U.S. patent application number 13/964956 was filed with the patent office on 2014-04-03 for human monoclonal antibodies against cd20.
This patent application is currently assigned to GENMAB A/S. The applicant listed for this patent is Genmab A/S. Invention is credited to Ole Baadsgaard, Martin Glennie, Haichun Huang, Paul Parren, Jorgen Petersen, Sigrid Ruuls, Jessica Teeling, Jan G.J. van de Winkel.
Application Number | 20140093454 13/964956 |
Document ID | / |
Family ID | 32110219 |
Filed Date | 2014-04-03 |
United States Patent
Application |
20140093454 |
Kind Code |
A1 |
Teeling; Jessica ; et
al. |
April 3, 2014 |
Human Monoclonal Antibodies Against CD20
Abstract
Isolated human monoclonal antibodies which bind to and inhibit
human CD20, and related antibody-based compositions and molecules,
are disclosed. The human antibodies can be produced by a
transfectoma or in a non-human transgenic animal, e.g., a
transgenic mouse, capable of producing multiple isotypes of human
monoclonal antibodies by undergoing V-D-J recombination and isotype
switching. Also disclosed are pharmaceutical compositions
comprising the human antibodies, non-human transgenic animals and
hybridomas which produce the human antibodies, and therapeutic and
diagnostic methods for using the human antibodies.
Inventors: |
Teeling; Jessica;
(Southampton, GB) ; Ruuls; Sigrid; (De Bilt,
NL) ; Glennie; Martin; (Southampton, GB) ; van
de Winkel; Jan G.J.; (Zeist, NL) ; Parren; Paul;
(Odyk, NL) ; Petersen; Jorgen; (Rungsted Kyst,
DK) ; Baadsgaard; Ole; (Malmo, SE) ; Huang;
Haichun; (Fremont, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genmab A/S |
Copenhagen K |
|
DK |
|
|
Assignee: |
GENMAB A/S
Copenhagen K
DK
|
Family ID: |
32110219 |
Appl. No.: |
13/964956 |
Filed: |
August 12, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10687799 |
Oct 17, 2003 |
8529902 |
|
|
13964956 |
|
|
|
|
60419163 |
Oct 17, 2002 |
|
|
|
60460028 |
Apr 2, 2003 |
|
|
|
Current U.S.
Class: |
424/9.1 ;
424/142.1; 435/252.33; 435/257.2; 435/320.1; 435/343.1; 435/69.6;
435/7.24; 435/7.9; 436/501; 514/44R; 530/387.2; 530/387.3;
530/388.15; 530/391.3; 530/391.7 |
Current CPC
Class: |
A61K 39/3955 20130101;
A61P 7/00 20180101; C07K 2317/54 20130101; A61P 1/00 20180101; A61P
25/28 20180101; A61P 37/08 20180101; C07K 16/2887 20130101; A61P
21/04 20180101; A61P 37/02 20180101; A61P 13/12 20180101; G01N
33/686 20130101; A61P 37/00 20180101; A61P 11/00 20180101; A61P
27/02 20180101; A61P 9/08 20180101; A61P 9/14 20180101; A61P 37/06
20180101; A61P 17/06 20180101; C07K 2317/92 20130101; A61P 1/04
20180101; A61P 43/00 20180101; A61K 2039/505 20130101; C07K
2317/734 20130101; A61P 7/06 20180101; A61P 31/20 20180101; C07K
2317/21 20130101; A61P 11/06 20180101; A61P 29/00 20180101; A61P
3/10 20180101; C07K 2317/56 20130101; A61K 45/06 20130101; C07K
2317/72 20130101; A61P 7/04 20180101; A61P 19/02 20180101; A61P
35/02 20180101; C07K 2317/732 20130101; A61P 5/14 20180101; A61P
31/22 20180101; A61P 35/00 20180101; A61P 25/00 20180101; A61P 9/10
20180101; A61P 17/00 20180101; A61P 31/18 20180101; C07K 16/4258
20130101; A61P 17/08 20180101 |
Class at
Publication: |
424/9.1 ;
530/388.15; 530/387.3; 435/252.33; 424/142.1; 530/391.3; 530/391.7;
436/501; 435/7.24; 435/320.1; 514/44.R; 530/387.2; 435/69.6;
435/257.2; 435/343.1; 435/7.9 |
International
Class: |
C07K 16/28 20060101
C07K016/28; A61K 45/06 20060101 A61K045/06; G01N 33/68 20060101
G01N033/68; A61K 39/395 20060101 A61K039/395 |
Claims
1. An isolated human monoclonal antibody which binds to human CD20,
comprising a heavy chain with a variable region (V.sub.H)
comprising CDRs 1-3 and a light chain with a variable region
(V.sub.L) comprising CDRs 1-3, wherein: (i) the V.sub.H CDR1 amino
acid sequence comprises the sequence of SEQ ID NO: 13; the V.sub.H
CDR2 amino acid sequence comprises the sequence of SEQ ID NO: 14;
the V.sub.H CDR3 amino acid sequence comprises the sequence of SEQ
ID NO: 15; the V.sub.L CDR1 amino acid sequence comprises the
sequence of SEQ ID NO: 16; the V.sub.L CDR2 amino acid sequence
comprises the sequence of SEQ ID NO: 17; and the V.sub.L CDR3 amino
acid sequence comprises the sequence of SEQ ID NO: 18, (ii) the
V.sub.H CDR1 amino acid sequence comprises the sequence of SEQ ID
NO: 19; the V.sub.H CDR2 amino acid sequence comprises the sequence
of SEQ ID NO: 20; the V.sub.H CDR3 amino acid sequence comprises
the sequence of SEQ ID NO: 21; the V.sub.L CDR1 amino acid sequence
comprises the sequence of SEQ ID NO: 22; the V.sub.L CDR2 amino
acid sequence comprises the sequence of SEQ ID NO: 23 and the
V.sub.L CDR3 amino acid sequence comprises the sequence of SEQ ID
NO: 25, or (iii) the V.sub.H CDR1 amino acid sequence comprises the
sequence of SEQ ID NO: 26; the V.sub.H CDR2 amino acid sequence
comprises the sequence of SEQ ID NO: 27; the V.sub.H CDR3 amino
acid sequence comprises the sequence of SEQ ID NO: 28; the V.sub.L
CDR1 amino acid sequence comprises the sequence of SEQ ID NO: 29;
the V.sub.L CDR2 amino acid sequence comprises the sequence of SEQ
ID NO: 30 and the V.sub.L CDR3 amino acid sequence comprises the
sequence of SEQ ID NO: 31.
2. The antibody of claim 1, selected from the group consisting of
an IgG1, an IgG2, an IgG3, an IgG4, an IgM, an IgA1, an IgA2, a
secretory IgA, an IgD, and an IgE antibody.
3. The antibody of claim 2, wherein the antibody is an IgG1
antibody.
4.-11. (canceled)
12. The antibody of claim 1 encoded by human heavy chain and human
kappa light chain nucleic acids comprising nucleotide sequences as
set forth in SEQ ID NO:1 and SEQ ID NO:3, respectively.
13. The antibody of claim 1 encoded by human heavy chain and human
kappa light chain nucleic acids comprising nucleotide sequences as
set forth in SEQ ID NO:5 and SEQ ID NO:7, respectively.
14. The antibody of claim 1 encoded by human heavy chain and human
kappa light chain nucleic acids comprising nucleotide sequences as
set forth in SEQ ID NO:9 and SEQ ID NO:11, respectively.
15. The antibody of claim 1 comprising human heavy chain and human
kappa light chain variable regions amino acid sequences comprising
SEQ ID NO:2 and SEQ ID NO:4, respectively.
16. (canceled)
17. The antibody of claim 1 comprising human heavy chain and human
kappa light chain variable regions amino acid sequences comprising
SEQ ID NO:6 and SEQ ID NO:8, respectively.
18. (canceled)
19. The antibody of claim 1 comprising human heavy chain and human
kappa light chain variable regions amino acid sequences comprising
SEQ ID NO:10 and SEQ ID NO:12, respectively.
20.-21. (canceled)
22. An isolated human monoclonal antibody which binds to an epitope
on human CD20 defined by the antibody of claim 1.
23. An isolated human monoclonal antibody which binds to an epitope
on CD20, which epitope does not comprise or require proline at
position 172.
24.-43. (canceled)
44. The antibody of claim 1 which is an intact antibody selected
from an intact IgG1 antibody, an intact IgG2 antibody, an intact
IgG3 antibody, an intact IgG4 antibody, an intact IgM antibody, an
intact IgA1 antibody, an intact IgA2 antibody, an intact secretory
IgA antibody, an intact IgD antibody, and an intact IgE antibody,
wherein the antibody is glycosylated when expressed in a eukaryotic
cell.
45. The antibody of claim 1 which is an antibody fragment or a
single chain antibody.
46.-52. (canceled)
53. A transfectoma which produces a human monoclonal antibody
encoded by nucleic acids comprising a human IgG heavy chain
nucleotide sequences as set forth in SEQ ID NOs: 1, 5, or 9 and a
human kappa light chain nucleotide sequence as set forth in SEQ ID
NOs: 3, 7, or 11.
54. A transfectoma which produces a human monoclonal antibody
having IgG heavy chain and kappa light chain variable regions amino
acid sequences comprising SEQ ID NOs:2, 6, or 10, and SEQ ID NOs:4,
8, or 12, respectively.
55. A eukaryotic or prokaryotic host cell which produces a human
monoclonal antibody having heavy chain and light chain variable
regions amino acid sequences comprising SEQ ID NOs:2, 6, or 10, and
SEQ ID Nos:4, 8, or 12, respectively.
56.-61. (canceled)
62. A composition comprising the human antibody of claim 1 and a
pharmaceutically acceptable carrier.
63.-64. (canceled)
65. A composition according to claim 62 further comprising an
additional therapeutic agent.
66. The antibody according to claim 1, further comprising a
chelator linker for attaching the antibody to a radioisotope.
67. An immunoconjugate comprising an antibody according to claim 1
linked to a cytotoxic agent, a radioisotope, or a drug.
68. A bispecific molecule comprising an antibody according to claim
1 wherein the bispecific molecule has binding specificity for a
human effector cell.
69. The bispecific molecule according to claim 68 wherein the
bispecific molecule has binding specificity for a human Fc receptor
or for a T cell receptor.
70.-72. (canceled)
73. A method of treating a disease or disorder involving cells
expressing CD20, comprising administering to a subject in need
thereof a human antibody according to claim 1, in an amount
effective to treat the disease.
74. The method of claim 73, wherein the disease or disorder is a B
cell lymphoma.
75. The method of claim 73, wherein the disease or disorder is B
cell non-Hodgkin's lymphoma.
76. The method of claim 73, wherein the disease or disorder is
precursor B cell lymphoblastic leukemia/lymphoma or a mature B cell
neoplasm.
77. The method of claim 73, wherein the disease or disorder is
follicular lymphoma (FL).
78. The method of claim 76, wherein the disease or disorder is B
cell chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma
(SLL).
79. The method of claim 73, wherein the disease or disorder is
selected from lymphomatoid granulomatosis, primary effusion
lymphoma, intravascular large B cell lymphoma, mediastinal large B
cell lymphoma, heavy chain and lymphomas induced by therapy with
immunosuppressive agents.
80. A method of treating an immune disease involving CD20
expressing immune cells, comprising administering to a subject in
need thereof the antibody of claim 1, in an amount effective to
treat the immune disease.
81. The method of claim 80, wherein treatment results in killing of
B cells which produce antibodies against autoantigens.
82. The method of claim 73, wherein the disease or disorder is
selected from psoriasis, psoriatic arthritis, dermatitis, systemic
scleroderma and sclerosis, inflammatory bowel disease (IBD),
Crohn's disease, ulcerative colitis, respiratory distress syndrome,
meningitis, encephalitis, uveitis, glomerulonephritis, eczema,
asthma, atherosclerosis, leukocyte adhesion deficiency, multiple
sclerosis, Raynaud's syndrome, Sjogren's syndrome, juvenile onset
diabetes, Reiter's disease, Behcet's disease, immune complex
nephritis, IgA nephropathy, IgM polyneuropathies, immune-mediated
thrombocytopenias, hemolytic anemia, myasthenia gravis, lupus
nephritis, systemic lupus erythematosus, rheumatoid arthritis (RA),
atopic dermatitis, pemphigus, Graves' disease, Hashimoto's
thyroiditis, Wegener's granulomatosis, Omenn's syndrome, chronic
renal failure, acute infectious mononucleosis, HIV, and herpes
virus associated diseases.
83. The method of claim 82, wherein the disease or disorder is
rheumatoid arthritis (RA).
84. The method of claim 73, wherein the disease or disorder is an
inflammatory, immune and/or autoimmune disorder selected from
ulcerative colitis, Crohn's disease, juvenile onset diabetes,
multiple sclerosis, immune-mediated thrombocytopenias, hemolytic
anemia, myasthenia gravis, systemic sclerosis, and pemphigus
vulgaris.
85. The method of claim 73, wherein the disease or disorder is an
inflammatory, immune and/or autoimmune disorder selected from
inflammatory bowel disease (IBD), ulcerative colitis, Crohn's
disease, and multiple sclerosis.
86. The method of claim 73, further comprising separately
administering another therapeutic agent to the subject.
87. The method of claim 86, wherein the other therapeutic agent is
a cytotoxic agent or a radiotoxic agent.
88. The method of claim 86, wherein the other therapeutic agent is
an immunosuppressant.
89. The method of claim 86, wherein the other therapeutic agent is
an immunological modulating agent.
90. The method of claim 86, wherein the other therapeutic agent is
selected from doxorubicin, cisplatin, bleomycin, carmustine,
chlorambucil, and cyclophosphamide.
91. The method of claim 86, wherein the other therapeutic agent is
selected from anti-CD25 antibodies, anti-CD 19 antibodies,
anti-CD21 antibodies, anti-CD22 antibodies, anti-CD37 antibodies,
anti-CD38 antibodies, antilL6R antibodies, anti-IL8 antibodies,
anti-IL15 antibodies, anti-IL15R antibodies, antiCD4 antibodies,
anti-CD11a antibodies, anti-alpha-4/beta-1 integrin (VLA4)
antibodies, CTLA4-Ig, and anti-C3b(i) antibodies.
92. An in vitro method for detecting the presence of CD20 antigen,
or a cell expressing CD20, in a sample comprising: contacting the
sample with the antibody of claim 1 under conditions that allow for
formation of a complex between the antibody and CD20; and detecting
the formation of a complex.
93. A kit for detecting the presence of CD20 antigen, or a cell
expressing CD20, in a sample, the kit comprising the antibody of
claim 1.
94. An in vivo method for detecting CD20 antigen, or a cell
expressing CD20, in an subject comprising: administering the
antibody of claim 1 under conditions that allow for formation of a
complex between the antibody and CD20; and detecting the formed
complex.
95.-96. (canceled)
97. An expression vector comprising a nucleotide sequence encoding
a heavy chain variable region comprising a nucleotide sequence set
forth in SEQ ID NO: 1, 5, or 9, and a light variable region
comprising a nucleotide sequence as set forth in SEQ ID NO: 3, 7,
or 11.
98. An expression vector comprising a nucleotide sequence encoding
a heavy chain variable region comprising an amino acid sequence as
set forth in SEQ ID NO:2, 6, or 10, and a light chain variable
region comprising an amino acid sequence as set forth in SEQ ID NO:
4, 8, or 12.
99. A pharmaceutical composition comprising the expression vector
of claim 95 and a pharmaceutically acceptable carrier.
100. An anti-idiotypic antibody binding to an antibody of claim
1.
101. (canceled)
102. A method for detecting the level of the antibody of claim 1 in
a sample, comprising obtaining a sample potentially comprising the
antibody and contacting the sample with an anti-idiotypic antibody
to the antibody.
103. A method for producing a human monoclonal antibody which binds
to human CD20 in a host cell, wherein the method comprises: (a)
transfecting the host cell with an expression vector comprising
human IgG heavy chain and human kappa light chain nucleic acids
comprising nucleotide sequences as set forth in: (i) SEQ ID NOs: 1
and 3, respectively, (ii) SEQ ID NOs: 5 and 7, respectively, or
(iii) SEQ ID NOs: 9 and 11, respectively; (b) culturing the host
cell in culture medium; (c) expressing the antibody in the host
cell; and (d) isolating and purifying the expressed antibody from
the culture supernatant and/or host cell.
104. The method according to claim 103, wherein the host cell is a
eukaryotic or prokaryotic cell.
105. An antibody produced according to the method of claim 103.
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 60/419,163, filed on Oct. 17, 2002, and U.S.
Provisional Application No. 60/460,028, filed on Apr. 2, 2003, both
entitled HUMAN MONOCLONAL ANTIBODIES AGAINST CD20, and both of
which are incorporated herein in their entirety by this
reference.
BACKGROUND OF THE INVENTION
[0002] The CD20 molecule (also called human B-lymphocyte-restricted
differentiation antigen or Bp35) is a hydrophobic transmembrane
protein with a molecular weight of approximately 35 kD located on
pre-B and mature B lymphocytes (Valentine et al. (1989)J. Biol.
Chem. 264(19):11282-11287; and Einfield et al. (1988) EMBO J.
7(3):711-717). CD20 is found on the surface of greater than 90% of
B cells from peripheral blood or lymphoid organs and is expressed
during early pre-B cell development and remains until plasma cell
differentiation. CD20 is present on both normal B cells as well as
malignant B cells. In particular, CD20 is expressed on greater than
90% of B cell non-Hodgkin's lymphomas (NHL) (Anderson et al. (1984)
Blood 63(6):1424-1433), but is not found on hematopoietic stem
cells, pro-B cells, normal plasma cells, or other normal tissues
(Tedder et al. (1985) J. Immunol. 135(2):973-979).
[0003] The 85 amino acid carboxyl-terminal region of the CD20
protein is located within the cytoplasm. The length of this region
contrasts with that of other B cell-specific surface structures
such as IgM, IgD, and IgG heavy chains or histocompatibility
antigens class II .alpha. or .beta. chains, which have relatively
short intracytoplasmic regions of 3, 3, 28, 15, and 16 amino acids,
respectively (Komaromy et al. (1983) NAR 11:6775-6785). Of the last
61 carboxyl-terminal amino acids, 21 are acidic residues, whereas
only 2 are basic, indicating that this region has a strong net
negative charge. The GenBank Accession No. is NP.sub.--690605.
[0004] It is thought that CD20 might be involved in regulating an
early step(s) in the activation and differentiation process of B
cells (Tedder et al. (1986) Eur. J. Immunol. 16:881-887) and could
function as a calcium ion channel (Tedder et al. (1990)J. Cell.
Biochem. 14D:195).
[0005] Despite uncertainty about the actual function of CD20 in
promoting proliferation and/or differentiation of B cells, it
provides an important target for antibody mediated therapy to
control or kill B cells involved in cancers and autoimmune
disorders. In particular, the expression of CD20 on tumor cells,
e.g., NHL, makes it an important target for antibody mediated
therapy to specifically target therapeutic agents against
CD20-positive neoplastic cells. However, while the results obtained
to date clearly establish CD20 as a useful target for
immunotherapy, they also show that currently available murine and
chimeric antibodies do not constitute ideal therapeutic agents.
[0006] Accordingly, the need exists for improved therapeutic
antibodies against CD20 which are effective in preventing and/or
treating a range of diseases involving cells expressing CD20.
SUMMARY OF THE INVENTION
[0007] The present invention provides improved antibody
therapeutics for treating and/or preventing diseases associated
with cells expressing CD20, including tumor-related diseases, and
immune diseases, including autoimmune diseases. The antibodies
encompassed by the invention are improved in that they are fully
human and, thus, are potentially less immunogenic in patients.
[0008] As exemplified herein, the human antibodies of the invention
mediate killing of B cells expressing CD20 by a variety of
mechanisms. In one embodiment, human antibodies of the invention
induce complement dependent cytotoxicity (CDC), e.g., at least
about 20% CDC mediated lysis, preferably about 30% CDC mediated
lysis, and more preferably 40-50% mediated lysis in cells, such as
chronic B-lymphocytic leukaemia (B-CLL) cells. In another
embodiment, human antibodies of the invention induce apoptosis of
cells expressing CD20. In another embodiment, human antibodies of
the invention induce homotypic adhesion of cells expressing CD20.
Furthermore, the human antibodies of the invention may induce
antibody dependent cellular cytotoxicity (ADCC) of cells expressing
CD20 in the presence of human effector cells (e.g., monocytes,
mononuclear cells, NK cells and PMNs). Furthermore, human
antibodies of the invention may induce phagocytosis of cells
expressing CD20 in the presence of macrophages. The human
monoclonal antibodies of the invention may work by one or more of
these mechanisms. Examples of cells which can be killed by human
antibodies of the present invention include, but are not limited
to, B cells expressing CD20, such as tumorigenic B cells and B
cells involved in immune diseases. In a particular embodiment, the
human antibodies are used to mediate killing of B lymphocytes in
the treatment of lymphoma, e.g., B cell non-Hodgkin's lymphoma.
[0009] Human antibodies of the invention include IgG1 (e.g.,
IgG1,.kappa.), IgG3 (e.g., IgG3,.kappa.) and IgG4 (e.g.,
IgG4,.kappa.) antibodies. However, other antibody isotypes are also
encompassed by the invention, including IgG2, IgM, IgA1, IgA2,
secretory IgA, IgD, and IgE. The antibodies can be whole antibodies
or antigen-binding fragments thereof including, for example, Fab,
F(ab').sub.2, Fv, single chain Fv fragments or bispecific
antibodies. Furthermore, the antigen-binding fragments include
binding-domain immunoglobulin fusion proteins comprising (i) a
binding domain polypeptide (such as a heavy chain variable region
or a light chain variable region) that is fused to an
immunoglobulin hinge region polypeptide, (ii) an immunoglobulin
heavy chain CH2 constant region fused to the hinge region, and
(iii) an immunoglobulin heavy chain CH3 constant region fused to
the CH2 constant region. Such binding-domain immunoglobulin fusion
proteins are further disclosed in US 2003/0118592 and US
2003/0133939.
[0010] Particular human antibodies of the present invention include
those referred to as 11B8, 2F2, and 7D8, encoded by human heavy
chain and human kappa light chain nucleic acids comprising
nucleotide sequences in their variable regions as set forth in SEQ
ID NOs:1, 5, or 9 and SEQ ID NOs:3, 7, or 11, respectively, and
conservative sequence modifications thereof. In another embodiment,
the human antibodies are characterized by having human heavy chain
and human kappa light chain variable regions comprising the amino
acid sequences as set forth in SEQ ID NOs:2, 6, or 10 and SEQ ID
NOs:4, 8, or 12, respectively, and conservative sequence
modifications thereof.
[0011] In yet another embodiment, the human antibodies are
characterized by having human heavy chain and human kappa light
chain variable regions which are at least 90% homologous,
preferably at least 95% homologous, and more preferably at least
98%, or at least 99% homologous to the amino acid sequences as set
forth in SEQ ID NO:2 and SEQ ID NO:4, respectively; SEQ ID NO:6 and
SEQ ID NO:8, respectively; or SEQ ID NO:10 and SEQ ID NO:12,
respectively.
[0012] Other particular human antibodies of the invention include
those which comprise a CDR domain having a human heavy and light
chain CDR1 region, a human heavy and light chain CDR2 region, and a
human heavy and light chain CDR3 region, wherein
[0013] (a) the CDR1, CDR2, and CDR3 human heavy chain regions
comprise an amino acid sequence selected from the group consisting
of the amino acid sequences CDR1, CDR2, and CDR3 shown in FIG. 53,
55, or 57 (SEQ ID NOs:13-15, 19-21, and 25-27), and conservative
sequence modifications thereof, and
[0014] (b) the CDR1, CDR2, and CDR3 human light chain regions
comprise an amino acid sequence selected from the group consisting
of the amino acid sequences CDR1, CDR2, and CDR3 shown in FIG. 53,
55, or 57 (SEQ ID NOs: 16-18, 22-24, and 28-30), and conservative
sequence modifications thereof.
[0015] Also included within the present invention are antibodies
which dissociate from CD20 with a dissociation equilibrium constant
(K.sub.D) of approximately 1-10 nM or less. Such antibodies also
include those which do not cross-react with related cell-surface
antigens and thus do not inhibit their function.
[0016] In another embodiment, human anti-CD20 antibodies of the
present invention can be characterized by one or more of the
following properties:
[0017] a) specificity for human CD20;
[0018] b) a binding affinity to CD20 (K.sub.D) of about 10 nM or
less, preferably, about 5 nM or less and, more preferably, about
1-3 nM or less as determined by the binding experiment disclosed in
Example 5 (FIG. 9) herein;
[0019] c) a dissociation rate constant (k.sub.d) from CD20 of about
10.sup.-4 sec.sup.-1 or less, preferably, about 10.sup.-5
sec.sup.-1 or less and, more preferably, about 10.sup.-6 sec.sup.-1
or less, as determined by the dissociation rate experiment
disclosed in Example 5 (FIG. 9) herein;
[0020] d) the ability to mediate a high level of CDC on either
CD55/59 negative or CD55/59 positive cells;
[0021] e) the ability to translocate into lipid rafts upon binding
to CD20;
[0022] f) the ability to inhibit the growth of cells which express
CD20;
[0023] g) the ability to induce apoptosis of cells which express
CD20;
[0024] h) the ability to induce homotypic adhesion of cells which
express CD20;
[0025] i) the ability to induce ADCC of cells which express CD20 in
the presence of effector cells;
[0026] j) the ability to prolong survival of a subject having tumor
cells which express CD20;
[0027] k) the ability to deplete cells which express CD20;
and/or
[0028] l) the ability to deplete cells which express low levels of
CD20 (CD20.sup.low cells).
[0029] The human anti-CD20 antibodies of the present invention can
be derivatized, linked to or co-expressed to other binding
specificities. In a particular embodiment, the invention provides a
bispecific or multispecific molecule comprising at least one first
binding specificity for CD20 (e.g., a human anti-CD20 antibody or
mimetic thereof), and a second binding specificity for a human
effector cell, such as a binding specificity for an Fc receptor
(e.g., a human Fc.gamma. receptor, such as Fc.gamma.RI, or a human
Fc.alpha. receptor) or a T cell receptor, e.g., CD3.
[0030] Accordingly, the present invention includes bispecific and
multispecific molecules that bind to both human CD20 and to an Fc
receptor or a T cell receptor, e.g., CD3. Examples of Fc receptors
are, e.g., a human IgG receptor, e.g., an Fc-gamma receptor
(Fc.gamma.R), such as Fc.gamma.RI (CD64), Fc.gamma.RII (CD32), and
Fc.gamma.RIII (CD 16). Other Fc receptors, such as human IgA
receptors (e.g., Fc.alpha.RI), also can be targeted. The Fc
receptor is preferably located on the surface of an effector cell,
e.g., a monocyte, macrophage or an activated mononuclear cell. In a
preferred embodiment, the bispecific and multispecific molecules
bind to an Fc receptor at a site which is distinct from the
immunoglobulin Fc (e.g., IgG or IgA) binding site of the receptor.
Therefore, the binding of the bispecific and multispecific
molecules is not blocked by physiological levels of
immunoglobulins.
[0031] In yet another aspect, human anti-CD20 antibodies of the
invention are derivatized, linked to or co-expressed with another
functional molecule, e.g., another peptide or protein (e.g., a Fab'
fragment). For example, an antibody of the invention can be
functionally linked (e.g., by chemical coupling, genetic fusion,
noncovalent association or otherwise) to one or more other
molecular entities, such as another antibody (e.g., to produce a
bispecific or a multispecific antibody), a cytotoxin, cellular
ligand or antigen (e.g., to produce an immunoconjugate, such as an
immunotoxin). An antibody of the present invention can be linked to
other therapeutic moieties, e.g., a radioisotope, a small molecule
anti-cancer drug, an anti-inflammatory agent, or an
immunosuppressive agent. Accordingly, the present invention
encompasses a large variety of antibody conjugates, bispecific and
multispecific molecules, and fusion proteins, all of which bind to
CD20 expressing cells and which can be used to target other
molecules to such cells.
[0032] In still another aspect, the invention provides
compositions, e.g., pharmaceutical and diagnostic
compositions/kits, comprising a pharmaceutically acceptable carrier
formulated along with one or a combination of human monoclonal
antibodies of the invention. In a particular embodiment, the
composition includes a combination of antibodies which bind to
distinct epitopes or which possess distinct functional
characteristics, such as inducing CDC and inducing apoptosis.
[0033] Human antibodies, immunoconjugates, bispecific and
multispecific molecules and compositions of the present invention
can be used in a variety of methods for inhibiting growth of cells
expressing CD20 and/or killing cells expressing CD20 by contacting
the cells with an effective amount of the antibody,
immunoconjugate, bispecific/multispecific molecule or composition,
such that the growth of the cell is inhibited and/or the cell is
killed. In one embodiment, the method includes killing of the cell
expressing CD20 in the presence of effector cells, for example, by
CDC, apoptosis, ADCC, phagocytosis, or by a combination of two or
more of these mechanisms. The cells are preferably killed or
inhibited without killing or inhibiting the activity of cells which
do not express CD20 but which may, for example, express a
structurally related cell-surface antigen (i.e., without
cross-reactivity to related but functionally distinct cell surface
antigens). Cells expressing CD20 which can be inhibited or killed
using the human antibodies of the invention include, for example,
tumorigenic B cells.
[0034] Accordingly, human antibodies of the present invention can
be used to treat and/or prevent a variety of diseases involving
cells expressing CD20 by administering the antibodies to patients
suffering from such diseases. Exemplary diseases that can be
treated (e.g., ameliorated) or prevented include, but are not
limited to, tumorigenic diseases and immune diseases, e.g.,
autoimmune diseases. Examples of tumorigenic diseases which can be
treated and/or prevented include B cell lymphoma, e.g., NHL,
including precursor B cell lymphoblastic leukemia/lymphoma and
mature B cell neoplasms, such as B cell chronic lymphocytic
leukemia (CLL)/small lymphocytic lymphoma (SLL), B cell
prolymphocytic leukemia, lymphoplamacytic lymphoma, mantle cell
lymphoma (MCL), follicular lymphoma (FL), including low-grade,
intermediate-grade and high-grade FL, cutaneous follicle center
lymphoma, marginal zone B cell lymphoma (MALT type, nodal and
splenic type), hairy cell leukemia, diffuse large B cell lymphoma,
Burkitt's lymphoma, plasmacytoma, plasma cell myeloma,
post-transplant lymphoproliferative disorder, Waldenstrom's
macroglobulinemia, and anaplastic large-cell lymphoma (ALCL).
Examples of immune disorders in which CD20 expressing B cells are
involved which can be treated and/or prevented include psoriasis,
psoriatic arthritis, dermatitis, systemic scleroderma and
sclerosis, inflammatory bowel disease (IBD), Crohn's disease,
ulcerative colitis, respiratory distress syndrome, meningitis,
encephalitis, uveitis, glomerulonephritis, eczema, asthma,
atherosclerosis, leukocyte adhesion deficiency, multiple sclerosis,
Raynaud's syndrome, Sjogren's syndrome, juvenile onset diabetes,
Reiter's disease, Behcet's disease, immune complex nephritis, IgA
nephropathy, IgM polyneuropathies, immune-mediated
thrombocytopenias, such as acute idiopathic thrombocytopenic
purpura and chronic idiopathic thrombocytopenic purpura, hemolytic
anemia, myasthenia gravis, lupus nephritis, systemic lupus
erythematosus, rheumatoid arthritis (RA), atopic dermatitis,
pemphigus, Graves' disease, Hashimoto's thyroiditis, Wegener's
granulomatosis, Omenn's syndrome, chronic renal failure, acute
infectious mononucleosis, HIV, and herpes virus associated
diseases. Further examples are severe acute respiratory distress
syndrome and choreoretinitis. Yet further examples are diseases and
disorders caused by infection of B-cells with virus, such as
Epstein-Barr virus (EBV).
[0035] In a particular embodiment of the invention, the subject
being administered the antibody is additionally treated with a
chemotherapeutic agent, radiation, or an agent that modulates,
e.g., enhances or inhibits, the expression or activity of an Fc
receptor, e.g., an Fc.alpha. receptor or an Fc.gamma. receptor,
such as a cytokine. Typical cytokines for administration during
treatment include granulocyte colony-stimulating factor (G-CSF),
granulocyte-macrophage colony-stimulating factor (GM-CSF),
interferon-.gamma. (IFN-.gamma.), and tumor necrosis factor (TNF).
Typical therapeutic agents include, among others, anti-neoplastic
agents such as doxorubicin, cisplatin, bleomycin, carmustine,
chlorambucil, and cyclophosphamide.
[0036] In yet another aspect, the present invention provides a
method for detecting in vitro or in vivo the presence of CD20 in a
sample or individual, e.g., for diagnosing a CD20-related disease,
preferably at an early stage. This can also be useful for
monitoring the disease and effect of treatment and for determining
and adjusting the dose of the antibody to be administered. The in
vivo method can be performed using imaging technique such as PET
(positron emission tomography) or SPECT (single photon emission
computed tomography). In one embodiment, this is achieved by
contacting a sample to be tested, optionally along with a control
sample, with a human monoclonal antibody of the invention under
conditions that allow for formation of a complex between the
antibody and CD20. Complex formation is then detected (e.g., using
an FACS analysis or Western blotting). When using a control sample
along with the test sample, complex is detected in both samples and
any statistically significant difference in the formation of
complexes between the samples is indicative of the presence of CD20
in the test sample.
[0037] In yet another aspect, the invention provides a transgenic
non-human animal, such as a transgenic mouse, which express human
monoclonal antibodies that bind to CD20. In a particular
embodiment, the transgenic non-human animal is a transgenic mouse
having a genome comprising a human heavy chain transgene and a
human light chain transgene encoding all or a portion of an
antibody of the invention. The transgenic non-human animal can be
immunized with a purified or enriched preparation of CD20 antigen
and/or cells expressing CD20. Preferably, the transgenic non-human
animal, e.g., the transgenic mouse, is capable of producing
multiple isotypes of human monoclonal antibodies to CD20 (e.g.,
IgG, IgA and/or IgM) by undergoing V-D-J recombination and isotype
switching. Isotype switching may occur by, e.g., classical or
non-classical isotype switching.
[0038] Accordingly, in yet another aspect, the invention provides
isolated B cells from a transgenic non-human animal as described
above, e.g., a transgenic mouse, which expresses human anti-CD20
antibodies. The isolated B cells can then be immortalized by fusion
to an immortalized cell to provide a source (e.g., a hybridoma) of
human anti-CD20 antibodies. Such hybridomas (i.e., which produce
human anti-CD20 antibodies) are also included within the scope of
the invention.
[0039] As exemplified herein, human antibodies of the invention can
be obtained directly from hybridomas which express the antibody, or
can be cloned and recombinantly expressed in a host cell (e.g., a
CHO cell, a NS/0 cell or a lymphocytic cell). Further examples of
host cells are microorganisms, such as E. coli, and fungi, such as
yeast. Alternatively, they can be produced recombinantly in a
transgenic non-human animal or plant. Accordingly, in another
aspect, the present invention provides methods for producing human
monoclonal antibodies which bind to human CD20. In one embodiment,
the method includes immunizing a transgenic non-human animal, e.g.,
a transgenic mouse, as previously described (e.g., having a genome
comprising a human heavy chain transgene and a human light chain
transgene encoding all or a portion of an anti-CD20 antibody), with
a purified or enriched preparation of human CD20 antigen and/or
cells expressing human CD20. B cells (e.g., splenic B cells) of the
animal are then obtained and fused with myeloma cells to form
immortal, hybridoma cells that secrete human monoclonal antibodies
against CD20.
[0040] In yet another aspect, the invention provides nucleic acid
molecules encoding human anti-CD20 antibodies (e.g., variable
regions thereof), as well as recombinant expression vectors which
include the nucleic acids of the invention, and host cells
transfected with such vectors. Methods of producing the antibodies
by culturing these host cells are also encompassed by the
invention. Particular nucleic acids provided by the invention
comprise the nucleotide sequences shown in SEQ ID NOs:1, 5, or 9
and SEQ ID NOs:3, 7, or 11, encoding the heavy and light chains,
respectively, of human anti-CD20 antibodies 2F2, 7D8, and 11B8.
[0041] Other features and advantages of the instant invention will
be apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] FIG. 1 shows the pCON.gamma.1f/variable-heavy vector used
for recombinant production of the human monoclonal antibodies 2F2
and 11B8.
[0043] FIG. 2 shows the pCON.kappa./variable-light vector used for
recombinant production of 2F2 and 11B8.
[0044] FIG. 3 shows the double-gene cloning vector
(pCON.gamma.1f/.kappa.2F2) used for recombinant production of 2F2
and 11B8.
[0045] FIG. 4 is a graph comparing the binding of human monoclonal
antibodies 2F2, 7D8, and 11B8 to Raji, Daudi, and CD20 transfected
NS/0 cells and parental NS/0 cells using flow cytometry.
[0046] FIGS. 5A and 5B show the binding of 2F2 to PBMCs from three
human donors using flow cytometry.
[0047] FIG. 6 is a graph comparing the binding affinity of
.sup.125I-labeled 2F2 and .sup.125I-labeled 11B8 to Ramos-EHRB
cells.
[0048] FIGS. 7A and 7B show the binding of .sup.125I-labeled 2F2
and .sup.125I-labeled 11B8 compared to .sup.125I-labeled rituximab
(chimeric anti-CD20 antibody, IDEC) and .sup.125I-labeled B1 (the
term B1 corresponds to the unlabeled form of Bexxar.TM., which is a
.sup.131I-labeled murine anti-human CD20 antibody, Coulter) to
Ramos-EHRB cells (A) and Daudi cells (B).
