DNA VACCINE CONTAINING SPECIFIC EPITOPE OF APOLIPOPROTEIN (a)

KYUTOKU; Mariko ;   et al.

Patent Application Summary

U.S. patent application number 14/032804 was filed with the patent office on 2014-03-27 for dna vaccine containing specific epitope of apolipoprotein (a). The applicant listed for this patent is AnGesMG, Inc.. Invention is credited to Hiroshi KORIYAMA, Mariko KYUTOKU, Ryuichi MORISHITA, Futoshi NAKAGAMI, Hironori NAKAGAMI.

Application Number20140086944 14/032804
Document ID /
Family ID50339073
Filed Date2014-03-27

United States Patent Application 20140086944
Kind Code A1
KYUTOKU; Mariko ;   et al. March 27, 2014

DNA VACCINE CONTAINING SPECIFIC EPITOPE OF APOLIPOPROTEIN (a)

Abstract

The present invention provides an agent for the treatment or prophylaxis of arteriosclerosis comprising an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of apolipoprotein (a), wherein the amino acid sequence containing the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.


Inventors: KYUTOKU; Mariko; (Osaka, JP) ; NAKAGAMI; Hironori; (Osaka, JP) ; KORIYAMA; Hiroshi; (Osaka, JP) ; NAKAGAMI; Futoshi; (Osaka, JP) ; MORISHITA; Ryuichi; (Osaka, JP)
Applicant:
Name City State Country Type

AnGesMG, Inc.

Osaka

JP
Family ID: 50339073
Appl. No.: 14/032804
Filed: September 20, 2013

Current U.S. Class: 424/185.1 ; 424/192.1; 435/320.1
Current CPC Class: C12N 2730/10171 20130101; A61K 39/0012 20130101; A61K 2039/58 20130101; A61P 9/10 20180101; C12N 7/00 20130101; C12N 15/85 20130101; A61K 2039/53 20130101; C12N 2730/10142 20130101; A61K 2039/545 20130101; A61K 2039/575 20130101; A61K 39/292 20130101; C12N 2730/10143 20130101
Class at Publication: 424/185.1 ; 424/192.1; 435/320.1
International Class: A61K 39/00 20060101 A61K039/00; A61K 39/29 20060101 A61K039/29; C12N 15/85 20060101 C12N015/85

Foreign Application Data

Date Code Application Number
Sep 21, 2012 JP 2012-208796

Claims



1. A method for treating or preventing a lipoprotein(a)-related disease in a mammal, comprising administering effective amount of an expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in the mammal.

2. The method according to claim 1, wherein a neutralizing antibody against lipoprotein(a) is produced by administering the expression vector.

3. The method according to claim 2, wherein the neutralizing antibody suppresses deposition of lipoprotein(a) to a vascular tissue.

4. The method according to claim 2, wherein the neutralizing antibody decreases the amount of an inflammatory cytokine in a blood.

5. The method according to claim 3, wherein the lipoprotein(a)-related disease is arteriosclerosis.

6. The method according to claim 4, wherein the lipoprotein(a)-related disease is arteriosclerosis.

7. The method according to claim 1, wherein the antigen polypeptide is a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.

8. The method according to claim 7, wherein the lipoprotein(a)-related disease is arteriosclerosis.

9. The method according to claim 8, wherein the arteriosclerosis is atherosclerosis.

10. The method according to claim 7, wherein the inserted amino acid sequence comprises the amino acid shown by SEQ ID NO: 1.

11. The method according to claim 10, wherein the inserted amino acid sequence further comprises one or more specific epitopes.

12. The method according to claim 11, wherein the further specific epitope is a specific epitope of apolipoprotein B.

13. The method according to claim 1, wherein the expression vector is administered plural times.

14. The method according to claim 13, wherein the expression vector is administered 2, 3 or 4 times.

15. A method of inducing a neutralizing antibody against lipoprotein(a) in a mammal, comprising administering effective amount of an expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in the mammal.

16. An expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.

17. The expression vector according to claim 16, wherein the inserted amino acid sequence comprises the amino acid shown by SEQ ID NO: 1.

18. The expression vector according to claim 16, wherein the inserted amino acid sequence further comprises one or more specific epitopes.
Description



CROSS-REFERENCE TO THE RELATED APPLICATION

[0001] The present application is based on a patent application No. 2012-208796 filed in Japan (filing date: Sep. 21, 2012), the contents of which are incorporated in full herein.

TECHNICAL FIELD OF THE INVENTION

[0002] The present invention relates to a DNA vaccine effective for the treatment or prophylaxis of a lipoprotein(a)-related diseases such as arteriosclerosis.

BACKGROUND OF THE INVENTION

[0003] Lipoprotein(a) [Lp(a)] is a serum lipoprotein consisting of one molecule of apolipoprotein B-100 (apoB) and one molecule of apolipoprotein(a) [apo(a)], which are bonded through a single disulfide bond; and a cholesterol-rich low-density lipoprotein (LDL) particle, (non-patent document 1), and found only in humans, primates and hedgehog. The apo(a) is a homologue of plasminogen (non-patent document 2), containing 10 different types (kringle-4 types 1 through 10) of plasminogen kringle-4 like repeats as well as regions homologous to the kringle-5 and inactive protease regions (non-patent document 3). Lp(a) has been considered as an independent cardiovascular risk factor and several studies have shown the association between plasma Lp(a) levels and cardiovascular disease (CVD)/coronary heart disease (CHD). Elevated Lp(a) levels promote atherosclerosis via Lp(a)-derived cholesterol entrapment in intima; via inflammatory cell recruitment; and/or via the binding of pro-inflammatory-oxidized phospholipids (non-patent document 4). Lipid lowering agents have little effect on plasma Lp(a) level (non-patent document 5). Although it has been reported that administration of niacin or estrogen may reduce the Lp(a) levels, there is no specific agent for the reduction of plasma Lp(a) (non-patent document 6-8).

[0004] Non-patent document 9 discloses a measurement method of Lp(a) which is not influenced by the polymorphism of apo(a).

[0005] While vaccine is often used for the prophylaxis or treatment of diseases caused by exogeneous factors, such as infections and the like, even for the diseases caused by endogenous aggravation factors such as Alzheimer's disease, hypertension and the like, vaccine therapy has been tried, which includes administering the aggravation factors, epitopes contained in the aggravation factors, or expression vectors encoding them to patients to induce the antibody to the aggravation factor in the body of patients, thereby neutralizing the function of the aggravation factor and mitigating the symptoms of the target disease (non-patent documents 10-12). Plasmid DNA vaccination is one of the tools to induce both humoral and cellular immune responses, without co-treatment with adjuvant, because in the case of plasmid DNA, unmethylated CpG motifs expressed with a plasmid unmethylated CpG motifs expressed with a plasmid backbone have been considered to be "built-in" adjuvants, owing to their ability to activate the innate immune system by means of TLR9 (non-patent document 13). In addition, recent accumulating evidence suggests that the double-stranded structure of DNA, independently of CpG motifs, possesses immunomodulatory effects when introduced into the cytosol or its homeostatic clearance is hampered.

[0006] However, when the aggravation factor is endogenous, the immune tolerance to the factor has generally been established since the factor is the patient's own component. Therefore, it is difficult to efficiently induce an antibody to the factor in the body of the patient even when these endogenous aggravation factors or partial peptides thereof are directly administered to the patient. As such, some technical idea is necessary to have the patient's immune system recognize these self antigens, thereby inducing the production of the antibody.

[0007] Hepatitis B virus core (HBc) antigen protein constitutes spherical core particles by self assembly. The core particles have very high immunogenicity. When a fusion polypeptide obtained by inserting a desired epitope into a particular site of the HBc antigen protein, or connecting a desired epitope to the terminus of the HBc antigen protein is used, the epitope is presented on the surface of the particles formed by self-assembly. Using the fusion polypeptide, the inserted epitope is easily recognized by the immune system, and the production of the antibody that recognizes the epitope can be efficiently induced. Therefore, utilizing the HBc antigen protein as a platform of vaccine, attempts have been made to induce production of the antibody to an antigen difficult to be recognized by the immune system (non-patent document 14, non-patent document 15).

[0008] Patent document 1 discloses particles composed of a chimeric HBc antigen protein containing an foreign amino acid sequence having an epitope, wherein the foreign amino acid sequence is inserted into the amino acid residues 80-81 of the HBc antigen.

[0009] Non-patent document 16 describes that intramuscular immunization with a DNA vaccine encoding ISS and an HBc antigen inserted with a CETP epitope consisting of 26 amino acids inhibited atherosclerosis in rabbit atherosclerosis model.

[0010] However, even if production of an antibody to an endogenous aggravation factor can be induced, when cellular immunity to the factor is simultaneously induced, side effects are caused by the autoimmune reaction. Therefore, it is necessary to efficiently induce the production of an antibody to the endogenous aggravation factor while suppressing the induction of self-reactive T cells.

[0011] Under the above situation, a DNA vaccine showing totally satisfying effectiveness to arteriosclerosis has not been developed yet.

