U.S. patent application number 14/055573 was filed with the patent office on 2014-04-17 for differentiation of human ips cells to human alveolar type ii via definitive endoderm.
This patent application is currently assigned to Yale University. The applicant listed for this patent is Yale University. Invention is credited to Mahboobe Ghaedi, Laura E. Niklason.
Application Number | 20140105870 14/055573 |
Document ID | / |
Family ID | 50388935 |
Filed Date | 2014-04-17 |
United States Patent
Application |
20140105870 |
Kind Code |
A1 |
Niklason; Laura E. ; et
al. |
April 17, 2014 |
Differentiation of Human IPS Cells to Human Alveolar Type II Via
Definitive Endoderm
Abstract
The present invention relates to compositions and methods for
generating populations of tissue precursor cells from pluripotent
cells, and preferably induction of stem cells into definitive
endoderm to generate anterior foregut endoderm from pluripotent
cells. The anterior foregut endoderm cells can then be
differentiated into an alveolar epithelial type II cell.
Inventors: |
Niklason; Laura E.;
(Greenwich, CT) ; Ghaedi; Mahboobe; (New Haven,
CT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Yale University |
New Haven |
CT |
US |
|
|
Assignee: |
Yale University
New Haven
CT
|
Family ID: |
50388935 |
Appl. No.: |
14/055573 |
Filed: |
October 16, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US13/61687 |
Sep 25, 2013 |
|
|
|
14055573 |
|
|
|
|
61705427 |
Sep 25, 2012 |
|
|
|
Current U.S.
Class: |
424/93.7 ;
435/325; 435/377 |
Current CPC
Class: |
C12N 2501/115 20130101;
C12N 2501/16 20130101; C12N 2533/90 20130101; C12N 2501/117
20130101; C12N 2506/45 20130101; C12N 2533/50 20130101; C12N
2533/54 20130101; C12N 2501/11 20130101; C12N 2501/119 20130101;
C12N 5/0688 20130101; C12N 2533/52 20130101; A61P 11/00 20180101;
A61K 35/42 20130101; C12N 2533/70 20130101; C12N 2501/415
20130101 |
Class at
Publication: |
424/93.7 ;
435/377; 435/325 |
International
Class: |
C12N 5/071 20060101
C12N005/071; A61K 35/42 20060101 A61K035/42 |
Claims
1. A method of differentiating a population of stem cells into a
population of lung cells, the method comprising: a) inducing a stem
cell into a definitive endoderm cell; b) inducing the definitive
endoderm cell into an anterior foregut endoderm cell; c) inducing
the anterior foregut endoderm cell into a lung cell, thereby
differentiating a stem cell into a lung cell.
2. The method of claim 1, wherein the stem cell is cultured without
serum in the presence of Activin A in order to induce the stem cell
into a the definitive endoderm cell.
3. The method of claim 1, wherein the definitive endoderm cell is
cultured in the presence of an extracellular matrix (ECM) protein
and a culture medium supplemented with an inhibitor of bone
morphogenic protein (BMP) and an inhibitor of TGF-.beta. signaling
in order to induce the definitive endoderm cell into an anterior
foregut endoderm cell.
4. The method of claim 3, wherein the inhibitor of BMP is NOGGIN
and the inhibitor of TGF-.beta. signaling is SB-431542.
5. The method of claim 3, wherein the ECM protein is human ECM
selected from the group consisting of collagen, laminin,
fibronectin, tenascin, elastin, proteoglycan, glycosaminoglycan,
and any combination thereof.
6. The method of claim 1, wherein the anterior foregut endoderm
cell is cultured in the presence of a differentiation medium
comprising FGF-10, EGF, Wnt3a, and KGF in order to induce the
anterior foregut endoderm cell into a lung cell wherein the lung
cell is an alveolar epithelial type II cell.
7. The method of claim 6, wherein the differentiation medium does
not include BMP4.
8. The method of claim 6, wherein the alveolar epithelial type II
cell is an alveolar epithelial type II progenitor cell.
9. The method of claim 1, wherein the population of lung cells is
at least 95% of cells exhibiting an alveolar type II phenotype.
10. The method of claim 9, wherein the alveolar type II phenotype
is expression of an alveolar type II cell marker selected from the
group consisting of SPC, Mucin-1, SPB, CD54, and any combination
thereof.
11. The method of claim 1, wherein the lung cell is cultured on a
decellularized lung matrix.
12. A population of lung cells produced by a method of
differentiating a stem cell into a lung cell, the method
comprising: a) inducing a stem cell into a definitive endoderm
cell; b) inducing the definitive endoderm cell into an anterior
foregut endoderm cell; c) inducing the anterior foregut endoderm
cell into a lung cell, thereby differentiating a stem cell into a
lung cell.
13. The population lung cells of claim 12, wherein the population
is at least 95% of cells exhibiting an alveolar type II
phenotype.
14. The population of lung cells of claim 13, wherein the alveolar
type II phenotype is expression of an alveolar type II cell marker
selected from the group consisting of SPC, Mucin-1, SPB, CD54, and
any combination thereof.
15. The population of lung cells of claim 12, wherein the
population comprises genetically modified cells.
16. The population of lung cells of claim 12, wherein the cells are
genetically modified to express a therapeutic gene.
17. The population of lungs cells of claim 12, wherein the cells
resemble freshly isolated human primary alveolar type II cells.
18. A method of alleviating or treating a lung defect in a mammal,
the method comprising administering to the mammal a therapeutically
effective amount of a composition comprising a population of lung
cells produced by a method of differentiating a stem cell into a
lung cell, thereby alleviating or treating said lung defect in said
mammal, wherein the differentiation method comprise: a) inducing a
stem cell into a definitive endoderm cell; b) inducing the
definitive endoderm cell into an anterior foregut endoderm cell; c)
inducing the anterior foregut endoderm cell into a lung cell,
thereby differentiating a stem cell into a lung cell.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional
Application Ser. No. 61/705,427, filed Sep. 25, 2012, the contents
of which are incorporated by reference herein in their
entirety.
BACKGROUND OF THE INVENTION
[0002] Lung disease is the third-leading cause of death in the
United States, with more than 400,000 deaths annually (Longmire T
A, et al. 2012. Cell Stem Cell 10(4):398-411, Petersen T H, et al.
2011. Material today 14(5):196-201). Lung transplantation is a
possible treatment for people who have end-stage lung disease. Lung
transplantation is limited by the low availability of donor lungs.
Moreover, surgical, medical and immunological complications cause
considerable morbidity and mortality in this population. As a
result, many patients die each year while on a waiting list or
because of transplant complications (Longmire T A, et al. 2012.
Cell Stem Cell 10(4):398-411, Nichols J E, et al. 2012. J Cell
Biochem 113(7):2185-2192, McCurry K R, et al. 2009. Am J Transplant
9(Part 2):942-958).
[0003] Transplantation of adult lung stem and progenitor cells or
alveolar cells, isolated from human lung, is emerging as an
alternative to whole organ transplantation (Wang D, et al. 2007.
Proc Natl Acad Sci USA. 104(11):4449-4454). However, this approach
is also limited by the scarcity of human epithelial cells, and the
difficulties of expanding these cells in vitro. Moreover, the
successful engraftment of such cells in vivo in injured lungs has
not yet been demonstrated (Wang D, et al. 2007. Proc Natl Acad Sci
USA. 104(10:4449-4454, Tesei A, et al. 2009. Cell Prolif
42(3):298-308, Fujino N, et al. 2012. Am J Respir Cell Mol Biol
46(4):422-430).
[0004] One potential future treatment for severe lung disease is
transplantation with engineered lungs that are capable of gas
exchange. To avoid immunological rejection, such engineered lungs
should be created using individual-specific (autologous) lung and
airway cells (Nichols J E, et al. 2012. J Cell Biochem
113(7):2185-2192, Petersen T H, et al. 2010. Science
329(5991):538-541, Badylak S F, et al. 2012. Lancet
379(9819):943-952). Therefore, a significant emphasis is being
placed on identifying a reliable source of functional lung
epithelial cells to be used in lung-related therapies (Petersen T
H, et al. 2011. Material today 14(5):196-201, Kotton D N, et al.
2012. Am J Respir Crit Care Med 185(12):1255-1260).
[0005] Induced pluripotent stem (iPS) cells are the product of
adult somatic cell reprogramming to an embryonic-like state by
inducing a "forced" expression of specific pluripotent genes
(Takahashi K, et al. 2007. Cell 131(5):861-872, Yu J, et al. 2007.
Science 318(5858):1917-1920). It is postulated that the use of
human iPS cells may be the most effective strategy to develop
respiratory epithelial cells that may be valuable in lung-related
cell therapies and tissue engineering (Nishikawa S, et al. 2008.
Nat Rev Mol Cell Biol 9(9):725-729, Green M D, et al. 2011. Nat
Biotechnol 29(3):267-272, Mou H, et al. 2012. Cell Stem Cell
10(4):385-397). Given that iPS cells can be derived from the
patient to be treated, they could provide a cell source that is
genetically identical to the patient, allowing tissue generated
from these cells to avoid immune rejection (Badylak S F, et al.
2012. Lancet 379(9819):943-952, Yu J, et al. 2007. Science
318(5858):1917-1920).
[0006] The differentiation of human embryonic stem and iPS cells
(hESCs and iPSCs, respectively) into pulmonary epithelium has been
challenging. Several research groups have reported the successful
differentiation toward a range of pulmonary epithelial cell types,
including both alveolar type II cells (AETII cells) and other
airway epithelium, using a variety of protocols (Longmire T A, et
al. 2012. Cell Stem Cell 10(4):398-411, Wang D, et al. 2007. Proc
Natl Acad Sci USA. 104(11):4449-4454, Green M D, et al. 2011. Nat
Biotechnol 29(3):267-272, Mou H, et al. 2012. Cell Stem Cell
10(4):385-397, Van Haute L, et al. 2009. Respir Res 10:105, Ali N
N, et al. 2002. Tissue Eng 8(4):541-550, Rippon H J, et al. 2006.
Stem Cells 24(5):1389-1398, Samadikuchaksaraei A, et al. 2006.
Tissue Eng 12(4):867-875). However, conditions for directing hESCs
or iPSCs to differentiate along an alveolar epithelial lineage with
high homogeneity have not yet been reported, and most protocols
generate a mixed population of epithelial cells from hESCs or
iPSCs.
[0007] Recently, the focus in organ engineering has centered on
decellularizing complex organs such as heart, liver, and kidney,
and using the acellular matrices as scaffolds for repopulation with
organ-specific cells. Because the decellularized organ has the
extracellular matrix template, it contains appropriate
three-dimensional (3D) architecture and regionally-specific sites
for cellular adhesion (Nichols J E, et al. 2012. J Cell Biochem
113(7):2185-2192, Petersen T H, et al. 2010. Science
329(5991):538-541). With extracellular matrix derived from donor
lungs, the capacity to regenerate lung tissue from autologous cells
(e.g., autologous iPS-derived epithelium) would therefore
constitute a major medical advance. One way to accomplish this in
lung engineering is to differentiate human iPSCs into respiratory
epithelial cells and/or into putative postnatal stem cells of the
respiratory system, and to reseed the lung acellular matrix with
these cells (Badylak S F, et al. 2012. Lancet
379(9819):943-952).
[0008] There is a need in the art for regeneration of lung tissue
from autologous cells. The present invention addresses this unmet
need in the art.
SUMMARY OF THE INVENTION
[0009] The invention provides a method of differentiating a
population of stem cells into a population of lung cells, the
method comprising: a) inducing a stem cell into a definitive
endoderm cell; b) inducing the definitive endoderm cell into an
anterior foregut endoderm cell; c) inducing the anterior foregut
endoderm cell into a lung cell, thereby differentiating a stem cell
into a lung cell.
[0010] In one embodiment, the stem cell is cultured without serum
in the presence of Activin A in order to induce the stem cell into
a the definitive endoderm cell.
[0011] In one embodiment, the definitive endoderm cell is cultured
in the presence of an extracellular matrix (ECM) protein and a
culture medium supplemented with an inhibitor of bone morphogenic
protein (BMP) and an inhibitor of TGF-.beta. signaling in order to
induce the definitive endoderm cell into an anterior foregut
endoderm cell.
[0012] In one embodiment, the inhibitor of BMP is NOGGIN and the
inhibitor of TGF-.beta. signaling is SB-431542.
[0013] In one embodiment, the ECM protein is human ECM selected
from the group consisting of collagen, laminin, fibronectin,
tenascin, elastin, proteoglycan, glycosaminoglycan, and any
combination thereof.
[0014] In one embodiment, the anterior foregut endoderm cell is
cultured in the presence of a differentiation medium comprising
FGF-10, EGF, Wnt3a, and KGF in order to induce the anterior foregut
endoderm cell into a lung cell wherein the lung cell is an alveolar
epithelial type II cell.
[0015] In one embodiment, the differentiation medium does not
include BMP4.
[0016] In one embodiment, the alveolar epithelial type II cell is
an alveolar epithelial type II progenitor cell.
[0017] In one embodiment, the population of lung cells is at least
95% of cells exhibiting an alveolar type II phenotype.
[0018] In one embodiment, the alveolar type II phenotype is
expression of an alveolar type II cell marker selected from the
group consisting of SPC, Mucin-1, SPB, CD54, and any combination
thereof.
[0019] In one embodiment, the lung cell is cultured on a
decellularized lung matrix.
[0020] The invention provides a population of lung cells produced
by a method of differentiating a stem cell into a lung cell, the
method comprising: a) inducing a stem cell into a definitive
endoderm cell; b) inducing the definitive endoderm cell into an
anterior foregut endoderm cell; c) inducing the anterior foregut
endoderm cell into a lung cell, thereby differentiating a stem cell
into a lung cell.
[0021] In one embodiment, the population is at least 95% of cells
exhibiting an alveolar type II phenotype.
[0022] In one embodiment, the alveolar type II phenotype is
expression of an alveolar type II cell marker selected from the
group consisting of SPC, Mucin-1, SPB, CD54, and any combination
thereof.
[0023] In one embodiment, the population of cells comprises
genetically modified cells.
[0024] In one embodiment, the cells are genetically modified to
express a therapeutic gene.
[0025] In one embodiment, the cells resemble freshly isolated human
primary alveolar type II cells.
[0026] The invention also provides a method of alleviating or
treating a lung defect in a mammal, the method comprising
administering to the mammal a therapeutically effective amount of a
composition comprising a population of lung cells produced by a
method of differentiating a stem cell into a lung cell, thereby
alleviating or treating said lung defect in said mammal, wherein
the differentiation method comprise: a) inducing a stem cell into a
definitive endoderm cell; b) inducing the definitive endoderm cell
into an anterior foregut endoderm cell; c) inducing the anterior
foregut endoderm cell into a lung cell, thereby differentiating a
stem cell into a lung cell.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The following detailed description of preferred embodiments
of the invention will be better understood when read in conjunction
with the appended drawings. For the purpose of illustrating the
invention, there are shown in the drawings embodiments which are
presently preferred. It should be understood, however, that the
invention is not limited to the precise arrangements and
instrumentalities of the embodiments shown in the drawings.
[0028] FIG. 1, comprising FIGS. 1A through 1D, is a series of
images depicting schematics summarizing the experiments. FIG. 1A is
an image depicting a schematic protocol for directed
differentiation of iPSCs to AETII in vitro in 22 days. Cytokines
were added at different steps indicated on top of panel. FIG. 1B is
an image depicting the summary of lung developmental steps and
corresponding markers at each step. FIG. 1C is an image depicting a
schematic summarizing the iPSC differentiation and
decellularization-recellularization of both rat and human lung with
iPSC-derived AETII cells. FIG. 1D is a series of phase-contrast
images of iPSCs at day 0, DE cells at day 6, and differentiated
cells at day 15 and 22, which are termed AETII cells. Scale bar, 63
.mu.m.
[0029] FIG. 2, comprising FIGS. 2A through 2O, is a series of
images depicting the characterization of cells at day 8 of
differentiation to produce anterior foregut endoderm (AFE). (FIGS.
2A-2I) Immunofluorescence analysis of AFE markers; (FIGS. 2A, 2D,
2G) show DAPI staining for nuclei; (FIGS. 2B, 2E, 2H) show PAX9,
TBX1 and SOX2 positive cells; (FIGS. 2C, 2F, 2I) merge at day 8.
(FIG. 2J) Immunofluorescence staining showing AFE cells are
positive for both SOX2 and FOXA2. (FIG. 2K) Flow cytometric
analysis of double positive cells for SOX2 and FOXA2 in AFE cells
at day 8 compared to cells cultured in activin A and RPMI medium
only (Y axis: % positive cells for FOXA2/SOX2). (FIG. 2L) mRNA
expression of SOX2, TBX1 and PAX9 in AFE generated from DE cells in
vitro at day 8 (data expressed as quantification of mRNA normalized
to GAPDH and average fold change in gene expression over iPS cells.
Y axis: fold changes in gene expression compared with iPSC) (FIG.
2M) Expression of NKX2.1 on day 13 after induction anterior foregut
endoderm quantified by DAPI staining for nuclei, NKX2.1 positive
cells, and merge. (FIG. 2N) Immunofluorescence staining showing
NKX2.1 cells in AFE stained positive for FOXA2 indicating these
cells are more lung progenitor rather than thyroid progenitor.
(FIG. 2O) Flow cytometric analysis of positive cells for NKX2.1. Up
to 24% of AFE cells were positive for NKX2.1 at day 13. (Y axis:
percentages of positive cells for NKX2.1). Bars indicate
mean.+-.SEM of n=3 independent experiments for qRT-PCR and flow
cytometry. * denotes statistically significant difference
p-value<0.05. Scale bar, 31 .mu.m.
[0030] FIG. 3, comprising FIGS. 3A through 3K, is a series of
imaged depicting functional characterization of AETII cells derived
from iPSCs, day 22 of differentiation (C1 clone). (FIGS. 3A-3D)
Immunostaining of alveolar type II marker, (FIG. 3A) ProSPC, (FIG.
3B) Mucin-1, (FIG. 3C) proSPA, (FIG. 3D) ProSPB. (Scale bar, 63
.mu.m) (FIGS. 3E-3F) Transmission electron microscopy represent
(FIG. 3E) human AETII and (FIG. 3F) iPSC-derived AETII containing
characteristic cytoplasmic laminar bodies (Scale bar, 0.5 .mu.m).
(FIG. 3G) qRT-PCR analysis in undifferentiated iPSC, DE, AFE and
differentiated AETII cells compared to human AETII, from three
independent experiments. Values from the triplicate PCR reactions
for a gene of interest (SPA, SPB, SPC, and Mucin-1) were normalized
against average GAPDH Ct values from the same cDNA sample. Fold
change of GOI transcript levels between iPS derived-AETII and human
type II cells equals 2.sup.-.DELTA..DELTA.Ct, where
.DELTA.Ct=Ct.sub.(GOI)-Ct.sub.(GAPDH), and
.DELTA..DELTA.Ct=.DELTA.Ct.sub.(AETII)-.DELTA.Ct.sub.(ATII). (FIG.
3H) Flow cytometry analysis for the percentage of positive cells
for alveolar type II and type I markers at day 22. Cells were
negative for, p63 and SOX2. (FIG. 3I) Expression of albumin, CD31,
TSHR, and CC10 (CCSP) in iPSC-AETII. Cells were negative for genes
indicative of other lineages at day 22. (FIG. 3J) Amount of
secreted SPC in the iPSC-derived AETII supernatants collected
during the time course of differentiation compared to human type II
cells determined by ELISA. (FIG. 3K) Western blot for proSPC in
iPSC-AETII at day 22 and .beta.-actin as an internal control. Bars
indicate .+-.SEM and n=3 independent experiments for qRT-PCR, ELISA
and flow cytometry. * denotes statistically significant difference
p-value<0.05.
[0031] FIG. 4, comprising FIG. 4A through FIG. 4D, is a series of
images depicting the functional characterization of AETI cells
derived from iPSCs, day 29 of differentiation (C1 clone). (FIG.
4A-4B) Immunofluorescent staining of alveolar type I marker (FIG.
4A) T1.alpha. (FIG. 4B) Caveolin-1 (Scale bar, 63 .mu.m). (FIG. 4C)
Flow cytometry analysis for the percentage of positive cells for
alveolar type I marker at day 29 in the presence and absence of
IWR-1 (Y axis: % of positive cells). (FIG. 4D) qRT-PCR analysis in
AETI cells as compared to native human type I (AETI) cells, from
three independent experiments. Values from the triplicate PCR
reactions for a gene of interest (AQ5, T1.alpha., Caveolin-1) were
normalized against average GAPDH Ct values from the same cDNA
sample. Fold change of GOI transcript levels between iPS
derived-AETI and humane I cells equals 2.sup.-.DELTA..DELTA.Ct,
where .DELTA.Ct=Ct.sub.(GOI)-Ct.sub.(GAPDH), and
.DELTA..DELTA.Ct=.DELTA.Ct.sub.(AETI)-.DELTA.Ct.sub.(hAETI) (Y
axis: relative gene expression compared with human type I cells).
Bars indicate .+-.SEM and n=3 independent experiments for qRT-PCR,
ELISA and flow cytometry.
[0032] FIG. 5, comprising FIG. 5A through FIG. 5P, is a series of
images depicting iPSC-derived AETII recellularized 3D rat lung
tissue scaffolds in a bioreactor (FIG. 5A) H&E staining of
decellularized rat lung; (FIG. 5B-5C) H&E staining of 3- and
7-day seeded rat lung with iPSC-derived AETII cells cultured in a
bioreactor (scale bar 25 .mu.m). (FIG. 5D-5F) Immunofluorescent
staining for pro-SPC in AETII seeded cells at day 3 (FIG. 5D) DAPI
staining; (FIG. 5E) Pro-SPC; (FIG. 5F) merge (arrows in FIG. 5F
indicate positive cells for pro-SPC). (FIG. 5G-I) Immunostaining
for NKX2.1 at day 7. (FIG. 5G) DAPI, (FIG. 5H) NKX2.1, (FIG. 5I)
merge (arrows in FIG. 5I indicate positive cells for NKX2.1) (FIG.
5J-5M) Caspase and PCNA immunostaining at day 7, (arrows indicates
positive cells for PCNA in FIG. 5L and caspase in FIG. 5M) (Scale
bar, 25 .mu.m). (FIG. 5N) Proliferation at day 7 compared with day
3. iPSC-AETII displayed a significantly increased fractional
proliferation (P<0.05) after 7 days when they were stained for
PCNA (Y axis: % proliferation based on the number of positive
nuclei stained for PCNA). (FIG. 5O) Immunostaining of the few
engrafted epithelial cells that acquired flattened morphology,
positive for T1.alpha. and negative for NKX2.1 at day 7 (Scale bar,
63 .mu.m, arrows in FIG. 5O indicate positive cells for T1.alpha.).
