U.S. patent application number 14/032804 was filed with the patent office on 2014-03-27 for dna vaccine containing specific epitope of apolipoprotein (a).
The applicant listed for this patent is AnGesMG, Inc.. Invention is credited to Hiroshi KORIYAMA, Mariko KYUTOKU, Ryuichi MORISHITA, Futoshi NAKAGAMI, Hironori NAKAGAMI.
Application Number | 20140086944 14/032804 |
Document ID | / |
Family ID | 50339073 |
Filed Date | 2014-03-27 |
United States Patent
Application |
20140086944 |
Kind Code |
A1 |
KYUTOKU; Mariko ; et
al. |
March 27, 2014 |
DNA VACCINE CONTAINING SPECIFIC EPITOPE OF APOLIPOPROTEIN (a)
Abstract
The present invention provides an agent for the treatment or
prophylaxis of arteriosclerosis comprising an expression vector
encoding a chimeric Hepatitis B virus core antigen polypeptide
inserted with an amino acid sequence containing a specific epitope
of apolipoprotein (a), wherein the amino acid sequence containing
the specific epitope is inserted between the amino acid residues 80
and 81 of the hepatitis B virus core antigen polypeptide.
Inventors: |
KYUTOKU; Mariko; (Osaka,
JP) ; NAKAGAMI; Hironori; (Osaka, JP) ;
KORIYAMA; Hiroshi; (Osaka, JP) ; NAKAGAMI;
Futoshi; (Osaka, JP) ; MORISHITA; Ryuichi;
(Osaka, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AnGesMG, Inc. |
Osaka |
|
JP |
|
|
Family ID: |
50339073 |
Appl. No.: |
14/032804 |
Filed: |
September 20, 2013 |
Current U.S.
Class: |
424/185.1 ;
424/192.1; 435/320.1 |
Current CPC
Class: |
C12N 2730/10171
20130101; A61K 39/0012 20130101; A61K 2039/58 20130101; A61P 9/10
20180101; C12N 7/00 20130101; C12N 15/85 20130101; A61K 2039/53
20130101; C12N 2730/10142 20130101; A61K 2039/545 20130101; A61K
2039/575 20130101; A61K 39/292 20130101; C12N 2730/10143
20130101 |
Class at
Publication: |
424/185.1 ;
424/192.1; 435/320.1 |
International
Class: |
A61K 39/00 20060101
A61K039/00; A61K 39/29 20060101 A61K039/29; C12N 15/85 20060101
C12N015/85 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 21, 2012 |
JP |
2012-208796 |
Claims
1. A method for treating or preventing a lipoprotein(a)-related
disease in a mammal, comprising administering effective amount of
an expression vector encoding an antigen polypeptide inserted with
an amino acid sequence comprising a specific epitope of
apolipoprotein (a) in the mammal.
2. The method according to claim 1, wherein a neutralizing antibody
against lipoprotein(a) is produced by administering the expression
vector.
3. The method according to claim 2, wherein the neutralizing
antibody suppresses deposition of lipoprotein(a) to a vascular
tissue.
4. The method according to claim 2, wherein the neutralizing
antibody decreases the amount of an inflammatory cytokine in a
blood.
5. The method according to claim 3, wherein the
lipoprotein(a)-related disease is arteriosclerosis.
6. The method according to claim 4, wherein the
lipoprotein(a)-related disease is arteriosclerosis.
7. The method according to claim 1, wherein the antigen polypeptide
is a chimeric Hepatitis B virus core antigen polypeptide inserted
with an amino acid sequence comprising a specific epitope of
apolipoprotein (a), wherein the amino acid sequence comprising the
specific epitope is inserted between the amino acid residues 80 and
81 of the hepatitis B virus core antigen polypeptide.
8. The method according to claim 7, wherein the
lipoprotein(a)-related disease is arteriosclerosis.
9. The method according to claim 8, wherein the arteriosclerosis is
atherosclerosis.
10. The method according to claim 7, wherein the inserted amino
acid sequence comprises the amino acid shown by SEQ ID NO: 1.
11. The method according to claim 10, wherein the inserted amino
acid sequence further comprises one or more specific epitopes.
12. The method according to claim 11, wherein the further specific
epitope is a specific epitope of apolipoprotein B.
13. The method according to claim 1, wherein the expression vector
is administered plural times.
14. The method according to claim 13, wherein the expression vector
is administered 2, 3 or 4 times.
15. A method of inducing a neutralizing antibody against
lipoprotein(a) in a mammal, comprising administering effective
amount of an expression vector encoding an antigen polypeptide
inserted with an amino acid sequence comprising a specific epitope
of apolipoprotein (a) in the mammal.
16. An expression vector encoding a chimeric Hepatitis B virus core
antigen polypeptide inserted with an amino acid sequence comprising
a specific epitope of apolipoprotein (a), wherein the amino acid
sequence comprising the specific epitope is inserted between the
amino acid residues 80 and 81 of the hepatitis B virus core antigen
polypeptide.
17. The expression vector according to claim 16, wherein the
inserted amino acid sequence comprises the amino acid shown by SEQ
ID NO: 1.
18. The expression vector according to claim 16, wherein the
inserted amino acid sequence further comprises one or more specific
epitopes.
Description
CROSS-REFERENCE TO THE RELATED APPLICATION
[0001] The present application is based on a patent application No.
2012-208796 filed in Japan (filing date: Sep. 21, 2012), the
contents of which are incorporated in full herein.
TECHNICAL FIELD OF THE INVENTION
[0002] The present invention relates to a DNA vaccine effective for
the treatment or prophylaxis of a lipoprotein(a)-related diseases
such as arteriosclerosis.
BACKGROUND OF THE INVENTION
[0003] Lipoprotein(a) [Lp(a)] is a serum lipoprotein consisting of
one molecule of apolipoprotein B-100 (apoB) and one molecule of
apolipoprotein(a) [apo(a)], which are bonded through a single
disulfide bond; and a cholesterol-rich low-density lipoprotein
(LDL) particle, (non-patent document 1), and found only in humans,
primates and hedgehog. The apo(a) is a homologue of plasminogen
(non-patent document 2), containing 10 different types (kringle-4
types 1 through 10) of plasminogen kringle-4 like repeats as well
as regions homologous to the kringle-5 and inactive protease
regions (non-patent document 3). Lp(a) has been considered as an
independent cardiovascular risk factor and several studies have
shown the association between plasma Lp(a) levels and
cardiovascular disease (CVD)/coronary heart disease (CHD). Elevated
Lp(a) levels promote atherosclerosis via Lp(a)-derived cholesterol
entrapment in intima; via inflammatory cell recruitment; and/or via
the binding of pro-inflammatory-oxidized phospholipids (non-patent
document 4). Lipid lowering agents have little effect on plasma
Lp(a) level (non-patent document 5). Although it has been reported
that administration of niacin or estrogen may reduce the Lp(a)
levels, there is no specific agent for the reduction of plasma
Lp(a) (non-patent document 6-8).
[0004] Non-patent document 9 discloses a measurement method of
Lp(a) which is not influenced by the polymorphism of apo(a).
[0005] While vaccine is often used for the prophylaxis or treatment
of diseases caused by exogeneous factors, such as infections and
the like, even for the diseases caused by endogenous aggravation
factors such as Alzheimer's disease, hypertension and the like,
vaccine therapy has been tried, which includes administering the
aggravation factors, epitopes contained in the aggravation factors,
or expression vectors encoding them to patients to induce the
antibody to the aggravation factor in the body of patients, thereby
neutralizing the function of the aggravation factor and mitigating
the symptoms of the target disease (non-patent documents 10-12).
Plasmid DNA vaccination is one of the tools to induce both humoral
and cellular immune responses, without co-treatment with adjuvant,
because in the case of plasmid DNA, unmethylated CpG motifs
expressed with a plasmid unmethylated CpG motifs expressed with a
plasmid backbone have been considered to be "built-in" adjuvants,
owing to their ability to activate the innate immune system by
means of TLR9 (non-patent document 13). In addition, recent
accumulating evidence suggests that the double-stranded structure
of DNA, independently of CpG motifs, possesses immunomodulatory
effects when introduced into the cytosol or its homeostatic
clearance is hampered.
[0006] However, when the aggravation factor is endogenous, the
immune tolerance to the factor has generally been established since
the factor is the patient's own component. Therefore, it is
difficult to efficiently induce an antibody to the factor in the
body of the patient even when these endogenous aggravation factors
or partial peptides thereof are directly administered to the
patient. As such, some technical idea is necessary to have the
patient's immune system recognize these self antigens, thereby
inducing the production of the antibody.
[0007] Hepatitis B virus core (HBc) antigen protein constitutes
spherical core particles by self assembly. The core particles have
very high immunogenicity. When a fusion polypeptide obtained by
inserting a desired epitope into a particular site of the HBc
antigen protein, or connecting a desired epitope to the terminus of
the HBc antigen protein is used, the epitope is presented on the
surface of the particles formed by self-assembly. Using the fusion
polypeptide, the inserted epitope is easily recognized by the
immune system, and the production of the antibody that recognizes
the epitope can be efficiently induced. Therefore, utilizing the
HBc antigen protein as a platform of vaccine, attempts have been
made to induce production of the antibody to an antigen difficult
to be recognized by the immune system (non-patent document 14,
non-patent document 15).
[0008] Patent document 1 discloses particles composed of a chimeric
HBc antigen protein containing an foreign amino acid sequence
having an epitope, wherein the foreign amino acid sequence is
inserted into the amino acid residues 80-81 of the HBc antigen.
[0009] Non-patent document 16 describes that intramuscular
immunization with a DNA vaccine encoding ISS and an HBc antigen
inserted with a CETP epitope consisting of 26 amino acids inhibited
atherosclerosis in rabbit atherosclerosis model.
[0010] However, even if production of an antibody to an endogenous
aggravation factor can be induced, when cellular immunity to the
factor is simultaneously induced, side effects are caused by the
autoimmune reaction. Therefore, it is necessary to efficiently
induce the production of an antibody to the endogenous aggravation
factor while suppressing the induction of self-reactive T
cells.
[0011] Under the above situation, a DNA vaccine showing totally
satisfying effectiveness to arteriosclerosis has not been developed
yet.
DOCUMENT LIST
Patent Document
[0012] patent document 1: JP-B-3228737
Non-Patent Documents
[0012] [0013] non-patent document 1: Acta Pathologica
Microbiologica Scandinavica, 1963, 59: 369-382 [0014] non-patent
document 2: Proceedings of the National Academy of Sciences, 1987,
84: 3224 [0015] non-patent document 3: Nature, 1987, 330: 132-137
[0016] non-patent document 4: Nature, 1989 May 25;
339(6222):301-303 [0017] non-patent document 5: Journal of Clinical
Investigation, 1990, 85: 1709 [0018] non-patent document 6: New
England journal of medicine, 1990, 323: 1289-1298 [0019] non-patent
document 7: New England journal of medicine, 2009, 361: 2113-2122
[0020] non-patent document 8: Atherosclerosis, 2010, 211: 41-47
[0021] non-patent document 9: Clinica chimica acta, 1999, 287:
29-43 [0022] non-patent document 10: Nature, 2000, 408: 982-985
[0023] non-patent document 11: Nat Rev Neurosci, 2002, 3: 824-828
[0024] non-patent document 12: The Lancet, 2008, 371: 821-827
[0025] non-patent document 13: Nature, 2008, 451: 725-729 [0026]
non-patent document 14: Expert Rev. Vaccines, vol. 8, no. 11, pp.
