U.S. patent application number 14/097928 was filed with the patent office on 2014-04-03 for rnai inhibition of ctgf for treatment of ocular disorders.
This patent application is currently assigned to Novartis AG. The applicant listed for this patent is Novartis AG. Invention is credited to lok-Hou Pang, Allan R. Shepard.
Application Number | 20140094502 14/097928 |
Document ID | / |
Family ID | 36218404 |
Filed Date | 2014-04-03 |
United States Patent
Application |
20140094502 |
Kind Code |
A1 |
Shepard; Allan R. ; et
al. |
April 3, 2014 |
RNAi INHIBITION OF CTGF FOR TREATMENT OF OCULAR DISORDERS
Abstract
RNA interference is provided for inhibition of connective tissue
growth factor mRNA expression in ocular disorders involving CTGF
expression. Ocular disorders involving aberrant CTGF expression
include glaucoma, macular degeneration, diabetic retinopathy,
choroidal neovascularization, proliferative vitreoretinopathy and
wound healing. Such disorders are treated by administering
interfering RNAs of the present invention.
Inventors: |
Shepard; Allan R.; (Fort
Worth, TX) ; Pang; lok-Hou; (Grand Prairie,
TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novartis AG |
Basel |
|
CH |
|
|
Assignee: |
Novartis AG
Basel
CH
|
Family ID: |
36218404 |
Appl. No.: |
14/097928 |
Filed: |
December 5, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12901019 |
Oct 8, 2010 |
|
|
|
14097928 |
|
|
|
|
12577267 |
Oct 12, 2009 |
7838507 |
|
|
12901019 |
|
|
|
|
11313200 |
Dec 19, 2005 |
7622454 |
|
|
12577267 |
|
|
|
|
60638705 |
Dec 23, 2004 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61P 9/10 20180101; C12N
15/111 20130101; A61P 17/02 20180101; C12N 2310/14 20130101; C12N
15/1136 20130101; A61P 27/06 20180101; A61K 31/713 20130101; A61P
27/02 20180101; C12N 2320/32 20130101 |
Class at
Publication: |
514/44.A |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/713 20060101 A61K031/713 |
Claims
1. A method of attenuating expression of connective tissue growth
factor mRNA in an eye of a subject, comprising: administering to
the eye of the subject a composition comprising an effective amount
of interfering RNA having a length of 19 to 49 nucleotides and a
pharmaceutically acceptable carrier, the interfering RNA
comprising: a sense nucleotide sequence, an antisense nucleotide
sequence, and a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides; wherein the antisense
sequence hybridizes under physiological conditions to a portion of
mRNA corresponding to SEQ ID NO:1, and has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the hybridizing portion of mRNA corresponding to SEQ ID NO:1,
wherein the expression of connective tissue growth factor mRNA is
attenuated.
2. The method of claim 1 wherein the subject has a connective
tissue growth factor-associated ocular disorder.
3. The method of claim 1 wherein the subject is at risk of
developing a connective tissue growth factor-associated ocular
disorder.
4. The method of claim 2 wherein the connective tissue growth
factor-associated ocular disorder is glaucoma, macular
degeneration, diabetic retinopathy, choroidal neovascularization,
proliferative vitreoretinopathy or wound healing.
5. The method of claim 1 wherein the antisense sequence has a
region of at least near-perfect contiguous complementarity of at
least 21 to 23 nucleotides with the hybridizing portion of mRNA
corresponding to SEQ ID NO:1 and comprises an additional TT
sequence at the 3' end of each of the sense and the antisense
sequence.
6. The method of claim 1 wherein the sense nucleotide sequence and
the antisense nucleotide sequence are connected by a loop
nucleotide sequence.
7. The method of claim 1 wherein the composition is administered
via a topical, intravitreal, or transcleral route.
8. The method of claim 1 wherein the antisense sequence is designed
to target a nucleotide sequence of mRNA corresponding to SEQ ID
NO:1 beginning at nucleotide 379, 691, 801, 901, 932, 937, 969,
986, 1119, 1170, 1201, 1346, 1473, 1478, 1481, 1488, 1626, 1660, or
1666.
9. The method of claim 1 wherein the antisense sequence is designed
to target a nucleotide sequence of mRNA corresponding to SEQ ID
NO:1 beginning at nucleotide 379, 901, or 1488.
10. The method of claim 1 wherein the antisense sequence is
designed to target a nucleotide sequence of mRNA corresponding to
SEQ ID NO:1 comprising nucleotide 379, 691, 801, 901, 932, 937,
969, 986, 1119, 1170, 1201, 1346, 1473, 1478, 1481, 1488, 1626,
1660, or 1666.
11. The method of claim 1 wherein the antisense sequence is
designed to target a nucleotide sequence of mRNA corresponding to
SEQ ID NO:1 comprising nucleotide 379, 901, or 1488.
12. The method of claim 1 wherein the antisense sequence comprises:
TABLE-US-00014 3'-TTcccguuuuucacguaggca-5'. SEQ ID NO: 33
13. The method of claim 1 wherein the antisense sequence comprises:
TABLE-US-00015 3'-TTcccggagaagacacugaag-5'. SEQ ID NO: 31
14. The method of claim 1 wherein the antisense sequence comprises:
TABLE-US-00016 3'-TTccaaucauaguagucuauc-5'. SEQ ID NO: 28
15. The method of claim 1 wherein the interfering RNA comprises:
TABLE-US-00017 5'-gggccucuucugugacuucTT-3' SEQ ID NO: 30 and
3'-TTcccggagaagacacugaag-5'. SEQ ID NO: 31
16. The method of claim 1 wherein the interfering RNA comprises:
TABLE-US-00018 5'-gggcaaaaagugcauccguTT-3' SEQ ID NO: 32 and
3'-TTcccguuuuucacguaggca-5'. SEQ ID NO: 33
17. The method of claim 1 further comprising administering to the
eye of the subject a second interfering RNA having a length of 19
to 49 nucleotides, and comprising: a sense nucleotide sequence, an
antisense nucleotide sequence, and a region of at least
near-perfect complementarity of at least 19 nucleotides; wherein
the antisense sequence of the second interfering RNA hybridizes
under physiological conditions to a second portion of mRNA
corresponding to SEQ ID NO:1, and the antisense sequence has a
region of at least near-perfect contiguous complementarity of at
least 19 nucleotides with the second hybridizing portion of mRNA
corresponding to SEQ ID NO:1.
18. A method of attenuating expression of connective tissue growth
factor mRNA in an eye of a subject, comprising: administering to
the eye of the subject a composition comprising an effective amount
of single-stranded interfering RNA having a length of 19 to 49
nucleotides and a pharmaceutically acceptable carrier, wherein the
single stranded interfering RNA hybridizes under physiological
conditions to a portion of mRNA corresponding to SEQ ID NO:1
beginning at nucleotide 379, 691, 801, 901, 932, 937, 969, 986,
1119, 1170, 1201, 1346, 1473, 1478, 1481, 1488, 1626, 1660, or
1666, and the interfering RNA has a region of at least near-perfect
complementarity with the hybridizing portion of mRNA corresponding
to SEQ ID NO:1, wherein the expression of connective tissue growth
factor mRNA is attenuated.
Description
[0001] The present application is a divisional of U.S. patent
application Ser. No. 12/901,019 filed on Oct. 8, 2010 (now
pending); which claims priority to U.S. application Ser. No.
12/577,267 filed on Oct. 12, 2009 (now U.S. Pat. No. 7,838,507);
which claims priority to U.S. application Ser. No. 11/313,200 filed
on Dec. 19, 2005 (now U.S. Pat. No. 7,622,454), which claims
benefit to U.S. Provisional Patent Application Ser. No. 60/638,705
filed Dec. 23, 2004.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of interfering
RNA compositions for inhibition of expression of connective tissue
growth factor (CTGF) in ocular disorders.
BACKGROUND OF THE INVENTION
[0003] Most ocular disorders are associated with cellular processes
including cell proliferation, survival, migration, differentiation,
and angiogenesis. CTGF is a secreted cytokine and a central
mediator in these cellular processes. In particular, CTGF is known
to increase extracellular matrix production primarily via increased
deposition of collagen I and fibronectin. Overexpression of CTGF
has been implicated as a major causative factor in conditions such
as scleroderma, fibroproliferative diseases, and scarring in which
there is an overaccumulation of extracellular matrix
components.
