U.S. patent application number 13/893821 was filed with the patent office on 2014-04-10 for method for producing yeast expressed hpv types 6 and 16 capsid proteins.
This patent application is currently assigned to Novartis Vaccines and Diagnostics, Inc.. The applicant listed for this patent is Novartis Vaccines and Diagnostics, Inc.. Invention is credited to Giuliano Bensi, Daniela Tornese Buonamassa, Cesira L. Galeotti, Catherine E. Greer, Roberto Petracca.
Application Number | 20140099719 13/893821 |
Document ID | / |
Family ID | 37018857 |
Filed Date | 2014-04-10 |
United States Patent
Application |
20140099719 |
Kind Code |
A1 |
Buonamassa; Daniela Tornese ;
et al. |
April 10, 2014 |
METHOD FOR PRODUCING YEAST EXPRESSED HPV TYPES 6 AND 16 CAPSID
PROTEINS
Abstract
Mosaic VLPs of viral capsid proteins from different virus types
are described, as are methods of making the same. Specifically, a
diploid yeast strain that coexpresses the L1 and L2 capsid proteins
of both HPV-6 and HPV-16 as mosaic VLPs is described. The mosaic
VLPs induced the production of conformational antibodies against
both L1 proteins upon administration to mice.
Inventors: |
Buonamassa; Daniela Tornese;
(Siena, IT) ; Greer; Catherine E.; (Oakland,
CA) ; Galeotti; Cesira L.; (Montegriggioni, IT)
; Bensi; Giuliano; (Firenze, IT) ; Petracca;
Roberto; (Siena, IT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novartis Vaccines and Diagnostics, Inc. |
Emeryville |
CA |
US |
|
|
Assignee: |
Novartis Vaccines and Diagnostics,
Inc.
Emeryville
CA
|
Family ID: |
37018857 |
Appl. No.: |
13/893821 |
Filed: |
May 14, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13005265 |
Jan 12, 2011 |
|
|
|
13893821 |
|
|
|
|
12316310 |
Dec 11, 2008 |
7897155 |
|
|
13005265 |
|
|
|
|
11404063 |
Apr 13, 2006 |
7494787 |
|
|
12316310 |
|
|
|
|
09762762 |
Apr 9, 2001 |
7112330 |
|
|
PCT/US99/18016 |
Aug 13, 1999 |
|
|
|
11404063 |
|
|
|
|
60096625 |
Aug 14, 1998 |
|
|
|
Current U.S.
Class: |
435/471 ;
435/235.1; 435/254.2; 435/254.21 |
Current CPC
Class: |
C12N 2710/20023
20130101; C12N 2800/108 20130101; C12N 7/00 20130101; C12N 15/81
20130101; C07K 2319/00 20130101; C12N 2800/102 20130101; A61K
2039/5258 20130101 |
Class at
Publication: |
435/471 ;
435/254.2; 435/254.21; 435/235.1 |
International
Class: |
C12N 15/81 20060101
C12N015/81 |
Claims
1. A diploid cell comprising vectors for expressing capsid proteins
from at least two Human Papilloma Viruses (HPV), wherein said at
least two HPVs are HPV type 6 and HPV type 16, wherein the capsid
proteins comprise a late 1 (L1) capsid protein from HPV type 6, an
L1 capsid protein from HPV type 16, a minor capsid protein late 2
(L2) from HPV type 6 and an L2 capsid protein from HPV type 16.
2. The diploid cell of claim 1, wherein the cell is a yeast
cell.
3. The diploid cell of claim 2, wherein the yeast is Saccharomyces
cerevisiae.
4. A method for producing a diploid cell according to claim 1
comprising: a) cloning said capsid proteins into expression
cassettes comprising the same promoters and termination sequences;
and b) expressing said cassettes in the same diploid cell.
5. The method of claim 4, wherein the diploid cell is a yeast
cell.
6. The method of claim 5, wherein the yeast is Saccharomyces
cerevisiae.
7. The method of claim 4, wherein the L1 expression cassettes are
cloned into non-integrative vectors, and the L2 expression
cassettes are cloned into integrative vectors.
8. The method of claim 7 wherein the non-integrative vector is
pBS24. 1.
9. The method of claim 7 wherein the integrative vector is
pUC8.
10. A method for producing a virus-like particle (VLP) comprising:
(a) cloning capsid proteins that comprise a late 1 (L1) capsid
protein from HPV type 6, an L1 capsid protein from HPV type 16, a
minor capsid protein late 2 (L2) from HPV type 6 and an L2 capsid
protein from HPV type 16 into expression cassettes comprising the
same promoters and termination sequences; and (b) expressing the
cassettes in the same diploid cell.
11. The method of claim 10 wherein the diploid cell is a yeast
cell.
12. The method of claim 11 wherein the yeast is Saccharomyces
cerevisiae.
13. The method of claim 10 wherein said L1 expression cassettes are
cloned into non-integrative vectors, and said L2 expression
cassettes are cloned into integrative vectors.
14. The method of claim 13 wherein the non-integrative vector is
pBS24. 1.
15. The method of claim 13 wherein the integrative vector is pUC8.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a Continuation of Ser. No.
13/005,265, filed Jan. 12, 2011, which is a Continuation of Ser.
No. 12/316,310, filed Dec. 11, 2008, now U.S. Pat. No. 7,897,155,
which is a Continuation of Ser. No. 11/404,063, filed Apr. 13,
2006, now U.S. Pat. No. 7,494,787, which is a Divisional of Ser.
No. 09/762,762, filed Apr. 9, 2001, now U.S. Pat. No. 7,112,330,
which is a 371 filing of PCT/US99/18016, filed Aug. 13, 1999 which
claims the benefit of Provisional Ser. No. 60/096,625, filed Aug.
14, 1998, from which applications priority is claimed pursuant to
35 U.S.C .sctn..sctn.119/120, and which applications are
incorporated herein by reference in their entireties.
FIELD OF THE INVENTION
[0002] The present invention is related to the production of mosaic
virus-like particles comprising capsid proteins of human papilloma
virus (HPV) types 6 and 16 capable of inducing immune response
against both HPV types.
BACKGROUND OF THE INVENTION
[0003] A promising strategy to induce an immune response capable of
neutralizing papillomavirus (PV) infections is the use of virus
capsid proteins as antigens. In the case of genital human
papillomaviruses (HPVs), this approach was hampered by the lack of
any in vivo or in vitro source of sufficient amounts of native
virus. In order to overcome this problem, heterologous expression
systems have been extensively used to obtain large quantities of
capsid proteins and to allow the analysis of their structural and
immunological properties. Expression of the major capsid protein
late 1 (L1) from different PV types using prokaryotic (25),
baculovirus (21, 23, 37, 41, 42, 46), yeast (14, 18, 19, 20, 29)
and mammalian expression systems (15, 16, 51), demonstrated that
this protein can self-assemble into virus-like particles (VLPs).
Coexpression of the minor capsid protein late 2 (L2) is not
strictly necessary to obtain VLPs, although its presence increases
the efficiency of particle formation (15, 22, 51) and induces
anti-L2 neutralizing antibodies (32). The L1 and L2 VLPs appear
similar to native virions by electron microscopy (EM). The use of
different animal models has shown that VLPs can be very efficient
at inducing a protective immune response.
[0004] VLPs meet many of the criteria which make them ideal
surrogates of native virions. They resemble infectious particles by
ultrastructural analysis (16), elicit virus neutralizing antibodies
and bind to the putative receptor on the surface of mammalian cells
(28, 31, 33, 44, 47). Most notably, the results obtained with
animal models demonstrated that prophylactic immunization with VLPs
Can be very effective in vivo. Cottontail rabbits, calves and dogs
immunized with L1 VLPs were protected from subsequent challenge
with the homologous PV (20, 23, 41) and passive transfer of immune
sera conferred protection to naive animals (20, 41), indicating
that an antibody-mediated response plays a major role in preventing
virus infection.
[0005] Studies with infectious HPV virions, as well as VLPs of
different HPV types, strongly suggested, however, that the immune
response is predominantly type-specific. Further, the efficacy of
VLP-based anti-HPV vaccine candidates cannot be evaluated in
animals since these viruses exhibit a high degree of species
specificity. Antibody-mediated virus neutralization has been
therefore studied using either in vitro assays (35, 40) or
xenograft systems which allow propagation of infectious virus of
specific HPV types (1, 2, 5, 6, 24). The primary conclusion which
could be drawn from these experiments was that immunization with
HPV VLPs evokes a neutralizing immune response which is
predominantly type-specific (6, 7, 34, 35, 36, 48).