DOCUMENT LIST

Patent Document

[0012] patent document 1: JP-B-3228737

Non-Patent Documents

[0012] [0013] non-patent document 1: Acta Pathologica Microbiologica Scandinavica, 1963, 59: 369-382 [0014] non-patent document 2: Proceedings of the National Academy of Sciences, 1987, 84: 3224 [0015] non-patent document 3: Nature, 1987, 330: 132-137 [0016] non-patent document 4: Nature, 1989 May 25; 339(6222):301-303 [0017] non-patent document 5: Journal of Clinical Investigation, 1990, 85: 1709 [0018] non-patent document 6: New England journal of medicine, 1990, 323: 1289-1298 [0019] non-patent document 7: New England journal of medicine, 2009, 361: 2113-2122 [0020] non-patent document 8: Atherosclerosis, 2010, 211: 41-47 [0021] non-patent document 9: Clinica chimica acta, 1999, 287: 29-43 [0022] non-patent document 10: Nature, 2000, 408: 982-985 [0023] non-patent document 11: Nat Rev Neurosci, 2002, 3: 824-828 [0024] non-patent document 12: The Lancet, 2008, 371: 821-827 [0025] non-patent document 13: Nature, 2008, 451: 725-729 [0026] non-patent document 14: Expert Rev. Vaccines, vol. 8, no. 11, pp. 1565-1573, 2009 [0027] non-patent document 15: Nature, vol. 330, pp. 381-384, 1987 [0028] non-patent document 16: Vaccine, 2006, 24: 4942-4950

SUMMARY OF THE INVENTION

[0029] The present invention aims to provide a DNA vaccine capable of treating or preventing a lipoprotein(a)-related diseases such as arteriosclerosis while avoiding the induction of self-reactive T cells.

[0030] The present inventors have conducted intensive studies and found that administration of an expression vector for chimeric Hepatitis B virus core antigen polypeptide obtained by inserting a specific epitope of apolipoprotein (a) between the amino acid residues 80 and 81 of hepatitis B virus core antigen polypeptide dominantly induces humoral immunity to apolipoprotein (a) while suppressing the induction of T cells that react with apolipoprotein (a), whereby deposition of lipoprotein (a) and vascular intimal thickening can be effectively suppressed. Based on these findings, they have further studied and completed the present invention.

[0031] Accordingly, the present invention relates to the following.

[1] A method for treating or preventing a lipoprotein(a)-related disease in a mammal, comprising administering effective amount of an expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in the mammal. [2] The method of [1], wherein a neutralizing antibody against lipoprotein(a) is produced by administering the expression vector. [3] The method of [2], wherein the neutralizing antibody suppresses deposition of lipoprotein(a) to a vascular tissue. [4] The method of [2], wherein the neutralizing antibody decreases the amount of an inflammatory cytokine in a blood. [5] The method of [3], wherein the lipoprotein(a)-related disease is arteriosclerosis. [6] The method of [4], wherein the lipoprotein(a)-related disease is arteriosclerosis. [7] The method of [1], wherein the antigen polypeptide is a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide. [8] The method of [7], wherein the lipoprotein(a)-related disease is arteriosclerosis. [9] The method of [8], wherein the arteriosclerosis is atherosclerosis. [10] The method of [7], wherein the inserted amino acid sequence comprises the amino acid shown by SEQ ID NO: 1. [11] The method of [10], wherein the inserted amino acid sequence further comprises one or more specific epitopes. [12] The method of [11], wherein the further specific epitope is a specific epitope of apolipoprotein B. [13] The method of [1], wherein the expression vector is administered plural times. [14] The method of [13], wherein the expression vector is administered 2, 3 or 4 times. [15] A method of inducing a neutralizing antibody against lipoprotein(a) in a mammal, comprising administering effective amount of an expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in the mammal. [16] An expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide. [17] The expression vector of [16], wherein the inserted amino acid sequence comprises the amino acid shown by SEQ ID NO: 1. [18] The expression vector of [16], wherein the inserted amino acid sequence further comprises one or more specific epitopes. [I] An agent for the treatment or prophylaxis of arteriosclerosis comprising an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide. [II] The agent of [I], wherein the arteriosclerosis is atherosclerosis. [III] The agent of [I] or [II], wherein the inserted amino acid sequence comprises the amino acid sequence represented by SEQ ID NO: 1. [IV] The agent of any of [I]-[III], wherein the inserted amino acid sequence further comprises one or more specific epitopes. [V] The agent of [IV], wherein the further specific epitope is a specific epitope of apolipoprotein B. [VI] The agent of any of [I]-[V], which is administered plural times. [VII] The agent of [VI], which is administered 2, 3 or 4 times. [VIII] An expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), for use in the treatment or prophylaxis of arteriosclerosis, wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide. [IX] The expression vector of [VIII], wherein the arteriosclerosis is atherosclerosis. [X] The expression vector of [VIII] or [IX], wherein the inserted amino acid sequence comprises the amino acid shown by SEQ ID NO: 1. [XI] The expression vector of any of [VIII]-[X], wherein the inserted amino acid sequence further comprises one or more specific epitopes.

EFFECT OF THE INVENTION

[0032] The present invention provides a DNA vaccine capable of treating or preventing arteriosclerosis while avoiding induction of self-reactive T cells.

[0033] Since the vaccine of the present invention dominantly induces humoral immunity to apolipoprotein (a) rather than the cellular immunity, the risk of an adverse influence of the self-reactive cellular immunity can be reduced.

BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG. 1 shows plasmid DNA construction for vaccination. a) Plasmid map of pcDNA3.1-HBc (control vector) and pcDNA3.1-HBc-apo(a) (vaccination vector). HBc indicates the full sequence of HBc. HBc-N indicates the N-terminus of HBc (1-80 a.a.) and HBc-C indicates the C-terminus of HBc (81-183 a.a.). b) The detail information of plasmid design for Apo(a) vaccine. Twelve amino acids (EAPSEQAPTEQR: SEQ ID NO: 1) as an antigen for Apo(a) and linkers (the N-terminal I-T dipeptide linker and the C-terminal G-A-T tripeptide) were designed to inframe fusion to HBc to allow flexibility in the conformation of apo(a) epitope when surface-exposed on HBc particle. The apo(a) and the linkers were represented by single-letter codes. c) Schema of Lp(a) showing the targeted antigen. Apo(a) is mainly composed of kringle IV like domain (1-10) and kringle V like domain, and repeated kringle IV domain type2 (IV type2) is variable repeats. Black box indicates the epitope (EAPSEQAPTEQR: SEQ ID NO: 1) which is overlapped in repeated sequences of kringle-4 type 2 of apo(a) and multiply presented in the repeated kringle IV domain type2 domain.

[0035] FIG. 2 shows DNA vaccination for Apo(a) to FVB mice. a) Time course of DNA vaccination. Vaccination was done at 8 weeks old (0 W) and at 2 weeks (2 W), 4 weeks (4 W), 10 weeks (10 W) after first vaccination. Titer was quantified at 6 weeks and 12 weeks after first vaccination, and T cell activity was evaluated at 16 weeks after first vaccination. b) and c) Titer of anti-apo(a) antibodies at 6 weeks and 12 weeks. Total IgG titer for apo(a) was increased only in mice serum (.times.100 dilution) from HBc-apo(a) group (left panel). IgG subtype (IgG1, IgG2a or IgG2b) in mice serum (.times.100 dilution) from HBc-apo(a) group was also evaluated by each IgG specific antibody (right panel). d) Anti-plasminogen antibodies in mice assayed by ELISA. Total IgG titer for plasminogen were evaluated in mice serum (.times.100 dilution) from HBc-apo(a) group at 6 week and 12 weeks after first immunization and anti-plasminogen antibody (PLG Ab) was used as a positive control.

[0036] FIG. 3 shows T-cell responses induced by DNA vaccination in FVB mice. a) T-cell proliferation assay by [.sup.3H] thymidine uptake. Cultured splenocytes from mice immunized with HBc-apo(a) were stimulated with or without peptide consisting of antigen sequence (apo(a) 12a.a.; EAPSEQAPTEQR:SEQ ID NO: 1). PHA was used as positive control of non-specific T-cell activator. b) Enzyme-Linked ImmunoSpot (ELISpot) assay. Splenocytes obtained from mice immunized with HBc-apo(a), HBc or Saline were stimulated with or without the antigen sequence peptide or PHA. Blue dots are positive spots for IFN-gamma (left panel) and IL-4 (right panel). c) Quantification of ELISpot assay. Quantification was assessed by counting spot numbers per well in each well.

[0037] FIG. 4 shows DNA vaccination for apo(a) in Lp(a) transgenic mice. a) Time course of DNA vaccination. Female Lp(a) transgenic mice were ovariectomized at 8 weeks old. After 2 weeks, DNA vaccination was done at 10 weeks old (0 W) and at 2 weeks (2 W), 4 weeks (4 W), and 10 weeks (10 W) after first vaccination. Titer was quantified at 6 weeks and 12 weeks after first vaccination, and T cell activity was evaluated at 16 weeks after first vaccination. b and c) Total IgG titer for apo(a) was increased only in mice serum (.times.100 dilution) from HBc-apo(a) group. d) Anti-plasminogen antibodies in mice assayed by ELISA. Total IgG titer for plasminogen were evaluated in mice serum (.times.100 dilution) from HBc-apo(a) group at 6 week and 12 weeks after first immunization and anti-plasminogen antibody (PLG Ab) was used as a positive control.

[0038] FIG. 5 shows carotid artery ligation model in Lp(a) transgenic mice. a) Representative images of H&E staining in ligated vessels. Left panel shows the immunized mice (HBc-apo(a) group) and Right panel shows the non-immunized mice (saline and HBc). Carotid artery ligation was performed at 13 weeks after first immunization, and the vascular remodeling was evaluated at 16 weeks. b) Quantification of intima and media area and ratio of intima to media in immunized mice and non-immunized mice. c) Immunostaining with anti-Lp(a) antibody. Lp(a) deposition (pink) in ligated vessels was observed only in non-immunized group.

[0039] FIG. 6 shows the expression of the inflammatory cytokines (IL-1.beta., TNF-.alpha., MCP-1) analyzed by real-time PCR, in macrophages that had differentiated from THP-1 cells in the presence of sera from mice immunized with HBc-apo(a) vaccine or control mice.

[0040] FIG. 7 shows Immunostaining of blood vessel with anti-Lp(a) antibody. Lp(a) deposition (pink, allow head) in ligated vessels was observed only in non-immunized group.