(FIG. 5P) Flow cytometry for SPC, T1.alpha., CCSP, p63 and SOX2
before and after seeding into rat lung scaffold in bioreactor. The
number of SPC positive cells decreased during 7-day culture, while
the number of positive cells for T1.alpha. increased from 9% to
31.2%. All differentiated cells from iPS cells were negative for
CCSP, p63 and SOX2 before and after cell seeding.
[0033] FIG. 6, comprising FIG. 6A through FIG. 6V, is a series of
images demonstrating that iPSC-derived AETII (C1 clone) adhere to
sections of acellular rat and human lung matrix. (FIG. 6A-G)
iPSC-AETII on human lung sections at day 7. (FIG. 6A) H&E,
scale bar 200 .mu.m (FIG. 6B) Immunostaining for SPC and CCSP.
(FIG. 6C) Immunostaining for NKX2.1 and T1.alpha. (arrows indicates
positive cells for SPC in FIG. 6B and T1.alpha. in FIG. 6C, scale
bar, 63 .mu.m). (FIG. 6D-6F) Immunostaining for NKX2.1. (FIG. 6D)
DAPI, (FIG. 6E) NKX2.1, (FIG. 6F) merge, scale bar 50 .mu.m (FIG.
6G) Caspase and PCNA immunostaining, scale bar 49 .mu.m. (FIG.
6H-6O) iPSC-derived AETII cultured on rat lung sections for 7 days.
(FIG. 6H) H&E, scale bar 200 .mu.m (FIG. 6I) Immunostaining for
SPC and CCSP. (FIG. 6J-6K) Immunostaining for NKX2.1 and T1.alpha.
(arrows indicates positive cells for SPC in FIG. 6I, T1.alpha. in
FIG. 6J and NKX2.1 in FIG. 6K), scale bar 63 .mu.m. (FIG. 6L) DAPI
staining (FIG. 6M) Immunostaining for PCNA and (FIG. 6N) caspase,
(FIG. 6O) merge (Scale bar 50 .mu.m). (FIG. 6P-6V) Native human
AETII cells, isolated from fresh adult human lung, cultured on
human lung sections for 7 days. (FIG. 6P) H&E, scale bar 200
.mu.m. (FIG. 6Q) Immunostaining for SPC and CCSP, scale bar 63
.mu.m (FIG. 6R) Immunostaining for NKX2.1 and T1.alpha., scale bar
63 .mu.m (arrows indicate positive cells for SPC in FIG. 6Q and
T1.alpha. in FIG. 6R). (FIG. 6S-6U) Immunostaining for NKX2.1.
(FIG. 6S) DAPI, (FIG. 6T) NKX2.1, (FIG. 6U) merge, scale bar 50
.mu.m. (FIG. 6V) Caspase and PCNA immunostaining, scale bar 49
.mu.m.
[0034] FIG. 7, comprising FIG. 7A through FIG. 7M, is a series of
images depicting the functional characteristics of definitive
endoderm (DE) cells derived from iPSCs (C1 clone), at day 6. (FIG.
7A-7F) Immunofluorescence analysis of DE marker proteins, SOX17 and
FOXA2 at day 6. (FIG. 7A and FIG. 7D) Nuclei were stained with
DAPI, (FIG. 7B and FIG. 7E) shows SOX17, FOXA2 staining in DE
cells, (FIG. 7C and FIG. 7E) Merge. (FIG. 7G-7J) immunofluorescence
staining showing DE cells are positive for both SOX17 and FOXA2 at
day 6, (FIG. 7K) flow cytometric analysis of double positive cells
for SOX17/FOXA2 in DE cells exposed to activin A at day 6 compare
to iPS cultured in media without activin A, (FIG. 7L) mRNA
expression of SOX17, FOXA2 and CXCR4 from three independent
experiments by qRT-PCR. (Data expressed as quantification of mRNA
normalized to GAPDH and average fold change in gene expression over
iPSCs), (FIG. 7M) Flow cytometric analysis of SOX17, FOXA2 and
CXCR4 during activin A-mediated induction of definitive endoderm in
iPSC cells at day 6 (compare to DE cells stained with corresponding
isotype). Bar indicate .+-.SEM and n=3 independent experiments for
qRT-PCR and flow cytometry. * on the graph denotes statistically
significant difference p-value<0.005, Scale bar, 31 .mu.m.
[0035] FIG. 8, comprising FIG. 8A through FIG. 8M, is a series of
images depicting the characteristics of definitive endoderm cells
derived from iPSCs C2 clone, at day 6: (FIG. 8A-8F)
Immunofluorescent staining of definitive endodermal markers, SOX17
and FOXA2 at day 6 of activin A induction (Scale bar, 31 .mu.m),
(FIG. 8G-8J) Immunofluorescence staining showing DE cells are
positive for both SOX17 and FOXA2, (FIG. 8K) flow cytometric
analysis of double positive cells for SOX17/FOXA2 in DE cells
exposed to activin A at day 6 compare to iPS cultured in media
without activin A, (FIG. 8L) Expression of SOX17, CXCR4 and FOXA2
mRNA in C2 iPSCs quantified by qRT-PCR at day 6. (Data expressed as
quantification of mRNA normalized to GAPDH and average fold change
in gene expression over iPS cells), (FIG. 8M) Representative flow
cytometric analysis of SOX17, CXCR4 and FOXA2 in C2 iPSCs derived
DE at 6 day. Bar indicate .+-.SEM and n=3 independent experiments
for qRT-PCR and flow cytometry. * on the graph denotes
statistically significant difference p-value<0.005, Scale bar,
31 .mu.m.
[0036] FIG. 9, comprising FIG. 9A through FIG. 9O, is a series of
images depicting the analysis of AFE markers in
NOGGIN/SB-431542-treated definitive endoderm in C2 iPS cells. (FIG.
9A-9I) Immunofluorescent staining of AFE markers; SOX2, TBX1, PAX9,
after 2 day of NOGGIN/SB431542 induction in C2 iPS cells (at day
8). Scale bar, 31 .mu.m, (FIG. 9J) Immunofluorescence staining
showing AFE cells are positive for both SOX2 and FOXA2 at day 8,
(FIG. 9K) Flow cytometric analysis of double positive cells for
SOX2/FOXA2 in AFE cells at day 8. More than 85% of cells were
double positive for both SOX2 and FOXA2. (FIG. 9L) Expression of
TBX1, SOX2, and PAX9 mRNA quantified by qRT-PCR in C2 iPS cells at
day 8 (Data expressed as quantification of mRNA normalized to GAPDH
and average fold change in gene expression over iPSCs cells). (FIG.
9M) Immunofluorescence staining of NKX2.1 in AFE derived from clone
C2 at day 13 (Scale bar, 31 .mu.m). (FIG. 9N) Immunofluorescence
staining showing AFE cells are positive for both NKX2.1 and FOXA2
at day 13; Most NKX2.1 positive cells were stained positive for
FOXA2 (Scale bar, 31 .mu.m). (FIG. 9O) Flow cytometric analysis of
positive cells for NKX2.1 in AFE cells at day 13. Exposing DE to
NOGGIN/SB431542 yield 26% positive cells for NKX2. Bar indicate
.+-.SEM and n=3 biological triplicate replicates for qRT-PCR and
flow cytometry, * denotes statistically significant difference
p-value<0.05.
[0037] FIG. 10, comprising FIG. 10A through FIG. 10C, is a series
of graphs demonstrating the differentiation of DE cells (day 6) to
AETII (day 22) on different extracellular matrix proteins. (FIG.
10A) SPC, (FIG. 10B) SPB and (FIG. 10C) NKX2.1 expression in AETII
differentiated on collagen I, collagen IV, fibronection, and human
ECM protein and matrigel, quantified qRT-PCR. The iPSC-derived DE
differentiated to AETII on different ECM protein. The gene
expression in iPS derived-AETII cells on different ECM proteins
were compared to the level seen in iPS derived-hAETII cells on
matrigel. Ct values from three independent experiments from the
triplicate PCR reactions for a gene of interest (SPB, SPC, and
NKX2.1) were normalized against average GAPDH Ct values from the
same cDNA sample. Fold change of GOI transcript levels between iPS
derived-AETII on each ECM protein and iPS derived-AETII cells on
matrigel equals 2.sup.-.DELTA..DELTA.Ct, where
.DELTA.Ct=Ct.sub.(GOI)-Ct.sub.(GAPDH), and
.DELTA..DELTA.Ct=.DELTA.Ct.sub.(iPSC-AETII on ECM of
interest)-.DELTA.Ct.sub.(iPSC-AETII on Matrigel). Human ECM induced
significantly higher levels of SPC, SPB and NKX2.1 expression
compared to each ECM proteins individually. (Bar indicate .+-.SEM
and n=3 independent experiments).
[0038] FIG. 11, comprising FIG. 11A through FIG. 11J, is a series
of images depicting the functional characterization of
differentiated AETII from C2 iPSCs line. (FIG. 11A) Phase-contrast
images AETII cells. (FIG. 11B-11C and FIG. 11E-11F)
Immunofluorescent staining of alveolar type II markers; (FIG. 11B)
Pro surfactant protein B (ProSPB), (FIG. 11C) Mucin-1, (FIG. 11E)
Surfactant protein A (SPA), (FIG. 11F) Pro surfactant protein C
(ProSPC) Scale bar, 63 .mu.m, (FIG. 11D) Transmission electron
microscopy, represent AETII contain characteristic cytoplasmic
laminar bodies (scale bar, 1 .mu.m) (FIG. 11G) qRT-PCR analysis in
undifferentiated iPSC, DE, AFE and AETII cells derived from C2
clone compared to hATII cells that were derived from fresh human
lung, from three independent experiments values from the triplicate
PCR reactions for a gene of interest (SPA, SPB, SPC, Mucin-1) were
normalized against average GAPDH Ct values from the same cDNA
sample. Fold change of GOI transcript levels between iPS
derived-AETII and human type II cells equals
2.sup.-.DELTA..DELTA.Ct, where
.DELTA.Ct=Ct.sub.(GOI)-Ct.sub.(GAPDH), and
.DELTA..DELTA.Ct=.DELTA.Ct.sub.(AETII)-.DELTA.Ct.sub.(ATII), (FIG.
11H) Flow cytometry analysis for the percentage of positive cells
for alveolar type II markers at day 22. More than 95% of population
were positive for type II cells marker (CD54, SPB, SPC, Mucin-1)
when they were negative for CCSP (Clara cell marker), p63 (basal
stem cell marker), (FIG. 11I) Expression of albumin, CD31, TSHR,
CC10 (CCSP) in iPSC-derived AETII; they were negative for genes
indicative of other lineages at day 22. (FIG. 11J) The amount of
secreted SPC in the iPSC-derived AETII during the time course of
differentiation compared to SPC secretion from isolated AETII from
human lung determined by enzyme-linked immunosorbent assay. Bars
indicate .+-.SEM and n=3 independent experiments for qRT-PCR, ELISA
and flow cytometry. * denotes statistically significant difference
p-value<0.05.
[0039] FIG. 12, comprising FIG. 12A through FIG. 12D, is a series
of graphs depicting the results of experiments. (FIG. 12A-12B)
Sequential up and downregulation of DE-specific and AFE-specific
genes during differentiation to AETII cells quantified by qRT-PCR.
(FIG. 12A-12B) Ratio of gene expression in DE cells compare to
iPSCs during differentiation quantified by qRT-PCR in (FIG. 12A) C1
clone and (FIG. 12B) C2 clone (Data expressed as quantification of
mRNA normalized to GAPDH and average fold change in gene expression
over DE cells) (FIG. 12C-12D) Sequential up and downregulation of
AFE-specific proteins during differentiation of iPSCs to AETII
quantified by qRT-PCR in (FIG. 12C) C1 clone and (FIG. 12D) C2
clone. Data expressed as quantification of mRNA normalized to GAPDH
and average fold change in gene expression over AFE cells; bar
indicate .+-.SEM and n=3 independent experiments.
[0040] FIG. 13, comprising FIG. 13A through FIG. 13D, is a series
of images depicting the kinetics of NKX2.1 and SPC expression
during differentiation of iPSC cells (C1 clone) to lung alveolar
epithelium. (FIG. 13A-13B) Kinetics of NKX2.1 and SPC mRNA
expression at different days, quantified by real time qRT-PCR.
(FIG. 13A) SPC expression during differentiation of iPS cells to
AETII. Ct values of SPC is normalized to GAPDH and expressed to
levels seen in ATII cells isolated from human lung (hATII) (FIG.
13B) NKX2.1 during differentiation of iPS cells to AETII. Data
expressed as quantification of mRNA normalized to GAPDH and
expressed to the level of seen in isolated human primary type II.
(FIG. 13C-13D) Flow cytometry analysis for the percentage of
positive cells for (FIG. 13C) NKX2.1 from day 13 to day 22 and
(FIG. 13D) SPC from day 10 to day 22. Bars indicate .+-.SEM and n=3
independent experiments for PCR and flow cytometry.
[0041] FIG. 14, comprising FIG. 14A through FIG. 14D, is a series
of images depicting the kinetics of NKX2.1 and SPC expression
during differentiation of iPSC cells (C2 clone) to lung alveolar
epithelium. (FIG. 14A-14B) NKX2.1 and SPC mRNA expression at
different days, quantified by real time RT-PCR in iPSC-derived
AETII (C2 clone). (FIG. 14A) SPC expression during differentiation
from day 0 to day 32. Ct value for SPC is normalized to GAPDH and
expressed to levels seen in AETII cells isolated from human lung
(hATII) (FIG. 14B) NKX2.1 expression during differentiation. Data
expressed as quantification of mRNA normalized to GAPDH and
expressed to the levels seen in isolated human type II (FIG.
14C-14D) Flow cytometry analysis for the percentage of positive
cells for (FIG. 14C) NKX2.1 from day 13 to day 22 and SPC (FIG.
14D) from day 10 to day 22. Bars indicate .+-.SEM and n=3
independent experiments for PCR and flow cytometry.
[0042] FIG. 15, comprising FIG. 15A through FIG. 15D, is a series
of images depicting the kinetics of .alpha.6.beta.4 and CD166
expression during differentiation of iPSC cells to lung alveolar
epithelium. (FIG. 15 and FIG. 15C) Flow cytometry analysis for the
percentage of positive cells for CD 166 from day 10 to day 28 in
AETII derived from (FIG. 15A) C1 clone and (FIG. 15C) C2 clone.
(FIG. 15B and FIG. 15D) Flow cytometry analysis for the percentage
of positive cells for .alpha.6.beta.4 from day 8 to day 22 in AETII
derived from (FIG. 15B) C1 clone and (FIG. 15D) C2 clone.
[0043] FIG. 16, comprising FIG. 16A through FIG. 16E, is a series
of images depicting the pluripotency marker analysis in C2 clone in
day 0 and during differentiation to AETII. (FIG. 16A).
Immunofluorescent staining of iPSC markers; OCT4, Nanog, SSEA4,
Tra1-81 in both iPSC clone C1 and C2 (Scale bar, 100 .mu.m). Both
clones were positive for pluripotency genes at day 0. (FIG. 16B-C)
Downregulation of iPSC-specific genes OCT4, SOX2, and Nanog during
differentiation to AETI. The expression of OCT4, SOX2, and Nanog
were downregulated over the time and by day 32 these markers were
undetectable in iPSC-derived AETII derived from both (FIG. 16B)
clone C1 and (FIG. 16C) clone C2 (Data expressed as quantification
of mRNA normalized to GAPDH and average fold change in gene
expression over iPS cells at day 0, bar indicates SEM and n=3
independent experiments), (FIG. 16D-16E) Expression of OCT4 and SPC
in differentiated AETII cells on day 0 compare to day 22 analyzed
by flow cytometry for (FIG. 16D) C1 clone and (FIG. 16E) C2 clone.
At day 22 of differentiation, SPC positive iPSC-derived AETII cells
were negative for OCT4.
[0044] FIG. 17, comprising FIG. 17A through FIG. 17M, is a series
of images demonstrating that AETII derived from iPSC C2 clone
respond to recellularize 3D lung tissue scaffolds in bioreactor
(FIG. 17A-17C) H&E staining of seeded rat lung scaffold with
iPSC-derived AETII cells at (FIG. 17A) day 3 and (FIG. 17B-17C) at
day 7 in bioreactor. Scale bar, 200 .mu.m. (FIG. 17D-17F)
Immunostaining for SPC on seeded rat lung scafold with iPSC-derived
AETII cells cultured in bioreactor at day 7 (FIG. 17D) Nuclei were
stained with DAPI; (FIG. 17E) shows Pro-SPC staining (FIG. 17F)
Merge, Scale bar, 50 .mu.m (FIG. 17G-17I) Immunostaining for NKX2.1
on seeded rat lung scafold with iPSC-derived AETII cells cultured
in bioreactor at day 7 (FIG. 17G) Nuclei were stained with DAPI;
(FIG. 17H) shows NKX2.1 staining (FIG. 17I) Merge, Scale bar, 50
.mu.m (FIG. 17J-17M) Immunostaining for PCNA and caspase of
bioreactor cultured iPSC-derived APTII cells at day 7. Scale bar,
49 .mu.m
DETAILED DESCRIPTION
[0045] The invention provides a method of differentiating a stem
cell into a lung cell, preferably an alveolar epithelial type II
cell. In one embodiment, the stem cell is a human induced
pluripotent stem (iPS) cell.
[0046] In one embodiment, the method of generating a lung cell
comprises culturing a stem cell without serum in the presence of
Activin A in order to generate a definitive endoderm (DE)
population. The DE population can then be differentiated into
anterior foregut endoderm (AFE) by culturing the DE cells in the
presence of the combination of an extracellular matrix (ECM)
protein and a culture medium supplemented with an inhibitor of BMP
and an inhibitor of TGF-.beta. signaling. Preferably, the inhibitor
of BMP is NOGGIN and the inhibitor of TGF-.beta. signaling is
SB-431542.
[0047] The AFE cells can be cultured in the presence of a
differentiation medium to induce differentiation into a desired
cell type. For example, induction to differentiate into an alveolar
epithelial type II cell comprises culturing the AFE cells in the
presence of a differentiation medium comprising FGF-10, EGF, Wnt3a,
and KGF. Preferably, the alveolar epithelial type II cell
differentiation medium does not include BMP4.
[0048] The compositions and methods of the invention are useful for
among other things, drug discovery, toxicity testing, disease
pathology, investigating lung developmental biology, and the
like.
[0049] The invention relates to the discovery that alveolar
epithelial type II cells can be generated in vitro. Accordingly,
the invention provides methods and compositions for the generation
of alveolar epithelial type II cells as a form of regenerative
medicine. In one embodiment, the method allows for the generation
of a pure population of alveolar type II progenitor cells whereby
the cells express a high percentage of lung alveolar type II
markers including but is not limited to SPC, SPB, Mucin-1, and
CD54.
[0050] The invention also provides a method of alleviating or
treating a lung defect in a mammal, preferably a human. The method
comprises administering to the mammal in need thereof a
therapeutically effective amount of a composition comprising an
alveolar epithelial type II cell or otherwise cells that exhibit at
least one characteristic of an alveolar epithelial type II cell,
thereby alleviating or treating the lung defect in the mammal.
[0051] In one embodiment, the invention provides a method of
repairing injured or diseased alveolar epithelial tissue in the
lung of a mammal comprising transplanting into the lung, at a site
comprising injured or diseased alveolar epithelial tissue, a
population of differentiated stem cells, or progeny thereof, at
least 95%, preferably at least 96%, more preferably at least 97%,
more preferably 98%, yet more preferably at least 99% of which
exhibit an alveolar type II phenotype. The population of cells with
alveolar type II phenotype is prepared using the methods of the
invention, and, after transplantation, is effective to repair at
least a portion of the injured or diseased alveolar epithelial
tissue at the site.
DEFINITIONS
[0052] Unless defined otherwise, all technical and scientific terms
used herein generally have the same meaning as commonly understood
by one of ordinary skill in the art to which this invention
belongs. Generally, the nomenclature used herein and the laboratory
procedures in cell culture, molecular genetics, organic chemistry,
and nucleic acid chemistry and hybridization are those well-known
and commonly employed in the art.
[0053] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0054] The term "about" will be understood by persons of ordinary
skill in the art and will vary to some extent based on the context
in which it is used.
[0055] The term "adult stem cell" or "ASC" is used to refer to any
multipotent stem cell derived from non-embryonic tissue, including
fetal, juvenile, and adult tissue. Stem cells have been isolated
from a wide variety of adult tissues including blood, bone marrow,
brain, olfactory epithelium, skin, pancreas, skeletal muscle, and
cardiac muscle. Each of these stem cells can be characterized based
on gene expression, factor responsiveness, and morphology in
culture. Exemplary adult stem cells include neural stem cells,
neural crest stem cells, mesenchymal stem cells, hematopoietic stem
cells, and pancreatic stem cells. As indicated above, stem cells
have been found resident in virtually every tissue. Accordingly,
the present invention appreciates that stem cell populations can be
isolated from virtually any animal tissue.
[0056] As used herein, "anterior foregut endoderm" refers to
endoderm that is anterior to the endoderm that gives rise to the
liver. One of ordinary skill in the art will readily appreciate
that "anterior foregut endoderm" thus includes, for example,
pharyngeal endoderm and other, more highly differentiated
populations of endodermal cells and that the various cell types
encompassed by the term "anterior foregut endoderm" may exhibit
different expression patterns of molecular markers. One of ordinary
skill in the art will appreciate that "anterior foregut endoderm"
gives rise to various tissues, e.g., tonsils, tympanic membrane,
thyroid, parathyroid glands, thymus, trachea, esophagus, stomach,
lung and larynx/pharynx.
[0057] As used herein, "autologous" refers to a biological material
derived from the same individual into whom the material will later
be re-introduced.
[0058] As used herein, "allogeneic" refers to a biological material
derived from a genetically different individual of the same species
as the individual into whom the material will be introduced.
[0059] As used here, "biocompatible" refers to any material, which,
when implanted in a mammal, does not provoke an adverse response in
the mammal A biocompatible material, when introduced into an
individual, is not toxic or injurious to that individual, nor does
it induce immunological rejection of the material in the
mammal.
[0060] As used herein, "anterior foregut endoderm" refers to
endoderm that is anterior to the endoderm. One of ordinary skill in
the art will readily appreciate that "anterior foregut endoderm"
thus includes, for example, pharyngeal endoderm and other, more
highly differentiated populations of endodermal cells and that the
various cell types encompassed by the term "anterior foregut
endoderm" may exhibit different expression patterns of molecular
markers. One of ordinary skill in the art will appreciate that
"anterior foregut endoderm" gives rise to various tissues, e.g.,
tonsils, tympanic membrane, thyroid, parathyroid glands, thymus,
trachea, esophagus, stomach, lung and larynx/pharynx.
[0061] As used herein, to "alleviate" a disease, defect, disorder
or condition means reducing the severity of one or more symptoms of
the disease, defect, disorder or condition.