[0006] Cross-neutralization has been reported between HPV-6 and
HPV-11 (92% amino acid sequence identity) (8) and between HPV-16
and HPV-33 (80% amino acid sequence identity) (48). This may
indicate the existence of some correlation between protein
sequences and structural similarities that could possibly be
relevant for the mechanism of capsid assembly. On the basis of
these considerations, however, the concept that HPV-6 and HPV-16 L1
proteins may coassemble is not obvious, since the two viruses
belong to phylogenetically more distant groups (3, 45) and exhibit
a lower (67%) L1 amino acid sequence identity.
[0007] Further, while envelope proteins of viruses belonging to
very different families can be incorporated into the same envelope
(50), nucleocapsid protein mixing appears to be much more
restricted. Mixed core particles between Moloney murine leukaemia
virus (MuLV) and human immunodeficiency virus (HIV) have been
obtained but only when artificial chimeric Gag precursors,
containing both HIV and MuLV determinants are coexpressed with
wild-type MuLV Gag proteins (10). By using a yeast two-hybrid
system based on GAL4-Gag fusion protein expression plasmids, Franke
et al. were able to show that the ability of two heterologous Gag
proteins to multimerize was correlated with the genetic relatedness
between them (13).
[0008] Mixed capsid formation between wild-type Gag proteins has
not been reported so far. In the case of the hepadnavirus core (C)
protein, Chang et al. (4) have shown that an epitope-tagged
truncated hepatitis B virus (HBV) C polypeptide could coassemble in
Xenopus oocytes with woodchuck hepatitis virus (WHV) and ground
squirrel hepatitis virus (GSHV) C proteins but not with that of
duck hepatitis B virus (DHBV). This result was not unexpected since
the two core protein sequences have diverged significantly and do
not show immunological cross-reactivity. When coassembly of C
polypeptides of HBV, WHV and GSHV occurred, formation of mixed
capsids resulted from the aggregation of different species of
homodimers (4).
[0009] Several reports have discussed the importance of disulfide
bonds for the integrity of native bovine papillomavirus type 1
(BPV-1) virions (26) and VLP structures (25, 38, 39). Li et al.
(26) have also shown that the cysteine 424 mutant (C424) of HPV-11
L1 in the carboxy-terminal domain that has been identified as
critical for capsid formation (25), is still able to form
capsomeres but not VLPs, indicating that this residue may be
involved in interpentamer bonding. The essential role of disulfide
bonds has been confirmed by a single point mutation of either C176
or C427 in HPV-33 L1 (C428 in HPV-18 L1), which converts all VLP
trimers into monomers, allowing capsomere formation but not VLP
assembly (39).
[0010] It has been recently proved that, by using an in vitro
infection system and a sensitive reverse transcriptase PCR-based
assay (RT-PCR), antisera to HPV-6 VLPs are not able to neutralize
authentic HPV-16 virions (48). Since cysteine residues
corresponding to those described as involved in disulfide bonding
above are conserved in the HPV-6 and HPV-16 L1 proteins, we
hypothesized that mosaic VLPs could either result from
intra-capsomeric or inter-capsomeric association of the two
proteins and/or from interaction between type-specific subsets of
capsomeres.
SUMMARY OF THE INVENTION
[0011] In one aspect, the present invention relates to a method for
producing mosaic virus like particles comprising the capsid
proteins from at least two types of viruses, preferably animal,
more preferably HPV. In a preferred aspect, the capsid proteins are
from HPV types 6 and 16. In a further preferred aspect, the capsid
proteins are L1 and L2 from HPV types 6 and 16.
[0012] In a further aspect, the present invention relates to
vectors and hosts for expressing the capsid proteins of at least
two types of viruses, preferably animal, more preferably HPV. In a
preferred aspect, the capsid proteins are from HPV types 6 and 16.
In a further preferred aspect, the capsid proteins are L1 and L2
from HPV types 6 and 16. In a further preferred aspect, the present
invention relates to a diploid yeast strain that coexpresses the L1
and L2 capsid proteins of HPV-6 and HPV-16 as mosaic VLPs.
[0013] In another aspect, the present invention relates to a method
for inducing an immune response against more than one type of virus
using mosaic VLPs comprising capsid proteins from each virus type.
In a preferred aspect, the mosaic VLPs comprise capsid proteins
from animal viruses, more preferably HPV, most preferably HPV types
6 and 16. In a further preferred aspect, the mosaic VLPs comprise
the L1 and L2 capsid proteins from HPV types 6 and 16.
[0014] In still another aspect, the present invention relates to an
immunogenic virus like particle comprising capsid proteins from
different types of viruses, preferably animal, more preferably HPV,
most preferably HPV types 6 and 16. In a further preferred aspect,
the mosaic VLPs comprise the L1 and L2 capsid proteins from HPV
types 6 and 16.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 is a schematic of the construction of the pBS-6L1
plasmid.
[0016] FIG. 2 depicts the recombinant PCR performed in constructing
the pBS-6L1 plasmid.
[0017] FIG. 3 depicts a Western blot analysis of cell extracts from
yeast strains expressing HPV-6 and HPV-16 capsid proteins.
Equivalent amounts of total cell extracts from the parental JSC310
strain (lanes 1) and different recombinant strains (lanes 2 and 3)
were separated by 10% SDS-PAGE, electrotransferred to
nitrocellulose filters and incubated with the H6.C6 (a) or the
H16.H5 (c) type-specific anti-L1 Mabs, and with HPV-6L2 (b) or
HPV-16L2 (d) antisera. Lanes 2a and 2c: JSC310-6L1epi; lanes 3a and
3c: JSC310-16L1epi; lanes 2b and 2d: JSC310-6L2epi; lanes 3b and
3d: JSC310-16L2epi. Molecular mass standards (in kDa) are
indicated. This multipanel figure and those which follow have been
assembled by using Photoshop 4.0 and FreeHand 7.0 programs for
Macintosh.
[0018] FIG. 4 is a schematic representation of the yeast
integrative plasmids YlpAde (a) and YTpLys-L2 (b) vectors. The
continuous lines represent pUC vector sequences. The empty box in
(a) represents the adenine 2 gene sequence. The black boxes in (b)
represent lysine 2 gene fragments, the grey box represents the L2
gene, the empty boxes represent the ADH2/GAP hybrid promoter and
the MF.alpha. gene transcriptional termination sequence. The arrow
in the L2 box indicates the 5'-3' orientation of the coding
sequence. Relevant restriction sites are indicated.
[0019] FIG. 5 depicts a Western blot analysis of cellular extracts
from recombinant haploid and diploid yeast strains. Total cell
extracts were separated by 10% SDS-PAGE, electrotransferred to
nitrocellulose filters and incubated with anti-HPV-6 L1 (a) and
anti-HPV-16 L1 (c) Mabs and with HPV-6 L2 (b) and HPV-16 L2 (d)
antisera. Lanes 1: AB110-6L1/16L2; lanes 2: JSC310-16L1/6L2; lanes
3: AB/JS-4L; lanes 4: JSC310-6L2epi; lanes 5: JSC310-16L2epi.
Arrows in (b) and (d) indicate the bands corresponding to the L2
proteins. Molecular mass standards (in kDa) are indicated.
[0020] FIG. 6 depicts an analysis of fractions from CsCl gradient
sedimentation of AB/JS-4L cell extract. (A) Aliquots from fractions
1 to 9 were blotted onto nitrocellulose filters using either (a and
c) denaturing and reducing (D) or (b and d) nondenaturing and
nonreducing (N) conditions. The filters were incubated with the
type-specific anti-L1 H6.C6 (a) and H16.H5 (c) Mabs, and with the
conformationally dependent type-specific anti-L1 H6.B 10.5 (b) and
H16.V5 (d) Mabs. As a control, the anti-HPV-6 and HPV-16 L1
conformational Mabs were incubated with CsCl purified VLPs (e)
blotted under either denaturing or nondenaturing conditions. The
arrows in A indicate fraction no. 5. (B) Aliquots of fraction no. 5
were subjected to SDS-PAGE, electroblotted on nitrocellulose
filters and incubated either with HPV-6 L2 (lane 3a) or HPV-16 L2
(lane 3b) antiserum. As a control, total cell extracts from the
JSC310-6L2epi (lanes 1) and JSC310-16L2epi (lanes 2) strains were
used. Molecular mass standards (in kDa) are indicated. Arrows
indicate bands corresponding to the L2 proteins.
[0021] FIG. 7 depicts an electron microscope (EM) analysis of CsCl
purified VLPs. HPV-6 (a), BPV-16 (b) and HPV-6/16 VLPs were
adsorbed onto Formvar-carbon coated grids, stained with 4% uranyl
acetate and examined under a Zeiss EM10C microscope at a
magnification of .times.100,000 (Bar=100 nm).