[0049] FIG. 8 is a graph comparing the dissociation rates of
.sup.125I-labeled 11B8T, .sup.125I-labeled 2F2; .sup.125I-labeled
rituximab (RIT), and .sup.125I-labeled B1.
[0050] FIG. 9 shows the dissociation rates of the F(ab').sub.2
fragments of 2F2, 11B8T, and rituximab in Ramos-EHRB cells.
[0051] FIGS. 10A and 10B show the CDC by 2F2T, 11B8T, 7D8,
rituximab, and an isotype control antibody (HuMab-KLH) of Daudi
cells (A) and SU-DHL-4 cells (B) at different time points
(functional off-rate) using flow cytometry.
[0052] FIGS. 11A-E show the kinetics of CDC induced by 2F2 and
rituximab in different cell lines using flow cytometry.
[0053] FIGS. 12A-D show CDC induced by 2F2 and rituximab in
different cell lines as a function of the concentration of
complement (normal human serum (NHS)) at two different antibody
concentrations using flow cytometry.
[0054] FIGS. 13A-D show concentration-dependent induction of CDC by
2F2 and rituximab in different cell lines using flow cytometry.
[0055] FIGS. 14A and 14B show concentration-dependent induction of
CDC by 2F2, 2F2T, 11B8T, B1, and rituximab in Daudi cells (A) and
Raji cells (B).
[0056] FIGS. 15A and 15B are graphs comparing CDC of Daudi cells
(cells expressing low levels of CD55/59) by human monoclonal
antibodies 2F2, 7D8, and 11B8 and rituximab; (A) shows percent
lysis of unwashed cells and (B) shows percent lysis of cells which
were washed before the addition of serum.
[0057] FIGS. 16A and 16B are graphs comparing CDC of Raji cells
(cells expressing high levels of CD55/59) by human monoclonal
antibodies 2F2, 7D8, and 11B8 and rituximab; (A) shows percent
lysis of cells not blocked with anti-CD55 and anti-CD59 antibodies,
and (B) shows percent lysis of cells blocked with anti-CD55 and
anti-CD59 antibodies.
[0058] FIGS. 17A-C show the role of CD55 and CD59 in CDC induced by
2F2 and rituximab in Raji cells. (A) shows the percentage of lysed
cells upon addition of anti-CD55 antibody, (B) shows the percentage
of lysed cells upon addition of anti-CD59 antibody, and (C) shows
the percentage of lysed cells upon addition of both anti-CD55
antibody and anti-CD59 antibody.
[0059] FIGS. 18A-D show the binding of complement factor C1q by 2F2
and rituximab in different cell lines as determined by flow
cytometry.
[0060] FIGS. 19A-D show the deposition of complement factor
fragment C4c by 2F2 and rituximab in different cell lines as
determined by flow cytometry.
[0061] FIG. 20 shows lysis of ARH-77 cells by 2F2, rituximab, and
11B8T in the presence of PMNs, MNCs, plasma or whole blood.
[0062] FIG. 21 shows lysis of B-CLL cells by 2F2, rituximab, and
11B8T in the presence of PMNs, MNCs, plasma or whole blood.
[0063] FIG. 22 shows lysis of HCL (hairy cell leukemia) cells by
2F2, rituximab, and 11B8T in the presence of PMNs, MNCs, plasma or
whole blood.
[0064] FIG. 23 shows lysis of B-ALL cells by 2F2, and rituximab, in
the presence of PMNs, MNCs, plasma or whole blood.
[0065] FIG. 24 shows lysis of follicular lymphoma (FL) cells by
2F2, rituximab, and 11B8T in the presence of PMNs, MNCs, plasma or
whole blood.
[0066] FIG. 25 shows lysis of mantle cell lymphoma cells by 2F2,
rituximab, and 11B8T in the presence of PMNs, MNCs, plasma or whole
blood.
[0067] FIG. 26 shows concentration dependent lysis of ARH-77 cells
by 2F2 and rituximab in the presence of whole blood.
[0068] FIG. 27 shows MNC-mediated lysis of ARH-77 cells by 2F2T,
11B8T, and rituximab.
[0069] FIG. 28 shows MNC-mediated lysis of Raji cells by 2F2T,
11B8T, and rituximab.
[0070] FIGS. 29A, B, and C are graphs showing clustering of CD20 in
the lipid rafts upon incubation with 2F2, 7D8, or 11B8 using FRET
analysis and Triton-X insolubility assay.
[0071] FIG. 30 shows clustering of CD20 in the lipid rafts upon
incubation with 2F2, rituximab, or 11B8T using FRET analysis.
[0072] FIG. 31 shows the proportion of CD20 remaining in the
insoluble raft fraction after treatment with Triton X-100 (TX) and
incubation with 2F2, rituximab, or 11B8T.
[0073] FIG. 32 shows the distribution of CD20 between the raft and
non-raft membrane fractions upon stimulating Daudi cells with 2F2,
rituximab, or 11B8T.
[0074] FIGS. 33A-G show apoptosis of Daudi cells by 2F2, 7D8, and
11B8 using flow cytometry.
[0075] FIG. 34 shows induction of apoptosis of Raji cells by 2F2,
11B8T, rituximab, or B1 using flow cytometry.
[0076] FIG. 35A shows induction of apoptosis of Daudi cells by
2F2T, 11B8T, rituximab, or B1 using flow cytometry.
[0077] FIG. 35B shows early stage and late stage apoptosis of Daudi
cells by human monoclonal antibodies 2F2T, 11B8T, rituximab, and B1
using flow cytometry.
[0078] FIGS. 36A-E show homotypic adhesion of Ramos-EHRB cells by
2F2, 7D8, and 11B8 using light microscopy.
[0079] FIG. 37 show homotypic adhesion of Daudi cells by 2F2,
rituximab, and B1 using light microscopy.
[0080] FIG. 38 is a graph showing the percent survival of SCID mice
injected with Daudi cells and treated with 2F2 or 7D8.
[0081] FIG. 39 shows the percent survival of SCID mice injected
with Tanoue cells and treated with 2F2, rituximab, or B1.
[0082] FIG. 40 shows the percent survival of SCID mice injected
with Daudi cells and treated with different concentrations of 2F2
or rituximab.
[0083] FIG. 41 shows the percent survival of SCID mice injected
with Daudi cells and treated with 11B8T or B1.
[0084] FIG. 42 shows bioluminescence imaging of tumor cells in SCID
mice on day 39 (31 days after treatment with 10 .mu.g of B1,
rituximab, 11B8T, 2F2T, or huIgG1). The bioluminescence is
represented in red color (the dark areas in the mice) (light
intensity>50 photons per 5 min) as overlay on the black and
white body image of the mice.
[0085] FIG. 43 shows the tumor mass in each mouse quantified on day
25, 32, 39, and 46 following administration, on day 8, of 10 .mu.g
of B1, rituximab, 11B8T, 2F2T, or huIgG1 by integrating the light
signals over the body surface.
[0086] FIGS. 44A-C show flow cytometric analysis of CD20.sup.+
cells in peripheral blood of cynomolgus monkeys following
intravenous administration of 2F2 or rituximab at different
dosages, 4.times.1.25 mk/kg (A), 4.times.6.25 mg/kg (B), or
4.times.12.50 mg/kg (C).
[0087] FIGS. 45A-C show flow cytometric analysis of CD21.sup.+
cells in peripheral blood of cynomolgus monkeys following
intravenous administration of 2F2 or rituximab at different
dosages, 4.times.1.25 mk/kg (A), 4.times.6.25 mg/kg (B), or
4.times.12.50 mg/kg (C).
[0088] FIGS. 46A-C show flow cytometric analysis of CD20.sup.+
cells in lymph node of cynomolgus monkeys following intravenous
administration of 2F2 or rituximab at different dosages,
4.times.1.25 mk/kg (A), 4.times.6.25 mg/kg (B), or 4.times.12.50
mg/kg (C).
[0089] FIGS. 47A-C show flow cytometric analysis of
CD20.sup.lowCD23.sup.+CD40.sup.high expressing cells in peripheral
blood of cynomolgus monkeys following intravenous administration of
2F2 or rituximab at different dosages, 4.times.1.25 mk/kg (A),
4.times.6.25 mg/kg (B), or 4.times.12.50 mg/kg (C).
[0090] FIGS. 48A-E show binding of rituximab (A), 2F2 (B), 11B8
(C), B1 (D), or an isotype control antibody (E) to CHO cells
expressing wild type (WT) CD20, mutant CD20 (A.times.P), or both WT
CD20 and mutant CD20 (A.times.P) as determined by flow
cytometry.
[0091] FIGS. 49A-F show percentage binding of 2F2, 11B8T, B1 or
rituximab to mutant P172S vs. WT CD20 (A), percentage binding of
2F2T, 11B8T, B1, CAT (CAT 13.6E12, a mouse monoclonal IgG2A
anti-CD20 antibody, Diatec.Com), a control isotype antibody (KLH)
or rituximab to mutant CD20 (A.times.P) vs. WT CD20 (B), percentage
binding of 2F2, 11B8T, B1 or rituximab to mutant N166D vs. WT CD20
(C), percentage binding of 2F2T, CAT or rituximab to mutant N166D
vs. WT CD20 (D), percentage binding of 2F2T, 2F2, 11B8T, B1 or
rituximab to mutant N163D vs. WT CD20 (E), and percentage binding
of 2F2T, CAT or rituximab to mutant N163D vs. WT CD20 (F).
[0092] FIG. 50 shows binding of 2F2T, 7D8, and isotype control
antibody, as determined by ELISA, to three anti-idiotypic
antibodies, anti-2F2 sab 1.1, anti-2F2 sab 1.2, and anti-2F2 sab
1.3, raised against 2F2.
[0093] FIG. 51 shows binding of 11B8T, as determined by ELISA, to
anti-idiotypic antibodies, anti-11B8T sab 2.2, anti-11B8T sab 2.3,
anti-11B8T sab 2.4, anti-11B8T sab 2.5, and anti-11B8T sab 2.6,
raised against 11B8T, but no binding to the anti-idiotypic anti-2F2
antibodies.
[0094] FIGS. 52A-C show dose-dependent binding of 2F2T, as
determined by ELISA, to three anti-idiotypic antibodies, anti-2F2
sab 1.1 (A), anti-2F2 sab 1.2 (B), and anti-2F2 sab 1.3 (C), raised
against 2F2.
[0095] FIG. 53 shows the amino acid sequence (SEQ ID NO:2) of the
heavy chain V region and the amino acid sequence (SEQ ID NO:4) of
the light (kappa) chain V region of human monoclonal antibody 2F2
with CDR regions designated.
[0096] FIG. 54 shows the nucleotide sequence (SEQ ID NO:1) of the
heavy chain V region and the nucleotide sequence (SEQ ID NO:3) of
the light (kappa) chain V region of human monoclonal antibody
2F2.
[0097] FIG. 55 shows the amino acid sequence (SEQ ID NO:6) of the
heavy chain V region and the amino acid sequence (SEQ ID NO:8) of
the light (kappa) chain V region of human monoclonal antibody 7D8
with CDR regions designated.
[0098] FIG. 56 shows the nucleotide sequence (SEQ ID NO:5) of the
heavy chain V region and the nucleotide sequence (SEQ ID NO:7) of
the light (kappa) chain V region of human monoclonal antibody
7D8.
[0099] FIG. 57 shows the amino acid sequence (SEQ ID NO:10) of the
heavy chain V region and the amino acid sequence (SEQ ID NO:12) of
the light (kappa) chain V region of human monoclonal antibody 11B8
with CDR regions designated.
[0100] FIG. 58 shows the nucleotide sequence (SEQ ID NO:9) of the
heavy chain V region and the nucleotide sequence (SEQ ID NO:11) of
the light (kappa) chain V region of human monoclonal antibody
11B8.
DETAILED DESCRIPTION OF THE INVENTION
[0101] The present invention provides improved antibody-based
therapies for treating and diagnosing a variety of disorders
involving cells expressing CD20. Therapies of the invention employ
isolated human monoclonal antibodies which specifically bind to an
epitope present on CD20. Isolated human monoclonal antibodies
encompassed by the present invention include IgA, IgG1-4, IgE, IgM,
and IgD antibodies.
[0102] In one embodiment the antibody is an IgG1 antibody, more
particularly an IgG1,.kappa. or IgG1, .lamda. isotype. In another
embodiment the antibody is an IgG3 antibody, more particularly an
IgG3,.kappa. or IgG3, .lamda. isotype. In yet another embodiment
the antibody is an IgG4 antibody, more particularly an IgG4,.kappa.
or IgG4, .lamda. isotype. In still another embodiment the antibody
is an IgA1 or IgA2 antibody.
[0103] In still another embodiment the antibody is an IgM
antibody.
[0104] In one embodiment, the human antibodies are produced in a
non-human transgenic animal, e.g., a transgenic mouse, capable of
producing multiple isotypes of human monoclonal antibodies to CD20
by undergoing V-D-J recombination and isotype switching.
Accordingly, aspects of the invention include not only antibodies,
antibody fragments, and pharmaceutical compositions thereof, but
also non-human transgenic animals, B cells, host cell
transfectomas, and hybridomas which produce monoclonal antibodies.
Such transgenic animal can also be a transgenic rabbit for
producing polyclonal antibodies such as disclosed in US
2003/0017534. Accordingly, the invention also encompasses human
polyclonal antibodies which specifically bind to CD20. In one
embodiment the invention relates to polyclonal antibodies which
bind to an epitope on CD20 (i) which does not comprise or require
the amino acid residue proline at position 172; (ii) which does not
comprise or require the amino acid residues alanine at position 170
or proline at position 172; (iii) which comprises or requires the
amino acid residues asparagine at position 163 and asparagine at
position 166; (iv) which does not comprise or require the amino
acid residue proline at position 172, but which comprises or
requires the amino acid residues asparagine at position 163 and
asparagine at position 166; or (v) which does not comprise or
require the amino acid residues alanine at position 170 or proline
at position 172, but which comprises or requires the amino acid
residues asparagine at position 163 and asparagine at position
166.
[0105] In another embodiment the invention relates to human
polyclonal antibodies which have one or more of the following
characteristics: (i) bind to mutant P172S CD20 (proline at position
172 mutated to serine) with at least the same affinity as to human
CD20; (ii) bind to mutant A.times.P (alanine at position 170
mutated to serine, and proline at position 172 mutated to serine)
with at least the same affinity as to human CD20; (iii) show a
reduced binding of 50% or more to mutant N166D (asparagine at
position 166 mutated to aspartic acid) to human CD20 at an antibody
concentration of 10 .mu.g/ml; and/or (iv) show a reduced binding of
50% or more to mutant N163D (asparagine at position 163 mutated to
aspartic acid) compared to human CD20 at an antibody concentration
of 10 .mu.g/ml.
[0106] In yet another embodiment the invention the invention
relates to human polyclonal antibodies which bind to an epitope in
the small first extracellular loop of human CD20. In still another
embodiment the invention also encompasses human polyclonal
antibodies which bind to a discontinuous epitope on CD20. In a
further embodiment the invention relates to human polyclonal
antibodies which bind a discontinuous epitope on CD20, which has
part of the first small extracellular loop and part of the second
extracellular loop. In still a further embodiment the invention
relates to human polyclonal antibodies which bind to a
discontinuous epitope on CD20, which has residues AGIYAP of the
small first extracellular loop and residues MESLNFIRAHTPYI of the
second extracellular loop.
[0107] Methods of using the antibodies of the invention to detect a
cell expressing CD20 are encompassed by the invention. Methods of
using the antibodies of the invention to block or inhibit CD20
induced activities, e.g., proliferative and/or differentiation
activities, are also provided and are useful in the treatment of
disorders associated with CD20, such as tumorigenic diseases (e.g.,
B cell lymphoma) and autoimmune diseases (e.g., RA, Chrohn's
disease and Wegener's granulomatosis).
[0108] In order that the present invention may be more readily
understood, certain terms are first defined. Additional definitions
are set forth throughout the detailed description.
[0109] The terms "CD20" and "CD20 antigen" are used interchangeably
herein, and include any variants, isoforms and species homologs of
human CD20 which are naturally expressed by cells or are expressed
on cells transfected with the CD20 gene. Binding of an antibody of
the invention to the CD20 antigen mediate the killing of cells
expressing CD20 (e.g., a tumor cell) by inactivating CD20. The
killing of the cells expressing CD20 may occur by one or more of
the following mechanisms:
[0110] complement dependent cytotoxity (CDC) of cells expressing
CD20;
[0111] apoptosis of cells expressing CD20;
[0112] effector cell phagocytosis of cells expressing CD20; or
[0113] effector cell antibody dependent cellular cytotoxicity
(ADCC) of cells expressing CD20.
[0114] Synonyms of CD20, as recognized in the art, include
B-lymphocyte antigen CD20, B-lymphocyte surface antigen B1, Leu-16,
Bp35, BM5, and LF5.
[0115] As used herein, the term "inhibits growth" (e.g., referring
to cells) is intended to include any measurable decrease in the
cell growth when contacted with an anti-CD20 antibody as compared
to the growth of the same cells not in contact with an anti-CD20
antibody, e.g., the inhibition of growth of a cell culture by at
least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or
100%. Such a decrease in cell growth can occur by a variety of
mechanisms, e.g., effector cell phagocytosis, ADCC, CDC, and/or
apoptosis.
[0116] The term "raft" refers to the sphingolipid- and
cholesterol-rich membrane microdomains located in the outer leaflet
area of the plasma membrane of a cell. The ability of certain
proteins to associate within such domains can effect the protein's
function. For example, the translocation of CD20 molecules into
lipid rafts, after being bound by human antibodies of the present
invention, creates a high density of CD20 antigen-antibody
complexes in the plasma membranes. Such a high density of CD20
antigen-antibody complexes can enable efficient activation of the
complement system during CDC.
[0117] The term "antibody" as referred to herein includes whole
antibodies and any antigen binding fragment (i.e., "antigen-binding
portion") or single chain thereof. An "antibody" refers to a
glycoprotein comprising at least two heavy (H) chains and two light
(L) chains inter-connected by disulfide bonds, or an antigen
binding portion thereof. Each heavy chain is comprised of a heavy
chain variable region (abbreviated herein as V.sub.H) and a heavy
chain constant region. Each light chain is comprised of a light
chain variable region (abbreviated herein as V.sub.L) and a light
chain constant region. The V.sub.H and V.sub.L regions can be
further subdivided into regions of hypervariability, termed
complementarity determining regions (CDR), interspersed with
regions that are more conserved, termed framework regions (FR).
Each V.sub.H and V.sub.L is composed of three CDRs and four FRs,
arranged from amino-terminus to carboxy-terminus in the following
order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions
of the heavy and light chains contain a binding domain that
interacts with an antigen. The constant regions of the antibodies
may mediate the binding of the immunoglobulin to host tissues or
factors, including various cells of the immune system (e.g.,
effector cells) and the first component (C1q) of the classical
complement system.
[0118] The term "antigen-binding portion" of an antibody (or simply
"antibody portion"), as used herein, refers to one or more
fragments of an antibody that retain the ability to specifically
bind to an antigen (e.g., CD20). It has been shown that the
antigen-binding function of an antibody can be performed by
fragments of a full-length antibody. Examples of binding fragments
encompassed within the term "antigen-binding portion" of an
antibody include (i) a Fab fragment, a monovalent fragment
consisting of the V.sub.L, V.sub.H, C.sub.L and C.sub.H1 domains;
(ii) a F(ab').sub.2 fragment, a bivalent fragment comprising two
Fab fragments linked by a disulfide bridge at the hinge region;
(iii) a Fd fragment consisting of the V.sub.H and C.sub.H1 domains;
(iv) a Fv fragment consisting of the V.sub.L and V.sub.H domains of
a single arm of an antibody, (v) a dAb fragment (Ward et al.,
(1989) Nature 341:544-546), which consists of a V.sub.H domain;
(vi) an isolated complementarity determining region (CDR), and
(vii) a combination of two or more isolated CDRs which may
optionally be joined by a synthetic linker. Furthermore, although
the two domains of the Fv fragment, V.sub.L and V.sub.H, are coded
for by separate genes, they can be joined, using recombinant
methods, by a synthetic linker that enables them to be made as a
single protein chain in which the V.sub.L and V.sub.H regions pair
to form monovalent molecules (known as single chain Fv (scFv); see
e.g., Bird et al. (1988) Science 242:423-426; and Huston et al.
(1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain
antibodies are also intended to be encompassed within the term
"antigen-binding portion" of an antibody. A further example is
binding-domain immunoglobulin fusion proteins comprising (i) a
binding domain polypeptide that is fused to an immunoglobulin hinge
region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant
region fused to the hinge region, and (iii) an immunoglobulin heavy
chain CH3 constant region fused to the CH2 constant region. The
binding domain polypeptide can be a heavy chain variable region or
a light chain variable region. The binding-domain immunoglobulin
fusion proteins are further disclosed in US 2003/0118592 and US
2003/0133939. These antibody fragments are obtained using
conventional techniques known to those with skill in the art, and
the fragments are screened for utility in the same manner as are
intact antibodies.
[0119] The term "epitope" means a protein determinant capable of
specific binding to an antibody. Epitopes usually consist of
chemically active surface groupings of molecules such as amino
acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. Conformational and nonconformational epitopes are
distinguished in that the binding to the former but not the latter
is lost in the presence of denaturing solvents.
[0120] The term "discontinuous epitope," as used herein, means a
conformational epitope on a protein antigen which is formed from at
least two separate regions in the primary sequence of the
protein.
[0121] The term "bispecific molecule" is intended to include any
agent, e.g., a protein, peptide, or protein or peptide complex,
which has two different binding specificities. For example, the
molecule may bind to, or interact with, (a) a cell surface antigen
and (b) an Fc receptor on the surface of an effector cell. The term
"multispecific molecule" or "heterospecific molecule" is intended
to include any agent, e.g., a protein, peptide, or protein or
peptide complex, which has more than two different binding
specificities. For example, the molecule may bind to, or interact
with, (a) a cell surface antigen, (b) an Fc receptor on the surface
of an effector cell, and (c) at least one other component.
Accordingly, the invention includes, but is not limited to,
bispecific, trispecific, tetraspecific, and other multispecific
molecules which are directed to cell surface antigens, such as
CD20, and to other targets, such as Fc receptors on effector
cells.
[0122] The term "bispecific antibodies" also includes diabodies.
Diabodies are bivalent, bispecific antibodies in which the V.sub.H
and V.sub.L domains are expressed on a single polypeptide chain,
but using a linker that is too short to allow for pairing between
the two domains on the same chain, thereby forcing the domains to
pair with complementary domains of another chain and creating two
antigen binding sites (see e.g., Holliger, P., et al. (1993) Proc.
Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994)
Structure 2:1121-1123).
[0123] The term "human antibody derivatives" refers to any modified
form of the antibody, e.g., a conjugate of the antibody and another
agent or antibody.
[0124] As used herein, a human antibody is "derived from" a
particular germline sequence if the antibody is obtained from a
system using human immunoglobulin sequences, e.g., by immunizing a
transgenic mouse carrying human immunoglobulin genes or by
screening a human immunoglobulin gene library, and wherein the
selected human antibody is at least 90%, more preferably at least
95%, even more preferably at least 96%, 97%, 98%, or 99% identical
in amino acid sequence to the amino acid sequence encoded by the
germline immunoglobulin gene. Typically, a human antibody derived
from a particular human germline sequence will display no more than
10 amino acid differences, more preferably, no more than 5, or even
more preferably, no more than 4, 3, 2, or 1 amino acid difference
from the amino acid sequence encoded by the germline immunoglobulin
gene.
[0125] As used herein, the term "heteroantibodies" refers to two or
more antibodies, derivatives therefrom, or antigen binding regions
linked together, at least two of which have different
specificities. These different specificities include a binding
specificity for an Fc receptor on an effector cell, and a binding
specificity for an antigen or epitope on a target cell, e.g., a
tumor cell.
[0126] The term "human antibody", as used herein, is intended to
include antibodies having variable and constant regions derived
from human germline immunoglobulin sequences. The human antibodies
of the invention may include amino acid residues not encoded by
human germline immunoglobulin sequences (e.g., mutations introduced
by random or site-specific mutagenesis in vitro or by somatic
mutation in vivo). However, the term "human antibody", as used
herein, is not intended to include antibodies in which CDR
sequences derived from the germline of another mammalian species,
such as a mouse, have been grafted onto human framework
sequences.
[0127] The terms "monoclonal antibody" or "monoclonal antibody
composition" as used herein refer to a preparation of antibody
molecules of single molecular composition. A monoclonal antibody
composition displays a single binding specificity and affinity for
a particular epitope. Accordingly, the term "human monoclonal
antibody" refers to antibodies displaying a single binding
specificity which have variable and constant regions derived from
human germline immunoglobulin sequences. In one embodiment, the
human monoclonal antibodies are produced by a hybridoma which
includes a B cell obtained from a transgenic or transchromosomal
non-human animal, e.g., a transgenic mouse, having a genome
comprising a human heavy chain transgene and a light chain
transgene fused to an immortalized cell.
[0128] The term "recombinant human antibody", as used herein,
includes all human antibodies that are prepared, expressed, created
or isolated by recombinant means, such as (a) antibodies isolated
from an animal (e.g., a mouse) that is transgenic or
transchromosomal for human immunoglobulin genes or a hybridoma
prepared therefrom (described further in Section I, below), (b)
antibodies isolated from a host cell transformed to express the
antibody, e.g., from a transfectoma, (c) antibodies isolated from a
recombinant, combinatorial human antibody library, and (d)
antibodies prepared, expressed, created or isolated by any other
means that involve splicing of human immunoglobulin gene sequences
to other DNA sequences. Such recombinant human antibodies have
variable and constant regions derived from human germline
immunoglobulin sequences. In certain embodiments, however, such
recombinant human antibodies can be subjected to in vitro
mutagenesis (or, when an animal transgenic for human Ig sequences
is used, in vivo somatic mutagenesis) and thus the amino acid
sequences of the V.sub.H and V.sub.L regions of the recombinant
antibodies are sequences that, while derived from and related to
human germline V.sub.H and V.sub.L sequences, may not naturally
exist within the human antibody germline repertoire in vivo.
[0129] The term "transfectoma", as used herein, includes
recombinant eukaryotic host cell expressing the antibody, such as
CHO cells, NS/0 cells, HEK293 cells, plant cells, or fungi,
including yeast cells.
[0130] As used herein, a "heterologous antibody" is defined in
relation to the transgenic non-human organism producing such an
antibody. This term refers to an antibody having an amino acid
sequence or an encoding nucleic acid sequence corresponding to that
found in an organism not consisting of the transgenic non-human
animal, and generally from a species other than that of the
transgenic non-human animal.
[0131] As used herein, a "heterohybrid antibody" refers to an
antibody having a light and heavy chains of different organismal
origins. For example, an antibody having a human heavy chain
associated with a murine light chain is a heterohybrid antibody.
Examples of heterohybrid antibodies include chimeric and humanized
antibodies, discussed supra.
[0132] An "isolated antibody," as used herein, is intended to refer
to an antibody which is substantially free of other antibodies
having different antigenic specificities (e.g., an isolated
antibody that specifically binds to CD20 is substantially free of
antibodies that specifically bind antigens other than CD20). An
isolated antibody that specifically binds to an epitope, isoform or
variant of human CD20 may, however, have cross-reactivity to other
related antigens, e.g., from other species (e.g., CD20 species
homologs). Moreover, an isolated antibody may be substantially free
of other cellular material and/or chemicals. In one embodiment of
the invention, a combination of "isolated" monoclonal antibodies
having different specificities are combined in a well defined
composition.
[0133] As used herein, "specific binding" refers to antibody
binding to a predetermined antigen. Typically, the antibody binds
with an affinity corresponding to a K.sub.D of about
1.times.10.sup.-7 M or less, and binds to the predetermined antigen
with an affinity corresponding to a K.sub.D that is at least two
orders of magnitude lower than its affinity for binding to a
non-specific antigen (e.g., BSA, casein) other than the
predetermined antigen or a closely-related antigen. The phrases "an
antibody recognizing an antigen" and "an antibody specific for an
antigen" are used interchangeably herein with the term "an antibody
which binds specifically to an antigen".
[0134] As used herein, the term "k.sub.d" (sec.sup.-1), as used
herein, is intended to refer to the dissociation rate constant of a
particular antibody-antigen interaction. Said value is also
referred to as the k.sub.off value.
[0135] The term "k.sub.a" (M.sup.-1.times.sec.sup.-1), as used
herein, is intended to refer to the association rate constant of a
particular antibody-antigen interaction.
[0136] The term "K.sub.D" (M), as used herein, is intended to refer
to the dissociation equilibrium constant of a particular
antibody-antigen interaction.
[0137] The term "K.sub.A" (M.sup.-1), as used herein, is intended
to refer to the association equilibrium constant of a particular
antibody-antigen interaction and is obtained by dividing the
k.sub.a by the k.sub.d.
[0138] As used herein, "isotype" refers to the antibody class
(e.g., IgM or IgG1) that is encoded by heavy chain constant region
genes.
[0139] As used herein, "isotype switching" refers to the phenomenon
by which the class, or isotype, of an antibody changes from one Ig
class to one of the other Ig classes.
[0140] As used herein, "nonswitched isotype" refers to the isotypic
class of heavy chain that is produced when no isotype switching has
taken place; the CH gene encoding the nonswitched isotype is
typically the first CH gene immediately downstream from the
functionally rearranged VDJ gene. Isotype switching has been
classified as classical or non-classical isotype switching.
Classical isotype switching occurs by recombination events which
involve at least one switch sequence region in the transgene.
Non-classical isotype switching may occur by, for example,
homologous recombination between human .sigma..sub..mu. and human
.SIGMA..sub..mu. (.delta.-associated deletion). Alternative
non-classical switching mechanisms, such as intertransgene and/or
interchromosomal recombination, among others, may occur and
effectuate isotype switching.
[0141] As used herein, the term "switch sequence" refers to those
DNA sequences responsible for switch recombination. A "switch
donor" sequence, typically a .mu. switch region, will be 5' (i.e.,
upstream) of the construct region to be deleted during the switch
recombination. The "switch acceptor" region will be between the
construct region to be deleted and the replacement constant region
(e.g., .gamma., .epsilon., etc.). As there is no specific site
where recombination always occurs, the final gene sequence will
typically not be predictable from the construct.
[0142] As used herein, "glycosylation pattern" is defined as the
pattern of carbohydrate units that are covalently attached to a
protein, more specifically to an immunoglobulin (antibody) protein.
A glycosylation pattern of a heterologous antibody can be
characterized as being substantially similar to glycosylation
patterns which occur naturally on antibodies produced by the
species of the non-human transgenic animal, when one of ordinary
skill in the art would recognize the glycosylation pattern of the
heterologous antibody as being more similar to said pattern of
glycosylation in the species of the non-human transgenic animal
than to the species from which the CH genes of the transgene were
derived.
[0143] The term "naturally-occurring" as used herein as applied to
an object refers to the fact that an object can be found in nature.
For example, a polypeptide or polynucleotide sequence that is
present in an organism (including viruses) that can be isolated
from a source in nature and which has not been intentionally
modified by man in the laboratory is naturally-occurring.
[0144] The term "rearranged" as used herein refers to a
configuration of a heavy chain or light chain immunoglobulin locus
wherein a V segment is positioned immediately adjacent to a D-J or
J segment in a conformation encoding essentially a complete V.sub.H
or V.sub.L domain, respectively. A rearranged immunoglobulin
(antibody) gene locus can be identified by comparison to germline
DNA; a rearranged locus will have at least one recombined
heptamer/nonamer homology element.
[0145] The term "unrearranged" or "germline configuration" as used
herein in reference to a V segment refers to the configuration
wherein the V segment is not recombined so as to be immediately
adjacent to a D or J segment.
[0146] The term "nucleic acid molecule", as used herein, is
intended to include DNA molecules and RNA molecules. A nucleic acid
molecule may be single-stranded or double-stranded, but preferably
is double-stranded DNA.
[0147] The term "isolated nucleic acid molecule," as used herein in
reference to nucleic acids encoding whole antibodies or antibody
portions (e.g., V.sub.H, V.sub.L, CDR3) that bind to CD20, is
intended to refer to a nucleic acid molecule in which the
nucleotide sequences encoding the intact antibody or antibody
portion are free of other nucleotide sequences encoding whole
antibodies or antibody portions that bind antigens other than CD20,
which other sequences may naturally flank the nucleic acid in human
genomic DNA. In one embodiment, the human anti-CD20 antibody
includes the nucleotide or amino acid sequence of 2F2, 7D8, or
11B8, as well as heavy chain (V.sub.H) and light chain (V.sub.L)
variable regions having the sequences shown in SEQ ID NOs: 1, 5, or
9, and SEQ ID NOs: 3, 7, or 11, respectively.
[0148] As disclosed and claimed herein, the sequences set forth in
SEQ ID NOs: 1-30 include "conservative sequence modifications,"
i.e., nucleotide and amino acid sequence modifications which do not
significantly affect or alter the binding characteristics of the
antibody encoded by the nucleotide sequence or containing the amino
acid sequence. Such conservative sequence modifications include
nucleotide and amino acid substitutions, additions and deletions.
Modifications can be introduced into SEQ ID NOs:1-30 by standard
techniques known in the art, such as site-directed mutagenesis and
PCR-mediated mutagenesis. Conservative amino acid substitutions
include ones in which the amino acid residue is replaced with an
amino acid residue having a similar side chain. Families of amino
acid residues having similar side chains have been defined in the
art. These families include amino acids with basic side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g.,
aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine,
leucine, isoleucine, proline, phenylalanine, methionine),
beta-branched side chains (e.g., threonine, valine, isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine). Thus, a predicted nonessential amino acid residue in a
human anti-CD20 antibody is preferably replaced with another amino
acid residue from the same side chain family.
[0149] The present invention also encompasses "derivatives" of the
amino acid sequences as set forth in SEQ ID NOs: 1-30 and
conservative sequence modifications thereof, wherein one or more of
the amino acid residues have been derivatised, e.g., by acylation
or glycosylation, without significantly affecting or altering the
binding characteristics of the antibody containing the amino acid
sequences.
[0150] Furthermore, the present invention comprises antibodies in
which alterations have been made in the Fc region in order to
change the functional or pharmacokinetic properties of the
antibodies. Such alterations may result in a decrease or increase
of C1q binding and CDC or of Fc.gamma.R binding and ADCC.
Substitutions can, for example, be made in one or more of the amino
acid residues at positions 234, 235, 236, 237, 297, 318, 320 and
322 of the heavy chain constant region, thereby causing an
alteration in an effector function while retaining the ability to
bind to the antigen as compared with the unmodified antibody, cf.
U.S. Pat. No. 5,624,821 and U.S. Pat. No. 5,648,260.
[0151] The in vivo half-life of the antibodies can also be improved
by modifying the salvage receptor epitope of the Ig constant domain
or an Ig-like constant domain such that the molecule does not
comprise an intact CH2 domain or an intact Ig Fc region, cf. U.S.
Pat. No. 6,121,022 and U.S. Pat. No. 6,194,551. The in vivo
half-life can furthermore be increased by making mutations in the
Fc region, e.g., by substituting threonine for leucine at position
252, by substituting threonine for serine at position 254, or by
substituting threonine for phenylalanine at position 256, cf. U.S.
Pat. No. 6,277,375.
[0152] Furthermore, the glycosylation pattern of the antibodies can
be modified in order to change the effector function of the
antibodies. For example, the antibodies can be expressed in a
transfectoma which does not add the fucose unit normally attached
to Asn at position 297 of the Fc region in order to enhance the
affinity of the Fc region for Fc.gamma.RIII which, in turn, will
result in an increased ADCC of the antibodies in the presence of NK
cells, cf. Shield et al. (2002) JBC, 277:26733. Furthermore,
modification of galactosylation can be made in order to modify
CDC.
[0153] Alternatively, in another embodiment, mutations can be
introduced randomly along all or part of a anti-CD20 antibody
coding sequence, such as by saturation mutagenesis, and the
resulting modified anti-CD20 antibodies can be screened for binding
activity.
[0154] Accordingly, antibodies encoded by the (heavy and light
chain variable region) nucleotide sequences disclosed herein and/or
containing the (heavy and light chain variable region) amino acid
sequences disclosed herein (i.e., SEQ ID NOs: 1-30) include
substantially similar antibodies encoded by or containing similar
sequences which have been conservatively modified. Further
discussion as to how such substantially similar antibodies can be
generated based on the partial (i.e., heavy and light chain
variable regions) sequences disclosed herein as SEQ ID Nos:1-30 is
provided below.
[0155] For nucleic acids, the term "substantial homology" indicates
that two nucleic acids, or designated sequences thereof, when
optimally aligned and compared, are identical, with appropriate
nucleotide insertions or deletions, in at least about 80% of the
nucleotides, usually at least about 90% to 95%, and more preferably
at least about 98% to 99.5% of the nucleotides. Alternatively,
substantial homology exists when the segments will hybridize under
selective hybridization conditions, to the complement of the
strand.
[0156] For nucleotide and amino acid sequences, the term "homology"
indicates the degree of identity between two nucleic acid or amino
acid sequences when optimally aligned and compared with appropriate
insertions or deletions. Alternatively, substantial homology exists
when the DNA segments will hybridize under selective hybridization
conditions, to the complement of the strand.
[0157] The percent identity between two sequences is a function of
the number of identical positions shared by the sequences (i.e., %
homology=# of identical positions/total # of positions.times.100),
taking into account the number of gaps, and the length of each gap,
which need to be introduced for optimal alignment of the two
sequences. The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm, as described in the non-limiting examples
below.
