U.S. patent application number 13/713031 was filed with the patent office on 2014-04-17 for hemoglobin-based oxygen carrier-containing pharmaceutical composition for cancer targeting treatment and prevention of cancer recurrence.
The applicant listed for this patent is Sui Yi KWOK, Sze Hang LAU, Norman Fung Man WAI, Bing Lou WONG. Invention is credited to Sui Yi KWOK, Sze Hang LAU, Norman Fung Man WAI, Bing Lou WONG.
Application Number | 20140106004 13/713031 |
Document ID | / |
Family ID | 50475529 |
Filed Date | 2014-04-17 |
United States Patent
Application |
20140106004 |
Kind Code |
A1 |
WONG; Bing Lou ; et
al. |
April 17, 2014 |
HEMOGLOBIN-BASED OXYGEN CARRIER-CONTAINING PHARMACEUTICAL
COMPOSITION FOR CANCER TARGETING TREATMENT AND PREVENTION OF CANCER
RECURRENCE
Abstract
The present invention provides a pharmaceutical composition
containing a hemoglobin-based oxygen carrier for treating cancer,
preventing recurrence and metastasis of cancerous tumor. The
composition can be used alone or in combination with at least one
chemotherapeutic agent such as 5FU, Bortezomib, doxorubicin,
cisplatin, or any combination thereof. The hemoglobin-based oxygen
carrier in the composition is capable of targeting a surface
receptor expressed on cancerous cells and facilitating the uptake
of both hemoglobin-based oxygen carrier and the chemotherapeutic
agent by the cancerous cells via a receptor-mediated mechanism. The
hemoglobin-based oxygen carrier inhibits the expression of hypoxic
response elements such as HIF1.alpha., VEGF, ET1, VHL, etc. The
pharmaceutical composition of the present invention is also useful
for inducing the apoptosis or cell death of a type of self-renewing
and tumor-initiating cells called cancer stem cells which are
located in the hypoxic niche of a cancerous tumor.
Inventors: |
WONG; Bing Lou; (Irvine,
CA) ; WAI; Norman Fung Man; (Vancouver, CA) ;
KWOK; Sui Yi; (Hong Kong, HK) ; LAU; Sze Hang;
(Hong Kong, HK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
WONG; Bing Lou
WAI; Norman Fung Man
KWOK; Sui Yi
LAU; Sze Hang |
Irvine
Vancouver
Hong Kong
Hong Kong |
CA |
US
CA
HK
HK |
|
|
Family ID: |
50475529 |
Appl. No.: |
13/713031 |
Filed: |
December 13, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61712853 |
Oct 12, 2012 |
|
|
|
Current U.S.
Class: |
424/649 ;
514/13.5; 530/385 |
Current CPC
Class: |
A61P 35/04 20180101;
A61K 33/38 20130101; A61K 38/05 20130101; A61K 45/06 20130101; A61N
5/00 20130101; A61K 38/42 20130101; A61K 31/513 20130101; A61P
35/02 20180101; A61P 35/00 20180101; A61P 43/00 20180101; A61K
33/38 20130101; A61K 2300/00 20130101 |
Class at
Publication: |
424/649 ;
530/385; 514/13.5 |
International
Class: |
A61K 38/42 20060101
A61K038/42; A61K 45/06 20060101 A61K045/06 |
Claims
1. A hemoglobin-based oxygen carrier pharmaceutical composition
configured to target a receptor expressed on the surface of cancer
cells within a mass of cancerous tissue or tumors such that the
hemoglobin-based oxygen carrier pharmaceutical composition triggers
a receptor-mediated mechanism to facilitate the uptake and
localization of the hemoglobin-based oxygen carrier into the cancer
cells within the mass of the cancerous tissues or tumor for
inducing apoptosis in cells of said cancerous tissues or tumors
including self-renewing and tumor-initiating cells to prevent
cancer recurrence, providing oxidative stress or shock to said
cancerous tissues or tumors, and sensitizing the cancerous tissues
or tumors to a chemotherapeutic agent or radiotherapy concurrently
or subsequently administered.
2. The pharmaceutical composition of claim 1, wherein said a
chemotherapeutic agent is chemically conjugated with the
hemoglobin-based oxygen carrier for synergistically targeting the
cancerous tissues or tumors and the cancerous tumor cells including
the self-renewing and tumor initiating cells.
3. The pharmaceutical composition of claim 1, wherein said
chemotherapeutic agent is 5 fluorouracil.
4. The pharmaceutical composition of claim 1, wherein said
hemoglobin-based oxygen carrier is a heat stable cross-linked
tetrameric hemoglobin with an undetectable amount of dimer
concentration and low concentration of met-hemoglobin.
5. The pharmaceutical composition of claim 1, wherein said
receptor-mediated mechanism is Clathrin-mediated endocytosis.
6. The pharmaceutical composition of claim 1 is administered to a
subject in need thereof prior to disruption of blood supply and/or
during re-establishment of blood supply in a surgical removal of a
tumor from said subject.
7. The pharmaceutical composition of claim 6 is administered in a
range of approximately 0.2 g/kg-1.2 g/kg body weight of said
subject.
8. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are hepatic.
9. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are hypoxic.
10. The pharmaceutical composition of claim 4, wherein said
cross-linked tetrameric hemoglobin has a molecular weight of 60-70
kDa and is heat treated with the addition of N-acetyl cysteine at a
concentration of 0.05-0.4%.
11. The pharmaceutical composition of claim 1 is free of
vasoconstricting impurities and protein impurities, non-pyrogenic,
endotoxin-free, phospholipid-free, stroma-free and a met-hemoglobin
level of less than 5%.
12. The pharmaceutical composition of claim 1, wherein said
hemoglobin-based oxygen carrier is modified having a longer half
life to penetrate into the mass of said cancerous tissues or tumors
and to provide oxidative stress or shock to said cancerous tissues
or tumors such that apoptosis in cells of said cancerous tissues or
tumors including said self-renewing and tumor-initiating cells is
induced.
13. The pharmaceutical composition of claim 1, wherein said
self-renewing and tumor-initiating cells are cancer stem cells
and/or progenitor cells.
14. The pharmaceutical composition of claim 12, wherein said
hemoglobin-based oxygen carrier is administered alone or in
combination with at least one chemotherapeutic agent and/or
radiotherapy, and wherein said hemoglobin-based oxygen carrier is
administered as an adjunctive therapy.
15. The pharmaceutical composition of claim 33, wherein said
modified hemoglobin molecule is pegylated hemoglobin molecule.
16. A method for treating cancerous tissues and preventing
recurrence of cancerous tumors by using the composition of claim 1,
wherein said composition is administered alone or in combination
with at least one chemotherapeutic agent to a subject in need
thereof.
17. The method of claim 16, wherein said composition is
administered to said subject during or after removal of cancerous
tissues or tumors.
18. The method of claim 16, wherein the cancerous tissues or tumors
are hepatic, nasopharyngeal, brain, colon, lung, head and neck,
mammary and leukemia.
19. The method of claim 16, wherein the cancerous tissues or tumor
are hypoxic.
20. The method of claim 16, wherein said hemoglobin-based oxygen
carrier is cross-linked tetrameric hemoglobin having a molecular
weight of 60-70 kDa and is heat stable after heat treatment and
addition of N-acetyl cysteine at a concentration of 0.05-0.4%.
21. The method of claim 20, wherein said composition is free of
vasoconstricting impurities and protein impurities, non-pyrogenic,
endotoxin-free, phospholipid-free, stroma-free and a met-hemoglobin
level of less than 5% after said heat treatment and reaction with
the added N-acetyl cysteine.
22. The method of claim 16, wherein said composition is
administered by infusion in a range of approximately 0.2-1.2 g/kg
body weight and at a rate of less than 10 ml/hour/kg body
weight.
23. The method of claim 16, wherein said at least one
chemotherapeutic agent is selected from 5-fluorouracil, Bortezomib,
doxorubicin, cisplatin, or any combination thereof.
24. The method of claim 16, wherein said combination of the
hemoglobin-based oxygen carrier and at least one chemotherapeutic
agent are configured to synergistically target cells with
expression of a receptor in said cancerous tissues or tumors,
triggering a receptor-mediated mechanism, thereby sensitizing the
cells in the cancerous tissues or tumors such that more
hemoglobin-based oxygen carriers and chemotherapeutic agent are
selectively taken up by the cells and localized in the cytoplasm of
the cells while said cells become more sensitive to said
chemotherapeutic agent.
25. The method of claim 16, wherein said hemoglobin-based oxygen
carrier is administered as an adjunctive therapy with said at least
one chemotherapeutic agent for providing oxidative stress or shock
to a mass of the cancerous tissues or tumors and for sensitizing
said cancerous tissues or tumors to said chemotherapeutic agent
such that apoptosis of cells in said cancerous tissues or tumors
including self-renewing and tumor-initiating cells is induced.
26. The method of claim 25, wherein said self-renewing and
tumor-initiating cells are cancer stem cells and/or cancerous
progenitor cells.
27. (canceled)
28. The method of claim 24, wherein said receptor-mediated
mechanism is Clathrin-mediated endocytosis.
29. The pharmaceutical composition of claim 1, wherein said
chemotherapeutic agent is Bortezomib.
30. The pharmaceutical composition of claim 1, wherein said
chemotherapeutic agent is doxorubicin.
31. The pharmaceutical composition of claim 1, wherein said
chemotherapeutic agent is cisplatin.
32. The pharmaceutical composition of claim 1, wherein said
chemotherapeutic agent is more than one of 5-fluorouracil,
Bortezomib, doxorubicin, and cisplatin.
33. The pharmaceutical composition of claim 1, wherein said
hemoglobin-based oxygen carrier is a polymerized hemoglobin with an
undetectable amount of dimer concentration and low concentration of
met-hemoglobin.
34. The pharmaceutical composition of claim 1, wherein said
hemoglobin-based oxygen carrier is a modified hemoglobin molecule
with an undetectable amount of dimer concentration and low
concentration of met-hemoglobin.
35. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are mammary.
36. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are brain cancerous tissues or
tumors.
37. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are colon cancerous tissues or
tumors.
38. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are lung cancerous tissues or
tumors.
39. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are head and neck cancerous tissues or
tumors.
40. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are nasopharyngeal.
41. The pharmaceutical composition of claim 1, wherein said
cancerous tissues or tumors are leukemia.
42. The pharmaceutical composition of claim 1, wherein said
hemoglobin-based oxygen carrier is configured to be administered as
an adjunctive therapy with said chemotherapeutic agent for
providing oxidative stress or shock to the mass of the cancerous
tissues or tumors and for sensitizing said cancerous tissues or
tumors to said chemotherapeutic agent such that apoptosis of cells
in said cancerous tissues or tumors including self-renewing and
tumor-initiating cells is induced.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority from the U.S.
provisional patent application Ser. No. 61/712,853 filed Oct. 12,
2012, and the disclosure of which is incorporated herein by
reference.
COPYRIGHT NOTICE/PERMISSION
[0002] A portion of the disclosure of this patent document contains
material which is subject to copyright protection. The copyright
owner has no objection to the facsimile reproduction by anyone of
the patent document or the patent disclosure as it appears in the
Patent and Trademark Office patent file or records, but otherwise
reserves all copyright rights whatsoever. The following notice
applies to the processes, experiments, and data as described below
and in the drawings attached hereto: Copyright .COPYRGT. 2012,
Vision Global Holdings Limited, All Rights Reserved.