[0062] As used herein, the term "basal medium" refers to a solution
of amino acids, vitamins, salts, and nutrients that is effective to
support the growth of cells in culture, although normally these
compounds will not support cell growth unless supplemented with
additional compounds. The nutrients include a carbon source (e.g.,
a sugar such as glucose) that can be metabolized by the cells, as
well as other compounds necessary for the cells'survival. These are
compounds that the cells themselves cannot synthesize, due to the
absence of one or more of the gene(s) that encode the protein(s)
necessary to synthesize the compound (e.g., essential amino acids)
or, with respect to compounds which the cells can synthesize,
because of their particular developmental state the gene(s)
encoding the necessary biosynthetic proteins are not being
expressed as sufficient levels. A number of base media are known in
the art of mammalian cell culture, such as Dulbecco's Modified
Eagle Media (DMEM), Knockout-DMEM (KO-DMEM), and DMEM/F12, although
any base medium that supports the growth of primate embryonic stem
cells in a substantially undifferentiated state can be
employed.
[0063] As used here, "biocompatible" refers to any material, which,
when implanted in a mammal, does not provoke an adverse response in
the mammal A biocompatible material, when introduced into an
individual, is not toxic or injurious to that individual, nor does
it induce immunological rejection of the material in the
mammal.
[0064] As used herein, the term "biocompatible lattice," is meant
to refer to a substrate that can facilitate formation into
three-dimensional structures conducive for tissue development.
Thus, for example, cells can be cultured or seeded onto such a
biocompatible lattice, such as one that includes extracellular
matrix material, synthetic polymers, cytokines, growth factors,
etc. The lattice can be molded into desired shapes for facilitating
the development of tissue types. Also, at least at an early stage
during culturing of the cells, the medium and/or substrate is
supplemented with factors (e.g., growth factors, cytokines,
extracellular matrix material, etc.) that facilitate the
development of appropriate tissue types and structures.
[0065] "Bioactive agents," as used herein, can include one or more
of the following: chemotactic agents; therapeutic agents (e.g.,
antibiotics, steroidal and non-steroidal analgesics and
anti-inflammatories (including certain amino acids such as
glycine), anti-rejection agents such as immunosuppressants and
anti-cancer drugs); various proteins (e.g., short term peptides,
bone morphogenic proteins, collagen, hyaluronic acid,
glycoproteins, and lipoprotein); cell attachment mediators;
biologically active ligands; integrin binding sequence; ligands;
various growth and/or differentiation agents and fragments thereof
(e.g., epidermal growth factor (EGF), hepatocyte growth factor
(HGF), vascular endothelial growth factors (VEGF), fibroblast
growth factors (e.g., bFGF), platelet derived growth factors
(PDGF), insulin derived growth factor (e.g., IGF-1, IGF-II) and
transforming growth factors (e.g., TGF.beta. parathyroid hormone,
parathyroid hormone related peptide, bone morphogenic proteins
(e.g., BMP-2, BMP-4; BMP-6; BMP-7; BMP-12; BMP-13; BMP-14), sonic
hedgehog, growth differentiation factors (e.g., GDF5, GDF6, GDF8),
recombinant human growth factors (e.g., MP52, and MP-52 variant
rhGDF-5), cartilage-derived morphogenic proteins (CDMP-1; CDMP-2,
CDMP-3)); small molecules that affect the upregulation of specific
growth factors; tenascin-C; hyaluronic acid; chondroitin sulfate;
fibronectin; decorin; thromboelastin; thrombin-derived peptides;
heparin-binding domains; heparin; heparan sulfate. Suitable
effectors likewise include the agonists and antagonists of the
agents described above. The growth factor can also include
combinations of the growth factors described above. In addition,
the growth factor can be autologous growth factor that is supplied
by platelets in the blood. In this case, the growth factor from
platelets will be an undefined cocktail of various growth factors.
If other such substances have therapeutic value in the orthopedic
field, it is anticipated that at least some of these substances
will have use in the present invention, and such substances should
be included in the meaning of "bioactive agent" and "bioactive
agents" unless expressly limited otherwise. Preferred examples of
bioactive agents include culture media, bone morphogenic proteins,
growth factors, growth differentiation factors, recombinant human
growth factors, cartilage-derived morphogenic proteins, hydrogels,
polymers, antibiotics, anti-inflammatory medications,
immunosuppressive mediations, autologous, allogenic or xenologous
cells such as stem cells, chondrocytes, fibroblast and proteins
such as collagen and hyaluronic acid. Bioactive agents can be
autologous, allogenic, xenogenic or recombinant.
[0066] The term "biologically compatible carrier" or "biologically
compatible medium" refers to reagents, cells, compounds, materials,
compositions, and/or dosage formulations which are suitable for use
in contact with the tissues of human beings and animals without
excessive toxicity, irritation, allergic response, or other
complication commensurate with a reasonable benefit/risk ratio.
[0067] The terms "cells" and "population of cells" are used
interchangeably and refer to a plurality of cells, i.e., more than
one cell. The population may be a pure population comprising one
cell type. Alternatively, the population may comprise more than one
cell type. In the present invention, there is no limit on the
number of cell types that a cell population may comprise.
[0068] The term "cell medium" as used herein, refers to a medium
useful for culturing cells. An example of a cell medium is a medium
comprising DMEM/F 12 Ham's, 10% fetal bovine serum, 100 U
penicillin/100 .mu.g streptomycin/0.25 .mu.g Fungizone. Typically,
the cell medium comprises a base medium, serum and an
antibiotic/antimycotic. However, cells can be cultured with stromal
cell medium without an antibiotic/antimycotic and supplemented with
at least one growth factor. Preferably the growth factor is human
epidermal growth factor (hEGF). The preferred concentration of hEGF
is about 1-50 ng/ml, more preferably the concentration is about 5
ng/ml. The preferred base medium is DMEM/F12 (1:1). The preferred
serum is fetal bovine serum (FBS) but other sera may be used
including horse serum or human serum. Preferably up to 20% FBS will
be added to the above media in order to support the growth of
stromal cells. However, a defined medium could be used if the
necessary growth factors, cytokines, and hormones in FBS for cell
growth are identified and provided at appropriate concentrations in
the growth medium. It is further recognized that additional
components may be added to the culture medium. Such components
include but are not limited to antibiotics, antimycotics, albumin,
growth factors, amino acids, and other components known to the art
for the culture of cells. Antibiotics which can be added into the
medium include, but are not limited to, penicillin and
streptomycin. The concentration of penicillin in the culture medium
is about 10 to about 200 units per ml. The concentration of
streptomycin in the culture medium is about 10 to about 200
.mu.g/ml. However, the invention should in no way be construed to
be limited to any one medium for culturing cells. Rather, any media
capable of supporting cells in tissue culture may be used.
[0069] The term "decellularized" or "decellularization" as used
herein refers to a biostructure (e.g., an organ, or part of an
organ), from which the cellular and tissue content has been removed
leaving behind an intact acellular infra-structure. Organs such as
the kidney are composed of various specialized tissues. The
specialized tissue structures of an organ, or parenchyma, provide
the specific function associated with the organ. The supporting
fibrous network of the organ is the stroma. Most organs have a
stromal framework composed of unspecialized connecting tissue which
supports the specialized tissue. The process of decellularization
removes the specialized tissue, leaving behind the complex
three-dimensional network of connective tissue. The connective
tissue infra-structure is primarily composed of collagen. The
decellularized structure provides a biocompatible substrate onto
which different cell populations can be infused. Decellularized
biostructures can be rigid, or semi-rigid, having an ability to
alter their shapes. Examples of decellularized organs useful in the
present invention include, but are not limited to, the heart, lung,
kidney, liver, pancreas, spleen, bladder, ureter and urethra,
cartilage, bone, brain, spine cord, peripheral nerve.
[0070] As used herein "definitive endoderm (DE)" and definitive
endoderm cells (DE-cells) refers to cells exhibiting such as but
not limited to protein or gene expression and or/or morphology
typical to cells of the definitive endoderm or a composition
comprising a significant number of cells resembling the cells of
the definitive endoderm. A definitive endoderm cell can expresses
the marker Sox17. Other markers of definitive endoderm cells
include, but are not limited to MIXL2, GATA4, HNF3b, GSC, FGF17,
VWF, CALCR, FOXQ1, CMKOR1 and CRIP1. Definitive endoderm cells have
the capacity to differentiate into cells including those of the
liver, lung, pancreas, thymus, intestine, stomach and thyroid.
[0071] The term "dedifferentiation", as used herein, refers to the
return of a cell to a less specialized state. After
dedifferentiation, such a cell will have the capacity to
differentiate into more or different cell types than was possible
prior to re-programming. The process of reverse differentiation
(i.e., de-differentiation) is likely more complicated than
differentiation and requires "re-programming" the cell to become
more primitive.
[0072] The term "differentiated cell" is meant any primary cell
that is not, in its native form, pluripotent as that term is
defined herein. Stated another way, the term "differentiated cell"
refers to a cell of a more specialized cell type derived from a
cell of a less specialized cell type (e.g., a stem cell such as an
induced pluripotent stem cell) in a cellular differentiation
process. Without wishing to be limited to theory, a pluripotent
stem cell in the course of normal ontogeny can differentiate first
to an endoderm cell that is capable of forming lung cells and other
endoderm cell types. Endoderm cells can also be differentiate into
other cells of endodermal origin, e.g. lung, liver, intestine,
thymus etc.
[0073] "Differentiation medium" is used herein to refer to a cell
growth medium comprising an additive or a lack of an additive such
that a stem cell, fetal pulmonary cell or other such progenitor
cell, that is not fully differentiated, develops into a cell with
some or all of the characteristics of a differentiated cell when
incubated in the medium.
[0074] The term "embryonic stem cell" is used to refer to the
pluripotent stem cells of the inner cell mass of the embryonic
blastocyst (see U.S. Pat. Nos. 5,843,780, 6,200,806). Such cells
can similarly be obtained from the inner cell mass of blastocysts
derived from somatic cell nuclear transfer (see, for example, U.S.
Pat. Nos. 5,945,577, 5,994,619, 6,235,970). The distinguishing
characteristics of an embryonic stem cell define an embryonic stem
cell phenotype. Accordingly, a cell has the phenotype of an
embryonic stem cell if it possesses one or more of the unique
characteristics of an embryonic stem cell such that that cell can
be distinguished from other cells. Exemplary distinguishing
embryonic stem cell characteristics include, without limitation,
gene expression profile, proliferative capacity, differentiation
capacity, karyotype, responsiveness to particular culture
conditions, and the like.
[0075] As used herein, "epithelial cell" means a cell which forms
the outer surface of the body and lines organs, cavities and
mucosal surfaces.
[0076] As used herein, "endothelial cell" means a cell which lines
the blood and lymphatic vessels and various other body
cavities.
[0077] As used herein "endogenous" refers to any material from or
produced inside an organism, cell or system.
[0078] "Exogenous" refers to any material introduced into or
produced outside an organism, cell, or system.
[0079] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0080] The term "endoderm cell" as used herein refers to a cell
which is from one of the three primary germ cell layers in the very
early embryo (the other two germ cell layers are the mesoderm and
ectoderm). The endoderm is the innermost of the three layers. An
endoderm cell differentiates to give rise first to the embryonic
gut and then to the linings of respiratory and digestive tracts
(e.g. the intestine), the liver and the pancreas.
[0081] "Expandability" is used herein to refer to the capacity of a
cell to proliferate, for example, to expand in number or, in the
case of a population of cells, to undergo population doublings.
[0082] As used herein, "extracellular matrix composition" includes
both soluble and non-soluble fractions or any portion thereof. The
non-soluble fraction includes those secreted ECM proteins and
biological components that are deposited on the support or
scaffold. The soluble fraction includes refers to culture media in
which cells have been cultured and into which the cells have
secreted active agent(s) and includes those proteins and biological
components not deposited on the scaffold. Both fractions may be
collected, and optionally further processed, and used individually
or in combination in a variety of applications as described
herein.
[0083] As used herein, a "fetal pulmonary cells" (FPCs) refer to
cells isolated from the lung tissue of an embryo. A mixed
population of FPCs can include, but is not limited to epithelial,
mesenchymal, and endothelial cells.
[0084] As used herein, a "graft" refers to a cell, tissue or organ
that is implanted into an individual, typically to replace, correct
or otherwise overcome a defect. A graft may further comprise a
scaffold. The tissue or organ may consist of cells that originate
from the same individual; this graft is referred to herein by the
following interchangeable terms: "autograft," "autologous
transplant," "autologous implant" and "autologous graft." A graft
comprising cells from a genetically different individual of the
same species is referred to herein by the following interchangeable
terms: "allograft", "allogeneic transplant," "allogeneic implant"
and "allogeneic graft." A graft from an individual to his identical
twin is referred to herein as an "isograft", a "syngeneic
transplant", a "syngeneic implant" or a "syngeneic graft." A
"xenograft," "xenogeneic transplant" or "xenogeneic implant" refers
to a graft from one individual to another of a different
species.
[0085] As used herein, the term "growth factor product" refers to a
protein, peptide, mitogen, or other molecule having a growth,
proliferative, differentiative, or trophic effect on a cell. Growth
factors include, but are not limited to, fibroblast growth factor
(FGF), basic fibroblast growth factor (bFGF), acidic fibroblast
growth factor (aFGF), epidermal growth factor (EGF), insulin-like
growth factor-I (IGF-T), insulin-like growth factor-II (IGF-II),
platelet-derived growth factor (PDGF), vascular endothelial cell
growth factor (VEGF), activin-A, bone morphogenic proteins (BMPs),
insulin, growth hormone, erythropoietin, thrombopoietin,
interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 7 (IL-7),
macrophage colony stimulating factor, c-kit ligand/stem cell
factor, osteoprotegerin ligand, insulin, nerve growth factor,
ciliary neurotrophic factor, cytokines, chemokines, morphogens,
neutralizing antibodies, other proteins, and small molecules.
Preferably, the FGF is selected from the group selected from FGF2,
FGF7, FGF10, and any combination thereof.
[0086] As used herein, the term "growth medium" is meant to refer
to a culture medium that promotes growth of cells. A growth medium
will generally contain animal serum. In some instances, the growth
medium may not contain animal serum.
[0087] As used herein, "human pluripotent stem cells" (hPS) refers
to cells that may be derived from any source and that are capable,
under appropriate conditions, of producing human progeny of
different cell types that are derivatives of all of the 3 germinal
layers (endoderm, mesoderm, and ectoderm). hPS cells may have the
ability to form a teratoma in 8-12 week old SCID mice and/or the
ability to form identifiable cells of all three germ layers in
tissue culture. Included in the definition of human pluripotent
stem cells are embryonic cells of various types including human
blastocyst derived stem (hBS) cells in literature often denoted as
human embryonic stem (hES) cells, (see, e.g., Thomson et al.
(1998), Heins et. al. (2004), as well as induced pluripotent stem
cells (see, e.g. Yu et al., (2007) Science 318:5858); Takahashi et
al., (2007) Cell 131(5):861). The various methods and other
embodiments described herein may require or utilize hPS cells from
a variety of sources. For example, hPS cells suitable for use may
be obtained from developing embryos. Additionally or alternatively,
suitable hPS cells may be obtained from established cell lines
and/or human induced pluripotent stem (hiPS) cells.
[0088] As used herein "hiPS cells" refers to human induced
pluripotent stem cells.
[0089] An "isolated cell" refers to a cell which has been separated
from other components and/or cells which naturally accompany the
isolated cell in a tissue or mammal.
[0090] An "isolated nucleic acid" refers to a nucleic acid segment
or fragment which has been separated from sequences which flank it
in a naturally-occurring state, i.e., a DNA fragment which has been
removed from the sequences which are normally adjacent to the
fragment, i.e., the sequences adjacent to the fragment in a genome
in which it naturally occurs. The term also applies to nucleic
acids which have been substantially purified from other components
which naturally accompany the nucleic acid, i.e., RNA or DNA or
proteins, which naturally accompany it in the cell. The term
therefore includes, for example, a recombinant DNA which is
incorporated into a vector, into an autonomously replicating
plasmid or virus, or into the genomic DNA of a prokaryote or
eukaryote, or which exists as a separate molecule (i.e., as a cDNA
or a genomic or cDNA fragment produced by PCR or restriction enzyme
digestion) independent of other sequences. It also includes a
recombinant DNA which is part of a hybrid gene encoding additional
polypeptide sequence.
[0091] The term "lung specific" refers to a nucleic acid molecule
or polypeptide that is expressed predominantly in the lung as
compared to other tissues in the body. In a preferred embodiment, a
"lung specific" nucleic acid molecule or polypeptide is expressed
at a level that is 5-fold higher than any other tissue in the body.
In a more preferred embodiment, the "lung specific" nucleic acid
molecule or polypeptide is expressed at a level that is 10-fold
higher than any other tissue in the body, more preferably at least
15-fold, 20-fold, 25-fold, 50-fold or 100-fold higher than any
other tissue in the body. Nucleic acid molecule levels may be
measured by nucleic acid hybridization, such as Northern blot
hybridization, or quantitative PCR. Polypeptide levels may be
measured by any method known to accurately measure protein levels,
such as Western blot analysis.
[0092] "Lung tissue" can include, but is not limited to, all lung
tissue structures and associated tissues, including, but not
limited to, veins, arteries, vessels, capillaries, and cells of the
type that are part of, or associated with, such structures; lung
and pleural tissue; and vascular smooth muscle, pericyte, and
vascular endothelial lineages and/or phenotypes.
[0093] The terms "precursor cell," "progenitor cell," and "stem
cell" are used interchangeably in the art and as used herein refer
either to a pluripotent or lineage-uncommitted progenitor cell,
which is potentially capable of an unlimited number of mitotic
divisions to either renew itself or to produce progeny cells which
will differentiate into the desired cell type. In contrast to
pluripotent stem cells, lineage-committed progenitor cells are
generally considered to be incapable of giving rise to numerous
cell types that phenotypically differ from each other. Instead,
progenitor cells give rise to one or possibly two lineage-committed
cell types.
[0094] "Proliferation" is used herein to refer to the reproduction
or multiplication of similar forms, especially of cells. That is,
proliferation encompasses production of a greater number of cells,
and can be measured by, among other things, simply counting the
numbers of cells, measuring incorporation of .sup.3H-thymidine into
the cell, and the like.
[0095] "Progression of or through the cell cycle" is used herein to
refer to the process by which a cell prepares for and/or enters
mitosis and/or meiosis. Progression through the cell cycle includes
progression through the G1 phase, the S phase, the G2 phase, and
the M-phase.
[0096] As used herein, "scaffold" refers to a structure, comprising
a biocompatible material, that provides a surface suitable for
adherence and proliferation of cells. A scaffold may further
provide mechanical stability and support. A scaffold may be in a
particular shape or form so as to influence or delimit a
three-dimensional shape or form assumed by a population of
proliferating cells. Such shapes or forms include, but are not
limited to, films (e.g. a form with two-dimensions substantially
greater than the third dimension), ribbons, cords, sheets, flat
discs, cylinders, spheres, 3-dimensional amorphous shapes, etc.
[0097] As used herein, the phrase "stem cells" refers both to the
earliest renewable cell population responsible for generating cell
mass in a tissue or body and the very early progenitor cells, which
are somewhat more differentiated, yet are not committed and can
readily revert to become a part of the earliest renewable cell
population.
[0098] As used herein, a "substantially purified" cell is a cell
that is essentially free of other cell types. Thus, a substantially
purified cell refers to a cell which has been purified from other
cell types with which it is normally associated in its
naturally-occurring state.
[0099] As used herein, the terms "subject" and "patient" are used
interchangeably. As used herein, a subject is preferably a mammal
such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats,
etc.) and a primate (e.g., monkey and human), most preferably a
human.
[0100] As used herein, to "treat" means reducing the frequency with
which symptoms of a disease, defect, disorder, or adverse
condition, and the like, are experienced by a patient.
[0101] As used herein, a "therapeutically effective amount" is the
amount of a composition of the invention sufficient to provide a
beneficial effect to the individual to whom the composition is
administered.
[0102] As used herein, "tissue engineering" refers to the process
of generating tissues ex vivo for use in tissue replacement or
reconstruction. Tissue engineering is an example of "regenerative
medicine," which encompasses approaches to the repair or
replacement of tissues and organs by incorporation of cells, gene
or other biological building blocks, along with bioengineered
materials and technologies.
[0103] As used herein, the terms "tissue grafting" and "tissue
reconstructing" both refer to implanting a graft into an individual
to treat or alleviate a tissue defect, such as a lung defect or a
soft tissue defect.
[0104] "Transplant" refers to a biocompatible lattice or a donor
tissue, organ or cell, to be transplanted. An example of a
transplant may include but is not limited to skin cells or tissue,
bone marrow, and solid organs such as heart, pancreas, kidney, lung
and liver.
[0105] Generally, a "trophic factor" is defined as a substance that
promotes survival, growth, proliferation and/or maturation of a
cell, or stimulates increased activity of a cell.
[0106] Ranges: throughout this disclosure, various aspects of the
invention can be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2,
2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of
the range.
DESCRIPTION
[0107] The present invention relates to the successful generation
of a pure population of alveolar epithelial type II cells from stem
cells. The alveolar epithelial type II cells differentiated from
stem cells serve as a promising source of cells for use
therapeutically to treat distal lung diseases, lung injuries, and
genetic diseases that affect the lung.
[0108] The present invention provides a method of differentiating
stem cells into cells that exhibit at least one characteristic of
an alveolar epithelial type II cell. In one embodiment, the method
comprises two phases wherein the first phase comprises generating a
definitive endoderm (DE) population from a stem cell population and
the second phase comprising differentiating the DE population into
cells of the anterior foregut endoderm (AFE). With respect to the
first phase, in one embodiment, stem cells are initially cultured
without serum in the presence of Activin A in order to generate a
DE population. With respect to the second phase, in one embodiment,
the DE population is cultured in the presence of a human
extracellular matrix (ECM) protein in combination with a culture
medium supplemented with an inhibitor of BMP and an inhibitor of
TGF-.beta. signaling and in the absence of Activin A in order to
induce differentiation into AFE. Preferably, the inhibitor of BMP
is NOGGIN and the inhibitor of TGF-.beta. signaling is
SB-431542.
[0109] After AFE cells are generated, they can be cultured in the
presence of a differentiation medium to induce differentiation into
a desired cell type. For example, the AFE cells can be induced to
differentiation into a cell that exhibits at least one
characteristic of an alveolar epithelial type II cell wherein the
differentiation medium comprises FGF-10, EGF, Wnt3a, and KGF.
Preferably, the alveolar epithelial type II cell differentiation
medium does not include BMP4.
[0110] Accordingly, the invention provides a method for directed
differentiation of stem cells into cell types and tissues derived
from the AFE including but is not limited to alveolar type II
cells.