[0022] FIG. 8 depicts a Western blot analysis of immunoprecipitated
VLPs. CsCl banded VLPs from the AB/JS-4L diploid strain were
immunoprecipitated with the anti-HPV-6 L1 conformationally
dependent H6.B10.5 Mab. The immunoprecipitated proteins were
separated using a 15 centimeter (cm) long 10% polyacrylamide
SDS-gel, electroblotted on nitrocellulose membrane and incubated
either with the anti-HPV-6 .mu.l specific H6.C6 Mab (a) or with the
anti-HPV-16 L1 specific H16.H5 Mab (b). Control reactions,
including either VLPs or the conformational Mab only, were set up
and processed under identical experimental conditions. Lane 1: VLPs
incubated overnight without the Mab; lane 2: Mab incubated
overnight; lane 3: VLPs incubated overnight with the H6.B 10.5
conformational Mab; lane 4: total cell extract from the
JSC310-6L1epi strain; lane 5: total cell extract from the
JSC310-16L1epi strain. Arrows indicate a conformational Mab-derived
band (A), the L1 bands (B) and a protein A Sepharose-derived band
(C).
[0023] FIG. 9 depicts a characterization of sera derived from mice
immunized with HPV-6, HPV-16 and mosaic VLPs. (A) Comparable
amounts of HPV-6 (lanes 1), HPV-16 (lanes 2) and mosaic VLPs (lanes
3) were separated on SDS-PAGE and immunoblotted with antisera from
mice immunized with HPV-6 VLPs (a) HPV-16 VLPs (b) and mosaic VLPs
(c). (B) Comparable amounts of HPV-6 and HPV-16 VLPs were
dot-blotted under denaturing and reducing (D) and nondenaturing and
nonreducing (N) conditions and incubated with the S16 antiserum of
a mice immunized with mosaic VLPs.
DETAILED DESCRIPTION OF THE INVENTION
[0024] To test the possibility of inducing antibodies against
multiple HPV types, we have generated a recombinant yeast diploid
strain that coexpresses the HPV-6 and HPV-16 L1 and L2 genes.
HPV-6/16 mosaic VLPs were purified from the cell lysate and used as
antigens to immunize mice. The data presented below supports the
formation of mosaic VLPs comprising all four proteins. The
immunoprecipitation experiment strongly suggests that the CsCl
purified VLPs represent the result of a reciprocal interaction of
the two L1 proteins, rather than the simple coexistence of
different VLP types. The fact that the L2 proteins are present in
the same CsCl fractions favors the hypothesis that they are
incorporated into the VLPs as well, since the L2 protein alone does
not band in a CsCl gradient at the same density as L1 VLPs (22).
Further, antisera able to recognize conformational epitopes of both
L1 proteins were obtained. Although it remains to be confirmed that
the immune response elicited by HPV-6/16 VLPs can neutralize the
two viruses, the data herein supports using mosaic VLPs to immunize
against a broader spectrum of virus types.
[0025] A yeast expression system as herein disclosed is preferred.
Different laboratories have observed that a Saccharomyces
cerevisiae expression system can be successfully used to easily
purify PV VLPs (14, 18) which are highly efficient at inducing a
protective immune response in animal models (20). Yeast-expressed
VLPs are able to elicite a specific immune response not only at
systemic but also at mucosal level. Lowe et al. have reported the
generation of IgG neutralizing antibodies in the sera and genital
secretions of African green monkeys immunized intramuscularly with
HPV-11 VLPs, adsorbed to aluminum adjuvant (27). Greer et al. have
observed the induction of anti-L1 specific IgG and IgA antibodies
in the sera and genital secretions of mice immunized intranasally
with HPV-6 VLPs, adjuvanted either with E. coli heat-labile
enterotoxin (LT) or with a LT-derived non toxic mutant (14).
Further, yeast expression affords the potential to scale-up to
thousands of liters at relatively low cost and many yeast-derived
products for human use are already market approved due to their
safety.
[0026] To express the HPV-6 and HPV-16 L1 and L2 genes in the same
yeast cell, we generated a S. cerevisiae diploid strain by mating
two haploid strains, each expressing two of the four capsid
proteins. In order to obtain expression of the heterologous genes
under identical culture conditions, each of them was cloned into
the same expression cassette based on the ADH2/GAP
glucose-repressible hybrid promoter and the T.sub.MF.alpha.
transcriptional termination sequence. The HPV-6 and HPV-16 L1
proteins were expressed by means of the episomal expression vector
pBS24.1. Expression of the HPV-6 and HPV-16 L2 proteins was instead
obtained by cloning the expression cassette into an integrative
plasmid suitable for insertion into the lys2 locus of the haploid
strain genome (FIG. 4b). As a consequence of this cloning strategy,
the L1 and L2 gene copy numbers in the haploid strains were
different and this resulted in higher expression levels of the L1
proteins. This should resemble the ratio of L1 to L2 observed in
native HPV virions, which has been estimated over a range from 5:1
to 30:1 (25). Table 1 lists the parental yeast strains used, the
two recombinant haploid strains obtained and the diploid strain
resulting from the mating.
TABLE-US-00001 TABLE 1 List of parental and recombinant yeast
strains with genotypes and HPV expressed genes Episomal Integrated
Yeast strain Genotype HPV gene HPVgene JSC310 MATa leu2-3 ura3-52
prb1-1122 pep4-3 prc1-407 adr1::DM15 cir.sup.o AB110 MAT.alpha.
leu2-3-112 ura3-52 pep4-3 his4-580 cir.sup.o JSC310-6L1epi MATa
prb1-1122 pep4-3 prc1-407 adr1::DM15 cir.sup.o 6L1 JSC310-16L1epi
MATa prb1-1122 pep4-3 prc1-407 adr1::DM15 cir.sup.o 16L1
JSC310-6L2epi MATa prb1-1122 pep4-3 prc1-407 adr1::DM15 cir.sup.o
6L2 JSC310-16L2epi MATa prb1-1122 pep4-3 prc1-407 adr1::DM15
cir.sup.o 16L2 JSC310-6L2int MATa leu2-3 ura3-52 prb1-1122 lys2
pep4-3 prc1-407 adr1::DM15 cir.sup.o 6L2 AB110-16L2int MAT.alpha.
leu2-3-112 ura3-52 pep4-3 lys2 his4-580 cir.sup.o 16L2
JSC310-16L1/6L2 MATa prb1-1122 lys2 prc1-407 pep4-3 ade2 adr1::DM15
cir.sup.o 16L1 6L2 AB110-6L1/16L2 MAT.alpha. pep4-3 lys2 his4-580
cir.sup.o 6L1 16L2 AB/JSC-4L MATa/MAT.alpha.PRB1/prb1-1122
lys2/lys2 PRC1/prc1-407 pep4-3/pep4-3 6L1-16L1 6L2-16L2
HIS4/his4-580 ADR1/adr1::DM15 cir.sup.o
[0027] As used herein, the term "mosaic VLP" refers to a VLP
comprising capsid proteins from more than one type of virus. VLPs
which result from intra- and/or inter-capsomeric association of the
proteins are included.
[0028] As used herein, the term "type" in reference to viruses
includes viruses (animal and plant) within the same family, group,
or genus as well as viruses in different families, groups, or
genuses.
[0029] As used herein, the term "non-integrative" in reference to a
vector indicates that the vector does not integrate into the host
DNA.
Yeast Strains.
[0030] The Saccharomyces cerevisiae haploid strains used were
JSC310 (MATa, leu2-3, ura3-52, prb1-1122, pep4-3, prc1-407,
adr1::DM15, cir.sup.o) (17) and AB110 (MAT.alpha., leu2-3-112,
ura3-52, pep4-3, his4-580, cir.sup.o) (43), provided by Vicky Hines
(Chiron Corporation, Emeryville, Calif., USA).
Monoclonal and Polyclonal Antibodies.
[0031] The H6.C6 and H16.H5 monoclonal antibodies (Mabs), which
bind to denatured HPV-6 and HPV-16 L1 proteins, respectively, in
addition to the H6.B 10.5 and H16.V5 Mabs, specific for HPV-6 and
HPV-16 intact VLPs, have been reported by Christensen et al. (8,
9). For Western blot analysis, these Mabs were used at 1:3000
dilution with a 4.degree. C. overnight incubation. HPV-16 L2 rabbit
antiserum was a gift of Lutz Gissmann (DKFZ, Heidelberg, Germany),
while HPV-6 L2 rabbit antisera were kindly provided by Denise
Galloway (Fred Hutchinson Cancer Research Center Seattle, Wash.)
and Robert C. Rose (University of Rochester, N.Y.). All the
antisera were used at 1:3000-5000 dilution with a 4.degree. C.
overnight incubation. Anti-rabbit and anti-mouse
peroxidase-conjugated antibodies were from Biosource International
(Camarillo, Calif.) and were used at 1:5000 dilution at room
temperature for 1.5 hours.