TECHNICAL FIELD
[0003] The present invention relates to a hemoglobin-based oxygen
carrier-containing pharmaceutical composition for cancer targeting
treatment and prevention of tumor recurrence in humans and other
animals. In particular, the present invention relates to a
composition including a hemoglobin-based oxygen carrier which is
either administered alone or in combination with at least one
chemotherapeutic agent for treating cancers, targeting cancerous
cells/cancer stem cells/tissues containing any of these cells, and
preventing the recurrence of tumors.
BACKGROUND OF INVENTION
[0004] Hemoglobin plays an important role in most vertebrates for
gaseous exchange between the vascular system and tissue. It is
responsible for carrying oxygen from the respiratory system to the
body cells via blood circulation and also carrying the metabolic
waste product carbon dioxide away from body cells to the
respiratory system, where the carbon dioxide is exhaled. Since
hemoglobin has this oxygen transport feature, it can be used as a
potent oxygen supplier if it can be stabilized ex vivo and used in
vivo.
[0005] Naturally-occurring hemoglobin is a tetramer which is
generally stable when present within red blood cells. However, when
naturally-occurring hemoglobin is removed from red blood cells, it
becomes unstable in plasma and splits into two .alpha.-.beta.
dimers. Each of these dimers is approximately 32 kDa in molecular
weight. These dimers may cause substantial renal injury when
filtered through the kidneys and excreted. The breakdown of the
tetramer linkage also negatively impacts the sustainability of the
functional hemoglobin in circulation.
[0006] In order to solve the problem, recent developments in
hemoglobin processing have incorporated various cross-linking
techniques to create intramolecular bonds within the tetramer as
well as intermolecular bonds between the tetramers to form
polymeric hemoglobin.
[0007] Hypoxia is common in cancers. Hypoxia can lead to ionizing
radiation and chemotherapy resistance by depriving tumor cells of
the oxygen essential for the cytotoxic activities of these agents.
Hypoxia may also reduce tumor sensitivity to radiation therapy and
chemotherapy through one or more indirect mechanisms that include
proteomic and genomic changes. Therefore, there is a need for
improved cancer-treatment compositions, particularly, improved
cancer-treatment compositions that enhance the efficacy of
cytotoxic agents.
[0008] Although tumor metastasis causes about 90 percent of cancer
deaths, the exact mechanism that allows cancer cells to spread from
on part of the body to another is not well understood. So, the
improved cancer-treatment compositions that prevent the cancer
recurrence is important.
[0009] Many recent studies have shown that cancer stem cells (CSCs)
play an important role in cancer and tumor development. Wang and
Dick (2005) revisited the self-renewal and tumor cell proliferating
potentials of leukemia stem cells found in tumor by the stochastic
model and cancer stem cell model proposed earlier. According to the
stochastic model, there is generally one class of tumor cells which
are functionally homogeneous, and the genetic changes can lead to
malignancy progression in all these tumor cells. In contrast, the
cancer stem cell model proposes that a rare population of cells
which have a distinct ability to consistently initiate tumor growth
and are able to reproduce a hierarchy of functionally heterogeneous
classes of cells may have different tumorigenic pathways compared
with the majority of the cells in a tumor. The tumor-initiating
cells proposed in the cancer stem cell model can be progressively
identified and purified from the rest of the cells. These cells are
called cancer stem cells (CSCs). Like leukemia stem cells, other
cancers such as breast cancer appear to be driven by the rare
population of tumor-initiating cells. Two phenotypes of cells have
been identified in breast cancer where one minority phenotype is
able to form mammary tumors while another phenotype is not. In
brain cancer, two types of cells are found: CD133.sup.+ cells
possess differentiative, self-renewal, and tumor-initiating
abilities in vivo whereas CD133.sup.- cells cannot. More and more
evidences have been found to support that these cancer stem cells
may be at the apex of all neoplastic systems, and thereby become a
new target for cancer treatment. A review article (Mohyeldin et
al., 2010) suggested that cancer stem cell niches have much lower
oxygen tension. A hypoxic niche is found to be located further away
from vasculature of a tumor and contains cancer stem cells which
differentially respond to hypoxia with distinct HIF
(Hypoxia-inducible factors) induction patterns, in particular
HIF-2.alpha.. It becomes a new target in the signaling pathways
that regulate cancer stem cell self-renewal, proliferation, and
survival, and the inhibition of which will attenuate their tumor
initiation potential.
[0010] Thus there is a need in the art for a composition that can
provide high oxygen tension in cancer stem cells. Such a
composition could be used to produce oxidative stress or shocks
which leads to DNA damage and subsequent DNA damage induced
apoptosis in the cancer stem cells.
SUMMARY OF INVENTION
[0011] The present invention relates to a hemoglobin-based oxygen
carrier-containing pharmaceutical composition for targeted treating
and preventing recurrence of cancer in humans and other animals.
The first aspect of the present invention is to provide a
hemoglobin-based oxygen carrier which is configured to target
cancerous cells, cancer stem cells (CSCs) and/or cancerous
progenitor cells, and/or tissues containing any of these cells in a
human or animal body, triggering a receptor-mediated mechanism and
leading a combined chemotherapeutic agent to localize together in
the cytoplasm of the cancerous cells, CSCs, and/or tissues
containing any of these cells, in order to increase the efficacy of
both hemoglobin-based oxygen carrier and the chemotherapeutic
agent. The localized hemoglobin-based oxygen carrier is also found
to sensitize the cancerous cells and CSCs such that the cancerous
cells and CSCs become more sensitive to the chemotherapeutic agent.
The second aspect of the present invention is to provide a method
of using the hemoglobin-based oxygen carrier-containing
pharmaceutical composition of the present invention for treating
cancer and preventing recurrence of cancer by administering said
composition to a subject in need thereof suffering from various
tumors, cancers or diseases associated with tumors or cancers.
[0012] The hemoglobin-based oxygen carrier used in the present
invention can be a heat stable cross-linked tetrameric,
polymerized, pegylated or recombinant/modified hemoglobin which is
used in combination with at least one chemotherapeutic agent for
the treatment of various cancers such as leukemia, head and neck
cancer, colorectal cancer, lung cancer, breast cancer, liver
cancer, nasopharyngeal cancer, esophageal cancer and brain cancer.
The hemoglobin-based oxygen carrier itself is also found to have an
ability to destroy cancer cells through improving the oxygenation
of tumors in a hypoxic condition, thereby enhancing the sensitivity
towards radiation and chemotherapeutic agents.
[0013] Moreover, the hemoglobin-based oxygen carrier of the present
invention can also be used alone for reducing cancerous tumor
recurrence and minimizing tumor cell metastasis. Said hemoglobin is
administered prior to ischemia for a tumor removal surgery and
during re-establishment of blood supply (reperfusion) upon removal
of tumor. The hemoglobin-based oxygen carrier can also be used to
increase oxygenation of cancerous tissues and with chemotherapeutic
agents then subsequently reducing the size of a tumor. As a result,
the hemoglobin-based oxygen carrier-containing composition of the
present invention can be administered alone or in combination with
at least a chemotherapeutic agent for treating or preventing the
recurrence of cancerous tumors.
[0014] The method of the present invention also includes using a
combination of different chemotherapeutic drugs and/or radiotherapy
with the hemoglobin-based oxygen carrier of the present invention
to give a synergistic effect on cancer treatment and prevention of
tumor recurrence.
[0015] The third aspect of the present invention relates to the
composition of the present invention for providing oxidative stress
or shock to the tumor in order to kill a rare population of
self-renewing and tumor-initiating cells known as cancer stem
cells. The composition of the present invention for providing high
oxygen tension to the tumor includes a hemoglobin-based oxygen
carrier which includes tetrameric cross-linked hemoglobin or
polymerized hemoglobin, where both of them are prepared to contain
an undetectable amount of dimer and low percentage of
met-hemoglobin. The hemoglobin-based oxygen carrier in said
composition is configured for penetration into the cancerous
tissues of the tumor where the cancer stem cells are found to
selectively proliferate within the tumor. Said hemoglobin-based
oxygen carrier can be used alone or in combination with at least
one chemotherapeutic agent including Bortezomib, 5-fluorouracil,
doxorubicin, cisplatin, or any combination thereof for oxygenating
the tumor and providing oxidative stress or shock to said cancer
stem cells in order to induce apoptosis or death of said cancer
stem cells, which result in the effect in the treatment of and
preventing from the recurrence of cancer or cancerous tumor. The
hemoglobin-based oxygen carrier of the present invention is also
modified to avoid dissociation into dimer such that it becomes more
stable and has a longer half life in the circulation. Unlike the
naturally occurring hemoglobin, this longer half life property
facilitates the penetration thereof into the target cells including
both cancerous cells, cancer stem cells and/or cancer progenitor
cells. Similar to the effect on cancer cells, the hemoglobin-based
oxygen carrier in the composition of the present invention also
sensitize the cancer stem cells to chemotherapeutic agent or
radiotherapy. In other words, the composition of the present
invention is an effective adjunctive therapy which can be
administered prior to or in combination with chemotherapy and/or
radiotherapy. In any aspects of the present invention described
herein, the hemoglobin-based oxygen carrier can be administered to
a subject in needs thereof at a concentration of 9.5 g/dL-10.5 g/dL
for the purpose(s) of targeting the cells in the cancerous tissues
or tumors, triggering the receptor-mediated mechanism, penetrating
and being localized into the cancerous tissue or tumor cells,
inducing apoptosis of the cancerous tissue or tumor cells,
sensitizing the cells to the chemotherapeutic agent or radiotherapy
which is administered concurrently or subsequently, either before,
during or after a surgical removal of the cancerous tissue or
tumor.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a set of microscopic images in the same
magnification showing the uptake of (A) fluorescent-labeled heat
stable hemoglobin-based oxygen carrier and (B) fluorescent-labeled
polymerized hemoglobin into liver cancer cells.
[0017] FIG. 2 is two sets of microscopic images in the same
magnification showing the uptake of fluorescent-labeled heat stable
hemoglobin-based oxygen carrier into liver cancer cells via the
Clathrin mediated pathway (upper panel) but not via Caveolin-1
mediated pathway (lower panel).
[0018] FIG. 3 shows the expression of different proteins in liver
cancer cells after treating with the heat stable hemoglobin-based
oxygen carrier in different concentrations.
[0019] FIG. 4 shows the expression of hypoxia-inducible factor 1
(HIF1.alpha.) gene in liver cancer cells (HepG2 and Huh7) after
treating with different concentrations of heat stable
hemoglobin-based oxygen carrier and under normoxic vs hypoxic
conditions.
[0020] FIG. 5 shows the expression of Vascular Endothelial Growth
Factor (VEGF) gene in liver cancer cells (HepG2 and Huh7) after
treating with different concentrations of heat stable
hemoglobin-based oxygen carrier and under normoxic vs hypoxic
conditions.
[0021] FIG. 6 shows the expression of endothelin-1 (ET1) gene in
liver cancer cells (HepG2 and Huh7) after treating with different
concentrations of heat stable hemoglobin-based oxygen carrier and
under normoxic vs hypoxic conditions.
[0022] FIG. 7 shows the expression of inducible nitric oxide
synthase (iNOS) gene in liver cancer cells (HepG2 and Huh7) after
treating with different concentrations of heat stable
hemoglobin-based oxygen carrier and under normoxic vs hypoxic
conditions.