DESCRIPTION OF EMBODIMENTS

[0041] The present invention provides an agent for the treatment or prophylaxis of a lipoprotein(a)-related disease, comprising an expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a). By administering effective amount of the expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in a mammal, a lipoprotein(a)-related disease in the mammal can be treated or prevented.

[0042] Though not bound by theory, by administering an effective amount of the expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in a mammal, production of an antibody against apolipoprotein (a) is induced in the mammal, and the induced antibody acts as a neutralizing antibody against lipoprotein (a), suppresses deposition of lipoprotein (a) to the vascular tissue, or inhibits production of inflammatory cytokines (e.g. IL-1.beta., TNF-.alpha., MCP-1) in macrophages and the like induced by lipoprotein (a) stimulation to decrease the amount of inflammatory cytokines in blood, thereby treating or preventing lipoprotein(a)-related diseases. The present invention also provides a method of inducing a neutralizing antibody against lipoprotein(a) in a mammal, comprising administering effective amount of an expression vector encoding an antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) in the mammal.

[0043] In one embodiment, the expression vector encoding an antigen polypeptide comprising a specific epitope of apolipoprotein (a) is an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a), wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.

[0044] When an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) is administered, an immune reaction (preferably humoral immune reaction such as antibody production and the like) to the specific epitope of apolipoprotein (a) in the expressed chimeric Hepatitis B virus core antigen polypeptide is induced, and production of lipoprotein (a) is suppressed by an antibody to apolipoprotein (a), whereby neointimal formation and vascular intimal thickening are suppressed.

[0045] Lipoprotein(a)-related disease refers to a disease caused by decreased function of endothelial cells, abnormal proliferation of vascular smooth muscle cells, or inflammatory cytokines produced by macrophages and the like, induced by lipoprotein (a) stimulation due to deposition of lipoprotein (a) to inner wall of blood vessel. Examples of the lipoprotein(a)-related disease include cerebral infarction, myocardial infarction, angina, sclerosis obliterans, vascular dementia, vascular restenosis and the like caused by arteriosclerosis. Preferable lipoprotein(a)-related disease is arteriosclerosis. While the kind of arteriosclerosis to be the target of the therapeutic or prophylactic agent of the present invention is not limited, it is preferably atherosclerosis.

[0046] In the present invention, use of apolipoprotein (a) derived from a mammal to be the application target of the therapeutic or prophylactic agent of the present invention is intended though without limitation thereto. The application target of the therapeutic or prophylactic agent of the present invention is a mammal expressing apolipoprotein (a). As a mammal expressing apolipoprotein (a), only primates such as human and the like and hedgehog are known. The application target of the therapeutic or prophylactic agent of the present invention is preferably a primate such as human. Therefore, for example, when the therapeutic or prophylactic agent of the present invention is applied to human, use of apolipoprotein (a) derived from human is intended though without limitation thereto.

[0047] In the present specification, regarding the particular factor X (polypeptide or polynucleotide), "factor X derived from organism Y" or "organism Y factor X" means that the amino acid sequence or nucleic acid sequence of factor X has the same or substantially the same amino acid sequence or nucleic acid sequence as the amino acid sequence or nucleic acid sequence of factor X naturally expressed in organism Y. Being "substantially the same" means that the amino acid sequence or nucleic acid sequence of interest has not less than 70% (preferably not less than 80%, more preferably not less than 90%, still more preferably not less than 95%, most preferably not less than 99%) identity with the amino acid sequence or nucleic acid sequence of factor X naturally expressed in organism Y, and the function of factor X is maintained.

[0048] Apolipoprotein (a) is a known angiogenesis factor, and the amino acid sequence and cDNA sequence thereof are also known. It is known that apolipoprotein (a) contains kringle-IV type 2 repeat sequences and the repeat number thereof varies. Those having repeat sequences with any repeat number are encompassed in apolipoprotein (a). The representative amino acid sequence of human apolipoprotein (a) includes, but is not limited to, the amino acid sequence shown by SEQ ID NO: 2(NP.sub.--005568.2). As a partial amino acid sequence of human apolipoprotein (a), SEQ ID NO: 17 (AAB49909, AAB66587) has been reported.

[0049] In the present specification, "epitope" refers to a basic element or minimum unit for recognition by each antibody or T cell receptor, which is a particular domain, region or molecular structure the aforementioned antibody or T cell receptor binds to.

[0050] The epitope of apolipoprotein (a) used in the present invention is specific to the apolipoprotein (a). Being "specific" means that a gene product (excluding variable regions of immunoglobulin and T cell receptor) other than apolipoprotein (a) naturally expressed in a mammal from which the apolipoprotein (a) is derived does not include said epitope.

[0051] As a specific epitope of apolipoprotein (a) used in the present invention, preferably selected is one at a position inhibiting the deposition of lipoprotein (a) to the vascular intima when an antibody recognizing the epitope binds to the epitope. Such epitope may be present in, for example, the kringle-IV type 2 repeat sequences. An epitope contained in the region removed during the maturation process of apolipoprotein (a) such as signal sequence and the like is preferably eliminated from the epitope used in the present invention.

[0052] The length of the amino acid sequence of the epitope is generally 5-30 amino acids, preferably 6-25 amino acids, more preferably 10-18 amino acids, further more preferably 11-16 amino acids. When the amino acid sequence is too short, the antigenicity of the epitope may be lost. When the amino acid sequence is too long, chimeric hepatitis B virus core antigen polypeptide does not easily form core particles due to self-assembly, as a result of which an antibody that specifically recognizes the epitope may not be produced, and a superior treatment or improvement effect on lipoprotein (a)-related diseases including arteriosclerosis may not be obtained.

[0053] Specific examples of preferable epitope of apolipoprotein (a) include the following.

TABLE-US-00001 (SEQ ID NO 1) EAPSEQAPTEQR

[0054] SEQ ID NO: 1 is a partial amino acid sequence of human apolipoprotein (a).

[0055] Hepatitis B virus core antigen polypeptide used in the present invention is

(1) a polypeptide containing the amino acid sequence shown by SEQ ID NO: 4, or (2) a polypeptide containing an amino acid sequence having not less than 90% (preferably not less than 95%, more preferably not less than 97%, still more preferably not less than 99%) identity with the amino acid sequence shown by SEQ ID NO: 4, and having an activity to form core particles due to self-assembly.

[0056] Self-assembly refers to a phenomenon wherein molecules dissolved in a solution associate to form an assembly. Core particle refers to a rigid structure having a specific repetitive constitution. In the present specification, the core particle may be a product of synthesis steps or a product of biological steps.

[0057] As the polypeptide of the embodiment of (2), a polypeptide containing the amino acid sequence shown by SEQ ID NO: 5 disclosed in WO2003/031466 can be mentioned. A polypeptide containing the amino acid sequence shown by SEQ ID NO: 5 except that one or plural cysteine residues of the positions 48, 61, 107 and 185 are deleted or substituted by other amino acid residue (e.g., serine residue) is also preferable as the polypeptide of the embodiment of (2). As recognized by those of ordinary skill in the art, in a polypeptide having an amino acid sequence different from that of SEQ ID NO: 5, cysteine residues at similar positions can be deleted or substituted by other amino acid residues, and polypeptides obtained by such deletion and substitution are also encompassed in the polypeptide of the embodiment of (2).

[0058] The polypeptide of the embodiment of (2) also encompasses a variant polypeptide wherein the isoleucine residue at the position corresponding to the position 97 of SEQ ID NO: 5 is substituted by leucine residue or phenylalanine residue (Yuan et al., J. Virol. vol. 73, pages 10122-10128 (1999)). In addition, amino acid sequences of many HBcAg variants and several kinds of hepatitis B core antigen precursor variants are disclosed in GenBank reports AAF121240, AF121239, X85297, X02496, X85305, X85303, AF151735, X85259, X85286, X85260, X85317, X85298, AF043593, M20706, X85295, X80925, X85284, X85275, X72702, X85291, X65258, X85302, M32138, X85293, X85315, U95551, X85256, X85316, X85296, AB033559, X59795, X8529, X85307, X65257, X85311, X85301, X85314, X85287, X85272, X85319, AB010289, X85285, AB010289, AF121242, M90520, PO.sub.3153, AF110999 and M95589 (each of the disclosures is incorporated in the present specification by reference), and polypeptides containing amino acid sequences of these variants are also encompassed in the polypeptide of the embodiment of (2). The above-mentioned variants have amino acid sequences different at many positions including amino acid residues corresponding to the amino acid residues present at the positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO: 5.

[0059] Furthermore, polypeptides containing the amino acid sequences of the HBcAg variants described in WO01/98333, WO01/77158 and WO02/14478, all of which are incorporated in the present specification by reference are also encompassed in the polypeptide of the embodiment of (2).

[0060] In the present specification, unless particularly indicated, the positions of amino acid residues in the amino acid sequence of hepatitis B virus core antigen polypeptide are specified with the amino acid sequence shown by SEQ ID NO: 4 as the standard. When a polypeptide does not contain the amino acid sequence shown by SEQ ID NO: 4, the amino acid sequence of the polypeptide is aligned with the amino acid sequence shown by SEQ ID NO: 4, and the position of the corresponding amino acid residue is adopted.

[0061] The hepatitis B virus core antigen polypeptide used in the present invention is preferably a polypeptide containing the amino acid sequence shown by SEQ ID NO: 4.

[0062] In the chimeric hepatitis B virus core antigen polypeptide to be used in the present invention, an amino acid sequence comprising a specific epitope of apolipoprotein (a) is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide. That is, the chimeric hepatitis B virus core antigen polypeptide to be used in the present invention contains the following elements (a)-(c):

(a) N-terminus part polypeptide residues of hepatitis B virus core antigen polypeptide (consisting of the continuous partial amino acid sequence of hepatitis B virus core antigen polypeptide from N-terminus to the amino acid residue 80), (b) an amino acid sequence consisting of a specific epitope of apolipoprotein (a), and (c) C-terminal partial polypeptide residues of hepatitis B virus core antigen polypeptide (consisting of the continuous partial amino acid sequence of hepatitis B virus core antigen polypeptide from the amino acid residue 81 to C-terminus) in the order of (a), (b), (c) from the N terminal side.