Example 1
HPV Type-Specific Detection of Capsid Proteins Expressed in
Yeast
[0032] A single yeast strain which could express the four HPV-6 and
HPV-16 L1 and L2 capsid proteins was prepared. A necessary tool in
achieving this was the availability of antibodies which reacted
specifically or preferentially with the L1 or the L2 protein of
only one HPV type. The HPV-6 and HPV-16 L1 and L2 genes were cloned
in the episomal vector pBS24.1 (see Example 2 below) and expressed
in the S. cerevisiae strain ISC310 to test the type specificity of
the available antibodies. FIG. 3 shows the results of a Western
blot analysis of total cell extracts prepared from the recombinant
strains incubated with specific anti-HPV-6 (a) or HPV-16 (c) L1
Mabs and with HPV-6 (b) or HPV-16 (d) L2 antisera. In all cases HPV
type-specific bands were detected, although a weak cross-reactivity
could be seen for both the L2 antisera. While the HPV-6 and HPV-16
L1 Mabs identified proteins with the expected molecular weight of
about 55 kilodalton (kDa), the L2 proteins, as previously reported
(11, 12), showed an electrophoretic mobility corresponding to
approximately 72-75 kDa, instead of the 55 kDa predicted on the
basis of their amino acid sequences.
Example 2
Construction of Recombinant Plasmids
[0033] DNA fragments encoding the HPV proteins were obtained from
available recombinant plasmids, either by restriction enzyme
digestion or by PCR amplification (Expand High Fidelity PCR System,
Boehringer Mannheim), and they were completely sequenced using an
Applied Biosystem (Norvalk, CELLTECH, USA) model 373 DNA
sequencer.
[0034] The episomal yeast expression vector pBS24.1, a yeast
"shuttle" vector (17 and Philip J. Barr, Chiron Corporation,
Emeryville, Calif., USA), containing the leucine 2 (Leu2) and
uracil 3 (Ura3) selectable genes was used. In this instance, it was
obtained by digesting an available pBS24.1 at6E7 plasmid With Bam
HI and Sal I. The pBS24.1.DELTA.t6E7 plasmid was prepared for the
yeast expression of the HPV-6E7 antigen in a secreted form.
[0035] The pBS-6L1 plasmid, expressing the HPV-6 L1 protein under
the control of the
alcohol-dehydrogenase-2-glyceraldehyde-3-phosphate-dehydrogenase
(ADH2/GAP) glucose repressible promoter (J. Shuster, Chiron
Corporation, Emeryville, Calif., USA) and the mating type alpha
factor gene transcriptional termination sequence (T.sub.MF.alpha.)
was derived from the pBS24.1 plasmid as follows.
[0036] The plasmid pBS-6L1 is a yeast expression vector which
contains the HPV-6L1 under the control of the ADH2\GAP promoter
cloned into BAM HI and Sal I sites of the vector pBS24.1. The
vector pBS24.1 contains the .alpha.-factor terminator, therefore an
"expression cassette" for HPV-6 L1 is obtained. The "expression
cassette" for HPV-6L1 consists of the following sequences fused
together (from 5' to 3'): ADH2\GAP hybrid promoter, HPV-6L1 gene,
and .alpha.-factor terminator. At the end of the cloning procedures
the above "expression cassette" was obtained into the pBS24.1 (17).
The vector pB524.1 may be replicated both in Escherichia coli and
in Saccharomyces cerevisiae since it contains PBR322 sequences
(including the origin of replication and the ampicillin resistance
gene) and the complete 2.mu. sequences (including the origin of
replication). It also contains the yeast URA3 gene and the yeast
LEU2 gene.
[0037] A summary of the construction of plasmid pBS24.1-A/G-6L1 is
presented schematically in FIG. 1. Due to the lack of suitable
restriction sites, the fusion between the glucose repressible
ADH2\GAP promoter and the L1 ORF has been obtained by means of
recombinant PCR. The 1-563 bp segment of the hybrid promoter (1113
bp long) is derived from GAG.alpha.t6E7 plasmid whilst the 564-1113
bp are derived from PCR amplification of Gga plasmid (see below).
The 1-115 bp segment of L1 sequence (1503 bp long) is derived from
PCR amplification of the pAcC13-6L1 plasmid (Greer et al., J. Clin.
Microbiology, 2058-2063, 1995 and Munemitsu et al., Mol. Cell.
Biol., 10:5977-5982, 1990), whilst the 116-1503 bp segment is
derived from pAcC13-6L1 plasmid directly. The DNA sequence of HPV 6
is reported in Schwarz et al., EMBO J., 2:2341-2348, 1983.
[0038] The GAG.alpha.t6E7 plasmid is a derivative of pGEM-3z
(Promega) vector in which the following sequence was constructed
(from 5' to 3'): ADH2\GAP promoter, an .alpha.-factor derived
leader sequence, and the HPV-6E7 coding sequence. The
GAG.alpha.t6E7 plasmid was digested with Bcl I and Xba I. The DH5a
derived plasmid DNA could not be cut with Bcl I because the
DH5.alpha. cells are dam+, but the Bcl I enzyme is inhibited by
overlapping dam methylation; in order to obtain a Bcl I digestible
DNA the plasmid was transformed in the dam-JM110 E. coli cells
(Stratagene). The JM110 derived plasmid was digested with Bcl I and
Xba I, the fragment containing the vector and the 5' half of the
ADH2\GAP promoter was gel purified and set aside for further
ligation.
[0039] The pAcC13-6L1 plasmid was digested with Xba I, the insert
was gel purified and set aside for ligation. The Xba I insert
consisted in the L1 sequence from by 115 to the end of the
sequence, including the stop codon.
[0040] The recombinant PCR is schematically represented in FIG. 2.
The sequences of the primers are listed below.
TABLE-US-00002 SEQ ID NO: 1 RP5
5'-ACTGATAGTTTGATCAAAGGGGCAAAACGTAGGGGC-3' SEQ ID NO: 2 RP6
5'-GTCGCTAGGCCGCCACATGGTGTTTGTTTATGTGTG-3' SEQ ID NO: 3 RP7
5'-AAACACACATAAACAAACACCATGTGGCGGCCTAGC-3' SEQ ID NO: 4 RP8
5'-GCAGTCACCACCCTGTACAGGTGTATTAGTACACTG-3'
[0041] A first PCR was performed using the RP5 and RP6 primers and
the Gga plasmid DNA as template. The Gga plasmid is a pGEM-3z
plasmid derivative obtained in the context of the previous
procedures for the HPV-6E7 cloning in yeast and contains the
ADH2\GAP promoter. The goal of this first PCR was to obtain the
563-1113 bp portion (3' half) of the ADH2\GAP promoter. The RP5
primer overlapped a Bcl I site. A second PCR was performed using
the RP7 and RP8 primers and the pAcC6L1 (Greer et al., 1995)
plasmid as template. The goal of this second PCR was to amplify the
5' end of the L1 sequence from the initiation codon to the bp 543.
The amplified fragment would contain an Xba I site at position 115.
The RP6 and RP7 primers were designed in such a way that the 3' end
of the first PCR product would anneal to the 5' end of the second
PCR product. A third PCR was performed by mixing the first and
second amplimers and the external primers RP5 and RP8. During this
PCR a joining between first and second amplimers would happen and
also an amplification of the joined product.
[0042] The expected 1126 bp product of the third PCR was predicted
to consist in the 563-1113 (3' half) sequence of the ADH2\GAP
promoter joined to the 1-530 (5' end) sequence of the HPV-6L1 ORF.
The final PCR product would have a Bcl I site at the 5' end and an
Xba I site in the L1 portion of the sequence at position 115. The
third PCR product was digested with Bcl I and Xba I and gel
purified. The fragment containing the pGEM-3z vector and the 5'
half of the promoter coming from the Bcl I-Xba I digestion of the
GAG.alpha.t6E7 Plasmid was ligated with the Bcl I-Xba I digested
recombinant PCR product and to the L1 insert coming from the Xba I
digestion of pAcC13-6L1 plasmid.
[0043] After transformation into DH5.alpha. cells, several
transformants were obtained. The miniprep DNAs from 14
transformants were digested using Eco RI. The Eco RI enzyme was
chosen because by using this enzyme it has been possible to verify
both the expected molecular sizes and the correct orientation of
the 6L1 fragment. The 6L1 fragment had identical extremities (such
as Xba I), therefore the probability for the fragment to assume an
opposite orientation was 50%. By using Eco RI the plasmid DNA of
the right clones should give two fragments, 2600 and 2700 bp long.