[0023] FIG. 8 shows the expression of von Hippel-Lindau (VHL) gene
in liver cancer cells (HepG2 and Huh7) after treating with
different concentrations of heat stable hemoglobin-based oxygen
carrier and under normoxic vs hypoxic conditions.
[0024] FIG. 9 shows the expression of a heat shock protein 90
(HSP90) gene in liver cancer cells after treating with different
concentrations of heat stable hemoglobin-based oxygen carrier and
under normoxic vs hypoxic conditions.
[0025] FIG. 10 is a schematic diagram illustrating the proposed
mechanism and signaling cascade involved in the inhibitory effect
of the heat stable hemoglobin-based oxygen carrier on tumor
recurrence.
[0026] FIG. 11 shows the expression of the heat shock protein 7C
(HSP7C) gene in liver cancer cells after treating with different
concentrations of heat stable hemoglobin-based oxygen carrier and
under normoxic vs hypoxic conditions.
[0027] FIG. 12 shows the expression of high-mobility group box 3
(HMGB3) gene in liver cancer cells after treating with different
concentrations of heat stable hemoglobin-based oxygen carrier and
under normoxic vs hypoxic conditions.
[0028] FIG. 13 shows the expression of replication factor 1C (RFC1)
gene in liver cancer cells after treating with different
concentrations of heat stable hemoglobin-based oxygen carrier and
under normoxic vs hypoxic conditions.
[0029] FIG. 14 shows an improvement of oxygenation in normal
tissue. Injection of 0.2 g/kg heat stable tetrameric hemoglobin
solution results in a significant increase in (A) plasma hemoglobin
concentration and (B) oxygen delivery to muscle.
[0030] FIG. 15 shows an improvement of oxygenation in hypoxic tumor
tissue. Injection of 0.2 g/kg heat stable tetrameric hemoglobin
solution results in a significant increase in oxygen delivery to
the head and neck squamous cell carcinoma (HNSCC) xenograft.
[0031] FIG. 16 shows partial tumor shrinkage in rodent models of
(A) nasopharyngeal carcinoma (NPC) and (B) liver tumor.
[0032] FIG. 17 shows a schematic drawing summarizing the surgical
and hemoglobin product administration procedures during liver
resection.
[0033] FIG. 18 shows representative examples of intra-hepatic liver
cancer recurrence and metastasis and distant lung metastasis
induced in the rats of the IR injury group after hepatectomy and
ischemia/reperfusion procedures and its protection using the
inventive heat stable tetrameric hemoglobin.
[0034] FIG. 19 shows the histological examination in experimental
and control groups at four weeks after liver resection and IR
injury procedures.
[0035] FIG. 20A shows the volume (cm.sup.3) of recurred liver tumor
found in rats of the IR injury group (Control group) after
hepatectomy and IR procedures and rats having treated with the
inventive heat stable tetrameric hemoglobin (Hb Treatment
group).
[0036] FIG. 20B shows the liver recurrence rate (left) and the
average recurred tumor size (right) of the IR injury rats after
hepatectomy and IR procedures (Control group) and rats having
treated with the inventive heat stable tetrameric hemoglobin (Hb
group).
[0037] FIG. 21 shows representative examples of intra-hepatic liver
cancer recurrence and metastasis and distant lung metastasis
induced in the rats of the IR injury group after hepatectomy and
ischemia/reperfusion procedures (control group: C10 & C13) and
rats treated with the inventive heat stable tetrameric hemoglobin
(Hb treatment group: Y9, Y10 & Y11).
[0038] FIG. 22 shows the representative examples of liver oxygen
partial pressure (mmHg) from the first administration of the
subject inventive hemoglobin product or RA buffer (control)
throughout the hepatic surgery and reperfusion.
[0039] FIG. 23 shows a comparison between levels of circulating
endothelial progenitor cells (EPC) in peripheral blood of rats with
or without treatment of the subject hemoglobin product 28 days
post-hepatic surgery.
[0040] FIG. 24 shows the temporal localization of the heat-stable
hemoglobin-based oxygen carrier within nasopharyngeal carcinoma
Xenograft.
[0041] FIG. 25 shows the tumor growth inhibitory effect of the
hemoglobin-based oxygen carrier alone or combined with radiation in
a Hep-2 laryngeal cancer model; lower panel shows the
representative image of tumor xenografts obtained from different
treatment groups. *p<0.05, **p<0.01 versus control.
[0042] FIG. 26 shows the tumor growth inhibitory effect of the
hemoglobin-based oxygen carrier combined with radiation in a C666-1
nasopharyngeal cancer model; lower panel shows representative image
of tumor xenografts obtained from different treatment groups.
**p<0.01 versus control, #p<0.05 versus radiation treatment
only.
[0043] FIG. 27 shows the hemoglobin-based oxygen carrier enhances
temozolomide (TMZ)-induced cytotoxicity in brain cancer cells.
[0044] FIG. 28 are microscopic images showing the morphological
change of mammospheres formation by cancer stem cells: (A) Day 0,
(B) Day 3, (C) Day 6, (D) Day 9-20, (E) Control (hollow
mammospheres from mammary epithelial cells).
[0045] FIG. 29 are western blots showing the expression level of
different markers Oct-4 and Sox-2 in unsorted mammospheres and
sorted MCF7 CD44.sup.+/CD24.sup.- cells collected from different
passages.
[0046] FIG. 30 are dot plots of different passages of MCF7 cells in
terms of the aldehyde dehydrogenase (ALDH) activity: (A) Control
(sorted MCF7 cells incubated with diethylaminobenzaldehyde (DEAB));
(B) sorted MCF7 cells at passage 0; (C) sorted MCF7 cells at
passage 3; (D) sorted MCF7 cells at passage 5.
[0047] FIG. 31 is dot plots of MCF7 cells under hypoxic conditions
and labeled with CD24 (PE-A) and CD44 (APC-A) antibodies in a flow
cytometry analysis. Quadrant 1 (Q1) are cells which are
CD44.sup.high and CD24.sup.low.
[0048] FIG. 32 are microscopic images showing the morphological
change of unsorted and CD24/CD44-sorted MCF7 cells after incubated
with DMSO (Control) and 90 nM Taxol treatment for 16 hours and 4
days.
DEFINITIONS
[0049] The term "cancer stem cell" refers to the biologically
distinct cell within the neoplastic clone that is capable of
initiating and sustaining tumor growth in vivo (i.e. the
cancer-initiating cell).
[0050] "Hb" used herein refers to cross-linked tetrameric
hemoglobin which is heat stable with undetectable amount of dimers
and low percentage of met-hemoglobin. The heat stable cross-linked
tetrameric hemoglobin has a molecular weight of 60-70 kDa which is
heat treated and added with 0.05%-0.4% of N-acetyl cysteine during
the synthesis. The resulting heat stable cross-linked tetrameric
hemoglobin has undetectable amount of dimers and less than 5% of
met-hemoglobin. The heat stable cross-linked tetrameric hemoglobin
is also free of vasoconstricting impurities and protein impurities,
non-pyrogenic, endotoxin-free, phospholipid-free, and stroma-free.
The cross-linking within the tetrameric hemoglobin molecule can be
between alpha/alpha subunits, alpha/beta subunits or alpha-beta
subunits.
[0051] "Modified hemoglobin" or "Recombinant hemoglobin" defined
herein refers to any natural hemoglobin or purified hemoglobin
which is either chemically conjugated with or surface modified with
at least one compound. Said compound may include poly(ethylene)
glycol (PEG). One of the examples of the modified hemoglobin used
in the present invention is pegylated hemoglobin.
DETAILED DESCRIPTION OF INVENTION
[0052] Hemoglobin is an iron-containing oxygen-transport protein in
red blood cells of the blood of mammals and other animals.
Hemoglobin exhibits characteristics of both the tertiary and
quaternary structures of proteins. Most of the amino acids in
hemoglobin form alpha helices connected by short non-helical
segments. Hydrogen bonds stabilize the helical sections inside the
hemoglobin causing attractions within the molecule thereto folding
each polypeptide chain into a specific shape. A hemoglobin molecule
is assembled from four globular protein subunits. Each subunit is
composed of a polypeptide chain arranged into a set of
.alpha.-helix structural segments connected in a "myoglobin fold"
arrangement with an embedded heme group.
[0053] The heme group consists of an iron atom held in a
heterocyclic ring, known as a porphyrin. The iron atom binds
equally to all four nitrogen atoms in the center of the ring which
lie in one plane. Oxygen is then able to bind to the iron center
perpendicular to the plane of the porphyrin ring. Thus a single
hemoglobin molecule has the capacity to combine with four molecules
of oxygen.
[0054] In adult humans, the most common type of hemoglobin is a
tetramer called hemoglobin A consisting of two .alpha. and two
.beta. non-covalently bound subunits designated as .alpha.2.beta.2,
each made of 141 and 146 amino acid residues respectively. The size
and structure of .alpha. and .beta. subunits are very similar to
each other. Each subunit has a molecular weight of about 16 kDa for
a total molecular weight of the tetramer of about 65 kDa. The four
polypeptide chains are bound to each other by salt bridges,
hydrogen bonds and hydrophobic interaction. The structure of bovine
hemoglobin is similar to human hemoglobin (90.14% identity in
.alpha. chain; 84.35% identity in .beta. chain). The difference is
the two sulfhydryl groups in the bovine hemoglobin positioned at
.beta. Cys 93, while the sulfhydryls in human hemoglobin are at
positioned at .alpha. Cys 104, .beta. Cys 93 and .beta. Cys 112
respectively.
[0055] In naturally-occurring hemoglobin inside the red blood
cells, the association of an .alpha. chain with its corresponding
.beta. chain is very strong and does not disassociate under
physiological conditions. However, the association of one
.alpha..beta. dimer with another .alpha..beta. dimer is fairly weak
outside red blood cells. The bond has a tendency to split into two
.alpha..beta. dimers each approximately 32 kDa. These undesired
dimers are small enough to be filtered by the kidneys and be
excreted, with the result being potential renal injury and
substantially decreased intravascular retention time. Therefore,
stabilized cross-linked tetrameric, polymeric and/or
recombinant/modified hemoglobin are the important molecule in a
pharmaceutical composition for oxygen delivery. The source of
hemoglobin can be from, but not limited to, human, bovine, porcine,
equine, and canine whole blood.
[0056] The pharmaceutical composition of the present invention
contains a heat stable hemoglobin-based oxygen carrier which is
configured to attach to receptors on tumor cells to facilitate
selective targeting of hypoxic tumor cells over normal, non-hypoxic
healthy tissue and that can be used in cancer treatment as it can
be taken up preferentially into cancer cells. In FIG. 1A, live cell
imaging is used to show how the heat-stable tetrameric hemoglobin
(Hb) has efficacy against liver cancer. A fluorescently-conjugated
Hb is prepared by allowing conjugation between Hb and fluorescein
isothiocyanate (FITC) (buffered with NaHCO.sub.3 at pH9.3) for 1
hour at room temperature in an enclosed system purged with N.sub.2.
Subsequent purification is performed to remove unconjugated Hb and
free FITC using protein purification columns (Millipore). The
freshly conjugated Hb-FITC probe is immediately employed for live
cell uptake studies. Liver cancer cells, HepG2, and the metastatic
liver cancer cells, Huh7, are exposed to 0.0125 g/dL for 15 min
prior to live cell acquisition. The uptake of Hb-FITC into both
types of liver cancer cells after 15 min of exposure is observed
(FIG. 1A). The uptake of Hb-FITC peaks after 1 hour of exposure
(FIG. 1A). Under a hypoxic condition, the monolayer liver cancer
cells are observed to curl-up into a three-dimensional structure,
and Hb-FITC is detected to be more preferentially taken up by these
cancer cells than normal cells. The uptake of polymerized
hemoglobin into liver cancer cell is shown in FIG. 1B.