[0158] The percent identity between two nucleotide sequences can be
determined using the GAP program in the GCG software package
(available at http://www.gcg.com), using a NWSgapdna.CMP matrix and
a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2,
3, 4, 5, or 6. The percent identity between two nucleotide or amino
acid sequences can also be determined using the algorithm of E.
Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)) which
has been incorporated into the ALIGN program (version 2.0), using a
PAM120 weight residue table, a gap length penalty of 12 and a gap
penalty of 4. In addition, the percent identity between two amino
acid sequences can be determined using the Needleman and Wunsch (J.
Mol. Biol. 48:444-453 (1970)) algorithm which has been incorporated
into the GAP program in the GCG software package (available at
http://www.gcg.com), using either a Blossum 62 matrix or a PAM250
matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length
weight of 1, 2, 3, 4, 5, or 6.
[0159] The nucleic acid and protein sequences of the present
invention can further be used as a "query sequence" to perform a
search against public databases to, for example, identify related
sequences. Such searches can be performed using the NBLAST and
XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol.
Biol. 215:403-10. BLAST nucleotide searches can be performed with
the NBLAST program, score=100, wordlength=12 to obtain nucleotide
sequences homologous to the nucleic acid molecules of the
invention. BLAST protein searches can be performed with the XBLAST
program, score=50, wordlength=3 to obtain amino acid sequences
homologous to the protein molecules of the invention. To obtain
gapped alignments for comparison purposes, Gapped BLAST can be
utilized as described in Altschul et al., (1997) Nucleic Acids Res.
25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs,
the default parameters of the respective programs (e.g., XBLAST and
NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.
[0160] The nucleic acids may be present in whole cells, in a cell
lysate, or in a partially purified or substantially pure form. A
nucleic acid is "isolated" or "rendered substantially pure" when
purified away from other cellular components or other contaminants,
e.g., other cellular nucleic acids or proteins, by standard
techniques, including alkaline/SDS treatment, CsCl banding, column
chromatography, agarose gel electrophoresis and others well known
in the art. See, F. Ausubel, et al., ed. Current Protocols in
Molecular Biology, Greene Publishing and Wiley Interscience, New
York (1987).
[0161] The nucleic acid compositions of the present invention,
while often in a native sequence (except for modified restriction
sites and the like), from either cDNA, genomic or mixtures thereof,
may be mutated in accordance with standard techniques to provide
gene sequences. For coding sequences, these mutations, may affect
amino acid sequence as desired. In particular, DNA sequences
substantially homologous to or derived from native V, D, J,
constant, switches and other such sequences, described herein are
contemplated (where "derived" indicates that a sequence is
identical or modified from another sequence).
[0162] A nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
instance, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the sequence. With
respect to transcription of regulatory sequences, operably linked
means that the DNA sequences being linked are contiguous and, where
necessary to join two protein coding regions, contiguous and in
reading frame. For switch sequences, operably linked indicates that
the sequences are capable of effecting switch recombination.
[0163] The term "vector," as used herein, is intended to refer to a
nucleic acid molecule capable of transporting another nucleic acid
to which it has been linked. One type of vector is a "plasmid",
which refers to a circular double stranded DNA loop into which
additional DNA segments may be ligated. Another type of vector is a
viral vector, wherein additional DNA segments may be ligated into
the viral genome. Certain vectors are capable of autonomous
replication in a host cell into which they are introduced (e.g.,
bacterial vectors having a bacterial origin of replication and
episomal mammalian vectors). Other vectors (e.g., non-episomal
mammalian vectors) can be integrated into the genome of a host cell
upon introduction into the host cell, and thereby are replicated
along with the host genome. Moreover, certain vectors are capable
of directing the expression of genes to which they are operatively
linked. Such vectors are referred to herein as "recombinant
expression vectors" (or simply, "expression vectors"). In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of plasmids. In the present specification,
"plasmid" and "vector" may be used interchangeably as the plasmid
is the most commonly used form of vector. However, the invention is
intended to include such other forms of expression vectors, such as
viral vectors (e.g., replication defective retroviruses,
adenoviruses and adeno-associated viruses), which serve equivalent
functions.
[0164] The term "recombinant host cell" (or simply "host cell"), as
used herein, is intended to refer to a cell into which a
recombinant expression vector has been introduced. It should be
understood that such terms are intended to refer not only to the
particular subject cell but to the progeny of such a cell. Because
certain modifications may occur in succeeding generations due to
either mutation or environmental influences, such progeny may not,
in fact, be identical to the parent cell, but are still included
within the scope of the term "host cell" as used herein.
Recombinant host cells include, for example, transfectomas, such as
CHO cells, NS/0 cells, and lymphocytic cells.
[0165] As used herein, the term "subject" includes any human or
non-human animal. The term "non-human animal" includes all
vertebrates, e.g., mammals and non-mammals, such as non-human
primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
[0166] The terms "transgenic, non-human animal" refers to a
non-human animal having a genome comprising one or more human heavy
and/or light chain transgenes or transchromosomes (either
integrated or non-integrated into the animal's natural genomic DNA)
and which is capable of expressing fully human antibodies. For
example, a transgenic mouse can have a human light chain transgene
and either a human heavy chain transgene or human heavy chain
transchromosome, such that the mouse produces human anti-CD20
antibodies when immunized with CD20 antigen and/or cells expressing
CD20. The human heavy chain transgene can be integrated into the
chromosomal DNA of the mouse, as is the case for transgenic, e.g.,
HuMAb mice, such as HCo7 or HCo 12 mice, or the human heavy chain
transgene can be maintained extrachromosomally, as is the case for
transchromosomal (e.g., KM) mice as described in WO 02/43478. Such
transgenic and transchromosomal mice are capable of producing
multiple isotypes of human monoclonal antibodies to CD20 (e.g.,
IgG, IgA and/or IgE) by undergoing V-D-J recombination and isotype
switching.
[0167] Various aspects of the invention are described in further
detail in the following subsections.
I. Production of Human Antibodies to CD20
[0168] Human monoclonal antibodies of the invention can be produced
by a variety of techniques, including conventional monoclonal
antibody methodology, e.g., the standard somatic cell hybridization
technique of Kohler and Milstein, Nature 256: 495 (1975). Although
somatic cell hybridization procedures are preferred, in principle,
other techniques for producing monoclonal antibody can be employed,
e.g., viral or oncogenic transformation of B-lymphocytes or phage
display techniques using libraries of human antibody genes.
[0169] The preferred animal system for preparing hybridomas that
secrete human monoclonal antibodies is the murine system. Hybridoma
production in the mouse is a very well established procedure.
Immunization protocols and techniques for isolation of immunized
splenocytes for fusion are known in the art. Fusion partners (e.g.,
murine myeloma cells) and fusion procedures are also known.
[0170] In a preferred embodiment, human monoclonal antibodies
directed against CD20 can be generated using transgenic or
transchromosomal mice carrying parts of the human immune system
rather than the mouse system. These transgenic and transchromosomic
mice include mice referred to herein as HuMAb mice and KM mice,
respectively, and are collectively referred to herein as
"transgenic mice."
[0171] The HuMAb mouse contains a human immunoglobulin gene
miniloci that encodes unrearranged human heavy (.mu. and .gamma.)
and .kappa. light chain immunoglobulin sequences, together with
targeted mutations that inactivate the endogenous .mu. and .kappa.
chain loci (Lonberg, N. et al. (1994) Nature 368 (6474): 856-859).
Accordingly, the mice exhibit reduced expression of mouse IgM or
.kappa. and in response to immunization, the introduced human heavy
and light chain transgenes, undergo class switching and somatic
mutation to generate high affinity human IgG .kappa. monoclonal
antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg,
N. (1994) Handbook of Experimental Pharmacology 113:49-101;
Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13:
65-93, and Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci.
764: 536-546). The preparation of HuMAb mice is described in detail
in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295;
Chen, J. et al (1993) International Immunology 5: 647-656; Tuaillon
et al. (1994) J. Immunol. 152:2912-2920; Lonberg et al., (1994)
Nature 368(6474): 856-859; Lonberg, N. (1994) Handbook of
Experimental Pharmacology 113:49-101; Taylor, L. et al. (1994)
International Immunology 6: 579-591; Lonberg, N. and Huszar, D.
(1995) Intern. Rev. Immunol. Vol. 13:65-93; Harding, F. and
Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536-546; Fishwild, D. et
al. (1996) Nature Biotechnology 14:845-851. See further, U.S. Pat.
Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650;
5,877,397; 5,661,016; 5,814,318; 5,874,299; and 5,770,429; all to
Lonberg and Kay, as well as U.S. Pat. No. 5,545,807 to Surani et
al.; WO 98/24884, WO 94/25585, WO 93/1227, WO 92/22645, WO 92/03918
and WO 01/09187.
[0172] The KM mouse contains a human heavy chain transchromosome
and a human kappa light chain transgene. The endogenous mouse heavy
and light chain genes also have been disrupted in the KM mice such
that immunization of the mice leads to production of human
immunoglobulins rather than mouse immunoglobulins. Construction of
KM mice and their use to raise human immunoglobulins is described
in detail in WO 02/43478.
Immunizations
[0173] To generate fully human monoclonal antibodies to CD20,
transgenic or transchromosomal mice containing human immunoglobulin
genes (e.g., HCo12, HCo7 or KM mice) can be immunized with an
enriched preparation of CD20 antigen and/or cells expressing CD20,
as described, for example, by Lonberg et al. (1994), supra;
Fishwild et al. (1996), supra, and WO 98/24884. Alternatively, mice
can be immunized with DNA encoding human CD20. Preferably, the mice
will be 6-16 weeks of age upon the first infusion. For example, an
enriched preparation (5-50 .mu.g) of the CD20 antigen can be used
to immunize the HuMAb mice intraperitoneally. In the event that
immunizations using a purified or enriched preparation of the CD20
antigen do not result in antibodies, mice can also be immunized
with cells expressing CD20, e.g., a cell line, to promote immune
responses.
[0174] Cumulative experience with various antigens has shown that
the HuMAb transgenic mice respond best when initially immunized
intraperitoneally (IP) or subcutaneously (SC) with CD20 expressing
cells in complete Freund's adjuvant, followed by every other week
IP immunizations (up to a total of 10) with CD20 expressing cells
in PBS. The immune response can be monitored over the course of the
immunization protocol with plasma samples being obtained by
retroorbital bleeds. The plasma can be screened by FACS analysis
(as described below), and mice with sufficient titers of anti-CD20
human immunoglobulin can be used for fusions. Mice can be boosted
intravenously with CD20 expressing cells 3 days before sacrifice
and removal of the spleen.
Generation of Hybridomas Producing Human Monoclonal Antibodies to
CD20
[0175] To generate hybridomas producing human monoclonal antibodies
to human CD20, splenocytes and lymph node cells from immunized mice
can be isolated and fused to an appropriate immortalized cell line,
such as a mouse myeloma cell line. The resulting hybridomas can
then be screened for the production of antigen-specific antibodies.
For example, single cell suspensions of splenic lymphocytes from
immunized mice can be fused to SP2/0-Ag8.653 nonsecreting mouse
myeloma cells (ATCC, CRL 1580) with 50% PEG (w/v). Cells can be
plated at approximately 1.times.10.sup.5 per well in flat bottom
microtiter plate, followed by a two week incubation in selective
medium containing besides usual reagents 10% fetal Clone Serum,
5-10% origen hybridoma cloning factor (IGEN) and 1.times.HAT
(Sigma). After approximately two weeks, cells can be cultured in
medium in which the HAT is replaced with HT. Individual wells can
then be screened by ELISA for human kappa-light chain containing
antibodies and by FACS analysis using CD20 expressing cells for
CD20 specificity. Once extensive hybridoma growth occurs, medium
can be observed usually after 10-14 days. The antibody secreting
hybridomas can be replated, screened again, and if still positive
for human IgG, anti-CD20 monoclonal antibodies can be subcloned at
least twice by limiting dilution. The stable subclones can then be
cultured in vitro to generate antibody in tissue culture medium for
characterization.
Generation of Transfectomas Producing Human Monoclonal Antibodies
to CD20
[0176] Human antibodies of the invention also can be produced in a
host cell transfectoma using, for example, a combination of
recombinant DNA techniques and gene transfection methods as is well
known in the art (Morrison, S. (1985) Science 229:1202).
[0177] For example, in one embodiment, the gene(s) of interest,
e.g., human antibody genes, can be ligated into an expression
vector such as a eukaryotic expression plasmid such as used by the
GS gene expression system disclosed in WO 87/04462, WO 89/01036 and
EP 338 841 or other expression systems well known in the art. The
purified plasmid with the cloned antibody genes can be introduced
in eukaryotic host cells such as CHO cells, NS/0 cells or HEK293
cells or alternatively other eukaryotic cells like a plant derived
cells, fungi or yeast cells. The method used to introduce these
genes could be methods described in the art such as
electroporation, lipofectine, lipofectamine or other. After
introducing these antibody genes in the host cells, cells
expressing the antibody can be identified and selected. These cells
represent the transfectomas which can then be amplified for their
expression level and upscaled to produce antibodies. Recombinant
antibodies can be isolated and purified from these culture
supernatants and/or cells.
Further Recombinant Means for Producing Human Monoclonal Antibodies
to CD20
[0178] Alternatively, the cloned antibody genes can be expressed in
other expression systems, including prokaryotic cells, such as
microorganisms, such as E. coli, for the production of single chain
Fv antibodies, algi, as well as insect cells. Furthermore, the
antibodies can be produced in transgenic non-human animals, such as
in milk from sheep and rabbits or in eggs from hens, or in
transgenic plants. See e.g. Verma, R., et al. (1998). Antibody
engineering: Comparison of bacterial, yeast, insect and mammalian
expression systems. J. Immunol. Meth. 216:165-181; Pollock, et al.
(1999). Transgenic milk as a method for the production of
recombinant antibodies. J. Immunol. Meth. 231:147-157; and Fischer,
R., et al. (1999). Molecular farming of recombinant antibodies in
plants. Biol. Chem. 380:825-839.
Use of Partial Antibody Sequences to Express Intact Antibodies
[0179] Antibodies interact with target antigens predominantly
through amino acid residues that are located in the six heavy and
light chain complementarity determining regions (CDRs). For this
reason, the amino acid sequences within CDRs are more diverse
between individual antibodies than sequences outside of CDRs.
Because CDR sequences are responsible for most antibody-antigen
interactions, it is possible to express recombinant antibodies that
mimic the properties of specific naturally occurring antibodies by
constructing expression vectors that include CDR sequences from the
specific naturally occurring antibody grafted onto framework
sequences from a different antibody with different properties (see,
e.g., Riechmann, L. et al. (1998) Nature 332:323-327; Jones, P. et
al. (1986) Nature 321:522-525; and Queen, C. et al. (1989) Proc.
Natl. Acad. Sci. U.S.A. 86:10029-10033). Such framework sequences
can be obtained from public DNA databases that include germline
antibody gene sequences. These germline sequences will differ from
mature antibody gene sequences because they will not include
completely assembled variable genes, which are formed by V(D)J
joining during B cell maturation. Germline gene sequences will also
differ from the sequences of a high affinity secondary repertoire
antibody at individual evenly across the variable region. For
example, somatic mutations are relatively infrequent in the amino
terminal portion of framework region 1 and in the carboxy-terminal
portion of framework region 4. Furthermore, many somatic mutations
do not significantly alter the binding properties of the antibody.
For this reason, it is not necessary to obtain the entire DNA
sequence of a particular antibody in order to recreate an intact
recombinant antibody having binding properties similar to those of
the original antibody (see WO 99/45962). Partial heavy and light
chain sequence spanning the CDR regions is typically sufficient for
this purpose. The partial sequence is used to determine which
germline variable and joining gene segments contributed to the
recombined antibody variable genes. The germline sequence is then
used to fill in missing portions of the variable regions. Heavy and
light chain leader sequences are cleaved during protein maturation
and do not contribute to the properties of the final antibody. To
add missing sequences, cloned cDNA sequences can be combined with
synthetic oligonucleotides by ligation or PCR amplification.
Alternatively, the entire variable region can be synthesized as a
set of short, overlapping, oligonucleotides and combined by PCR
amplification to create an entirely synthetic variable region
clone. This process has certain advantages such as elimination or
inclusion or particular restriction sites, or optimization of
particular codons.
[0180] The nucleotide sequences of heavy and light chain
transcripts from hybridomas are used to design an overlapping set
of synthetic oligonucleotides to create synthetic V sequences with
identical amino acid coding capacities as the natural sequences.
The synthetic heavy and kappa chain sequences can differ from the
natural sequences in three ways: strings of repeated nucleotide
bases are interrupted to facilitate oligonucleotide synthesis and
PCR amplification; optimal translation initiation sites are
incorporated according to Kozak's rules (Kozak, 1991, J. Biol.
Chem. 266:19867-19870); and HindIII sites are engineered upstream
of the translation initiation sites.
[0181] For both the heavy and light chain variable regions, the
optimized coding and corresponding non-coding, strand sequences are
broken down into 30-50 nucleotides approximately at the midpoint of
the corresponding non-coding oligonucleotide. Thus, for each chain,
the oligonucleotides can be assembled into overlapping double
stranded sets that span segments of 150-400 nucleotides. The pools
are then used as templates to produce PCR amplification products of
150-400 nucleotides. Typically, a single variable region
oligonucleotide set will be broken down into two pools which are
separately amplified to generate two overlapping PCR products.
These overlapping products are then combined by PCR amplification
to form the complete variable region. It may also be desirable to
include an overlapping fragment of the heavy or light chain
constant region (including the BbsI site of the kappa light chain,
or the AgeI site if the gamma heavy chain) in the PCR amplification
to generate fragments that can easily be cloned into the expression
vector constructs.
[0182] The reconstructed heavy and light chain variable regions are
then combined with cloned promoter, leader sequence, translation
initiation, constant region, 3' untranslated, polyadenylation, and
transcription termination, sequences to form expression vector
constructs. The heavy and light chain expression constructs can be
combined into a single vector, co-transfected, serially
transfected, or separately transfected into host cells which are
then fused to form a host cell expressing both chains.
[0183] Plasmids for use in construction of expression vectors for
human IgG.kappa. are described below. The plasmids were constructed
so that PCR amplified V heavy and V kappa light chain cDNA
sequences could be used to reconstruct complete heavy and light
chain minigenes. These plasmids can be used to express completely
human, or chimeric IgG1,.kappa. or IgG4,.kappa. antibodies. Similar
plasmids can be constructed for expression of other heavy chain
isotypes, or for expression of antibodies comprising lambda light
chains.
[0184] Thus, in another aspect of the invention, the structural
features of the human anti-CD20 antibodies of the invention, e.g.,
11B8, 2F2, or 7D8, are used to create structurally related human
anti-CD20 antibodies that retain at least one functional property
of the antibodies of the invention, such as binding to CD20. More
specifically, one or more CDR regions of 2F2, 7D8, or 11B8 can be
combined recombinantly with known human framework regions and CDRs
to create additional, recombinantly-engineered, human anti-CD20
antibodies of the invention.
[0185] Accordingly, in another embodiment, the invention provides a
method for preparing an anti-CD20 antibody comprising:
[0186] preparing an antibody comprising (1) human heavy chain
framework regions and human heavy chain CDRs, wherein at least one
of the human heavy chain CDRs comprises an amino acid sequence
selected from the amino acid sequences of CDRs shown in FIG. 53,
55, or 57 (or corresponding amino acid residues in SEQ ID
NOs:13-15, 19-21, or 25-27); and (2) human light chain framework
regions and human light chain CDRs, wherein at least one of the
human light chain CDRs comprises an amino acid sequence selected
from the amino acid sequences of CDRs shown in FIG. 53, 55, or 57
(or corresponding amino acid residues in SEQ ID NOs: 16-18, 22-24,
or 28-30); wherein the antibody retains the ability to bind to
CD20.
[0187] The ability of the antibody to bind CD20 can be determined
using standard binding assays, such as those set forth in the
Examples (e.g., a FACS analysis).
[0188] Since it is well known in the art that antibody heavy and
light chain CDR3 domains play a particularly important role in the
binding specificity/affinity of an antibody for an antigen, the
recombinant antibodies of the invention prepared as set forth above
preferably comprise the heavy and light chain CDR3s of 2F2, 7D8, or
11B8. The antibodies further can comprise the CDR2s of 2F2, 7D8, or
11B8. The antibodies further can comprise the CDR1s of 2F2, 7D8, or
11B8. Accordingly, the invention further provides anti-CD20
antibodies comprising: (1) human heavy chain framework regions, a
human heavy chain CDR1 region, a human heavy chain CDR2 region, and
a human heavy chain CDR3 region, wherein the human heavy chain CDR3
region is the CDR3 of 2F2, 7D8, or 11B8 as shown in FIG. 53, 55, or
57 (or corresponding amino acid residues as shown in SEQ ID NOs:
15, 21, or 27); and (2) human light chain framework regions, a
human light chain CDR1 region, a human light chain CDR2 region, and
a human light chain CDR3 region, wherein the human light chain CDR3
region is the CDR3 of 2F2, 7D8, or 11B8 as shown in FIG. 53, 55, or
57 (or corresponding amino acid residues as shown in SEQ ID NOs:18,
24, or 30), wherein the antibody binds CD20. The antibody may
further comprise the heavy chain CDR2 and/or the light chain CDR2
of 2F2, 7D8, or 11B8. The antibody may further comprise the heavy
chain CDR1 and/or the light chain CDR1 of 2F2, 7D8, or 11B8.
[0189] Preferably, the CDR1, 2, and/or 3 of the engineered
antibodies described above comprise the exact amino acid
sequence(s) as those of 2F2, 7D8, or 11B8 disclosed herein.
However, the ordinarily skilled artisan will appreciate that some
deviation from the exact CDR sequences of 2F2, 7D8, or 11B8 may be
possible while still retaining the ability of the antibody to bind
CD20 effectively (e.g., conservative substitutions). Accordingly,
in another embodiment, the engineered antibody may be composed of
one or more CDRs that are, for example, 90%, 95%, 98% or 99.5%
identical to one or more CDRs of 2F2, 7D8, or 11B8.
[0190] In addition to simply binding CD20, engineered antibodies
such as those described above may be selected for their retention
of other functional properties of antibodies of the invention, such
as:
[0191] (1) low dissociation rate from CD20;
[0192] (2) high affinity binding to CD20;
[0193] (3) binding to a unique epitope on CD20, and/or binding in a
specific orientation to CD20, and/or binding to a specific form of
CD20;
[0194] (4) mediation of a high level of CDC on either CD55/59
negative or CD55/59 positive cells;
[0195] (5) translocation into lipid rafts upon binding to CD20;
[0196] (6) inhibition of the growth of cells which express
CD20;
[0197] (7) inducement of apoptosis of cells which express CD20;
[0198] (8) inducement of homotypic adhesion of cells which express
CD20;
[0199] (9) prolonged survival of a subject having tumor cells which
express CD20;
[0200] (10) mediation of ADCC of CD20 targets when mixed with
appropriate effector cells;
[0201] (11) ability to deplete cells which express CD20; and/or
[0202] (12) ability to deplete cells which express low levels of
CD20 (CD20.sup.low cells).
Characterization of Binding of Human Monoclonal Antibodies to
CD20
[0203] To purify human anti-CD20 antibodies, selected hybridomas
can be grown in two-liter spinner-flasks for monoclonal antibody
purification. Supernatants can be filtered and concentrated before
affinity chromatography with protein A-sepharose (for IgG1 isotype
antibodies) (Pharmacia, Piscataway, N.J.) or anti-human IgG coated
sepharose or protein G-sepharose in case of IgG3 isotype
antibodies. Eluted IgG can be checked by gel electrophoresis and
high performance liquid chromatography to ensure purity. The buffer
solution can be exchanged into PBS, and the concentration can be
determined by OD.sub.280 using 1.43 extinction coefficient. The
monoclonal antibodies can be aliquoted and stored at -80.degree.
C.
[0204] To determine if the selected human anti-CD20 monoclonal
antibodies bind to unique epitopes, site-directed or multi-site
directed mutagenesis can be used.
[0205] To determine the isotype of purified antibodies, isotype
ELISAs can be performed. Wells of microtiter plates can be coated
with 10 .mu.g/ml of anti-human Ig overnight at 4.degree. C. After
blocking with 5% BSA, the plates are reacted with 10 .mu.g/ml of
monoclonal antibodies or purified isotype controls, at ambient
temperature for two hours. The wells can then be reacted with
either human IgG1, IgG2, IgG3 or IgG4 or human IgM-specific
alkaline phosphatase-conjugated probes. After washing, the plates
are developed with pNPP substrate (1 mg/ml) and analyzed at OD of
405-650.
[0206] In order to demonstrate presence of anti-CD20 antibodies in
sera of immunized mice or binding of monoclonal antibodies to live
cells expressing the CD20, flow cytometry can be used. Briefly,
cell lines expressing CD20 (grown under standard growth conditions)
are mixed with various concentrations of monoclonal antibodies in
PBS containing 0.1% BSA and 0.02% sodium-azide, and incubated at
4.degree. C. for 30 min. After washing, the cells are reacted with
fluorescein-labeled anti-human IgG antibody under the same
conditions as the primary antibody staining. The samples can be
analyzed by flow cytometry with a FACS instrument using light and
side scatter properties to gate on single, living cells. An
alternative assay using fluorescence microscopy may be used (in
addition to or instead of) the flow cytometry assay. Cells can be
stained exactly as described above and examined by fluorescence
microscopy. This method allows visualization of individual cells,
but may have diminished sensitivity depending on the density of the
antigen.
[0207] Anti-CD20 human IgGs can be further tested for reactivity
with CD20 antigen by Western blotting. Briefly, cell extracts from
cells expressing CD20 can be prepared and subjected to sodium
dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After
electrophoresis, the separated antigens will be transferred to
nitrocellulose membranes, blocked with 20% mouse serum, and probed
with the monoclonal antibodies to be tested. Human IgG binding can
be detected using anti-human IgG alkaline phosphatase and developed
with BCIP/NBT substrate tablets (Sigma Chem. Co., St. Louis,
Mo.).
Phagocytic and Cell Killing Activities of Human Monoclonal
Antibodies to CD20
[0208] In addition to binding specifically to CD20, human
monoclonal anti-CD20 antibodies can be tested for their ability to
mediate phagocytosis and killing of cells expressing CD20. The
testing of monoclonal antibody activity in vitro will provide an
initial screening prior to testing in vivo models. Briefly,
polymorphonuclear cells (PMNs), NK cells, monocytes or other
effector cells, from healthy donors can be purified by Ficoll
Hypaque density centrifugation, followed by lysis of contaminating
erythrocytes. Washed PMNs, can be suspended in RPMI supplemented
with 10% heat-inactivated fetal calf serum and mixed with .sup.51Cr
labeled cells expressing CD20, at various ratios of effector cells
to tumor cells (-effector cells:tumor cells). Purified human
anti-CD20 IgGs can then be added at various concentrations.
Irrelevant human IgG can be used as negative control. Assays can be
carried out for 4 to 20 hours at 37.degree. C. depending on the
effector cell type used. Samples can be assayed for cytolysis by
measuring .sup.51Cr release into the culture supernatant. Anti-CD20
monoclonal antibodies can also be tested in combinations with each
other to determine whether cytolysis is enhanced with multiple
monoclonal antibodies.
[0209] Human monoclonal antibodies which bind to CD20 also can be
tested in an in vivo model (e.g., in mice) to determine their
efficacy in controlling growth of CD20-expressing tumor cells.
These antibodies can be selected, for example, based on the
following criteria, which are not intended to be exclusive:
[0210] 1. binding to live cells expressing CD20;
[0211] 2. low dissociation rate from CD20;
[0212] 3. high affinity of binding to CD20;
[0213] 4. binding to a unique epitope on CD20; and/or binding in a
specific orientation to CD20, and/or binding to a specific form of
CD20;
[0214] 5. opsonization of cells expressing CD20;
[0215] 6. mediation of growth inhibition, phagocytosis and/or
killing of cells expressing CD20 in the presence of human effector
cells;
[0216] 7. ability to induce CDC on either CD55/CD59 negative or
positive cells;
[0217] 8. ability to induce homotypic adhesion;
[0218] 9. ability to induce translocation into lipid rafts upon
binding to CD20;
[0219] 10. ability to induce apoptosis;
[0220] 11. ability to induce ADCC on cells expressing CD20;
[0221] 12. ability to deplete cells which express CD20; and/or
[0222] 13. ability to deplete cells which express low levels of
CD20 (CD20.sup.low cells).
[0223] Preferred human monoclonal antibodies of the invention meet
one or more of these criteria.
[0224] Human monoclonal anti-CD20 antibodies can be tested for
their ability to mediate CDC using a variety of known techniques.
For example, serum for complement can be obtained from the blood of
healthy subjects which can be centrifuged and harvested. To
determine the CDC activity of various mAbs, different methods can
be used. .sup.51Cr release can for example be measured or elevated
membrane permeability can be assessed using a propidium iodide (PI)
exclusion assay. Briefly, target cells can be washed and
resuspended in RPMI-1% BSA at 1.times.10.sup.6/ml. Various
concentrations of mAb can be added to the cells and allowed to bind
for 10-15 min at room temperature. Serum can then be added to a
final concentration of 20% (v/v) and the cells incubated at
37.degree. C. for 45 min. All cells from each sample can be added
to the PI solution in a FACS tube. The mixture can then be assessed
immediately by flow cytometry using a FACScalibur flow cytometer
and analysed using CellQuest pro software (BD Biosciences, Mountain
view, Calif.).
[0225] To test for the ability to initiate apoptosis, human
monoclonal anti-CD20 antibodies can, for example, be incubated with
CD20 positive tumor cells, e.g., Daudi at 37.degree. C. for about
20 hours. The cells can be harvested, washed in Annexin-V-FITC
binding buffer (BD biosciences), and labeled with Annexin V-FITC
(BD biosciences) for 15 min in the dark at 4.degree. C. All cells
from each sample can be added to PI solution (10 .mu.g/ml in PBS)
in a FACS tube and assessed immediately by flow cytometry (as
above).
[0226] In a particular embodiment of the invention, the human
monoclonal antibodies are used in combination, e.g., as a
pharmaceutical composition comprising two or more anti-CD20
monoclonal antibodies. For example, human anti-CD20 monoclonal
antibodies having different but complementary activities can be
combined in a single therapy to achieve a desired therapeutic or
diagnostic effect. In a preferred embodiment, the composition
includes an anti-CD20 human monoclonal antibody that mediates CDC
combined with another human anti-CD20 monoclonal antibody that
induces apoptosis. In another embodiment, the composition includes
an anti-CD20 human monoclonal antibody that mediates highly
effective killing of target cells in the presence of effector
cells, combined with another human anti-CD20 monoclonal antibody
that inhibits the growth of cells expressing CD20.
II. Production of Transgenic Non-Human Animals which Generate Human
Monoclonal Anti-CD20 Antibodies
[0227] In yet another aspect, the invention provides transgenic and
transchromosomal non-human animals, such as transgenic or
transchromosomal mice, which are capable of expressing human
antibodies that specifically bind to CD20. In a particular
embodiment, the invention provides a transgenic or transchromosomal
mouse having a genome comprising a human heavy chain transgene,
such that the mouse produces human anti-CD20 antibodies when
immunized with cells expressing CD20. The human heavy chain
transgene can be integrated into the chromosomal DNA of the mouse,
as is the case for transgenic, e.g., HuMAb mice, as described in
detail herein and exemplified. Alternatively, the human heavy chain
transgene can be maintained extrachromosomally, as is the case for
transchromosomal (e.g., KM) mice as described in WO 02/43478. Such
transgenic and transchromosomal animals are capable of producing
multiple isotypes of human monoclonal antibodies to CD20 (e.g.,
IgG, IgA and/or IgE) by undergoing V-D-J/V-J recombination and
isotype switching. The design of a transgenic or transchromosomal
non-human animal that responds to foreign antigen stimulation with
a heterologous antibody repertoire, requires that the heterologous
immunoglobulin transgenes contained within the transgenic animal
function correctly throughout the pathway of B cell development.
This includes, for example, isotype switching of the heterologous
heavy chain transgene. Accordingly, transgenes are constructed so
as that isotype switching can be induced and one or more of the
following characteristics of antibody genes: (1) high level and
cell-type specific expression, (2) functional gene rearrangement,
(3) activation of and response to allelic exclusion, (4) expression
of a sufficient primary repertoire, (5) signal transduction, (6)
somatic hypermutation, and (7) domination of the transgene antibody
locus during the immune response.
[0228] Not all of the foregoing criteria need be met. For example,
in those embodiments wherein the endogenous immunoglobulin loci of
the transgenic animal are functionally disrupted, the transgene
need not activate allelic exclusion. Further, in those embodiments
wherein the transgene comprises a functionally rearranged heavy
and/or light chain immunoglobulin gene, the second criteria of
functional gene rearrangement is unnecessary, at least for that
transgene which is already rearranged. For background on molecular
immunology, see, Fundamental Immunology, 2nd edition (1989), Paul
William E., ed. Raven Press, N.Y.
[0229] In certain embodiments, the transgenic or transchromosomal
non-human animals used to generate the human monoclonal antibodies
of the invention contain rearranged, unrearranged or a combination
of rearranged and unrearranged heterologous immunoglobulin heavy
and light chain transgenes in the germline of the transgenic
animal. Each of the heavy chain transgenes comprises at least one
C.sub.H gene. In addition, the heavy chain transgene may contain
functional isotype switch sequences, which are capable of
supporting isotype switching of a heterologous transgene encoding
multiple C.sub.H genes in the B cells of the transgenic animal.
Such switch sequences may be those which occur naturally in the
germline immunoglobulin locus from the species that serves as the
source of the transgene C.sub.H genes, or such switch sequences may
be derived from those which occur in the species that is to receive
the transgene construct (the transgenic animal). For example, a
human transgene construct that is used to produce a transgenic
mouse may produce a higher frequency of isotype switching events if
it incorporates switch sequences similar to those that occur
naturally in the mouse heavy chain locus, as presumably the mouse
switch sequences are optimized to function with the mouse switch
recombinase enzyme system, whereas the human switch sequences are
not. Switch sequences may be isolated and cloned by conventional
cloning methods, or may be synthesized de novo from overlapping
synthetic oligonucleotides designed on the basis of published
sequence information relating to immunoglobulin switch region
sequences (Mills et al., Nucl. Acids Res. 15:7305-7316 (1991);
Sideras et al., Intl. Immunol. 1:631-642 (1989)). For each of the
foregoing transgenic animals, functionally rearranged heterologous
heavy and light chain immunoglobulin transgenes are found in a
significant fraction of the B cells of the transgenic animal (at
least 10 percent).
[0230] The transgenes used to generate the transgenic non-human
animals of the invention include a heavy chain transgene comprising
DNA encoding at least one variable gene segment, one diversity gene
segment, one joining gene segment and at least one constant region
gene segment. The immunoglobulin light chain transgene comprises
DNA encoding at least one variable gene segment, one joining gene
segment and at least one constant region gene segment. The gene
segments encoding the light and heavy chain gene segments are
heterologous to the transgenic animal in that they are derived
from, or correspond to, DNA encoding immunoglobulin heavy and light
chain gene segments from a species not consisting of the transgenic
non-human animal. In one aspect of the invention, the transgene is
constructed such that the individual gene segments are
unrearranged, i.e., not rearranged so as to encode a functional
immunoglobulin light or heavy chain. Such unrearranged transgenes
support recombination of the V, D, and J gene segments (functional
rearrangement) and preferably support incorporation of all or a
portion of a D region gene segment in the resultant rearranged
immunoglobulin heavy chain within the transgenic animal when
exposed to CD20 antigen.
[0231] In an alternate embodiment, the transgenes comprise an
unrearranged "minilocus". Such transgenes typically comprise a
substantial portion of the C, D, and J segments as well as a subset
of the V gene segments. In such transgene constructs, the various
regulatory sequences, e.g. promoters, enhancers, class switch
regions, splice-donor and splice-acceptor sequences for RNA
processing, recombination signals and the like, comprise
corresponding sequences derived from the heterologous DNA. Such
regulatory sequences may be incorporated into the transgene from
the same or a related species of the non-human animal used in the
invention. For example, human immunoglobulin gene segments may be
combined in a transgene with a rodent immunoglobulin enhancer
sequence for use in a transgenic mouse. Alternatively, synthetic
regulatory sequences may be incorporated into the transgene,
wherein such synthetic regulatory sequences are not homologous to a
functional DNA sequence that is known to occur naturally in the
genomes of mammals. Synthetic regulatory sequences are designed
according to consensus rules, such as, for example, those
specifying the permissible sequences of a splice-acceptor site or a
promoter/enhancer motif. For example, a minilocus comprises a
portion of the genomic immunoglobulin locus having at least one
internal (i.e., not at a terminus of the portion) deletion of a
non-essential DNA portion (e.g., intervening sequence; intron or
portion thereof) as compared to the naturally-occurring germline Ig
locus.
[0232] Preferred transgenic and transchromosomal non-human animals,
e.g., mice, will exhibit immunoglobulin production with a
significant repertoire, ideally substantially similar to that of a
human after adjusting for volume.
[0233] The repertoire will ideally approximate that shown in a
human when adjusted for volume, usually with a diversity at least
about 10% as great, preferably 25 to 50% or more. Generally, at
least about a thousand different immunoglobulins (ideally IgG),
preferably 10.sup.4 to 10.sup.6 or more, will be produced,
depending on the number of different V, J and D regions introduced
into the mouse genome and driven by the additional diversity
generated by V(-D-)J gene segment rearrangements random nucleotide
additions at the joining regions. Typically, the immunoglobulins
will exhibit an affinity (K.sub.D) for preselected antigens of
below 10.sup.-7 M, such as of below 10.sup.-8M, 10.sup.-9M or
10.sup.-10 M or even lower.