[0063] The chimeric hepatitis B virus core antigen polypeptide to be used in the present invention having the above-mentioned constitution forms core particles due to self-assembly, and a specific epitope of apolipoprotein (a) is presented on the outside of the particles.

[0064] The inserted amino acid sequence between element (a) and element (c) may further contain, in addition to element (b) (amino acid sequence consisting of specific epitopes of apolipoprotein (a)), one or more (preferably 1-3, more preferably 1) specific epitope. As the further specific epitope, a specific, epitope, which is an aggravation factor of arteriosclerosis other than apolipoprotein (a), is used. Examples of the further specific epitope include, but are not limited to, apolipoprotein B and the like. The further specific epitope may be inserted at any position between element (a) and element (b), and between element (b) and element (c). The length of the amino acid sequence of the further specific epitope is generally 5-30, amino acids, preferably 6-25 amino acids, more preferably 10-18 amino acids, further more preferably 11-16 amino acids.

[0065] When plural specific epitopes are inserted between constituent element (a) and constituent element (c), the specific epitopes may be directly connected by a covalent bond or via a spacer sequence. The spacer sequence means an amino acid sequence containing one or more amino acid residues, which is inserted between two adjacent elements contained in chimeric hepatitis B virus core antigen polypeptide. Specific epitopes are preferably connected via a spacer sequence so that plural specific epitopes will be stably presented while maintaining their structures. While the length of the spacer sequence is not limited as long as the chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and all inserted specific epitopes are presented on the outside of the particles, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids.

[0066] A specific epitope between element (a) and element (c), which is the closest to the N terminus, and element (a) may be directly connected by a covalent bond or via a spacer sequence. The element (a) and the specific epitope between element (a) and element (c), which is the closest to the N terminus, are preferably connected via a spacer sequence so that a specific epitope of apolipoprotein (a) will be stably presented on the outside of the particles formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. While the length of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of apolipoprotein (a) is presented on the outside of the particles, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of apolipoprotein (a) is presented on the outside of the particles. Examples of a preferable spacer sequence include, but are not limited to, IT, GAT, CGG and the like.

[0067] A specific epitope between element (a) and element (c), which is the closest to the C terminus, and element (c) may be directly connected by a covalent bond or via a spacer sequence. The element (b) and element (c) are preferably connected via a spacer sequence so that a specific epitope of apolipoprotein (a) will be stably presented on the outside of the particles formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. While the length of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and an epitope of apolipoprotein (a) is presented on the outside of the particles, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of apolipoprotein (a) is presented on the outside of the particles. Examples of a preferable spacer sequence include, but are not limited to, IT, GAT, CGG and the like.

[0068] While the length of the inserted amino acid sequence between element (a) and element (c) is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly, a specific epitope of apolipoprotein (a) is presented on the outside of the particles, and arteriosclerosis can be treated or prevented, it is generally 5-80 amino acids. When the inserted amino acid sequence is too short, the antigenicity of the epitope may be lost. When the inserted amino acid sequence is too long, chimeric hepatitis B virus core antigen polypeptide does not easily form core particles due to self-assembly, as a result of which an antibody that specifically recognizes the inserted epitope is not produced, and a good treatment or improvement effect on lipoprotein (a)-related diseases including arteriosclerosis may not be achieved.

[0069] The expression vector used in the present invention is a recombinant vector incorporating a polynucleotide encoding the above-mentioned chimeric hepatitis B virus core antigen polypeptide. When the expression vector is administered to a target mammal, the expression vector is intracellularly incorporated into the target mammal, and the cell expresses the above-mentioned chimeric hepatitis B virus core antigen polypeptide. Examples of the expression vector inserted with polynucleotide encoding chimeric hepatitis B virus core antigen polypeptide include plasmid, virus, phage, cosmid and other vectors conventionally used in the art. Examples of the plasmid vector include, but are not limited to, pCAGGS (Gene 108: 193-199 (1991)), pCR-X8 (Vaccine 24: 4942-4950 (2006)), pcDNA3.1 (trade name, Invitrogen), pZeoSV (trade name, Invitrogen), pBK-CMV (trade name, Stratagene) and the like. The virus vector is a DNA virus or an RNA virus. Examples of the virus vector include, but are not limited to, detoxicated retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, polio virus, Sindbis virus, Hemagglutinating Virus of Japan (HVJ), SV40, human immunodeficient virus (HIV) and the like. Furthermore, Hemagglutinating Virus of Japan envelope (HVJ-E) and the like can also be utilized.

[0070] In the above-mentioned expression vector, polynucleotide (preferably DNA) encoding chimeric hepatitis B virus core antigen polypeptide is operably connected to a promoter capable of exhibiting a promoter activity in the cell of a mammal (preferably human) to be the administration subject.

[0071] The promoter to be used is not particularly limited as long as it can function in the cell of a mammal (preferably human) to be the administration subject. Examples of the promoter include pol I promoter, pol II promoter, pol III promoter and the like. Specifically, virus promoters such as SV40-derived initial promoter, cytomegalovirus LTR and the like, mammal constituting protein gene promoters such as .beta.-actin gene promoter and the like, RNA promoters such as tRNA promoter and the like, and the like are used.

[0072] The above-mentioned expression vector preferably contains a transcription termination signal, i.e., terminator region, at the downstream of the polynucleotide encoding chimeric hepatitis B virus core antigen polypeptide. It can further contain a selection marker gene for the selection of a transformed cell (gene conferring resistance to medicaments such as tetracycline, ampicillin, kanamycin and the like, gene complementing auxotrophic mutation etc.).

[0073] In one embodiment, the above-mentioned expression vector may contain an immune stimulatory sequence (ISS) (also referred to as CpG) to potentiate the immune effect. The immune stimulatory sequence is a DNA containing a non-methylated CpG motif of bacterium, and is known to function as a ligand of a particular receptor (Toll-like receptor 9) (see Biochim. Biophys. Acta 1489, 107-116 (1999) and Curr. Opin. Microbiol. 6, 472-477 (2003) for the detail). Preferable examples of the immune stimulatory sequence include the following.

TABLE-US-00002 CpG-B1018 22 bp (SEQ ID NO: 6) 5'-tga ctg tga acg ttc gag atg a-3' CpG-A D19 20 bp (D type) (SEQ ID NO: 7) 5'-ggt gca tcg atg cag ggg gg-3' CpG-CC274 21 bp (SEQ ID NO: 8) 5'-tcg tcg aac gtt cga gat gat-3' CpG-CC695 25 bp (SEQ ID NO: 9) 5'-tcg aac gtt cga acg ttc gaa cgt t-3'

[0074] Alternatively, 2, 3 or 4 from these ISSs may be connected and used. Preferable examples of the connected ISS sequence include the following.

TABLE-US-00003 (SEQ ID NO: 10) 5'-ggt gca tcg atg cag ggg gg tga ctg tga acg ttc gag atg a tcg tcg aac gtt cgagat gat tcg aac gtt cga acg ttc gaa cgt t-3'

[0075] Those of ordinary skill in the art can construct the aforementioned expression vector according to well-known genetic engineering techniques described in, for example, "edit. Sambrook et al., Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory (1989) N.Y.", "edit. Ausubel et al., Current Protocols in Molecular Biology (1987) John Wiley & Sons" and the like.

[0076] The therapeutic or prophylactic agent of the present invention can be provided as a pharmaceutical composition containing, in addition to a therapeutically effective amount of the above-mentioned expression vector, any carrier, for example, a pharmaceutically acceptable carrier.

[0077] Examples of the pharmaceutically acceptable carrier include, though not limited thereto, excipients such as sucrose, starch, mannit, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate and the like, binders such as cellulose, methylcellulose, hydroxypropylcellulose, gelatin, gum arabic, polyethylene glycol, sucrose, starch and the like, disintegrants such as starch, carboxymethylcellulose, hydroxypropylstarch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, calcium citrate and the like, lubricants such as magnesium stearate, aerosil, talc, sodium lauryl sulfate and the like, aromatics such as citric acid, menthol, glycyrrhizin.ammonium salt, glycine, orange power and the like, preservatives such as sodium benzoate, sodium bisulfite, methylparaben, propylparaben and the like, stabilizers such as citric acid, sodium citrate, acetic acid and the like, suspensions such as methylcellulose, polyvinylpyrrolidone, aluminum stearate and the like, dispersing agents such as surfactant and the like, diluents such as water, saline and the like, base waxes such as cacao butter, polyethylene glycol, white kerosine and the like, and the like.

[0078] The therapeutic or improving agent of the present invention may further contain an adjuvant to potentiate its effect. Examples of the adjuvant include aluminum hydroxide, complete Freund's adjuvant, incomplete Freund's adjuvant, pertussis adjuvant, poly(I:C), CpG-DNA and the like.

[0079] To promote intracellular introduction of an expression vector, the therapeutic or prophylactic agent of the present invention may further contain a reagent for nucleic acid introduction. As the reagent for nucleic acid introduction, cationic lipids such as lipofection (trade name, Invitrogen), lipofectamine (trade name, Invitrogen), transfectam (trade name, Promega), DOTAP (trade name, Roche Applied Science), dioctadecylamidoglycyl spermine (DOGS), L-dioleoyl phosphatidyl-ethanolamine (DOPE), dimethyldioctadecyl-ammonium bromide (DDAB), N,N-di-n-hexadecyl-N,N-dihydroxyethylammonium bromide (DHDEAB), N-n-hexadecyl-N,N-dihydroxyethylammonium bromide (HDEAB), polybrene, poly(ethyleneimine) (PEI) and the like can be used. In addition, an expression vector may be included in any known liposome constituted of a lipid bilayer such as electrostatic liposome. Such liposome may be fused with a virus such as inactivated Hemagglutinating Virus of Japan (HVJ). HVJ-liposome has a very high fusion activity with a cellular membrane, as compared to general liposomes. When retrovirus is used as an expression vector, RetroNectin, fibronectin, polybrene and the like can be used as transfection reagents.