[0057] The ability of cellular uptake of the hemoglobin molecule is
through protein-coat vesicular endocytosis. Two common protein
coats which could be internalized are Clathrin and Caveolin 1. Red
fluorescent protein tagged Clathrin (RFP-Clathrin) and Caveolin 1
(mCherry-Caveolin1) plasmids are constructed, and the plasmids are
independently expressed in HepG2 or Huh7 cells taken up with
FITC-conjugated Hb. Time lapse imaging studies (FIG. 2) reveals
that Hb-FITC colocalizes with RFP-Clathrin, but not
mCherry-Caveolin1, suggesting that hemoglobin molecule enters into
liver cancer cells through Clathrin-mediated endocytosis.
[0058] The efficacy of hemoglobin alone and with adjunctive
therapies in non-metastatic and metastatic liver cancer cells is
demonstrated in the present invention by studying the IC.sub.50 of
various drugs in two liver cancer models, HepG2 and Huh7, and under
both normoxic and hypoxic conditions (the results are shown in
TABLE 1). Under normoxic condition, the IC.sub.50 of Cisplatin,
Doxorubicin, Bortezomib, and 5-fluorouracil (5FU) in HepG2 cells
are 130 uM, 10 uM, 0.5 uM, and 4 mM respectively, and the IC.sub.50
of Cisplatin, Doxorubicin, Bortezomib, and 5FU in Huh7 cells are 70
uM, 5 uM, 55 uM, and 3.5 mM respectively. Under hypoxic condition,
the IC.sub.50 of Cisplatin, Doxorubicin, Bortezomib, and 5FU in
HepG2 cells are 170 uM, 30 uM, 0.7 uM, and 4 mM respectively, and
the IC.sub.50 of Cisplatin, Doxorubicin, Bortezomib, and 5FU in
Huh7 cells are 100 uM, 6 uM, 60 uM, and 4 mM respectively. The
3-(4,5-cimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT)
assay result suggests that under normoxic condition, Huh7 cells are
more sensitive to Cisplatin and Doxorubicin, but are 110-fold more
resistance to Bortezomib as compared to HepG2 cells under normoxic
condition (a target drug against the proteasomal subunits PSMB1, 5
and 6). Under hypoxic condition, Huh7 cells become more sensitive
to Cisplatin and Doxorubicin, and are also highly resistant to
Bortezomib (86-fold) as compared to HepG2 cells under hypoxic
condition. The results reveal that metastatic liver cancer cells
(Huh7) are generally more resistant to Bortezomib than
non-metastatic liver cancer cells (HepG2) notwithstanding under
normoxic or hypoxic condition.
TABLE-US-00001 TABLE 1 HepG2 normoxic HepG2 hypoxic Cisplatin 130
uM Cisplatin 170 uM Doxorubicin 10 uM Doxorubicin 30 uM Bortezomib
0.5 uM Bortezomib 0.7 uM 5FU 4 mM 5FU 4 mM Huh7 normoxic Huh7
hypoxic Cisplatin 70 uM Cisplatin 100 uM Doxorubicin 5 uM
Doxorubicin 6 uM Bortezomib 55 uM Bortezomib 60 uM 5FU 3.5 mM 5FU 4
mM
[0059] The MTT results also reveal that Hb alone would not cause
any cell death. However, significant chemosensitization of 5FU and
Bortezomib is observed when administered at their respective
IC.sub.50 together with 0.2 g/dL of Hb. Under normoxic condition,
an additional 33% (total 83%) cell death is detected in 5FU and Hb
treated HepG2 cells, whereas an additional 20% (total 50%) cell
death is observed in Bortezomib and Hb-treated Huh7 cells. Under a
hypoxic condition, an additional 42% (total 92%) cell death is
detected in Bortezomib and Hb-treated HepG2 cells, while an
increment of 35% (total 85%) cell death is observed in 5FU and
Hb-treated HepG2 cells. Under the same hypoxic condition, an
additional 20% (total 72%) cell death in 5FU and Hb-treated Huh7
cells is observed. 5FU is a pyrimidine analog that inhibits
thymidylate synthase. Bortezomib is the first therapeutic
proteasome inhibitor used initially for treating myeloma patients.
It is reported to cause apoptosis in liver cancer cells (Koschny et
AL., Hepatology, 2007). Taken together, hemoglobin molecule is
observed to have significant synergistic effects with 5FU and
Bortezomib on both non-metastatic and metastatic cancer.
[0060] Hypoxia is a common physiological feature of tumors.
Intratumoural hypoxia is also common in liver cancer. The condition
of hypoxia is known to activate a signaling cascade that results in
the stabilization of the hypoxia-inducible factor 1 (HIF1.alpha.)
transcription factor and activation of HIF1.alpha. effector genes
(over 60 genes) that possess a hypoxia response element (HRE).
These HIF1.alpha. downstream effectors are involved in cell
survival, adaptation, anaerobic metabolism, immune reaction,
cytokine production, vascularization and general tissue
homeostasis.
[0061] In FIG. 3, Hb is demonstrated to affect HIF1.alpha. protein
expression in the HepG2 and the metastatic Huh7 liver cancer
models. Hb downregulates HIF1.alpha. in both normoxia and hypoxia,
suggesting that the depletion of HIF1.alpha. by Hb alone (40%
compared with untreated control) affects the binding of HIF1.alpha.
to its downstream effectors and results in transcriptional
repression of these effector genes. Similar downregulation patterns
can be detected in the upstream regulators of HIF1.alpha. (FIG. 4),
heat shock protein 90 (HSP90) (FIG. 9) and von Hippel-Lindau (VHL)
(FIG. 8), after treatment with Hb.
[0062] A substantial reduction of HIF1.alpha. is detected, both
transcript and protein levels exemplified by respective
quantitative qPCR and Western blotting studies, when liver cancer
cells are treated with Hb and 5FU (95% suppression) or Hb and
Bortezomib (80% suppression). These data suggests that Hb alone, Hb
combined treatment with 5FU or Bortezomib can abolish the
hypoxia-induced HIF1.alpha. mRNA and protein stabilization. As a
consequence, the downregulation of vascular endothelial growth
factor (VEGF) (FIG. 5) and endothelin-1 (ET1) (FIG. 6) expression
in Huh7 cells are observed, suggesting that the combination of Hb
and 5FU or Hb and Bortezomib can inhibit angiogenesis and vascular
tone in the liver metastatic model, where the inhibition of
angiogenesis is intrinsically connected to the development of
metastasis. The combination treatments are observed to reduce
inducible nitric oxide synthase (iNOS) (FIG. 7) expression in Huh7,
suggesting that the degree of vasculature and angiogenesis can also
be compromised in the liver metastatic model. In total, our
findings indicate that combined administration of Hb with 5FU or
Bortezomib can synergistically repress hypoxic induction of VEGF,
ET1 and iNOS expressions by inhibiting HIF1.alpha.. The proposed
mechanism involved in the inhibitory effect of Hb on tumor
recurrence and its signaling cascade is illustrated in FIG. 10. The
relationship of oxygen supply, prolyl hydroxylase domain-containing
protein (PDH), HIF and endothelial progenitor cell (EPC) is clearly
shown.
[0063] A pharmaceutical composition including a hemoglobin-based
oxygen carrier configured to target DNA-damage-sensing cell
regulation apparatus is also found to go through novel regulatory
pathways. In the present invention, two of the proteins which are
the intrinsic parts of the DNA-damage-sensing apparatus,
replication factor 1C (RFC1) (FIG. 13) and the HSP7C (heat shock
protein 7C) (FIG. 11), are upregulated in Hb-treated liver cancer
cells, and are drastically upregulated in the combined treatment
with Bortezomib (3-10 fold upregulation for RFC1, and 25-45 fold
upregulation for HSP7C). These novel Hb target proteins suggest
that Hb is a potential Reactive Oxygen Species (ROS) inducer, and
it is clearly important for the metastatic liver cancer cells,
Huh7, to sense and respond to the ROS-mediated DNA damage. The
drastic upregulation of the DNA damage response proteins in
reaction with Hb and Bortezomib may result in subsequent
oxidative-stress induced apoptosis.
[0064] For uses in cancer treatment, the oxygen carrier-containing
pharmaceutical composition of the present invention serves as a
tissue oxygenation agent to improve the oxygenation in tumor
tissues, thereby enhancing chemosensitivity and radiation
sensitivity.
[0065] In addition, the ability of the heat stable tetrameric
hemoglobin to improve oxygenation in normal tissues (FIG. 14) and
in extremely hypoxic tumors (FIG. 15), is demonstrated in this
invention. Oxygen partial pressure (pO.sub.2) within the tumor mass
is directly monitored by a fibreoptic oxygen sensor (Oxford
Optronix Limited) coupled with a micro-positioning system (DTI
Limited). After intravenous injection of 0.2 g/kg of the heat
stable tetrameric hemoglobin, the median pO.sub.2 value rises from
baseline to about two-fold of relative mean oxygen partial pressure
within 15 minutes and extends to 6 hours. Further, the oxygen level
on average still maintains a level of 25% to 30% above the baseline
value 24 to 48 hours post infusion. No commercial products or
existing technologies show as high an efficacy when compared to the
oxygen carrier-containing pharmaceutical composition prepared in
this invention.
[0066] For tumor tissue oxygenation, a representative oxygen
profile of a human head and neck squamous cell carcinoma (HNSCC)
xenograft (FaDu) is shown in FIG. 15. After intravenous injection
of 0.2 g/kg of the heat stable tetrameric hemoglobin, a significant
increase in the mean pO.sub.2 of more than 6.5-fold and 5-fold is
observed at 3 and 6 hours, respectively (FIG. 15).
[0067] For applications in cancer treatment, the oxygen
carrier-containing pharmaceutical composition of the present
invention serves as a tissue oxygenation agent to improve the
oxygenation in tumor tissues, thereby enhancing chemo- and
radiation sensitivity. In conjunction with X-ray irradiation and
the heat stable tetrameric hemoglobin, tumor growth is delayed. In
FIG. 16A, the representative curves show significant tumor
shrinkage in rodent models of nasopharyngeal carcinoma. Nude mice
bearing CNE2 xenografts are treated with X-ray alone (2Gy) or in
combination with the heat stable tetrameric hemoglobin (2Gy+Hb).
1.2 g/kg of the heat stable tetrameric hemoglobin is injected
intravenously into the mouse approximately 3 to 6 hours before
X-ray irradiation and results in a partial shrinkage of
nasopharyngeal carcinoma xenograft.
[0068] In one embodiment, significant liver tumor shrinkage is
observed after injecting the composition, in conjunction with a
chemotherapeutic agent. In FIG. 16B, the representative chart shows
significant tumor shrinkage in a rat orthotopic liver cancer model.
Buffalo rats bearing a liver tumor orthograft (CRL1601 cell line)
are treated with 3 mg/kg cisplatin alone, or in combination with
0.4 g/kg of the heat stable tetrameric hemoglobin (Cisplatin+Hb).
Administration of the heat stable tetrameric hemoglobin before
cisplatin injection results in a partial shrinkage of the liver
tumor.