[0111] The invention is partly based upon the discovery that the
unique protocol disclosed elsewhere herein allows for the highly
efficient conversion of AFE cells into alveolar type II progenitor
cells. For example, the use of ECM protein-coated surfaces in
combination with specific growth factors generated a cell
population that expressed a high percentage of lung alveolar type
II cell markers. In one example, the methods of the invention
allows for the generation of a pure population of alveolar type II
cells derived from human stem cells, preferably human induced
pluripotent stem (iPS) cells.
[0112] In one embodiment, the method of differentiating stem cells
towards an alveolar type II cell phenotype is distinct from prior
art in that the step of differentiating AFE to an alveolar type II
cell phenotype requires the use of the combination of growth
factors and ECM proteins. In one embodiment, the combination of
growth factors includes FGF-10, EGF, Wnt3a, and KGF. In another
embodiment, the combination of growth factors excludes BMP4. With
respect to ECM proteins, the cells in one embodiment, can be
cultured in the presence of ECM proteins that mimic ECM proteins
that exist during embryogenesis for lung development (e.g.,
collagens, laminin, fibronectin, tenascin, elastin, and a number of
proteoglycans and glycosaminoglycans).
Definitive Endoderm
[0113] During embryonic development, the tissues of the body are
formed from three major cell populations: ectoderm, mesoderm and
definitive endoderm. These cell populations, also known as primary
germ cell layers, are formed through a process known as
gastrulation. Following gastrulation, each primary germ cell layer
generates a specific set of cell populations and tissues. Mesoderm
gives rise to, for example, blood cells, endothelial cells, cardiac
and skeletal muscle, and adipocytes. Definitive endoderm generates,
for example, liver, pancreas and lung. Ectoderm gives rise to, for
example, the nervous system, skin and adrenal tissues.
[0114] Described herein is the demonstration that definitive
endoderm can be produced, purified and expanded from stem cells.
Thus purified or sub-cultured stem cell-derived definitive endoderm
can be used as a platform for differentiation toward lung
progenitors (e.g., alveolar type II progenitor cells). In one
embodiment, the invention provides a method of generating cell
populations comprising definitive endoderm cells from a cell
population substantially initially consisting essentially of stem
cells, preferably human induced pluripotent stem (iPS) cells.
[0115] In one embodiment, the invention provides a method of
producing endoderm cells, such as definitive endoderm cells by
exposing stem cells such as embryonic stem cells (ES) or iPS cells
to an effective amount of at least one compound described herein to
differentiate the stem cells into the endoderm cells such as
definitive endoderm cells. Differentiated endoderm cells produced
by the methods disclosed herein can be differentiated into endoderm
derivatives such as pancreas, thymus, liver, stomach, intestine and
lung. Another aspect of the present invention relates to a method
of producing alveolar type II progenitor cells by exposing endoderm
cells, such as definitive endoderm cells to an effective amount of
at least one compound described herein to differentiate the
definitive endoderm cells into alveolar type II progenitor
cells.
[0116] Methods of the invention can be used for stimulating
differentiation of stem cells into DE cells in medium which is free
of serum and free of serum extract. Preferably, such methods are
also carried out in the absence of feeder cells and/or feeder cell
extracts.
[0117] For example, differentiation of stem cells into DE cells can
be carried out comprising the steps of: 1) maintaining stem cells
in a first culture medium for a period of time, optionally on
feeders, in the presence of serum or an extract of serum or in a
serum free/serum extract free medium; 2) replacing the first medium
with a second serum free medium comprising activin or removing the
serum or the serum extract from the first medium and withdrawing
the feeders (if present) and adding activin, so that the first
medium is free of feeders, serum and serum extract; and 3)
subsequently propagating the stem cells in the medium comprising
activin in order to obtain cells comprising DE cells.
[0118] In one embodiment, directed differentiation of pluripotent
cells, e.g., stem cells, into definitive endoderm can be obtained
by application of high concentrations of Activin A. Without wishing
to be bound by any particular theory, it is believed that the
scientific basis for this strategy is that signaling by the
morphogen nodal is required for endoderm formation. Activin A
activates the same receptor as nodal, but is available as a soluble
cytokine.
[0119] In one embodiment, generation of definitive endoderm stem
cells may be accomplished by adapting a protocol used to develop
definitive endoderm from mouse ES cells (Kubo et al, 2004
Development 131: 1651-1662). Preferably, the stem cells are
initially cultured without serum in the presence of a high
concentration of Activin A (about 50-500 ng/ml, about 75-150 ng/ml,
about 100 ng/ml).
[0120] One can use any means common to one of ordinary skill in the
art to confirm the presence of an endoderm cell, e.g. a definitive
endoderm cell produced the methods of the invention. In some
embodiments, the presence of endoderm cells can be detected using
suitable markers such as those listed in U.S. Pat. No. 7,326,572,
which is incorporated herein by reference.
[0121] In some embodiments, the presence of definitive endoderm
markers, e.g. chemically induced definitive endoderm cells, can be
evaluated by detecting the presence or absence of one or more
markers indicative of a definitive endoderm cell. In some
embodiments, the method can include detecting the positive
expression (e.g., the presence) of a marker for definitive endoderm
cells. In some embodiments, the marker can be detected using a
reagent, e.g., a reagent for the detection of one or more of SOX17,
HNF3.beta. (Fox2A), MIXL2, GATA4, GSC, FGF17, VWF, CALCR, FOXQ1,
CMKOR1, CRIP1, and the like. In particular, definitive endoderm
cells express Sox17 and/or HNF3B, and do not express significant
levels of extra-embryonic endoderm markers such as GATA4, SPARC,
APF, and DAB. Other positive markers for definitive endoderm cells
also include but are not limited to Nodal, Tmprss2, Tmem30b, St14,
Spink3, Sh3g12, Ripk4, Rab15, Npnt, Clic6, Cldn8, Cacna1b, Bnip1,
Anxa4, Emb, FoxA1, and Rbm35a.
[0122] Negative markers (e.g., the absence of significant levels of
expression) for definitive endoderm cells include extra-embryonic
(EE) endoderm markers such as Gata4, SPARC, APF and DAB, as well as
negative markers Zic, Pax6, Flk1 or CD31. Negative markers of
definitive endoderm cells are useful for the purposes of negative
selection of non-definitive endoderm cells (e.g., selection and
discarding cells which express Gata4, SPARC, APF, DAB, Zic, Pax6,
Flk1 or CD31) or for identification of cells which do not express
these negative markers (e.g. definitive endoderm cells).
[0123] A reagent for a marker can be, for example, an antibody
against the marker or primers for a RT-PCR or PCR reaction, e.g., a
semi-quantitative or quantitative RT-PCR or PCR reaction. Such
markers can be used to evaluate whether a definitive endoderm cell
has been produced. The antibody or other detection reagent can be
linked to a label, e.g., a radiological, fluorescent (e.g., GFP) or
colorimetric label for use in detection. If the detection reagent
is a primer, it can be supplied in dry preparation, e.g.,
lyophilized, or in a solution.
[0124] The progression of a pluripotent stem cell to a definitive
endoderm can be monitored by determining the expression of markers
characteristic of definitive endoderm cells. In some processes, the
expression of certain markers is determined by detecting the
presence or absence of the marker. Alternatively, the expression of
certain markers can be determined by measuring the level at which
the marker is present in the cells of the cell culture or cell
population. In certain processes, the expression of markers
characteristic of definitive endoderm cells as well as the lack of
significant expression of markers characteristic of the pluripotent
stem cell from which it was derived is determined.
Anterior Foregut Endoderm (AFE)
[0125] Lung, esophagus and trachea are derived from anterior
foregut endoderm distal to the pouches. The ability to generate
populations of anterior foregut/pharyngeal endoderm cells from
pluripotent cells would be useful in cell replacement therapy for
these tissues, in assays for agents that affect cell growth and
differentiation, and in studies on tissue development and
differentiation.
[0126] The definitive endoderm cells of the present invention may
be allowed to differentiate into cells of the anterior foregut
endoderm. It has been discovered that although Activin A induces
endoderm, Activin A posteriorizes this tissue. Preparation of
anterior foregut endoderm thus requires reducing or removing
Activin A following formation of definitive endoderm. In certain
aspects, the present invention thus provides a method for the
formation of a population of cells enriched for anterior foregut
endoderm, and the depletion of mid- and posterior endoderm
signals.
[0127] In one embodiment, the definitive endoderm cell population
can then be differentiated into anterior foregut endoderm by
culturing the definitive endoderm cells in the presence of the
combination of an extracellular matrix (ECM) protein and a culture
medium supplemented with an inhibitor of BMP and an inhibitor of
TGF-.beta. signaling. Preferably, the inhibitor of BMP is NOGGIN
and the inhibitor of TGF-.beta. signaling is SB-431542.
[0128] In certain embodiments, the invention thus provides cell
populations enriched for anterior foregut endoderm cells. Enriched
populations of anterior foregut endoderm comprise at least 25%, at
least 50%, at least 75%, at least 90%, at least 95% at least 99% or
at least 99.9% anterior foregut endoderm cells.
[0129] Endoderm cell populations are characterized and
distinguished by markers known in the art. Within definitive
endoderm, the embryonic stem cell marker SOX2 reemerges as a marker
of anterior foregut endoderm, while CDX2 is a marker of posterior
endoderm (hindgut). Prolonged culture of cells induced for 4 to 5
days to form endoderm by Activin A leads to an increase of CDX2 and
a loss of SOX2, suggesting posteriorization in these conditions.
Anteriorization of definitive endoderm may be accomplished by
withdrawing or blocking Activin A and adding anteriorizing
morphogens. Preferred anteriorizing morphogens are inhibitors of
BMP and TGF-.beta. signaling. Inhibitors of BMP and TGF-.beta.
signaling may be used singly or in combination. Preferably,
inhibitors of BMP and TGF-.beta. signaling are used in combination.
Examples of BMP inhibitors are Noggin, Chordin, and follistatin. A
preferred inhibitor of BMP is Noggin. Examples of inhibitors of
TGF-.beta. signaling are Ly364947 (SD208), SM16, SB-505124,
SB-431542, and anti-TGF-.beta. antibodies. A preferred inhibitor of
TGF-.beta. signaling is SB-431542. In a preferred embodiment, a
combination of Noggin and SB-431542 is used to induce
anteriorization of definitive endoderm. In certain embodiments, a
combination of Noggin and SB-431542 is added for about 2 days in
culture to induce anteriorization of definitive endoderm.
Anteriorization of definitive endoderm with Noggin and SB-431542
may be confirmed by, for example, detecting expression of, for
example, one or more of SOX2, TBX1 (pharynx), PAX9 (pharynx,
thymus), FOXP2 (lung, airway epithelium), DLX3 (esophagus), FOXA2
(definitive endoderm), and/or SOX7 (early endodermal marker); and
optionally detecting lack of expression of PAX6 (ectoderm) and/or
BRACHYURY (mesoderm).
[0130] In certain embodiments, the invention provides a method of
deriving anterior foregut endoderm comprising culturing definitive
endoderm with an inhibitor of BMP or an inhibitor of TGF-.beta.
signaling and in the absence of Activin A. In preferred
embodiments, definitive endoderm is cultured with both an inhibitor
of BMP and an inhibitor of TGF-.beta. signaling and in the absence
of Activin A.
[0131] In some embodiments, an inhibitor of BMP is Noggin. In some
embodiments Noggin is present in cultures at a concentration of
about 1 ng/ml to 10 .mu.g/ml, 10 ng/ml to 1 .mu.g/ml, 10 ng/ml to
500 ng/ml, 10 ng/ml to 250 ng/ml, or 10 ng/ml to 100 ng/ml. In
preferred embodiments, Noggin is present in cultures at a
concentration of about 25 ng/ml to 150 ng/ml, 50 ng/ml to 150 ng/ml
or 75 ng/ml to 150 ng/ml. In most preferred embodiments, Noggin is
present in cultures at a concentration of about 100 ng/ml.
[0132] In some embodiments, an inhibitor of TGF-.beta. is
SB-431542. In some embodiments of the methods described herein,
SB-431542 is present in cultures at a concentration of about 0.1
.mu.M to 100 mM, 1 .mu.M to 10 mM, 1 .mu.M to 500 .mu.M, 1 .mu.M to
250 .mu.M, or 1 .mu.M to 100 .mu.M. In most preferred embodiments,
SB-431542 is present in cultures at a concentration of about 10
mM.
[0133] Also preferred are embodiments wherein cultures used in the
methods of the invention comprise Noggin at a concentration of
about 75 ng/ml to 150 ng/ml and SB-431542 at a concentration of
about 500 .mu.M to 10 mM. Preferably, Noggin is at a concentration
of about 200 ng/ml and SB-431542 is at a concentration of about 10
mM.
[0134] With respect to ECM proteins, the definitive endoderm cell
population can be cultured in the presence of ECM proteins. That
is, the present invention is based on the discovery that culturing
definitive endoderm cells in the presence of the combination of ECM
proteins and culture medium supplemented with NOGGIN and SB-431542
resulted in highly efficient anterior forgut endoderm
differentiation. In one embodiment, the ECM proteins useful for
anterior forgut endoderm differentiation mimic ECM proteins that
exist during embryogenesis for lung development (e.g., collagens,
laminin, fibronectin, tenascin, elastin, and a number of
proteoglycans and glycosaminoglycans).
[0135] In another embodiment, the present invention provides a
method of culturing cells in the presence of ECM proteins on a
surface (e.g., two-dimensional or three-dimensional) in a suitable
growth medium. In one embodiment, the ECM is coated on the surface
of a culturing apparatus.
[0136] In another embodiment, the present invention includes a
tissue culture system. In various aspects, the culture system is
composed of the ECM compositions described herein, such as being
included in two-dimensional or three-dimensional support materials.
In another aspect, the ECM compositions described herein serve as a
support or two-dimensional or three-dimensional support for the
growth of various cell types. For example, the culture system can
be used to support the growth of stem cells. In one aspect, the
culture system can be used to support the differentiation of stem
cells. In yet another embodiment, the culture system can be used to
support the differentiation of definitive endoderm cells into cells
of the anterior foregut endoderm.
[0137] ECM is known to be secreted by certain cells and is
comprised mainly of fibrous proteins, polysaccharides, and other
minor constituents. Its components include structural elements such
as collagen and elastin, adhesive proteins such as the
glycoproteins fibronectin, laminin, vitronectin, thrombospondin I
and tenascins, as well as proteoglycans such as decorin, biglycan,
chondroitin sulfate and heparin sulfate and glycosaminoglycans
(GAG) such as hyaluronic acid (HA).
[0138] In one embodiment, the ECM compositions can include any or
all of the following: fibronectin, fibrillin, laminin, elastin,
members of the collagen family (e.g., collagen I, III, and IV),
glycosaminoglycans, ground substance, reticular fibers and
thrombospondin. Preferably, human ECM is used for culturing the
definitive endoderm. In one embodiment, human ECM includes
collagens, laminin, fibronectin, tenascin, elastin, and a number of
proteoglycans and glycosaminoglycans.
[0139] In another embodiment, it is desirable to culture the cells
on a solid support that comprises a reconstituted basement
membrane, wherein the membrane can be obtained by being extracted
and prepared from a suitable cell tissue that is contained in the
thin, membranous extracellular matrix present below the cell layer
in vivo and contains proteins and glycoproteins such as laminin,
collagen IV and heparin sulphate proteoglycan as well as various
cell growth factors and activating factors, etc.
[0140] In one embodiment, the predominant major extracellular
matrix component is fibrillar collagen, particularly collagen type
I. However, other fibrillar and non-fibrillar collagens, including
collagen types II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII,
XIV, XV, XVI, XVII, XVIII, XIX, and others.
[0141] The ECM compositions of the present invention may be
processed in a variety of ways. Accordingly, in one embodiment, the
present invention includes a tissue culture system. In various
aspects, the culture system is composed of the ECM compositions
described herein. The ECM compositions of the present invention may
be incorporated into the tissue culture system in a variety of
ways. For example, compositions may be incorporated as coatings, by
impregnating three-dimensional scaffold materials as described
herein, or as additives to media for culturing cells. Accordingly,
in one aspect, the culture system can include three-dimensional
support materials impregnated with any of the ECM compositions
described herein, such as growth factors or embryonic proteins.
Alveolar Type II Progenitor Cells
[0142] Cells that are able to differentiate into the alveolar
epithelial system are cells involved in tissue repair after a lung
injury, and are therefore clinically very important cells for
regenerative medicine, etc. Furthermore, these cells are also
useful as materials for discovering new markers for identifying
human lung tissue stem cells, and it is believed that analyzing the
differentiation signals, etc. of these cells may lead to the
discovery of new drugs.
[0143] In one embodiment, the anterior foregut endoderm cells of
the invention can be induced to differentiate into a desired cell
type by culturing the cells in an appropriate differentiation
medium.
[0144] Differentiation can be induced using one or more
differentiation agents, including without limitation, Ca.sup.2+, an
epidermal growth factor (EGF), a platelet derived growth factor
(PDGF), a keratinocyte growth factor (KGF), a transforming growth
factor (TGF), cytokines such as an interleukin, an interferon, or
tumor necrosis factor, retinoic acid, transferrin, hormones (e.g.,
androgen, estrogen, insulin, prolactin, triiodothyronine,
hydrocortisone, or dexamethasone), sodium butyrate, TPA, DMSO, NMF
(N-methyl formamide), DMF (dimethylformamide), or matrix elements
such as collagen, laminin, heparan sulfate).
[0145] In one embodiment, the anterior foregut endoderm cells of
the invention can be induced to differentiate into cells having a
lung phenotype. For example, anterior foregut endoderm cells can be
induced to differentiate into type II alveolar cells, which also
are known as type II pneumocytes. A medium can be used that
contains one or more of pituitary extract (e.g. a bovine pituitary
extract), steroid hormones (e.g. hydrocortisone, or a salt thereof
such as the acetate), growth factors (e.g., epidermal growth
factor, preferably human epidermal growth factor), catecholamines
(e.g., epinephrine, either in racemic or enantiomeric form),
iron-binding proteins (e.g., a transferrin), insulin, vitamins
(e.g., retinoic acid), thyroid hormones (e.g., triiodothyronine),
serum albumins (e.g., bovine or human serum albumin, including
recombinant preparations), antibiotics (e.g., aminoglycoside
antibiotics, such as gentamicin), and/or antifungals (e.g.,
amphotericin-B). For example, a medium can include hydrocortisone,
epidermal growth factor, insulin, triiodothyronine, transferrin,
and bovine serum albumin and in some embodiments, further can
include retinoic acid, pituitary extract, and epinephrine. SAGM.TM.
medium from Cambrex (catalog CC-3118) is particularly useful for
differentiating anterior foregut endoderm cells into type II
alveolar cells.
[0146] The present inventors have been able to obtain, through use
of appropriate differentiation factors, a pure population of lung
cells. Preferably, the lung cell is a distal lung cell type,
preferably an alveolar-type cell, more preferably, a type-I or
type-II alveolar-type cell.
[0147] In some embodiments, the methods of the invention
efficiently induce direct differentiation of stem cells into
alveolar type II cells. In some embodiments, the method results in
a sufficiently pure population of alveolar type II cells (e.g., at
least 95% alveolar type II phenotype).
[0148] In one embodiment, the anterior foregut endoderm cells of
the invention can be induced to differentiate into cells that
exhibit at least one characteristic of an alveolar type II cell.
For example, the anterior foregut endoderm cells can be cultured in
the presence of a differentiation medium comprising FGF-10, EGF,
Wnt3a, and KGF for a period of time sufficient for differentiation
towards an alveolar type II cell phenotype
[0149] In some embodiments, an agonist of Wnt signaling is Wnt3a;
others can also be used, as described herein. For use in the
methods described herein, Wnt3a is present in cultures at a
concentration of about 1 ng/ml to 10 .mu.g/ml, 10 ng/ml to 1
.mu.g/ml, 10 ng/ml to 500 ng/ml, 10 ng/ml to 250 ng/ml, or 10 ng/ml
to 100 ng/ml. In preferred embodiments, Wnt3a is present in
cultures at a concentration of about 25 ng/ml to 150 ng/ml, 50
ng/ml to 150 ng/ml or 75 ng/ml to 150 ng/ml. In further preferred
embodiments, Wnt3a is present in cultures at a concentration of
about 100 ng/ml.
[0150] In some embodiments, agonists of FGF signaling are FGF7 or
FGF 10; others can also be used, as described herein. For use in
the methods described herein, FGF7 or FGF10 are present in cultures
at a concentration of about 1 ng/ml to 10 .mu.g/ml, 10 ng/ml to 1
.mu.g/ml, 10 ng/ml to 500 ng/ml, 10 ng/ml to 250 ng/ml, or 10 ng/ml
to 100 ng/ml. In preferred embodiments, FGF7 or FGF10 are present
in cultures at a concentration of about 25 ng/ml to 150 ng/ml, 50
ng/ml to 150 ng/ml or 75 ng/ml to 150 ng/ml. In most preferred
embodiments, both FGF7 and FGF 10 are present in cultures at a
concentration of about 10 ng/ml.
[0151] Exemplary stem cell differentiated alveolar type II cells
appear morphologically normal, express the characteristic
surfactant proteins A, B, and C, CFTR and .alpha.-1AT RNA as well
as synthesize and secrete complement proteins C3 and C5. Thus, a
unique approach is provided to reliably generate significant
quantities of sufficiently pure stem cell-derived alveolar type II
cells that can be used therapeutically to reconstitute damaged lung
alveolus and other lung diseases or disorders such as, but not
limited to, genetic diseases that affect the lung.
[0152] Preferably, the cells form histiotypic alveolar-like
structures, comprised of differentiated distal epithelial cells
(proSpC expressing) forming ductal structures. Thus, the implanted
cells will develop characteristics that liken it to the surrounding
tissue. Using these methods, the biological scaffolding can augment
the tissue; the biological scaffolding of the invention can be used
for tissue engineering and in any conventional tissue engineering
setting.
[0153] In one embodiment, the present methods result in direct
differentiation of stem cells into alveolar type II cells which
contrasts with previous attempts at differentiation of alveolar
type II cells from stem cells, in which multiple steps were used to
derive alveolar type II cells from stem cells through embryonic
body formation. Previous approaches require prolonged time periods
to develop the endoderm from which the alveolar type II cells are
derived, and yet in the end the produce scarcely detectable numbers
of alveolar type II cells in mixed cell populations. Therefore, in
addition to providing sufficiently pure and numerous alveolar type
II cells, embodiments of the present methods decrease the time and
effort in generating stem cell-derived alveolar type II cells and
facilitate their therapeutic and clinical use.