[0234] Transgenic and transchromosomal non-human animals, e.g.,
mice, as described above can be immunized with, for example, cells
expressing CD20. Alternatively, the transgenic animals can be
immunized with DNA encoding human CD20. The animals will then
produce B cells which undergo class-switching via switch
recombination (cis-switching) and express immunoglobulins reactive
with CD20. The immunoglobulins can be human antibodies (also
referred to as "human sequence antibodies"), wherein the heavy and
light chain polypeptides are encoded by human transgene sequences,
which may include sequences derived by somatic mutation and V
region recombinatorial joints, as well as germline-encoded
sequences; these human antibodies can be referred to as being
substantially identical to a polypeptide sequence encoded by a
human V.sub.L and J.sub.L or V.sub.H, D.sub.H and J.sub.H gene
segments, even though other non-germline sequences may be present
as a result of somatic mutation and differential V-J and V-D-J
recombination joints. The variable regions of each antibody chain
are typically at least 80 percent similar to human germline V, J,
and, in the case of heavy chains, D, gene segments; frequently at
least 85 percent similar to human germline sequences present on the
transgene; often 90 or 95 percent or more similar to human germline
sequences present on the transgene. However, since non-germline
sequences are introduced by somatic mutation and VJ and VDJ
joining, the human sequence antibodies will frequently have some
variable region sequences which are not encoded by human V, D, or J
gene segments as found in the human transgene(s) in the germline of
the mice. Typically, such non-germline sequences (or individual
nucleotide positions) will cluster in or near CDRs, or in regions
where somatic mutations are known to cluster.
[0235] Another aspect of the invention includes B cells derived
from transgenic or transchromosomal non-human animals as described
herein. The B cells can be used to generate hybridomas expressing
human monoclonal antibodies which bind with high affinity (e.g., a
dissociation equilibrium constant (K.sub.D) of lower than 10.sup.-7
M) to human CD20. Thus, in another embodiment, the invention
provides a hybridoma which produces a human antibody having an
affinity (K.sub.D) of below 10.sup.-7 M, such as of below 10.sup.-8
M, 10.sup.-9 M or 10.sup.-10 M or even lower when determined by
scatchard analysis of CD20 expressing cells using a radioactively
labeled monoclonal antibody or by determination of the half-maximal
binding concentration using FACS analysis.
[0236] Herein the monoclonal antibody comprises a human sequence
light chain composed of (1) a light chain variable region having a
polypeptide sequence which is substantially identical to a
polypeptide sequence encoded by a human V.sub.L gene segment and a
human J.sub.L segment, and (2) a light chain constant region
encoded by a human C.sub.L gene segment; and
[0237] a human sequence heavy chain composed of a (1) a heavy chain
variable region having a polypeptide sequence which is
substantially identical to a polypeptide sequence encoded by a
human V.sub.H gene segment, a D region, and a human J.sub.H
segment, and (2) a constant region encoded by a human C.sub.H gene
segment.
[0238] The development of high affinity human monoclonal antibodies
against CD20 can be facilitated by a method for expanding the
repertoire of human variable region gene segments in a transgenic
non-human animal having a genome comprising an integrated human
immunoglobulin transgene, said method comprising introducing into
the genome a V gene transgene comprising V region gene segments
which are not present in said integrated human immunoglobulin
transgene. Often, the V region transgene is a yeast artificial
chromosome comprising a portion of a human V.sub.H or V.sub.L
(V.sub.K) gene segment array, as may naturally occur in a human
genome or as may be spliced together separately by recombinant
methods, which may include out-of-order or omitted V gene segments.
Often at least five or more functional V gene segments are
contained on the YAC. In this variation, it is possible to make a
transgenic animal produced by the V repertoire expansion method,
wherein the animal expresses an immunoglobulin chain comprising a
variable region sequence encoded by a V region gene segment present
on the V region transgene and a C region encoded on the human Ig
transgene. By means of the V repertoire expansion method,
transgenic animals having at least 5 distinct V genes can be
generated; as can animals containing at least about 24 V genes or
more. Some V gene segments may be non-functional (e.g., pseudogenes
and the like); these segments may be retained or may be selectively
deleted by recombinant methods available to the skilled artisan, if
desired.
[0239] Once the mouse germline has been engineered to contain a
functional YAC having an expanded V segment repertoire,
substantially not present in the human Ig transgene containing the
J and C gene segments, the trait can be propagated and bred into
other genetic backgrounds, including backgrounds where the
functional YAC having an expanded V segment repertoire is bred into
a non-human animal germline having a different human Ig transgene.
Multiple functional YACs having an expanded V segment repertoire
may be bred into a germline to work with a human Ig transgene (or
multiple human Ig transgenes). Although referred to herein as YAC
transgenes, such transgenes when integrated into the genome may
substantially lack yeast sequences, such as sequences required for
autonomous replication in yeast; such sequences may optionally be
removed by genetic engineering (e.g., restriction digestion and
pulsed-field gel electrophoresis or other suitable method) after
replication in yeast is no longer necessary (i.e., prior to
introduction into a mouse ES cell or mouse prozygote). Methods of
propagating the trait of human sequence immunoglobulin expression,
include breeding a transgenic animal having the human Ig
transgene(s), and optionally also having a functional YAC having an
expanded V segment repertoire. Both V.sub.H and V.sub.L gene
segments may be present on the YAC. The transgenic animal may be
bred into any background desired by the practitioner, including
backgrounds harboring other human transgenes, including human Ig
transgenes and/or transgenes encoding other human lymphocyte
proteins. The invention also provides a high affinity human
sequence immunoglobulin produced by a transgenic mouse having an
expanded V region repertoire YAC transgene. Although the foregoing
describes a preferred embodiment of the transgenic animal of the
invention, other embodiments are contemplated which have been
classified in three categories:
[0240] I. Transgenic animals containing an unrearranged heavy and
rearranged light chain immunoglobulin transgene;
[0241] II. Transgenic animals containing an unrearranged heavy and
unrearranged light chain immunoglobulin transgene; and
[0242] III. Transgenic animal containing rearranged heavy and an
unrearranged light chain immunoglobulin transgene.
[0243] Of these categories of transgenic animal, the preferred
order of preference is as follows II>I>III where the
endogenous light chain genes (or at least the K gene) have been
knocked out by homologous recombination (or other method) and
I>II>III where the endogenous light chain genes have not been
knocked out and must be dominated by allelic exclusion.
III. Bispecific/Multispecific Molecules which Bind to CD20
[0244] In yet another embodiment of the invention, human monoclonal
antibodies to CD20 can be derivatized or linked to another
functional molecule, e.g., another peptide or protein (e.g., an
Fab' fragment) to generate a bispecific or multispecific molecule
which binds to multiple binding sites or target epitopes. For
example, an antibody of the invention can be functionally linked
(e.g., by chemical coupling, genetic fusion, noncovalent
association or otherwise) to one or more other binding molecules,
such as another antibody, peptide or binding mimetic.
[0245] Accordingly, the present invention includes bispecific and
multispecific molecules comprising at least one first binding
specificity for CD20 and a second binding specificity for a second
target epitope. In a particular embodiment of the invention, the
second target epitope is an Fc receptor, e.g., human Fc.gamma.RI
(CD64) or a human Fc.alpha. receptor (CD89), or a T cell receptor,
e.g., CD3. Therefore, the invention includes bispecific and
multispecific molecules capable of binding both to Fc.gamma.R,
Fc.alpha.R or Fc.epsilon.R expressing effector cells (e.g.,
monocytes, macrophages or polymorphonuclear cells (PMNs)), and to
target cells expressing CD20. These bispecific and multispecific
molecules target CD20 expressing cells to effector cell and, like
the human monoclonal antibodies of the invention, trigger Fc
receptor-mediated effector cell activities, such as phagocytosis of
a CD20 expressing cells, antibody dependent cellular cytotoxicity
(ADCC), cytokine release, or generation of superoxide anion.
[0246] Bispecific and multispecific molecules of the invention can
further include a third binding specificity, in addition to an
anti-Fc binding specificity and an anti-CD20 binding specificity.
In one embodiment, the third binding specificity is an
anti-enhancement factor (EF) portion, e.g., a molecule which binds
to a surface protein involved in cytotoxic activity and thereby
increases the immune response against the target cell. The
"anti-enhancement factor portion" can be an antibody, functional
antibody fragment or a ligand that binds to a given molecule, e.g.,
an antigen or a receptor, and thereby results in an enhancement of
the effect of the binding determinants for the F.sub.C receptor or
target cell antigen. The "anti-enhancement factor portion" can bind
an F.sub.C receptor or a target cell antigen. Alternatively, the
anti-enhancement factor portion can bind to an entity that is
different from the entity to which the first and second binding
specificities bind. For example, the anti-enhancement factor
portion can bind a cytotoxic T cell (e.g., via CD2, CD3, CD8, CD28,
CD4, CD40, ICAM-1 or other immune cell that results in an increased
immune response against the target cell).
[0247] In one embodiment, the bispecific and multispecific
molecules of the invention comprise as a binding specificity at
least one antibody, including, e.g., an Fab, Fab', F(ab').sub.2,
Fv, or a single chain Fv. The antibody may also be a light chain or
heavy chain dimer, or any minimal fragment thereof such as a Fv or
a single chain construct as described in Ladner et al. U.S. Pat.
No. 4,946,778. The antibody may also be a binding-domain
immunoglobulin fusion protein as disclosed in US 2003/0118592 and
US 2003/0133939.
[0248] In one embodiment bispecific and multispecific molecules of
the invention comprise a binding specificity for an Fc.gamma.R or
an Fc.alpha.R present on the surface of an effector cell, and a
second binding specificity for a target cell antigen, e.g.,
CD20.
[0249] In one embodiment, the binding specificity for an Fc
receptor is provided by a human monoclonal antibody, the binding of
which is not blocked by human immunoglobulin G (IgG). As used
herein, the term "IgG receptor" refers to any of the eight
.gamma.-chain genes located on chromosome 1. These genes encode a
total of twelve transmembrane or soluble receptor isoforms which
are grouped into three Fc.gamma. receptor classes: Fc.gamma.RI
(CD64), Fc.gamma.RII(CD32), and Fc.gamma.RIII(CD16). In one
preferred embodiment, the Fc.gamma. receptor is a human high
affinity Fc.gamma.RI.
[0250] The production and characterization of these preferred
monoclonal antibodies are, described by Fanger et al. in WO
88/00052 and in U.S. Pat. No. 4,954,617. These antibodies bind to
an epitope of Fc.gamma.RI, Fc.gamma.RII or Fc.gamma.RIII at a site
which is distinct from the Fc.gamma. binding site of the receptor
and, thus, their binding is not blocked substantially by
physiological levels of IgG. Specific anti-Fc.gamma.RI antibodies
useful in this invention are mAb 22, mAb 32, mAb 44, mAb 62 and mAb
197. In other embodiments, the anti-Fc.gamma. receptor antibody is
a humanized form of monoclonal antibody 22 (H22). The production
and characterization of the 1122 antibody is described in Graziano,
R. F. et al. (1995) J. Immunol. 155 (10): 4996-5002 and WO
94/10332. The H22 antibody producing cell line was deposited at the
American Type Culture Collection on Nov. 4, 1992 under the
designation HA022CL1 and has the accession No. CRL 11177.
[0251] In still other preferred embodiments, the binding
specificity for an Fe receptor is provided by an antibody that
binds to a human IgA receptor, e.g., an Fc-alpha receptor
(Fc.alpha.RI (CD89)), the binding of which is preferably not
blocked by human immunoglobulin A (IgA). The term "IgA receptor" is
intended to include the gene product of one .alpha.-gene
(Fc.alpha.RI) located on chromosome 19. This gene is known to
encode several alternatively spliced transmembrane isoforms of 55
to 110 kDa. Fc.alpha.RI (CD89) is constitutively expressed on
monocytes/macrophages, eosinophilic and neutrophilic granulocytes,
but not on non-effector cell populations. Fc.alpha.RI has medium
affinity for both IgA1 and IgA2, which is increased upon exposure
to cytokines such as G-CSF or GM-CSF (Morton, H. C. et al. (1996)
Critical Reviews in Immunology 16:423-440). Four Fecal-specific
monoclonal antibodies, identified as A3, A59, A62 and A77, which
bind Fc.alpha.RI outside the IgA ligand binding domain, have been
described (Monteiro, R. C. et al. (1992) J. Immunol. 148:1764).
[0252] Fc.alpha.RI and Fc.gamma.RI are preferred trigger receptors
for use in the invention because they are (1) expressed primarily
on immune effector cells, e.g., monocytes, PMNs, macrophages and
dendritic cells; (2) expressed at high levels (e.g., 5,000-100,000
per cell); (3) mediators of cytotoxic activities (e.g., ADCC,
phagocytosis); (4) mediate enhanced antigen presentation of
antigens, including self-antigens, targeted to them.
[0253] In another embodiment the bispecific molecule is comprised
by two human monoclonal antibodies according to the invention which
have complementary functional activities, such as one antibody
predominately working by inducing CDC and the other antibody
predominately working by inducing apoptosis, e.g., 2F2 in
combination with 11B8.
[0254] In other embodiments, bispecific and multispecific molecules
of the invention further comprise a binding specificity which
recognizes, e.g., binds to, a target cell antigen, e.g., CD20. In a
preferred embodiment, the binding specificity is provided by a
human monoclonal antibody of the present invention.
[0255] An "effector cell specific antibody" as used herein refers
to an antibody or functional antibody fragment that binds the Fc
receptor of effector cells. Preferred antibodies for use in the
subject invention bind the Fc receptor of effector cells at a site
which is not bound by endogenous immunoglobulin.
[0256] As used herein, the term "effector cell" refers to an immune
cell which is involved in the effector phase of an immune response,
as opposed to the cognitive and activation phases of an immune
response. Exemplary immune cells include a cell of a myeloid or
lymphoid origin, e.g., lymphocytes (e.g., B cells and T cells
including cytolytic T cells (CTLs)), killer cells, natural killer
cells, macrophages, monocytes, eosinophils, neutrophils,
polymorphonuclear cells, granulocytes, mast cells, and basophils.
Some effector cells express specific Fc receptors and carry out
specific immune functions. In preferred embodiments, an effector
cell is capable of inducing antibody-dependent cellular
cytotoxicity (ADCC), e.g., a neutrophil capable of inducing ADCC.
For example, monocytes, macrophages, which express FcR are involved
in specific killing of target cells and presenting antigens to
other components of the immune system, or binding to cells that
present antigens. In other embodiments, an effector cell can
phagocytose a target antigen, target cell, or microorganism. The
expression of a particular FcR on an effector cell can be regulated
by humoral factors such as cytokines. For example, expression of
Fc.gamma.RI has been found to be up-regulated by interferon gamma
(IFN-.gamma.). This enhanced expression increases the cytotoxic
activity of Fc.gamma.RI-bearing cells against targets. An effector
cell can phagocytose or lyse a target antigen or a target cell.
[0257] "Target cell" shall mean any undesirable cell in a subject
(e.g., a human or animal) that can be targeted by a composition
(e.g., a human monoclonal antibody, a bispecific or a multispecific
molecule) of the invention. In preferred embodiments, the target
cell is a cell expressing or overexpressing CD20. Cells expressing
CD20 typically include B cells and B cell tumors.
[0258] While human monoclonal antibodies are preferred, other
antibodies which can be employed in the bispecific or multispecific
molecules of the invention are murine, chimeric and humanized
monoclonal antibodies. Such murine, chimeric and humanized
monoclonal antibodies can be prepared by methods known in the
art.
[0259] Bispecific and multispecific molecules of the present
invention can be made using chemical techniques (see e.g., D. M.
Kranz et al. (1981) Proc. Natl. Acad. Sci. USA 78:5807), "polydoma"
techniques (See U.S. Pat. No. 4,474,893, to Reading), or
recombinant DNA techniques.
[0260] In particular, bispecific and multispecific molecules of the
present invention can be prepared by conjugating the constituent
binding specificities, e.g., the anti-FcR and anti-CD20 binding
specificities, using methods known in the art and described in the
examples provided herein. For example, each binding specificity of
the bispecific and multispecific molecule can be generated
separately and then conjugated to one another. When the binding
specificities are proteins or peptides, a variety of coupling or
cross-linking agents can be used for covalent conjugation. Examples
of cross-linking agents include protein A, carbodiimide,
N-succinimidyl-5-acetyl-thioacetate (SATA),
5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), o-phenylenedimaleimide
(oPDM), N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), and
sulfosuccinimidyl 4-(N-maleimidomethyl)cyclo-hexane-1-carboxylate
(sulfo-SMCC) (see e.g., Karpovsky et al. (1984) J. Exp. Med.
160:1686; Liu, M A et al. (1985) Proc. Natl. Acad. Sci. USA
82:8648). Other methods include those described by Paulus (Behring
Ins. Mitt. (1985) No. 78, 118-132); Brennan et al. (Science (1985)
229:81-83), and Glennie et al. (J. Immunol. (1987) 139: 2367-2375).
Preferred conjugating agents are SATA and sulfo-SMCC, both
available from Pierce Chemical Co. (Rockford, Ill.).
[0261] When the binding specificities are antibodies, they can be
conjugated via sulfhydryl bonding of the C-terminus hinge regions
of the two heavy chains. In a particularly preferred embodiment,
the hinge region is modified to contain an odd number of sulfhydryl
residues, preferably one, prior to conjugation.
[0262] Alternatively, both binding specificities can be encoded in
the same vector and expressed and assembled in the same host cell.
This method is particularly useful where the bispecific and
multispecific molecule is a mAb.times.mAb, mAb.times.Fab,
Fab.times.F(ab').sub.2 or ligand.times.Fab fusion protein. A
bispecific and multispecific molecule of the invention, e.g., a
bispecific molecule can be a single chain molecule, such as a
single chain bispecific antibody, a single chain bispecific
molecule comprising one single chain antibody and a binding
determinant, or a single chain bispecific molecule comprising two
binding determinants. Bispecific and multispecific molecules can
also be single chain molecules or may comprise at least two single
chain molecules. Methods for preparing bi- and multispecific
molecules are described for example in U.S. Pat. No. 5,260,203;
U.S. Pat. No. 5,455,030; U.S. Pat. No. 4,881,175; U.S. Pat. No.
5,132,405; U.S. Pat. No. 5,091,513; U.S. Pat. No. 5,476,786; U.S.
Pat. No. 5,013,653; U.S. Pat. No. 5,258,498; and U.S. Pat. No.
5,482,858.
[0263] Binding of the bispecific and multispecific molecules to
their specific targets can be confirmed by enzyme-linked
immunosorbent assay (ELISA), a radioimmunoassay (RIA), FACS
analysis, a bioassay (e.g., growth inhibition), or a Western Blot
Assay. Each of these assays generally detects the presence of
protein-antibody complexes of particular interest by employing a
labeled reagent (e.g., an antibody) specific for the complex of
interest. For example, the FcR-antibody complexes can be detected
using e.g., an enzyme-linked antibody or antibody fragment which
recognizes and specifically binds to the antibody-FcR complexes.
Alternatively, the complexes can be detected using any of a variety
of other immunoassays. For example, the antibody can be
radioactively labeled and used in a radioimmunoassay (RIA) (see,
for example, Weintraub, B., Principles of Radioimmunoassays,
Seventh Training Course on Radioligand Assay Techniques, The
Endocrine Society, March, 1986). The radioactive isotope can be
detected by such means as the use of a .gamma. counter or a
scintillation counter or by autoradiography.
IV. Immunoconjugates
[0264] In another aspect, the present invention features a human
anti-CD20 monoclonal antibody conjugated to a therapeutic moiety,
such as a cytotoxin, a drug (e.g., an immunosuppressant) or a
radioisotope. Such conjugates are referred to herein as
"immunoconjugates". Immunoconjugates which include one or more
cytotoxins are referred to as "immunotoxins." A cytotoxin or
cytotoxic agent includes any agent that is detrimental to (e.g.,
kills) cells. Examples include taxol, cytochalasin B, gramicidin D,
ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin
D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof.
[0265] Suitable therapeutic agents for forming immunoconjugates of
the invention include, but are not limited to, antimetabolites
(e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine,
fludarabin, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU)
and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol,
streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II)
(DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly actinomycin), bleomycin, mithramycin, and anthramycin
(AMC)), and anti-mitotic agents (e.g., vincristine and
vinblastine). In a preferred embodiment, the therapeutic agent is a
cytotoxic agent or a radiotoxic agent. In another embodiment, the
therapeutic agent is an immunosuppressant. In yet another
embodiment, the therapeutic agent is GM-CSF. In a preferred
embodiment, the therapeutic agent is doxorubicin, cisplatin,
bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide or
ricin A.
[0266] Antibodies of the present invention also can be conjugated
to a radioisotope, e.g., iodine-131, yttrium-90 or indium-111, to
generate cytotoxic radiopharmaceuticals for treating a CD20-related
disorder, such as a cancer. The antibody conjugates of the
invention can be used to modify a given biological response, and
the drug moiety is not to be construed as limited to classical
chemical therapeutic agents. For example, the drug moiety may be a
protein or polypeptide possessing a desired biological activity.
Such proteins may include, for example, an enzymatically active
toxin, or active fragment thereof, such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor or interferon-.gamma.; or, biological response
modifiers such as, for example, lymphokines, interleukin-1
("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"),
granulocyte macrophage colony stimulating factor ("GM-CSF"),
granulocyte colony stimulating factor ("G-CSF"), or other growth
factors.
[0267] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Amon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62:119-58 (1982).
[0268] In a further embodiment, the human monoclonal antibodies
according to the invention are attached to a linker-chelator, e.g.,
tiuxetan, which allows for the antibody to be conjugated to a
radioisotope.
V. Pharmaceutical Compositions
[0269] In another aspect, the present invention provides a
composition, e.g., a pharmaceutical composition, containing one or
a combination of human monoclonal antibodies of the present
invention. The pharmaceutical compositions may be formulated with
pharmaceutically acceptable carriers or diluents as well as any
other known adjuvants and excipients in accordance with
conventional techniques such as those disclosed in Remington: The
Science and Practice of Pharmacy, 19.sup.th Edition, Gennaro, Ed.,
Mack Publishing Co., Easton, Pa., 1995. In one embodiment, the
compositions include a combination of multiple (e.g., two or more)
isolated human antibodies of the invention which act by different
mechanisms, e.g., one antibody which predominately acts by inducing
CDC in combination with another antibody which predominately acts
by inducing apoptosis.
[0270] Pharmaceutical compositions of the invention also can be
administered in combination therapy, i.e., combined with other
agents. For example, the combination therapy can include a
composition of the present invention with at least one
anti-inflammatory agent or at least one immunosuppressive agent. In
one embodiment such therapeutic agents include one or more
anti-inflammatory agents, such as a steroidal drug or a NSAID
(nonsteroidal anti-inflammatory drug). Preferred agents include,
for example, aspirin and other salicylates, Cox-2 inhibitors, such
as rofecoxib (Vioxx) and celecoxib (Celebrex), NSAIDs such as
ibuprofen (Motrin, Advil), fenoprofen (Nalfon), naproxen
(Naprosyn), sulindac (Clinoril), diclofenac (Voltaren), piroxicam
(Feldene), ketoprofen (Orudis), diflunisal (Dolobid), nabumetone
(Relafen), etodolac (Lodine), oxaprozin (Daypro), and indomethacin
(Indocin).
[0271] In another embodiment, such therapeutic agents include one
or more DMARDs, such as methotrexate (Rheumatrex),
hydroxychloroquine (Plaquenil), sulfasalazine (Asulfidine),
pyrimidine synthesis inhibitors, e.g., leflunomide (Arava), IL-1
receptor blocking agents, e.g., anakinra (Kineret), and TNF-.alpha.
blocking agents, e.g., etanercept (Enbrel), infliximab (Remicade)
and adalimumab.
[0272] In another embodiment, such therapeutic agents include one
or more immunosuppressive agents, such as cyclosporine (Sandimmune,
Neoral) and azathioprine (Imural).
[0273] In yet another embodiment, such therapeutic agents include
one or more chemotherapeutics, such as doxorubicin (Adriamycin),
cisplatin (Platinol), bleomycin (Blenoxane), carmustine (Gliadel),
cyclophosphamide (Cytoxan, Procytox, Neosar), and chlorambucil
(Leukeran).
[0274] In another embodiment, human antibodies of the present
invention may be administered in combination with chlorambucil and
prednisolone; cyclophosphamide and prednisolone; cyclophosphamide,
vincristine, and prednisone; cyclophosphamide, vincristine,
doxorubicin, and prednisone; fludarabine and anthracycline; or in
combination with other common multi-drugs regimens for NHL, such as
disclosed, e.g., in Non-Hodgkin's Lymphomas: Making sense of
Diagnosis, Treatment, and Options, Lorraine Johnston, 1999,
O'Reilly and Associates, Inc.
[0275] In yet another embodiment, the human antibodies may be
administered in conjunction with radiotherapy and/or autologous
peripheral stem cell or bone marrow transplantation.
[0276] In still another embodiment, the human antibodies may be
administered in combination with one or more antibodies selected
from anti-CD25 antibodies, anti-CD19 antibodies, anti-CD21
antibodies, anti-CD22 antibodies, anti-CD37 antibodies, anti-CD38
antibodies, anti-IL6R antibodies, anti-IL8 antibodies, anti-IL15
antibodies, anti-IL15R antibodies, anti-CD4 antibodies, anti-CD11a
antibodies (e.g., efalizumab), anti-alpha-4/beta-1 integrin (VLA4)
antibodies (e.g., natalizumab), and CTLA4-Ig.
[0277] In a particular embodiment, the human monoclonal antibodies
are administered in combination with an anti-CD25 antibody for the
treatment of bullous pemphigoid, e.g., in patients with
graft-versus-host disease.
[0278] In another particular embodiment, the human monoclonal
antibodies are administered in combination with one or more
antibodies selected from anti-CD19 antibodies, anti-CD21
antibodies, anti-CD22 antibodies, anti-CD37 antibodies, and
anti-CD38 antibodies for the treatment of malignant diseases.
[0279] In still another particular embodiment, the human antibodies
are administered in combination with one or more antibodies
selected from anti-IL6R antibodies, anti-IL8 antibodies, anti-IL15
antibodies, anti-IL15R antibodies, anti-CD4 antibodies, anti-CD11a
antibodies (e.g., efalizumab), anti-alpha-4/beta-1 integrin (VLA4)
antibodies (e.g natalizumab), and CTLA4-Ig for the treatment of
inflammatory diseases.
[0280] In yet a further embodiment, the human antibodies may be
administered in combination with an anti-C3b(i) antibody in order
to enhance complement activation.
[0281] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like that are physiologically compatible.
Preferably, the carrier is suitable for intravenous, intramuscular,
subcutaneous, parenteral, spinal or epidermal administration (e.g.,
by injection or infusion). Depending on the route of
administration, the active compound, i.e., antibody, bispecific and
multispecific molecule, may be coated in a material to protect the
compound from the action of acids and other natural conditions that
may inactivate the compound.
[0282] A "pharmaceutically acceptable salt" refers to a salt that
retains the desired biological activity of the parent compound and
does not impart any undesired toxicological effects (see e.g.,
Berge, S. M., et al. (1977) J. Pharm. Sci. 66:1-19). Examples of
such salts include acid addition salts and base addition salts.
Acid addition salts include those derived from nontoxic inorganic
acids, such as hydrochloric, nitric, phosphoric, sulfuric,
hydrobromic, hydroiodic, phosphorous and the like, as well as from
nontoxic organic acids such as aliphatic mono- and dicarboxylic
acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids,
aromatic acids, aliphatic and aromatic sulfonic acids and the like.
Base addition salts include those derived from alkaline earth
metals, such as sodium, potassium, magnesium, calcium and the like,
as well as from nontoxic organic amines, such as
N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine,
choline, diethanolamine, ethylenediamine, procaine and the
like.
[0283] A composition of the present invention can be administered
by a variety of methods known in the art. As will be appreciated by
the skilled artisan, the route and/or mode of administration will
vary depending upon the desired results. The active compounds can
be prepared with carriers that will protect the compound against
rapid release, such as a controlled release formulation, including
implants, transdermal patches, and microencapsulated delivery
systems. Biodegradable, biocompatible polymers can be used, such as
ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
collagen, polyorthoesters, and polylactic acid. Methods for the
preparation of such formulations are generally known to those
skilled in the art. See, e.g., Sustained and Controlled Release
Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc.,
New York, 1978.
[0284] To administer a compound of the invention by certain routes
of administration, it may be necessary to coat the compound with,
or co-administer the compound with, a material to prevent its
inactivation. For example, the compound may be administered to a
subject in an appropriate carrier, for example, liposomes, or a
diluent. Pharmaceutically acceptable diluents include saline and
aqueous buffer solutions. Liposomes include water-in-oil-in-water
CGF emulsions as well as conventional liposomes (Strejan et al.
(1984) J. Neuroimmunol. 7:27).
[0285] Pharmaceutically acceptable carriers include sterile aqueous
solutions or dispersions and sterile powders for the extemporaneous
preparation of sterile injectable solutions or dispersion. The use
of such media and agents for pharmaceutically active substances is
known in the art. Except insofar as any conventional media or agent
is incompatible with the active compound, use thereof in the
pharmaceutical compositions of the invention is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0286] Therapeutic compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
liposome, or other ordered structure suitable to high drug
concentration. The carrier can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (for example,
glycerol, propylene glycol, and liquid polyethylene glycol, and the
like), and suitable mixtures thereof. The proper fluidity can be
maintained, for example, by the use of a coating such as lecithin,
by the maintenance of the required particle size in the case of
dispersion and by the use of surfactants. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol, sorbitol, or sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent that
delays absorption, for example, monostearate salts and gelatin.
[0287] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by sterilization
microfiltration. Generally, dispersions are prepared by
incorporating the active compound into a sterile vehicle that
contains a basic dispersion medium and the required other
ingredients from those enumerated above. In the case of sterile
powders for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum drying and
freeze-drying (lyophilization) that yield a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0288] Dosage regimens are adjusted to provide the optimum desired
response (e.g., a therapeutic response). For example, a single
bolus may be administered, several divided doses may be
administered over time or the dose may be proportionally reduced or
increased as indicated by the exigencies of the therapeutic
situation. It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
subjects to be treated; each unit contains a predetermined quantity
of active compound calculated to produce the desired therapeutic
effect in association with the required pharmaceutical carrier. The
specification for the dosage unit forms of the invention are
dictated by and directly dependent on (a) the unique
characteristics of the active compound and the particular
therapeutic effect to be achieved, and (b) the limitations inherent
in the art of compounding such an active compound for the treatment
of sensitivity in individuals.
[0289] Examples of pharmaceutically-acceptable antioxidants
include: (1) water soluble antioxidants, such as ascorbic acid,
cysteine hydrochloride, sodium bisulfate, sodium metabisulfite,
sodium sulfite and the like; (2) oil-soluble antioxidants, such as
ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated
hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol,
and the like; and (3) metal chelating agents, such as citric acid,
ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid,
phosphoric acid, and the like.
[0290] For the therapeutic compositions, formulations of the
present invention include those suitable for oral, nasal, topical
(including buccal and sublingual), rectal, vaginal and/or
parenteral administration. The formulations may conveniently be
presented in unit dosage form and may be prepared by any methods
known in the art of pharmacy. The amount of active ingredient which
can be combined with a carrier material to produce a single dosage
form will vary depending upon the subject being treated, and the
particular mode of administration. The amount of active ingredient
which can be combined with a carrier material to produce a single
dosage form will generally be that amount of the composition which
produces a therapeutic effect. Generally, out of one hundred
percent, this amount will range from about 0.01 percent to about
ninety-nine percent of active ingredient, preferably from about 0.1
percent to about 70 percent, most preferably from about 1 percent
to about 30 percent.
[0291] Formulations of the present invention which are suitable for
vaginal administration also include pessaries, tampons, creams,
gels, pastes, foams or spray formulations containing such carriers
as are known in the art to be appropriate. Dosage forms for the
topical or transdermal administration of compositions of this
invention include powders, sprays, ointments, pastes, creams,
lotions, gels, solutions, patches and inhalants. The active
compound may be mixed under sterile conditions with a
pharmaceutically acceptable carrier, and with any preservatives,
buffers, or propellants which may be required.
[0292] The phrases "parenteral administration" and "administered
parenterally" as used herein means modes of administration other
than enteral and topical administration, usually by injection, and
includes, without limitation, intravenous, intramuscular,
intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac, intradermal, intraperitoneal, transtracheal,
subcutaneous, subcuticular, intraarticular, subcapsular,
subarachnoid, intraspinal, epidural and intrasternal injection and
infusion.
[0293] Examples of suitable aqueous and nonaqueous carriers which
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity can be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0294] These compositions may also contain adjuvants such as
preservatives, wetting agents, emulsifying agents and dispersing
agents. Prevention of presence of microorganisms may be ensured
both by sterilization procedures, supra, and by the inclusion of
various antibacterial and antifungal agents, for example, paraben,
chlorobutanol, phenol sorbic acid, and the like. It may also be
desirable to include isotonic agents, such as sugars, sodium
chloride, and the like into the compositions. In addition,
prolonged absorption of the injectable pharmaceutical form may be
brought about by the inclusion of agents which delay absorption
such as aluminum monostearate and gelatin.
[0295] In one embodiment the human monoclonal antibodies of the
invention are administered in crystalline form by subcutaneous
injection, cf. Yang et al. (2003) PNAS, 100(12):6934-6939
[0296] When the compounds of the present invention are administered
as pharmaceuticals, to humans and animals, they can be given alone
or as a pharmaceutical composition containing, for example, 0.01 to
99.5% (more preferably, 0.1 to 90%) of active ingredient in
combination with a pharmaceutically acceptable carrier.
[0297] Regardless of the route of administration selected, the
compounds of the present invention, which may be used in a suitable
hydrated form, and/or the pharmaceutical compositions of the
present invention, are formulated into pharmaceutically acceptable
dosage forms by conventional methods known to those of skill in the
art.
[0298] Actual dosage levels of the active ingredients in the
pharmaceutical compositions of the present invention may be varied
so as to obtain an amount of the active ingredient which is
effective to achieve the desired therapeutic response for a
particular patient, composition, and mode of administration,
without being toxic to the patient. The selected dosage level will
depend upon a variety of pharmacokinetic factors including the
activity of the particular compositions of the present invention
employed, or the ester, salt or amide thereof, the route of
administration, the time of administration, the rate of excretion
of the particular compound being employed, the duration of the
treatment, other drugs, compounds and/or materials used in
combination with the particular compositions employed, the age,
sex, weight, condition, general health and prior medical history of
the patient being treated, and like factors well known in the
medical arts.
[0299] A physician or veterinarian having ordinary skill in the art
can readily determine and prescribe the effective amount of the
pharmaceutical composition required. For example, the physician or
veterinarian could start doses of the compounds of the invention
employed in the pharmaceutical composition at levels lower than
that required in order to achieve the desired therapeutic effect
and gradually increase the dosage until the desired effect is
achieved. In general, a suitable daily dose of a composition of the
invention will be that amount of the compound which is the lowest
dose effective to produce a therapeutic effect. Such an effective
dose will generally depend upon the factors described above. It is
preferred that administration be intravenous, intramuscular,
intraperitoneal, or subcutaneous, preferably administered proximal
to the site of the target. If desired, the effective daily dose of
a therapeutic composition may be administered as two, three, four,
five, six or more sub-doses administered separately at appropriate
intervals throughout the day, optionally, in unit dosage forms.
While it is possible for a compound of the present invention to be
administered alone, it is preferable to administer the compound as
a pharmaceutical formulation (composition).
[0300] In one embodiment, the human monoclonal antibodies according
to the invention may be administered by infusion in a weekly dosage
of 10 to 500 mg/m.sup.2, such as 200 to 400 mg/m.sup.2. Such
administration may be repeated, e.g., 1 to 8 times, such as 3 to 5
times. The administration may be performed by continuous infusion
over a period of from 2 to 24 hours, such as of from 2 to 12
hours.
[0301] In another embodiment, the human monoclonal antibodies are
administered by slow continuous infusion over a long period, such
as more than 24 hours, in order to reduce toxic side effects.
[0302] In still another embodiment the human monoclonal antibodies
are administered in a weekly dosage of from 250 mg to 2000 mg, such
as for example 300 mg, 500 mg, 700 mg, 1000 mg, 1500 mg or 2000 mg,
for up to 8 times, such as from 4 to 6 times. The administration
may be performed by continuous infusion over a period of from 2 to
24 hours, such as of from 2 to 12 hours. Such regimen may be
repeated one or more times as necessary, for example, after 6
months or 12 months. The dosage can be determined or adjusted by
measuring the amount of circulating monoclonal anti-CD20 antibodies
upon administration in a biological sample by using anti-idiotypic
antibodies which target the anti-CD20 antibodies.
[0303] In yet another embodiment, the human monoclonal antibodies
are administered by maintenance therapy, such as, e.g., once a week
for a period of 6 months or more.
[0304] In still another embodiment, the human monoclonal antibodies
according to the invention may be administered by a regimen
including one infusion of a human monoclonal antibody against CD20
followed by an infusion of a human monoclonal antibody against CD20
conjugated to a radioisotope. The regimen may be repeated, e.g., 7
to 9 days later.