1565-1573, 2009 [0027] non-patent document 15: Nature, vol. 330,
pp. 381-384, 1987 [0028] non-patent document 16: Vaccine, 2006, 24:
4942-4950
SUMMARY OF THE INVENTION
[0029] The present invention aims to provide a DNA vaccine capable
of treating or preventing a lipoprotein(a)-related diseases such as
arteriosclerosis while avoiding the induction of self-reactive T
cells.
[0030] The present inventors have conducted intensive studies and
found that administration of an expression vector for chimeric
Hepatitis B virus core antigen polypeptide obtained by inserting a
specific epitope of apolipoprotein (a) between the amino acid
residues 80 and 81 of hepatitis B virus core antigen polypeptide
dominantly induces humoral immunity to apolipoprotein (a) while
suppressing the induction of T cells that react with apolipoprotein
(a), whereby deposition of lipoprotein (a) and vascular intimal
thickening can be effectively suppressed. Based on these findings,
they have further studied and completed the present invention.
[0031] Accordingly, the present invention relates to the
following.
[1] A method for treating or preventing a lipoprotein(a)-related
disease in a mammal, comprising administering effective amount of
an expression vector encoding an antigen polypeptide inserted with
an amino acid sequence comprising a specific epitope of
apolipoprotein (a) in the mammal. [2] The method of [1], wherein a
neutralizing antibody against lipoprotein(a) is produced by
administering the expression vector. [3] The method of [2], wherein
the neutralizing antibody suppresses deposition of lipoprotein(a)
to a vascular tissue. [4] The method of [2], wherein the
neutralizing antibody decreases the amount of an inflammatory
cytokine in a blood. [5] The method of [3], wherein the
lipoprotein(a)-related disease is arteriosclerosis. [6] The method
of [4], wherein the lipoprotein(a)-related disease is
arteriosclerosis. [7] The method of [1], wherein the antigen
polypeptide is a chimeric Hepatitis B virus core antigen
polypeptide inserted with an amino acid sequence comprising a
specific epitope of apolipoprotein (a), wherein the amino acid
sequence comprising the specific epitope is inserted between the
amino acid residues 80 and 81 of the hepatitis B virus core antigen
polypeptide. [8] The method of [7], wherein the
lipoprotein(a)-related disease is arteriosclerosis. [9] The method
of [8], wherein the arteriosclerosis is atherosclerosis. [10] The
method of [7], wherein the inserted amino acid sequence comprises
the amino acid shown by SEQ ID NO: 1. [11] The method of [10],
wherein the inserted amino acid sequence further comprises one or
more specific epitopes. [12] The method of [11], wherein the
further specific epitope is a specific epitope of apolipoprotein B.
[13] The method of [1], wherein the expression vector is
administered plural times. [14] The method of [13], wherein the
expression vector is administered 2, 3 or 4 times. [15] A method of
inducing a neutralizing antibody against lipoprotein(a) in a
mammal, comprising administering effective amount of an expression
vector encoding an antigen polypeptide inserted with an amino acid
sequence comprising a specific epitope of apolipoprotein (a) in the
mammal. [16] An expression vector encoding a chimeric Hepatitis B
virus core antigen polypeptide inserted with an amino acid sequence
comprising a specific epitope of apolipoprotein (a), wherein the
amino acid sequence comprising the specific epitope is inserted
between the amino acid residues 80 and 81 of the hepatitis B virus
core antigen polypeptide. [17] The expression vector of [16],
wherein the inserted amino acid sequence comprises the amino acid
shown by SEQ ID NO: 1. [18] The expression vector of [16], wherein
the inserted amino acid sequence further comprises one or more
specific epitopes. [I] An agent for the treatment or prophylaxis of
arteriosclerosis comprising an expression vector encoding a
chimeric Hepatitis B virus core antigen polypeptide inserted with
an amino acid sequence comprising a specific epitope of
apolipoprotein (a), wherein the amino acid sequence comprising the
specific epitope is inserted between the amino acid residues 80 and
81 of the hepatitis B virus core antigen polypeptide. [II] The
agent of [I], wherein the arteriosclerosis is atherosclerosis.
[III] The agent of [I] or [II], wherein the inserted amino acid
sequence comprises the amino acid sequence represented by SEQ ID
NO: 1. [IV] The agent of any of [I]-[III], wherein the inserted
amino acid sequence further comprises one or more specific
epitopes. [V] The agent of [IV], wherein the further specific
epitope is a specific epitope of apolipoprotein B. [VI] The agent
of any of [I]-[V], which is administered plural times. [VII] The
agent of [VI], which is administered 2, 3 or 4 times. [VIII] An
expression vector encoding a chimeric Hepatitis B virus core
antigen polypeptide inserted with an amino acid sequence comprising
a specific epitope of apolipoprotein (a), for use in the treatment
or prophylaxis of arteriosclerosis, wherein the amino acid sequence
comprising the specific epitope is inserted between the amino acid
residues 80 and 81 of the hepatitis B virus core antigen
polypeptide. [IX] The expression vector of [VIII], wherein the
arteriosclerosis is atherosclerosis. [X] The expression vector of
[VIII] or [IX], wherein the inserted amino acid sequence comprises
the amino acid shown by SEQ ID NO: 1. [XI] The expression vector of
any of [VIII]-[X], wherein the inserted amino acid sequence further
comprises one or more specific epitopes.
EFFECT OF THE INVENTION
[0032] The present invention provides a DNA vaccine capable of
treating or preventing arteriosclerosis while avoiding induction of
self-reactive T cells.
[0033] Since the vaccine of the present invention dominantly
induces humoral immunity to apolipoprotein (a) rather than the
cellular immunity, the risk of an adverse influence of the
self-reactive cellular immunity can be reduced.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1 shows plasmid DNA construction for vaccination. a)
Plasmid map of pcDNA3.1-HBc (control vector) and
pcDNA3.1-HBc-apo(a) (vaccination vector). HBc indicates the full
sequence of HBc. HBc-N indicates the N-terminus of HBc (1-80 a.a.)
and HBc-C indicates the C-terminus of HBc (81-183 a.a.). b) The
detail information of plasmid design for Apo(a) vaccine. Twelve
amino acids (EAPSEQAPTEQR: SEQ ID NO: 1) as an antigen for Apo(a)
and linkers (the N-terminal I-T dipeptide linker and the C-terminal
G-A-T tripeptide) were designed to inframe fusion to HBc to allow
flexibility in the conformation of apo(a) epitope when
surface-exposed on HBc particle. The apo(a) and the linkers were
represented by single-letter codes. c) Schema of Lp(a) showing the
targeted antigen. Apo(a) is mainly composed of kringle IV like
domain (1-10) and kringle V like domain, and repeated kringle IV
domain type2 (IV type2) is variable repeats. Black box indicates
the epitope (EAPSEQAPTEQR: SEQ ID NO: 1) which is overlapped in
repeated sequences of kringle-4 type 2 of apo(a) and multiply
presented in the repeated kringle IV domain type2 domain.
[0035] FIG. 2 shows DNA vaccination for Apo(a) to FVB mice. a) Time
course of DNA vaccination. Vaccination was done at 8 weeks old (0
W) and at 2 weeks (2 W), 4 weeks (4 W), 10 weeks (10 W) after first
vaccination. Titer was quantified at 6 weeks and 12 weeks after
first vaccination, and T cell activity was evaluated at 16 weeks
after first vaccination. b) and c) Titer of anti-apo(a) antibodies
at 6 weeks and 12 weeks. Total IgG titer for apo(a) was increased
only in mice serum (.times.100 dilution) from HBc-apo(a) group
(left panel). IgG subtype (IgG1, IgG2a or IgG2b) in mice serum
(.times.100 dilution) from HBc-apo(a) group was also evaluated by
each IgG specific antibody (right panel). d) Anti-plasminogen
antibodies in mice assayed by ELISA. Total IgG titer for
plasminogen were evaluated in mice serum (.times.100 dilution) from
HBc-apo(a) group at 6 week and 12 weeks after first immunization
and anti-plasminogen antibody (PLG Ab) was used as a positive
control.
[0036] FIG. 3 shows T-cell responses induced by DNA vaccination in
FVB mice. a) T-cell proliferation assay by [.sup.3H] thymidine
uptake. Cultured splenocytes from mice immunized with HBc-apo(a)
were stimulated with or without peptide consisting of antigen
sequence (apo(a) 12a.a.; EAPSEQAPTEQR:SEQ ID NO: 1). PHA was used
as positive control of non-specific T-cell activator. b)
Enzyme-Linked ImmunoSpot (ELISpot) assay. Splenocytes obtained from
mice immunized with HBc-apo(a), HBc or Saline were stimulated with
or without the antigen sequence peptide or PHA. Blue dots are
positive spots for IFN-gamma (left panel) and IL-4 (right panel).
c) Quantification of ELISpot assay. Quantification was assessed by
counting spot numbers per well in each well.
[0037] FIG. 4 shows DNA vaccination for apo(a) in Lp(a) transgenic
mice. a) Time course of DNA vaccination. Female Lp(a) transgenic
mice were ovariectomized at 8 weeks old. After 2 weeks, DNA
vaccination was done at 10 weeks old (0 W) and at 2 weeks (2 W), 4
weeks (4 W), and 10 weeks (10 W) after first vaccination. Titer was
quantified at 6 weeks and 12 weeks after first vaccination, and T
cell activity was evaluated at 16 weeks after first vaccination. b
and c) Total IgG titer for apo(a) was increased only in mice serum
(.times.100 dilution) from HBc-apo(a) group. d) Anti-plasminogen
antibodies in mice assayed by ELISA. Total IgG titer for
plasminogen were evaluated in mice serum (.times.100 dilution) from
HBc-apo(a) group at 6 week and 12 weeks after first immunization
and anti-plasminogen antibody (PLG Ab) was used as a positive
control.
[0038] FIG. 5 shows carotid artery ligation model in Lp(a)
transgenic mice. a) Representative images of H&E staining in
ligated vessels. Left panel shows the immunized mice (HBc-apo(a)
group) and Right panel shows the non-immunized mice (saline and
HBc). Carotid artery ligation was performed at 13 weeks after first
immunization, and the vascular remodeling was evaluated at 16
weeks. b) Quantification of intima and media area and ratio of
intima to media in immunized mice and non-immunized mice. c)
Immunostaining with anti-Lp(a) antibody. Lp(a) deposition (pink) in
ligated vessels was observed only in non-immunized group.
[0039] FIG. 6 shows the expression of the inflammatory cytokines
(IL-1.beta., TNF-.alpha., MCP-1) analyzed by real-time PCR, in
macrophages that had differentiated from THP-1 cells in the
presence of sera from mice immunized with HBc-apo(a) vaccine or
control mice.
[0040] FIG. 7 shows Immunostaining of blood vessel with anti-Lp(a)
antibody. Lp(a) deposition (pink, allow head) in ligated vessels
was observed only in non-immunized group.
DESCRIPTION OF EMBODIMENTS
[0041] The present invention provides an agent for the treatment or
prophylaxis of a lipoprotein(a)-related disease, comprising an
expression vector encoding an antigen polypeptide inserted with an
amino acid sequence comprising a specific epitope of apolipoprotein
(a). By administering effective amount of the expression vector
encoding an antigen polypeptide inserted with an amino acid
sequence comprising a specific epitope of apolipoprotein (a) in a
mammal, a lipoprotein(a)-related disease in the mammal can be
treated or prevented.