[0004] An overaccumulation of extracellular matrix materials in the
region of the trabecular meshwork (TM) is a hallmark of many forms
of glaucoma; such increases are believed to lead to increased
resistance to aqueous outflow and, therefore, elevated intraocular
pressures. International Patent Application No. PCT/US2003/012521
to Fleenor et al. published Nov. 13, 2003 as WO 03/092584 and
assigned to Alcon, Inc. describes the elevated presence of CTGF
mRNA in glaucomatous TM cells vs. normal TM cells. Thus, it is
believed that CTGF plays a role in extracellular matrix production
by the trabecular meshwork cells.
[0005] Macular degeneration is the loss of photoreceptors in the
portion of the central retina, termed the macula, responsible for
high-acuity vision. Degeneration of the macula is associated with
abnormal deposition of extracellular matrix components in the
membrane between the retinal pigment epithelium and the vascular
choroid. This debris-like material is termed drusen. Drusen is
observed using a funduscopic eye examination. Normal eyes may have
maculas free of drusen, yet drusen may be abundant in the retinal
periphery. The presence of soft drusen in the macula, in the
absence of any loss of macular vision, is considered an early stage
of AMD.
[0006] Choroidal neovascularization commonly occurs in macular
degeneration in addition to other ocular disorders and is
associated with proliferation of choroidal endothelial cells,
overproduction of extracellular matrix, and formation of a
fibrovascular subretinal membrane. Retinal pigment epithelium cell
proliferation and production of angiogenic factors appears to
effect choroidal neovascularization.
[0007] Diabetic retinopathy is an ocular disorder that develops in
diabetes due to thickening of capillary basement membranes and lack
of contact between pericytes and endothelial cells of the
capillaries. Loss of pericytes increases leakage of the capillaries
and leads to breakdown of the blood-retina barrier.
[0008] Proliferative vitreoretinopathy is associated with cellular
proliferation of cellular and fibrotic membranes within the
vitreous membranes and on the surfaces of the retina. Retinal
pigment epithelium cell proliferation and migration is common with
this ocular disorder. The membranes associated with proliferative
vitreoretinopathy contain extracellular matrix components such as
collagen types I, II, and IV and fibronectin, and become
progressively fibrotic.
[0009] Wound healing disorders may lead to severe ocular tissue
damage via activation of inflammatory cells, release of growth
factors and cytokines, proliferation and differentiation of ocular
cells, increased capillary permeability, alterations in basement
membrane matrix composition, increased deposition of extracellular
matrix, fibrosis, neovascularization, and tissue remodeling.
[0010] Overexpression of CTGF therefore has been implicated as a
major causative factor in these ocular disorders. Current therapies
do not directly address the pathogenic mechanism of these
disorders.
SUMMARY OF THE INVENTION
[0011] The present invention is directed to interfering RNAs that
target CTGF mRNA and thereby interfere with CTGF mRNA expression.
The interfering RNAs of the invention are useful for treating
CTGF-related ocular disorders such as glaucoma, macular
degeneration, diabetic retinopathy, choroidal neovascularization,
proliferative vitreoretinopathy and aberrant wound healing.
[0012] An embodiment of the present invention provides a method of
attenuating expression of connective tissue growth factor mRNA in
an eye of a subject. The method comprises administering to the eye
of the subject a composition comprising an effective amount of
interfering RNA such as double-stranded (ds) siRNA or
single-stranded (ss) siRNA having a length of 19 to 49 nucleotides
and a pharmaceutically acceptable carrier.
[0013] The double stranded siRNA comprises a sense nucleotide
sequence, an antisense nucleotide sequence and a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides.
Further, the antisense sequence hybridizes under physiological
conditions to a portion of mRNA corresponding to SEQ ID NO:1 (the
sense strand sequence of DNA for connective tissue growth factor
for humans, GenBank reference no. NM.sub.--001901), and has a
region of at least near-perfect contiguous complementarity of at
least 19 nucleotides with the hybridizing portion of mRNA
corresponding to SEQ ID NO:1. The administration of such a
composition attenuates the expression of connective tissue growth
factor mRNA of the eye of the subject.
[0014] The single-stranded siRNA has a length of 19 to 49
nucleotides, hybridizes under physiological conditions to a portion
of mRNA corresponding to SEQ ID NO:1 beginning at nucleotide 379,
691, 801, 901, 932, 937, 969, 986, 1119, 1170, 1201, 1346, 1473,
1478, 1481, 1488, 1626, 1660, or 1666, and has a region of at least
near-perfect complementarity with the hybridizing portion of mRNA
corresponding to SEQ ID NO:1.
[0015] In an embodiment of the invention, the antisense sequence of
a double-stranded interfering RNA is designed to target a
nucleotide sequence of mRNA corresponding to SEQ ID NO:1 beginning
at or comprising nucleotide 379, 691, 801, 901, 932, 937, 969, 986,
1119, 1170, 1201, 1346, 1473, 1478, 1481, 1488, 1626, 1660, or
1666.
[0016] A further embodiment of the invention is a method of
treating a connective tissue growth factor-associated ocular
disorder in a subject in need thereof. The method comprises
administering to the eye of the subject a composition comprising an
effective amount of interfering RNA having a length of 19 to 49
nucleotides and a pharmaceutically acceptable carrier, the
interfering RNA comprising a sense nucleotide sequence, an
antisense nucleotide sequence, and a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides.
The antisense sequence hybridizes under physiological conditions to
a portion of mRNA corresponding to SEQ ID NO:1, and has a region of
at least near-perfect contiguous complementarity of at least 19
nucleotides with the hybridizing portion of mRNA corresponding to
SEQ ID NO:1. The connective tissue growth factor-associated ocular
disorder is treated thereby.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1A shows SITOX.TM. data demonstrating that transfection
efficiency of trabecular meshwork cells was not rate-limiting when
taken together with data of FIG. 1B. GTM3 cells were transfected
with SITOX.TM. (Dharmacon) transfection control. After 24 hr,
trypan blue exclusion was used to determine the number of viable
cells remaining in the SITOX.TM. culture, which reflects the
relative transfection efficiency. Open bars: no transfection; Solid
bars: with SITOXT.TM..
[0018] FIG. 1B shows a SIGLO.TM. image of siRNA uptake in GTM3
cells demonstrating that transfection efficiency was not
rate-limiting when taken together with data of FIG. 1A. GTM3 cells
were transfected with SIGLO.TM. siRNA (Dharmacon) using
LIPOFECTAMINE 2000.TM.. SIGLO.TM. siRNA uptake was determined after
24 hr using fluorescence microscopy (red irregular shapes).
Individual cell nuclei were identified by DAPI
(4',6-diamidino-2-phenylindole), a stain for double stranded DNA
(blue round areas). As the data of FIG. 1A and the image of FIG. 1B
show, nearly all cells were either dead (SITOX.TM.) or fluorescent
(SIGLO.TM.).
[0019] FIG. 2A is a schematic showing the CTGF gene exon (boxes)
and intron (lines) structure and location of siRNAs S1, S2, and S3
and QPCR primer/probe sets Q1 and Q2 in relation to the GenBank
CTGF sequence NM.sub.--001901, the sequence of which is provided as
SEQ ID NO:1. The sequences of the siRNAs and primer/probe sets are
provided in Example 1.
[0020] FIG. 2B shows QPCR amplification of CTGF mRNA using the exon
5 primer/probe set Q2. Using the S1 and S4 siRNAs, no significant
knock-down of the CTGF mRNA levels was detected.
[0021] FIG. 2C shows QPCR amplification of CTGF mRNA using the exon
4/5 spanning primer/probe set Q1. Knock-down of CTGF mRNA was
observed by each of the siRNAs and an .about.90% knock-down was
observed with the S2 siRNA.
[0022] FIG. 3 shows a titration study in which various
concentrations of the S2 siRNA were tested for efficacy of
knock-down of CTGF mRNA levels. CTGF mRNA knock-down was assessed
by QPCR amplification using primer/probe set Q1. An IC.sub.50 of
.about.2.5 nM was observed in GTM3 cells after 24 hour treatment
with 0, 1, 3, 10, 30, and 100 nM S2 siRNA as described in Example
1.
DETAILED DESCRIPTION OF THE INVENTION
[0023] RNA interference, termed "RNAi," is a method for reducing
the expression of a target gene that is effected by small single-
or double-stranded RNA molecules. Interfering RNAs include small
interfering RNAs, either double-stranded or single-stranded (ds
siRNAs or ss siRNAs), microRNAs (miRNAs), small hairpin RNAs
(shRNAs), and others. While not wanting to be bound by theory, RNA
interference appears to occur in vivo with the cleavage of dsRNA
precursors into small RNAs of about 20 to 25 nucleotides in length.