[0305] Therapeutic compositions can be administered with medical
devices known in the art. For example, in a preferred embodiment, a
therapeutic composition of the invention can be administered with a
needleless hypodermic injection device, such as the devices
disclosed in U.S. Pat. No. 5,399,163; U.S. Pat. No. 5,383,851; U.S.
Pat. No. 5,312,335; U.S. Pat. No. 5,064,413; U.S. Pat. No.
4,941,880; U.S. Pat. No. 4,790,824; or U.S. Pat. No. 4,596,556.
Examples of well-known implants and modules useful in the present
invention include: U.S. Pat. No. 4,487,603, which discloses an
implantable micro-infusion pump for dispensing medication at a
controlled rate; U.S. Pat. No. 4,486,194, which discloses a
therapeutic device for administering medicants through the skin;
U.S. Pat. No. 4,447,233, which discloses a medication infusion pump
for delivering medication at a precise infusion rate; U.S. Pat. No.
4,447,224, which discloses a variable flow implantable infusion
apparatus for continuous drug delivery; U.S. Pat. No. 4,439,196,
which discloses an osmotic drug delivery system having
multi-chamber compartments; and U.S. Pat. No. 4,475,196, which
discloses an osmotic drug delivery system. Many other such
implants, delivery systems, and modules are known to those skilled
in the art.
[0306] In certain embodiments, the human monoclonal antibodies of
the invention can be formulated to ensure proper distribution in
vivo. For example, the blood-brain barrier (BBB) excludes many
highly hydrophilic compounds. To ensure that the therapeutic
compounds of the invention cross the BBB (if desired), they can be
formulated, for example, in liposomes. For methods of manufacturing
liposomes, see, e.g., U.S. Pat. No. 4,522,811; U.S. Pat. No.
5,374,548; and U.S. Pat. No. 5,399,331. The liposomes may comprise
one or more moieties which are selectively transported into
specific cells or organs, thus enhance targeted drug delivery (see,
e.g., V. V. Ranade (1989) J. Clin. Pharmacol. 29:685). Exemplary
targeting moieties include folate or biotin (see, e.g., U.S. Pat.
No. 5,416,016 to Low et al.); mannosides (Umezawa et al., (1988)
Biochem. Biophys. Res. Commun. 153:1038); antibodies (P. G. Bloeman
et al. (1995) FEBS Lett. 357:140; M. Owais et al. (1995)
Antimicrob. Agents Chemother. 39:180); surfactant protein A
receptor (Briscoe et al. (1995) Am. J. Physiol. 1233:134),
different species of which may comprise the formulations of the
inventions, as well as components of the invented molecules; p120
(Schreier et al. (1994) J. Biol. Chem. 269:9090); see also K.
Keinanen; M. L. Laukkanen (1994) FEBS Lett. 346:123; J. J. Killion;
I. J. Fidler (1994) Immunomethods 4:273. In one embodiment of the
invention, the therapeutic compounds of the invention are
formulated in liposomes; in a more preferred embodiment, the
liposomes include a targeting moiety. In a most preferred
embodiment, the therapeutic compounds in the liposomes are
delivered by bolus injection to a site proximal to the desired
area, e.g., the site of inflammation or infection, or the site of a
tumor. The composition must be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and
fungi.
[0307] In a further embodiment, human monoclonal antibodies of the
invention can be formulated to prevent or reduce their transport
across the placenta. This can be done by methods known in the art,
e.g., by PEGylation of the antibodies or by use of F(ab)2'
fragments. Further references can be made to "Cunningham-Rundles C,
Zhuo Z, Griffith B, Keenan J. (1992) Biological activities of
polyethylene-glycol immunoglobulin conjugates. Resistance to
enzymatic degradation. J Immunol Methods. 152:177-190; and to
"Landor M. (1995) Maternal-fetal transfer of immunoglobulins, Ann
Allergy Asthma Immunol 74:279-283. This is particularly relevant
when the antibodies are used for treating or preventing recurrent
spontaneous abortion.
[0308] A "therapeutically effective dosage" for tumor therapy can
be measured by objective tumor responses which can either be
complete or partial. A complete response (CR) is defined as no
clinical, radiological or other evidence of disease. A partial
response (PR) results from a reduction in aggregate tumor size of
greater than 50%. Median time to progression is a measure that
characterizes the durability of the objective tumor response.
[0309] A "therapeutically effective dosage" for tumor therapy can
also be measured by its ability to stabilize the progression of
disease. The ability of a compound to inhibit cancer can be
evaluated in an animal model system predictive of efficacy in human
tumors. Alternatively, this property of a composition can be
evaluated by examining the ability of the compound to inhibit cell
growth or apoptosis by in vitro assays known to the skilled
practitioner. A therapeutically effective amount of a therapeutic
compound can decrease tumor size, or otherwise ameliorate symptoms
in a subject. One of ordinary skill in the art would be able to
determine such amounts based on such factors as the subject's size,
the severity of the subject's symptoms, and the particular
composition or route of administration selected.
[0310] A "therapeutically effective dosage" for rheumatoid
arthritis preferably will result in an ACR20 Preliminary Definition
of Improvement in the patients, more preferred in an ACR50
Preliminary Definition of Improvement and even more preferred in an
ARC70 Preliminary Definition of Improvement.
[0311] ACR20Preliminary Definition of Improvement is defined as:
.gtoreq.20% improvement in: Tender Joint Count (TCJ) and Swollen
Joint Count (SWJ) and .gtoreq.20% improvement in 3 of following 5
assessments: Patient Pain Assessment (VAS), Patient Global
assessment (VAS), Physician Global Assessment (VAS), Patent
Self-Assessed Disability (HAQ), Acute Phase Reactant (CRP or
ESR).
[0312] ACR50 and ACR70 are defined in the same way with .gtoreq.50%
and .gtoreq.70% improvements, respectively. For further details see
Felson et al. in American College of Rheumatology Preliminary
Definition of Improvement in Rheumatoid Arthritis; Arthritis
Rheumatism (1995) 38: 727-735.
[0313] The composition must be sterile and fluid to the extent that
the composition is deliverable by syringe. In addition to water,
the carrier can be an isotonic buffered saline solution; ethanol,
polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), and suitable mixtures thereof.
Proper fluidity can be maintained, for example, by use of coating
such as lecithin, by maintenance of required particle size in the
case of dispersion and by use of surfactants. In many cases, it is
preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol or sorbitol, and sodium chloride in
the composition. Long-term absorption of the injectable
compositions can be brought about by including in the composition
an agent which delays absorption, for example, aluminum
monostearate or gelatin.
[0314] When the active compound is suitably protected, as described
above, the compound may be orally administered, for example, with
an inert diluent or an assimilable edible carrier.
VI. Uses and Methods of the Invention
[0315] The human antibodies (including immunoconjugates,
bispecifics/multispecifics, compositions and other derivatives
described herein) of the present invention have numerous in vitro
and in vivo diagnostic and therapeutic utilities involving the
diagnosis and treatment of disorders involving cells expressing
CD20. For example, the antibodies can be administered to cells in
culture, e.g., in vitro or ex vivo, or to human subjects, e.g., in
vivo, to treat, prevent and to diagnose a variety of disorders. As
used herein, the term "subject" is intended to include human and
non-human animals which respond to the human antibodies against
CD20. Preferred subjects include human patients having disorders
that can be corrected or ameliorated by inhibiting or controlling B
cells (normal or malignant).
[0316] For example, in one embodiment, human antibodies of the
present invention can be used to treat a subject with a tumorigenic
disorder, e.g., a disorder characterized by the presence of tumor
cells expressing CD20 including, for example, B cell lymphoma,
e.g., NHL. Examples of tumorigenic diseases which can be treated
and/or prevented include B cell lymphoma, e.g., NHL, including
precursor B cell lymphoblastic leukemia/lymphoma and mature B cell
neoplasms, such as B cell chronic lymphocytic leukemia(CLL)/small
lymphocytic lymphoma (SLL), B cell prolymphocytic leukemia,
lymphoplasmacytic lymphoma, mantle cell lymphoma (MCL), follicular
lymphoma (FL), including low-grade, intermediate-grade and
high-grade FL, cutaneous follicle center lymphoma, marginal zone B
cell lymphoma (MALT type, nodal and splenic type), hairy cell
leukemia, diffuse large B cell lymphoma, Burkitt's lymphoma,
plasmacytoma, plasma cell myeloma, post-transplant
lymphoproliferative disorder, Waldenstrom's macroglobulinemia, and
anaplastic large-cell lymphoma (ALCL).
[0317] Further examples of B cell non-Hodgkin's lymphomas are
lymphomatoid granulomatosis, primary effusion lymphoma,
intravascular large B cell lymphoma, mediastinal large B cell
lymphoma, heavy chain diseases (including .gamma., .mu., and
.alpha. disease), lymphomas induced by therapy with
immunosuppressive agents, such as cyclosporine-induced lymphoma,
and methotrexate-induced lymphoma.
[0318] In a further embodiment, the human antibodies of the present
invention can be used to treat Hodgkin's lymphoma.
[0319] Examples of immune disorders in which CD20 expressing B
cells are involved which can be treated and/or prevented include
autoimmune disorders, such as psoriasis, psoriatic arthritis,
dermatitis, systemic scleroderma and sclerosis, inflammatory bowel
disease (IBD), Crohn's disease, ulcerative colitis, respiratory
distress syndrome, meningitis, encephalitis, uveitis,
glomerulonephritis, eczema, asthma, atherosclerosis, leukocyte
adhesion deficiency, multiple sclerosis, Raynaud's syndrome,
Sjogren's syndrome, juvenile onset diabetes, Reiter's disease,
Behcet's disease, immune complex nephritis, IgA nephropathy, IgM
polyneuropathies, immune-mediated thrombocytopenias, such as acute
idiopathic thrombocytopenic purpura and chronic idiopathic
thrombocytopenic purpura, hemolytic anemia, myasthenia gravis,
lupus nephritis, systemic lupus erythematosus, rheumatoid arthritis
(RA), atopic dermatitis, pemphigus, Graves' disease, Hashimoto's
thyroiditis, Wegener's granulomatosis, Omenn's syndrome, chronic
renal failure, acute infectious mononucleosis, HIV, and herpes
virus associated diseases. Further examples are severe acute
respiratory distress syndrome and choreoretinitis. Furthermore,
other diseases and disorders include those caused by or mediated by
infection of B-cells with virus, such as Epstein-Barr virus
(EBV).
[0320] Further examples of inflammatory, immune and/or autoimmune
disorders in which autoantibodies and/or excessive B lymphocyte
activity are prominent and which can be treated and/or prevented,
include the following:
[0321] vasculitides and other vessel disorders, such as microscopic
polyangiitis, Churg-Strauss syndrome, and other ANCA-associated
vasculitides, polyarteritis nodosa, essential cryoglobulinaemic
vasculitis, cutaneous leukocytoclastic angiitis, Kawasaki disease,
Takayasu arteritis, giant cell arthritis, Henoch-Schonlein purpura,
primary or isolated cerebral angiitis, erythema nodosum,
thrombangiitis obliterans, thrombotic thrombocytopenic purpura
(including hemolytic uremic syndrome), and secondary vasculitides,
including cutaneous leukocytoclastic vasculitis (e.g., secondary to
hepatitis B, hepatitis C, Waldenstrom's macroglobulinemia, B-cell
neoplasias, rheumatoid arthritis, Sjogren's syndrome, or systemic
lupus erythematosus); further examples are erythema nodosum,
allergic vasculitis, panniculitis, Weber-Christian disease, purpura
hyperglobulinaemica, and Buerger's disease;
[0322] skin disorders, such as contact dermatitis, linear IgA
dermatosis, vitiligo, pyoderma gangrenosum, epidermolysis bullosa
acquisita, pemphigus vulgaris (including cicatricial pemphigoid and
bullous pemphigoid), alopecia greata (including alopecia
universalis and alopecia totalis), dermatitis herpetiformis,
erythema multiforme, and chronic autoimmune urticaria (including
angioneurotic edema and urticarial vasculitis);
[0323] immune-mediated cytopenias, such as autoimmune neutropenia,
and pure red cell aplasia;
[0324] connective tissue disorders, such as CNS lupus, discoid
lupus erythematosus, CREST syndrome, mixed connective tissue
disease, polymyositis/dermatomyositis, inclusion body myositis,
secondary amyloidosis, cryoglobulinemia type I and type II,
fibromyalgia, phospholipid antibody syndrome, secondary hemophilia,
relapsing polychondritis, sarcoidosis, stiff man syndrome, and
rheumatic fever; a further example is eosinophil fasciitis;
[0325] arthritides, such as ankylosing spondylitis, juvenile
chronic arthritis, adult Still's disease, and SAPHO syndrome;
further examples are sacroileitis, reactive arthritis, Still's
disease, and gout;
[0326] hematologic disorders, such as aplastic anemia, primary
hemolytic anemia (including cold agglutinin syndrome), hemolytic
anemia secondary to CLL or systemic lupus erythematosus; POEMS
syndrome, pernicious anemia, and Waldemstrom's purpura
hyperglobulinaemica; further examples are agranulocytosis,
autoimmune neutropenia, Franklin's disease, Seligmann's disease,
.mu.-chain disease, paraneoplastic syndrome secondary to thymoma
and lymphomas, and factor VIII inhibitor formation;
[0327] endocrinopathies, such as polyendocrinopathy, and Addison's
disease; further examples are autoimmune hypoglycemia, autoimmune
hypothyroidism, autoimmune insulin syndrome, de Quervain's
thyroiditis, and insulin receptor antibody-mediated insulin
resistance;
[0328] hepato-gastrointestinal disorders, such as celiac disease,
Whipple's disease, primary biliary cirrhosis, chronic active
hepatitis, and primary sclerosing cholangiitis; a further example
is autoimmune gastritis;
[0329] nephropathies, such as rapid progressive glomerulonephritis,
post-streptococcal nephritis, Goodpasture's syndrome, membranous
glomerulonephritis, and cryoglobulinemic nephritis; a further
example is minimal change disease;
[0330] neurological disorders, such as autoimmune neuropathies,
mononeuritis multiplex, Lambert-Eaton's myasthenic syndrome,
Sydenham's chorea, tabes dorsalis, and Guillain-Barre's syndrome;
further examples are myelopathy/tropical spastic paraparesis,
myasthenia gravis, acute inflammatory demyelinating polyneuropathy,
and chronic inflammatory demyelinating polyneuropathy;
[0331] cardiac and pulmonary disorders, such as fibrosing
alveolitis, bronchiolitis obliterans, allergic aspergillosis,
cystic fibrosis, Loffler's syndrome, myocarditis, and pericarditis;
further examples are hypersensitivity pneumonitis, and
paraneoplastic syndrome secondary to lung cancer;
[0332] allergic disorders, such as bronchial asthma and hyper-IgE
syndrome; a further example is amaurosis fugax;
[0333] ophthalmologic disorders, such as idiopathic
chorioretinitis;
[0334] infectious diseases, such as parvovirus B infection
(including hands-and-socks syndrome); and
[0335] gynecological-obstretical disorders, such as recurrent
abortion, recurrent fetal loss, and intrauterine growth
retardation; a further example is paraneoplastic syndrome secondary
to gynecological neoplasms;
[0336] male reproductive disorders, such as paraneoplastic syndrome
secondary to testicular neoplasms; and
[0337] transplantation-derived disorders, such as allograft and
xenograft rejection, and graft-versus-host disease.
[0338] In one embodiment, the disease is an inflammatory, immune
and/or autoimmune disorder selected from ulcerative colitis,
Crohn's disease, juvenile onset diabetes, multiple sclerosis,
immune-mediated thrombocytopenias, such as acute idiopathic
thrombocytopenic purpura and chronic idiopathic thrombocytopenic
purpura, hemolytic anemia (including autoimmune hemolytic anemia),
myasthenia gravis, systemic sclerosis, and pemphigus vulgaris.
[0339] In another embodiment, human antibodies of the invention can
be used to detect levels of CD20, or levels of cells which contain
CD20 on their membrane surface, which levels can then be linked to
certain disease symptoms. Alternatively, the antibodies can be used
to deplete or interact with the function of CD20 expressing cells,
thereby implicating these cells as important mediators of the
disease. This can be achieved by contacting a sample and a control
sample with the anti-CD20 antibody under conditions that allow for
the formation of a complex between the antibody and CD20. Any
complexes formed between the antibody and CD20 are detected and
compared in the sample and the control.
[0340] Human antibodies of the invention can be initially tested
for binding activity associated with therapeutic or diagnostic use
in vitro. For example, the antibodies can be tested using flow
cytometric assays described in the Examples below. Moreover,
activity of the antibodies in triggering at least one
effector-mediated effector cell activity, including inhibiting the
growth of and/or killing of cells expressing CD20, can be assayed.
For example, the ability of the antibodies to trigger CDC and/or
apoptosis can be assayed. Protocols for assaying for CDC, homotypic
adhesion, molecular clustering or apoptosis are described in the
Examples below.
[0341] Human antibodies of the invention also have additional
utility in therapy and diagnosis of a variety of CD20-related
diseases. For example, the human antibodies can be used to elicit
in vivo or in vitro one or more of the following biological
activities: to inhibit the growth of and/or differentiation of a
cell expressing CD20; to kill a cell expressing CD20; to mediate
phagocytosis or ADCC of a cell expressing CD20 in the presence of
human effector cells; to mediate CDC of a cell expressing CD20 in
the presence of complement; to mediate apoptosis of a cell
expressing CD20; to induce homotypic adhesion; and/or to induce
translocation into lipid rafts upon binding CD20.
[0342] In a particular embodiment, the human antibodies are used in
vivo to treat, prevent or diagnose a variety of CD20-related
diseases. Examples of CD20-related diseases include, among others,
B cell lymphoma, e.g., NHL, and immune diseases, e.g., autoimmune
diseases, such as those listed above.
[0343] In a particular embodiment, the antibodies of the invention
are used to treat or to prevent NHL, as the antibodies deplete the
CD20 bearing tumor cells).
[0344] Non-Hodgkin's lymphoma is a type of B cell lymphoma.
Lymphomas, e.g., B cell lymphomas, are a group of related cancers
that arise when a lymphocyte (a blood cell) becomes malignant. The
normal function of lymphocytes is to defend the body against
invaders: germs, viruses, fungi, even cancer. There are many
subtypes and maturation stages of lymphocytes and, therefore, there
are many kinds of lymphomas. Like normal cells, malignant
lymphocytes can move to many parts of the body. Typically, lymphoma
cells form tumors in the lymphatic system: bone marrow, lymph
nodes, spleen, and blood. However, these cells can migrate to other
organs. Certain types of lymphoma will tend to grow in locations in
which the normal version of the cell resides. For example, it's
common for follicular NHL tumors to develop in the lymph nodes.
[0345] CD20 is usually expressed at elevated levels on neoplastic
(i.e., tumorigenic) B cells associated with NHL. Accordingly, CD20
binding antibodies of the invention can be used to deplete CD20
bearing tumor cells which lead to NHL and, thus, can be used to
prevent or treat this disease.
[0346] Human antibodies (e.g., human monoclonal antibodies,
multispecific and bispecific molecules) of the present invention
also can be used to block or inhibit other effects of CD20. For
example, it is known that CD20 is expressed on B lymphocytes and is
involved in the proliferation and/or differentiation of these
cells. Since B lymphocytes function as immunomodulators, CD20 is an
important target for antibody mediated therapy to target B
lymphocytes, e.g., to inactivate or kill B lymphocytes, involved in
autoimmune disorders. Such autoimmune disorders include, for
example, the above listed diseases
[0347] Suitable routes of administering the antibody compositions
(e.g., human monoclonal antibodies, multispecific and bispecific
molecules and immunoconjugates) of the invention in vivo and in
vitro are well known in the art and can be selected by those of
ordinary skill. For example, the antibody compositions can be
administered by injection (e.g., intravenous or subcutaneous).
Suitable dosages of the molecules used will depend on the age and
weight of the subject and the concentration and/or formulation of
the antibody composition. Furthermore, tumor load can be determined
and used to calculate suitable dosages.
[0348] As previously described, human anti-CD20 antibodies of the
invention can be co-administered with one or other more therapeutic
agents, e.g., a cytotoxic agent, a radiotoxic agent or an
immunosuppressive agent. The antibody can be linked to the agent
(as an immunocomplex) or can be administered separate from the
agent. In the latter case (separate administration), the antibody
can be administered before, after or concurrently with the agent or
can be co-administered with other known therapies, e.g., an
anti-cancer therapy, e.g., radiation. Such therapeutic agents
include, among others, anti-neoplastic agents such as doxorubicin,
cisplatin, bleomycin, carmustine, chlorambucil, and
cyclophosphamide. Co-administration of the human anti-CD20
antibodies of the present invention with chemotherapeutic agents
provides two anti-cancer agents which operate via different
mechanisms which yield a cytotoxic effect to human tumor cells.
Such co-administration can solve problems due to development of
resistance to drugs or a change in the antigenicity of the tumor
cells which would render them unreactive with the antibody.
[0349] Target-specific effector cells, e.g., effector cells linked
to compositions (e.g., human antibodies, multispecific and
bispecific molecules) of the invention can also be used as
therapeutic agents. Effector cells for targeting can be human
leukocytes such as macrophages, neutrophils or monocytes. Other
cells include eosinophils, natural killer cells and other IgG- or
IgA-receptor bearing cells. If desired, effector cells can be
obtained from the subject to be treated. The target-specific
effector cells, can be administered as a suspension of cells in a
physiologically acceptable solution. The number of cells
administered can be in the order of 10.sup.8 to 10.sup.9 but will
vary depending on the therapeutic purpose. In general, the amount
will be sufficient to obtain localization at the target cell, e.g.,
a tumor cell expressing CD20, and to effect cell killing by, e.g.,
phagocytosis. Routes of administration can also vary.
[0350] Therapy with target-specific effector cells can be performed
in conjunction with other techniques for removal of targeted cells.
For example, anti-tumor therapy using the compositions (e.g., human
antibodies, multispecific and bispecific molecules) of the
invention and/or effector cells armed with these compositions can
be used in conjunction with chemotherapy. Additionally, combination
immunotherapy may be used to direct two distinct cytotoxic effector
populations toward tumor cell rejection. For example, anti-CD20
antibodies linked to anti-Fc-.gamma.RI or anti-CD3 may be used in
conjunction with IgG- or IgA-receptor specific binding agents.
[0351] Bispecific and multispecific molecules of the invention can
also be used to modulate Fc.gamma.R or Fc.alpha.R levels on
effector cells, such as by capping and elimination of receptors on
the cell surface. Mixtures of anti-Fc receptors can also be used
for this purpose.
[0352] The compositions (e.g., human antibodies, multispecific and
bispecific molecules and immunoconjugates) of the invention which
have complement binding sites, such as portions from IgG1, -2, or
-3 or IgM which bind complement, can also be used in the presence
of complement. In one embodiment, ex vivo treatment of a population
of cells comprising target cells with a binding agent of the
invention and appropriate effector cells can be supplemented by the
addition of complement or serum containing complement. Phagocytosis
of target cells coated with a binding agent of the invention can be
improved by binding of complement proteins. In another embodiment
target cells coated with the compositions (e.g., human antibodies,
multispecific and bispecific molecules) of the invention can also
be lysed by complement. In yet another embodiment, the compositions
of the invention do not activate complement.
[0353] The compositions (e.g., human antibodies, multispecific and
bispecific molecules and immunoconjugates) of the invention can
also be administered together with complement. Accordingly, within
the scope of the invention are compositions comprising human
antibodies, multispecific or bispecific molecules and serum or
complement. These compositions are advantageous in that the
complement is located in close proximity to the human antibodies,
multispecific or bispecific molecules. Alternatively, the human
antibodies, multispecific or bispecific molecules of the invention
and the complement or serum can be administered separately. Binding
of the compositions of the present invention to target cells causes
translocation of the CD20 antigen-antibody complex into lipid rafts
of the cell membrane. Such translocation creates a high density of
antigen-antibody complexes which may efficiently activate and/or
enhance CDC.
[0354] Also within the scope of the present invention are kits
comprising the antibody compositions of the invention (e.g., human
antibodies and immunoconjugates) and instructions for use. The kit
can further contain one or more additional reagents, such as an
immunosuppressive reagent, a cytotoxic agent or a radiotoxic agent,
or one or more additional human antibodies of the invention (e.g.,
a human antibody having a complementary activity).
[0355] Accordingly, patients treated with antibody compositions of
the invention can be additionally administered (prior to,
simultaneously with, or following administration of a human
antibody of the invention) with another therapeutic agent, such as
a cytotoxic or radiotoxic agent, which enhances or augments the
therapeutic effect of the human antibodies.
[0356] In other embodiments, the subject can be additionally
treated with an agent that modulates, e.g., enhances or inhibits,
the expression or activity of Fc.gamma. or Fc.alpha. receptors by,
for example, treating the subject with a cytokine. Preferred
cytokines for administration during treatment with the
multispecific molecule include of granulocyte colony-stimulating
factor (G-CSF), granulocyte-macrophage colony-stimulating factor
(GM-CSF), interferon-.gamma. (IFN-.gamma.), and tumor necrosis
factor (TNF).
[0357] The compositions (e.g., human antibodies, multispecific and
bispecific molecules) of the invention can also be used to target
cells expressing Fc.gamma.R or CD20, for example for labeling such
cells. For such use, the binding agent can be linked to a molecule
that can be detected. Thus, the invention provides methods for
localizing ex vivo or in vitro cells expressing Fc receptors, such
as Fc.gamma.R, or CD20. The detectable label can be, e.g., a
radioisotope, a fluorescent compound, an enzyme, or an enzyme
co-factor.
[0358] In a particular embodiment, the invention provides methods
for detecting the presence of CD20 antigen in a sample, or
measuring the amount of CD20 antigen, comprising contacting the
sample, and a control sample, with a human monoclonal antibody
which specifically binds to CD20, under conditions that allow for
formation of a complex between the antibody or portion thereof and
CD20. The formation of a complex is then detected, wherein a
difference complex formation between the sample compared to the
control sample is indicative the presence of CD20 antigen in the
sample. In other embodiments, the invention provides methods for
treating a disorder involving cells expressing CD20 in a subject,
e.g., non-Hodgkin's lymphoma or rheumatoid arthritis, by
administering to the subject the human antibodies described above.
Such antibodies and derivatives thereof are used to inhibit CD20
induced activities associated with certain disorders, e.g.,
proliferation and/or differentiation. By contacting the antibody
with CD20 (e.g., by administering the antibody to a subject), the
ability of CD20 to induce such activities is inhibited and, thus,
the associated disorder is treated.
[0359] Accordingly, in another embodiment, the present invention
provides a method for treating or preventing a tumorigenic disorder
involving CD20 expressing cells, e.g., NHL. The method involves
administering to a subject an antibody composition of the present
invention in an amount effective to treat or prevent the disorder.
The antibody composition can be administered alone or along with
another therapeutic agent, such as a cytotoxic or a radiotoxic
agent which acts in conjunction with or synergistically with the
antibody composition to treat or prevent the diseases involving
CD20 expressing cells. In a particularly preferred embodiment, the
present invention provides a method for treating non-Hodgkin's
lymphoma.
[0360] In another embodiment, the present invention provides a
method for treating or preventing an autoimmune disorder involving
human CD20 expressing cells, e.g., those diseases as listed above.
The method involves administering to a subject an antibody
composition of the present invention in an amount effective to
treat or prevent the disorder. The antibody composition can be
administered alone or along with another therapeutic agent, such as
an immunosuppressant which acts in conjunction with or
synergistically with the antibody composition to treat or prevent
the disease involving cells expressing CD20.
[0361] In still another embodiment, the invention provides a method
for detecting the presence or quantifying the amount of
CD20-expressing cells in vivo or in vitro. The method comprises (i)
administering to a subject a composition (e.g., a multi- or
bispecific molecule) of the invention conjugated to a detectable
marker; (ii) exposing the subject to a means for detecting said
detectable marker to identify areas containing CD20-expressing
cells. In yet another embodiment, immunoconjugates of the invention
can be used to target compounds (e.g., therapeutic agents, labels,
cytotoxins, radiotoxins immunosuppressants, etc.) to cells which
have CD20 expressed on their surface by linking such compounds to
the antibody. Thus, the invention also provides methods for
localizing ex vivo or in vitro cells expressing CD20, such as
Reed-Sternberg cells (e.g., with a detectable label, such as a
radioisotope, a fluorescent compound, an enzyme, or an enzyme
co-factor). Alternatively, the immunoconjugates can be used to kill
cells which have CD20 expressed on their surface by targeting
cytotoxins or radiotoxins to CD20.
[0362] The present invention is further illustrated by the
following examples which should not be construed as further
limiting.
EXAMPLES
B-Cell Lines Used in the Examples
TABLE-US-00001 [0363] Cell line Origin Obtained from Daudi Negroid
Burkitt's Lymphoma ECACC (85011437) ARH-77 IgG plasma cell leukemia
DSMZ (ACC 512) DOHH Refractory immunoblastic B DSMZ (ACC 47) cell
lymphoma Raji Negroid Burkitt's Lymphoma ECACC (85011429) SU-DHL-4
B-NHL, diffuse histiocytic lymphoma DSMZ (ACC 495) Ramos-EHRB
Burkitt's Lymphoma ECACC (85030804) Tanoue Human B-cell leukemia
DSMZ (ACC 399)
[0364] Daudi, ARH-77, DOHH, Raji, Ramos-EHRB, and Tanoue B-cell
lines were cultured in RPMI 1640 culture medium supplemented with
10% fetal calf serum (FCS) (Optimum C241, Wisent Inc., st. Bruno,
Canada), 2 mM L-glutamine, 100 IU/ml penicillin, 100 .mu.g/ml
streptomycin, and 1 mM sodium pyruvate (all Gibco BRL, Life
Technologies, Paisley, Scotland).
[0365] SU-DHL-4 B-cell line was cultured in the same medium but
without sodium pyruvate.
[0366] Cultures were maintained at 37.degree. C. in a humidified 5%
CO.sub.2 incubator, split and harvested at 80-90% confluence.
Medium was refreshed twice a week. At this time cells were split
and seeded out to 1-1.5.times.10.sup.6 cells/ml to ensure viability
and optimal growth.
Example 1
Production of Human Antibodies Against CD20
[0367] HCo7 and KM Mice:
[0368] Fully human monoclonal antibodies to CD20 were prepared
using HCo7 and KM mice which express human antibody genes. In the
KM mouse strain, the endogenous mouse kappa light chain gene has
been homozygously disrupted as described in Chen et al. (1993) EMBO
J. 12:811-820 and the endogenous mouse heavy chain gene has been
homozygously disrupted as described in Example 1 of PCT Publication
WO 01/09187. This mouse strain carries a human kappa light chain
transgene, KCo5, as described in Fishwild et al. (1996) Nature
Biotechnology 14:845-851. This mouse strain also carries a human
heavy chain transchromosome composed of chromosome 14 fragment hCF
(SC20) as described in WO 02/43478.
[0369] The HCo7 mice have a JKD disruption in their endogenous
light chain (kappa) genes (as described in Chen et al. (1993) EMBO
J. 12: 821-830), a CMD disruption in their endogenous heavy chain
genes (as described in Example 1 of WO 01/14424), a KCo5 human
kappa light chain transgene (as described in Fishwild et al. (1996)
Nature Biotechnology 14:845-851), and a HCo7 human heavy chain
transgene (as described in U.S. Pat. No. 5,770,429).
[0370] HCo7 and KM Mice Immunizations:
[0371] HCo7 and KM mice were immunized with human CD20 transfected
NS/0 cells. For the first immunization, per mouse, 1.times.10.sup.7
cells in 150 .mu.l PBS were mixed 1:1 with Complete Freunds
Adjuvant and injected intraperitoneally (i.p.). Subsequent i.p.
immunizations were done using a similar amount of cells without
adjuvant. Three and two days prior to fusion the mice were
intravenously boosted with 0.5.times.10.sup.7 cells suspended in
PBS.
[0372] The presence of antibodies directed against human CD20 in
the serum of the mice was monitored by flow cytometry using FACS
analysis, using human CD20 transfected NS/0 cells as well as CD20
negative parental NS/0 cells.
[0373] Generation of Hybridomas Producing Human Monoclonal
Antibodies to CD20:
[0374] The mouse splenocytes were isolated from the HCo7 and KM
mice and fused with PEG to a mouse myeloma cell line based upon
standard protocols. The resulting hybridomas were then screened for
human IgG,.kappa. production by ELISA and for CD20 specificity
using human CD20 transfected NS/O and SKBR3 cells by FACS analysis.
Single cell suspensions of splenic lymphocytes from immunized mice
were fused to one-fourth the number of SP2/0 nonsecreting mouse
myeloma cells (ATCC, CRL 1581) with 50% PEG (Sigma). Cells were
plated at approximately 1.times.10.sup.5/well in flat bottom
microtiter plate, followed by about two week incubation in
selective medium containing 10% fetal bovine serum, 10% P388D1
(ATCC, CRL TIB-63) conditioned medium, 3-5% origen (IGEN) in DMEM
(Mediatech, CRL 10013, with high glucose, L-glutamine and sodium
pyruvate) plus 5 mM HEPES, 0.055 mM 2-mercaptoethanol, 50 mg/ml
gentamycin and 1.times.HAT (Sigma, CRL P-7185). After 1-2 weeks,
cells were cultured in medium in which the HAT was replaced with
HT. Individual wells were then screened by flow cytometry for human
anti-CD20 monoclonal IgG antibodies. Once extensive hybridoma
growth occurred, medium was monitored usually after 10-14 days. The
antibody secreting hybridomas were replated, screened again and, if
still positive for human IgG, anti-CD20 monoclonal antibodies were
subcloned by limiting dilution. The stable subclones were then
cultured in vitro to generate small amounts of antibody in tissue
culture medium for characterization. One clone from each hybridoma,
which retained the reactivity of parent cells (by FACS), was
chosen. 5-10 vial cell banks were generated for each clone and
stored in liquid nitrogen.
[0375] Selection of Human Monoclonal Antibodies Binding to
CD20/Primary Screens:
[0376] To determine the isotype of antibodies, an isotype ELISA was
performed. Wells of microtiter plates were coated with 1 .mu.g/ml
of mouse anti-human kappa light chain, 50 .mu.l/well in PBS
incubated 4.degree. C. overnight. After blocking with 5% chicken
serum, the plates were reacted with supernatant and purified
isotype control. Plates were then incubated at ambient temperature
for 1-2 hours. The wells were then reacted with either human IgG1,
IgG2, IgG3 or IgG4-specific Horseradish peroxidase-conjugated
probes. Plates were developed and analyzed as described above.
[0377] Four hybridoma cell lines were generated, three from fusion
of KM mouse and one from fusion of HCo7 mouse, expressing the
following antibodies:
[0378] 2F2: a human monoclonal IgG1,.kappa. antibody with the
nucleotide sequences: SEQ ID NOs: 1 and 3 and the amino acid
sequences: SEQ ID NOs: 2 and 4.
[0379] 4C9: a human monoclonal IgG1,.kappa. antibody with exactly
the same amino acid sequences as 2F2: SEQ ID NOs: 2 and 4.
[0380] 7D8: a human monoclonal IgG1,.kappa. antibody with the
nucleotide sequences: SEQ ID NOs: 5 and 7 and the amino acid
sequences: SEQ ID NOs: 6 and 8.
[0381] 11B8: a human monoclonal IgG3,.kappa. antibody with the
nucleotide sequences: SEQ ID NOs: 9 and 11 and the amino acid
sequences: SEQ ID NOs: 10 and 12.
[0382] The term "2F2" is used herein to designate both the antibody
derived from hybridoma clone 2F2 and the identical antibody derived
from hybridoma clone 4C9.
[0383] The antibodies of the invention can be switched to other
isotypes as determined by the transgenic or transchromosomal
non-human animal from which they are derived. In one embodiment of
the invention, the 11B8 human monoclonal IgG3,.kappa. antibody can
be switched to a human monoclonal IgG1,.kappa.isotype having
exactly the same V.sub.H and V.sub.L sequences. In another
embodiment, the 2F2 IgG 1,.kappa. antibody or 7D8 IgG1,.kappa.
antibody can be switched to a human monoclonal IgG2, IgG4, IgA1,
IgA2 or IgE isotype having exactly the same V.sub.H and V.sub.L
sequences.
Example 2
Antibody Sequencing of Human Antibodies Against CD20
Sequencing of the V.sub.L and V.sub.H Regions
[0384] RNA Preparation:
[0385] Total RNA was prepared from 5.times.10.sup.6 cells of all
HuMAb CD20 hybridoma cell lines (2F2, 7D8 and 11B8) with RNeasy kit
(Qiagen, Westburg, Leusden, Netherlands) according to the
manufacturer's protocol.
[0386] cDNA Preparation of 2F2 and 7D8:
[0387] 5'-RACE-Ready Complementary DNA (cDNA) of RNA was prepared
from 1 .mu.g total RNA, using the SMART RACE cDNA Amplification kit
(Clonetech), following the manufacturer's protocol.
V.sub.H and V.sub.L regions were amplified using an advantage HF 2
PCR Kit (Clonetech, BD) and using the following primers:
TABLE-US-00002 V.sub.K RACE2 5' GCA GGC ACA CAA CAG AGG CAG TTC CAG
ATT TC anneals in C-kappa V.sub.H RACE2 5' GCT GTG CCC CCA GAG GTG
CTC TTG GAG G anneals in C.sub.Hl
[0388] cDNA Preparation of 11B8:
[0389] Complementary DNA (cDNA) of RNA from 11B8 cells was prepared
from 3 .mu.g total RNA with AMV Reverse Transcriptase with buffer
(Roche Diagnostics GmbH, Mannheim, Germany), oligo d(T).sub.15
(Promega, Madison, Wis., USA), dNTP (Roche Diagnostics GmbH,
Mannheim, Germany) and RNAsin (Promega) according to the
manufacturer's protocol (2000, version 3).