EXAMPLES
[0069] The following examples are provided by way of describing
specific embodiments of this invention without intending to limit
the scope of this invention in any way.
Example 1
Culture and Reagents for Liver Cancer Cell Line
[0070] HepG2 and Huh7 cell lines are used. These cells are cultured
in DMEM (Invitrogen) with 10% Fetal bovine serum (FBS), 100 U/ml
penicillin and 100 .mu.g/ml streptomycin at 37.degree. C. For
normoxic condition, cells are incubated with ambient O.sub.2
concentration and 5% CO.sub.2, for hypoxic condition, cells are
incubated with 0.1-0.5% O.sub.2 (Quorum FC-7 automatic
CO.sub.2/O.sub.2/N.sub.2 gas mixer) and 5% CO.sub.2.
Example 2
Live Cell Time-Lapse Microscopy
[0071] HepG2 or Huh7 cells are seeded onto glass bottom microwell
dishes (MatTek Corporation). Live cells at defined zooms
(63.times., 20.times.) are acquired using Zeiss Observer.Z1
widefield microscope, equipped with
atmospheric/temperature-controlled chamber and motorized stage for
multi-positional acquisition. The incubation is performed in an
enclosed live cell imaging system purged with 0.1% O.sub.2 and 5%
CO.sub.2 (premixed). Cells transfected with pcDNA3, pRFP-Caveolin1,
or pRFP-Clathrin are exposed to HB-FITC for 15 min prior to the
acquisition of images every 3 min for a period of 2 hours. Images
are deconvolved and compacted into time-lapse movies using the
MetaMorph software (Molecular Device).
Example 3
Cytotoxicity Assay
[0072] Cell viability is measured using a
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
proliferation assay. Briefly, HepG2 or Huh7 cells are seeded in a
96-well flat-bottomed microplate (6000 cells/well) and cultured in
100 .mu.L growth medium at 37.degree. C. and 5% CO.sub.2 for 24 h.
Cell culture medium in each well is then replaced by 100 .mu.L cell
growth medium, containing either no drug, Hb alone or Hb with
another chemotherapeutics at their IC.sub.50 concentrations.
Incubation of Hb for 24 h, 20 .mu.L MTT labeling reagent (5 mg/mL
in PBS solution) is added to each well for further 4 h at
37.degree. C. The growth medium is removed gently, and 200 .mu.L
DMSO is then added to each well as solubilizing agent to dissolve
the formazan crystals completely. The absorbance at the wavelength
of 570 nm is measured by Multiskan EX (Thermo Electron
Corporation), and each data point represents the means.+-.SD from
triplicate wells.
Example 4
RNA Isolation and Quantitative Real-Time PCR
[0073] Total RNA is isolated using the Trizol reagent (Invitrogen)
and 5 .mu.g of the total RNA is reverse transcribed with an
oligo-dT primer and Superscript II reverse transcriptase
(Invitrogen). One-tenth of the first strand cDNA is used for
quantitative measurements of HIF1alpha, VHL, HSP90, VEGF, iNOS,
ET1, HSP7c, RFC1, HMGB3, and GAPDH transcript levels by the SYBR
Green PCR Master Mix kit (Applied Biosystems) with specific primers
(shown below). The fluorescence signals are measured in real time
during the extension step by the 7900HT Fast Real Time PCR System
(Applied Biosystems). The threshold cycle (Ct) is defined as the
fractional cycle number at which the fluorescence signal reached
10-fold standard deviation of the baseline (from cycles 2 to 10).
The ratio change in the target gene relative to the GAPDH control
gene is determined by the 2.sup.-.DELTA..DELTA.ct method.
TABLE-US-00002 HIF1.alpha.: SEQ NO. 1: Forward Primer:
5-GGCGCGAACGACAAGAAAAAG-3 (420-440) SEQ NO. 2: Reverse Primer:
5-CCTTATCAAGATGCGAACTCACA-3 (21-44) SEQ NO. 3: Forward Primer:
CAGAGCAGGAAAAGGAGTCA (2414-2433) SEQ NO. 4: Reverse Primer:
AGTAGCTGCATGATCGTCTG (2645-2625) SEQ NO. 5: Forward Primer:
5'-AATGGAATGGAGCAAAAGACAATT-3' (2694-2720) SEQ NO. 6: Reverse
Primer: 5'-ATTGATTGCCCCAGCAGTCTAC-3' (2764-2743) VEGF: SEQ NO. 7:
Forward Primer: GCTACTGCCATCCAATCGAG (1187-1206) SEQ NO. 8: Reverse
Primer: CTCTCCTATGTGCTGGCCTT (1395-1376) SEQ NO. 9: Forward Primer:
5'-CTCTCTCCCTCATCGGTGACA-3' (3146-3167) SEQ NO. 10: Reverse Primer:
5'-GGAGGGCAGAGCTGAGTGTTAG-3' (3202-3223) SEQ NO. 11: Forward
Primer: ACTGCCATCCAATCGAGACC (1190-1209) SEQ NO. 12: Reverse
Primer: GATGGCTGAAGATGTACTCGATCT (1265-1241) INOS: SEQ NO. 13:
Forward Primer: 5'-ACAACAAATTCAGGTACGCTGTG-3' (2111-2137) SEQ NO.
14: Reverse Primer: 5'-TCTGATCAATGTCATGAGCAAAGG-3 (2194-2171) SEQ
NO. 15: Forward Primer: GTTCTCAAGGCACAGGTCTC (121-140) SEQ NO. 16:
Reverse Primer: GCAGGTCACTTATGTCACTTATC (225-247) ET1: SEQ NO. 17:
Forward Primer: TGCCAAGCAGGAAAAGAACT (701-720) SEQ NO. 18: Reverse
Primer: TTTGACGCTGTTTCTCATGG (895-876) HSP90: SEQ NO. 19: Forward
Primer: TTCAGACAGAGCCAAGGTGC (640-659) SEQ NO. 20: Reverse Primer:
CAATGACATCAACTGGGCAAT (807-787) SEQ NO. 21: Forward Primer:
GGCAGTCAAGCACTTTTCTGTAG (1032-1054) SEQ NO. 22: Reverse Primer:
GTCAACCACACCACGGATAAA (1230-1210) VHL: SEQ NO. 23: Forward Primer:
ATTAGCATGGCGGCACACAT (2806-2825) SEQ NO. 24: Reverse Primer:
TGGAGTGCAGTGGCATACTCAT (2921-2900)
Example 5
Western Blotting Analysis
[0074] Cells are harvested and protein concentrations are
determined. Protein (30 .mu.g) is resolved on 10% SDS-PAGE,
transferred onto a nitrocellulose membrane (PVDF, BioRad). Actin is
used as loading control. Relative protein expression levels are
quantified by gel documentation system (Ultra-Violet Product
Ltd).
Example 6
Improvement of Oxygenation
[0075] (6a) Improvement of Oxygenation in Normal Tissue
[0076] Some studies for the normal tissue oxygenation by heat
stable tetrameric hemoglobin are carried out (shown in FIG. 14). A
comparative pharmacokinetic and pharmacodynamic study is conducted
in buffalo rats. Male inbred buffalo rats are individually
administered with 0.2 g/kg heat stable tetrameric hemoglobin
solution or ringer's acetate buffer (control group). The
concentration-time profile of plasma hemoglobin is determined by
Hemocue.TM. photometer at 1, 6, 24, 48 hours and compared with the
baseline reading. The methods are based on photometric measurement
of hemoglobin where the concentration of hemoglobin is directly
read out as g/dL. Oxygen partial pressure (pO.sub.2) is directly
measured by the Oxylab.TM. tissue oxygenation and temperature
monitor (Oxford Optronix Limited) in hind leg muscle of buffalo
rats. Rats are anesthetized by intra-peritoneal injection of 30-50
mg/kg pentobarbitone solution followed by insertion of oxygen
sensor into the muscle. All pO.sub.2 readings are recorded by
Datatrax2 data acquisition system (World Precision Instrument) in a
real-time manner Results demonstrate that after an intravenous
injection of 0.2 g/kg of the heat stable tetrameric hemoglobin, the
mean pO.sub.2 value rises from baseline to about two-fold of the
relative mean oxygen partial pressure within 15 minutes and extends
to 6 hours. Further, the oxygen level on average is still
maintained at 25% to 30% above the baseline value 24 to 48 hours
post injection (FIG. 14B).
[0077] (6b) Significant Improvement of Oxygenation in Extremely
Hypoxic Tumor Area
[0078] Improvement of oxygenation in an extremely hypoxic tumor
area is evaluated by a human head and neck squamous cell carcinoma
(HNSCC) xenograft model. A hypopharyngeal squamous cell carcinoma
(FaDu cell line) is obtained from the American Type Culture
Collection. Approximately 1.times.10.sup.6 cancer cells are
injected subcutaneously into four to six week-old inbred BALB/c
AnN-nu (nude) mice. When the tumor xenograft reaches a diameter of
8-10 mm, oxygen partial pressure (pO.sub.2) within the tumor mass
is directly monitored by the Oxylab.TM. tissue oxygenation and
temperature monitor (Oxford Optronix Limited). All pO.sub.2
readings are recorded by the Datatrax2 data acquisition system
(World Precision Instrument) in a real-time manner. When the
pO.sub.2 reading is stabilized, 0.2 g/kg heat stable tetrameric
hemoglobin solution is injected intravenously through the tail vein
of the mice and the tissue oxygenation is measured. Results
demonstrate that after intravenous injection of 0.2 g/kg of the
said heat stable tetrameric hemoglobin, a significant increase in
the mean pO.sub.2 of more than 6.5-fold and 5-fold is observed in 3
and 6 hours, respectively (FIG. 15).
Example 7
Cancer Treatment Studies
A Significant Tumor Shrinkage in Nasopharyngeal Carcinoma
[0079] A significant tumor shrinkage is observed after
administration of heat stable tetrameric hemoglobin solution in
combination with X-ray irradiation (FIG. 16A). A human
nasopharyngeal carcinoma xenograft model is employed. Approximately
1.times.10.sup.6 cancer cells (CNE2 cell line) are injected
subcutaneously into four to six week-old inbred BALB/c AnN-nu
(nude) mice. When the tumor xenograft reaches a diameter of 8-10
mm, tumor-bearing mice are randomized into three groups as
follows:
[0080] Group 1: Ringer's acetate buffer (Ctrl)
[0081] Group 2: Ringer's acetate buffer+X-ray irradiation (2Gy)
[0082] Group 3: Heat stable tetrameric hemoglobin+X-ray irradiation
(2Gy+Hb)
[0083] Nude mice bearing CNE2 xenografts are irradiated with
X-irradiation alone (Group 2) or in combination with heat stable
tetrameric hemoglobin (Group 3). For X-ray irradiation (Groups 2
and 3), mice are anesthetized by an intra-peritoneal injection of
50 mg/kg pentobarbitone solution. 2 Grays of X-ray is delivered to
the xenograft of tumor-bearing mice by a linear accelerator system
(Varian Medical Systems). For Group 3, 1.2 g/kg heat stable
tetrameric hemoglobin is injected intravenously through the tail
vein into the mouse before X-ray treatment. Tumor dimensions and
body weights are recorded every alternate day starting with the
first day of treatment. Tumor weights are calculated using the
equation 1/2.times.LW.sup.2, where L and W represent the length and
width of the tumor mass, measured by a digital caliper (Mitutoyo
Co, Tokyo, Japan) at each measurement. Group 1 is the non-treatment
control group. Results (shown in FIG. 16) demonstrate that
significant shrinkage of the CNE2 xenograft is observed in mice
treated with the heat stable tetrameric hemoglobin solution in
conjunction with X-irradiation (Group 3, FIG. 16A).