[0080] While the content of the above-mentioned expression vector in the pharmaceutical composition is not particularly limited and appropriately selected from a wide range, it is generally about 0.00001 to 100 wt % of the whole pharmaceutical composition.

[0081] By introducing the above-mentioned expression vector into an application target, mammalian tissue (or cell), the therapeutic or prophylactic agent of the present invention induces an in vivo expression of the above-mentioned antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide), induces production of an antibody to a specific epitope of apolipoprotein (a) contained in the antigen polypeptide, as a result of which the induced antibody suppresses production of lipoprotein (a), thereby suppressing neointimal formation and blood vessel intimal thickening. Various methods for introducing nucleic acids such as expression vector and the like into the body are known (T. Friedman, Science 244: 1275-1281 (1989)), and any introduction method can be employed as long as it induces an in vivo expression of the above-mentioned antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide), induces production of an antibody to a specific epitope of apolipoprotein (a) contained in the antigen polypeptide, and treats or prevents lipoprotein (a)-related diseases including arteriosclerosis.

[0082] Examples of the method for introducing an expression vector into a mammalian tissue (or cell) in vivo include, but are not limited to, inner liposome method, electrostatic liposome method, HVJ-liposome method, HVJ-AVE liposome method, receptor-mediated transgene, particle gun method, naked DNA method, introduction method by positive electric charge polymer, electroporation method and the like.

[0083] Alternatively, cells such as blood cells, bone marrow cells and the like may be isolated from the application target mammal, the above-mentioned expression vector may be introduced into the cells ex vivo, after which cells containing the obtained above-mentioned expression vector may be returned to the application target mammal.

[0084] Examples of the method for introducing an expression vector into a mammalian cell ex vivo include, but are not limited to, lipofection method, calcium phosphate coprecipitation method, DEAE-dextran method, direct DNA introduction method using glass microcapillary, electroporation method and the like.

[0085] The therapeutic or prophylactic agent of the present invention may be administered by any method as long as in the administration subject mammal, the agent induces in vivo expression of the above-mentioned antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide), induces production of an antibody to a specific epitope of apolipoprotein (a) contained in the antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide), and treats or prevents lipoprotein (a)-related diseases including arteriosclerosis. Preferably, the therapeutic or prophylactic agent of the present invention is parenterally administered in an amount sufficient to induce production of an antibody to a specific epitope of apolipoprotein (a) contained in the antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide), and treat or prevent lipoprotein (a)-related diseases including arteriosclerosis. For example, injection via intravenous, intraperitoneal, subcutaneous, intradermal, intraadipose tissue, intramammary gland tissue, or intramuscular pathway; gas induced particle bombarding method (by electron gun and the like); a method in the form of collunarium and the like via a mucosal pathway, and the like are recited as examples of the administration methods. In one embodiment, the therapeutic or prophylactic agent of the present invention is preferably injected subcutaneously or intramuscularly.

[0086] In one embodiment, the therapeutic or prophylactic agent of the present invention is subcutaneously administered by a needleless injector. The needleless injector is preferably a pressure injector. Examples of the needleless injector include, but are not limited to, ShimaJET (trade name, SHIMADZU CORPORATION), Twinject EZII (trade name, Japan chemical research), Syrijet (trade name, Keystone), ZENEO (trade name, Crossject) and the like. In this case, the therapeutic or prophylactic agent of the present invention can be provided as an injection preparation containing the above-mentioned expression vector and needleless injector, wherein the expression vector is enclosed in the needleless injector.

[0087] In one embodiment, the therapeutic or prophylactic agent of the present invention is administered subcutaneously, intradermally or intramuscularly with a gene gun. In this case, the above-mentioned expression vector may be applied onto the carrier particles such as colloidal gold particles and the like to be introduced into the body and used for administration. A technique for coating carrier particles with polynucleotide is known (see, for example, WO93/17706). Finally, the expression vector can be prepared in an aqueous solution such as physiological brine and the like suitable for administration to the body.

[0088] To induce good immune responses, the therapeutic or improving agent of the present invention is preferably administered plural times at given intervals. While the frequency can be appropriately determined by monitoring the level of immune response, it is generally 2-10 times, preferably 2-6 times, more preferably 2, 3 or 4 times.

[0089] The administration frequency is generally once per 1 week-1 year, preferably once per 1-6 months.

[0090] While the dose of the therapeutic or prophylactic agent of the present invention depends on the immunogenicity of a specific epitope of apolipoprotein (a) contained in the antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide) encoded by the active ingredient expression vector in an administration subject mammal, those of ordinary skill in the art can determine the dose necessary for a good immune response by administering a given amount of an expression vector to an administration subject mammal, measuring the antibody titer specific to the epitope by a detection method such as ELISA and the like, and observing the immune response. Those of ordinary skill in the art appreciate that the immunogenicity of the therapeutic or prophylactic agent of the present invention also depends on the strength of the regulatory sequence such as promoter used for the expression vector as an active ingredient. Moreover, those of ordinary skill in the art can also control the dose of the therapeutic or prophylactic agent of the present invention with ease depending on the kind of the expression vector to be used.

an antigen polypeptide (e.g. lipoprotein (a)-related diseases including

[0091] When an expression vector encoding an antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide) inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) is administered, an immune reaction (preferably humoral immune reaction such as antibody production and the like) against the specific epitope of apolipoprotein (a) in the expressed antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide) is induced, and production of lipoprotein (a) is suppressed by an antibody to apolipoprotein (a), whereby neointimal formation and vascular intimal thickening are suppressed. Therefore, an administration subject of the therapeutic or prophylactic agent of the present invention includes patients with a lipoprotein (a)-related disease (e.g. arteriosclerosis (preferably, atherosclerosis)), non-lipoprotein (a)-related disease patients with the risk of developing lipoprotein (a)-related disease (e.g. arteriosclerosis (preferably, atherosclerosis)) (e.g., healthy individual; individual who has not developed lipoprotein (a)-related disease (e.g. arteriosclerosis) while blood apolipoprotein (a) level or lipoprotein (a) level is higher than healthy individual; hyperlipidemia patients etc.) and the like. By administering an expression vector encoding an antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide) inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) to lipoprotein (a)-related disease (e.g. arteriosclerosis) patients, further deposition of lipoprotein (a) in the diseased part of the patients can be suppressed, neointimal formation and vascular intimal thickening can be suppressed, whereby the progression of lipoprotein (a)-related disease (e.g. arteriosclerosis) can be inhibited. In addition, by administering an expression vector encoding an antigen polypeptide (e.g. chimeric hepatitis B virus core antigen polypeptide) inserted with an amino acid sequence comprising a specific epitope of apolipoprotein (a) to non-lipoprotein (a)-related disease patients (e.g. non-arteriosclerosis patients) with the risk of developing lipoprotein (a)-related disease (e.g. arteriosclerosis), the onset of lipoprotein (a)-related disease (e.g. arteriosclerosis) in the non-lipoprotein (a)-related disease patients (e.g. non-arteriosclerosis patients) can be prevented.

[0092] All references cited in the present specification, including publication, patent document and the like, are hereby incorporated individually and specifically by reference, to the extent that the entireties thereof have been specifically disclosed herein.

[0093] The present invention is explained in more detail in the following by referring to Examples, which are not to be construed as limitative.

EXAMPLES

Example 1

Materials and Methods

Animals

[0094] The experiments were approved by the Ethical Committee for animal experiments of Osaka University Graduate School of Medicine. Mice had free access to water and food during the experimental periods. Female FVB mice were purchased from Charles River. Lp(a) transgenic mice were created by the mating of human apo(a) transgenic mice and human apoB transgenic mice (Nature genetics, 1995, 9: 424-431; Nature, 1992, 360: 670-672; Proceedings of the National Academy of Sciences, 1994, 91: 2130; Circulation, 2002, 105: 1491-1496). Human apo(a) YAC transgenic mice were created by insertion of human apo(a) YAC transgenic mice, including the apo(a) gene, 70 kb apo(a)-like gene, and the 260 kb genomic DNA (YAC DNA) (Nature, 1992, 360: 670-672). Human apoB transgenic mice were created by insertion of 76 kb genomic DNA (P1 phagemid DNA) containing the intact apoB gene (Proceedings of the National Academy of Sciences, 1994, 91: 2130). The background of both mice was FVB mouse.

Construction of HBc-Apo(a) Fusion Gene Expression Vector

[0095] The plasmid pcDNA3.1 (pcDNA3.1/V5-His-TOPO, Invitrogen) containing the cytomegalovirus promoter was used. The HBc gene was obtained by PCR and engineered into pcDNA3.1 [HBc]. The apo(a) 12 amino acids (a.a.) sequence (EAPSEQAPTEQR: SEQ No. 1) with a N-terminus Ile-Thr dipeptide linker and C-terminus Gly-Ala-Thr tripeptide extension was synthesized by PCR using the following oligonucleotide:

TABLE-US-00004 (PCR1) the forward primer: HBc-1 (SEQ ID NO: 11) 5'GCCATGGATATCGATCCTTATAAAGAATTCGGAGC3', the reverse primer: Lp(a)-1 (SEQ ID NO: 12) 5'GTTAACTTGGAAGATCCAGCTATCACTGAGGCTCCTTCCGAACAAGC ACCGACT3', and template: pPLc3 (BCCM/LMBP); (PCR2) the forward primer: HBc-2 (SEQ ID NO: 13) 5'GGCCTCTCACTAACATTGAGATTCCCGAGATTGAGA3', the reverse primer: Lp(a)-2 (SEQ ID NO: 14) 5'TTCCGAACAAGCACCGACTGAGCAAAGGGGTGCTACTAGCAGGGACC TGGTAGTC3', and template: pPLc3

[0096] The PCR products from PCR1 and PCR2 were use as the template of PCR3. In PCR3, HBc-1 was used as the forward primer and HBc-2 was used as the reverse primer. The PCR product from PCR3 was engineered into pcDNA3.1 [HBc-apo(a)].

