U.S. patent application number 14/107291 was filed with the patent office on 2014-04-17 for full cold-pcr enrichment with reference blocking sequence.
This patent application is currently assigned to DANA-FARBER CANCER INSTITUTE, INC.. The applicant listed for this patent is Dana-Farber Cancer Institute, Inc.. Invention is credited to Gerassimos Makrigiorgos.
Application Number | 20140106362 14/107291 |
Document ID | / |
Family ID | 43983637 |
Filed Date | 2014-04-17 |
United States Patent
Application |
20140106362 |
Kind Code |
A1 |
Makrigiorgos; Gerassimos |
April 17, 2014 |
Full COLD-PCR Enrichment with Reference Blocking Sequence
Abstract
The present invention is directed to methods, compositions and
software for enriching low abundance alleles in a sample. It is
directed in particular to the use of an excess amount of reference
blocking sequence in an amplification reaction mixture in order to
improve the enrichment efficiency, and reduce cycle time, of full
COLD-PCR.
Inventors: |
Makrigiorgos; Gerassimos;
(Chestnut Hill, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dana-Farber Cancer Institute, Inc. |
Boston |
MA |
US |
|
|
Assignee: |
DANA-FARBER CANCER INSTITUTE,
INC.
Boston
MA
|
Family ID: |
43983637 |
Appl. No.: |
14/107291 |
Filed: |
December 16, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13042549 |
Mar 8, 2011 |
8623603 |
|
|
14107291 |
|
|
|
|
61311642 |
Mar 8, 2010 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
C12Q 1/6858 20130101;
C12Q 1/6848 20130101; C12Q 2527/107 20130101; C12Q 2537/159
20130101; C12Q 2537/163 20130101; C12Q 1/6858 20130101 |
Class at
Publication: |
435/6.12 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1-24. (canceled)
25. A kit for enriching a target nucleic acid sequence suspected to
be in a nucleic acid sample which also contains a concentration of
a reference nucleic acid sequence, said target nucleic acid
sequence is at least 50% homologous to the reference nucleic acid
sequence and differs from the reference nucleic acid sequence by at
least one deletion, insertion or substitution and is amplifiable by
a same primer pair as the reference nucleic acid sequence, the kit
comprising: buffer; DNA polymerase; deoxyribonucleotide
triphosphates; a first primer pair comprising a first forward
primer and a first reverse primer that anneal to respective binding
sites on complementary strands of the reference nucleic acid
sequence in the nucleic acid sample and the target nucleic acid
sequence suspected to be in the nucleic acid sample, the first
forward and first reverse primers annealing to the respective
strands of reference nucleic acid sequence and target nucleic acid
sequence at or below a defined first primer binding temperature;
and an engineered reference blocking sequence oligonucleotide that
is fully complementary with at least a portion of one of the
strands of the reference nucleic acid sequence to which one of the
first forward or first reverse primer binds, and is not fully
complementary with the strand of the target nucleic acid sequence
to which said first forward or first reverse primer binds; wherein
when the engineered reference blocking sequence oligonucleotide is
in molar excess to the concentration of the reference nucleic acid
sequence in a reaction mixture and the reaction mixture is cooled
to a temperature that is higher than the defined primer binding
temperature, the reference blocking sequence oligonucleotide
anneals to the respective strands of target nucleic acid sequence
and reference nucleic acid sequence to which one of the forward or
reverse primers anneals to form heteroduplexes of the engineered
reference blocking sequence oligonucleotide and target nucleic acid
sequence and duplexes of the engineered reference blocking sequence
oligonucleotide and reference nucleic acid sequence, and the
melting temperature of heteroduplexes of the engineered reference
blocking sequence oligonucleotide and the target nucleic acid
sequence is lower than the melting temperature of duplexes of the
reference blocking sequence oligonucleotide and the reference
nucleic acid sequence.
26. The kit of claim 25 wherein a 3'-end of the reference blocking
sequence oligonucleotide is blocked to inhibit extension.
27. The kit of claim 25 wherein the 5'-end on the reference
blocking sequence oligonucleotide strands comprises a nucleotide
that prevents 5' to 3' exonucleolysis by Taq DNA polymerases.
28. The kit of claim 25 wherein the engineered reference blocking
sequence oligonucleotide has a length of less than or equal to 200
bp.
29. The kit of claim 25 further comprising: a second primer pair
comprising a second forward primer and a second reverse primer
capable of amplifying a portion of the reference sequence and the
target sequence larger than and comprising the portion of the
reference sequence and the target sequence amplified by the first
primer pair; and a high fidelity polymerase.
30. The kit of claim 25 wherein the engineered reference blocking
sequence oligonucleotide is one of single-stranded DNA, RNA,
peptide nucleic acid or locked nucleic acid.
31. The kit of claim 25 wherein the engineered reference blocking
sequence oligonucleotide is a chimera between single-stranded DNA,
RNA, peptide nucleic acid or locked nucleic acid or another
modified nucleotide.
32. The kit of claim 31 wherein the position of the peptide nucleic
acid or locked nucleic acid on the chimera sequence are selected to
match positions where mutations are suspected to be present in the
target nucleic acid sequence, thereby maximizing the difference
between the temperature needed to denature heteroduplexes of the
reference blocking sequence oligonucleotide and target strands and
the temperature needed to denature duplexes of the reference
blocking sequence oligonucleotide and the complementary reference
strand.
33. The kit of claim 25 wherein the engineered reference blocking
sequence oligonucleotide overlaps partially with one of the first
forward and the first reverse primers such that said primer does
not bind appreciably to the complementary strand of the reference
nucleic acid sequence fragment when annealed to the engineered
reference blocking sequence oligonucleotide and further does not
bind appreciably to the engineered reference blocking sequence
oligonucleotide.
34. A reaction mixture comprising: a buffer; DNA polymerase;
deoxyribonucleotide triphosphates; a nucleic acid sample comprising
a concentration of reference sequence nucleic acid fragments in the
reaction mixture and also suspected of containing one or more
target nucleic acid sequence fragments, said target nucleic acid
sequence fragments being at least 50% homologous to the reference
nucleic acid sequence fragments and differing from the reference
nucleic acid sequence fragments by at least one deletion, insertion
or substitution and amplifiable by a same primer pair as the
reference nucleic acid sequence; a primer pair comprising a forward
primer and a reverse primer that anneal to respective binding sites
on complementary strands of the reference nucleic acid sequence
fragments in the reaction mixture and the target nucleic acid
sequence fragments suspected to be present in the nucleic acid
sample and in the reaction mixture, the forward and reverse primers
annealing to the respective strands of references nucleic acid
sequence and target nucleic acid sequence when the reaction mixture
is cooled to or below a defined primer binding temperature; and an
engineered reference blocking sequence oligonucleotide that is
fully complementary with at least a portion of the strand of the
reference nucleic acid sequence fragments to which one of the
forward or reverse primer anneals, and is not fully complementary
with a portion of the strand of the target nucleic acid sequence to
which said one of the forward or reverse primer anneals, wherein
the engineered reference blocking sequence oligonucleotide anneals
to the respective strands of target nucleic acid sequence and
reference nucleic acid sequence to which said one of the forward or
reverse primers anneals to form heteroduplexes of the engineered
reference blocking sequence oligonucleotide and target nucleic acid
sequence and duplexes of the engineered reference blocking sequence
oligonucleotide and reference nucleic acid sequence when the
reaction mixture is cooled to a temperature that is higher than the
defined primer binding temperature, and the melting temperature of
heteroduplexes of the engineered reference blocking sequence
oligonucleotide and the target strands is lower than the melting
temperature of duplexes of the reference blocking sequence
oligonucleotide and the reference strands; and further wherein the
engineered reference blocking sequence oligonucleotide is in molar
excess to the concentration of the complementary reference sequence
fragments in the reaction mixture.
35. The reaction mixture of claim 34 wherein a 3'-end of the
engineered reference blocking sequence oligonucleotide is blocked
to inhibit extension.