Example 8
Cancer Treatment Studies
A Significant Shrinkage in Liver Tumor
[0084] In addition, significant tumor shrinkage is observed after
administration of heat stable tetrameric hemoglobin solution in
combination with cisplatin (FIG. 16B). A rat orthotopic liver
cancer model is employed. Approximately 2.times.10.sup.6 rat liver
tumor cells labeled with luciferase gene (CRL1601-Luc) are injected
into the left lobe of the liver in a buffalo rat. Tumor growth is
monitored by a Xenogen in vivo imaging system. Two to three weeks
after injection, the tumor tissue is harvested, dissected into
small pieces and orthotopically implanted into the left liver lobe
of a second group of rats. Rats bearing liver tumor are randomized
into three groups as follows:
[0085] Group 1: Ringer's acetate buffer (Control)
[0086] Group 2: Ringer's acetate buffer+cisplatin (Cisplatin)
[0087] Group 3: Heat stable tetrameric hemoglobin+cisplatin
(Cisplatin+Hb)
[0088] Rats implanted with liver tumor tissue are treated with 3
mg/kg of cisplatin alone (Group 2) or in conjunction with heat
stable tetrameric hemoglobin (Group 3). For groups 2 and 3, rats
are anesthetized by an intra-peritoneal injection of 30-50 mg/kg
pentobarbitone solution and cisplatin are administered via the left
portal vein. For Group 3, 0.4 g/kg heat stable tetrameric
hemoglobin is injected intravenously before cisplatin treatment.
Group 1 is the non-treatment control group. Importantly, a
significant shrinkage of liver tumor is observed 3 weeks after
treatment (FIG. 16B).
Example 9
Method of Preventing Post-Operative Liver Tumor Recurrence and
Metastasis
[0089] Surgical resection of liver tumors is a frontline treatment
of liver cancer. However, post-operative recurrence and metastasis
of cancer remains a major attribute of unfavorable prognosis in
these patients. For instance, previous studies reported that
hepatic resection is associated with a 5-year survival rate of 50%
but also a 70% recurrence rate. Follow-up studies on hepatocellular
carcinoma (HCC) patients also reveal that extrahepatic metastases
from primary HCC were detected in approximately 15% of HCC patients
with the lungs being the most frequent site of extrahepatic
metastases. It has been suggested that surgical stress, especially
ischemia/reperfusion (IR) injury introduced during liver surgery is
a major cause of tumor progression. Conventionally, hepatic
vascular control is commonly used by surgeons to prevent massive
hemorrhage during hepatectomy. For example, inflow occlusion by
clamping of the portal triad (Pringle maneuver) has been used to
minimize blood loss and reduce the requirement of perioperative
transfusions. A recent Japanese study shows that 25% surgeons apply
a Pringle maneuver on a routine basis. However, Pringle maneuver
induces various degrees of ischemic injury in the remnant liver and
is associated with cancer recurrence and metastasis.
[0090] Association of IR injury and tumor progression is also
supported by previous animal studies. Firstly, the effect of IR
injury and hepatic resection on liver cancer recurrence and
metastasis was demonstrated in a recent study with an orthotopic
liver cancer model. Hepatic IR injury and hepatectomy resulted in
prominent recurrence and metastasis of liver tumors. Similar
results were obtained in a colorectal liver metastasis mouse model
where introduction of IR injury accelerates the outgrowth of
colorectal liver metastasis.
[0091] Previously, several protective strategies have been studied
for use to reduce IR injury during resection. For example, the
application of a short period of ischemia before prolonged
clamping, known as ischemic preconditioning (IP), was suggested to
trigger hepatocellular defense mechanisms and has been used to
reduce IR injury during liver resection. Others apply intermittent
clamping (IC) procedures which allows cycles of inflow occlusion
followed by reperfusion. Both methods were suggested to be
effective in protecting against postoperative liver injury in
non-cirrhotic patients undergoing major liver surgery. However, in
a tumor setting, animal studies also show that IP failed to protect
the liver against accelerated tumor growth induced by IR injury. In
addition, some groups attempt to use anti-oxidants such as
.alpha.-tocopherol and ascorbic acid to protect the liver from IR
injury, thereby preventing liver metastasis. However, both
anti-oxidants failed to restrict intrahepatic tumor growth
stimulated by IR.
[0092] Mechanistically, different lines of evidence suggest hypoxia
is associated with tumor recurrence and metastasis for a number of
reasons: (1) studies show that hypoxic tumor is more resistant to
radiation- and a chemo-therapy, tumor cells that survive the
treatment are prone to recur; clinical evidence also suggests that
patients with more hypoxic tumor areas have higher rates of
metastases; (2) under hypoxic condition, cancer cells become more
aggressive through the activation of hypoxia inducible factor-1
(HIF-1) pathway. This in turn triggers complementary responses
involving pro-angiogenic factor vascular endothelial growth factor
(VEGF) and receptors such as c-Met and CXCR4, which enhanced cell
motility and homing to specific, distant organs; (3) recent studies
also demonstrated that circulating cancer cells (CTCs) become more
aggressive under hypoxic condition. Circulating tumor cells
detected in the peripheral blood of cancer patients was shown to be
an index of disease aggression in patients with distant metastasis,
while hypoxia enabled those cells a more aggressive phenotype and
diminished apoptotic potential. In particular, cancer stem cell
population, which is more radio-resistant were enriched under
reduced oxygen level in brain tumor.
[0093] Therefore, in view of the above observations and studies,
the cross-linked tetrameric hemoglobin of the present invention is
used to prevent post-operative liver tumor recurrence and
metastasis following hepatic resection. A rat orthotopic liver
cancer model is established. Hepatocellular carcinoma cell line
(McA-RH7777 cells) is used to establish the orthotopic liver cancer
model in Buffalo rats (Male, 300-350 g). FIG. 17 shows a schematic
drawing summarizing the surgical and hemoglobin product
administration procedures. McA-RH7777 cells (approximately
1.times.10.sup.6 cells/100 .mu.L) are injected into the hepatic
capsule of buffalo rat to induce solid tumor growth. Two weeks
later (when the tumor volume reaches about 10.times.10 mm), tumor
tissue is collected and cut into 1-2 mm.sup.3 cubes and implanted
into the left liver lobes of a new group of buffalo rats. Two weeks
after orthotopic liver tumor implantation, the rats undergo liver
resection (left lobe bearing liver tumor) and partial hepatic IR
injury (30 minutes of ischemia on right lobe).
[0094] Two groups of rats with implanted tumor tissue are used for
comparison of tumor recurrence and metastases. In group 1, rats are
anesthetized with pentobarbital and administered intravenously with
0.2 g/kg at a concentration of 10 g/dL of the heat stable
tetrameric hemoglobin of the present invention 1 hour before
ischemia. Ischemia is introduced in the right lobe of the liver by
clamping of right branches of hepatic portal vein and hepatic
artery with a bulldog clamp. Subsequently, ligation is performed in
the left liver lobe followed by resection of the left liver lobe
bearing the liver tumor. At 30 minutes after ischemia, an
additional 0.2 g/kg of the heat stable tetrameric hemoglobin is
injected through the inferior vena cava followed by reperfusion. In
group 2, ringer's acetate buffer is injected as a vehicle control
with the same procedure. All rats are sacrificed 4 weeks after the
hepatectomy procedures.
[0095] To examine tumor growth and metastasis, the liver and lungs
of Buffalo rats are sampled at 4 weeks after Ischemia/reperfusion
and hepatectomy procedures for morphological examination. Tissue is
harvested, parafilm-embedded and sectioned followed by Hematoxylin
and Eosin (H&E) staining. Local recurrence/metastasis
(intrahepatic) and distant metastasis (lungs) are confirmed by
histological examination. Table 2 summarizes the comparison of
tumor recurrence/metastasis at four weeks after liver resection and
IR injury in a rat orthotopic liver cancer model.
TABLE-US-00003 TABLE 2 Control (n = 13) Treatment (n = 13)
Intrahepatic metastasis/ 9 (69.2%) 4 (30.8%) recurrence Lung
metastasis 7 (53.9%) 4 (30.8%)
[0096] To examine the protective effects of nonpolymeric heat
stable tetrameric hemoglobin on liver tumor recurrence and
metastasis, all rats are sacrificed 4 weeks after the hepatectomy
and IR procedures. Lungs and liver tissues are harvested; hepatic
tumor recurrence/metastasis and distant metastasis in the lungs are
compared in both groups. Results show that the hemoglobin treatment
decreases occurrence of recurrence and metastasis in both
organs.
[0097] FIG. 18 shows representative examples of intra-hepatic liver
cancer recurrence and metastasis and distant lung metastasis
induced in the rats of the IR injury group after hepatectomy and
ischemia/reperfusion procedures and its protection using the
inventive heat stable tetrameric hemoglobin. In FIG. 18A, extensive
intrahepatic liver cancer recurrence/metastasis is observed in the
IR injury group. Distant lung metastasis is also occurred in the
same rat (indicated by a solid arrow). In FIG. 18B, intrahepatic
liver cancer recurrence/metastasis is observed in another case in
the IR injury group (indicated by a dotted arrow). Extensive lung
metastasis is observed in the same case (indicated by solid
arrows). In contrast, FIG. 18C shows a representative example of
protection from intrahepatic liver cancer recurrence/metastasis and
distant lung metastasis in the inventive heat stable tetrameric
hemoglobin treated rat.
[0098] FIG. 19 shows the histological examination in both groups at
four weeks after liver resection and IR injury procedures.
Histological examination (H&E staining) of liver and lung
tissues in both the IR injury and hemoglobin treatment groups is
performed to confirm the identity of the tumor nodules.
Representative fields showing intrahepatic recurrence (T1 and T2)
and lung metastasis (M) in the IR injury group are shown (top).
Histological examination showing a normal liver architecture in the
treatment group (N1) and a tumor nodule detected in the liver after
hemoglobin treatment (T3) are included for comparison (bottom). In
addition, lung tissue without metastasis is shown in the treatment
group (N2) for comparison.
[0099] To further confirm the protective effects of heat stable
tetrameric hemoglobin on tumor recurrence and metastasis,
recurrence rate of tumor and size of the recurred tumor
post-ischemia/reperfusion and hepatectomy procedures are
investigated. Again, rats with implanted tumor tissue prepared by
injection of McA-RH7777 cells as described above are treated
intravenously with either approximately 0.2-0.4 g/kg of the heat
stable tetrameric hemoglobin of the present invention or Ringer's
acetate (RA) buffer as a negative control prior to ischemia and at
reperfusion upon hepatic resection procedure as described in FIG.
17. A total of 26 rats are tested, where 13 rats are treated with
the subject hemoglobin and 13 are negative control rats which are
merely treated with RA buffers. All rats are sacrificed 4 weeks
after the hepatectomy and IR procedures, livers and lungs of the
test rats are examined for tumor recurrence/metastasis and the
relative size of the recurred tumors are measured.
