and not intended to be limiting.
IV. Overview of Several Embodiments
[0159] It is disclosed herein that melanoma patients exhibit a
number of different mutations in PTK family members (see Table 4).
In particular, it is demonstrated that ERBB4 is highly mutated in
metastatic melanoma. Described herein are novel ERBB4 mutations,
which result in expression of ERBB4 protein with increased kinase
activity. In addition, cells expressing mutant ERBB4 exhibit
transformation capacity. The ERBB4 mutations disclosed herein also
activate the PI3K/AKT pathway.
[0160] Provided herein is a method of predicting the prognosis of a
subject diagnosed with melanoma, comprising detecting the presence
or absence of a mutation in the ERBB4 gene, wherein the presence of
a mutation in the ERBB4 gene predicts a poor prognosis. A poor
prognosis refers to any negative clinical outcome. For example, in
some embodiments, a poor prognosis is an increase in the likelihood
of death. In some embodiments, a poor prognosis is an increase in
the likelihood of metastasis of the melanoma.
[0161] Further provided is a method of selecting a subject
diagnosed with melanoma as a candidate for treatment with an ERBB4
inhibitor, a PI3K/AKT pathway inhibitor, or both, comprising
detecting the presence or absence of a mutation in the ERBB4 gene,
wherein the presence of a mutation in the ERBB4 gene indicates that
the subject is a candidate for treatment with an ERBB4 inhibitor, a
PI3K/AKT pathway inhibitor, or both.
[0162] In particular examples, the ERBB4 mutation is selected from
G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbered
with reference to SEQ ID NO: 1).
[0163] In some embodiments, the method further comprises
administering to the subject an ERBB4 inhibitor, a PI3K/AKT pathway
inhibitor, or both. In some examples, the ERBB4 inhibitor is
lapatinib. Agents that decrease expression or activity of ERBB4 or
a member of the PI3K/AKT pathway (such as, but not limited to, AKT
or PI3K) are known in the art, some of which are described
herein.
[0164] In some embodiments of the methods, the ERBB4 mutation
results in an increase in kinase activity of the ERBB4 protein. In
particular examples, the ERBB4 mutation introduces an amino acid
change selected from E317K, E452K, E542K, R544W, E563K, E836K and
E872K (numbered with reference to SEQ ID NO: 2).
[0165] Methods of detecting mutations in a gene are well known in
the art. Detection of one or more mutations in the ERBB4 gene can
be accomplished using any suitable technique, such as those
described in detail in the sections below. For example,
ERBB4-specific primers can be used to amplify ERBB4 nucleic acid
from a biological sample (such as a tumor tissue sample or blood
sample). The amplified molecule can then be sequenced and compared
to a reference ERBB4 sequence (such as SEQ ID NO: 1), or compared
with ERBB4 from a control sample such as a non-cancerous tissue
sample, to detect a mutation in ERBB4. ERBB4 amplification primers
and sequencing primers can be designed according to well known
methods. Examples of ERBB4 primers are provided in Table 1 and
Table 3 (SEQ ID NOs: 3-60 and 64-77). Mutations in ERBB4 can also
be detected using oligonucleotides that specifically hybridize with
a particular mutation. Hybridization of such oligonucleotides can
be detected by labeling the oligonucleotide with a detectable
marker, such as a fluorescent marker, enzymatic marker or
radioisotope.
[0166] For detection of ERBB4 mutations, nucleic acid (such as DNA
or RNA) can be isolated from a biological sample according to well
known methods. In some embodiments, the biological sample is tissue
sample, such as a tumor tissue sample. In other embodiments, the
biological sample is a fluid sample, such as blood. For example,
nucleic acid can be isolated from cells obtained from a blood
sample. In some embodiments, the biological sample is obtained from
a patient diagnosed with melanoma. In some embodiments, the
biological sample is obtained from a control subject.
[0167] Also provided is a method of identifying a therapeutic agent
for the treatment of a subject diagnosed with melanoma, comprising
screening candidate agents to select an agent that decreases
activity (such as kinase activity) of ERBB4, thereby identifying a
therapeutic agent for the treatment of a subject with melanoma. In
particular examples, the ERBB4 mutation is selected from G949A,
G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbered with
reference to SEQ ID NO: 1).
[0168] In some embodiments, the candidate agent is a small
molecule, polypeptide (such as an antibody) or nucleic acid
molecule (such as an antisense compound, including antisense
oligonucleotides, siRNAs or ribozymes). In some examples, screening
comprises contacting the candidate agents with cells expressing
ERBB4. In some embodiments, the cells express WT ERBB4. In other
embodiments, the cells express ERBB4 protein comprising a mutation
selected from E317K, E452K, E542K, R544W, E563K, E836K and E872K
(numbered with reference to SEQ ID NO: 2). In some embodiments, the
therapeutic agent increases kinase activity of ERBB4 at least
2-fold, at least 3-fold, at least 4-fold or at least 5-fold
relative to untreated cells.
[0169] Further provided is a method of identifying a therapeutic
agent for the treatment of a subject diagnosed with melanoma,
comprising screening candidate agents to select an agent that
decreases expression or activity of a member of the PI3K/AKT
pathway, thereby identifying a therapeutic agent for the treatment
of a subject with melanoma. In some cases, the agent decreases
activity of AKT, such as by reducing phosphorylation of AKT. In
some embodiments, the candidate agent is a small molecule,
polypeptide (such as an antibody) or nucleic acid molecule (such as
an antisense compound, including antisense oligonucleotides, siRNAs
or ribozymes).
[0170] Further provided herein are oligonucleotides that
specifically hybridize with an ERBB4 nucleic acid molecule, wherein
the ERBB4 nucleic acid molecule comprises a mutation selected from
G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbered
with reference to SEQ ID NO: 1). In some embodiments, the
oligonucleotide is about 15 to about 40 nucleotides in length. In
some embodiments, the oligonucleotide comprises a label, such as,
but not limited to a fluorescent label, an enzymatic label or a
radioisotope.
[0171] Also provided are arrays comprising one or more
oligonucleotides that specifically hybridize with an ERBB4 nucleic
acid molecule, wherein the ERBB4 nucleic acid molecule comprises a
mutation selected from G949A, G1354A, G1624A, C1630T, G1687A,
G2506A and G2614A (numbered with reference to SEQ ID NO: 1). In
some embodiments, the array is a microarray.
V. Methods of Detecting ERBB4 Mutations
[0172] Disclosed herein is the identification of novel mutations in
ERBB4, which result in expression of ERBB4 protein with enhanced
kinase activity. Seven mutations in human ERBB4 were identified,
including G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A
(numbered with reference to SEQ ID NO: 1).
[0173] Detecting mutations in ERBB4 can be accomplished using any
technique known in the art. For example, the presence or absence of
an ERBB4 mutation can be determined by conventional methods such as
gene or RNA detection methods (for example, DNA sequencing,
oligonucleotide hybridization, polymerase chain reaction (PCR)
amplification with primers specific to the mutation), or protein
detection methods (for example, immunoassays or biochemical assays
to identify a mutated ERBB4 protein, such as an ERBB4 with
decreased kinase activity or increased cell migration capacity).
Generally, the nucleic acid sequence of the ERBB4 gene or RNA in a
sample can be detected by any suitable method or technique of
detecting gene sequence. Such methods include, but are not limited
to, PCR, reverse transcriptase-PCR (RT-PCR), in situ PCR, in situ
hybridization, Southern blot, Northern blot, sequence analysis,
microarray analysis, or other DNA/RNA hybridization platforms.
[0174] Detection of point mutations in target nucleic acids can be
accomplished by molecular cloning of the target nucleic acid
molecules and sequencing the nucleic acid molecules using
techniques well known in the art. Alternatively, amplification
techniques such as PCR can be used to amplify target nucleic acid
sequences directly from a genomic DNA preparation from a tumor
tissue or cell sample. The nucleic acid sequence of the amplified
molecules can then be determined to identify mutations.
Representative primer pairs that can be used to amplify ERBB4
nucleic acid from a biological sample are provided in Tables 1 and
3 (SEQ ID NOs: 3-60 and 64-77). However, design and selection of
appropriate primers is well within the abilities of one of ordinary
skill in the art.
[0175] The ligase chain reaction (Wu et al., Genomics 4:560-569,
1989) and allele-specific PCR (Ruano and Kidd, Nucleic Acids Res.
17:8392, 1989) can also be used to amplify target nucleic acid
sequences. Amplification by allele-specific PCR uses primers that
hybridize at their 3' ends to a particular target nucleic acid
mutation. If the particular mutation is not present, an
amplification product is not observed. Amplification Refractory
Mutation System can also be used to detect mutations in nucleic
acid sequences (U.S. Pat. No. 5,595,890; Newton et al., Nucleic
Acids Res. 17:2503-2516, 1989). Insertions and deletions of genes
can also be detected by cloning, sequencing and amplification. In
addition, restriction fragment length polymorphism probes for the
gene or surrounding marker genes can be used to score alteration of
an allele or an insertion in a polymorphic fragment. Single
stranded conformation polymorphism analysis can also be used to
detect base change variants of an allele (Orita et al., Proc. Natl.
Acad. Sci. USA 86:2766-2770, 1989). Other known techniques for
detecting insertions and deletions can also be used with the
claimed methods.
[0176] Mismatch detection can be used to detect point mutations in
a target nucleic acid molecule, such as ERBB4. Mismatches are
hybridized nucleic acid duplexes which are not 100% complementary.
The lack of total complementarity can be due to deletions,
insertions, inversions, substitutions or frameshift mutations. An
example of a mismatch cleavage technique is the RNase protection
method, which is described in detail in Winter et al. (Proc. Natl.
Acad. Sci. USA 82:7575-7579, 1985) and Myers et al. (Science
230:1242-1246, 1985). For example, detection of mutations in ERBB4
can involve the use of a labeled riboprobe that is complementary to
wild-type ERBB4. The riboprobe and nucleic acid molecule to be
tested (for example, obtained from a tumor sample) are annealed
(hybridized) together and subsequently digested with the enzyme
RNase A, which is able to detect mismatches in a duplex RNA
structure. If a mismatch is detected by RNase A, it cleaves at the
site of the mismatch. Thus, when the annealed RNA preparation is
separated on an electrophoretic gel matrix, if a mismatch has been
detected and cleaved by RNase A, an RNA product will be seen which
is smaller than the full-length duplex RNA for the riboprobe and
the mRNA or DNA. The riboprobe need not be the full length of the
target nucleic acid mRNA or gene, but can a portion of the target
nucleic acid, provided it encompasses the position suspected of
being mutated. If the riboprobe comprises only a segment of the
target nucleic acid mRNA or gene, it may be desirable to use a
number of these probes to screen the whole target nucleic acid
sequence for mismatches if desired.
[0177] In a similar manner, DNA probes can be used to detect
mismatches, for example through enzymatic or chemical cleavage
(Cotton et al., Proc. Natl. Acad. Sci. USA 85: 4397-4401, 1988;
Shenk et al., Proc. Natl. Acad. Sci. USA 72:989-993, 1975).
Alternatively, mismatches can be detected by shifts in the
electrophoretic mobility of mismatched duplexes relative to matched
duplexes (Cariello, Am. J. Hum. Genet. 42:726-734, 1988). With
either riboprobes or DNA probes, the target nucleic acid mRNA or
DNA which may contain a mutation can be amplified before
hybridization. Changes in target nucleic acid DNA can also be
detected using Southern hybridization, especially if the changes
are gross rearrangements, such as deletions and insertions.
[0178] Amplified nucleic acid sequences can also be screened using
allele-specific probes. These probes are nucleic acid oligomers,
each of which contains a region of the target nucleic acid gene
harboring a known mutation. For example, one oligomer may be about
30 nucleotides in length, corresponding to a portion of the target
gene sequence. By use of a battery of such allele-specific probes,
target nucleic acid amplification products can be screened to
identify the presence of a previously identified mutation in the
target gene. Hybridization of allele-specific probes with amplified
target nucleic acid sequences can be performed, for example, on a
nylon filter. Hybridization to a particular probe under stringent
hybridization conditions indicates the presence of the same
mutation in the tumor tissue as in the allele-specific probe.
[0179] The ERBB4 primer pairs disclosed herein are useful for
determination of the nucleotide sequence of a target nucleic acid
using nucleic acid amplification techniques such as the polymerase
chain reaction. The pairs of single stranded DNA primers can be
annealed to sequences within or surrounding the target nucleic acid
sequence in order to prime amplification of the target sequence.
Allele-specific primers can also be used. Such primers anneal only
to particular mutant target sequence, and thus will only amplify a
product in the presence of the mutant target sequence as a
template. In order to facilitate subsequent cloning of amplified
sequences, primers may have restriction enzyme site sequences
appended to their ends. Such enzymes and sites are well known in
the art. The primers themselves can be synthesized using techniques
which are well known in the art. Generally, the primers can be made
using oligonucleotide synthesizing machines which are commercially
available. Design of particular primers is well within the skill of
the art.
[0180] Nucleic acid probes that hybridize with an ERBB4 nucleic
acid molecule, such as a wild-type ERBB4 nucleic acid molecule or a
mutant ERBB4 nucleic acid molecule described herein, are useful for
a number of purposes. They can be used in Southern hybridization to
genomic DNA and in RNase protection assays for detecting point
mutations. The probes can also be used to detect target nucleic
acid amplification products. ERBB4 probes can also be used to
detect mismatches with the wild type gene or mRNA using other
techniques. Mismatches can be detected using either enzymes (e.g.,
S1 nuclease), chemicals (e.g., hydroxylamine or osmium tetroxide
and piperidine), or changes in electrophoretic mobility of
mismatched hybrids as compared to totally matched hybrids (Novack
et al., Proc. Natl. Acad. Sci. USA 83:586, 1986).
[0181] Mutations in nucleic acid molecules can also be detected by
screening for alteration of the corresponding protein. For example,
monoclonal antibodies immunoreactive with a target gene product can
be used to screen a tissue, for example an antibody that is known
to bind to a particular mutated position of the gene product
(protein). For example, a suitable antibody may be one that binds
to a deleted exon or that binds to a conformational epitope
comprising a deleted portion of the target protein. Lack of cognate
antigen would indicate a mutation. Such immunological assays can be
accomplished using any convenient format known in the art, such as
Western blot, immunohistochemical assay and enzyme-linked
immunosorbent assay (ELISA). In some embodiments, the ERBB4 amino
acid mutation is selected from E317K, E452K, E542K, R544W, E563K,
E836K and E872K (numbered with reference to SEQ ID NO: 2).
VI. Arrays
[0182] In particular embodiments provided herein, arrays can be
used to evaluate the presence or absence of mutations in ERBB4. In
some examples, the array comprises an oligonucleotide that
specifically hybridizes with an ERBB4 nucleic acid molecule
comprising a mutation selection from G949A, G1354A, G1624A, C1630T,
G1687A, G2506A and G2614A (numbered with reference to SEQ ID NO:
1). Oligonucleotides that specifically hybridize with an ERBB4
nucleic acid comprising a mutation do not hybridize to WT ERBB4, or
hybridization of the oligonucleotide to WT ERBB4 is significantly
weaker than hybridization to the mutant ERBB4. In some embodiments
the array comprises two or more oligonucleotides that specifically
hybridize with an ERBB4 nucleic acid comprising a mutation selected
from G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A
(numbered with reference to SEQ ID NO: 1). In other embodiments,
the array comprises oligonucleotides that specifically hybridize
with ERBB4 nucleic acid molecules comprising each mutation of
G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbered
with reference to SEQ ID NO: 1). In some examples, the array
further comprises other oligonucleotides, such as control
oligonucleotides or oligonucleotides that specifically hybridize
with WT ERBB4 or other mutant ERBB4 nucleic acid molecules.
Exemplary control oligonucleotide probes include GAPDH, actin, and
YWHAZ.
[0183] The oligonucleotide probes can further include one or more
detectable labels, to permit detection of hybridization signals
between the probe and target sequence (such as one of the mutant
ERBB4 nucleic acid molecules).
Array Substrates
[0184] The solid support of the array can be formed from an organic
polymer. Suitable materials for the solid support include, but are
not limited to: polypropylene, polyethylene, polybutylene,
polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine,
polytetrafluoroethylene, polyvinylidene difluoroide,
polyfluoroethylene-propylene, polyethylenevinyl alcohol,
polymethylpentene, polycholorotrifluoroethylene, polysulformes,
hydroxylated biaxially oriented polypropylene, aminated biaxially
oriented polypropylene, thiolated biaxially oriented polypropylene,
etyleneacrylic acid, thylene methacrylic acid, and blends of
copolymers thereof (see U.S. Pat. No. 5,985,567).
[0185] In general, suitable characteristics of the material that
can be used to form the solid support surface include: being
amenable to surface activation such that upon activation, the
surface of the support is capable of covalently attaching a
biomolecule such as an oligonucleotide thereto; amenability to "in
situ" synthesis of biomolecules; being chemically inert such that
at the areas on the support not occupied by the oligonucleotides
are not amenable to non-specific binding, or when non-specific
binding occurs, such materials can be readily removed from the
surface without removing the oligonucleotides.
[0186] In one example, the solid support surface is polypropylene.
Polypropylene is chemically inert and hydrophobic. Non-specific
binding is generally avoidable, and detection sensitivity is
improved. Polypropylene has good chemical resistance to a variety
of organic acids (such as formic acid), organic agents (such as
acetone or ethanol), bases (such as sodium hydroxide), salts (such
as sodium chloride), oxidizing agents (such as peracetic acid), and
mineral acids (such as hydrochloric acid). Polypropylene also
provides a low fluorescence background, which minimizes background
interference and increases the sensitivity of the signal of
interest.
[0187] In another example, a surface activated organic polymer is
used as the solid support surface. One example of a surface
activated organic polymer is a polypropylene material aminated via
radio frequency plasma discharge. Such materials are easily
utilized for the attachment of nucleotide molecules. The amine
groups on the activated organic polymers are reactive with
nucleotide molecules such that the nucleotide molecules can be
bound to the polymers. Other reactive groups can also be used, such
as carboxylated, hydroxylated, thiolated, or active ester
groups.
Array Formats
[0188] A wide variety of array formats can be employed in
accordance with the present disclosure. One example includes a
linear array of oligonucleotide bands, generally referred to in the
art as a dipstick. Another suitable format includes a
two-dimensional pattern of discrete cells (such as 4096 squares in
a 64 by 64 array). As is appreciated by those skilled in the art,
other array formats including, but not limited to slot
(rectangular) and circular arrays are equally suitable for use (see
U.S. Pat. No. 5,981,185). In some examples, the array is a
multi-well plate. In one example, the array is formed on a polymer
medium, which is a thread, membrane or film. An example of an
organic polymer medium is a polypropylene sheet having a thickness
on the order of about 1 mil. (0.001 inch) to about 20 mil.,
although the thickness of the film is not critical and can be
varied over a fairly broad range. The array can include biaxially
oriented polypropylene (BOPP) films, which in addition to their
durability, exhibit low background fluorescence.
[0189] The array formats of the present disclosure can be included
in a variety of different types of formats. A "format" includes any
format to which the solid support can be affixed, such as
microtiter plates (e.g. multi-well plates), test tubes, inorganic
sheets, dipsticks, and the like. For example, when the solid
support is a polypropylene thread, one or more polypropylene
threads can be affixed to a plastic dipstick-type device;
polypropylene membranes can be affixed to glass slides. The
particular format is, in and of itself, unimportant. All that is
necessary is that the solid support can be affixed thereto without
affecting the functional behavior of the solid support or any
biopolymer absorbed thereon, and that the format (such as the
dipstick or slide) is stable to any materials into which the device
is introduced (such as clinical samples and hybridization
solutions).
[0190] The arrays of the present disclosure can be prepared by a
variety of approaches. In one example, oligonucleotide sequences
are synthesized separately and then attached to a solid support
(see U.S. Pat. No. 6,013,789). In another example, sequences are
synthesized directly onto the support to provide the desired array
(see U.S. Pat. No. 5,554,501). Suitable methods for covalently
coupling oligonucleotides to a solid support and for directly
synthesizing the oligonucleotides onto the support are known to
those working in the field; a summary of suitable methods can be
found in Matson et al. (Anal. Biochem. 217:306-10, 1994). In one
example, the oligonucleotides are synthesized onto the support
using conventional chemical techniques for preparing
oligonucleotides on solid supports (such as see International
application publications WO 85/01051 and WO 89/10977, or U.S. Pat.
No. 5,554,501).
[0191] A suitable array can be produced using automated means to
synthesize oligonucleotides in the cells of the array by laying
down the precursors for the four bases in a predetermined pattern.
Briefly, a multiple-channel automated chemical delivery system is
employed to create oligonucleotide probe populations in parallel
rows (corresponding in number to the number of channels in the
delivery system) across the substrate. Following completion of
oligonucleotide synthesis in a first direction, the substrate can
then be rotated by 90.degree. to permit synthesis to proceed within
a second (2.degree.) set of rows that are now perpendicular to the
first set. This process creates a multiple-channel array whose
intersection generates a plurality of discrete cells.
[0192] The oligonucleotides can be bound to the polypropylene
support by either the 3' end of the oligonucleotide or by the 5'
end of the oligonucleotide. In one example, the oligonucleotides
are bound to the solid support by the 3' end. However, one of skill
in the art can determine whether the use of the 3' end or the 5'
end of the oligonucleotide is suitable for bonding to the solid
support. In general, the internal complementarity of an
oligonucleotide probe in the region of the 3' end and the 5' end
determines binding to the support.
[0193] In particular examples, the oligonucleotide probes on the
array include one or more labels, that permit detection of
oligonucleotide probe:target sequence hybridization complexes.
VII. Use of ERBB4 for Prognosis and Therapy
[0194] It is disclosed herein that ERBB4 is highly mutated in
melanoma tumors. The disclosed ERBB4 somatic mutations result in
increased ERBB4 kinase activity, transformation capacity and
anchorage-independent growth. The high frequency of mutations
identified in ERBB4, their co-localization, and the identification
of two identical missense mutations (E452K and E872K) in multiple
MM samples indicates these mutations play a role in tumorigenesis.
In addition, the ERBB4 mutations disclosed herein exhibit
ligand-independent basal phosphorylation, providing evidence that
these mutations are oncogenic. Accordingly, the identified
mutations in ERBB4 predict a poor prognosis for patients with
melanoma. In some embodiments, a poor prognosis is an increase in
the likelihood of death. In some embodiments, a poor prognosis is
an increase in metastasis.
[0195] The detection of one or more ERBB4 mutations selected from
G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbered
with reference to SEQ ID NO: 1) can be used as a clinical tool to
determine the prognosis of a patient with melanoma. Since these
mutations are oncogenic and play a role in tumorigenesis of MM, a
poor prognosis is indicated when one or more of the mutations is
detected in a sample from a subject diagnosed with melanoma.
Detection of one or more of these mutations can also be used as a
tool for determining an appropriate therapy for a subject with
melanoma. The presence of one or more of these mutations indicates
the subject is a candidate for treatment with a kinase inhibitor,
such an EGFR family inhibitor, or more particularly, an
ERBB4-specific inhibitor. In some examples, the ERBB4 mutation
introduces an amino acid change selected from E317K, E452K, E542K,
R544W, E563K, E836K and E872K (numbered with reference to SEQ ID
NO: 2).
[0196] It is also disclosed herein that mutations in ERBB4 activate
the PI3K/AKT pathway, as indicated by increased phosphorylation of
AKT in melanoma cells harboring the disclosed ERBB4 mutations.
Thus, the presence of one or more ERBB4 mutations indicates the
subject is a candidate for treatment with an inhibitor of the
PI3K/AKT pathway, such as an inhibitor of PI3K or AKT. In some
embodiments, the method of selecting a patient as a candidate for
treatment with an ERBB4 and/or PI3K/AKT pathway inhibitor further
includes treating the subject with an ERBB4 inhibitor, a PI3K/AKT
pathway inhibitor, or both.
[0197] The finding that the presence of prognosis-associated ERBB4
mutations selected from G949A, G1354A, G1624A, C1630T, G1687A,
G2506A and G2614A (numbered with reference to SEQ ID NO: 1) result
in an increase in kinase activity, transformation capacity and/or
anchorage-independent growth indicates that compounds that inhibit
(such as decrease kinase activity of) ERBB4 will be useful as
therapeutic agents for the treatment of melanoma. Thus, provided
herein is a method of identifying therapeutic agents for the
treatment of melanoma, comprising screening candidate agents to
select an agent that inhibits activity (such as kinase activity) or
expression of ERBB4.
[0198] In some embodiments, screening comprises contacting the
candidate agents with cells that express ERBB4 and detecting any
change in activity or expression of ERBB4. The ERBB4 expressing
cells can be primary cells obtained from a subject diagnosed with
melanoma, immortalized or transformed cells obtained from a
melanoma patient, or the cells can be commercially available
immortalized cell lines. In some embodiments, the cells express
wild-type ERBB4. In other embodiments, the cells express mutant
ERBB4, such as ERBB4 with a mutation selection from G949A, G1354A,
G1624A, C1630T, G1687A, G2506A and G2614A (numbered with reference
to SEQ ID NO: 1). In some examples, a cell line is transfected with
an expression vector encoding wild-type or mutant ERBB4. In other
examples, primary tumor cells expressing mutant ERBB4 are
evaluated. In either case, the cells are either untreated or
treated with a candidate agent and ERBB4 kinase activity is
measured, for example by incorporation of radiolabeled ATP. A
decrease in ERBB4 activity in the treated cells, compared to the
untreated cells, indicates the candidate agent is a therapeutic
agent for melanoma.
[0199] In some embodiments, a decrease in kinase activity of ERBB4
following treatment with the candidate agent identifies the agent
as a therapeutic agent for the treatment of melanoma. In some
embodiments, the therapeutic agent decreases kinase activity of
ERBB4 at least 2-fold, at least 3-fold, at least 4-fold or at least
5-fold relative to untreated cells. Methods of screening candidate
agents to identify therapeutic agents for the treatment of disease
are well known in the art. In one embodiment, screening comprises a
high-throughput screen. In another embodiment, candidate agents are
screened individually.
[0200] Given the finding that mutations in ERBB4 result in
activation of the PI3K/AKT pathway, provided herein is a method of
identifying therapeutic agents for the treatment of melanoma,
comprising screening candidate agents to select an agent that
inhibits activity or expression of a member of the PI3K/AKT
pathway, such as PI3K or AKT. In some embodiments, screening
comprises contacting the candidate agents with cells that express
mutant ERBB4 and detecting any change in activity or expression of
a member of the PI3K/AKT pathway. The mutant ERBB4 expressing cells
can be primary cells obtained from a subject diagnosed with
melanoma, immortalized or transformed cells obtained from a
melanoma patient, or the cells can be commercially available
immortalized cell lines. In some embodiments, the cells express
ERBB4 with a mutation selection from G949A, G1354A, G1624A, C1630T,
G1687A, G2506A and G2614A (numbered with reference to SEQ ID NO:
1). In some examples, a cell line is transfected with an expression
vector encoding mutant ERBB4. In other examples, primary tumor
cells expressing mutant ERBB4 are evaluated. In either case, the
cells are either untreated or treated with a candidate agent and
PI3K/AKT activity is measured. In some examples, PI3K/AKT activity
is measured by detecting the level of AKT phosphorylation. A
decrease in PI3K/AKT activity in the treated cells, compared to the
untreated cells, indicates the candidate agent is a therapeutic
agent for melanoma.
[0201] The candidate agents can be any type of molecule, such as,
but not limited to nucleic acid molecules, proteins, polypeptides,
antibodies, lipids, small molecules, chemicals, cytokines,
chemokines, hormones, or any other type of molecule that may alter
ERBB4 or PI3K/AKT activity either directly or indirectly. In some
embodiments, the candidate agents are small molecules, polypeptides
(such as antibodies) or nucleic acid molecules (such as antisense
compounds, including antisense oligonucleotides, siRNAs or
ribozymes).
[0202] The following examples are provided to illustrate certain
particular features and/or embodiments. These examples should not
be construed to limit the disclosure to the particular features or
embodiments described.
EXAMPLES
Example 1
Experimental Procedures
[0203] This example describes the materials and methods used for
the experiments described in Examples 2-6.
Amplification, Sequencing and Mutational Analysis of ERBB4
[0204] Metastatic melanoma samples and their matched normal samples
were obtained according to standard procedures. Genomic DNA was
isolated using DNeasy.TM. Blood & Tissue kit (Qiagen, Valencia,
Calif.). For all samples, matching between germline and tumor DNA
was verified by direct sequencing of 26 single nucleotide
polymorphisms (SNPs) at 24 loci. The tissue and melanoma cell lines
used in the Examples below are also described in Palavalli et al.
(Nat. Genet. 41:518-520, 2009).
[0205] PCR and sequencing primers were designed using Primer 3
(available online at
frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and synthesized
by Invitrogen (Carlsbad, Calif.). The primers used for PCR
amplification of the whole coding region of ERBB4 are shown in
Table 1 (CCDS accession CCDS2394.1; GenBank Accession No.
NM.sub.--005235; SEQ ID NO: 1). The coding region of ERBB4 was
sequenced using a primer with the following sequence:
GTAAAACGACGGCCAGT (SEQ ID NO: 61). PCR amplification, sequencing
and analysis were performed as previously described (Samuels et
al., Science 304:554, 2004). Briefly, PCR products were purified
using exonuclease (Epicentre Biotechnologies, Madison, Wis.) and
shrimp alkaline phosphatase (USB Corporation, Cleveland, Ohio).
Products were purified with rehydrated Sephadex.TM. G-50 powder (GE
Healthcare, Piscataway, N.J.) and cycle sequencing was carried out
using BigDye Terminator.TM. v3.1 Cycle Sequencing kit (Applied
Biosystems, Foster City, Calif.). Sequence data was collected on an
ABI3730x1 (Applied Biosystems, Foster City, Calif.).
[0206] The kinase domain mutation screen was analyzed using Consed
(Gordon et al., Genome Res. 8(3):195-202, 1998). Variants were
called using Polyphred 6.11 (Bhangale et al., Nat. Genet.
38(12):1457-1462, 2006) and DIPDetector, an indel detector for
improved sensitivity in finding insertions and deletions.
[0207] Sequence traces of the secondary screen were analyzed using
the Mutation Surveyor software package (SoftGenetics, State
College, Pa.).
TABLE-US-00005 TABLE 1 Primers used for PCR amplification of the
ERBB4 coding region ERBB4 SEQ ID SEQ ID Exon Forward Primer NO:
Reverse Primer NO: Exon 1 GGAAATAGCTGCACAG 3 GTAAAACGACGGCCAG 32
TCCG TATGGGTGAAGAGGGC AGG Exon 2 AGAACTGGGATAGGCT 4
GTAAAACGACGGCCAG 33 TGTGG TTTCCAGGTATCAGCA CACAGG Exon 3
GTAAAACGACGGCCAG 5 TGCCTTAGAGTGTTCC 34 TAAGCCAATTCTTTAGA TCAATG
ATATGATATGG Exon 4 TCTTGGCTATTAGCAAC 6 GTAAAACGACGGCCAG 35 ATGACTC
TCAATGAATGCAATCA AAGTTCAA Exon 5 GTAAAACGACGGCCAG 7
CCAAAGCAAATCAACC 36 TAAATCCTCATAAAGG ACAAG AGCAGGAG Exon 6
GTAAAACGACGGCCAG 8 GGAATGACTTTGAGGA 37 TTGAATTGAGTCAAAG GGGC
ACAGGGTG Exon 7 TTTGGAAACACACATG 9 GTAAAACGACGGCCAG 38 ACTCTTAAA
TTTTGCTATGAAACTTT ACACAAATCA Exon 8 GTGGAGCAGTAACCAA 10
GTAAAACGACGGCCAG 39 GCAAG TGTGTGGGTAGGTTTG GTTGTG Exon 9
AAAGCAGAACCAGTAG 11 GTAAAACGACGGCCAG 40 TGAATGTTG TGGTGAAACTCTTCAG
CTTCCAG Exon 10 GTAAAACGACGGCCAG 12 TCTCCTGACCTCATGA 41
TCCTCCTCCACATCTAG TCCAC CACAG Exon 11 GTAAAACGACGGCCAG 13
TACCTCACACCATCAT 42 TCCTTTCTCACTTCCCA CGGAG ACTTTC Exon 12
GTAAAACGACGGCCAG 14 GAGCAACAATTCTGAC 43 TTTGATTCAGTTTCCAT CGGAT
TTATACACCA Exon 13 GTAAAACGACGGCCAG 15 GAATGGCGTGAACCCA 44
TTAGGCCACCAAAGTC GG ATTTGC Exon 14 GTAAAACGACGGCCAG 16
CCCATGGCATCCTGTA 45 TTGATGCTCCTGGCACA AGTAG TAGAG Exon 15
TCTTAGAGGAAGATTT 17 GTAAAACGACGGCCAG 46 GCCACC TCATTTCAGAGATGGT
ACCAGGG Exon 16 GCTTCCCATGTTCTTCC 18 GTAAAACGACGGCCAG 47 TCC
TAAGTAAGAAAGTTGG CTTGAGAAGG Exon 17 TGTGGATAATGTCTTGT 19
GTAAAACGACGGCCAG 48 ACAACTGC TTTCACAAGCTTTGTTT AACGGAC Exon 18
GGTTGTCAAGGCAAAC 20 GTAAAACGACGGCCAG 49 CAAG TAGACTGTATCCGTCC
CAGCTC Exon 19 AAGCAGACAACAAAGT 21 GTAAAACGACGGCCAG 50 TGCAGAG
TTCTAGGCAGACAGTT GTGAAGC Exon 20 GTAAAACGACGGCCAG 22
TTTGGCACCTAGTCAA 51 TTCAGCACCATTAGTAC TTCAA AATCCAA Exon 21
GTAAAACGACGGCCAG 23 AGGCAAATGGTAGAAC 52 TGCACTTCCAACTGAA CAAGG
GGCTAAG Exon 22 GTAAAACGACGGCCAG 24 TAACTGCTTTAGGAAA 53
TAGGCCAGCCCAAAGA TTAGGCTTATC CTC Exon 23 TGATTGGTGTTTGGATT 25
GTAAAACGACGGCCAG 54 GACC TCAAAGAGGCGTTCAT ATGTTCC Exon 24
GTAAAACGACGGCCAG 26 TGTTTGTGGTCCTTTCC 55 TGAGTCGTTTCTTTCAC ACAG
TAGCTTGC Exon 25 TAGGTTTCTTAATGGCC 27 GTAAAACGACGGCCAG 56 GGTG
TGGCATCACATTGATT TGAGCTA Exon 26 TGCTTAGGAAGCTTCAC 28
GTAAAACGACGGCCAG 57 TGTTG TTAACTCACTGTTGGC AAAGGC Exon 27
TGGCTTTGATATCCTTG 29 GTAAAACGACGGCCAG 58 TGGC TCAGCTATCTGGCAAT
TTCTATTCTG Exon 28 CCATATGCAGAAGAGA 30 GTAAAACGACGGCCAG 59 CAAATGC
TAGGTAGTCTGGGTGC TGAAGG Exon 28 TGAATCCAGTGGAGGA 31
GTAAAACGACGGCCAG 60 GAACC TGACCACCAGAGAAAG AGAGGG
Construction of Wild-Type and Mutant ERBB4 Expression Vectors
[0208] Human ERBB4 (GenBank Accession No. NM.sub.--005235; SEQ ID
NO: 1) was cloned by PCR using PHUSION.TM. Hot Start High-Fidelity
DNA Polymerase (New England Biolabs, Inc., Ipswich, Mass.) using a
clone purchased from Open Biosystems (clone ID #8327667) and cloned
with the following primers:
TABLE-US-00006 CGGCTCTAGAGCCACCATGAAGCCGGCGAC (SEQ ID NO: 62)
ATCGGCGGCCGCTTACACCACAGTATTCCGG (SEQ ID NO: 63)
[0209] The PCR product was cloned into the mammalian expression
vector pCDF-MCS2-EF1-Puro.TM. (Systems Biosciences, Inc., Mountain
View, Calif.) via the XbaI and NotI restriction sites. The E317K,
E452K, E542K, R544W, E563K, K751M, E836K, and E872K point mutants
were made using Fusion PCR for site-directed mutagenesis.
Cell Culture and Transient Expression
[0210] Metastatic melanoma tumor lines were maintained according to
standard methods (see Chappell et al., Cancer Res. 59:59-62, 1999).
HEK 293T cells and NIH 3T3 cells were purchased from the American
Type Culture Collection (ATCC) (Manassas, Va.) and maintained in
complete Dulbecco's Modified Eagles Medium (DMEM) supplemented with
10% Fetal Bovine Serum (FBS), 1.times. nonessential amino acids, 2
mM L-glutamine, and 0.75% sodium bicarbonate. HEK 293T cells were
transfected with Lipofectamine.TM. 2000 reagent (Invitrogen,
Carlsbad, Calif.) at a 6:1 ratio with DNA (.mu.l/.mu.g) using 3-5
.mu.g of plasmid DNA.
Immunoprecipitation and Western Blotting
[0211] Transfected cells were washed 3.times. in PBS and lysed
using 0.5 ml 1% NP-40 lysis buffer (1% NP-40, 50 mM Tris-HCl pH
7.5, 150 mM NaCl, complete protease inhibitor tablet, EDTA-free
(Roche, Indianapolis, Ind.), 1 .mu.M sodium orthovanadate, 1 mM
sodium fluoride, and 0.1% .beta.-mercaptoethanol) per T-75 flask
for 20 minutes on ice. Lysed cells were scraped and transferred
into a 1.5 mL microcentrifuge tube. Extracts were centrifuged for
10 minutes at 14,000 rpm at 4.degree. C. Supernatant (450 .mu.l)
was immunoprecipitated overnight using 20 .mu.l of anti-ERBB4
agarose-conjugated beads (Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.). The immunoprecipitates were washed and subjected to
SDS-PAGE and western blotting according to standard methods (see
Samuels et al., Science 304:554, 2004). The primary antibodies used
in these experiments were anti-ERBB4 (Santa Cruz Biotechnology,
Santa Cruz, Calif.), anti-P-ERBB4 (Y1162) (Abgent, San Diego,
Calif.), anti-P-ERBB4 (Y1284) (Cell Signaling, Danvers, Mass.),
anti-PY20 (Zymed-Invitrogen,), anti-P-ERK1/2 (T202/Y204),
anti-ERK1/2, anti-P-AKT (S473), anti-AKT (Cell Signaling),
anti-P-STAT5A/B (Y694/Y699) (Upstate Biotech-Millipore), anti-STATS
(Cell Signaling) and anti-.alpha.-tubulin (Calbiochem-EMD
Biosciences, Gibbstown, N.J.).
ERBB4 Phosphorite-Specificantibody Analysis
[0212] ERBB4 was immunoprecipitated as described above and
subjected to SDS-PAGE. Primary phospho-antibodies were
pre-incubated overnight with the relevant competitive
phospho-peptides (pPep Y1162-Abgent #BP3122a, pPep Y1284-Cell
Signaling #1022). Following blocking/competition, the
antibody/peptide mixture was diluted into blocking buffer and
western blotting was performed as described above.
Pooled Stable Expression
[0213] To make lentivirus, ERBB4 constructs were co-transfected
into HEK 293T cells seeded at 1.5.times.10.sup.6 per T75 flask with
pVSV-G and pFIV-34N helper plasmids (System Biosciences, Mountain
View, Calif.) using Lipofectamine.TM. 2000. Virus-containing
conditioned media was harvested 48-60 hours after transfection,
filtered, aliquoted and stored at -80.degree. C. ERBB4 lentivirus
was used to make SK-MeI-2 and NIH 3T3 stable clones.
[0214] SK-MeI-2 cells (National Cancer Institute, Division of
Cancer Treatment, Developmental Therapeutics Program, Frederick,
Md.) were grown in RPMI-1640 (Lonza, Walkersville, Md.)
supplemented with 10% fetal bovine serum (HyClone, Logan, Utah).
NIH 3T3 cells were grown in DMEM supplemented with 10% FBS, 2 mM
L-glutamine, 1.times. non-essential amino acids, and 0.75% sodium
bicarbonate. Sk-Mel-2 and NIH 3T3 cells were seeded at
1.5.times.10.sup.6 cells per T75 flask 24 hours prior to infection.
Lentivirus for ERBB4 (WT, E317K, E452K, E542K, R544W, E563K, K751M,
E836K, and E872K point mutants) and empty vector control were
diluted with equal volume of normal complete medium in the presence
of 8 .mu.g/ml polybrene. Cells were incubated for 24 hours in the
presence of virus followed by changing of the medium to normal
complete medium for an additional 24 hours. Lentivirus-infected
cells were then selected for by addition of complete medium
containing 3 .mu.g/ml puromycin for SK-MeI-2 cells or 2 .mu.g/ml
puromycin for NIH 3T3 cells and allowed to incubate for 3 days.
Stable expression of ERBB4 proteins (WT and mutants) was determined
by SDS-PAGE analysis followed by immunoblotting with anti-ERBB4 and
anti-tubulin to show equivalent expression among pools.
Lentiviral shRNA
[0215] Constructs for stable depletion of ERBB4 were obtained from
Open Biosystems (Huntsville, Ala.). Negative control constructs in
the same vector system (pLKO.1 vector alone and scrambled shRNA)
were obtained from Addgene (Cambridge, Mass.). To prepare transient
virus stocks, 1.5.times.10.sup.6 HEK 293T cells were plated in T75
flasks. The next day, the cells were co-transfected with shRNA
constructs (3 .mu.g), together with pHR'8.2.DELTA.R and pCMV-VSV-G
helper constructs (3 .mu.g and 0.3 .mu.g, respectively), using
Lipofectamine.TM. 2000 (Invitrogen). The media were changed the
next day, and the following day, and virus-containing media were
harvested. The viral stocks were centrifuged and filtered to remove
any non-adherent HEK 293T cells.
[0216] Next, MM lines (2T, 7T, 17T, 31T and 63T) were infected with
shRNA lentiviruses for each condition (vector and scrambled
controls and three independent ERBB4-specific shRNAs). To do this,
cells were plated at sub-confluent densities. The next day, cells
were infected with a cocktail of 1 ml virus-containing medium, 1 ml
regular medium and 8 .mu.g/ml polybrene. The medium was changed one
day post-infection, and selective medium was added two days
post-infection (2 .mu.g/ml puromycin for all cells). After three
days of puromycin selection, the mock-infected cells had all died.
Stably infected pooled clones were tested in functional assays.
[0217] To rescue shRNA-mediated knock-down of ERBB4 in melanoma
cell lines, the non-targetable ERBB4 lentivirus was made as
described above and used to infect the melanoma cell line 17T.
After infection, cells were given 48 to 72 hours to recover from
infection prior to testing in functional assays.
Proliferation and Growth Inhibition Assays
[0218] To examine growth potential, melanoma cell lines (2T, 7T,
17T, 31T and 63T) stably infected with either vector or scrambled
controls or ERBB4-specific shRNAs were seeded into 96-well plates
at 2,500 cells per well and incubated for 13-17 days. Samples were
analyzed every 48 hours by lysing cells in 50 .mu.l 0.2% SDS/well
and incubating for 2 hours at 37.degree. C. prior to addition of
150 .mu.l/well of SYBR Green I solution (1:750 SYBR Green I
(Invitrogen-Molecular Probes) diluted in dH.sub.20).
[0219] The effects of tyrosine kinase inhibitors (TKIs) on the
proliferation of melanoma cell lines were tested by seeding 96-well
plates at 5,000 cells/well in the presence or absence of
serum-containing media and incubated for 24 hours prior to addition
of TKIs. Increasing concentrations of lapatinib
(Tykerb-GlaxoSmithKline) were added to each well in four replicates
with DMSO as negative control. Plates were analyzed 72 hours
post-addition of TKIs using the SYBR Green I proliferation assay
described above.
[0220] To further test TKIs on melanoma cell lines, 96-well plates
were seeded at 5,000 cells per well and incubated 24 hours prior to
addition of TKIs (e.g. lapatinib) at concentrations from 10 nM to
30 .mu.M. Once inhibitors were added, cells were incubated for 72
hours at 37.degree. C. Cells were then analyzed according to
previously described methods (Rusnak et al., Mol. Cancer. Ther.
1:85-94, 2001). Plates were read at 650 nm on a Molecular Devices
(Spectra Max) Plate Reader and analyzed using SoftMax v5 and
GraphPad Prism v5.
Soft Agar Assay
[0221] SK-MeI-2 pooled ERBB4 clones were plates in duplicate at
1000 cells/well and NIH 3T3 pooled ERBB4 clones were plated in
duplicate at 5000 cells/well in top plugs consisting of sterile
0.33% Bacto-Agar (BD, Sparks, Mo.) and 10% FBS (HyClone, Logan,
Utah) in a 24-well plate. The lower plug contained sterile 0.5%
Bacto-Agar and 10% FBS. After two weeks, the colonies were
photographed and counted.
NIH 3T3 Transformation Assay
[0222] Each plasmid (150 ng) was transfected into NIH 3T3 cells
cultured in 12-well plates by the calcium phosphate precipitation
method. Twenty-four hours after transfection, 5% of transfected
cells were transferred into T25 flasks and cultured for 10 days in
normal growth medium. The cells were stained with Hema3 (Sigma St.
Louis, Mo.) and analyzed for the presence of foci.
Analysis of ERBB4 Kinase Activity
[0223] HEK 293T cells were transiently transfected with ERBB4 (WT,
E317K, E452K, E542K, R544W, E563K, E836K, E872K and kinase-dead
K751M) or empty vector and incubated for 18-24 hours at 37.degree.
C. in the presence (10%) or absence (0.5%) of serum-containing
medium prior to immunoprecipitation. Cells were harvested and
approximately 3 mg of lysate was immunoprecipitated as described
above and subjected to a kinase assay. Immune complexes were washed
three times in lysis buffer followed by two washes in kinase buffer
(20 mM HEPES pH 7.4, 50 mM NaCl, 3 mM MnCl.sub.2, 20 mM MgCl.sub.2,
1 mM sodium orthovanadate, 1 mM sodium fluoride, and 1.times.
complete protease inhibitor tablet). Immune complexes were
resuspended in 50 .mu.l kinase buffer and 10 .mu.l was incubated in
the presence of [.gamma.-.sup.32P]ATP (3 .mu.Ci per reaction) for
15 minutes at 37.degree. C. Kinase reactions were stopped by the
addition of 2.times.SDS sample buffer and phosphorylated samples
were resolved on 8% tris-glycine gels. Gels were fixed in a 50%
methanol/7% acetic acid solution, washed three times in dH.sub.2O
then stained for 1 hour in GelCode.TM. Blue stain (Pierce) followed
by destaining for an additional hour. Gels were dried prior to
autoradiography.
Immunoblot Quantitation Analysis
[0224] Scanned films from western blot analysis of SDS-PAGE were
analyzed using ImageJ (NIH software). Individual bands were
quantitated and plots were generated to determine the intensities
in each band. The data was then exported to Microsoft Excel and
analyzed further for phospho:total ratios of protein.
Flow Cytometry Analysis
[0225] Melanoma cells were seeded into T-25 flasks at densities of
3.times.10.sup.5 cells per flask in normal complete T2 medium and
incubated at 37.degree. C. for 24 hours prior to addition of
lapatinib. Lapatinib or vehicle was added for 72 hours at a
concentration of 5 .mu.M. Cells were then harvested for FACS
analysis by first removing the medium into a new conical tube
followed by trypsinization of attached cells in T-25 flasks.
Trypsinized cells and those from the medium were combined and
washed in ice-cold PBS. Cells were collected by centrifugation at
1,000 rpm at 4.degree. C. Ice-cold 70% ethanol was added to cell
pellets and allowed to fix overnight at 4.degree. C. followed by
washing in ice-cold PBS. DNase-free RNase (Roche) was added to
cells resuspended in 0.5-1 ml PBS and incubated at 37.degree. C.
for 30 minutes before adding 50-100 .mu.l of propidium iodide
(PI-0.5 mg/ml) (Roche). Cellular DNA content was analyzed on Becton
Dickinson FACSCalibur.TM. using CellQuest.TM. software.
[0226] X-ray crystal structure assembly
[0227] The X-ray crystal structures of the ERBB4 extracellular and
kinase domains were used as templates in the program SWISS-MODEL
(Guex and Peitsch, Electrophoresis 18:2714-2723, 1997). Location of
EGFR and ERBB2 mutations in the crystal were found by aligning the
protein sequences for EGFR, ERBB2, ERBB3, and ERBB4 using ClustalW
(Guex and Peitsch, Electrophoresis 18:2714-2723, 1997). Previously
identified mutations in EGFR and ERBB2 were matched to the sequence
of ERBB4 using the ClustalW alignment.
Statistical Analysis
[0228] To determine whether the ratio of nonsynonymous to
synonymous mutations observed was statistically significant, the
exact binomial test was used, with an expected ratio of 2.5:1. All
the statistical calculations were performed in the R statistical
environment (available online on the World Wide Web at
r-project.org) (Sjoblom et al., Science 314:268-274, 2006). Further
statistical analyses were performed using Microsoft Excel to
generate p-values to determine significance (two-tailed t-test).
Inhibition curves (IC.sub.50) were analyzed and plotted using
GraphPad Prism v5.
Example 2
High-Throughput DNA Sequence Analysis of the PTK Family in MM
[0229] This example describes the identification of somatic
mutations in members of the PTK family, including ERBB4, in
patients with melanoma. Kinase mutations have been previously
identified by sequencing genes encoding these domains (Bardelli et
al., Science 300:949, 2003; Davies et al., Nature
417(6892):949-954, 2002; Greenman et al., Nature 446:153-158, 2007;
Samuels et al., Science 304:554, 2004). Thus, PTKs were evaluated
herein to determine if they are genetically altered in MM.
Initially, the kinase domain coding exons of this gene superfamily
were analyzed in 29 MM samples (Table 2). A total of 593 exons were
extracted from genomic databases. These exons were amplified by
polymerase chain reaction (PCR) from cancer genomic DNA samples
using the primers listed in Table 1 and directly sequenced with dye
terminator chemistry.
TABLE-US-00007 TABLE 2 Tyrosine Kinase genes analyzed CCDS Ref Seq
accession and accession and amplimer amplimer number number Gene
Name Gene Description CCDS35165.1 NM_007313.2 ABL1/ABL v-abl
Abelson murine leukemia viral oncogene homolog 1 CCDS30947.1
NM_007314.2 ABL2/ARG v-abl Abelson murine leukemia viral oncogene
homolog 2 (arg, Abelson-related gene) CCDS33928.1 NM_005781.4
ACK1/TNK2 tyrosine kinase, non-receptor, 2 CCDS33172.1 NM_004304.3
ALK anaplastic lymphoma kinase (Ki-1) CCDS12575.1 NM_021913.3 AXL
AXL receptor tyrosine kinase CCDS5982.1 NM_001715.2 BLK B lymphoid
tyrosine kinase CCDS14168.1 NM_203281.2 BMX BMX non-receptor
tyrosine kinase CCDS13524.1 NM_005975.2 BRK/PTK6 PTK6 protein
tyrosine kinase 6 CCDS14482.1 NM_000061.1 BTK Bruton
agammaglobulinemia tyrosine kinase CCDS4302.1 NM_005211.2 CSF1R
colony stimulating factor 1 receptor, formerly McDonough feline
sarcoma viral (v-fms) oncogene homolog CCDS10269.1 NM_004383.1 CSK
c-src tyrosine kinase CCDS4690.1 NM_001954.4 DDR1 discoidin domain
receptor family, member 1 CCDS1241.1 NM_006182.2 DDR2 discoidin
domain receptor family, member 2 CCDS5514.1 NM_005228.3 EGFR
epidermal growth factor receptor (erythroblastic leukemia viral
(v-erb-b) oncogene homolog, avian) CCDS5884.1 NM_005232.3 EPHA1
ephrin receptor EphA1 CCDS169.1 NM_004431.2 EPHA2 ephrin receptor
EphA2 CCDS2922.1 NM_005233.5 EPHA3 ephrin receptor EphA3 isoform a
precursor CCDS2447.1 NM_004438.3 EPHA4 ephrin receptor EphA4
CCDS3514.1 NM_182472.1 EPHA5 ephrin receptor EphA5 isoform b N/A
NM_001080448.2 EPHA6 EPH receptor A6 isoform a CCDS5031.1
NM_004440.2 EPHA7 ephrin receptor EphA7 CCDS30626.1 NM_001006943.1
EPHA8 EPH receptor A8 isoform 2 precursor CCDS425.1 NM_173641.2
EPHA10 EPH receptor A10 isoform 2 N/A NM_004441.3 EPHB1 ephrin
receptor EphB1 precursor CCDS230.1 NM_004442.6 EPHB2 ephrin
receptor EphB2 isoform 2 precursor CCDS3268.1 NM_004443.3 EPHB3
ephrin receptor EphB3 precursor CCDS5706.1 NM_004444.4 EPHB4 ephrin
receptor EphB4 precursor CCDS5873.1 NM_004445.2 EPHB6 ephrin
receptor EphB6 precursor CCDS32642.1 NM_004448.2 ERBB2 v-erb-b2
erythroblastic leukemia viral oncogene homolog 2,
neuro/glioblastoma derived oncogene homolog (avian) CCDS31833.1
NM_001982.2 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene
homolog 3 (avian) CCDS2394.1 NM_005235.2 ERBB4 v-erb-a
erythroblastic leukemia viral oncogene homolog 4 (avian) CCDS6381.1
NM_153831.2 FAK/PTK2 PTK2 protein tyrosine kinase 2 CCDS4098.1
NM_005246.2 FER fer (fps/fes related) tyrosine kinase
(phosphoprotein NCP94) CCDS10365.1 NM_002005.2 FES V-FES feline
sarcoma viral/V-FPS fujinami avian CCDS6107.1 NM_023110.2 FGFR1
fibroblast growth factor receptor 1 (fms- related tyrosine kinase
2, Pfeiffer syndrome) CCDS31298.1 NM_000141.3 FGFR2 fibroblast
growth factor receptor 2 (bacteria-expressed kinase, keratinocyte
growth factor receptor) CCDS3353.1 NM_000142.2 FGFR3 fibroblast
growth factor receptor 3 (achondroplasia, thanatophoric
dwarfism)William Allan Nix CCDS4410.1 NM_002011.3 FGFR4 fibroblast
growth factor receptor 4 isoform 1 CCDS305.1 NM_005248.2 FGR
Gardner-Rasheed feline sarcoma viral (v- fgr) oncogene homolog
CCDS9330.1 NM_002019.3 FLT1/VEGFR1 fms-related tyrosine kinase 1
(vascular endothelial growth factor/vascular permeability factor
receptor) CCDS31953.1 NM_004119.2 FLT3 fms-related tyrosine kinase
3 CCDS4457.1 NM_182925.3 FLT4/VEGFR3 fms-related tyrosine kinase 4
CCDS5103.1 NM_002031.2 FRK fyn-related kinase CCDS5094.1
NM_002037.3 FYN FYN oncogene related to SRC, FGR, YES CCDS33460.1
NM_002110.2 HCK hemopoietic cell kinase CCDS10378.1 NM_000875.3
IGF1R insulin-like growth factor 1 receptor CCDS12176.1 NM_000208.2
INSR insulin receptor CCDS1160.1 NM_014215.1 INSRR insulin
receptor-related receptor CCDS4336.1 NM_005546.3 ITK IL2-inducible
T-cell kinase N/A NM_002227.2 JAK1 Janus kinase 1 CCDS6457.1
NM_004972.2 JAK2 Janus kinase 2 CCDS12366.1 NM_000215.2 JAK3 Janus
kinase 3 CCDS3497.1 NM_002253.1 KDR/VEGFR2 kinase insert domain
receptor (a type III receptor tyrosine kinase) CCDS3496.1
NM_000222.2 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral
oncogene homolog CCDS359.1 NM_005356.3 LCK lymphocyte-specific
protein tyrosine kinase CCDS10078.1 NM_206961.1 LTK leukocyte
tyrosine kinase CCDS6162.1 NM_002350.2 LYN v-yes-1 Yamaguchi
sarcoma viral related oncogene homolog CCDS12113.1 NM_002378.3 MATK
megakaryocyte-associated tyrosine kinase CCDS2094.1 NM_006343.2
MERTK/MER c-mer proto-oncogene tyrosine kinase N/A NM_000245.2 MET
met proto-oncogene (hepatocyte growth factor receptor) CCDS2807.1
NM_002447.2 MST1R/RON macrophage stimulating 1 receptor (c-met-
related tyrosine kinase) N/A NM_005592.1 MUSK muscle, skeletal,
receptor tyrosine kinase CCDS1161.1 NM_002529.3 NTRK1 neurotrophic
tyrosine kinase, receptor, type 1 CCDS35053.1 NM_001007097.1 NTRK2
neurotrophic tyrosine kinase receptor type 2 CCDS32322.1
NM_001012338.1 NTRK3 neurotrophic tyrosine kinase receptor type 3
CCDS3495.1 NM_006206.3 PDGFRA platelet-derived growth factor
receptor alpha CCDS4303.1 NM_002609.3 PDGFRB platelet-derived
growth factor receptor beta CCDS4884.1 NM_002821.3 PTK7 PTK7
protein tyrosine kinase 7 CCDS6057.1 NM_004103.3 PYK2/PTK2B PTK2B
protein tyrosine kinase 2 beta CCDS7200.1 NM_020975.4 RET ret
proto-oncogene CCDS626.1 NM_005012.2 ROR1 receptor tyrosine
kinase-like orphan receptor 1 CCDS6691.1 NM_004560.2 ROR2 receptor
tyrosine kinase-like orphan receptor 2 CCDS5116.1 NM_002944.2 ROS1
v-ros UR2 sarcoma virus oncogene homolog 1 (avian) N/A
NM_001005861.2 RYK RYK receptor-like tyrosine kinase CCDS13294.1
NM_005417.3 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene
homolog (avian) CCDS13525.1 NM_080823.2 SRMS src-related kinase
lacking C-terminal regulatory tyrosine and N-terminal myristylation
sites CCDS6688.1 NM_003177.3 SYK spleen tyrosine kinase CCDS3481.1
NM_003215.2 TEC tec protein tyrosine kinase CCDS6519.1 NM_000459.2
TEK TEK tyrosine kinase, endothelial (venous malformations,
multiple cutaneous and mucosal) CCDS482.1 NM_005424.2 TIE tyrosine
kinase with immunoglobulin-like and EGF-like domains 1 N/A
NM_003985.3 TNK1 tyrosine kinase, non-receptor, 1 CCDS3480.1
NM_003328.2 TXK TXK tyrosine kinase CCDS12236.1 NM_003331.3 TYK2
tyrosine kinase 2 CCDS10080.1 NM_006293.2 TYRO3 TYRO3 protein
tyrosine kinase CCDS11824.1 NM_005433.3 YES1 v-yes-1 Yamaguchi
sarcoma viral oncogene homolog 1 CCDS33254.1 NM_001079.3 ZAP70
zeta-chain (TCR) associated protein kinase 70 kDa
[0230] Next, it was determined whether a mutation was somatic
(i.e., tumor specific) by examining the sequence of the gene in
genomic DNA from normal tissue of the relevant patient. From the
approximately 12 Mb of sequence information obtained, 19 genes
containing a total of 30 somatic mutations within their kinase
domains were identified.
[0231] All coding exons of these 19 genes were then analyzed for
mutations in a total of 79 MM samples. The primers used for PCR
amplification of ERBB4 (CCDS accession CCDS2394.1; GenBank
Accession No. NM.sub.--005235.2; SEQ ID NO: 1) are listed in Table
3. ERBB4 was sequenced using the following primers:
TABLE-US-00008 Forward - TGTAAAACGACGGCCAGT (SEQ ID NO: 78) Reverse
- CAGGAAACAGCTATGACC (SEQ ID NO: 79)
TABLE-US-00009 TABLE 3 Primers used for PCR amplification of the
ERBB4 kinase domain ERBB4 SEQ ID SEQ ID Exon Forward Primer NO:
Reverse Primer NO: Exon 18 TCATTTGTGCAGCAACTTC 64
CTGTCCTAGGGTTTTGGC 71 TC ATT Exon 19 GCAGACAGTTGTGAAGCA 65
TGCTATCCTATTTCCATG 72 AAAG CTGT Exon 22 CAAGCTTTAATTCGCAAA 66
TCCCCACTTAATTATTTT 73 GAAGA TACCTTT Exon 22 TGCTTTAGGAAATTAGGC 67
GGCTACTCAGAGGCTAA 74 TTATC GGTG Exon 23 TTTTTCCTTCATGTTTAGA 68
TTTTTAATTGATTGGTGT 75 TCATTT TTGG Exon 23 ACCTTGTCCTGCTAATTTG 69
TGACCTGTAAGGAGTAT 76 CTC TCTTTTACTAC Exon 24 CAGTAGCAGAGCCACTTG 70
TGTCCACCAGGACAAAT 77 AA GTA
[0232] Through this approach, 99 non-synonymous mutations were
identified in 19 genes (Table 4, FIGS. 4A-4B and FIG. 5). All of
these mutations were shown to be somatic by sequencing of DNA from
matched normal tissue. Only three genes (EPHA6, PDGFRA and PTK2)
out of the 19 had previously been reported to be mutated in MM (see
Cancer Gene Census, available online at
www.sanger.ac.uk/genetics/CGP/Census/). The majority of tumors with
PTK gene mutations also contained mutations in NRAS or BRAF (Table
4).
TABLE-US-00010 TABLE 4 Somatic mutations identified in PTKs CCDS
Ref Seq No. % of cases Gene Other names accession* accession* of
mutations# affected # DDR1 CAK, CCDS4690.1 NM_001954.3 2 2.6 CD167
EDDR1, NEP, NTRK4 PTK3A, RTK6 FER TYK3 CCDS4098.1 NM_005246.1 2 2.6
FLT1 FLT CCDS9330.1 NM_002019.3 8 10.3 VEGFR1 EPHA6 FLJ35246
NM_001080448.2 5 6.4 EPHA10 FLJ16103 CCDS41305.1 NM_001099439.1 7
6.4 FLJ33655 EPHB1 EPHT2 NM_004441 4 5.1 Hek6 EPHB2 DRT CCDS229.2
NM_017449.1 7 9.0 EPHT3 ERK Hek5 Tyro5 EPHB6 HEP CCDS5873.1
NM_004445.1 7 9.0 ERBB4 HER4 CCDS2394.1 NM_005235.2 24 18.8
MGC138404 p180erbB4 MATK CTK CCDS12113.1 NM_002378.2 1 1.3 HYLTK
MET HGFR CCDS43636.1 NM_000245 3 3.8 NTRK1 MTC CCDS1161.1
NM_002529.2 2 2.6 TRK PDGFRA TRKA CCDS3495.1 NM_006206.2 5 5.1
CD140a PDGFR2 PTK2 FAK, CCDS6381.1 NM_153831.2 1 1.3 FADK FAK1,
pp125FAK PTK2B PYK2 CCDS6057.1 NM_173176.1 8 10.0 PKB PTK CAKB FAK2
FRNK CADTK FADK2 PTK6 RAFTK CCDS13524.1 NM_005975.2 2 2.6 BRK PTK7
CCK4 CCDS4884.1 NM_002821.3 1 1.3 ROR2 BDB CCDS6691.1 NM_004560.2 4
5.1 BDB1 NTRKR2 TIE1 JTK14 CCDS482.1 NM_005424.2 6 7.7 TIE NRAS/
Functional BRAF Gene Exon Nucleotide.dagger. Amino Acid.dagger.
Domain Tumor mutation** DDR1 8 C1115T S372F None 6T BRAF 11 G1709A
R570Q Protein 43T BRAF Tyrosine Kinase FER 11 T1594C Y532H SH2
Motif 58T BRAF 13 G1739A G580D Protein 30T BRAF Tyrosine Kinase
FLT1 7 G842A R281Q IG 37T BRAF 7 C860T S287F IG 7T NRAS 12 -9
Intronic Splice N/A 20T BRAF C > A Site 13 G1767A W589X IGc2 13T
None 17 C2440T P814S None 39T None 21 G2827A E943K Protein 44T NRAS
Tyrosine Kinase 24 G3241A D1081N Protein 78T BRAF Tyrosine Kinase
28 G3667A E1223K/ None 85T BRAF LOH EPHA6 1 C1202G T307S None 30T
BRAF 4 G1763T R494M Protein 36T BRAF Tyrosine Kinase 4 G1891A E537K
Protein 32T BRAF Tyrosine Kinase 8 A2246T K655I Protein 29T BRAF
Tyrosine Kinase 8 G2320A E680K None 21T BRAF EPHA10 3 G235A V79M
Ephrin 52T BRAF Receptor 3 T236C V79A Ephrin 52T BRAF Receptor 3
G370A E124K Ephrin 55T None Receptor 3 G649A G217S None 71T BRAF 3
G650A G217D None 71T BRAF 13 G2369A G790E Protein 63T NRAS Tyrosine
Kinase 14 G2528C G843A Protein 37T BRAF Tyrosine Kinase EPHB1 3
C235T R79W Ephrin 39T None Receptor 12 G2311A D771N Protein 60T
NRAS Tyrosine Kinase 13 G2432A G811E Protein 44T NRAS Tyrosine
Kinase 15 G2757A W919X Sterile Alpha 63T NRAS Motif EPHB2 3 G325A
E109K Ephrin 4T BRAF Receptor 3 C614T A205V None 72T None 4 G952A
D318N Fibronectin 71T BRAF Type 3 Domain 7 C1535T T512I Fibronectin
83T Both Type 3 Domain 10 G1846A E615K Protein 29T BRAF Tyrosine
Kinase 10 G1846A E615K Protein 68T BRAF Tyrosine Kinase 14 C2663T
P887L None 77T None EPHB6 3 C392T S131F Ephrin 60T NRAS Receptor 3
C455T S152F Ephrin 55T None Receptor 5 G1210A G404S Fibronectin 50T
BRAF Type 3 Domain 11 G2036A R679Q Protein 5T BRAF Tyrosine Kinase
11 C2063G A688G Protein 54T BRAF Tyrosine Kinase 11 C2110T R704W
Protein 26T BRAF Tyrosine Kinase 13 -5 Intronic Splice N/A 18T None
C > T Site ERBB4 2 C113T L39F Receptor L 71T BRAF Domain 3 T331C
Y111H Receptor L 13T None Domain 8 G939A M313I Growth Factor 63T
NRAS Receptor 8 G949A E317K Growth Factor 17T NRAS Receptor 9
C1022T S341L Receptor L 96T None Domain 10 C1177T R393W Receptor L
49T BRAF Domain 11 C1226T P409L Receptor L 76T None Domain 12
G1354A E452K Receptor L 7T NRAS Domain 12 G1354A E452K/ Receptor L
55T None LOH Domain 12 G1472A R491K/ Growth Factor 34T BRAF LOH
Receptor 14 G1624A E542K Growth Factor 63T NRAS Receptor 14 C1630T
R544W Growth Factor 56T BRAF Receptor 14 G1687A E563K Growth Factor
12T NRAS Receptor 15 -10 Splice N/A 68T BRAF Intronic Site/ C >
T LOH 15 G1825A D609N Growth Factor 76T None Receptor 18 C2098T
P700S None 24T NRAS 21 G2506A E836K Protein 86T BRAF Tyrosine
Kinase 21 G2614A E872K Protein 63T NRAS Tyrosine Kinase/Activation
Loo 23 G2806A G936R Protein 24T NRAS Tyrosine Kinase 24 -4 Intronic
Splice N/A 13T None C > T Site 25 C3097T P1033S None 76T None 26
-1 Intronic Splice N/A 76T None G > A Site 28 G3521A R1174Q None
63T NRAS 28 G3737A S1246N His-Me Finger 71T BRAF Endonucleases MATK
12 G1248A W416X Protein 13T None Tyrosine Kinase MET 5 G1829A
C610Y/ IPT 1T BRAF LOH 14 A3176G N1059S None 13T None 16 G3509A
R1170Q Protein 29T BRAF Tyrosine Kinase NTRK1 8 G1137A M349I None
18T None 14 C1747G R547G Protein 13T None Tyrosine Kinase PDGFRA 3
G571A A191T IG 64T BRAF 9 G1375A E459K/ None 32T BRAF LOH 18 C2669T
S890F Protein 41T BRAF Tyrosine Kinase 20 C2810T P937L/ Protein 32T
BRAF LOH Tyrosine Kinase 21 G3070A D1024N None 63T NRAS PTK2 15
C1481T A494V Protein 13T None Tyrosine Kinase PTK2B 5 -4 Intronic
Splice N/A 79T BRAF C > T Site 8 G818A W273X FERM 76T None 13
G1241A G414E None 95T NRAS 14 C1285T R429C Protein 17T NRAS
Tyrosine Kinase 16 G1480A E494K Protein 26T BRAF Tyrosine Kinase 24
G2374A E792K None 36T BRAF 29 G2753A R918Q Focal AT 85T BRAF 29
G2812A E938K Focal AT 83T Both PTK6 4 G629A W210X Protein 12T NRAS
Tyrosine Kinase 5 -7 Intronic Splice N/A 51T BRAF C > T Site
PTK7 7 C1054T P352S IGc2 84T BRAF ROR2 5 T574C Y192H Frizzled 71T
BRAF Cysteine-Rich Domain 7 T1172C V391A Kringle 72T None 9 C1670T
S557L Protein 5T BRAF Tyrosine Kinase 9 G2377T A793S None 81T BRAF
TIE1 2 G139A E47K None 13T None 2 C161T S54L None 16T BRAF 2 C266T
T89M None 52T BRAF 2 G292A D98N None 43T BRAF 11 G1598A G533E
Fibronectin 39T None Type 3 Domain 22 C3281T P1094L/ Protein 12T
NRAS LOH Tyrosine Kinase *Accession numbers for mutated PTKs in
Santa Cruz and GenBank. # Number of non-synonymous and splice site
mutations observed and percent of tumors affected for each of the
19 genes in the panel of 80 melanoma cancers. .dagger.Nucleotide
and amino acid change resulting from mutation. "X" refers to stop
codon. "LOH" refers to cases wherein the wild-type allele was lost
and only the mutant allele remained. "Splice site" refers to a case
wherein the alteration affected ten bases spanning the exon.
**Mutations previously observed in NRAS, or BRAF. "None" refers to
no mutation observed. SH2 Motif, Src homology 2 domain; IG,
Immunoglobin; IGc2, Immunoglobin C-2 Type; IPT, IG-like, p1exins,
transcription factors; Focal AT, Focal Adhesion Targeting Region;
FERM, Protein 4.1, Ezrin, Radixin, Moesin Domain. Domains were
found using Ensembl and InterPro.
[0233] The observed somatic mutations could either be "driver"
mutations that play a functional role underlying the neoplastic
process or nonfunctional "passenger" changes. In the 19 genes found
to be mutated, 99 non-synonymous and 17 synonymous somatic
mutations were identified, yielding a N:S
(non-synonymous:synonymous) ratio of 99:17, significantly higher
than the N:S ratio of 2.5:1 predicted for nonselected passenger
mutations (P<1.times.10.sup.-5) (Sjoblom et al., Science
314:268-274, 2006), suggesting that these are likely to be "driver"
mutations. The number of C>T mutations was significantly greater
than other nucleotide substitutions resulting in a high prevalence
of C:G>T:A transitions (p<0.0001) (FIG. 6A), confirming
previously reported melanoma signatures. A summary of the most
highly mutated genes is shown in FIG. 5.
Example 3
Somatic Mutations within ERBB4 are Frequent in MM
[0234] This example describes the biochemical analysis of several
ERBB4 mutations identified in patients with melanoma. To evaluate
the effect of some of these mutations on kinase function, the
studies described herein focus on ERBB4, a member of the EGFR
kinase subfamily, which was the most highly mutated gene (19%) in
the screen. Five of the 15 samples with ERBB4 mutations contained
more than one somatic mutation in ERBB4, which may act
synergistically as previously seen for EGFR (Godin-Heymann et al.,
Cancer Res. 67:7319-7326, 2007). The large number of mutations
observed in ERBB4 strongly suggests that these mutations are
functionally important (FIG. 1A). This conclusion is supported by
analysis of the ratio of non-synonymous to synonymous mutations in
ERBB4, which was 24:3, significantly higher than the 2.5:1 ratio
expected by chance (P<1.times.10.sup.-2) (Sjoblom et al.,
Science 314:268-274, 2006).
[0235] Interestingly, 7 out of the 24 non-synonymous somatic
mutations discovered in ERBB4 occurred at Glu (E) residues
(p<0.00005, binomial test), all of which resulted in changes to
Lys (K), causing a charge reversal. The underlying reason for this
might be due to the high frequency of C:G>T:A transitions (FIG.
6B). Clustering of somatic mutations is seen in various functional
domains of ERBB4 (FIG. 1A and FIG. 5), with mutations in the kinase
domain co-localizing with previously described mutations (found in
various cancer types at frequencies ranging from 1.1-4.7%; Soung et
al., Int. J. Cancer 118:1426-1429, 2006; Ding et al., Nature
455:1069-1075, 2008) and occurring at highly conserved residues.
These genetic data suggest that mutant ERBB4 is likely to function
as an oncogene in melanoma.
[0236] The positions of these mutations within ERBB4 and their
predominantly heterozygous nature imply that they are likely to be
gain of function mutations. No truncating mutations were observed
and the alterations occurred in functionally important domains
(FIG. 1A). The affected residues in ERBB4 are highly conserved
evolutionarily, retaining identity in chimp, horse, rat, mouse and
opossum. Clustering of somatic missense mutations is seen in
various domains. Mutations S341L, R393W, P409L, E452K and R491K all
occur in the extracellular sub region III, with the E452K mutation
occurring in two different cases. Mutations E542K, R544W and E563K
are all adjacent in the extracellular sub region IV. A similar
clustering was observed in the kinase domain where our novel
mutations co-localized with previously described mutations (found
in various cancer types at frequencies ranging from 1.1%-4.7% (Ding
et al., Nature 455:1069-1075, 2008; Soung et al., Int. J. Cancer
118:1426-1429, 2006). The clustering of somatic missense mutations
in specific domains of ERBB4 is similar to that observed for
activating mutations in other oncogenes, such as BRAF and PIK3CA
(Davies et al., Nature 417(6892):949-954, 2002; Samuels et al.,
Science 304:554, 2004). These genetic data suggest that mutant
ERBB4 is likely to function as an oncogene in MM.
Example 4
ERBB4 Mutations Increase its Kinase Activity
[0237] This example describes the assessment of kinase activity of
ERBB4 mutations present in melanoma tumors. To directly test
whether the mutations identified in ERBB4 activate its kinase
activity, the positions of the various ERBB4 missense mutations in
its crystal structure were assessed. The crystal structures of the
extracellular and kinase domains of ERBB4 (Bouyain et al., Proc.
Natl. Acad. Sci. USA 102:15024-15029, 2005; Qiu et al., Structure
16:460-467, 2008) demonstrated that most of the observed
alterations had similar positioning to mutations reported in the
ERBB4 family members EGFR and ERBB2 in lung cancer, glioblastoma
and gastric cancer (Riese et al., Bioessays 29:558-565, 2007). The
mutations that were further evaluated in the extracellular domain
included the E317K mutation, which is near the EGFR
[0238] R324L mutation, the E542K, R544W, and E563K mutations, as
these co-localize, and finally the E452K mutation, as this
substitution occurred in two patients. Additionally, two mutations
that were found in the kinase domain were cloned: E836K, which is
found near the ERBB2 N857S mutation, and the E872K alteration.
[0239] To investigate the biochemical effects of the identified
ERBB4 mutations, wild type (WT) ERBB4 or the seven mutants (E317K,
E452K, E542K, R544W, E563K, E836K, E872K), as well as a kinase dead
(KD) version of ERBB4 (K751M), were transiently expressed in HEK
293T cells and the basal catalytic activity of ERBB4 was assessed
using ERBB4 autophosphorylation as a readout for receptor
activation. ERBB4 autophosphorylation was determined by measuring
the total phosphotyrosine content of the immunoprecipitated
receptor as well as by measuring two auto-phosphorylation sites
(Tyr-1162 and Tyr-1284) in the C-terminus of ERBB4. Compared to WT
ERBB4, all the missense mutants showed a marked increase in
receptor autophosphorylation on total phosphotyrosine as well as on
residues Tyr-1162 and Tyr-1284 (FIG. 1B). No site-specific
phosphorylation was observed in cells exogenously expressing the KD
version of ERBB4. Similar expression levels of total ERBB4 protein
were observed, except KD ERBB4, which had a higher expression level
(FIG. 1B).
[0240] The specificity of the phosphosite-specific anti-ERBB4
antibodies was confirmed using competitive
ERBB4-phosphosite-specific phospho-peptides (FIG. 7). To assess
whether the increased tyrosine phosphorylation of the ERBB4 mutants
correlates with increased kinase activity, a kinase assay using the
same set of ERBB4 mutants was performed. FIGS. 1C-1D show that in
low serum, the ERBB4 mutants exhibit a marked increase in kinase
activity compared to WT ERBB4. In contrast, in the presence of
serum, the ERBB4 mutants showed a similar kinase activity compared
to WT ERBB4. Similar expression levels of total ERBB4 protein were
observed (FIG. 1D). These results suggest that increased ERBB4
phosphorylation is due to its constitutive activation rather than
alteration in its protein levels.
[0241] To extend these observations, a MM line containing
endogenous mutant ERBB4 (63T, E542K/E872K) was studied and compared
it to a MM line containing endogenous WT ERBB4 (39T). As in
transfected cells, ERBB4 autophosphorylation was markedly elevated
in the MM line with an endogenous ERBB4 mutation (FIG. 8).
[0242] To determine if the increased tyrosine phosphorylation of
the ERBB4 mutants correlates with increased kinase activity, a
kinase assay using the same set of ERBB4 mutants was performed. The
ERBB4 mutants showed a marked increase in kinase activity compared
to WT ERBB4 and expression levels of total ERBB4 protein were
comparable (FIG. 1E). As in transfected cells, ERBB4
autophosphorylation was markedly elevated in the melanoma lines
harboring ERBB4 mutations compared to melanoma lines harboring
endogenous WT ERBB4 (FIGS. 1F-1G).
[0243] ERBB4 is known to activate several downstream signaling
pathways including the ERK and AKT pathways (Frey et al.,
Gastroenterology 136:217-226, 2009). To evaluate which of these
signaling pathways is activated by the ERBB4 mutations, immunoblot
analysis of melanoma cell lines harboring endogenous ERBB4
mutations was performed. Phosphorylation of AKT was elevated in
cells expressing any of the three evaluated mutant ERBB4s, whereas
ERK showed similar activation in cells expressing WT or mutant
ERBB4 (FIG. 11).
Example 5
ERBB4 Mutations Promote Colony Formation Abilities and
Anchorage-Independent Growth
[0244] The example describes the phenotypic analysis of ERBB4
mutants identified in melanoma tumors. The combination of
biochemical and genetic data disclosed herein suggested that the
mutant ERBB4 proteins might be oncogenic. However, previous studies
have described the generation of ERBB4 mutants that are
constitutively active but non-transforming (Penington et al., Cell
Growth Differ. 13:247-256, 2002; Williams et al., Cancer Lett.
192:67-74, 2003). Thus, the following studies were performed to
determine whether the melanoma ERBB4 variants described in this
study are transforming. To test this, NIH 3T3 cells were
transiently transfected with vector, WT, one of the seven
constitutively active ERBB4 mutants (E317K, E452K, E542K, R544W,
E563K, E836K and E872K) or oncogenic K-Ras.sup.G12v. Ten days after
transfection, all ERBB4 mutations transformed NIH 3T3 cells more
efficiently than WT ERBB4. Strikingly, the transformation ability
of the ERBB4 mutants was similar to oncogenic K-Ras.sup.G12V (FIG.
2A). Similarly, the same set of ERBB4 mutants were able to promote
anchorage-independent growth as depicted in FIG. 9A. All the
presented results were significant (P<0.05, t test).
[0245] To test the transformation abilities of the ERBB4 mutations
in human melanoma cells, stable cell pools expressing vector, WT,
and three ERBB4 mutations (E452K, E563K and E872K) were derived in
SK-MeI-2 cells, a melanoma cell line that expresses WT ERBB4.
Western blot analysis showed a similar expression level of ERBB4 in
all clones (FIG. 9B). As seen in FIG. 2B, expression of all the
ERBB4 mutants elicited a significantly higher cell transformation
ability compared to clones expressing vector or WT ERBB4
(p<0.05, t-test). When the same set of clones was suspended in
soft agar, cells expressing mutant ERBB4 formed a significantly
higher number of anchorage-independent colonies (p<0.05, t-test,
FIG. 9C). Thus, all the tested ERBB4 mutants potently increased
both colony formation ability as well as growth on soft agar in all
the cell lines compared to vector or WT ERBB4 stable clones.
Example 6
Dependency of MM Lines Harboring ERBB4 Mutations on ERBB4
Signaling
[0246] This example describes the effect of inhibiting expression
of WT and mutant ERBB4 using shRNA. In order to assess if melanoma
cells harboring endogenous ERBB4 mutations are dependent on ERBB4
signaling for proliferation, short hairpin RNA (shRNA) was used to
stably knockdown ERBB4 protein levels in melanoma lines harboring
either WT (2T and 31T) or mutant ERBB4 (17T, E317K; 63T,
E542K/E872K; or 7T, E452K). Specific targeting of ERBB4 by shRNAs
was confirmed both in transfected HEK 293 cells and in one of the
melanoma cell lines by immunoblotting (FIGS. 3A-3B). Three unique
shRNA constructs targeting ERBB4 had minimal effect on the
proliferation of cells expressing WT receptor, but significantly
reduced the growth of melanoma lines containing mutant ERBB4 (FIGS.
3C-3G). Thus, mutant ERBB4 is essential for growth of melanomas
harboring these mutations. Evaluation of the effects of ERBB4
knockdown on downstream signaling pathways revealed that
down-regulation of ERBB4 in cells harboring mutant versions of the
gene reduces levels of endogenous, phosphorylated AKT, but not of
phosphorylated ERK. In contrast, inhibition of ERBB4 expression in
cells harboring WT versions of the gene showed similar levels of
AKT and ERK activation (FIG. 12).
[0247] Because shRNA-mediated cell death could result from specific
or nonspecific effects, an exogenous, non-targetable WT ERBB4
construct (NT ERBB4), engineered to be resistant to knockdown by
the introduction of three silent mutations in the region of ERBB4
targeted by shRNA #6, was examined for the ability to rescue the
effects of knockdown of endogenous ERBB4. Melanoma cells harboring
the E317K mutation stably expressing either control or ERBB4 shRNA
#6 construct were transduced with the lentiviral NT ERBB4 construct
or empty vector as control. Similar phosphotyrosine content is
observed in both WT and NT ERBB4 constructs, demonstrating that the
silent mutations in the NT construct do not affect the ability of
the receptor to be phosphorylated to wild-type levels (FIG. 13A).
Importantly, pooled clones of NT reconstituted cells were markedly
more resistant to growth inhibition induced by ERBB4 knockdown
(#6/NT) than shRNA control-infected cells (Vect/Vect).
[0248] To evaluate mutant ERBB4 as a potential target for specific
inhibition of melanoma cell survival, the ERBB4 pathway was
targeted with the FDA-approved pan-ERBB pharmacologic inhibitor,
lapatinib (GW2016) (Heymach et al., Clin. Cancer Res.
12:4441s-4445s, 2006). Exposure of melanoma cells to lapatinib
resulted in reduced cell proliferation to a greater extent in cells
containing endogenous ERBB4 mutations than in cells containing
endogenous WT ERBB4 (FIG. 10A). An IC.sub.50 calculation revealed
that melanoma cells harboring ERBB4 mutations were 10- to 250-fold
more sensitive to lapatinib than cells with WT receptor (FIG. 10B)
and treatment with lapatinib inhibited receptor autophosphorylation
in a dose-dependent manner (FIG. 10C). This increased sensitivity
to lapatinib was accompanied by specific inhibition of ERBB4 and
AKT activation in cells harboring mutant ERBB4 (FIGS. 10D-10E).
Activation of other downstream elements, such as ERK, was also
slightly inhibited by lapatinib (FIGS. 14A-14B). Thus, although
signaling by mutant ERBB4 demonstrates selective activation of AKT,
lapatinib treatment of cells harboring mutant ERRB4 results in
uniform inhibition of downstream signaling pathways. Only mutant
ERBB4 was inhibited by lapatinib in the melanoma cell lines. No
inhibition of its family member ERBB2 was observed (FIGS. 10D-10E)
and no phosphorylation of EGFR was observed in any of these cells.
The observed reduced proliferation occurred in cells harboring
BRAF, NRAS, ARAF or CRAF mutations in addition to the ERBB4
mutations.
TABLE-US-00011 TABLE 5 Mutations identified in RAF and RAS isoforms
Sample ERBB4 BRAF NRAS ARAF CRAF HRAS KRAS 7T E452K wt Q61R wt wt
wt wt 12T E563K wt Q61Q/R wt wt wt wt 17T E317K wt Q61Q/K wt wt wt
wt 31T wt wt wt wt wt wt wt 34T R491K V600V/E wt wt T362T/A wt wt
39T wt wt wt wt wt wt 49T R393R/W V600V/E wt wt wt wt wt 55T E452K
V600V/E wt P216S wt wt wt P254L 56T R544R/W V600V/E wt wt wt wt wt
63T E542K wt Q61Q/K wt wt wt wt E872K 68T Splice site V600V/E wt wt
wt wt wt LOH 71T L39L/F V600V/M wt wt wt wt wt S1246S/N V600V/E 86T
E836E/K V600V/E wt wt wt wt wt 93T wt wt wt A345A/G wt wt wt
[0249] To elucidate the mechanism of decreased growth of cells
expressing mutant ERBB4 following lapatinib treatment, cells were
examined for cell cycle perturbations or apoptosis by flow
cytometry. Lapatinib markedly increased apoptosis of melanoma cells
harboring mutant ERBB4 compared to lines harboring WT ERBB4 (FIGS.
10E-10G). Thus, expression of mutant ERBB4 appears essential for
suppression of pro-apoptotic signals in melanoma cells harboring
these mutations, which is consistent with the selective activation
of AKT in ERBB4 mutant cells (FIGS. 11A-11B) and previous results
demonstrating an anti-apoptotic role for AKT (Grant et al., Front.
Biosci. 7:d76-89, 2002). These results suggest that lapatinib
preferentially inhibits mutant ERBB4 signaling and that cells with
ERBB4 mutations are subject to "oncogene addiction" (Weinstein,
Science 297:63-64, 2002). Moreover, the enhanced AKT signaling in
cells with mutant ERBB4 may provide an additional therapeutic
target in these tumors.
[0250] In view of the many possible embodiments to which the
principles of the disclosed invention may be applied, it should be
recognized that the illustrated embodiments are only preferred
examples of the invention and should not be taken as limiting the
scope of the invention. Rather, the scope of the invention is
defined by the following claims. We therefore claim as our
invention all that comes within the scope and spirit of these
claims.
Sequence CWU 1
1
7913927DNAHomo sapiensCDS(1)..(3927)misc_feature(949)..(949)n = g
or a 1atg aag ccg gcg aca gga ctt tgg gtc tgg gtg agc ctt ctc gtg
gcg 48Met Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val
Ala 1 5 10 15 gcg ggg acc gtc cag ccc agc gat tct cag tca gtg tgt
gca gga acg 96Ala Gly Thr Val Gln Pro Ser Asp Ser Gln Ser Val Cys
Ala Gly Thr 20 25 30 gag aat aaa ctg agc tct ctc tct gac ctg gaa
cag cag tac cga gcc 144Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu
Gln Gln Tyr Arg Ala 35 40 45 ttg cgc aag tac tat gaa aac tgt gag
gtt gtc atg ggc aac ctg gag 192Leu Arg Lys Tyr Tyr Glu Asn Cys Glu
Val Val Met Gly Asn Leu Glu 50 55 60 ata acc agc att gag cac aac
cgg gac ctc tcc ttc ctg cgg tct gtt 240Ile Thr Ser Ile Glu His Asn
Arg Asp Leu Ser Phe Leu Arg Ser Val 65 70 75 80 cga gaa gtc aca ggc
tac gtg tta gtg gct ctt aat cag ttt cgt tac 288Arg Glu Val Thr Gly
Tyr Val Leu Val Ala Leu Asn Gln Phe Arg Tyr 85 90 95 ctg cct ctg
gag aat tta cgc att att cgt ggg aca aaa ctt tat gag 336Leu Pro Leu
Glu Asn Leu Arg Ile Ile Arg Gly Thr Lys Leu Tyr Glu 100 105 110 gat
cga tat gcc ttg gca ata ttt tta aac tac aga aaa gat gga aac 384Asp
Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn 115 120
125 ttt gga ctt caa gaa ctt gga tta aag aac ttg aca gaa atc cta aat
432Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn
130 135 140 ggt gga gtc tat gta gac cag aac aaa ttc ctt tgt tat gca
gac acc 480Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala
Asp Thr 145 150 155 160 att cat tgg caa gat att gtt cgg aac cca tgg
cct tcc aac ttg act 528Ile His Trp Gln Asp Ile Val Arg Asn Pro Trp
Pro Ser Asn Leu Thr 165 170 175 ctt gtg tca aca aat ggt agt tca gga
tgt gga cgt tgc cat aag tcc 576Leu Val Ser Thr Asn Gly Ser Ser Gly
Cys Gly Arg Cys His Lys Ser 180 185 190 tgt act ggc cgt tgc tgg gga
ccc aca gaa aat cat tgc cag act ttg 624Cys Thr Gly Arg Cys Trp Gly
Pro Thr Glu Asn His Cys Gln Thr Leu 195 200 205 aca agg acg gtg tgt
gca gaa caa tgt gac ggc aga tgc tac gga cct 672Thr Arg Thr Val Cys
Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly Pro 210 215 220 tac gtc agt
gac tgc tgc cat cga gaa tgt gct gga ggc tgc tca gga 720Tyr Val Ser
Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly 225 230 235 240
cct aag gac aca gac tgc ttt gcc tgc atg aat ttc aat gac agt gga
768Pro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly
245 250 255 gca tgt gtt act cag tgt ccc caa acc ttt gtc tac aat cca
acc acc 816Ala Cys Val Thr Gln Cys Pro Gln Thr Phe Val Tyr Asn Pro
Thr Thr 260 265 270 ttt caa ctg gag cac aat ttc aat gca aag tac aca
tat gga gca ttc 864Phe Gln Leu Glu His Asn Phe Asn Ala Lys Tyr Thr
Tyr Gly Ala Phe 275 280 285 tgt gtc aag aaa tgt cca cat aac ttt gtg
gta gat tcc agt tct tgt 912Cys Val Lys Lys Cys Pro His Asn Phe Val
Val Asp Ser Ser Ser Cys 290 295 300 gtg cgt gcc tgc cct agt tcc aag
atg gaa gta gaa naa aat ggg att 960Val Arg Ala Cys Pro Ser Ser Lys
Met Glu Val Glu Xaa Asn Gly Ile 305 310 315 320 aaa atg tgt aaa cct
tgc act gac att tgc cca aaa gct tgt gat gg 1008Lys Met Cys Lys Pro
Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly 325 330 335 att ggc aca
gga tca ttg atg tca gct cag act gtg gat tcc agt aac 1056Ile Gly Thr
Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser Ser Asn 340 345 350 att
gac aaa ttc ata aac tgt acc aag atc aat ggg aat ttg atc ttt 1104Ile
Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe 355 360
365 cta gtc act ggt att cat ggg gac cct tac aat gca att gaa gcc ata
1152Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile
370 375 380 gac cca gag aaa ctg aac gtc ttt cgg aca gtc aga gag ata
aca ggt 1200Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile
Thr Gly 385 390 395 400 ttc ctg aac ata cag tca tgg cca cca aac atg
act gac ttc agt gtt 1248Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met
Thr Asp Phe Ser Val 405 410 415 ttt tct aac ctg gtg acc att ggt gga
aga gta ctc tat agt ggc ctg 1296Phe Ser Asn Leu Val Thr Ile Gly Gly
Arg Val Leu Tyr Ser Gly Leu 420 425 430 tcc ttg ctt atc ctc aag caa
cag ggc atc acc tct cta cag ttc cag 1344Ser Leu Leu Ile Leu Lys Gln
Gln Gly Ile Thr Ser Leu Gln Phe Gln 435 440 445 tcc ctg aag naa atc
agc gca gga aac atc tat att act gac aac agc 1392Ser Leu Lys Xaa Ile
Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser 450 455 460 aac ctg tgt
tat tat cat acc att aac tgg aca aca ctc ttc agc aca 1440Asn Leu Cys
Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr 465 470 475 480
atc aac cag aga ata gta atc cgg gac aac aga aaa gct gaa aat tgt
1488Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Arg Lys Ala Glu Asn Cys
485 490 495 act gct gaa gga atg gtg tgc aac cat ctg tgt tcc agt gat
ggc tgt 1536Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp
Gly Cys 500 505 510 tgg gga cct ggg cca gac caa tgt ctg tcg tgt cgc
cgc ttc agt aga 1584Trp Gly Pro Gly Pro Asp Gln Cys Leu Ser Cys Arg
Arg Phe Ser Arg 515 520 525 gga agg atc tgc ata gag tct tgt aac ctc
tat gat ggt naa ttt ngg 1632Gly Arg Ile Cys Ile Glu Ser Cys Asn Leu
Tyr Asp Gly Xaa Phe Xaa 530 535 540 gag ttt gag aat ggc tcc atc tgt
gtg gag tgt gac ccc cag tgt gag 1680Glu Phe Glu Asn Gly Ser Ile Cys
Val Glu Cys Asp Pro Gln Cys Glu 545 550 555 560 aag atg naa gat ggc
ctc ctc aca tgc cat gga ccg ggt cct gac aac 1728Lys Met Xaa Asp Gly
Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn 565 570 575 tgt aca aag
tgc tct cat ttt aaa gat ggc cca aac tgt gtg gaa aaa 1776Cys Thr Lys
Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys 580 585 590 tgt
cca gat ggc tta cag ggg gca aac agt ttc att ttc aag tat gct 1824Cys
Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe Lys Tyr Ala 595 600
605 gat cca gat cgg gag tgc cac cca tgc cat cca aac tgc acc caa ggg
1872Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gln Gly
610 615 620 tgt aac ggt ccc act agt cat gac tgc att tac tac cca tgg
acg ggc 1920Cys Asn Gly Pro Thr Ser His Asp Cys Ile Tyr Tyr Pro Trp
Thr Gly 625 630 635 640 cat tcc act tta cca caa cat gct aga act ccc
ctg att gca gct gga 1968His Ser Thr Leu Pro Gln His Ala Arg Thr Pro
Leu Ile Ala Ala Gly 645 650 655 gta att ggt ggg ctc ttc att ctg gtc
att gtg ggt ctg aca ttt gct 2016Val Ile Gly Gly Leu Phe Ile Leu Val
Ile Val Gly Leu Thr Phe Ala 660 665 670 gtt tat gtt aga agg aag agc
atc aaa aag aaa aga gcc ttg aga aga 2064Val Tyr Val Arg Arg Lys Ser
Ile Lys Lys Lys Arg Ala Leu Arg Arg 675 680 685 ttc ttg gaa aca gag
ttg gtg gaa cca tta act ccc agt ggc aca gca 2112Phe Leu Glu Thr Glu
Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala 690 695 700 ccc aat caa
gct caa ctt cgt att ttg aaa gaa act gag ctg aag agg 2160Pro Asn Gln
Ala Gln Leu Arg Ile Leu Lys Glu Thr Glu Leu Lys Arg 705 710 715 720
gta aaa gtc ctt ggc tca ggt gct ttt gga acg gtt tat aaa ggt att
2208Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly Ile
725 730 735 tgg gta cct gaa gga gaa act gtg aag att cct gtg gct att
aag att 2256Trp Val Pro Glu Gly Glu Thr Val Lys Ile Pro Val Ala Ile
Lys Ile 740 745 750 ctt aat gag aca act ggt ccc aag gca aat gtg gag
ttc atg gat gaa 2304Leu Asn Glu Thr Thr Gly Pro Lys Ala Asn Val Glu
Phe Met Asp Glu 755 760 765 gct ctg atc atg gca agt atg gat cat cca
cac cta gtc cgg ttg ctg 2352Ala Leu Ile Met Ala Ser Met Asp His Pro
His Leu Val Arg Leu Leu 770 775 780 ggt gtg tgt ctg agc cca acc atc
cag ctg gtt act caa ctt atg ccc 2400Gly Val Cys Leu Ser Pro Thr Ile
Gln Leu Val Thr Gln Leu Met Pro 785 790 795 800 cat ggc tgc ctg ttg
gag tat gtc cac gag cac aag gat aac att gga 2448His Gly Cys Leu Leu
Glu Tyr Val His Glu His Lys Asp Asn Ile Gly 805 810 815 tca caa ctg
ctg ctt aac tgg tgt gtc cag ata gct aag gga atg atg 2496Ser Gln Leu
Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met 820 825 830 tac
ctg gaa naa aga cga ctc gtt cat cgg gat ttg gca gcc cgt aat 2544Tyr
Leu Glu Xaa Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn 835 840
845 gtc tta gtg aaa tct cca aac cat gtg aaa atc aca gat ttt ggg cta
2592Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu
850 855 860 gcc aga ctc ttg gaa gga gat naa aaa gag tac aat gct gat
gga gga 2640Ala Arg Leu Leu Glu Gly Asp Xaa Lys Glu Tyr Asn Ala Asp
Gly Gly 865 870 875 880 aag atg cca att aaa tgg atg gct ctg gag tgt
ata cat tac agg aaa 2688Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys
Ile His Tyr Arg Lys 885 890 895 ttc acc cat cag agt gac gtt tgg agc
tat gga gtt act ata tgg ga 2736Phe Thr His Gln Ser Asp Val Trp Ser
Tyr Gly Val Thr Ile Trp Glu 900 905 910 ctg atg acc ttt gga gga aaa
ccc tat gat gga att cca acg cga gaa 2784Leu Met Thr Phe Gly Gly Lys
Pro Tyr Asp Gly Ile Pro Thr Arg Glu 915 920 925 atc cct gat tta tta
gag aaa gga gaa cgt ttg cct cag cct ccc atc 2832Ile Pro Asp Leu Leu
Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile 930 935 940 tgc act att
gac gtt tac atg gtc atg gtc aaa tgt tgg atg att gat 2880Cys Thr Ile
Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp 945 950 955 960
gct gac agt aga cct aaa ttt aag gaa ctg gct gct gag ttt tca agg
2928Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg
965 970 975 atg gct cga gac cct caa aga tac cta gtt att cag ggt gat
gat cgt 2976Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp
Asp Arg 980 985 990 atg aag ctt ccc agt cca aat gac agc aag ttc ttt
cag aat ctc t 3024Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe
Gln Asn Leu Leu 995 1000 1005 gat gaa gag gat ttg gaa gat atg atg
gat gct gag gag tac ttg 3069Asp Glu Glu Asp Leu Glu Asp Met Met Asp
Ala Glu Glu Tyr Leu 1010 1015 1020 gtc cct cag gct ttc aac atc cca
cct ccc atc tat act tcc aga 3114Val Pro Gln Ala Phe Asn Ile Pro Pro
Pro Ile Tyr Thr Ser Arg 1025 1030 1035 gca aga att gac tcg aat agg
agt gaa att gga cac agc cct cct 3159Ala Arg Ile Asp Ser Asn Arg Ser
Glu Ile Gly His Ser Pro Pro 1040 1045 1050 cct gcc tac acc ccc atg
tca gga aac cag ttt gta tac cga gat 3204Pro Ala Tyr Thr Pro Met Ser
Gly Asn Gln Phe Val Tyr Arg Asp 1055 1060 1065 gga ggt ttt gct gct
gaa caa gga gtg tct gtg ccc tac aga gcc 3249Gly Gly Phe Ala Ala Glu
Gln Gly Val Ser Val Pro Tyr Arg Ala 1070 1075 1080 cca act agc aca
att cca gaa gct cct gtg gca cag ggt gct act 3294Pro Thr Ser Thr Ile
Pro Glu Ala Pro Val Ala Gln Gly Ala Thr 1085 1090 1095 gct gag att
ttt gat gac tcc tgc tgt aat ggc acc cta cgc aag 3339Ala Glu Ile Phe
Asp Asp Ser Cys Cys Asn Gly Thr Leu Arg Lys 1100 1105 1110 cca gtg
gca ccc cat gtc caa gag gac agt agc acc cag agg tac 3384Pro Val Ala
Pro His Val Gln Glu Asp Ser Ser Thr Gln Arg Tyr 1115 1120 1125 agt
gct gac ccc acc gtg ttt gcc cca gaa cgg agc cca cga gga 3429Ser Ala
Asp Pro Thr Val Phe Ala Pro Glu Arg Ser Pro Arg Gly 1130 1135 1140
gag ctg gat gag gaa ggt tac atg act cct atg cga gac aaa ccc 3474Glu
Leu Asp Glu Glu Gly Tyr Met Thr Pro Met Arg Asp Lys Pro 1145 1150
1155 aaa caa gaa tac ctg aat cca gtg gag gag aac cct ttt gtt tct
3519Lys Gln Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser
1160 1165 1170 cgg aga aaa aat gga gac ctt caa gca ttg gat aat ccc
gaa tat 3564Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu Asp Asn Pro Glu
Tyr 1175 1180 1185 cac aat gca tcc aat ggt cca ccc aag gcc gag gat
gag tat gtg 3609His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp Glu
Tyr Val 1190 1195 1200 aat gag cca ctg tac ctc aac acc ttt gcc aac
acc ttg gga aaa 3654Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr
Leu Gly Lys 1205 1210 1215 gct gag tac ctg aag aac aac ata ctg tca
atg cca gag aag gcc 3699Ala Glu Tyr Leu Lys Asn Asn Ile Leu Ser Met
Pro Glu Lys Ala 1220 1225 1230 aag aaa gcg ttt gac aac cct gac tac
tgg aac cac agc ctg cca 3744Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp
Asn His Ser Leu Pro 1235 1240 1245 cct cgg agc acc ctt cag cac cca
gac tac ctg cag gag tac agc 3789Pro Arg Ser Thr Leu Gln His Pro Asp
Tyr Leu Gln Glu Tyr Ser 1250 1255 1260 aca aaa tat ttt tat aaa cag
aat ggg cgg atc cgg cct att gtg 3834Thr Lys Tyr Phe Tyr Lys Gln Asn
Gly Arg Ile Arg Pro Ile Val 1265 1270 1275 gca gag aat cct gaa tac
ctc tct gag ttc tcc ctg aag cca ggc 3879Ala Glu Asn Pro Glu Tyr Leu
Ser Glu Phe Ser Leu Lys Pro Gly 1280 1285 1290 act gtg ctg ccg cct
cca cct tac aga cac cgg aat act gtg gtg 3924Thr Val Leu Pro Pro Pro
Pro Tyr Arg His Arg Asn Thr Val Val 1295 1300 1305 taa
392721308PRTHomo sapiensmisc_feature(317)..(317)The 'Xaa' at
location 317
stands for Lys, Glu, or Gln. 2Met Lys Pro Ala Thr Gly Leu Trp Val
Trp Val Ser Leu Leu Val Ala 1 5 10 15 Ala Gly Thr Val Gln Pro Ser
Asp Ser Gln Ser Val Cys Ala Gly Thr 20 25 30 Glu Asn Lys Leu Ser
Ser Leu Ser Asp Leu Glu Gln Gln Tyr Arg Ala 35 40 45 Leu Arg Lys
Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu 50 55 60 Ile
Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val 65 70
75 80 Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gln Phe Arg
Tyr 85 90 95 Leu Pro Leu Glu Asn Leu Arg Ile Ile Arg Gly Thr Lys