Vaccination Protocol

[0097] Female FVB or Lp(a) transgenic mice were vaccinated intramuscularly three times at 2-week interval (8 weeks, 10 weeks, 12 weeks old, respectively) with 60 .mu.l, TE containing 120 .mu.g HBc-apo(a) or HBc, or 60 .mu.l, saline. In the vaccination, electric pulse generator (NEPA GENE) connected to a switch box with a pair of stainless steel needles of 10 mm in length and 0.3 mm in diameter, fixed with a distance between them of 3 mm was used. The voltage remained constant, 70V, during the pulse duration. Three pulses of the indicated voltage followed by three more pulses of the opposite polarity were administered to each injection site at a rate of one pulse/s, with each pulse being 50 ms in duration. Six weeks after third immunization (18 weeks old), additional immunization was given to mice. Lp(a) transgenic mice were bilateral ovariectomized before first immunization.

Measurement of Apo(a) Antibody in Serum

[0098] Two weeks after both third immunization and last immunization, respectively, serum was collected from immunized mice of all groups. Serum levels of apo(a)-specific antibodies in these mice were measured by ELISA. Briefly, ELISA plates was coated with 5 .mu.g/mL apo(a) 12 a.a. peptide (peptide consisting of the amino acid sequence shown by SEQ ID NO: 1) in carbonate buffer overnight at 4.degree. C. The plates were blocked with PBST containing 3% skim milk at room temperature for 2 hours, and serial dilution (1:100 to 1:312500) of serum samples from immunized mice were added to the well. Further, the plates were incubated overnight at 4.degree. C., washed seven times with PBST, and HRP-conjugated mouse IgG (whole or each subtype) was added and incubated at room temperature for three hours. After four times wash with PBST, 3,3',5,5'-tetaramethylbenzidine (TMB, Sigma-Aldrich) was added, the blue reaction product was stopped by 0.5 mol/L sulfuric acid and the resulting end product was read at 450 nm.

T-Cell Proliferation Assay

[0099] The T-cell proliferation assay was performed as previously reported. Syngeneic T-cells (mouse splenocytes, 5.times.10.sup.5 cells/well) were cultured with 10 .mu.g/ml recombinant apo(a) 12 a.a. peptide, phytohemagglutinin (PHA, 50 .mu.g/mL as positive control) and medium separately, at 37.degree. C., 5% CO.sub.2 for 40 hours. Further, 1 .mu.Ci of [.sup.3H] thymidine (Perkin Elmer) was added to each well for 8 hours. The cells were harvested, and the [.sup.3H] thymidine uptake was determined using a MicroBeta 1450 Trilux scintillation counter (Wallac Oy). The stimulation index was expressed as the ratio of stimulated cells to non-stimulated cells.

Enzyme-Linked ImmunoSpot (ELISpot) Assay

[0100] ELISpot assay was carried out using Mouse IFN-.gamma. Development Module and Mouse IL-4 Development Module, respectively (R&D Systems) according to the manufacturer's instructions. Briefly, 96-well filter plates for ELISpot were preincubated with anti-mouse IFN-.gamma. or IL-4 antibodies overnight at 4.degree. C. and blocked with PBS containing 1% BSA and 5% sucrose. For two hours at room temperature. The splenocytes from individual immunized mice of 5.times.10.sup.5 cells per well were added to wells with 10 .mu.g/ml recombinant apo(a) 12a.a. peptide, PHA (50 .mu.g/mL as positive control) and medium separately, and incubated at 37.degree. C., 5% CO.sub.2 for 48 h. The plates were washed four times with PBST, incubated with biotinylated anti-mouse IFN-.gamma. or IL-4 antibody overnight at 4.degree. C. and washed again with PBST three times. ELISpot color module (R&D systems) was used as color development. Diluted Streptavidin-AP concentrate with PBS containing 1% BSA complex was added into each well and incubated for 2 hours at room temperature. After washing with PBS-T and deionized water, BCIP/NBT was added into each well and incubated in dark for 30 minutes at room temperature. The plates were washed with deionized water, air-dried at room temperature. The colored spots were quantified manually using a dissecting microscope (Olympus).

Carotid Artery Ligation Model

[0101] Carotid artery ligation model was performed for Lp(a) female transgenic mice as previously described. One week after the final immunization, the left common carotid artery of female Lp(a) transgenic mice was exposed through a small midline incision in the neck, and the artery was completely ligated with a 6-0 silk just proximal to the carotid bifurcation to disrupt blood flow. Following ligation of the common carotid artery, the vessel typically undergoes inflammatory changes and neointima formation.

Pathological Analysis

[0102] Quantification of vascular remodeling was performed after three weeks of carotid ligation model. The left common carotid artery was removed and fixed in 4% paraformaldehyde, equilibrated in PBS containing 10% sucrose, in PBS/20% sucrose and in PBS/30% sucrose. The samples were then embedded for quick freezing. Cross sections were laid on slides and stained; some of them were frozen at -80.degree. C. For evaluation of neointima formation, slides were stained with hematoxylin and eosin (HE). Each five stained slide was quantified by measuring the area of neointima and media (Image J). Immunostaining with anti-Lp(a) antibody were visualized with VECTASTAIN ABC-AP and Vector Red (Vector Laboratories Inc.).

Statistics

[0103] All values were expressed as mean.+-.S.E.M. Data were compared by t-test or using ANOVA followed by Fischer's test for multiple comparisons. All statistical analysis was performed using StatView (SAS Institute, Inc.). Values of p<0.05 were considered to represent statistical significance.

[Results]

In Vitro Expression of Plasmid DNA Construct

[0104] Plasmid DNA including hepatitis B virus cores protein (HBc) was used because HBc is a carrier protein and possesses its ability to self-assemble into icosahedral virus-like particles (VLPs) in heterologous expression systems. The plasmid pcDNA3.1-HBc (control vector) and pcDNA3.1-HBc-apo(a) were constructed (FIG. 1a). The 12 amino acids (EAPSEQAPTEQR: SEQ No. 1) of apo(a) were selected as a targeted antigen, which is overlapped in repeated sequences of kringle-4 type 2 of apo(a) and multiply presented in the repeated kringle IV domain type2 domain. (FIGS. 1b and 1c). Although apo(a) is a high homologue of plasminogen, containing multiple copies of kringle-4, a single copy of kringle-5 and an inactive protease domain, the selected epitope sequence was not high homology with plasminogen. The antigen sequence was hydrophilic domain and known as a potential of B-cell epitope as previously described (Clinica chimica acta, 1999, 287: 29-43).

DNA Vaccination to FVB Mice

[0105] FVB female mice were immunized with pcDNA3.1-HBc-apo(a) [HBc-apo(a)], pcDNA3.1-HBc [HBc] or saline, respectively, by intramuscular administration using electroporator, three times every two weeks (FIG. 2a). Although FVB has no endogenous apo(a), the antigen of this DNA vaccine might be recognized as a foreign substance. Titer of anti-apo(a) antibody was observed only in HBc-apo(a) group (FIG. 2b-left). From the analysis of IgG subtypes, the immunization was predicted to lead to Th1-biased immune responses with predominant IgG2a production (FIG. 2b-right). Six weeks after third immunization, additional immunization was given to mice, which raised the titer of anti-apo(a) antibody (FIG. 2c-left). This immunization was also predicted to lead to Th1-biased immune responses with predominant IgG2a production (FIG. 2c-right). Furthermore, anti-plasminogen antibodies were not detected after these immunization (FIG. 2d), although apo(a) was highly homologue to plasminogen, which indicated that these immunization had little effect on fibrinolytic system.

[0106] To assess the safety and validity of the epitope, 12 a.a in apo(a), T-cell proliferation assay and ELISpot assay were performed. In immunized female FVB mice, T-cell proliferation assay showed that stimulation with apo(a) 12 a.a. peptide (peptide consisting of the amino acid sequence shown by SEQ ID NO: 1) did not induce the proliferation of splenocytes from immunized mice (FIG. 3a). Also, in ELISpot assay, stimulation with apo(a) 12 a.a. peptide induced a production of neither IFN-.gamma. nor IL-4 (FIGS. 3b and 3c). These data indicated that the amino acid sequence shown by SEQ ID NO: 1 did not contain T-cell epitopes to induce T-cell activation.

DNA Vaccination to Lp(a) Transgenic Mice

[0107] As apo(a) is present only in humans, primates and hedgehogs, Lp(a) transgenic mice generated by crossing human apo(a) transgenic mice and human apoB transgenic mice were used (Nature genetics, 1995, 9: 424-431; Nature, 1992, 360: 670-672; Proceedings of the National Academy of Sciences, 1994, 91: 2130; Circulation, 2002, 105: 1491-1496). In Lp(a) transgenic mice, serum Lp(a) level was higher in female mice than in male mice (Atherosclerosis, 211: 41-47). Since the bilateral ovariectomy in Lp(a) transgenic mice increased serum Lp(a) level, ovariectomy on Lp(a) transgenic mice was performed two weeks before first immunization. Similarly, Lp(a) transgenic mice were immunized (FIG. 4a). Two weeks after third and fourth immunization, titer of anti-apo(a) antibody was observed only in HBc-apo(a) group (FIGS. 4b and 4c). In Lp(a) transgenic mice, this immunization also did not produce anti-plasminogen antibodies (FIG. 4d).