36. The reaction mixture of claim 34 wherein the 5'-end on the
engineered reference blocking sequence oligonucleotide comprises a
nucleotide that prevents 5' to 3' exonucleolysis by Taq DNA
polymerases.
37. The reaction mixture of claim 34 wherein the engineered
reference blocking sequence oligonucleotide overlaps partially with
one of the forward and the reverse primers such that the said
primer does not bind appreciably to the complementary strand of
reference nucleic acid sequence fragment when annealed to the
engineered reference blocking sequence oligonucleotide and further
do not bind appreciably to the engineered reference blocking
sequence oligonucleotide.
38. The reaction mixture of claim 34 wherein the engineered
reference blocking sequence oligonucleotide has a length of less
than or equal to 200 bp.
39. The reaction mixture of claim 34 wherein the engineered
reference blocking sequence oligonucleotide is a chimera between
single-stranded DNA, RNA, peptide nucleic acid or locked nucleic
acid or another modified nucleotide.
40. The reaction mixture of claim 39 wherein the position of the
peptide nucleic acid or locked nucleic acid on the chimera sequence
are selected to match positions where mutations are suspected to be
present in the target nucleic acid sequence, thereby maximizing the
difference between the temperature needed to denature
heteroduplexes of the engineered reference blocking sequence
oligonucleotide and target strands and the temperature needed to
denature heteroduplexes of the reference blocking sequence
oligonucleotide and the complementary reference strand.
41. The reaction mixture of claim 34 wherein the nucleic acid
sample is obtained via a pre-amplification process that comprises:
amplifying a sample of genomic DNA via a polymerase chain reaction
using a second forward and second reverse PCR primers and a
high-fidelity polymerase in order to increase the amount of target
nucleic acid sequence fragments that may be in the sample, and
diluting the PCR product to result in a nucleic acid sample
comprising said concentration of reference nucleic acid sequence
fragments.
42. The reaction mixture of claim 34 wherein the target nucleic
acid sequence contains between 1 to 10 sequence changes compared to
the reference nucleic acid sequence.
Description
FIELD OF THE INVENTION
[0001] The invention pertains to improvements to the amplification
and enrichment of low prevalence target sequences, e.g. mutations,
in nucleic acid samples. In particular, the invention pertains to
the use of reference blocking sequences during full COLD-PCR
(CO-amplification at Lower Denaturation temperature).
BACKGROUND OF THE INVENTION
[0002] A commonly encountered situation in genetic analysis entails
the need to identify a low percent of variant DNA sequences
(`target sequences`) in the presence of a large excess of
non-variant sequences (`reference sequences`). Examples for such
situations include: (a) identification and sequencing of a few
mutated alleles in the presence of a large excess of normal
alleles; (b) identification of a few methylated alleles in the
presence of a large excess of unmethylated alleles (or vice versa)
in epigenetic analysis; (c) detection of low levels of heteroplasmy
in mitochondrial DNA; (d) detection of drug-resistant quasi-species
in viral infections and (e) identification of tumor-circulating DNA
in blood of cancer patients (where people are suspected of having
cancer, to track the success of cancer treatment or to detect
relapse) in the presence of a large excess of wild-type
alleles.
[0003] The inventor of the present application has previously
described COLD-PCR methods for enriching the concentration of low
abundance alleles in a sample PCR reaction mixture; see published
patent PCT application entitled "Enrichment of a Target Sequence",
International Application No. PCT/US2008/009248, now U.S. Ser. No.
12/671,295, by Gerassimos Makrigiorgos and assigned to the assignee
of the present invention. The described COLD-PCR enrichment methods
are based on a modified nucleic acid amplification protocol which
incubates the reaction mixture at a critical denaturing temperature
"T.sub.c". The prior patent application discloses two formats of
COLD-PCR, namely full COLD-PCR and fast COLD-PCR.
[0004] In full COLD-PCR, the reaction mixture is subjected to a
first denaturation temperature (e.g., 94.degree. C.) which is
chosen well above the melting temperature for the reference (e.g.,
wild-type) and target (e.g., mutant) sequences similar to
conventional PCR. Then, the mixture is cooled slowly to facilitate
the formation of reference-target heteroduplexes by hybridization.
Steady lowering of the temperature in a controlled manner from
94.degree. C. to 70.degree. C. over an 8 minute time period is
typical to assure proper hybridization. Alternatively, the
temperature is rapidly lowered to 70.degree. C. and retained at
this temperature for 8 min to assure proper hybridization. Once
cooled, the reaction mixture contains not only reference-target
heteroduplexes but also reference-reference homoduplexes (and to a
lesser extent target-target homoduplexes). When the target sequence
and reference sequence cross hybridize, minor sequence differences
of one or more single nucleotide mismatches or insertions or
deletions anywhere along a short (e.g., <200 bp) double stranded
DNA sequence will generate a small but predictable change in the
melting temperature (T.sub.m) for that sequence (Lipsky, R. H., et
al. (2001) Clin Chem, 47, 635-644; Liew, M., et al. (2004) Clin
Chem, 50, 1156-1164). Depending on the exact sequence context and
position of the mismatch, melting temperature changes of
0.1-20.degree. C., are contemplated. Full COLD-PCR, as described in
the above referred patent application, is premised on the
difference in melting temperature between the double stranded
reference sequence and the hybridized reference-target
heteroduplexes. After cooling down to form reference-target
heteroduplexes, the reaction mixture is incubated at a critical
denaturing temperature (T.sub.c), which is chosen to be less than
the melting temperature for the double stranded reference sequence
and higher than the lower melting temperature of the
reference-target heteroduplexes, thereby preferentially denaturing
the cross hybridized target-reference heteroduplexes over the
reference-reference homoduplexes.
[0005] The critical denaturing temperature (T.sub.c) is a
temperature below which PCR efficiency drops abruptly for the
reference nucleic acid sequence (yet sufficient to facilitate
denaturation of the reference-target heteroduplexes). For example,
a 167 bp p53 sequence amplifies well if the PCR denaturing
temperature is set at 87.degree. C., amplifies modestly at
86.5.degree. C. and yields no detectable product if PCR
denaturation is set at 86.degree. C. or less. Therefore, in this
example T.sub.c.about.86.5.degree. C. After intermediate incubation
at the critical denaturing temperature (T.sub.c), the primers are
annealed to the denatured target and reference strands from the
denatured heteroduplexes and extended by a polymerase, thus
enriching the concentration of the target sequence relative to the
reference sequence. One of the advantages of full COLD-PCR is that
the same primer pair is used for both target and reference
sequences.
[0006] Fast COLD-PCR, as described in the above referred patent
application, is premised on there being a difference in melting
temperature between the double stranded reference sequence (e.g.,
wild-type sequence) and the double stranded target sequence mutant
sequence). In particular, the melting temperature of the target
sequence must be lower than the reference sequence. The critical
denaturing temperature (T.sub.c) in fast COLD-PCR is a temperature
below which PCR efficiency drops abruptly for the double stranded
reference nucleic acid sequence, yet is still sufficient to
facilitate denaturation of the double stranded target sequence.
During the fast COLD-PCR enrichment cycle, the reaction mixture is
not subjected to denaturation at a temperature (e.g., 94.degree.
C.) above the melting temperature of the reference sequence as in
the first step of the full COLD-PCR cycle. Rather, the reaction
mixture is incubated at a critical denaturing temperature (e.g.,
T.sub.c=83.5.degree. C.), which is chosen either (a) to be less
than the melting temperature for the double stranded reference
sequence and higher than the lower melting temperature of the
double stranded target sequence, or; (b) to be lower than the
T.sub.m of both reference and target sequences, whilst still
creating a differential between the degree of denaturation of
reference and target sequences. After incubation at the critical
denaturing temperature (T.sub.c), the primers are annealed to the
denatured target strands and extended by a polymerase, thus
enriching the concentration of the target sequence relative to the
reference sequence. Again, the same primer pair is used for both
target and reference sequences.