[0154] Differentiation to lung cells (e.g., alveolar type II cells)
can be confirmed, for example, by a lung morphology as assessed by
light microscopy and the presence of lamellar bodies and
microvesicular bodies as assessed by transmission electron
microscopy. Lamellar bodies are secretory lysosomes that serve as
the storage form of lung surfactant, surfactant protein C (SPC),
which is an integral membrane protein that is expressed only in
alveolar type II cells. The presence of SPC mRNA can be detected by
reverse-transcriptase PCR and the presence of SPC protein can be
detected by immunofluorescence staining.
Methods
[0155] The invention relates to the discovery that stem cells
(e.g., iPS cells) can be differentiated to alveolar type II cells
by way of the definitive endoderm. For example in one embodiment,
the invention provides a method of differentiating a population of
stem cells into a population of lung cells comprising: 1) inducing
a stem cell into a cell of the definitive endoderm; 2) inducing the
cell of the definitive endoderm into an anterior foregut endoderm
cell; 3) inducing the anterior foregut endoderm cell into a lung
cell, thereby differentiating a stem cell into a lung cell. The
cells of the invention are useful for investigating lung
developmental biology. In addition, the cells of the invention are
useful for among other things, drug discovery, toxicity testing,
disease pathology, and the like. Accordingly, the invention
provides methods and compositions for the generation of
vascularized pulmonary tissues as a form of regenerative
medicine.
[0156] The production of a population of in vitro cultured cells of
alveolar epithelial type II cell lineage derived from at least one
stem cell includes culturing at least stem cell in vitro according
to the method of the invention in order to produce differentiated
cells, preferably without formation of an embryonic body. In one
embodiment, the method of production further includes identifying
the differentiated cells of alveolar epithelial type II cell
phenotype by detecting expression of at least one biomarker of
alveolar epithelial type II cells, and isolating the differentiated
cells having alveolar epithelial type II cell phenotype. In some
cases, this may include selecting a purified population of
differentiated cells wherein at least 95%, preferably at least 96%,
preferably at least 97%, more preferably at least 98%, more
preferably at least 99% of the cells have alveolar epithelial type
II cell phenotype.
[0157] The cells of the invention and cells derived therefrom can
be derived from, inter alia, humans, primates, rodents and birds.
Preferably, the cells of the invention are derived from mammals,
especially mice, rats and humans. Stem cells from which the of
alveolar epithelial type II cells are derived may be either
wild-type or genetically modified stem cells.
[0158] The cells of the present invention, whether grown in
suspension or as adherent cell cultures, are grown in contact with
culture media.
[0159] Culture media used in the present invention preferably
comprise a basal medium, optionally supplemented with additional
components.
[0160] Basal medium is a medium that supplies essential sources of
carbon and/or vitamins and/or minerals for the cells. The basal
medium is generally free of protein and incapable on its own of
supporting self-renewal/symmetrical division of the cells.
[0161] Preferably, the suitable cell is isolated from a mammal,
more preferably a primate and more preferably still, a human. The
cells useful in the methods of the present invention are isolated
using methods discussed herein, for example in the Examples
section, or by any method known in the art. Following isolation,
the suitable cells are cultured in a culture medium. Media
formulations that support the growth of cells include, but are not
limited to, Minimum Essential Medium Eagle, ADC-1, LPM (bovine
serum albumin-free), F10 (HAM), F12 (HAM), DCCM1, DCCM2, RPMI 1640,
BGJ Medium (with and without Fitton-Jackson Modification), Basal
Medium Eagle (BME--with the addition of Earle's salt base),
Dulbecco's Modified Eagle Medium (DMEM-without serum), Yamane,
IMEM-20, Glasgow Modification Eagle Medium (GMEM), Leibovitz L-15
Medium, McCoy's 5A Medium, Medium M199 (M199E--with Earle's salt
base), Medium M199 (M199H--with Hank's salt base), Minimum
Essential Medium Eagle (MEM-E--with Earle's salt base), Minimum
Essential Medium Eagle (MEM-H--with Hank's salt base) and Minimum
Essential Medium Eagle (MEM-NAA with nonessential amino acids), and
the like.
[0162] It is further recognized that additional components may be
added to the culture medium. Such components include, but are not
limited to, antibiotics, antimycotics, albumin, growth factors,
amino acids, and other components known to the art for the culture
of cells. Antibiotics which can be added into the medium include,
but are not limited to, penicillin and streptomycin. The
concentration of penicillin in the culture medium is about 10 to
about 200 units per ml. The concentration of streptomycin in the
culture medium is about 10 to about 200 .mu.g/ml. However, the
invention should in no way be construed to be limited to any one
medium for culturing the cells of the invention. Rather, any media
capable of supporting the cells of the invention in tissue culture
may be used.
[0163] In certain embodiments, culture media used in the invention
do not contain any components which are undefined (e.g. serum
and/or feeder cells), that is to say components whose content is
unknown or which may contain undefined or varying factors that are
unspecified. An advantage of using fully defined media, free of
serum and free of serum extracts, is that efficient and consistent
protocols for culture and subsequent manipulation of the cells of
the invention and cells derived therefrom can be obtained.
[0164] Typical substrates for culture of the cells in all aspects
of the invention are culture surfaces recognized in this field as
useful for cell culture, and these include surfaces of plastics,
metal, composites, though commonly a surface such as a plastic
tissue culture plate, widely commercially available, is used. Such
plates are often a few centimeters in diameter. For scale up, this
type of plate can be used at much larger diameters and many repeat
plate units used.
[0165] The culture surface may further comprise a cell adhesion
protein, usually coated onto the surface. Receptors or other
molecules present on the cells bind to the protein or other cell
culture substrate and this promotes adhesion to the surface and
promotes growth.
[0166] In certain embodiments, the cultures of the invention are
preferably adherent cultures, i.e. the cells are attached to a
substrate.
[0167] In some instances, the cells of the invention can be
cultured on a decellularized tissue, preferably a decellularized
lung tissue. In some instances, cells of the invention are cultured
on the decellularized tissue for regeneration of lung tissue. An
example of a decellularized lung tissue is disclosed in
PCT/US2010/023213, the content of which is incorporated herein by
reference in its entirety.
[0168] In one embodiment, the invention provides cells that "seed"
the decellularized tissue scaffold. The cells can differentiate in
vitro by culturing the cells on the scaffold in the presence of an
appropriate differentiation medium. Differentiated cells can be
identified by their gross morphology and by the connections they
form with other cells. For example, cells that differentiate into
lung cells can develop complex morphology resembling
bronchioles.
[0169] The present invention also provides an in vivo method of
repairing injured or diseased alveolar epithelial tissue in the
lung of a mammal is provided in accordance with some embodiments.
Such method comprises transplanting into a lung that contains
injured or diseased alveolar epithelial tissue, a population of
differentiated stem cells, or progeny thereof, at least 95% of
which have alveolar epithelial type II phenotype. The population of
cells is prepared in accordance with a method described herein, and
is effective to repair at least a portion of the injured or
diseased alveolar epithelial tissue. In some embodiments, the
mammal suffers from a genetic disease affecting alveolar epithelial
tissue in the lung, and said therapeutic transgene encodes a gene
product for ameliorating the detrimental effects of said genetic
disease in said alveolar epithelial tissue. In some embodiments, at
least one differentiated stem cell, or progeny thereof, comprises a
therapeutic transgene operably linked to a cell-specific promoter,
wherein the transgene encodes a therapeutic gene product. In some
embodiments, an above-described population of cells is transplanted
directly to injured or diseased alveolar epithelial tissue in said
lung. In some embodiments, transplanting the population of cells
comprises administering them into the lung endotracheally via
oropharynx intubation.
[0170] In one embodiment, the methods of the invention provides the
generation of lung progenitor cells from differentiated cultures of
stem cells. Moreover, with the recent discovery that iPS cells can
be created from dermal skin fibroblasts, investigations have begun
to examine the possibility of generating lung progenitor epithelial
cells from somatic cells. If these efforts succeed,
patient-specific iPS cells could be obtained, thereby avoiding the
immune rejection problems that might occur if heterologous sources
of embryonic stem cells were employed. Moreover, iPS cells offer
the possibility of generating gene-corrected, patient-specific lung
progenitor cells from individuals with genetic diseases affecting
the lung, including cystic fibrosis, alpha-1-antitrypsin
deficiency, and surfactant protein deficiencies.
[0171] Many embodiments of the present compositions and methods
efficiently induce direct differentiation of human stem cells into
alveolar epithelial type II cells without EB formation and also
produce a highly pure population of human alveolar epithelial type
II cells. In some embodiments the method results in a clonal
population of alveolar epithelial type II phenotype cells
sufficiently pure (e.g., at least 95% and in many cases at least
99% alveolar epithelial type II phenotype) suitable for
implantation into a mammalian host lung tissue without significant
risk of producing a teratoma.
[0172] Transplantation of the stem cell-derived alveolar epithelial
type II cells, produced using embodiments of the described methods
reversed or prevented acute lung injury when transplanted 1 or 2
days following injury, as demonstrated by recovery of body weight
and arterial blood oxygen saturation, decreased collagen
deposition, and increased survival. Interestingly, some injured
lung alveolar epithelium regions appeared healthy after
transplantation of the stem cell-derived alveolar epithelial type
II cells, produced using embodiments of the described methods,
despite having no observable engrafted stem cell-derived alveolar
epithelial type II cells. This suggests that stem cell-derived
alveolar epithelial type II cells, produced using embodiments of
the described methods, may provide paracrine repair/protection to
injured lung epithelium, such as, but not limited to, the release
of anti-inflammatory mediators such as IL-10, angiopoietin-1, and
keratinocyte growth factor.
[0173] In some embodiments, the alveolar type II epithelial cells
derived from stem cells (such as but not limited to human iPS
cells, as used in the examples) is used therapeutically in the
treatment of lung injury. Therapeutic activity is demonstrated
herein using alveolar type II epithelial cells derived from stem
cells in an animal model of acute lung injury. When transplanted
into lungs of mice subjected to bleomycin-induced acute lung
injury, stem cell derived-alveolar epithelial type II cells behaved
as normal primary alveolar epithelial type II cells,
differentiating into cells expressing phenotypic markers of
alveolar type I epithelial cells. Without experiencing tumorigenic
side effects, lung injury was abrogated in mice transplanted with
stem cell derived-alveolar epithelial type II cells, demonstrated
by recovery of body weight and arterial blood oxygen saturation,
decreased collagen deposition, and increased survival. Therefore,
transplantation of stem cell derived-alveolar epithelial type II
cells shows promise as an effective therapeutic to treat acute lung
injury and related disorders.
[0174] In one embodiment, the invention provides a method of
repairing injured or diseased alveolar epithelial tissue in the
lung of a mammal comprising transplanting a population of
differentiated stem cells, or progeny thereof of the invention into
the mammal Preferably, cells of the invention are transplanted at a
site comprising injured or diseased alveolar epithelial tissue. In
another embodiment, the cells of the invention are transplanted
directly into the lung of the mammal. In one embodiment, the
population of differentiated stem cells, or progeny thereof of the
invention is at least 95%, preferably at least 96%, preferably at
least 97%, more preferably at least 98%, more preferably at least
99% of which exhibit alveolar epithelial type II phenotype, wherein
the population of cells is prepared in accordance with the methods
of the invention, and is effective to repair at least a portion of
the injured or diseased alveolar epithelial tissue at the site. The
differentiated stem cell, or progeny thereof, may comprise a
transgene, which encodes a desirable gene product (e.g., a
therapeutic protein or peptide), operably linked to a cell-specific
promoter.
[0175] In one embodiment, the invention provides a method of
treating a genetic disease affecting alveolar epithelial tissue in
the lung of a mammal comprising transplanting a population of
differentiated stem cells, or progeny thereof of the invention into
the mammal Preferably, the cells of the invention are transplanted
into the lung, at a site comprising alveolar epithelial tissue
detrimentally affected by the genetic disease. The differentiated
stem cell, or progeny thereof of the invention can comprise a
transgene that encodes a gene product which ameliorates the genetic
disease or its detrimental effects in the alveolar epithelial
tissue at least at the site of implantation when expressed in vivo.
The cells of the invention may comprise a transgene operably linked
to a cell-specific promoter, wherein the transgene encodes a
therapeutic gene product.
[0176] Methods of treatment of the diseases encompassed by the
invention can comprise the transplantation of single cells, cell
lines, compositions, or cell populations of the invention into a
mammal in need thereof. Preferably, the mammal is a human.
[0177] In one embodiment, the cells of the invention can be used to
assay the effectiveness of inductive or blocking factors on the
differentiation of the cells of the invention. Such an assay may
comprise contacting a cell of the invention (i.e. as present in the
compositions, cell lines, and populations, or a single cell) with
the factor to be tested. The effect of the factor on the
differentiation of the cell can be suitably assessed by determining
the marker profile of the resultant cells, i.e. to show whether the
cells have a similar marker profile to the cells of the invention,
or whether these markers have been lost. The cells of the invention
are also suitable for assaying pharmaceuticals, for example, the
treatment of lung disease.
Genetic Modification
[0178] The cells of the invention can be used to treat a lung
disease including but not limited to emphysema, bronchiolitis
obliterans, and cystic fibrosis. For example, cells and be
delivered to a recipient via tracheal instillation, inhalation, or
injection, among other ways. Such cells that are expanded in
culture can be used to affect therapy in the recipient.
[0179] In the context of gene therapy, the cells of the invention
can be treated with a gene of interest prior to delivery of the
cells into the lung of a recipient. In some cases, such cell-based
gene delivery can present significant advantages of other means of
gene delivery to the lung, such as inhalation of adenoviral gene
delivery vectors. This superiority of cell-based gene delivery to a
host stems from the observation that inhaled gene delivery vectors
typically result in poor efficiency of cellular transduction, due
to barriers imposed by the mucous layer and the host immune system.
Delivery of a therapeutic gene that has been pre-inserted into
cells avoids the problems associated with penetration of gene
therapy vectors into recipient lung cells.
[0180] Accordingly, the invention provides the use of genetically
modified cells that have been cultured according to the methods of
the invention. Genetic modification may, for instance, result in
the expression of exogenous genes ("transgenes") or in a change of
expression of an endogenous gene. Such genetic modification may
have therapeutic benefit. Alternatively, the genetic modification
may provide a means to track or identify the cells so-modified, for
instance, after implantation of a composition of the invention into
an individual. Tracking a cell may include tracking migration,
assimilation and survival of a transplanted genetically-modified
cell. Genetic modification may also include at least a second gene.
A second gene may encode, for instance, a selectable
antibiotic-resistance gene or another selectable marker.
[0181] Proteins useful for tracking a cell include, but are not
limited to, green fluorescent protein (GFP), any of the other
fluorescent proteins (e.g., enhanced green, cyan, yellow, blue and
red fluorescent proteins; Clontech, Palo Alto, Calif.), or other
tag proteins (e.g., LacZ, FLAG-tag, Myc, His.sub.6, and the
like).
[0182] When the purpose of genetic modification of the cell is for
the production of a biologically active substance, the substance
will generally be one that is useful for the treatment of a given
disorder. For example, it may be desired to genetically modify
cells so that they secrete a certain growth factor product
associated with bone or soft tissue formation. Growth factor
products to induce growth of other, endogenous cell types relevant
to tissue repair are also useful. For instance, growth factors to
stimulate endogenous capillary and/or microvascular endothelial
cells can be useful in repair of soft tissue defect, especially for
larger volume defects.
[0183] The cells of the present invention can be genetically
modified by having exogenous genetic material introduced into the
cells, to produce a molecule such as a trophic factor, a growth
factor, a cytokine, and the like, which is beneficial to culturing
the cells. In addition, by having the cells genetically modified to
produce such a molecule, the cell can provide an additional
therapeutic effect to the mammal when transplanted into a mammal in
need thereof. For example, the genetically modified cell can
secrete a molecule that is beneficial to cells neighboring the
transplant site in the mammal.
[0184] The cells of the invention may be genetically modified using
any method known to the skilled artisan. See, for instance,
Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), and in
Ausubel et al., Eds, (1997, Current Protocols in Molecular Biology,
John Wiley & Sons, New York, N.Y.). For example, a cell may be
exposed to an expression vector comprising a nucleic acid including
a transgene, such that the nucleic acid is introduced into the cell
under conditions appropriate for the transgene to be expressed
within the cell. The transgene generally is an expression cassette,
including a polynucleotide operably linked to a suitable promoter.
The polynucleotide can encode a protein, or it can encode
biologically active RNA (e.g., antisense RNA or a ribozyme). Thus,
for example, the polynucleotide can encode a gene conferring
resistance to a toxin, a hormone (such as peptide growth hormones,
hormone releasing factors, sex hormones, adrenocorticotrophic
hormones, cytokines (e.g., interferins, interleukins, lymphokines,
etc.), a cell-surface-bound intracellular signaling moiety (e.g.,
cell adhesion molecules, hormone receptors, etc.), a factor
promoting a given lineage of differentiation (e.g., bone
morphogenic protein (BMP)), etc.
[0185] Within the expression cassette, the coding polynucleotide is
operably linked to a suitable promoter. Examples of suitable
promoters include prokaryotic promoters and viral promoters (e.g.,
retroviral ITRs, LTRs, immediate early viral promoters (IEp), such
as herpesvirus IEp (e.g., ICP4-IEp and ICPO-IEEp), cytomegalovirus
(CMV) IEp, and other viral promoters, such as Rous Sarcoma Virus
(RSV) promoters, and Murine Leukemia Virus (MLV) promoters). Other
suitable promoters are eukaryotic promoters, such as enhancers
(e.g., the rabbit .beta.-globin regulatory elements),
constitutively active promoters (e.g., the .beta.-actin promoter,
etc.), signal specific promoters (e.g., inducible promoters such as
a promoter responsive to RU486, etc.), and tissue-specific
promoters. It is well within the skill of the art to select a
promoter suitable for driving gene expression in a predefined
cellular context. The expression cassette can include more than one
coding polynucleotide, and it can include other elements (e.g.,
polyadenylation sequences, sequences encoding a membrane-insertion
signal or a secretion leader, ribosome entry sequences,
transcriptional regulatory elements (e.g., enhancers, silencers,
etc.), and the like), as desired.
[0186] The expression cassette containing the transgene should be
incorporated into a genetic vector suitable for delivering the
transgene to the cells. Depending on the desired end application,
any such vector can be so employed to genetically modify the cells
(e.g., plasmids, naked DNA, viruses such as adenovirus,
adeno-associated virus, herpesviruses, lentiviruses,
papillomaviruses, retroviruses, etc.). Any method of constructing
the desired expression cassette within such vectors can be
employed, many of which are well known in the art (e.g., direct
cloning, homologous recombination, etc.). The choice of vector will
largely determine the method used to introduce the vector into the
cells (e.g., by protoplast fusion, calcium-phosphate precipitation,
gene gun, electroporation, DEAE dextran or lipid carrier mediated
transfection, infection with viral vectors, etc.), which are
generally known in the art.
[0187] Examples of techniques sufficient to direct persons of skill
through in vitro amplification methods, including the polymerase
chain reaction (PCR), the ligase chain reaction (LCR), and other
DNA or RNA polymerase-mediated techniques are found in Sambrook et
al., MOLECULAR CLONING: A LABORATORY MANUAL, volumes 1-3 (3rd ed.,
Cold Spring Harbor Press, NY 2001).
[0188] Once the nucleic acid for a protein is cloned, a skilled
artisan may express the recombinant gene(s) in a variety of lung
cells. It is expected that those of skill in the art are
knowledgeable in the numerous expression systems available for
expressing the desired transgene.
Bioreactor
[0189] The invention provides a system (e.g., a bioreactor) for
culturing the cells of the invention that have been introduced to a
decellularized lung. The bioreactor enables the maintenance of cell
viability, cellular differentiation state, and lung morphology. The
bioreactor of the invention incorporates key features of the vivo
environment. The bioreactor can be designed to allow modifications
for optimizing decellularization and/or recellularization
processes.
[0190] In one embodiment, the bioreactor is capable of perfusing
media through the vasculature at a rate specified by the user and
within the physiological flow and pressure levels of a mammal. In
another embodiment, the bioreactor is capable of ventilating the
tissue (e.g., lung) with air or media through the trachea.
Preferably, negative pressure ventilation is used in order to be
consistent with normal physiological conditions, though ventilation
using positive pressure can also be done. In yet another
embodiment, the bioreactor is capable of allowing different media
types to bathe the vascular and airway compartments of the tissue.
In another embodiment, the bioreactor allows for gas exchange into
the culture medium, while simultaneously meeting the desired
requirements for ventilation. In another embodiment, the bioreactor
has ports to allow for pressure measurements, for example
measurements of the pulmonary artery and tracheal pressures.
Preferably, pressures are within normal physiological values. In
another embodiment, the bioreactor has a means of allowing media
exchange on a periodic basis.
[0191] The bioreactor of the invention generally includes at least
one cannulation device for cannulating a tissue, a perfusion
apparatus for perfusing media through the cannula(s), and means
(e.g., a containment system) to maintain a sterile environment for
the organ or tissue. A cannulation device generally includes
size-appropriate hollow tubing for introducing into a vessel, duct,
and/or cavity of a tissue. Typically, one or more vessels, ducts,
and/or cavities are cannulated in a tissue. A perfusion apparatus
can include a holding container for the liquid (e.g., a cellular
disruption medium) and a mechanism for moving the liquid through
the organ (e.g., a pump, air pressure, gravity) via the one or more
cannulae. The sterility of a tissue during decellularization and/or
recellularization can be maintained using the methods discussed
elsewhere herein.
[0192] The bioreactor for can be used to recellularize tissues as
described herein. The process can be monitored for certain
perfusion characteristics (e.g., pressure, volume, flow pattern,
temperature, gases, pH), mechanical forces (e.g., ventricular wall
motion and stress), and electrical stimulation (e.g., pacing). The
effectiveness of perfusion can be evaluated in the effluent and in
tissue sections. Perfusion volume, flow pattern, temperature,
partial O.sub.2 and CO.sub.2 pressures and pH can be monitored
using standard methods.
[0193] Sensors can be used to monitor the bioreactor and/or the
tissue. Sonomicromentry, micromanometry, and/or conductance
measurements can be used to acquire pressure-volume. For example,
sensors can be used to monitor the pressure of a liquid moving
through a cannulated organ or tissue; the ambient temperature in
the system and/or the temperature of the organ or tissue; the pH
and/or the rate of flow of a liquid moving through the cannulated
organ or tissue; and/or the biological activity of a
recellularizing tissue. In addition to having sensors for
monitoring such features, a system for recellularizing a tissue
also can include means for maintaining or adjusting such features.
Means for maintaining or adjusting such features can include
components such as a thermometer, a thermostat, electrodes,
pressure sensors, overflow valves, valves for changing the rate of
flow of a liquid, valves for opening and closing fluid connections
to solutions used for changing the pH of a solution, a balloon, an
external pacemaker, and/or a compliance chamber. To help ensure
stable conditions (e.g., temperature), the chambers, reservoirs and
tubings can be water-jacketed.