[0100] FIG. 20A shows liver tumor recurrence in test rats and the
volume of individual recurred tumors. Liver tumor
recurred/metastasis in 9 of the 13 non-treated control rats,
whereas only 4 of the 13 treated rats experienced tumor
recurrences/metastasis. It is also evident that where tumor
recurrence is seen, the sizes of the recurred tumors of rats having
treated with the subject hemoglobin are significantly smaller than
those untreated. The results show that tumor recurrence rate is
greatly reduced and recurred tumor size is significantly reduced
with treatment of the subject invention, as summarized in FIG.
20B.
[0101] FIG. 21 illustrates representative examples of liver and
lung tissues harvested 4 weeks post hepatectomy and IR procedures
of rats having treated with the subject inventive heat stable
tetrameric hemoglobin and the IR injury (negative control) group.
As seen in representative examples of the untreated negative
control group, rats C10 and 13, extensive intrahepatic liver cancer
recurrence/metastasis and distant lung metastasis are observed
(circled). On the other hand, intrahepatic liver cancer
recurrence/metastasis and distant lung metastasis are prevented by
the treatment of the subject inventive hemoglobin, as seen in rats
Y9, Y10 and Y11.
Example 10
Treatment with Heat Stable Tetrameric Hemoglobin Reduces
Ischemia
[0102] As demonstrated in Example 6, intravenous injection of the
subject heat stable tetrameric hemoglobin to hypoxic tumor
significantly improves the oxygenation therein. Accordingly, the
oxygenation effect of the subject hemoglobin product during tumor
resection and IR procedure is investigated. Rats with implanted
liver tumor tissue prepared by injection of McA-RH7777 cells are
used and are subjected to surgery and 0.2-0.4 g/kg of the subject
hemoglobin product or RA buffer administration procedures as
outline in FIG. 17. Oxygen partial pressure of liver is measured
from the time the subject hemoglobin product/RA buffer is first
administered to the hepatic tumor and throughout the IR procedure,
hepatic tumor resection and after reperfusion. Results (FIG. 22)
shows that increased oxygenation with the subject hemoglobin
treatment is observed after introduction of ischemia. In addition,
as seen in FIG. 22, the liver having treated with the subject
hemoglobin has approximately 3-fold higher oxygen partial pressure
than without treatment after reperfusion. It is confirmed that the
treatment of the subject hemoglobin prior to ischemia and at
reperfusion upon tumor resection significantly improves the
oxygenation of the liver tissue as compared to non-treatment. In
view of the strong correlation between hypoxic tumor and the
increased likelihood of tumor recurrences/metastasis suggested in
the art, the profound oxygenation effects of the present hemoglobin
product and the use thereof during tumor resection procedure as
demonstrated in this example, the usefulness of the present
hemoglobin product to reduce tumor recurrence and metastasis are
evidently confirmed.
Example 11
Treatment with Heat Stable Tetrameric Hemoglobin Reduces
Circulating Endothelial Progenitor Cell Levels
[0103] Different lines of study have demonstrated the significance
of cancer stem cells (CSCs) and/or progenitor cell populations in
the progression of liver cancer. Importantly, previous studies show
that a significantly higher level of circulating endothelial
progenitor cells (EPCs) is found in HCC patients, including those
undergoing hepatectomy.
[0104] Accordingly, the level of circulating EPCs is evaluated by
expression of surface molecules such as CD133, CD34 and VEGFR2. The
circulating endothelial progenitor cell levels post-hepatic
resection surgery and IR procedure with or without the treatment of
the subject hemoglobin product is investigated. Two groups of rats
with implanted hepatic tumor are subjected to treatment of the
subject hemoglobin or RA buffer (control), respectively prior to
ischemia and at reperfusion upon hepatic resection as shown in FIG.
17. Number of circulating EPC of the two group of rats are then
measured at 0, 3, 7 14, 21 and 28 days after hepatic resection and
IR procedures. Results (FIG. 23) shows that while EPC levels of the
treated and non-treated groups are comparable during day 0-day 3
post-surgery, EPC levels of the hemoglobin treated group are
profoundly lower than those RA buffer treated group. The result
shows that the protection effects of the subject hemoglobin can
reduce and minimize tumor recurrence/metastasis.
Example 12
Localization of Heat Stable Tetrameric Hemoglobin within a Tumor
Mass
[0105] To visualize the localization of the heat stable tetrameric
hemoglobin within the tumor mass, the inventive hemoglobin is
labeled with Alexa Fluor.RTM. 750 SAIVI.TM. Antibody Labeling
System according to manufacturer's instruction. Briefly,
fluorescently labeled inventive hemoglobin (fl-Hb) is mixed with
unlabeled counterpart in a ratio of approximately 1:80. The mixture
is injected intravenously into nude mice bearing nasopharyngeal
carcinoma xenograft (C666-1). For each nude mouse, the amount of
fl-Hb is around 0.2 mg to ensure sufficient fluorescent signal to
be captured by the Maestro2 imaging system. Nude mice are
anesthetized at different time points before exposure to the
Maestro2 fluorescent imaging system for analysis. FIG. 24 shows
representative image of Hb concentrated within the tumor xenograft
(indicated by an arrow).
Example 13
Radio-Sensitization Effects of the Heat Stable Tetrameric
Hemoglobin in Laryngeal Cancers
[0106] To evaluate the radio-sensitization effects of heat stable
tetrameric hemoglobin in head and neck cancers, the
hemoglobin-based oxygen carrier of the present invention is
administered once before radiation, and the result shows that tumor
growth inhibitory effects in the Hep-2 laryngeal cancer model. The
tumor volume of high dose of Hb (2.2 g/kg) combined with radiation
at the end of experiment is 90.0 mm.sup.3, which is significantly
smaller than the control group (336.1 mm.sup.3) (P<0.01). The
tumor volume of radiation alone is 143.1 mm.sup.3, and the
combination q value of administering a high dose of Hb is 1.17,
indicating a synergistic effect of this combination (q>1.15,
synergistic effect). FIG. 25 shows the tumor growth inhibition
effects of the hemoglobin-based oxygen carrier of the present
invention followed by radiation.
Example 14
Radio-Sensitization Effects of Heat Stable Tetrameric Hemoglobin in
Nasopharyngeal Cancer
[0107] To evaluate the radio-sensitization effects of heat stable
tetrameric hemoglobin in nasopharyngeal cancer, the
hemoglobin-based oxygen carrier of the present invention is
administered once before radiation, and the result shows that tumor
growth inhibitory effect in the C666-1 nasopharyngeal cancer model.
The tumor volume of high dose of Hb (2.2 g/kg) combined with
radiation at the end of experiment is 110.3 mm.sup.3, which is
significantly smaller compared with the control group (481.1
mm.sup.3) (P<0.01), and also significantly smaller compared with
the radiation alone group (160 mm.sup.3) (P<0.05). The
combination q value of Hb high dose is 1.24, indicating a
synergistic effect of this combination (q>1.15, synergistic
effect). FIG. 26 shows the tumor growth inhibition effects of the
hemoglobin-based oxygen carrier of the present invention followed
by radiation.
Example 15
Chemo-Sensitization Effects of the Heat Stable Tetrameric
Hemoglobin in Brain Cancer
[0108] Glioblastoma multiforme (GBM) is the commonest type of
primary brain tumor in adults and one of the most aggressive and
lethal malignancies in human, it is characterized by rapid growth,
invasiveness and early recurrences. The prognosis of GBM patients
is extremely unfavorable with a median survival of approximately 1
year. Although the alkylating agent temozolomide (TMZ) can
significantly prolong survival, most patients develop tumor
recurrences due to de novo or acquired TMZ-resistance.
[0109] Accordingly, the sensitization effect of Hb on
temozolomide-induced cytotoxicity in glioblastoma multiforme is
studied. GBM cells sensitive (D54-S) and resistant (D54-R) to
temozolomide are treated with various concentration (0.015 to 0.03
g/dL) of Hb alone, TMZ alone or in combination under hypoxia (1%
oxygen) for 72 hours followed by cell viability assays.
[0110] Results show that Hb enhances TMZ-induced cytotoxicity in
both D54-S and D54-R GBM cells in vitro. FIG. 27A shows
representative 96-well plates of D54-S and D54-R cells after
different treatment conditions. FIG. 27B shows a dose-dependent
enhancement of TMZ-induced cytotoxicity by Hb.
Example 16
Isolation of Cancer Stem Cells by Flow Cytometry
[0111] A breast cancer cell line, MCF7 cells, is labelled with CD24
and CD44 antibodies and analyzed by flow cytometry using PE and APC
isotypes which are excited by 488 nm (blue laser) and 633 nm (red
laser), respectively, and the respective emissions are measured by
585 nm and 660 nm Band Pass filters. The flow cytometry result
shows that the percentage of the commercially available MCF7 cells
which highly express CD44 but not CD24 is only about 0.5% in the
total population.
[0112] In order to obtain the desired cancer stem cells, MCF7 cells
are cultured in suspension on non-coated petri dishes in
MammoCult.TM. for at least 7-9 days before spheroids formation. The
culture medium contains both MammoCult Basal Medium and MammoCult
Proliferation Supplement for human mammospheres. The culture medium
is also supplemented with 0.48 .mu.g/mL freshly dissolved
hydrocortisone and 4 .mu.g/mL heparin before use. The culture
medium in the petri dishes is changed every 1-2 days and the
frequency can be determined from the color of the medium. The
morphology of the cell is observed under microscope. FIG. 28 shows
the cell morphology observed in the phase contrast field under a
light microscope. As compared to the hollow mammospheres derived
from mammary epithelial cells (E, Control), solid mammospheres are
observed at about 9.sup.th to 20.sup.th days of growth after
pouring the flow-sorted MCF7 cells onto the petri dishes. The
self-renewal ability is further confirmed by passing the cancer
stem cells for about 9 passages and each subsequent passage after
passage 0 may take about 9-14 days to develop into solid
mammospheres. From one passage to the other, the solid mammospheres
are separated into single cells by chemical (e.g. trypsinization)
or mechanical means in a sterile environment (e.g. using cell
scraper to detach the cell clump from the Petri dish followed by
pipetting up and down). Single cells from each passage are
collected for further protein analysis to confirm the identity and
self-renewal ability of the cancer stem cells. FIG. 29 shows
western blots of lysed cells collected in different passages. In
FIG. 29A, sample 1 is for unsorted cells from mammospheres and
sample 2 is for CD44+/CD24- sorted cells from mammospheres at
passage 1. In FIG. 29B, sample 1 is for unsorted cells from
mammospheres and samples 2, 3 and 4 are for CD44+/CD22- sorted
cells from mammospheres at passage 1, 2 and 3, respectively. From
the western blot, both unsorted and sorted cells from mammospheres
are shown to express the stem cell marker Oct-4 (39 kDa) and Sox-2
(40 kDa). However, the expression level of these markers between
unsorted and sorted cells is different. Obviously, the CD44+/CD24-
sorted cells have higher expression level of Oct-4 than that of
unsorted cells in the same passage. The self-renewal ability of the
cancer stem cells becomes higher in terms of the expression level
of these stem cells markers from one passage to another because of
the application of cell sorting in each passage to select
CD44+/CD24- cells.
[0113] To further examine the tumor-initiating ability of the
cancer stem cells, aldehyde dehydrogenase (ALDH) activity is
studied by labelling the collected cells from mammospheres at
different passages with ALDH-antibody and analyzing the labelled
cells with the flow cytometry. FIG. 30A is the result of the
analysis on a control (cells incubated with
diethylaminobenzaldehyde (DEAB), an inhibitor of ALDH); FIG. 30B is
the result of cells collected at passage 0, where it shows 1% of
the cell population having the ALDH activity; FIG. 30C is the
result of the cells collected at passage 3, where it shows about
8.7% of the cell population having ALDH activity; cells collected
at passage 5 have about 10-13% of the population having ALDH
activity (FIG. 30D). In this analysis, it demonstrates that the
cells isolated from mammosphere have tumor-initiating and
self-renewal abilities while become more dominant in the cell
population of the cancer cells under the selective pressures from
passage to passage. It also coincides with the previous studies on
the cancer stem cells.