The miniprep DNA of the n.degree. 8 clone gave a single band on a
first gel but by running the gel much more was possible to resolve
the 2600 and 2700 bp fragments. Also using Sph I it was possible to
have a further indication that the clone n.sup.o8 was good. It was,
thus, assumed that the clone n.sup.o8 contained the correct
pGAG-6L1 plasmid consisting in the pGEM-3z vector containing the
HPV-6 L1 sequence under the control of the ADH2\GAP promoter.
[0044] The ADH2\GAP-HPV-6L1 insert was excised from pGAG-6L1
plasmid by digesting with Bam HI and Sal I, the insert was gel
purified and set aside for further ligation. The promoter-L1
fragment and the pBS24.1 vector were ligated and the product of the
reaction was transformed into DH5.alpha. cells. The miniprep DNAs
from 5 transformants were analyzed by digesting the Bam HI and Sal
I and the clones A, B, C, and E were selected as good clones
exhibiting the right molecular weight pattern.
[0045] A clone was transformed in JSC310 strain of Saccharomyces
cerevisiae by means of electroporation and the cells were plated on
URA-plates. Selected transformants were picked from URA-plates and
streaked on LEU-plates. Single colonies from LEU-plates were
inoculated in LEU-medium. Four clones grown in LEU-medium were
reinoculated in YEPD medium. Cell pellets from the four ISC310-6L1
clones, A, B, C and D were frozen at -20.degree. C. after 24 and 48
hours of growth in YEPD medium on purpose to check L1 protein
expression. Glycerol batches of the four clones were stored at
-80.degree. C.
[0046] The 6L1 yeast cell pellets were glass beads extracted,
soluble and insoluble extracts were separated by means of
centrifugation and prepared for SDS-PAGE analysis. Extracts from a
strain not containing the pBS-6L1 plasmid (JSC310 cells transformed
with pAB24 vector) were also prepared as a negative control. In
Coomassie strained gel and in western immunoblot an induced band
exhibiting the expected molecular weight was visible. A comparison
of the HPV-6L1 expressed in the yeast JSC310 strain and the same
antigen expressed in insect cells showed that the two antigens have
similar molecular weight.
[0047] The DNA portion of the L1 gene deriving from recombinant PCR
(bp 1-115) has been sequenced using the following primer:
TABLE-US-00003 SEQ ID NO: 12 5' TAGTTTTAAAACACCAA 3'.
The primer annealed at the 3' end of the ADH2\GAP promoter, at
position -37 from the L1 start codon. The pGAG-6L1 plasmid (pGEM-3z
containing the ADH2\GAP promoter fused to the L1 sequence) was used
as template. By sequencing it was established that no errors
occurred during the recombinant PCR manipulations nor in the
cloning steps.
[0048] To construct the YIpAde integrative plasmid, a 1,059 bp XbaI
genomic DNA fragment of the S. cerevisiae adenine 2 gene (Ade2) was
amplified by using the PCR oligonucleotide primers 5'AdeE
(5'-GCGGCGAATTCTAGAACAGTTGGTATATTAG-3' SEQ ID NO:5, inserting an
EcoRI site) and 3'AdeP (5'GCGGCCTGCAGGGTCTAGACTC rr r
ICCATATA-3'SEQ ID NO:6, inserting a PstI site). The amplified DNA
fragment was cloned into plasmid pUC8 digested with EcoRI and PstI
and the XbaI sites, included in the amplified DNA fragment, were
used to excise the insert for yeast transformation. To obtain the
integrative YIpLys-L2 expression plasmids, a 1,318 bp genomic DNA
fragment of the S. cerevisiae lysine 2 (Lys2) gene was amplified by
using the PCR oligonucleotide primers 5'LysE
(5'-GCGGAATTCCACTAGTAATTACA-3'SEQ ID NO:7, inserting an EcoRI site)
and 3'LysH (5'-GATGTAAGCTTCTACTAGTTGA-3'SEQ ID NO:8, inserting a
HindIII site). The amplified DNA fragment was then inserted into
pUC8 (derivatives readily available from commercial sources, e.g.,
Promega) digested with EcoRI and HindIII, generating a plasmid
named YIpLys. A BamHI DNA fragment from pSI3 vector (Isabel Zaror,
Chiron Corporation, Emeryville, Calif., USA, pBR322 backbone,
ADH2/GAP promoter, SOD protein, and T.sub.MF.alpha.), including the
ADH2/GAP promoter, the human superoxide dismutase (SOD) gene and
the T.sub.MF.alpha. transcriptional termination sequence, was
cloned into the single BglII restriction site in the Lys2 gene
sequence of YIpLys, obtaining a plasmid named YIpLys-SOD. The
YIpLys-6L2 plasmid was derived from YIpLys-SOD replacing the
NcoI-SalI DNA fragment encoding the SOD gene with the NcoI-SalI DNA
fragment from pGEM3z-6L2 (Kent Thudium, Chiron Corporation,
Emeryville, Calif., USA) encoding the HPV-6b L2 open reading frame
(ORF). To construct the YIpLys-16L2 plasmid, the L2 gene was
amplified from the cloned HPV-16 genomic DNA (kindly provided in
this instance by Dennis J. McCance, University of Rochester, N.Y.)
by using the PCR oligonucleotide primers DT-5'L2
(5'-CGACACAAACGTTCTGCAA-3' SEQ ID NO:9) and DT-3'L2
(5'-ATTAGTCGACCTAGGCAGCCAAGAGACATC-3'SEQ ID NO:10), including the
translation termination codon and a SalI site. The DNA fragment
obtained was digested with SalI and cloned into YIpLys-SOD from
which the SOD coding sequence had been removed by digestion with
NcoI, filling-in with Klenow enzyme and digestion with SalI.
[0049] The pBS-6L2 and pBS-16L2 episomal expression plasmids were
obtained by replacing a SacI-SalI DNA fragment from pBS-6L1,
including part of the ADH2/GAP promoter and the entire HPV-6b L1
ORF, with SacI-SalI DNA fragments, derived from either YIpLys-6L2
or YIpLys-16L2, including the corresponding promoter region and the
L2 ORF.
[0050] To construct the pBS-16L1 episomal expression plasmid, the
L1 gene was amplified from cloned HPV-16 genomic DNA by using the
PCR oligonucleotide primers DT-5'L1 (5'-TCTCTTGGCTGCCTAGTGAGGCCA-3'
SEQ ID NO:11) and DT-3'L1
(5'-CTAGTAATGTCGACTTACAGCTTACGTITTITGCG-3'SEQ ID NO:12), comprising
the translational termination codon and a Sari site. The amplified
DNA fragment was purified from agarose gel and cloned into
blunt-ended pSI3 vector from which the SOD gene had been previously
removed by digestion with NcoI and SalI restriction enzymes and
filling-in with Klenow enzyme. From this intermediate construct, a
SacI-SalI DNA fragment, including part of the ADH2/GAP promoter and
the HPV-16L1 ORF, was purified and used to replace the
corresponding SacI-SalI DNA fragment in pBS-6L1.
Example 3
Generation of Recombinant Yeast Strains
[0051] The strains JSC310-6L1epi (14), JSC310-16L1 epi,
JSC310-6L2epi and JSC310-16L2epi, expressing the four capsid
proteins by means of episomal vectors, were obtained by
transformation of the parental JSC310 strain with the expression
plasmids pBS-6L1 (14), pBS-16L1, pBS-6L2 and pBS-16L2.
[0052] The JSC310-6L2int and the AB110-16L2int strains were
obtained using the following experimental approach. Competent yeast
cells were cotransformed with 5 .mu.g of EcoRI-HindIII digested
YIpLys-6L2 or YIpLys-16L2 integrative plasmid and 1 .mu.g of
pBS24.1 episomal vector to allow the selection of transformants.
Different clones were tested for growth onto plates of minimal
medium (MM) supplemented with .alpha.-adipate to select mutants
with an inactivated Lys2 gene (49). Correct integration into the
Lys2 locus was verified by PCR analysis by using pairs of
oligonucleotide primers complementary to sequences within the
expression cassette and the genomic portion of the Lys2 gene. Among
the colonies expressing the L2 protein, one was chosen, cured of
the pBS24.1 plasmid and tested for the inability to grow in the
absence of uracil and leucine. Introduction of the episomal L1
expressing vectors into these strains was carried out following two
different strategies. AB110-16L2int was transformed with the
pBS-6L1 expression plasmid and selection of transformants on MM
plates without leucine and uracil allowed the isolation of the
haploid strain AB110-6L1/16L2. The JSC310-6L2int strain was instead
cotransformed with the pBS-16L1 expression vector and with the XbaI
digested YIpAde integrative plasmid. Transformants grown on
selective plates were plated on complete yeast extract-peptone
medium (YEP) and allowed to grow at 30.degree. C. for 3-4 days
until colonies (1-2%) developed a red color due to disruption of
the ade2 locus (52). One of the clones, which showed correct
integration into the ade2 locus by PCR and L1 and L2 expression by
Western blot analysis, was designated JSC310-16L1/6L2.