[0390] PCR Primers Used to Amplify V.sub.H and V.sub.L Regions for
Cloning:
Primer Pairs Used:
TABLE-US-00003 [0391] V.sub.H: FR1 5' primers AB62 CAg gTK CAg CTg
gTg CAg TC AB63 SAg gTg CAg CTg KTg gAg TC AB65 gAg gTg CAg CTg gTg
CAg TC V.sub.H leader 5' primers AB85 ATg gAC Tgg ACC Tgg AgC ATC
AB86 ATg gAA TTg ggg CTg AgC Tg AB87 ATg gAg TTT ggR CTg AgC Tg
AB88 ATg AAA CAC CTg Tgg TTC TTC AB89 ATg ggg TCA ACC gCC ATC CT
V.sub.H 3' primer AB90 TgC CAg ggg gAA gAC CgA Tgg V.sub.K: FR1 5'
primers AB8 RAC ATC CAg ATg AYC CAg TC AB9 gYC ATC YRg ATg ACC CAg
TC AB10 gAT ATT gTg ATg ACC CAg AC AB11 gAA ATT gTg TTg ACR CAg TC
AB12 gAA ATW gTR ATg ACA CAg TC AB13 gAT gTT gTg ATg ACA CAG TC
AB14 gAA ATT gTg CTg ACT CAg TC V.sub.K leader 5' primers AB123 CCC
gCT Cag CTC CTg ggg CTC CTg AB124 CCC TgC TCA gCT CCT ggg gCT gC
AB125 CCC AgC gCA gCT TCT CTT CCT CCT gC AB126 ATg gAA CCA Tgg AAg
CCC CAg CAC AgC V.sub.K 3' primer AB16 Cgg gAA gAT gAA gAC AgA Tg
wherein K = T or G, S = C or G, R = A or G, Y = C or T, and W = A
or T.
[0392] PCR Conditions Used to Amplify V.sub.H and V.sub.L Regions
for Cloning 2F2 and 7D8:
[0393] Polymerase chain reactions (PCR) were performed with HF
polymerase mix (Clonetech.) on a T1 cycler (Biometra,
Westburg).
PCR Conditions:
TABLE-US-00004 [0394] 94.degree. C. 30 sec 5 cycles 72.degree. C. 1
min 94.degree. C. 30 sec 5 cycles 70.degree. C. 30 sec 72.degree.
C. 1 min 94.degree. C. 30 sec 27-30 cycles 68.degree. C. 30 sec
72.degree. C. 1 min
[0395] PCR Conditions Used to Amplify V.sub.H and V.sub.L Regions
for Cloning 11B8:
[0396] Polymerase chain reactions (PCR) were performed with
AmpliTaq polymerase (Perkin Elmer) on a T1 Cycler (Biometra,
Westburg, Leusden, Netherlands).
PCR cycling protocol:
TABLE-US-00005 94.degree. C. 2 min 11 cycles 94.degree. C. 30 sec
65.degree. C. 30 sec, minus 1.degree. C. per cycle 72.degree. C. 30
sec 30 cycles 94.degree. C. 30 sec 55.degree. C. 30 sec 72.degree.
C. 30 sec 72.degree. C. 10 min cool down to 4.degree. C.
[0397] Cloning of V.sub.H and V.sub.L in pGEMT-Vector System II
(2F2, 7D8, and 11B8):
[0398] After analysing the PCR products on an agarose gel, the
products were purified with the QIAEX II Gel Extraction Kit
(Qiagen, Westburg, Leusden, Netherlands). Two independently
amplified PCR products of each V.sub.H and V.sub.L region were
cloned in pGEMT-Vector System II (Promega) according to
manufacturer's protocol (1999, version 6).
[0399] After transformation to E. coli JM109, individual colonies
were screened by colony PCR using T7 and SP6 primers, 30 annealing
cycles at 55.degree. C. Plasmid DNA from colonies was purified
using Qiaprep Spin miniprep kit (Qiagen). To further analyse the
V.sub.H and V.sub.L regions, a Nco1/Not1 (NE Biolabs, Westburg,
Leusden, Netherlands) digestion was performed and analysed on
agarose gel.
[0400] Sequencing (2F2, 7D8 and 11B8):
[0401] The V-regions regions were sequenced after cloning in the
pGEMT-Vector System II. Sequencing was performed at Baseclear
(Leiden, Netherlands). The sequences were analyzed by aligning
germline V-gene sequences in Vbase
(www.mrc-cpe.cam.ac.uk/imt-doc/public/intro.htm).http://www.mrc-cpe.cam.a-
c.uk/vbase-ok.php?menu=901.
[0402] The sequences obtained are shown in FIGS. 53-58.
Example 3
Recombinant Production of 2F2 and 11B8 in GS-NS/0 Cell Line
[0403] 2F2T:
[0404] The heavy chain and light chain variable regions of the 2F2
antibody were amplified, using PCR, from a standard cloning vector,
pGem-5Zf (Promega), using primers which included an optimal Kozak
sequence and suitable restriction sites to clone the fragments in
the GS constant region vectors pCON.gamma.1f and PCON.kappa.
(Lonza).
[0405] After amplification, the fragments were purified and
digested with the restriction enzymes for cloning and ligated in
the two vectors. The heavy chain variable fragment was digested
with Hind III and Bsi WI and ligated into the pCON.gamma.1f vector
which had been digested with Hind III and Bsi WI, and
dephosphorylated with alkaline phosphatase. The light chain
variable fragment was digested with Hind III and Apa I and ligated
into the PCON.kappa. vector which had been digested with Hind III
and Apa I, and dephosphorylated with alkaline phosphatase. The
pCON.gamma.1f/variable-heavy and PCON.kappa./variable-light vectors
are shown in FIGS. 1 and 2, respectively. Transformed E. coli
colonies were checked by colony PCR and 2 positive colonies of each
the heavy chain (HC) and light chain (LC) construct were grown for
plasmid isolation. Isolated plasmid of these 4 clones was sequenced
to confirm the sequence. Both of the HC clones and one of the LC
clones were found to have the correct sequences.
[0406] The two HC and one LC constructs were combined to give two
combinations of LC-HC and transiently co-transfected in CHO-K1
cells to check the constructs for proper production of 2F2
antibody. Normal production levels were reached for all
combinations in this expression experiment and 1 clone of each of
the HC and LC constructs were chosen for construction of a
double-gene vector.
[0407] Standard cloning procedures were used to combine the HC and
LC constructs in a double-gene cloning vector, designated
pCON.gamma.1f/.kappa.2F2, by ligating the complete expression
cassette from the heavy chain vector, pCON.gamma.1f/variable-heavy,
into the light chain vector, pCON.kappa./variable-light. The
pCON.gamma.1f/.kappa.2F2 vector is shown in FIG. 3.
[0408] This construct was again functionally tested in a transient
transfection in CHO-K1 cells and showed normal expression
levels.
[0409] The variable regions of the pCON.gamma.1f/.kappa.2F2 plasmid
were sequenced to reconfirm the correct sequences.
[0410] Linear plasmid was prepared for stable transfections by
digesting pCON.gamma.1f/.kappa.2F2 with a unique restriction
enzyme, Pvu I, cutting outside regions vital for expression.
Complete linearization was confirmed by agarose gel electrophoresis
and the DNA was purified and stored at -20.degree. C. until
use.
[0411] Six transfections of NS/0 host cells were performed, by
electroporation with plasmid DNA, using the above linear DNA
plasmid. Following transfection, the cells were distributed into
96-wells plates and incubated. Selective medium (containing 10%
dialysed fetal calf serum (dFCS) and 10 .mu.M of the GS-inhibitor
L-methionine sulphoximine but lacking glutamine) was added and the
plates were monitored to determine when the non-transfected cells
died to leave foci of transfected cells. For further details
concerning GS vector systems, see WO 87/04462. The transfected
plates were incubated for approximately three weeks to allow colony
formation. The resulting colonies were examined microscopically to
verify that the colonies were of a suitable size for assay
(covering greater than 60% of the bottom of the well), and that
only one colony was present in each well. Cell supernatants from
436 transfectants were screened for assembled antibody by
IgG,.kappa.-ELISA. Using this data, 111 transfectants were selected
for progression and further assessment in static culture. Cultures
of the selected cell lines were expanded and adapted to low-serum
containing medium (containing bovine serum albumin (BSA) and added
1% dFCS) and a further assessment of productivity in static culture
was undertaken (ELISA and measurement of percentage confluence).
The 65 highest ranking cell lines were selected for progression. A
preliminary assessment of the productivity of the selected cell
lines was made in batch shake flask suspension culture in low
serum-containing medium (containing BSA and added 1% dFCS). Based
upon harvest antibody concentration (by ELISA) and acceptable
growth characteristics, 30 cell lines were selected for further
evaluation in serum-free medium using a batch shake flask
suspension culture. The 10 cell lines that produced the highest
antibody concentrations were further evaluated in duplicate
fed-batch shake flask suspension cultures in serum-free medium.
Product concentrations at harvest were determined by protein A high
performance liquid chromatography (HPLC), according to well-known
standard methods. All cell lines produced 2F2 antibody (denoted
2F2T) in good yields in the range of from 671-1333 mg/L as
determined by protein A HPLC.
[0412] 11B8T:
[0413] In a similar way a GS-NS/0 cell line was established for
recombinant production of 11B8 (denoted 11B8T) modifying the
transfection procedure slightly as follows.
[0414] Four transfections of NS/0 host cells were performed, by
electroporation with plasmid DNA, using the above linear DNA
plasmid. After examining the resulting colonies microscopically to
verify that the colonies were of a suitable size for assay
(covering greater than 60% of the bottom of the well) and that only
one colony was present in each well, cell supernatants from 596
transfectants were screened for assembled antibody by
IgG,.kappa.-ELISA. Using this data, 100 transfectants were selected
for progression and further assessment in static culture. Cultures
of the selected cell lines were expanded and adapted to low-serum
containing medium (containing bovine serum albumin (BSA) and added
1% dFCS) and a further assessment of productivity in static culture
was undertaken (ELISA and measurement of percentage confluence).
The 60 highest ranking cell lines were selected for progression,
and an additional 13 cell lines for which productivity data was
unavailable were also progressed. A preliminary assessment of the
productivity of the selected cell lines was made in batch shake
flask suspension culture in low serum-containing medium (containing
BSA and added 1% dFCS). Based upon harvest antibody concentration
(by ELISA) and acceptable growth characteristics, 10 cell lines
were selected for further evaluation in duplicate fed-batch shake
flask suspension cultures in low serum-containing medium
(containing BSA and added 1% dFCS). Product concentrations at
harvest were determined by protein A high performance liquid
chromatography (HPLC), according to well-known standard methods.
Based on this one of the cell lines was discarded. The resulting 9
cell lines all produced 11B8 antibody (denoted "11B8T") in good
yields in the range of from 354-771 mg/L as determined by protein A
HPLC.
Example 4
Comparison of Hybridoma-Derived 2F2 and Transfectoma-Derived
Recombinant 2F2T
[0415] By use of gel electrophoresis (SDS-PAGE and native agarose
gel electrophoresis) it was shown that 2F2 and 2F2T are of the same
size, and only slightly differ in electric charge.
[0416] Furthermore, 2F2 and 2F2T bind to CD20-transfected NS/0
cells and Raji cells with similar affinity as measured by flow
cytometry using FACScalibur.TM. (Becton Dickinson, San Diego,
Calif., USA). No binding to non-transfected NS/0 cells was observed
demonstrating the specificity of 2F2 and 2F2T. 2F2 and 2F2T also
induce CDC in a concentration-dependent manner to the same extent
in ARH-77 cells (IgG plasma cell leukemia), Daudi cells, DOHH cells
(refractory immunoblastic B cell lymphoma progressed from
follicular centroblastic/centrolytic lymphoma, DSMZ, Braunschweig,
Germany) and Raji cells, measuring cell lysis (number of
PI-positive cells) by flow cytometry (FACScalibur). In a second
experiment, the concentrations of 2F2 and 2F2T were kept constant
while serum was added in different concentrations. No significant
differences between 2F2 and 2F2T were observed.
[0417] Finally, 2F2 and 2F2T bound to cell-associated CD20 binds
complement factor C1q strongly and to the same extent. The
experiment was performed in Daudi cells, DOHH cells, and Raji cells
using fluorescein-conjugated anti-C1q polyclonal antibodies for
detecting binding of C1q.
Example 5
Binding Characteristics of Human Antibodies Against CD20
[0418] Binding to Different Cell Lines:
[0419] NS/0, NS/0 transfected with human CD20, Daudi and Raji cells
were incubated for 30 min at 4.degree. C. with culture supernatant
containing human antibodies 2F2, 7D8, and 11B8 followed by
incubation with FITC-conjugated anti-human IgG Ab. Binding was
assessed by flow cytometry using a FACScalibur flow cytometer.
Fluorescence intensities were compared with negative control
isotype matched samples. As shown in FIG. 4, all three antibodies
bound to NS/0 cells transfected with human CD20, whereas no binding
was observed to parental, non-transfected NS/0 cells. All three
antibodies also bound to the two different Burkitt lymphoma B cell
lines (Raji and Daudi) indicating that 2F2, 7D8, and 11B8 are CD20
specific. Supernatant containing 7D8 or 11B8 were tested under
non-saturating conditions, therefore, lower mean fluorescence
intensities compared to 2F2 are observed.
[0420] EC.sub.50 Value of 2F2 as Determined by Flow Cytometry:
[0421] In order to determine the apparent affinity of 2F2 for CD20
expressed on human B cells, a binding curve was made of 2F2 using
isolated PBMCs from three human donors and gating of CD3-negative
cells. The isolated PBMCs were incubated for 1 hour with a
concentration range of F1TC labeled 2F2 and analysed on FACS, and
the mean fluorescence intensity (MFI) determined. The MFI values
are shown in FIGS. 5A and 5B as a function of the antibody
concentration. The EC.sub.50 values were calculated by use of Graph
Pad Prism 3.02 by non-linear regression. The EC.sub.50 value of 2F2
in humans was similar for all three donors with a mean (.+-.s.e.m.)
of 287.+-.12.7 ng/ml (1.9.+-.0.1 nM).
[0422] Binding of .sup.125I-Labeled mAbs to CD20 Expressing
Cells:
[0423] mAbs were iodinated using Iodobeads (Pierce Chemical Co.,
Rockford, Ill.). .sup.125I-labelled mAbs were serially diluted and
incubated with Ramos-EHRB (cells for 2 hours at 37.degree. C. in
the presence of sodium azide and 2-deoxyglucose to prevent
endocytosis. The cell bound and free .sup.125I labeled mAbs were
then separated by centrifugation at 14,000.times.g for 2 min
through a mixture of phthalate oils, allowing rapid separation
without disturbing the binding equilibrium. The pelleted cells
together with bound antibody were then counted using a gamma
counter (Wallac UK Ltd, Milton Keynes, UK).
[0424] As shown in FIG. 6, 2F2 and 11B8 exhibit similar K.sub.D (or
similar saturation points) indicating that both antibodies bind
with similar affinity. However, 11B8 saturates at a lower level
than 2F2 indicating that it recognized a different form of CD20.
This is also in agreement with a further experiment showing that a
similar number of 2F2 and rituximab antibody molecules binds to
CD20 on Ramos-EHRB cells and Daudi cells, as shown by the similar
levels of binding saturation (approximately 2-3.times.10.sup.5
antibody molecules per cell). 11B8 and B1, in contrast, saturate at
half this level and only about 1-2.times.10.sup.5 antibody
molecules bind to the Ramos-EHRB cells (FIG. 7A) and Daudi cells
(FIG. 7B).
[0425] To exclude the possibility that the iodinated antibodies
bind via Fc-receptors, binding curves were confirmed by use of
anti-CD20 F(ab').sub.2 fragments. Again, similar numbers of 2F2 and
rituximab-F(ab').sub.2 fragments bound to both Ramos-EHRB and Daudi
cells. Also in these experiments, the number of 2F2 or rituximab
antibody molecules bound to Ramos-EHRB cells and Daudi cells
saturates at approximately twice the number of 11B8 and B1
molecules bound to the cells.
[0426] Dissociation Rate:
[0427] To determine the dissociation rate of the mAbs, Ramos-EHRB
cells (final volume of 1 ml in the presence of azide/2DOG) were
incubated for 2 hours at 37.degree. C. with 2 .mu.g/ml .sup.125I
mAbs to achieve maximum binding. Following centrifugation in a
microfuge (2000 rpm for 2 min), the supernatant was removed, the
pellet quickly resuspended in 1 ml medium, and immediately
transferred to 9 ml medium at 37.degree. C. in a 15 ml conical
tube. At various times over the next 2 hours, 0.4 ml samples were
removed and separated on phthalate oils to determine the level of
radiolabeled mAbs remaining on the cell surface. As shown in FIG.
8, both 2F2 and 11B8 dissociated significantly more slowly from
CD20 than rituximab or B1.
[0428] Dissociation Rates of Anti-CD20 F(ab).sub.2 Fragments:
[0429] Ramos-EHBR cells were saturated with 2 .mu.g/ml of
.sup.125I-labeled F(ab).sub.2 fragments of 2F2, 11B8, and
rituximab, respectively. The Ramos-EHBR cells were washed and
incubated in the presence of a high concentration of the unlabeled
antibody. The maximal (initial) binding to Ramos-EHRB cells was set
at 100%. At several time points over the next 3 hours following
loading, 0.4 ml samples were removed and separated on phthalate oil
to determine the levels of radiolabeled mAb remaining on the cell
surface. As can be seen from FIG. 9, 2F2 and 11B8 dissociated much
more slowly from the surface of CD20 than rituximab. At 90 min,
approximately 50% of the F(ab).sub.2 rituximab molecules were bound
to the cell, whereas half of the F(ab).sub.2 2F2 molecules were
dissociated after 3 hours. The k.sub.d (k.sub.off) values for 2F2,
11B8T, and rituximab are calculated as follows:
F(ab).sub.22F2:k.sub.d=ln 2/t.sub.1/2(sec)=ln
2/10800(sec)=6.4.times.10.sup.-5sec.sup.-1
F(ab).sub.211B8T:k.sub.d=ln 2/t.sub.1/2(sec)=ln
2/9000(sec)=7.7.times.10.sup.-5sec.sup.-1
F(ab).sub.2rituximab:k.sub.d=ln 2/t.sub.1/2(sec)=ln
2/5400(sec)=1.3.times.10.sup.4sec.sup.-1
[0430] Anti-CD20 mAb Functional Off Rates:
[0431] The impact of the slow 2F2 dissociation rate compared to
rituximab was assessed in a functional CDC assay. To this end,
Daudi or SU-DHL4 cells were pre-incubated with 10 .mu.g/ml
anti-CD20 mAb or an isotype control antibody, washed and incubated
in medium for different time points. At these time points after
start of the assay, samples were incubated with complement (normal
human serum 20 vol/vol %) and then incubated for another 45 min at
37.degree. C. Thereafter, cell lysis was determined on FACS by
using PI (propidium iodide) staining method. The % lysed cells
(PI-positive cells) are shown in FIG. 10A (Daudi cells) or FIG. 10B
(SU-DHL4 cells) as a function of incubation time. 2F2 induced high
CDC in both cell lines, and still lysed up to 90% of the cells
after 6 hours, indicating that the CD20 saturation of the cells
remained sufficiently high to induce complement-mediated lysis of
most of the cells. Rituximab, in contrast and in agreement with the
above dissociation rate studies, dissociated rapidly from the cells
and failed to induce specific lysis following the 6 hour incubation
period. 11B8 was used as a control and did not induce CDC.
Example 6
CDC of Human Antibodies Against CD20
[0432] Serum Preparation:
[0433] Serum for complement lysis was prepared by drawing blood
from healthy volunteers into autosep gel and clot activator
vacutainer tubes (BD biosciences, Rutherford, N.J.) which were held
at room temperature for 30-60 min and then centrifuged at 3000 rpm
for 5 min. Serum was harvested and stored at -80.degree. C.
[0434] Flow Cytometry:
[0435] For flow cytometry a FACScalibur flow cytometer was used
with CellQuest pro software (BD Biosciences, Mountain view,
Calif.). At least 5000 events were collected for analysis with cell
debris excluded by adjustment of the forward sideward scatter (FCS)
threshold.
[0436] CDC Kinetics:
[0437] In a first set of experiments (n=3) the kinetics of CDC of
five different B-cell lines, i.e., Daudi, SU-DHL-4, Raji, DOHH and
ARH-77, were determined by adding 10 .mu.g/ml 12F2, rituximab and
an IgG control antibody, respectively, for 10 min before human
serum was added. At several time intervals (up to one hour) after
induction of CDC, the cells were suspended in PI solution and cell
lysis (number of PI-positive cells) was measured by flow cytometry.
The results are depicted in FIGS. 11A (ARH-77 cells), 11 B (Daudi
cells), 11C (Raji cells), 11D (DOHH) and 11 E (SU-DHL-4). As seen,
addition of antibodies induced cell lysis within 5 min.
Interestingly, addition of 2F2 resulted in a marked cell lysis of
more than 80% in all five B-cell lines. Rituximab induced more than
80% cell lysis only in the SU-DHL-4 and Daudi cell lines, whereas
the cell lysis of the DOHH cell line was .about.50%, and less than
20% in the ARH-77 and Raji cell lines. No lysis was observed with
the IgG control antibody (data only shown in FIG. 11B).
[0438] CDC Serum Titration:
[0439] In a separate set of experiments (n=5), NHS (normal human
serum) was titrated at two different antibody concentrations of 0.5
.mu.g/ml and 5 .mu.g/ml. Cells were pre-incubated with 2F2 or
rituximab for 10 min, before a concentration range of NHS was
added. At 45 min after induction of CDC, cells were resuspended in
PI solution. Cell lysis (number of PI-positive cells) was measured
by flow cytometry. FIGS. 12A-D show the percentage of lysed
(PI-positive) cells as a function of NHS concentration. FIG. 12A
shows cell lysis of Daudi cells, FIG. 12B cell lysis of ARH-77
cells, FIG. 12C cell lysis of DOHH cells, and FIG. 12D cell lysis
of Raji cells. Increased lysis of cells was observed with increased
NHS concentration. Addition of 2F2 caused maximal lysis of Daudi
cells at the highest NHS and antibody concentration. Rituximab
induced about 50% cell lysis of Daudi cells at the highest NHS
concentration.
[0440] In ARH-77 cells, only the highest concentration of NHS and
2F2 led to approximately 75% cell lysis. Lower antibody
concentrations were insufficient to induce ARH-77 cell lysis.
Rituximab was not able to induce cell lysis of ARH-77 cells in this
experiment.
[0441] 2F2 was able to induce NHS-concentration dependent cell
lysis of DOHH cells at both the high and the low concentration,
whereas rituximab was not able to induce lysis under these
conditions.
[0442] Finally, 2F2 induced NHS-concentration-dependent lysis of
Raji cells, which was only apparent by use of 5 .mu.g/ml mAb. No
lysis was observed with rituximab.
[0443] In these experiments, no lysis was observed with the isotype
control antibody (data not shown).
[0444] CDC Antibody Titration:
[0445] To measure the ability of the anti-CD20 antibodies to induce
CDC at low concentrations, an experiment was performed where the
antibodies were titrated (n=6). Various cell lines were
pre-incubated with a concentration range of 2F2 and rituximab,
respectively, for 10 min before NHS was added. After 45 min
incubation at 37.degree. C. (when maximal lysis occurs) the cells
were resuspended in PI solution and cell lysis (number of
PI-positive cells) was measured by flow cytometry. FIGS. 13A (Daudi
cells), 13B (DOHH cells), 13C (ARH-77 cells), and 13D (Raji cells)
show the percentage of lysed (PI-positive) cells as a function of
antibody concentration. Both 2F2 and rituximab induced a
concentration-dependent increase in cell lysis. 2F2 induced more
than 80% lysis of Daudi cells upon addition of 2 .mu.g/ml, whereas
with rituximab this level was not reached even after addition of 10
.mu.g/ml. Furthermore, 2F2 induced more than 80% lysis of DOHH
cells at 0.4 .mu.g/ml, whereas minimal lysis was observed with
rituximab at this concentration. The maximal lysis of DOHH cells
with rituximab (-30% of total cell analyzed) was reached at 10
.mu.g/ml. Induction of lysis of ARH-77 and Raji cells by 2F2 was
lower, but still .about.70% lysis was reached at an antibody
concentration of 10 .mu.g/ml. At its highest concentration,
rituximab induced lysis in only .about.23% of ARH-77 cells, and in
only .about.6% of Raji cells.
[0446] In a similar experiment, 2F2, 2F2T, 11B8T, and rituximab
were investigated for their ability to induce CDC of Daudi and Raji
cell lines, see FIGS. 14A and 14B. Also in this experiment more
than 80% lysis of Daudi cells was observed with
(transfectoma-derived) 2F2T at 10 .mu.g/ml, whereas rituximab
reached only to 60% lysis even at 10 .mu.g/ml, cf. FIG. 14A. Lysis
of Daudi cells with 2F2T was identical to the lysis obtained with
hybridoma-derived 2F2.
[0447] Lysis of Raji cells was more difficult, but again both 2F2
and 2F2T induced lysis of Raji cells to a similar extent (FIG.
14B). Rituximab was not able to induce CDC of Raji cells which is
in agreement with the experiment shown in FIG. 13D.
[0448] As can be seen from FIGS. 14A and 14B neither Daudi nor Raji
cells were susceptible to CDC by 11B8T. B1 induced lysis of Daudi
cells, but only to a small extent, and was not able to induce lysis
of Raji cells.
[0449] CDC Activity of Anti-CD20 in Daudi Cells:
[0450] To determine the CDC activity of each antibody, elevated
membrane permeability was assessed using FACS analysis of propidium
iodide (PI)-stained cells. Briefly, the Daudi cells were washed and
resuspended in RPMI/1% BSA at 1.times.10.sup.6 cells/ml. Various
concentrations of human monoclonal antibodies were added to the
Daudi cells and allowed to bind to CD20 on the cells for 10-15 min
at room temperature. Thereafter, serum as a source of complement
was added to a final concentration of 20% (v/v) and the mixtures
were incubated for 45 min at 37.degree. C. The cells were then kept
at 4.degree. C. until analysis. Each sample (150 .mu.l) was then
added to 10 .mu.l of PI solution (10 .mu.g/ml in PBS) in a FACS
tube. The mixture was assessed immediately by flow cytometry. As
shown in FIG. 15A, 2F2 and 7D8 showed superior CDC activity
compared to rituximab.
[0451] In a second experiment, cells were labeled with human
monoclonal antibodies as above, then washed and incubated in PBS
for 45 min at 37.degree. C. prior to the addition of human serum.
This ensured that only antibody bound to the cell at the time of
serum addition was available to activate complement for cell lysis.
As shown in FIG. 15B, decreased CDC activity was found for
rituximab compared to 2F2 and 7D8 indicating that the human
antibodies (2F2 and 7D8) are not affected by washing the cells
prior to the addition of serum.
[0452] CDC Activity of Anti-CD20 in Raji Cells:
[0453] CDC activity was assessed using Raji cells which have
relatively high surface expression of CD55 and CD59 and, therefore,
are more resistant to complement attack. Human antibodies were
added to Raji cells and allowed to bind for 15 min. Human serum
(20%) was added and the mixtures incubated for 45 min at 37.degree.
C. As shown in FIG. 16A, rituximab was ineffective in mediating CDC
of Raji cells whereas significant levels of cell lysis occurred in
Raji cells opsonized with 2F2 or 7D8. Accordingly, 2F2 and 7D8 have
a unique capacity to lyse CD55/59 positive target cells.
[0454] In a separate experiment, Raji cells were pre-incubated with
saturating concentrations of anti-CD55 mAb (final concentration of
5 .mu.g/ml) and anti-CD59 mAb (final concentration of 5 .mu.g/ml)
to block the effects of these complement defense molecules. Human
anti-CD20 antibodies were then added along with serum (20%) as
above for 45 min at 37.degree. C. As shown in FIG. 16B, the
blockade of CD55 and CD59 molecules resulted in almost 100% lysis
of Raji cells with human antibodies 2F2 or 7D8 whereas only a 25%
increase in cell lysis was observed using rituximab.
[0455] Role of Complement Inhibitors I--Expression of Surface
Molecules:
[0456] Since complement inhibitors such as CD55 and CD59 appear to
play an important role in susceptibility to rituximab-induced CDC,
an experiment was performed to determine the expression of these
molecules on the B-cell lines under investigation (Raji, Daudi,
DOHH, ARH-77, and SU-DHL-4).
[0457] The cells were stained with FITC-conjugated anti-CD55,
anti-CD59 and anti-CD20 antibodies and molecules expression was
analyzed by flow cytometry. The results are shown in the below
Table 1.
TABLE-US-00006 TABLE 1 Expression CD20 CD55 CD59 ARH-77 ++ ++++ ++
Raji + ++ +++ DOHH ++ +++ ++ SU-DHL-4 +++ + ++ Daudi ++ + +
[0458] Role of Complement Inhibitors II--Blockade of CD55 and
CD59:
[0459] To further study the roles of CD55 and CD59 in
anti-CD20-induced CDC, both complement inhibitor molecules were
blocked by specific antibodies prior to induction of CDC (n=3).
Raji cells were used because only partial lysis was induced by 2F2
alone. Raji cells (1.times.10.sup.5 cells/50 .mu.l) were
pre-incubated with a concentration range of 2F2 and rituximab
together with anti-CD55 (5 .mu.g/ml) or anti-CD59 (5 .mu.g/ml)
antibodies for 10 min, before pooled NHS (20%) was added. At 45 min
after induction of CDC, cells were resuspended in PI solution. Cell
lysis (number of PI-positive cells) was measured by flow cytometry.
FIGS. 17A-C show the percentage of lysed (PI-positive) cells as a
function of antibody concentration, and show one experiment which
is exemplary of three experiments. FIG. 17A shows incubation of
Raji cells with anti-CD55 antibody, FIG. 17B incubation of Raji
cells with anti-CD59 antibody, and FIG. 17C incubation of Raji
cells with anti-CD55 and anti-CD59 antibodies.
[0460] As can be seen in FIG. 17A, addition of anti-CD55 antibody
did not influence 2F2 or rituximab-induced CDC. Addition of
anti-CD59 antibody increased susceptibility of the cells to both
2F2 and to rituximab with .about.30% (FIG. 17B). Addition of both
anti-CD55 and anti-CD59 further enhanced anti-CD20-induced lysis of
cells with .about.30% (FIG. 17C).
[0461] Role of Complement Factors, as Determined by Flow Cytometry
I--C1q Binding:
[0462] Anti-CD20 antibodies (2F2 and rituximab) and an isotype
control antibody were added to various B-cell lines. After 10 min
incubation, NHS (1 vol/vol %) was added. After further incubation
for 10 min at 37.degree. C. and washing of the cells, the
supernatant was discarded and the cell pellet was incubated with
FITC-conjugated anti-C1q antibody. Data show mean fluorescence
intensity of cells stained with C1q and are depicted in FIGS. 18A
(Daudi), 18B (ARH-77), 18C (DOHH), and 18D (Raji) (n=6). The
results indicated antibody concentration-dependent increase in
binding of C1q by 2F2, irrespective of the B-cell line
investigated. Moreover, C1q binding by 2F2 was always higher than
binding by rituximab, in all cell lines tested. No increase in mean
fluorescence was observed with the isotype control antibody (data
not shown).
[0463] Role of Complement Factors, as Determined by Flow Cytometry
II--Complement Activation Via the Classical Route:
[0464] Fixation of C4c to antibody-coated cells is an indication of
activation of complement activation via the classical route.
Anti-CD20 antibodies (2F2 and rituximab) and an isotype control
antibody were added to various B-cell lines. After 10 min
incubation at 37.degree. C., NHS (1 vol/vol %) was added. After
further incubation and washing of the cells, the supernatant was
discarded and the cell pellet was incubated with FITC-conjugated
anti-C4c antibody. Data show mean fluorescence intensity of cells
stained with C4c and are depicted in FIGS. 19A (Daudi), 19B
(ARH-77), 19C (DOHH), and 19D (Raji) (n=6). Complement factor C4c
fixation to 2F2 was demonstrated in all B-cell lines tested (n=3),
with a maximum reached at .about.1 .mu.g/ml of antibody. Fixation
of C4c after 2F2 binding was much higher than after rituximab,
irrespective of the cell line tested. No increase in mean
fluorescence was observed with the isotype control antibody (data
not shown).
[0465] CDC in Heat-Inactivated Serum:
[0466] Cells (Daudi cells, ARH-77 cells or Raji cells) and
antibodies (rituximab, 2F2, 2F2T, 11B8, and isotype control
antibody HuMab-KLH IgG1) were pre-incubated in a concentration
range of anti-CD20 antibodies for 10 min, before NHS (active or
heat-inactivated in a water bath at 57.degree. C. at 30 min) was
added. At 45 min after induction of CDC, cells were resuspended in
PI solution. Cell lysis (number of PI-positive cells) was measured
by flow cytometry. No lysis of the cells was observed in the
presence of heat-inactivated serum, irrespective of the cell-line
and CD20-antibody used, no CDC was observed in the presence of
heat-inactivated serum.
Example 7
ADCC of Human Antibodies Against CD20 ADCC Assay I
[0467] Enrichment of Human Neutrophils:
[0468] Polymorphonuclear cells (neutrophils, PMNs) were enriched
from heparinized whole blood. Blood was diluted twice in RPMI 1640
and was layered on Ficoll (Lymphocyte Separation Medium 1077 g/ml,
710 g, RT, 20 mM; BioWhittaker, cat. 17-829E, lot no. 0148 32) and
centrifuged at 2000 rpm for 20 min. The mononuclear cell layer was
removed, and erythrocytes within the pellet containing neutrophils
were hypotonically lysed using ice-cold NH.sub.4Cl solution (155 mM
NH.sub.4C1, 10 mM NaHCO.sub.3, 0.1 mM EDTA, pH 7.4). The remaining
neutrophils were washed twice and resuspended in RPMI 1640
supplemented with 10% FCS(RPMI-10).
[0469] Enrichment of Human Peripheral Blood Mononuclear Cells:
[0470] Human blood was diluted twice in RPMI 1640 and blood cells
were layered on Ficoll (Lymphocyte Separation Medium 1077 g/ml, 710
g, RT, 20 min; BioWhittaker, Cambrex Bio Science Verviers,
Verviers, Belgium, cat. 17-829E, lot no. 0148 32). Peripheral blood
mononuclear cells (MNCs) were collected from the interphase, washed
and resuspended in RPMI 1640 culture medium supplemented with 10%
FCS, 2 mM L-glutamine, 5 U/ml penicillin, 50 .mu.g/ml streptomycin
(all derived from BioWhittaker) to which 25 mM HEPES (BioWhittaker)
was added.
[0471] ADCC Set Up:
[0472] Target B-cells (freshly isolated B-cells or from B-cell
lines) were labeled with 20 .mu.Ci .sup.51Cr (Amersham Biosciences,
Uppsala, Sweden) for 2 hours. After extensive washing in RPMI-10,
the cells were adjusted to 1.times.10.sup.5 cells/ml. Whole blood
or isolated effector cells (50 .mu.l; MNCs, PMNs) or plasma (50
.mu.l), sensitizing antibodies (50 .mu.l), and RPMI-10 (50 .mu.l)
were added to round-bottom microtiter plates (Greiner Bio-One GmbH,
Frickenhausen, Germany). Assays were started by adding target cells
(50 .mu.l) giving a final volume of 200 .mu.l. For isolated
effector cells, an effector to target (E:T) ratio of 40:1 was used.
For whole blood, an amount of 33 vol/vol % was used corresponding
to an estimated effector to target ratio of 40:1. After incubation
(3 hours, 37.degree. C.), assays were stopped by centrifugation,
and .sup.51Cr release from triplicates was measured in counts per
minute (cpm) in a scintillation counter. Percentage of cellular
cytotoxicity was calculated using the following formula:
%specific lysis=(experimental cpm-basal cpm)/(maximal cpm-basal
cpm).times.100
with maximal .sup.51Cr release determined by adding perchloric acid
(3% final concentration) to target cells, and basal release
measured in the absence of sensitizing antibodies and effector
cells.
[0473] Statistics:
[0474] Data were analyzed by one-way ANOVA, followed by Tukey's
multi comparison post-hoc test. Analysis was performed using Graph
Pad Prism (version 3.02 for Windows, Graph Pad Software, San Diego,
Calif., USA).
[0475] Lysis of ARH-77 Cells:
[0476] In a first set of experiments, ARH-77 cells were used as
target cells (FIG. 20). Addition of 2F2 (n=3), rituximab (n=3) or
11B8T (n=1) resulted in MNC-mediated lysis of ARH-77 cells of
approximately 50%. No specific lysis was observed in the presence
of neutrophils. Addition of plasma (to evaluate the role of
complement) induced lysis of ARH-77 cells after incubation with
2F2, but not after incubation with rituximab (p<0.05, 2F2 vs. no
antibody, ANOVA) or 11B8T. In the presence of whole blood, lysis of
ARH-77 cells increased after incubation with 2F2 (p<0.05, 2F2
vs. rituximab and 2F2 vs. no antibody, ANOVA), but not with
rituximab. Specific lysis induced by rituximab was in fact very low
in the presence of whole blood. 11B8T induced cell lysis of
approximately 25% (n=1) in the presence of whole blood. In the
absence of antibody, non-specific lysis of 10-15% was observed.