[0194] The bioreactor is capable of providing sufficient nutrient
supply and mechanical stimulation to the lung tissue in order to
support cell survival and differentiation. The bioreactor can be
used for in vitro lung tissue culture and for engineered lung
tissue culture. Preferably, the bioreactor is used to culture
engineered lung tissue using the decellularized lung scaffolds in
combination with the cells of the invention.
[0195] The development of a bioreactor capable of the in vitro
culture of true 3-dimensional segments of lung tissue is an
important step in the development of clinically useful engineered
lung tissue. For example, growth and maturation of the engineered
lung tissue can take place in the bioreactor prior to implantation
of the engineered lung into a recipient, thereby enhancing the
functionality of the final implanted lung tissue in vivo. In
addition, the bioreactor for in vitro lung culture can be used to
assist the study of pulmonary biology, physiology, and development.
That is, the interactions of lung endothelial and epithelial cells
to form the alveolar-capillary barrier can be studied using the
engineered lung tissue and bioreactor of the invention. A skilled
artisan would be able to study lung behavior in a more controlled
environment than the various animal models currently used. The
engineered lung tissue and bioreactor could also be used for
pharmacologic testing and investigation in human or animal tissue
before proceeding to time-consuming and costly human or animal
trials.
Administration
[0196] The invention contemplates use of the cells of the invention
in both in vitro and in vivo settings. Thus, the invention provides
for use of the cells of the invention for research purposes and for
therapeutic or medical/veterinary purposes. In research settings,
an enormous number of practical applications exist for the
technology. One example of such applications is use of the cells of
the invention in an ex vivo cancer model, such as one to test the
effectiveness of various ablation techniques (including, for
example, radiation treatment, chemotherapy treatment, or a
combination) in a lab, thus avoiding use of ill patients to
optimize a treatment method. For example, one can attach a recently
removed lung to a bioreactor and treat the lung to ablate tissue.
Another example of an in vivo use is for tissue engineering.
[0197] The invention also provides a method of alleviating or
treating a lung defect in a mammal, preferably a human. The method
comprises administering to the mammal in need thereof a
therapeutically effective amount of a composition comprising the
cells of the invention, thereby alleviating or treating the lung
defect in the mammal.
[0198] The cells of the present invention have use in vivo. Among
the various uses, mention can be made of methods of in vivo
treatment of subjects (used interchangeably herein with "patients",
and meant to encompass both human and animals). In general for
certain embodiments, methods of treating subjects comprise
implanting a cell of the invention into or on the surface of a
subject, where implanting of the cell results in a detectable
change in the subject. The detectable change can be any change that
can be detected using the natural senses or using man-made devices.
While any type of treatment is envisioned by the present invention
(e.g., therapeutic treatment of a disease or disorder, cosmetic
treatment of skin blemishes, etc.), in many embodiments, the
treatment is a therapeutic treatment of a disease, disorder, or
other affliction of a subject. As such, a detectable change may be
detection of a change, preferably an improvement, in at least one
clinical symptom of a disease or disorder affecting the subject.
Exemplary in vivo therapeutic methods include regeneration of
organs after treatment for a tumor, preparation of a surgical site
for implantation of a medical device, skin grafting, and
replacement of part or all of a tissue or organ, such as one
damaged or destroyed by a disease or disorder. In view of the fact
that a subject may be a human or animal, the present invention has
both medical and veterinary applications.
[0199] The invention also provides methods of treating a patient by
implanting the cells of the invention into a mammal in need
thereof. In some instances, the cells of the invention comprise
suitable cells, for example alveolar epithelial type II cells.
However, the invention should not be limited to any particular type
of cells. After implantation, the grafted cells can respond to
environmental cues that will cause it to develop characteristics of
the endogenous tissue. Preferably, the cells form histiotypic
alveolar-like structures, comprised of differentiated distal
epithelial cells (proSpC expressing) forming ductal structures.
Thus, the implanted cells will develop characteristics that liken
it to the surrounding tissue. Using these methods, the biological
scaffolding can augment the tissue; the biological scaffolding of
the invention can be used for tissue engineering and in any
conventional tissue engineering setting.
[0200] Accordingly, the invention encompasses tissue regeneration
applications. The objective of the tissue regeneration therapy
approach is to deliver high densities of repair-competent cells (or
cells that can become competent when influenced by the local
environment) to the defect site in a format that optimizes both
initial wound mechanics and eventual neotissue production. The
composition of the instant invention is particularly useful in
methods to alleviate or treat lung tissue defects in individuals.
Advantageously, the composition of the invention provides for
improved lung tissue regeneration. Specifically, the tissue
regeneration is achieved more rapidly as a result of the inventive
composition.
[0201] Advantageously, the compositions and methods of the
invention represent an improvement over prior art methods.
Preferably the composition for use in treating a lung tissue defect
comprises alveolar epithelial type II cells as described elsewhere
herein.
EXPERIMENTAL EXAMPLES
[0202] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0203] Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the compounds
of the present invention and practice the claimed methods. The
following working examples therefore, specifically point out the
preferred embodiments of the present invention, and are not to be
construed as limiting in any way the remainder of the
disclosure.
Example 1
Differentiation and Characterization of Alveolar Type II Cells from
Human Induced Pluripotent Stem Cells
[0204] The experiments presented herein were designed to explore
whether lung tissue can be regenerated in vitro. A relatively
homogeneous population of alveolar epithelial type II (AETII) and
type I cells (AETI) was generated from human iPS cells which had
phenotypic properties similar to mature human alveolar type II and
type I cells. Up to 97% of cells were positive for surfactant
protein C, 95% for Mucin-1, 93% for surfactant protein B, and 89%
for the epithelial marker, CD54. Additionally, exposing AETII to a
Wnt/.beta.-catenin inhibitor (e.g., IWR-1) changed the iPSC-AETII
like phenotype to a predominantly AETI like phenotype. Of the cells
that were AET1 cells, more than 90% of were positive for the type I
markers, T1.alpha. and caveolin-1. Acellular lung matrices were
prepared by treating whole rat or human adult lungs with
decellularization reagents, followed by seeding these matrices with
alveolar cells derived from human iPS cells. Under appropriate
culture conditions, these progenitor cells adhered to and
proliferated within the 3D lung tissue scaffold, and displayed
markers of differentiated pulmonary epithelium.
[0205] The materials and method employed in these experiments are
now described.
[0206] Chemical and Reagents
[0207] Mouse embryonic fibroblasts (MEFs) (GSC-6201) were purchased
from Global stem, Matrigel (354277) were purchased from BD,
Recombinant human WNT3a (5036WN) was purchased from R&D.
Dispase (07923) was obtained from Stem Cell Technology.
Keratinocyte growth factor (KGF) (PHG0094), fibroblast growth
factor 10 (FGF-10) (PHG0204), epidermal growth factor (EGF)
(PHG0311), human basic fibroblast growth factor (bFGF) (13256-029),
NOGGIN (PHC1506), Activin A (PHG9014), knock out serum replacement
(108280280), Superscript first strand synthesis system for RT-PCR
(18080-051) were purchased from Invitrogen. Dulbecco's Modified
Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (11330-032),
Dulbecco's Modified Eagle Medium (DMEM) (11905-092), RPMI 1640
(11875-093), IMDM (12440-053), non-essential amino acids
(1140-050), L-glutamine (25030164), sodium pyruvate (11360-070),
2-mercaptoethanol (21985-023), B27 supplement (17504-044), Trypsin
(25200-056), Penicillin-streptomycin (15140-122) fetal bovine serum
(FBS) were purchased from GIBCO by life technology. Retinoic acid
(R2625) gelatin (G1393), SB431542(S4317), human ECM protein
(E0282), IWR-1(I0161), human collagen type I (C7624) and IV
(C7521), human fibronectin (F0895), human ECM protein (E0282),
CHAPs C3023), Benzonase (E1014), Sodium Deoxycholate (D6750),
Elastase (E8140) Triton X-100 (T9284), were purchased from
Sigma-Aldrich. Sodium Nitroprusside Dihydrate (71778) was obtained
from Fluka. DNase I (LS006333) was purchased from Worthington
Biochemical Corporation. Small Airway Growth Medium (SAGM)
(CC-3119), Amphotericin B (17836R) was purchased from Lonza. Human
SPC ELISA kit (E01S0168) was obtained from Life Science Advanced
Technologiest Inc. Peracetic acid or PAA (P05020) was obtained from
Pfalz & Bauer. Fetal bovine serum (FBS) (SH30071.03) was
obtained from Hyclone. iQ.TM. SYBR Green Supermix (170-8882) was
obtained from Bio-Rad. All antibodies were used in this study are
listed in Table 1.
TABLE-US-00001 TABLE 1 List of antibodies used in staining, flow
cytometry and western blot for various experiments Primary
Antibodies Antigen Type Provider (Cat #) (lot #) Application
Beta-actin Monoclonal Abcam (Cat# ab8226, Lot# GR88207-1) WB
Caspase3 Rabbit Abcam (Cat# ab13847, Lot# GR62173- IHC polyclonal
2) CCSP Rabbit Millipore (Cat# 07-623, Lot# 1972321) IHC polyclonal
CCSP Goat Biovender (Cat# RD81022220, Lot# IHC polyclonal RD2412)
CD54-PE Mouse BD Pharmingen (Cat# 560971, Lot# FC Monoclonal 10609)
CXCR4-APC Monoclonal BD Pharmingen (Cat# 560936, Lot# FC 41560)
Cytokeratin-5 Rabbit Abbiotec (Cat# 251431, Lot# 11092101) IHC
polyclonal FoxA2 Goat R&D Systems (Cat# AF2400, Lot# ICC, FC
polyclonal ULB0311101) Muc-1 Monoclonal R&D Systems (Cat#
MAB6298, Lot# ICC, FC CDYA0111031) Nanog Rabbit Abcam (Cat#
ab80892, Lot# GR40243- ICC monoclonal 14) Nkx2.1 Rabbit Abcam (Cat#
ab76013, Lot# GR76790- ICC, IHC, polyclonal 2) FC Oct4 Goat Abcam
(Cat# ab27985, Lot# GR56247- ICC, FC polyclonal 1) p63 Monoclonal
Santa Cruz (Cat# sc-71825, Lot# H2510) IHC Pax9 Rat monoclonal
Abcam (Cat# ab28538, Lot# GR53993- ICC 1) Pax9 Goat Santa Cruz
(Cat# sc-7746, Lot# K121) ICC polyclonal PCNA Monoclonal Abcam
(Cat# ab29, Lot# GR70504-2) IHC proSPB Rabbit Millipore (Cat#
ab3430, Lot# ICC, FC polyclonal NG1820771) proSPC Rabbit Millipore
(Cat# ab3786, Lot# 2117989) ICC, IHC, monoclonal FC proSPC Rabbit
Abcam (Cat# ab40879, Lot# GR86765- WB polyclonal 1) Sox2 Rabbit
Abcam (Cat# ab97959, Lot# Unknown) ICC polyclonal Sox2-AF647
Monoclonal BD Pharmingen (Cat# 562139, Lot# ICC, FC 18245) Sox17
Goat R&D Systems (Cat# AF1924, Lot# ICC, FC polyclonal
KGA0411031) Sox17 Mouse Abcam (Cat#ab84990) ICC monoclonal SPA
Rabbit Millipore (Cat# ab3420, Lot# ICC polyclonal NG1888873) SPA
Rabbit Santa Cruz (Cat# sc-13977, Lot# K0807) WB polyclonal SPC
Rabbit Santa Cruz (Cat# sc-13979, Lot# L1710) ICC, IHC, polyclonal
FC SPC Monoclonal Life Sciences Advanced Tech.(Cat ELISA #E01S0168)
SSEA4 Monoclonal Millipore(Cat# MAB4304, Lot # ICC LV1488380
T1.alpha. Monoclonal Abcam (Cat# ab10288, Lot# GR47830- IHC 3) Tbx1
Rabbit Abcam(Cat # ab18530) ICC polyclonal TRA-1-81 Monoclonal
Millipore(Cat#MAB4381, Lot # ICC LV1512392) CD166-PE Mouse (Cat#
559263, Lot# 3018832) FC Monoclonal CD104-FITC Mouse (Cat# 64233,
Lot # 3039557 FC Monoclonal Detection Antbodies Type Provider(Cat
#) (lot #) Application Alexa Fluor .RTM. 555 Donkey Anti-
Invitrogen (Cat# A21432, Lot# ICC, IHC Goat IgG (H + L) 439379)
Alexa Fluor .RTM. 568 Donkey Anti- Invitrogen (Cat# A10037, Lot#
ICC, IHC Mouse IgG 1110068) Alexa Fluor .RTM. 488 Donkey Anti-Rat
Invitrogen (Cat# A21208, Lot# ICC IgG (H + L) 1017330) Alexa Fluor
.RTM. 488 Rabbit Anti-Goat Invitrogen (Cat# A11078, Lot# ICC, IHC
IgG (H + L) 1069847) Alexa Fluor .RTM. 555 Goat Anti-Rabbit
Invitrogen (Cat# A21429, Lot# ICC, IHC IgG (H + L), highly
cross-absorbed 1010124) Alexa Fluor .RTM. 488 Goat Anti-Rabbit
Invitrogen (Cat# A11034, Lot# ICC, IHC IgG (H + L), highly
cross-adsorbed 1008720) Alexa Fluor .RTM. 555 Goat Anti-Mouse
Invitrogen (Cat# A21424, Lot# ICC, IHC IgG (H + L), highly
cross-adsorbed 1214852) Alexa Fluor .RTM. 555 Goat Anti-Rat
Invitrogen (Cat# A21434, Lot# ICC IgG (H + L) 1008806) Alexa Fluor
.RTM. 488 Chicken Anti- Invitrogen (Cat# A21441, Lot# ICC, IHC
Rabbit IgG (H + L) 1003212) Alexa Fluor .RTM. 488 Chicken Anti-
Invitrogen (Cat# A21467, Lot# ICC, IHC Goat IgG (H + L) 474697)
Goat anti-Mouse IgG .RTM. H&L (FITC) Abcam (Cat# ab6785, Lot#
ICC, IHC GR6891-4) Goat anti-Rabbit IgG-HRP Santa Cruz (Cat#
sc-2004, Lot# WB H2806) HRP-conjugated Life Sciences Advanced
Tech.(Cat ELISA #E01S0168 APC Mouse IgG2a,.kappa. Isotype Control
BD Pharmingen (Cat# 555576, Lot# Isotype 33828) control PE Mouse
IgG1, .kappa. Isotype Control eBiosciences (Cat# 12-4714-82,
Isotype Lot# E01672-1630) control Alexa Fluor .RTM. 647 Mouse IgG1,
.kappa. BD Pharmingen (Cat# 557714, Lot# Isotype Isotype Control
34876) control Mouse IgG2a .kappa. Isotype Control eBiosciences
(Cat# 11-4724-81, Isotype FTIC - Lot# E00590-1630) control Isotype
FITC Goat Anti mouse Ig (Cat# 611233, Lot# 039557) PE mouse IgG
.kappa. isotype control (Cat# 555749, Lot# 38193) Abbreviations:
IHC, immunohistochemistry; ICC, immunocytochemistry; FC, flow
cytometry; WB, Western Blot; ELISA, Enzyme-linked immunosorbent
assay; PE, Phycoerythrin, APC, Allophycocyanin; FITC, Fluorescein
isothiocyanate; HRP, horseradish peroxidase; CCSP, Clara cell
secretory protein; PCNA, Proliferating cell nuclear antigen; SSEA4,
Stage-Specific Embryonic Antigen-4; Oct4, Octamer-binding
transcription factor 4; Muc-1, Mucin 1; SPA, Surfactant protein A;
SPB, Surfactant protein B; SPC, Surfactant protein C; Nkx2.1, NK2
homeobox 1; Sox2, SRY (sex determining region Y)-box 2; Sox17,
SRY-box 17; Tbx1, T-box 1; Pax 9, Paired box gene 9; CXCR4, C-X-C
chemokine receptor type 4; FoxA2, forkhead box protein A2; AF647,
Alexa Fluor .RTM. 647.
[0208] Cultivation of Human iPS Cells.
[0209] The human iPS cell lines, iPSC (IMR90, C1) and iPSC
(neonatal foreskin, C2), were obtained (Takahashi K, et al. 2007.
Cell 131(5):861-872). Both human iPS cell lines were generated by
lentiviral transduction of isolated human skin fibroblasts (IMR90,
C1 clone) and neonatal foreskin fibroblast (C2 clone) with OCT-4,
SOX2, Nanog and lin28 genes. These induced pluripotent human stem
cells have been extensively characterized; they have normal
karyotypes and telomerase activity, express cell surface markers
and genes that characterize human ES cells, and maintain the
developmental potential to differentiate into advanced derivatives
of all three primary germ layers (Takahashi K, et al. 2007. Cell
131(5):861-872). Both lines were cultured and maintained as
described previously (Takahashi K, et al. 2007. Cell
131(5):861-872). Briefly, iPS cells were propagated on irradiated
mouse embryonic fibroblast (MEF) feeder layers in DMEM-F12 media
supplemented with 20% knock out serum replacement, 4 ng/ml bFGF, 1
mM glutamine, 1% mM non-essential amino acids and 0.1 mM
.beta.-mercaptoethanol at 37.degree. C., 5% CO2 and 90-95%
humidity, with medium changes every day. Undifferentiated iPS cells
were passaged every 4-5 days onto fresh feeders by mechanical
dissociation using a Stem Cell Cutting Tool (VWR).
[0210] In Vitro Differentiation of iPS Cells to AETII Cells
[0211] Human iPSCs were differentiated to alveolar epithelium in a
directed differentiation protocol via definitive endoderm (DE) and
anterior foregut endoderm (AFE). iPS cells were differentiated
towards definitive endoderm under conditions described previously
(Duan Y, et al. 2010. Stem Cells 28(4):674-686, Kubo A, et al.
2004. Development. 131(7): 1651-1662). Briefly, h-iPSC were
cultured in RPMI 1640 medium supplemented with 100 ng/ml activin A,
2 mM L-glutamine and 1% antibiotic-antimycotic for 48 hours;
1.times.B27 supplement, 0.5 mM sodium butyrate and 0.1% FBS were
added into the same medium and the cells were cultured for another
4 days, with daily medium changes (D'Amour K A, et al. 2005. Nat
Biotechnol 23(12):1534-1541).
[0212] DE generated by exposure to activin A were trypsinized,
reseeded at a ratio of 1:1-2 on human ECM protein-coated plates and
differentiated to anterior foregut endoderm with IMDM+5% FBS, 2 mM
L-glutamine, 1 mM nonessential amino acids, 1%
antibiotic-antimycotic supplemented with 200 ng/ml NOGGIN and 10 mM
SB-431542 for 2 days (Longmire T A, et al. 2012. Cell Stem Cell
10(4):398-411, Green M D, et al. 2011. Nat Biotechnol
29(3):267-272).
[0213] AFE cells were maintained in IMDM differentiation medium
with 10% FBS, 2 mM L-glutamine, 1 mM nonessential amino acids, 1%
antibiotic-antimycotic, retinoic acid (0.5 .mu.M), FGF-10 (10
ng/ml), EGF (10 ng/ml), Wnt3a (100 ng/ml), and KGF (10 ng/ml each)
for 10-14 days. Cells were maintained in SAGM culture medium
(Lonza), plus 1% fetal bovine serum (FBS) until seeding into lung
matrices (Longmire T A, et al. 2012. Cell Stem Cell 10(4):398-411,
Green M D, et al. 2011. Nat Biotechnol 29(3):267-272).
[0214] Differentiated cells at day 22 were then maintained in DMEM
medium with 10% FBS, 2 mM L-glutamine, 1 mM nonessential amino
acids, 1% antibiotic-antimycotic and 100 mM IWR-1 for 7 days.
[0215] Isolation of Human Type II Cells
[0216] Alveolar type II (AETII) cells were isolated from human
lungs rejected for transplant as previously described (Bove P F et
al. 2010. J Biol Chem 285(45):34939-34949). Briefly, the right
middle lobe was cannulated through the main stem bronchus and
removed from the rest of the lung. The distal airspaces were
lavaged 6-10 times using a Ca.sup.2+- and Mg.sup.2+-free solution
(0.5 mm EGTA, 140 mm NaCl, 5 mm KCl, 2.5 mm Na.sub.2HPO.sub.4, 10
mm HEPES, and 6 mm glucose) and lavaged 3 times with a modified
version of this solution (no glucose, 2.0 mm CaCl.sub.2 and 1.3 mm
MgSO.sub.4). Elastase (13 units/ml), was instilled into the distal
airspaces and incubated at 37.degree. C. for 30 min. Isolated cells
were resuspended in DMEM and decanted onto PBS- and DMEM-rinsed
Petri dishes coated with human IgG antibody. After 60 min at
37.degree. C., non-adherent AETII cells were incubated with a
monoclonal antibody against fibroblasts (AS02) and pan-mouse IgG
Dynabeads for removal by magnet. AETII cells were resuspended in
DMEM containing 10% FBS, amphotericin B, ceftazidime, tobramycin,
and vancomycin.
[0217] Flow Cytometry and Immunochemistry
[0218] DE, AFE and iPSC-AETII cell populations were assessed by
immunofluorescence or/and flow cytometry before differentiation,
during the induction of DE and AFE and iPSC-AETII, and after
cultivation in the decellularized lung matrix.
[0219] For immunostaining, cells were washed with PBS, fixed in 4%
paraformaldehyde for 20 min at room temperature (RT) and
permeabilized with 0.1% Triton X-100 in PBS for 15 min at RT. Cells
were blocked in 3% BSA in PBS for 60 min at RT and incubated with
primary antibody overnight at 4.degree. C. The next day, cells were
washed with PBS and incubated with secondary antibody for 2 h at
RT. After washing, the cells were incubated with
4,6-diamidino-2-phenylindole (DAPI) (1:1000) nuclear stain.
[0220] Paraffin sections of cell-seeded lung scaffolds were stained
with H&E. Additional sections were permeabilized with 0.2%
Triton X for 15 min after heat-mediated citric acid antigen
retrieval and blocked with 5% BSA for 1 hr. at RT. Primary
antibodies were applied overnight at 4.degree. C. Sections were
incubated with secondary antibodies for 1 hr at RT, rinsed, treated
with DAPI for 1 minute, and mounted with PVA-DABCO cover slipping
solution. Stained cells and slides were imaged with a Zeiss
Axiovert 200M inverted microscope and a Hamamatsu camera.
[0221] For flow cytometry, cells were dissociated into single-cell
suspensions by incubation with 0.25% trypsin for 2 min, and fixed
(Fixation/Permeabilization kit, BD Biosciences). After blocking for
30 min on ice, the cells were incubated with primary antibody in
blocking solution for 30 min on ice. The cells were resuspended in
350 .mu.l of Perm/Wash buffer after incubation with conjugated
secondaries for 30 min on ice, washed twice, and analyzed by flow
cytometry. See Table 1 for antibody information.