Cleavage is accomplished by RNaseIII-RNA helicase Dicer. The
"sense" strand of an siRNA, i.e., the strand that has exactly the
same sequence as a target mRNA sequence, is removed, leaving the
`antisense" strand which is complementary to the target mRNA to
function in reducing expression of the mRNA. The antisense strand
of the siRNA appears to guide a protein complex known as
RISC(RNA-induced silencing complex) to the mRNA, which complex then
cleaves the mRNA by the Argonaute protein of the RISC, thereby
reducing protein production by that mRNA. Interfering RNAs are
catalytic and reduction in expression of mRNA can be achieved with
substoichiometric amounts of interfering RNAs in relation to mRNA.
Reduction in mRNA expression may also occur via transcriptional and
translational mechanisms.
[0024] The present invention relates to the use of interfering RNA
for inhibition of expression of connective tissue growth factor
(CTGF) in ocular disorders. According to the present invention,
tissues of the eye, in particular, trabecular meshwork cells of the
eye, carry out siRNA silencing, and exogenously provided siRNAs
effect silencing. Further, aspects of the present invention have
determined that, when using a PCR-based approach to determine the
efficacy of siRNA knock-down, the PCR amplification primers should
be designed to encompass the siRNA targeting sequence to accurately
measure silencing.
[0025] Nucleic acid sequences cited herein are written in a 5' to
3' direction unless indicated otherwise. The term "nucleic acid,"
as used herein, refers to either DNA or RNA or a modified form
thereof comprising the purine or pyrimidine bases present in DNA
(adenine "A," cytosine "C," guanine "G," thymine "T") or in RNA
(adenine "A," cytosine "C," guanine "G," uracil "U"). Interfering
RNAs provided herein may comprise "T" bases, particularly at 3'
ends, even though "T" bases do not naturally occur in RNA. "Nucleic
acid" includes the terms "oligonucleotide" and "polynucleotide" and
can refer to a single stranded molecule or a double stranded
molecule. A double stranded molecule is formed by Watson-Crick base
pairing between A and T bases, C and G bases, and A and U bases.
The strands of a double stranded molecule may have partial,
substantial or full complementarity to each other and will form a
duplex hybrid, the strength of bonding of which is dependent upon
the nature and degree of complementarity of the sequence of bases.
A mRNA sequence is readily determined by knowing the sense or
antisense strand sequence of DNA encoding therefor. For example,
SEQ ID NO:1 provides the sense strand sequence of DNA corresponding
to the mRNA for connective tissue growth factor. The sequence of
mRNA is identical to the sequence of the sense strand of DNA with
the "T" bases replaced with "U" residues. Therefore, the mRNA
sequence of connective tissue growth factor is known from SEQ ID
NO:1.
[0026] Connective Tissue Growth Factor mRNA:
[0027] The GenBank database of the National Center for
Biotechnology Information at ncbi.nlm.nih.gov provides the
corresponding DNA sequence for the messenger RNA of human
connective tissue growth factor as reference no. NM.sub.--001901,
provided below as SEQ ID NO:1. The coding sequence for connective
tissue growth factor is from nucleotides 146-1195.
TABLE-US-00001 SEQ ID NO: 1: 1 tccagtgacg gagccgcccg gccgacagcc
ccgagacgac agcccggcgc gtcccggtcc 61 ccacctccga ccaccgccag
cgctccaggc cccgcgctcc ccgctcgccg ccaccgcgcc 121 ctccgctccg
cccgcagtgc caaccatgac cgccgccagt atgggccccg tccgcgtcgc 181
cttcgtggtc ctcctcgccc tctgcagccg gccggccgtc ggccagaact gcagcgggcc
241 gtgccggtgc ccggacgagc cggcgccgcg ctgcccggcg ggcgtgagcc
tcgtgctgga 301 cggctgcggc tgctgccgcg tctgcgccaa gcagctgggc
gagctgtgca ccgagcgcga 361 cccctgcgac ccgcacaagg gcctcttctg
tgacttcggc tccccggcca accgcaagat 421 cggcgtgtgc accgccaaag
atggtgctcc ctgcatcttc ggtggtacgg tgtaccgcag 481 cggagagtcc
ttccagagca gctgcaagta ccagtgcacg tgcctggacg gggcggtggg 541
ctgcatgccc ctgtgcagca tggacgttcg tctgcccagc cctgactgcc ccttcccgag
601 gagggtcaag ctgcccggga aatgctgcga ggagtgggtg tgtgacgagc
ccaaggacca 661 aaccgtggtt gggcctgccc tcgcggctta ccgactggaa
gacacgtttg gcccagaccc 721 aactatgatt agagccaact gcctggtcca
gaccacagag tggagcgcct gttccaagac 781 ctgtgggatg ggcatctcca
cccgggttac caatgacaac gcctcctgca ggctagagaa 841 gcagagccgc
ctgtgcatgg tcaggccttg cgaagctgac ctggaagaga acattaagaa 901
gggcaaaaag tgcatccgta ctcccaaaat ctccaagcct atcaagtttg agctttctgg
961 ctgcaccagc atgaagacat accgagctaa attctgtgga gtatgtaccg
acggccgatg 1021 ctgcaccccc cacagaacca ccaccctgcc ggtggagttc
aagtgccctg acggcgaggt 1081 catgaagaag aacatgatgt tcatcaagac
ctgtgcctgc cattacaact gtcccggaga 1141 caatgacatc tttgaatcgc
tgtactacag gaagatgtac ggagacatgg catgaagcca 1201 gagagtgaga
gacattaact cattagactg gaacttgaac tgattcacat ctcatttttc 1261
cgtaaaaatg atttcagtag cacaagttat ttaaatctgt ttttctaact gggggaaaag
1321 attcccaccc aattcaaaac attgtgccat gtcaaacaaa tagtctatct
tccccagaca 1381 ctggtttgaa gaatgttaag acttgacagt ggaactacat
tagtacacag caccagaatg 1441 tatattaagg tgtggcttta ggagcagtgg
gagggtacca gcagaaaggt tagtatcatc 1501 agatagctct tatacgagta
atatgcctgc tatttgaagt gtaattgaga aggaaaattt 1561 tagcgtgctc
actgacctgc ctgtagcccc agtgacagct aggatgtgca ttctccagcc 1621
atcaagagac tgagtcaagt tgttccttaa gtcagaacag cagactcagc tctgacattc
1681 tgattcgaat gacactgttc aggaatcgga atcctgtcga ttagactgga
cagcttgtgg 1741 caagtgaatt tcctgtaaca agccagattt tttaaaattt
atattgtaaa tattgtgtgt 1801 gtgtgtgtgt gtgtatatat atatatatat
gtacagttat ctaagttaat ttaaagttgt 1861 ttgtgccttt ttatttttgt
ttttaatgct ttgatatttc aatgttagcc tcaatttctg 1921 aacaccatag
gtagaatgta aagcttgtct gatcgttcaa agcatgaaat ggatacttat 1981
atggaaattc tctcagatag aatgacagtc cgtcaaaaca gattgtttgc aaaggggagg
2041 catcagtgtc cttggcaggc tgatttctag gtaggaaatg tggtagctca
cgctcacttt 2101 taatgaacaa atggccttta ttaaaaactg agtgactcta
tatagctgat cagttttttc 2161 acctggaagc atttgtttct actttgatat
gactgttttt cggacagttt atttgttgag 2221 agtgtgacca aaagttacat
gtttgcacct ttctagttga aaataaagta tattttttct 2281 aaaaaaaaaa
aaaaacgaca gcaacggaat tc.
Equivalents of the above cited CTGF mRNA sequence are alternative
splice forms, allelic forms, or a cognate thereof A cognate is a
connective tissue growth factor mRNA from another mammalian species
that is homologous to SEQ ID NO:1. CTGF nucleic acid sequences
related to SEQ ID NO:1 are those having GenBank accession numbers
AK092280, AK125220, AY395801, AY550024, BT019794, BT019795,
CR541759, M92934, U14750, and X78947, and the sequence of SEQ ID
NO:1 of U.S. Pat. No. 5,585,270, incorporated by reference
herein.