[0007] Enrichment via full COLD-PCR has been found to be relatively
inefficient, and time consuming, compared to enrichment via fast
COLD-PCR. However, the use of fast COLD-PCR is limited to
applications in which the melting temperature of the double
stranded target sequence is suitably less than the melting
temperature for the double stranded reference sequence. For
example, mutations will not be detectable in sequencing data for a
sample with a low abundance of mutant sequences that has been
subjected to fast COLD-PCR if the melting temperature of the mutant
sequence is the same or higher than the melting temperature of the
wild-type sequence. Therefore, it is desired to improve the
efficacy and rate of the full COLD-PCR cycle.
[0008] It is believed that the relative inefficiency of full
COLD-PCR is due primarily to the paucity of heteroduplexes formed
particularly during the early cycles of full COLD-PCR. Even if slow
cool down during the hybridization step is optimized (e.g.,
steadily cool down for 8 minutes from 94.degree. C. to 70.degree.
C.), the very low concentration of target (e.g. mutant) strands
especially during early cycles reduces the ability to form
heteroduplexes. Increasing the time for hybridization cool down is
not desired, and in any event has not been found to be particularly
effective to improve enrichment. Another reason that full COLD-PCR
may be relatively less efficient than fast COLD-PCR is that the
amplicons during later cycles of full COLD-PCR have a propensity to
reform their homoduplexes rather than form heteroduplexes.
[0009] One object of the present invention is to improve the
efficiency of heteroduplex formation in the early cycles of full
COLD-PCR. Another object is to decrease the overall cycle time for
full COLD-PCR.
SUMMARY OF THE INVENTION
[0010] The present invention is directed to methods for enriching
low abundance alleles in a sample, and is directed in particular to
the use of an excess amount of reference blocking sequence in the
reaction mixture in order to improve the efficiency, and reduce
cycle time, of full COLD-PCR.
[0011] The present invention involves a modification to the
COLD-PCR methods described in connection with FIGS. 1 and 2 of the
above referred patent application, "Enrichment of a Target
Sequence", International Application No. PCT/US2008/009248, now
U.S. Ser. No. 12/671,295, by Gerassimos Makrigiorgos and assigned
to the assignee of the present invention, and which is hereby
incorporated herein by reference. More specifically, in accordance
with the invention, an engineered reference blocking sequence
(e.g., a single stranded oligonucleotide) is added in excess to the
reaction mixture prior to subjecting the reaction mixture to
thermocycling per a modified, full COLD-PCR protocol.
[0012] The modified, full COLD-PCR method involves the preparation
of an amplification reaction mixture containing a nucleic acid
sample. The nucleic acid sample will have a reference sequence,
such as a wild-type sequence, and will also be suspected of
containing one or more target sequences, such as one or more mutant
sequences. As mentioned, the purpose of the invention is to enrich
the concentration of the target sequence, and therefore in most
circumstances, the method will be used when the target sequence, if
present, is in low abundance. The target sequence in accordance
with the invention is at least 50% homologous to the reference
sequence, although the method is especially well suited to enrich a
mutant allele containing about 1 to 10 nucleotide sequence changes.
The target sequence is amplifiable via PCR with the same pair of
primers as those used for the reference sequence. As mentioned, the
invention involves the presence of a reference blocking sequence in
the reaction mixture at an excess concentration level. The
reference blocking sequence is a nucleic acid sequence
complementary with at least a portion of one of the strands of the
reference sequence between its primer sites, or partly overlapping
the primer sites. The reference blocking sequence added to the
reaction mixture is desirably single stranded (but can also be
double stranded inasmuch as the initial denaturing step will result
in denatured, single stranded reference blocking sequences).
[0013] In accordance with the full COLD-PCR protocol, the reaction
mixture is subjected to a first denaturing temperature, e.g.
95.degree. C., which is above the melting temperature (T.sub.m) of
the reference sequence and also the target sequence, and results in
denatured strands of the reference sequence and the target
sequence. The reaction mixture is cooled to promote hybridization,
for example to about 70.degree. C. Since the cooling down occurs in
the presence of an excess amount of reference blocking sequences,
the reference blocking sequences preferentially hybridize with the
complementary strand of the reference sequence, and also the
complementary strand of the target sequence. For example assuming
that single stranded reference blocking sequence is added in excess
at the beginning of the process, the reaction mixture at this point
in the process will contains heteroduplexes of the reference
blocking sequences and the complementary reference (e.g.,
wild-type) strand and heteroduplexes of the reference blocking
sequences and the target (e.g. mutant) strands. The reaction
mixture at this point also contains the denatured negative strands
for the reference and target sequences. The formed heteroduplexes
present in the modified full COLD-PCR cycle are fundamentally
different from the reference-target heteroduplexes formed in the
full COLD-PCR protocol described in the above referenced patent
application. Supplying an excess amount of reference blocking
sequence promotes faster hybridization (e.g., about 30 seconds)
than in the prior full COLD-PCR protocol (e.g., about minutes). In
a preferred embodiment of the present invention, the cool down
hybridization step is less than one minute in duration.
[0014] The reaction mixture is then subjected to a critical
temperature (e.g., T.sub.c=84.5.degree. C.) which is sufficient to
permit preferential denaturation of the target strands from the
reference blocking sequence. The critical temperature (T.sub.c) is
selected so that duplexes of the reference blocking strands and the
complementary reference strands remain substantially undenatured
when the reaction mixture is incubated at T.sub.c yet duplexes of
the reference blocking strands and the target strands substantially
denature. The term "substantially" means at least 60%, and
preferably at least 90% or more preferably at least 98% in a given
denatured or undenatured form. The melting temperature for the
duplex of the reference blocking sequence and the target strands
will always be less than the melting temperature of the duplex of
the reference blocking sequence and the complementary reference
strand because the former contains a mismatch whereas the latter
does not.
[0015] After preferential denaturation, the temperature of the
reaction mixture is reduced so as to permit the primer pairs to
anneal to the free target and reference strands in the reaction
mixture. Again, assuming that single stranded reference blocking
oligonucleotides are added in excess at the beginning of the
process, at this point in the cycle there are, theoretically, two
free strands of the target sequence compared to the initial
denaturation step and only one free reference strand. The other
reference strand is hybridized with the reference blocking
sequence, and is therefore unavailable for amplification. The
annealed primers are then extended, thus resulting in exponential
amplification of the target sequence, while the reference strand is
only amplified linearly. Accordingly, the target sequence is
gradually enriched relative to the reference sequence in the sample
during the COLD-PCR cycles.
[0016] The method is likely repeated ten to thirty cycles or more.
It has been found to substantially increase enrichment of target
amplicons and decrease cycle time for full COLD-PCR. It is also
able to enrich homozygous mutations, which would not form
heteroduplexes in the prior full COLD-PCR protocol.
[0017] The length of the reference blocking sequence can be equal
to, or smaller or larger than the length of the target or reference
sequences. In a preferred embodiment, the reference blocking
sequence is several bases smaller than the target and reference
sequences, on each side of the sequence so that the primers do not
bind appreciably to the reference sequence. Hence, the reference
blocking sequence cannot be extended by the primers that amplify
the target sequence. To this end, optionally the 3' OH end of the
reference blocking sequence can be blocked to DNA-polymerase
extension. Also, optionally, the 5'-end of the reference blocking
sequence may be designed with nucleotide sequence that partially
overlaps the primer binding sites such that 5' to 3' exonucleolysis
by Taq DNA polymerases (i.e. degradation of the hybridized
reference blocking sequence) may be prevented.
[0018] As mentioned, the reference sequence is single stranded or
double stranded. In a preferred embodiment, the reference blocking
sequence is single stranded nucleic acid. However, the reference
blocking sequence can take other forms, such as a chimera between
single stranded DNA, RNA, peptide nucleic acid (PNA) or locked
nucleic acid (LNA), or another modified nucleotide. The PNA or LNA
positions on the chimera sequence can be selected to match
positions where mutations are likely, so as to maximize the effect
of potential mismatches at those positions. The reference blocking
sequence can be also single stranded PNA or single stranded
DNA.