[0477] Lysis of B-CLL Cells:
[0478] In a second set of experiments, chronic B-lymphocytic
leukaemia (B-CLL) cells obtained from B-CLL patients (n=12) were
subcloned for 5 rounds and then used as target cells in the
experiment (FIG. 21). In the absence of antibody, no specific lysis
was observed, but addition of 2F2, 11B8T or rituximab (10 .mu.g/ml)
increased MNC-mediated specific lysis to 10-20% (p<0.001,
ANOVA). Incubation of target cells with plasma and 2F2 induced
specific lysis of B-CLL cells, whereas no specific lysis was
observed with 11B8T or rituximab (p<0.001, ANOVA). Moreover, 2F2
mediated specific lysis of B-CLL cells after incubation in whole
blood. No specific lysis of B-CLL cells by whole blood was observed
with 11B8T (p<0.01, ANOVA) or rituximab (p<0.001, ANOVA). No
specific lysis was observed in the presence of neutrophils.
[0479] Because rituximab was able to mediate effective ADCC but not
CDC of the tumor cells tested, it is likely that whole
blood-induced B-cell lysis by 2F2 is mediated via complement.
[0480] Lysis of Hairy Cell Leukaemia (HCL) Cells:
[0481] In a third set of experiments lysis of HCL cells by 2F2,
11B8T, and rituximab by ADCC or in the presence of plasma or whole
blood was determined. Data are shown in FIG. 22. Whereas
neutrophils could not mediate ADCC irrespective of the mAb used,
11B8T was able to induce MNC-mediated lysis of HCL cells more
efficiently than 2F2 (p<0.001, ANOVA) or rituximab (p<0.05,
ANOVA). 2F2 and rituximab were not able to induce MNC-mediated
lysis of HCL cells. Plasma-mediated lysis of the cells was strongly
enhanced with 2F2, as compared to rituximab (p<0.05, ANOVA),
11B8T (p<0.01, ANOVA) or without antibody (p<0.001, ANOVA).
When lysis induced by anti-CD20 in the presence of whole blood was
studied, 2F2 induced complete lysis of cells, and was superior to
rituximab (p<0.01, ANOVA), 11B8T or no antibody added
(p<0.001, ANOVA).
[0482] Lysis of B-ALL Cells:
[0483] Using cells from two patients the ability of 2F2 and
rituximab to induce lysis B-ALL cells by ADCC or complement was
investigated (FIG. 23). As was observed in the previous
experiments, 2F2 and rituximab induced MNC-mediated ADCC of B-ALL
cells to a similar extent. But again 2F2 was able to induce plasma-
and whole blood-mediated lysis of B-ALL cells, whereas rituximab
was not.
[0484] Lysis of Follicular Lymphoma Cells:
[0485] When lysis of follicular lymphoma cells (n=2) was
investigated, a different picture emerged (FIG. 24). A minor
PMN-mediated lysis of cells with 2F2 was observed, and both 2F2 and
rituximab were not able to induce MNC-mediated ADCC. 11B8T was
still able to induce MNC-mediated lysis of approximately 20%.
Although a relatively high plasma-mediated lysis was induced by
rituximab, complete plasma-mediated lysis was observed with 2F2.
Also with whole blood, complete lysis was observed with 2F2,
whereas 70% lysis with rituximab. Minimal plasma- or whole
blood-mediated lysis by 11B8T was observed.
[0486] Lysis of Primary Mantle Cell Lymphoma Cells:
[0487] Specific lysis of mantle cell lymphoma cells was more
difficult to induce (n=1, FIG. 25). Minimal or no lysis by 2F2,
11B8T or rituximab was observed after addition of PMN or MNC and
CD20 mAbs. However, 2F2 was still able to induce approximately 40%
lysis by plasma or whole blood, whereas with rituximab only 10-20%
of the cells were lysed. 11B8T was not able to induce lysis of
primary mantle cell lymphoma cells.
[0488] Antibody Concentration-Dependent Lysis of ARH-77 Cells in
Whole Blood:
[0489] In a further experiment (n=4) dose-dependency regarding the
induction of ADCC on ARH-77 cells in the presence of whole blood
was analyzed. As can be seen in FIG. 26, titration of 2F2 induced a
dose-dependent increase in the percentage of specific lysis
(p<0.05: treatment-effect, two-way ANOVA) of ARH-77 cells. No
specific lysis of ARH-77 cells was observed with rituximab.
ADCC Assay II
[0490] Preparation .sup.51Cr-Labeled Target Cells:
[0491] ARH-77 cells and Raji cells were collected (3.times.10.sup.6
cells) in RPMI++, spun down (1500 rpm; 5 min), resuspended in 140
.sup.51Cr (Chromium-51; CJS11-1mCi, batch 12; 140 .mu.l is about
100 .mu.Ci) and incubated (37.degree. C. water bath; 1 hour). After
washing cells (1500 rpm, 5 min, in PBS, 3.times.), cells were
resuspended in RPMI++ and counted by trypan blue exclusion. Cells
were brought at concentration of 2.times.10.sup.4 cells/ml.
[0492] Preparation of Effector Cells:
[0493] Fresh peripheral blood mononuclear cells (MNC) were isolated
from 40 ml of heparin blood by Ficoll (Bio Whittaker; lymphocyte
separation medium, cat 17-829E) via manufacturer's instructions.
After resuspension of cells in RPMI++, cells were counted by trypan
blue exclusion and adjusted to a concentration of 1.times.10.sup.6
cells/ml.
[0494] ADCC Set Up:
[0495] 50 .mu.l RPMI++ was pipetted into 96 wells plates, and 50
.mu.l of .sup.51Cr-labeled targets cells were added. Thereafter, 50
.mu.l of antibody was added, diluted in RPMI++ (final
concentrations 10, 1, 0.1, 0.01 .mu.g/ml). Cells were incubated
(RT, 10 min), and 50 .mu.l effector cells were added, resulting in
an effector to target ratio of 50:1 (for determination of maximal
lysis, 50 .mu.l 5% Triton-X-100 was added instead of effector
cells). Cells were spun down (500 rpm, 5 min), and incubated
(37.degree. C., 5% CO.sub.2, 4 hours). After spinning down the
cells (1500 rpm, 5 min), 100 .mu.l of supernatant was harvested
into micronic tubes, and counted in a gamma counter. The percentage
specific lysis was calculated as follows:
%specific lysis=(cpm sample-cpm target cells only)/(cpm maximal
lysis-cpm target cells only).times.100
[0496] Statistics:
[0497] Data were analyzed by one-way ANOVA, followed by Tukey's
multi comparison post-hoc test. Analysis was performed using Graph
Pad Prism (version 3.02 for Windows, Graph Pad Software, San Diego,
Calif., USA).
[0498] Antibody Concentration-Dependent Lysis of ARH-77 and Raji
Cells:
[0499] 2F2T and 11B8T were tested for their ability to induce ADCC
of ARH-77 and Raji cells (n=3) in comparison with rituximab.
[0500] A dose-effect relation with CD20 mAbs was observed in ADCC
of ARH-77 cells using MNC as effector cells (FIG. 27). Both 2F2T
and 11B8T induced specific lysis of ARH-77 cells which was maximal
(50%) at 10 .mu.g/ml of mAb. Rituximab induced only 25% lysis of
target cells. Addition of the isotype control antibody (HuMab-KLH)
did not induce ADCC. No specific lysis was observed without
addition of MNCs (data not shown).
[0501] When Raji cells were used as target cells, a similar picture
as with ARH-77 cells emerged (FIG. 28). Both 2F2T and 11B8T induced
MNC-mediated lysis of Raji cells, albeit that 2F2T seemed more
potent than 11B8T at low concentrations. The maximum lysis reached
with 2F2T and 11B8T was approximately 35%. Rituximab induced
MNC-mediated lysis of Raji cells, although only 20% of target cells
were susceptible to rituximab. Addition of the isotype control
antibody (HuMab-KLH) did not induce ADCC. No specific lysis was
observed without addition of MNCs (data not shown).
Example 8
FRET and Triton-X Insolubility Analysis
[0502] Preparation of Cy3- and Cy5-Conjugated mAb for Fluorescence
Resonance Energy Transfer (FRET):
[0503] Monoclonal antibodies were directly conjugated to
bifunctional NHS-ester derivatives of Cy3 and Cy5 (Amserham
Biosciences UK Ltd) as described in the manufacturer's
instructions. Briefly, mAb were dialyzed against 0.1 M
carbonate/bicarbonate buffer (pH 9). Thereafter, dye was dissolved
in H.sub.2O, immediately added to 1 mg of the mAb, and incubated at
room temperature in the dark for 45 min. The labeled mAbs were
separated from the unconjugated dye by gel chromatography using a
PD10-Sephadex G25 column equilibrated in PBS. Molar ratios of
coupling were determined spectrophotometrically from
.epsilon..sub.552=150/mM/cm for Cy3, .epsilon..sub.650=250/mM/cm
for Cy5, and .epsilon..sub.280=170/mM/cm for protein, and ranged
from 5- to 8-fold excess dye:protein.
[0504] FRET Analysis:
[0505] Daudi cells were resuspended at 5.times.10.sup.6 cells/ml in
PBS/0.1% BSA, and equimolar donor (Cy3)-conjugated and acceptor
(Cy5)-conjugated mAb were combined and added to the cell suspension
(final concentration 10 .mu.g/ml). Cells were incubated for 30 min
in the dark, at 4.degree. C. or 37.degree. C. Each experiment
included cells labeled with donor- and acceptor-conjugated mAb
after pre-incubation with a 20-fold molar excess of unconjugated
mAb, and cells labeled with donor- or acceptor-conjugated mAb in
the presence of equimolar unlabeled mAb. To assess the association
of labeled antigens, flow cytrometric FRET measurement was carried
out using a FACScalibur (BD Biosciences). The fluorescence
intensities at 585 nm (FL2) and 650 nm (FL3), both excited at 488
nm, and the fluorescence intensities at 661 nm (FL4), excited at
635 nm, were detected and used to calculate FRET according to the
equitation below, where A is acceptor (Cy5), and D is donor (Cy3).
All values obtained were corrected for autofluorescence using the
following formula:
FRET=FL3(D,A)-FL2(D,A)/a-FL4(D,A)/b
where a=FL2(D)/FL3(D), and b=FL4(A)/FL3(A) Correction parameters
were obtained using data collected from single-labeled cells, and
side angle light scattering was used to gate out debris and dead
cells. FRET between donor and acceptor mAb derivatives on dually
labeled cells is expressed in terms of acceptor sensitized emission
at 488 nm. Larger FRET values indicate closer physical association
of the donor- and acceptor labeled antibodies or a higher density
of acceptor-labeled mAb in the vicinity of donor-labeled mAb.
[0506] Assessment of Raft Associated Antigen by Triton X-100 (TX)
Insolubility:
[0507] As a rapid assessment of the presence of antigen in raft
microdomains, a flow cytometry method based on Triton X-100 (TX)
insolubility at low temperatures was used, as described previously.
In brief, Daudi cells were washed in RPMI 1% BSA and resuspended at
2.5.times.10.sup.6/ml. The cells (100 .mu.l) were then incubated
with 10 .mu.g/ml of FITC conjugated mAb for 15 min at 37.degree.
C., washed in cold PBS/1% BSA/20 mM sodium azide (PBS-BS), and the
sample was divided in half. All samples were kept on ice throughout
the remainder of the assay. One half was maintained on ice to allow
calculation of 100% surface antigen levels, whilst the other was
treated with 0.5% TX for 15 min on ice to determine to proportion
of antigens remaining in the insoluble raft fraction. Cells were
then maintained at 4.degree. C. throughout the remainder of the
assay, washed once in PBS-BS, resuspended in PBS-BS and assessed by
flow cytometry. To determine the constitutive level of raft
association of the target antigens, cells were first treated with
0.5% TX for 15 min on ice and washed in PBS-BS prior to binding of
FITC-labeled mAb.
[0508] As shown in FIGS. 29A, 29B, and 29, fluorescence resonance
energy transfer (FRET) analysis indicates clustering of CD20 upon
incubation with 2F2 or 7D8. No such clustering was observed upon
incubation with 11B8. These results are consistent with the TX
treatment data, cf. FIG. 29C, (i.e., 2F2 and 7D8, unlike 11B8
remain with the insoluble fraction of the cell following binding)
and support the concept that 2F2 and 7D8, upon binding, translocate
CD20 into lipid raft compartment of the B cell membrane.
[0509] As shown if FIG. 30 (FRET values and s.e.m. of three
experiments using one-way ANOVA followed by Tukey's multi
comparison post-hoc test) the FRET analysis indicates clustering of
rituximab and 2F2, whereas no clustering was observed with 11B8T.
These data are in agreement with the data obtained after treatment
with 0.5% TX prior to binding of FITC-labeled mAbs as shown in FIG.
31 (n=2).
[0510] Preparation of lipid Raft Fractions and Western
Blotting:
[0511] Another way to examine the association of CD20 with lipid
rafts, is to investigate the distribution of CD20 between the raft
and non-raft membrane fractions using the sucrose gradient
fractionation method as disclosed by Deans, J. P., et al., J. Biol.
Chem., 1998. 273(1): pp 344-348, except that Optiprep (Sigma) was
used instead of sucrose. Monoclonal antibodies directed against
CD20 (10 .mu.g/ml) were allowed to bind to Daudi cells
(1.times.10.sup.7) for 20 min at 37.degree. C. Following this
incubation, the cells were pelleted, washed twice with PBS and
lysed in ice-cold lysis buffer (1.0% TX in MES-buffered saline (25
mM MES, pH 6.5, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 5
.mu.g/ml aprotinin, 5 .mu.g/ml leupeptin, 10 mM EDTA)). The cell
pellet was resuspended thoroughly and incubated for 20 min on ice.
Thereafter, the lysate was mixed with 400 .mu.l cold 60% Optiprep
(Sigma). The sample was overlaid with a 600 .mu.l step of each 35%,
30%, 25%, 20%, 0% Optiprep in lysis buffer. The gradients were spun
at 40.000 rpm at 4.degree. C. for 18 hours. Six fractions from the
top were collected, resolved on a 4-15% SDS-PAGE gel, transferred
onto nitrocellulose membranes and incubated with primary antibody
(mouse anti-CD20 polysera; Serotec, UK), followed by HRP-conjugated
secondary antibody (rabbit anti mouse-HRP; Jackson, Bar Harbor,
Me., USA). Blots were visualised using Supersignal West Dura
extended duration substrate (Pierce, Woburn, Mass., USA).
[0512] The results are shown in FIG. 32. As it can be seen, CD20
molecules are confined to the high-density fraction 5 (untreated
cells). Cells treated with rituximab showed a distinct shift in
CD20 distribution with a significant proportion in the lower
density membrane fractions 2 and 3, coincident with the fraction
where membrane rafts are expected to sediment. Cells treated with
2F2 also showed this shift to fractions 2 and 3. In contrast, cells
treated with 11B8T for 20 mM showed a similar distribution to
untreated cells, with CD20 molecules in fraction 5. In conclusion
binding to 2F2 and rituximab induces a shift of CD20 molecules to
the lower density membrane fractions, whereas binding to 11B8T does
not.
Example 9
Apoptosis of Burkitt Cell Lines with Human Antibodies Against
CD20
[0513] Apoptosis:
[0514] Daudi cells, 0.5.times.10.sup.6 in 1 ml tissue culture
medium, were placed into 24-well flat-bottom plates with 1 or 10
.mu.g/ml mAb or control antibodies, and incubated at 37.degree. C.
After 20 hours, cells were harvested, washed in Annexin-V-FITC
binding buffer (BD biosciences) and labeled with Annexin V-FITC (BD
biosciences) for 15 min in the dark at 4.degree. C. The cells were
kept at 4.degree. C. until analysis. Each sample (150 .mu.l) was
added to 10 .mu.l of PI solution (10 .mu.g/ml in PBS) in a FACS
tube. The mixture was assessed immediately by flow cytometry using
a FACScalibur flow cytometer with CellQuest pro software (BD
Biosciences, Mountain view, Calif.). At least 10,000 events were
collected for analysis.
[0515] Induction of Apoptosis in Daudi Cells:
[0516] Daudi cells were incubated for 20 hours in the presence of
human antibodies against CD20 (1 .mu.g/ml) (without the addition of
a secondary cross-linking antibody). Induction of apoptosis was
assessed by AnnexinV/PI staining using flow cytometry.
[0517] As shown in FIGS. 33A-G, 11B8 shows clear evidence of
inducing apoptosis (similar to that induced by an anti-IgM
antibody). 2F2 and 7D8 did not induce apoptosis of Daudi cells. An
apoptosis-inducing mouse anti-CD20 antibody, AT80, was used as a
control.
[0518] Induction of Apoptosis in Raji Cells:
[0519] Induction of apoptosis of Raji cells was tested with a
concentration range of CD20 mAbs. FIG. 34 shows the percentage of
annexin-V-positive cells. As can be seen from FIG. 34, the positive
control mouse anti-human CD20-mAb, B1, induced a
concentration-dependent increase in apoptosis of Raji cells with a
maximum of approximately 70% at 10 .mu.g/ml mAb. Also 11B8 was a
strong inducer of apoptosis, resulting in apoptosis of Raji cells
with a maximum of 53.4% at 10 .mu.g/ml mAb. On the other hand, 2F2
and rituximab were very poor in inducing apoptosis of Raji cells,
with slightly elevated levels of apoptosis compared to negative
control levels.
[0520] Induction of Apoptosis in Daudi Cells:
[0521] The same picture emerged when Daudi cells were used as
target cells, after addition of 1.0 .mu.g/ml CD20 mAb (FIGS. 35A
and 35B). Data in FIG. 35A show the total of annexin-V positive
cells, and data in FIG. 35B (the X-axis showing annexin-V, and the
Y-axis showing PI) show the percentages of Daudi cells in early
apoptosis (annexin-V positive and PI negative) and late apoptosis
(annexin-V positive and PI positive). Again, Both B1 (65.9%) and
11B8T (56.3%) were strong inducers of apoptosis (FIG. 36), when
used at a concentration of 1.0 .mu.g/ml. Addition of 2F2T resulted
in a low level of apoptotic Daudi cells (17%). Addition of
rituximab resulted in approximately 29% apoptosis of Daudi cells.
Addition of isotype control antibody HuMab-KLH did not induce
apoptosis of Daudi cells (6%).
Example 10
Homotypic Adhesion of Cells with Human Antibodies Against CD20
[0522] Homotypic aggregation correlates with induction of
apoptosis. Therefore, the ability of the anti-CD20 mAbs to induce
homotypic aggregation of B cells was investigated
[0523] Homotypic Aggregation of Ramos-EHRB Cells:
[0524] Ramos-EHRB cells (0.5.times.10.sup.6 in 1 ml tissue culture
medium) were incubated at 37.degree. C. for 4 hours in the presence
of anti-CD20 antibodies 11B8, 2F2, or 7D8 (without cross-linking)
and induction of homotypic adhesion was assessed by light
microscopy (as described above).
[0525] As shown in FIGS. 36A-E, 11B8 caused extensive aggregation
of Ramos-EHRB cells (similar to the aggregation caused by murine
anti-CD20 antibody, AT80). 2F2, and 7D8 did not induce homotypic
aggregation of Ramos cells.
[0526] Homotypic Aggregation of Daudi Cells:
[0527] Daudi cells were placed into 24-well flat-bottom plates with
1 or 10 .mu.g/ml anti-CD20 mAbs or control antibody, and incubated
at 37.degree. C. for 4 hours. The extent of homotypic aggregation
was determined by light microscopy. As can be seen from FIG. 37,
2F2 hardly induced homotypic aggregation of Daudi cells, with 1.0
.mu.g/ml (and 10 .mu.g/ml, data not shown). Rituximab gave little
homotypic aggregation of Daudi cells. In contrast, the B1 antibody
was a strong inducer of homotypic aggregation.
Example 11
Immunotherapy Using Human Antibodies Against CD20
[0528] Therapy with High Dose (100 .mu.g) 2F2 and 7D8 of SCID Mice
Challenged with Daudi Cells:
[0529] The SCID mice were obtained from Harlan UK Ltd., Blackthorn,
Oxon, UK, and bred and maintained under pathogen free conditions.
Daudi cells (2.5.times.10.sup.6) were injected i.v. into the tail
vein of cohorts of 12-16 weeks old SCID mice, followed 7 days later
by injection of 100 .mu.g of 2F2 or 7D8 via the same route. Animals
were sacrificed upon presentation of limb paralysis, according to
the instructions of the animal ethics committee. As shown in FIG.
38, survival of the mice is prolonged after treatment with 2F2 or
7D8.
[0530] Therapy with High Dose (100 .mu.g) 2F2 and Rituximab of SCID
Mice Challenged with Tanoue Cells:
[0531] Tanoue cells (2.5.times.10.sup.6 in 200 .mu.l PBS) were
injected i.v. into the tail vein of cohorts of 12-16 week old SCID
mice (Harlan UK Ltd., Blackthorn, Oxon, UK) followed 7 days later
by the injection of 100 .mu.g (in 200 .mu.l PBS) of anti-CD20 mAb
via the same route. In this experiment, 2F2 was compared to
rituximab and B 1. Animals were sacrified upon presentation of
rear-limb paralysis. The results are shown in FIG. 39. At day 39,
the first two control mice died, and death within this group was
complete at day 54. Only one mouse died within this time interval
following 2F2 treatment and survival was considerably increased for
the other mice in this group. One mouse died 81 days following
injection of the tumor cells and the remaining mice (60% of the
total number) survived beyond the termination of the experiment at
100 days post tumor challenge. Rituximab in contrast only increased
survival for 2 out of 5 mice (dying at 66 and 83 days post
challenge) and none of the mice survived until the end of the
experiment. In the B1-group, the survival of SCID mice was similar
to that in the 2F2 group, with two mice dying on day 48, and one
mouse on day 76. In this group, forty percent was alive at the time
the experiment was terminated.
[0532] Dose Response of 2F2 and Rituximab Treatment of SCID Mice
Challenged with Daudi Cells:
[0533] To assess the efficacy of 2F2 in comparison to rituximab in
protection against tumorigenesis, a dose titration was performed in
therapy of SCID mice challenged with Daudi tumor cells. Daudi cells
express more CD20 than Tanoue cells and are more sensitive to
killing in vitro. 10 groups of SOD mice (4 per group) and 1 control
group (5 SOD mice) were injected with 2.5.times.10.sup.6 Daudi
cells (in 200 .mu.l PBS) i.v. on day 0, and then treated with 20,
5, 2, 0.5 or 0.1 .mu.g (in 200 .mu.A PBS) rituximab, 2F2 or PBS
(control) i.v. on day 7. Animals were sacrificed upon presentation
of rear-limb paralysis. The results are shown in FIG. 40.
[0534] In the control group, all mice died within the time interval
of 26-29 days. However, a clear dose-effect relation was observed
with 2F2 (FIG. 40, upper graph). Whereas no effect was observed
with doses of 0.1 .mu.g and 0.5 .mu.g 2F2, as little as 2 .mu.g 2F2
substantially extended survival until day 41, 5 .mu.g 2F2 extended
survival until day 47, and 20 .mu.g 2F2 extended survival even
until day 50.
[0535] In contrast, rituximab even tested at the highest dose of 20
.mu.g only slightly increased survival and no dose-effect relation
was therefore observed at the lower concentrations tested (FIG. 40,
lower graph).
[0536] Therapy of SCID Mice with Daudi Tumors by 11B8T and B1:
[0537] Daudi cells (2.5.times.10.sup.6) in 200 .mu.l PBS were
injected i.v. into the tail vein of cohorts of 12-16 week old SCID
mice, followed 7 days later by the injection of 100 .mu.g 11B8 or
B1 in 200 .mu.l PBS via the same route. Animals were sacrificed
upon presentation of rear-limb paralysis. In control mice treated
with PBS, all mice died within a time interval of 35-53 days (FIG.
41). 11B8T treatment strongly protected the mice, with mice dying
between 72 and 98 days post tumor challenge. In the B 1-treatment
group, most mice survived until day 98 and 40% of the mice survived
beyond the end of the experiment, i.e., day 100.
Example 12
Evaluation of Anti-CD20 Antibodies in a Daudi-Luc Xenograft Model
Using SCID Mice
[0538] The therapeutic efficacy of anti-CD20 antibodies was
evaluated in a mouse model in which disseminated outgrowth of human
B-cell tumor cells is followed using external optical imaging. In
this model tumor cells are transfected with firefly luciferase.
Upon administration of luciferin (Molecular Probes, Leiden, The
Netherlands) to the mice the labeled cells can be detected in vivo
by bioluminescent imaging using a highly sensitive CCD camera, cf.
Wetterwald et al. (2002) American Journal of Pathology,
160(3):1143-1153.
[0539] Daudi cells were transfected with gWIZ luciferase from Gene
Therapy Systems (San Diego, Calif.) and cultured in RPMI with 10%
FCS, Pen/Strep, Sodium Pyruvate and 1 ug/ml puromycin (Sigma).
Cells were analysed for luciferase expression (expressed in
RLU/1.times.10.sup.5 cells) in a luminometer and for CD20
expression by FACS. 2.5.times.10.sup.6 luciferase-transfected Daudi
cells/mouse were injected i.v. into SCID mice. Eight days after
inoculation, the mice received a single dose (10 .mu.g) treatment
of 2F2T, 11B8T, rituximab, B1 or isotype control antibody (huIgG1)
(6 mice per treatment group). For imaging, mice were anesthetized
by i.p. injection of a mixture of ketamine/xylazine/atropine.
Synthetic D-Luciferin (sodium salt, Molecular Probes) was given
i.p. at a dose of 25 mg/ml. Mice were then placed in a light tight
box and after 3 min, imaging was started using a VersArray 1300B
liquid nitrogen cooled CCD detector (Roper Scientific). Photons
emitted from the luciferase were counted over an exposure period of
5 min. Under illumination black and white images were made for
reference. MetaVue software (Universal Imaging Corp) was used for
data collection and image analysis. Statistical significance of
differences between groups was established using one-way analysis
of variance with a Newman-Keuls post test using GraphPad PRISM
version 3.02 (Graphpad Software Inc).
[0540] Imaging from the back side was performed at one-week
intervals. On day 8, the day of treatment, light emission was only
detected at the inoculation sites in the tail. Tumor formation at
distant sites was detected on day 14 in all mice from the isotype
control group (huIgG1) and in one mouse from the rituximab group.
In the following weeks light emission steadily increased. FIG. 42
gives the images of all mice made on day 39 (31 days after
treatment), in which bioluminescence is represented in red color
(the dark areas in the mice) (light intensity>50 photons per 5
min) as overlay on the black and white body image of the mice. The
tumor mass in each mouse was quantified on day 25, 32, 39, and 46
by integrating the light signals over the body surface, cf. FIG.
43. The fastest tumor growth was observed in the isotype control
group. Treatment with rituximab gave significant inhibition of
tumor growth. However, tumor growth inhibition by 2F2T, 11B8T and
B1 was significantly more potent (see below Table 2 for
significance levels.
TABLE-US-00007 TABLE 2 Significance levels of differences in
integrated light intensity between groups at different time points
Day 25 Day 32 Day 39 Day 46 B1 vs. rituximab P > 0.05 P <
0.05 P < 0.01 P < 0.001 B1 vs. 11B8T P > 0.05 P > 0.05
P > 0.05 P > 0.05 B1 vs. 2F2T P > 0.05 P > 0.05 P >
0.05 P > 0.05 B1 vs. huIgG1 P < 0.001 P < 0.001 P <
0.001 rituximab vs. 11B8T P > 0.05 P < 0.05 P < 0.01 P
< 0.001 rituximab vs. 2F2T P > 0.05 P > 0.05 P > 0.05 P
< 0.001 rituximab vs. huIgG1 P < 0.001 P > 0.05 P <
0.05 11B8T vs. 2F2T P > 0.05 P > 0.05 P > 0.05 P > 0.05
11B8T vs. huIgG1 P < 0.001 P < 0.001 P < 0.001 2F2T vs.
huIgG1 P < 0.001 P < 0.01 P < 0.01
Example 13
Pilot and Pharmacokinetic Study in Cynomolgus Monkeys
[0541] The objective was to determine the pharmacokinetic pattern
and pharmacological effects of 2F2 in cynomolgus monkeys
(approximately 2 years old; weight range of 2.1-2.6 kg) following
once daily intravenous infusion administrations (via the saphenous
vein) for 4 consecutive days. The study also compared the
pharmacological effects of rituximab in order to determine its
equivalent potential. For this purpose, 6 male and 6 female
cynomolgus monkeys were assigned to 6 dose groups that received 2F2
or rituximab at dose levels of 1.25, 6.25 and 12.5 mg/kg/day at a
constant dose volume of 10 ml/kg for 4 consecutive days, in total
5, 25 and 50 mg/kg, respectively. On completion of the last dose
administration, the animals were retained for a post dose
observation period of 130 days. The practices and procedures
adopted during this study were consistent with the OECD Principles
of Good Laboratory Practice as set forth by the United Kingdom
Department of Health. All animals were observed at regular
intervals for signs of ill health or reaction to treatment and were
subjected to a physical examination. Laboratory investigations of
haematology, coagulation, clinical chemistry and urine analysis
were performed during the study. Blood samples and lymph node
biopsies were obtained (from the superficial lymph nodes) for flow
cytometry analysis throughout the dosing and post dose observation
periods. The following cell phenotypes were analysed by flow
cytometry: CD3, CD4, CD8, CD20 and CD21. On completion of the post
dose observation period the animals were sacrificed and subjected
to a detailed necropsy.
[0542] There were no adverse clinical signs or any findings that
were considered to be related to treatment with 2F2 or rituximab.
FIGS. 44 and 45 shows the flow cytometry analysis of CD20 and CD21
expressing cells in peripheral blood of treated animals,
respectively. FIG. 46 shows the flow cytometry analysis of CD20
expressing cells in lymph nodes. Together, both phenotypes analysed
during the study indicate a strong and efficient B cell depletion
after administration of 2F2 and rituximab at 6.25 mg/kg/day (25
mg/kg in total) and 12.5 mg/kg/day (50 mg/kg in total). In
addition, data shows that repopulation of CD20 expressing cells in
the lymph nodes and peripheral blood of 2F2 treated animals
restarted approximately at day 75 post dosing of 25 mg/kg and 50
mg/kg, i.e., markedly later than in rituximab treated animals.
[0543] Furthermore, FIGS. 47A-C show the flow cytometric analysis
of CD20.sup.lowCD23.sup.+CD40.sup.high expressing cell
subpopulations in the peripheral blood (Y. Vugmeyster et al. (2003)
Cytometry 52A:101-109).
[0544] Peripheral blood cells obtained from either 2F2 or rituximab
treated monkeys at dose levels of 1.25 mg/kg (FIG. 47A), 6.25 mg/kg
(FIG. 47B), and 12.5 mg/kg (FIG. 47C) once daily by intravenous
infusion administrations for 4 consecutive days were incubated with
anti-human CD20 FITC murine monoclonal antibody (Coulter) at room
temperature for 10 min. Afterwards, count beads were added together
with PBS and the cells were washed twice (300 g for 10 min),
followed by immediate analysis of
CD20.sup.lowCD23.sup.+CD40.sup.high vs.
CD20.sup.highCD23.sup.+CD40.sup.high expressing cell subpopulation
in a flow cytometer (Beckman Coulter). Results of
CD20.sup.lowCD23.sup.+CD40.sup.high cells shown are expressed as
cells per .mu.l. As can be seen from the FIG. 47 2F2 was capable of
inducing a complete and longer depletion of
CD20.sup.low'CD23.sup.+CD40.sup.high expressing cells compared to
rituximab.
Example 14
Epitope Mapping Using Site-Directed Mutagenesis
[0545] Epitope mapping studies using a mutagenesis approach have
indicated that alanine at position 170 (A170) and proline at
position 172 (P172) in the second extracellular loop are critical
for the recognition of human CD20 by known anti-CD20 antibodies. In
studies by Deans and colleagues (M. J. Polyak, et al., Blood,
(2002) 99(9): pp 3256-3262; M. J. Polyak, et al., J. Immunol.,
(1998) 161(7): pp 3242-3248) the binding of all anti-CD20 mAbs
tested was abrogated by changing A170 and P172 into the
corresponding murine CD20 residues S170 and S172. Some
heterogeneity in the recognition of the A.times.P epitope has been
recognized however as most antibodies like rituximab recognize
murine CD20 with S170 and S172 mutated to the human A170.times.P172
sequence whereas some others require additional mutations
immediately N-terminal of the A.times.P sequence. To verify whether
the A170.times.P172 motive is also important for the binding of the
antibodies according to the invention the A.times.P sequence was
mutated into S.times.S using site-directed mutagenesis (A.times.P
mutant=A170S, P172S), cells were transfected with the A.times.P
mutant and wild-type (WT) CD20 DNA, and the binding characteristics
of the anti-CD20 mAbs were compared.
[0546] Further mutants were prepared, P172S (proline at position
172 mutated to serine), N166D (asparagine at position 166 mutated
to aspartic acid), and N163D (asparagine at position 163 mutated to
aspartic acid), using site-directed mutagenesis to evaluate whether
the mutated amino acid residues are important for binding of the
antibodies of the invention. To examine this, a CD20 expression
vector was constructed by amplifying the CD20 coding sequence using
suitable primers introducing restriction sites and an ideal Kozak
sequence for optimal expression. The amplified fragment was
digested and ligated in the expression vector pEE13.4. After
transformation in E. coli, colonies were screened for inserts and
two clones were selected for sequencing to confirm the correct
sequence. The construct was named pEE13.4CD20HS.
[0547] Mutagenesis was performed to introduce the A.times.P
mutation and to introduce 20 mouse mutations in the extracellular
loop regions of human CD20. Mutagenesis was checked by restriction
enzyme digestion and sequencing. The constructs were transiently
transfected in CHO cells (for A.times.P mutations) or HEK293F cells
and analyzed 24 or 48 hours post-transfection using flow
cytometry.
[0548] Oligonucleotide PCR Primers:
[0549] Oligonucleotide primers were synthesized and quantified by
Isogen BV (Maarssen, The Netherlands). Primers were reconstituted
in water in a concentration of 100 pmol/.mu.l and stored at
-20.degree. C. until required. A summary of PCR and sequencing
primers is shown in Table 3.
[0550] Optical Density Determination of Nucleic Acids:
[0551] Optical density was determined using an Ultrospec 2100 pro
Classic (Amersham Biosciences, Uppsala, Sweden) according to the
manufacturer's instructions. The DNA concentration was measured by
analysis of the OD.sub.260nm, where one OD.sub.260nm unit=50
.mu.g/ml. The reference solution was identical to the solution used
to dissolve the nucleic acids.
[0552] Plasmid DNA Isolation from E. coli Culture:
[0553] Plasmid DNA was isolated from E. coli cultures using kits
from Qiagen according to the manufacturer's instructions (Westburg
BV, Leusden, The Netherlands). For `bulk` plasmid preparation
either a Hi-Speed plasmid Maxi kit or a Hi-Speed plasmid Midi kit
were used (Qiagen). For a small scale plasmid preparation (i.e., 2
ml of E. coli culture) a Qiaprep Spin Miniprep Kit (Qiagen) was
used and the DNA eluted in 50 .mu.l TE (Tris-HCl 10 mM pH 8.0, EDTA
1 mM).
[0554] PCR Amplification:
[0555] PCR reactions were performed according to the manufacturer's
instructions for the Pfu-Turbo.COPYRGT. Hotstart DNA polymerase
(Stratagene, Amsterdam, The Netherlands). Each 20 .mu.l reaction
contained 1.times.PCR reaction buffer, 200 .mu.M mixed dNTPs, 6.7
pmol of each forward and reverse primer, approximately 1 ng
template DNA and 1 unit of Pfu-Turbo.COPYRGT. Hotstart DNA
polymerase. PCR reactions were performed on a T-gradient
Thermocycler 96 (Biometra GmbH, Goettingen, Germany) using a 30
cycle program of: +95.degree. C. for 2 min, followed by 30 cycles
of: +95.degree. C. for 30 sec, anneal: a gradient of 45-65.degree.
C. for 30 sec and extension: +72.degree. C. for 2 min, followed by
a final extension step of 10 min at 72.degree. C. and subsequent
storage at 4.degree. C. The completed reactions were analysed by
agarose gel electrophoresis.
[0556] Agarose Gel Electrophoresis:
[0557] Agarose gel electrophoresis was performed according to
Sambrook (Molecular Cloning Laboratory Manual, 3rd edition) using
gels of 50 ml, in 1.times.Tris/acetic acid/EDTA (TAE) buffer. DNA
was visualized by the inclusion of ethidium bromide in the gel and
observation under UV light. Gel images were recorded by a CCD
camera and an image analysis system (GeneGnome; Syngene, Cambridge,
UK).
[0558] Restriction Enzyme Digestions:
[0559] Restriction enzymes were supplied by New England Biolabs
(Beverly, Mass.) and used according to the supplier's
recommendations. In general, 100 ng was digested with 5 units of
enzyme(s) in appropriate buffer in a final volume of 10 .mu.l.
Reaction volumes were scaled up as appropriate. Digestions were
incubated for a minimum of 60 min at the manufacturer's recommended
temperature.
[0560] For fragments requiring double digestions with restriction
enzymes which have incompatible buffer or temperature requirements,
digestions were performed sequentially so as to offer favourable
conditions for each enzyme in turn.