[0042] Though not bound by theory, by administering an effective
amount of the expression vector encoding an antigen polypeptide
inserted with an amino acid sequence comprising a specific epitope
of apolipoprotein (a) in a mammal, production of an antibody
against apolipoprotein (a) is induced in the mammal, and the
induced antibody acts as a neutralizing antibody against
lipoprotein (a), suppresses deposition of lipoprotein (a) to the
vascular tissue, or inhibits production of inflammatory cytokines
(e.g. IL-1.beta., TNF-.alpha., MCP-1) in macrophages and the like
induced by lipoprotein (a) stimulation to decrease the amount of
inflammatory cytokines in blood, thereby treating or preventing
lipoprotein(a)-related diseases. The present invention also
provides a method of inducing a neutralizing antibody against
lipoprotein(a) in a mammal, comprising administering effective
amount of an expression vector encoding an antigen polypeptide
inserted with an amino acid sequence comprising a specific epitope
of apolipoprotein (a) in the mammal.
[0043] In one embodiment, the expression vector encoding an antigen
polypeptide comprising a specific epitope of apolipoprotein (a) is
an expression vector encoding a chimeric Hepatitis B virus core
antigen polypeptide inserted with an amino acid sequence comprising
a specific epitope of apolipoprotein (a), wherein the amino acid
sequence comprising the specific epitope is inserted between the
amino acid residues 80 and 81 of the hepatitis B virus core antigen
polypeptide.
[0044] When an expression vector encoding a chimeric Hepatitis B
virus core antigen polypeptide inserted with an amino acid sequence
comprising a specific epitope of apolipoprotein (a) is
administered, an immune reaction (preferably humoral immune
reaction such as antibody production and the like) to the specific
epitope of apolipoprotein (a) in the expressed chimeric Hepatitis B
virus core antigen polypeptide is induced, and production of
lipoprotein (a) is suppressed by an antibody to apolipoprotein (a),
whereby neointimal formation and vascular intimal thickening are
suppressed.
[0045] Lipoprotein(a)-related disease refers to a disease caused by
decreased function of endothelial cells, abnormal proliferation of
vascular smooth muscle cells, or inflammatory cytokines produced by
macrophages and the like, induced by lipoprotein (a) stimulation
due to deposition of lipoprotein (a) to inner wall of blood vessel.
Examples of the lipoprotein(a)-related disease include cerebral
infarction, myocardial infarction, angina, sclerosis obliterans,
vascular dementia, vascular restenosis and the like caused by
arteriosclerosis. Preferable lipoprotein(a)-related disease is
arteriosclerosis. While the kind of arteriosclerosis to be the
target of the therapeutic or prophylactic agent of the present
invention is not limited, it is preferably atherosclerosis.
[0046] In the present invention, use of apolipoprotein (a) derived
from a mammal to be the application target of the therapeutic or
prophylactic agent of the present invention is intended though
without limitation thereto. The application target of the
therapeutic or prophylactic agent of the present invention is a
mammal expressing apolipoprotein (a). As a mammal expressing
apolipoprotein (a), only primates such as human and the like and
hedgehog are known. The application target of the therapeutic or
prophylactic agent of the present invention is preferably a primate
such as human. Therefore, for example, when the therapeutic or
prophylactic agent of the present invention is applied to human,
use of apolipoprotein (a) derived from human is intended though
without limitation thereto.
[0047] In the present specification, regarding the particular
factor X (polypeptide or polynucleotide), "factor X derived from
organism Y" or "organism Y factor X" means that the amino acid
sequence or nucleic acid sequence of factor X has the same or
substantially the same amino acid sequence or nucleic acid sequence
as the amino acid sequence or nucleic acid sequence of factor X
naturally expressed in organism Y. Being "substantially the same"
means that the amino acid sequence or nucleic acid sequence of
interest has not less than 70% (preferably not less than 80%, more
preferably not less than 90%, still more preferably not less than
95%, most preferably not less than 99%) identity with the amino
acid sequence or nucleic acid sequence of factor X naturally
expressed in organism Y, and the function of factor X is
maintained.
[0048] Apolipoprotein (a) is a known angiogenesis factor, and the
amino acid sequence and cDNA sequence thereof are also known. It is
known that apolipoprotein (a) contains kringle-IV type 2 repeat
sequences and the repeat number thereof varies. Those having repeat
sequences with any repeat number are encompassed in apolipoprotein
(a). The representative amino acid sequence of human apolipoprotein
(a) includes, but is not limited to, the amino acid sequence shown
by SEQ ID NO: 2(NP.sub.--005568.2). As a partial amino acid
sequence of human apolipoprotein (a), SEQ ID NO: 17 (AAB49909,
AAB66587) has been reported.
[0049] In the present specification, "epitope" refers to a basic
element or minimum unit for recognition by each antibody or T cell
receptor, which is a particular domain, region or molecular
structure the aforementioned antibody or T cell receptor binds
to.
[0050] The epitope of apolipoprotein (a) used in the present
invention is specific to the apolipoprotein (a). Being "specific"
means that a gene product (excluding variable regions of
immunoglobulin and T cell receptor) other than apolipoprotein (a)
naturally expressed in a mammal from which the apolipoprotein (a)
is derived does not include said epitope.
[0051] As a specific epitope of apolipoprotein (a) used in the
present invention, preferably selected is one at a position
inhibiting the deposition of lipoprotein (a) to the vascular intima
when an antibody recognizing the epitope binds to the epitope. Such
epitope may be present in, for example, the kringle-IV type 2
repeat sequences. An epitope contained in the region removed during
the maturation process of apolipoprotein (a) such as signal
sequence and the like is preferably eliminated from the epitope
used in the present invention.
[0052] The length of the amino acid sequence of the epitope is
generally 5-30 amino acids, preferably 6-25 amino acids, more
preferably 10-18 amino acids, further more preferably 11-16 amino
acids. When the amino acid sequence is too short, the antigenicity
of the epitope may be lost. When the amino acid sequence is too
long, chimeric hepatitis B virus core antigen polypeptide does not
easily form core particles due to self-assembly, as a result of
which an antibody that specifically recognizes the epitope may not
be produced, and a superior treatment or improvement effect on
lipoprotein (a)-related diseases including arteriosclerosis may not
be obtained.
[0053] Specific examples of preferable epitope of apolipoprotein
(a) include the following.
TABLE-US-00001 (SEQ ID NO 1) EAPSEQAPTEQR
[0054] SEQ ID NO: 1 is a partial amino acid sequence of human
apolipoprotein (a).
[0055] Hepatitis B virus core antigen polypeptide used in the
present invention is
(1) a polypeptide containing the amino acid sequence shown by SEQ
ID NO: 4, or (2) a polypeptide containing an amino acid sequence
having not less than 90% (preferably not less than 95%, more
preferably not less than 97%, still more preferably not less than
99%) identity with the amino acid sequence shown by SEQ ID NO: 4,
and having an activity to form core particles due to
self-assembly.
[0056] Self-assembly refers to a phenomenon wherein molecules
dissolved in a solution associate to form an assembly. Core
particle refers to a rigid structure having a specific repetitive
constitution. In the present specification, the core particle may
be a product of synthesis steps or a product of biological
steps.
[0057] As the polypeptide of the embodiment of (2), a polypeptide
containing the amino acid sequence shown by SEQ ID NO: 5 disclosed
in WO2003/031466 can be mentioned. A polypeptide containing the
amino acid sequence shown by SEQ ID NO: 5 except that one or plural
cysteine residues of the positions 48, 61, 107 and 185 are deleted
or substituted by other amino acid residue (e.g., serine residue)
is also preferable as the polypeptide of the embodiment of (2). As
recognized by those of ordinary skill in the art, in a polypeptide
having an amino acid sequence different from that of SEQ ID NO: 5,
cysteine residues at similar positions can be deleted or
substituted by other amino acid residues, and polypeptides obtained
by such deletion and substitution are also encompassed in the
polypeptide of the embodiment of (2).
[0058] The polypeptide of the embodiment of (2) also encompasses a
variant polypeptide wherein the isoleucine residue at the position
corresponding to the position 97 of SEQ ID NO: 5 is substituted by
leucine residue or phenylalanine residue (Yuan et al., J. Virol.
vol. 73, pages 10122-10128 (1999)). In addition, amino acid
sequences of many HBcAg variants and several kinds of hepatitis B
core antigen precursor variants are disclosed in GenBank reports
AAF121240, AF121239, X85297, X02496, X85305, X85303, AF151735,
X85259, X85286, X85260, X85317, X85298, AF043593, M20706, X85295,
X80925, X85284, X85275, X72702, X85291, X65258, X85302, M32138,
X85293, X85315, U95551, X85256, X85316, X85296, AB033559, X59795,
X8529, X85307, X65257, X85311, X85301, X85314, X85287, X85272,
X85319, AB010289, X85285, AB010289, AF121242, M90520, PO.sub.3153,
AF110999 and M95589 (each of the disclosures is incorporated in the
present specification by reference), and polypeptides containing
amino acid sequences of these variants are also encompassed in the
polypeptide of the embodiment of (2). The above-mentioned variants
have amino acid sequences different at many positions including
amino acid residues corresponding to the amino acid residues
present at the positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38,
40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81,
87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126,
130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID
NO: 5.
[0059] Furthermore, polypeptides containing the amino acid
sequences of the HBcAg variants described in WO01/98333, WO01/77158
and WO02/14478, all of which are incorporated in the present
specification by reference are also encompassed in the polypeptide
of the embodiment of (2).
[0060] In the present specification, unless particularly indicated,
the positions of amino acid residues in the amino acid sequence of
hepatitis B virus core antigen polypeptide are specified with the
amino acid sequence shown by SEQ ID NO: 4 as the standard. When a
polypeptide does not contain the amino acid sequence shown by SEQ
ID NO: 4, the amino acid sequence of the polypeptide is aligned
with the amino acid sequence shown by SEQ ID NO: 4, and the
position of the corresponding amino acid residue is adopted.
[0061] The hepatitis B virus core antigen polypeptide used in the
present invention is preferably a polypeptide containing the amino
acid sequence shown by SEQ ID NO: 4.
[0062] In the chimeric hepatitis B virus core antigen polypeptide
to be used in the present invention, an amino acid sequence
comprising a specific epitope of apolipoprotein (a) is inserted
between the amino acid residues 80 and 81 of the hepatitis B virus
core antigen polypeptide. That is, the chimeric hepatitis B virus
core antigen polypeptide to be used in the present invention
contains the following elements (a)-(c):
(a) N-terminus part polypeptide residues of hepatitis B virus core
antigen polypeptide (consisting of the continuous partial amino
acid sequence of hepatitis B virus core antigen polypeptide from
N-terminus to the amino acid residue 80), (b) an amino acid
sequence consisting of a specific epitope of apolipoprotein (a),
and (c) C-terminal partial polypeptide residues of hepatitis B
virus core antigen polypeptide (consisting of the continuous
partial amino acid sequence of hepatitis B virus core antigen
polypeptide from the amino acid residue 81 to C-terminus) in the
order of (a), (b), (c) from the N terminal side.