[0028] Attenuating Expression of an mRNA:
[0029] The phrase, "attenuating expression of an mRNA," as used
herein, means administering an amount of interfering RNA to effect
a reduction of the full mRNA transcript levels of a target gene in
a cell, thereby decreasing translation of the mRNA into protein as
compared to a control RNA having a scrambled sequence. The
reduction in expression of the mRNA is commonly referred to as
"knock-down" of mRNA. Knock-down of expression of an amount of
between and including an amount of 50% and 100% is contemplated by
embodiments herein. However, it is not necessary that such
knock-down levels be achieved for purposes of the present
invention. Further, two sets of interfering RNAs may be mildly
effective at knock-down individually, however, when administered
together may be significantly more effective. In one embodiment, an
individual ds siRNA is effective at knock-down at an amount of at
least up to 70%. In another embodiment, two or more ds si RNAs are
together effective at knock-down at an amount of at least up to
70%.
[0030] Knock-down is commonly measured by determining the mRNA
levels by Quantitative Polymerase Chain Reaction (QPCR)
amplification or by determining protein levels by Western Blot or
enzyme linked immunosorbent assay (ELISA). Analyzing the protein
level provides an assessment of both mRNA degradation by the RNA
Induced Silencing Complex (RISC) as well as translation inhibition.
Further techniques for measuring knock-down include RNA solution
hybridization, nuclease protection, Northern hybridization, reverse
transcription, gene expression monitoring with a microarray,
antibody binding, radioimmunoassay, and fluorescence activated cell
analysis. A further method of measurement includes overexpressing
TGF.beta.2 which induces CTGF, adding back CTGF siRNA, and then
measuring CTGF mRNA/protein knockdown by any of the above-cited
methods.
[0031] Inhibition of CTGF is also inferred in a human or mammal by
observing an improvement in an ocular disorder. For example, in age
related macular degeneration a slowing or reversal of vision loss
indicates an inhibition of CTGF and silencing of CTGF mRNA in
glaucoma patients leads to lowered intraocular pressure and a delay
or prevention of the onset of symptoms in a subject at risk for
developing glaucoma.
[0032] Interfering RNA of embodiments of the invention act in a
catalytic manner, i.e., interfering RNA is able to effect
inhibition of target mRNA in substoichiometric amounts. As compared
to antisense therapies, significantly less interfering RNA is
required to provide a therapeutic effect.
[0033] Double-Stranded Interfering RNA:
[0034] Double stranded interfering RNA (also referred to as ds
siRNA), as used herein, has a sense nucleotide sequence and an
antisense nucleotide sequence, the sense and antisense sequence
comprising a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides. The length of the
interfering RNA comprises 19 to 49 nucleotides, and may comprise a
length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or
49 nucleotides. The antisense sequence of the ds siRNA hybridizes
under physiological conditions to a portion of mRNA corresponding
to SEQ ID NO:1, and has a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides with the
hybridizing portion of mRNA corresponding to SEQ ID NO:1.
[0035] The antisense strand of the siRNA is the active guiding
agent of the siRNA in that the antisense strand binds to a RISC
complex within a cell, and guides the bound complex to bind with
specificity to the mRNA at a sequence complementary to the sequence
of the antisense RNA, thereby allowing subsequent cleavage of the
mRNA by the bound complex.
[0036] Techniques for selecting target sequences for siRNAs are
provided by Tuschl, T. et al., "The siRNA User Guide," revised May
6, 2004, available on the Rockefeller University web site, by
Technical Bulletin #506, "siRNA Design Guidelines," Ambion Inc. at
Ambion's web site, by the Invitrogen web site using search
parameters of min 35%, max 55% G/C content, and by the Dharmacon
web site. The target sequence may be located in the coding region
or a 5' or 3' untranslated region of the mRNA.
[0037] An embodiment of a DNA target sequence for CTGF is present
at nucleotides 1488 to 1506 of SEQ ID NO:1:
TABLE-US-00002 5'-ggttagtatcatcagatag-3'. SEQ ID NO: 18. nt
1488
A double stranded siRNA of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:18 and having a 3'UU
overhang on each strand is:
TABLE-US-00003 5'-gguuaguaucaucagauagUU-3' SEQ ID NO: 25
3'-UUccaaucauaguagucuauc-5'. SEQ ID NO: 26
The 3' overhang may have a number of "U" residues, for example, a
number of "U" residues between and including 2, 3, 4, 5, and 6. The
5' end may also have a 5' overhang of nucleotides. A double
stranded siRNA of the invention for targeting a corresponding mRNA
sequence of SEQ ID NO:18 and having a 3' TT overhang on each strand
is:
TABLE-US-00004 5'-gguuaguaucaucagauagTT-3' SEQ ID NO: 27
3'-TTccaaucauaguagucuauc-5'. SEQ ID NO: 28
The strands of a double-stranded siRNA may be connected by a
hairpin loop to form a single stranded siRNA as follows:
##STR00001##
N is a nucleotide A, T, C, G, U, or a modified form known by one of
ordinary skill in the art. The number of nucleotides N is a number
between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9,
or 9 to 11, or the number of nucleotides N is 9.
[0038] Table 1 lists examples of CTGF DNA target sequences of SEQ
ID NO:1 from which siRNAs of the present invention are designed in
a manner as set forth above.
TABLE-US-00005 TABLE 1 CTGF Target Sequences for siRNAs # of
Starting Nucleotide with SEQ reference to ID Target Sequence SEQ ID
NO: 1 NO: GGGCCTCTTCTGTGACTTC 379 2 CCGACTGGAAGACACGTTT 691 3
CCCGGGTTACCAATGACAA 801 4 GGGCAAAAAGTGCATCCGT 901 5
TCCAAGCCTATCAAGTTTGAGCTTT 932 6 GCCTATCAAGTTTGAGCTT 937 7
GCATGAAGACATACCGAGCTAAATT 969 8 GCTAAATTCTGTGGAGTAT 986 9
GCCATTACAACTGTCCCGGAGACAA 1119 10 GGAAGATGTACGGAGACAT 1170 11
GAGAGTGAGAGACATTAACTCATTA 1201 12 GCCATGTCAAACAAATAGTCTATCT 1346 13
GGGTACCAGCAGAAAGGTT 1473 14 CCAGCAGAAAGGTTAGTAT 1478 15
GCAGAAAGGTTAGTATCAT 1481 16 GCAGAAAGGTTAGTATCATCAGATA 1481 17
GGTTAGTATCATCAGATAG 1488 18 GGTTAGTATCATCAGATAGCTCTTA 1488 19
GAGACTGAGTCAAGTTGTTCCTTAA 1626 20 GCAGACTCAGCTCTGACAT 1660 21
TCAGCTCTGACATTCTGATTCGAAT 1666 22 TCCTGTCGATTAGACTGGACAGCTT 1712 23
GCTTGTGGCAAGTGAATTT 1733 24
As cited in the examples above, one of skill in the art is able to
use the target sequence information provided in Table 1 to design
interfering RNAs having a length shorter or longer than the
sequences provided in Table 1 by referring to the sequence position
in SEQ ID NO:1 and adding or deleting nucleotides complementary or
near complementary to SEQ ID NO:1.
[0039] The target RNA cleavage reaction guided by ds or ss siRNAs
is highly sequence specific. In general, siRNA containing a sense
nucleotide sequence identical to a portion of the target mRNA and
an antisense portion exactly complementary to the sense sequence
are siRNA embodiments for inhibition of CTGF mRNA. However, 100%
sequence complementarity between the antisense strand of siRNA and
the target mRNA is not required to practice the present invention.
Thus the invention allows for sequence variations that might be
expected due to genetic mutation, strain polymorphism, or
evolutionary divergence. For example, siRNA sequences with
insertions, deletions, or single point mutations relative to the
target sequence are effective for inhibition.
[0040] The antisense sequence of the siRNA has at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the target sequence of the mRNA. "Near-perfect," as used
herein, means the antisense sequence of the siRNA is "substantially
complementary to," and the sense sequence of the siRNA is
"substantially identical" to at least a portion of the target mRNA.
"Identity," as known by one of ordinary skill in the art, is the
degree of sequence relatedness between nucleotide sequences as
determined by matching the order of nucleotides between the
sequences. In one embodiment, antisense RNA having 80% and between
80% up to 100% complementarity to the target mRNA sequence are
considered near-perfect complementarity and may be used in the
present invention. "Perfect" contiguous complementarity is standard
Watson-Crick base pairing of adjacent base pairs. "At least
near-perfect" contiguous complementarity includes "perfect"
complementarity as used herein. Computer methods for determining
identity or complementarity are designed to provide the greatest
degree of matching of nucleotide sequences, for example, BLASTP and
BLASTN (Altschul, S. F., et al. (1990) J. Mol. Biol. 215:403-410),
and FASTA.