[0053] Generation of the AB/JSC-4L diploid strain was obtained by
mixing cultures, in YEP medium containing 5% glucose, of the two
haploid strains, AB110-6L1/16L2 and JSC310-16L1/6L2. Selection of
the AB/JSC-4L diploid strain required an additional genetic marker
in the haploid JSC310-6L2int strain. This was obtained inactivating
the endogenous Ade2 gene by means of the integration plasmid
represented in FIG. 4a. Diploid cells were selected onto MM plates
lacking histidine and adenine.
[0054] Expression of the four proteins in the haploid strains and
in the strain resulting from their mating was evaluated by Western
blot analysis. FIG. 5 shows the results of such experiments
demonstrating that both the haploid strains AB110-6L1/16L2 (a and
d, lanes 1) and JSC310-16L1/6L2 (b and c, lanes 2) expressed the
heterologous genes and that the expression of all four proteins was
stably maintained in the resulting AB/JS-4L diploid strain (a, b, c
and d, lanes 3).
Example 4
Preparation of VLPs
[0055] Parental yeast strains were grown in complete YEP medium.
Strains transformed with episomal vectors were first cultured in
leucine-deficient MM medium with 4% glucose until they reached
midlog phase. Expression of the genes under the control of the
ADH2/GAP glucose-repressible promoter was induced by diluting these
cultures 1:50 into YEP complete medium and culturing the cells at
30.degree. C. for 2-3 days. Total cell extracts were prepared from
3.5 optical densities (OD) of yeast cell cultures grown to
approximately OD.sub.600=20. Cells were lysed with a 10 minute
incubation on ice in 0.24 N NaOH and 0.96% .beta.-mercaptoethanol,
followed by trichloroacetic acid (TCA) precipitation, ice cold
acetone washing and final suspension of the protein pellet in 100
.mu.l of protein loading buffer. To carry out dot-blot experiments
where preservation of L1 conformation was necessary, yeast cells
were collected, washed, suspended in phosphate-buffered saline
(PBS, pH 7.5) and disrupted by vortexing five times for 1 minute in
the presence of glass beads (425-600 .mu.m, Sigma).
[0056] Frozen yeast cell pellets were thawed in buffer containing
0.1 M Tris-HC1 (pH 7.5), 0.15 M NaCl, 2 mM MgCl.sub.2 and 1 mM EGTA
(#E3889, Sigma Chemical Co.) and Complete.TM.Protease Inhibitors
(#1-697-498, Boehringer Mannheim). Cells were disrupted by
vortexing twice for 10 minutes, with a 5 minute interval on ice, in
the presence of glass beads (0.5 ml beads per ml of cell
suspension) using a VWRbrand Multi-tube vortexer (VWR Scientific
Product). Cellular debris was removed by a 20 minute centrifugation
at 2000.times.g. The supernatants were then centrifuged through a
40% (w/w) sucrose cushion (2 hour centrifugation at
100,000.times.g). The resulting pellets were suspended in PBS,
applied to a pre-formed CsCl gradient (1.17-1.57 g/ml) and
centrifuged for 24 hours at 285,000.times.g. The gradients were
fractionated and aliquots from each fraction were subjected to
Western blot analysis with type-specific anti-L1 and anti-L2
antibodies. Peak fractions were pooled and dialyzed against PBS.
Total protein concentration was determined by BCA.TM. Protein Assay
Reagent (#23225, Pierce Chemicals).
Example 5
Characterization of VLPs
[0057] Proteins were analyzed by denaturing sodium-dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE, 10% polyacrylamide)
and Western blotting onto nitrocellulose membrane (pore size 0.45
.mu.m, MSI, Westborough, Mass. USA) according to standard
protocols. Dot-blot analysis of denatured and reduced VLPs was
carried out boiling the protein samples for 5 minutes in the
presence of dithiothreitol (DTT) before applying them to
nitrocellulose filters using a bio-dot apparatus (Biorad). When
native VLP structure had to be maintained, VLPs in PBS were applied
to the membrane without boiling and in the absence of DTT. Reaction
with HPV-specific antibodies was detected using the Enhanced
Chemiluminescence (ECL) Western blotting reagent (Amersham) and
Hyperfilm ECL (Amersham).
[0058] Specifically, the cell extract from the diploid strain was
subjected to CsCl gradient sedimentation and aliquots of the
collected fractions were boiled in the presence of DTT and blotted
in duplicate onto nitrocellulose filters. The filters were
incubated with anti-HPV-6 and anti-HPV-16 specific Mabs which react
with denatured L1 (8, 9), revealing that the two L1 proteins were
enriched in the same fractions (FIGS. 6A, a and c). The dot-blot
experiment was repeated without denaturing and without reducing the
protein samples and using anti-HPV-6 and HPV-16 L1 specific Mabs
which were previously reported to react exclusively with intact
VLPs in enzyme-linked immunosorbent assay (ELISA) experiments (8,
9). The result obtained confirmed that the two conformationally
dependent Mabs were able to recognize the L1 proteins which
copurified in the CsCl fractions (FIGS. 6A, b and d). As expected,
the two Mabs reacted specifically with HPV-6 and HPV-16 control
VLPs only under nondenaturing and nonreducing conditions (FIG. 6A,
e). Western blot analysis of fraction 5 confirmed that both HPV-6
and HPV-16 L2 proteins were also present (FIGS. 6B, a and b).
Estimation of the refractive index of the identified protein peak
gave a value of 1.29-1.3 mg/ml. EM analysis of the enriched
fraction revealed the presence of VLPs which appeared to be similar
to control VLPs formed by either HPV-6 or HPV-16 L1 (FIG. 7).
[0059] To evaluate whether the HPV-6 and HPV-16 L1 proteins could
interact and assemble into mosaic VLPs, we performed
immunoprecipitation experiments using CsCl banded VLPs and the
specific anti-HPV-6 L1 conformationally dependent Mab H6.B 10.5
(9). Approximately 1 .mu.g of CsCL banded VLPs were diluted with
PBS and incubated with the conformationally dependent anti-HPV-6 L1
Mab H6.B 10.5 (1:1000 dilution) overnight at 4.degree. C. with
gentle shaking. The immune complexes were collected with Protein A
Sepharose CL-4B (Pharmacia Biotech), washed 4 times with 1 ml PBS,
suspended in sample buffer, boiled for 5 minutes, subjected to
SDS-PAGE and analyzed by Western blot using anti-HPV-6 and
anti-HPV-16 L1 Mabs. The Western blot carried out on the
immunoprecipitates using type-specific anti-L1 Mabs (FIG. 8)
identified three major bands: (A) was a Mab-derived band, since it
could be also observed when the conformational Mab was
immunoblotted with the anti-mouse antibody; (B) was a band that
appeared only when the VLPs were incubated with the conformational
anti-HPV-6 L1 Mab (lanes 3), identifying specifically
immunoprecipitated proteins with an electrophoretic mobility
corresponding to that of HPV-6 L1 (a, lane 4) and HPV-16 L1 (b,
lane 5); (C) was a resin-derived band that was also detected when
an aliquot of protein A Sepharose was suspended in PBS and
immunoblotted with the anti-mouse antibody. Bands (B) were not
visible when the immunoprecipitation was carried out using an
unrelated Mab Similarly, HPV-16 L1 could not be detected when HPV-6
and HPV-16 VLPs were mixed and immunoprecipitated.
Example 6
Mouse Immunization with VLPs
[0060] To investigate whether HPV-6/16 mosaic VLPs were able to
induce an immune response directed against both HPV types, groups
of mice were immunized subcutaneously with HPV-6, HPV-16 and mosaic
VLPs and the sera were tested after the third immunization. Six
week old female Balb/c mice were injected subcutaneously with 20
.mu.g of the following purified antigens: (I) VLPs, (ii) HPV-16
VLPs, (iii) HPV-6/16 VLPs. MI the antigens were administered with
equal volume of MF59 adjuvant (30). A group of control mice was
injected only with MF59. The mice were boosted with 15 .mu.g of the
respective antigen at week 3 and 10 .mu.g at week 5. Serum samples
were collected on day 12 after the final booster and assayed for
capsid protein specific antibodies.
[0061] FIG. 9A shows the result of the Western blot carried out
with the three types of denatured VLPs incubated with three sera,
each representative of the different groups of immunized mice.
While the reactivity of the sera from mice immunized either with
HPV-6 or HPV-16 VLPs was predominantly type-specific (FIGS. 9A, a
and b), the serum from mouse 16 (S16), immunized with HPV6/16 VLPs,
reacted against both HPV-6 and HPV-16 L1 (FIG. 9A, c). To analyze
whether the immune response was also directed against
conformational epitopes of the L1 proteins, equal amounts of either
HPV-6 or HPV-16 VLPs were blotted under denaturing and
nondenaturing conditions and incubated with the S16 antiserum. FIG.