[0063] The chimeric hepatitis B virus core antigen polypeptide to
be used in the present invention having the above-mentioned
constitution forms core particles due to self-assembly, and a
specific epitope of apolipoprotein (a) is presented on the outside
of the particles.
[0064] The inserted amino acid sequence between element (a) and
element (c) may further contain, in addition to element (b) (amino
acid sequence consisting of specific epitopes of apolipoprotein
(a)), one or more (preferably 1-3, more preferably 1) specific
epitope. As the further specific epitope, a specific, epitope,
which is an aggravation factor of arteriosclerosis other than
apolipoprotein (a), is used. Examples of the further specific
epitope include, but are not limited to, apolipoprotein B and the
like. The further specific epitope may be inserted at any position
between element (a) and element (b), and between element (b) and
element (c). The length of the amino acid sequence of the further
specific epitope is generally 5-30, amino acids, preferably 6-25
amino acids, more preferably 10-18 amino acids, further more
preferably 11-16 amino acids.
[0065] When plural specific epitopes are inserted between
constituent element (a) and constituent element (c), the specific
epitopes may be directly connected by a covalent bond or via a
spacer sequence. The spacer sequence means an amino acid sequence
containing one or more amino acid residues, which is inserted
between two adjacent elements contained in chimeric hepatitis B
virus core antigen polypeptide. Specific epitopes are preferably
connected via a spacer sequence so that plural specific epitopes
will be stably presented while maintaining their structures. While
the length of the spacer sequence is not limited as long as the
chimeric hepatitis B virus core antigen polypeptide forms core
particles due to self-assembly and all inserted specific epitopes
are presented on the outside of the particles, it is generally 1-10
amino acids, preferably 1-5 amino acids, more preferably 1-3 amino
acids, most preferably 2 or 3 amino acids.
[0066] A specific epitope between element (a) and element (c),
which is the closest to the N terminus, and element (a) may be
directly connected by a covalent bond or via a spacer sequence. The
element (a) and the specific epitope between element (a) and
element (c), which is the closest to the N terminus, are preferably
connected via a spacer sequence so that a specific epitope of
apolipoprotein (a) will be stably presented on the outside of the
particles formed by self-assembly of chimeric hepatitis B virus
core antigen polypeptides, while maintaining its structure. While
the length of the spacer sequence is not limited as long as
chimeric hepatitis B virus core antigen polypeptide forms core
particles due to self-assembly and a specific epitope of
apolipoprotein (a) is presented on the outside of the particles, it
is generally 1-10 amino acids, preferably 1-5 amino acids, more
preferably 1-3 amino acids, most preferably 2 or 3 amino acids.
Also, the kind of the spacer sequence is not limited as long as
chimeric hepatitis B virus core antigen polypeptide forms core
particles due to self-assembly and a specific epitope of
apolipoprotein (a) is presented on the outside of the particles.
Examples of a preferable spacer sequence include, but are not
limited to, IT, GAT, CGG and the like.
[0067] A specific epitope between element (a) and element (c),
which is the closest to the C terminus, and element (c) may be
directly connected by a covalent bond or via a spacer sequence. The
element (b) and element (c) are preferably connected via a spacer
sequence so that a specific epitope of apolipoprotein (a) will be
stably presented on the outside of the particles formed by
self-assembly of chimeric hepatitis B virus core antigen
polypeptides, while maintaining its structure. While the length of
the spacer sequence is not limited as long as chimeric hepatitis B
virus core antigen polypeptide forms core particles due to
self-assembly and an epitope of apolipoprotein (a) is presented on
the outside of the particles, it is generally 1-10 amino acids,
preferably 1-5 amino acids, more preferably 1-3 amino acids, most
preferably 2 or 3 amino acids. Also, the kind of the spacer
sequence is not limited as long as chimeric hepatitis B virus core
antigen polypeptide forms core particles due to self-assembly and a
specific epitope of apolipoprotein (a) is presented on the outside
of the particles. Examples of a preferable spacer sequence include,
but are not limited to, IT, GAT, CGG and the like.
[0068] While the length of the inserted amino acid sequence between
element (a) and element (c) is not limited as long as chimeric
hepatitis B virus core antigen polypeptide forms core particles due
to self-assembly, a specific epitope of apolipoprotein (a) is
presented on the outside of the particles, and arteriosclerosis can
be treated or prevented, it is generally 5-80 amino acids. When the
inserted amino acid sequence is too short, the antigenicity of the
epitope may be lost. When the inserted amino acid sequence is too
long, chimeric hepatitis B virus core antigen polypeptide does not
easily form core particles due to self-assembly, as a result of
which an antibody that specifically recognizes the inserted epitope
is not produced, and a good treatment or improvement effect on
lipoprotein (a)-related diseases including arteriosclerosis may not
be achieved.
[0069] The expression vector used in the present invention is a
recombinant vector incorporating a polynucleotide encoding the
above-mentioned chimeric hepatitis B virus core antigen
polypeptide. When the expression vector is administered to a target
mammal, the expression vector is intracellularly incorporated into
the target mammal, and the cell expresses the above-mentioned
chimeric hepatitis B virus core antigen polypeptide. Examples of
the expression vector inserted with polynucleotide encoding
chimeric hepatitis B virus core antigen polypeptide include
plasmid, virus, phage, cosmid and other vectors conventionally used
in the art. Examples of the plasmid vector include, but are not
limited to, pCAGGS (Gene 108: 193-199 (1991)), pCR-X8 (Vaccine 24:
4942-4950 (2006)), pcDNA3.1 (trade name, Invitrogen), pZeoSV (trade
name, Invitrogen), pBK-CMV (trade name, Stratagene) and the like.
The virus vector is a DNA virus or an RNA virus. Examples of the
virus vector include, but are not limited to, detoxicated
retrovirus, adenovirus, adeno-associated virus, herpes virus,
vaccinia virus, poxvirus, polio virus, Sindbis virus,
Hemagglutinating Virus of Japan (HVJ), SV40, human immunodeficient
virus (HIV) and the like. Furthermore, Hemagglutinating Virus of
Japan envelope (HVJ-E) and the like can also be utilized.
[0070] In the above-mentioned expression vector, polynucleotide
(preferably DNA) encoding chimeric hepatitis B virus core antigen
polypeptide is operably connected to a promoter capable of
exhibiting a promoter activity in the cell of a mammal (preferably
human) to be the administration subject.
[0071] The promoter to be used is not particularly limited as long
as it can function in the cell of a mammal (preferably human) to be
the administration subject. Examples of the promoter include pol I
promoter, pol II promoter, pol III promoter and the like.
Specifically, virus promoters such as SV40-derived initial
promoter, cytomegalovirus LTR and the like, mammal constituting
protein gene promoters such as .beta.-actin gene promoter and the
like, RNA promoters such as tRNA promoter and the like, and the
like are used.
[0072] The above-mentioned expression vector preferably contains a
transcription termination signal, i.e., terminator region, at the
downstream of the polynucleotide encoding chimeric hepatitis B
virus core antigen polypeptide. It can further contain a selection
marker gene for the selection of a transformed cell (gene
conferring resistance to medicaments such as tetracycline,
ampicillin, kanamycin and the like, gene complementing auxotrophic
mutation etc.).
[0073] In one embodiment, the above-mentioned expression vector may
contain an immune stimulatory sequence (ISS) (also referred to as
CpG) to potentiate the immune effect. The immune stimulatory
sequence is a DNA containing a non-methylated CpG motif of
bacterium, and is known to function as a ligand of a particular
receptor (Toll-like receptor 9) (see Biochim. Biophys. Acta 1489,
107-116 (1999) and Curr. Opin. Microbiol. 6, 472-477 (2003) for the
detail). Preferable examples of the immune stimulatory sequence
include the following.
TABLE-US-00002 CpG-B1018 22 bp (SEQ ID NO: 6) 5'-tga ctg tga acg
ttc gag atg a-3' CpG-A D19 20 bp (D type) (SEQ ID NO: 7) 5'-ggt gca
tcg atg cag ggg gg-3' CpG-CC274 21 bp (SEQ ID NO: 8) 5'-tcg tcg aac
gtt cga gat gat-3' CpG-CC695 25 bp (SEQ ID NO: 9) 5'-tcg aac gtt
cga acg ttc gaa cgt t-3'
[0074] Alternatively, 2, 3 or 4 from these ISSs may be connected
and used. Preferable examples of the connected ISS sequence include
the following.
TABLE-US-00003 (SEQ ID NO: 10) 5'-ggt gca tcg atg cag ggg gg tga
ctg tga acg ttc gag atg a tcg tcg aac gtt cgagat gat tcg aac gtt
cga acg ttc gaa cgt t-3'
[0075] Those of ordinary skill in the art can construct the
aforementioned expression vector according to well-known genetic
engineering techniques described in, for example, "edit. Sambrook
et al., Molecular Cloning A Laboratory Manual Cold Spring Harbor
Laboratory (1989) N.Y.", "edit. Ausubel et al., Current Protocols
in Molecular Biology (1987) John Wiley & Sons" and the
like.
[0076] The therapeutic or prophylactic agent of the present
invention can be provided as a pharmaceutical composition
containing, in addition to a therapeutically effective amount of
the above-mentioned expression vector, any carrier, for example, a
pharmaceutically acceptable carrier.
[0077] Examples of the pharmaceutically acceptable carrier include,
though not limited thereto, excipients such as sucrose, starch,
mannit, sorbit, lactose, glucose, cellulose, talc, calcium
phosphate, calcium carbonate and the like, binders such as
cellulose, methylcellulose, hydroxypropylcellulose, gelatin, gum
arabic, polyethylene glycol, sucrose, starch and the like,
disintegrants such as starch, carboxymethylcellulose,
hydroxypropylstarch, sodium-glycol-starch, sodium hydrogen
carbonate, calcium phosphate, calcium citrate and the like,
lubricants such as magnesium stearate, aerosil, talc, sodium lauryl
sulfate and the like, aromatics such as citric acid, menthol,
glycyrrhizin.ammonium salt, glycine, orange power and the like,
preservatives such as sodium benzoate, sodium bisulfite,
methylparaben, propylparaben and the like, stabilizers such as
citric acid, sodium citrate, acetic acid and the like, suspensions
such as methylcellulose, polyvinylpyrrolidone, aluminum stearate
and the like, dispersing agents such as surfactant and the like,
diluents such as water, saline and the like, base waxes such as
cacao butter, polyethylene glycol, white kerosine and the like, and
the like.
[0078] The therapeutic or improving agent of the present invention
may further contain an adjuvant to potentiate its effect. Examples
of the adjuvant include aluminum hydroxide, complete Freund's
adjuvant, incomplete Freund's adjuvant, pertussis adjuvant,
poly(I:C), CpG-DNA and the like.
[0079] To promote intracellular introduction of an expression
vector, the therapeutic or prophylactic agent of the present
invention may further contain a reagent for nucleic acid
introduction. As the reagent for nucleic acid introduction,
cationic lipids such as lipofection (trade name, Invitrogen),
lipofectamine (trade name, Invitrogen), transfectam (trade name,
Promega), DOTAP (trade name, Roche Applied Science),
dioctadecylamidoglycyl spermine (DOGS), L-dioleoyl
phosphatidyl-ethanolamine (DOPE), dimethyldioctadecyl-ammonium
bromide (DDAB), N,N-di-n-hexadecyl-N,N-dihydroxyethylammonium
bromide (DHDEAB), N-n-hexadecyl-N,N-dihydroxyethylammonium bromide
(HDEAB), polybrene, poly(ethyleneimine) (PEI) and the like can be
used. In addition, an expression vector may be included in any
known liposome constituted of a lipid bilayer such as electrostatic
liposome. Such liposome may be fused with a virus such as
inactivated Hemagglutinating Virus of Japan (HVJ). HVJ-liposome has
a very high fusion activity with a cellular membrane, as compared
to general liposomes. When retrovirus is used as an expression
vector, RetroNectin, fibronectin, polybrene and the like can be
used as transfection reagents.