[0019] Other embodiments and advantages of the invention may be
apparent to those skilled in the art upon reviewing the drawings
and the following detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] FIG. 1 illustrates a prior art embodiment of full COLD-PCR
for selectively enriching a target sequence as described in the
prior patent application entitled "Enrichment of a Target
Sequence", International Application No. PCT/US2008/009248, now
U.S. Ser. No. 12/671,295, and incorporated herein by reference.
[0021] FIG. 2 illustrates the principle of the present invention
which improves full COLD-PCR via the presence of an excess amount
of a reference blocking sequence in the amplification reaction
mixture.
[0022] FIG. 3 is a schematic drawing illustrating a 60 bp reference
blocking sequence for implementing one embodiment of the invention
An 87 bp amplicon is preliminarily amplified using the underlined
primers. A complementary reference blocking sequence is designed
for each strand and contains a 3' non-extensible phosphate
group.
[0023] FIG. 4 displays Sanger sequencing data for the enrichment of
PFSK-1 mutant alleles from samples processed using regular PCR,
full COLD-PCR without the use of a reference blocking sequence in
the reaction mixture; full COLD-PCR with an excess of reference
blocking sequence in the reaction mixture, and fast COLD-PCR,
respectively.
[0024] FIG. 5 displays Sanger sequencing data for the enrichment of
HCC1008 mutant alleles from samples processed using regular PCR,
full COLD-PCR without the use of a reference blocking sequence in
the reaction mixture; full COLD-PCR with an excess of reference
blocking sequence (RS) (60 bp) in the reaction mixture, and fast
COLD-PCR, respectively.
[0025] FIG. 6 displays Sanger sequencing data for the enrichment of
HCC2218 mutant alleles from samples processed using regular PCR,
full COLD-PCR without the use of a reference blocking sequence in
the reaction mixture COLD-PCR with an excess of reference blocking
sequence (RS) in the reaction mixture, and fast COLD-PCR,
respectively.
[0026] FIG. 7 displays Sanger sequencing data for the enrichment of
TL92 mutant alleles (1 bp G del) from samples processed using
regular PCR, full COLD-PCR without the use of a reference blocking
sequence in the reaction mixture; full COLD-PCR with an excess of
reference blocking sequence (RS) in the reaction mixture, and fast
COLD-PCR, respectively.
[0027] FIG. 8 displays Sanger sequencing data for the enrichment of
HCC1008 mutant alleles from samples processed using full COLD-PCR
with the use of a 90 bp reference blocking sequence (RS).
DETAILED DESCRIPTION
[0028] Definitions
[0029] As used herein, the term "enriching a target sequence"
refers to increasing the amount of a target sequence and increasing
the ratio of target sequence relative to the corresponding
reference sequence in a sample. For example, where the ratio of
target sequence to reference sequence is initially 5% to in a
sample, the target sequence may be preferentially amplified in an
amplification reaction so as to produce a ratio of 70% target
sequence to 30% reference sequence. Thus, there is a 14-fold
enrichment of the target sequence relative to the reference
sequence.
[0030] As used herein the term "target sequence" refers to a
nucleic acid that is less prevalent in a nucleic acid sample than a
corresponding reference sequence. The target sequence makes-up less
than 50% of the total amount of reference sequence+target sequence
in a sample. The target sequence may be a mutant allele. For
example, a sample (e.g., blood sample) may contain numerous normal
cells and few cancerous cells. The normal cells contain non-mutant
or wild-type alleles, while the small number of cancerous cells
contains somatic mutations. In this case the mutant is the target
sequence while the wild-type sequence is the reference
sequence.
[0031] As used herein, a "target strand" refers to a single nucleic
acid strand of a target sequence.
[0032] The target sequence must be at least 50% homologous to the
corresponding reference sequence, but must differ by at least one
nucleotide from the reference sequence. Target sequences are
amplifiable via PCR with the same pair of primers as those used for
the reference sequence.
[0033] As used herein, the term "reference sequence" refers to a
nucleic acid that is more prevalent in a nucleic acid sample than a
corresponding target sequence. The reference sequence makes-up over
50% of the total reference sequence+target sequence in a sample.
Preferably the reference sequence is expressed at the RNA and/or
DNA level 10.times., 15.times., 20.times., 25.times., 30.times.,
35.times., 40.times., 45.times., 50.times., 60.times., 70.times.,
80.times., 90.times. 100.times., 150.times., 200.times. or more
than the target sequence. As used herein, a "reference strand"
refers to a single nucleic acid strand of a reference sequence.
[0034] As used herein, the term "Wild-type" refers to the most
common polynucleotide sequence or allele for a certain gene in a
population. Generally, the wild-type allele will be obtained from
normal cells.
[0035] As used herein, the term "mutant" refers to a nucleotide
change (i.e., a single or multiple nucleotide substitution,
deletion, or insertion) in a nucleic acid sequence. A nucleic acid
which bears a mutation has a nucleic acid sequence (mutant allele)
that is different in sequence from that of the corresponding
wild-type polynucleotide sequence. The invention is broadly
concerned with somatic mutations and polymorphisms. The methods of
the invention are especially useful in selectively enriching a
mutant allele which contains between about 1 and 10 nucleotide
sequence changes, although is useful even with a higher number of
sequence changes. A mutant allele will typically be obtained from
diseased tissues or cells and is associated with a disease
state.
[0036] As used herein the term "melting temperature" or "T.sub.m"
refers to the temperature at which a polynucleotide dissociates
from its complementary sequence. Generally, the T.sub.m may be
defined as the temperature at which one-half of the Watson-Crick
base pairs in a double stranded nucleic acid molecule are broken or
dissociated (i.e., are "melted") while the other half of the
Watson-Crick base pairs remain intact in a double stranded
conformation. In other words the T.sub.m is defined as the
temperature at which 50% of the nucleotides of two complementary
sequences are annealed (double strands) and 50% of the nucleotides
are denatured (single strands). T.sub.m therefore defines a
midpoint in the transition from double-stranded to single-stranded
nucleic acid molecules (or, conversely, in the transition from
single-stranded to double-stranded nucleic acid molecules).
[0037] The T.sub.m can be estimated by a number of methods, for
example by a nearest-neighbor calculation as per Wetmur 1991
(Wetmur, J. G. 1991. DNA probes: applications of the principles of
nucleic acid hybridization. Crit Rev Biochem Mol Biol 26: 227-259,)
and by commercial programs including Oligo.TM. Primer Design and
programs available on the internet. Alternatively, the T.sub.m can
be determined though actual experimentation. For example,
double-stranded DNA binding or intercalating dyes, such as Ethidium
bromide or SYBR-green (Molecular Probes) can be used in a melting
curve assay to determine the actual T.sub.m of the nucleic acid.
Additional methods for determining the T.sub.m of a nucleic acid
are well known in the art. Some of these methods are listed in the
inventor's prior patent application entitled "Enrichment of a
Target Sequence", International Application No. PCT/US2008/009248,
now U.S. Ser. No. 12/671,295, by reference herein.
[0038] As used herein, "reference blocking sequence" is an
engineered single stranded or double stranded nucleic acid
sequence, such as an oligonucleotide and preferably has a length
smaller than the target sequence. In a preferred embodiment, the
reference blocking sequence is several bases smaller than the
reference sequence, on each side of the sequence so that the
primers do not bind appreciably to the reference sequence.
Optionally, the 3' OH end of the reference blocking sequence is
blocked to DNA-polymerase extension, the 5-end is modified to
prevent 5' to '3 exonucleolysis by Tag DNA polymerases. The
reference blocking sequence can also take other forms which remain
annealed to the reference sequence when the reaction mixture is
subject to the critical temperature "T.sub.c", such as a chimera
between single stranded DNA, RNA, peptide nucleic acid (PNA or
locked nucleic acid (LNA), or another modified nucleotide.