9B shows that the signal was significantly lower when the samples
were denatured and reduced, suggesting that conformational
antibodies had been elicited.
[0062] The foregoing examples are meant to illustrate the invention
and are not to be construed to limit the invention in any way.
Those skilled in the art will recognize modifications that are
within the spirit and scope of the invention. All references cited
herein are hereby incorporated by reference in their entirety.
REFERENCES
[0063] 1. Bonnez; W., R. C. Rose, C. da Rin, C. Borkhuis, K. de
Mesy Jensen, and R. C. Reichman. 1993. Propagation of human
papillomavirus type 11 in human xenografts using the severe
combined immunodeficiency (SCID) mouse and comparison to the nude
mouse model. Virology 197:455-458. [0064] 2. Bonnez, W., C. da Rin,
C. Borkhuis, K. de Mesy Jensen, R. C. Reichman, and R. C. Rose.
1998. Isolation and propagation of human papillomavirus type 16 in
human xenografts implanted in the severe Combined immunodeficiency
mouse. J. Virol. 72:5256-5261. [0065] 3. Chan, S. Y., H. U.
Bernard, C. K. Hong, S. P. Chan, B. Hoffmann, and H. Delius. 1992.
Phylogenetic analysis of 48 papillomavirus types and 28 subtypes
and variants: a showcase for the molecular evolution of DNA
viruses. J. Virol. 66:5714-5725. [0066] 4. Chang, C., S. Zhou, D.
Ganem, and D. N. Standring. 1994. Phenotypic mixing between
different hepadnavirus nucleocapsid proteins reveals C protein
dimerization to be cis preferential. J. Virol. 68:5225-5231. [0067]
5. Christensen, N. D., and J. W. Kreider. 1990. Antibody-mediated
neutralization in vivo of infectious papillomavirus. J. Virol.
64:3151-3156. [0068] 6. Christensen, N. D., J. W. Kreider, N. M.
Cladel, S. D. Patrick, and P. A. Welsh. 1990. Monoclonal
antibody-mediated neutralization of infectious human papillomavirus
type 11. J. Virol. 64:5678-5681. [0069] 7. Christensen, N. D., R.
Kirnbauer, J. T. Schiller, S. J. Ghim, R. Schlegel, and J. W.
Kreider. 1994. Human papillomavirus types 6 and 11 have
antigenically distinct strongly immunogenic conformationally
dependent neutralizing epitopes. Virology 205:329-335. [0070] 8.
Christensen, N. D., C. A. Reed, N. M. Cladel, K. Hall, and G. S.
Leiserowitz. 1996. Monoclonal antibodies to HPV-6 L1 virus-like
particles identify conformational and linear neutralizing epitopes
on HPV-11 in addition to type-specific epitopes on HPV-6. Virology
224:477-486. [0071] 9. Christensen, N. D., J. Diliner, C. Eklund,
J. J. Carter, G. C. Wipf, C. A. Reed, N. M. Cladel, and D. A.
Galloway. 1996. Surface conformational and linear epitopes on
HPV-16 and HPV-18 L1 virus-like particles as defined by monoclonal
antibodies. Virology 223:174-184. [0072] 10. Deminie, C. A., and M.
Emerman. 1993. Incorporation of human immunodeficiency virus type 1
Gag proteins into murine leukemia virus virions. J. Virol.
67:6499-6506. [0073] 11. Doorbar, J., and P. H. Gallimore. 1987.
Identification of proteins encoded by the L1 and L2 open reading
frames of human papillomavirus Ia. J. Virol. 61:1131-1142. [0074]
12. Firzlaff, J. M., N. B. Kiviat, A. M. Beckmann, S. A. Denison,
and D. A. Galloway. 1988. Detection of human papillomavirus capsid
antigens in various squamous epithelial lesions using antibodies
directed against the L1 and L2 open reading frames. Virology
164:467-477. [0075] 13: Franke, E. K., H. E. H. Yuan, K. L.
Bossolt, S. P. Goff, and J. Luban. 1994. Specificity and sequence
requirements for interactions between various retroviral Gag
proteins. J. Virol. 68:5300-5305. [0076] 14. Greer K. E., IL
Petracca, B. Gervase, D. Tornese Buonamassa, M. Ugozzoli, A. Di
Tommaso, M. T. De Magistris, G. Van Nest, and G. Bensi. in
preparation. [0077] 15. Hagensee, M. E., N. Yaegashi, and D. A.
Galloway. 1993. Self-assembly of human papillomavirus type 1
capsids by expression of L1 protein alone or by coexpression of the
L1 and L2 capsid proteins. J. Virol. 67:315-322. [0078] 16.
Hagensee, M. E., N. H. Olson, T. S. Baker, and D. A. Galloway.
1994. Three-dimensional structure of vaccinia virus-produced human
papillomavirus type I capsids. J. Virol. 68:4503-4505. [0079] 17.
Hines, V., W. Zhang, N. Ramakrishna, J. Styles, P. Mehta, K. S.
Kim, M. Innis, and D. L. Miller. 1994. The expression and
processing of human beta-amyloid peptide precursors in
Saccharomyces cerevisiae: evidence for a novel endopeptidase in the
yeast secretory system. Cell. Mol. Biol. Res. 40:273-284. [0080]
18. Hofmann, K. J., J. C. Cook, J. G. Joyce, D. R. Brown, L. D.
Schultz, H. A. George, M. Rosolowsky, K. H. Fife, and K. U. Jansen.
1995. Sequence determination of human papillomavirus 6a and
assembly of virus-like particles in Saccharomyces cerevisiae.
Virology 209:506-518. [0081] 19. Hofmann, K. J., M. P. Neeper, H.
Z. Markus, D. R. Brown, M. Muller, and K. U. Jansen. 1996. Sequence
conservation within the major capsid protein of human
papillomavirus (HPV) type 18 and formation of HPV-18 virus-like
particles in Saccharomyces cerevisiae. J. Gen. Virol. 77:465-468.
[0082] 20. Jansen, K. U., M. Rosolowsky, L. D. Schultz, H. Z.
Markus, J. C. Cook, J. J. Donnelly, D. Martinez, R. W. Ellis, and
A. R. Shaw. 1995. Vaccination with yeast-expressed cottontail
rabbit papillomavirus (CRPV) virus-like particles protects rabbits
from CRPV-induced papilloma formation. Vaccine 13:1509-1514. [0083]
21. Kirnbauer, R., G. Booy, N. Cheng, R. R Lowy, and J. T.
Schiller. 1992. Papillomavirus L1 major capsid protein
self-assembles into virus-like particles that are highly
immunogenic. Proc. Natl. Acad. Sci. USA 89:12180-12184. [0084] 22.
Kirnbauer, R., J. Taub, H. Greenstone, R. B. S. Roden, M. Durst, L.
Gissmann, D. R. Lowy, and J. T. Schiller. 1993. Efficient
self-assembly of human papillomavirus type 16 L1 and L1-L2 into
virus-like particles. J. Virol. 67:6929-6936. [0085] 23. Kirnbauer,
R., L. M. Chandrachud, B. W. O'Neil, E. R. Wagner, G. J. Grindlay,
A. Armstrong, G. M. McGarvie, J. T. Schiller, D. R. Lowy, and M. S.
Campo. 1996. Virus-like particles of bovine papillomavirus type 4
in prophylactic and therapeutic immunization. Virology 219:37-44.
[0086] 24. Kreider, J. W., M. K. Howett, A. E.-Leure-Dupree, R. J.
Zaino, and J. A. Weber. 1987. Laboratory production in vivo of
infectious human papillomavirus type 11. J. Virol. 61:590-593.
[0087] 25. Li, M., T. P. Cripe, P. A. Estes, M. K. Lyon, R. C.
Rose, and R. L. Garcea. 1997. Expression of the human
papillomavirus type-11 capsid protein in Escherichia coli:
characterization of protein domains involved in DNA-binding and
capsid assembly. J. Virol. 71:2988-2995. [0088] 26. Li, M., P.
Beard, P. A. Estes, M. K. Lyon, and R. L. Garcea. 1998.
Intercapsomeric disulfide bonds in papillomavirus assembly and
disassembly. J. Virol. 72:2160-2167. [0089] 27. Lowe, R. S., D. R.
Brown, J. T. Bryan, J. C. Cook, H. A. George, K. J. Hofmann, W. M.
Hurni, J. G. Joyce, E. D. Lehman, H. Z. Markus, M. P. Neeper, L. D.
Schultz, A. R. Shaw, and K. U. Jansen. 1997. Human papillomavirus
type 11 (HPV-11) neutralizing antibodies in the serum and genital
mucosal secretions of African green monkeys immunized with HPV-11
virus-like particles expressed in yeast. J. Infect. Dis.
176:1141-1145. [0090] 28. Muller, M., L. Gissmann, R. J. Cristiano,
X. Y. Sun, H. Frazer, A. B. Jenson, A. Alonso, H. Zentgraf, and J.
Zhou. 1995. Papillomavirus capsid binding and uptake by cells from
different tissues and species. J. Virol. 69:948-954. [0091] 29.
Neeper, M. P., K. J. Hofmann, and K. U. Jansen. 1996. Expression of
the major capsid protein of human papillomavirus type 11 in
Saccharomyces cerevisiae. Gene 180:1-6. [0092] 30. Ott, G., G. L.
Barchfeld, D. Chemoff, R. Radakrishnan, P. van Hoogevest and G. van
Nest. 1995. MF59: Design and evaluation of a safe and potent
adjuvant for human vaccines, p. 277-296. In M. F. Powell and M. J.
Newman (ed.), Vaccine design. The subunit and adjuvant approach.
Plenum Press, New York, N.Y. [0093] 31. Qi, Y. M.; S. W. Peng, K.
Hengst, M. Evander, D. S. Park, J. Zhou, and I. A. Frazer. 1996.
Epithelial cells display separate receptors for papillomavirus VLPs
and for soluble L1 capsid protein. Virology 216:35-45. [0094] 32.
Roden, R. B., E. M. Weissinger, D. W. Henderson, F. Booy, R.
Kirnbauer, J. F. Mushinski, D. R. Lowy and J. T. Schiller. 1994.
Neutralization of bovine papillomavirus by antibodies to L1 and L2
capsid proteins. J. Virol. 68:7570-7574 [0095] 33. Roden, R. B., R.
Kirnbauer, A. B. Jenson, D. R. Lowy, and J. T. Schiller. 1994.
Interaction of papillomaviruses with the cell surface. J. Virol.
68:7260-7266. [0096] 34. Roden, R. B. S., H. L. Greenstone, R.
Kirnbauer, F. P. Booy, J. Jessie, D. R. Lowy, and J. T. Schiller.
1996. In vitro generation and type-specific neutralization of human
papillomavirus type 16 virion pseudotype. J. Virol. 70:5875-5883.
[0097] 35. Roden, R. B. S., N. L. Hubbert, R. Kirnbauer, N. D.
Christensen, D. R. Lowy, and J. T. Schiller. 1996. Assessment of
serological relatedness of genital human papillomaviruses by
hemagglutination inhibition. J. Virol. 70:3298-3301. [0098] 36.
Rose, R. C., W. Bonnez, C. da Rin, D. J. McCance, and R. C.
Reichman. 1994. Serological differentiation of human papillomavirus
types 11, 16 and 18 using recombinant virus-like particles. J. Gen.
Virol. 75:2445-2449. [0099] 37. Rose, R. C., W. Bonnez, R. C.
Reichman, and R. L. Garcea. 1993. Expression of human
papillomavirus type 11 L1 protein in insects cells: in vivo and in
vitro assembly of virus-like particles. J. Virol. 67:1936-1944.
[0100] 38. Sapp, M., C. Volpers, M. Muller, and R. E. Streeck.
1995. Organization of the major and minor capsid proteins in human
papillomavirus type 33 virus-like particles. J. Gen. Virol.
76:2407-2412. [0101] 39. Sapp, M., C. Fligge, I. Petzak, J. R.
Harris, and R. E. Streeck. 1998. Papillomavirus assembly requires
trimerization of the major capsid protein by disulfides between two
highly conserved cysteines. J. Virol. 72:6186-6189. [0102] 40.
Smith, L. H., C. Foster, M. E. Hitchcock, G. S. Leiserowitz, K.
Hall, R. Iseroff, N. D. Christensen, and J. W. Kreider. 1995.
Titration of HPV-11 infectivity and antibody neutralization can be
measured in vitro. J. Invest. Dermatol. 105:1-7. [0103] 41. Suzich,
J. A., S. Ghim, F. J. Palmer-Hill, W. I. White, J. K. Tamura, J. A.
Bell, J. A. Newsome, A. Bennet Jenson, and R. Schlegel. 1995.
Systemic immunization with papillomavirus L1 protein completely
prevents the development of viral mucosa papillomas. Proc. Natl.
Acad. Sci. USA 92:1553-11557. [0104] 42. Touze, A., C. Dupuy, D.
Mahe, P. Y. Sizaret, and P. Coursaget. 1998. Production of
recombinant virus-like particles from human papillomavirus type 6
and 11, and study of serological reactivities between HPV 6, 11 and
45 by ELISA: implications for papillomavirus prevention and
detection. FEMS Microbiol. 160: 111-118. [0105] 43. Travis, J., M.
Owen, P. George, R. Carrel, S. Rosenberg, R. A. Hallewell, and P.
J. Barr. 1985. Isolation and properties of recombinant DNA produced
variants of human .alpha..sub.1-proteinase inhibitor. J. Biol.
Chem. 260:4384-4389. [0106] 44. Unckell, F., R. E. Streeck, and M.
Sapp. 1997. Generation and neutralization of pseudovirions of human
papillomavirus type 33. J. Virol. 71:2934-2939. [0107] 45. Van
Ranst, M., J. B. Kaplan, and R. D. Burk. 1992. Phylogenetic
classification of human papillomaviruses: correlation with clinical
manifestations. J. Gen. Virol. 73:2653-2660. [0108] 46. Volpers,
C., P. Schirmacher, R. E. Streeck, and M. Sapp. 1994. Assembly of
the major and the minor capsid protein of human papillomavirus type
33 into virus-like particles and tubular structures in insect
cells. Virology 200:504-512. [0109] 47. Volpers, C., F. Unckell, P.
Schirmacher, R. E. Streeck, and M. Sapp. 1995. Binding and
internalization of human papillomavirus type 33 virus-like
particles by eukaryotic cells. J. Virol. 69:3258-3264. [0110] 48.
White, W. I., S. D. Wilson, W. Bonnez, R. C. Rose, S. Koenig, and
J. A. Suzich. 1998. In vitro infection of type-restricted
antibody-mediated neutralization of authentic human papillomavirus
type 16. J. Virol. 72:959-964. [0111] 49. Zaret, K. S., and F.
Sherman. 1985. .alpha.-Aminoadipate as a primary nitrogen source
for Saccharomyces cerevisiae mutants. J. Bacteriol. 162:579-583.
[0112] 50. Zavada, J. 1982. The pseudotypic paradox. J. Gen. Virol.
63:15-24. [0113] 51. Zhou, J., D. J. Stenzel, X. Y. Sun, and I. H.
Frazer. 1993. Synthesis and assembly of infectious bovine
papillomavirus particles in vitro. J. Gen. Virol. 74:763-768.
[0114] 52. Zimmermann, F. K. 1975. Procedures used in the induction
of mitotic recombination and mutation in the yeast Saccharomyces
cerevisiae. Mutat. Res. 31:71-86.
Sequence CWU 1
1
13136DNAArtificial SequenceDescription of Artificial Sequence
Primer 1actgatagtt tgatcaaagg ggcaaaacgt aggggc 36236DNAArtificial
SequenceDescription of Artificial Sequence Primer 2gtcgctaggc
cgccacatgg tgtttgttta tgtgtg 36336DNAArtificial SequenceDescription
of Artificial Sequence Primer 3aaacacacat aaacaaacac catgtggcgg
cctagc 36436DNAArtificial SequenceDescription of Artificial
Sequence Primer 4gcagtcacca ccctgtacag gtgtattagt acactg
36531DNAArtificial SequenceDescription of Artificial Sequence
Primer 5gcggcgaatt ctagaacagt tggtatatta g 31633DNAArtificial
SequenceDescription of Artificial Sequence Primer 6gcggcctgca
gggtctagac tcttttccat ata 33723DNAArtificial SequenceDescription of
Artificial Sequence Primer 7gcggaattcc actagtaatt aca
23822DNAArtificial SequenceDescription of Artificial Sequence
Primer 8gatgtaagct tctactagtt ga 22919DNAArtificial
SequenceDescription of Artificial Sequence Primer 9cgacacaaac
gttctgcaa 191030DNAArtificial SequenceDescription of Artificial
Sequence Primer 10attagtcgac ctaggcagcc aagagacatc
301124DNAArtificial SequenceDescription of Artificial Sequence
Primer 11tctcttggct gcctagtgag gcca 241235DNAArtificial
SequenceDescription of Artificial Sequence Primer 12ctagtaatgt
cgacttacag cttacgtttt ttgcg 351317DNAArtificial SequenceDescription
of Artificial Sequence Primer 13tagttttaaa acaccaa 17
* * * * *