[0080] While the content of the above-mentioned expression vector
in the pharmaceutical composition is not particularly limited and
appropriately selected from a wide range, it is generally about
0.00001 to 100 wt % of the whole pharmaceutical composition.
[0081] By introducing the above-mentioned expression vector into an
application target, mammalian tissue (or cell), the therapeutic or
prophylactic agent of the present invention induces an in vivo
expression of the above-mentioned antigen polypeptide (e.g.
chimeric hepatitis B virus core antigen polypeptide), induces
production of an antibody to a specific epitope of apolipoprotein
(a) contained in the antigen polypeptide, as a result of which the
induced antibody suppresses production of lipoprotein (a), thereby
suppressing neointimal formation and blood vessel intimal
thickening. Various methods for introducing nucleic acids such as
expression vector and the like into the body are known (T.
Friedman, Science 244: 1275-1281 (1989)), and any introduction
method can be employed as long as it induces an in vivo expression
of the above-mentioned antigen polypeptide (e.g. chimeric hepatitis
B virus core antigen polypeptide), induces production of an
antibody to a specific epitope of apolipoprotein (a) contained in
the antigen polypeptide, and treats or prevents lipoprotein
(a)-related diseases including arteriosclerosis.
[0082] Examples of the method for introducing an expression vector
into a mammalian tissue (or cell) in vivo include, but are not
limited to, inner liposome method, electrostatic liposome method,
HVJ-liposome method, HVJ-AVE liposome method, receptor-mediated
transgene, particle gun method, naked DNA method, introduction
method by positive electric charge polymer, electroporation method
and the like.
[0083] Alternatively, cells such as blood cells, bone marrow cells
and the like may be isolated from the application target mammal,
the above-mentioned expression vector may be introduced into the
cells ex vivo, after which cells containing the obtained
above-mentioned expression vector may be returned to the
application target mammal.
[0084] Examples of the method for introducing an expression vector
into a mammalian cell ex vivo include, but are not limited to,
lipofection method, calcium phosphate coprecipitation method,
DEAE-dextran method, direct DNA introduction method using glass
microcapillary, electroporation method and the like.
[0085] The therapeutic or prophylactic agent of the present
invention may be administered by any method as long as in the
administration subject mammal, the agent induces in vivo expression
of the above-mentioned antigen polypeptide (e.g. chimeric hepatitis
B virus core antigen polypeptide), induces production of an
antibody to a specific epitope of apolipoprotein (a) contained in
the antigen polypeptide (e.g. chimeric hepatitis B virus core
antigen polypeptide), and treats or prevents lipoprotein
(a)-related diseases including arteriosclerosis. Preferably, the
therapeutic or prophylactic agent of the present invention is
parenterally administered in an amount sufficient to induce
production of an antibody to a specific epitope of apolipoprotein
(a) contained in the antigen polypeptide (e.g. chimeric hepatitis B
virus core antigen polypeptide), and treat or prevent lipoprotein
(a)-related diseases including arteriosclerosis. For example,
injection via intravenous, intraperitoneal, subcutaneous,
intradermal, intraadipose tissue, intramammary gland tissue, or
intramuscular pathway; gas induced particle bombarding method (by
electron gun and the like); a method in the form of collunarium and
the like via a mucosal pathway, and the like are recited as
examples of the administration methods. In one embodiment, the
therapeutic or prophylactic agent of the present invention is
preferably injected subcutaneously or intramuscularly.
[0086] In one embodiment, the therapeutic or prophylactic agent of
the present invention is subcutaneously administered by a
needleless injector. The needleless injector is preferably a
pressure injector. Examples of the needleless injector include, but
are not limited to, ShimaJET (trade name, SHIMADZU CORPORATION),
Twinject EZII (trade name, Japan chemical research), Syrijet (trade
name, Keystone), ZENEO (trade name, Crossject) and the like. In
this case, the therapeutic or prophylactic agent of the present
invention can be provided as an injection preparation containing
the above-mentioned expression vector and needleless injector,
wherein the expression vector is enclosed in the needleless
injector.
[0087] In one embodiment, the therapeutic or prophylactic agent of
the present invention is administered subcutaneously, intradermally
or intramuscularly with a gene gun. In this case, the
above-mentioned expression vector may be applied onto the carrier
particles such as colloidal gold particles and the like to be
introduced into the body and used for administration. A technique
for coating carrier particles with polynucleotide is known (see,
for example, WO93/17706). Finally, the expression vector can be
prepared in an aqueous solution such as physiological brine and the
like suitable for administration to the body.
[0088] To induce good immune responses, the therapeutic or
improving agent of the present invention is preferably administered
plural times at given intervals. While the frequency can be
appropriately determined by monitoring the level of immune
response, it is generally 2-10 times, preferably 2-6 times, more
preferably 2, 3 or 4 times.
[0089] The administration frequency is generally once per 1 week-1
year, preferably once per 1-6 months.
[0090] While the dose of the therapeutic or prophylactic agent of
the present invention depends on the immunogenicity of a specific
epitope of apolipoprotein (a) contained in the antigen polypeptide
(e.g. chimeric hepatitis B virus core antigen polypeptide) encoded
by the active ingredient expression vector in an administration
subject mammal, those of ordinary skill in the art can determine
the dose necessary for a good immune response by administering a
given amount of an expression vector to an administration subject
mammal, measuring the antibody titer specific to the epitope by a
detection method such as ELISA and the like, and observing the
immune response. Those of ordinary skill in the art appreciate that
the immunogenicity of the therapeutic or prophylactic agent of the
present invention also depends on the strength of the regulatory
sequence such as promoter used for the expression vector as an
active ingredient. Moreover, those of ordinary skill in the art can
also control the dose of the therapeutic or prophylactic agent of
the present invention with ease depending on the kind of the
expression vector to be used.
an antigen polypeptide (e.g. lipoprotein (a)-related diseases
including
[0091] When an expression vector encoding an antigen polypeptide
(e.g. chimeric hepatitis B virus core antigen polypeptide) inserted
with an amino acid sequence comprising a specific epitope of
apolipoprotein (a) is administered, an immune reaction (preferably
humoral immune reaction such as antibody production and the like)
against the specific epitope of apolipoprotein (a) in the expressed
antigen polypeptide (e.g. chimeric hepatitis B virus core antigen
polypeptide) is induced, and production of lipoprotein (a) is
suppressed by an antibody to apolipoprotein (a), whereby neointimal
formation and vascular intimal thickening are suppressed.
Therefore, an administration subject of the therapeutic or
prophylactic agent of the present invention includes patients with
a lipoprotein (a)-related disease (e.g. arteriosclerosis
(preferably, atherosclerosis)), non-lipoprotein (a)-related disease
patients with the risk of developing lipoprotein (a)-related
disease (e.g. arteriosclerosis (preferably, atherosclerosis))
(e.g., healthy individual; individual who has not developed
lipoprotein (a)-related disease (e.g. arteriosclerosis) while blood
apolipoprotein (a) level or lipoprotein (a) level is higher than
healthy individual; hyperlipidemia patients etc.) and the like. By
administering an expression vector encoding an antigen polypeptide
(e.g. chimeric hepatitis B virus core antigen polypeptide) inserted
with an amino acid sequence comprising a specific epitope of
apolipoprotein (a) to lipoprotein (a)-related disease (e.g.
arteriosclerosis) patients, further deposition of lipoprotein (a)
in the diseased part of the patients can be suppressed, neointimal
formation and vascular intimal thickening can be suppressed,
whereby the progression of lipoprotein (a)-related disease (e.g.
arteriosclerosis) can be inhibited. In addition, by administering
an expression vector encoding an antigen polypeptide (e.g. chimeric
hepatitis B virus core antigen polypeptide) inserted with an amino
acid sequence comprising a specific epitope of apolipoprotein (a)
to non-lipoprotein (a)-related disease patients (e.g.
non-arteriosclerosis patients) with the risk of developing
lipoprotein (a)-related disease (e.g. arteriosclerosis), the onset
of lipoprotein (a)-related disease (e.g. arteriosclerosis) in the
non-lipoprotein (a)-related disease patients (e.g.
non-arteriosclerosis patients) can be prevented.
[0092] All references cited in the present specification, including
publication, patent document and the like, are hereby incorporated
individually and specifically by reference, to the extent that the
entireties thereof have been specifically disclosed herein.
[0093] The present invention is explained in more detail in the
following by referring to Examples, which are not to be construed
as limitative.
EXAMPLES
Example 1
Materials and Methods
Animals
[0094] The experiments were approved by the Ethical Committee for
animal experiments of Osaka University Graduate School of Medicine.
Mice had free access to water and food during the experimental
periods. Female FVB mice were purchased from Charles River. Lp(a)
transgenic mice were created by the mating of human apo(a)
transgenic mice and human apoB transgenic mice (Nature genetics,
1995, 9: 424-431; Nature, 1992, 360: 670-672; Proceedings of the
National Academy of Sciences, 1994, 91: 2130; Circulation, 2002,
105: 1491-1496). Human apo(a) YAC transgenic mice were created by
insertion of human apo(a) YAC transgenic mice, including the apo(a)
gene, 70 kb apo(a)-like gene, and the 260 kb genomic DNA (YAC DNA)
(Nature, 1992, 360: 670-672). Human apoB transgenic mice were
created by insertion of 76 kb genomic DNA (P1 phagemid DNA)
containing the intact apoB gene (Proceedings of the National
Academy of Sciences, 1994, 91: 2130). The background of both mice
was FVB mouse.
Construction of HBc-Apo(a) Fusion Gene Expression Vector
[0095] The plasmid pcDNA3.1 (pcDNA3.1/V5-His-TOPO, Invitrogen)
containing the cytomegalovirus promoter was used. The HBc gene was
obtained by PCR and engineered into pcDNA3.1 [HBc]. The apo(a) 12
amino acids (a.a.) sequence (EAPSEQAPTEQR: SEQ No. 1) with a
N-terminus Ile-Thr dipeptide linker and C-terminus Gly-Ala-Thr
tripeptide extension was synthesized by PCR using the following
oligonucleotide:
TABLE-US-00004 (PCR1) the forward primer: HBc-1 (SEQ ID NO: 11)
5'GCCATGGATATCGATCCTTATAAAGAATTCGGAGC3', the reverse primer:
Lp(a)-1 (SEQ ID NO: 12)
5'GTTAACTTGGAAGATCCAGCTATCACTGAGGCTCCTTCCGAACAAGC ACCGACT3', and
template: pPLc3 (BCCM/LMBP); (PCR2) the forward primer: HBc-2 (SEQ
ID NO: 13) 5'GGCCTCTCACTAACATTGAGATTCCCGAGATTGAGA3', the reverse
primer: Lp(a)-2 (SEQ ID NO: 14)
5'TTCCGAACAAGCACCGACTGAGCAAAGGGGTGCTACTAGCAGGGACC TGGTAGTC3', and
template: pPLc3
[0096] The PCR products from PCR1 and PCR2 were use as the template
of PCR3. In PCR3, HBc-1 was used as the forward primer and HBc-2
was used as the reverse primer. The PCR product from PCR3 was
engineered into pcDNA3.1 [HBc-apo(a)].