[0108] As to DNA vaccination to Lp(a) transgenic mice, T-cell proliferation assay and ELISpot assay were performed. In immunized Lp(a) transgenic mice, T-cell proliferation assay showed that stimulation with apo(a) 12 a.a. peptide did not induce the proliferation of splenocytes from immunized mice. In ELISpot assay, stimulation with apo(a) 12 a.a. peptide induced a production of neither IFN-.gamma. nor IL-4. These data also indicated that the amino acid sequence shown by SEQ ID NO: 1 did not contain T-cell epitopes to induce T-cell activation.

Carotid Artery Ligation Model in Lp(a) Transgenic Mice

[0109] As a result of flow cessation caused by ligation of the left common carotid artery, a higher increase in intima formation was observed in Lp(a) transgenic mice immunized with HBc and saline, compared to Lp(a) transgenic mice immunized with HBc-apo(a) (FIG. 5a). There was no difference in media formation among Lp(a) transgenic mice immunized HBc-apo(a), HBc or saline. The ratio of intima to media was higher significantly in HBc and saline group than HBc-apo(a) group (FIG. 5b), suggested that HBc-apo(a) vaccination to Lp(a) transgenic mice attenuated neointima formation (FIG. 5b). Moreover, the expression of Lp(a) in ligated vessels of Lp(a) transgenic mice was assessed by immunohistochemistry. There are multiple studies documenting the deposition of Lp(a) in arteries affected by atherosclerosis. The deposition of Lp(a) in ligated vessels was observed in non-immunized group much more strongly than in immunized group (FIG. 5c). Unexpectedly, HBc-apo(a) vaccination did not decrease serum Lp(a) level.

[0110] The produced amino acid sequence of HBc-apo(a) is shown in SEQ ID NO: 16, and the nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 15. The following region corresponds to the inserted sequence.

nucleotide Nos. 244-294 of SEQ ID NO: 15 (Of these, nucleotide No. 250-285 encode SEQ ID NO: 1) amino acid Nos. 81-97 of SEQ ID NO: 16 (Of these, amino acid Nos. 83-94 correspond to SEQ ID NO: 1)

Example 2

[0111] Carotid artery ligation model in Lp(a) transgenic mice in Example 1 was further analyzed.

[0112] In order to evaluate neutralization activity of the antibody induced by HBc-apo(a) vaccination, expression of inflammatory cytokines (IL-1.beta., TNF-.alpha., MCP-1) induced by Lp(a) was analyzed using real-time PCR in macrophages differentiated from THP-1 cells in the presence of sera from immunized (apo(a) vaccination) or control group mice. As a result, serum from mice vaccinated by HBc-apo(a) significantly inhibit LP(a) induced IL-1.beta., TNF-.alpha., and MCP-1 expression in macrophase as compared to control mice serum (FIG. 6). This result suggests that HBc-apo(a) vaccination induces neutralizing antibody against apo(a), and the neutralizing antibody binds to Lp(a) in a blood to suppress inflammatory cytokine production due to Lp(a) stimulation, decreases the amount of inflammatory cytokine in the blood, thereby suppressing intimal thickening (i.e. arteriosclerosis).

[0113] In addition, Lp(a) deposition in ligated vessels in Lp(a) transgenic mouse was evaluated by immunohistochemistry. In control mice, Lp(a) deposition was localized to the site of arteriosclerosis disease (i.e. neointimal formation site). Such Lp(a) deposition was significantly decreased in mice immunized with HBc-apo(a) vaccine as compared to non-immunized group. These results suggest that neutralizing antibody against apo(a) induced by HBc-apo(a) vaccination binds to Lp(a) in a blood, and inhibits Lp(a) deposition to vascular tissue, thereby suppressing neointimal thickening (i.e. arteriosclerosis).

INDUSTRIAL APPLICABILITY

[0114] The present invention provides a DNA vaccine capable of treating or preventing arteriosclerosis, while avoiding self-reactive T cell induction.

Sequence CWU 1

1

17112PRTMus musculus 1Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg 1 5 10 22040PRTHomo sapiens 2Met Glu His Lys Glu Val Val Leu Leu Leu Leu Leu Phe Leu Lys Ser 1 5 10 15 Ala Ala Pro Glu Gln Ser His Val Val Gln Asp Cys Tyr His Gly Asp 20 25 30 Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 35 40 45 Cys Gln Ala Trp Ser Ser Met Thr Pro His Gln His Asn Arg Thr Thr 50 55 60 Glu Asn Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro 65 70 75 80 Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 85 90 95 Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 100 105 110 Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser 115 120 125 Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 130 135 140 Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly 145 150 155 160 Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg 165 170 175 Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 180 185 190 Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly 195 200 205 Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly 210 215 220 Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 225 230 235 240 Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys 245 250 255 Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val 260 265 270 Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 275 280 285 Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 290 295 300 Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp 305 310 315 320 Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 325 330 335 Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu 340 345 350 Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln 355 360 365 Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 370 375 380 Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His 385 390 395 400 Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 405 410 415 Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 420 425 430 Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser 435 440 445 Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro 450 455 460 Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 465 470 475 480 Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr 485 490 495 Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr 500 505 510 Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 515 520 525 Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 530 535 540 Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 545 550 555 560 Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 565 570 575 Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg 580 585 590 Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly 595 600 605 Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 610 615 620 Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala 625 630 635 640 Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 645 650 655 Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 660 665 670 Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val 675 680 685 Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu 690 695 700 Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 705 710 715 720 Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp 725 730 735 Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro 740 745 750 Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 755 760 765 Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 770 775 780 Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro 785 790 795 800 Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 805 810 815 Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln 820 825 830 Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 835 840 845 Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 850 855 860 Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Pro 865 870 875 880 Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Ser Val Arg Trp Glu 885 890 895 Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 900 905 910 Pro Pro Thr Ile Thr Pro Ile Pro Ser Leu Glu Ala Pro Ser Glu Gln 915 920 925 Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn 930 935 940 Gly Gln Ser Tyr Gln Gly Thr Tyr Phe Ile Thr Val Thr Gly Arg Thr 945 950 955 960 Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro 965 970 975 Ala Tyr Tyr Pro Asn Ala Gly Leu Ile Lys Asn Tyr Cys Arg Asn Pro 980 985 990 Asp Pro Val Ala Ala Pro Trp Cys Tyr Thr Thr Asp Pro Ser Val Arg 995 1000 1005 Trp Glu Tyr Cys Asn Leu Thr Arg Cys Ser Asp Ala Glu Trp Thr 1010 1015 1020 Ala Phe Val Pro Pro Asn Val Ile Leu Ala Pro Ser Leu Glu Ala 1025 1030 1035 Phe Phe Glu Gln Ala Leu Thr Glu Glu Thr Pro Gly Val Gln Asp 1040 1045 1050 Cys Tyr Tyr His Tyr Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 1055 1060 1065 Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro 1070 1075 1080 His Gln His Ser Arg Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu 1085 1090 1095 Thr Arg Asn Tyr Cys Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp 1100 1105 1110 Cys Tyr Thr Met Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu 1115 1120 1125 Thr Gln Cys Leu Val Thr Glu Ser Ser Val Leu Ala Thr Leu Thr 1130 1135 1140 Val Val Pro Asp Pro Ser Thr Glu Ala Ser Ser Glu Glu Ala Pro 1145 1150 1155 Thr Glu Gln Ser Pro Gly Val Gln Asp Cys Tyr His Gly Asp Gly 1160 1165 1170 Gln Ser Tyr Arg Gly Ser Phe Ser Thr Thr Val Thr Gly Arg Thr 1175 1180 1185 Cys Gln Ser Trp Ser Ser Met Thr Pro His Trp His Gln Arg Thr 1190 1195 1200 Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg Asn Tyr Cys Arg 1205 1210 1215 Asn Pro Asp Ala Glu Ile Ser Pro Trp Cys Tyr Thr Met Asp Pro 1220 1225 1230 Asn Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Pro Val Thr 1235 1240 1245 Glu Ser Ser Val Leu Ala Thr Ser Thr Ala Val Ser Glu Gln Ala 1250 1255 1260 Pro Thr Glu Gln Ser Pro Thr Val Gln Asp Cys Tyr His Gly Asp 1265 1270 1275 Gly Gln Ser Tyr Arg Gly Ser Phe Ser Thr Thr Val Thr Gly Arg 1280 1285 1290 Thr Cys Gln Ser Trp Ser Ser Met Thr Pro His Trp His Gln Arg 1295 1300 1305 Thr Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg Asn Tyr Cys 1310 1315 1320 Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp Cys Tyr Thr Met Asp 1325 1330 1335 Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Pro Val 1340 1345 1350 Met Glu Ser Thr Leu Leu Thr Thr Pro Thr Val Val Pro Val Pro 1355 1360 1365 Ser Thr Glu Leu Pro Ser Glu Glu Ala Pro Thr Glu Asn Ser Thr 1370 1375 1380 Gly Val Gln Asp Cys Tyr Arg Gly Asp Gly Gln Ser Tyr Arg Gly 1385 1390 1395 Thr Leu Ser Thr Thr Ile Thr Gly Arg Thr Cys Gln Ser Trp Ser 1400 1405 1410 Ser Met Thr Pro His Trp His Arg Arg Ile Pro Leu Tyr Tyr Pro 1415 1420 1425 Asn Ala Gly Leu Thr Arg Asn Tyr Cys Arg Asn Pro Asp Ala Glu 1430 1435 1440 Ile Arg Pro Trp Cys Tyr Thr Met Asp Pro Ser Val Arg Trp Glu 1445 1450 1455 Tyr Cys Asn Leu Thr Arg Cys Pro Val Thr Glu Ser Ser Val Leu 1460 1465 1470 Thr Thr Pro Thr Val Ala Pro Val Pro Ser Thr Glu Ala Pro Ser 1475 1480 1485 Glu Gln Ala Pro Pro Glu Lys Ser Pro Val Val Gln Asp Cys Tyr 1490 1495 1500 His Gly Asp Gly Arg Ser Tyr Arg Gly Ile Ser Ser Thr Thr Val 1505 1510 1515 Thr Gly Arg Thr Cys Gln Ser Trp Ser Ser Met Ile Pro His Trp 1520 1525 1530 His Gln Arg Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu Thr Glu 1535 1540 1545 Asn Tyr Cys Arg Asn Pro Asp Ser Gly Lys Gln Pro Trp Cys Tyr 1550 1555 1560 Thr Thr Asp Pro Cys Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 1565 1570 1575 Cys Ser Glu Thr Glu Ser Gly Val Leu Glu Thr Pro Thr Val Val 1580 1585 1590 Pro Val Pro Ser Met Glu Ala His Ser Glu Ala Ala Pro Thr Glu 1595 1600 1605 Gln Thr Pro Val Val Arg Gln Cys Tyr His Gly Asn Gly Gln Ser 1610 1615 1620 Tyr Arg Gly Thr Phe Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 1625 1630 1635 Ser Trp Ser Ser Met Thr Pro His Arg His Gln Arg Thr Pro Glu 1640 1645 1650 Asn Tyr Pro Asn Asp Gly Leu Thr Met Asn Tyr Cys Arg Asn Pro 1655 1660 1665 Asp Ala Asp Thr Gly Pro Trp Cys Phe Thr Met Asp Pro Ser Ile 1670 1675 1680 Arg Trp Glu Tyr Cys Asn Leu Thr Arg Cys Ser Asp Thr Glu Gly 1685 1690 1695 Thr Val Val Ala Pro Pro Thr Val Ile Gln Val Pro Ser Leu Gly 1700 1705 1710 Pro Pro Ser Glu Gln Asp Cys Met Phe Gly Asn Gly Lys Gly Tyr 1715 1720 1725 Arg Gly Lys Lys Ala Thr Thr Val Thr Gly Thr Pro Cys Gln Glu 1730 1735 1740 Trp Ala Ala Gln Glu Pro His Arg His Ser Thr Phe Ile Pro Gly 1745 1750 1755 Thr Asn Lys Trp Ala Gly Leu Glu Lys Asn Tyr Cys Arg Asn Pro 1760 1765 1770 Asp Gly Asp Ile Asn Gly Pro Trp Cys Tyr Thr Met Asn Pro Arg 1775 1780 1785 Lys Leu Phe Asp Tyr Cys Asp Ile Pro Leu Cys Ala Ser Ser Ser 1790 1795 1800 Phe Asp Cys Gly Lys Pro Gln Val Glu Pro Lys Lys Cys Pro Gly 1805 1810 1815 Ser Ile Val Gly Gly Cys Val Ala His Pro His Ser Trp Pro Trp 1820 1825 1830 Gln Val Ser Leu Arg Thr Arg Phe Gly Lys His Phe Cys Gly Gly 1835 1840 1845 Thr Leu Ile Ser Pro Glu Trp Val Leu Thr Ala Ala His Cys Leu 1850 1855 1860 Lys Lys Ser Ser Arg Pro Ser Ser Tyr Lys Val Ile Leu Gly Ala 1865 1870 1875 His Gln Glu Val Asn Leu Glu Ser His Val Gln Glu Ile Glu Val 1880 1885 1890 Ser Arg Leu Phe Leu Glu Pro Thr Gln Ala Asp Ile Ala Leu Leu 1895 1900 1905 Lys Leu Ser Arg Pro Ala Val Ile Thr Asp Lys Val Met Pro Ala 1910 1915 1920 Cys Leu Pro Ser Pro Asp Tyr Met Val Thr Ala Arg Thr Glu Cys 1925 1930 1935 Tyr Ile Thr Gly Trp Gly Glu Thr Gln Gly Thr Phe Gly Thr Gly 1940 1945 1950 Leu Leu Lys Glu Ala Gln Leu Leu Val Ile Glu Asn Glu Val Cys 1955 1960 1965 Asn His Tyr Lys Tyr Ile Cys Ala Glu His Leu Ala Arg Gly Thr 1970 1975 1980 Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Phe Glu 1985 1990 1995 Lys Asp Lys Tyr Ile Leu Gln Gly Val Thr Ser Trp Gly Leu Gly 2000 2005 2010 Cys Ala Arg Pro Asn Lys Pro Gly Val Tyr Ala Arg Val Ser Arg 2015 2020 2025 Phe Val Thr Trp Ile Glu Gly Met Met Arg Asn Asn 2030 2035 2040 3556DNAHepatitis B virusCDS(2)..(553) 3c atg gat atc gat cct tat aaa gaa ttc gga gct act gtg gag tta ctc 49 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 tcg ttt ctc ccg agt gac ttc ttt cct tca gta cga gat ctt ctg gat 97Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 acc gcc agc gcg ctg tat cgg gaa gcc ttg gag tct cct gag cac tgc 145Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 agc cct cac cat act gcc ctc agg caa gca att ctt tgc tgg ggg gag 193Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 ctc atg act ctg gcc acg tgg gtg ggt gtt aac ttg gaa gat cca gct 241Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 agc agg gac ctg gta gtc agt tat gtc aac act aat atg ggt tta aag 289Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 ttc agg caa ctc ttg tgg ttt cac att agc tgc ctc act ttc ggc cga 337Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110