[0041] The target sequence of SEQ ID NO:1 may be in the 5' or 3'
untranslated regions of the mRNA as well as in the coding region of
the mRNA.
[0042] One or both of the strands of double-stranded interfering
RNA may have a 3' overhang of from 1 to 6 nucleotides which may be
ribonucleotides or deoxyribonucleotides or a mixture thereof. The
nucleotides of the overhang are not base-paired. In one embodiment
of the invention, the interfering ds RNA comprises a 3' overhang of
TT or UU.
[0043] The sense and antisense strands of the double stranded siRNA
may be in a duplex formation of two single strands as described
above or may be a single molecule where the regions of
complementarity are base-paired and are covalently linked by a
hairpin or loop so as to form a single strand. It is believed that
the hairpin is cleaved intracellularly by a protein termed Dicer to
form an interfering RNA of two individual base-paired RNA
molecules.
[0044] Interfering RNAs may differ from naturally-occurring RNA by
the addition, deletion, substitution or modification of one or more
nucleotides. Non-nucleotide material may be bound to the
interfering RNA, either at the 5' end, the 3' end, or internally.
Such modifications are commonly designed to increase the nuclease
resistance of the interfering RNAs, to improve cellular uptake, to
enhance cellular targeting, to assist in tracing the interfering
RNA, or to further improve stability. For example, interfering RNAs
may comprise a purine nucleotide at the ends of overhangs.
Conjugation of cholesterol to the 3' end of the sense strand of a
ds siRNA molecule by means of a pyrrolidine linker, for example,
also provides stability to an siRNA. Further modifications include
a 3' terminal biotin molecule, a peptide known to have
cell-penetrating properties, a nanoparticle, a peptidomimetic, a
fluorescent dye, or a dendrimer, for example.
[0045] Nucleotides may be modified on their base portion, on their
sugar portion, or on the phosphate portion of the molecule and
function in embodiments of the present invention. Modifications
include substitutions with alkyl, alkoxy, amino, deaza, halo,
hydroxyl, thiol groups, or a combination thereof, for example.
Nucleotides may be substituted with analogs with greater stability
such as replacing U with 2'deoxy-T, or having a sugar modification
such as a 2'OH replaced by a 2' amino or 2' methyl group, 2'
methoxyethyl groups, or a 2'-0, 4'-C methylene bridge, for example.
Examples of a purine or pyrimidine analog of nucleotides include a
xanthine, a hypoxanthine, an azapurine, a methylthioadenine,
7-deaza-adenosine and O- and N-modified nucleotides. The phosphate
group of the nucleotide may be modified by substituting one or more
of the oxygens of the phosphate group with nitrogen or with sulfur
(phosphorothioates).
[0046] There may be a region of the antisense siRNA that is not
complementary to a portion of mRNA corresponding to SEQ ID NO:1.
Non-complementary regions may be at the 3', 5' or both ends of a
complementary region.
[0047] Interfering RNAs may be synthetically generated, generated
by in vitro transcription, siRNA expression vectors, or PCR
expression cassettes, for example. Interfering RNAs that function
well as transfected siRNAs also function well as siRNAs expressed
in vivo.
[0048] Interfering RNAs are chemically synthesized using protected
ribonucleoside phosphoramidites and a conventional DNA/RNA
synthesizer and may be obtained from commercial suppliers such as
Ambion Inc. (Austin, Tex.), Invitrogen (Carlsbad, Calif.), or
Dharmacon (Lafayette, Colo., USA), for example. Interfering RNAs
are purified by extraction with a solvent or resin, precipitation,
electrophoresis, chromatography, or a combination thereof, for
example. Alternatively, interfering RNA may be used with little if
any purification to avoid losses due to sample processing.
[0049] Interfering RNA may be provided to a subject by expression
from a recombinant plasmid using a constitutive or inducible
promoter such as the U6 or H1 RNA pol III promoter, the
cytomegalovirus promoter, SP6, T3, or T7 promoter, known to those
of ordinary skill in the art. For example, the psiRNA.TM. from
InvivoGen (San Diego, Calif.) allows production of siRNAs within
cells from an RNA pol III promoter. Interfering RNA expressed from
recombinant plasmids may be isolated by standard techniques.
[0050] A viral vector for expression of interfering RNA may be
derived from adenovirus, adeno-associated virus, vaccinia virus,
retroviruses (lentiviruses, Rhabdoviruses, murine leukemia virus,
for example), herpes virus, or the like, using promoters as cited
above, for example, for plasmids. Selection of viral vectors,
methods for expressing the interfering RNA by the vector and
methods of delivering the viral vector are within the ordinary
skill of one in the art.
[0051] Expression of interfering RNAs is also provided by use of
SILENCER EXPRESS.TM. (Ambion, Austin, Tex.) via expression
cassettes (SECs) with a human H1, human U6 or mouse U6 promoter by
PCR. Silencer expression cassettes are PCR products that include
promoter and terminator sequences flanking a hairpin siRNA
template. Upon transfection into cells, the hairpin siRNA is
expressed from the PCR product and induces specific silencing.
[0052] Hybridization Under Physiological Conditions:
[0053] "Hybridization" refers to a technique where single-stranded
nucleic acids (DNA or RNA) are allowed to interact so that
hydrogen-bonded complexes called hybrids are formed by those
nucleic acids with complementary or near-complementary base
sequences. Hybridization reactions are sensitive and selective so
that a particular sequence of interest is identified in samples in
which it is present at low concentrations. The specificity of
hybridization (i.e., stringency) is controlled by the
concentrations of salt or formamide in the prehybridization and
hybridization solutions in vitro, for example, and by the
hybridization temperature, and are well known in the art. In
particular, stringency is increased by reducing the concentration
of salt, increasing the concentration of formamide, or raising the
hybridization temperature.
[0054] For example, high stringency conditions could occur at about
50% formamide at 37.degree. C. to 42.degree. C. Reduced stringency
conditions could occur at about 35% to 25% formamide at about
30.degree. C. to 35.degree. C. Examples of stringency conditions
for hybridization are provided in Sambrook, J., 1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. Further examples of stringent
hybridization conditions include 400 mM NaCl, 40 mM PIPES pH 6.4, 1
mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by
washing, or hybridization at 70.degree. C. in 1XSSC or 50.degree.
C. in 1.times.SSC, 50% formamide followed by washing at 70.degree.
C. in 0.3XSSC, or hybridization at 70.degree. C. in 4XSSC or
50.degree. C. in 4.times.SSC, 50% formamide followed by washing at
67.degree. C. in 1XSSC. The temperature for hybridization is about
5-10.degree. C. less than the melting temperature (T.sub.m) of the
hybrid where T.sub.m is determined for hybrids between 19 and 49
base pairs in length using the following calculation:
T.sub.m.degree. C.=81.5+16.6(log.sub.10[Na+])+0.41(% G+C)-(600/N)
where N is the number of bases in the hybrid, and [Na+] is the
concentration of sodium ions in the hybridization buffer.
[0055] In embodiments of the present invention, an antisense strand
of an interfering RNA that hybridizes with CTGF mRNA in vitro under
high stringency conditions will bind specifically in vivo under
physiological conditions. Identification or isolation of a related
nucleic acid that does not hybridize to a nucleic acid under highly
stringent conditions is carried out under reduced stringency.
[0056] Single Stranded Interfering RNA:
[0057] As cited above, interfering RNAs ultimately function as
single strands. SS siRNA has been found to effect mRNA silencing,
albeit less efficiently than double-stranded RNA. Therefore,
embodiments of the present invention also provide for
administration of ss siRNA where the single stranded siRNA
hybridizes under physiological conditions to a portion of mRNA
corresponding to SEQ ID NO:1, and has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the hybridizing portion of mRNA corresponding to SEQ ID NO:1.
The ss siRNA has a length of 19 to 49 nucleotides as for the ds
siRNA cited above. The ss siRNA has a 5' phosphate or is
phosphorylated in situ or in vivo at the 5' position. The term "5'
phosphorylated" is used to describe, for example, polynucleotides
or oligonucleotides having a phosphate group attached via ester
linkage to the C5 hydroxyl of the 5' sugar (e.g., the 5' ribose or
deoxyribose, or an analog of same). The ss siRNA may have a mono-,
di-, or triphosphate group.
[0058] SS siRNAs are synthesized chemically or via vectors as for
ds siRNAs. 5' Phosphate groups may be added via a kinase, or a 5'
phosphate may be the result of nuclease cleavage of an RNA.
Delivery is as for ds siRNAs. In one embodiment, ss siRNAs having
protected ends and nuclease resistant modifications are
administered for silencing. SS siRNAs may be dried for storage or
dissolved in an aqueous solution. The solution may contain buffers
or salts to inhibit annealing or for stabilization.
[0059] Hairpin Interfering RNA:
[0060] A hairpin interfering RNA is single-stranded and contains
both the sense and antisense sequence within the one strand. For
expression by a DNA vector, the corresponding DNA oligonucleotides
of at least 19-nucleotides corresponding to the sense siRNA
sequence are linked to its reverse complementary antisense sequence
by a short spacer. If needed for the chosen expression vector, 3'
terminal T's and nucleotides forming restriction sites may be
added. The resulting RNA transcript folds back onto itself to form
a stem-loop structure.
[0061] Mode of Administration:
[0062] Interfering RNA may be delivered directly to the eye by
ocular tissue injection such as periocular, conjunctival,
sub-Tenons, intracameral, intravitreal, sub-retinal, retrobulbar,
or intracanalicular injections; by direct application to the eye
using a catheter or other placement device such as a retinal
pellet, intraocular insert, suppository or an implant comprising a
porous, non-porous, or gelatinous material; by topical ocular drops
or ointments; by a slow release device in the cul-de-sac or
implanted adjacent to the sclera (transsclerahl) or within the eye.
Intracameral injection may be through the cornea into the anterior
chamber to allow the agent to reach the trabecular meshwork.
Intracanalicular injection may be into the venous collector
channels draining Schlemm's canal or into Schlemm's canal.
[0063] Subject:
[0064] A subject in need of treatment for an ocular disorder or at
risk for developing an ocular disorder is a human or other mammal
having a condition or at risk of having a condition associated with
expression or activity of CTGF, i.e., a CTGF-associated ocular
disorder. Such an ocular disorder may include, for example,
glaucoma, macular degeneration, diabetic retinopathy, choroidal
neovascularization, proliferative vitreoretinopathy, wound healing,
and conditions with excessive scarring, with endothelial cell
proliferation, or fibroproliferation. Ocular structures associated
with such disorders may include the retina, choroid, lens, cornea,
trabecular meshwork, rod, cone, ganglia, macula, iris, sclera,
aqueous chamber, vitreous chamber, ciliary body, optic disc,
papilla, or fovea, for example.
[0065] Formulations and Dosage:
[0066] Pharmaceutical formulations comprise an interfering RNA, or
salt thereof, of the invention up to 99% by weight mixed with a
physiologically acceptable ophthalmic carrier medium such as water,
buffer, saline, glycine, hyaluronic acid, mannitol, and the
like.
[0067] Interfering RNAs of the present invention are administered
as solutions, suspensions, or emulsions. The following are examples
of possible formulations embodied by this invention.
TABLE-US-00006 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Hydroxypropylmethylcellulose 0.5 Sodium chloride
.8 Benzalkonium Chloride 0.01 EDTA 0.01 NaOH/HCl qs pH 7.4 Purified
water qs 100 mL
TABLE-US-00007 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0 Benzalkonium
Chloride 0.01 Polysorbate 80 0.5 Purified water q.s. to 100%
TABLE-US-00008 Interfering RNA up to 99; 0.1-99; 0.1-50; 0.5-10.0
Monobasic sodium phosphate 0.05 Amount in weight % Dibasic sodium
phosphate 0.15 (anhydrous) Sodium chloride 0.75 Disodium EDTA 0.05
Cremophor EL 0.1 Benzalkonium chloride 0.01 HCl and/or NaOH pH
7.3-7.4 Purified water q.s. to 100%
TABLE-US-00009 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0
Hydroxypropyl-.beta.-cyclodextrin 4.0 Purified water q.s. to
100%
[0068] Generally, an effective amount of the interfering RNA of
embodiments of the invention comprises an intercellular
concentration at or near the ocular site of from 200 pM to 100 nM,
or from 1 nM to 50 nM, or from 5 nM to about 25 nM. Topical
compositions are delivered to the surface of the eye one to four
times per day according to the routine discretion of a skilled
clinician. The pH of the formulation is about pH 4-9, or pH 4.5 to
pH 7.4.
[0069] While the precise regimen is left to the discretion of the
clinician, interfering RNA may be administered by placing one drop
in each eye one to four times a day, or as directed by the
clinician. An effective amount of a formulation may depend on
factors such as the age, race, and sex of the subject, or the
severity of the ocular disorder, for example. In one embodiment,
the interfering RNA is delivered topically to the eye and reaches
the trabecular meshwork, retina or optic nerve head at a
therapeutic dose thereby ameliorating a CTGF-associated disease
process.
[0070] Acceptable Carriers:
[0071] An ophthalmically acceptable carrier refers to those
carriers that cause at most, little to no ocular irritation,
provide suitable preservation if needed, and deliver one or more
interfering RNAs of the present invention in a homogenous dosage.
An acceptable carrier for administration of interfering RNA of
embodiments of the present invention include the Minis
TransIT.RTM.-TKO siRNA Tranfection Reagent (Minis Corporation,
Madison, Wis.), LIPOFECTIN.RTM., lipofectamine, OLIGOFECTAMINET.TM.
(Invitrogen, Carlsbad, Calif.), CELLFECTIN.RTM., DHARMAFECT.TM.
(Dharmacon, Chicago, Ill.) or polycations such as polylysine,
liposomes, or fat-soluble agents such as cholesterol. Liposomes are
formed from standard vesicle-forming lipids and a sterol, such as
cholesterol, and may include a targeting molecule such as a
monoclonal antibody having binding affinity for endothelial cell
surface antigens, for example. Further, the liposomes may be
PEGylated liposomes.
[0072] For ophthalmic delivery, an interfering RNA may be combined
with ophthalmologically acceptable preservatives, co-solvents,
surfactants, viscosity enhancers, penetration enhancers, buffers,
sodium chloride, or water to form an aqueous, sterile ophthalmic
suspension or solution. Ophthalmic solution formulations may be
prepared by dissolving the inhibitor in a physiologically
acceptable isotonic aqueous buffer. Further, the ophthalmic
solution may include an ophthalmologically acceptable surfactant to
assist in dissolving the inhibitor. Viscosity building agents, such
as hydroxymethyl cellulose, hydroxyethyl cellulose,
methylcellulose, polyvinylpyrrolidone, or the like, may be added to
the compositions of the present invention to improve the retention
of the compound.
[0073] In order to prepare a sterile ophthalmic ointment
formulation, the interfering RNA is combined with a preservative in
an appropriate vehicle, such as mineral oil, liquid lanolin, or
white petrolatum. Sterile ophthalmic gel formulations may be
prepared by suspending the interfering RNA in a hydrophilic base
prepared from the combination of, for example, CARBOPOL.RTM.-940
(BF Goodrich, Charlotte, N.C.), or the like, according to methods
known in the art for other ophthalmic formulations. VISCOAT.RTM.
(Alcon Laboratories, Inc., Fort Worth, Tex.) may be used for
intraocular injection, for example. Other compositions of the
present invention may contain penetration enhancing agents such as
cremephor and TWEEN.RTM. 80 (polyoxyethylene sorbitan monolaureate,
Sigma Aldrich, St. Louis, Mo.), in the event the interfering RNA is
less penetrating in the eye.
[0074] Kits:
[0075] Embodiments of the present invention provide a kit that
includes reagents for attenuating the expression of a CTGF mRNA in
a cell. The kit contains a DNA template that has two different
promoters such as a T7 promoter, a T3 promoter or an SP6 promoter,
each operably linked to a nucleotide sequence that encodes two
complementary single-stranded RNAs corresponding to an interfering
RNA. RNA is transcribed from the DNA template and is annealed to
form a double-stranded RNA effective to attenuate expression of the
target mRNA. The kit optionally contains amplification primers for
amplifying the DNA sequence from the DNA template and nucleotide
triphosphates (i.e., ATP, GTP, CTP and UTP) for synthesizing RNA.
Optionally, the kit contains two RNA polymerases, each capable of
binding to a promoter on the DNA template and effecting
transcription of the nucleotide sequence to which the promoter is
operably linked, a purification column for purifying
single-stranded RNA, such as a size exclusion column, one or more
buffers, for example, a buffer for annealing single-stranded RNAs
to yield double stranded RNA, and RNAse A or RNAse T for purifying
double stranded RNA.
Example 1
Interfering RNA for Silencing CTGF in Trabecular Meshwork Cells and
Criteria for Measuring Silencing
[0076] The present study examines the ability of CTGF interfering
RNA to knock-down the levels of endogenous CTGF expression in human
trabecular meshwork (TM) cells. The present study also provides
criteria for determining the efficacy of interfering RNA on mRNA
levels when QPCR primers are used for measurement.
[0077] Transfection of a transformed human TM cell line designated
GTM3 or HTM-3 (see Pang, I. H. et al., 1994. Curr. Eye Res.
13:51-63) was accomplished using standard in vitro concentrations
of CTGF interfering RNA (100 nM) and LIPOFECTAMINE.TM. 2000
(Invitrogen, Carlsbad, Calif.) at a 1:1 (w/v) ratio. A pool of
commercially designed interfering RNAs of unknown sequence
(siGENOME SMARTPOOL.RTM. CTGF interfering RNA (designated siRNA S4
herein), Dharmacon, Lafayette, Colo.) was used to target CTGF.
Scrambled and lamin A/C siRNA (Dharmacon) were used as
controls.
[0078] Control experiments resulted in close to 90% knock-down
efficiency of lamin A/C using lamin A/C interfering RNA when
compared to the scrambled interfering RNA control. Initial studies
showed an efficiency of knock-down of CTGF of about 20-30% when
using siGENOME SMARTPOOL.RTM. CTGF siRNA M-012633-00-0020 (siRNA
S4) using primer/probe set Q2 directed to the CTGF mRNA 3'UTR in
exon 5 (FIG. 2B). Q2 is a QPCR TAQMAN.RTM. primer/probe sets from
ABI (Applied Biosystems, Foster City, Calif.).
[0079] To determine the reason for the poor CTGF siRNA efficacy,
several variables were tested. Dose response with the CTGF
interfering RNA was tested to determine if a suboptimal interfering
RNA concentration or a suboptimal interfering RNA:lipid ratio was
being used. Resultant data indicated poor CTGF mRNA knock-down
regardless of the interfering RNA concentration or interfering
RNA:lipid ratio employed. Given the importance of cellular uptake
on siRNA activity and the inherent difficulty of transfecting TM
cells, the TM cell transfection efficiency was determined under the
above-cited conditions. Transfection efficiency was examined as a
reflection of either cell death induced by SITOX.TM. (Dharmacon)
delivery to the cell cytoplasm or cell fluorescence as measured by
cytoplasmic fluorescence with SIGLO.TM. (Dharmacon). In both cases,
nearly all cells were either dead (FIG. 1A; SITOX.TM.) or
fluorescent (FIG. 1B; SIGLO.TM.), suggesting that the transfection
efficiency was nearly quantitative and not the rate-limiting step
in the process.
[0080] Further, three additional individual CTGF siRNA sequences
from Ambion Inc. (Austin, Tex.) designated siRNA S1, S2, and S3
were tested in combination with two different QPCR TAQMAN.RTM.
primer/probe sets designated Q2 and Q1 (ABI, Applied Biosystems,
Foster City, Calif.). The target sequences for Ambion siRNAs are as
follows using GenBank reference sequence number NM.sub.--001901 for
nucleotides (nts) of CTGF:
TABLE-US-00010 target for S1: (nts 379-397): gggcctcttctgtgacttc
SEQ ID NO: 2 target for S2: (nts 901-919): gggcaaaaagtgcatccgt SEQ
ID NO: 5 target for S3: (nts 1488-1506): ggttagtatcatcagatag SEQ ID
NO: 18
[0081] Double stranded siRNA with a 3'TT overhang on each strand
for each of the above targeted sequences are:
TABLE-US-00011 siRNA Si: 5'-gggccucuucugugacuucTT-3' SEQ ID NO: 30
3'-Ttcccggagaagacacugaag-5' SEQ ID NO: 31 siRNA S2:
5'-gggcaaaaagugcauccguTT-3' SEQ ID NO: 32
3'-TTcccguuuuucacguaggca-5' SEQ ID NO: 33 siRNA S3:
5'-gguuaguaucaucagauagTT-3' SEQ ID NO: 27
3'-TTccaaucauaguagucuauc-5' SEQ ID NO: 28
[0082] The QPCR Q1 primer is a proprietary sequence from ABI ASSAY
ON DEMAND.TM. Hs00170014_m1 (Applied Bio Systems).
[0083] The QPCR Q2 forward primer has the sequence:
TABLE-US-00012 5'-CAGCTCTGACATTCTGATTCGAA-3' SEQ ID NO: 34
[0084] and the Q2 reverse primer has the sequence:
TABLE-US-00013 5'-TGCCACAAGCTGTCCAGTCT-3' SEQ ID NO: 35
[0085] The Q2 probe has the sequence:
[0086] 5'-AATCGACAGGATTCCGATTCCTGAACAGTG-3' SEQ ID NO:36 and has an
FAM group at the 5' end (6-carboxyfluorescein) and a TAMRA group at
the 3' end (Applied Biosystems).
[0087] The location of the primer/probe sets in relation to the
siRNA target sites for the individual siRNAs is shown in FIG. 2A.
Also shown in the schematic of FIG. 2A are the CTGF gene exon
(boxes) and intron (lines) structure and location of siRNAs S1, S2,
and S3 and QPCR primer/probe sets Q1 and Q2 in relation to the
GenBank CTGF sequence NM.sub.--001901, the sequence of which is
provided as SEQ ID NO:1.
[0088] FIG. 2B shows QPCR amplification of CTGF mRNA using the exon
5 primer/probe set Q2 and siRNAs S1-S4. Using the S1 and S4 siRNAs,
no significant knock-down of the CTGF mRNA levels was detected with
the Q2 primer/probe set. Knock-down was demonstrated by siRNAs S2
and S3. The primer/probe set Q2 has closer proximity to the targets
of the S2 and S3 siRNAs as compared to the target of the S1
siRNA.
[0089] FIG. 2C shows QPCR amplification of CTGF mRNA using the exon
4/5 spanning primer/probe set Q1. Knock-down of CTGF mRNA was
demonstrated by each of the siRNAs and an .about.90% knock-down was
observed with the S2 siRNA using the Q1 primer/probe set for
detection. The primer/probe set Q1 appears to be more efficient at
demonstrating knock-down by the siRNAs as compared to the Q2 primer
probe set.
[0090] The data of FIG. 2B and FIG. 2C suggest that the particular
region amplified using the 3'-UTR-directed primer/probe set Q2 may
be relatively stable and thus a poor choice for assessing the
cleavage and degradation of the CTGF mRNA by the targeting siRNA.
Therefore, siRNA efficacy may be underreported in specific cases
where the QPCR amplification region lies outside the siRNA
targeting region.
[0091] To reduce the chance of non-specific, off-target effects,
the lowest possible siRNA concentration for inhibiting CTGF mRNA
expression was determined. CTGF mRNA knock-down was assessed by
QPCR amplification using primer/probe set Q1. A dose response of
CTGF S2 siRNA in GTM3 cells is shown in FIG. 3. An IC.sub.50 of
.about.2.5 nM was observed in GTM3 cells after 24 hour treatment
with 0, 1, 3, 10, 30, and 100 nM dose range of S2 siRNA. Data were
fitted using GraphPad Prism 4 software (GraphPad Software, Inc.,
San Diego, Calif.) with a variable slope, sigmoidal dose response
algorithm and a top constraint of 100%.
[0092] The results of this example demonstrate that i) trabecular
meshwork cells carry out siRNA silencing, ii) all of the siRNAs
cited herein effect a degree of silencing, and iii) when using a
PCR-based approach to determine the efficacy of siRNA knock-down,
the PCR amplification primers are designed to encompass the siRNA
targeting sequence for optimum detection of silencing.
[0093] Cleavage of target mRNA by the RISC endonuclease has been
shown to occur near the center of the siRNA targeting sequence
(Elbashir, S. M., et al., 2001. Genes Dev 15:188-200) and is
accomplished by Argonaute RNaseH activity (Liu, J., et al., 2004.
Science 305:1437-1441). However, complete degradation of the
remaining mRNA appears not to be guaranteed. Stable fragments of
mRNA may remain following Argonaute cleavage and amplification of
one of these fragments by QPCR may underreport the siRNA efficacy
as shown herein. The present invention provides an embodiment where
QPCR primer sets encompass the siRNA target sequence to ensure
optimum siRNA efficiency readout.
[0094] The references cited herein, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated by reference.
[0095] Those of skill in the art, in light of the present
disclosure, will appreciate that obvious modifications of the
embodiments disclosed herein can be made without departing from the
spirit and scope of the invention. All of the embodiments disclosed
herein can be made and executed without undue experimentation in
light of the present disclosure. The full scope of the invention is
set out in the disclosure and equivalent embodiments thereof. The
specification should not be construed to unduly narrow the full
scope of protection to which the present invention is entitled.
[0096] As used herein and unless otherwise indicated, the terms "a"
and "an" are taken to mean "one", "at least one" or "one or more".
Sequence CWU 1
1
3612312DNAHomo sapiens 1tccagtgacg gagccgcccg gccgacagcc ccgagacgac
agcccggcgc gtcccggtcc 60ccacctccga ccaccgccag cgctccaggc cccgcgctcc
ccgctcgccg ccaccgcgcc 120ctccgctccg cccgcagtgc caaccatgac
cgccgccagt atgggccccg tccgcgtcgc 180cttcgtggtc ctcctcgccc
tctgcagccg gccggccgtc ggccagaact gcagcgggcc 240gtgccggtgc
ccggacgagc cggcgccgcg ctgcccggcg ggcgtgagcc tcgtgctgga
300cggctgcggc tgctgccgcg tctgcgccaa gcagctgggc gagctgtgca
ccgagcgcga 360cccctgcgac ccgcacaagg gcctcttctg tgacttcggc
tccccggcca accgcaagat 420cggcgtgtgc accgccaaag atggtgctcc
ctgcatcttc ggtggtacgg tgtaccgcag 480cggagagtcc ttccagagca
gctgcaagta ccagtgcacg tgcctggacg gggcggtggg 540ctgcatgccc
ctgtgcagca tggacgttcg tctgcccagc cctgactgcc ccttcccgag
600gagggtcaag ctgcccggga aatgctgcga ggagtgggtg tgtgacgagc
ccaaggacca 660aaccgtggtt gggcctgccc tcgcggctta ccgactggaa
gacacgtttg gcccagaccc 720aactatgatt agagccaact gcctggtcca
gaccacagag tggagcgcct gttccaagac 780ctgtgggatg ggcatctcca
cccgggttac caatgacaac gcctcctgca ggctagagaa 840gcagagccgc
ctgtgcatgg tcaggccttg cgaagctgac ctggaagaga acattaagaa
900gggcaaaaag tgcatccgta ctcccaaaat ctccaagcct atcaagtttg
agctttctgg 960ctgcaccagc atgaagacat accgagctaa attctgtgga
gtatgtaccg acggccgatg 1020ctgcaccccc cacagaacca ccaccctgcc
ggtggagttc aagtgccctg acggcgaggt 1080catgaagaag aacatgatgt
tcatcaagac ctgtgcctgc cattacaact gtcccggaga 1140caatgacatc
tttgaatcgc tgtactacag gaagatgtac ggagacatgg catgaagcca
1200gagagtgaga gacattaact cattagactg gaacttgaac tgattcacat
ctcatttttc 1260cgtaaaaatg atttcagtag cacaagttat ttaaatctgt
ttttctaact gggggaaaag 1320attcccaccc aattcaaaac attgtgccat
gtcaaacaaa tagtctatct tccccagaca 1380ctggtttgaa gaatgttaag
acttgacagt ggaactacat tagtacacag caccagaatg 1440tatattaagg
tgtggcttta ggagcagtgg gagggtacca gcagaaaggt tagtatcatc
1500agatagctct tatacgagta atatgcctgc tatttgaagt gtaattgaga
aggaaaattt 1560tagcgtgctc actgacctgc ctgtagcccc agtgacagct
aggatgtgca ttctccagcc 1620atcaagagac tgagtcaagt tgttccttaa
gtcagaacag cagactcagc tctgacattc 1680tgattcgaat gacactgttc
aggaatcgga atcctgtcga ttagactgga cagcttgtgg 1740caagtgaatt
tcctgtaaca agccagattt tttaaaattt atattgtaaa tattgtgtgt
1800gtgtgtgtgt gtgtatatat atatatatat gtacagttat ctaagttaat
ttaaagttgt 1860ttgtgccttt ttatttttgt ttttaatgct ttgatatttc
aatgttagcc tcaatttctg 1920aacaccatag gtagaatgta aagcttgtct
gatcgttcaa agcatgaaat ggatacttat 1980atggaaattc tctcagatag
aatgacagtc cgtcaaaaca gattgtttgc aaaggggagg 2040catcagtgtc
cttggcaggc tgatttctag gtaggaaatg tggtagctca cgctcacttt
2100taatgaacaa atggccttta ttaaaaactg agtgactcta tatagctgat
cagttttttc 2160acctggaagc atttgtttct actttgatat gactgttttt
cggacagttt atttgttgag 2220agtgtgacca aaagttacat gtttgcacct
ttctagttga aaataaagta tattttttct 2280aaaaaaaaaa aaaaacgaca
gcaacggaat tc 2312219DNAArtificial SequenceTARGETING SEQUENCE
2gggcctcttc tgtgacttc 19319DNAArtificial SequenceTargeting Sequence
3ccgactggaa gacacgttt 19419DNAArtificial SequenceTargeting Sequence
4cccgggttac caatgacaa 19525DNAArtificial SequenceTargeting Sequence
5tccaagccta tcaagtttga gcttt 25625DNAArtificial SequenceTargeting
Sequence 6tccaagccta tcaagtttga gcttt 25719DNAArtificial
SequenceTargeting Sequence 7gcctatcaag tttgagctt 19825DNAArtificial
SequenceTargeting Sequence 8gcatgaagac ataccgagct aaatt
25919DNAArtificial SequenceTargeting Sequence 9gctaaattct gtggagtat
191025DNAArtificial SequenceTargeting Sequence 10gccattacaa
ctgtcccgga gacaa 251119DNAArtificial SequenceTargeting Sequence
11ggaagatgta cggagacat 191225DNAArtificial SequenceTargeting
Sequence 12gagagtgaga gacattaact catta 251325DNAArtificial
SequenceTargeting Sequence 13gccatgtcaa acaaatagtc tatct
251419DNAArtificial SequenceTargeting Sequence 14gggtaccagc
agaaaggtt 191519DNAArtificialTargeting Sequence 15ccagcagaaa
ggttagtat 191619DNAArtificial SequenceTargeting Sequence
16gcagaaaggt tagtatcat 191725DNAArtificial SequenceTargeting
Sequence 17gcagaaaggt tagtatcatc agata 251819DNAArtificial
SequenceTargeting Sequence 18ggttagtatc atcagatag
191925DNAArtificial SequenceTargeting Sequence 19ggttagtatc
atcagatagc tctta 252025DNAArtificial SequenceTargeting Sequence
20gagactgagt caagttgttc cttaa 252119DNAArtificial SequenceTargeting
Sequence 21gcagactcag ctctgacat 192225DNAArtificial
SequenceTargeting Sequence 22tcagctctga cattctgatt cgaat
252325DNAArtificial SequenceTargeting Sequence 23tcctgtcgat
tagactggac agctt 252419DNAArtificial SequenceTargeting Sequence
24gcttgtggca agtgaattt 192521RNAArtificial SequenceSense Strand
25gguuaguauc aucagauagu u 212621RNAArtificial SequenceAntisense
Strand 26cuaucugaug auacuaaccu u 212721DNAArtificial SequenceSense
Strand with 3'TT 27gguuaguauc aucagauagt t 212821DNAArtificial
SequenceAntisense Strand with 3'TT 28cuaucugaug auacuaacct t
212951DNAArtificial SequenceHairpin Duplex With Loop 29gguuaguauc
aucagauagu unnnnnnnnn cuaucugaug auacuaaccu u 513021DNAArtificial
SequenceSense Strand with 3'TT 30gggccucuuc ugugacuuct t
213121DNAArtificial SequenceAntisense Strand with 3'TT 31gaagucacag
aagaggccct t 213221DNAArtificial SequenceSense Strand with 3'TT
32gggcaaaaag ugcauccgut t 213321DNAArtificialAntisense Strand with
3'TT 33acggaugcac uuuuugccct t 213423DNAArtificial
SequenceProbe/Primer Sequence 34cagctctgac attctgattc gaa
233520DNAArtificial SequenceProbe/Primer Sequence 35tgccacaagc
tgtccagtct 203630DNAArtificial SequenceProbe/Primer Sequence
36aatcgacagg attccgattc ctgaacagtg 30
* * * * *