[0039] As used in connection with the present invention, the term
"critical temperature" or "T.sub.c" refers to a temperature
selected to preferentially denature duplexes of target strands and
the reference blocking sequence. The critical temperature (T.sub.c)
is selected so that duplexes consisting of the reference blocking
strands and complementary reference strands remain substantially
undenatured when the reaction mixture is incubated at T.sub.c yet
duplexes consisting of the reference blocking strands and the
target strands substantially denature. The term "substantially"
means at least 60%, and preferably at least 90% or more preferably
at least 98% in a given denatured or undenatured form. In the
examples provided below, the selected critical temperature
"T.sub.c" for the intermediate incubation step is 84.5.degree. C.,
whereas the first denaturing temperature is 95.degree. C.
[0040] As used herein, "primer pair" refers to two primers that
anneal to opposite strands of a target and reference sequence so as
to form an amplification product during a PCR reaction. The target
and the reference sequence should be at least 25 bases in order to
facilitate primer attachment. The primer pair is designed so as to
have a T.sub.m lower than the T.sub.c of the reaction.
[0041] As used herein, "homology" refers to the subunit sequence
similarity between two polymeric molecules, e.g., two
polynucleotides or two polypeptides. An example of an algorithm
that is suitable for determining percent sequence identity and
sequence similarity are the BLAST and BLAST 2.0 algorithms, which
are described in Altschul et al., Nucleic Acids Res. 25:3389-3402
(1997) and Altschul et al., J. Mol. Biol. 215:403-410 (1990),
respectively. Software for performing. BLAST analyses is publicly
available through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/).
Nucleic Acid Amplification Generally
[0042] In one embodiment, a nucleic acid sample utilized in the
method of the invention comprises genomic DNA having a target and
reference sequence. In another embodiment, the nucleic acid sample
of the method of the invention comprises target and reference
sequences that were previously amplified in a nucleic acid
amplification reaction. The skilled artisan will appreciate that
there are many methods available to amplify a nucleic acid. Perhaps
the most popular method is the polymerase chain reaction (PCR; for
example, see, U.S. Pat. Nos. 4,683,195 and 4,683,202, as well as
Saiki et al., Science 230:1350-1354 (1985) and Gyllensten et al.,
PNAS (USA) 85:7652-7656 (1985)). A preferred variation of the PCR
method is asymmetrical PCR (for example, see Mao et al.,
Biotechniques 27(4)674-678 (1999); Lehbein et al., Electrophoresis
19(8-9):1381-1384 (1998); Lazaro et al., Mol. Cell. Probes
6(5):357-359 (1992); and U.S. Pat. No. 6,197,499). Other
amplification methods include, but are not limited to, strand
displacement amplification (SDA) (see, Walker et al., Nucleic Acids
Res. 20(7)11691-1696 (1992), as well as U.S. Pat. Nos. 5,744,311,
5,648,211 and 5,631,147), rolling circle amplification (RCA) (see
PCT publication WO 97/19193), nucleic acid sequence-based
amplification (NASBA) (see Compton, Nature 350:91-92 (1991); as
well as U.S. Pat. Nos. 5,409,818 and 5,554,527), transcript
mediated amplification (TMA) (see Kwoh et al., PNAS (USA)
86:1173-1177 (1989), as well as U.S. Pat. No. 5,399,491), self
sustained sequence replication (3SR) (see Guatelli et al., PNAS
(USA) 87:1874-1879 (1990) and ligase chain reaction (LCA) (see U.S.
Pat. Nos. 5,427,930 and 5,792,607).
[0043] In its simplest form, PCR is an in vitro method for the
enzymatic synthesis of specific DNA sequences, using two
oligonucleotide primers that hybridize to opposite strands and
flank the region of interest in the target DNA. A repetitive series
of reaction steps involving template denaturation, primer annealing
and the extension of the annealed primers by DNA polymerase results
in the exponential accumulation of a specific fragment whose
termini are defined by the 5' ends of the primers. PCR is reported
to be capable of producing a selective enrichment of a specific DNA
sequence by a factor of 109 relative to other sequences in genomic
DNA. The PCR method is also described in Saiki et al., 1985,
Science 230:1350.
[0044] PCR is performed using template DNA (target and reference
sequences) (at least 1 fg; more usefully, 1-1000 ng) and at least
25 pmol of oligonucleotide primers. A typical reaction mixture
includes: 2 .mu.l of DNA, 25 pmol of oligonucleotide primer, 2.5
.mu.l of a suitable buffer, 0.4 .mu.l of 1.25 .mu.M dNTP, 2.5 units
of Taq DNA polymerase (Stratagene) and deionized water to a total
volume of 25 .mu.l. PCR is performed using a programmable thermal
cycler.
[0045] The length and temperature of each step of a PCR cycle, as
well as the number of cycles, are adjusted according to the
stringency requirements in effect. Annealing temperature and timing
are determined both by the efficiency with which a primer is
expected to anneal to a template and the degree of mismatch that is
to be tolerated. The ability to optimize the stringency of primer
annealing conditions is well within the knowledge of one of
moderate skill in the art. An annealing temperature of between
30.degree. C. and 72.degree. C. is used. Initial denaturation of
the template molecules normally occurs at between 92.degree. C. and
99.degree. C. for 4 minutes, followed by 20-40 cycles consisting of
denaturation (94-99.degree. C. for 15 seconds to 1 minute),
annealing (temperature determined as discussed above; 1-2 minutes),
and extension (72.degree. C. for 1 minute). The final extension
step is generally carried out for 4 minutes at 72.degree. C., and
may be followed by an indefinite (0-24 hour) step at 4.degree.
C.
[0046] PCR utilizes a nucleic acid polymerase, or enzyme that
catalyzes the polymerization of nucleoside triphosphates.
Generally, the enzyme will initiate synthesis at the 3'-end of the
primer annealed to the target sequence, and will proceed in the
5'-direction along the template. Known DNA polymerases include, for
example, E. coli DNA polymerase 1, T7 DNA polymerase, Thermus
thermophilus (Tth) DNA polymerase, Bacillus stearothermophilus DNA
polymerase, Thermococcus litoralis DNA polymerase, Thermus
aquaticus (Tag) DNA polymerase and Pyrococcus furiosus (Pfu) DNA
polymerase. The term "nucleic acid polymerase" also encompasses RNA
polymerases. If the nucleic acid template is RNA, then "nucleic
acid polymerase" refers to an RNA-dependent polymerization
activity, such as a reverse transcriptase.
[0047] The enrichment procedures of the present invention are
performed in a PCR device such as a thermocycler, or more
preferably under real-time reaction conditions in a real-time PCR
device. Real-time reaction conditions further utilize a nucleic
acid detection agent (e.g., dye or probe) in order to
measure/detect the PCR product as it is produced.
Samples
[0048] As used herein, "sample" refers to any substance containing
or presumed to contain a nucleic acid of interest (target and
reference sequences) or which is itself a nucleic acid containing
or presumed to contain a target nucleic acid of interest The term
"sample" thus includes a sample of nucleic acid (genomic DNA, cDNA,
RNA), cell, organism, tissue, fluid, or substance including but not
limited to, for example, plasma, serum, spinal fluid, lymph fluid,
synovial fluid, urine, tears, stool, external secretions of the
skin, respiratory, intestinal and genitourinary tracts, saliva,
blood cells, tumors, organs, tissue, samples of in vitro cell
culture constituents, natural isolates (such as drinking water,
seawater, solid materials), microbial specimens, and objects or
specimens that have been "marked" with nucleic acid tracer
molecules.
[0049] Nucleic acid sequences of the invention can be amplified
from genomic DNA. Genomic DNA can be isolated from tissues or cells
according to the following method. Alternatively nucleic acids
sequences of the invention can be isolated from blood by methods
well known in the art.
[0050] To facilitate detection of a variant form of a gene from a
particular tissue, the tissue is isolated. To isolate genomic DNA
from mammalian tissue, the tissue is minced and frozen in liquid
nitrogen. Frozen tissue is ground into a fine powder with a
prechilled mortar and pestle, and suspended in digestion buffer
(100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 25 mM EDTA, pH 8.0, 0.5%
(w/v) SDS, 0.1 mg/ml proteinase K) at 1.2 ml digestion buffer per
100 mg of tissue. To isolate genomic DNA from mammalian tissue
culture cells, cells are pelleted by centrifugation for 5 min at
500.times.g, resuspended in 1-10 ml ice-cold PBS, repelleted for 5
min at 500.times.g and resuspended in 1 volume of digestion
buffer.
[0051] Samples in digestion buffer are incubated (with shaking) for
12-18 hours at 50.degree. C., and then extracted with an equal
volume of phenol/chloroform/isoamyl alcohol. If the phases are not
resolved following a centrifugation step (10 min at 1700.times.g),
another volume of digestion buffer (without proteinase K) is added
and the centrifugation step is repeated. If a thick white material
is evident at the interface of the two phases, the organic
extraction step is repeated. Following extraction the upper,
aqueous layer is transferred to a new tube to which will be added
1/2 volume of 7.5 M ammonium acetate and 2 volumes of 100% ethanol.
The nucleic acid is pelleted by centrifugation for 2 min at
1700.times.g, washed with 70% ethanol, air dried and resuspended in
TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) at 1 mg/ml.
Residual RNA is removed by incubating the sample for 1 hour at
37.degree. C. in the presence of 0.1% SDS and 1 .mu.g/ml DNase-free
RNase, and repeating the extraction and ethanol precipitation
steps. The yield of genomic DNA, according to this method is
expected to be approximately 2 mg DNA/1 g cells or tissue Ausubel
et al., supra). Genomic DNA isolated according to this method can
be used according to the invention.
[0052] The target DNA may also be extracted from whole blood. For
example, blood may be drawn by standard methods into a collection
tube, preferably comprising siliconized glass, either without
anticoagulant for preparation of serum, or with EDTA, sodium
citrate, heparin, or similar anticoagulants, most preferably EDTA,
for preparation of plasma. The preferred method, although not
absolutely required, is that plasma or serum be fractionated from
whole blood. Plasma or serum may be fractionated from whole blood
by centrifugation, preferably gentle centrifugation at 300 to
800.times.g for 5-10 minutes, or fractionated by other standard
methods. Since heparin may interfere with PCR, use of heparinized
blood may require pretreatment with heparinase. Thus, EDTA is the
preferred anticoagulant for blood specimens. Either
freshly-collected blood plasma or serum, or frozen (stored) and
subsequently thawed plasma or serum can be used in the methods of
the invention. Stored plasma or serum should be kept at -20.degree.
C. to -70.degree. C., and freshly-collected plasma or serum kept
refrigerated or maintained on ice until use. The DNA may then be
extracted by methods well known in the art.
[0053] The method of the present invention can be used to detect
whether methylation has occurred in a target sequence. The
methylation detection method comprises a chemical or enzymatic
approach for methylation-sensitive treatment of DNA. Chemical
treatments include the incubation of DNA with sodium bisulfite,
which selectively converts non-methylated cytosines to uracils. The
DNA is first heat-denatured and then treated with 5M bisulfite, pH
5-7. Pretreatment of genomic DNA to remove pre-existing uracils is
used prior to bisulfite treatment. This pretreatment consists of
uracil glycosylase treatment in the presence of 5 mM hydroxylamine,
pH 7.
[0054] Because the methylated cytosines of the target sequence are
converted to uracils, they will now form mismatches when duplexed
with the reference blocking sequence in the hybridization cool down
step of full COLD-PCR (in the presence of reference blocking
sequence).
Full COLD-PCR in the Absence of Reference Blocking Sequence (Prior
Art)
[0055] FIG. 1 illustrates the prior art procedure known as full
COLD-PCR for enriching a target sequence in a nucleic acid sample
containing a target and reference sequence, as explained the above
incorporated U.S. application Ser. No. 12/671,295, entitled
"Enrichment of a target Sequence". FIG. 1 is a reproduction of FIG.
1 in the above incorporated patent application.
[0056] The target and reference sequences can be obtained from a
variety of sources including, genomic DNA, cDNA, viral DNA,
mammalian DNA, fetal DNA or bacterial DNA. While the reference
sequence is generally the wild-type allele and the target sequence
is the mutant allele, the reverse may also be true. The mutant
allele may include any one or more nucleotide deletions, insertions
or alterations. In some embodiments, the mutant allele is a somatic
mutation. In other embodiments, the target sequence is methylated
DNA while the reference sequence is un-methylated DNA.
[0057] The method includes subjecting the amplification reaction
mixture to a first denaturing temperature (FIG. 1A, Step 1) that is
above the melting temperature "T.sub.m" of a reference sequence.
The T.sub.m of a nucleic acid can be determined through
experimentation or estimated by calculation. The skilled artisan is
well aware of numerous well known methods for determining the
T.sub.m of a nucleic acid some of which are described herein. The
first denaturing temperature is generally selected as one would
generally select the denaturing temperature of a PCR reaction and
should be sufficiently high so as to allow the full denaturing of
the target and reference sequences (e.g., 94.degree. C.). In one
embodiment, the first denaturing temperature is about 1.degree. C.
to 30.degree. C. above the T.sub.m of the reference sequence, more
preferably the T.sub.m of the reference sequence is about 5.degree.
C. to 20.degree. C. above the T.sub.m of the reference
sequence.
[0058] Next, the temperature of the amplification reaction mixture
is decreased allowing the target sequences and reference sequences
to hybridize (FIG. 1A, Step 2). This annealing step results in the
formation of duplexes of target-target, reference-reference and
target-reference sequences, but should be optimized to form
target-reference duplexes. The PCR primers used in the method are
designed to have a melting temperature that prevents them from
binding to the target and reference sequences at this intermediate
temperature. As mentioned above, the requirement of
target-reference hybridization and the relatively large amount of
time needed for cool down (FIG. 1A, Step 2) has been found to limit
the effectiveness of full COLD-PCR at least in some
applications.
[0059] The target-reference hybridization duplexes are then
preferentially denatured by increasing the temperature of the
reaction mixture to the T.sub.c (FIG. 1A, Step 3). The T.sub.c or
critical temperature in FIG. 1 is selected to be below the T.sub.m
of the reference sequence yet above the T.sub.m of the
target-reference duplex. As mentioned previously, when the target
sequence and reference sequence cross hybridize, minor sequence
differences of one or more single nucleotide mismatch anywhere
along a double stranded DNA sequence will generate a small but
predictable change in the melting temperature (T.sub.m) for that
sequence (Lipsky, R. H., et al. (2001) Clin Chem, 47, 635-644;
Liew, M., et al. (2004) Clin Chem, 50, 1156-1164). Depending on the
exact sequence context and position of the mismatch, melting
temperature changes in the range of 0.1-20.degree. C. are possible.
The T.sub.c is generally applied (FIG. 1A, Step 3) from about 1
second to 5 minutes, more preferably 5 seconds to 30 seconds. It is
possible to oscillate between steps 3 and 2 for multiple cycles if
desired.
[0060] After the preferential denaturing of the target-reference
hybridization duplexes, the temperature of the reaction mixture is
reduced so as to allow one or more primers to anneal to the target
sequence (FIG. 1A, Step 4). The annealed primers are then extended
by a nucleic acid polymerase (FIG. 1A, Step 5), thus enriching the
target sequence in the population of nucleic acids contained in the
sample.
[0061] The steps of the method are generally repeated for multiple
cycles in order to get sufficient amplification of the target and
reference sequences. In one embodiment, the steps of the method are
repeated for 5-40 cycles and more preferably 10-30 cycles. The
optimal number of cycles can be determined by one of ordinary skill
in the art. Preferably, the present methods are performed in a PCR
device, more preferably under real-time reaction conditions in a
real-time detection PCR device, such as the SMARTCYCLER real-time
PCR device (Cepheid, Sunnyvale, Calif.) and the Mx3005P real-time
PCR device (Stratagene, La Jolla, Calif.). In this embodiment, the
reaction mixture may include a nucleic acid detection agent (e.g.,
nucleic acid detection dye such as SYBR Green dye or LC-Green dye
or a probe operatively coupled to a fluorescent dye) for
quantifying and/or monitoring the amplification products of the
reaction. Once the enrichment of the target sequence is complete
the sample may be further processed, e.g., subjected to a
sequencing reaction. The enriched alleles may be further processed
by a variety of procedures including: MALDI-TOF, HR-Melting,
Di-deoxy-sequencing, Single-molecule sequencing, second generation
high throughput sequencing, pyrosequencing, RFLP, digital PCR and
quantitative-PCR (See FIG. 1B). A more detail description of these
processing technologies as well as diagnostic assays is included in
the above mentioned U.S. application Ser. No. 12/671,295, entitled
"Enrichment of a target Sequence", and incorporated herein by
reference.
Full COLD-PCR Cycle with Excess Reference Blocking Sequence in
Reaction Mixture
[0062] FIG. 2 illustrates enrichment of a target sequence in
accordance with the modified full COLD-PCR method of the present
invention. To begin (FIG. 2, step 1), the nucleic acid sample
contains a double-stranded reference sequence 10 (e.g., a wild-type
sequence) and contains a double-stranded target sequence 12 (e.g.,
a mutant sequence). The amplification reaction mixture contains the
sample, other PCR ingredients, and in accordance with the invention
a reference blocking sequence 14 at an excess concentration level,
such as 25 nM. In FIG. 2, the depicted reference blocking sequence
14 is a single-stranded nucleic acid sequence complementary with
one of the strands 10A of the reference sequence 10 between its
primer sites.
[0063] The reaction mixture in step 1 of FIG. 2 is subjected to a
first denaturing temperature, e.g. 95.degree. C. for 10 seconds,
which results in denatured strands of the reference sequence 10A,
10B and the target sequence 12A, 12B. The reaction mixture is then
cooled to promote hybridization, 70.degree. C. for 30 seconds,
which is a dramatic reduction from the normal 8 minute cool down in
the prior art. Since the cool down occurs in the presence of an
excess amount of reference blocking sequences 14, the reference
blocking sequences 14 preferentially hybridize with the
complementary strand 10A of the reference sequence and also the
complementary strand 12A of the target sequence. Step 2 in FIG. 2
illustrates the state of the reaction mixture after the
hybridization cool down to 70.degree. C. in addition to
heteroduplexes 16 of the reference blocking sequence 14 and the
complementary reference strand 10A and heteroduplexes 18 of the
reference blocking sequence 14 and the complementary target strand
12A, the reaction mixture also contains the denatured negative
strands 10B and 12B of the reference and target sequences,
respectively.
[0064] In step 3 of FIG. 2, the reaction mixture is then subjected
to the critical temperature "T.sub.c", e.g., 84.5.degree. C., which
is chosen to permit preferential denaturation of the heteroduplexes
18 of the target strand 12A and reference blocking sequence 14. The
critical temperature (T.sub.c) is selected so that duplexes 16 of
the reference blocking strands 14 and the complementary reference
strands 10A remain substantially undenatured when the reaction
mixture is incubated at "T.sub.c". The melting temperature for the
duplex 18 of the reference blocking sequence 14 and the target
strand 10B will always be less than the melting temperature of the
duplex 16 of the reference blocking sequence 14 and the
complementary reference strand 10A because the reference blocking
sequence 14 is fully complementary with at least a portion of the
reference strand 10A, and there will be at least one mismatch with
the target strand 12A.
[0065] Referring to step 4 of FIG. 2, after preferential
denaturation, the temperature of the reaction mixture is reduced,
e.g., 60.degree. C., to permit the primer pair 20A, 20B to anneal
to the free target strands 12A, 12B and the free reference strand
10B in the reaction mixture. Reference number 20A refers to the
forward primer and reference number 20B refers to the reverse
primer. As described previously, the target sequence 12 is
amplifiable via the same pair of primers 20A, 20B as those used for
the reference sequence 10. Step 5 of FIG. 2 illustrates two free
strands 12A, 12B of the target sequence compared to the initial
denaturation step and only one free reference strand 10B. The other
reference strand 10A is hybridized with the reference blocking
sequence 14, and is therefore unavailable for amplification. The
temperature of the reaction mixture is then raised, e.g. 72.degree.
C., to extend the annealed primers 20A, 20B, thus enriching the
concentration of the target sequence 12 in the reaction mixture
relative to the reference sequence 10. The method is likely
repeated five to thirty cycles.
[0066] The method illustrated in FIG. 2 can and should be optimized
for individual protocols. Such protocols can be embodied in
software, if desired, for operating various PCR and real-time PCR
equipment.
Design Considerations for the Preferred Reference Blocking
Sequence
[0067] As mentioned, the reference blocking sequence can take many
forms, yet the preferred form is single stranded, non-extensible
DNA. More specifically, the preferred reference blocking sequence
has the following characteristics: [0068] (a) comprises
single-stranded DNA of up to 200 bp in length; [0069] (b) has a
length that is several bases smaller than the target sequence (e.g.
8-12 bases on each side of the sequence) so that the primers do not
bind appreciably to the reference sequence when annealed to the
reference blocking sequence; and also do not hind appreciably to
the reference blocking sequence itself; and [0070] (c) contains a
3'-end that is blocked to DNA-polymerase extension.
[0071] Such a reference blocking sequence can be synthesized in one
of the several methods. First, the reference blocking sequence can
be made by direct synthesis using standard oligonucleotide
synthesis methods that allow modification of the 3'-end of the
sequence. The 3'-end may contain a phosphate group, an amino-group,
a di-deoxy-nucleotide or any other moiety that blocks 5' to 3'
polymerase extension. Alternatively, the reference blocking
sequence can be made by polymerase synthesis during a PCR reaction
that generates single stranded DNA as the end product. In this
case, the generated single stranded DNA corresponds to the exact
sequence necessary for the reference blocking sequence. Methods to
synthesize single stranded. DNA via polymerase synthesis are
several and well known to those skilled in the art. For example,
asymmetric PCR or LATE PCR would be suitable. Alternatively, a
single stranded DNA reference blocking sequence can be synthesized
by binding double stranded PCR product on solid support. This is
accomplished by performing a standard PCR reaction, using a primer
pair one of which is biotinylated. Following PCR, the PCR product
is incubated with a streptavidin-coated solid support (e.g.
magnetic heads) and allowed to bind to the beads. Subsequently, the
temperature is raised to 95.degree. C. for 2-3 minutes to denature
DNA and release to the solution the non-biotinylated DNA strand
from the immobilized PCR product. The magnetic beads with the
complementary DNA strand are then removed and the single stranded
product remaining in the solution serves as the reference blocking
sequence.
[0072] Before the single stranded reference blocking sequence is
used, the 3'-end is preferably blocked to polymerase extension.
This can be accomplished in several ways well known to those
skilled in the art. For example, a reaction with Terminal
Deoxynucleotide Transferase (TdT) can be employed, in the presence
of di-deoxy-nucleotides (ddNTP) in the solution, to add a single
ddNTP to the end of the single stranded reference blocking
sequence. ddNTPs serve to block polymerase extension.
Alternatively, an oligonucleotide template complementary to the
3'-end of the reference blocking sequence can be used to provide a
transient double stranded structure. Then, polymerase can be used
to insert a single ddNTP at the 3'-end of the reference blocking
sequence opposite the hybridized oligonucleotide.
[0073] In another method to synthesize the reference blocking
sequence in a double stranded form, a conventional PCR is carried
out to amplify a wild type version of the sequence of interest,
using primers that contain rare enzymatic restriction sites.
Following PCR amplification, restriction enzymes are applied to
digest both ends of the PCR product and create overhangs. These
overhangs are then subjected to polymerase extension in the
presence of di-deoxy-nucleotides, thereby blocking the 3'-end on
both sides from further extension. The double-stranded, 3'-end
blocked PCR product can then serve as a double stranded reference
blocking sequence.
Specific Examples of Oligonucleotide-Synthesis-Generated Reference
Blocking Sequences
[0074] Two reference blocking sequences were synthesized: a 60 bp
(RBS60) and a 90 bp (RBS90) reference blocking sequence
corresponding to sections of p53 exon 8. Table 1 contains the
listed sequences for the synthesized RBS60 and RBS90 reference
blocking sequences. Both the RBS60 and the RBS90 sequence were
synthesized with a 3'-blocking phosphate group by Integrated DNA
Technologies, Inc. Cell lines with mutations in the same exon 8
fragment were used to test the method (see, listing in Table
1).
[0075] FIG. 3 is a schematic drawing illustrating the use of the
RBS60 reference blocking sequence in connection with modified, full
COLD-PCR enrichment. An 87 bp amplicon is preliminarily amplified
using the underlined primers. The complementary reference blocking
sequence (RBS60) is designed for the reference strand in FIG. 3. As
apparent from FIG. 3 RBS60 prevents the primers from binding, and
contains a 3' phosphate group to prevent extension.
[0076] Protocol for RBS60: A 167 bp sequence from p53 exon 8 was
initially amplified using conventional PCR and the primers
Ex8-1671F and Ex8-167R (Table 1). The genomic DNA used was either
wild-type DNA, or a mixture of 3% mutant DNA into wild-type DNA.
The mutant cell lines used, that contain specific mutations, are
listed in Table 1.
[0077] The PCR product was then diluted 500-fold. Then, the
modified full-COLD-PCR reaction in the presence of 25 nM reference
blocking sequence RBS60, and 200 nM primers 87f and 87r that
amplify a region nested within the 167 bp fragment was implemented.
Phusion.TM. polymerase (New England Biolabs) was used for the
amplification. The full-COLD-PCR program was: 5 cycles of
conventional PCR (30 sec at 95.degree. C.; 30 sec 60.degree. C.; 1
min 72.degree. C.;); then 25 cycles of full COLD-PCR (30 sec at
95.degree. C.; 30 sec at 70.degree. C.; then 3 sec at
T.sub.c=84.5.degree. C., then 30 sec at 60.degree. C.; 1. min at
72.degree. C.).times.25. Alternatively, full COLD-PCR (in the
absence of RBS60) was performed by applying the exact same program
as for full COLD-PCR in the presence of RBS60, but by omitting the
RBS60 from the reaction mixture. Following full COLD-PCR in the
presence of RBS60 (and full COLD-PCR (no RBS60) and fast COLD-PCR,
and regular PCR) the products were sequenced by using the longer
primer 30T-p53-87F.
[0078] Protocol for RBSS90: The same procedure was applied for
RBS90 as detailed for RBS60; but with the difference that the
primers set for the nested full COLD-PCR were p53-ex8-115F and
p53-ex8-115R and the T.sub.c applied for RBS90 was
T.sub.c=84.4.degree. C.
TABLE-US-00001 TABLE 1 Oligo Sequence (5' to 3') Source Reference
Blocking Sequence 1 (RBS60) Ex8-167F GCTTCTCTTTTCCTATCCTG (SEQ ID
NO: 1) Li et al (2008) Ex8-167R CTTACCTCGCTTAGTGCT (SEQ ID NO: 2)
Li et al (2008) 87f TGGTAATCTACTGGGACG (SEQ ID NO: 3) Li et al
(2008) 87r CGGAGATTCTCTTCCTCT (SEQ ID NO: 4) Li et al (2008)
30T-p53-87F TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTAATCTAC TGGGACG (SEQ
ID NO: 5) 60refseq-for GGACGGAACAGCTTT (SEQ ID NO: 6) 60refseq-rev
CTGGCCGCGTGTCT (SEQ ID NO: 7) RBS60
5'CTCTGTGCGCCGGTCTCTCCCAGGACAGGCACAAACA
CGCACCTCAAAGCTGTTCCGTCC-phos-3' (SEQ ID NO: 8) Reference Blocking
Sequence 2 (RBS90) Ex8-167F GCTTCTCTTTTCCTATCCTG (SEQ ID NO: 9) Li
et al (2008) Ex8-167R CTTACCTCGCTTAGTGCT (SEQ ID NO: 10) Li et al
(2008) p53-ex8-115F TTGCTTCTCTTTTCCTAT (SEQ ID NO: 11) p53-ex8-115R
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT GCTTCTCTTTTCCTATCC(SEQ
ID NO: 12) R8S90 5'CTTCCTCTGTGCGCCGGTCTCTCCCAGGACAGGCACA
AACACGCACCTCAAAGCTGTTCCGTCCCAGTAGATTAC CACTACTCAGGATAG-phos-3' (SEQ
ID NO: 13)
[0079] Results: Representative results are depicted in FIGS. 4
through 7 for the RBS60 and FIG. 8 for RBS90. In FIGS. 4 through 7,
modified, full COLD-PCR (in presence of RBS60 is compared with full
COLD-PCR (no RBS60). Fast COLD-PCR, and conventional PCR.
[0080] FIG. 4 illustrates that enrichment via modified full
COLD-PCR (25 nM RBS) is robust (an increase from 3% to 37%) for a
circumstance in which the mutation increases the melting
temperature. The mutation is not detectable when using fast
COLD-PCR and conventional PCR in FIG. 4. FIG. 5 similarly
illustrates that enrichment via modified full COLD-PCR (25 nM RBS)
is robust (an increase from 3% to 47%) for a. circumstance in which
the mutation does not effect melting temperature. Again, the
mutation is not detectable when using fast COLD-PCR and
conventional PCR in FIG. 5. FIG. 6 also illustrates that enrichment
via modified full COLD-PCR (25 nM RBS) is robust (an increase from
3% to 45%) for a circumstance in which the mutation reduces
inciting temperature. In FIG. 6, enrichment via fast COLD-PCR is
robust as well (i.e., due to the reduced melting temperature).
Again, in FIG. 6, the mutation is not detectable when using
conventional PCR. FIG. 7 illustrates the results for a temperature
reducing deletion. Enrichment via modified full COLD-PCR (25 nM
RBS) is robust (an increase from 3% to 45%) as is enrichment via
fast COLD-PCR. Again, the mutation is not detectable when using
conventional PCR.
[0081] FIG. 8 displays Sanger sequencing data for the enrichment of
HCC 1008 mutant alleles from samples processed using RBS90, and
illustrates that enrichment with modified full COLD-PCR in the
presence of the 90 bp reference blocking sequence is robust an
increase from 3% to 38%). Comparing the results in FIG. 5, which
displays Sanger sequencing data for the enrichment of HCC 1008
mutant alleles from samples processed using RBS60, to the results
in FIG. 8 confirms that the method of the present invention is
robust with reference blocking sequences of different lengths. In
all cases and for all mutations studied thus far, modified full
COLD-PCR (in presence of RBS) appears to have the best performance,
in that it enriches all types of mutations (T.sub.m increasing,
retaining or decreasing mutations), in a short reaction time, and
with better enrichment than Full-COLD-PCR (no RBS).
Sequence CWU 1
1
13120DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 1gcttctcttt tcctatcctg
20218DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 2cttacctcgc ttagtgct
18318DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 3tggtaatcta ctgggacg
18418DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 4cggagattct cttcctct
18548DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 5tttttttttt tttttttttt tttttttttt
tggtaatcta ctgggacg 48615DNAArtificialOligonucleotide primer for
polymerase chain amplification of human p53 gene 6ggacggaaca gcttt
15715DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 7ctggccgcgt gtctc
15860DNAArtificialOligonucleotide that hybridizes to human p53 gene
8ctctgtgcgc cggtctctcc caggacaggc acaaacacgc acctcaaagc tgttccgtcc
60920DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 9gcttctcttt tcctatcctg
201018DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 10cttacctcgc ttagtgct
181118DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 11ttgcttctct tttcctat
181260DNAArtificialOligonucleotide primer for polymerase chain
amplification of human p53 gene 12tttttttttt tttttttttt tttttttttt
tttttttttt ttgcttctct tttcctatcc 601390DNAArtificialOligonucleotide
that hybridizes to human p53 gene 13cttcctctgt gcgccggtct
ctcccaggac aggcacaaac acgcacctca aagctgttcc 60gtcccagtag attaccacta
ctcaggatag 90
* * * * *
References