Example 17
Effect of Hemoglobin-Based Oxygen Carrier on Cancer Stem Cells
[0114] In order to test the effect of hemoglobin-based oxygen
carrier on the cancer stem cells in a tumor, the MCF7 cells are
incubated under hypoxic condition (5% CO.sub.2 and 1.1% O.sub.2)
for 9-20 days before passing to the cell sorter where two filters
are used: PE-A for CD24 marker while APC-A for CD44 marker.
Quadrant 1 where cells are positive to CD44 and negative to CD24
(FIG. 31) are sorted for further analysis.
[0115] To test sensitivity of the cancer stem cells to
chemotherapeutic agent alone or to the combined therapy of
hemoglobin-based oxygen carrier and the chemotherapeutic agent,
different sets of chemotherapeutic agent and/or the
hemoglobin-based oxygen carrier of the present invention are
administered to MCF7 cells isolated from mammospheres which are
obtained at later passages, e.g. passages 7 and 8. Before testing
the sensitivity of the cancer stem cells, the drug resistance of
CD44+/CD24- to chemotherapeutic agent is shown in FIG. 32. Unsorted
MCF7 cells and CD44+/CD24- sorted cells are incubated with DMSO (as
control) and 90 nM of Taxol for 16 hours and 4 days. Phase contrast
images (FIG. 32) for each set of sample are taken at each time
interval (16 hours and 4 days) and the sorted cells after Taxol
treatment for 4 days are further tested by MTT assay (as described
in Example 3) to confirm the drug resistance of these cells to
chemotherapeutic agent. From the cell morphology, the mammosphere
formation of both unsorted and CD44+/CD24- sorted cells seem to be
inhibited by Taxol at 90 nM. However, the MTT assay of the sorted
cells after treatment with Taxol for 4 days shows about 96%
survival, which means that the CD44+/CD24- sorted cells possess
high resistance to Taxol alone.
[0116] The high resistance of the CSCs to chemotherapeutic agent is
further confirmed by the results of MTT assays on single cells from
two passages (P7 and P8) after the mammospheres are treated with
different combination of chemical(s) for at least 24 hours before
trypsinization of mammospheres. The mammospheres are grown under
the hypoxic conditions (5% CO2, 1.1% O2) to mimic the physiological
environment of a tumor. Different combination of chemical(s) used
in the MTT assays include the Hb alone (0.2 g/dL), Bortezomib
("Bort", 0.5 .mu.M) alone, 5-fluorouracil ("5FU", 5 .mu.M) alone,
or any combination of the above. In case of the combinational drug
(i.e. Hb+at least one chemotherapeutic agent), the trypsinized
cells are incubated with 0.2 g/dL of Hb for 24 hours followed by
the addition of the intended chemotherapeutic agent(s) and
incubated for another 24 hours. The absorbance is measured by the
spectrometer and the normalized value of the absorbance is given in
Table 3 below. In the normalized value, "1" represents 100% of
survival rate; 0.75 represents 75% of survival rate, etc.
[0117] In the set of administering 0.2 g/dL of Hb only, the
survival rate of cells from two passages is about 61-65% survival
rate. In the set of administering 0.5 .mu.M of Bortezomib alone,
cells from two passages have about 78%-91% survival rate. In the
set of administering 5 .mu.M of 5FU alone, cells from two passages
have about 72%-87% survival rate. In the set of administering 0.2
g/dL of Hb+0.5 .mu.M of Bortezomib, the survival rate of cells from
two passages is about 38%-49%. In the set of administering 0.2 g/dL
of Hb+5 .mu.M of 5FU, the survival rate of cells from two passages
is about 52%-72%. In the set of administering 0.5 .mu.M of
Bortezomib and 5 .mu.M of 5FU, the survival rate of cells from two
passages is about 60%-64%. In the set of administering 0.2 g/dL of
Hb+0.5 .mu.M of Bortezomib and 5 .mu.M of 5FU, the survival rate of
cells from two passages is about 33%-39%. By comparing the set of
administering one chemotherapeutic agent alone and the combination
of the hemoglobin-based oxygen carrier and the same agent, the
survival rate is decreased almost by half in the case of
Bortezomib; the survival rate is decreased by about 17% to 20% in
the case of 5FU. Although the survival rate of the cells in the
combination of Bortezomib and 5FU is about 60%-64%, it is still
comparatively higher than that of the cells treated with the
hemoglobin-based oxygen carrier and Bortezomib. It is interesting
to note that hemoglobin-based oxygen carrier alone can kill the
CSCs by almost the same percentage as that of using the combination
of Bortezomib and 5FU. Finally, the most effective combination of
killing the CSCs in this test is the hemoglobin-based oxygen
carrier plus Bortezomib and 5FU because the survival rate is only
about 33%-39% which is far lower than any of the other combination
as described herein. However, it should be noted that the
chemotherapeutic agent administered in combination with the
hemoglobin-based oxygen carrier of the present invention is not
limited to Bortezomib or 5FU. Any other conventional
chemotherapeutic agents which have been proven to be less effective
in treating cancer/tumor or any other therapy such as radiotherapy
can also be used in combination with the hemoglobin-based oxygen
carrier of the present invention with an improved efficacy in
killing CSCs.
TABLE-US-00004 TABLE 3 Mammosphere (P7) under Hypoxic condition
Absorbance Avg Normalized Avg Control 0.167 0.188 0.217 0.191 0.182
0.189 0.883598 0.994709 1.148148 1.010582 0.962963 1 Hb only 0.114
0.126 0.128 0.118 0.132 0.603175 0.666667 0.677249 0.624339
0.698413 0.653968 Bort 0.5 .mu.M 0.178 0.172 0.177 0.163 0.174
0.941799 0.910053 0.936508 0.862434 0.920635 0.914286 Hb + Bort 0.5
.mu.M 0.091 0.077 0.089 0.105 0.101 0.481481 0.407407 0.470899
0.555556 0.534392 0.489947 5FU 5 .mu.M 0.171 0.197 0.139 0.143
0.169 0.904762 1.042328 0.73545 0.756614 0.89418 0.866667 Hb + 5FU
5 .mu.M 0.126 0.144 0.141 0.135 0.137 0.666667 0.761905 0.746032
0.714286 0.724868 0.722751 Bort 0.5 .mu.M + 0.126 0.112 0.117 0.129
0.121 0.666667 0.592593 0.619048 0.68254 0.640212 0.640212 5FU 5
.mu.M Hb + Bort 0.5 .mu.M + 0.071 0.071 0.079 0.079 0.069 0.375661
0.375661 0.417989 0.417989 0.365079 0.390476 5FU 5 .mu.M
Mammosphere (P8) under Hypoxic condition Absorbance Avg Normalized
Avg Control 0.244 0.183 0.22 0.189 0.209 1.167464 0.875598 1.052632
0.904306 1 Hb only 0.139 0.125 0.127 0.122 0.665072 0.598086
0.607656 0.583732 0.613636 Bort 0.5 .mu.M 0.169 0.166 0.159 0.155
0.808612 0.794258 0.760766 0.741627 0.776316 Hb + Bort 0.5 .mu.M
0.084 0.062 0.087 0.082 0.401914 0.296651 0.416268 0.392344
0.376794 5FU 5 .mu.M 0.155 0.165 0.129 0.157 0.741627 0.789474
0.617225 0.751196 0.72488 Hb + 5FU 5 .mu.M 0.112 0.111 0.102 0.108
0.535885 0.5311 0.488038 0.516746 0.517943 Bort 0.5 .mu.M + 0.122
0.129 0.127 0.124 0.583732 0.617225 0.607656 0.593301 0.600478 5FU
5 .mu.M Hb + Bort 0.5 .mu.M + 0.069 0.063 0.076 0.064 0.330144
0.301435 0.363636 0.30622 0.325359 5FU 5 .mu.M
[0118] If desired, the different functions discussed herein may be
performed in a different order and/or concurrently with each other.
Furthermore, if desired, one or more of the above-described
functions may be optional or may be combined.
[0119] As a result of the above investigations, it is concluded
that treatment with the heat stable tetrameric hemoglobin of the
present invention has a preventative effect on both the recurrence
of hepatic tumors and on metastasis in other organs.
[0120] While the foregoing invention has been described with
respect to various embodiments, such embodiments are not limiting.
Numerous variations and modifications would be understood by those
of ordinary skill in the art. Such variations and modifications are
considered to be included within the scope of the following
claims.
[0121] Although various aspects of the invention are set out in the
independent claims, other aspects of the invention comprise other
combinations of features from the described embodiments and/or the
dependent claims with the features of the independent claims, and
not solely the combinations explicitly set out in the claims.
[0122] It is also noted herein that while the above describes
exemplary embodiments of the invention, these descriptions should
not be viewed in a limiting sense. Rather, there are several
variations and modifications which may be made without departing
from the scope of the present invention as defined in the appended
claims.
Sequence CWU 1
1
24121DNAArtificial SequenceDNA primer 1ggcgcgaacg acaagaaaaa g
21223DNAArtificial SequenceDNA primer 2ccttatcaag atgcgaactc aca
23320DNAArtificial SequenceDNA primer 3cagagcagga aaaggagtca
20420DNAArtificial SequenceDNA primer 4agtagctgca tgatcgtctg
20524DNAArtificial SequenceDNA primer 5aatggaatgg agcaaaagac aatt
24622DNAArtificial SequenceDNA primer 6attgattgcc ccagcagtct ac
22720DNAArtificial SequenceDNA primer 7gctactgcca tccaatcgag
20820DNAArtificial SequenceDNA primer 8ctctcctatg tgctggcctt
20921DNAArtificial SequenceDNA primer 9ctctctccct catcggtgac a
211022DNAArtificial SequenceDNA primer 10ggagggcaga gctgagtgtt ag
221120DNAArtificial SequenceDNA primer 11actgccatcc aatcgagacc
201224DNAArtificial SequenceDNA primer 12gatggctgaa gatgtactcg atct
241323DNAArtificial SequenceDNA primer 13acaacaaatt caggtacgct gtg
231424DNAArtificial SequenceDNA primer 14tctgatcaat gtcatgagca aagg
241520DNAArtificial SequenceDNA primer 15gttctcaagg cacaggtctc
201623DNAArtificial SequenceDNA primer 16gcaggtcact tatgtcactt atc
231720DNAArtificial SequenceDNA primer 17tgccaagcag gaaaagaact
201820DNAArtificial SequenceDNA primer 18tttgacgctg tttctcatgg
201920DNAArtificial SequenceDNA primer 19ttcagacaga gccaaggtgc
202021DNAArtificial SequenceDNA primer 20caatgacatc aactgggcaa t
212123DNAArtificial SequenceDNA primer 21ggcagtcaag cacttttctg tag
232221DNAArtificial SequenceDNA primer 22gtcaaccaca ccacggataa a
212320DNAArtificial SequenceDNA primer 23attagcatgg cggcacacat
202422DNAArtificial SequenceDNA primer 24tggagtgcag tggcatactc at
22
* * * * *