Leu Tyr Glu 100 105 110 Asp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr
Arg Lys Asp Gly Asn 115 120 125 Phe Gly Leu Gln Glu Leu Gly Leu Lys
Asn Leu Thr Glu Ile Leu Asn 130 135 140 Gly Gly Val Tyr Val Asp Gln
Asn Lys Phe Leu Cys Tyr Ala Asp Thr 145 150 155 160 Ile His Trp Gln
Asp Ile Val Arg Asn Pro Trp Pro Ser Asn Leu Thr 165 170 175 Leu Val
Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser 180 185 190
Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gln Thr Leu 195
200 205 Thr Arg Thr Val Cys Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly
Pro 210 215 220 Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly
Cys Ser Gly 225 230 235 240 Pro Lys Asp Thr Asp Cys Phe Ala Cys Met
Asn Phe Asn Asp Ser Gly 245 250 255 Ala Cys Val Thr Gln Cys Pro Gln
Thr Phe Val Tyr Asn Pro Thr Thr 260 265 270 Phe Gln Leu Glu His Asn
Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe 275 280 285 Cys Val Lys Lys
Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys 290 295 300 Val Arg
Ala Cys Pro Ser Ser Lys Met Glu Val Glu Xaa Asn Gly Ile 305 310 315
320 Lys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly
325 330 335 Ile Gly Thr Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser
Ser Asn 340 345 350 Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly
Asn Leu Ile Phe 355 360 365 Leu Val Thr Gly Ile His Gly Asp Pro Tyr
Asn Ala Ile Glu Ala Ile 370 375 380 Asp Pro Glu Lys Leu Asn Val Phe
Arg Thr Val Arg Glu Ile Thr Gly 385 390 395 400 Phe Leu Asn Ile Gln
Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val 405 410 415 Phe Ser Asn
Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu 420 425 430 Ser
Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln 435 440
445 Ser Leu Lys Xaa Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser
450 455 460 Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe
Ser Thr 465 470 475 480 Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Arg
Lys Ala Glu Asn Cys 485 490 495 Thr Ala Glu Gly Met Val Cys Asn His
Leu Cys Ser Ser Asp Gly Cys 500 505 510 Trp Gly Pro Gly Pro Asp Gln
Cys Leu Ser Cys Arg Arg Phe Ser Arg 515 520 525 Gly Arg Ile Cys Ile
Glu Ser Cys Asn Leu Tyr Asp Gly Xaa Phe Xaa 530 535 540 Glu Phe Glu
Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu 545 550 555 560
Lys Met Xaa Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn 565
570 575 Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu
Lys 580 585 590 Cys Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe
Lys Tyr Ala 595 600 605 Asp Pro Asp Arg Glu Cys His Pro Cys His Pro
Asn Cys Thr Gln Gly 610 615 620 Cys Asn Gly Pro Thr Ser His Asp Cys
Ile Tyr Tyr Pro Trp Thr Gly 625 630 635 640 His Ser Thr Leu Pro Gln
His Ala Arg Thr Pro Leu Ile Ala Ala Gly 645 650 655 Val Ile Gly Gly
Leu Phe Ile Leu Val Ile Val Gly Leu Thr Phe Ala 660 665 670 Val Tyr
Val Arg Arg Lys Ser Ile Lys Lys Lys Arg Ala Leu Arg Arg 675 680 685
Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala 690
695 700 Pro Asn Gln Ala Gln Leu Arg Ile Leu Lys Glu Thr Glu Leu Lys
Arg 705 710 715 720 Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val
Tyr Lys Gly Ile 725 730 735 Trp Val Pro Glu Gly Glu Thr Val Lys Ile
Pro Val Ala Ile Lys Ile 740 745 750 Leu Asn Glu Thr Thr Gly Pro Lys
Ala Asn Val Glu Phe Met Asp Glu 755 760 765 Ala Leu Ile Met Ala Ser
Met Asp His Pro His Leu Val Arg Leu Leu 770 775 780 Gly Val Cys Leu
Ser Pro Thr Ile Gln Leu Val Thr Gln Leu Met Pro 785 790 795 800 His
Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn Ile Gly 805 810
815 Ser Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met
820 825 830 Tyr Leu Glu Xaa Arg Arg Leu Val His Arg Asp Leu Ala Ala
Arg Asn 835 840 845 Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr
Asp Phe Gly Leu 850 855 860 Ala Arg Leu Leu Glu Gly Asp Xaa Lys Glu
Tyr Asn Ala Asp Gly Gly 865 870 875 880 Lys Met Pro Ile Lys Trp Met
Ala Leu Glu Cys Ile His Tyr Arg Lys 885 890 895 Phe Thr His Gln Ser
Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu 900 905 910 Leu Met Thr
Phe Gly Gly Lys Pro Tyr Asp Gly Ile Pro Thr Arg Glu 915 920 925 Ile
Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile 930 935
940 Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp
945 950 955 960 Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu
Phe Ser Arg 965 970 975 Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile
Gln Gly Asp Asp Arg 980 985 990 Met Lys Leu Pro Ser Pro Asn Asp Ser
Lys Phe Phe Gln Asn Leu Leu 995 1000 1005 Asp Glu Glu Asp Leu Glu
Asp Met Met Asp Ala Glu Glu Tyr Leu 1010 1015 1020 Val Pro Gln Ala
Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Arg 1025 1030 1035 Ala Arg
Ile Asp Ser Asn Arg Ser Glu Ile Gly His Ser Pro Pro 1040 1045 1050
Pro Ala Tyr Thr Pro Met Ser Gly Asn Gln Phe Val Tyr Arg Asp 1055
1060 1065 Gly Gly Phe Ala Ala Glu Gln Gly Val Ser Val Pro Tyr Arg
Ala 1070 1075 1080 Pro Thr Ser Thr Ile Pro Glu Ala Pro Val Ala Gln
Gly Ala Thr 1085 1090 1095 Ala Glu Ile Phe Asp Asp Ser Cys Cys Asn
Gly Thr Leu Arg Lys 1100 1105 1110 Pro Val Ala Pro His Val Gln Glu
Asp Ser Ser Thr Gln Arg Tyr 1115 1120 1125 Ser Ala Asp Pro Thr Val
Phe Ala Pro Glu Arg Ser Pro Arg Gly 1130 1135 1140 Glu Leu Asp Glu
Glu Gly Tyr Met Thr Pro Met Arg Asp Lys Pro 1145 1150 1155 Lys Gln
Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser 1160 1165 1170
Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu Asp Asn Pro Glu Tyr 1175
1180 1185 His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp Glu Tyr
Val 1190 1195 1200 Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr
Leu Gly Lys 1205 1210 1215 Ala Glu Tyr Leu Lys Asn Asn Ile Leu Ser
Met Pro Glu Lys Ala 1220 1225 1230 Lys Lys Ala Phe Asp Asn Pro Asp
Tyr Trp Asn His Ser Leu Pro 1235 1240 1245 Pro Arg Ser Thr Leu Gln
His Pro Asp Tyr Leu Gln Glu Tyr Ser 1250 1255 1260 Thr Lys Tyr Phe
Tyr Lys Gln Asn Gly Arg Ile Arg Pro Ile Val 1265 1270 1275 Ala Glu
Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly 1280 1285 1290
Thr Val Leu Pro Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val 1295
1300 1305 320DNAArtificial SequenceSynthetic oligonucleotide
3ggaaatagct gcacagtccg 20421DNAArtificial SequenceSynthetic
oligonucleotide 4agaactggga taggcttgtg g 21544DNAArtificial
SequenceSynthetic oligonucleotide 5gtaaaacgac ggccagtaag ccaattcttt
agaatatgat atgg 44624DNAArtificial SequenceSynthetic
oligonucleotide 6tcttggctat tagcaacatg actc 24740DNAArtificial
SequenceSynthetic oligonucleotide 7gtaaaacgac ggccagtaaa tcctcataaa
ggagcaggag 40840DNAArtificial SequenceSynthetic oligonucleotide
8gtaaaacgac ggccagttga attgagtcaa agacagggtg 40925DNAArtificial
SequenceSynthetic oligonucleotide 9tttggaaaca cacatgactc ttaaa
251021DNAArtificial SequenceSynthetic oligonucleotide 10gtggagcagt
aaccaagcaa g 211125DNAArtificial SequenceSynthetic oligonucleotide
11aaagcagaac cagtagtgaa tgttg 251238DNAArtificial SequenceSynthetic
oligonucleotide 12gtaaaacgac ggccagtcct cctccacatc tagcacag
381339DNAArtificial SequenceSynthetic oligonucleotide 13gtaaaacgac
ggccagtcct ttctcacttc ccaactttc 391443DNAArtificial
SequenceSynthetic oligonucleotide 14gtaaaacgac ggccagtttg
attcagtttc catttataca cca 431538DNAArtificial SequenceSynthetic
oligonucleotide 15gtaaaacgac ggccagttag gccaccaaag tcatttgc
381638DNAArtificial SequenceSynthetic oligonucleotide 16gtaaaacgac
ggccagttga tgctcctggc acatagag 381722DNAArtificial
SequenceSynthetic oligonucleotide 17tcttagagga agatttgcca cc
221820DNAArtificial SequenceSynthetic oligonucleotide 18gcttcccatg
ttcttcctcc 201925DNAArtificial SequenceSynthetic oligonucleotide
19tgtggataat gtcttgtaca actgc 252020DNAArtificial SequenceSynthetic
oligonucleotide 20ggttgtcaag gcaaaccaag 202123DNAArtificial
SequenceSynthetic oligonucleotide 21aagcagacaa caaagttgca gag
232240DNAArtificial SequenceSynthetic oligonucleotide 22gtaaaacgac
ggccagttca gcaccattag tacaatccaa 402339DNAArtificial
SequenceSynthetic oligonucleotide 23gtaaaacgac ggccagtgca
cttccaactg aaggctaag 392435DNAArtificial SequenceSynthetic
oligonucleotide 24gtaaaacgac ggccagtagg ccagcccaaa gactc
352521DNAArtificial SequenceSynthetic oligonucleotide 25tgattggtgt
ttggattgac c 212641DNAArtificial SequenceSynthetic oligonucleotide
26gtaaaacgac ggccagtgag tcgtttcttt cactagcttg c 412721DNAArtificial
SequenceSynthetic oligonucleotide 27taggtttctt aatggccggt g
212822DNAArtificial SequenceSynthetic oligonucleotide 28tgcttaggaa
gcttcactgt tg 222921DNAArtificial SequenceSynthetic oligonucleotide
29tggctttgat atccttgtgg c 213023DNAArtificial SequenceSynthetic
oligonucleotide 30ccatatgcag aagagacaaa tgc 233121DNAArtificial
SequenceSynthetic oligonucleotide 31tgaatccagt ggaggagaac c
213235DNAArtificial SequenceSynthetic oligonucleotide 32gtaaaacgac
ggccagtatg ggtgaagagg gcagg 353338DNAArtificial SequenceSynthetic
oligonucleotide 33gtaaaacgac ggccagtttc caggtatcag cacacagg
383422DNAArtificial SequenceSynthetic oligonucleotide 34tgccttagag
tgttcctcaa tg 223540DNAArtificial SequenceSynthetic oligonucleotide
35gtaaaacgac ggccagtcaa tgaatgcaat caaagttcaa 403621DNAArtificial
SequenceSynthetic oligonucleotide 36ccaaagcaaa tcaaccacaa g
213720DNAArtificial SequenceSynthetic oligonucleotide 37ggaatgactt
tgaggagggc 203843DNAArtificial SequenceSynthetic oligonucleotide
38gtaaaacgac ggccagtttt gctatgaaac tttacacaaa tca
433938DNAArtificial SequenceSynthetic oligonucleotide 39gtaaaacgac
ggccagtgtg tgggtaggtt tggttgtg 384039DNAArtificial
SequenceSynthetic oligonucleotide 40gtaaaacgac ggccagtggt
gaaactcttc agcttccag 394121DNAArtificial SequenceSynthetic
oligonucleotide 41tctcctgacc tcatgatcca c 214221DNAArtificial
SequenceSynthetic oligonucleotide 42tacctcacac catcatcgga g
214321DNAArtificial SequenceSynthetic oligonucleotide 43gagcaacaat
tctgaccgga t 214418DNAArtificial SequenceSynthetic oligonucleotide
44gaatggcgtg aacccagg 184521DNAArtificial SequenceSynthetic
oligonucleotide 45cccatggcat cctgtaagta g 214639DNAArtificial
SequenceSynthetic oligonucleotide 46gtaaaacgac ggccagtcat
ttcagagatg gtaccaggg 394742DNAArtificial SequenceSynthetic
oligonucleotide 47gtaaaacgac ggccagtaag taagaaagtt ggcttgagaa gg
424840DNAArtificial SequenceSynthetic oligonucleotide 48gtaaaacgac
ggccagtttc acaagctttg tttaacggac 404938DNAArtificial
SequenceSynthetic oligonucleotide 49gtaaaacgac ggccagtaga
ctgtatccgt cccagctc 385039DNAArtificial SequenceSynthetic
oligonucleotide 50gtaaaacgac ggccagttct aggcagacag ttgtgaagc
395121DNAArtificial SequenceSynthetic oligonucleotide 51tttggcacct
agtcaattca a 215221DNAArtificial SequenceSynthetic oligonucleotide
52aggcaaatgg tagaaccaag g 215327DNAArtificial SequenceSynthetic
oligonucleotide 53taactgcttt aggaaattag gcttatc 275439DNAArtificial
SequenceSynthetic oligonucleotide 54gtaaaacgac ggccagtcaa
agaggcgttc atatgttcc 395521DNAArtificial SequenceSynthetic
oligonucleotide 55tgtttgtggt cctttccaca g 215639DNAArtificial
SequenceSynthetic oligonucleotide 56gtaaaacgac
ggccagtggc atcacattga tttgagcta 395738DNAArtificial
SequenceSynthetic oligonucleotide 57gtaaaacgac ggccagttaa
ctcactgttg gcaaaggc 385842DNAArtificial SequenceSynthetic
oligonucleotide 58gtaaaacgac ggccagtcag ctatctggca atttctattc tg
425938DNAArtificial SequenceSynthetic oligonucleotide 59gtaaaacgac
ggccagtagg tagtctgggt gctgaagg 386038DNAArtificial
SequenceSynthetic oligonucleotide 60gtaaaacgac ggccagtgac
caccagagaa agagaggg 386117DNAArtificial SequenceSynthetic
oligonucleotide 61gtaaaacgac ggccagt 176230DNAArtificial
SequenceSynthetic oligonucleotide 62cggctctaga gccaccatga
agccggcgac 306331DNAArtificial SequenceSynthetic oligonucleotide
63atcggcggcc gcttacacca cagtattccg g 316421DNAArtificial
SequenceSynthetic oligonucleotide 64tcatttgtgc agcaacttct c
216522DNAArtificial SequenceSynthetic oligonucleotide 65gcagacagtt
gtgaagcaaa ag 226623DNAArtificial SequenceSynthetic oligonucleotide
66caagctttaa ttcgcaaaga aga 236723DNAArtificial SequenceSynthetic
oligonucleotide 67tgctttagga aattaggctt atc 236825DNAArtificial
SequenceSynthetic oligonucleotide 68tttttccttc atgtttagat cattt
256922DNAArtificial SequenceSynthetic oligonucleotide 69accttgtcct
gctaatttgc tc 227020DNAArtificial SequenceSynthetic oligonucleotide
70cagtagcaga gccacttgaa 207121DNAArtificial SequenceSynthetic
oligonucleotide 71ctgtcctagg gttttggcat t 217222DNAArtificial
SequenceSynthetic oligonucleotide 72tgctatccta tttccatgct gt
227325DNAArtificial SequenceSynthetic oligonucleotide 73tccccactta
attattttta ccttt 257421DNAArtificial SequenceSynthetic
oligonucleotide 74ggctactcag aggctaaggt g 217522DNAArtificial
SequenceSynthetic oligonucleotide 75tttttaattg attggtgttt gg
227628DNAArtificial SequenceSynthetic oligonucleotide 76tgacctgtaa
ggagtattct tttactac 287720DNAArtificial SequenceSynthetic
oligonucleotide 77tgtccaccag gacaaatgta 207818DNAArtificial
SequenceSynthetic oligonucleotide 78tgtaaaacga cggccagt
187918DNAArtificial SequenceSynthetic oligonucleotide 79caggaaacag
ctatgacc 18
* * * * *
References