Vaccination Protocol
[0097] Female FVB or Lp(a) transgenic mice were vaccinated
intramuscularly three times at 2-week interval (8 weeks, 10 weeks,
12 weeks old, respectively) with 60 .mu.l, TE containing 120 .mu.g
HBc-apo(a) or HBc, or 60 .mu.l, saline. In the vaccination,
electric pulse generator (NEPA GENE) connected to a switch box with
a pair of stainless steel needles of 10 mm in length and 0.3 mm in
diameter, fixed with a distance between them of 3 mm was used. The
voltage remained constant, 70V, during the pulse duration. Three
pulses of the indicated voltage followed by three more pulses of
the opposite polarity were administered to each injection site at a
rate of one pulse/s, with each pulse being 50 ms in duration. Six
weeks after third immunization (18 weeks old), additional
immunization was given to mice. Lp(a) transgenic mice were
bilateral ovariectomized before first immunization.
Measurement of Apo(a) Antibody in Serum
[0098] Two weeks after both third immunization and last
immunization, respectively, serum was collected from immunized mice
of all groups. Serum levels of apo(a)-specific antibodies in these
mice were measured by ELISA. Briefly, ELISA plates was coated with
5 .mu.g/mL apo(a) 12 a.a. peptide (peptide consisting of the amino
acid sequence shown by SEQ ID NO: 1) in carbonate buffer overnight
at 4.degree. C. The plates were blocked with PBST containing 3%
skim milk at room temperature for 2 hours, and serial dilution
(1:100 to 1:312500) of serum samples from immunized mice were added
to the well. Further, the plates were incubated overnight at
4.degree. C., washed seven times with PBST, and HRP-conjugated
mouse IgG (whole or each subtype) was added and incubated at room
temperature for three hours. After four times wash with PBST,
3,3',5,5'-tetaramethylbenzidine (TMB, Sigma-Aldrich) was added, the
blue reaction product was stopped by 0.5 mol/L sulfuric acid and
the resulting end product was read at 450 nm.
T-Cell Proliferation Assay
[0099] The T-cell proliferation assay was performed as previously
reported. Syngeneic T-cells (mouse splenocytes, 5.times.10.sup.5
cells/well) were cultured with 10 .mu.g/ml recombinant apo(a) 12
a.a. peptide, phytohemagglutinin (PHA, 50 .mu.g/mL as positive
control) and medium separately, at 37.degree. C., 5% CO.sub.2 for
40 hours. Further, 1 .mu.Ci of [.sup.3H] thymidine (Perkin Elmer)
was added to each well for 8 hours. The cells were harvested, and
the [.sup.3H] thymidine uptake was determined using a MicroBeta
1450 Trilux scintillation counter (Wallac Oy). The stimulation
index was expressed as the ratio of stimulated cells to
non-stimulated cells.
Enzyme-Linked ImmunoSpot (ELISpot) Assay
[0100] ELISpot assay was carried out using Mouse IFN-.gamma.
Development Module and Mouse IL-4 Development Module, respectively
(R&D Systems) according to the manufacturer's instructions.
Briefly, 96-well filter plates for ELISpot were preincubated with
anti-mouse IFN-.gamma. or IL-4 antibodies overnight at 4.degree. C.
and blocked with PBS containing 1% BSA and 5% sucrose. For two
hours at room temperature. The splenocytes from individual
immunized mice of 5.times.10.sup.5 cells per well were added to
wells with 10 .mu.g/ml recombinant apo(a) 12a.a. peptide, PHA (50
.mu.g/mL as positive control) and medium separately, and incubated
at 37.degree. C., 5% CO.sub.2 for 48 h. The plates were washed four
times with PBST, incubated with biotinylated anti-mouse IFN-.gamma.
or IL-4 antibody overnight at 4.degree. C. and washed again with
PBST three times. ELISpot color module (R&D systems) was used
as color development. Diluted Streptavidin-AP concentrate with PBS
containing 1% BSA complex was added into each well and incubated
for 2 hours at room temperature. After washing with PBS-T and
deionized water, BCIP/NBT was added into each well and incubated in
dark for 30 minutes at room temperature. The plates were washed
with deionized water, air-dried at room temperature. The colored
spots were quantified manually using a dissecting microscope
(Olympus).
Carotid Artery Ligation Model
[0101] Carotid artery ligation model was performed for Lp(a) female
transgenic mice as previously described. One week after the final
immunization, the left common carotid artery of female Lp(a)
transgenic mice was exposed through a small midline incision in the
neck, and the artery was completely ligated with a 6-0 silk just
proximal to the carotid bifurcation to disrupt blood flow.
Following ligation of the common carotid artery, the vessel
typically undergoes inflammatory changes and neointima
formation.
Pathological Analysis
[0102] Quantification of vascular remodeling was performed after
three weeks of carotid ligation model. The left common carotid
artery was removed and fixed in 4% paraformaldehyde, equilibrated
in PBS containing 10% sucrose, in PBS/20% sucrose and in PBS/30%
sucrose. The samples were then embedded for quick freezing. Cross
sections were laid on slides and stained; some of them were frozen
at -80.degree. C. For evaluation of neointima formation, slides
were stained with hematoxylin and eosin (HE). Each five stained
slide was quantified by measuring the area of neointima and media
(Image J). Immunostaining with anti-Lp(a) antibody were visualized
with VECTASTAIN ABC-AP and Vector Red (Vector Laboratories
Inc.).
Statistics
[0103] All values were expressed as mean.+-.S.E.M. Data were
compared by t-test or using ANOVA followed by Fischer's test for
multiple comparisons. All statistical analysis was performed using
StatView (SAS Institute, Inc.). Values of p<0.05 were considered
to represent statistical significance.
[Results]
In Vitro Expression of Plasmid DNA Construct
[0104] Plasmid DNA including hepatitis B virus cores protein (HBc)
was used because HBc is a carrier protein and possesses its ability
to self-assemble into icosahedral virus-like particles (VLPs) in
heterologous expression systems. The plasmid pcDNA3.1-HBc (control
vector) and pcDNA3.1-HBc-apo(a) were constructed (FIG. 1a). The 12
amino acids (EAPSEQAPTEQR: SEQ No. 1) of apo(a) were selected as a
targeted antigen, which is overlapped in repeated sequences of
kringle-4 type 2 of apo(a) and multiply presented in the repeated
kringle IV domain type2 domain. (FIGS. 1b and 1c). Although apo(a)
is a high homologue of plasminogen, containing multiple copies of
kringle-4, a single copy of kringle-5 and an inactive protease
domain, the selected epitope sequence was not high homology with
plasminogen. The antigen sequence was hydrophilic domain and known
as a potential of B-cell epitope as previously described (Clinica
chimica acta, 1999, 287: 29-43).
DNA Vaccination to FVB Mice
[0105] FVB female mice were immunized with pcDNA3.1-HBc-apo(a)
[HBc-apo(a)], pcDNA3.1-HBc [HBc] or saline, respectively, by
intramuscular administration using electroporator, three times
every two weeks (FIG. 2a). Although FVB has no endogenous apo(a),
the antigen of this DNA vaccine might be recognized as a foreign
substance. Titer of anti-apo(a) antibody was observed only in
HBc-apo(a) group (FIG. 2b-left). From the analysis of IgG subtypes,
the immunization was predicted to lead to Th1-biased immune
responses with predominant IgG2a production (FIG. 2b-right). Six
weeks after third immunization, additional immunization was given
to mice, which raised the titer of anti-apo(a) antibody (FIG.
2c-left). This immunization was also predicted to lead to
Th1-biased immune responses with predominant IgG2a production (FIG.
2c-right). Furthermore, anti-plasminogen antibodies were not
detected after these immunization (FIG. 2d), although apo(a) was
highly homologue to plasminogen, which indicated that these
immunization had little effect on fibrinolytic system.
[0106] To assess the safety and validity of the epitope, 12 a.a in
apo(a), T-cell proliferation assay and ELISpot assay were
performed. In immunized female FVB mice, T-cell proliferation assay
showed that stimulation with apo(a) 12 a.a. peptide (peptide
consisting of the amino acid sequence shown by SEQ ID NO: 1) did
not induce the proliferation of splenocytes from immunized mice
(FIG. 3a). Also, in ELISpot assay, stimulation with apo(a) 12 a.a.
peptide induced a production of neither IFN-.gamma. nor IL-4 (FIGS.
3b and 3c). These data indicated that the amino acid sequence shown
by SEQ ID NO: 1 did not contain T-cell epitopes to induce T-cell
activation.
DNA Vaccination to Lp(a) Transgenic Mice
[0107] As apo(a) is present only in humans, primates and hedgehogs,
Lp(a) transgenic mice generated by crossing human apo(a) transgenic
mice and human apoB transgenic mice were used (Nature genetics,
1995, 9: 424-431; Nature, 1992, 360: 670-672; Proceedings of the
National Academy of Sciences, 1994, 91: 2130; Circulation, 2002,
105: 1491-1496). In Lp(a) transgenic mice, serum Lp(a) level was
higher in female mice than in male mice (Atherosclerosis, 211:
41-47). Since the bilateral ovariectomy in Lp(a) transgenic mice
increased serum Lp(a) level, ovariectomy on Lp(a) transgenic mice
was performed two weeks before first immunization. Similarly, Lp(a)
transgenic mice were immunized (FIG. 4a). Two weeks after third and
fourth immunization, titer of anti-apo(a) antibody was observed
only in HBc-apo(a) group (FIGS. 4b and 4c). In Lp(a) transgenic
mice, this immunization also did not produce anti-plasminogen
antibodies (FIG. 4d).
[0108] As to DNA vaccination to Lp(a) transgenic mice, T-cell
proliferation assay and ELISpot assay were performed. In immunized
Lp(a) transgenic mice, T-cell proliferation assay showed that
stimulation with apo(a) 12 a.a. peptide did not induce the
proliferation of splenocytes from immunized mice. In ELISpot assay,
stimulation with apo(a) 12 a.a. peptide induced a production of
neither IFN-.gamma. nor IL-4. These data also indicated that the
amino acid sequence shown by SEQ ID NO: 1 did not contain T-cell
epitopes to induce T-cell activation.
Carotid Artery Ligation Model in Lp(a) Transgenic Mice
[0109] As a result of flow cessation caused by ligation of the left
common carotid artery, a higher increase in intima formation was
observed in Lp(a) transgenic mice immunized with HBc and saline,
compared to Lp(a) transgenic mice immunized with HBc-apo(a) (FIG.
5a). There was no difference in media formation among Lp(a)
transgenic mice immunized HBc-apo(a), HBc or saline. The ratio of
intima to media was higher significantly in HBc and saline group
than HBc-apo(a) group (FIG. 5b), suggested that HBc-apo(a)
vaccination to Lp(a) transgenic mice attenuated neointima formation
(FIG. 5b). Moreover, the expression of Lp(a) in ligated vessels of
Lp(a) transgenic mice was assessed by immunohistochemistry. There
are multiple studies documenting the deposition of Lp(a) in
arteries affected by atherosclerosis. The deposition of Lp(a) in
ligated vessels was observed in non-immunized group much more
strongly than in immunized group (FIG. 5c). Unexpectedly,
HBc-apo(a) vaccination did not decrease serum Lp(a) level.
[0110] The produced amino acid sequence of HBc-apo(a) is shown in
SEQ ID NO: 16, and the nucleotide sequence encoding the amino acid
sequence is shown in SEQ ID NO: 15. The following region
corresponds to the inserted sequence.
nucleotide Nos. 244-294 of SEQ ID NO: 15 (Of these, nucleotide No.
250-285 encode SEQ ID NO: 1) amino acid Nos. 81-97 of SEQ ID NO: 16
(Of these, amino acid Nos. 83-94 correspond to SEQ ID NO: 1)
Example 2
[0111] Carotid artery ligation model in Lp(a) transgenic mice in
Example 1 was further analyzed.
[0112] In order to evaluate neutralization activity of the antibody
induced by HBc-apo(a) vaccination, expression of inflammatory
cytokines (IL-1.beta., TNF-.alpha., MCP-1) induced by Lp(a) was
analyzed using real-time PCR in macrophages differentiated from
THP-1 cells in the presence of sera from immunized (apo(a)
vaccination) or control group mice. As a result, serum from mice
vaccinated by HBc-apo(a) significantly inhibit LP(a) induced
IL-1.beta., TNF-.alpha., and MCP-1 expression in macrophase as
compared to control mice serum (FIG. 6). This result suggests that
HBc-apo(a) vaccination induces neutralizing antibody against
apo(a), and the neutralizing antibody binds to Lp(a) in a blood to
suppress inflammatory cytokine production due to Lp(a) stimulation,
decreases the amount of inflammatory cytokine in the blood, thereby
suppressing intimal thickening (i.e. arteriosclerosis).
[0113] In addition, Lp(a) deposition in ligated vessels in Lp(a)
transgenic mouse was evaluated by immunohistochemistry. In control
mice, Lp(a) deposition was localized to the site of
arteriosclerosis disease (i.e. neointimal formation site). Such
Lp(a) deposition was significantly decreased in mice immunized with
HBc-apo(a) vaccine as compared to non-immunized group. These
results suggest that neutralizing antibody against apo(a) induced
by HBc-apo(a) vaccination binds to Lp(a) in a blood, and inhibits
Lp(a) deposition to vascular tissue, thereby suppressing neointimal
thickening (i.e. arteriosclerosis).
INDUSTRIAL APPLICABILITY
[0114] The present invention provides a DNA vaccine capable of
treating or preventing arteriosclerosis, while avoiding
self-reactive T cell induction.
Sequence CWU 1
1
17112PRTMus musculus 1Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln
Arg 1 5 10 22040PRTHomo sapiens 2Met Glu His Lys Glu Val Val Leu
Leu Leu Leu Leu Phe Leu Lys Ser 1 5 10 15 Ala Ala Pro Glu Gln Ser
His Val Val Gln Asp Cys Tyr His Gly Asp 20 25 30 Gly Gln Ser Tyr
Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 35 40 45 Cys Gln
Ala Trp Ser Ser Met Thr Pro His Gln His Asn Arg Thr Thr 50 55 60
Glu Asn Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro 65
70 75 80 Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly
Val Arg 85 90 95 Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
Glu Gly Thr Ala 100 105 110 Val Ala Pro Pro Thr Val Thr Pro Val Pro
Ser Leu Glu Ala Pro Ser 115 120 125 Glu Gln Ala Pro Thr Glu Gln Arg
Pro Gly Val Gln Glu Cys Tyr His 130 135 140 Gly Asn Gly Gln Ser Tyr
Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly 145 150 155 160 Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg 165 170 175 Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 180 185
190 Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly
195 200 205 Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
Glu Gly 210 215 220 Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro
Ser Leu Glu Ala 225 230 235 240 Pro Ser Glu Gln Ala Pro Thr Glu Gln
Arg Pro Gly Val Gln Glu Cys 245 250 255 Tyr His Gly Asn Gly Gln Ser
Tyr Arg Gly Thr Tyr Ser Thr Thr Val 260 265 270 Thr Gly Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His Ser His 275 280 285 Ser Arg Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 290 295 300 Cys
Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp 305 310
315 320 Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp
Ala 325 330 335 Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val
Pro Ser Leu 340 345 350 Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln
Arg Pro Gly Val Gln 355 360 365 Glu Cys Tyr His Gly Asn Gly Gln Ser
Tyr Arg Gly Thr Tyr Ser Thr 370 375 380 Thr Val Thr Gly Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His 385 390 395 400 Ser His Ser Arg
Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 405 410 415 Asn Tyr
Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 420 425 430
Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser 435
440 445 Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val
Pro 450 455 460 Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln
Arg Pro Gly 465 470 475 480 Val Gln Glu Cys Tyr His Gly Asn Gly Gln
Ser Tyr Arg Gly Thr Tyr 485 490 495 Ser Thr Thr Val Thr Gly Arg Thr
Cys Gln Ala Trp Ser Ser Met Thr 500 505 510 Pro His Ser His Ser Arg
Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 515 520 525 Ile Met Asn Tyr
Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 530 535 540 Tyr Thr
Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 545 550 555
560 Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro
565 570 575 Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu
Gln Arg 580 585 590 Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln
Ser Tyr Arg Gly 595 600 605 Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr
Cys Gln Ala Trp Ser Ser 610 615 620 Met Thr Pro His Ser His Ser Arg
Thr Pro Glu Tyr Tyr Pro Asn Ala 625 630 635 640 Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 645 650 655 Tyr Cys Tyr
Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 660 665 670 Thr
Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val 675 680
685 Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu
690 695 700 Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln
Ser Tyr 705 710 715 720 Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg
Thr Cys Gln Ala Trp 725 730 735 Ser Ser Met Thr Pro His Ser His Ser
Arg Thr Pro Glu Tyr Tyr Pro 740 745 750 Asn Ala Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro Asp Ala Val Ala 755 760 765 Ala Pro Tyr Cys Tyr
Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 770 775 780 Asn Leu Thr
Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro 785 790 795 800
Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 805
810 815 Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly
Gln 820 825 830 Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg
Thr Cys Gln 835 840 845 Ala Trp Ser Ser Met Thr Pro His Ser His Ser
Arg Thr Pro Glu Tyr 850 855 860 Tyr Pro Asn Ala Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro Asp Pro 865 870 875 880 Val Ala Ala Pro Tyr Cys
Tyr Thr Arg Asp Pro Ser Val Arg Trp Glu 885 890 895 Tyr Cys Asn Leu
Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 900 905 910 Pro Pro
Thr Ile Thr Pro Ile Pro Ser Leu Glu Ala Pro Ser Glu Gln 915 920 925
Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn 930
935 940 Gly Gln Ser Tyr Gln Gly Thr Tyr Phe Ile Thr Val Thr Gly Arg
Thr 945 950 955 960 Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His
Ser Arg Thr Pro 965 970 975 Ala Tyr Tyr Pro Asn Ala Gly Leu Ile Lys
Asn Tyr Cys Arg Asn Pro 980 985 990 Asp Pro Val Ala Ala Pro Trp Cys
Tyr Thr Thr Asp Pro Ser Val Arg 995 1000 1005 Trp Glu Tyr Cys Asn
Leu Thr Arg Cys Ser Asp Ala Glu Trp Thr 1010 1015 1020 Ala Phe Val
Pro Pro Asn Val Ile Leu Ala Pro Ser Leu Glu Ala 1025 1030 1035 Phe
Phe Glu Gln Ala Leu Thr Glu Glu Thr Pro Gly Val Gln Asp 1040 1045
1050 Cys Tyr Tyr His Tyr Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr
1055 1060 1065 Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met
Thr Pro 1070 1075 1080 His Gln His Ser Arg Thr Pro Glu Asn Tyr Pro
Asn Ala Gly Leu 1085 1090 1095 Thr Arg Asn Tyr Cys Arg Asn Pro Asp
Ala Glu Ile Arg Pro Trp 1100 1105 1110 Cys Tyr Thr Met Asp Pro Ser
Val Arg Trp Glu Tyr Cys Asn Leu 1115 1120 1125 Thr Gln Cys Leu Val
Thr Glu Ser Ser Val Leu Ala Thr Leu Thr 1130 1135 1140 Val Val Pro
Asp Pro Ser Thr Glu Ala Ser Ser Glu Glu Ala Pro 1145 1150 1155 Thr
Glu Gln Ser Pro Gly Val Gln Asp Cys Tyr His Gly Asp Gly 1160 1165
1170 Gln Ser Tyr Arg Gly Ser Phe Ser Thr Thr Val Thr Gly Arg Thr
1175 1180 1185 Cys Gln Ser Trp Ser Ser Met Thr Pro His Trp His Gln
Arg Thr 1190 1195 1200 Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg
Asn Tyr Cys Arg 1205 1210 1215 Asn Pro Asp Ala Glu Ile Ser Pro Trp
Cys Tyr Thr Met Asp Pro 1220 1225 1230 Asn Val Arg Trp Glu Tyr Cys
Asn Leu Thr Gln Cys Pro Val Thr 1235 1240 1245 Glu Ser Ser Val Leu
Ala Thr Ser Thr Ala Val Ser Glu Gln Ala 1250 1255 1260 Pro Thr Glu
Gln Ser Pro Thr Val Gln Asp Cys Tyr His Gly Asp 1265 1270 1275 Gly
Gln Ser Tyr Arg Gly Ser Phe Ser Thr Thr Val Thr Gly Arg 1280 1285
1290 Thr Cys Gln Ser Trp Ser Ser Met Thr Pro His Trp His Gln Arg
1295 1300 1305 Thr Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg Asn
Tyr Cys 1310 1315 1320 Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp Cys
Tyr Thr Met Asp 1325 1330 1335 Pro Ser Val Arg Trp Glu Tyr Cys Asn
Leu Thr Gln Cys Pro Val 1340 1345 1350 Met Glu Ser Thr Leu Leu Thr
Thr Pro Thr Val Val Pro Val Pro 1355 1360 1365 Ser Thr Glu Leu Pro
Ser Glu Glu Ala Pro Thr Glu Asn Ser Thr 1370 1375 1380 Gly Val Gln
Asp Cys Tyr Arg Gly Asp Gly Gln Ser Tyr Arg Gly 1385 1390 1395 Thr
Leu Ser Thr Thr Ile Thr Gly Arg Thr Cys Gln Ser Trp Ser 1400 1405
1410 Ser Met Thr Pro His Trp His Arg Arg Ile Pro Leu Tyr Tyr Pro
1415 1420 1425 Asn Ala Gly Leu Thr Arg Asn Tyr Cys Arg Asn Pro Asp
Ala Glu 1430 1435 1440 Ile Arg Pro Trp Cys Tyr Thr Met Asp Pro Ser
Val Arg Trp Glu 1445 1450 1455 Tyr Cys Asn Leu Thr Arg Cys Pro Val
Thr Glu Ser Ser Val Leu 1460 1465 1470 Thr Thr Pro Thr Val Ala Pro
Val Pro Ser Thr Glu Ala Pro Ser 1475 1480 1485 Glu Gln Ala Pro Pro
Glu Lys Ser Pro Val Val Gln Asp Cys Tyr 1490 1495 1500 His Gly Asp
Gly Arg Ser Tyr Arg Gly Ile Ser Ser Thr Thr Val 1505 1510 1515 Thr
Gly Arg Thr Cys Gln Ser Trp Ser Ser Met Ile Pro His Trp 1520 1525
1530 His Gln Arg Thr Pro Glu Asn Tyr Pro Asn Ala Gly Leu Thr Glu
1535 1540 1545 Asn Tyr Cys Arg Asn Pro Asp Ser Gly Lys Gln Pro Trp
Cys Tyr 1550 1555 1560 Thr Thr Asp Pro Cys Val Arg Trp Glu Tyr Cys
Asn Leu Thr Gln 1565 1570 1575 Cys Ser Glu Thr Glu Ser Gly Val Leu
Glu Thr Pro Thr Val Val 1580 1585 1590 Pro Val Pro Ser Met Glu Ala
His Ser Glu Ala Ala Pro Thr Glu 1595 1600 1605 Gln Thr Pro Val Val
Arg Gln Cys Tyr His Gly Asn Gly Gln Ser 1610 1615 1620 Tyr Arg Gly
Thr Phe Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 1625 1630 1635 Ser
Trp Ser Ser Met Thr Pro His Arg His Gln Arg Thr Pro Glu 1640 1645
1650 Asn Tyr Pro Asn Asp Gly Leu Thr Met Asn Tyr Cys Arg Asn Pro
1655 1660 1665 Asp Ala Asp Thr Gly Pro Trp Cys Phe Thr Met Asp Pro
Ser Ile 1670 1675 1680 Arg Trp Glu Tyr Cys Asn Leu Thr Arg Cys Ser
Asp Thr Glu Gly 1685 1690 1695 Thr Val Val Ala Pro Pro Thr Val Ile
Gln Val Pro Ser Leu Gly 1700 1705 1710 Pro Pro Ser Glu Gln Asp Cys
Met Phe Gly Asn Gly Lys Gly Tyr 1715 1720 1725 Arg Gly Lys Lys Ala
Thr Thr Val Thr Gly Thr Pro Cys Gln Glu 1730 1735 1740 Trp Ala Ala
Gln Glu Pro His Arg His Ser Thr Phe Ile Pro Gly 1745 1750 1755 Thr
Asn Lys Trp Ala Gly Leu Glu Lys Asn Tyr Cys Arg Asn Pro 1760 1765
1770 Asp Gly Asp Ile Asn Gly Pro Trp Cys Tyr Thr Met Asn Pro Arg
1775 1780 1785 Lys Leu Phe Asp Tyr Cys Asp Ile Pro Leu Cys Ala Ser
Ser Ser 1790 1795 1800 Phe Asp Cys Gly Lys Pro Gln Val Glu Pro Lys
Lys Cys Pro Gly 1805 1810 1815 Ser Ile Val Gly Gly Cys Val Ala His
Pro His Ser Trp Pro Trp 1820 1825 1830 Gln Val Ser Leu Arg Thr Arg
Phe Gly Lys His Phe Cys Gly Gly 1835 1840 1845 Thr Leu Ile Ser Pro
Glu Trp Val Leu Thr Ala Ala His Cys Leu 1850 1855 1860 Lys Lys Ser
Ser Arg Pro Ser Ser Tyr Lys Val Ile Leu Gly Ala 1865 1870 1875 His
Gln Glu Val Asn Leu Glu Ser His Val Gln Glu Ile Glu Val 1880 1885
1890 Ser Arg Leu Phe Leu Glu Pro Thr Gln Ala Asp Ile Ala Leu Leu
1895 1900 1905 Lys Leu Ser Arg Pro Ala Val Ile Thr Asp Lys Val Met
Pro Ala 1910 1915 1920 Cys Leu Pro Ser Pro Asp Tyr Met Val Thr Ala
Arg Thr Glu Cys 1925 1930 1935 Tyr Ile Thr Gly Trp Gly Glu Thr Gln
Gly Thr Phe Gly Thr Gly 1940 1945 1950 Leu Leu Lys Glu Ala Gln Leu
Leu Val Ile Glu Asn Glu Val Cys 1955 1960 1965 Asn His Tyr Lys Tyr
Ile Cys Ala Glu His Leu Ala Arg Gly Thr 1970 1975 1980 Asp Ser Cys
Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Phe Glu 1985 1990 1995 Lys
Asp Lys Tyr Ile Leu Gln Gly Val Thr Ser Trp Gly Leu Gly 2000 2005
2010 Cys Ala Arg Pro Asn Lys Pro Gly Val Tyr Ala Arg Val Ser Arg
2015 2020 2025 Phe Val Thr Trp Ile Glu Gly Met Met Arg Asn Asn 2030
2035 2040 3556DNAHepatitis B virusCDS(2)..(553) 3c atg gat atc gat
cct tat aaa gaa ttc gga gct act gtg gag tta ctc 49 Met Asp Ile Asp
Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 tcg ttt
ctc ccg agt gac ttc ttt cct tca gta cga gat ctt ctg gat 97Ser Phe
Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30
acc gcc agc gcg ctg tat cgg gaa gcc ttg gag tct cct gag cac tgc
145Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys
35 40 45 agc cct cac cat act gcc ctc agg caa gca att ctt tgc tgg
ggg gag 193Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp
Gly Glu 50 55 60 ctc atg act ctg gcc acg tgg gtg ggt gtt aac ttg
gaa gat cca gct 241Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu
Glu Asp Pro Ala 65 70 75 80 agc agg gac ctg gta gtc agt tat gtc aac
act aat atg ggt tta aag 289Ser Arg Asp Leu Val Val Ser Tyr Val Asn
Thr Asn Met Gly Leu Lys 85 90 95 ttc agg caa ctc ttg tgg ttt cac
att agc tgc ctc act ttc ggc cga 337Phe Arg Gln Leu Leu Trp Phe His
Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110
gaa aca gtt cta gaa tat ttg gtg tct ttc gga gtg tgg atc cgc act
385Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr
115 120 125 cct cca gct tat agg cct ccg aat gcc cct atc ctg tcg aca
ctc ccg 433Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr
Leu Pro 130 135 140 gag act act gtt gtt aga cgt cga ggc agg tca cct
aga aga aga act 481Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro
Arg Arg Arg Thr 145 150 155 160 cct tcg cct cgc agg cga agg tct caa
tcg ccg cgg cgc cga aga tct 529Pro Ser Pro Arg Arg Arg Arg Ser Gln
Ser Pro Arg Arg Arg Arg Ser 165 170 175 caa tct cgg gaa tct caa tgt
tag tga 556Gln Ser Arg Glu Ser Gln Cys 180 4183PRTHepatitis B virus
4Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1
5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu
Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro
Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile
Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly
Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser
Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu
Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val
Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro
Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135
140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr
145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg
Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180
5185PRTHepatitis B virus 5Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly
Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe
Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr
Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His
Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met
Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80
Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85
90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly
Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp
Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile
Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Asp
Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro Ser Pro Arg
Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg Ser Gln Ser
Arg Glu Ser Gln Cys 180 185 622DNAArtificial SequenceSynthetic
CpG-B 1018 6tgactgtgaa cgttcgagat ga 22720DNAArtificial
SequenceSynthetic CpG-A D19 7ggtgcatcga tgcagggggg
20821DNAArtificial SequenceSynthetic CpG-C C274 8tcgtcgaacg
ttcgagatga t 21925DNAArtificial SequenceSynthetic CpG-C C695
9tcgaacgttc gaacgttcga acgtt 251088DNAArtificial SequenceSynthetic
ISS 10ggtgcatcga tgcagggggg tgactgtgaa cgttcgagat gatcgtcgaa
cgttcgagat 60gattcgaacg ttcgaacgtt cgaacgtt 881135DNAArtificial
SequenceSynthetic primer HBc-1 11gccatggata tcgatcctta taaagaattc
ggagc 351254DNAArtificial SequenceSynthetic primer Lp(a)-1
12gttaacttgg aagatccagc tatcactgag gctccttccg aacaagcacc gact
541336DNAArtificial SequenceSynthetic primer HBc-2 13ggcctctcac
taacattgag attcccgaga ttgaga 361455DNAArtificial SequenceSynthetic
primer Lp(a)-2 14ttccgaacaa gcaccgactg agcaaagggg tgctactagc
agggacctgg tagtc 5515609DNAArtificial SequenceSynthetic HBc-apo(a)
chimera 15gcc atg gat atc gat cct tat aaa gaa ttc gga gct act gtg
gag tta 48 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu
Leu 1 5 10 15 ctc tcg ttt ctc ccg agt gac ttc ttt cct tca gta cga
gat ctt ctg 96Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg
Asp Leu Leu 20 25 30 gat acc gcc agc gcg ctg tat cgg gaa gcc ttg
gag tct cct gag cac 144Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu
Glu Ser Pro Glu His 35 40 45 tgc agc cct cac cat act gcc ctc agg
caa gca att ctt tgc tgg ggg 192Cys Ser Pro His His Thr Ala Leu Arg
Gln Ala Ile Leu Cys Trp Gly 50 55 60 gag ctc atg act ctg gcc acg
tgg gtg ggt gtt aac ttg gaa gat cca 240Glu Leu Met Thr Leu Ala Thr
Trp Val Gly Val Asn Leu Glu Asp Pro 65 70 75 gct atc act gag gct
cct tcc gaa caa gca ccg act gag caa agg ggt 288Ala Ile Thr Glu Ala
Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Gly 80 85 90 95 gct act agc
agg gac ctg gta gtc agt tat gtc aac act aat atg ggt 336Ala Thr Ser
Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly 100 105 110 tta
aag ttc agg caa ctc ttg tgg ttt cac att agc tgc ctc act ttc 384Leu
Lys Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe 115 120
125 ggc cga gaa aca gtt cta gaa tat ttg gtg tct ttc gga gtg tgg atc
432Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile
130 135 140 cgc act cct cca gct tat agg cct ccg aat gcc cct atc ctg
tcg aca 480Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu
Ser Thr 145 150 155 ctc ccg gag act act gtt gtt aga cgt cga ggc agg
tca cct aga aga 528Leu Pro Glu Thr Thr Val Val Arg Arg Arg Gly Arg
Ser Pro Arg Arg 160 165 170 175 aga act cct tcg cct cgc agg cga agg
tct caa tcg ccg cgg cgc cga 576Arg Thr Pro Ser Pro Arg Arg Arg Arg
Ser Gln Ser Pro Arg Arg Arg 180 185 190 aga tct caa tct cgg gaa tct
caa tgt tag tga 609Arg Ser Gln Ser Arg Glu Ser Gln Cys 195 200
16200PRTArtificial SequenceSynthetic Construct 16Met Asp Ile Asp
Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe
Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30
Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35
40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly
Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu
Asp Pro Ala 65 70 75 80 Ile Thr Glu Ala Pro Ser Glu Gln Ala Pro Thr
Glu Gln Arg Gly Ala 85 90 95 Thr Ser Arg Asp Leu Val Val Ser Tyr
Val Asn Thr Asn Met Gly Leu 100 105 110 Lys Phe Arg Gln Leu Leu Trp
Phe His Ile Ser Cys Leu Thr Phe Gly 115 120 125 Arg Glu Thr Val Leu
Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg 130 135 140 Thr Pro Pro
Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu 145 150 155 160
Pro Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg 165
170 175 Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg
Arg 180 185 190 Ser Gln Ser Arg Glu Ser Gln Cys 195 200 1716PRTHomo
sapiens 17Met Glu His Lys Glu Val Val Leu Leu Leu Leu Leu Phe Leu
Lys Ser 1 5 10 15
* * * * *