[0561] Alkaline Phosphatase Treatment:
[0562] Shrimp alkaline phosphatase (USB, Cleveland, Ohio) was used
according to the supplier's recommendations. Alkaline phosphatase
removes 5'-phosphate groups from the ends of DNA fragments thereby
preventing self-ligation. This is of particular relevance when self
re-ligation of a DNA fragment could result in a
replication-competent vector. The enzyme is active in most
restriction enzyme buffers and was added as appropriate. After the
digestion, the enzyme was inactivated by raising the temperature to
70.degree. C. for 15 min.
[0563] Purification of PCR and Restriction Enzyme Reaction
Products:
[0564] Purification was carried out using the mini-elute PCR
Purification kit (supplied by Qiagen), according to the
manufacturer's instructions. Briefly, DNA samples were diluted in 5
volumes of binding buffer I (Qiagen) and loaded onto a mini-elute
column within an Eppendorf centrifuge tube. The assembly was
centrifuged in a bench-top microcentrifuge. The column was washed
twice with buffer II (Qiagen): Following buffer application, the
assembly was centrifuged and the flow-through was discarded. The
column was dried by centrifugation in the absence of added buffer.
DNA was eluted by adding elution buffer to the column and the
eluate collected by centrifugation. Isolated DNA was quantified by
UV spectroscopy and quality assessed by agarose gel
electrophoresis.
[0565] Isolation of DNA Fragments from Agarose Gel:
[0566] Where appropriate (i.e., when multiple fragments were
present), digested DNA samples were separated by gel
electrophoresis and the desired fragment excised from the gel and
recovered using the QIAEX II gel extraction kit (Qiagen), according
to the manufacturer's instructions. Briefly, DNA bands were excised
from the agarose gel and melted in an appropriate buffer at
+55.degree. C. QIAEX II resin was added and incubated for 5 min.
QIAEX II resin was pelleted by a short centrifugation step (1 min,
14000 g, RT) and washed twice with 500 .mu.l of wash buffer PE. The
final pellet was dried in a hood and DNA was eluted with the
appropriate volume of TE and temperature (depending on the size of
the DNA).
[0567] Ligation of DNA Fragments:
[0568] Ligations were performed with the Quick Ligation Kit (New
England Biolabs) according to the manufacturer's instructions. For
each ligation, the vector DNA was mixed with approximately 3-fold
molar excess of insert DNA such that the total amount of DNA was
lower than 200 ng in 10 .mu.l, with volume adjusted with water as
appropriate. To this was added 10 .mu.l 2.times.Quick Ligation
Buffer and 1 .mu.l Quick T4 DNA ligase and the ligation mix was
incubated for 5-30 min at room temperature.
[0569] Transformation of DNA into Bacteria:
[0570] Samples of DNA were used to transform One Shot
DH5.alpha.-T1R competent E. coli cells (Invitrogen, Breda, The
Netherlands) using the heat-shock method according to the
manufacturer's instructions. Briefly, 1-5 .mu.l of DNA solution
(typically 2 .mu.l of DNA ligation mix) was added to an aliquot of
transformation-competent bacterial cells and the mixture incubated
on ice for 30 min. The cells were then heat-shocked by transferring
to a waterbath at 42.degree. C. for 30 sec followed by a further
incubation on ice for 5 min. Cells were left to recover by
incubation in a non-selective culture medium (SOC) for 1 hour with
agitation at 37.degree. C. and were subsequently spread onto agar
plates containing appropriate selective agent (ampicillin at 50
.mu.g/ml). Plates were incubated for 16-18 hours at +37.degree. C.
or until colonies of bacteria became evident.
[0571] Screening of Bacterial Colonies by PCR:
[0572] Bacterial colonies were screened for the presence of vectors
containing the desired sequences using the PCR colony screening
technique. 20 .mu.l of PCR reaction mix containing 0.5 volumes of
HotStarTaq Master Mix (Qiagen), 4 pmol of the forward and reverse
primers and completed with water was added to a PCR tube. A colony
was lightly touched with a 20 .mu.l pipet tip, once touched in 2 ml
LB in a culture tube (for growing bacteria containing the
corresponding plasmid) and resuspended in the 20 .mu.l PCR mix. PCR
was performed on a T-gradient Thermocycler 96 (Biometra) using a 35
cycle program of: +95.degree. C. for 15 min, followed by 35 cycles
of: +94.degree. C. for 30 sec, anneal: 55.degree. C. for 30 sec and
extension: +72.degree. C. for 2 min, followed by a final extension
step of 10 min at 72.degree. C. and subsequent storage at 4.degree.
C. The completed reactions were analyzed by agarose gel
electrophoresis. See Table 3 for details of primer pairs used for
colony PCR.
[0573] DNA Sequencing:
[0574] Plasmid DNA samples were send to AGOWA (Berlin, Germany) for
sequence analysis. Sequences were analyzed using the Vector NTI
software package (Informax, Frederick, Md., USA).
TABLE-US-00008 TABLE 3 Name Application Length Oligo Sequence
CD20P172S CD20 mutagenesis 36
TGGGGAGTTTTTCTCAGAGGAATTCGATGGTTCACAGTTGTA CD20N166D CD20
mutagenesis 39 TGTAACAGTATTGGGTAGATGGG CD20N163D CD20 mutagenesis
36 AATCATGGACATACTTAATATTA cd20exfor CD20 construction 41
TATAGCCCGGGGCCGCCACCATGACAACACCCAGAAATTCA cd20exrev CD20
construction 38 GCGTCTCATGTACATTAAGGAGAGCTGTCATTTTCTAT
pee13.4seqrev2 Colony PCR 23 TCGGACATCTCATGACTTTCTTT pConKseq 1
Colony PCR 23 GTAGTCTGAGCAGTACTCGTTGC cd20hsapmutr (AxP) CD20
mutagenesis 42 TGGGGAGTTTTTCTCAGAGGAATTCGATGGTTCACAGTTGTA
cd20hsapmutf (AxP) CD20 mutagenesis 42
TACAACTGTGAACCATCGAATTCCTCTGAGAAAAACTCCCCA CD20seq2 CD20 sequencing
23 TGTAACAGTATTGGGTAGATGGG cd20seq1 CD20 sequencing 23
AATCATGGACATACTTAATATTA
[0575] Mutagenesis:
[0576] The mutagenesis was performed, using either the
QuikChange.RTM. XL Site-Directed Mutagenesis kit (Cat 200517-5, Lot
1120630, Stratagene Europe) according to the manufacturer's
instructions.
[0577] Mutagenesis reactions were concentrated using ethanol
precipitation and transformed into either oneshot DH5.alpha.-T1R
competent E. coli cells or electroporated into ElectroTen-Blue.RTM.
Electroporation-Competent Cells. Colonies were checked by colony
PCR and restriction digestion prior to transfection.
[0578] HEK293F Cell Transfection:
[0579] HEK293F cells were obtained from Invitrogen and transfected
according to the manufacturer's instructions, using 293fectin. The
HEK293F cells were used for all the single mutant sequences.
[0580] CHO Cell Transfection:
[0581] CHO cells grown to approximately 95% confluence were
transiently transfected with CD20 wild-type, mutant cDNA or a
combination of both constructs using lipofectamine 2000 (M668-019,
Invitrogen, Breda, Netherlands). To this end, 24 .mu.g precipitated
DNA was diluted (1 .mu.g/p1) in 500 .mu.l optimem, in ratios of
A.times.P 100%:WT 0%; A.times.P 33.3%:WT 66.6%; A.times.P 66.6%:WT
33.3%; A.times.P 0%:WT 100%. For each transfection 24 .mu.l
lipofectamine was diluted in 500 .mu.l optimem. Then, the diluted
lipofectamine was incubated (RT, 5 min), and the diluted DNA
combined with the diluted lipofectamine. After gently mixing and
incubating the solution (RT, 20 min), 1000 .mu.l DNA/lipofectamine
was added to the CHO cells, thoroughly mixed and incubated for 48
hours at 37.degree. C., 5% CO.sub.2. Two days after transfection of
CHO cells, cells were washed twice with FACS buffer (PBS
supplemented with 0.1% BSA and 0.002% NaN.sub.3). CHO cells were
treated with trypsin/EDTA (Gibco BRL, Life Technologies, Paisley,
Scotland) and lifted off the culture plates.
[0582] Anti-CD20 Antibody Binding:
[0583] HEK293F cells and CHO cells were taken up in PBS in a
concentration of 2.times.10.sup.6/ml, and added to round bottom
plates (1.times.10.sup.5/well). Then, 50 .mu.l CD20 mAb was added,
in serial dilutions of 10, 5, 2.5, or 0 .mu.g per well (4.degree.
C., 30 min). After washing in FACS buffer (PBS supplemented with
0.1% BSA and 0.002% NaN.sub.3), the cells were analyzed on a flow
cytometer (Becton Dickinson, San Diego, Calif., USA), and 5,000
events per sample were acquired at high flow rate.
[0584] As can be seen from FIGS. 48A-E, all anti-CD20 mAbs bound
efficiently to CHO cells expressing WT CD20. As expected, rituximab
did not bind the A.times.P mutant (FIG. 48A), and B1 bound this
mutant poorly (FIG. 48D). Both 2F2 and 11B8 in contrast bound to WT
and A.times.P mutant CD20 equally well (FIG. 48B and FIG. 48C).
Titrating the amount of WT CD20 on the surface indeed titrated the
binding of rituximab and B 1. Both 2F2 and 11B8 again were
insensitive to the absence or presence of the mutation.
[0585] This study indicates that the binding of 2F2 and 11B8 to
human CD20 is insensitive to mutations at amino acid positions 170
and 172. 2F2 and 11B8 therefore represent a new class of CD20 mAbs
recognizing a novel CD20 epitope.
[0586] FIG. 49A shows percentage binding of 2F2, 11B8T, B1 or
rituximab to mutant P172S vs. WT CD20, FIG. 49B shows percentage
binding of 2F2T, 11B8T, B1, CAT (CAT 13.6E12, a mouse monoclonal
IgG2A anti-CD20 antibody, Diatec.Com), a control isotype antibody
(KLH), or rituximab to mutant CD20 (A.times.P) vs. WT CD20.
[0587] For the mutant wherein asparagine at position 166 has been
replaced with aspartic acid (CD20N166D) 2F2 showed very low
binding, whereas B1, rituximab and 11B8T were able to bind, see
FIG. 49C. In a similar experiment CAT 13.6E12 and rituximab were
able to bind to CD20N166D, whereas 2F2T only showed very low
binding, see FIG. 49D. For the mutant wherein asparagine at
position 163 has been replaced by aspartic acid (CD20N163D) again
rituximab, 11B8T, and B1 were able to bind to CD20N163D, whereas
2F2 and 2F2T only showed very low binding, see FIG. 49E. In a
similar experiment CAT 13.6E12 and rituximab were able to bind to
CD20N163D, whereas 2F2T only showed very low binding, see FIG.
49F.
[0588] These experiments indicate that 2F2 and 11B8 bind to
different epitopes.
Example 15
Epitope Mapping Using Pepscan Method
[0589] Synthesis of Peptides:
[0590] 7-, 9-, and 15-mer peptides were synthesized according to
standard methods. In some cases chemical linkage of the legs of a
15-mer peptide helps to identify amino acid sequences of a
potentially discontinuous epitope. According to known procedures
(H. M. Geysen et al. (1984) Proc. Natl. Acad. Sci. USA, 81:3998; J.
W. Slootstra et al. (1996) Mol. Divers. 1:87; and WO 01/60769), 7-,
9-, and 15-mer peptides were synthesized that could be possible
binding sites or epitopes involved in binding of 2F2 or 11B8 to the
human CD20 molecule. The 9- and 15-mers were synthesized as loops
and screened using credit-card format mini-PEPSCAN cards (455
peptide format/card). In all looped peptides amino acids at varied
positions were replaced by a cysteine (e.g.,
acetyl-XCXXXXXXXXXXXCX-minicard). The peptides were synthesized
using standard Fmoc-chemistry and deprotected using TFA with
scavengers. Subsequently, the deprotected peptides were reacted on
the microarray with an 0.5 mM solution of
1,3-bis(bromomethyl)-benzene in ammonium bicarbonate (20 mM, pH
7.9), supplemented with acetonitrile (1:1 (v/v)). The microarrays
were gently shaken in the solution for 30-60 mM, while completely
covered in the solution. Finally, the microarrays were washed
extensively with excess of Millipore H.sub.2O and sonicated in
disrupt-buffer containing 1% sodium dodecylsulfate, 0.1%
.beta.-mercaptoethanol, in PBS (pH 7.2) at 70.degree. C. for 30
min, followed by sonication in millipore H.sub.2O for another 45
mM. Subsequently, the microwells were ready for screening in an
ELISA-assay.
[0591] Pepscan ELISA-Assay:
[0592] The 455-well credit card-format polyethylene cards,
containing the covalently linked peptides, were incubated with
serum (diluted 1:1000 in blocking solution which contains 5% horse
serum (v/v) and 5% ovalbumin (w/v)) (4.degree. C., over night).
After washing, the peptides were incubated with anti-human antibody
peroxidase (dilution 1:1000, 1 hour, 25.degree. C.), and after
washing the peroxidase substrate,
2,2'-azino-di-3-ethylbenzthiazoline sulfonate and 2 .mu.l/m 3%
H.sub.2O.sub.2 were added. After one hour, the color development
was measured. The color development of the ELISA was quantified
with a CCD-camera and an image processing system. The set up
consists of a CCD-camera and a 55 mm lens (Sony CCD Video Camera
XC-77RR, Nikon micro-nikk or 55 mm f/2.8 lens), a camera adaptor
(Sony Camera adaptor DC-77RR) and the Image Processing Software
package Optimas, version 6.5 (Media Cybernetics, Silver Spring, Md.
20910, U.S.A.). Optimas runs on a pentium II computer system.
[0593] The absorbances (OD values) for the peptides at different
antibody concentrations are shown in below Table 4 and Table 5.
TABLE-US-00009 TABLE 4 11B8 11B8 7D8 7D8 rituximab 2F2 2F2 B1 B1 10
100 10 100 10 10 100 10 100 .mu.g/ml .mu.g/ml .mu.g/ml .mu.g/ml
.mu.g/ml .mu.g/ml .mu.g/ml .mu.g/ml .mu.g/ml KMECLNFIRAHCPYI 763
2997 134 41 90 48 66 147 304 LKMECLNFIRCHTPY 165 738 160 41 120 49
87 179 216 KMESCNFIRACTPYI 625 3090 142 52 123 39 78 170 308
MESLCFIRAHCPYIN 179 956 127 55 102 41 65 119 178 CFIRAHTPC 188 534
181 69 134 91 114 170 212 CIRAHTPYC 151 449 186 60 132 57 92 151
195 CRAHTPYIC 427 1605 188 64 145 48 87 179 216 CAHTPYINC 179 452
174 65 125 42 106 161 172 IPAGIYA 217 950 164 76 177 48 85 165 192
PAGIYAP 449 2501 170 64 111 43 85 165 300 AGIYAPI 251 2207 188 73
110 44 98 187 143 GIYAPIC 99 251 152 64 141 34 93 177 147 IYAPICV
137 313 174 58 159 58 99 175 90 GIYAPIA 172 857 177 96 156 62 96
165 121 IYAPIAV 161 654 181 58 116 62 76 161 106
TABLE-US-00010 TABLE 5 11B8 7D8 rituximab 2F2 10 10 10 10 .mu.g/ml
.mu.g/ml .mu.g/ml .mu.g/ml PCINIYNAEPANPCE 118 163 152 65
YCNIYNAEPANPSCK 287 181 2418 86 ICIYNAEPANPSECN 138 192 142 78
NCYNAEPANPSEKCS 93 121 2649 49 ICNAEPANPSEKNCP 115 165 3283 43
YCAEPANPSEKNSCS 106 188 3770 65 NCEPANPSEKNSPCT 159 183 3476 61
ACPANPSEKNSPSCQ 146 148 250 77 ECANPSEKNSPSTCY 134 179 188 68
[0594] As appears from Table 4, 11B8 showed binding to AGIYAP of
the small first extracellular loop of human CD20 at both 10
.mu.g/ml and 100 .mu.g/ml, whereas the other antibodies tested did
not show significant binding to AGIYAP.
[0595] Furthermore, 11B8 showed binding to MESLNFIRAHTPYI of the
second extracellular loop of human CD20 at both 10 .mu.g/ml and 100
.mu.g/ml, whereas the other antibodies tested did not show
significant binding to MESLNFIRAHTPYI.
[0596] As appears from Table 5, rituximab showed binding to
EPANPSEK of the second extracellular loop of human CD20 at both 1
.mu.g/ml and 10 .mu.g/ml, whereas the other antibodies tested did
not show significant binding to EPANPSEK.
Example 16
Anti-idiotypic antibodies
[0597] Generation of Anti-Idiotypic Antibodies:
[0598] Mouse anti-idiotypic antibodies were made by immunizing
Balb/C mice with 2F2 or 11B8T, and generating hybridomas from
spleens of these mice by fusion with NS1 myeloma cells using
standard techniques. The following anti-idiotypic antibodies were
generated: anti-2F2 sab 1.1, anti-2F2 sab 1.2, anti-2F2 sab 1.3,
anti-11B8T sab 2.2, anti-11B8T sab 2.3, anti-11B8T sab 2.4,
anti-11B8T sab 2.5, and anti-11B8T sab 2.6. These were tested for
specific binding to 2F2T, 7D8 and 11B8T. ELISA plates were coated
with purified 2F2T, 7D8 or 11B8T (diluted in PBS to a final
concentration of 1-2 .mu.g/ml, 37.degree. C., 2 hours). Plates were
blocked with PBS containing 0.05% Tween-20 and 2% chicken serum
(RT, 1 hour). Subsequently, the plates were incubated with
supernatants from cultures of the anti-idiotypic antibodies (final
concentration adjusted to 1-10 RT, 2 hours). Bound mouse
anti-idiotypic antibodies were detected with rabbit-anti-mouse
IgG-HRP conjugated antibody (Jackson ImmunoResearch).
[0599] As shown in FIG. 50 anti-2F2 sab 1.1, anti-2F2 sab 1.2, and
anti-2F2 sab 1.3 bind to 2F2T and 7D8, but not to 11B8T or an
unrelated, isotype control human antibody. Since 2F2T and 7D8 are
very homologous in V.sub.L and V.sub.H sequence, reaction of
anti-2F2 idiotypic antibodies with 7D8 was expected.
[0600] FIG. 51 shows that anti-11B8T sab 2.2, anti-11B8T sab 2.3,
anti-11B8T sab 2.4, anti-11B8T sab 2.5, and anti-11B8T sab 2.6 all
bind to 11B8T to a similar extent.
[0601] Anti-Idiotypic Antibodies as an Immunodiagnostic Tool:
[0602] The 2F2/7D8 and 11B8T specific anti-idiotypic antibodies can
be used as an immunodiagnostic tool to detect and quantify levels
of human monoclonal antibodies against CD20 in laboratory or
patient samples. This may be useful for examining pharmakokinetics
of the anti-CD20 antibody or for determining and adjusting the
dosage of the anti-CD20 antibody and for monitoring the disease and
the effect of treatment in a patient. As an example of such an
assay, ELISA plates were coated with 4 .mu.g/ml anti-2F2 sab 1.1,
anti-2F2 sab 1.2 or anti-2F2 sab 1.3. Plates were blocked with PBS
containing 0.05% Tween-20 and 2% chicken serum (RT, 1 hour).
Subsequently, the plates were incubated with a serial dilution of
2F2T (10,000-9.77 ng/ml, RT, 2 hours). Bound 2F2T was detected with
mouse-anti-human IgG HRP-conjugated antibody. As shown in FIGS.
52A-C a dose dependent binding of 2F2T was observed.
EQUIVALENTS
[0603] Those skilled in the art will recognize or be able to
ascertain, using no more than routine experimentation, many
equivalents of the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims. Any combination of the embodiments disclosed in
the dependent claims are also contemplated to be within the scope
of the invention.
INCORPORATION BY REFERENCE
[0604] All patents, pending patent applications and other
publications cited herein are hereby incorporated by reference in
their entirety.
Sequence CWU 1
1
951424DNAHomo sapiens 1atggagttgg gactgagctg gattttcctt ttggctattt
taaaaggtgt ccagtgtgaa 60gtgcagctgg tggagtctgg gggaggcttg gtacagcctg
gcaggtccct gagactctcc 120tgtgcagcct ctggattcac ctttaatgat
tatgccatgc actgggtccg gcaagctcca 180gggaagggcc tggagtgggt
ctcaactatt agttggaata gtggttccat aggctatgcg 240gactctgtga
agggccgatt caccatctcc agagacaacg ccaagaagtc cctgtatctg
300caaatgaaca gtctgagagc tgaggacacg gccttgtatt actgtgcaaa
agatatacag 360tacggcaact actactacgg tatggacgtc tggggccaag
ggaccacggt caccgtctcc 420tcag 4242122PRTHomo sapiens 2Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1 5 10 15 Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn Asp Tyr 20 25
30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45 Ser Thr Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp
Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Lys Ser Leu Tyr65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Lys Asp Ile Gln Tyr Gly Asn
Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val
Thr Val Ser Ser 115 120 3382DNAHomo sapiens 3atggaagccc cagctcagct
tctcttcctc ctgctactct ggctcccaga taccaccgga 60gaaattgtgt tgacacagtc
tccagccacc ctgtctttgt ctccagggga aagagccacc 120ctctcctgca
gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct
180ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg
catcccagcc 240aggttcagtg gcagtgggtc tgggacagac ttcactctca
ccatcagcag cctagagcct 300gaagattttg cagtttatta ctgtcagcag
cgtagcaact ggccgatcac cttcggccaa 360gggacacgac tggagattaa ac
3824107PRTHomo sapiens 4Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu
Ser Leu Ser Pro Gly1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Gln Ser Val Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Asn
Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75 80 Glu
Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Ile 85 90
95 Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 5424DNAHomo
sapiens 5atggagttgg gactgagctg gattttcctt ttggctattt taaaaggtgt
ccagtgtgaa 60gtgcagctgg tggagtctgg gggaggcttg gtacagcctg acaggtccct
gagactctcc 120tgtgcagcct ctggattcac ctttcatgat tatgccatgc
actgggtccg gcaagctcca 180gggaagggcc tggagtgggt ctcaactatt
agttggaata gtggtaccat aggctatgcg 240gactctgtga agggccgatt
caccatctcc agagacaacg ccaagaactc cctgtatctg 300caaatgaaca
gtctgagagc tgaggacacg gccttgtatt actgtgcaaa agatatacag
360tacggcaact actactacgg tatggacgtc tggggccaag ggaccacggt
caccgtctcc 420tcag 4246122PRTHomo sapiens 6Glu Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Val Gln Pro Asp Arg1 5 10 15 Ser Leu Arg Leu
Ser Cys Ala Ala Ser Gly Phe Thr Phe His Asp Tyr 20 25 30 Ala Met
His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45
Ser Thr Ile Ser Trp Asn Ser Gly Thr Ile Gly Tyr Ala Asp Ser Val 50
55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu
Tyr65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu
Tyr Tyr Cys 85 90 95 Ala Lys Asp Ile Gln Tyr Gly Asn Tyr Tyr Tyr
Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser
Ser 115 120 7382DNAHomo sapiens 7atggaagccc cagctcagct tctcttcctc
ctgctactct ggctcccaga taccaccgga 60gaaattgtgt tgacacagtc tccagccacc
ctgtctttgt ctccagggga aagagccacc 120ctctcctgca gggccagtca
gagtgttagc agctacttag cctggtacca acagaaacct 180ggccaggctc
ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc
240aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag
cctagagcct 300gaagattttg cagtttatta ctgtcagcag cgtagcaact
ggccgatcac cttcggccaa 360gggacacgac tggagattaa ac 3828107PRTHomo
sapiens 8Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser
Pro Gly1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser
Val Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Asn Arg Ala Thr
Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75 80 Glu Asp Phe Ala
Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Ile 85 90 95 Thr Phe
Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 9433DNAHomo sapiens
9atggagttgg ggctgagctg ggttttcctt gttgctatat taaaaggtgt ccagtgtgag
60gttcagctgg tgcagtctgg gggaggcttg gtacatcctg gggggtccct gagactctcc
120tgtacaggct ctggattcac cttcagttac catgctatgc attgggttcg
ccaggctcca 180ggaaaaggtc tggaatgggt atcaattatt gggactggtg
gtgtcacata ctatgcagac 240tccgtgaagg gccgattcac catctccaga
gacaatgtca agaactcctt gtatcttcaa 300atgaacagcc tgagagccga
ggacatggct gtgtattact gtgcaagaga ttactatggt 360gcggggagtt
tttatgacgg cctctacggt atggacgtct ggggccaagg gaccacggtc
420accgtctcct cag 43310125PRTHomo sapiens 10Glu Val Gln Leu Val Gln
Ser Gly Gly Gly Leu Val His Pro Gly Gly1 5 10 15 Ser Leu Arg Leu
Ser Cys Thr Gly Ser Gly Phe Thr Phe Ser Tyr His 20 25 30 Ala Met
His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45
Ser Ile Ile Gly Thr Gly Gly Val Thr Tyr Tyr Ala Asp Ser Val Lys 50
55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Val Lys Asn Ser Leu Tyr
Leu65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val Tyr
Tyr Cys Ala 85 90 95 Arg Asp Tyr Tyr Gly Ala Gly Ser Phe Tyr Asp
Gly Leu Tyr Gly Met 100 105 110 Asp Val Trp Gly Gln Gly Thr Thr Val
Thr Val Ser Ser 115 120 125 11382DNAHomo sapiens 11atggaagccc
cagcacagct tctcttcctc ctgctactct ggctcccaga taccaccgga 60gaaattgtgt
tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc
120ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca
acagaaacct 180ggccaggctc ccaggctcct catctatgat gcatccaaca
gggccactgg catcccagcc 240aggttcagtg gcagtgggtc tgggacagac
ttcactctca ccatcagcag cctagagcct 300gaagattttg cagtttatta
ctgtcagcag cgtagcgact ggccgctcac tttcggcgga 360gggaccaagg
tggagatcaa ac 38212107PRTHomo sapiens 12Glu Ile Val Leu Thr Gln Ser
Pro Ala Thr Leu Ser Leu Ser Pro Gly1 5 10 15 Glu Arg Ala Thr Leu
Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr 20 25 30 Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr
Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55
60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu
Pro65 70 75 80 Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asp
Trp Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 135PRTHomo sapiens 13Asp Tyr Ala Met His1 5 1417PRTHomo
sapiens 14Thr Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser
Val Lys1 5 10 15 Gly1513PRTHomo sapiens 15Asp Ile Gln Tyr Gly Asn
Tyr Tyr Tyr Gly Met Asp Val1 5 10 1611PRTHomo sapiens 16Arg Ala Ser
Gln Ser Val Ser Ser Tyr Leu Ala1 5 10 177PRTHomo sapiens 17Asp Ala
Ser Asn Arg Ala Thr1 5 189PRTHomo sapiens 18Gln Gln Arg Ser Asn Trp
Pro Ile Thr1 5 195PRTHomo sapiens 19Asp Tyr Ala Met His1 5
2017PRTHomo sapiens 20Thr Ile Ser Trp Asn Ser Gly Thr Ile Gly Tyr
Ala Asp Ser Val Lys1 5 10 15 Gly2113PRTHomo sapiens 21Asp Ile Gln
Tyr Gly Asn Tyr Tyr Tyr Gly Met Asp Val1 5 10 2211PRTHomo sapiens
22Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala1 5 10 237PRTHomo
sapiens 23Asp Ala Ser Asn Arg Ala Thr1 5 249PRTHomo sapiens 24Gln
Gln Arg Ser Asn Trp Pro Ile Thr1 5 255PRTHomo sapiens 25Tyr His Ala
Met His1 5 2616PRTHomo sapiens 26Ile Ile Gly Thr Gly Gly Val Thr
Tyr Tyr Ala Asp Ser Val Lys Gly1 5 10 15 2717PRTHomo sapiens 27Asp
Tyr Tyr Gly Ala Gly Ser Phe Tyr Asp Gly Leu Tyr Gly Met Asp1 5 10
15 Val2811PRTHomo sapiens 28Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu
Ala1 5 10 297PRTHomo sapiens 29Asp Ala Ser Asn Arg Ala Thr1 5
309PRTHomo sapiens 30Gln Gln Arg Ser Asp Trp Pro Leu Thr1 5
3132DNAArtificial SequencePrimer 31gcaggcacac aacagaggca gttccagatt
tc 323228DNAArtificial SequencePrimer 32gctgtgcccc cagaggtgct
cttggagg 283320DNAArtificial SequencePrimer 33caggtncagc tggtgcagtc
203420DNAArtificial SequencePrimer 34naggtgcagc tgntggagtc
203520DNAArtificial SequencePrimer 35gaggtgcagc tggtgcagtc
203621DNAArtificial SequencePrimer 36atggactgga cctggagcat c
213720DNAArtificial SequencePrimer 37atggaattgg ggctgagctg
203820DNAArtificial SequencePrimer 38atggagtttg gnctgagctg
203921DNAArtificial SequencePrimer 39atgaaacacc tgtggttctt c
214020DNAArtificial SequencePrimer 40atggggtcaa ccgccatcct
204121DNAArtificial SequencePrimer 41tgccaggggg aagaccgatg g
214220DNAArtificial SequencePrimer 42nacatccaga tganccagtc
204320DNAArtificial SequencePrimer 43gncatcnnga tgacccagtc
204420DNAArtificial SequencePrimer 44gatattgtga tgacccagac
204520DNAArtificial SequencePrimer 45gaaattgtgt tgacncagtc
204620DNAArtificial SequencePrimer 46gaaatngtna tgacacagtc
204720DNAArtificial SequencePrimer 47gatgttgtga tgacacagtc
204820DNAArtificial SequencePrimer 48gaaattgtgc tgactcagtc
204924DNAArtificial SequencePrimer 49cccgctcagc tcctggggct cctg
245023DNAArtificial SequencePrimer 50ccctgctcag ctcctggggc tgc
235126DNAArtificial SequencePrimer 51cccagcgcag cttctcttcc tcctgc
265227DNAArtificial SequencePrimer 52atggaaccat ggaagcccca gcacagc
275320DNAArtificial SequencePrimer 53cgggaagatg aagacagatg
2054116PRTHomo sapiens 54Met Glu Leu Gly Leu Ser Trp Val Phe Leu
Val Ala Ile Leu Glu Gly1 5 10 15 Val Gln Cys Glu Val Gln Leu Val
Gln Ser Gly Gly Gly Leu Val His 20 25 30 Pro Gly Gly Ser Leu Arg
Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe 35 40 45 Ser Ser Tyr Ala
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60 Glu Trp
Val Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala Asp65 70 75 80
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser 85
90 95 Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val
Tyr 100 105 110 Tyr Cys Ala Arg 115 55139PRTHomo sapiens 55Met Glu
Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro1 5 10 15
Asp Thr Thr Gly Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser 20
25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln
Ser 35 40 45 Val Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly
Gln Ala Pro 50 55 60 Arg Leu Leu Ile Tyr Asp Ala Ser Asn Arg Ala
Thr Gly Ile Pro Ala65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Glu Pro Glu Asp Phe
Ala Val Tyr Tyr Cys Gln Gln Arg Ser 100 105 110 Asn Trp Pro Leu Thr
Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 115 120 125 Thr Val Ala
Ala Pro Ser Val Phe Ile Phe Pro 130 135 56141PRTHomo sapiens 56Met
Glu Leu Gly Leu Ser Trp Ile Phe Leu Leu Ala Ile Leu Lys Gly1 5 10
15 Val Gln Cys Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln
20 25 30 Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe 35 40 45 Asp Asp Tyr Ala Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu 50 55 60 Glu Trp Val Ser Gly Ile Ser Trp Asn Ser
Gly Ser Ile Gly Tyr Ala65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ala Lys Asn 85 90 95 Ser Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu 100 105 110 Tyr Tyr Cys Ala
Lys Asp Ile Asp Tyr Tyr Tyr Tyr Tyr Tyr Gly Met 115 120 125 Asp Val
Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 130 135 140
57127PRTHomo sapiens 57Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu
Leu Leu Trp Leu Pro1 5 10 15 Asp Thr Thr Gly Glu Ile Val Leu Thr
Gln Ser Pro Ala Thr Leu Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala
Thr Leu Ser Cys Arg Ala Ser Gln Ser 35 40 45 Val Ser Ser Tyr Leu
Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro 50 55 60 Arg Leu Leu
Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala65 70 75 80 Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90
95 Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser
100 105 110 Asn Trp Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile
Lys 115 120 125 5842DNAArtificial SequencePrimer 58tggggagttt
ttctcagagg aattcgatgg ttcacagttg ta 425923DNAArtificial
SequencePrimer 59tgtaacagta ttgggtagat ggg 236023DNAArtificial
SequencePrimer 60aatcatggac atacttaata tta 236141DNAArtificial
SequencePrimer 61tatagcccgg ggccgccacc atgacaacac ccagaaattc a
416238DNAArtificial SequencePrimer 62gcgtctcatg tacattaagg
agagctgtca ttttctat 386323DNAArtificial SequencePrimer 63tcggacatct
catgactttc ttt
236423DNAArtificial SequencePrimer 64gtagtctgag cagtactcgt tgc
236542DNAArtificial SequencePrimer 65tggggagttt ttctcagagg
aattcgatgg ttcacagttg ta 426642DNAArtificial SequencePrimer
66tacaactgtg aaccatcgaa ttcctctgag aaaaactccc ca
426723DNAArtificial SequencePrimer 67tgtaacagta ttgggtagat ggg
236823DNAArtificial SequencePrimer 68aatcatggac atacttaata tta
236915PRTArtificial SequenceSynthetic peptide 69Lys Met Glu Cys Leu
Asn Phe Ile Arg Ala His Cys Pro Tyr Ile1 5 10 15 7015PRTArtificial
SequenceSynthetic peptide 70Leu Lys Met Glu Cys Leu Asn Phe Ile Arg
Cys His Thr Pro Tyr1 5 10 15 7115PRTArtificial SequenceSynthetic
peptide 71Lys Met Glu Ser Cys Asn Phe Ile Arg Ala Cys Thr Pro Tyr
Ile1 5 10 15 7215PRTArtificial SequenceSynthetic peptide 72Met Glu
Ser Leu Cys Phe Ile Arg Ala His Cys Pro Tyr Ile Asn1 5 10 15
739PRTArtificial SequenceSynthetic peptide 73Cys Phe Ile Arg Ala
His Thr Pro Cys1 5 749PRTArtificial SequenceSynthetic peptide 74Cys
Ile Arg Ala His Thr Pro Tyr Cys1 5 759PRTArtificial
SequenceSynthetic peptide 75Cys Arg Ala His Thr Pro Tyr Ile Cys1 5
769PRTArtificial SequenceSynthetic peptide 76Cys Ala His Thr Pro
Tyr Ile Asn Cys1 5 777PRTArtificial SequenceSynthetic peptide 77Ile
Pro Ala Gly Ile Tyr Ala1 5 787PRTArtificial SequenceSynthetic
peptide 78Pro Ala Gly Ile Tyr Ala Pro1 5 797PRTArtificial
SequenceSynthetic peptide 79Ala Gly Ile Tyr Ala Pro Ile1 5
807PRTArtificial SequenceSynthetic peptide 80Gly Ile Tyr Ala Pro
Ile Cys1 5 817PRTArtificial SequenceSynthetic peptide 81Ile Tyr Ala
Pro Ile Cys Val1 5 827PRTArtificial SequenceSynthetic peptide 82Gly
Ile Tyr Ala Pro Ile Ala1 5 837PRTArtificial SequenceSynthetic
peptide 83Ile Tyr Ala Pro Ile Ala Val1 5 8415PRTArtificial
SequenceSynthetic peptide 84Pro Cys Ile Asn Ile Tyr Asn Ala Glu Pro
Ala Asn Pro Cys Glu1 5 10 15 8515PRTArtificial SequenceSynthetic
peptide 85Tyr Cys Asn Ile Tyr Asn Ala Glu Pro Ala Asn Pro Ser Cys
Lys1 5 10 15 8615PRTArtificial SequenceSynthetic peptide 86Ile Cys
Ile Tyr Asn Ala Glu Pro Ala Asn Pro Ser Glu Cys Asn1 5 10 15
8715PRTArtificial SequenceSynthetic peptide 87Asn Cys Tyr Asn Ala
Glu Pro Ala Asn Pro Ser Glu Lys Cys Ser1 5 10 15 8815PRTArtificial
SequenceSynthetic peptide 88Ile Cys Asn Ala Glu Pro Ala Asn Pro Ser
Glu Lys Asn Cys Pro1 5 10 15 8915PRTArtificial SequenceSynthetic
peptide 89Tyr Cys Ala Glu Pro Ala Asn Pro Ser Glu Lys Asn Ser Cys
Ser1 5 10 15 9015PRTArtificial SequenceSynthetic peptide 90Asn Cys
Glu Pro Ala Asn Pro Ser Glu Lys Asn Ser Pro Cys Thr1 5 10 15
9115PRTArtificial SequenceSynthetic peptide 91Ala Cys Pro Ala Asn
Pro Ser Glu Lys Asn Ser Pro Ser Cys Gln1 5 10 15 9215PRTArtificial
SequenceSynthetic peptide 92Glu Cys Ala Asn Pro Ser Glu Lys Asn Ser
Pro Ser Thr Cys Tyr1 5 10 15 936PRTArtificial SequenceSynthetic
peptide 93Ala Gly Ile Tyr Ala Pro1 5 9414PRTArtificial
SequenceSynthetic peptide 94Met Glu Ser Leu Asn Phe Ile Arg Ala His
Thr Pro Tyr Ile1 5 10 958PRTArtificial SequenceSynthetic peptide
95Glu Pro Ala Asn Pro Ser Glu Lys1 5
* * * * *
References