[0222] Real Time Quantitative RT-PCR Total RNA was extracted using
the RNeasy Mini Kit from Qiagen, following the manufacturer's
instructions. First-strand complementary DNA (cDNA) was synthesized
with random hexamers as primers, using SuperScript First-Strand
Synthesis System according to manufacturer's protocol (Invitrogen).
Each sample was run in triplicate with iQ.TM. SYBR Green Supermix
(Bio-Rad). PCR conditions included an initial denaturation step of
4 min at 95.degree. C., followed by 40 cycles of PCR consisting of
15 s at 95.degree. C., 30 s at 60.degree. C., and 30 s at
72.degree. C. Average threshold cycle (Ct) values from the
triplicate PCR reactions for a gene of interest (GOI) were
normalized against average GAPDH Ct values from the same cDNA
sample. Fold change of GOI transcript levels between sample A and
sample B equals 2.sup.-.DELTA..DELTA.Ct, where
.DELTA.Ct=Ct.sub.(GOI)-Ct.sub.(GAPDH), and
.DELTA..DELTA.Ct=.DELTA.Ct.sub.(A)-.DELTA.Ct.sub.(B). See Table 2
for primers.
TABLE-US-00002 TABLE 2 Sequences of primers used in qRT- PCR for
various experiments Length Gene (bp) Primer Sequences hSPA 180
Forward: TCCAAGCCACACTCCACGA; (Seq id no: 1) Reverse:
TTCCTCTGGATTCCTTGGG; (Seq id no: 2) hSPB 69 Forward:
TGGGAGCCGATGACCTATG; (Seq id no: 3) Reverse: GCCTCCTTGGCCATCTTGT;
(Seq id no: 4) hNKX2.1 93 Forward: GGACGTGAGCAAGAACATG; (Seq id no:
5) Reverse: TCGCTCCAGCTCGTACACC; (Seq id no: 6) hSPC 94 Forward:
CCTTCTTATCGTGGTGGTGGT; (Seq id no: 7) Reverse:
TCTCCGTGTGTTTCTGGCTCAT; (Seq id no: 8) hMucin-1 88 Forward:
AGCTTCTACTCTGGTGCACAA; (Seq id no: 9) Reverse: GGTGGCTGGGAATTGAGA;
(Seq id no: 10) hOCT4 164 Forward: CCTCACTTCACTGCACTGTA; (Seq id
no: 11) endogenous Reverse: CAGGTTTTCTTTCCCTAGCT; (Seq id no: 12)
hSOX2 151 Forward: CCCAGCAGACTTCACATGT; (Seq id no: 13) endogenous
Reverse: CCTCCCATTTCCCTCGTTTT; (Seq id no: 14) hNANOG 239 Forward:
CCAAATTCTCCTGCCAGTGAC; (Seq id no: 15) endogenous Reverse:
CACGTGGTTTCCAAACAAGAAA; (Seq id no: 16) hCC10 105 Forward:
CCCTGGTCACACTGGCTCTC; (Seq id no: 17) Reverse:
TCATAACTGGAGGGTGTGTC; (Seq id no: 18) hCXCR4 79 Forward:
CACCGCATCTGGAGAACCA; (Seq id no: 19) Reverse:
GCCCATTTCCTCGGTGTAGTT; (Seq id no: 20) hFOXA2 89 Forward:
GGGAGCGGTGAAGATGGA; (Seq id no: 21) Reverse:
TCATGTTGCTCACGGAGGAGTA; (Seq id no: 22) hSOX17 61 Forward:
GGCGCAGCAGAATCCAGA; (Seq id no: 23) Reverse: CCACGACTTGCCCAGCAT;
(Seq id no: 24) hPAX9 132 Forward: GTTATGTTGCTGGACATGGGT; (Seq id
no: 25) Reverse: GAAGCCGTGACAGAATGACTAC; (Seq id no: 26) hTBX1 117
Forward: GCTCCTACGACTATTGCCC; (Seq id no: 27) Reverse:
CGTATTCCTTGCTTGCCCT; (Seq id no: 28) hCD31 140 Forward:
ATTGCAGTGGTTATCATCGGAGTG; (Seq id no: 29) Reverse:
CTCGTTGTTGGAGTTCAGAAGTGG; (Seq id no: 30) hTSHR 156 Forward:
TTTCTTACCCAAGCCACTGC; (Seq id no: 31) Reverse:
TTCTCTTCATATTCCTGGTGG; (Seq id no: 32) hALB 149 Forward:
AAACGCCAGTAAGTGACAGAG; (Seq id no: 33) Reverse:
ATATCTGCATGGAAGGTGAAT; (Seq id no: 34) hGAPDH 122 Forward:
GACAACAGCCTCAAGATCATCAG; (Seq id no: 35) Reverse:
ATGGCATGGACTGTGGTCATGAG; (Seq id no: 36)
[0223] Transmission Electron Micrograph
[0224] Cell samples were prepared following a modified protocol
from Schmiedl et al (Schmiedl, et al. Histochem Cell Biol 1-12).
Briefly, native human AETII and iPSC-AETII cells were fixed at
37.degree. C. with a 2.5% glutaraldehyde/2.0% paraformaldehyde
mixture in 0.2M sodium cacodylate for 30 minutes, followed by 2
hour incubation at 4.degree. C. The samples were dehydrated
following a standard ethanol series. The samples were
post-processed by OsO.sub.4 fixation and en block uranyl acetate
staining. Sections (70 to 80-nm) were taken and incubated in
uranyle acetate and lead citrate for increased contrast. Images
were taken using a Philips Tecnai transmission electron
microscope.
[0225] Preparation of Decellularized Extracellular Matrix
Scaffolds
[0226] Three-month-old Fischer or Sprague Dawley rats were
anesthetized with sodium pentobarbital, according to the guidelines
set forth by the American Veterinary Medical Association (60 mg/kg
IP). Lung extracellular matrix scaffolds were prepared as
previously described (Petersen T H, et al. 2010. Science
329(5991):538-541, Calle E A, et al. 2011. J Vis Exp (49). pii:
2651). Lungs were perfused with heparin (50 U/ml, Sigma) in PBS,
and removed with the heart and trachea. The pulmonary artery and
trachea were cannulated and the lungs were perfused through the
pulmonary artery with sodium nitroprusside (1 ml/ml, Fluka) before
being treated with decellularization solution (8 mM CHAPS, 1M NaCl,
5 mM EDTA in PBS) for 2-3 hours at 37.degree. C. Scaffolds were
treated with benzonase endonuclease (90 U/ml, Sigma) for 1 hr. at
37.degree. C., followed by extensive rinsing with PBS, antibiotics
and antimycotics.
[0227] Human lungs were obtained from beating-heart donors or warm
autopsy as arranged through Gift of Life Michigan, and were
decellularized as recently described (Booth A J. 2012. Am J Resp
Grit Care Med. 186(9): 866-76). Lung samples were agitated in
sterile deionized, distilled water and incubated in 0.1% Triton
X-100 for cell lysis. Samples were washed with sterile PBS,
incubated with 2% sodium deoxycholate and washed again. Lungs were
incubated in 1M NaCl to lyse residual nuclei. After decanting NaCl,
tissues were rinsed and incubated with 30 .mu.g/mL DNAse in 1.3 mM
MgSO4 and 2 mM CaCl2. The DNAse solution was decanted and tissues
were washed with sterile PBS. (Booth A J, et al. 2012. Am J Resp
Grit Care Med. 186(9): 866-76).
[0228] Culture of Cells on Rat Lung Extracellular Matrix
Scaffolds
[0229] Rat scaffolds were mounted in the bioreactor as described
previously (Petersen T H, et al. 2010. Science 329(5991):538-541).
Cannulas were connected to tubing loops to provide perfusion and
introduction of cells to the scaffold. Forty million iPSC-AETII
cells were suspended in 3-5 ml of culture medium (SAGM-1% FBS) and
introduced into the airway compartment; perfusion was initiated at
1 ml/min immediately after cell seeding. In additional experiments,
6.times.10.sup.6 native human AETII cells--isolated from human
lung--were introduced into the upper right lobe of a decellularized
rat lung. The full volume of culture media was changed once at day
3 or 4 and samples were harvested at days 1, 3 and 7 and saved for
histology. In parallel experiments, iPSC-AETII cells were seeded
onto sections of decellularized rat lung at a concentration of
1.5.times.10.sup.5 cells/slice in SAGM-1% FBS media for 7 days.
Finally, 3.times.10.sup.5 of either AETII cells or native human
AETII cells were transferred onto decellularized human lungs slices
in SAGM-1% FBS and cultured for 1 week; media was changed every
other day.
[0230] Enzyme-Linked Immunosorbent Assay Analysis (ELISA) for
SPC
[0231] ELISA was performed on cell culture media collected during
iPSC-AETII differentiation to quantify secreted SPC (Life Science
Advanced Technology) according to the manufacturer's instructions.
SPC values were normalized to the total number of cells.
[0232] Western Blotting
[0233] Cells were incubated in RIPA buffer supplemented with
protease inhibitors (Complete Mini, Roche,) on ice for 30 min.
Protein concentration was determined from cell lysates using a
bicinchoninic acid protein assay (Thermo Fisher Scientific). Cell
lysates were denatured and equal amounts of protein per sample were
subjected to SDS-PAGE and immunoblotting as described previously.
HRP-conjugated goat anti-mouse and goat anti-rabbit secondaries
were detected by enhanced chemiluminescence.
[0234] Proliferation Assay
[0235] To assess cell proliferation within the lung scaffold, lungs
seeded and cultured with AETII for 3 days and 7 days were fixed in
4% PBS-buffered paraformaldehyde (pH 7.4) and post-fixed with 70%
EtOH. The immunocytochemical staining against human caspase and
PCNA was performed as described in elsewhere herein. The images
were visualized with a Zeiss Axiovert 200M inverted microscope and
imaged with Hamamatsu camera. The percentage of positive nuclear
staining was calculated based on total cell numbers in three high
power fields.
[0236] Statistical Analyses
[0237] Statistics were done with Origin (OriginLab, Northampton,
Mass.). The data were expressed as mean.+-.SEM. (standard error of
measurement, all error bars represent .+-.SEM). Unpaired,
two-tailed Student's t-tests were performed to evaluate whether the
two groups were significantly different from each other. p values
less than 0.05 (two-tailed) were considered statistically
significant. All error bars represent .+-.SEM
[0238] The results of the experiments are now described.
[0239] The experiments presented herein demonstrate an efficient
and consistent, step-wise differentiation method to generate
definitive endoderm (DE), anterior foregut endoderm (AFE), and
subsequently, a relatively homogeneous population of human AETII
and AETI cells from human iPSCs (iPSCs) (FIG. 1A). These cells not
only demonstrate the phenotype of mature human alveolar type I and
type II cells, but also express a high percentage of type I and II
cell markers when compared to freshly isolated human primary
alveolar type I and type II cells. Additionally, these iPSC-derived
AETII cells are capable of repopulating an acellular lung matrix,
and give rise to cell types that reside in the distal lung (FIG.
1B).
Efficient Derivation of Definitive Endoderm Cells
[0240] Embryonic lung arises from definitive endoderm (DE) (Green M
D, et al. 2011. Nat Biotechnol 29(3):267-272, Banerjee E R, et al.
2012. PLoS One 7(3):e33165, Kadzik R S, et al. 2012. Cell Stem Cell
10(4):355-361). Therefore, in the first step, iPSC were
differentiated to DE by exposing them to saturating concentrations
of activin A during the first 6 days of differentiation. iPSC were
initially cultured without serum for 48 hours with 100 ng/ml
activin A, and then changed to a low serum concentration provided
with 1.times.B27 culture medium. During the time that iPSC were
exposed to activin A, the majority of the cells in the colonies
converted to DE cells, while those cells that did not gradually
died as monitored through visual observation. After 6 days of
differentiation, both iPSC clones (denoted as C1 and C2) stained
positively for SOX17 and FOXA2, and the majority of the cells were
positive for both SOX17 and FOXA2 (FIG. 1D, FIG. 7A-7J for C1
cells, FIG. 8A-8J for C2 cells). When endoderm marker expression
was monitored using qRT-PCR for SOX17, CXCR4 and FOXA2, no
expression of these markers was observed at day 0; expression then
increased from day 0 to day 6 in iPS cells exposed to activin A
(FIG. 7L and FIG. 12A for C1 cells, FIG. 8L and FIG. 12B for C2).
Flow cytometric analysis demonstrated that the cell population
derived from iPS cells at day 6 expressed a high percentage of
markers associated with definitive endoderm, including
92.71.+-.4.0% for CXCR4, 83.76.+-.2.0% for SOX17, and 87.66.+-.1.2%
FOXA2 in C1 and 87.23.+-.2.0% for CXCR4, 91.42.+-.3.0% for SOX17,
and 83.54.+-.1.8% FOXA2 in C2 (FIG. 7M for C1 cells, FIG. 8M for
C2). It was found that the protocol used herein was highly
efficient for generating a relatively homogeneous population of DE
from iPSC; based on the dual expression of SOX17 and FOXA2 in iPSC
clones. It was observed that more than 85% of C1 and 89% of C2 was
comprised of endodermal cells (FIG. 7K for C1 cells, FIG. 8K for
C2). Both the C1 clone (which is of fetal lung origin) and the C2
clone (which is derived from neonatal fibroblasts) yield similar
results. This suggests that this protocol may be generalized to
other iPSC lines from other cell origins or that are reprogrammed
using other techniques.
Generating Anterior Foregut Endoderm from Definitive Endoderm
Cells
[0241] Following developmental paradigms, directed differentiation
of iPS cells to alveolar epithelium should proceed by generation of
definitive endoderm, followed by patterning into anterior foregut
endoderm (AFE). Differentiation of AFE cells from DE was induced by
exposing cells to NOGGIN (200 ng/ml) and SB-431524 (10 mM) for 2
days, per the conditions described previously by Green and
colleagues (Longmire T A, et al. 2012. Cell Stem Cell
10(4):398-411, Green M D, et al. 2011. Nat Biotechnol
29(3):267-272, Mou H, et al. 2012. Cell Stem Cell 10(4):385-397).
Application of NOGGIN/SB-431542 to definitive endoderm yielded a
highly enriched population of cells with strong expression of
markers associated with the AFE phenotype, including SOX2, PAX9 and
TBX1 in both clones. The majority of cells co-expressed SOX2 and
FOXA2, as demonstrated by immunostaining at day 8 (FIG. 2A-FIG. 2J
for C1 cells, FIG. 9A-FIG. 9J for C2). Cells that were negative for
definitive endoderm markers gradually died off after switching to
AFE differentiation media as we visualized by microscopy. In
addition, the present results show that inhibition of TGF-.beta.
signaling and activin A/nodal signaling with NOGGIN/SB-431542 was
sufficient in the two iPSC clones tested to increase the anterior
endoderm cell population (as defined by FOXA2.sup.+/SOX2.sup.+) up
to 92-95% as compared to <0.1% without NOGGIN/SB-431542. (FIG.
2K, for C1 cells, FIG. 9K for C2). Quantitative RT-PCR revealed a
relatively modest increase in both PAX9 and TBX1 when compared to
SOX2 expression, which was highly expressed in AFE cells derived
from both iPSCs colonies at day 8 (FIG. 2L, for C1 cells, FIG. 9L
for C2). After activin A removal at day 6 and switching to
NOGGIN/SB-431542, it was observed that both CXCR4 and SOX17
decreased from day 6 to day 12. In the case of FOXA2, an increase
in expression at day 8 was observed, followed by a decrease with
time in culture (FIG. 12A for C1 cells, FIG. 12B for C2). These
results are expected, given that endoderm is a transient stage in
lung development and is expected to peak and then fade as stem
cells differentiate toward later phenotypes (Yasunaga M, et al.
2005. Nat Biotechnol 23(12):1542-1550).
[0242] Prior to lung differentiation, all cells that will belong to
the pulmonary lineage must first progress through a primordial
progenitor stage defined by the upregulation of the ventral marker,
NKX2.1 (Longmire T A, et al. 2012. Cell Stem Cell 10(4):398-411,
Van Haute L, et al. 2009. Respir Res 10:105). NKX2.1
(homeodomain-containing transcription factor) is the earliest known
marker associated with commitment to thyroid and lung, but several
studies suggest that NKX2.1 induction is indicative of commitment
to a lung, rather than a thyroid fate (Longmire T A, et al. 2012.
Cell Stem Cell 10(4):398-411, Green M D, et al. 2011. Nat
Biotechnol 29(3):267-272, Van Haute L, et al. 2009. Respir Res
10:105). Replacing activin A with NOGGIN/SB-431542 from day 6 to
day 8, followed by the addition of a cocktail containing
BMP4/Wnt3a/bFGF/KGF induced NKX2.1 expression in the AFE cell
population at day 13. Most of NKX2.1 positive cells in both iPSC
clones co-stained with the endoderm marker FOXA2 (FIG. 2M and FIG.
2N for C1 cells, FIG. 9M and FIG. 9N, for C2). Additionally, flow
cytometric analysis showed that 24.+-.2% of the AFE cell population
derived from C1 and 26.+-.3% from C2 was positive for NKX2.1, as
compared to <1% in activin A induced cells and in cells cultured
in media without NOGGIN/SB-431542 at day 13. Continuous activin A
treatment from day 6 to day 8 without the addition of
NOGGIN/SB-431542 resulted in rare FOXA2.sup.+/SOX2.sup.+ cells and
few NKX2.1.sup.+ cells (FIG. 2O, for C1 cells, FIG. 9O for C2).
Collectively, these expression data show that in activin A-induced
definitive endoderm, exposure to NOGGIN/SB-431542 results in a
highly enriched population of cells with an AFE phenotype.
Extracellular Matrix Protein Effects on Differentiation
[0243] In traditional stem cell cultivation/differentiation
experiments, growth factors (GFs) are added in soluble form in
order to provide signals for tissue-specific differentiation (Green
M D, et al. 2011. Nat Biotechnol 29(3):267-272, Mou H, et al. 2012.
Cell Stem Cell 10(4):385-397, Ali N N, et al. 2002. Tissue Eng
8(4):541-550, Rippon H J, et al. 2006. Stem Cells 24(5):1389-1398,
Banerjee E R, et al. 2012. PLoS One 7(3): e33165). However,
differentiation has recently become increasingly linked to
mechanobiological concepts such as interaction between cells and
the extracellular matrix (ECM) (Reilly G C, et al. 2010. J Biomech
43(1):55-62, Lin Y M, et al. 2010. Tissue Eng Part A
16(5):1515-1526, Gutierrez J A, et al. 1998. Am J Physiol 274(2 Pt
1):L196-202). Moreover, during development, ECM protein expression
represents some of the most important inducers of organ fate.
Accordingly, before switching media to NOGGIN/SB-431542 to generate
AFE from human pluripotent cells, the DE cells were split with
trypsin and reseeded at a ratio of 1:1-2 on ECM-coated plates in
media containing NOGGIN/SB-431542 for 48 hours. Adhesion of DE
cells to fibronectin, collagen I, collagen IV, Matrigel, and a
mixture of human ECM proteins (comprising of collagens, laminin,
fibronectin, tenascin, elastin, and a number of proteoglycans and
glycosaminoglycans; Sigma) was examined Fibronectin, collagen I,
collagen IV and laminin are principal components of lung matrix,
and DE cells attach well to all of these proteins. However, mixed
human ECM protein resulted in faster DE cell attachment and
significantly higher expression of SPC, SPB, and NKX2.1 genes on
both day 15 and 30 (FIG. 10A-FIG. 10C).
Efficient Derivation of Purified Lung Alveolar Type II from AFE
[0244] After differentiation to AFE on day 8, the medium was
switched to alveolar differentiation medium containing FGF-10, EGF,
WNT3a, KGF, and RA for 14 days on human ECM protein. These factors
or reagents were chosen through empiric studies, and are thought to
play a crucial role in alveolar pneumocyte differentiation and lung
development (Longmire T A, et al. 2012. Cell Stem Cell
10(4):398-411, Green M D, et al. 2011. Nat Biotechnol
29(3):267-272, Mou H, et al. 2012. Cell Stem Cell 10(4):385-397,
Ali N N, et al. 2002. Tissue Eng 8(4):541-550, Rippon H J, et al.
2006. Stem Cells 24(5):1389-1398, Banerjee E R, et al. 2012. PLoS
One 7(3):e33165). Compared with other reports, it was found that
the differentiation cocktail that lacked BMP4 in the final stage,
resulted in distal markers, especially those associated with type
II pneumocytes. After day 22, the cells--now termed AETII cells
(FIG. 1A and FIG. 1C)--were maintained in SAGM culture medium
containing 1% FBS. AETII cells derived from both the C1 and C2
clones were strongly positive for type II markers, including
pro-SPC, pro-surfactant protein B (SPB), mucin-1 and surfactant
protein A (SPA). In addition to the positive marker expression
associated with type II cells, the presence of lamellar bodies,
typical of human type II cells, was also examined by electron
microscopy in the iPSC-derived AETII cells. TEM identification of
lamellar bodies is used as a method for positively identifying type
2 pneumocytes. The TEM data clearly show the presence of lamellar
bodies in the iPSC-derived AETII cells. (FIG. 3A-FIG. 3F, for C1
cells, FIG. 11A-FIG. 11F). Quantitative RT-PCR demonstrated a high
percentage of expression of type II cell markers in iPSC-AETII
cells, that was comparable to expression levels of freshly isolated
human primary alveolar type II cells (hATII cells) (FIG. 3G, for C1
cells, FIG. 11G for C2). Up to 97% of cells were positive for SPC,
92.+-.0.9% positive for Mucin-1, 89.+-.0.9% positive for SPB and
the vast majority of the cells, 94.+-.0.9%, expressed the
epithelial surface marker CD54 in clone C1 and 96.27.+-.0.5% for
SPC, 94.42.+-.0.3% for SPB, and 91.54.+-.1.8% for Mucin-1 and
89.83.+-.0.5% for CD54 in clone C2. Moreover, AETII cells were
negative for CCSP (a Clara cell marker), p63 (basal stem cell
marker) and SOX2 (proximal airway epithelial cell marker) by FACS
analysis, indicating that these cells are a relatively homogeneous
population of type II cells (FIG. 3H and FIG. 3I, for C1 cells,
FIG. 11H and FIG. 11I for C2). ELISA measurements of SPC protein in
the cell culture supernatants indicated that day 13 cells
synthesized and secreted SPC at a rate of 16.78 ng/ml and 15.78
ng/ml in C1 and C2 clones, respectively, every 24 h. The rate of
secretion was significantly increased on day 22 of differentiation
when compared to secretion at day 13 (P<0.05). At day 22, the
iPSC-AETII cells from C1 and C2 produced 68.5 ng/ml and 71.5 ng/ml
SPC every 24 h, which was comparable to that produced by freshly
isolated human AETII cells (82.95 ng/ml) (FIG. 3J, for C1 cells,
FIG. 11J for C2).
[0245] A previous study has found that airway progenitor cells,
which ultimately give rise to trachea, bronchus and bronchioles,
are NKX2.1.sup.+/SOX2.sup.+ and sustain high levels of SOX2
expression (Mou H, et al. 2012. Cell Stem Cell 10(4):385-397).
However, by day 22, no NKX2.1.sup.+/SOX2.sup.+ cells or single
positive SOX2.sup.+ cells were detected in the population of
differentiated iPSC-AETII cells. All the AETII cells were also
negative for CCSP and p63 as determined by flow cytometry (FIG. 3H
for C1 cells, FIG. 11H for C2 cells). This may indicate that these
cells are not airway progenitor cells. Since anterior foregut
endoderm can be theoretically differentiated into cells expressing
markers of thyroid, parathyroid and lung (Longmire T A, et al.
2012. Cell Stem Cell 10(4):398-411), the expression of CD31
(endothelial marker), albumin (mature hepatocyte marker) and TSGHR
(thyroid cells marker) were investigated by quantitative RT-PCR, to
determine whether the iPSC-AETII cells were contaminated by cells
from these other lineages. No specific markers of thyroid,
endothelial cells or hepatocyte lineage were detected in iPSC-AETII
cells at day 22, thereby confirming the absence of cells from these
lineages in the differentiated lung progenitor population (FIG. 3I,
for C1 cells, FIG. 11I for C2 cells).
[0246] The expression of AFE markers (SOX2, PAX9 and TBX1) and DE
markers (SOX17, CXCR4 and FOXA2) decreased from day 8 to day 22. By
day 32, none of these markers were detectable in iPSC-AETII cells.
In case of FOXA2 and SOX2, after activin A removal at day 6 and
switching to NOGGIN/SB-431542 an increase in FOXA2 and SOX2
expression was observed at day 8 followed by a decrease in the
expression of these genes in culture over time (FIG. 12A, FIG. 12C,
and FIG. 16B for C1 cells, FIG. 12B, FIG. 12D, and FIG. 16CC for C2
cells).
[0247] Following exposure to alveolar pneumocyte induction media
containing Wnt3a, EGF, KGF and FGF at day 9 of culture, there was
lower expression of AFE genes, especially SOX2, and there was a
concomitant upregulation of NKX2.1. After day 8, SOX2 was rapidly
downregulated while NKX2.1 was upregulated. The expression of
NKX2.1 gradually increased from 24.+-.2% at day 13 to 94.+-.0.4% at
days 20-22 in C1. Quantitative RT-PCR and flow cytometry revealed
that the percentage of SPC positive cells gradually increased from
58.+-.1.6% at day 13 to 90.+-.0.4% at days 20-22 during
differentiation in the C1 clone. The same pattern of NKX2.1 and SPC
expression was observed in the C2 clone during differentiation from
day 8 to day 22. (FIG. 13A-FIG. 13D, for C1 cells, FIG. 14A-FIG.
14D for C2 cells). Between days 8 and 22, NKX2.1.sup.+ cells
proliferated slowly, ultimately leading to an increase in the
number of NKX2.1 and SPC positive cells. The amount of cell death,
following the switch in culture medium to alveolar epithelium
differentiation medium, was negligible when compared to the earlier
medium switch from DE to AFE differentiation medium from day 0 to
day 8. Immunostaining for NKX2.1.sup.+ cells at different days (day
13, 18 and 21) demonstrated that colonies expressing NKX2.1 were
gradually expanded and over-grew the NKX2.1 negative cells. This
ultimately led to an increase in the number of NKX2.1 positive
cells, as shown by a gradual progression from 24% at day 13 to 94%
at days 20-22.
[0248] Since several recent studies have reported CD166 and
.alpha.6.beta.4 to be markers of lung epithelial progenitors
(Chapman H A, et al. 2011. J Clin Invest 121(7):2855-2862, Whitsett
J A, et al. 2011. J Clin Invest 121(7):2543-2545, Soh B S, et al.
2012. Mol Ther 20(12):2335-2346, Asselin-Labat M L, et al. 2012.
Open Biol 2:120094), the expression of these markers were
characterized during the differentiation of iPSC to epithelial
cells at several time points. Flow cytometry revealed that the
percentage of CD 166 positive cells gradually increased from
15.+-.0.8% at day 13 to 35.+-.1.4% at days 20-22 during
differentiation in the C1 clone. The expression of CD166
subsequently decreased in mature cultures of iPSC-derived
epithelial cells at day 28. In the case of .alpha.6.beta.4, the
expression progressively increased from 10.+-.0.7% at day 13 to
25.+-.1.2% at day 18 in C1. By day 22 only 7-8% of the cells were
positive for .alpha.6.beta.4. The same pattern of CD166 and
.alpha.6.beta.4 expression was observed in the C2 clone during
differentiation from day 8 to day 22. (FIG. 15A and FIG. 15B, for
C1 cells, FIG. 15C and FIG. 15D for C2 cells).
[0249] Replacing the NOGGIN/SB-431542 media with differentiation
media at day 9 of culture resulted in decreasing expression of
pluripotency genes such as OCT4 and Nanog over time. As expected,
from day 13 to day 22 the pluripotency gene expression was almost
undetectable. Flow cytometry on iPSC-derived AETII cells from both
clones showed that SPC-positive cells at day 22 were negative for
OCT4 (FIG. 16A-FIG. 16E for C1 and C2 cells).
[0250] Since type II cells can spontaneously differentiate into
cells expressing markers of type I cells (Fehrenbach H, et al.
2001. Respir Res 2(1):33-46, Bove P F et al. 2010. J Biol Chem
285(45):34939-34949, Fujino N, et al. 2011. Lab Invest
91(3):363-37833) the expression of type I markers, T1.alpha., AQ5,
and caveolin-1, were assessed by flow cytometry and qPCR. Flow
cytometry revealed that 8-11% of cells expressed type I markers
following the differentiation protocol. Up to 9% of cells were
positive for AQ5, 9.6% positive for caveolin-1 and 8.1% expressed
the type I surface marker T1.alpha. in clone C1 (FIG. 4C).
Differentiation of iPSC-Derived AETII to Type I Cells
[0251] To further differentiate iPSC-AETII to AETI, we next
examined the effect of modulating Wnt/.beta.-catenin signaling on
type I marker expression in AETII cells. We examined whether the
selective .beta.-catenin/CBP inhibitor IWR-1 (Banerjee E R, et al.
2012. PLoS One 7(3):e33165, Fehrenbach H, et al. 2001. Respir Res
2(1):33-46) would modulate the differentiation of iPSC-AETII cells
to AETI cells. Differentiated AETII cells at day 22 were cultured
on human ECM protein coated plates in DMEM-10%, FBS supplemented
with 100 mM IWR-1 for 7 days. As data from independent experiments
indicated, incubation of iPSC-AETII cells with IWR-1 induced the
differentiation of AETII cells to the AETI cell phenotype (FIG.
4A-FIG. 4D). Following treatment with IWR-1, there was a
significant increase in AETI markers AQ5, T1.alpha. and caveolin-1,
in iPSCs-derived AETII compared to untreated AETII as determined by
immunostaining (FIGS. 4A and 4B). Flow cytometry revealed that up
to 92% of cells were positive for aquaporin-5 (AQ5), 98% positive
for caveolin-1, and 88% of the cells expressed the epithelial
marker T1.alpha. (FIG. 4C). In contrast, the AETII cell marker,
SPC, decreased significantly as determined by flow cytometry (FIG.
4C). Quantitative RT-PCR demonstrated a high percentage of
expression of type I cell markers in iPSC-AETII cells exposed to
IWR-1, that was comparable to expression levels of freshly isolated
human primary alveolar type I cells (hAETI cells) (FIG. 4D)
Repopulation of Rat and Human Acellular Matrix with iPSC-Derived
AETII
[0252] To explore the regenerative potential of iPS-derived AETII
cells to generate lung tissue in vitro, lungs from adult humans and
rats were decellularized by processes that remove cellular
components but leave behind a scaffold of extracellular matrix that
retains the hierarchical branching structures of airways and
vasculature (Petersen T H, et al. 2010. Science 329(5991):538-541,
Booth A J, et al. 2012. Am J Resp Crit Care Med. 186(9): 866-76).
This is an assay that was recently developed to test the
regenerative potential of primary lung epithelial cells or stem
cells derived lung epithelial cells (Longmire T A, et al. 2012.
Cell Stem Cell 10(4):398-411, Petersen T H, et al. 2010. Science
329(5991):538-541, Daly A B, et al. 2012. Tissue Eng Part A
18(1-2):1-16, Ott H C, et al. 2010. Nat Med 16(8):927-933). Both
ATI and ATII pneumocytes are differentiated cell types, however
several reports have demonstrated that ATII cells retain a level of
plasticity. When damage occurs to the ATI pneumocytes, ATII cells
proliferate and can, in turn, differentiate into ATI cells
(Asselin-Labat M L, et al. 2012. Open Biol 2:120094, Fehrenbach H,
et al. 2001. Respir Res 2(1):33-46, Fujino N, et al. 2011. Lab
Invest 91(3):363-37833). Therefore, in the studies presented herein
the capacity of iPSC derived type II cells to repopulate the airway
compartment of a decellularized lung extracellular matrix was
examined iPSC-AETII cells at day 28 were utilized to repopulate the
acellular matrices. This stage seemed most suitable because of
their commitment to a pneumocyte type II phenotype and function.
The seeded matrix was cultured in a bioreactor that was designed
and described previously (Petersen T H, et al. 2010. Science
329(5991):538-541, Petersen T H, et al. 2011. Cell Transplant
20(7):1117-1126). This bioreactor is capable of replicating key
aspects of the in vivo fetal lung environment, including vascular
perfusion and liquid ventilation. In addition to seeding iPSC-AETII
cells into decellularized whole rat lung tissue, we also seeded
iPSC-AETII cells onto slices of either rat or human acellular lung
matrix cultured in 6-well plates (FIG. 1C)
[0253] For the rat lung bioreactor experiments, approximately
40.times.10.sup.6 cells were injected into the airway through the
trachea to repopulate the decellularized rat lung matrix (FIG. 1C).
The seeded matrix was then cultured and maintained for up to 7 days
in a bioreactor in SAGM (1% FBS). H&E staining showed that
iPSC-AETII cells were able to diffusely repopulate alveolar lung
structures within distal lung. The majority of seeded AETII cells
still showed approximate AETII morphology--a cuboidal shape and
round single nuclei (FIG. 5A-FIG. 5C for C1 cells, FIG. 17A-FIG.
17C for C2 cells). Many AETII cells within the lung matrix
expressed the type II cell marker, pro-SPC and NKX2.1. In native
lung, this marker is normally found on AETII cells. In the reseeded
rat lungs, cellular expression of pro-SPC was robust in the alveoli
by day 3 and remained present at day 7 (FIG. 5D-5I for C1 cells,
FIG. 17D-17I for C2 cells).
[0254] It was investigated whether iPSC-derived AETII are able to
proliferate in the acellular matrix. After culturing iPSC-AETII
cells in the bioreactor, sections from the reseeded lung at day 3
and day 7 were stained for PCNA (proliferating cell nuclear
antigen) expression. The majority of cells on the rat scaffold
expressed PCNA, at both day 3 and day 7 while they displayed few
markers of apoptotic cell death, as determined by immunostaining
for caspase-3. However, iPSC-AETII cultured in the rat lung
scaffold for 7 days had an increased rate of positive PCNA staining
when compared to the day 3 cultures. The data suggest that the
iPSC-AETII are able to proliferate when they are seeded in rat
scaffold (FIG. 5J-5N for C1 cells, FIG. 17-17M for C2 cells).
[0255] The formation of type 1 cells in vivo, from type II cells,
is accompanied by a loss of the NKX 2.1 protein (Longmire T A, et
al. 2012. Cell Stem Cell 10(4):398-411). Consistent with this
pattern, some engrafted AETII cells acquired a flattened
morphology, and expressed the type 1 pneumocyte marker T1.alpha.
but lacked expression of NKX2.1 protein by co-staining (FIG. 5O).
Moreover the number of T1.alpha. positive cells significantly
increased from 9.7% before cell seeding to 31.2% after culturing
cells in the rat lung bioreactor. Conversely, the number of SPC
positive cells decreased from 98% before cell seeding to 72.3%
after 7 days cultured in rat lung scaffold in bioreactor. Since
type I cells are terminally differentiated cells and are not able
to proliferate like type II cells, These observations may indicate
that the extracellular matrix cues support a epithelial
populations, and that iPSC-AETII are able to differentiate to type
I cells within the lung scaffold. (FIG. 5P). All of the iPSC-AETII
cells were negative for CCSP and p63 by FACS analysis after 7 days
cultured in the rat lung scaffold (FIG. 5P).
[0256] In parallel experiments, iPSC-derived AETII were cultured on
sections of rat and human lung matrix. To prepare sections of the
acellular lung matrix, lungs from adult donors were treated using a
procedure similar to that previously described (Petersen T H, et
al. 2010. Science 329(5991):538-541, Booth A J, et al. 2012. Am J
Resp Crit Care Med. 186(9): 866-76). Then, iPSC-AETII cells were
seeded in the acellular matrices by directly pipetting onto
sections of the matrix (thickness: 600 .mu.m), and maintaining in
culture in 6-well plates in SAGM with 1% FBS. The iPSC-AETII cells
adhered well to matrix surfaces and were initially distributed
widely throughout alveoli in the matrix, in both the rat and human
decellularized lung sections. Many of the cells still showed AETII
morphology and there was robust expression of SPC and NKX2.1 (FIG.
6A-FIG. 6F on human lung sections and FIG. 6H-6K on rat lung
sections), while some engrafted AETII cells acquired a flattened
morphology and expressed the alveolar type I marker, T1.alpha.
(FIG. 6C on human lung sections and FIG. 6J on rat lung section).
iPSC-derived AETII are able to proliferate on both rat and human
lung sections, as determined by immunostaining for PCNA and
caspase-3 (FIG. 6G on human lung sections and FIG. 6L-FIG. 6O on
rat lung section).
[0257] As a control for these experiments, isolated human type II
cells from adult human lung (hAETII cells) were also seeded onto
decellularized human lung sections. As with the iPSC-AETII cells,
many of the cells with hAETII morphology expressed SPC and NKX2.1,
and some of the hAETII cells gave rise to T1.alpha. positive cells
(FIG. 6P-FIG. 6U). Moreover they were able to replicate on the
human scaffold sections, and the majority of cells expressed PCNA,
while they displayed few markers of apoptotic cell death, as
determined by immunostaining for caspase-3 (FIG. 6V).
Differentiation of iPSCs Toward DE, AFE, AETII and AETI Cells
[0258] Lung epithelia remain among the least-studied lineages to be
derived from ESCs and iPSCs in vitro to date, and few research
groups have reported on the differentiation toward lung epithelium
(Wang D, et al. 2007. Proc Natl Acad Sci USA. 104(11):4449-4454,
Green M D, et al. 2011. Nat Biotechnol 29(3):267-272, Mou H, et al.
2012. Cell Stem Cell 10(4):385-397, Van Haute L, et al. 2009.
Respir Res 10:105). Conditions for directing hESCs or iPSCs to
differentiate along an alveolar epithelial lineage with homogeneity
are not yet fully defined, and most protocols generate a mixed
population of alveolar epithelium from hESCs or iPSCs. In the
mouse, a NKX2.1:GFP reporter was used to isolate cells committed to
the lung fate which were then amenable to further differentiation
(Longmire T A, et al. 2012. Cell Stem Cell 10(4):398-411).
Moreover, in heterogeneous cultures of differentiating ESCs,
induction of late markers of development such as surfactant protein
C (SPC) have been reported, but their expression appears to be
stochastic, and the cells expressing these markers have been
difficult to expand (Longmire T A, et al. 2012. Cell Stem Cell
10(4):398-411, Green M D, et al. 2011. Nat Biotechnol
29(3):267-272, Mou H, et al. 2012. Cell Stem Cell 10(4):385-397,
Ali N N, et al. 2002. Tissue Eng 8(4):541-550, Rippon H J, et al.
2006. Stem Cells 24(5):1389-1398, Banerjee E R, et al. 2012. PLoS
One 7(3):e33165). The studies presented herein demonstrate an
efficient and consistent, step-wise differentiation method to
generate definitive endoderm (DE), anterior foregut endoderm (AFE),
and subsequently, a relatively homogeneous population of human
alveolar type II cells from two different human iPSCs clones (C1,
reprogrammed from fetal lung fibroblasts and C2 reprogrammed from
neonatal fibroblasts). Interestingly both iPSC clones yield similar
results and had similar efficiency to differentiate toward DE, AFE,
AETII and AETI cells, suggesting this protocol can be generalized
to other iPSC lines from other sources. Unlike isolated human type
II cells, however, these iPSC-AETII cells are capable of
proliferating for several passages without losing AETII
cell-associated markers, such as SPC, SPA and mucin-1, and can be
used to generate tens of millions of cells with which to seed the
acellular matrix scaffold. The ability to "scale up" a progenitor
population will be particularly valuable when translating these
technologies for use in producing human tissues, and allows for the
possibility of using autologous iPSC derived cells in future lung
bioengineering work.
[0259] Under appropriate culture conditions, iPSC-derived AETII
cells seeded into either rat decellularized lung bioreactors, or
onto decellularized rat or human lung sections, behave similarly to
isolated human type II cells. In these studies, the iPSC-AETII
cells were able to diffusely repopulate alveolar lung structures.
Although the majority of seeded iPSC-AETII cells still showed
approximate AETII morphology, the percentages of T1.alpha. positive
cells increased to approximately 30% within the rat lung matrix
over a 7-day culture period. While not wishing to be bound by any
particular theory, it is possible that this shift in expression is
a differentiating effect of correct cell-matrix interactions.
Although type II cells are differentiated cells, these cells
nonetheless retain a level of plasticity. Following peripheral lung
injury, type II cells undergo proliferation and differentiation
toward the type I phenotype. In fact, type II cells are considered
to be putative alveolar stem cells and are crucial to the natural
regenerative process of the alveoli (Banerjee E R, et al. 2012.
PLoS One 7(3):e33165, Asselin-Labat M L, et al. 2012. Open Biol
2:120094). The interaction between AETII cells and the lung matrix
may have been especially impactful since it is likely that the
AETII cells are still in a progenitor state able to give rise to
T1.alpha. cells when they adhere in regions where native lung
contains type I cells and maintain a type II cell phenotype in
regions where type II cells are typically be found. While not
wishing to be bound by any particular theory, since type I cell
markers were not detected in the majority of the cells cultured
within lung scaffold in bioreactor, it is possible that additional
stimuli, such as cyclic stretch or exposure to an air-liquid
interface, may be necessary to promote expression of more type I
alveolar markers (Gutierrez J A, et al. 1998. Am J Physiol 274(2 Pt
1):L196-202, Ostrowski L E, et al. Expt Lung Res 21 (6) 957-970,
Alcorn D, et al. J Anat 123(Pt 3):649-660). Collectively, the data
presented herein demonstrate that that in vitro lung regeneration
from autologous cells may be a viable strategy for tissue repair
and cell therapy applications.
[0260] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety. While this invention has
been disclosed with reference to specific embodiments, it is
apparent that other embodiments and variations of this invention
may be devised by others skilled in the art without departing from
the true spirit and scope of the invention. The appended claims are
intended to be construed to include all such embodiments and
equivalent variations.
Sequence CWU 1
1
36119DNAArtificial SequenceChemically synthesized 1tccaagccac
actccacga 19219DNAArtificial SequenceChemically synthesized
2ttcctctgga ttccttggg 19319DNAArtificial SequenceChemically
synthesized 3tgggagccga tgacctatg 19419DNAArtificial
SequenceChemically synthesized 4gcctccttgg ccatcttgt
19519DNAArtificial SequenceChemically synthesized 5ggacgtgagc
aagaacatg 19619DNAArtificial SequenceChemically synthesized
6tcgctccagc tcgtacacc 19721DNAArtificial SequenceChemically
synthesized 7ccttcttatc gtggtggtgg t 21822DNAArtificial
SequenceChemically synthesized 8tctccgtgtg tttctggctc at
22921DNAArtificial SequenceChemically synthesized 9agcttctact
ctggtgcaca a 211018DNAArtificial SequenceChemically synthesized
10ggtggctggg aattgaga 181120DNAArtificial SequenceChemically
synthesized 11cctcacttca ctgcactgta 201220DNAArtificial
SequenceChemically synthesized 12caggttttct ttccctagct
201319DNAArtificial SequenceChemically synthesized 13cccagcagac
ttcacatgt 191420DNAArtificial SequenceChemically synthesized
14cctcccattt ccctcgtttt 201521DNAArtificial SequenceChemically
synthesized 15ccaaattctc ctgccagtga c 211622DNAArtificial
SequenceChemically synthesized 16cacgtggttt ccaaacaaga aa
221720DNAArtificial SequenceChemically synthesized 17ccctggtcac
actggctctc 201820DNAArtificial SequenceChemically synthesized
18tcataactgg agggtgtgtc 201919DNAArtificial SequenceChemically
synthesized 19caccgcatct ggagaacca 192021DNAArtificial
SequenceChemically synthesized 20gcccatttcc tcggtgtagt t
212118DNAArtificial SequenceChemically synthesized 21gggagcggtg
aagatgga 182222DNAArtificial SequenceChemically synthesized
22tcatgttgct cacggaggag ta 222318DNAArtificial SequenceChemically
synthesized 23ggcgcagcag aatccaga 182418DNAArtificial
SequenceChemically synthesized 24ccacgacttg cccagcat
182521DNAArtificial SequenceChemically synthesized 25gttatgttgc
tggacatggg t 212622DNAArtificial SequenceChemically synthesized
26gaagccgtga cagaatgact ac 222719DNAArtificial SequenceChemically
synthesized 27gctcctacga ctattgccc 192819DNAArtificial
SequenceChemically synthesized 28cgtattcctt gcttgccct
192924DNAArtificial SequenceChemically synthesized 29attgcagtgg
ttatcatcgg agtg 243024DNAArtificial SequenceChemically synthesized
30ctcgttgttg gagttcagaa gtgg 243120DNAArtificial SequenceChemically
synthesized 31tttcttaccc aagccactgc 203221DNAArtificial
SequenceChemically synthesized 32ttctcttcat attcctggtg g
213321DNAArtificial SequenceChemically synthesized 33aaacgccagt
aagtgacaga g 213421DNAArtificial SequenceChemically synthesized
34atatctgcat ggaaggtgaa t 213523DNAArtificial SequenceChemically
synthesized 35gacaacagcc tcaagatcat cag 233623DNAArtificial
SequenceChemically synthesized 36atggcatgga ctgtggtcat gag 23
* * * * *