gaa aca gtt cta gaa tat ttg gtg tct ttc gga gtg tgg atc cgc act 385Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 cct cca gct tat agg cct ccg aat gcc cct atc ctg tcg aca ctc ccg 433Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 gag act act gtt gtt aga cgt cga ggc agg tca cct aga aga aga act 481Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 cct tcg cct cgc agg cga agg tct caa tcg ccg cgg cgc cga aga tct 529Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 caa tct cgg gaa tct caa tgt tag tga 556Gln Ser Arg Glu Ser Gln Cys 180 4183PRTHepatitis B virus 4Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 5185PRTHepatitis B virus 5Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg Ser Gln Ser Arg Glu Ser Gln Cys 180 185 622DNAArtificial SequenceSynthetic CpG-B 1018 6tgactgtgaa cgttcgagat ga 22720DNAArtificial SequenceSynthetic CpG-A D19 7ggtgcatcga tgcagggggg 20821DNAArtificial SequenceSynthetic CpG-C C274 8tcgtcgaacg ttcgagatga t 21925DNAArtificial SequenceSynthetic CpG-C C695 9tcgaacgttc gaacgttcga acgtt 251088DNAArtificial SequenceSynthetic ISS 10ggtgcatcga tgcagggggg tgactgtgaa cgttcgagat gatcgtcgaa cgttcgagat 60gattcgaacg ttcgaacgtt cgaacgtt 881135DNAArtificial SequenceSynthetic primer HBc-1 11gccatggata tcgatcctta taaagaattc ggagc 351254DNAArtificial SequenceSynthetic primer Lp(a)-1 12gttaacttgg aagatccagc tatcactgag gctccttccg aacaagcacc gact 541336DNAArtificial SequenceSynthetic primer HBc-2 13ggcctctcac taacattgag attcccgaga ttgaga 361455DNAArtificial SequenceSynthetic primer Lp(a)-2 14ttccgaacaa gcaccgactg agcaaagggg tgctactagc agggacctgg tagtc 5515609DNAArtificial SequenceSynthetic HBc-apo(a) chimera 15gcc atg gat atc gat cct tat aaa gaa ttc gga gct act gtg gag tta 48 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu 1 5 10 15 ctc tcg ttt ctc ccg agt gac ttc ttt cct tca gta cga gat ctt ctg 96Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu 20 25 30 gat acc gcc agc gcg ctg tat cgg gaa gcc ttg gag tct cct gag cac 144Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His 35 40 45 tgc agc cct cac cat act gcc ctc agg caa gca att ctt tgc tgg ggg 192Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly 50 55 60 gag ctc atg act ctg gcc acg tgg gtg ggt gtt aac ttg gaa gat cca 240Glu Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro 65 70 75 gct atc act gag gct cct tcc gaa caa gca ccg act gag caa agg ggt 288Ala Ile Thr Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Gly 80 85 90 95 gct act agc agg gac ctg gta gtc agt tat gtc aac act aat atg ggt 336Ala Thr Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly 100 105 110 tta aag ttc agg caa ctc ttg tgg ttt cac att agc tgc ctc act ttc 384Leu Lys Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe 115 120 125 ggc cga gaa aca gtt cta gaa tat ttg gtg tct ttc gga gtg tgg atc 432Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile 130 135 140 cgc act cct cca gct tat agg cct ccg aat gcc cct atc ctg tcg aca 480Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr 145 150 155 ctc ccg gag act act gtt gtt aga cgt cga ggc agg tca cct aga aga 528Leu Pro Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg 160 165 170 175 aga act cct tcg cct cgc agg cga agg tct caa tcg ccg cgg cgc cga 576Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 180 185 190 aga tct caa tct cgg gaa tct caa tgt tag tga 609Arg Ser Gln Ser Arg Glu Ser Gln Cys 195 200 16200PRTArtificial SequenceSynthetic Construct 16Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ile Thr Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Gly Ala 85 90 95 Thr Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu 100 105 110 Lys Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly 115 120 125 Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg 130 135 140 Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu 145 150 155 160 Pro Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg 165 170 175 Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg 180 185 190 Ser Gln Ser Arg Glu Ser Gln Cys 195 200 1716PRTHomo sapiens 17Met Glu His Lys Glu Val Val Leu Leu Leu Leu Leu Phe Leu Lys Ser 1 5 10 15

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed